#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
INS-IGF2	723961	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	11	2168965	2168965	+	Silent	SNP	C	C	T			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr11:2168965C>T	ENST00000397270.1	-	4	538	c.480G>A	c.(478-480)tcG>tcA	p.S160S	INS-IGF2_ENST00000481781.1_5'UTR|IGF2-AS_ENST00000381361.3_RNA|IGF2-AS_ENST00000381363.4_RNA|IGF2_ENST00000300632.5_5'UTR|IGF2-AS_ENST00000445504.2_RNA	NM_001042376.2	NP_001035835.1	F8WCM5	INSR2_HUMAN	INS-IGF2 readthrough	160						extracellular region (GO:0005576)				haematopoietic_and_lymphoid_tissue(1)|lung(3)|prostate(1)	5		all_epithelial(84;0.00018)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)|all_lung(207;0.24)	Colorectal(5;0.00245)|COAD - Colon adenocarcinoma(6;0.0239)	BRCA - Breast invasive adenocarcinoma(625;0.00256)|LUSC - Lung squamous cell carcinoma(625;0.0832)|Lung(200;0.156)		GAGCTGGCAGCGATTCAGAGC	0.647																																						.											0													9.0	11.0	10.0					11																	2168965		1802	3876	5678	SO:0001819	synonymous_variant	723961			DQ104205	CCDS41598.1	11p15.5	2011-03-23			ENSG00000129965	ENSG00000129965			33527	other	readthrough						16531418	Standard	NM_001042376		Approved		uc001lvm.3	F8WCM5	OTTHUMG00000166213	ENST00000397270.1:c.480G>A	11.37:g.2168965C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q1WM24	Silent	SNP	ENST00000397270.1	37	CCDS41598.1																																																																																				0.647	INS-IGF2-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000388404.1	NM_001042376.2	
MXRA8	54587	hgsc.bcm.edu;mdanderson.org	37	1	1290408	1290408	+	Silent	SNP	A	A	G	rs147996767	byFrequency	TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr1:1290408A>G	ENST00000309212.6	-	5	633	c.603T>C	c.(601-603)gcT>gcC	p.A201A	MXRA8_ENST00000477278.2_Silent_p.A192A|MXRA8_ENST00000342753.4_Silent_p.A100A|MXRA8_ENST00000445648.2_Silent_p.A201A	NM_001282582.1|NM_032348.2	NP_001269511.1|NP_115724.1	Q9BRK3	MXRA8_HUMAN	matrix-remodelling associated 8	201	Ig-like V-type 2.				establishment of glial blood-brain barrier (GO:0060857)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(3)	7	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;2.83e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.77e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		CCACCTGTTGAGCCTCCTCCA	0.751													-|||	361	0.0720847	0.2579	0.0274	5008	,	,		8344	0.0		0.001	False		,,,				2504	0.0					.											0										722,3238		65,592,1323	7.0	9.0	9.0		603	-0.7	1.0	1	dbSNP_134	9	6,7864		0,6,3929	no	coding-synonymous	MXRA8	NM_032348.2		65,598,5252	GG,GA,AA		0.0762,18.2323,6.1538		201/443	1290408	728,11102	1980	3935	5915	SO:0001819	synonymous_variant	54587			BC006213	CCDS24.1, CCDS59950.1, CCDS59951.1, CCDS59952.1	1p36.33	2013-01-11			ENSG00000162576	ENSG00000162576		"""Immunoglobulin superfamily / V-set domain containing"""	7542	protein-coding gene	gene with protein product	"""limitrin"""					14603461	Standard	XM_005244758		Approved	DKFZp586E2023	uc001aew.3	Q9BRK3	OTTHUMG00000002973	ENST00000309212.6:c.603T>C	1.37:g.1290408A>G		Somatic		WXS	Illumina HiSeq	Phase_I	B3KTR6|B4DE34|Q5TA39|Q96KC3	Silent	SNP	ENST00000309212.6	37	CCDS24.1																																																																																				0.751	MXRA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008282.2	NM_032348	
DCST2	127579	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	1	155002604	155002604	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr1:155002604A>G	ENST00000368424.3	-	7	1191	c.1133T>C	c.(1132-1134)gTg>gCg	p.V378A	DCST2_ENST00000295536.5_Missense_Mutation_p.V378A	NM_144622.2	NP_653223.2	Q5T1A1	DCST2_HUMAN	DC-STAMP domain containing 2	378						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(13)|ovary(3)|prostate(1)|skin(1)	38	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			GAGCGGTAGCACTGTGGGCAG	0.622																																						.											0													85.0	84.0	84.0					1																	155002604		2203	4300	6503	SO:0001583	missense	127579			AK057496	CCDS1082.2	1q22	2008-02-05		2005-08-09	ENSG00000163354	ENSG00000163354			26562	protein-coding gene	gene with protein product							Standard	NM_144622		Approved	FLJ32934	uc001fgm.3	Q5T1A1	OTTHUMG00000037371	ENST00000368424.3:c.1133T>C	1.37:g.155002604A>G	ENSP00000357409:p.Val378Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q2M2R2|Q8N810|Q96M03	Missense_Mutation	SNP	ENST00000368424.3	37	CCDS1082.2	.	.	.	.	.	.	.	.	.	.	A	17.88	3.497713	0.64186	.	.	ENSG00000163354	ENST00000368424;ENST00000295536	T;T	0.35421	1.31;1.31	4.68	3.54	0.40534	Dendritic cell-specific transmembrane protein-like (1);	0.085942	0.44902	D	0.000406	T	0.38026	0.1025	L	0.55481	1.735	0.38624	D	0.951212	D	0.76494	0.999	D	0.72625	0.978	T	0.29640	-1.0005	10	0.52906	T	0.07	-21.6605	8.4994	0.33148	0.8267:0.0:0.0:0.1733	.	378	Q5T1A1	DCST2_HUMAN	A	378	ENSP00000357409:V378A;ENSP00000295536:V378A	ENSP00000295536:V378A	V	-	2	0	DCST2	153269228	1.000000	0.71417	0.987000	0.45799	0.784000	0.44337	3.656000	0.54467	0.790000	0.33803	0.533000	0.62120	GTG		0.622	DCST2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090953.3	NM_144622	
ADAMTS4	9507	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	161161010	161161010	+	Missense_Mutation	SNP	C	C	T	rs148170603		TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr1:161161010C>T	ENST00000367996.5	-	9	2860	c.2432G>A	c.(2431-2433)cGc>cAc	p.R811H	ADAMTS4_ENST00000478394.1_5'Flank	NM_005099.4	NP_005090.3	O75173	ATS4_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 4	811	Spacer.				defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)|protease binding (GO:0002020)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(20)|ovary(4)|prostate(3)|skin(1)|urinary_tract(1)	43	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)		Tinzaparin(DB06822)	GGGAGTGGGGCGTGGCGTTGA	0.647																																						.											0								C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	38.0	37.0	37.0		2432	1.8	0.0	1	dbSNP_134	37	0,8600		0,0,4300	no	missense	ADAMTS4	NM_005099.4	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	811/838	161161010	1,13005	2203	4300	6503	SO:0001583	missense	9507			AB014588	CCDS1223.1	1q31-q32	2008-02-05	2005-08-19		ENSG00000158859	ENSG00000158859		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	220	protein-coding gene	gene with protein product		603876	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 4"""			10094461	Standard	NM_005099		Approved	KIAA0688, ADAMTS-2, ADMP-1	uc001fyt.4	O75173	OTTHUMG00000034349	ENST00000367996.5:c.2432G>A	1.37:g.161161010C>T	ENSP00000356975:p.Arg811His	Somatic		WXS	Illumina HiSeq	Phase_I	Q5VTW2|Q6P4Q8|Q6UWA8|Q9UN83	Missense_Mutation	SNP	ENST00000367996.5	37	CCDS1223.1	.	.	.	.	.	.	.	.	.	.	C	8.713	0.912622	0.17907	2.27E-4	0.0	ENSG00000158859	ENST00000367996	T	0.62639	0.01	4.62	1.75	0.24633	.	0.522526	0.18210	N	0.148239	T	0.23370	0.0565	N	0.24115	0.695	0.32533	N	0.534718	P	0.36027	0.533	B	0.29176	0.099	T	0.02173	-1.1201	10	0.45353	T	0.12	.	9.1087	0.36714	0.0:0.7543:0.0:0.2457	.	811	O75173	ATS4_HUMAN	H	811	ENSP00000356975:R811H	ENSP00000356975:R811H	R	-	2	0	ADAMTS4	159427634	0.012000	0.17670	0.003000	0.11579	0.372000	0.29890	0.829000	0.27449	0.289000	0.22422	-0.234000	0.12200	CGC		0.647	ADAMTS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083066.2	NM_005099	
OR6F1	343169	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	1	247875280	247875280	+	Missense_Mutation	SNP	C	C	T	rs145498993		TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr1:247875280C>T	ENST00000302084.2	-	1	825	c.778G>A	c.(778-780)Gtc>Atc	p.V260I	RP11-634B7.4_ENST00000449298.1_RNA	NM_001005286.1	NP_001005286.1	Q8NGZ6	OR6F1_HUMAN	olfactory receptor, family 6, subfamily F, member 1	260						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(1)|large_intestine(5)|lung(34)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)	47	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.0168)			GAGGTGCGGACGTGAAGGAAA	0.532																																						.											0								C	ILE/VAL	0,4406		0,0,2203	99.0	95.0	96.0		778	1.7	0.0	1	dbSNP_134	96	1,8599	2.2+/-6.3	0,1,4299	no	missense	OR6F1	NM_001005286.1	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	260/309	247875280	1,13005	2203	4300	6503	SO:0001583	missense	343169			BK004460	CCDS31095.1	1q44	2012-08-09			ENSG00000169214	ENSG00000169214		"""GPCR / Class A : Olfactory receptors"""	15027	protein-coding gene	gene with protein product							Standard	NM_001005286		Approved	OST731	uc001idj.1	Q8NGZ6	OTTHUMG00000040213	ENST00000302084.2:c.778G>A	1.37:g.247875280C>T	ENSP00000305640:p.Val260Ile	Somatic		WXS	Illumina HiSeq	Phase_I	B2RNV6|Q6IF02|Q96R39	Missense_Mutation	SNP	ENST00000302084.2	37	CCDS31095.1	.	.	.	.	.	.	.	.	.	.	C	2.854	-0.237700	0.05944	0.0	1.16E-4	ENSG00000169214	ENST00000302084	T	0.36699	1.24	3.72	1.72	0.24424	GPCR, rhodopsin-like superfamily (1);	0.185901	0.25922	N	0.027428	T	0.22437	0.0541	L	0.28694	0.88	0.09310	N	1	B	0.17852	0.024	B	0.17098	0.017	T	0.23048	-1.0199	10	0.18276	T	0.48	-23.4907	8.8577	0.35238	0.0:0.535:0.3724:0.0926	.	260	Q8NGZ6	OR6F1_HUMAN	I	260	ENSP00000305640:V260I	ENSP00000305640:V260I	V	-	1	0	OR6F1	245941903	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-2.433000	0.01021	0.025000	0.15241	-1.094000	0.02160	GTC		0.532	OR6F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096870.1	NM_001005286	
SRRM2	23524	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	16	2813651	2813651	+	Missense_Mutation	SNP	C	C	A			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr16:2813651C>A	ENST00000301740.8	+	11	3671	c.3122C>A	c.(3121-3123)tCt>tAt	p.S1041Y		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	1041	Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						GGAGTAAAATCTAGCACACCA	0.458																																						.											0													94.0	95.0	95.0					16																	2813651		2198	4300	6498	SO:0001583	missense	23524			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.3122C>A	16.37:g.2813651C>A	ENSP00000301740:p.Ser1041Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	ENST00000301740.8	37	CCDS32373.1	.	.	.	.	.	.	.	.	.	.	C	12.29	1.892469	0.33442	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000544933	T	0.27256	1.68	5.54	5.54	0.83059	.	0.522580	0.19245	N	0.119072	T	0.25082	0.0609	L	0.34521	1.04	0.35720	D	0.817096	P	0.44090	0.826	B	0.41088	0.347	T	0.26258	-1.0108	10	0.66056	D	0.02	-0.5501	16.9676	0.86290	0.0:1.0:0.0:0.0	.	1041	Q9UQ35	SRRM2_HUMAN	Y	1041;1041;293	ENSP00000301740:S1041Y	ENSP00000301740:S1041Y	S	+	2	0	SRRM2	2753652	0.060000	0.20803	0.975000	0.42487	0.454000	0.32378	2.762000	0.47597	2.622000	0.88805	0.655000	0.94253	TCT		0.458	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1		
ATMIN	23300	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	16	81077627	81077627	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr16:81077627G>A	ENST00000299575.4	+	4	1548	c.1524G>A	c.(1522-1524)atG>atA	p.M508I	ATMIN_ENST00000566488.1_Missense_Mutation_p.M352I|ATMIN_ENST00000564241.1_Missense_Mutation_p.M352I|ATMIN_ENST00000539819.1_3'UTR	NM_015251.2	NP_056066.2	O43313	ATMIN_HUMAN	ATM interactor	508					cellular response to DNA damage stimulus (GO:0006974)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dynein binding (GO:0045502)|metal ion binding (GO:0046872)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	20						ATGTACAGATGGACCAAGCTG	0.433																																						.											0													74.0	74.0	74.0					16																	81077627		2201	4300	6501	SO:0001583	missense	23300			BC002701	CCDS32494.1, CCDS73917.1	16q23.2	2013-01-07			ENSG00000166454	ENSG00000166454		"""Zinc fingers, C2H2-type"""	29034	protein-coding gene	gene with protein product	"""ATM/ATR-Substrate Chk2-Interacting Zn++-finger protein"", ""ATM INteracting protein"""	614693				15933716, 17525732, 19001856	Standard	XM_005255866		Approved	ASCIZ, KIAA0431, ZNF822	uc002ffz.1	O43313	OTTHUMG00000176469	ENST00000299575.4:c.1524G>A	16.37:g.81077627G>A	ENSP00000299575:p.Met508Ile	Somatic		WXS	Illumina HiSeq	Phase_I	A8K4H8|Q68DC9	Missense_Mutation	SNP	ENST00000299575.4	37	CCDS32494.1	.	.	.	.	.	.	.	.	.	.	G	10.50	1.367893	0.24771	.	.	ENSG00000166454	ENST00000299575;ENST00000539819	T	0.29917	1.55	5.91	3.89	0.44902	.	0.304822	0.42964	N	0.000621	T	0.33206	0.0855	M	0.72118	2.19	0.36086	D	0.843124	B	0.06786	0.001	B	0.06405	0.002	T	0.33701	-0.9858	10	0.54805	T	0.06	-8.3303	11.3485	0.49575	0.0657:0.0:0.8075:0.1268	.	508	O43313	ATMIN_HUMAN	I	508;279	ENSP00000299575:M508I	ENSP00000299575:M508I	M	+	3	0	ATMIN	79635128	1.000000	0.71417	0.871000	0.34182	0.464000	0.32679	2.981000	0.49329	0.779000	0.33543	0.655000	0.94253	ATG		0.433	ATMIN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000432140.1	NM_015251	
NLRP11	204801	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	19	56321650	56321650	+	Missense_Mutation	SNP	T	T	G			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr19:56321650T>G	ENST00000589093.1	-	3	419	c.326A>C	c.(325-327)gAa>gCa	p.E109A	NLRP11_ENST00000592953.1_Missense_Mutation_p.E10A|NLRP11_ENST00000589824.2_Missense_Mutation_p.E109A|NLRP11_ENST00000360133.3_Missense_Mutation_p.E109A|NLRP11_ENST00000443188.1_Missense_Mutation_p.E109A			P59045	NAL11_HUMAN	NLR family, pyrin domain containing 11	109							ATP binding (GO:0005524)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen (GO:0016715)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	66		Colorectal(82;0.0002)		GBM - Glioblastoma multiforme(193;0.0325)		AGTGTGACTTTCCCATTGCAG	0.378																																						.											0													41.0	41.0	41.0					19																	56321650		2203	4300	6503	SO:0001583	missense	204801			AY095145	CCDS12935.1, CCDS74458.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179873		"""Nucleotide-binding domain and leucine rich repeat containing"""	22945	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 11"""	609664	"""NACHT, leucine rich repeat and PYD containing 11"""	NALP11		12563287, 12019269	Standard	NM_145007		Approved	PYPAF6, NOD17, PAN10, CLR19.6	uc010ygf.2	P59045		ENST00000589093.1:c.326A>C	19.37:g.56321650T>G	ENSP00000466285:p.Glu109Ala	Somatic		WXS	Illumina HiSeq	Phase_I	C9JSF5|Q2TV85|Q2TV86|Q53ZZ0|Q8NBF5	Missense_Mutation	SNP	ENST00000589093.1	37	CCDS12935.1	.	.	.	.	.	.	.	.	.	.	T	5.794	0.330843	0.10956	.	.	ENSG00000179873	ENST00000443188;ENST00000360133	T;T	0.74526	-0.85;-0.79	1.99	1.99	0.26369	.	.	.	.	.	T	0.55862	0.1947	N	0.08118	0	0.09310	N	1	B;B	0.28584	0.138;0.216	B;B	0.37731	0.131;0.257	T	0.50750	-0.8791	9	0.34782	T	0.22	.	5.9904	0.19458	0.0:0.0:0.0:1.0	.	109;109	P59045;P59045-2	NAL11_HUMAN;.	A	109	ENSP00000409898:E109A;ENSP00000353251:E109A	ENSP00000353251:E109A	E	-	2	0	NLRP11	61013462	0.011000	0.17503	0.028000	0.17463	0.008000	0.06430	0.622000	0.24433	1.168000	0.42723	0.533000	0.62120	GAA		0.378	NLRP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453657.1	NM_145007	
TMEM108	66000	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	3	133099424	133099424	+	Missense_Mutation	SNP	C	C	A			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr3:133099424C>A	ENST00000321871.6	+	4	1079	c.869C>A	c.(868-870)aCc>aAc	p.T290N	TMEM108_ENST00000508711.1_Intron|TMEM108_ENST00000393130.3_Missense_Mutation_p.T290N|TMEM108_ENST00000515826.1_Missense_Mutation_p.T290N	NM_001136469.1|NM_023943.2	NP_001129941.1|NP_076432.1	Q6UXF1	TM108_HUMAN	transmembrane protein 108	290						integral component of membrane (GO:0016021)				endometrium(3)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						GGTGGTTCTACCTTCACCAGC	0.647																																						.											0													37.0	35.0	36.0					3																	133099424		2203	4300	6503	SO:0001583	missense	66000			AL136578	CCDS33858.1, CCDS75012.1	3q22.1	2014-04-07			ENSG00000144868	ENSG00000144868			28451	protein-coding gene	gene with protein product	"""cancer/testis antigen 124"""					11214970	Standard	XM_005247726		Approved	MGC3040, CT124	uc003epi.3	Q6UXF1	OTTHUMG00000159685	ENST00000321871.6:c.869C>A	3.37:g.133099424C>A	ENSP00000324651:p.Thr290Asn	Somatic		WXS	Illumina HiSeq	Phase_I	D3DNC9|Q9BQH1|Q9BW81|Q9C0H3	Missense_Mutation	SNP	ENST00000321871.6	37	CCDS33858.1	.	.	.	.	.	.	.	.	.	.	C	8.898	0.955594	0.18507	.	.	ENSG00000144868	ENST00000321871;ENST00000393130;ENST00000515826	T;T;T	0.46451	0.89;0.89;0.87	3.84	1.87	0.25490	.	0.837931	0.10125	N	0.712876	T	0.34337	0.0894	L	0.51422	1.61	0.09310	N	1	B;B	0.11235	0.004;0.002	B;B	0.12156	0.007;0.002	T	0.28364	-1.0046	10	0.33141	T	0.24	-1.9903	6.0362	0.19708	0.3953:0.5047:0.0:0.0999	.	290;290	E9PB58;Q6UXF1	.;TM108_HUMAN	N	290	ENSP00000324651:T290N;ENSP00000376838:T290N;ENSP00000423338:T290N	ENSP00000324651:T290N	T	+	2	0	TMEM108	134582114	0.001000	0.12720	0.001000	0.08648	0.257000	0.26127	1.219000	0.32479	0.298000	0.22638	0.561000	0.74099	ACC		0.647	TMEM108-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356907.2	NM_023943	
TBCC	6903	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	6	42713337	42713337	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr6:42713337G>A	ENST00000372876.1	-	1	497	c.475C>T	c.(475-477)Ccc>Tcc	p.P159S	TBCC_ENST00000244625.2_Missense_Mutation_p.P159S	NM_003192.2	NP_003183	Q15814	TBCC_HUMAN	tubulin folding cofactor C	159					'de novo' posttranslational protein folding (GO:0051084)|cell morphogenesis (GO:0000902)|cellular protein metabolic process (GO:0044267)|GTP catabolic process (GO:0006184)|post-chaperonin tubulin folding pathway (GO:0007023)|protein folding (GO:0006457)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)	chaperone binding (GO:0051087)|GTPase activity (GO:0003924)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|urinary_tract(3)	14	Colorectal(47;0.196)		all cancers(41;0.00122)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.125)			ACTGCCGGGGGGATGCCAGGA	0.637																																						.											0													12.0	14.0	13.0					6																	42713337		2196	4291	6487	SO:0001583	missense	6903			U61234	CCDS4872.1	6p21.1	2008-02-05	2006-11-21		ENSG00000124659	ENSG00000124659			11580	protein-coding gene	gene with protein product		602971	"""tubulin-specific chaperone c"""			8706133, 11847227	Standard	NM_003192		Approved	CFC	uc003osl.3	Q15814	OTTHUMG00000014704	ENST00000372876.1:c.475C>T	6.37:g.42713337G>A	ENSP00000361967:p.Pro159Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q53Y43|Q5T787	Missense_Mutation	SNP	ENST00000372876.1	37	CCDS4872.1	.	.	.	.	.	.	.	.	.	.	G	0.019	-1.449022	0.01080	.	.	ENSG00000124659	ENST00000372876;ENST00000244625	T;T	0.75154	-0.91;-0.91	1.03	-1.1	0.09872	.	0.817042	0.11186	N	0.590398	T	0.32164	0.0820	L	0.35854	1.095	0.32258	N	0.570472	B	0.12013	0.005	B	0.11329	0.006	T	0.01484	-1.1343	10	0.10111	T	0.7	-13.7078	2.3667	0.04321	0.0:0.319:0.3634:0.3176	.	159	Q15814	TBCC_HUMAN	S	159	ENSP00000361967:P159S;ENSP00000244625:P159S	ENSP00000244625:P159S	P	-	1	0	TBCC	42821315	0.001000	0.12720	0.561000	0.28357	0.392000	0.30506	0.015000	0.13355	0.308000	0.22923	0.313000	0.20887	CCC		0.637	TBCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040559.1	NM_003192	
PEX6	5190	hgsc.bcm.edu	37	6	42946490	42946490	+	Silent	SNP	C	C	A	rs9462858	byFrequency	TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr6:42946490C>A	ENST00000304611.8	-	1	468	c.399G>T	c.(397-399)gtG>gtT	p.V133V	PEX6_ENST00000244546.4_Silent_p.V133V	NM_000287.3	NP_000278.3	Q13608	PEX6_HUMAN	peroxisomal biogenesis factor 6	133					ATP catabolic process (GO:0006200)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix, translocation (GO:0016561)|protein stabilization (GO:0050821)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(3)	15			all cancers(41;0.00235)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0562)			GCGGTCCGGGCACTGGGAGGG	0.746													C|||	1662	0.331869	0.3691	0.3516	5008	,	,		10923	0.1002		0.4612	False		,,,				2504	0.3732					.											0								C		1002,2080		214,574,753	2.0	3.0	3.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	399	2.1	0.9	6	dbSNP_119	3	2653,4001		636,1381,1310	no	coding-synonymous	PEX6	NM_000287.3		850,1955,2063	AA,AC,CC		39.8708,32.5114,37.5411		133/981	42946490	3655,6081	1541	3327	4868	SO:0001819	synonymous_variant	5190			U56602	CCDS4877.1	6p22-p11	2010-04-21			ENSG00000124587	ENSG00000124587		"""ATPases / AAA-type"""	8859	protein-coding gene	gene with protein product		601498				8670792	Standard	NM_000287		Approved	PXAAA1, PAF-2	uc003otf.3	Q13608	OTTHUMG00000014713	ENST00000304611.8:c.399G>T	6.37:g.42946490C>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q5T8W1|Q8WYQ0|Q8WYQ1|Q8WYQ2|Q99476	Silent	SNP	ENST00000304611.8	37	CCDS4877.1																																																																																				0.746	PEX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040569.1	NM_000287	
PHF2	5253	hgsc.bcm.edu	37	9	96439004	96439005	+	In_Frame_Ins	INS	-	-	CCTGCCTCCACCACA	rs75653373|rs149736720|rs368818072	byFrequency	TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr9:96439004_96439005insCCTGCCTCCACCACA	ENST00000359246.4	+	21	3328_3329	c.2961_2962insCCTGCCTCCACCACA	c.(2962-2964)ccg>CCTGCCTCCACCACAccg	p.988_988P>PASTTP	PHF2_ENST00000375376.4_In_Frame_Ins_p.219_219P>PASTTP	NM_005392.3	NP_005383.3	O75151	PHF2_HUMAN	PHD finger protein 2	988	Ser/Thr-rich.				liver development (GO:0001889)|negative regulation of chromatin silencing at rDNA (GO:0061188)|protein demethylation (GO:0006482)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K9 specific) (GO:0032454)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.T987_P988insPASTT(1)|p.T987T(1)		breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;9.11e-28)		cctctaccaccccggcctccac	0.688														2369	0.473043	0.6853	0.4265	5008	,	,		14854	0.4246		0.5089	False		,,,				2504	0.2321					.											2	Insertion - In frame(1)|Substitution - coding silent(1)	large_intestine(1)|central_nervous_system(1)								3102,73,967		1205,35,657,8,22,144						0.7	1.0		dbSNP_130	68	5084,99,2939		1725,33,1601,12,42,648	no	codingComplex	PHF2	NM_005392.3		2930,68,2258,20,64,792	A1A1,A1A2,A1R,A2A2,A2R,RR		37.4046,25.1086,33.2518				8186,172,3906				SO:0001652	inframe_insertion	5253			AF043725	CCDS35069.1	9q22	2013-01-28			ENSG00000197724	ENSG00000197724		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	8920	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1E"", ""centromere protein 35"""	604351				10051327, 20129925	Standard	NM_005392		Approved	KIAA0662, JHDM1E, CENP-35	uc004aub.3	O75151	OTTHUMG00000020253	Exception_encountered	9.37:g.96439004_96439005insCCTGCCTCCACCACA	ENSP00000352185:p.AlaSerThrThrPro993dup	Somatic		WXS	Illumina HiSeq	Phase_I	Q4VXG0|Q8N3K2|Q9Y6N4	In_Frame_Ins	INS	ENST00000359246.4	37	CCDS35069.1																																																																																				0.688	PHF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053162.1	NM_005392	
TTLL11	158135	hgsc.bcm.edu;ucsc.edu	37	9	124751435	124751435	+	Silent	SNP	C	C	T			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr9:124751435C>T	ENST00000373776.3	-	4	1765	c.1578G>A	c.(1576-1578)ttG>ttA	p.L526L	TTLL11_ENST00000474723.1_Intron|TTLL11_ENST00000321582.5_Intron	NM_194252.2	NP_919228.2	Q8NHH1	TTL11_HUMAN	tubulin tyrosine ligase-like family, member 11	526	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cellular protein modification process (GO:0006464)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(3)|skin(1)	18						TGAGGCCGGTCAAGGCTGGAA	0.612																																						.											0													68.0	67.0	67.0					9																	124751435		2203	4300	6503	SO:0001819	synonymous_variant	158135			AF521886	CCDS6834.2, CCDS48012.1	9q34.11	2013-02-14	2005-07-28	2005-07-28	ENSG00000175764	ENSG00000175764		"""Tubulin tyrosine ligase-like family"""	18113	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 20"""	C9orf20		15890843	Standard	NM_001139442		Approved	bA244O19.1	uc011lyl.2	Q8NHH1	OTTHUMG00000020597	ENST00000373776.3:c.1578G>A	9.37:g.124751435C>T		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000373776.3	37	CCDS6834.2																																																																																				0.612	TTLL11-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053907.1	XM_088486	
SLC25A28	81894	hgsc.bcm.edu	37	10	101373519	101373519	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr10:101373519A>G	ENST00000370495.4	-	2	482	c.454T>C	c.(454-456)Tac>Cac	p.Y152H	SLC25A28_ENST00000496035.1_5'UTR	NM_031212.3	NP_112489.3	Q96A46	MFRN2_HUMAN	solute carrier family 25 (mitochondrial iron transporter), member 28	152					ion transport (GO:0006811)|iron ion homeostasis (GO:0055072)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				endometrium(1)|kidney(2)|large_intestine(4)|liver(1)|lung(2)|stomach(1)	11		Colorectal(252;0.234)		Epithelial(162;2.57e-10)|all cancers(201;2.01e-08)		AACTTTTCGTAGCAGGCAAAA	0.522																																						.											0													63.0	68.0	66.0					10																	101373519		1907	4115	6022	SO:0001583	missense	81894			AF327402	CCDS41559.1	10q24.2	2013-05-22	2012-03-29		ENSG00000155287	ENSG00000155287		"""Solute carriers"""	23472	protein-coding gene	gene with protein product	"""mitoferrin 2"""	609767	"""solute carrier family 25, member 28"""			11297739	Standard	NM_031212		Approved	MRS3/4, MRS4L	uc001kpx.2	Q96A46	OTTHUMG00000018886	ENST00000370495.4:c.454T>C	10.37:g.101373519A>G	ENSP00000359526:p.Tyr152His	Somatic		WXS	Illumina HiSeq	Phase_I	Q4VBZ0|Q5T777|Q86VX5|Q969G8|Q9H2J3	Missense_Mutation	SNP	ENST00000370495.4	37	CCDS41559.1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.565618	0.86439	.	.	ENSG00000155287	ENST00000370495	D	0.84873	-1.91	5.26	5.26	0.73747	Mitochondrial carrier domain (2);	0.000000	0.64402	D	0.000001	D	0.95674	0.8593	H	0.98918	4.37	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97451	1.0028	10	0.72032	D	0.01	-20.6478	15.3365	0.74260	1.0:0.0:0.0:0.0	.	152	Q96A46	MFRN2_HUMAN	H	152	ENSP00000359526:Y152H	ENSP00000359526:Y152H	Y	-	1	0	SLC25A28	101363509	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.735000	0.91549	2.208000	0.71279	0.459000	0.35465	TAC		0.522	SLC25A28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049801.1	NM_031212	
CCDC73	493860	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	11	32635093	32635093	+	Missense_Mutation	SNP	G	G	A	rs201737265		TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr11:32635093G>A	ENST00000335185.5	-	16	2814	c.2771C>T	c.(2770-2772)tCg>tTg	p.S924L	CCDC73_ENST00000534415.1_5'Flank	NM_001008391.2	NP_001008392.2	Q6ZRK6	CCD73_HUMAN	coiled-coil domain containing 73	924										NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	51	Breast(20;0.112)					GCAAGGGGTCGAACTGCTCGC	0.378													G|||	1	0.000199681	0.0	0.0	5008	,	,		16516	0.001		0.0	False		,,,				2504	0.0					.											0													126.0	116.0	120.0					11																	32635093		1837	4075	5912	SO:0001583	missense	493860			AK128159	CCDS41630.1	11p13	2006-02-11			ENSG00000186714	ENSG00000186714			23261	protein-coding gene	gene with protein product		612328					Standard	NM_001008391		Approved	NY-SAR-79	uc001mtv.4	Q6ZRK6	OTTHUMG00000166279	ENST00000335185.5:c.2771C>T	11.37:g.32635093G>A	ENSP00000335325:p.Ser924Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q6P5Q7|Q6ZMW0|Q86WE7	Missense_Mutation	SNP	ENST00000335185.5	37	CCDS41630.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	4.192	0.034318	0.08101	.	.	ENSG00000186714	ENST00000335185	.	.	.	5.18	0.492	0.16872	.	1.274690	0.05407	N	0.541652	T	0.33904	0.0879	L	0.38838	1.175	0.20074	N	0.999939	B	0.25169	0.119	B	0.17979	0.02	T	0.29119	-1.0022	9	0.36615	T	0.2	.	10.1385	0.42721	0.3216:0.0:0.6784:0.0	.	924	Q6ZRK6	CCD73_HUMAN	L	924	.	ENSP00000335325:S924L	S	-	2	0	CCDC73	32591669	0.991000	0.36638	0.009000	0.14445	0.015000	0.08874	1.933000	0.40153	0.183000	0.20059	0.544000	0.68410	TCG		0.378	CCDC73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388874.2	NM_001008391	
C2orf78	388960	hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	2	74043649	74043649	+	Missense_Mutation	SNP	C	C	A			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr2:74043649C>A	ENST00000409561.1	+	3	2420	c.2299C>A	c.(2299-2301)Cca>Aca	p.P767T		NM_001080474.1	NP_001073943.1	A6NCI8	CB078_HUMAN	chromosome 2 open reading frame 78	767										cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(2)|prostate(2)|soft_tissue(1)|urinary_tract(1)	34						TGCAGTCAATCCATCCCGACC	0.542																																						.											0													109.0	114.0	112.0					2																	74043649		2119	4237	6356	SO:0001583	missense	388960			AC092653, AC136006, AK125975	CCDS46338.1	2p13.2	2008-07-18			ENSG00000187833	ENSG00000187833			34349	protein-coding gene	gene with protein product							Standard	NM_001080474		Approved	FLJ43987, hCG1989538, COG5373	uc002sjr.1	A6NCI8	OTTHUMG00000152819	ENST00000409561.1:c.2299C>A	2.37:g.74043649C>A	ENSP00000387124:p.Pro767Thr	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000409561.1	37	CCDS46338.1	.	.	.	.	.	.	.	.	.	.	C	11.68	1.709494	0.30322	.	.	ENSG00000187833	ENST00000409561;ENST00000342345	T	0.44482	0.92	5.23	-1.87	0.07737	.	0.889887	0.09394	N	0.808096	T	0.31638	0.0803	L	0.59436	1.845	0.09310	N	1	P	0.38078	0.617	B	0.30855	0.121	T	0.24190	-1.0167	10	0.87932	D	0	0.0072	5.999	0.19509	0.0:0.4846:0.2746:0.2408	.	767	A6NCI8	CB078_HUMAN	T	767;737	ENSP00000387124:P767T	ENSP00000340692:P737T	P	+	1	0	C2orf78	73897157	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-1.473000	0.02339	-0.235000	0.09767	0.563000	0.77884	CCA		0.542	C2orf78-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000328083.1	NM_001080474	
NT5C1A	84618	broad.mit.edu	37	1	40124870	40124870	+	Missense_Mutation	SNP	C	C	A			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr1:40124870C>A	ENST00000235628.1	-	6	1029	c.1030G>T	c.(1030-1032)Gcc>Tcc	p.A344S		NM_032526.1	NP_115915.1	Q9BXI3	5NT1A_HUMAN	5'-nucleotidase, cytosolic IA	344					adenosine metabolic process (GO:0046085)|dephosphorylation (GO:0016311)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside metabolic process (GO:0009116)|purine nucleobase metabolic process (GO:0006144)|purine nucleoside monophosphate catabolic process (GO:0009128)|purine nucleotide catabolic process (GO:0006195)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	5'-nucleotidase activity (GO:0008253)|magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)			breast(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(2)	15	Lung NSC(20;3.81e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;4.3e-17)|all cancers(16;8.48e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			ACATGGGCGGCCACAGTGCCC	0.597																																						.											0													60.0	63.0	62.0					1																	40124870		2203	4300	6503	SO:0001583	missense	84618			AF331801	CCDS440.1	1p34.3-p33	2008-07-18			ENSG00000116981	ENSG00000116981			17819	protein-coding gene	gene with protein product	"""cytosolic 5' nucleotidase, type 1A"", ""AMP-specific 5'-NT"", ""cytosolic 5'-nucleotidase IA"""	610525				11133996, 11690631	Standard	NM_032526		Approved	CN-I, CN-IA, CN1A, CN1, MGC119199, MGC119201	uc001cdq.1	Q9BXI3	OTTHUMG00000009244	ENST00000235628.1:c.1030G>T	1.37:g.40124870C>A	ENSP00000235628:p.Ala344Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q3SYB9|Q5TG98|Q9BWT8	Missense_Mutation	SNP	ENST00000235628.1	37	CCDS440.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.588502	0.86851	.	.	ENSG00000116981	ENST00000235628	.	.	.	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.46776	0.1410	N	0.20807	0.61	0.80722	D	1	P	0.39551	0.678	B	0.41619	0.361	T	0.32322	-0.9911	9	0.10902	T	0.67	0.0215	19.6491	0.95794	0.0:1.0:0.0:0.0	.	344	Q9BXI3	5NT1A_HUMAN	S	344	.	ENSP00000235628:A344S	A	-	1	0	NT5C1A	39897457	1.000000	0.71417	0.999000	0.59377	0.774000	0.43823	7.792000	0.85828	2.726000	0.93360	0.655000	0.94253	GCC		0.597	NT5C1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025626.1	NM_032526	
LPPR5	163404	broad.mit.edu;mdanderson.org;bcgsc.ca	37	1	99418744	99418744	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr1:99418744G>A	ENST00000263177.4	-	3	724	c.503C>T	c.(502-504)aCa>aTa	p.T168I	LPPR5_ENST00000370188.3_Missense_Mutation_p.T168I	NM_001037317.1	NP_001032394.1	Q32ZL2	LPPR5_HUMAN		168						integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)										GATGAATTGTGTATACTGCTG	0.463																																						.											0													122.0	110.0	114.0					1																	99418744		2203	4300	6503	SO:0001583	missense	0																														ENST00000263177.4:c.503C>T	1.37:g.99418744G>A	ENSP00000263177:p.Thr168Ile	Somatic		WXS	Illumina HiSeq	Phase_I	A8MPX4|B7UCH3|Q32ZD0|Q3ZCU7	Missense_Mutation	SNP	ENST00000263177.4	37	CCDS30778.1	.	.	.	.	.	.	.	.	.	.	G	8.713	0.912415	0.17907	.	.	ENSG00000117598	ENST00000370188;ENST00000263177	T;T	0.41065	1.01;1.01	4.7	4.7	0.59300	.	0.140387	0.49305	D	0.000157	T	0.14700	0.0355	N	0.11000	0.08	0.35912	D	0.831142	B;B	0.21821	0.05;0.061	B;B	0.22152	0.022;0.038	T	0.04320	-1.0960	10	0.36615	T	0.2	.	16.9952	0.86365	0.0:0.0:1.0:0.0	.	168;168	Q32ZL2-2;Q32ZL2	.;LPPR5_HUMAN	I	168	ENSP00000359207:T168I;ENSP00000263177:T168I	ENSP00000263177:T168I	T	-	2	0	AL161744.1	99191332	0.970000	0.33590	1.000000	0.80357	0.828000	0.46876	3.609000	0.54117	2.300000	0.77407	0.655000	0.94253	ACA		0.463	LPPR5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000393221.1		
RGS16	6004	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	1	182572462	182572462	+	Missense_Mutation	SNP	G	G	T			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr1:182572462G>T	ENST00000367558.5	-	2	205	c.57C>A	c.(55-57)ttC>ttA	p.F19L		NM_002928.3	NP_002919.3	O15492	RGS16_HUMAN	regulator of G-protein signaling 16	19					positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)			NS(1)|endometrium(3)|large_intestine(2)|lung(4)|ovary(1)	11						GACGTGTCTTGAACTCTTTGG	0.483																																						.											0													129.0	117.0	121.0					1																	182572462		2203	4300	6503	SO:0001583	missense	6004			U70426	CCDS1348.1	1q25-q31	2008-02-05	2007-08-14		ENSG00000143333	ENSG00000143333		"""Regulators of G-protein signaling"""	9997	protein-coding gene	gene with protein product		602514	"""regulator of G-protein signalling 16"""			9469939	Standard	NM_002928		Approved	A28-RGS14, RGS-r	uc001gpl.4	O15492	OTTHUMG00000035212	ENST00000367558.5:c.57C>A	1.37:g.182572462G>T	ENSP00000356529:p.Phe19Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B2R4M4|Q5VYN9|Q99701	Missense_Mutation	SNP	ENST00000367558.5	37	CCDS1348.1	.	.	.	.	.	.	.	.	.	.	G	7.895	0.733217	0.15574	.	.	ENSG00000143333	ENST00000367558	T	0.52057	0.68	5.25	4.31	0.51392	.	0.388578	0.29684	N	0.011467	T	0.28995	0.0720	N	0.12637	0.245	0.27994	N	0.935533	B;B	0.12013	0.005;0.0	B;B	0.11329	0.006;0.003	T	0.12066	-1.0562	10	0.20046	T	0.44	.	13.1514	0.59492	0.0:0.3075:0.6925:0.0	.	19;19	B4DVW5;O15492	.;RGS16_HUMAN	L	19	ENSP00000356529:F19L	ENSP00000356529:F19L	F	-	3	2	RGS16	180839085	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.166000	0.31834	1.158000	0.42547	0.561000	0.74099	TTC		0.483	RGS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085188.1	NM_002928	
MUC2	4583	broad.mit.edu;mdanderson.org	37	11	1092631	1092631	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr11:1092631C>T	ENST00000441003.2	+	30	4477	c.4450C>T	c.(4450-4452)Ccc>Tcc	p.P1484S	MUC2_ENST00000359061.5_Missense_Mutation_p.P1485S|MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	4219	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	aaccaccactcccaGCCCTCC	0.627																																						.											0													245.0	372.0	327.0					11																	1092631		1617	3015	4632	SO:0001583	missense	4583			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4450C>T	11.37:g.1092631C>T	ENSP00000415183:p.Pro1484Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	c	0.346	-0.947869	0.02304	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.13307	2.67;2.6	1.51	-3.01	0.05463	.	2582.360000	0.00783	U	0.001290	T	0.05364	0.0142	.	.	.	0.09310	N	1	B	0.17852	0.024	B	0.09377	0.004	T	0.22765	-1.0207	9	0.09590	T	0.72	.	0.5823	0.00714	0.3056:0.3209:0.141:0.2324	.	1484	E7EUV1	.	S	1484;1485	ENSP00000415183:P1484S;ENSP00000351956:P1485S	ENSP00000351956:P1485S	P	+	1	0	MUC2	1082631	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.001000	0.01465	-1.883000	0.01120	0.000000	0.15137	CCC		0.627	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
STRN3	29966	broad.mit.edu	37	14	31420078	31420078	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr14:31420078A>G	ENST00000357479.5	-	4	729	c.533T>C	c.(532-534)cTt>cCt	p.L178P	STRN3_ENST00000355683.5_Missense_Mutation_p.L178P	NM_001083893.1	NP_001077362.1	Q13033	STRN3_HUMAN	striatin, calmodulin binding protein 3	178	Calmodulin-binding. {ECO:0000255}.				negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to estradiol (GO:0032355)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Hepatocellular(127;0.0877)|Breast(36;0.148)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.0124)		CTGTCTTAAAAGCTGTCTGCC	0.348																																						.											0													131.0	130.0	130.0					14																	31420078		2203	4300	6503	SO:0001583	missense	29966				CCDS9641.1, CCDS41938.1	14q13-q21	2013-01-10			ENSG00000196792	ENSG00000196792		"""WD repeat domain containing"""	15720	protein-coding gene	gene with protein product	"""cell cycle S/G2 nuclear autoantigen"""	614766				7864889, 10681496	Standard	NM_014574		Approved	SG2NA	uc001wqu.2	Q13033	OTTHUMG00000140201	ENST00000357479.5:c.533T>C	14.37:g.31420078A>G	ENSP00000350071:p.Leu178Pro	Somatic		WXS	Illumina HiSeq	Phase_I	A2RTX7|A6NHZ7|Q9NRA5	Missense_Mutation	SNP	ENST00000357479.5	37	CCDS41938.1	.	.	.	.	.	.	.	.	.	.	A	23.9	4.466525	0.84425	.	.	ENSG00000196792	ENST00000355683;ENST00000357479;ENST00000555152	D;D	0.86097	-2.07;-2.07	5.93	5.93	0.95920	Striatin, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.93354	0.7881	M	0.86864	2.845	0.80722	D	1	D;D	0.89917	0.996;1.0	D;D	0.91635	0.91;0.999	D	0.94299	0.7535	10	0.87932	D	0	-17.0829	16.4321	0.83853	1.0:0.0:0.0:0.0	.	178;178	Q13033-2;Q13033	.;STRN3_HUMAN	P	178;178;59	ENSP00000347909:L178P;ENSP00000350071:L178P	ENSP00000347909:L178P	L	-	2	0	STRN3	30489829	1.000000	0.71417	0.998000	0.56505	0.975000	0.68041	8.604000	0.90877	2.281000	0.76405	0.529000	0.55759	CTT		0.348	STRN3-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409713.1	NM_014574	
SPESP1	246777	broad.mit.edu	37	15	69238206	69238206	+	Silent	SNP	A	A	G			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr15:69238206A>G	ENST00000310673.3	+	2	487	c.333A>G	c.(331-333)ggA>ggG	p.G111G	NOX5_ENST00000260364.5_Intron|NOX5_ENST00000455873.3_Intron|NOX5_ENST00000448182.3_Intron|RP11-809H16.2_ENST00000557966.1_RNA|SPESP1_ENST00000560188.1_3'UTR	NM_145658.3	NP_663633.1	Q6UW49	SPESP_HUMAN	sperm equatorial segment protein 1	111					acrosome reaction (GO:0007340)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organismal development (GO:0007275)	acrosomal vesicle (GO:0001669)				breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|prostate(1)|skin(1)|urinary_tract(1)	19						CGGAAATAGGAAAGAAAAAAC	0.398																																						.											0													61.0	62.0	62.0					15																	69238206		2200	4298	6498	SO:0001819	synonymous_variant	246777			AF275321	CCDS10230.1	15q22.31	2011-04-15				ENSG00000258484			15570	protein-coding gene	gene with protein product		609399				12773409	Standard	NM_145658		Approved	SP-ESP	uc002arn.2	Q6UW49		ENST00000310673.3:c.333A>G	15.37:g.69238206A>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q8NG22|Q8WVH8	Silent	SNP	ENST00000310673.3	37	CCDS10230.1																																																																																				0.398	SPESP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257125.1	NM_145658	
PKM	5315	broad.mit.edu;mdanderson.org;bcgsc.ca	37	15	72492092	72492092	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr15:72492092C>T	ENST00000335181.5	-	11	1598	c.1495G>A	c.(1495-1497)Gcc>Acc	p.A499T	GRAMD2_ENST00000309731.7_5'Flank|PKM_ENST00000565154.1_Missense_Mutation_p.A499T|PKM_ENST00000568459.1_Missense_Mutation_p.A499T|PKM_ENST00000449901.2_Missense_Mutation_p.A484T|PKM_ENST00000568883.1_Missense_Mutation_p.A334T|PKM_ENST00000565184.1_Missense_Mutation_p.A499T|PKM_ENST00000389093.3_Missense_Mutation_p.A499T|PKM_ENST00000319622.6_Missense_Mutation_p.A499T	NM_002654.4	NP_002645.3	P14618	KPYM_HUMAN	pyruvate kinase, muscle	499	Interaction with POU5F1.				carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|programmed cell death (GO:0012501)|small molecule metabolic process (GO:0044281)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MHC class II protein complex binding (GO:0023026)|poly(A) RNA binding (GO:0044822)|potassium ion binding (GO:0030955)|pyruvate kinase activity (GO:0004743)			endometrium(1)|lung(7)	8					Pyruvic acid(DB00119)	AAGCCTCGGGCCTTGCCTGGA	0.587											OREG0023252	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										.											0													45.0	41.0	42.0					15																	72492092		2199	4297	6496	SO:0001583	missense	5315			M23725	CCDS32284.1, CCDS32285.1, CCDS55972.1, CCDS73752.1	15q23	2012-10-02		2012-05-23	ENSG00000067225	ENSG00000067225	2.7.1.40		9021	protein-coding gene	gene with protein product		179050		PKM2		2040271	Standard	NM_002654		Approved	THBP1, OIP3, PK3	uc002atr.1	P14618	OTTHUMG00000172709	ENST00000335181.5:c.1495G>A	15.37:g.72492092C>T	ENSP00000334983:p.Ala499Thr	Somatic	1138	WXS	Illumina HiSeq	Phase_I	A6NFK3|B2R5N8|B3KRY0|B4DFX8|B4DUU6|P14786|Q53GK4|Q96E76|Q9BWB5|Q9UCV6|Q9UPF2	Missense_Mutation	SNP	ENST00000335181.5	37	CCDS32284.1	.	.	.	.	.	.	.	.	.	.	C	15.82	2.947399	0.53186	.	.	ENSG00000067225	ENST00000319622;ENST00000335181;ENST00000434220;ENST00000327974;ENST00000389093;ENST00000449901	D;D;D;D	0.99051	-5.37;-5.37;-5.37;-5.37	5.33	5.33	0.75918	Pyruvate kinase, C-terminal (2);Pyruvate kinase, alpha/beta (1);	0.051452	0.85682	D	0.000000	D	0.97816	0.9283	M	0.61703	1.905	0.58432	D	0.999999	B;B;B;B;B;B;B;B	0.12630	0.001;0.005;0.0;0.0;0.0;0.003;0.0;0.006	B;B;B;B;B;B;B;B	0.14578	0.003;0.011;0.007;0.002;0.003;0.009;0.003;0.009	D	0.97679	1.0171	10	0.16896	T	0.51	-14.6084	19.3858	0.94555	0.0:1.0:0.0:0.0	.	425;484;479;499;499;334;426;334	B4DNK4;B4DUU6;E7EUQ8;P14618;P14618-2;Q504U3;E9PF79;E7EUJ4	.;.;.;KPYM_HUMAN;.;.;.;.	T	499;499;426;334;499;484	ENSP00000320171:A499T;ENSP00000334983:A499T;ENSP00000373745:A499T;ENSP00000403365:A484T	ENSP00000320171:A499T	A	-	1	0	PKM2	70279146	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	4.787000	0.62432	2.659000	0.90383	0.561000	0.74099	GCC		0.587	PKM-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420056.1		
C17orf74	201243	broad.mit.edu	37	17	7329926	7329926	+	Missense_Mutation	SNP	T	T	G			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr17:7329926T>G	ENST00000333870.3	+	3	690	c.616T>G	c.(616-618)Ttt>Gtt	p.F206V	C17orf74_ENST00000574034.1_Missense_Mutation_p.V93G|RP11-104H15.7_ENST00000575310.1_RNA	NM_175734.4	NP_783861.3	Q0P670	CQ074_HUMAN	chromosome 17 open reading frame 74	206						integral component of membrane (GO:0016021)				cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	22		Prostate(122;0.157)				CTGGGGCGGGTTTTATCAGAG	0.617																																						.											0													61.0	68.0	66.0					17																	7329926		1986	4144	6130	SO:0001583	missense	201243			BC044816	CCDS42255.1	17p13.1	2012-05-30			ENSG00000184560	ENSG00000184560			27315	protein-coding gene	gene with protein product						12477932	Standard	NM_175734		Approved		uc002ggw.3	Q0P670	OTTHUMG00000178190	ENST00000333870.3:c.616T>G	17.37:g.7329926T>G	ENSP00000328061:p.Phe206Val	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000333870.3	37	CCDS42255.1	.	.	.	.	.	.	.	.	.	.	T	13.98	2.400165	0.42613	.	.	ENSG00000184560	ENST00000333870	T	0.29397	1.57	4.18	-2.97	0.05530	.	0.539313	0.14997	N	0.286328	T	0.15046	0.0363	N	0.19112	0.55	0.09310	N	1	B	0.24426	0.103	B	0.25140	0.058	T	0.15263	-1.0443	10	0.59425	D	0.04	-18.58	4.2722	0.10792	0.1662:0.2783:0.0:0.5555	.	206	Q0P670	CQ074_HUMAN	V	206	ENSP00000328061:F206V	ENSP00000328061:F206V	F	+	1	0	C17orf74	7270650	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.504000	0.02275	-0.285000	0.09089	-0.415000	0.06103	TTT		0.617	C17orf74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440933.2	NM_175734	
TP53	7157	broad.mit.edu	37	17	7577559	7577559	+	Missense_Mutation	SNP	G	G	A	rs397516437|rs28934573		TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr17:7577559G>A	ENST00000269305.4	-	7	911	c.722C>T	c.(721-723)tCc>tTc	p.S241F	TP53_ENST00000420246.2_Missense_Mutation_p.S241F|TP53_ENST00000359597.4_Missense_Mutation_p.S241F|TP53_ENST00000445888.2_Missense_Mutation_p.S241F|TP53_ENST00000413465.2_Missense_Mutation_p.S241F|TP53_ENST00000455263.2_Missense_Mutation_p.S241F|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	241	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		S -> A (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.|S -> C (in sporadic cancers; somatic mutation).|S -> F (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934573). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228}.|S -> P (in sporadic cancers; somatic mutation).|S -> T (in LFS; germline mutation and in sporadic cancers; somatic mutation).|S -> Y (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.S241F(85)|p.S241C(26)|p.0?(8)|p.S241Y(8)|p.C242fs*5(6)|p.?(5)|p.S241del(5)|p.S148F(4)|p.N239_C242delNSSC(3)|p.N239_C242>S(1)|p.C238fs*21(1)|p.S241fs*22(1)|p.N239_C242del(1)|p.Y236_M243delYMCNSSCM(1)|p.S241_G245delSCMGG(1)|p.S148C(1)|p.N239fs*4(1)|p.C238_M246delCNSSCMGGM(1)|p.H233_C242del10(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCCCATGCAGGAACTGTTACA	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	160	Substitution - Missense(124)|Deletion - In frame(13)|Deletion - Frameshift(9)|Whole gene deletion(8)|Unknown(5)|Complex - deletion inframe(1)	urinary_tract(19)|large_intestine(18)|breast(17)|endometrium(15)|ovary(15)|lung(12)|skin(9)|biliary_tract(8)|central_nervous_system(8)|haematopoietic_and_lymphoid_tissue(7)|upper_aerodigestive_tract(6)|stomach(6)|oesophagus(5)|bone(5)|liver(3)|pancreas(3)|eye(2)|thyroid(1)|kidney(1)	GRCh37	CM920673	TP53	M	rs28934573						139.0	108.0	118.0					17																	7577559		2203	4300	6503	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.722C>T	17.37:g.7577559G>A	ENSP00000269305:p.Ser241Phe	Somatic		WXS	Illumina HiSeq	Phase_I	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	17.50	3.404027	0.62288	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99857	-7.22;-7.22;-7.22;-7.22;-7.22;-7.22;-7.22;-7.22	4.62	3.64	0.41730	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.120078	0.56097	D	0.000022	D	0.99871	0.9939	M	0.92784	3.345	0.53688	A	0.999973	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.96525	0.9388	9	0.87932	D	0	-35.4617	12.8645	0.57932	0.0:0.1651:0.8349:0.0	rs28934573	241;241;148;241;241;241	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	F	241;241;241;241;241;241;230;148;109;148	ENSP00000410739:S241F;ENSP00000352610:S241F;ENSP00000269305:S241F;ENSP00000398846:S241F;ENSP00000391127:S241F;ENSP00000391478:S241F;ENSP00000425104:S109F;ENSP00000423862:S148F	ENSP00000269305:S241F	S	-	2	0	TP53	7518284	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.346000	0.44027	1.295000	0.44724	0.462000	0.41574	TCC		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
CTDP1	9150	broad.mit.edu;ucsc.edu;mdanderson.org	37	18	77513733	77513733	+	Silent	SNP	C	C	T			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr18:77513733C>T	ENST00000299543.7	+	13	2976	c.2829C>T	c.(2827-2829)agC>agT	p.S943S	CTDP1_ENST00000075430.7_3'UTR	NM_001202504.1|NM_004715.4	NP_001189433.1|NP_004706.3	Q9Y5B0	CTDP1_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1	943					exit from mitosis (GO:0010458)|gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|protein dephosphorylation (GO:0006470)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	CTD phosphatase activity (GO:0008420)|DNA-directed RNA polymerase activity (GO:0003899)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|prostate(2)|urinary_tract(1)	35		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;5.2e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0277)		AGGGCAGCAGCTCCGAGGCCG	0.642																																						.											0													46.0	45.0	46.0					18																	77513733		2203	4300	6503	SO:0001819	synonymous_variant	9150			AF081287	CCDS12017.1, CCDS12018.1, CCDS74239.1	18q23	2014-09-17			ENSG00000060069	ENSG00000060069		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	2498	protein-coding gene	gene with protein product		604927				9405607, 9765293	Standard	NM_004715		Approved	FCP1	uc002lnh.2	Q9Y5B0	OTTHUMG00000132920	ENST00000299543.7:c.2829C>T	18.37:g.77513733C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A8MY97|Q7Z644|Q96BZ1|Q9Y6F5	Silent	SNP	ENST00000299543.7	37	CCDS12017.1																																																																																				0.642	CTDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256432.1	NM_004715	
TMEM205	374882	broad.mit.edu;mdanderson.org;bcgsc.ca	37	19	11453585	11453585	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr19:11453585C>T	ENST00000354882.5	-	3	902	c.476G>A	c.(475-477)cGc>cAc	p.R159H	TMEM205_ENST00000587948.1_Missense_Mutation_p.R159H|TMEM205_ENST00000588560.1_Missense_Mutation_p.R159H|CCDC159_ENST00000588790.1_5'Flank|TMEM205_ENST00000447337.1_Missense_Mutation_p.R159H|RAB3D_ENST00000589655.1_Intron|TMEM205_ENST00000589555.1_Missense_Mutation_p.R159H|TMEM205_ENST00000586956.1_Missense_Mutation_p.R159H|TMEM205_ENST00000586218.1_Missense_Mutation_p.R98H|TMEM205_ENST00000586590.1_Missense_Mutation_p.R159H|TMEM205_ENST00000593256.2_Missense_Mutation_p.R159H			Q6UW68	TM205_HUMAN	transmembrane protein 205	159						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				endometrium(1)|lung(1)	2						CCCATGGTAGCGGAAGAAATT	0.607																																						.											0													117.0	108.0	111.0					19																	11453585		2203	4300	6503	SO:0001583	missense	374882			AK127147	CCDS32909.1	19p13.2	2008-01-09				ENSG00000105518			29631	protein-coding gene	gene with protein product		613771				12975309	Standard	NM_198536		Approved	UNQ501, MBC3205	uc002mrb.2	Q6UW68		ENST00000354882.5:c.476G>A	19.37:g.11453585C>T	ENSP00000346954:p.Arg159His	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000354882.5	37	CCDS32909.1	.	.	.	.	.	.	.	.	.	.	C	9.193	1.026438	0.19512	.	.	ENSG00000105518	ENST00000354882;ENST00000447337	.	.	.	4.82	-1.58	0.08479	.	0.304262	0.31519	N	0.007512	T	0.40886	0.1135	L	0.39898	1.24	0.43368	D	0.995457	B	0.11235	0.004	B	0.06405	0.002	T	0.15867	-1.0422	9	0.19147	T	0.46	-3.7126	10.4082	0.44276	0.0:0.4892:0.0:0.5108	.	159	Q6UW68	TM205_HUMAN	H	159	.	ENSP00000346954:R159H	R	-	2	0	TMEM205	11314585	0.906000	0.30813	0.936000	0.37596	0.393000	0.30537	0.156000	0.16382	-0.129000	0.11620	0.561000	0.74099	CGC		0.607	TMEM205-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458743.1	NM_198536	
ZNF98	148198	broad.mit.edu	37	19	22575373	22575373	+	Missense_Mutation	SNP	C	C	T	rs201074450		TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr19:22575373C>T	ENST00000357774.5	-	4	785	c.664G>A	c.(664-666)Gcc>Acc	p.A222T		NM_001098626.1	NP_001092096.1	A6NK75	ZNF98_HUMAN	zinc finger protein 98	222					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	37		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)				AGGTTTGAGGCCTCATTATAG	0.383																																						.											0													12.0	13.0	13.0					19																	22575373		1871	4124	5995	SO:0001583	missense	148198				CCDS46031.1	19p12	2014-02-14	2010-04-20	2008-06-12	ENSG00000197360	ENSG00000197360		"""Zinc fingers, C2H2-type"", ""-"""	13174	protein-coding gene	gene with protein product	"""zinc finger protein 739"""	603980					Standard	NM_001098626		Approved	ZNF739, F7175	uc002nqt.2	A6NK75	OTTHUMG00000182940	ENST00000357774.5:c.664G>A	19.37:g.22575373C>T	ENSP00000350418:p.Ala222Thr	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000357774.5	37	CCDS46031.1	.	.	.	.	.	.	.	.	.	.	.	4.784	0.145770	0.09134	.	.	ENSG00000197360	ENST00000357774	T	0.33654	1.4	1.28	-1.83	0.07833	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.18002	0.0432	N	0.17674	0.51	0.09310	N	1	B	0.22541	0.071	B	0.25987	0.065	T	0.27262	-1.0079	9	0.39692	T	0.17	.	0.0814	0.00032	0.2369:0.2268:0.2367:0.2996	.	222	A6NK75	ZNF98_HUMAN	T	222	ENSP00000350418:A222T	ENSP00000350418:A222T	A	-	1	0	ZNF98	22367213	0.000000	0.05858	0.001000	0.08648	0.138000	0.21146	-0.793000	0.04589	-0.223000	0.09943	0.305000	0.20034	GCC		0.383	ZNF98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464398.1	NM_001098626	
EML2	24139	broad.mit.edu	37	19	46124887	46124887	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr19:46124887G>A	ENST00000245925.3	-	10	900	c.850C>T	c.(850-852)Cgt>Tgt	p.R284C	EML2_ENST00000536630.1_Missense_Mutation_p.R431C|EML2_ENST00000586902.1_5'UTR|EML2_ENST00000589876.1_Missense_Mutation_p.R284C|EML2_ENST00000587152.1_Missense_Mutation_p.R485C	NM_012155.2	NP_036287.1	O95834	EMAL2_HUMAN	echinoderm microtubule associated protein like 2	284	Tandem atypical propeller in EMLs. {ECO:0000250}.				negative regulation of microtubule polymerization (GO:0031115)|regulation of microtubule nucleation (GO:0010968)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			NS(1)|breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(13)|ovary(1)|urinary_tract(1)	31		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)		TGTGTGATACGGTTCCCACCT	0.662																																						.											0													20.0	21.0	21.0					19																	46124887		2202	4295	6497	SO:0001583	missense	24139			AF103939	CCDS12670.1, CCDS54280.1, CCDS59399.1	19q13.32	2013-01-10				ENSG00000125746		"""WD repeat domain containing"""	18035	protein-coding gene	gene with protein product	"""echinoderm MT-associated protein (EMAP)-like protein 70"", ""microtubule-associated protein like echinoderm EMAP"""					11694528, 10521658	Standard	NM_012155		Approved	EMAP2, ELP70, EMAP-2	uc010xxm.2	O95834		ENST00000245925.3:c.850C>T	19.37:g.46124887G>A	ENSP00000245925:p.Arg284Cys	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z3I2|B7Z3Q9|K7ERL7|Q59EN8|Q8N5A2|Q9UG50	Missense_Mutation	SNP	ENST00000245925.3	37	CCDS12670.1	.	.	.	.	.	.	.	.	.	.	G	16.30	3.083522	0.55861	.	.	ENSG00000125746	ENST00000536630;ENST00000245925;ENST00000448055;ENST00000399594	T;T;T	0.39406	1.08;1.08;5.0	3.1	3.1	0.35709	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);WD40-repeat-containing domain (1);	0.069226	0.56097	U	0.000031	T	0.58850	0.2151	M	0.74881	2.28	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.83275	0.962;0.972;0.996;0.95	T	0.60642	-0.7223	10	0.62326	D	0.03	-16.5272	7.354	0.26709	0.0:0.0:0.739:0.261	.	284;450;431;284	B7Z918;B7Z3Q9;B7Z3I2;O95834	.;.;.;EMAL2_HUMAN	C	431;284;485;442	ENSP00000442365:R431C;ENSP00000245925:R284C;ENSP00000382503:R442C	ENSP00000245925:R284C	R	-	1	0	EML2	50816727	1.000000	0.71417	1.000000	0.80357	0.653000	0.38743	3.887000	0.56197	1.565000	0.49641	0.195000	0.17529	CGT		0.662	EML2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000459608.1	NM_012155	
USP34	9736	broad.mit.edu	37	2	61415632	61415632	+	Silent	SNP	G	G	T			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr2:61415632G>T	ENST00000398571.2	-	80	10322	c.10246C>A	c.(10246-10248)Cga>Aga	p.R3416R	AHSA2_ENST00000394457.3_3'UTR	NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	3416					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			ACTTCCATTCGGTATTCTTTA	0.403																																						.											0													105.0	97.0	99.0					2																	61415632		1906	4136	6042	SO:0001819	synonymous_variant	9736			AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.10246C>A	2.37:g.61415632G>T		Somatic		WXS	Illumina HiSeq	Phase_I	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Silent	SNP	ENST00000398571.2	37	CCDS42686.1	.	.	.	.	.	.	.	.	.	.	.	2.169	-0.390428	0.04932	.	.	ENSG00000115464	ENST00000411912	.	.	.	5.52	0.617	0.17619	.	.	.	.	.	T	0.68540	0.3012	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.68194	-0.5473	4	.	.	.	.	15.2903	0.73862	0.0:0.0:0.3806:0.6194	.	.	.	.	Q	1092	.	.	P	-	2	0	USP34	61269136	1.000000	0.71417	0.986000	0.45419	0.766000	0.43426	2.414000	0.44627	0.294000	0.22547	0.591000	0.81541	CCG		0.403	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4		
APOBEC3D	140564	broad.mit.edu	37	22	39421307	39421307	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr22:39421307T>C	ENST00000216099.8	+	3	850	c.443T>C	c.(442-444)cTc>cCc	p.L148P	APOBEC3D_ENST00000381568.4_Missense_Mutation_p.L148P|APOBEC3D_ENST00000427494.2_Intron	NM_152426.3	NP_689639.2	Q96AK3	ABC3D_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3D	148					defense response to virus (GO:0051607)|DNA cytosine deamination (GO:0070383)|innate immune response (GO:0045087)|negative regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045869)|negative regulation of transposition (GO:0010529)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amidines (GO:0016814)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(2)	11	Melanoma(58;0.04)					TGGGTGCTCCTCAGGCTGCAT	0.582																																						.											0													48.0	52.0	50.0					22																	39421307		2203	4300	6503	SO:0001583	missense	140564			BF832090	CCDS46709.1	22q13.1	2012-10-19	2008-05-01		ENSG00000243811	ENSG00000243811		"""Apolipoprotein B mRNA editing enzymes"""	17354	protein-coding gene	gene with protein product		609900	"""apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3D (putative)"", ""apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3E pseudogene"""	APOBEC3E		11863358	Standard	NM_152426		Approved	ARP6, APOBEC3DE	uc003awt.4	Q96AK3	OTTHUMG00000151084	ENST00000216099.8:c.443T>C	22.37:g.39421307T>C	ENSP00000216099:p.Leu148Pro	Somatic		WXS	Illumina HiSeq	Phase_I	Q5JZ91|Q7Z2N2|Q7Z2N5|Q7Z2N6	Missense_Mutation	SNP	ENST00000216099.8	37	CCDS46709.1	.	.	.	.	.	.	.	.	.	.	.	14.01	2.406990	0.42715	.	.	ENSG00000243811	ENST00000381568;ENST00000216099	T;T	0.67865	-0.29;-0.29	2.44	-4.53	0.03462	APOBEC-like, C-terminal (1);Cytidine deaminase-like (1);	.	.	.	.	T	0.46073	0.1374	L	0.29908	0.895	0.09310	N	1	B;B	0.12630	0.006;0.006	B;B	0.09377	0.004;0.004	T	0.19289	-1.0310	9	0.48119	T	0.1	.	3.8466	0.08937	0.3382:0.0:0.4:0.2618	.	148;148	B2CML4;Q96AK3	.;ABC3D_HUMAN	P	148	ENSP00000370980:L148P;ENSP00000216099:L148P	ENSP00000216099:L148P	L	+	2	0	APOBEC3D	37751253	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.614000	0.24314	-1.624000	0.01556	-0.258000	0.10820	CTC		0.582	APOBEC3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321232.2	NM_152426	
DAZL	1618	broad.mit.edu;mdanderson.org	37	3	16633629	16633629	+	Silent	SNP	C	C	T			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr3:16633629C>T	ENST00000399444.2	-	10	1055	c.762G>A	c.(760-762)acG>acA	p.T254T	DAZL_ENST00000250863.8_Silent_p.T274T	NM_001351.3	NP_001342.2	Q92904	DAZL_HUMAN	deleted in azoospermia-like	254					female meiosis II (GO:0007147)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|oocyte maturation (GO:0001556)|positive regulation of meiosis (GO:0045836)|positive regulation of translational initiation (GO:0045948)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|polysome (GO:0005844)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|translation activator activity (GO:0008494)	p.T254T(1)	RAF1/DAZL(2)	endometrium(1)|large_intestine(3)|lung(4)|prostate(3)	11						AAGATACCACCGTTTGTATGC	0.363																																						.											1	Substitution - coding silent(1)	lung(1)											239.0	241.0	241.0					3																	16633629		2203	4300	6503	SO:0001819	synonymous_variant	1618			BC027595	CCDS43059.1, CCDS54556.1	3p24	2013-02-12			ENSG00000092345	ENSG00000092345		"""RNA binding motif (RRM) containing"""	2685	protein-coding gene	gene with protein product		601486		DAZLA		8896558	Standard	NM_001351		Approved	DAZH, SPGYLA, MGC26406, DAZL1	uc003cbb.3	Q92904	OTTHUMG00000157050	ENST00000399444.2:c.762G>A	3.37:g.16633629C>T		Somatic		WXS	Illumina HiSeq	Phase_I	O15396|Q5HYB4|Q92909	Silent	SNP	ENST00000399444.2	37	CCDS43059.1																																																																																				0.363	DAZL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347261.2	NM_001351	
SETD2	29072	broad.mit.edu	37	3	47162042	47162042	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr3:47162042T>C	ENST00000409792.3	-	3	4126	c.4084A>G	c.(4084-4086)Aaa>Gaa	p.K1362E		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1362					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		CCCTTGTCTTTCTGAAGGGAT	0.383			"""N, F, S, Mis"""		clear cell renal carcinoma																																	.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	0													66.0	70.0	68.0					3																	47162042		2203	4300	6503	SO:0001583	missense	29072			AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.4084A>G	3.37:g.47162042T>C	ENSP00000386759:p.Lys1362Glu	Somatic		WXS	Illumina HiSeq	Phase_I	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	ENST00000409792.3	37	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	T	11.82	1.752143	0.31046	.	.	ENSG00000181555	ENST00000451092;ENST00000543224;ENST00000409792;ENST00000412450	D;T	0.89050	-2.46;1.39	5.32	4.15	0.48705	.	0.095949	0.45126	D	0.000397	T	0.79387	0.4437	N	0.24115	0.695	0.28142	N	0.929768	B;B	0.27229	0.085;0.172	B;B	0.22386	0.026;0.039	T	0.72308	-0.4332	10	0.66056	D	0.02	.	7.1006	0.25336	0.0:0.0736:0.1495:0.7769	.	1362;1362	F2Z317;Q9BYW2	.;SETD2_HUMAN	E	1362;1362;1362;1318	ENSP00000386759:K1362E;ENSP00000416401:K1318E	ENSP00000386759:K1362E	K	-	1	0	SETD2	47137046	0.567000	0.26626	1.000000	0.80357	0.737000	0.42083	1.203000	0.32284	1.011000	0.39340	0.460000	0.39030	AAA		0.383	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
FAM43A	131583	broad.mit.edu	37	3	194407863	194407863	+	Missense_Mutation	SNP	G	G	T			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr3:194407863G>T	ENST00000329759.4	+	1	1242	c.308G>T	c.(307-309)gGc>gTc	p.G103V		NM_153690.4	NP_710157.2	Q8N2R8	FA43A_HUMAN	family with sequence similarity 43, member A	103										breast(2)|central_nervous_system(1)|lung(6)|skin(1)	10	all_cancers(143;2.04e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.147)	OV - Ovarian serous cystadenocarcinoma(49;8.37e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;1.78e-05)		AGCGAGGCGGGCCGTCAGGGC	0.682																																						.											0													40.0	39.0	39.0					3																	194407863		2203	4299	6502	SO:0001583	missense	131583			AK074503	CCDS33923.1	3q29	2004-07-28			ENSG00000185112	ENSG00000185112			26888	protein-coding gene	gene with protein product						12477932	Standard	NM_153690		Approved	FLJ90022	uc003fuj.3	Q8N2R8	OTTHUMG00000156016	ENST00000329759.4:c.308G>T	3.37:g.194407863G>T	ENSP00000371397:p.Gly103Val	Somatic		WXS	Illumina HiSeq	Phase_I	A3KME2|Q8IXP4|Q8WZ07	Missense_Mutation	SNP	ENST00000329759.4	37	CCDS33923.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.736427	0.89482	.	.	ENSG00000185112	ENST00000329759	T	0.66638	-0.22	5.16	5.16	0.70880	Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	T	0.81014	0.4735	M	0.65975	2.015	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.83152	-0.0103	10	0.87932	D	0	-26.1764	17.6527	0.88169	0.0:0.0:1.0:0.0	.	103	Q8N2R8	FA43A_HUMAN	V	103	ENSP00000371397:G103V	ENSP00000371397:G103V	G	+	2	0	FAM43A	195889152	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.316000	0.96319	2.403000	0.81681	0.455000	0.32223	GGC		0.682	FAM43A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342734.1	NM_153690	
AREG	374	broad.mit.edu;mdanderson.org	37	4	75314901	75314901	+	Missense_Mutation	SNP	T	T	G			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr4:75314901T>G	ENST00000395748.3	+	3	660	c.448T>G	c.(448-450)Ttt>Gtt	p.F150V	AREG_ENST00000511560.1_3'UTR|AREG_ENST00000264487.2_Missense_Mutation_p.F150V|AREG_ENST00000502307.1_Missense_Mutation_p.F150V	NM_001657.2	NP_001648.1	P15514	AREG_HUMAN	amphiregulin	150	EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|dichotomous subdivision of terminal units involved in mammary gland duct morphogenesis (GO:0060598)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation involved in mammary gland duct elongation (GO:0060750)|G-protein coupled receptor signaling pathway (GO:0007186)|glial cell proliferation (GO:0014009)|mammary gland alveolus development (GO:0060749)|mammary gland branching involved in thelarche (GO:0060744)|negative regulation of osteoblast differentiation (GO:0045668)|neuron projection development (GO:0031175)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of phosphorylation (GO:0042327)|response to cAMP (GO:0051591)|response to estradiol (GO:0032355)|response to glucocorticoid (GO:0051384)|response to hydrogen peroxide (GO:0042542)|response to peptide hormone (GO:0043434)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	growth factor activity (GO:0008083)			lung(4)	4			Lung(101;0.196)			TAATGCAGAATTTCAAAATTT	0.313																																						.											0													7.0	8.0	7.0					4																	75314901		1825	3986	5811	SO:0001583	missense	374			M30704	CCDS3565.1	4q13.3	2014-06-19	2008-08-01		ENSG00000109321	ENSG00000109321		"""Endogenous ligands"""	651	protein-coding gene	gene with protein product		104640	"""schwannoma-derived growth factor"", ""amphiregulin B"""	SDGF, AREGB			Standard	NM_001657		Approved		uc021xpc.1	P15514	OTTHUMG00000130006	ENST00000395748.3:c.448T>G	4.37:g.75314901T>G	ENSP00000379097:p.Phe150Val	Somatic		WXS	Illumina HiSeq	Phase_I	Q5U026	Missense_Mutation	SNP	ENST00000395748.3	37	CCDS3565.1	.	.	.	.	.	.	.	.	.	.	T	16.48	3.134212	0.56828	.	.	ENSG00000109321	ENST00000395748;ENST00000264487;ENST00000502307	T;T;T	0.12879	2.64;2.64;2.64	4.94	4.94	0.65067	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.169682	0.53938	D	0.000048	T	0.29256	0.0728	L	0.60455	1.87	0.34369	D	0.691807	D	0.76494	0.999	D	0.80764	0.994	T	0.42120	-0.9470	10	0.66056	D	0.02	-7.351	7.6046	0.28095	0.0:0.0967:0.0:0.9033	.	150	P15514	AREG_HUMAN	V	150	ENSP00000379097:F150V;ENSP00000264487:F150V;ENSP00000421414:F150V	ENSP00000264487:F150V	F	+	1	0	AREG	75533765	0.881000	0.30235	0.997000	0.53966	0.767000	0.43475	3.655000	0.54460	1.974000	0.57490	0.455000	0.32223	TTT		0.313	AREG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252277.1		
C1GALT1	56913	broad.mit.edu	37	7	7278070	7278070	+	Silent	SNP	A	A	G			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr7:7278070A>G	ENST00000223122.3	+	2	467	c.405A>G	c.(403-405)aaA>aaG	p.K135K	C1GALT1_ENST00000436587.2_Silent_p.K135K|C1GALT1_ENST00000402468.3_Silent_p.K135K			Q9NS00	C1GLT_HUMAN	core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase 1	135					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|kidney development (GO:0001822)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase activity (GO:0016263)|metal ion binding (GO:0046872)			breast(1)|kidney(1)|lung(3)|prostate(1)|urinary_tract(1)	7				UCEC - Uterine corpus endometrioid carcinoma (126;0.177)		TGGGACTGAAAACCAAAGAAG	0.378																																						.											0													67.0	68.0	67.0					7																	7278070		2203	4300	6503	SO:0001819	synonymous_variant	56913			AF155582	CCDS5355.1	7p21.3	2014-06-24	2014-06-24		ENSG00000106392	ENSG00000106392	2.4.1.122	"""Beta 3-glycosyltransferases"""	24337	protein-coding gene	gene with protein product	"""core 1 beta3-Gal-T"""	610555				10580128, 11677243	Standard	NM_020156		Approved	C1GALT, T-synthase	uc003srb.3	Q9NS00	OTTHUMG00000151912	ENST00000223122.3:c.405A>G	7.37:g.7278070A>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q96QH4|Q9BTU1	Silent	SNP	ENST00000223122.3	37	CCDS5355.1																																																																																				0.378	C1GALT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324379.2	NM_020156	
TMEM196	256130	broad.mit.edu	37	7	19769017	19769017	+	Frame_Shift_Del	DEL	T	T	-			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr7:19769017delT	ENST00000405764.3	-	2	888	c.192delA	c.(190-192)aaafs	p.K64fs	TMEM196_ENST00000422233.1_5'UTR|TMEM196_ENST00000405844.1_Frame_Shift_Del_p.K64fs|TMEM196_ENST00000493519.1_5'UTR|TMEM196_ENST00000433641.1_5'UTR	NM_152774.3	NP_689987.3	Q5HYL7	TM196_HUMAN	transmembrane protein 196	70						integral component of membrane (GO:0016021)				breast(1)|large_intestine(1)|lung(4)	6						CAAGTCCTGATTTTTTTTTGG	0.353																																						.											0										11,11,1946		3,0,5,4,3,969	161.0	137.0	144.0			5.4	1.0	7		148	5,6,4003		0,0,5,0,6,1996	no	codingComplex	TMEM196	NM_152774.3		3,0,10,4,9,2965	A1A1,A1A2,A1R,A2A2,A2R,RR		0.274,1.1179,0.5517			19769017	16,17,5949	692	1591	2283	SO:0001589	frameshift_variant	256130				CCDS34607.2	7p15.3	2007-11-21			ENSG00000173452	ENSG00000173452			22431	protein-coding gene	gene with protein product							Standard	NM_152774		Approved	MGC42090	uc011jyg.2	Q5HYL7	OTTHUMG00000152504	ENST00000405764.3:c.192delA	7.37:g.19769017delT	ENSP00000384234:p.Lys64fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q8N6I6	Frame_Shift_Del	DEL	ENST00000405764.3	37	CCDS34607.2																																																																																				0.353	TMEM196-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326499.1	NM_152774	
DNAJB9	4189	broad.mit.edu	37	7	108212318	108212318	+	Missense_Mutation	SNP	G	G	T			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr7:108212318G>T	ENST00000249356.3	+	2	694	c.148G>T	c.(148-150)Gcc>Tcc	p.A50S	THAP5_ENST00000493722.1_5'Flank|DNAJB9_ENST00000465725.1_3'UTR|THAP5_ENST00000415914.3_5'Flank|THAP5_ENST00000438865.1_5'Flank|THAP5_ENST00000313516.5_5'Flank	NM_012328.2	NP_036460.1	Q9UBS3	DNJB9_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 9	50	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)	misfolded protein binding (GO:0051787)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|urinary_tract(1)	13						TCACAAGTTGGCCATGAAGTA	0.413																																						.											0													99.0	107.0	105.0					7																	108212318		2203	4300	6503	SO:0001583	missense	4189			AB026908	CCDS5752.1	7q31	2011-09-02			ENSG00000128590	ENSG00000128590		"""Heat shock proteins / DNAJ (HSP40)"""	6968	protein-coding gene	gene with protein product		602634		MDG1		9533036, 11147971	Standard	NM_012328		Approved		uc003vfn.3	Q9UBS3	OTTHUMG00000154866	ENST00000249356.3:c.148G>T	7.37:g.108212318G>T	ENSP00000249356:p.Ala50Ser	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000249356.3	37	CCDS5752.1	.	.	.	.	.	.	.	.	.	.	G	35	5.477236	0.96291	.	.	ENSG00000128590	ENST00000249356	T	0.36878	1.23	5.34	5.34	0.76211	Heat shock protein DnaJ, N-terminal (5);	0.000000	0.85682	D	0.000000	T	0.45034	0.1322	N	0.17312	0.475	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.37686	-0.9695	9	.	.	.	.	18.035	0.89298	0.0:0.0:1.0:0.0	.	50	Q9UBS3	DNJB9_HUMAN	S	50	ENSP00000249356:A50S	.	A	+	1	0	DNAJB9	107999554	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.471000	0.97696	2.483000	0.83821	0.563000	0.77884	GCC		0.413	DNAJB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337414.1		
AASS	10157	broad.mit.edu	37	7	121755170	121755170	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr7:121755170A>G	ENST00000393376.1	-	8	1096	c.1001T>C	c.(1000-1002)tTc>tCc	p.F334S	AASS_ENST00000417368.2_Missense_Mutation_p.F334S|AASS_ENST00000473553.1_Intron			Q9UDR5	AASS_HUMAN	aminoadipate-semialdehyde synthase	334	Lysine-ketoglutarate reductase.				cellular nitrogen compound metabolic process (GO:0034641)|L-lysine catabolic process to acetyl-CoA via saccharopine (GO:0033512)|lysine catabolic process (GO:0006554)|protein tetramerization (GO:0051262)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity (GO:0047131)|saccharopine dehydrogenase (NADP+, L-lysine-forming) activity (GO:0047130)			autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(6)|large_intestine(12)|lung(27)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	54						AGCAGGTGAGAACTTGCCCGG	0.488																																						.											0													126.0	117.0	120.0					7																	121755170		2203	4300	6503	SO:0001583	missense	10157			AF229180	CCDS5783.1	7q31.3	2010-12-14			ENSG00000008311	ENSG00000008311			17366	protein-coding gene	gene with protein product		605113				10775527	Standard	NM_005763		Approved	LORSDH, LKRSDH	uc003vkb.3	Q9UDR5	OTTHUMG00000157058	ENST00000393376.1:c.1001T>C	7.37:g.121755170A>G	ENSP00000377040:p.Phe334Ser	Somatic		WXS	Illumina HiSeq	Phase_I	O95462	Missense_Mutation	SNP	ENST00000393376.1	37	CCDS5783.1	.	.	.	.	.	.	.	.	.	.	A	7.479	0.648272	0.14516	.	.	ENSG00000008311	ENST00000393376;ENST00000417368	.	.	.	5.68	-0.0723	0.13740	Alanine dehydrogenase/PNT, C-terminal (1);	0.798338	0.12272	N	0.483760	T	0.06917	0.0176	N	0.00289	-1.7	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.38650	-0.9651	9	0.07813	T	0.8	0.0617	11.6038	0.51020	0.2361:0.0:0.7639:0.0	.	334	Q9UDR5	AASS_HUMAN	S	334	.	ENSP00000351834:F334S	F	-	2	0	AASS	121542406	0.999000	0.42202	0.792000	0.32020	0.453000	0.32348	2.070000	0.41491	-0.325000	0.08577	-0.256000	0.11100	TTC		0.488	AASS-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347300.1	NM_005763	
SH2D2A	9047	broad.mit.edu	37	1	156777068	156777069	+	Frame_Shift_Ins	INS	-	-	T			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr1:156777068_156777069insT	ENST00000368199.3	-	8	1224_1225	c.1071_1072insA	c.(1069-1074)cagcccfs	p.P358fs	SH2D2A_ENST00000392306.2_Frame_Shift_Ins_p.P368fs|SH2D2A_ENST00000368198.3_Frame_Shift_Ins_p.P340fs	NM_001161443.1|NM_001161444.1|NM_003975.3	NP_001154915.1|NP_001154916.1|NP_003966.2	Q9NP31	SH22A_HUMAN	SH2 domain containing 2A	358	Pro-rich.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	SH3/SH2 adaptor activity (GO:0005070)			endometrium(1)|large_intestine(2)|lung(15)	18	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					GCGGGTGGGGGCTGGTGGGGCA	0.599																																						.											0																																										SO:0001589	frameshift_variant	9047			AJ000553	CCDS1159.1, CCDS53380.1, CCDS53381.1	1q21	2013-02-14	2010-04-21		ENSG00000027869	ENSG00000027869		"""SH2 domain containing"""	10821	protein-coding gene	gene with protein product	"""T lymphocyte specific adaptor protein"", ""T cell specific adapter protein TSAd"", ""T cell specific adpater protein TSAd"""	604514	"""SH2 domain protein 2A"""			9468509	Standard	NM_003975		Approved	TSAd, F2771	uc009wsh.2	Q9NP31	OTTHUMG00000041305	ENST00000368199.3:c.1071_1072insA	1.37:g.156777068_156777069insT	ENSP00000357182:p.Pro358fs	Somatic		WXS	Illumina HiSeq	Phase_I	O43817|Q5UBZ1|Q5VZS4|Q5VZS5|Q9UPA7	Frame_Shift_Ins	INS	ENST00000368199.3	37	CCDS1159.1																																																																																				0.599	SH2D2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000098982.1	NM_003975	
COL9A3	1299	broad.mit.edu	37	20	61450635	61450636	+	Frame_Shift_Ins	INS	-	-	G	rs146260681|rs199653123		TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr20:61450635_61450636insG	ENST00000343916.3	+	4	248_249	c.245_246insG	c.(244-249)ccgggtfs	p.PG82fs		NM_001853.3	NP_001844.3	Q14050	CO9A3_HUMAN	collagen, type IX, alpha 3	82	Triple-helical region 3 (COL3).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female gonad development (GO:0008585)|male gonad development (GO:0008584)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(1)|endometrium(3)|large_intestine(1)|lung(18)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	28	Breast(26;5.68e-08)					CCGGGACTGCCGGGTGTGGATG	0.688																																						.											0																																										SO:0001589	frameshift_variant	1299			AK075240	CCDS13505.1	20q13.3	2013-01-16			ENSG00000092758	ENSG00000092758		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2219	protein-coding gene	gene with protein product	"""collagen type IX proteoglycan"""	120270				8586434, 1429648	Standard	NM_001853		Approved	IDD, MED, EDM3, FLJ90759, DJ885L7.4.1	uc002ydm.3	Q14050	OTTHUMG00000032938	ENST00000343916.3:c.248dupG	20.37:g.61450638_61450638dupG	ENSP00000341640:p.Pro82fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q13681|Q9H4G9|Q9UPE2	Frame_Shift_Ins	INS	ENST00000343916.3	37	CCDS13505.1																																																																																				0.688	COL9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080071.2	NM_001853	
SRD5A3	79644	broad.mit.edu	37	4	56212670	56212671	+	Frame_Shift_Ins	INS	-	-	G			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr4:56212670_56212671insG	ENST00000264228.4	+	1	395_396	c.167_168insG	c.(166-171)aagtgtfs	p.C57fs		NM_024592.4	NP_078868.1	Q9H8P0	PORED_HUMAN	steroid 5 alpha-reductase 3	57					androgen biosynthetic process (GO:0006702)|cellular protein metabolic process (GO:0044267)|dolichol metabolic process (GO:0019348)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|dolichyl diphosphate biosynthetic process (GO:0006489)|polyprenol catabolic process (GO:0016095)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	3-oxo-5-alpha-steroid 4-dehydrogenase activity (GO:0003865)|cholestenone 5-alpha-reductase activity (GO:0047751)|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor (GO:0016628)	p.K56K(1)		cervix(1)|large_intestine(3)|lung(6)|prostate(1)|skin(1)	12	all_cancers(7;0.0308)|all_lung(4;0.00195)|Lung NSC(11;0.00431)|all_epithelial(27;0.0425)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.0179)		Spironolactone(DB00421)	GGGAAAACCAAGTGTGGGGAGC	0.693																																						.											1	Substitution - coding silent(1)	lung(1)																																								SO:0001589	frameshift_variant	79644			AK023414	CCDS3498.1	4q12	2009-07-21			ENSG00000128039	ENSG00000128039			25812	protein-coding gene	gene with protein product		611715				17986282	Standard	NM_024592		Approved	FLJ13352, SRD5A2L, SRD5A2L1	uc003hau.3	Q9H8P0	OTTHUMG00000128733	ENST00000264228.4:c.168dupG	4.37:g.56212671_56212671dupG	ENSP00000264228:p.Cys57fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q4W5Q6	Frame_Shift_Ins	INS	ENST00000264228.4	37	CCDS3498.1																																																																																				0.693	SRD5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250644.2	NM_024592	
CORO1A	11151	ucsc.edu	37	16	30198795	30198795	+	Silent	SNP	T	T	C			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr16:30198795T>C	ENST00000219150.5	+	6	1034	c.729T>C	c.(727-729)agT>agC	p.S243S	CORO1A_ENST00000565497.1_Silent_p.S243S|RP11-455F5.5_ENST00000567153.1_RNA|RP11-455F5.5_ENST00000568506.1_RNA|RP11-455F5.5_ENST00000566144.1_RNA|CORO1A_ENST00000570045.1_Silent_p.S243S	NM_001193333.2|NM_007074.3	NP_001180262.1|NP_009005.1	P31146	COR1A_HUMAN	coronin, actin binding protein, 1A	243					actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|calcium ion transport (GO:0006816)|cell-substrate adhesion (GO:0031589)|cellular component movement (GO:0006928)|cellular response to interleukin-4 (GO:0071353)|homeostasis of number of cells within a tissue (GO:0048873)|innate immune response (GO:0045087)|leukocyte chemotaxis (GO:0030595)|negative regulation of actin nucleation (GO:0051126)|phagocytosis (GO:0006909)|phagolysosome assembly (GO:0001845)|positive chemotaxis (GO:0050918)|positive regulation of cell migration (GO:0030335)|positive regulation of T cell proliferation (GO:0042102)|regulation of actin filament polymerization (GO:0030833)|regulation of cell shape (GO:0008360)|T cell homeostasis (GO:0043029)|uropod organization (GO:0032796)	actin filament (GO:0005884)|cell-cell junction (GO:0005911)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|lamellipodium (GO:0030027)|membrane (GO:0016020)|phagocytic cup (GO:0001891)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	actin filament binding (GO:0051015)|cytoskeletal protein binding (GO:0008092)|phosphatidylinositol 3-kinase binding (GO:0043548)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	9						GCCGCATGAGTGAGCGGCAGG	0.672																																						.											0													26.0	27.0	26.0					16																	30198795		2196	4300	6496	SO:0001819	synonymous_variant	11151			X89109	CCDS10673.1	16p11.2	2014-09-17	2001-11-28		ENSG00000102879	ENSG00000102879		"""Coronins"", ""WD repeat domain containing"""	2252	protein-coding gene	gene with protein product	"""Clabp TACO"""	605000	"""coronin, actin-binding protein, 1A"""			9778037	Standard	NM_007074		Approved	HCORO1, p57, coronin-1	uc002dww.3	P31146	OTTHUMG00000132148	ENST00000219150.5:c.729T>C	16.37:g.30198795T>C		Somatic		WXS	Illumina HiSeq	Phase_I	B2RBL1|Q2YD73	Silent	SNP	ENST00000219150.5	37	CCDS10673.1																																																																																				0.672	CORO1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255195.2	NM_007074	
DENND2A	27147	ucsc.edu	37	7	140301430	140301430	+	Silent	SNP	A	A	C			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr7:140301430A>C	ENST00000275884.6	-	2	1185	c.768T>G	c.(766-768)ggT>ggG	p.G256G	DENND2A_ENST00000496613.1_Silent_p.G256G|DENND2A_ENST00000537639.1_Silent_p.G256G|DENND2A_ENST00000492720.1_Silent_p.G256G			Q9ULE3	DEN2A_HUMAN	DENN/MADD domain containing 2A	256					positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.G256G(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(22)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49	Melanoma(164;0.00956)					TTGTGGGGGAACCCTCCGAGC	0.587																																						.											1	Substitution - coding silent(1)	kidney(1)											114.0	120.0	118.0					7																	140301430		1896	4112	6008	SO:0001819	synonymous_variant	27147			AB033103	CCDS43659.1	7q34	2012-10-03	2005-08-17	2005-08-17	ENSG00000146966	ENSG00000146966		"""DENN/MADD domain containing"""	22212	protein-coding gene	gene with protein product			"""KIAA1277"""	KIAA1277			Standard	NM_015689		Approved	FAM31D	uc010lnj.3	Q9ULE3	OTTHUMG00000157411	ENST00000275884.6:c.768T>G	7.37:g.140301430A>C		Somatic		WXS	Illumina HiSeq	Phase_I	C9JUI3|Q1RMD5|Q86XY0	Silent	SNP	ENST00000275884.6	37	CCDS43659.1																																																																																				0.587	DENND2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348742.1	NM_015689	
DGKE	8526	ucsc.edu	37	17	54935999	54935999	+	Missense_Mutation	SNP	A	A	T			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr17:54935999A>T	ENST00000284061.3	+	9	1437	c.1257A>T	c.(1255-1257)gaA>gaT	p.E419D		NM_003647.2	NP_003638.1	P52429	DGKE_HUMAN	diacylglycerol kinase, epsilon 64kDa	419					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|phospholipid biosynthetic process (GO:0008654)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(3)|endometrium(3)|large_intestine(3)|lung(10)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	25	Breast(9;3.59e-07)					TAGTGCAAGAATGTAAAGATT	0.269																																						.											0													41.0	44.0	43.0					17																	54935999		2199	4297	6496	SO:0001583	missense	8526			U49379	CCDS11590.1	17q22	2008-07-18	2002-08-29			ENSG00000153933	2.7.1.107		2852	protein-coding gene	gene with protein product		601440	"""diacylglycerol kinase, epsilon (64kD)"""			8626589, 10051413	Standard	NM_003647		Approved	DAGK6, DGK	uc002iur.3	P52429		ENST00000284061.3:c.1257A>T	17.37:g.54935999A>T	ENSP00000284061:p.Glu419Asp	Somatic		WXS	Illumina HiSeq	Phase_I	Q8TBM4|Q9UKQ3	Missense_Mutation	SNP	ENST00000284061.3	37	CCDS11590.1	.	.	.	.	.	.	.	.	.	.	A	13.18	2.159400	0.38119	.	.	ENSG00000153933	ENST00000284061	T	0.42513	0.97	5.49	2.03	0.26663	Diacylglycerol kinase, accessory domain (2);	0.045848	0.85682	D	0.000000	T	0.24084	0.0583	N	0.12746	0.255	0.80722	D	1	B;B	0.27594	0.182;0.182	B;B	0.33960	0.173;0.173	T	0.04041	-1.0982	10	0.21540	T	0.41	.	9.1053	0.36694	0.7885:0.0:0.2115:0.0	.	419;419	A1L4Q0;P52429	.;DGKE_HUMAN	D	419	ENSP00000284061:E419D	ENSP00000284061:E419D	E	+	3	2	DGKE	52290998	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.237000	0.51344	0.371000	0.24564	0.477000	0.44152	GAA		0.269	DGKE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440601.1	NM_003647	
GAL3ST3	89792	ucsc.edu	37	11	65810618	65810618	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr11:65810618T>C	ENST00000312006.4	-	3	937	c.656A>G	c.(655-657)gAc>gGc	p.D219G	GAL3ST3_ENST00000527878.1_Missense_Mutation_p.D219G	NM_033036.2	NP_149025.1	Q96A11	G3ST3_HUMAN	galactose-3-O-sulfotransferase 3	219					monosaccharide metabolic process (GO:0005996)|oligosaccharide metabolic process (GO:0009311)|poly-N-acetyllactosamine metabolic process (GO:0030309)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|carbohydrate binding (GO:0030246)|galactose 3-O-sulfotransferase activity (GO:0050694)|galactosylceramide sulfotransferase activity (GO:0001733)|proteoglycan sulfotransferase activity (GO:0050698)			kidney(1)|lung(9)|ovary(2)|skin(2)	14						GGCGGCGTCGTCGCGCGGGCT	0.667																																						.											0													33.0	38.0	36.0					11																	65810618		2199	4292	6491	SO:0001583	missense	89792			AY026481	CCDS8128.1	11q13.1	2014-08-12			ENSG00000175229	ENSG00000175229		"""Sulfotransferases, membrane-bound"""	24144	protein-coding gene	gene with protein product		608234				11323440, 11356829	Standard	NM_033036		Approved	GAL3ST2	uc001ogw.3	Q96A11	OTTHUMG00000166667	ENST00000312006.4:c.656A>G	11.37:g.65810618T>C	ENSP00000308591:p.Asp219Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q14D05	Missense_Mutation	SNP	ENST00000312006.4	37	CCDS8128.1	.	.	.	.	.	.	.	.	.	.	T	11.86	1.763983	0.31228	.	.	ENSG00000175229	ENST00000312006;ENST00000527878	T;T	0.14640	2.49;2.49	3.99	3.99	0.46301	.	0.639319	0.15481	N	0.260103	T	0.08846	0.0219	N	0.14661	0.345	0.09310	N	0.999993	B	0.14012	0.009	B	0.17722	0.019	T	0.19516	-1.0303	10	0.56958	D	0.05	-21.5566	9.4764	0.38873	0.0:0.0:0.0:1.0	.	219	Q96A11	G3ST3_HUMAN	G	219	ENSP00000308591:D219G;ENSP00000434829:D219G	ENSP00000308591:D219G	D	-	2	0	GAL3ST3	65567194	0.085000	0.21516	0.998000	0.56505	0.987000	0.75469	2.256000	0.43231	1.800000	0.52685	0.459000	0.35465	GAC		0.667	GAL3ST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391052.1	NM_033036	
HTR4	3360	ucsc.edu	37	5	147929716	147929716	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr5:147929716A>G	ENST00000377888.3	-	3	274	c.136T>C	c.(136-138)Tgg>Cgg	p.W46R	HTR4_ENST00000517929.1_Missense_Mutation_p.W46R|HTR4_ENST00000354217.2_Missense_Mutation_p.W46R|HTR4_ENST00000521735.1_Missense_Mutation_p.W46R|HTR4_ENST00000362016.2_Missense_Mutation_p.W46R|HTR4_ENST00000360693.3_Missense_Mutation_p.W46R|HTR4_ENST00000314512.6_Missense_Mutation_p.W46R|HTR4_ENST00000520514.1_Missense_Mutation_p.W46R|HTR4_ENST00000521530.1_Missense_Mutation_p.W46R|HTR4_ENST00000519495.1_5'UTR	NM_000870.5	NP_000861.1	Q13639	5HT4R_HUMAN	5-hydroxytryptamine (serotonin) receptor 4, G protein-coupled	46					G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of cell proliferation (GO:0008284)|regulation of appetite (GO:0032098)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)			endometrium(5)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Cinitapride(DB08810)|Cisapride(DB00604)|Ergoloid mesylate(DB01049)|Metoclopramide(DB01233)|Ondansetron(DB00904)	TGCCTGTCCCAGCACACAGCC	0.542																																					GBM(120;370 1604 14007 17804 41573)	.											0													106.0	75.0	86.0					5																	147929716		2203	4300	6503	SO:0001583	missense	3360			Y08756	CCDS4291.1, CCDS34270.1, CCDS34271.1, CCDS34272.1, CCDS34273.1, CCDS34273.2, CCDS75353.1	5q31-q33	2012-08-08	2012-02-03		ENSG00000164270	ENSG00000164270		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5299	protein-coding gene	gene with protein product		602164	"""5-hydroxytryptamine (serotonin) receptor 4"""			9371406, 9276448	Standard	NM_199453		Approved	5-HT4	uc021yfj.1	Q13639	OTTHUMG00000129931	ENST00000377888.3:c.136T>C	5.37:g.147929716A>G	ENSP00000367120:p.Trp46Arg	Somatic		WXS	Illumina HiSeq	Phase_I	C4WYH4|Q546Q1|Q684M0|Q712M9|Q96KH9|Q96KI0|Q9H199|Q9NY73|Q9UBM6|Q9UBT4|Q9UE22|Q9UE23|Q9UQR6	Missense_Mutation	SNP	ENST00000377888.3	37	CCDS4291.1	.	.	.	.	.	.	.	.	.	.	A	1.046	-0.677331	0.03378	.	.	ENSG00000164270	ENST00000521530;ENST00000354217;ENST00000314512;ENST00000521735;ENST00000517929;ENST00000520514;ENST00000377888;ENST00000360693;ENST00000362016	T;T;T;T;T;T;T;T;T	0.31769	1.48;1.48;1.48;1.48;1.48;1.48;1.48;1.48;1.48	5.61	0.0268	0.14151	GPCR, rhodopsin-like superfamily (1);	0.139010	0.64402	N	0.000005	T	0.04724	0.0128	N	0.00074	-2.255	0.24527	N	0.994136	B;B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B	0.04013	0.0;0.0;0.001;0.0;0.0;0.0;0.0	T	0.44283	-0.9338	10	0.02654	T	1	.	10.5223	0.44927	0.1218:0.0:0.5811:0.297	.	46;46;46;46;46;46;46	C4WYH4;Q13639;Q712M9;Q13639-6;Q13639-3;Q13639-2;Q684M0	.;5HT4R_HUMAN;.;.;.;.;.	R	46	ENSP00000428320:W46R;ENSP00000346156:W46R;ENSP00000314906:W46R;ENSP00000430979:W46R;ENSP00000435904:W46R;ENSP00000427913:W46R;ENSP00000367120:W46R;ENSP00000353915:W46R;ENSP00000355037:W46R	ENSP00000314906:W46R	W	-	1	0	HTR4	147909909	1.000000	0.71417	0.997000	0.53966	0.966000	0.64601	1.802000	0.38853	-0.202000	0.10268	-1.294000	0.01345	TGG		0.542	HTR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252187.2	NM_000870	
INSL3	3640	ucsc.edu	37	19	17932190	17932190	+	Silent	SNP	T	T	C	rs1047233	byFrequency	TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr19:17932190T>C	ENST00000317306.7	-	1	142	c.126A>G	c.(124-126)ctA>ctG	p.L42L	INSL3_ENST00000379695.5_Silent_p.L42L	NM_005543.3	NP_005534.2	P51460	INSL3_HUMAN	insulin-like 3 (Leydig cell)	42					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cell-cell signaling (GO:0007267)|in utero embryonic development (GO:0001701)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|oocyte maturation (GO:0001556)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell proliferation (GO:0008284)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|perinuclear region of cytoplasm (GO:0048471)	insulin receptor binding (GO:0005158)|protease binding (GO:0002020)|receptor binding (GO:0005102)			breast(1)|lung(1)	2						ACACGCGCACTAGCGCGCGTA	0.721													C|||	1288	0.257188	0.3941	0.3127	5008	,	,		12303	0.005		0.4076	False		,,,				2504	0.138					.											0								C		1224,2548		247,730,909	4.0	7.0	6.0		126	-1.9	1.0	19	dbSNP_86	6	2298,4938		486,1326,1806	no	coding-synonymous	INSL3	NM_005543.2		733,2056,2715	CC,CT,TT		31.7579,32.4496,31.9949		42/132	17932190	3522,7486	1886	3618	5504	SO:0001819	synonymous_variant	3640				CCDS12365.1, CCDS58655.1	19p13.2-p12	2013-02-26	2003-05-13			ENSG00000248099		"""Endogenous ligands"""	6086	protein-coding gene	gene with protein product	"""prepro-INSL3"""	146738	"""relaxin-like factor"""	RLNL		8020942	Standard	NM_001265587		Approved	RLF, MGC119818, MGC119819	uc010ebf.2	P51460		ENST00000317306.7:c.126A>G	19.37:g.17932190T>C		Somatic		WXS	Illumina HiSeq	Phase_I	B4DZ72|G3XAG0|Q3KPI5|Q3KPI6|Q6YNB5|Q9UEA2|Q9UPH6	Silent	SNP	ENST00000317306.7	37	CCDS12365.1																																																																																				0.721	INSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466836.1	NM_005543	
PDE7A	5150	ucsc.edu	37	8	66753704	66753704	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr8:66753704T>C	ENST00000401827.3	-	1	483	c.40A>G	c.(40-42)Agg>Ggg	p.R14G	PDE7A_ENST00000396642.3_Missense_Mutation_p.R14G|CTD-2532N20.1_ENST00000607622.1_lincRNA	NM_001242318.2	NP_001229247.1	Q13946	PDE7A_HUMAN	phosphodiesterase 7A	14					cAMP catabolic process (GO:0006198)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|metal ion binding (GO:0046872)			large_intestine(5)|lung(3)|stomach(1)|urinary_tract(1)	10			Epithelial(68;0.0509)|BRCA - Breast invasive adenocarcinoma(89;0.111)|all cancers(69;0.168)|OV - Ovarian serous cystadenocarcinoma(28;0.238)		Caffeine(DB00201)|Dyphylline(DB00651)|Ketotifen(DB00920)	GGGACCGGCCTGTCCAGGGGC	0.711																																						.											0													13.0	19.0	17.0					8																	66753704		1952	4148	6100	SO:0001583	missense	5150			L12052	CCDS34901.1, CCDS56538.1	8q13	2008-03-18				ENSG00000205268	3.1.4.17	"""Phosphodiesterases"""	8791	protein-coding gene	gene with protein product		171885				8389765, 9521885	Standard	NM_001242318		Approved	HCP1	uc003xvq.3	Q13946		ENST00000401827.3:c.40A>G	8.37:g.66753704T>C	ENSP00000385632:p.Arg14Gly	Somatic		WXS	Illumina HiSeq	Phase_I	A0AVH6|A8K436|A8K9G5|O15380|Q96T72	Missense_Mutation	SNP	ENST00000401827.3	37	CCDS56538.1	.	.	.	.	.	.	.	.	.	.	T	19.02	3.745540	0.69418	.	.	ENSG00000205268	ENST00000401827;ENST00000396642	T;T	0.79749	-1.3;-1.3	4.0	4.0	0.46444	.	.	.	.	.	D	0.83608	0.5291	L	0.50333	1.59	0.38053	D	0.935848	D;D	0.57899	0.981;0.967	D;P	0.66351	0.943;0.879	T	0.82472	-0.0440	9	0.30078	T	0.28	.	9.8698	0.41166	0.0:0.0:0.172:0.828	.	14;14	Q13946-3;Q13946	.;PDE7A_HUMAN	G	14	ENSP00000385632:R14G;ENSP00000379881:R14G	ENSP00000379881:R14G	R	-	1	2	PDE7A	66916258	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.285000	0.72658	1.442000	0.47568	0.455000	0.32223	AGG		0.711	PDE7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378905.1		
PERP	64065	ucsc.edu	37	6	138428444	138428444	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr6:138428444G>A	ENST00000421351.3	-	1	204	c.34C>T	c.(34-36)Cgc>Tgc	p.R12C		NM_022121.4	NP_071404.2	Q96FX8	PERP_HUMAN	PERP, TP53 apoptosis effector	12					activation of cysteine-type endopeptidase activity (GO:0097202)|amelogenesis (GO:0097186)|desmosome organization (GO:0002934)|heterotypic cell-cell adhesion (GO:0034113)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|positive regulation of proteolysis (GO:0045862)	cell junction (GO:0030054)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)				breast(1)|cervix(1)|endometrium(1)|lung(1)|prostate(1)	5	Breast(32;0.0799)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000878)|OV - Ovarian serous cystadenocarcinoma(155;0.000997)		AGGATCCAGCGGCAGCGCTCG	0.741																																						.											0													18.0	24.0	22.0					6																	138428444		2085	4108	6193	SO:0001583	missense	64065			AF317550	CCDS5188.1	6q24	2014-04-29			ENSG00000112378	ENSG00000112378			17637	protein-coding gene	gene with protein product	"""keratinocyte associated protein 1"""	609301				11062687	Standard	NM_022121		Approved	PIGPC1, dJ496H19.1, KCP1, THW, KRTCAP1	uc003qht.2	Q96FX8	OTTHUMG00000015668	ENST00000421351.3:c.34C>T	6.37:g.138428444G>A	ENSP00000397157:p.Arg12Cys	Somatic		WXS	Illumina HiSeq	Phase_I	B2RB73|E1P590|Q8IWS3|Q8N1J6|Q8NC16|Q9H1C5|Q9H230	Missense_Mutation	SNP	ENST00000421351.3	37	CCDS5188.1	.	.	.	.	.	.	.	.	.	.	g	22.5	4.294854	0.81025	.	.	ENSG00000112378	ENST00000421351;ENST00000265603	T	0.55052	0.54	4.14	-2.01	0.07410	.	0.051614	0.64402	D	0.000001	T	0.44623	0.1302	L	0.27053	0.805	0.58432	D	0.999991	D	0.89917	1.0	D	0.78314	0.991	T	0.53892	-0.8374	10	0.87932	D	0	-7.0466	13.4994	0.61445	0.0:0.0:0.7533:0.2467	.	12	Q96FX8	PERP_HUMAN	C	12	ENSP00000397157:R12C	ENSP00000265603:R12C	R	-	1	0	PERP	138470137	0.756000	0.28383	0.998000	0.56505	0.987000	0.75469	-0.511000	0.06321	-0.142000	0.11354	-0.408000	0.06270	CGC		0.741	PERP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042423.2	NM_022121	
PPM1F	9647	ucsc.edu	37	22	22287827	22287827	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr22:22287827T>C	ENST00000263212.5	-	5	788	c.683A>G	c.(682-684)gAg>gGg	p.E228G	PPM1F_ENST00000407142.1_Missense_Mutation_p.E60G|PPM1F_ENST00000538191.1_Missense_Mutation_p.E124G|PPM1F_ENST00000397495.4_Missense_Mutation_p.E228G	NM_014634.3	NP_055449.1	P49593	PPM1F_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1F	228					cellular response to drug (GO:0035690)|histone dephosphorylation (GO:0016576)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-threonine dephosphorylation (GO:0035970)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of gene expression (GO:0010628)|positive regulation of growth (GO:0045927)|positive regulation of stress fiber assembly (GO:0051496)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	calmodulin-dependent protein phosphatase activity (GO:0033192)|metal ion binding (GO:0046872)|phosphatase activity (GO:0016791)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	12	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.155)		GAGGGCTCCCTCAGGGTCTGT	0.642																																						.											0													59.0	54.0	55.0					22																	22287827		2203	4300	6503	SO:0001583	missense	9647			D13640	CCDS13796.1	22q11.22	2012-04-17	2010-03-05		ENSG00000100034	ENSG00000100034	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	19388	protein-coding gene	gene with protein product	"""partner of PIX 2"", ""Ca(2+)/calmodulin-dependent protein kinase phosphatase"""		"""protein phosphatase 1F (PP2C domain containing)"""			11864573, 11559703	Standard	NM_014634		Approved	FEM-2, KIAA0015, POPX2, CaMKPase, CAMKP	uc002zvp.2	P49593	OTTHUMG00000150835	ENST00000263212.5:c.683A>G	22.37:g.22287827T>C	ENSP00000263212:p.Glu228Gly	Somatic		WXS	Illumina HiSeq	Phase_I	A8K6G3|B7Z2C3|Q96PM2	Missense_Mutation	SNP	ENST00000263212.5	37	CCDS13796.1	.	.	.	.	.	.	.	.	.	.	G	12.25	1.882171	0.33255	.	.	ENSG00000100034	ENST00000263212;ENST00000407142;ENST00000406981;ENST00000538191;ENST00000397495;ENST00000445205	T;T;T;T;T	0.20200	2.09;2.09;2.09;2.09;2.09	4.96	2.81	0.32909	Protein phosphatase 2C-like (5);	0.279101	0.38720	N	0.001592	T	0.15305	0.0369	L	0.33753	1.03	0.09310	N	1	B;B;B	0.12630	0.006;0.003;0.0	B;B;B	0.15484	0.012;0.013;0.005	T	0.19516	-1.0303	10	0.32370	T	0.25	-21.7728	10.4831	0.44706	0.0:0.1197:0.4748:0.4056	.	124;228;228	B7Z2C3;A8MX49;P49593	.;.;PPM1F_HUMAN	G	228;60;60;124;228;60	ENSP00000263212:E228G;ENSP00000384930:E60G;ENSP00000439915:E124G;ENSP00000380632:E228G;ENSP00000392372:E60G	ENSP00000263212:E228G	E	-	2	0	PPM1F	20617827	0.006000	0.16342	0.007000	0.13788	0.000000	0.00434	1.462000	0.35266	0.246000	0.21394	-1.338000	0.01255	GAG		0.642	PPM1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320267.2	NM_014634	
ARHGAP8	23779	ucsc.edu	37	22	45204237	45204237	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr22:45204237T>C	ENST00000389774.2	+	4	359	c.218T>C	c.(217-219)gTc>gCc	p.V73A	ARHGAP8_ENST00000517296.3_Intron|ARHGAP8_ENST00000389773.5_Missense_Mutation_p.V195A|ARHGAP8_ENST00000356099.6_Missense_Mutation_p.V73A|PRR5-ARHGAP8_ENST00000352766.7_Intron|PRR5-ARHGAP8_ENST00000361473.5_Missense_Mutation_p.V204A|ARHGAP8_ENST00000336963.4_Missense_Mutation_p.V73A	NM_001017526.1	NP_001017526.1	P85298	RHG08_HUMAN	Rho GTPase activating protein 8	73	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(9)|prostate(1)|skin(7)	29		all_neural(38;0.00409)|Ovarian(80;0.00976)|Glioma(61;0.0649)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0204)		TATACCATCGTCTATTTCCAC	0.478																																						.											0													88.0	78.0	82.0					22																	45204237		2203	4300	6503	SO:0001583	missense	553158			AF177331	CCDS14060.2, CCDS33664.1, CCDS56233.1	22q13.3	2010-05-11			ENSG00000241484	ENSG00000241484		"""Rho GTPase activating proteins"""	677	protein-coding gene	gene with protein product		609405				10591208	Standard	NM_001198726		Approved	FLJ20185, BPGAP1		P85298	OTTHUMG00000030234	ENST00000389774.2:c.218T>C	22.37:g.45204237T>C	ENSP00000374424:p.Val73Ala	Somatic		WXS	Illumina HiSeq	Phase_I	A6ZJ79|A6ZJ80|O75983|O95695|Q96RW1|Q96RW2|Q9HA49|Q9HC46|Q9NSG0|Q9NVX8|Q9NXL1|Q9UH20	Missense_Mutation	SNP	ENST00000389774.2	37	CCDS33664.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.77|12.77	2.036253|2.036253	0.35893|0.35893	.|.	.|.	ENSG00000248405|ENSG00000248405;ENSG00000241484;ENSG00000241484;ENSG00000241484;ENSG00000241484;ENSG00000241484;ENSG00000241484	ENST00000515632|ENST00000361473;ENST00000389773;ENST00000389774;ENST00000396119;ENST00000336963;ENST00000356099;ENST00000412433	.|T;T;T;T;T;T;T	.|0.76186	.|-1.0;-1.0;-1.0;-1.0;-1.0;-1.0;-1.0	4.34|4.34	3.27|3.27	0.37495|0.37495	.|Cellular retinaldehyde-binding/triple function, C-terminal (4);	.|0.222293	.|0.22584	.|U	.|0.058178	T|T	0.77705|0.77705	0.4170|0.4170	L|L	0.58669|0.58669	1.825|1.825	0.44048|0.44048	D|D	0.996789|0.996789	.|P;P;P;P;P;P;P	.|0.48503	.|0.809;0.624;0.517;0.809;0.911;0.802;0.835	.|P;B;B;P;P;P;P	.|0.53518	.|0.639;0.279;0.205;0.639;0.7;0.607;0.728	T|T	0.76838|0.76838	-0.2811|-0.2811	5|10	.|0.59425	.|D	.|0.04	.|.	10.5667|10.5667	0.45177|0.45177	0.0:0.0:0.1625:0.8375|0.0:0.0:0.1625:0.8375	.|.	.|109;73;109;73;114;195;204	.|B7ZMA4;A6ZJ79;A2RU51;P85298;Q6PCC7;F8W6F3;B1AHC3	.|.;.;.;RHG08_HUMAN;.;.;.	P|A	127|204;195;73;73;73;73;73	.|ENSP00000354732:V204A;ENSP00000374423:V195A;ENSP00000374424:V73A;ENSP00000379425:V73A;ENSP00000337287:V73A;ENSP00000348407:V73A;ENSP00000402775:V73A	.|ENSP00000337287:V73A	S|V	+|+	1|2	0|0	PRR5-ARHGAP8|PRR5-ARHGAP8;ARHGAP8	43582901|43582901	1.000000|1.000000	0.71417|0.71417	0.815000|0.815000	0.32552|0.32552	0.154000|0.154000	0.21943|0.21943	6.995000|6.995000	0.76257|0.76257	0.663000|0.663000	0.31027|0.31027	0.482000|0.482000	0.46254|0.46254	TCT|GTC		0.478	ARHGAP8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000075088.4	NM_017701	
SLC35G6	643664	ucsc.edu	37	17	7385479	7385479	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr17:7385479A>G	ENST00000412468.2	+	2	291	c.176A>G	c.(175-177)cAt>cGt	p.H59R	ZBTB4_ENST00000311403.4_Intron|POLR2A_ENST00000322644.6_5'Flank|ZBTB4_ENST00000380599.4_5'Flank|POLR2A_ENST00000572844.1_5'Flank	NM_001102614.1	NP_001096084.1	P0C7Q6	S35G6_HUMAN	solute carrier family 35, member G6	59	EamA 1.					integral component of membrane (GO:0016021)											CCCCTTTCTCATATGGCTTAC	0.632																																						.											0													98.0	103.0	101.0					17																	7385479		2203	4300	6503	SO:0001583	missense	643664				CCDS45603.1	17p13.1	2013-05-22	2011-08-03	2011-08-03		ENSG00000259224		"""Solute carriers"""	31351	protein-coding gene	gene with protein product			"""transmembrane protein 21B"", ""acyl-malonyl condensing enzyme 1-like 3"""	TMEM21B, AMAC1L3			Standard	NM_001102614		Approved		uc010cmj.1	P0C7Q6		ENST00000412468.2:c.176A>G	17.37:g.7385479A>G	ENSP00000396523:p.His59Arg	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000412468.2	37	CCDS45603.1	.	.	.	.	.	.	.	.	.	.	G	0.010	-1.796575	0.00617	.	.	ENSG00000181222	ENST00000412468	T	0.16597	2.33	4.21	3.24	0.37175	.	.	.	.	.	T	0.04679	0.0127	N	0.00926	-1.1	0.20703	N	0.999863	B	0.02656	0.0	B	0.01281	0.0	T	0.39683	-0.9602	9	0.02654	T	1	-1.8351	9.504	0.39035	0.181:0.0:0.819:0.0	.	59	P0C7Q6	S35G6_HUMAN	R	59	ENSP00000396523:H59R	ENSP00000396523:H59R	H	+	2	0	SLC35G6	7326203	1.000000	0.71417	0.996000	0.52242	0.106000	0.19336	3.612000	0.54142	0.373000	0.24621	-0.355000	0.07637	CAT		0.632	SLC35G6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001102614	
SPTA1	6708	ucsc.edu;bcgsc.ca	37	1	158641982	158641982	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr1:158641982T>C	ENST00000368147.4	-	11	1535	c.1355A>G	c.(1354-1356)gAa>gGa	p.E452G		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	452					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					GTCAAGTATTTCCATCTTTGG	0.363																																						.											0													85.0	77.0	79.0					1																	158641982		1877	4122	5999	SO:0001583	missense	6708			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.1355A>G	1.37:g.158641982T>C	ENSP00000357129:p.Glu452Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	T	9.975	1.226664	0.22542	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.36699	1.24;1.24	5.24	-2.0	0.07433	.	1.622580	0.04359	N	0.357116	T	0.08670	0.0215	N	0.20986	0.625	0.80722	D	1	B	0.02656	0.0	B	0.09377	0.004	T	0.37314	-0.9711	10	0.23891	T	0.37	.	6.0076	0.19554	0.0654:0.1029:0.3444:0.4873	.	452	P02549	SPTA1_HUMAN	G	452	ENSP00000357130:E452G;ENSP00000357129:E452G	ENSP00000357129:E452G	E	-	2	0	SPTA1	156908606	0.001000	0.12720	0.000000	0.03702	0.172000	0.22775	0.236000	0.17967	-0.560000	0.06102	-1.106000	0.02097	GAA		0.363	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
ZNF254	9534	ucsc.edu	37	19	24310753	24310753	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr19:24310753A>G	ENST00000357002.4	+	4	2066	c.1951A>G	c.(1951-1953)Act>Gct	p.T651A	ZNF254_ENST00000342944.6_Missense_Mutation_p.T566A	NM_001278661.1|NM_001278662.1|NM_001278664.1|NM_001278677.1|NM_001278678.1|NM_203282.2	NP_001265590.1|NP_001265591.1|NP_001265593.1|NP_001265606.1|NP_001265607.1|NP_975011.3	O75437	ZN254_HUMAN	zinc finger protein 254	651					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)						all_cancers(12;0.086)|all_lung(12;0.00528)|Lung NSC(12;0.00731)|all_epithelial(12;0.0186)				AGATAAGATAACTCATTGGAG	0.363																																						.											0													78.0	83.0	81.0					19																	24310753		2202	4297	6499	SO:0001583	missense	9534			AF054180	CCDS32983.1, CCDS62622.1, CCDS62623.1, CCDS74323.1, CCDS74324.1	19p13	2013-01-08				ENSG00000213096		"""Zinc fingers, C2H2-type"", ""-"""	13047	protein-coding gene	gene with protein product		604768	"""zinc finger protein 539"""	ZNF91L, ZNF539		9653160	Standard	NM_001278661		Approved	HD-ZNF1, BMZF-5	uc002nru.3	O75437		ENST00000357002.4:c.1951A>G	19.37:g.24310753A>G	ENSP00000349494:p.Thr651Ala	Somatic		WXS	Illumina HiSeq	Phase_I	A4QPC0|Q86XL7	Missense_Mutation	SNP	ENST00000357002.4	37	CCDS32983.1	.	.	.	.	.	.	.	.	.	.	A	6.168	0.399173	0.11696	.	.	ENSG00000213096	ENST00000342944;ENST00000357002;ENST00000392281	T;T	0.06768	3.26;3.41	0.525	0.525	0.17072	Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08537	0.0212	L	0.54965	1.715	0.19575	N	0.999965	B	0.06786	0.001	B	0.04013	0.001	T	0.30621	-0.9972	9	0.66056	D	0.02	.	5.2926	0.15735	0.9999:0.0:1.0E-4:0.0	.	651	O75437	ZN254_HUMAN	A	566;651;343	ENSP00000445527:T566A;ENSP00000349494:T651A	ENSP00000445527:T566A	T	+	1	0	ZNF254	24102593	0.000000	0.05858	0.027000	0.17364	0.015000	0.08874	0.213000	0.17521	0.446000	0.26666	0.254000	0.18369	ACT		0.363	ZNF254-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466453.1	NM_004876	
AHNAK2	113146	mdanderson.org	37	14	105411784	105411784	+	Missense_Mutation	SNP	G	G	T	rs371364837		TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr14:105411784G>T	ENST00000333244.5	-	7	10123	c.10004C>A	c.(10003-10005)gCg>gAg	p.A3335E	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3335						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CGCCTTCGGCGCAGACACATC	0.602																																						.											0													150.0	153.0	152.0					14																	105411784		1986	4152	6138	SO:0001583	missense	113146			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.10004C>A	14.37:g.105411784G>T	ENSP00000353114:p.Ala3335Glu	Somatic		WXS	Illumina HiSeq	Phase_I	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	g	10.45	1.353939	0.24512	.	.	ENSG00000185567	ENST00000333244	T	0.00949	5.51	3.83	-3.74	0.04385	.	.	.	.	.	T	0.01189	0.0039	M	0.70275	2.135	0.09310	N	1	B	0.31040	0.305	B	0.36808	0.233	T	0.48364	-0.9042	9	0.02654	T	1	.	5.4244	0.16417	0.4015:0.2619:0.3366:0.0	.	3335	Q8IVF2	AHNK2_HUMAN	E	3335	ENSP00000353114:A3335E	ENSP00000353114:A3335E	A	-	2	0	AHNAK2	104482829	0.027000	0.19231	0.000000	0.03702	0.001000	0.01503	-0.307000	0.08167	-1.065000	0.03168	-1.424000	0.01105	GCG		0.602	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
ARHGAP23	57636	mdanderson.org	37	17	36667022	36667022	+	Silent	SNP	C	C	T	rs15537	byFrequency	TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr17:36667022C>T	ENST00000431231.2	+	24	4358	c.4290C>T	c.(4288-4290)ccC>ccT	p.P1430P	ARHGAP23_ENST00000443378.1_Silent_p.P1336P	NM_001199417.1	NP_001186346.1	Q9P227	RHG23_HUMAN	Rho GTPase activating protein 23	1430					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(8)|kidney(6)|lung(1)|skin(1)|stomach(2)	20						GAGGGGGCCCCCCGGAGCCTG	0.731													C|||	356	0.0710863	0.1112	0.0504	5008	,	,		6979	0.0327		0.0736	False		,,,				2504	0.0685					.											0													2.0	3.0	3.0					17																	36667022		407	1191	1598	SO:0001819	synonymous_variant	57636			AB040934	CCDS56027.1	17q12	2014-05-06			ENSG00000225485	ENSG00000275832		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	29293	protein-coding gene	gene with protein product		610590				10819331, 15254754	Standard	NM_001199417		Approved	KIAA1501	uc021twd.1	Q9P227	OTTHUMG00000188547	ENST00000431231.2:c.4290C>T	17.37:g.36667022C>T		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000431231.2	37	CCDS56027.1																																																																																				0.731	ARHGAP23-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441789.1	XM_290799	
BRAT1	221927	mdanderson.org	37	7	2578285	2578285	+	Silent	SNP	G	G	A	rs142346283	byFrequency	TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr7:2578285G>A	ENST00000340611.4	-	14	2140	c.1884C>T	c.(1882-1884)gcC>gcT	p.A628A	BRAT1_ENST00000473879.1_5'UTR	NM_152743.3	NP_689956.2	Q6PJG6	BRAT1_HUMAN	BRCA1-associated ATM activator 1	628					response to ionizing radiation (GO:0010212)	membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	23						CCGTGTCCTGGGCCGCGTCGG	0.697													G|||	33	0.00658946	0.0227	0.0043	5008	,	,		13062	0.0		0.0	False		,,,				2504	0.0					.											0								G		86,4228		0,86,2071	15.0	18.0	17.0		1884	-8.1	0.0	7	dbSNP_134	17	1,8423		0,1,4211	no	coding-synonymous	BRAT1	NM_152743.3		0,87,6282	AA,AG,GG		0.0119,1.9935,0.683		628/822	2578285	87,12651	2157	4212	6369	SO:0001819	synonymous_variant	221927			BC015632	CCDS5334.1	7p22.3	2011-03-22	2011-02-28	2011-03-22	ENSG00000106009	ENSG00000106009			21701	protein-coding gene	gene with protein product	"""BRCA1-associated protein required for ATM activation protein 1"""	614506	"""chromosome 7 open reading frame 27"""	C7orf27, BAAT1		16452482	Standard	NM_152743		Approved	MGC22916	uc003smi.3	Q6PJG6	OTTHUMG00000119091	ENST00000340611.4:c.1884C>T	7.37:g.2578285G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A4D200|C9JY24|Q8IW85|Q8IZ43|Q8WVR8|Q96IV9|Q9H7J8|Q9UFA3	Silent	SNP	ENST00000340611.4	37	CCDS5334.1																																																																																				0.697	BRAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239305.2	NM_152743	
C9orf172	389813	mdanderson.org	37	9	139739643	139739643	+	Silent	SNP	T	T	C	rs10870132	byFrequency	TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr9:139739643T>C	ENST00000436881.1	+	1	777	c.777T>C	c.(775-777)ccT>ccC	p.P259P		NM_001080482.2	NP_001073951.2	C9J069	CI172_HUMAN	chromosome 9 open reading frame 172	259	Pro-rich.									endometrium(2)|large_intestine(1)|lung(6)	9						GGCCCCTGCCTGGGCCCCGGG	0.726													T|||	3952	0.789137	0.7799	0.6744	5008	,	,		8348	0.879		0.7972	False		,,,				2504	0.7822					.											0													5.0	5.0	5.0					9																	139739643		1547	3489	5036	SO:0001819	synonymous_variant	389813				CCDS48059.1	9q34.3	2012-04-03			ENSG00000232434	ENSG00000232434			37284	protein-coding gene	gene with protein product							Standard	NM_001080482		Approved		uc011meh.2	C9J069		ENST00000436881.1:c.777T>C	9.37:g.139739643T>C		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000436881.1	37	CCDS48059.1																																																																																				0.726	C9orf172-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001080482	
CLEC18A	348174	mdanderson.org	37	16	69988292	69988292	+	Missense_Mutation	SNP	C	C	T	rs2549089	byFrequency	TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr16:69988292C>T	ENST00000288040.6	+	3	459	c.272C>T	c.(271-273)aCc>aTc	p.T91I	CLEC18A_ENST00000568461.1_Missense_Mutation_p.T91I|CLEC18A_ENST00000449317.2_Missense_Mutation_p.T91I|CLEC18A_ENST00000393701.2_Missense_Mutation_p.T91I	NM_001136214.2	NP_001129686.1	A5D8T8	CL18A_HUMAN	C-type lectin domain family 18, member A	91	SCP.					extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)	p.T91I(2)		NS(1)|endometrium(2)|lung(1)|skin(1)	5						CTCTGTGGAACCCCAACCCCG	0.647													.|||	21	0.00419329	0.0159	0.0	5008	,	,		17779	0.0		0.0	False		,,,				2504	0.0					.											2	Substitution - Missense(2)	NS(1)|skin(1)											55.0	53.0	54.0					16																	69988292		2198	4300	6498	SO:0001583	missense	348174			AF428259	CCDS10886.1	16q22.1	2010-04-27	2009-03-10	2009-03-10		ENSG00000157322		"""C-type lectin domain containing"""	30388	protein-coding gene	gene with protein product	"""mannose receptor-like"""					12975309	Standard	NM_001136214		Approved	MRCL	uc010vlo.3	A5D8T8		ENST00000288040.6:c.272C>T	16.37:g.69988292C>T	ENSP00000288040:p.Thr91Ile	Somatic		WXS	Illumina HiSeq	Phase_I	A8K1G9|Q6DCB3|Q7Z5K9|Q96HH2	Missense_Mutation	SNP	ENST00000288040.6	37	CCDS10886.1	.	.	.	.	.	.	.	.	.	.	.	3.377	-0.127284	0.06753	.	.	ENSG00000157322	ENST00000393701;ENST00000539957;ENST00000449317;ENST00000288040	T;T;T	0.07800	3.16;3.16;3.16	1.97	0.987	0.19790	CAP domain (3);	0.641843	0.13978	N	0.349648	T	0.05227	0.0139	N	0.22421	0.69	0.09310	N	1	B;B;B	0.28470	0.027;0.213;0.078	B;B;B	0.32022	0.014;0.139;0.087	T	0.42816	-0.9429	9	.	.	.	.	4.4066	0.11413	0.0:0.7949:0.0:0.2051	rs2549089	91;91;91	B4DPF2;A5D8T8;F8W692	.;CL18A_HUMAN;.	I	91	ENSP00000377304:T91I;ENSP00000413990:T91I;ENSP00000288040:T91I	.	T	+	2	0	CLEC18A	68545793	0.037000	0.19845	0.022000	0.16811	0.346000	0.29079	0.463000	0.21972	0.390000	0.25115	0.184000	0.17185	ACC		0.647	CLEC18A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000268955.2	NM_182619	
DDX31	64794	mdanderson.org	37	9	135545386	135545386	+	Missense_Mutation	SNP	C	C	T	rs75901862	byFrequency	TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr9:135545386C>T	ENST00000372159.3	-	1	402	c.251G>A	c.(250-252)gGg>gAg	p.G84E	DDX31_ENST00000544003.1_5'UTR|GTF3C4_ENST00000483873.2_5'Flank|DDX31_ENST00000310532.2_Missense_Mutation_p.G84E|GTF3C4_ENST00000372146.4_5'Flank|DDX31_ENST00000480876.1_5'UTR|DDX31_ENST00000372153.1_Missense_Mutation_p.G84E	NM_022779.7	NP_073616.6	Q9H8H2	DDX31_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 31	84						nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(1)	27				OV - Ovarian serous cystadenocarcinoma(145;2.67e-06)|Epithelial(140;7.61e-05)		GCCCGGGACCCCACGTGGGAC	0.741													C|||	64	0.0127796	0.0477	0.0	5008	,	,		13282	0.0		0.001	False		,,,				2504	0.0					.											0								C	GLU/GLY,GLU/GLY	138,4042		3,132,1955	9.0	6.0	7.0		251,251	0.6	0.6	9	dbSNP_131	7	4,8142		0,4,4069	no	missense,missense	DDX31	NM_022779.7,NM_138620.1	98,98	3,136,6024	TT,TC,CC		0.0491,3.3014,1.152	possibly-damaging,possibly-damaging	84/852,84/586	135545386	142,12184	2090	4073	6163	SO:0001583	missense	64794			AF427339	CCDS6951.1, CCDS6952.1	9q34.2	2012-04-17	2003-06-13		ENSG00000125485	ENSG00000125485		"""DEAD-boxes"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	16715	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 25"""		"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31"""				Standard	NM_022779		Approved	FLJ13633, FLJ23349, FLJ14578, PPP1R25	uc004cbq.1	Q9H8H2	OTTHUMG00000020843	ENST00000372159.3:c.251G>A	9.37:g.135545386C>T	ENSP00000361232:p.Gly84Glu	Somatic		WXS	Illumina HiSeq	Phase_I	Q5K6N2|Q5K6N3|Q5K6N4|Q5VZJ4|Q5VZJ9|Q96E91|Q96NY2|Q96SX5|Q9H5K6	Missense_Mutation	SNP	ENST00000372159.3	37	CCDS6951.1	25	0.011446886446886446	24	0.04878048780487805	0	0.0	0	0.0	1	0.0013192612137203166	C	12.05	1.820370	0.32145	0.033014	4.91E-4	ENSG00000125485	ENST00000372159;ENST00000372155;ENST00000372153;ENST00000310532	T;T;T	0.06142	4.17;3.73;3.34	1.66	0.633	0.17712	.	.	.	.	.	T	0.00580	0.0019	N	0.14661	0.345	0.58432	D	0.999999	B;P;B	0.42357	0.274;0.777;0.18	B;B;B	0.39935	0.082;0.314;0.023	T	0.57917	-0.7728	9	0.52906	T	0.07	.	5.4778	0.16706	0.0:0.6115:0.3885:0.0	.	84;84;84	Q9H8H2-2;Q9H8H2-3;Q9H8H2	.;.;DDX31_HUMAN	E	84	ENSP00000361232:G84E;ENSP00000361226:G84E;ENSP00000310539:G84E	ENSP00000310539:G84E	G	-	2	0	DDX31	134535207	0.011000	0.17503	0.639000	0.29394	0.605000	0.37080	0.287000	0.18920	0.189000	0.20188	0.462000	0.41574	GGG		0.741	DDX31-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054794.1	NM_138620	
FAM182A	284800	mdanderson.org	37	20	26061909	26061909	+	RNA	SNP	G	G	A	rs116264914		TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr20:26061909G>A	ENST00000376398.2	+	0	929					NR_026713.1		Q5T1J6	F182A_HUMAN	family with sequence similarity 182, member A											breast(1)|endometrium(2)|kidney(1)	4						AGCACTGCGGGTGCCCAGCAA	0.562																																						.											0													29.0	25.0	26.0					20																	26061909		691	1558	2249			284800			AL391119		20p11	2013-03-18	2008-08-05	2008-08-05	ENSG00000125804	ENSG00000125804			16222	other	unknown			"""chromosome 20 open reading frame 91"""	C20orf91			Standard	NR_026713		Approved	bB329D4.1, C20orf91A	uc010gdq.3	Q5T1J6	OTTHUMG00000032144		20.37:g.26061909G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A2RRD0|Q8N947	RNA	SNP	ENST00000376398.2	37																																																																																					0.562	FAM182A-001	KNOWN	basic	lincRNA	processed_transcript	OTTHUMT00000078473.2		
FAM182B	728882	mdanderson.org	37	20	25755562	25755562	+	Missense_Mutation	SNP	A	A	T			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr20:25755562A>T	ENST00000376403.1	-	3	772	c.394T>A	c.(394-396)Tgg>Agg	p.W132R	FAM182B_ENST00000376404.2_Intron|FAM182B_ENST00000478164.1_Intron			Q5T319	F182B_HUMAN	family with sequence similarity 182, member B	132										lung(1)	1						TCCTGGGACCACTCCGGCCCC	0.716																																						.											0																																										SO:0001583	missense	728882					20p11.1	2010-07-14			ENSG00000175170	ENSG00000175170			34503	pseudogene	pseudogene							Standard	NR_027061		Approved			Q5T319	OTTHUMG00000032136	ENST00000376403.1:c.394T>A	20.37:g.25755562A>T	ENSP00000365585:p.Trp132Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q4G0Q1	RNA	SNP	ENST00000376403.1	37		.	.	.	.	.	.	.	.	.	.	.	1.172	-0.640656	0.03557	.	.	ENSG00000175170	ENST00000376403	.	.	.	.	.	.	.	.	.	.	.	T	0.39036	0.1063	.	.	.	0.09310	N	0.999996	.	.	.	.	.	.	T	0.39210	-0.9625	3	0.87932	D	0	.	.	.	.	.	.	.	.	R	132	.	ENSP00000365585:W132R	W	-	1	0	FAM182B	25703562	0.019000	0.18553	0.149000	0.22428	0.150000	0.21749	-1.161000	0.03144	0.056000	0.16144	0.055000	0.15244	TGG		0.716	FAM182B-003	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000078463.2	NR_026714	
FAM182A	284800	mdanderson.org	37	20	26061973	26061973	+	RNA	SNP	C	C	A			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr20:26061973C>A	ENST00000376398.2	+	0	993					NR_026713.1		Q5T1J6	F182A_HUMAN	family with sequence similarity 182, member A											breast(1)|endometrium(2)|kidney(1)	4						GTCGGCATCGCAGCTGATGGT	0.592																																						.											0													20.0	16.0	17.0					20																	26061973		692	1567	2259			284800			AL391119		20p11	2013-03-18	2008-08-05	2008-08-05	ENSG00000125804	ENSG00000125804			16222	other	unknown			"""chromosome 20 open reading frame 91"""	C20orf91			Standard	NR_026713		Approved	bB329D4.1, C20orf91A	uc010gdq.3	Q5T1J6	OTTHUMG00000032144		20.37:g.26061973C>A		Somatic		WXS	Illumina HiSeq	Phase_I	A2RRD0|Q8N947	RNA	SNP	ENST00000376398.2	37		.	.	.	.	.	.	.	.	.	.	N	1.822	-0.472046	0.04445	.	.	ENSG00000125804	ENST00000376398;ENST00000246000;ENST00000415411	.	.	.	.	.	.	.	.	.	.	.	T	0.39172	0.1068	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.38779	-0.9645	3	0.87932	D	0	.	.	.	.	.	.	.	.	K	109;109;50	.	ENSP00000246000:Q109K	Q	+	1	0	FAM182A	26009973	0.042000	0.20092	0.116000	0.21606	0.117000	0.20001	0.055000	0.14229	0.121000	0.18284	0.123000	0.15791	CAG		0.592	FAM182A-001	KNOWN	basic	lincRNA	processed_transcript	OTTHUMT00000078473.2		
FRG1	2483	mdanderson.org	37	4	190873347	190873347	+	Missense_Mutation	SNP	A	A	G	rs73024948		TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr4:190873347A>G	ENST00000226798.4	+	3	386	c.164A>G	c.(163-165)gAa>gGa	p.E55G	FRG1_ENST00000514482.1_3'UTR	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1	55					mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		AACTTTGGTGAAATTTCAGGA	0.333																																						.											0													83.0	96.0	92.0					4																	190873347		2201	4296	6497	SO:0001583	missense	2483			L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.164A>G	4.37:g.190873347A>G	ENSP00000226798:p.Glu55Gly	Somatic		WXS	Illumina HiSeq	Phase_I	A8K775	Missense_Mutation	SNP	ENST00000226798.4	37	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	.	19.43	3.825859	0.71143	.	.	ENSG00000109536	ENST00000226798	T	0.34859	1.34	3.47	3.47	0.39725	.	0.050175	0.85682	D	0.000000	T	0.43656	0.1257	M	0.83953	2.67	0.80722	D	1	P	0.40578	0.722	B	0.41510	0.359	T	0.53851	-0.8380	10	0.72032	D	0.01	-24.5471	10.6186	0.45465	1.0:0.0:0.0:0.0	.	55	Q14331	FRG1_HUMAN	G	55	ENSP00000226798:E55G	ENSP00000226798:E55G	E	+	2	0	FRG1	191110341	1.000000	0.71417	0.995000	0.50966	0.984000	0.73092	6.760000	0.74939	1.815000	0.52974	0.441000	0.28932	GAA		0.333	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	
GLG1	2734	mdanderson.org	37	16	74566050	74566050	+	Splice_Site	SNP	G	G	A	rs201232267		TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr16:74566050G>A	ENST00000422840.2	-	2	439	c.440C>T	c.(439-441)cCt>cTt	p.P147L	GLG1_ENST00000447066.2_Intron|GLG1_ENST00000205061.5_Splice_Site_p.P147L	NM_001145667.1	NP_001139139.1	Q92896	GSLG1_HUMAN	golgi glycoprotein 1	147					blood coagulation (GO:0007596)|bone morphogenesis (GO:0060349)|leukocyte migration (GO:0050900)|negative regulation of protein processing (GO:0010955)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of chondrocyte differentiation (GO:0032330)	extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(2)|cervix(2)|endometrium(6)|kidney(8)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(1)	57						TTCATTTTCAGGCTAGAAGAG	0.308																																						.											0																																										SO:0001630	splice_region_variant	2734				CCDS32485.1, CCDS45526.1, CCDS45527.1	16q22-q23	2010-02-12	2010-02-12			ENSG00000090863			4316	protein-coding gene	gene with protein product		600753	"""golgi apparatus protein 1"""			8530051, 7531823	Standard	NM_012201		Approved	MG-160, ESL-1, CFR-1	uc002fcx.3	Q92896		ENST00000422840.2:c.439-1C>T	16.37:g.74566050G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B7Z8Y4|D3DUJ7|Q13221|Q6P9D1	Missense_Mutation	SNP	ENST00000422840.2	37	CCDS45527.1	.	.	.	.	.	.	.	.	.	.	G	15.12	2.739791	0.49045	.	.	ENSG00000090863	ENST00000205061;ENST00000422840	.	.	.	4.8	4.8	0.61643	.	0.075280	0.56097	D	0.000031	T	0.50803	0.1637	N	0.08118	0	0.80722	D	1	B;D	0.76494	0.038;0.999	B;D	0.78314	0.016;0.991	T	0.53308	-0.8457	9	0.33940	T	0.23	-4.2986	13.2184	0.59873	0.0:0.0:1.0:0.0	.	147;147	Q92896;Q92896-2	GSLG1_HUMAN;.	L	147	.	ENSP00000205061:P147L	P	-	2	0	GLG1	73123551	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	4.495000	0.60353	2.507000	0.84556	0.455000	0.32223	CCT		0.308	GLG1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000435750.1	NM_012201	Missense_Mutation
GPR108	56927	mdanderson.org	37	19	6737481	6737481	+	Missense_Mutation	SNP	T	T	C	rs340138	byFrequency	TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr19:6737481T>C	ENST00000264080.7	-	1	133	c.107A>G	c.(106-108)cAg>cGg	p.Q36R	TRIP10_ENST00000313285.8_5'Flank|TRIP10_ENST00000313244.9_5'Flank|TRIP10_ENST00000600428.1_5'Flank|GPR108_ENST00000430424.4_5'Flank|TRIP10_ENST00000596758.1_5'Flank	NM_001080452.1	NP_001073921.1	Q9NPR9	GP108_HUMAN	G protein-coupled receptor 108	36			Q -> R (in dbSNP:rs340138). {ECO:0000269|Ref.2, ECO:0000269|Ref.4}.			integral component of membrane (GO:0016021)				breast(2)|cervix(1)|large_intestine(4)|lung(4)|skin(1)|urinary_tract(1)	13						CAGCGCCAGCTGGTGGATGCG	0.726													C|||	4440	0.886581	0.8434	0.9236	5008	,	,		10979	0.9861		0.8936	False		,,,				2504	0.8088					.											0								C	ARG/GLN	3027,409		1332,363,23	5.0	8.0	7.0		107	3.1	1.0	19	dbSNP_79	7	6743,857		2996,751,53	no	missense	GPR108	NM_001080452.1	43	4328,1114,76	CC,CT,TT		11.2763,11.9034,11.4715	benign	36/544	6737481	9770,1266	1718	3800	5518	SO:0001583	missense	56927				CCDS42479.1	19p13.3	2014-01-30				ENSG00000125734		"""GPCR / Unclassified : 7TM orphan receptors"""	17829	protein-coding gene	gene with protein product							Standard	NM_001080452		Approved	LUSTR2	uc002mfp.3	Q9NPR9	OTTHUMG00000170129	ENST00000264080.7:c.107A>G	19.37:g.6737481T>C	ENSP00000264080:p.Gln36Arg	Somatic		WXS	Illumina HiSeq	Phase_I	B9EJD7	Missense_Mutation	SNP	ENST00000264080.7	37	CCDS42479.1	1973	0.9033882783882784	409	0.8313008130081301	332	0.9171270718232044	565	0.9877622377622378	667	0.8799472295514512	C	4.694	0.128956	0.08981	0.880966	0.887237	ENSG00000125734	ENST00000264080	T	0.20738	2.05	4.2	3.1	0.35709	.	0.309721	0.25663	N	0.029139	T	0.00012	0.0000	N	0.00099	-2.14	0.09310	P	0.999999999395269	B	0.02656	0.0	B	0.01281	0.0	T	0.36890	-0.9729	9	0.16896	T	0.51	-4.2341	5.3586	0.16075	0.0:0.7344:0.0:0.2656	rs340138;rs344628;rs1193120;rs1193215;rs3745557;rs3947071;rs11539589;rs59869501;rs340138	36	Q9NPR9	GP108_HUMAN	R	36	ENSP00000264080:Q36R	ENSP00000264080:Q36R	Q	-	2	0	GPR108	6688481	0.989000	0.36119	1.000000	0.80357	0.926000	0.56050	0.194000	0.17135	0.997000	0.38969	-0.215000	0.12644	CAG		0.726	GPR108-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407508.2		
HELZ2	85441	mdanderson.org	37	20	62195726	62195726	+	Silent	SNP	G	G	A	rs45469491	byFrequency	TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr20:62195726G>A	ENST00000467148.1	-	8	4518	c.4449C>T	c.(4447-4449)gaC>gaT	p.D1483D	HELZ2_ENST00000427522.2_Silent_p.D914D	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	1483					cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										CGACGCAGGCGTCCACGGAGT	0.711													G|||	242	0.0483227	0.121	0.0418	5008	,	,		15557	0.002		0.0467	False		,,,				2504	0.0041					.											0								G	,	377,3757		16,345,1706	5.0	5.0	5.0		4449,2742	-7.8	0.3	20	dbSNP_127	5	202,7874		1,200,3837	no	coding-synonymous,coding-synonymous	PRIC285	NM_001037335.2,NM_033405.3	,	17,545,5543	AA,AG,GG		2.5012,9.1195,4.742	,	1483/2650,914/2081	62195726	579,11631	2067	4038	6105	SO:0001819	synonymous_variant	85441			AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.4449C>T	20.37:g.62195726G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Silent	SNP	ENST00000467148.1	37	CCDS33508.1																																																																																				0.711	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354127.1	NM_001037335	
HPR	3250	mdanderson.org	37	16	72108254	72108254	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr16:72108254A>G	ENST00000540303.2	+	3	195	c.163A>G	c.(163-165)Aac>Gac	p.N55D	HPR_ENST00000561690.1_Missense_Mutation_p.N55D|HPR_ENST00000228226.8_Missense_Mutation_p.N92D|HPR_ENST00000356967.5_Missense_Mutation_p.N55D	NM_020995.3	NP_066275.3	P00739	HPTR_HUMAN	haptoglobin-related protein	55	Sushi.					blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|spherical high-density lipoprotein particle (GO:0034366)	hemoglobin binding (GO:0030492)|serine-type endopeptidase activity (GO:0004252)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|stomach(1)|urinary_tract(2)	20		Ovarian(137;0.125)				CCAGTGTAAGAACTACTACAG	0.498																																						.											0													211.0	131.0	157.0					16																	72108254		1982	4150	6132	SO:0001583	missense	3250			BC160066	CCDS42193.1	16q22.2	2012-10-03			ENSG00000261701	ENSG00000261701			5156	protein-coding gene	gene with protein product		140210				2987228, 16778136	Standard	NM_020995		Approved		uc002fby.3	P00739	OTTHUMG00000173010	ENST00000540303.2:c.163A>G	16.37:g.72108254A>G	ENSP00000441828:p.Asn55Asp	Somatic		WXS	Illumina HiSeq	Phase_I	Q7LE20|Q92658|Q92659|Q9ULB0	Missense_Mutation	SNP	ENST00000540303.2	37	CCDS42193.1	.	.	.	.	.	.	.	.	.	.	A	7.220	0.597158	0.13875	.	.	ENSG00000257017	ENST00000356967;ENST00000540303;ENST00000228226	T;T;T	0.46451	0.87;0.87;0.87	2.4	-4.79	0.03200	Complement control module (2);	4.420860	0.00639	N	0.000520	T	0.25269	0.0614	N	0.19112	0.55	0.09310	N	1	B	0.13594	0.008	B	0.15484	0.013	T	0.09271	-1.0682	10	0.23891	T	0.37	.	5.6919	0.17835	0.2734:0.5827:0.1439:0.0	.	55	P00739	HPTR_HUMAN	D	55;55;92	ENSP00000349451:N55D;ENSP00000441828:N55D;ENSP00000228226:N92D	ENSP00000228226:N92D	N	+	1	0	HP	70665755	0.000000	0.05858	0.000000	0.03702	0.116000	0.19942	-1.020000	0.03618	-1.454000	0.01926	0.172000	0.16884	AAC		0.498	HPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421696.1	NM_020995	
KRT86	3892	mdanderson.org	37	12	52699044	52699044	+	Silent	SNP	C	C	G	rs61915660	byFrequency	TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr12:52699044C>G	ENST00000423955.2	+	7	934	c.756C>G	c.(754-756)tcC>tcG	p.S252S	KRT86_ENST00000544024.1_Silent_p.S252S|RP11-845M18.6_ENST00000552441.1_RNA|KRT86_ENST00000293525.5_Silent_p.S252S			O43790	KRT86_HUMAN	keratin 86	252	Coil 1B.|Rod.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|cervix(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	10				BRCA - Breast invasive adenocarcinoma(357;0.189)		TTCTCCAGTCCCACATCTCAG	0.557																																						.											0													150.0	129.0	136.0					12																	52699044		2203	4300	6503	SO:0001819	synonymous_variant	3892			X99142	CCDS41785.1	12q13	2013-01-16	2006-07-17	2006-07-17		ENSG00000170442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6463	protein-coding gene	gene with protein product	"""hard keratin type II 6"""	601928	"""keratin, hair, basic, 6 (monilethrix)"""	KRTHB6		9241275, 16831889	Standard	NM_002284		Approved	MNX, Hb6	uc001sad.3	O43790		ENST00000423955.2:c.756C>G	12.37:g.52699044C>G		Somatic		WXS	Illumina HiSeq	Phase_I	P78387	Silent	SNP	ENST00000423955.2	37	CCDS41785.1																																																																																				0.557	KRT86-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404911.1	NM_002284	
KRTAP5-5	439915	mdanderson.org	37	11	1651645	1651645	+	Missense_Mutation	SNP	A	A	G	rs77039648		TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr11:1651645A>G	ENST00000399676.2	+	1	613	c.575A>G	c.(574-576)tAc>tGc	p.Y192C		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	192	8 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		TGTAAGCCCTACTGCTGCCAG	0.602																																						.											0													78.0	86.0	83.0					11																	1651645		2200	4299	6499	SO:0001583	missense	439915			AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.575A>G	11.37:g.1651645A>G	ENSP00000382584:p.Tyr192Cys	Somatic		WXS	Illumina HiSeq	Phase_I	A8MWN2	Missense_Mutation	SNP	ENST00000399676.2	37	CCDS41592.1	.	.	.	.	.	.	.	.	.	.	a	0.016	-1.537048	0.00942	.	.	ENSG00000185940	ENST00000399676;ENST00000422553	T	0.01323	5.01	2.94	0.953	0.19590	.	.	.	.	.	T	0.00468	0.0015	N	0.00186	-1.895	0.58432	P	4.000000000004E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.42413	-0.9453	8	0.37606	T	0.19	.	4.0328	0.09716	0.1469:0.2455:0.6076:0.0	.	192	Q701N2	KRA55_HUMAN	C	192;163	ENSP00000382584:Y192C	ENSP00000382584:Y192C	Y	+	2	0	KRTAP5-5	1608221	0.002000	0.14202	0.035000	0.18076	0.003000	0.03518	0.006000	0.13152	0.009000	0.14813	-1.591000	0.00844	TAC		0.602	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127919.1		
MAML2	84441	mdanderson.org	37	11	95825362	95825362	+	Silent	SNP	C	C	T			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr11:95825362C>T	ENST00000524717.1	-	2	3117	c.1833G>A	c.(1831-1833)caG>caA	p.Q611Q		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	611					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.Q611Q(2)	CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gctgttgctgctgctgctgct	0.542			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																	.		Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	2	Substitution - coding silent(2)	endometrium(1)|kidney(1)											39.0	44.0	42.0					11																	95825362		2057	4042	6099	SO:0001819	synonymous_variant	84441			AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1833G>A	11.37:g.95825362C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Silent	SNP	ENST00000524717.1	37	CCDS44714.1																																																																																				0.542	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1		
MUC4	4585	mdanderson.org	37	3	195507093	195507093	+	Silent	SNP	G	G	A			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr3:195507093G>A	ENST00000463781.3	-	2	11817	c.11358C>T	c.(11356-11358)tcC>tcT	p.S3786S	MUC4_ENST00000475231.1_Silent_p.S3786S|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGTCACCTGTGGATGCTGAGG	0.597																																						.											0													9.0	9.0	9.0					3																	195507093		641	1526	2167	SO:0001819	synonymous_variant	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11358C>T	3.37:g.195507093G>A		Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																				0.597	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC7	4589	mdanderson.org	37	4	71347116	71347116	+	Missense_Mutation	SNP	C	C	T	rs41454651	byFrequency	TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr4:71347116C>T	ENST00000304887.5	+	3	845	c.655C>T	c.(655-657)Cct>Tct	p.P219S	MUC7_ENST00000413702.1_Missense_Mutation_p.P219S|MUC7_ENST00000456088.1_Missense_Mutation_p.P219S	NM_152291.2	NP_689504.2	Q8TAX7	MUC7_HUMAN	mucin 7, secreted	219	Thr-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(2)|lung(23)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	42			Lung(101;0.211)			ACCCACACCTCCTGCAACTAC	0.587																																						.											0													446.0	385.0	406.0					4																	71347116		2201	4300	6501	SO:0001583	missense	4589			BC025688	CCDS3541.1	4q13.3	2008-02-05	2006-03-14		ENSG00000171195	ENSG00000171195		"""Mucins"""	7518	protein-coding gene	gene with protein product		158375	"""mucin 7, salivary"""			8838308	Standard	NM_152291		Approved	FLJ27047, MG2	uc003hfj.3	Q8TAX7	OTTHUMG00000129916	ENST00000304887.5:c.655C>T	4.37:g.71347116C>T	ENSP00000302021:p.Pro219Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q9UCD7|Q9UCD8	Missense_Mutation	SNP	ENST00000304887.5	37	CCDS3541.1	.	.	.	.	.	.	.	.	.	.	T	0.003	-2.401533	0.00195	.	.	ENSG00000171195	ENST00000413702;ENST00000456088;ENST00000304887	T;T;T	0.64085	-0.08;-0.08;-0.08	1.9	-3.8	0.04307	.	.	.	.	.	T	0.27134	0.0665	N	0.02539	-0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.09640	-1.0665	8	.	.	.	.	4.2434	0.10660	0.4479:0.3631:0.0:0.189	rs41454651	219	Q8TAX7	MUC7_HUMAN	S	219	ENSP00000407422:P219S;ENSP00000400585:P219S;ENSP00000302021:P219S	.	P	+	1	0	MUC7	71381705	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.309000	0.00517	-2.323000	0.00639	-1.216000	0.01612	CCT		0.587	MUC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252168.2	NM_152291	
PRB2	653247	mdanderson.org	37	12	11546495	11546495	+	Missense_Mutation	SNP	A	A	C	rs567948307	byFrequency	TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr12:11546495A>C	ENST00000389362.4	-	3	552	c.517T>G	c.(517-519)Tct>Gct	p.S173A	PRB2_ENST00000545829.1_5'Flank|PRB1_ENST00000546254.1_Intron	NM_006248.3	NP_006239.3	P02812	PRB2_HUMAN	proline-rich protein BstNI subfamily 2	173	15 X 20 AA approximate tandem repeats of P-P-G-K-P-Q-G-P-P-P-Q-G-[GD]-[NKS]-[KSQ]- [PRS]-[QRS] [GPS]-[PSAR]-[PSR].					extracellular region (GO:0005576)				NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(5)|skin(4)|stomach(2)|urinary_tract(1)	37		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			GGAGATCGAGAACTTCGGGAC	0.607																																						.											0													276.0	256.0	263.0					12																	11546495		2200	4299	6499	SO:0001583	missense	653247			K03208	CCDS41757.2	12p13.2	2012-10-02			ENSG00000121335	ENSG00000121335			9338	protein-coding gene	gene with protein product		168810				8554050	Standard	NM_006248		Approved	PRPPRB1, Ps, cP7	uc010shk.1	P02812	OTTHUMG00000156975	ENST00000389362.4:c.517T>G	12.37:g.11546495A>C	ENSP00000374013:p.Ser173Ala	Somatic		WXS	Illumina HiSeq	Phase_I	O00599|P02811|P04281	Missense_Mutation	SNP	ENST00000389362.4	37	CCDS41757.2	.	.	.	.	.	.	.	.	.	.	.	0.015	-1.550172	0.00926	.	.	ENSG00000121335	ENST00000389362	T	0.04083	3.71	1.07	-1.34	0.09143	.	0.224686	0.18466	U	0.140380	T	0.01627	0.0052	N	0.08118	0	0.09310	N	1	B	0.31893	0.345	B	0.25291	0.059	T	0.46884	-0.9159	10	0.07175	T	0.84	.	5.5822	0.17256	0.2598:0.0:0.7402:0.0	.	173	P02812	PRB2_HUMAN	A	173	ENSP00000374013:S173A	ENSP00000374013:S173A	S	-	1	0	PRB2	11437762	0.000000	0.05858	0.002000	0.10522	0.154000	0.21943	-5.737000	0.00101	-0.425000	0.07371	0.092000	0.15492	TCT		0.607	PRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346925.2	NM_006248	
RGPD3	653489	mdanderson.org	37	2	107049681	107049681	+	Missense_Mutation	SNP	T	T	C	rs369310197		TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr2:107049681T>C	ENST00000409886.3	-	16	2353	c.2266A>G	c.(2266-2268)Aac>Gac	p.N756D	RGPD3_ENST00000304514.7_Missense_Mutation_p.N756D	NM_001144013.1	NP_001137485.1	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	756					protein targeting to Golgi (GO:0000042)			p.N756D(6)		breast(2)|central_nervous_system(1)|endometrium(50)|kidney(4)|lung(11)|ovary(1)|urinary_tract(2)	71						TCACTATAGTTTTCGAGTTCC	0.373																																						.											6	Substitution - Missense(6)	endometrium(6)											164.0	133.0	142.0					2																	107049681		692	1590	2282	SO:0001583	missense	653489				CCDS46379.1	2q12.2	2013-01-10			ENSG00000153165	ENSG00000153165		"""Tetratricopeptide (TTC) repeat domain containing"""	32416	protein-coding gene	gene with protein product		612706				15710750, 15815621	Standard	NM_001144013		Approved	RGP3	uc010ywi.1	A6NKT7	OTTHUMG00000153182	ENST00000409886.3:c.2266A>G	2.37:g.107049681T>C	ENSP00000386588:p.Asn756Asp	Somatic		WXS	Illumina HiSeq	Phase_I	B8ZZM4	Missense_Mutation	SNP	ENST00000409886.3	37	CCDS46379.1	.	.	.	.	.	.	.	.	.	.	.	0.003	-2.481585	0.00163	.	.	ENSG00000153165	ENST00000409886;ENST00000452099;ENST00000304514	T;T	0.23754	1.89;1.89	2.34	2.34	0.29019	.	.	.	.	.	T	0.07638	0.0192	N	0.02011	-0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.37979	-0.9682	9	0.02654	T	1	-2.2547	7.1228	0.25454	0.0:0.8499:0.0:0.1501	.	756	A6NKT7	RGPD3_HUMAN	D	756;514;756	ENSP00000386588:N756D;ENSP00000303659:N756D	ENSP00000303659:N756D	N	-	1	0	RGPD3	106416113	0.974000	0.33945	0.242000	0.24170	0.003000	0.03518	4.107000	0.57811	0.325000	0.23359	-1.206000	0.01644	AAC		0.373	RGPD3-002	KNOWN	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000329975.1	XM_929931	
USP32	84669	mdanderson.org	37	17	58289415	58289415	+	Missense_Mutation	SNP	C	C	A	rs199769573		TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr17:58289415C>A	ENST00000300896.4	-	19	2343	c.2149G>T	c.(2149-2151)Gca>Tca	p.A717S	USP32_ENST00000592339.1_Missense_Mutation_p.A387S	NM_032582.3	NP_115971.2	Q8NFA0	UBP32_HUMAN	ubiquitin specific peptidase 32	717					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			NS(3)|breast(5)|endometrium(5)|kidney(4)|large_intestine(12)|liver(1)|lung(24)|pancreas(1)|prostate(3)|skin(3)|urinary_tract(1)	62	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;2.02e-11)|all cancers(12;5.23e-10)|Colorectal(3;0.198)			CTACTATTTGCTATAAAAGAC	0.303																																						.											0													84.0	82.0	83.0					17																	58289415		2203	4297	6500	SO:0001583	missense	84669			AF533230	CCDS32697.1	17q23.3	2013-01-10	2005-08-08		ENSG00000170832	ENSG00000170832		"""Ubiquitin-specific peptidases"", ""EF-hand domain containing"""	19143	protein-coding gene	gene with protein product		607740	"""ubiquitin specific protease 32"""			12838346	Standard	NM_032582		Approved	NY-REN-60, USP10	uc002iyo.1	Q8NFA0		ENST00000300896.4:c.2149G>T	17.37:g.58289415C>A	ENSP00000300896:p.Ala717Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q7Z5T3|Q9BX85|Q9Y591	Missense_Mutation	SNP	ENST00000300896.4	37	CCDS32697.1	63	0.028846153846153848	10	0.02032520325203252	7	0.019337016574585635	18	0.03146853146853147	28	0.036939313984168866	C	31	5.097133	0.94197	.	.	ENSG00000170832	ENST00000300896	T	0.49720	0.77	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	T	0.30198	0.0757	M	0.61703	1.905	0.80722	D	1	D	0.67145	0.996	P	0.62649	0.905	T	0.44143	-0.9347	10	0.17369	T	0.5	.	18.5194	0.90947	0.0:1.0:0.0:0.0	.	717	Q8NFA0	UBP32_HUMAN	S	717	ENSP00000300896:A717S	ENSP00000300896:A717S	A	-	1	0	USP32	55644197	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.679000	0.84048	2.438000	0.82558	0.655000	0.94253	GCA		0.303	USP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449235.2	NM_032582	
VSX1	30813	mdanderson.org	37	20	25062342	25062342	+	Missense_Mutation	SNP	G	G	T	rs6050307	byFrequency	TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr20:25062342G>T	ENST00000376709.4	-	1	654	c.391C>A	c.(391-393)Cgc>Agc	p.R131S	VSX1_ENST00000429762.3_Missense_Mutation_p.R131S|VSX1_ENST00000444511.2_Missense_Mutation_p.R131S|VSX1_ENST00000424574.1_Missense_Mutation_p.R131S|VSX1_ENST00000376707.3_Missense_Mutation_p.R131S|VSX1_ENST00000451258.1_Missense_Mutation_p.R131S|VSX1_ENST00000398332.1_Missense_Mutation_p.R131S	NM_014588.5	NP_055403.2	Q9NZR4	VSX1_HUMAN	visual system homeobox 1	131			R -> S (in dbSNP:rs6050307). {ECO:0000269|PubMed:15051220}.		neuron maturation (GO:0042551)|response to stimulus (GO:0050896)|retinal bipolar neuron differentiation (GO:0060040)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(3)|lung(2)	6						CGCTTCTGGCGGCCGAGCGCA	0.741													G|||	206	0.0411342	0.1483	0.0144	5008	,	,		11176	0.0		0.0	False		,,,				2504	0.0					.											0								G	SER/ARG,SER/ARG	328,3228		8,312,1458	4.0	4.0	4.0		391,391	-3.9	0.0	20	dbSNP_114	4	13,6761		0,13,3374	yes	missense,missense	VSX1	NM_014588.4,NM_199425.1	110,110	8,325,4832	TT,TG,GG		0.1919,9.2238,3.3011	benign,benign	131/366,131/240	25062342	341,9989	1778	3387	5165	SO:0001583	missense	30813			AF176797	CCDS13168.1, CCDS13169.1, CCDS58766.1, CCDS58767.1	20p11.21	2014-02-14	2007-07-12		ENSG00000100987	ENSG00000100987		"""Homeoboxes / PRD class"""	12723	protein-coding gene	gene with protein product		605020	"""posterior polymorphous corneal dystrophy"", ""visual system homeobox 1 homolog, CHX10-like (zebrafish)"""	PPCD		10673340	Standard	NM_001256272		Approved	PPD, PPCD1	uc002wuf.4	Q9NZR4	OTTHUMG00000032111	ENST00000376709.4:c.391C>A	20.37:g.25062342G>T	ENSP00000365899:p.Arg131Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B9EGJ4|D1MF28|Q0GM60|Q0GM61|Q0GM62|Q0GM63|Q0GM64|Q0GM65|Q5TF40|Q5TF41|Q9HCU3|Q9NU27	Missense_Mutation	SNP	ENST00000376709.4	37	CCDS13168.1	90	0.04120879120879121	82	0.16666666666666666	8	0.022099447513812154	0	0.0	0	0.0	G	3.761	-0.049660	0.07407	0.092238	0.001919	ENSG00000100987	ENST00000429762;ENST00000444511;ENST00000424574;ENST00000451258;ENST00000376709;ENST00000376707;ENST00000398332	D;D;D;D;D;D;T	0.91792	-2.73;-2.91;-2.72;-2.77;-2.82;-2.83;-0.0	4.14	-3.91	0.04168	.	1.617690	0.02904	N	0.135773	T	0.00412	0.0013	N	0.00926	-1.1	0.80722	P	0.0	B;B;B;B	0.09022	0.001;0.0;0.002;0.0	B;B;B;B	0.06405	0.001;0.002;0.001;0.001	T	0.56992	-0.7887	9	0.06625	T	0.88	.	0.1523	0.00094	0.3252:0.149:0.2095:0.3163	rs6050307;rs61429181	131;131;131;131	Q9NZR4-7;Q9NZR4-8;Q9NZR4-2;Q9NZR4	.;.;.;VSX1_HUMAN	S	131	ENSP00000401690:R131S;ENSP00000387720:R131S;ENSP00000399496:R131S;ENSP00000389654:R131S;ENSP00000365899:R131S;ENSP00000365897:R131S;ENSP00000381376:R131S	ENSP00000365897:R131S	R	-	1	0	VSX1	25010342	0.000000	0.05858	0.000000	0.03702	0.543000	0.35085	-0.882000	0.04174	-0.591000	0.05859	0.563000	0.77884	CGC		0.741	VSX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078384.3		
CALHM2	51063	bcgsc.ca	37	10	105209398	105209398	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr10:105209398G>A	ENST00000260743.5	-	3	824	c.301C>T	c.(301-303)Ctc>Ttc	p.L101F	CALHM2_ENST00000494180.1_5'UTR|CALHM2_ENST00000393235.1_Missense_Mutation_p.L101F|RP11-225H22.7_ENST00000608063.1_RNA|CALHM2_ENST00000369788.3_Missense_Mutation_p.L101F	NM_015916.4	NP_057000.2	Q9HA72	CAHM2_HUMAN	calcium homeostasis modulator 2	101					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(5)|skin(1)	11						CTTAGAAGGAGGAAGGTGGGG	0.602																																						.											0													76.0	75.0	76.0					10																	105209398		2203	4300	6503	SO:0001583	missense	51063			BC000039	CCDS7549.1	10q24.33	2008-07-02	2008-07-02	2008-07-02	ENSG00000138172	ENSG00000138172			23493	protein-coding gene	gene with protein product		612235	"""family with sequence similarity 26, member B"""	FAM26B		18585350	Standard	NM_015916		Approved		uc001kxa.3	Q9HA72	OTTHUMG00000018990	ENST00000260743.5:c.301C>T	10.37:g.105209398G>A	ENSP00000260743:p.Leu101Phe	Somatic		WXS	Illumina HiSeq	Phase_I	D3DR94|O95893|Q6ZUV9	Missense_Mutation	SNP	ENST00000260743.5	37	CCDS7549.1	.	.	.	.	.	.	.	.	.	.	G	18.43	3.622214	0.66787	.	.	ENSG00000138172	ENST00000369788;ENST00000260743;ENST00000393235	T;T;T	0.18810	2.19;2.19;2.19	5.31	5.31	0.75309	.	0.147583	0.44285	D	0.000467	T	0.27697	0.0681	L	0.32530	0.975	0.44323	D	0.997208	D;D;B	0.71674	0.998;0.993;0.081	D;P;B	0.69142	0.962;0.857;0.061	T	0.04650	-1.0936	10	0.09843	T	0.71	-21.218	9.6544	0.39917	0.1548:0.0:0.8452:0.0	.	101;101;101	Q9HA72-2;Q9HA72-3;Q9HA72	.;.;CAHM2_HUMAN	F	101	ENSP00000358803:L101F;ENSP00000260743:L101F;ENSP00000376927:L101F	ENSP00000260743:L101F	L	-	1	0	CALHM2	105199388	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	2.876000	0.48498	2.474000	0.83562	0.561000	0.74099	CTC		0.602	CALHM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050159.1	NM_015916	
TP53	7157	bcgsc.ca	37	17	7578370	7578370	+	Splice_Site	SNP	C	C	A			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr17:7578370C>A	ENST00000269305.4	-	5	749		c.e5+1		TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000574684.1_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(54)|p.0?(8)|p.G187fs*16(2)|p.D186_P191delDGLAPP(1)|p.L188fs*19(1)|p.G187_L188delGL(1)|p.G187fs*22(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAGCTGCTCACCATCGCTATC	0.632		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	68	Unknown(54)|Whole gene deletion(8)|Deletion - Frameshift(3)|Deletion - In frame(2)|Insertion - Frameshift(1)	lung(12)|breast(9)|oesophagus(7)|ovary(7)|liver(7)|urinary_tract(5)|NS(5)|haematopoietic_and_lymphoid_tissue(4)|bone(4)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(2)|stomach(1)|soft_tissue(1)											48.0	46.0	47.0					17																	7578370		2203	4300	6503	SO:0001630	splice_region_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.559+1G>T	17.37:g.7578370C>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	11.69	1.713974	0.30413	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	4.7	3.7	0.42460	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.0738	0.59075	0.0:0.8363:0.1637:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7519095	1.000000	0.71417	0.967000	0.41034	0.201000	0.24016	3.085000	0.50151	1.248000	0.43934	0.655000	0.94253	.		0.632	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	Intron
BPTF	2186	bcgsc.ca	37	17	65907097	65907097	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr17:65907097A>G	ENST00000321892.4	+	13	3536	c.3475A>G	c.(3475-3477)Agt>Ggt	p.S1159G	BPTF_ENST00000424123.3_Missense_Mutation_p.S1020G|BPTF_ENST00000335221.5_Missense_Mutation_p.S1159G|BPTF_ENST00000306378.6_Missense_Mutation_p.S1033G			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	1159					anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			TTGTCAGGAGAGTTCTCAAGT	0.383																																						.											0													93.0	90.0	91.0					17																	65907097		2203	4300	6503	SO:0001583	missense	2186			AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.3475A>G	17.37:g.65907097A>G	ENSP00000315454:p.Ser1159Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q6NX67|Q7Z7D6|Q9UIG2	Missense_Mutation	SNP	ENST00000321892.4	37		.	.	.	.	.	.	.	.	.	.	A	5.510	0.279120	0.10458	.	.	ENSG00000171634	ENST00000306378;ENST00000335221;ENST00000321892	T;T;T	0.62941	0.0;-0.01;-0.0	5.64	0.846	0.18955	.	.	.	.	.	T	0.44582	0.1300	L	0.27053	0.805	0.09310	N	1	B;B	0.11235	0.003;0.004	B;B	0.11329	0.006;0.004	T	0.28267	-1.0049	9	0.38643	T	0.18	0.0342	6.1773	0.20451	0.6778:0.1243:0.1979:0.0	.	1033;1159	Q12830-2;Q12830-4	.;.	G	1033;1159;1159	ENSP00000307208:S1033G;ENSP00000334351:S1159G;ENSP00000315454:S1159G	ENSP00000307208:S1033G	S	+	1	0	BPTF	63337559	0.009000	0.17119	0.008000	0.14137	0.504000	0.33889	0.642000	0.24735	-0.070000	0.12908	0.528000	0.53228	AGT		0.383	BPTF-201	KNOWN	basic	protein_coding	protein_coding		NM_182641, NM_004459	
FRG1B	284802	bcgsc.ca	37	20	29628398	29628398	+	Intron	SNP	G	G	A			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr20:29628398G>A	ENST00000278882.3	+	6	713				FRG1B_ENST00000358464.4_Intron|FRG1B_ENST00000439954.2_Missense_Mutation_p.M117I			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B											endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TCTTTAAAATGTTAAGTCATC	0.299																																						.											0																																										SO:0001627	intron_variant	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.333+67G>A	20.37:g.29628398G>A		Somatic		WXS	Illumina HiSeq	Phase_I	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	g	0.005	-2.123639	0.00346	.	.	ENSG00000149531	ENST00000439954	T	0.32515	1.45	1.75	-1.99	0.07457	.	.	.	.	.	T	0.09379	0.0231	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.34825	-0.9813	6	0.02654	T	1	.	5.8283	0.18566	0.5261:0.0:0.4739:0.0	.	.	.	.	I	117	ENSP00000408863:M117I	ENSP00000408863:M117I	M	+	3	0	FRG1B	28242059	0.000000	0.05858	0.014000	0.15608	0.062000	0.15995	-0.453000	0.06778	-0.482000	0.06782	0.184000	0.17185	ATG		0.299	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
HLA-DRB1	3123	bcgsc.ca	37	6	32551957	32551958	+	Missense_Mutation	DNP	GC	GC	CT	rs200320734|rs1064592|rs568948309|rs9269942	byFrequency	TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr6:32551957_32551958GC>CT	ENST00000360004.5	-	2	403_404	c.298_299GC>AG	c.(298-300)GCg>AGg	p.A100R		NM_002124.3	NP_002115.2	Q30167	2B1A_HUMAN	major histocompatibility complex, class II, DR beta 1	100	Beta-1.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)				large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(2)|stomach(1)	10						CGCGGCCCGCGCCTGCTCCAGG	0.678										Multiple Myeloma(14;0.17)																												.											0																																										SO:0001583	missense	3123			AJ297583	CCDS47409.1	6p21.3	2013-01-11			ENSG00000196126	ENSG00000196126		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4948	protein-coding gene	gene with protein product		142857		HLA-DR1B			Standard	NM_001243965		Approved		uc011eri.2	P01911	OTTHUMG00000031196	ENST00000360004.5:c.298_299delinsCT	6.37:g.32551957_32551958delinsCT	ENSP00000353099:p.Ala100Arg	Somatic		WXS	Illumina HiSeq	Phase_I	P01914|Q9MYF5	Missense_Mutation	SNP	ENST00000360004.5	37	CCDS47409.1																																																																																				0.678	HLA-DRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076393.3	NM_002124	
PCMTD1	115294	bcgsc.ca	37	8	52733191	52733191	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8337-01A-11D-2310-10	TCGA-KL-8337-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a3fd2ee0-3dd0-4992-9a9f-75e487b43441	48a0412d-0d33-43a8-9079-ccd5b28bef22	g.chr8:52733191G>A	ENST00000360540.5	-	7	1200	c.794C>T	c.(793-795)gCc>gTc	p.A265V	PCMTD1_ENST00000544451.1_Missense_Mutation_p.A189V|PCMTD1_ENST00000522514.1_Missense_Mutation_p.A265V|PCMTD1_ENST00000519559.1_5'UTR	NM_052937.2	NP_443169.2	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1	265						cytoplasm (GO:0005737)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)			NS(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(17)|prostate(2)|skin(8)|soft_tissue(1)	37		Lung NSC(129;0.0795)|all_lung(136;0.144)				AATCCCCTTGGCCTGCATCTC	0.413																																						.											0													100.0	104.0	103.0					8																	52733191		2203	4297	6500	SO:0001583	missense	115294				CCDS6148.1, CCDS69480.1	8q11.23	2010-08-05			ENSG00000168300	ENSG00000168300			30483	protein-coding gene	gene with protein product							Standard	XM_005251146		Approved	FLJ10883	uc003xqx.4	Q96MG8	OTTHUMG00000164246	ENST00000360540.5:c.794C>T	8.37:g.52733191G>A	ENSP00000353739:p.Ala265Val	Somatic		WXS	Illumina HiSeq	Phase_I	Q96FK9	Missense_Mutation	SNP	ENST00000360540.5	37	CCDS6148.1	.	.	.	.	.	.	.	.	.	.	G	17.94	3.511582	0.64522	.	.	ENSG00000168300	ENST00000360540;ENST00000544451;ENST00000522514	T;T;T	0.40476	1.03;1.03;1.03	5.77	5.77	0.91146	.	0.057264	0.64402	D	0.000002	T	0.56702	0.2003	L	0.44542	1.39	0.52501	D	0.999951	P;D;B	0.71674	0.791;0.998;0.012	B;D;B	0.65684	0.272;0.937;0.011	T	0.43410	-0.9393	10	0.26408	T	0.33	-28.5971	19.9832	0.97338	0.0:0.0:1.0:0.0	.	135;189;265	B4E2B4;F5H1M8;Q96MG8	.;.;PCMD1_HUMAN	V	265;189;265	ENSP00000353739:A265V;ENSP00000444026:A189V;ENSP00000428099:A265V	ENSP00000353739:A265V	A	-	2	0	PCMTD1	52895744	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.494000	0.60347	2.722000	0.93159	0.655000	0.94253	GCC		0.413	PCMTD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377909.2	NM_052937	
