#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
VAV3	10451	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	108303461	108303461	+	Missense_Mutation	SNP	C	C	T	rs139065569		TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr1:108303461C>T	ENST00000370056.4	-	10	1236	c.962G>A	c.(961-963)cGa>cAa	p.R321Q	VAV3_ENST00000371846.4_Missense_Mutation_p.R256Q|VAV3_ENST00000527011.1_Missense_Mutation_p.R321Q|VAV3_ENST00000343258.4_5'UTR	NM_006113.4	NP_006104.4	Q9UKW4	VAV3_HUMAN	vav 3 guanine nucleotide exchange factor	321	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular response to DNA damage stimulus (GO:0006974)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell adhesion (GO:0045785)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of signal transduction (GO:0009967)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|vesicle fusion (GO:0006906)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|SH3/SH2 adaptor activity (GO:0005070)			NS(2)|breast(5)|endometrium(4)|kidney(2)|large_intestine(14)|lung(20)|ovary(6)|prostate(3)|stomach(1)|urinary_tract(1)	58		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)		AAGCAAGTCTCGAAGAGTAAA	0.333																																						.											0								C	GLN/ARG	0,4406		0,0,2203	93.0	81.0	85.0		962	5.7	1.0	1	dbSNP_134	85	1,8597	1.2+/-3.3	0,1,4298	no	missense	VAV3	NM_006113.4	43	0,1,6501	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	321/848	108303461	1,13003	2203	4299	6502	SO:0001583	missense	10451			AF118886	CCDS785.1, CCDS44181.1	1p13.3	2013-02-14	2007-07-25		ENSG00000134215	ENSG00000134215		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12659	protein-coding gene	gene with protein product		605541	"""vav 3 oncogene"""				Standard	NM_001079874		Approved		uc001dvk.1	Q9UKW4	OTTHUMG00000010995	ENST00000370056.4:c.962G>A	1.37:g.108303461C>T	ENSP00000359073:p.Arg321Gln	Somatic		WXS	Illumina HiSeq	Phase_I	B1AMM0|B1APV5|B4E232|B7ZLR1|E9PQ97|O60498|O95230|Q9Y5X8	Missense_Mutation	SNP	ENST00000370056.4	37	CCDS785.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.5|25.5	4.642639|4.642639	0.87859|0.87859	0.0|0.0	1.16E-4|1.16E-4	ENSG00000134215|ENSG00000134215	ENST00000490388|ENST00000370056;ENST00000527011;ENST00000371846	.|T;T;T	.|0.61980	.|0.06;0.06;0.06	5.66|5.66	5.66|5.66	0.87406|0.87406	.|Guanine-nucleotide dissociation stimulator, CDC24, conserved site (1);Dbl homology (DH) domain (5);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.68081|0.68081	0.2962|0.2962	L|L	0.45581|0.45581	1.43|1.43	0.80722|0.80722	D|D	1|1	.|P;D;D;D	.|0.89917	.|0.873;1.0;0.993;0.993	.|P;D;P;P	.|0.81914	.|0.515;0.995;0.621;0.734	T|T	0.60919|0.60919	-0.7167|-0.7167	5|10	.|0.25106	.|T	.|0.35	.|.	19.7509|19.7509	0.96268|0.96268	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|321;321;256;321	.|B7ZLR1;E9PQ97;B4DHL6;Q9UKW4	.|.;.;.;VAV3_HUMAN	K|Q	316|321;321;256	.|ENSP00000359073:R321Q;ENSP00000432540:R321Q;ENSP00000360912:R256Q	.|ENSP00000359073:R321Q	E|R	-|-	1|2	0|0	VAV3|VAV3	108104984|108104984	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	7.441000|7.441000	0.80485|0.80485	2.664000|2.664000	0.90586|0.90586	0.650000|0.650000	0.86243|0.86243	GAG|CGA		0.333	VAV3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030242.2	NM_006113	
METTL15	196074	broad.mit.edu;hgsc.bcm.edu	37	11	28232627	28232627	+	Frame_Shift_Del	DEL	T	T	-			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr11:28232627delT	ENST00000407364.3	+	4	641	c.289delT	c.(289-291)tttfs	p.F97fs	METTL15_ENST00000406787.3_Frame_Shift_Del_p.F97fs|METTL15_ENST00000342303.5_Frame_Shift_Del_p.F97fs|METTL15_ENST00000303459.6_Frame_Shift_Del_p.F97fs			A6NJ78	MET15_HUMAN	methyltransferase like 15	97							methyltransferase activity (GO:0008168)			NS(1)|breast(1)|endometrium(4)|large_intestine(2)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	14						AGATATGACATTTGGTTCGGG	0.373																																						.											0													82.0	76.0	78.0					11																	28232627		2202	4298	6500	SO:0001589	frameshift_variant	196074			AL832668	CCDS31450.1, CCDS44559.1, CCDS73269.1	11p14.1	2011-03-02	2011-03-02	2011-03-02	ENSG00000169519	ENSG00000169519			26606	protein-coding gene	gene with protein product			"""methyltransferase 5 domain containing 1"""	METT5D1		12477932	Standard	NM_152636		Approved	FLJ33979	uc001msh.2	A6NJ78	OTTHUMG00000150448	ENST00000407364.3:c.289delT	11.37:g.28232627delT	ENSP00000384369:p.Phe97fs	Somatic		WXS	Illumina HiSeq	Phase_I	A8MRS5|B7WNU2|Q3MHD3|Q8N601|Q8NBA7	Frame_Shift_Del	DEL	ENST00000407364.3	37	CCDS44559.1																																																																																				0.373	METTL15-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318135.2	NM_152636	
ATAD3C	219293	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	1	1391260	1391260	+	Silent	SNP	C	C	T	rs569952968		TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr1:1391260C>T	ENST00000378785.2	+	6	1523	c.528C>T	c.(526-528)taC>taT	p.Y176Y		NM_001039211.2	NP_001034300.2	Q5T2N8	ATD3C_HUMAN	ATPase family, AAA domain containing 3C	176							ATP binding (GO:0005524)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|lung(4)	7	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		TCCTGCTGTACGGGCCACCAG	0.627													c|||	1	0.000199681	0.0008	0.0	5008	,	,		19249	0.0		0.0	False		,,,				2504	0.0					.											0													79.0	87.0	84.0					1																	1391260		692	1591	2283	SO:0001819	synonymous_variant	219293			AK091918	CCDS44039.1	1p36.33	2010-04-21		2007-02-08	ENSG00000215915	ENSG00000215915		"""ATPases / AAA-type"""	32151	protein-coding gene	gene with protein product							Standard	NM_001039211		Approved	FLJ34599	uc001aft.2	Q5T2N8	OTTHUMG00000000531	ENST00000378785.2:c.528C>T	1.37:g.1391260C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q8N1Z5	Silent	SNP	ENST00000378785.2	37	CCDS44039.1																																																																																				0.627	ATAD3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001279.3	NM_001039211	
SCT	6343	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	11	626499	626499	+	Missense_Mutation	SNP	G	G	T			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr11:626499G>T	ENST00000176195.3	-	4	297	c.298C>A	c.(298-300)Ctg>Atg	p.L100M	CDHR5_ENST00000358353.3_5'Flank|CDHR5_ENST00000349570.7_5'Flank|CDHR5_ENST00000529337.1_5'Flank|CDHR5_ENST00000397542.2_5'Flank	NM_021920.2	NP_068739.1	P09683	SECR_HUMAN	secretin	100					dentate gyrus development (GO:0021542)|negative regulation of neuron apoptotic process (GO:0043524)|neuronal stem cell maintenance (GO:0097150)|pancreatic juice secretion (GO:0030157)|visual learning (GO:0008542)	extracellular region (GO:0005576)	hormone activity (GO:0005179)						all_cancers(49;1.69e-08)|all_epithelial(84;1.65e-05)|Breast(177;0.000231)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;1.17e-27)|Epithelial(43;7.44e-27)|OV - Ovarian serous cystadenocarcinoma(40;3.53e-21)|BRCA - Breast invasive adenocarcinoma(625;6.96e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CCAGGGGGCAGCCAGGGAGAC	0.677																																						.											0													22.0	20.0	21.0					11																	626499		2188	4273	6461	SO:0001583	missense	6343			AF244355	CCDS7709.1	11p15.5	2013-02-28			ENSG00000070031	ENSG00000070031		"""Endogenous ligands"""	10607	protein-coding gene	gene with protein product	"""prepro-secretin"""	182099				2315322	Standard	NM_021920		Approved		uc001lqo.1	P09683	OTTHUMG00000133313	ENST00000176195.3:c.298C>A	11.37:g.626499G>T	ENSP00000176195:p.Leu100Met	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000176195.3	37	CCDS7709.1	.	.	.	.	.	.	.	.	.	.	G	15.38	2.815434	0.50527	.	.	ENSG00000070031	ENST00000176195	T	0.61040	0.14	2.31	1.37	0.22104	.	.	.	.	.	T	0.46776	0.1410	L	0.29908	0.895	0.09310	N	1	D	0.55385	0.971	P	0.47299	0.543	T	0.30149	-0.9988	9	0.46703	T	0.11	.	6.9028	0.24293	0.0:0.2901:0.7099:0.0	.	100	P09683	SECR_HUMAN	M	100	ENSP00000176195:L100M	ENSP00000176195:L100M	L	-	1	2	SCT	616499	0.997000	0.39634	0.007000	0.13788	0.642000	0.38348	2.170000	0.42443	0.557000	0.29117	0.555000	0.69702	CTG		0.677	SCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257111.3	NM_021920	
PDZRN4	29951	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	12	41967467	41967467	+	Missense_Mutation	SNP	C	C	A			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr12:41967467C>A	ENST00000402685.2	+	10	2894	c.2886C>A	c.(2884-2886)ttC>ttA	p.F962L	PDZRN4_ENST00000539469.2_Missense_Mutation_p.F704L|PDZRN4_ENST00000298919.7_Missense_Mutation_p.F702L	NM_001164595.1	NP_001158067.1	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing ring finger 4	962							ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	77	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				GCCGTGAGTTCATGATGCGAA	0.517																																						.											0													75.0	70.0	71.0					12																	41967467		2203	4300	6503	SO:0001583	missense	29951			AK094690	CCDS8739.1, CCDS53777.1	12q12	2008-08-14	2008-08-14			ENSG00000165966		"""RING-type (C3HC4) zinc fingers"""	30552	protein-coding gene	gene with protein product	"""similar to semaF cytoplasmic domain associated protein 3"""	609730				11230166, 15010864	Standard	NM_013377		Approved	DKFZp434B0417, LNX4, FLJ33777, IMAGE5767589	uc010skn.2	Q6ZMN7		ENST00000402685.2:c.2886C>A	12.37:g.41967467C>A	ENSP00000384197:p.Phe962Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q52LY3|Q52LY4|Q6N052|Q8IUU1|Q9NTP7	Missense_Mutation	SNP	ENST00000402685.2	37	CCDS53777.1	.	.	.	.	.	.	.	.	.	.	C	12.06	1.825721	0.32237	.	.	ENSG00000165966	ENST00000402685;ENST00000539469;ENST00000298919	T;T;T	0.39229	1.09;1.09;1.09	4.9	4.9	0.64082	.	0.067180	0.64402	D	0.000007	T	0.41213	0.1149	L	0.35487	1.065	0.58432	D	0.999999	P;B;B	0.46220	0.874;0.045;0.045	P;B;B	0.45119	0.47;0.061;0.075	T	0.32824	-0.9892	10	0.49607	T	0.09	-20.3562	18.9769	0.92740	0.0:1.0:0.0:0.0	.	962;702;704	Q6ZMN7;Q6ZMN7-4;Q6ZMN7-2	PZRN4_HUMAN;.;.	L	962;704;702	ENSP00000384197:F962L;ENSP00000439990:F704L;ENSP00000298919:F702L	ENSP00000298919:F702L	F	+	3	2	PDZRN4	40253734	1.000000	0.71417	1.000000	0.80357	0.358000	0.29455	3.234000	0.51320	2.656000	0.90262	0.557000	0.71058	TTC		0.517	PDZRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403701.1	NM_013377	
KRT1	3848	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	12	53073958	53073958	+	Missense_Mutation	SNP	C	C	G			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr12:53073958C>G	ENST00000252244.3	-	1	233	c.175G>C	c.(175-177)Ggt>Cgt	p.G59R		NM_006121.3	NP_006112.3	P04264	K2C1_HUMAN	keratin 1	59	Gly/Phe/Ser-rich.|Head.				complement activation, lectin pathway (GO:0001867)|establishment of skin barrier (GO:0061436)|fibrinolysis (GO:0042730)|negative regulation of inflammatory response (GO:0050728)|regulation of angiogenesis (GO:0045765)|response to oxidative stress (GO:0006979)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(7)|skin(3)	39						AATccaccaccagcaccaaag	0.557																																						.											0													153.0	152.0	153.0					12																	53073958		2202	4300	6502	SO:0001583	missense	3848			X69725	CCDS8836.1	12q13.13	2014-06-05	2008-08-01		ENSG00000167768	ENSG00000167768		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6412	protein-coding gene	gene with protein product		139350	"""epidermolytic hyperkeratosis 1"""	EHK1		2461420, 2470667, 16831889	Standard	NM_006121		Approved	KRT1A	uc001sau.1	P04264	OTTHUMG00000169749	ENST00000252244.3:c.175G>C	12.37:g.53073958C>G	ENSP00000252244:p.Gly59Arg	Somatic		WXS	Illumina HiSeq	Phase_I	B2RA01|P85925|P86104|Q14720|Q6GSJ0|Q9H298	Missense_Mutation	SNP	ENST00000252244.3	37	CCDS8836.1	.	.	.	.	.	.	.	.	.	.	C	3.038	-0.198146	0.06219	.	.	ENSG00000167768	ENST00000252244	D	0.96073	-3.9	3.52	1.64	0.23874	.	.	.	.	.	D	0.94235	0.8149	L	0.59436	1.845	0.25709	N	0.9855	D	0.54047	0.964	P	0.52672	0.706	D	0.86298	0.1678	9	0.24483	T	0.36	.	5.6488	0.17604	0.0:0.739:0.0:0.261	.	59	P04264	K2C1_HUMAN	R	59	ENSP00000252244:G59R	ENSP00000252244:G59R	G	-	1	0	KRT1	51360225	0.000000	0.05858	0.355000	0.25773	0.381000	0.30169	-0.526000	0.06207	0.318000	0.23185	0.491000	0.48974	GGT		0.557	KRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405706.1	NM_006121	
RASAL1	8437	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	12	113543595	113543595	+	Missense_Mutation	SNP	G	G	A	rs149732792		TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr12:113543595G>A	ENST00000261729.5	-	17	2066	c.1751C>T	c.(1750-1752)aCg>aTg	p.T584M	RASAL1_ENST00000418411.2_5'UTR|RASAL1_ENST00000548055.1_Missense_Mutation_p.T585M|RASAL1_ENST00000446861.3_Missense_Mutation_p.T584M|RASAL1_ENST00000546530.1_Missense_Mutation_p.T586M			O95294	RASL1_HUMAN	RAS protein activator like 1 (GAP1 like)	584	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	metal ion binding (GO:0046872)|phospholipid binding (GO:0005543)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(19)|ovary(3)|prostate(2)|skin(2)	43						GGCAAAGCGCGTGGCCAGGCC	0.627													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20842	0.0		0.0	False		,,,				2504	0.0					.											0								G	MET/THR,MET/THR,MET/THR	2,4404	4.2+/-10.8	0,2,2201	65.0	69.0	68.0		1757,1751,1751	5.4	0.5	12	dbSNP_134	68	0,8600		0,0,4300	no	missense,missense,missense	RASAL1	NM_001193520.1,NM_001193521.1,NM_004658.2	81,81,81	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	possibly-damaging,possibly-damaging,possibly-damaging	586/807,584/777,584/805	113543595	2,13004	2203	4300	6503	SO:0001583	missense	8437			AF086713	CCDS9165.1, CCDS55888.1, CCDS55889.1, CCDS73529.1	12q23-q24	2013-01-10			ENSG00000111344	ENSG00000111344		"""Pleckstrin homology (PH) domain containing"""	9873	protein-coding gene	gene with protein product		604118				9751798	Standard	NM_001193520		Approved	RASAL	uc001tul.3	O95294	OTTHUMG00000169705	ENST00000261729.5:c.1751C>T	12.37:g.113543595G>A	ENSP00000261729:p.Thr584Met	Somatic		WXS	Illumina HiSeq	Phase_I	B7ZKM4|C9JFK5|F8VQX1|Q52M03|Q59H24|Q96CC7	Missense_Mutation	SNP	ENST00000261729.5	37	CCDS9165.1	.	.	.	.	.	.	.	.	.	.	G	12.02	1.811715	0.32053	4.54E-4	0.0	ENSG00000111344	ENST00000546530;ENST00000261729;ENST00000446861;ENST00000548055	T;T;T;T	0.17370	2.28;2.28;2.28;2.28	5.36	5.36	0.76844	Rho GTPase activation protein (1);Pleckstrin homology-type (1);Pleckstrin homology domain (3);Ras GTPase-activating protein (1);	0.653207	0.16178	N	0.225974	T	0.22044	0.0531	N	0.21373	0.66	0.09310	N	0.999999	D;D;D;B;B;D	0.58970	0.982;0.98;0.984;0.132;0.16;0.98	P;P;P;B;B;P	0.54544	0.755;0.641;0.755;0.017;0.029;0.641	T	0.21245	-1.0251	10	0.16420	T	0.52	.	17.8471	0.88733	0.0:0.0:1.0:0.0	.	585;585;598;586;584;584	B4DG06;F8VRH9;Q59H24;F8VQX1;O95294;O95294-2	.;.;.;.;RASL1_HUMAN;.	M	586;584;584;585	ENSP00000450244:T586M;ENSP00000261729:T584M;ENSP00000395920:T584M;ENSP00000448510:T585M	ENSP00000261729:T584M	T	-	2	0	RASAL1	112027978	1.000000	0.71417	0.484000	0.27391	0.791000	0.44710	5.909000	0.69923	2.517000	0.84864	0.455000	0.32223	ACG		0.627	RASAL1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405522.2	NM_004658	
PABPN1	8106	hgsc.bcm.edu	37	14	23790864	23790864	+	Silent	SNP	G	G	A	rs188436762	byFrequency	TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr14:23790864G>A	ENST00000216727.4	+	1	367	c.186G>A	c.(184-186)ctG>ctA	p.L62L	PABPN1_ENST00000556821.1_5'UTR|AL049829.1_ENST00000594872.1_Missense_Mutation_p.P85L|BCL2L2-PABPN1_ENST00000557008.1_Intron|PABPN1_ENST00000397276.2_Silent_p.L62L|BCL2L2-PABPN1_ENST00000553781.1_Intron|PABPN1_ENST00000557702.1_5'Flank	NM_004643.3	NP_004634.1	Q86U42	PABP2_HUMAN	poly(A) binding protein, nuclear 1	62	Interacts with SKIP.				gene expression (GO:0010467)|modification by virus of host mRNA processing (GO:0046778)|modulation by virus of host morphology or physiology (GO:0019048)|modulation by virus of host process (GO:0019054)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|muscle contraction (GO:0006936)|poly(A)+ mRNA export from nucleus (GO:0016973)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)|viral life cycle (GO:0019058)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			large_intestine(1)|lung(1)|ovary(2)	4	all_cancers(95;6.69e-06)			GBM - Glioblastoma multiforme(265;0.00643)		AGCTGCTGCTGGAGCCCGAGC	0.801													G|||	74	0.0147764	0.0	0.0058	5008	,	,		4069	0.0		0.0219	False		,,,				2504	0.0491					.											0								G	,	7,2789		0,7,1391	2.0	2.0	2.0		,186	1.7	1.0	14		2	49,5451		0,49,2701	no	intron,coding-synonymous	PABPN1,BCL2L2-PABPN1	NM_001199864.1,NM_004643.3	,	0,56,4092	AA,AG,GG		0.8909,0.2504,0.675	,	,62/307	23790864	56,8240	1398	2750	4148	SO:0001819	synonymous_variant	8106			AF026029	CCDS9592.1	14q11.2	2013-02-12	2001-11-28		ENSG00000100836	ENSG00000100836		"""RNA binding motif (RRM) containing"""	8565	protein-coding gene	gene with protein product		602279	"""poly(A)-binding protein, nuclear 1"""	OPMD, PABP2		7795598	Standard	NM_004643		Approved	PAB2		Q86U42	OTTHUMG00000028739	ENST00000216727.4:c.186G>A	14.37:g.23790864G>A		Somatic		WXS	Illumina HiSeq	Phase_I	D3DS49|O43484	Silent	SNP	ENST00000216727.4	37	CCDS9592.1																																																																																				0.801	PABPN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071767.4	NM_004643	
ADCY4	196883	hgsc.bcm.edu;mdanderson.org	37	14	24788628	24788628	+	Silent	SNP	G	G	T			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr14:24788628G>T	ENST00000310677.4	-	23	2861	c.2748C>A	c.(2746-2748)ccC>ccA	p.P916P	ADCY4_ENST00000418030.2_Silent_p.P916P|ADCY4_ENST00000554068.2_Silent_p.P916P	NM_001198568.1|NM_001198592.1|NM_139247.3	NP_001185497.1|NP_001185521.1|NP_640340.2	Q8NFM4	ADCY4_HUMAN	adenylate cyclase 4	916					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(265;0.0192)		CACTGAACTTGGGCTTGGAGA	0.547																																						.											0													153.0	128.0	136.0					14																	24788628		2203	4300	6503	SO:0001819	synonymous_variant	196883			AF497516	CCDS9627.1	14q11.2	2013-02-04			ENSG00000129467	ENSG00000129467	4.6.1.1	"""Adenylate cyclases"""	235	protein-coding gene	gene with protein product		600292				7766992	Standard	NM_001198592		Approved	AC4	uc001woy.3	Q8NFM4	OTTHUMG00000029347	ENST00000310677.4:c.2748C>A	14.37:g.24788628G>T		Somatic		WXS	Illumina HiSeq	Phase_I	B3KV74|D3DS75|Q17R40|Q6ZTM6|Q96ML7	Silent	SNP	ENST00000310677.4	37	CCDS9627.1																																																																																				0.547	ADCY4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073200.4		
RNF167	26001	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	17	4845935	4845935	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr17:4845935C>T	ENST00000262482.6	+	5	1011	c.355C>T	c.(355-357)Ctt>Ttt	p.L119F	RNF167_ENST00000575111.1_Missense_Mutation_p.L119F|RNF167_ENST00000571816.1_Missense_Mutation_p.L119F|RNF167_ENST00000570492.1_3'UTR|RNF167_ENST00000572430.1_Missense_Mutation_p.L119F|SLC25A11_ENST00000544061.2_5'Flank|SLC25A11_ENST00000225665.7_5'Flank|RNF167_ENST00000576229.1_Missense_Mutation_p.L84F	NM_015528.1	NP_056343.1	Q9H6Y7	RN167_HUMAN	ring finger protein 167	119	PA.				negative regulation of cell cycle (GO:0045786)|protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)|lung(1)	4						TTCCAATGAACTTCTGAACAT	0.512																																						.											0													152.0	152.0	152.0					17																	4845935		2203	4300	6503	SO:0001583	missense	26001			AL050060	CCDS11060.1	17p13.3	2013-02-21			ENSG00000108523	ENSG00000108523		"""RING-type (C3HC4) zinc fingers"""	24544	protein-coding gene	gene with protein product		610431				23129617, 23353890	Standard	NM_015528		Approved	DKFZP566H073	uc002fzs.3	Q9H6Y7	OTTHUMG00000099397	ENST00000262482.6:c.355C>T	17.37:g.4845935C>T	ENSP00000262482:p.Leu119Phe	Somatic		WXS	Illumina HiSeq	Phase_I	D3DTK8|Q6XYE0|Q8NDC1|Q9Y3V1	Missense_Mutation	SNP	ENST00000262482.6	37	CCDS11060.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.158175	0.78114	.	.	ENSG00000108523	ENST00000262482	T	0.06608	3.28	5.91	5.91	0.95273	Protease-associated domain, PA (1);	0.000000	0.85682	D	0.000000	T	0.34600	0.0903	M	0.91510	3.215	0.53005	D	0.999963	D	0.76494	0.999	D	0.83275	0.996	T	0.19289	-1.0310	10	0.56958	D	0.05	-23.6247	17.7884	0.88545	0.0:1.0:0.0:0.0	.	119	Q9H6Y7	RN167_HUMAN	F	119	ENSP00000262482:L119F	ENSP00000262482:L119F	L	+	1	0	RNF167	4786680	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.819000	0.39022	2.804000	0.96469	0.462000	0.41574	CTT		0.512	RNF167-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216854.3	NM_015528	
TP53	7157	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	17	7577094	7577094	+	Missense_Mutation	SNP	G	G	A	rs28934574		TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr17:7577094G>A	ENST00000269305.4	-	8	1033	c.844C>T	c.(844-846)Cgg>Tgg	p.R282W	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.R282W|TP53_ENST00000445888.2_Missense_Mutation_p.R282W|TP53_ENST00000455263.2_Missense_Mutation_p.R282W|TP53_ENST00000359597.4_Missense_Mutation_p.R282W|TP53_ENST00000413465.2_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	282	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		DR -> EW (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in a sporadic cancer; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|Ref.22}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; dbSNP:rs28934574). {ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R282W(401)|p.R282G(29)|p.0?(8)|p.R282fs*24(4)|p.R282R(3)|p.?(2)|p.D281fs*63(2)|p.D281_R282>EW(2)|p.A276_R283delACPGRDRR(1)|p.D281_R282insXX(1)|p.C275fs*20(1)|p.R282_E287delRRTEEE(1)|p.L265_K305del41(1)|p.D281_R282delDR(1)|p.G279fs*59(1)|p.R280fs*62(1)|p.S269fs*21(1)|p.R282fs*63(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCTGTGCGCCGGTCTCTCCCA	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	463	Substitution - Missense(430)|Whole gene deletion(8)|Deletion - In frame(6)|Deletion - Frameshift(5)|Insertion - Frameshift(4)|Substitution - coding silent(3)|Unknown(2)|Complex - frameshift(2)|Complex - compound substitution(2)|Insertion - In frame(1)	large_intestine(136)|oesophagus(49)|upper_aerodigestive_tract(43)|stomach(33)|central_nervous_system(29)|breast(29)|lung(26)|ovary(21)|skin(20)|urinary_tract(16)|haematopoietic_and_lymphoid_tissue(16)|pancreas(10)|biliary_tract(5)|liver(5)|bone(5)|vulva(4)|prostate(4)|endometrium(3)|peritoneum(2)|thyroid(2)|NS(2)|autonomic_ganglia(1)|soft_tissue(1)|salivary_gland(1)	GRCh37	CM056413|CM920678	TP53	M	rs28934574	G	TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG	0,4406		0,0,2203	83.0	71.0	75.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	844,844,844,844,448,448,448	1.5	0.3	17	dbSNP_125	75	2,8598	2.2+/-6.3	1,0,4299	no	missense,missense,missense,missense,missense,missense,missense	TP53	NM_000546.4,NM_001126112.1,NM_001126113.1,NM_001126114.1,NM_001126115.1,NM_001126116.1,NM_001126117.1	101,101,101,101,101,101,101	1,0,6502	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	282/394,282/394,282/347,282/342,150/262,150/210,150/215	7577094	2,13004	2203	4300	6503	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.844C>T	17.37:g.7577094G>A	ENSP00000269305:p.Arg282Trp	Somatic		WXS	Illumina HiSeq	Phase_I	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.057525	0.76074	0.0	2.33E-4	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.75	1.49	0.22878	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99825	0.9922	M	0.89968	3.075	0.58432	A	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.998;1.0;0.999	D	0.97713	1.0192	9	0.87932	D	0	-12.0909	8.7508	0.34613	0.0:0.1376:0.5833:0.2792	rs28934574	282;282;282;282	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	W	282;282;282;282;282;271;150	ENSP00000352610:R282W;ENSP00000269305:R282W;ENSP00000398846:R282W;ENSP00000391127:R282W;ENSP00000391478:R282W;ENSP00000425104:R150W	ENSP00000269305:R282W	R	-	1	2	TP53	7517819	1.000000	0.71417	0.327000	0.25402	0.901000	0.52897	4.477000	0.60223	0.174000	0.19809	0.462000	0.41574	CGG		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
KIAA0100	9703	hgsc.bcm.edu;ucsc.edu	37	17	26941165	26941165	+	IGR	SNP	G	G	C			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr17:26941165G>C	ENST00000528896.2	-	0	7407				RP11-192H23.4_ENST00000534850.1_Missense_Mutation_p.S5R|SPAG5-AS1_ENST00000424210.1_RNA|KIAA0100_ENST00000579924.2_5'Flank|SPAG5-AS1_ENST00000414744.1_RNA|SGK494_ENST00000301037.5_Missense_Mutation_p.S5R|RP11-192H23.4_ENST00000577790.1_Missense_Mutation_p.S5R|SPAG5-AS1_ENST00000554154.1_RNA|SGK494_ENST00000469832.3_5'UTR	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100							extracellular region (GO:0005576)				breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					CCTGCCGACAGCTTACTGCTC	0.602																																						.											0													70.0	59.0	63.0					17																	26941165		2203	4300	6503	SO:0001628	intergenic_variant	0			D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587		17.37:g.26941165G>C		Somatic		WXS	Illumina HiSeq	Phase_I	A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Missense_Mutation	SNP	ENST00000528896.2	37	CCDS32595.1	.	.	.	.	.	.	.	.	.	.	G	14.33	2.502072	0.44455	.	.	ENSG00000258472;ENSG00000167524;ENSG00000167524;ENSG00000167524;ENSG00000167524;ENSG00000167524	ENST00000531839;ENST00000378976;ENST00000481916;ENST00000301037;ENST00000534850;ENST00000530121	T;T	0.69685	-0.42;1.38	5.69	3.69	0.42338	.	0.467347	0.22679	N	0.056977	T	0.55065	0.1897	L	0.27053	0.805	0.27099	N	0.962675	P;P	0.48016	0.904;0.578	P;B	0.45829	0.494;0.172	T	0.49995	-0.8879	10	0.44086	T	0.13	-2.377	9.2841	0.37746	0.1697:0.0:0.8303:0.0	.	5;5	E9PMD0;Q96LW2	.;SG494_HUMAN	R	5	ENSP00000301037:S5R;ENSP00000434603:S5R	ENSP00000301037:S5R	S	-	3	2	AC005726.6;RP11-192H23.4	23965292	1.000000	0.71417	0.999000	0.59377	0.953000	0.61014	2.075000	0.41538	1.407000	0.46875	0.650000	0.86243	AGC		0.602	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390571.3	NM_014680	
USP14	9097	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	18	211193	211193	+	Missense_Mutation	SNP	G	G	T	rs554797989		TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr18:211193G>T	ENST00000261601.7	+	16	1485	c.1394G>T	c.(1393-1395)cGg>cTg	p.R465L	USP14_ENST00000582707.1_Missense_Mutation_p.R430L|USP14_ENST00000383589.2_Missense_Mutation_p.R419L|USP14_ENST00000400266.3_Missense_Mutation_p.R454L	NM_005151.3	NP_005142.1	P54578	UBP14_HUMAN	ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase)	465	USP.				negative regulation of endopeptidase activity (GO:0010951)|protein deubiquitination (GO:0016579)|regulation of chemotaxis (GO:0050920)|regulation of proteasomal protein catabolic process (GO:0061136)|synaptic transmission (GO:0007268)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteasome complex (GO:0000502)|synapse (GO:0045202)	cysteine-type endopeptidase activity (GO:0004197)|endopeptidase inhibitor activity (GO:0004866)|proteasome binding (GO:0070628)|tRNA guanylyltransferase activity (GO:0008193)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			endometrium(1)|large_intestine(1)|lung(5)|ovary(2)|skin(2)	11		all_cancers(4;0.0896)|Myeloproliferative disorder(11;0.0412)				GATATCTTACGGCTTTCTGGT	0.393																																						.											0													122.0	105.0	111.0					18																	211193		2203	4300	6503	SO:0001583	missense	9097			U30888	CCDS32780.1, CCDS32781.1	18p11.32	2006-10-06	2005-08-08			ENSG00000101557		"""Ubiquitin-specific peptidases"""	12612	protein-coding gene	gene with protein product		607274	"""ubiquitin specific protease 14 (tRNA-guanine transglycosylase)"""			12838346	Standard	NM_001037334		Approved	TGT	uc002kkf.1	P54578		ENST00000261601.7:c.1394G>T	18.37:g.211193G>T	ENSP00000261601:p.Arg465Leu	Somatic		WXS	Illumina HiSeq	Phase_I	J3QRZ5|Q53XY5	Missense_Mutation	SNP	ENST00000261601.7	37	CCDS32780.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.791266	0.90367	.	.	ENSG00000101557	ENST00000261601;ENST00000383589;ENST00000400266	T;T	0.30981	1.51;1.51	6.03	6.03	0.97812	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.103869	0.64402	D	0.000007	T	0.57681	0.2070	M	0.81942	2.565	0.80722	D	1	P;P;P	0.51933	0.879;0.825;0.949	P;P;P	0.58721	0.642;0.647;0.844	T	0.58358	-0.7650	10	0.66056	D	0.02	-17.2505	20.5568	0.99304	0.0:0.0:1.0:0.0	.	454;430;465	B7Z4N8;A6NJA2;P54578	.;.;UBP14_HUMAN	L	465;430;454	ENSP00000261601:R465L;ENSP00000383125:R454L	ENSP00000261601:R465L	R	+	2	0	USP14	201193	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.135000	0.71696	2.861000	0.98227	0.655000	0.94253	CGG		0.393	USP14-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440305.3	NM_005151	
SERPINB8	5271	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	18	61654433	61654433	+	Missense_Mutation	SNP	C	C	A			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr18:61654433C>A	ENST00000397985.2	+	7	1302	c.1046C>A	c.(1045-1047)gCa>gAa	p.A349E	SERPINB8_ENST00000493661.1_Intron|SERPINB8_ENST00000542677.1_Missense_Mutation_p.A167E|SERPINB8_ENST00000353706.2_Missense_Mutation_p.A349E	NM_001276490.1	NP_001263419.1	P50452	SPB8_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 8	349					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|kidney(1)|large_intestine(4)|lung(9)|skin(1)	17		Esophageal squamous(42;0.129)				AGATTCTGTGCAGACCACCCT	0.512																																						.											0													96.0	94.0	95.0					18																	61654433		2203	4300	6503	SO:0001583	missense	5271			L40377	CCDS11991.1, CCDS42442.1, CCDS62460.1	18q22.1	2014-02-18	2005-08-18		ENSG00000166401	ENSG00000166401		"""Serine (or cysteine) peptidase inhibitors"""	8952	protein-coding gene	gene with protein product	"""cytoplasmic antiproteinase 2"""	601697	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 8"""	PI8		8530382, 9268635, 24172014	Standard	NM_198833		Approved	CAP2	uc002lju.3	P50452	OTTHUMG00000060596	ENST00000397985.2:c.1046C>A	18.37:g.61654433C>A	ENSP00000381072:p.Ala349Glu	Somatic		WXS	Illumina HiSeq	Phase_I	B4DTW2|Q7Z2V6|Q8N178	Missense_Mutation	SNP	ENST00000397985.2	37	CCDS11991.1	.	.	.	.	.	.	.	.	.	.	C	19.36	3.812074	0.70797	.	.	ENSG00000166401	ENST00000397985;ENST00000353706;ENST00000542677	D;D;T	0.85702	-2.02;-2.02;2.4	5.65	4.74	0.60224	Serpin domain (3);Protease inhibitor I4, serpin, conserved site (1);	0.203488	0.51477	D	0.000086	D	0.94364	0.8188	H	0.97611	4.04	0.58432	D	0.999993	D	0.76494	0.999	D	0.78314	0.991	D	0.94705	0.7887	10	0.87932	D	0	.	9.2896	0.37778	0.0:0.8315:0.0:0.1685	.	349	P50452	SPB8_HUMAN	E	349;349;167	ENSP00000381072:A349E;ENSP00000331368:A349E;ENSP00000438328:A167E	ENSP00000331368:A349E	A	+	2	0	SERPINB8	59805413	0.998000	0.40836	1.000000	0.80357	0.590000	0.36582	3.061000	0.49963	1.534000	0.49203	-0.345000	0.07892	GCA		0.512	SERPINB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134014.1	NM_001031848	
PVRL2	5819	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	19	45368669	45368669	+	Missense_Mutation	SNP	C	C	T	rs111808500		TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr19:45368669C>T	ENST00000252483.5	+	2	230	c.230C>T	c.(229-231)gCg>gTg	p.A77V	PVRL2_ENST00000252485.4_Missense_Mutation_p.A77V	NM_001042724.1	NP_001036189.1	Q92692	PVRL2_HUMAN	poliovirus receptor-related 2 (herpesvirus entry mediator B)	77	Ig-like V-type.				acrosome assembly (GO:0001675)|adherens junction organization (GO:0034332)|adhesion of symbiont to host (GO:0044406)|cell junction assembly (GO:0034329)|cell part morphogenesis (GO:0032990)|cell-cell junction organization (GO:0045216)|cilium organization (GO:0044782)|coreceptor-mediated virion attachment to host cell (GO:0046814)|cytoskeleton organization (GO:0007010)|establishment of mitochondrion localization (GO:0051654)|fertilization (GO:0009566)|fusion of virus membrane with host plasma membrane (GO:0019064)|homophilic cell adhesion (GO:0007156)|positive regulation of immunoglobulin mediated immune response (GO:0002891)|positive regulation of mast cell activation (GO:0033005)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|sperm mitochondrion organization (GO:0030382)|spermatid development (GO:0007286)|spermatid nucleus differentiation (GO:0007289)|susceptibility to natural killer cell mediated cytotoxicity (GO:0042271)|susceptibility to T cell mediated cytotoxicity (GO:0060370)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|zonula adherens (GO:0005915)	cell adhesion molecule binding (GO:0050839)|coreceptor activity (GO:0015026)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|virus receptor activity (GO:0001618)			breast(1)|endometrium(1)|large_intestine(6)|lung(5)	13	Lung NSC(12;0.00195)|all_lung(12;0.00522)	Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0143)		GATGCACCTGCGAACCACCAG	0.662																																						.											0								T	VAL/ALA,VAL/ALA	0,4406		0,0,2203	71.0	60.0	64.0		230,230	-5.8	0.0	19	dbSNP_132	64	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	PVRL2	NM_001042724.1,NM_002856.2	64,64	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	77/539,77/480	45368669	1,13005	2203	4300	6503	SO:0001583	missense	5819			X80038	CCDS12645.1, CCDS42576.1	19q13.32	2013-01-29			ENSG00000130202	ENSG00000130202		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9707	protein-coding gene	gene with protein product		600798		HVEB		7622062, 10196354	Standard	NM_001042724		Approved	PVRR2, PRR2, CD112	uc002ozw.1	Q92692	OTTHUMG00000180839	ENST00000252483.5:c.230C>T	19.37:g.45368669C>T	ENSP00000252483:p.Ala77Val	Somatic		WXS	Illumina HiSeq	Phase_I	A8K5L5|O75455|Q6IBI6|Q96J29	Missense_Mutation	SNP	ENST00000252483.5	37	CCDS42576.1	.	.	.	.	.	.	.	.	.	.	c	10.27	1.304881	0.23736	0.0	1.16E-4	ENSG00000130202	ENST00000252483;ENST00000252485	T;T	0.66280	-0.2;-0.2	4.33	-5.77	0.02369	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.585450	0.03789	N	0.262576	T	0.32585	0.0834	N	0.08118	0	0.09310	N	1	B;B	0.24043	0.067;0.096	B;B	0.16289	0.015;0.013	T	0.06734	-1.0810	10	0.40728	T	0.16	.	0.3328	0.00321	0.2868:0.2892:0.1884:0.2357	.	77;77	Q92692;Q92692-2	PVRL2_HUMAN;.	V	77	ENSP00000252483:A77V;ENSP00000252485:A77V	ENSP00000252483:A77V	A	+	2	0	PVRL2	50060509	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.589000	0.05767	-1.068000	0.03156	-1.385000	0.01166	GCG		0.662	PVRL2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453231.1	NM_002856	
NOVA2	4858	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	19	46443970	46443970	+	Silent	SNP	G	G	A			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr19:46443970G>A	ENST00000263257.5	-	4	824	c.630C>T	c.(628-630)ctC>ctT	p.L210L		NM_002516.2	NP_002507.1	Q9UNW9	NOVA2_HUMAN	neuro-oncological ventral antigen 2	210					regulation of RNA metabolic process (GO:0051252)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(3)|large_intestine(5)|lung(13)	21		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.00245)|GBM - Glioblastoma multiforme(486;0.0782)|Epithelial(262;0.179)		AGCTGATGTTGAGGCAGCTGC	0.687																																						.											0													60.0	32.0	42.0					19																	46443970		2168	4243	6411	SO:0001819	synonymous_variant	4858			U70477	CCDS12679.1	19q13.3	2008-07-17				ENSG00000104967			7887	protein-coding gene	gene with protein product	"""neuro-oncological ventral antigen 3"""	601991		NOVA3		9344654, 10368286	Standard	NM_002516		Approved	ANOVA	uc002pdv.2	Q9UNW9		ENST00000263257.5:c.630C>T	19.37:g.46443970G>A		Somatic		WXS	Illumina HiSeq	Phase_I	O43267|Q9UEA1	Silent	SNP	ENST00000263257.5	37	CCDS12679.1																																																																																				0.687	NOVA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437210.2	NM_002516	
ZNF845	91664	hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	19	53856300	53856300	+	Missense_Mutation	SNP	C	C	A			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr19:53856300C>A	ENST00000595091.1	+	5	2591	c.2372C>A	c.(2371-2373)gCa>gAa	p.A791E	ZNF845_ENST00000458035.1_Missense_Mutation_p.A791E			Q96IR2	ZN845_HUMAN	zinc finger protein 845	791					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(10)|lung(7)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	26						TCACACCTGGCACAACATACT	0.403																																						.											0													47.0	43.0	44.0					19																	53856300		692	1591	2283	SO:0001583	missense	91664			BC007307	CCDS46170.1	19q13.42	2013-01-08			ENSG00000213799	ENSG00000213799		"""Zinc fingers, C2H2-type"", ""-"""	25112	protein-coding gene	gene with protein product							Standard	NM_138374		Approved		uc010ydv.1	Q96IR2		ENST00000595091.1:c.2372C>A	19.37:g.53856300C>A	ENSP00000470005:p.Ala791Glu	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000595091.1	37	CCDS46170.1	.	.	.	.	.	.	.	.	.	.	C	3.789	-0.044051	0.07452	.	.	ENSG00000213799	ENST00000458035;ENST00000427984	T	0.07114	3.22	2.06	-4.11	0.03928	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04048	0.0113	N	0.17631	0.505	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.35425	-0.9789	9	0.32370	T	0.25	.	2.0734	0.03618	0.4102:0.2163:0.271:0.1025	.	791	Q96IR2	ZN845_HUMAN	E	791;707	ENSP00000388311:A791E	ENSP00000412086:A707E	A	+	2	0	ZNF845	58548112	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-5.320000	0.00131	-2.637000	0.00431	-0.512000	0.04463	GCA		0.403	ZNF845-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464359.1	XM_039908	
KCNF1	3754	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	2	11053758	11053758	+	Silent	SNP	C	C	T			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr2:11053758C>T	ENST00000295082.1	+	1	1696	c.1206C>T	c.(1204-1206)atC>atT	p.I402I		NM_002236.4	NP_002227.2	Q9H3M0	KCNF1_HUMAN	potassium voltage-gated channel, subfamily F, member 1	402					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)			NS(1)|endometrium(2)|large_intestine(2)|lung(10)|ovary(2)|skin(1)|urinary_tract(1)	19	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.128)		CCCTGCCCATCCACCCCATCA	0.597																																						.											0													148.0	112.0	124.0					2																	11053758		2203	4300	6503	SO:0001819	synonymous_variant	3754			AF033382	CCDS1676.1	2p25	2011-07-05			ENSG00000162975	ENSG00000162975		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6246	protein-coding gene	gene with protein product		603787		KCNF		9434767, 16382104	Standard	NM_002236		Approved	Kv5.1, kH1, IK8	uc002rax.3	Q9H3M0	OTTHUMG00000119054	ENST00000295082.1:c.1206C>T	2.37:g.11053758C>T		Somatic		WXS	Illumina HiSeq	Phase_I	O43527|Q585L3	Silent	SNP	ENST00000295082.1	37	CCDS1676.1																																																																																				0.597	KCNF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239265.1	NM_002236	
HES6	55502	hgsc.bcm.edu;ucsc.edu	37	2	239147555	239147555	+	Silent	SNP	A	A	G			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr2:239147555A>G	ENST00000272937.5	-	4	806	c.588T>C	c.(586-588)gcT>gcC	p.A196A	HES6_ENST00000409574.1_3'UTR|AC096574.4_ENST00000456601.1_RNA|HES6_ENST00000409160.3_3'UTR|HES6_ENST00000409182.1_Silent_p.A167A|HES6_ENST00000409002.3_Silent_p.A194A					hes family bHLH transcription factor 6											lung(1)|skin(1)	2		Breast(86;0.000523)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;3.23e-24)|OV - Ovarian serous cystadenocarcinoma(60;7.29e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.19e-08)|BRCA - Breast invasive adenocarcinoma(100;5.98e-05)|Lung(119;0.0086)|LUSC - Lung squamous cell carcinoma(224;0.0148)		CCTCAGCAGGAGCCTGACTCA	0.692																																						.											0													7.0	8.0	8.0					2																	239147555		2167	4256	6423	SO:0001819	synonymous_variant	55502			AB035179	CCDS2527.1, CCDS46556.1, CCDS63180.1	2q37.3	2013-10-17	2013-10-17		ENSG00000144485	ENSG00000144485		"""Basic helix-loop-helix proteins"""	18254	protein-coding gene	gene with protein product		610331	"""hairy and enhancer of split 6 (Drosophila)"""			10851137	Standard	XM_005246095		Approved	bHLHb41	uc002vxz.3	Q96HZ4	OTTHUMG00000133340	ENST00000272937.5:c.588T>C	2.37:g.239147555A>G		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000272937.5	37	CCDS2527.1																																																																																				0.692	HES6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257170.2	NM_018645	
PRSS50	29122	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	3	46784475	46784475	+	Intron	SNP	G	G	T			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr3:46784475G>T	ENST00000460241.1	-	4	1129				PRSS45_ENST00000442359.2_Missense_Mutation_p.F127L			Q9UI38	TSP50_HUMAN	protease, serine, 50						proteolysis (GO:0006508)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)	serine-type endopeptidase activity (GO:0004252)|threonine-type endopeptidase activity (GO:0004298)			endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	11						CTGGGGGGAAGAAGGACTTCT	0.532																																					Pancreas(41;915 1239 11561 17469)	.											0													71.0	78.0	75.0					3																	46784475		2069	4212	6281	SO:0001627	intron_variant	377047			AF100707	CCDS2745.1	3p21.31	2011-05-24			ENSG00000206549	ENSG00000206549		"""Serine peptidases / Serine peptidases"""	17910	protein-coding gene	gene with protein product	"""cancer/testis antigen 20"", ""testes specific protease 50"""	607950				10397268	Standard	NM_013270		Approved	TSP50, CT20	uc003cqe.1	Q9UI38	OTTHUMG00000164067	ENST00000460241.1:c.541+5639C>A	3.37:g.46784475G>T		Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000460241.1	37	CCDS2745.1	.	.	.	.	.	.	.	.	.	.	G	6.913	0.538018	0.13188	.	.	ENSG00000188086	ENST00000331814;ENST00000442359	D	0.88431	-2.38	4.82	0.879	0.19155	.	2.205680	0.01770	N	0.031130	T	0.77177	0.4092	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.65561	-0.6138	9	0.10111	T	0.7	.	4.9752	0.14136	0.1879:0.3344:0.4777:0.0	.	127	Q7RTY3-2	.	L	159;127	ENSP00000401932:F127L	ENSP00000330940:F159L	F	-	3	2	PRSS45	46759479	0.000000	0.05858	0.000000	0.03702	0.075000	0.17131	0.091000	0.15046	0.304000	0.22809	0.655000	0.94253	TTC		0.532	PRSS50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354544.1		
GMPPB	29925	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	3	49755708	49755708	+	3'UTR	SNP	G	G	A			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr3:49755708G>A	ENST00000480687.1	-	0	4676				RNF123_ENST00000327697.6_Intron|AMIGO3_ENST00000320431.7_Silent_p.L397L|AMIGO3_ENST00000535833.1_Silent_p.L397L|RNF123_ENST00000433785.1_Intron|RNF123_ENST00000497099.1_Intron			Q9Y5P6	GMPPB_HUMAN	GDP-mannose pyrophosphorylase B						cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose biosynthetic process (GO:0009298)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|mannose-1-phosphate guanylyltransferase activity (GO:0004475)			endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|skin(1)	6				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		AGAGCAGCACGAGCACAAGGC	0.682																																						.											0													51.0	51.0	51.0					3																	49755708		2203	4300	6503	SO:0001624	3_prime_UTR_variant	386724			AF135421	CCDS2802.1, CCDS2803.1	3p21.31	2008-02-05			ENSG00000173540	ENSG00000173540	2.7.7.22		22932	protein-coding gene	gene with protein product		615320					Standard	NM_013334		Approved	KIAA1851	uc003cxl.1	Q9Y5P6	OTTHUMG00000158151	ENST00000480687.1:c.*3477C>T	3.37:g.49755708G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A8K6N5|Q9H7U3	Silent	SNP	ENST00000480687.1	37	CCDS2803.1																																																																																				0.682	GMPPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350291.1	NM_013334	
PDZRN3	23024	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	3	73657758	73657758	+	Silent	SNP	C	C	G			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr3:73657758C>G	ENST00000263666.4	-	2	915	c.801G>C	c.(799-801)cgG>cgC	p.R267R	PDZRN3_ENST00000308537.4_Silent_p.R267R	NM_015009.1	NP_055824.1	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	267	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				neuromuscular junction development (GO:0007528)|protein ubiquitination (GO:0016567)	neuromuscular junction (GO:0031594)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(31)|ovary(4)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		CCACACTCGGCCGGCCACCAA	0.473																																						.											0													52.0	53.0	53.0					3																	73657758		2203	4300	6503	SO:0001819	synonymous_variant	23024			AB029018	CCDS33789.1	3p14.1	2013-01-09	2008-08-14		ENSG00000121440	ENSG00000121440		"""RING-type (C3HC4) zinc fingers"""	17704	protein-coding gene	gene with protein product	"""likely ortholog of mouse semaF cytoplasmic domain associated protein 3"""	609729				10470851	Standard	XM_005264718		Approved	KIAA1095, SEMACAP3, LNX3	uc003dpl.1	Q9UPQ7	OTTHUMG00000158865	ENST00000263666.4:c.801G>C	3.37:g.73657758C>G		Somatic		WXS	Illumina HiSeq	Phase_I	A7MCZ6|Q8N2N7|Q96CC2|Q9NSQ2	Silent	SNP	ENST00000263666.4	37	CCDS33789.1																																																																																				0.473	PDZRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352460.1	XM_041363	
KCTD8	386617	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	4	44177218	44177218	+	Missense_Mutation	SNP	T	T	G			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr4:44177218T>G	ENST00000360029.3	-	2	1294	c.1011A>C	c.(1009-1011)aaA>aaC	p.K337N		NM_198353.2	NP_938167.1	Q6ZWB6	KCTD8_HUMAN	potassium channel tetramerization domain containing 8	337					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)				central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|prostate(3)|upper_aerodigestive_tract(4)	41						CTTTGTCATGTTTCCTATCTT	0.408										HNSCC(17;0.042)																												.											0													119.0	112.0	115.0					4																	44177218		2203	4300	6503	SO:0001583	missense	386617			AK123347	CCDS3467.1	4p13	2013-06-20	2013-06-20		ENSG00000183783	ENSG00000183783			22394	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 8"""				Standard	NM_198353		Approved		uc003gwu.3	Q6ZWB6	OTTHUMG00000099409	ENST00000360029.3:c.1011A>C	4.37:g.44177218T>G	ENSP00000353129:p.Lys337Asn	Somatic		WXS	Illumina HiSeq	Phase_I	A2RU39	Missense_Mutation	SNP	ENST00000360029.3	37	CCDS3467.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.27|15.27	2.783160|2.783160	0.49891|0.49891	.|.	.|.	ENSG00000183783|ENSG00000183783	ENST00000360029|ENST00000515268	T|.	0.39997|.	1.05|.	4.65|4.65	1.02|1.02	0.19986|0.19986	.|.	0.000000|.	0.51477|.	D|.	0.000081|.	T|T	0.31482|0.31482	0.0798|0.0798	N|N	0.19112|0.19112	0.55|0.55	0.32695|0.32695	N|N	0.513629|0.513629	B|.	0.10296|.	0.003|.	B|.	0.06405|.	0.002|.	T|T	0.39840|0.39840	-0.9594|-0.9594	10|5	0.66056|.	D|.	0.02|.	.|.	7.0943|7.0943	0.25301|0.25301	0.0:0.3611:0.0:0.6389|0.0:0.3611:0.0:0.6389	.|.	337|.	Q6ZWB6|.	KCTD8_HUMAN|.	N|T	337|73	ENSP00000353129:K337N|.	ENSP00000353129:K337N|.	K|N	-|-	3|2	2|0	KCTD8|KCTD8	43871975|43871975	0.996000|0.996000	0.38824|0.38824	0.917000|0.917000	0.36280|0.36280	0.937000|0.937000	0.57800|0.57800	0.277000|0.277000	0.18734|0.18734	0.388000|0.388000	0.25054|0.25054	0.477000|0.477000	0.44152|0.44152	AAA|AAC		0.408	KCTD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216868.1		
LOX	4015	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	5	121413160	121413160	+	Missense_Mutation	SNP	G	G	A	rs369582946		TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr5:121413160G>A	ENST00000231004.4	-	1	820	c.521C>T	c.(520-522)cCc>cTc	p.P174L	LOX_ENST00000513319.1_5'Flank	NM_001178102.1|NM_002317.5	NP_001171573.1|NP_002308.2	P28300	LYOX_HUMAN	lysyl oxidase	174					blood vessel development (GO:0001568)|cellular protein modification process (GO:0006464)|collagen fibril organization (GO:0030199)|elastic fiber assembly (GO:0048251)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|wound healing (GO:0042060)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)			endometrium(1)|lung(6)|prostate(1)	8		all_cancers(142;0.0124)|Prostate(80;0.0322)|Ovarian(225;0.0814)|Breast(839;0.143)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;2.14e-11)|OV - Ovarian serous cystadenocarcinoma(64;7.87e-10)|all cancers(49;2.49e-09)|COAD - Colon adenocarcinoma(49;0.02)		GTACTTGTAGGGGTTGTAAGG	0.612																																						.											0													63.0	73.0	70.0					5																	121413160		2203	4300	6503	SO:0001583	missense	4015				CCDS4129.1	5q23.3-q31.2	2008-02-05			ENSG00000113083	ENSG00000113083	1.4.3.13		6664	protein-coding gene	gene with protein product		153455				1685472	Standard	NM_002317		Approved		uc003ksu.3	P28300	OTTHUMG00000128914	ENST00000231004.4:c.521C>T	5.37:g.121413160G>A	ENSP00000231004:p.Pro174Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B2R5Q3|Q5FWF0	Missense_Mutation	SNP	ENST00000231004.4	37	CCDS4129.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.254976	0.80135	.	.	ENSG00000113083	ENST00000231004;ENST00000543620	T	0.31247	1.5	4.41	4.41	0.53225	.	0.000000	0.85682	D	0.000000	T	0.44685	0.1305	M	0.65498	2.005	0.80722	D	1	D	0.54047	0.964	P	0.50860	0.652	T	0.53143	-0.8480	10	0.87932	D	0	.	16.6221	0.84933	0.0:0.0:1.0:0.0	.	174	P28300	LYOX_HUMAN	L	174;134	ENSP00000231004:P174L	ENSP00000231004:P174L	P	-	2	0	LOX	121441059	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	8.810000	0.91950	1.993000	0.58246	0.305000	0.20034	CCC		0.612	LOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250887.2		
CMYA5	202333	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	5	79039710	79039710	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr5:79039710G>A	ENST00000446378.2	+	3	10730	c.10699G>A	c.(10699-10701)Gtt>Att	p.V3567I		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	3567	B-box coiled-coil; BBC.				negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		TGAAGCCTTTGTTAGTGAGAT	0.318																																						.											0													88.0	80.0	83.0					5																	79039710		1801	4060	5861	SO:0001583	missense	202333			AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.10699G>A	5.37:g.79039710G>A	ENSP00000394770:p.Val3567Ile	Somatic		WXS	Illumina HiSeq	Phase_I	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	ENST00000446378.2	37	CCDS47238.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.519669	0.85495	.	.	ENSG00000164309	ENST00000446378	T	0.27256	1.68	5.58	5.58	0.84498	.	0.000000	0.42294	D	0.000733	T	0.45256	0.1333	L	0.39397	1.21	0.45607	D	0.998549	D	0.76494	0.999	D	0.78314	0.991	T	0.28713	-1.0035	10	0.56958	D	0.05	.	19.5743	0.95436	0.0:0.0:1.0:0.0	.	3567	Q8N3K9	CMYA5_HUMAN	I	3567	ENSP00000394770:V3567I	ENSP00000394770:V3567I	V	+	1	0	CMYA5	79075466	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.746000	0.74866	2.611000	0.88343	0.655000	0.94253	GTT		0.318	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	NM_153610	
NEUROG1	4762	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	5	134871070	134871070	+	Missense_Mutation	SNP	C	C	A			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr5:134871070C>A	ENST00000314744.4	-	1	569	c.311G>T	c.(310-312)cGc>cTc	p.R104L		NM_006161.2	NP_006152.2	Q92886	NGN1_HUMAN	neurogenin 1	104	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				cell fate commitment (GO:0045165)|inner ear morphogenesis (GO:0042472)|nervous system development (GO:0007399)|neuron differentiation (GO:0030182)|positive regulation of exit from mitosis (GO:0031536)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|perikaryon (GO:0043204)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)			endometrium(1)|liver(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GTTGTGCATGCGGTTGCGCTC	0.711																																						.											0													37.0	38.0	38.0					5																	134871070		2203	4299	6502	SO:0001583	missense	4762			U63842	CCDS4187.1	5q23-q31	2013-05-21			ENSG00000181965	ENSG00000181965		"""Basic helix-loop-helix proteins"""	7764	protein-coding gene	gene with protein product	"""neurogenic differentiation 3"""	601726		NEUROD3		9119405	Standard	NM_006161		Approved	AKA, Math4C, ngn1, bHLHa6	uc003lax.3	Q92886	OTTHUMG00000129138	ENST00000314744.4:c.311G>T	5.37:g.134871070C>A	ENSP00000317580:p.Arg104Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q5U0Q9|Q96HE1	Missense_Mutation	SNP	ENST00000314744.4	37	CCDS4187.1	.	.	.	.	.	.	.	.	.	.	c	27.3	4.818538	0.90790	.	.	ENSG00000181965	ENST00000314744	D	0.99709	-6.48	4.74	4.74	0.60224	Helix-loop-helix DNA-binding (5);	0.000000	0.85682	D	0.000000	D	0.99866	0.9937	H	0.98833	4.345	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96174	0.9125	10	0.87932	D	0	-2.6733	17.7034	0.88302	0.0:1.0:0.0:0.0	.	104	Q92886	NGN1_HUMAN	L	104	ENSP00000317580:R104L	ENSP00000317580:R104L	R	-	2	0	NEUROG1	134898969	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.696000	0.84270	2.166000	0.68216	0.651000	0.88453	CGC		0.711	NEUROG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251192.1	NM_006161	
SLC18B1	116843	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	6	133105219	133105219	+	Missense_Mutation	SNP	C	C	G			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr6:133105219C>G	ENST00000275227.4	-	6	607	c.511G>C	c.(511-513)Gag>Cag	p.E171Q	SLC18B1_ENST00000538764.1_Missense_Mutation_p.E45Q|SLC18B1_ENST00000367918.1_Intron	NM_052831.2	NP_439896.1	Q6NT16	S18B1_HUMAN	solute carrier family 18, subfamily B, member 1	171					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)											GAAAAAGTCTCAAGACTTCCC	0.333																																						.											0													70.0	75.0	73.0					6																	133105219		2203	4300	6503	SO:0001583	missense	116843			AK124442	CCDS5163.1	6q22.3-q23.3	2013-05-22	2012-03-09	2012-03-09	ENSG00000146409	ENSG00000146409		"""Solute carriers"""	21573	protein-coding gene	gene with protein product		613361	"""chromosome 6 open reading frame 192"""	C6orf192		19697161	Standard	XM_006715328		Approved	dJ55C23.6	uc003qdw.1	Q6NT16	OTTHUMG00000015595	ENST00000275227.4:c.511G>C	6.37:g.133105219C>G	ENSP00000275227:p.Glu171Gln	Somatic		WXS	Illumina HiSeq	Phase_I	A8K1K3|B3KW77|Q6ISF2	Missense_Mutation	SNP	ENST00000275227.4	37	CCDS5163.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.982690	0.74474	.	.	ENSG00000146409	ENST00000275227;ENST00000538764	T;T	0.57595	0.39;0.39	5.53	5.53	0.82687	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.67924	0.2945	M	0.85859	2.78	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.996	T	0.65664	-0.6113	10	0.12766	T	0.61	-13.6973	19.0578	0.93072	0.0:1.0:0.0:0.0	.	45;171	B7Z1S5;Q6NT16	.;CF192_HUMAN	Q	171;45	ENSP00000275227:E171Q;ENSP00000444098:E45Q	ENSP00000275227:E171Q	E	-	1	0	C6orf192	133146912	1.000000	0.71417	1.000000	0.80357	0.553000	0.35397	7.188000	0.77739	2.588000	0.87417	0.655000	0.94253	GAG		0.333	SLC18B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042273.1	NM_052831	
ASB15	142685	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	7	123254584	123254584	+	Missense_Mutation	SNP	G	G	C			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr7:123254584G>C	ENST00000451558.1	+	6	549	c.28G>C	c.(28-30)Gac>Cac	p.D10H	RP11-390E23.3_ENST00000422401.1_RNA|ASB15_ENST00000434204.1_Missense_Mutation_p.D10H|ASB15_ENST00000540573.1_Missense_Mutation_p.D10H|RP11-390E23.3_ENST00000440504.1_RNA|ASB15_ENST00000451215.1_Missense_Mutation_p.D10H|RP11-390E23.3_ENST00000418409.1_RNA|ASB15_ENST00000275699.3_Missense_Mutation_p.D10H			Q8WXK1	ASB15_HUMAN	ankyrin repeat and SOCS box containing 15	10					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					breast(1)|kidney(1)|large_intestine(1)|lung(6)|skin(3)	12						CCCTGATGAAGACCATCTTAC	0.358																																						.											0													207.0	209.0	209.0					7																	123254584		2203	4300	6503	SO:0001583	missense	142685			AF403033	CCDS34742.1	7q31.31	2013-01-10	2011-01-25		ENSG00000146809	ENSG00000146809		"""Ankyrin repeat domain containing"""	19767	protein-coding gene	gene with protein product			"""ankyrin repeat and SOCS box-containing 15"""			12076535	Standard	XM_005250149		Approved	FLJ43370	uc003vkw.1	Q8WXK1	OTTHUMG00000157114	ENST00000451558.1:c.28G>C	7.37:g.123254584G>C	ENSP00000397655:p.Asp10His	Somatic		WXS	Illumina HiSeq	Phase_I	Q3ZCP3|Q3ZCP5|Q68D37	Missense_Mutation	SNP	ENST00000451558.1	37	CCDS34742.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.659785	0.88154	.	.	ENSG00000146809	ENST00000451558;ENST00000434204;ENST00000437535;ENST00000451215;ENST00000540573;ENST00000447789;ENST00000275699	T;T;T;T;T;T;T	0.73789	-0.71;-0.71;0.18;-0.71;-0.71;-0.78;-0.71	6.04	6.04	0.98038	.	0.000000	0.64402	D	0.000002	D	0.85448	0.5699	M	0.65498	2.005	0.58432	D	0.999999	D	0.76494	0.999	D	0.68039	0.955	D	0.84706	0.0731	10	0.56958	D	0.05	-26.6264	20.1899	0.98228	0.0:0.0:1.0:0.0	.	10	Q8WXK1	ASB15_HUMAN	H	10	ENSP00000397655:D10H;ENSP00000390963:D10H;ENSP00000406163:D10H;ENSP00000416433:D10H;ENSP00000438643:D10H;ENSP00000401166:D10H;ENSP00000275699:D10H	ENSP00000275699:D10H	D	+	1	0	ASB15	123041820	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.723000	0.84788	2.873000	0.98535	0.563000	0.77884	GAC		0.358	ASB15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347493.1		
FUBP3	8939	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	9	133507382	133507382	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr9:133507382A>G	ENST00000319725.9	+	15	1481	c.1406A>G	c.(1405-1407)aAt>aGt	p.N469S		NM_003934.1	NP_003925.1	Q96I24	FUBP3_HUMAN	far upstream element (FUSE) binding protein 3	469					positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(10)|ovary(2)|urinary_tract(2)	21				OV - Ovarian serous cystadenocarcinoma(145;0.000279)		GCCAAGGTGAATGGGAACCCC	0.552																																						.											0													99.0	104.0	103.0					9																	133507382		1953	4139	6092	SO:0001583	missense	8939			U69127	CCDS43893.1	9q34.11	2008-02-05			ENSG00000107164	ENSG00000107164			4005	protein-coding gene	gene with protein product		603536		FBP3		8940189	Standard	NM_003934		Approved		uc004bzr.1	Q96I24	OTTHUMG00000020809	ENST00000319725.9:c.1406A>G	9.37:g.133507382A>G	ENSP00000318177:p.Asn469Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A3KFK8|A3KFL0|Q92946|Q9BVB6	Missense_Mutation	SNP	ENST00000319725.9	37	CCDS43893.1	.	.	.	.	.	.	.	.	.	.	A	7.924	0.739134	0.15642	.	.	ENSG00000107164	ENST00000319725	T	0.43294	0.95	4.57	4.57	0.56435	.	0.354853	0.28151	N	0.016416	T	0.25827	0.0629	N	0.22421	0.69	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.07046	-1.0793	10	0.11485	T	0.65	-7.3958	10.6122	0.45429	1.0:0.0:0.0:0.0	.	469;469	A3KFK8;Q96I24	.;FUBP3_HUMAN	S	469	ENSP00000318177:N469S	ENSP00000318177:N469S	N	+	2	0	FUBP3	132497203	0.974000	0.33945	0.953000	0.39169	0.746000	0.42486	2.155000	0.42301	1.814000	0.52955	0.459000	0.35465	AAT		0.552	FUBP3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054666.1		
SRGN	5552	broad.mit.edu;hgsc.bcm.edu;bcgsc.ca	37	10	70863802	70863802	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr10:70863802T>C	ENST00000242465.3	+	3	443	c.403T>C	c.(403-405)Tct>Cct	p.S135P	SRGN_ENST00000462445.1_3'UTR	NM_002727.2	NP_002718.2	P10124	SRGN_HUMAN	serglycin	135					biomineral tissue development (GO:0031214)|blood coagulation (GO:0007596)|granzyme-mediated apoptotic signaling pathway (GO:0008626)|maintenance of granzyme B location in T cell secretory granule (GO:0033382)|maintenance of protease location in mast cell secretory granule (GO:0033373)|mast cell secretory granule organization (GO:0033364)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cytokine secretion (GO:0050710)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein processing (GO:0016485)|T cell secretory granule organization (GO:0033371)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|mast cell granule (GO:0042629)|platelet alpha granule lumen (GO:0031093)|zymogen granule (GO:0042588)				large_intestine(1)|lung(1)|skin(2)|upper_aerodigestive_tract(3)	7						CAACCTTAGGTCTCTTGACAG	0.463																																						.											0													105.0	94.0	98.0					10																	70863802		2203	4300	6503	SO:0001583	missense	5552			BC015516	CCDS7285.1	10q22.1	2007-02-16	2007-02-15	2007-02-15	ENSG00000122862	ENSG00000122862		"""Proteoglycans / Extracellular Matrix : Other"""	9361	protein-coding gene	gene with protein product	"""serglycin proteoglycan"""	177040	"""proteoglycan 1, secretory granule"""	PRG, PRG1			Standard	NR_036430		Approved	PPG	uc001joz.3	P10124	OTTHUMG00000018369	ENST00000242465.3:c.403T>C	10.37:g.70863802T>C	ENSP00000242465:p.Ser135Pro	Somatic		WXS	Illumina HiSeq	Phase_I	B2R4L7|Q5VW06	Missense_Mutation	SNP	ENST00000242465.3	37	CCDS7285.1	.	.	.	.	.	.	.	.	.	.	T	0.011	-1.716689	0.00706	.	.	ENSG00000122862	ENST00000242465	T	0.47869	0.83	4.71	-2.7	0.06004	.	0.726897	0.12665	N	0.449259	T	0.21145	0.0509	N	0.12502	0.225	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.33317	-0.9873	10	0.02654	T	1	-17.6268	9.7899	0.40699	0.0:0.3672:0.0:0.6328	.	135	P10124	SRGN_HUMAN	P	135	ENSP00000242465:S135P	ENSP00000242465:S135P	S	+	1	0	SRGN	70533808	0.000000	0.05858	0.000000	0.03702	0.376000	0.30014	-1.341000	0.02647	-0.655000	0.05387	0.459000	0.35465	TCT		0.463	SRGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048379.1	NM_002727	
CDK11A	728642	broad.mit.edu;hgsc.bcm.edu;mdanderson.org	37	1	1647844	1647844	+	Silent	SNP	G	G	A	rs368053496		TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr1:1647844G>A	ENST00000378633.1	-	5	478	c.399C>T	c.(397-399)cgC>cgT	p.R133R	CDK11A_ENST00000358779.5_Silent_p.R133R|CDK11A_ENST00000378638.2_Silent_p.R109R|CDK11A_ENST00000378635.3_Silent_p.R133R|CDK11A_ENST00000356200.3_Silent_p.R109R|CDK11A_ENST00000404249.3_Silent_p.R143R|CDK11A_ENST00000357760.2_Silent_p.R133R|RP1-283E3.8_ENST00000598846.1_RNA			Q9UQ88	CD11A_HUMAN	cyclin-dependent kinase 11A	133	Glu-rich.				apoptotic process (GO:0006915)|mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of mRNA processing (GO:0050684)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(4)|stomach(1)|urinary_tract(1)	18						CCCATTCCCGGCGAGCTTTAT	0.483																																					Pancreas(186;965 2119 30274 40311 50569)	.											0													227.0	224.0	225.0					1																	1647844		1977	4163	6140	SO:0001819	synonymous_variant	984			AF067522	CCDS44042.1, CCDS44043.1	1p36.33	2011-11-08	2009-12-16	2009-12-16	ENSG00000008128	ENSG00000008128		"""Cyclin-dependent kinases"""	1730	protein-coding gene	gene with protein product		116951	"""cell division cycle 2-like 2"", ""cell division cycle 2-like 2 (PITSLRE proteins)"""	CDC2L3, CDC2L2		7920654, 9750192, 19884882	Standard	NM_033529		Approved	PITSLRE, CDK11-p110, CDK11-p58, CDK11-p46, p58GTA		Q9UQ88	OTTHUMG00000000703	ENST00000378633.1:c.399C>T	1.37:g.1647844G>A		Somatic		WXS	Illumina HiSeq	Phase_I	O95227|O95228|O96012|Q12821|Q12853|Q12854|Q2TAJ0|Q5QPR0|Q5QPR1|Q5QPR2|Q9UBC4|Q9UBI3|Q9UEI1|Q9UEI2|Q9UP53|Q9UP54|Q9UP55|Q9UP56|Q9UQ86|Q9UQ87|Q9UQ89	Silent	SNP	ENST00000378633.1	37																																																																																					0.483	CDK11A-005	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000001735.1	NM_024011	
CACNA1C	775	hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	12	2794921	2794921	+	Missense_Mutation	SNP	G	G	A	rs200231105	byFrequency	TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr12:2794921G>A	ENST00000347598.4	+	46	5737	c.5737G>A	c.(5737-5739)Gaa>Aaa	p.E1913K	CACNA1C_ENST00000399617.1_Missense_Mutation_p.E1900K|CACNA1C_ENST00000335762.5_Missense_Mutation_p.E1890K|CACNA1C_ENST00000406454.3_Missense_Mutation_p.E1936K|CACNA1C_ENST00000399637.1_Missense_Mutation_p.E1884K|CACNA1C_ENST00000399597.1_Missense_Mutation_p.E1865K|CACNA1C_ENST00000399591.1_Missense_Mutation_p.E1873K|CACNA1C_ENST00000399601.1_Missense_Mutation_p.E1865K|CACNA1C_ENST00000402845.3_Missense_Mutation_p.E1884K|CACNA1C_ENST00000399621.1_Missense_Mutation_p.E1884K|CACNA1C_ENST00000344100.3_Missense_Mutation_p.E1906K|CACNA1C_ENST00000399655.1_Missense_Mutation_p.E1865K|CACNA1C_ENST00000399644.1_Missense_Mutation_p.E1865K|CACNA1C_ENST00000399595.1_Missense_Mutation_p.E1873K|CACNA1C_ENST00000327702.7_Missense_Mutation_p.E1900K|CACNA1C_ENST00000399629.1_Missense_Mutation_p.E1882K|CACNA1C_ENST00000399606.1_Missense_Mutation_p.E1885K|CACNA1C_ENST00000399603.1_Missense_Mutation_p.E1865K|CACNA1C_ENST00000399649.1_Missense_Mutation_p.E1871K|CACNA1C_ENST00000399641.1_Missense_Mutation_p.E1865K|CACNA1C_ENST00000399638.1_Missense_Mutation_p.E1893K|CACNA1C_ENST00000399634.1_Missense_Mutation_p.E1936K|CACNA1C-AS1_ENST00000501371.1_RNA	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	1948					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.E1913K(2)|p.E1906K(2)|p.E1978K(2)|p.E1900K(2)|p.E1400K(2)		NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CCAGGATGACGAAAATCGGCA	0.592																																						.											10	Substitution - Missense(10)	kidney(5)|endometrium(5)											47.0	48.0	48.0					12																	2794921		2013	4164	6177	SO:0001583	missense	775			AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.5737G>A	12.37:g.2794921G>A	ENSP00000266376:p.Glu1913Lys	Somatic		WXS	Illumina HiSeq	Phase_I	B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	ENST00000347598.4	37	CCDS44788.1	.	.	.	.	.	.	.	.	.	.	G	15.97	2.988512	0.53934	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595;ENST00000322367	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.57595	0.39;0.39;0.39;0.39;0.39;0.39;0.39;0.39;0.39;0.39;0.39;0.39;0.39;0.39;0.39;0.39;0.39;0.39;0.39;0.39;0.39;0.39	4.26	3.35	0.38373	.	1.675690	0.03914	N	0.282339	T	0.64427	0.2597	L	0.39633	1.23	0.24214	N	0.99546	P;D;P;B;D;P;P;D;B;B;D;P;P;B;P;B;P;B;D;P;P;D;D;P;P	0.76494	0.801;0.999;0.941;0.097;0.999;0.921;0.953;0.961;0.11;0.33;0.978;0.941;0.757;0.432;0.902;0.306;0.757;0.062;0.978;0.588;0.769;0.961;0.961;0.882;0.941	B;P;B;B;D;B;B;P;B;B;P;B;B;B;B;B;B;B;P;B;B;P;P;B;B	0.78314	0.21;0.858;0.304;0.03;0.991;0.308;0.378;0.485;0.04;0.071;0.485;0.304;0.122;0.099;0.114;0.033;0.122;0.024;0.485;0.172;0.172;0.485;0.485;0.172;0.304	T	0.56056	-0.8042	10	0.07030	T	0.85	.	14.0749	0.64885	0.0:0.1521:0.8479:0.0	.	556;1906;1862;1948;1900;1884;1865;1882;1893;1865;1885;1865;1896;1913;1865;1900;1936;1873;1871;1873;1854;1884;1884;1865;1865	B7Z7Z5;Q13936-14;Q13936-35;Q13936;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-28;Q13936-11;E9PDJ1;E9PDJ0;F5GY28;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;Q13936-12	.;.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	K	1890;1865;1865;1893;1865;1884;1884;1873;1865;1913;1885;1865;1906;1882;1900;1871;1884;1865;1936;1900;1936;1873;1766	ENSP00000336982:E1890K;ENSP00000382563:E1865K;ENSP00000382552:E1865K;ENSP00000382547:E1893K;ENSP00000382506:E1865K;ENSP00000382530:E1884K;ENSP00000382546:E1884K;ENSP00000382500:E1873K;ENSP00000382549:E1865K;ENSP00000266376:E1913K;ENSP00000382515:E1885K;ENSP00000382510:E1865K;ENSP00000341092:E1906K;ENSP00000382537:E1882K;ENSP00000329877:E1900K;ENSP00000382557:E1871K;ENSP00000385724:E1884K;ENSP00000382512:E1865K;ENSP00000382542:E1936K;ENSP00000382526:E1900K;ENSP00000385896:E1936K;ENSP00000382504:E1873K	ENSP00000323129:E1766K	E	+	1	0	CACNA1C	2665182	1.000000	0.71417	0.943000	0.38184	0.802000	0.45316	5.486000	0.66856	0.981000	0.38548	0.449000	0.29647	GAA		0.592	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1	NM_000719	
SCN10A	6336	broad.mit.edu;hgsc.bcm.edu;mdanderson.org	37	3	38739683	38739683	+	Silent	SNP	G	G	T			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr3:38739683G>T	ENST00000449082.2	-	27	5027	c.5028C>A	c.(5026-5028)ccC>ccA	p.P1676P		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	1676					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.Y1677fs*21(1)		NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	GGTCACAGTAGGGGGGCCCTG	0.592																																						.											1	Deletion - Frameshift(1)	pancreas(1)											70.0	74.0	72.0					3																	38739683		2203	4300	6503	SO:0001819	synonymous_variant	6336			AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.5028C>A	3.37:g.38739683G>T		Somatic		WXS	Illumina HiSeq	Phase_I	A6NDQ1	Silent	SNP	ENST00000449082.2	37	CCDS33736.1																																																																																				0.592	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109745.3	NM_006514	
ROBO1	6091	hgsc.bcm.edu;ucsc.edu	37	3	78735005	78735005	+	Silent	SNP	G	G	A	rs80267939	byFrequency	TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr3:78735005G>A	ENST00000464233.1	-	10	1346	c.1233C>T	c.(1231-1233)ggC>ggT	p.G411G	ROBO1_ENST00000467549.1_Silent_p.G375G|ROBO1_ENST00000436010.2_Silent_p.G372G|ROBO1_ENST00000495273.1_Silent_p.G375G	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	411	Ig-like C2-type 4.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		TTGTGAGGTCGCCAGTCTGGG	0.408													G|||	9	0.00179712	0.0061	0.0014	5008	,	,		16783	0.0		0.0	False		,,,				2504	0.0					.											0								G	,,	9,3839		0,9,1915	59.0	59.0	59.0		1125,1233,1125	-4.1	1.0	3	dbSNP_132	59	1,8215		0,1,4107	no	coding-synonymous,coding-synonymous,coding-synonymous	ROBO1	NM_001145845.1,NM_002941.3,NM_133631.3	,,	0,10,6022	AA,AG,GG		0.0122,0.2339,0.0829	,,	375/1552,411/1652,375/1607	78735005	10,12054	1924	4108	6032	SO:0001819	synonymous_variant	6091			AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.1233C>T	3.37:g.78735005G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Silent	SNP	ENST00000464233.1	37	CCDS54611.1																																																																																				0.408	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941	
RBMXL1	494115	broad.mit.edu;mdanderson.org	37	1	89449440	89449440	+	Missense_Mutation	SNP	G	G	T			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr1:89449440G>T	ENST00000321792.5	-	2	497	c.70C>A	c.(70-72)Ctt>Att	p.L24I	RBMXL1_ENST00000413769.1_5'UTR|RBMXL1_ENST00000399794.2_Missense_Mutation_p.L24I|CCBL2_ENST00000446900.2_Intron|CCBL2_ENST00000370491.3_Intron|CCBL2_ENST00000370485.2_Intron|CCBL2_ENST00000260508.4_Intron	NM_019610.5	NP_062556.2	Q96E39	RMXL1_HUMAN	RNA binding motif protein, X-linked-like 1	24	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)										ACTGTTTCAAGAGCTTTCTCA	0.413											OREG0013593	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										.											0													185.0	184.0	185.0					1																	89449440		2203	4300	6503	SO:0001583	missense	494115			BC012942	CCDS716.1	1p22.2	2013-02-12	2007-01-04	2007-01-04	ENSG00000213516	ENSG00000213516		"""RNA binding motif (RRM) containing"""	25073	protein-coding gene	gene with protein product	"""kynurenine aminotransferase III"""					10441733	Standard	NM_019610		Approved	KAT3	uc001dms.3	Q96E39	OTTHUMG00000010661	ENST00000321792.5:c.70C>A	1.37:g.89449440G>T	ENSP00000318415:p.Leu24Ile	Somatic	1267	WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000321792.5	37	CCDS716.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.156042	0.78114	.	.	ENSG00000213516	ENST00000321792;ENST00000399794	T;T	0.37915	1.17;1.17	1.28	1.28	0.21552	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.64402	U	0.000009	T	0.32255	0.0823	L	0.31845	0.965	0.41177	D	0.986203	P	0.44344	0.833	D	0.73380	0.98	T	0.18398	-1.0338	10	0.66056	D	0.02	-1.6719	8.103	0.30868	0.0:0.0:1.0:0.0	.	24	Q96E39	RBMXL_HUMAN	I	24	ENSP00000318415:L24I;ENSP00000446099:L24I	ENSP00000318415:L24I	L	-	1	0	RBMXL1	89222028	1.000000	0.71417	0.821000	0.32701	0.926000	0.56050	2.359000	0.44142	0.693000	0.31634	0.306000	0.20318	CTT		0.413	RBMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029403.3	NM_019610	
OR10J5	127385	broad.mit.edu	37	1	159504971	159504971	+	Missense_Mutation	SNP	G	G	A	rs149096656	byFrequency	TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr1:159504971G>A	ENST00000334857.2	-	1	871	c.827C>T	c.(826-828)aCg>aTg	p.T276M		NM_001004469.1	NP_001004469.1	Q8NHC4	O10J5_HUMAN	olfactory receptor, family 10, subfamily J, member 5	276						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	22	all_hematologic(112;0.0429)					GATGGTGTACGTCACTGAGAG	0.463																																						.											0								G	MET/THR	0,4406		0,0,2203	90.0	86.0	87.0		827	3.9	1.0	1	dbSNP_134	87	3,8597	3.0+/-9.4	0,3,4297	yes	missense	OR10J5	NM_001004469.1	81	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	probably-damaging	276/310	159504971	3,13003	2203	4300	6503	SO:0001583	missense	127385				CCDS30910.1	1q23.2	2012-08-09			ENSG00000184155	ENSG00000184155		"""GPCR / Class A : Olfactory receptors"""	14993	protein-coding gene	gene with protein product							Standard	NM_001004469		Approved		uc010piw.2	Q8NHC4	OTTHUMG00000022738	ENST00000334857.2:c.827C>T	1.37:g.159504971G>A	ENSP00000334441:p.Thr276Met	Somatic		WXS	Illumina HiSeq	Phase_I	B9EH35|Q6IFH2	Missense_Mutation	SNP	ENST00000334857.2	37	CCDS30910.1	.	.	.	.	.	.	.	.	.	.	G	9.539	1.112783	0.20795	0.0	3.49E-4	ENSG00000184155	ENST00000334857	T	0.00058	8.79	3.94	3.94	0.45596	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00073	0.0002	N	0.12527	0.23	0.28773	N	0.900281	D	0.71674	0.998	D	0.66497	0.944	T	0.43163	-0.9408	9	0.40728	T	0.16	.	7.6339	0.28255	0.116:0.0:0.884:0.0	.	276	Q8NHC4	O10J5_HUMAN	M	276	ENSP00000334441:T276M	ENSP00000334441:T276M	T	-	2	0	OR10J5	157771595	0.077000	0.21312	0.996000	0.52242	0.006000	0.05464	3.109000	0.50345	2.178000	0.69098	0.491000	0.48974	ACG		0.463	OR10J5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059021.1	NM_001004469	
ANKRD2	26287	broad.mit.edu;mdanderson.org;bcgsc.ca	37	10	99342111	99342111	+	Nonsense_Mutation	SNP	C	C	T			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr10:99342111C>T	ENST00000307518.5	+	7	1042	c.775C>T	c.(775-777)Cag>Tag	p.Q259*	PI4K2A_ENST00000555577.1_5'Flank|ANKRD2_ENST00000298808.5_Intron|HOGA1_ENST00000370646.4_5'Flank|HOGA1_ENST00000370647.4_5'Flank|PI4K2A_ENST00000370649.3_5'Flank|ANKRD2_ENST00000455090.1_Intron|ANKRD2_ENST00000370655.1_Nonsense_Mutation_p.Q232*			Q9GZV1	ANKR2_HUMAN	ankyrin repeat domain 2 (stretch responsive muscle)	259					muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|skeletal muscle cell differentiation (GO:0035914)	cytosol (GO:0005829)|euchromatin (GO:0000791)|I band (GO:0031674)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	protein kinase B binding (GO:0043422)|structural constituent of muscle (GO:0008307)			breast(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|stomach(1)	7		all_hematologic(284;1.95e-06)|Colorectal(252;0.0163)		Epithelial(162;1.18e-94)|all cancers(201;9.31e-86)|BRCA - Breast invasive adenocarcinoma(275;0.0233)|STAD - Stomach adenocarcinoma(243;0.181)|KIRC - Kidney renal clear cell carcinoma(50;0.206)|Kidney(138;0.241)		CCGGACAGGGCAGGTGGAGAT	0.612																																						.											0													58.0	44.0	49.0					10																	99342111		2187	4286	6473	SO:0001587	stop_gained	26287			AJ304805	CCDS7466.1, CCDS44468.1	10q23	2013-01-10			ENSG00000165887	ENSG00000165887		"""Ankyrin repeat domain containing"""	495	protein-coding gene	gene with protein product		610734				10873377, 15136035, 15677738	Standard	NM_001129981		Approved	ARPP	uc001knw.3	Q9GZV1	OTTHUMG00000018860	ENST00000307518.5:c.775C>T	10.37:g.99342111C>T	ENSP00000306163:p.Gln259*	Somatic		WXS	Illumina HiSeq	Phase_I	Q3B778|Q5T456|Q70EZ9|Q8WUD7|Q96MG0|Q9NQC9	Nonsense_Mutation	SNP	ENST00000307518.5	37	CCDS7466.1	.	.	.	.	.	.	.	.	.	.	C	19.57	3.852611	0.71719	.	.	ENSG00000165887	ENST00000307518;ENST00000370655	.	.	.	5.6	5.6	0.85130	.	0.494981	0.20990	N	0.082053	.	.	.	.	.	.	0.58432	D	0.999996	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	-0.7429	13.9655	0.64207	0.1523:0.8477:0.0:0.0	.	.	.	.	X	259;232	.	ENSP00000306163:Q259X	Q	+	1	0	ANKRD2	99332101	0.573000	0.26676	0.303000	0.25071	0.007000	0.05969	4.842000	0.62831	2.636000	0.89361	0.655000	0.94253	CAG		0.612	ANKRD2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
LUZP2	338645	broad.mit.edu	37	11	24936024	24936024	+	Frame_Shift_Del	DEL	A	A	-	rs140841896		TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr11:24936024delA	ENST00000336930.6	+	7	528	c.462delA	c.(460-462)tcafs	p.S154fs	LUZP2_ENST00000533227.1_Frame_Shift_Del_p.S68fs			Q86TE4	LUZP2_HUMAN	leucine zipper protein 2	154						extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(11)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	32						CCTTACAGTCAAAAAAAATCC	0.348																																						.											0										62,4202		28,6,2098	89.0	89.0	89.0			5.5	1.0	11		89	137,8117		63,11,4053	no	frameshift	LUZP2	NM_001009909.2		91,17,6151	A1A1,A1R,RR		1.6598,1.454,1.5897			24936024	199,12319	2203	4300	6503	SO:0001589	frameshift_variant	338645			AL832641	CCDS31446.1, CCDS58128.1	11p14.3	2005-09-18			ENSG00000187398	ENSG00000187398			23206	protein-coding gene	gene with protein product		608178				12856284	Standard	NM_001009909		Approved		uc001mqs.3	Q86TE4	OTTHUMG00000166109	ENST00000336930.6:c.462delA	11.37:g.24936024delA	ENSP00000336817:p.Ser154fs	Somatic		WXS	Illumina HiSeq	Phase_I	A2RUB8|E9PN53|Q6UXE7|Q6ZS65	Frame_Shift_Del	DEL	ENST00000336930.6	37	CCDS31446.1																																																																																				0.348	LUZP2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387861.1	NM_001009909	
CCDC73	493860	broad.mit.edu	37	11	32637520	32637520	+	Frame_Shift_Del	DEL	T	T	-			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr11:32637520delT	ENST00000335185.5	-	15	1384	c.1341delA	c.(1339-1341)aaafs	p.K447fs	CCDC73_ENST00000534415.1_5'UTR	NM_001008391.2	NP_001008392.2	Q6ZRK6	CCD73_HUMAN	coiled-coil domain containing 73	447										NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	51	Breast(20;0.112)					ATGAGCCTTCTTTTTTTTCTT	0.249																																						.											0													42.0	38.0	40.0					11																	32637520		1765	4040	5805	SO:0001589	frameshift_variant	493860			AK128159	CCDS41630.1	11p13	2006-02-11			ENSG00000186714	ENSG00000186714			23261	protein-coding gene	gene with protein product		612328					Standard	NM_001008391		Approved	NY-SAR-79	uc001mtv.4	Q6ZRK6	OTTHUMG00000166279	ENST00000335185.5:c.1341delA	11.37:g.32637520delT	ENSP00000335325:p.Lys447fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q6P5Q7|Q6ZMW0|Q86WE7	Frame_Shift_Del	DEL	ENST00000335185.5	37	CCDS41630.1																																																																																				0.249	CCDC73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388874.2	NM_001008391	
MED21	9412	broad.mit.edu;mdanderson.org;bcgsc.ca	37	12	27179446	27179446	+	Missense_Mutation	SNP	C	C	A			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr12:27179446C>A	ENST00000282892.3	+	2	166	c.136C>A	c.(136-138)Cag>Aag	p.Q46K	MED21_ENST00000546323.1_Missense_Mutation_p.Q46K|MED21_ENST00000536503.1_Intron	NM_001271811.1|NM_004264.3	NP_001258740.1|NP_004255.2	Q13503	MED21_HUMAN	mediator complex subunit 21	46					blastocyst development (GO:0001824)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	mediator complex (GO:0016592)	DNA-directed RNA polymerase activity (GO:0003899)|transcription coactivator activity (GO:0003713)					Colorectal(261;0.0847)					TAACAAAGACCAGCCAGCTAA	0.373																																						.											0													120.0	106.0	111.0					12																	27179446		2203	4300	6503	SO:0001583	missense	9412			U46837	CCDS8711.1	12p12	2007-07-30	2007-07-30	2007-07-30		ENSG00000152944			11473	protein-coding gene	gene with protein product		603800	"""SRB7 (suppressor of RNA polymerase B, yeast) homolog"", ""SRB7 suppressor of RNA polymerase B homolog (yeast)"""	SURB7		8598913	Standard	NM_004264		Approved	SRB7	uc001rhp.2	Q13503		ENST00000282892.3:c.136C>A	12.37:g.27179446C>A	ENSP00000282892:p.Gln46Lys	Somatic		WXS	Illumina HiSeq	Phase_I	B2R4I3|Q6IB05|Q92811	Missense_Mutation	SNP	ENST00000282892.3	37	CCDS8711.1	.	.	.	.	.	.	.	.	.	.	C	14.74	2.624150	0.46840	.	.	ENSG00000152944	ENST00000546323;ENST00000282892	.	.	.	4.99	4.99	0.66335	.	0.056410	0.64402	D	0.000001	T	0.48874	0.1524	L	0.44542	1.39	0.80722	D	1	P	0.34462	0.454	B	0.34652	0.187	T	0.45585	-0.9251	9	0.06236	T	0.91	-25.0929	18.762	0.91855	0.0:1.0:0.0:0.0	.	46	Q13503	MED21_HUMAN	K	46	.	ENSP00000282892:Q46K	Q	+	1	0	MED21	27070713	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.995000	0.76257	2.708000	0.92522	0.585000	0.79938	CAG		0.373	MED21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403262.1	NM_004264	
DIAPH3	81624	broad.mit.edu;mdanderson.org;bcgsc.ca	37	13	60240728	60240728	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr13:60240728C>T	ENST00000400324.4	-	28	3792	c.3572G>A	c.(3571-3573)cGa>cAa	p.R1191Q	DIAPH3_ENST00000400320.1_Missense_Mutation_p.R1145Q|DIAPH3_ENST00000377908.2_Missense_Mutation_p.R1180Q|DIAPH3_ENST00000400319.1_Missense_Mutation_p.R1121Q|DIAPH3_ENST00000400330.1_Missense_Mutation_p.R1191Q	NM_001042517.1|NM_001258366.1	NP_001035982.1|NP_001245295.1	Q9NSV4	DIAP3_HUMAN	diaphanous-related formin 3	1191					actin cytoskeleton organization (GO:0030036)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|liver(1)|lung(20)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;2.77e-05)		TTATAAAGCTCGTAATCTTGC	0.323																																						.											0													62.0	59.0	60.0					13																	60240728		1798	4064	5862	SO:0001583	missense	81624			AL137718	CCDS41898.1, CCDS58294.1, CCDS58295.1, CCDS58296.1, CCDS58297.1, CCDS73579.1, CCDS73580.1	13q21.2	2013-05-24	2013-05-24		ENSG00000139734	ENSG00000139734			15480	protein-coding gene	gene with protein product		614567	"""diaphanous (Drosophila, homolog) 3"", ""auditory neuropathy, autosomal dominant 1"", ""diaphanous homolog 3 (Drosophila)"""	AUNA1		14767582, 20624953	Standard	NM_030932		Approved	DRF3, FLJ34705, AN, NSDAN	uc001vht.4	Q9NSV4	OTTHUMG00000017004	ENST00000400324.4:c.3572G>A	13.37:g.60240728C>T	ENSP00000383178:p.Arg1191Gln	Somatic		WXS	Illumina HiSeq	Phase_I	A2A3B8|A2A3B9|A2A3C0|Q18P99|Q18PA0|Q18PA1|Q2KPB6|Q3ZK23|Q5JTP8|Q5T2S7|Q5XKF6|Q6MZF0|Q6NUP0|Q86VS4|Q8NAV4	Missense_Mutation	SNP	ENST00000400324.4	37	CCDS41898.1	.	.	.	.	.	.	.	.	.	.	C	19.51	3.841641	0.71488	.	.	ENSG00000139734	ENST00000400324;ENST00000400330;ENST00000400327;ENST00000413168;ENST00000400329;ENST00000377908;ENST00000400319;ENST00000400320	D;D;D;D;D	0.82803	-1.63;-1.63;-1.65;-1.6;-1.59	5.55	4.7	0.59300	.	1.783920	0.04654	U	0.407671	D	0.87442	0.6178	N	0.24115	0.695	0.28433	N	0.917184	D	0.89917	1.0	D	0.79108	0.992	T	0.78945	-0.2004	10	0.87932	D	0	.	14.7908	0.69841	0.0:0.9292:0.0:0.0708	.	1191	Q9NSV4	DIAP3_HUMAN	Q	1191;1191;1180;1145;1121;1180;1121;1145	ENSP00000383178:R1191Q;ENSP00000383184:R1191Q;ENSP00000367141:R1180Q;ENSP00000383173:R1121Q;ENSP00000383174:R1145Q	ENSP00000367141:R1180Q	R	-	2	0	DIAPH3	59138729	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.392000	0.59659	2.602000	0.87976	0.655000	0.94253	CGA		0.323	DIAPH3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045166.3	NM_001042517	
CD276	80381	broad.mit.edu;mdanderson.org	37	15	73996604	73996604	+	Missense_Mutation	SNP	G	G	A	rs150186392	byFrequency	TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr15:73996604G>A	ENST00000318443.5	+	6	1462	c.1160G>A	c.(1159-1161)cGg>cAg	p.R387Q	CD276_ENST00000318424.5_Missense_Mutation_p.R169Q|CD276_ENST00000564751.1_Missense_Mutation_p.R169Q|CD276_ENST00000561213.1_Missense_Mutation_p.R387Q|CD276_ENST00000537340.2_Missense_Mutation_p.R241Q	NM_001024736.1	NP_001019907.1	Q5ZPR3	CD276_HUMAN	CD276 molecule	387	Ig-like C2-type 2.			R -> Q (in Ref. 3; AAQ88709). {ECO:0000305}.	cell proliferation (GO:0008283)|immune response (GO:0006955)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interleukin-2 biosynthetic process (GO:0045085)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of bone mineralization (GO:0030501)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-2 secretion (GO:1900042)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of T cell proliferation (GO:0042102)|regulation of immune response (GO:0050776)|T cell activation (GO:0042110)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor binding (GO:0005102)	p.R387Q(1)		endometrium(3)|lung(5)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	13						TCCAGCTACCGGGGCTACCCT	0.637													G|||	8	0.00159744	0.0023	0.0014	5008	,	,		21293	0.001		0.003	False		,,,				2504	0.0					.											1	Substitution - Missense(1)	lung(1)											97.0	88.0	91.0					15																	73996604		2198	4297	6495	SO:0001583	missense	80381			AF302102	CCDS10251.1, CCDS32288.1	15q23-q24	2013-01-11	2006-03-28		ENSG00000103855	ENSG00000103855		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	19137	protein-coding gene	gene with protein product		605715	"""CD276 antigen"""			11224528, 12055244	Standard	XM_005254699		Approved	B7-H3, B7H3, B7RP-2	uc002avv.1	Q5ZPR3	OTTHUMG00000137585	ENST00000318443.5:c.1160G>A	15.37:g.73996604G>A	ENSP00000320084:p.Arg387Gln	Somatic		WXS	Illumina HiSeq	Phase_I	Q6P5Y4|Q6UXI2|Q8NBI8|Q8NC34|Q8NCB6|Q9BXR1	Missense_Mutation	SNP	ENST00000318443.5	37	CCDS32288.1	.	.	.	.	.	.	.	.	.	.	G	9.790	1.177721	0.21787	.	.	ENSG00000103855	ENST00000318424;ENST00000318443;ENST00000379823;ENST00000537340	T;T;T	0.16897	2.31;2.31;2.31	4.28	2.34	0.29019	Immunoglobulin subtype (1);CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.430418	0.25130	N	0.032914	T	0.06280	0.0162	N	0.04724	-0.175	0.22531	N	0.999014	B;B;B;B	0.31435	0.073;0.001;0.323;0.276	B;B;B;B	0.25140	0.024;0.002;0.058;0.026	T	0.23797	-1.0178	10	0.62326	D	0.03	-14.0859	3.2429	0.06787	0.3219:0.2114:0.4667:0.0	.	333;169;387;387	B4DK26;Q5ZPR3-2;Q5ZPR3;Q5ZPR3-4	.;.;CD276_HUMAN;.	Q	169;387;387;241	ENSP00000320058:R169Q;ENSP00000320084:R387Q;ENSP00000441087:R241Q	ENSP00000320058:R169Q	R	+	2	0	CD276	71783657	0.984000	0.35163	1.000000	0.80357	0.996000	0.88848	2.125000	0.42016	0.774000	0.33427	0.456000	0.33151	CGG		0.637	CD276-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268979.1	NM_025240	
IL32	9235	broad.mit.edu	37	16	3119142	3119142	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr16:3119142G>A	ENST00000534507.1	+	6	702	c.491G>A	c.(490-492)cGg>cAg	p.R164Q	RNU1-125P_ENST00000516752.1_RNA|IL32_ENST00000008180.9_Missense_Mutation_p.R98Q|IL32_ENST00000551122.1_Intron|IL32_ENST00000552356.1_Missense_Mutation_p.R98Q|IL32_ENST00000528163.2_Missense_Mutation_p.R118Q|IL32_ENST00000444393.3_Missense_Mutation_p.R118Q|IL32_ENST00000440815.3_Missense_Mutation_p.R118Q|IL32_ENST00000382213.3_Missense_Mutation_p.R109Q|IL32_ENST00000552936.1_Missense_Mutation_p.R142Q|IL32_ENST00000529699.1_Missense_Mutation_p.R98Q|IL32_ENST00000548476.1_Missense_Mutation_p.R164Q|IL32_ENST00000530890.1_Missense_Mutation_p.R98Q|IL32_ENST00000552664.1_Missense_Mutation_p.R118Q|IL32_ENST00000396890.2_Missense_Mutation_p.R164Q|IL32_ENST00000551513.1_Missense_Mutation_p.R155Q|IL32_ENST00000525643.2_Missense_Mutation_p.R118Q|IL32_ENST00000533097.2_Missense_Mutation_p.R118Q|IL32_ENST00000526464.2_Missense_Mutation_p.R118Q|IL32_ENST00000396887.3_Intron|IL32_ENST00000548652.1_Missense_Mutation_p.R109Q|IL32_ENST00000530538.2_Missense_Mutation_p.R118Q|IL32_ENST00000531965.1_Missense_Mutation_p.R108Q|IL32_ENST00000548246.1_Missense_Mutation_p.R78Q|IL32_ENST00000529550.1_Missense_Mutation_p.R118Q|IL32_ENST00000549213.1_Intron|IL32_ENST00000325568.5_Missense_Mutation_p.R118Q			P24001	IL32_HUMAN	interleukin 32	164					cell adhesion (GO:0007155)|defense response (GO:0006952)|immune response (GO:0006955)	extracellular space (GO:0005615)|membrane (GO:0016020)				breast(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	15						ATGCTGCAGCGGCTGCAGACC	0.602																																						.											0													14.0	17.0	16.0					16																	3119142		2187	4273	6460	SO:0001583	missense	9235			M59807	CCDS32377.1, CCDS32378.1, CCDS32379.1, CCDS45394.1	16p13.3	2011-07-21			ENSG00000008517	ENSG00000008517		"""Interleukins and interleukin receptors"""	16830	protein-coding gene	gene with protein product	"""natural killer cell transcript 4"""	606001				1729377, 9653642	Standard	XM_005255686		Approved	NK4, TAIF, TAIFb, TAIFd	uc002ctn.3	P24001	OTTHUMG00000167498	ENST00000534507.1:c.491G>A	16.37:g.3119142G>A	ENSP00000431775:p.Arg164Gln	Somatic		WXS	Illumina HiSeq	Phase_I	A6NNM0|A8MPX0|B4DJM1|B8Q191|D3DUB0|D3DUB2|Q5VFH7|Q5VFH8|Q8WV38|Q96GK9	Missense_Mutation	SNP	ENST00000534507.1	37		.	.	.	.	.	.	.	.	.	.	G	12.54	1.967547	0.34754	.	.	ENSG00000008517	ENST00000325568;ENST00000534507;ENST00000531965;ENST00000529699;ENST00000526464;ENST00000440815;ENST00000529550;ENST00000525643;ENST00000548807;ENST00000528163;ENST00000530890;ENST00000444393;ENST00000533097;ENST00000008180;ENST00000396890;ENST00000525228;ENST00000548652;ENST00000530538;ENST00000552936;ENST00000548476;ENST00000552664;ENST00000552356;ENST00000551513;ENST00000382213;ENST00000548246	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.73047	-0.71;0.84;0.84;0.84;-0.71;-0.71;-0.71;-0.71;0.84;-0.71;0.84;-0.71;-0.71;0.84;0.84;-0.71;-0.71;-0.71;0.84;0.84;-0.71;0.84;0.84;-0.71;0.84	1.89	-1.81	0.07882	.	.	.	.	.	T	0.50718	0.1632	N	0.14661	0.345	0.09310	N	1	P;P;P;P;P;P	0.41188	0.741;0.741;0.741;0.741;0.555;0.741	B;B;B;B;B;B	0.42916	0.312;0.402;0.402;0.312;0.116;0.402	T	0.43475	-0.9389	9	0.39692	T	0.17	.	5.3676	0.16123	0.5537:0.0:0.4463:0.0	.	78;98;109;98;164;118	B8Q191;C6GKH1;A6NNM0;A8MPX0;P24001;P24001-2	.;.;.;.;IL32_HUMAN;.	Q	118;164;108;98;118;118;118;118;164;118;98;118;118;98;164;89;109;118;142;164;118;98;155;109;78	ENSP00000324742:R118Q;ENSP00000431775:R164Q;ENSP00000433177:R108Q;ENSP00000436937:R98Q;ENSP00000450364:R118Q;ENSP00000405063:R118Q;ENSP00000437020:R118Q;ENSP00000432218:R118Q;ENSP00000448354:R164Q;ENSP00000432850:R118Q;ENSP00000433747:R98Q;ENSP00000411958:R118Q;ENSP00000432917:R118Q;ENSP00000008180:R98Q;ENSP00000380099:R164Q;ENSP00000431740:R89Q;ENSP00000446624:R109Q;ENSP00000436929:R118Q;ENSP00000447033:R142Q;ENSP00000449483:R164Q;ENSP00000448683:R118Q;ENSP00000446978:R98Q;ENSP00000449147:R155Q;ENSP00000371648:R109Q;ENSP00000447979:R78Q	ENSP00000008180:R98Q	R	+	2	0	IL32	3059143	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.432000	0.06956	-0.401000	0.07644	-0.287000	0.09952	CGG		0.602	IL32-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000394812.2	NM_004221	
KIAA0753	9851	broad.mit.edu;ucsc.edu;mdanderson.org	37	17	6515464	6515464	+	Silent	SNP	C	C	T			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr17:6515464C>T	ENST00000361413.3	-	8	1678	c.1320G>A	c.(1318-1320)aaG>aaA	p.K440K	KIAA0753_ENST00000542606.1_Silent_p.K141K|KIAA0753_ENST00000572370.1_Silent_p.K141K|KIAA0753_ENST00000589033.1_Intron	NM_014804.2	NP_055619.2	Q2KHM9	K0753_HUMAN	KIAA0753	440						centrosome (GO:0005813)|cytoplasm (GO:0005737)				endometrium(4)|large_intestine(11)|lung(5)|prostate(4)	24				COAD - Colon adenocarcinoma(228;0.157)		CGGGCTGATACTTATCTACAT	0.393																																						.											0													79.0	79.0	79.0					17																	6515464		1846	4094	5940	SO:0001819	synonymous_variant	9851				CCDS42247.1	17p13.1	2014-04-04			ENSG00000198920	ENSG00000198920			29110	protein-coding gene	gene with protein product						24613305	Standard	NM_014804		Approved		uc002gde.4	Q2KHM9	OTTHUMG00000177928	ENST00000361413.3:c.1320G>A	17.37:g.6515464C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A8KA11|B7Z479|O94853|Q05D97|Q2KHN0|Q9UG45	Silent	SNP	ENST00000361413.3	37	CCDS42247.1																																																																																				0.393	KIAA0753-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439769.3	NM_014804	
LRRC37A16P	651250	broad.mit.edu	37	17	66122126	66122126	+	IGR	DEL	T	T	-	rs35429148		TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr17:66122126delT								LINC00674 (10467 upstream) : LRRC37A16P (4264 downstream)																							TTACAGGttcttttttttttt	0.388																																						.											0																																										SO:0001628	intergenic_variant	100499466																															17.37:g.66122126delT		Somatic		WXS	Illumina HiSeq	Phase_I		RNA	DEL		37																																																																																				0	0.388								
APCDD1	147495	broad.mit.edu;mdanderson.org	37	18	10485688	10485688	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr18:10485688A>G	ENST00000355285.5	+	4	1358	c.1004A>G	c.(1003-1005)aAg>aGg	p.K335R	APCDD1_ENST00000578882.1_Intron	NM_153000.4	NP_694545.1			adenomatosis polyposis coli down-regulated 1											NS(1)|breast(1)|endometrium(3)|large_intestine(5)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22				READ - Rectum adenocarcinoma(15;0.08)		CCGGTGTGCAAGCACCCCACC	0.607																																						.											0													85.0	62.0	70.0					18																	10485688		2203	4300	6503	SO:0001583	missense	147495			AB056722	CCDS11849.1	18p11.21	2006-07-07			ENSG00000154856	ENSG00000154856			15718	protein-coding gene	gene with protein product		607479				12384519	Standard	NM_153000		Approved	B7323	uc002kom.4	Q8J025	OTTHUMG00000131635	ENST00000355285.5:c.1004A>G	18.37:g.10485688A>G	ENSP00000347433:p.Lys335Arg	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000355285.5	37	CCDS11849.1	.	.	.	.	.	.	.	.	.	.	A	11.80	1.747738	0.30955	.	.	ENSG00000154856	ENST00000355285;ENST00000423585	T	0.17054	2.3	4.77	4.77	0.60923	.	0.096491	0.64402	D	0.000001	T	0.10035	0.0246	N	0.20483	0.58	0.80722	D	1	B	0.10296	0.003	B	0.15870	0.014	T	0.06006	-1.0851	10	0.02654	T	1	-48.6664	13.6296	0.62188	1.0:0.0:0.0:0.0	.	335	Q8J025	APCD1_HUMAN	R	335;386	ENSP00000347433:K335R	ENSP00000347433:K335R	K	+	2	0	APCDD1	10475688	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.455000	0.60075	2.013000	0.59113	0.459000	0.35465	AAG		0.607	APCDD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254529.2	NM_153000	
HS6ST1	9394	broad.mit.edu;mdanderson.org	37	2	129025737	129025737	+	Nonstop_Mutation	SNP	T	T	A			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr2:129025737T>A	ENST00000259241.6	-	2	1248	c.1235A>T	c.(1234-1236)tAg>tTg	p.*412L		NM_004807.2	NP_004798.3	O60243	H6ST1_HUMAN	heparan sulfate 6-O-sulfotransferase 1	0					angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|labyrinthine layer blood vessel development (GO:0060716)|lung alveolus development (GO:0048286)|neuron development (GO:0048666)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)	heparan sulfate 6-O-sulfotransferase activity (GO:0017095)|sulfotransferase activity (GO:0008146)			endometrium(3)|liver(1)|lung(7)|pancreas(1)|prostate(2)|skin(1)	15	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.117)		CCACCGCCACTACCACTTCTC	0.642																																						.											0													8.0	9.0	8.0					2																	129025737		1828	3965	5793	SO:0001578	stop_lost	9394			AB006179	CCDS42748.1	2q21	2010-03-19		2002-08-23	ENSG00000136720	ENSG00000136720		"""Sulfotransferases, membrane-bound"""	5201	protein-coding gene	gene with protein product		604846		HS6ST		9535912	Standard	NM_004807		Approved		uc002tpt.4	O60243	OTTHUMG00000153542	ENST00000259241.6:c.1235A>T	2.37:g.129025737T>A		Somatic		WXS	Illumina HiSeq	Phase_I	B4DEP2|B4DJ29|Q53SL2|Q9BVI1	Missense_Mutation	SNP	ENST00000259241.6	37	CCDS42748.1	.	.	.	.	.	.	.	.	.	.	T	15.36	2.810086	0.50421	.	.	ENSG00000136720	ENST00000259241	.	.	.	4.19	4.19	0.49359	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.5576	0.61768	0.0:0.0:0.0:1.0	.	.	.	.	L	412	.	.	X	-	2	0	HS6ST1	128742207	1.000000	0.71417	0.998000	0.56505	0.915000	0.54546	3.892000	0.56235	1.671000	0.50874	0.260000	0.18958	TAG		0.642	HS6ST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331572.1	NM_004807	
RUFY4	285180	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	2	218940146	218940146	+	Missense_Mutation	SNP	G	G	C			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr2:218940146G>C	ENST00000344321.7	+	9	1449	c.931G>C	c.(931-933)Ggg>Cgg	p.G311R	RUFY4_ENST00000463872.1_3'UTR|RUFY4_ENST00000374155.3_Missense_Mutation_p.G331R|RUFY4_ENST00000441828.2_3'UTR	NM_198483.3	NP_940885.2	Q6ZNE9	RUFY4_HUMAN	RUN and FYVE domain containing 4	311							metal ion binding (GO:0046872)			endometrium(2)|kidney(2)|large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(1)	10		Renal(207;0.0915)		Epithelial(149;4.11e-06)|all cancers(144;0.000519)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		GGAGGTGATAGGGATGGAGGC	0.572																																						.											0													36.0	36.0	36.0					2																	218940146		2016	4185	6201	SO:0001583	missense	285180			AK128393		2q35	2007-01-29			ENSG00000188282	ENSG00000188282		"""Zinc fingers, FYVE domain containing"""	24804	protein-coding gene	gene with protein product							Standard	NM_198483		Approved	FLJ46536	uc010fvl.2	Q6ZNE9	OTTHUMG00000155235	ENST00000344321.7:c.931G>C	2.37:g.218940146G>C	ENSP00000345900:p.Gly311Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q6ZR96	Missense_Mutation	SNP	ENST00000344321.7	37		.	.	.	.	.	.	.	.	.	.	G	15.50	2.852055	0.51270	.	.	ENSG00000188282	ENST00000344321;ENST00000374155	T;T	0.52754	1.36;0.65	4.46	-0.99	0.10238	.	0.730338	0.12322	N	0.479218	T	0.26268	0.0641	L	0.29908	0.895	0.09310	N	1	B	0.25235	0.121	B	0.17722	0.019	T	0.15636	-1.0430	10	0.19590	T	0.45	-3.477	3.3551	0.07167	0.4335:0.0:0.3818:0.1847	.	311	Q6ZNE9	RUFY4_HUMAN	R	311;331	ENSP00000345900:G311R;ENSP00000363270:G331R	ENSP00000345900:G311R	G	+	1	0	RUFY4	218648391	0.004000	0.15560	0.000000	0.03702	0.228000	0.25075	1.215000	0.32431	-0.083000	0.12618	0.467000	0.42956	GGG		0.572	RUFY4-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_198483	
NIPSNAP1	8508	broad.mit.edu;mdanderson.org;bcgsc.ca	37	22	29956774	29956774	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr22:29956774C>T	ENST00000216121.7	-	8	909	c.655G>A	c.(655-657)Ggc>Agc	p.G219S		NM_001202502.1|NM_003634.3	NP_001189431.1|NP_003625.2	Q9BPW8	NIPS1_HUMAN	nipsnap homolog 1 (C. elegans)	219					sensory perception of pain (GO:0019233)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|synaptic membrane (GO:0097060)	neurotransmitter binding (GO:0042165)	p.?(1)		large_intestine(2)|lung(2)|skin(1)	5						AAGAAGCCGCCCACTGCCTCC	0.562																																						.											1	Unknown(1)	lung(1)											126.0	122.0	123.0					22																	29956774		2203	4300	6503	SO:0001583	missense	8508			AJ001258	CCDS13860.1	22q12	2013-09-12	2001-11-28		ENSG00000184117	ENSG00000184117			7827	protein-coding gene	gene with protein product	"""4-nitrophenylphosphatase domain and non-neuronal SNAP25-like 1"""	603249	"""NIPSNAP, C. elegans, homolog 1"""			9661659	Standard	NM_003634		Approved		uc003afx.4	Q9BPW8	OTTHUMG00000151294	ENST00000216121.7:c.655G>A	22.37:g.29956774C>T	ENSP00000216121:p.Gly219Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B2RAY3|O43800	Missense_Mutation	SNP	ENST00000216121.7	37	CCDS13860.1	.	.	.	.	.	.	.	.	.	.	C	35	5.553847	0.96501	.	.	ENSG00000184117	ENST00000216121	T	0.71698	-0.59	4.91	4.91	0.64330	Dimeric alpha-beta barrel (1);	0.000000	0.85682	D	0.000000	D	0.88276	0.6393	M	0.93854	3.465	0.80722	D	1	D;D	0.69078	0.997;0.992	D;D	0.79108	0.992;0.954	D	0.90843	0.4725	10	0.66056	D	0.02	-0.3221	18.245	0.89982	0.0:1.0:0.0:0.0	.	199;219	B4DQI7;Q9BPW8	.;NIPS1_HUMAN	S	219	ENSP00000216121:G219S	ENSP00000216121:G219S	G	-	1	0	NIPSNAP1	28286774	1.000000	0.71417	0.902000	0.35471	0.980000	0.70556	7.341000	0.79300	2.716000	0.92895	0.561000	0.74099	GGC		0.562	NIPSNAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322117.1		
EOMES	8320	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	27763289	27763289	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr3:27763289T>C	ENST00000295743.4	-	1	700	c.497A>G	c.(496-498)cAg>cGg	p.Q166R	EOMES_ENST00000449599.1_Missense_Mutation_p.Q166R|EOMES_ENST00000461503.1_Intron|EOMES_ENST00000537516.1_Intron			O95936	EOMES_HUMAN	eomesodermin	166					brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|CD8-positive, alpha-beta T cell differentiation involved in immune response (GO:0002302)|cell differentiation involved in embryonic placenta development (GO:0060706)|cerebral cortex neuron differentiation (GO:0021895)|cerebral cortex regionalization (GO:0021796)|endoderm formation (GO:0001706)|endodermal cell fate specification (GO:0001714)|interferon-gamma production (GO:0032609)|mesoderm formation (GO:0001707)|mesodermal to mesenchymal transition involved in gastrulation (GO:0060809)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|olfactory bulb development (GO:0021772)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|skeletal muscle cell differentiation (GO:0035914)|stem cell maintenance (GO:0019827)|trophectodermal cell differentiation (GO:0001829)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(3)|prostate(1)	21						AGCCGCCGCCTGGTACGGGAA	0.721																																						.											0													4.0	6.0	5.0					3																	27763289		2019	4107	6126	SO:0001583	missense	8320			BC025363	CCDS2646.1, CCDS63585.1	3p24.1	2011-06-13	2010-06-24		ENSG00000163508	ENSG00000163508		"""T-boxes"""	3372	protein-coding gene	gene with protein product	"""T-box brain2"""	604615	"""eomesodermin (Xenopus laevis) homolog"""			9888994, 9434949	Standard	NM_005442		Approved	TBR2	uc003cdy.4	O95936	OTTHUMG00000130570	ENST00000295743.4:c.497A>G	3.37:g.27763289T>C	ENSP00000295743:p.Gln166Arg	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z4I2|B7ZA51|G3XAI5|Q8TAZ2|Q9UPM7	Missense_Mutation	SNP	ENST00000295743.4	37	CCDS2646.1	.	.	.	.	.	.	.	.	.	.	T	12.73	2.026049	0.35701	.	.	ENSG00000163508	ENST00000295743;ENST00000449599;ENST00000535713	D;D	0.85013	-1.93;-1.93	4.11	-0.0134	0.13984	.	1.268390	0.05332	N	0.528499	T	0.69351	0.3101	N	0.08118	0	0.80722	D	1	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.08055	0.003;0.001;0.0	T	0.58589	-0.7610	10	0.42905	T	0.14	.	4.5502	0.12108	0.0:0.1166:0.426:0.4574	.	166;166;166	F5H3K1;G3XAI5;O95936	.;.;EOMES_HUMAN	R	166;166;31	ENSP00000295743:Q166R;ENSP00000388620:Q166R	ENSP00000295743:Q166R	Q	-	2	0	EOMES	27738293	1.000000	0.71417	0.973000	0.42090	0.978000	0.69477	1.439000	0.35013	0.225000	0.20959	0.379000	0.24179	CAG		0.721	EOMES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252995.1	NM_005442	
ERICH6	131831	broad.mit.edu	37	3	150421548	150421548	+	Silent	SNP	T	T	C			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr3:150421548T>C	ENST00000295910.6	-	1	190	c.138A>G	c.(136-138)gaA>gaG	p.E46E	RP11-103G8.2_ENST00000471093.1_RNA|RP11-103G8.2_ENST00000475393.1_RNA|FAM194A_ENST00000491361.1_Intron	NM_152394.3	NP_689607.2												p.E46E(1)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						cctccacctcttcctcctcct	0.607																																						.											1	Substitution - coding silent(1)	endometrium(1)											121.0	108.0	112.0					3																	150421548		2202	4300	6502	SO:0001819	synonymous_variant	131831																														ENST00000295910.6:c.138A>G	3.37:g.150421548T>C		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000295910.6	37	CCDS3151.2																																																																																				0.607	FAM194A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257666.1		
KCTD8	386617	broad.mit.edu	37	4	44177044	44177044	+	Frame_Shift_Del	DEL	T	T	-			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr4:44177044delT	ENST00000360029.3	-	2	1468	c.1185delA	c.(1183-1185)aaafs	p.K395fs		NM_198353.2	NP_938167.1	Q6ZWB6	KCTD8_HUMAN	potassium channel tetramerization domain containing 8	395					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)				central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|prostate(3)|upper_aerodigestive_tract(4)	41						GTACAGGTGCTTTTTTAGAGG	0.502										HNSCC(17;0.042)																												.											0													173.0	176.0	175.0					4																	44177044		2203	4300	6503	SO:0001589	frameshift_variant	386617			AK123347	CCDS3467.1	4p13	2013-06-20	2013-06-20		ENSG00000183783	ENSG00000183783			22394	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 8"""				Standard	NM_198353		Approved		uc003gwu.3	Q6ZWB6	OTTHUMG00000099409	ENST00000360029.3:c.1185delA	4.37:g.44177044delT	ENSP00000353129:p.Lys395fs	Somatic		WXS	Illumina HiSeq	Phase_I	A2RU39	Frame_Shift_Del	DEL	ENST00000360029.3	37	CCDS3467.1																																																																																				0.502	KCTD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216868.1		
CLOCK	9575	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	4	56319289	56319289	+	Nonsense_Mutation	SNP	C	C	A	rs1056478		TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr4:56319289C>A	ENST00000309964.4	-	14	1388	c.1138G>T	c.(1138-1140)Gaa>Taa	p.E380*	CLOCK_ENST00000381322.1_Nonsense_Mutation_p.E380*|CLOCK_ENST00000513440.1_Nonsense_Mutation_p.E380*	NM_004898.3	NP_004889.1	O15516	CLOCK_HUMAN	clock circadian regulator	380	Interaction with NR3C1. {ECO:0000250|UniProtKB:O08785}.		E -> K (in dbSNP:rs1056478).		cellular response to ionizing radiation (GO:0071479)|chromatin organization (GO:0006325)|circadian regulation of gene expression (GO:0032922)|circadian rhythm (GO:0007623)|DNA damage checkpoint (GO:0000077)|histone acetylation (GO:0016573)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of transcription, DNA-templated (GO:0045892)|photoperiodism (GO:0009648)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of hair cycle (GO:0042634)|regulation of insulin secretion (GO:0050796)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of type B pancreatic cell development (GO:2000074)|response to redox state (GO:0051775)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|chromosome (GO:0005694)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|histone acetyltransferase activity (GO:0004402)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(8)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38	Lung NSC(11;0.00335)|Glioma(25;0.08)|all_epithelial(27;0.0992)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(4;1.62e-07)|Lung(4;1.34e-06)|Epithelial(7;0.0107)			GCCCTAACTTCTGCATAACTA	0.338																																						.											0													78.0	75.0	76.0					4																	56319289		2203	4300	6503	SO:0001587	stop_gained	9575			AF011568	CCDS3500.1	4q12	2012-12-07	2012-12-07		ENSG00000134852	ENSG00000134852		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	2082	protein-coding gene	gene with protein product		601851	"""clock (mouse) homolog"", ""clock homolog (mouse)"""			10198158	Standard	NM_001267843		Approved	KIAA0334, KAT13D, bHLHe8	uc003hba.2	O15516	OTTHUMG00000102141	ENST00000309964.4:c.1138G>T	4.37:g.56319289C>A	ENSP00000308741:p.Glu380*	Somatic		WXS	Illumina HiSeq	Phase_I	A0AV01|A2I2N9|O14516|Q9UIT8	Nonsense_Mutation	SNP	ENST00000309964.4	37	CCDS3500.1	.	.	.	.	.	.	.	.	.	.	C	43	10.219861	0.99362	.	.	ENSG00000134852	ENST00000309964;ENST00000381322;ENST00000513440	.	.	.	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	19.423	0.94729	0.0:1.0:0.0:0.0	.	.	.	.	X	380	.	ENSP00000308741:E380X	E	-	1	0	CLOCK	56014046	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.653000	0.67967	2.680000	0.91292	0.650000	0.86243	GAA		0.338	CLOCK-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361993.2	NM_004898	
FSTL5	56884	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	4	162697068	162697068	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr4:162697068C>T	ENST00000306100.5	-	5	1004	c.568G>A	c.(568-570)Gac>Aac	p.D190N	FSTL5_ENST00000536695.1_Missense_Mutation_p.D189N|FSTL5_ENST00000427802.2_Missense_Mutation_p.D189N|FSTL5_ENST00000379164.4_Missense_Mutation_p.D189N	NM_001128427.2|NM_020116.4	NP_001121899.1|NP_064501.2	Q8N475	FSTL5_HUMAN	follistatin-like 5	190	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(18)|lung(43)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	91	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		CCATTACTGTCTGCATCAAAA	0.289																																						.											0													89.0	93.0	91.0					4																	162697068		2203	4294	6497	SO:0001583	missense	56884			BC036502	CCDS3802.1, CCDS47157.1, CCDS47158.1	4q32.3	2013-01-11			ENSG00000168843	ENSG00000168843		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	21386	protein-coding gene	gene with protein product						10574462, 15527507	Standard	NM_020116		Approved	DKFZp566D234, KIAA1263	uc003iqh.4	Q8N475	OTTHUMG00000161397	ENST00000306100.5:c.568G>A	4.37:g.162697068C>T	ENSP00000305334:p.Asp190Asn	Somatic		WXS	Illumina HiSeq	Phase_I	E9PCP6|Q9NSW7|Q9ULF7	Missense_Mutation	SNP	ENST00000306100.5	37	CCDS3802.1	.	.	.	.	.	.	.	.	.	.	C	14.07	2.425985	0.43020	.	.	ENSG00000168843	ENST00000306100;ENST00000379164;ENST00000427802;ENST00000536695	T;T;T;T	0.20598	2.06;2.06;2.06;2.06	5.3	5.3	0.74995	EF-hand-like domain (1);	0.050469	0.85682	D	0.000000	T	0.22975	0.0555	L	0.56124	1.755	0.58432	D	0.999999	B;B;B	0.25390	0.125;0.11;0.125	B;B;B	0.27262	0.028;0.078;0.056	T	0.06445	-1.0826	10	0.10111	T	0.7	.	18.3021	0.90167	0.0:1.0:0.0:0.0	.	189;189;190	E9PCP6;F8VZ90;Q8N475	.;.;FSTL5_HUMAN	N	190;189;189;189	ENSP00000305334:D190N;ENSP00000368462:D189N;ENSP00000389270:D189N;ENSP00000440409:D189N	ENSP00000305334:D190N	D	-	1	0	FSTL5	162916518	0.997000	0.39634	1.000000	0.80357	0.996000	0.88848	3.313000	0.51935	2.625000	0.88918	0.650000	0.86243	GAC		0.289	FSTL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364773.2	NM_020116	
FSTL4	23105	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	5	132534972	132534972	+	Missense_Mutation	SNP	C	C	A			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr5:132534972C>A	ENST00000265342.7	-	16	2593	c.2344G>T	c.(2344-2346)Gca>Tca	p.A782S	CTB-49A3.2_ENST00000509051.1_RNA	NM_015082.1	NP_055897.1	Q6MZW2	FSTL4_HUMAN	follistatin-like 4	782						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(8)|skin(2)|upper_aerodigestive_tract(1)	23		all_cancers(142;0.244)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GCTGGCCCTGCGGGTGGCTCC	0.602																																						.											0													43.0	43.0	43.0					5																	132534972		2203	4300	6503	SO:0001583	missense	23105			AB028984	CCDS34238.1	5q31.1	2013-01-29			ENSG00000053108	ENSG00000053108		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21389	protein-coding gene	gene with protein product						10470851, 15527507	Standard	NM_015082		Approved	KIAA1061	uc003kyn.1	Q6MZW2	OTTHUMG00000162729	ENST00000265342.7:c.2344G>T	5.37:g.132534972C>A	ENSP00000265342:p.Ala782Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q8TBU0|Q9UPU1	Missense_Mutation	SNP	ENST00000265342.7	37	CCDS34238.1	.	.	.	.	.	.	.	.	.	.	T	3.228	-0.158117	0.06544	.	.	ENSG00000053108	ENST00000265342;ENST00000360575	T	0.25579	1.79	4.9	-9.79	0.00494	.	1.566590	0.03671	N	0.243995	T	0.15435	0.0372	L	0.42245	1.32	0.09310	N	1	B;B	0.15141	0.012;0.001	B;B	0.11329	0.006;0.004	T	0.15578	-1.0432	10	0.09590	T	0.72	2.0844	6.6114	0.22753	0.1669:0.5332:0.0789:0.2209	.	782;431	Q6MZW2;B3KPF3	FSTL4_HUMAN;.	S	782;613	ENSP00000265342:A782S	ENSP00000265342:A782S	A	-	1	0	FSTL4	132562871	0.000000	0.05858	0.000000	0.03702	0.039000	0.13416	-1.725000	0.01863	-2.178000	0.00768	-0.352000	0.07741	GCA		0.602	FSTL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370212.1	XM_048786	
DIAPH1	1729	broad.mit.edu	37	5	140907261	140907261	+	Frame_Shift_Del	DEL	G	G	-			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr5:140907261delG	ENST00000398557.4	-	24	3292	c.3152delC	c.(3151-3153)tctfs	p.S1051fs	DIAPH1_ENST00000389057.5_Frame_Shift_Del_p.S1042fs|DIAPH1_ENST00000520569.1_Frame_Shift_Del_p.S994fs|DIAPH1_ENST00000389054.3_Frame_Shift_Del_p.S1048fs|DIAPH1_ENST00000398562.2_Frame_Shift_Del_p.S1027fs|DIAPH1_ENST00000518047.1_Frame_Shift_Del_p.S1039fs|DIAPH1_ENST00000494967.1_5'Flank|DIAPH1_ENST00000253811.6_Frame_Shift_Del_p.S1052fs|DIAPH1_ENST00000398566.3_Frame_Shift_Del_p.S1043fs	NM_005219.4	NP_005210.3	O60610	DIAP1_HUMAN	diaphanous-related formin 1	1051	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin filament polymerization (GO:0030041)|cellular response to histamine (GO:0071420)|cytoskeleton organization (GO:0007010)|positive regulation of cell migration (GO:0030335)|protein localization to microtubule (GO:0035372)|regulation of cell shape (GO:0008360)|regulation of microtubule-based process (GO:0032886)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|mitotic spindle (GO:0072686)|ruffle membrane (GO:0032587)	ion channel binding (GO:0044325)|poly(A) RNA binding (GO:0044822)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(12)|pancreas(1)|skin(2)|stomach(2)	23			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTTTTCAGCAGAAACTaaaaa	0.358																																						.											0													46.0	41.0	42.0					5																	140907261		1799	4064	5863	SO:0001589	frameshift_variant	1729			BC007411		5q31	2013-05-24	2013-05-24		ENSG00000131504	ENSG00000131504			2876	protein-coding gene	gene with protein product		602121	"""diaphanous (Drosophila, homolog) 1"", ""diaphanous homolog 1 (Drosophila)"""	DFNA1		9360932, 1350680	Standard	NM_005219		Approved	hDIA1, LFHL1	uc003llb.4	O60610	OTTHUMG00000149893	ENST00000398557.4:c.3152delC	5.37:g.140907261delG	ENSP00000381565:p.Ser1051fs	Somatic		WXS	Illumina HiSeq	Phase_I	A6NF18|B7ZKW2|E9PEZ2|Q17RN4|Q59FH8|Q9UC76	Frame_Shift_Del	DEL	ENST00000398557.4	37	CCDS43374.1																																																																																				0.358	DIAPH1-203	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_005219	
HIST1H2BO	8348	broad.mit.edu;mdanderson.org;bcgsc.ca	37	6	27861260	27861260	+	Missense_Mutation	SNP	C	C	G			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr6:27861260C>G	ENST00000303806.4	+	1	58	c.20C>G	c.(19-21)tCt>tGt	p.S7C	HIST1H2AM_ENST00000359611.2_5'Flank|HIST1H3J_ENST00000479986.1_5'Flank|HIST1H3J_ENST00000359303.2_5'Flank	NM_003527.4	NP_003518.2	P23527	H2B1O_HUMAN	histone cluster 1, H2bo	7					chromatin organization (GO:0006325)|nucleosome assembly (GO:0006334)	nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)										CCGGCTAAATCTGCTCCTGCC	0.498																																						.											0													51.0	55.0	54.0					6																	27861260		2203	4300	6503	SO:0001583	missense	8348			X57138	CCDS4640.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000196331			"""Histones / Replication-dependent"""	4758	protein-coding gene	gene with protein product		602808	"""H2B histone family, member N"", ""histone 1, H2bo"""	H2BFN		1768865, 12408966	Standard	NM_003527		Approved	H2B/n, H2B.2	uc003nkc.1	P23527	OTTHUMG00000014493	ENST00000303806.4:c.20C>G	6.37:g.27861260C>G	ENSP00000303408:p.Ser7Cys	Somatic		WXS	Illumina HiSeq	Phase_I	Q3KPI7|Q8TCV6	Missense_Mutation	SNP	ENST00000303806.4	37	CCDS4640.1	.	.	.	.	.	.	.	.	.	.	C	17.01	3.279650	0.59758	.	.	ENSG00000196331	ENST00000303806	T	0.19105	2.17	3.7	3.7	0.42460	Histone-fold (2);	.	.	.	.	T	0.25344	0.0616	M	0.85859	2.78	0.35931	D	0.832534	D	0.54047	0.964	P	0.45610	0.487	T	0.40979	-0.9534	9	0.87932	D	0	.	15.2409	0.73468	0.0:1.0:0.0:0.0	.	7	P23527	H2B1O_HUMAN	C	7	ENSP00000303408:S7C	ENSP00000303408:S7C	S	+	2	0	HIST1H2BO	27969239	0.988000	0.35896	0.544000	0.28141	0.045000	0.14185	3.909000	0.56363	2.356000	0.79943	0.561000	0.74099	TCT		0.498	HIST1H2BO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040161.1	NM_003527	
WBSCR17	64409	broad.mit.edu	37	7	70880909	70880909	+	Missense_Mutation	SNP	C	C	A			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr7:70880909C>A	ENST00000333538.5	+	4	1258	c.624C>A	c.(622-624)caC>caA	p.H208Q	WBSCR17_ENST00000498380.2_3'UTR	NM_022479.1	NP_071924.1	Q6IS24	GLTL3_HUMAN	Williams-Beuren syndrome chromosome region 17	208	Catalytic subdomain A.				protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(5)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(7)|large_intestine(22)|lung(45)|ovary(2)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	100		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				AGTATGTCCACAAACGCTACC	0.512																																						.											0													72.0	67.0	68.0					7																	70880909		2203	4300	6503	SO:0001583	missense	64409			AF410457	CCDS5540.1	7q11.23	2014-03-13			ENSG00000185274	ENSG00000185274		"""Glycosyltransferase family 2 domain containing"""	16347	protein-coding gene	gene with protein product	"""polypeptide N-acetylgalactosaminyltransferase-like 3"", ""polypeptide GalNAc transferase 3"""	615137				12073013, 15744064, 22787146	Standard	NM_022479		Approved	GALNTL3, GalNAc-T5L	uc003tvy.4	Q6IS24	OTTHUMG00000129783	ENST00000333538.5:c.624C>A	7.37:g.70880909C>A	ENSP00000329654:p.His208Gln	Somatic		WXS	Illumina HiSeq	Phase_I	Q8NFV9|Q9NTA8	Missense_Mutation	SNP	ENST00000333538.5	37	CCDS5540.1	.	.	.	.	.	.	.	.	.	.	C	14.64	2.597224	0.46318	.	.	ENSG00000185274	ENST00000333538;ENST00000447516	T;T	0.60040	0.22;2.03	5.17	2.99	0.34606	Glycosyl transferase, family 2 (1);	0.161582	0.53938	N	0.000060	T	0.25754	0.0627	N	0.01522	-0.82	0.39451	D	0.967404	B	0.18310	0.027	B	0.22152	0.038	T	0.08166	-1.0735	10	0.12766	T	0.61	.	9.7602	0.40528	0.0:0.7346:0.1376:0.1277	.	208	Q6IS24	GLTL3_HUMAN	Q	208;186	ENSP00000329654:H208Q;ENSP00000392019:H186Q	ENSP00000329654:H208Q	H	+	3	2	WBSCR17	70518845	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.171000	0.31896	1.170000	0.42753	0.563000	0.77884	CAC		0.512	WBSCR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252006.1	NM_022479	
ARHGEF5	7984	broad.mit.edu	37	7	144062428	144062428	+	Frame_Shift_Del	DEL	T	T	-			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr7:144062428delT	ENST00000056217.5	+	2	2840	c.2666delT	c.(2665-2667)ctcfs	p.L889fs	ARHGEF5_ENST00000471847.2_5'Flank	NM_005435.3	NP_005426.2	Q12774	ARHG5_HUMAN	Rho guanine nucleotide exchange factor (GEF) 5	889					actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)|myeloid dendritic cell chemotaxis (GO:0002408)|positive regulation of podosome assembly (GO:0071803)|regulation of Rho GTPase activity (GO:0032319)		GTP binding (GO:0005525)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.L889P(1)		breast(1)|endometrium(6)|kidney(8)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Melanoma(164;0.14)					ACAGTCCCCCTCCCTGCCTCT	0.597																																						.											1	Substitution - Missense(1)	large_intestine(1)											12.0	14.0	13.0					7																	144062428		2011	4057	6068	SO:0001589	frameshift_variant	7984			U02082	CCDS34771.1	7q35	2012-09-20			ENSG00000050327	ENSG00000050327		"""Rho guanine nucleotide exchange factors"""	13209	protein-coding gene	gene with protein product	"""transforming immortalized mammary oncogene"", ""guanine nucleotide regulatory protein TIM"""	600888				8134109, 7656213	Standard	NM_005435		Approved	TIM, TIM1, GEF5, P60	uc003wel.3	Q12774	OTTHUMG00000158004	ENST00000056217.5:c.2666delT	7.37:g.144062428delT	ENSP00000056217:p.Leu889fs	Somatic		WXS	Illumina HiSeq	Phase_I	A6NNJ2|Q6ZML7	Frame_Shift_Del	DEL	ENST00000056217.5	37	CCDS34771.1																																																																																				0.597	ARHGEF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349981.1	NM_005435	
MTMR9	66036	broad.mit.edu	37	8	11162509	11162509	+	Frame_Shift_Del	DEL	A	A	-			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr8:11162509delA	ENST00000221086.3	+	4	1050	c.577delA	c.(577-579)aaafs	p.K194fs	MTMR9_ENST00000526292.1_Frame_Shift_Del_p.K109fs	NM_015458.3	NP_056273.2	Q96QG7	MTMR9_HUMAN	myotubularin related protein 9	194	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.			K -> R (in Ref. 2; BAA91170). {ECO:0000305}.		cytoplasm (GO:0005737)	enzyme regulator activity (GO:0030234)|phosphatase activity (GO:0016791)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|urinary_tract(2)	16			STAD - Stomach adenocarcinoma(15;0.215)	COAD - Colon adenocarcinoma(149;0.0678)		CTATTACCACAAAAAAAATGG	0.453																																						.											0													97.0	82.0	87.0					8																	11162509		2203	4300	6503	SO:0001589	frameshift_variant	66036			AJ297823	CCDS5979.1	8p23-p22	2011-06-09	2002-09-05	2002-09-06	ENSG00000104643	ENSG00000104643		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	14596	protein-coding gene	gene with protein product		606260	"""myotubularin related protein 8"""	C8orf9, MTMR8		11472061, 11896452, 12890864	Standard	NM_015458		Approved	DKFZp434K171, LIP-STYX	uc003wtm.3	Q96QG7	OTTHUMG00000090647	ENST00000221086.3:c.577delA	8.37:g.11162509delA	ENSP00000221086:p.Lys194fs	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z291|Q52LU3|Q8WW11|Q96QG6|Q9NX50	Frame_Shift_Del	DEL	ENST00000221086.3	37	CCDS5979.1																																																																																				0.453	MTMR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207307.2	NM_015458	
CPNE3	8895	broad.mit.edu	37	8	87558847	87558847	+	Frame_Shift_Del	DEL	A	A	-			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr8:87558847delA	ENST00000521271.1	+	10	919	c.757delA	c.(757-759)aaafs	p.K254fs	CPNE3_ENST00000198765.4_Frame_Shift_Del_p.K254fs	NM_003909.3	NP_003900.1	O75131	CPNE3_HUMAN	copine III	254					lipid metabolic process (GO:0006629)|protein phosphorylation (GO:0006468)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	calcium-dependent phospholipid binding (GO:0005544)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)|transporter activity (GO:0005215)			NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	23						CATAAATGAGAAAAAAAGGCA	0.308																																						.											0													90.0	104.0	99.0					8																	87558847		2203	4300	6503	SO:0001589	frameshift_variant	8895			AB014536	CCDS6243.1	8q21	2008-07-03				ENSG00000085719			2316	protein-coding gene	gene with protein product		604207				9430674	Standard	NM_003909		Approved		uc003ydv.2	O75131		ENST00000521271.1:c.757delA	8.37:g.87558847delA	ENSP00000430934:p.Lys254fs	Somatic		WXS	Illumina HiSeq	Phase_I	A8KA47|Q8IYA1	Frame_Shift_Del	DEL	ENST00000521271.1	37	CCDS6243.1																																																																																				0.308	CPNE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374994.1		
KCNQ3	3786	broad.mit.edu;ucsc.edu;mdanderson.org	37	8	133141626	133141626	+	Silent	SNP	G	G	A			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr8:133141626G>A	ENST00000388996.4	-	15	2922	c.2502C>T	c.(2500-2502)gcC>gcT	p.A834A	KCNQ3_ENST00000521134.1_Silent_p.A714A|KCNQ3_ENST00000519445.1_Silent_p.A822A	NM_004519.3	NP_004510.1	O43525	KCNQ3_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 3	834					axon guidance (GO:0007411)|membrane hyperpolarization (GO:0060081)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	70	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	TCTCACCCTCGGCGAGGTACC	0.592																																						.											0													77.0	67.0	70.0					8																	133141626		2203	4300	6503	SO:0001819	synonymous_variant	3786			AB208890	CCDS34943.1, CCDS56554.1	8q24	2012-07-05			ENSG00000184156	ENSG00000184156		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6297	protein-coding gene	gene with protein product		602232		EBN2		9425900, 16382104	Standard	NM_004519		Approved	Kv7.3	uc003ytj.3	O43525	OTTHUMG00000137472	ENST00000388996.4:c.2502C>T	8.37:g.133141626G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A2VCT8|B4DJY4|E7EQ89	Silent	SNP	ENST00000388996.4	37	CCDS34943.1																																																																																				0.592	KCNQ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268621.2	NM_004519	
PHF20L1	51105	broad.mit.edu;mdanderson.org	37	8	133851655	133851655	+	Missense_Mutation	SNP	C	C	T	rs371605549		TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr8:133851655C>T	ENST00000395386.2	+	18	2514	c.2215C>T	c.(2215-2217)Cgt>Tgt	p.R739C	PHF20L1_ENST00000220847.7_Missense_Mutation_p.R126C|PHF20L1_ENST00000395390.2_Missense_Mutation_p.R714C|AF230666.2_ENST00000429151.1_RNA|AF230666.2_ENST00000608375.1_RNA	NM_016018.4	NP_057102.4	A8MW92	P20L1_HUMAN	PHD finger protein 20-like 1	739							zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(1)|lung(10)|ovary(2)	15	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			TGCAAAATATCGTTATGATAA	0.368																																						.											0								C	CYS/ARG	0,3774		0,0,1887	135.0	129.0	131.0		2215	5.4	0.9	8		131	1,8249		0,1,4124	no	missense	PHF20L1	NM_016018.4	180	0,1,6011	TT,TC,CC		0.0121,0.0,0.0083	possibly-damaging	739/1018	133851655	1,12023	1887	4125	6012	SO:0001583	missense	51105			AF230666	CCDS6367.2, CCDS6368.1, CCDS75791.1	8q24.22	2014-03-24			ENSG00000129292	ENSG00000129292		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	24280	protein-coding gene	gene with protein product	"""tudor domain containing 20B"""					10810093, 24492612	Standard	NM_016018		Approved	CGI-72, FLJ13649, MGC64923, FLJ21615, TDRD20B	uc003ytt.3	A8MW92	OTTHUMG00000148656	ENST00000395386.2:c.2215C>T	8.37:g.133851655C>T	ENSP00000378784:p.Arg739Cys	Somatic		WXS	Illumina HiSeq	Phase_I	A8MZC9|Q86U89|Q86W43|Q96BT0|Q9H702|Q9HBK3|Q9NYR3|Q9Y381	Missense_Mutation	SNP	ENST00000395386.2	37	CCDS6367.2	.	.	.	.	.	.	.	.	.	.	C	18.44	3.624173	0.66901	0.0	1.21E-4	ENSG00000129292	ENST00000395386;ENST00000220847;ENST00000395390	T;T	0.32023	1.47;1.47	5.41	5.41	0.78517	Zinc finger, FYVE/PHD-type (1);	0.405112	0.24003	U	0.042449	T	0.42268	0.1195	L	0.54323	1.7	0.58432	D	0.999992	D;D	0.64830	0.994;0.99	P;B	0.50049	0.629;0.425	T	0.35176	-0.9799	10	0.66056	D	0.02	-30.1161	18.1918	0.89809	0.0:1.0:0.0:0.0	.	714;739	F8W9L8;A8MW92	.;P20L1_HUMAN	C	739;126;714	ENSP00000378784:R739C;ENSP00000378788:R714C	ENSP00000220847:R126C	R	+	1	0	PHF20L1	133920837	1.000000	0.71417	0.945000	0.38365	0.976000	0.68499	4.465000	0.60141	2.552000	0.86080	0.655000	0.94253	CGT		0.368	PHF20L1-008	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308949.3	NM_016018	
COL22A1	169044	broad.mit.edu;ucsc.edu;mdanderson.org	37	8	139674282	139674282	+	Silent	SNP	G	G	A	rs368271751		TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr8:139674282G>A	ENST00000303045.6	-	43	3677	c.3231C>T	c.(3229-3231)gcC>gcT	p.A1077A	COL22A1_ENST00000341807.4_5'UTR|COL22A1_ENST00000435777.1_Silent_p.A1057A	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	1077	Collagen-like 9.|Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			CGTCCCGGCCGGCTGGGCCCT	0.542										HNSCC(7;0.00092)																												.											0								G		0,4406		0,0,2203	106.0	95.0	99.0		3231	-2.6	1.0	8		99	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	COL22A1	NM_152888.1		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		1077/1627	139674282	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	169044			AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.3231C>T	8.37:g.139674282G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B7ZMH0|C9K0G4|Q8IVT9	Silent	SNP	ENST00000303045.6	37	CCDS6376.1																																																																																				0.542	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257	
DOCK8	81704	broad.mit.edu	37	9	405015	405015	+	Frame_Shift_Del	DEL	T	T	-			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr9:405015delT	ENST00000453981.1	+	27	3444	c.3332delT	c.(3331-3333)cttfs	p.L1111fs	DOCK8_ENST00000469391.1_Frame_Shift_Del_p.L1011fs|DOCK8_ENST00000432829.2_Frame_Shift_Del_p.L1043fs|DOCK8_ENST00000382329.1_Frame_Shift_Del_p.L578fs|DOCK8_ENST00000382331.1_Frame_Shift_Del_p.L413fs			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	1111					blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		AATCTGAACCTTTTTTTTATG	0.393																																						.											0													132.0	114.0	121.0					9																	405015		2203	4300	6503	SO:0001589	frameshift_variant	81704			AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.3332delT	9.37:g.405015delT	ENSP00000408464:p.Leu1111fs	Somatic		WXS	Illumina HiSeq	Phase_I	A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Frame_Shift_Del	DEL	ENST00000453981.1	37	CCDS6440.2																																																																																				0.393	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171792.5	XM_036307	
GNA14	9630	broad.mit.edu	37	9	80049325	80049325	+	Silent	SNP	G	G	A			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr9:80049325G>A	ENST00000341700.6	-	3	936	c.423C>T	c.(421-423)taC>taT	p.Y141Y	GNA14_ENST00000464095.1_5'Flank	NM_004297.3	NP_004288.1	O95837	GNA14_HUMAN	guanine nucleotide binding protein (G protein), alpha 14	141					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|platelet activation (GO:0030168)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			endometrium(3)|kidney(1)|large_intestine(7)|lung(4)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	24						TCCTCCTGTCGTAACACTCCT	0.582											OREG0019263	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										.											0													120.0	93.0	102.0					9																	80049325		2203	4300	6503	SO:0001819	synonymous_variant	9630			AF105201	CCDS6657.1	9q21	2008-05-23			ENSG00000156049	ENSG00000156049			4382	protein-coding gene	gene with protein product		604397				10191087, 17620339	Standard	NM_004297		Approved		uc004aku.3	O95837	OTTHUMG00000020058	ENST00000341700.6:c.423C>T	9.37:g.80049325G>A		Somatic	1195	WXS	Illumina HiSeq	Phase_I	B1ALW3	Silent	SNP	ENST00000341700.6	37	CCDS6657.1																																																																																				0.582	GNA14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052759.1		
RP11-383M4.6	0	broad.mit.edu;mdanderson.org	37	9	84562780	84562780	+	lincRNA	SNP	G	G	A			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr9:84562780G>A	ENST00000585776.1	-	0	942				SPATA31D3_ENST00000334208.4_RNA																							ATTAAACATCGAAATTTGGCA	0.458																																						.											0													95.0	76.0	81.0					9																	84562780		692	1591	2283			389762																															9.37:g.84562780G>A		Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000585776.1	37																																																																																					0.458	RP11-383M4.6-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000453562.1		
HEMGN	55363	broad.mit.edu;mdanderson.org	37	9	100693400	100693400	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr9:100693400C>T	ENST00000259456.3	-	4	420	c.277G>A	c.(277-279)Gaa>Aaa	p.E93K		NM_018437.3|NM_197978.2	NP_060907.2|NP_932095.1	Q9BXL5	HEMGN_HUMAN	hemogen	93					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)	nucleus (GO:0005634)				NS(1)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|skin(2)|urinary_tract(1)	27		Acute lymphoblastic leukemia(62;0.0559)				ATTTCCTTTTCTATCTGTGGC	0.443																																						.											0													154.0	146.0	149.0					9																	100693400		2203	4300	6503	SO:0001583	missense	55363			AF228713	CCDS6731.1	9q22.33	2014-01-21			ENSG00000136929	ENSG00000136929			17509	protein-coding gene	gene with protein product		610715					Standard	NM_018437		Approved	EDAG, CT155, NDR	uc004axy.4	Q9BXL5	OTTHUMG00000020336	ENST00000259456.3:c.277G>A	9.37:g.100693400C>T	ENSP00000259456:p.Glu93Lys	Somatic		WXS	Illumina HiSeq	Phase_I	Q6XAR3|Q86XY5|Q9NPC0	Missense_Mutation	SNP	ENST00000259456.3	37	CCDS6731.1	.	.	.	.	.	.	.	.	.	.	C	10.06	1.248041	0.22880	.	.	ENSG00000136929	ENST00000375112;ENST00000259456	.	.	.	4.84	1.5	0.22942	.	0.604415	0.17410	N	0.175222	T	0.18923	0.0454	N	0.19112	0.55	0.09310	N	1	B	0.26602	0.154	B	0.23716	0.048	T	0.15263	-1.0443	9	0.26408	T	0.33	-4.9581	5.7006	0.17881	0.0:0.5751:0.0:0.4249	.	93	Q9BXL5	HEMGN_HUMAN	K	93	.	ENSP00000259456:E93K	E	-	1	0	HEMGN	99733221	0.855000	0.29742	0.267000	0.24556	0.773000	0.43773	0.103000	0.15292	0.533000	0.28675	0.591000	0.81541	GAA		0.443	HEMGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053344.2	NM_197978	
MUC5B	727897	broad.mit.edu	37	11	1264078	1264079	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr11:1264078_1264079insC	ENST00000529681.1	+	31	6026_6027	c.5968_5969insC	c.(5968-5970)accfs	p.T1990fs	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Frame_Shift_Ins_p.T1993fs	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	1990	11 X approximate tandem repeats, Ser/Thr- rich.|7 X Cys-rich subdomain repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CTCCCTGGGCACCACCTGGACC	0.629																																						.											0																																										SO:0001589	frameshift_variant	727897			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.5970dupC	11.37:g.1264080_1264080dupC	ENSP00000436812:p.Thr1990fs	Somatic		WXS	Illumina HiSeq	Phase_I	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Frame_Shift_Ins	INS	ENST00000529681.1	37	CCDS44515.2																																																																																				0.629	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
MTG2	26164	broad.mit.edu	37	20	60774224	60774225	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr20:60774224_60774225insC	ENST00000370823.3	+	6	755_756	c.737_738insC	c.(736-741)aacgccfs	p.A247fs	MTG2_ENST00000436421.2_Intron|MTG2_ENST00000536470.1_Frame_Shift_Ins_p.A19fs	NM_015666.3	NP_056481.1	Q9H4K7	MTG2_HUMAN	mitochondrial ribosome-associated GTPase 2	247	Localized in the mitochondria.|Not localized in the mitochondria.|OBG-type G.				GTP catabolic process (GO:0006184)|regulation of mitochondrial translation (GO:0070129)|regulation of respiratory system process (GO:0044065)|ribosome biogenesis (GO:0042254)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial ribosome (GO:0005761)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|magnesium ion binding (GO:0000287)										GCCATTTCAAACGCCAGACCCG	0.614																																						.											0																																										SO:0001589	frameshift_variant	26164			AK001603	CCDS13492.1	20q13.33	2013-05-24	2013-05-24	2013-05-24	ENSG00000101181	ENSG00000101181			16239	protein-coding gene	gene with protein product		610919	"""GTP-binding protein 5 (putative)"", ""GTP binding protein 5 (putative)"""	GTPBP5		17054726, 23396448	Standard	NM_015666		Approved	FLJ10741, dJ1005F21.2, ObgH1		Q9H4K7	OTTHUMG00000032897	ENST00000370823.3:c.738dupC	20.37:g.60774225_60774225dupC	ENSP00000359859:p.Ala247fs	Somatic		WXS	Illumina HiSeq	Phase_I	A6NDR3|B4DR85|Q96I17|Q9NVG9|Q9UFR4	Frame_Shift_Ins	INS	ENST00000370823.3	37	CCDS13492.1																																																																																				0.614	MTG2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079989.1	NM_015666	
PLXND1	23129	broad.mit.edu	37	3	129290413	129290414	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr3:129290413_129290414insC	ENST00000324093.4	-	17	3452_3453	c.3274_3275insG	c.(3274-3276)gagfs	p.E1092fs	PLXND1_ENST00000393239.1_Frame_Shift_Ins_p.E1092fs	NM_015103.2	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1	1092	IPT/TIG 3.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell migration (GO:0043542)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|positive regulation of protein binding (GO:0032092)|regulation of angiogenesis (GO:0045765)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|synapse assembly (GO:0007416)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)		PLXND1/TMCC1(4)	NS(1)|breast(1)|endometrium(4)|kidney(5)|large_intestine(17)|lung(28)|prostate(10)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	72						GTGGAAACGCTCACCAGCCACT	0.658																																					Ovarian(97;366 1484 3738 22084 39045)	.											0																																										SO:0001589	frameshift_variant	23129			AY116661	CCDS33854.1	3q21.3	2007-05-16			ENSG00000004399	ENSG00000004399		"""Plexins"""	9107	protein-coding gene	gene with protein product		604282				12412018	Standard	NM_015103		Approved	KIAA0620	uc003emx.2	Q9Y4D7	OTTHUMG00000159547	ENST00000324093.4:c.3275dupG	3.37:g.129290414_129290414dupC	ENSP00000317128:p.Glu1092fs	Somatic		WXS	Illumina HiSeq	Phase_I	A7E2C6|C9JPZ6|Q6PJS9|Q8IZJ2|Q9BTQ2	Frame_Shift_Ins	INS	ENST00000324093.4	37	CCDS33854.1																																																																																				0.658	PLXND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356132.4	NM_015103	
FAM46A	55603	ucsc.edu	37	6	82461832	82461832	+	Silent	SNP	G	G	A			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr6:82461832G>A	ENST00000320172.6	-	2	341	c.27C>T	c.(25-27)gcC>gcT	p.A9A	FAM46A_ENST00000369756.3_Silent_p.A90A|FAM46A_ENST00000369754.3_Silent_p.A28A	NM_017633.2	NP_060103.2	Q96IP4	FA46A_HUMAN	family with sequence similarity 46, member A	9					regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)		poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(3)|lung(5)|skin(1)|urinary_tract(1)	12		all_cancers(76;6.74e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000282)|all_epithelial(107;0.0104)		BRCA - Breast invasive adenocarcinoma(397;0.0428)		CCTCAGACATGGCGAAGTACC	0.677																																						.											0													4.0	5.0	4.0					6																	82461832		1640	3652	5292	SO:0001819	synonymous_variant	55603			AF350451	CCDS34489.1	6q14	2008-07-03	2004-08-19	2004-08-26	ENSG00000112773	ENSG00000112773			18345	protein-coding gene	gene with protein product		611357	"""chromosome 6 open reading frame 37"""	C6orf37		12054608, 17803723	Standard	NM_017633		Approved	FLJ20037	uc003pjg.3	Q96IP4	OTTHUMG00000015097	ENST00000320172.6:c.27C>T	6.37:g.82461832G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A8K7U4|Q5TF86|Q8NFZ9|Q9BW32|Q9NXV5	Silent	SNP	ENST00000320172.6	37	CCDS34489.1																																																																																				0.677	FAM46A-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041331.1		
FUT11	170384	ucsc.edu;bcgsc.ca	37	10	75532602	75532602	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr10:75532602T>C	ENST00000372841.3	+	1	554	c.511T>C	c.(511-513)Ttc>Ctc	p.F171L	AC022400.2_ENST00000595757.1_5'Flank|FUT11_ENST00000394790.1_Missense_Mutation_p.F171L|FUT11_ENST00000465695.1_3'UTR|RMRPP1_ENST00000517236.1_RNA	NM_173540.2	NP_775811.2	Q495W5	FUT11_HUMAN	fucosyltransferase 11 (alpha (1,3) fucosyltransferase)	171					protein glycosylation (GO:0006486)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-(1->3)-fucosyltransferase activity (GO:0046920)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(3)	7	Prostate(51;0.0112)					TACCTCCACCTTCAGTCGCCA	0.682																																						.											0													22.0	24.0	24.0					10																	75532602		2061	4087	6148	SO:0001583	missense	170384			BC036037	CCDS7333.1, CCDS60558.1	10q22.3	2014-01-02			ENSG00000196968	ENSG00000196968		"""Fucosyltransferases"""	19233	protein-coding gene	gene with protein product						11698403, 24318988	Standard	NM_173540		Approved	MGC33202	uc001jva.3	Q495W5	OTTHUMG00000018483	ENST00000372841.3:c.511T>C	10.37:g.75532602T>C	ENSP00000361932:p.Phe171Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q495W7|Q8IYE4	Missense_Mutation	SNP	ENST00000372841.3	37	CCDS7333.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.422370	0.83559	.	.	ENSG00000196968	ENST00000372841;ENST00000394790	T;T	0.28666	1.6;1.6	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.60379	0.2264	M	0.90425	3.115	0.80722	D	1	D;D;P	0.60160	0.987;0.957;0.693	D;P;P	0.63381	0.914;0.723;0.67	T	0.69580	-0.5107	10	0.66056	D	0.02	-40.4463	14.5265	0.67892	0.0:0.0:0.0:1.0	.	171;171;171	Q495W5;Q495W5-2;B2RC53	FUT11_HUMAN;.;.	L	171	ENSP00000361932:F171L;ENSP00000378270:F171L	ENSP00000361932:F171L	F	+	1	0	FUT11	75202608	1.000000	0.71417	0.998000	0.56505	0.320000	0.28249	7.951000	0.87819	2.040000	0.60383	0.379000	0.24179	TTC		0.682	FUT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048689.1	NM_173540	
GDPD3	79153	ucsc.edu;bcgsc.ca	37	16	30122776	30122776	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr16:30122776C>T	ENST00000406256.3	-	7	1017	c.640G>A	c.(640-642)Ggg>Agg	p.G214R	RP11-455F5.4_ENST00000566190.1_RNA	NM_024307.2	NP_077283.2	Q7L5L3	GDPD3_HUMAN	glycerophosphodiester phosphodiesterase domain containing 3	214	GP-PDE.				glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	glycerophosphodiester phosphodiesterase activity (GO:0008889)|metal ion binding (GO:0046872)			biliary_tract(1)|breast(1)|central_nervous_system(1)|large_intestine(2)|lung(6)	11						GGCAGCAGCCCCAGGTAGTAG	0.552																																						.											0													134.0	136.0	135.0					16																	30122776		2197	4300	6497	SO:0001583	missense	79153			AK026256	CCDS10671.2	16p11.2	2008-02-05			ENSG00000102886	ENSG00000102886			28638	protein-coding gene	gene with protein product							Standard	NM_024307		Approved	MGC4171	uc002dwp.3	Q7L5L3	OTTHUMG00000132106	ENST00000406256.3:c.640G>A	16.37:g.30122776C>T	ENSP00000384363:p.Gly214Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q9H652	Missense_Mutation	SNP	ENST00000406256.3	37	CCDS10671.2	.	.	.	.	.	.	.	.	.	.	C	25.1	4.606060	0.87157	.	.	ENSG00000102886	ENST00000406256;ENST00000360688	T	0.12039	2.72	5.45	5.45	0.79879	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);	0.000000	0.85682	D	0.000000	T	0.44393	0.1291	M	0.88775	2.98	0.52099	D	0.999946	D	0.89917	1.0	D	0.91635	0.999	T	0.50717	-0.8795	10	0.72032	D	0.01	.	14.7878	0.69816	0.0:1.0:0.0:0.0	.	214	Q7L5L3	GDPD3_HUMAN	R	214;152	ENSP00000384363:G214R	ENSP00000353909:G152R	G	-	1	0	GDPD3	30030277	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	4.966000	0.63715	2.523000	0.85059	0.655000	0.94253	GGG		0.552	GDPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255144.1	NM_024307	
HSPG2	3339	ucsc.edu	37	1	22211304	22211304	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr1:22211304A>G	ENST00000374695.3	-	12	1542	c.1463T>C	c.(1462-1464)gTg>gCg	p.V488A		NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	488	Ig-like C2-type 1.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	AATGCCAAACACCATGCCCCG	0.642																																						.											0													54.0	42.0	46.0					1																	22211304		2203	4300	6503	SO:0001583	missense	3339			M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.1463T>C	1.37:g.22211304A>G	ENSP00000363827:p.Val488Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	ENST00000374695.3	37	CCDS30625.1	.	.	.	.	.	.	.	.	.	.	A	14.29	2.492182	0.44352	.	.	ENSG00000142798	ENST00000374695	T	0.37752	1.18	5.32	4.18	0.49190	.	0.000000	0.33110	N	0.005264	T	0.42086	0.1187	N	0.21282	0.65	0.52501	D	0.999958	D	0.59357	0.985	D	0.73708	0.981	T	0.25502	-1.0130	10	0.48119	T	0.1	.	9.4212	0.38553	0.9145:0.0:0.0854:0.0	.	488	P98160	PGBM_HUMAN	A	488	ENSP00000363827:V488A	ENSP00000363827:V488A	V	-	2	0	HSPG2	22083891	1.000000	0.71417	1.000000	0.80357	0.083000	0.17756	6.779000	0.75057	0.848000	0.35191	-0.441000	0.05720	GTG		0.642	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529	
OR2T27	403239	ucsc.edu	37	1	248813292	248813292	+	Silent	SNP	T	T	C	rs71199329	byFrequency	TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr1:248813292T>C	ENST00000344889.3	-	1	893	c.894A>G	c.(892-894)acA>acG	p.T298T		NM_001001824.1	NP_001001824.1	Q8NH04	O2T27_HUMAN	olfactory receptor, family 2, subfamily T, member 27	298						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|endometrium(2)|large_intestine(4)|lung(20)|skin(3)|stomach(1)	32	all_cancers(71;1.15e-05)|all_epithelial(71;5.29e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.089)|Lung NSC(105;0.0969)|Melanoma(84;0.199)	all_cancers(173;0.237)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GTAGGGCCCCTGTGACATCCT	0.468													t|||	437	0.0872604	0.2269	0.0519	5008	,	,		19865	0.0159		0.0586	False		,,,				2504	0.0266					.											0								C		324,4022		71,182,1920	70.0	72.0	72.0		894	-4.9	0.0	1	dbSNP_130	72	282,8262		35,212,4025	no	coding-synonymous	OR2T27	NM_001001824.1		106,394,5945	CC,CT,TT		3.3006,7.4551,4.7013		298/318	248813292	606,12284	2173	4272	6445	SO:0001819	synonymous_variant	403239				CCDS31124.1	1q44	2012-08-09			ENSG00000187701	ENSG00000187701		"""GPCR / Class A : Olfactory receptors"""	31252	protein-coding gene	gene with protein product							Standard	NM_001001824		Approved		uc010pzo.2	Q8NH04	OTTHUMG00000040376	ENST00000344889.3:c.894A>G	1.37:g.248813292T>C		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000344889.3	37	CCDS31124.1																																																																																				0.468	OR2T27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097124.1	NM_001001824	
PNPLA7	375775	ucsc.edu;mdanderson.org;bcgsc.ca	37	9	140409846	140409846	+	Missense_Mutation	SNP	G	G	C			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr9:140409846G>C	ENST00000277531.4	-	11	1321	c.1135C>G	c.(1135-1137)Cct>Gct	p.P379A	PNPLA7_ENST00000406427.1_Missense_Mutation_p.P404A|PNPLA7_ENST00000371457.1_5'UTR	NM_152286.3	NP_689499.3	Q6ZV29	PLPL7_HUMAN	patatin-like phospholipase domain containing 7	379					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	lysophospholipase activity (GO:0004622)			breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_cancers(76;0.126)			OV - Ovarian serous cystadenocarcinoma(145;0.000268)|Epithelial(140;0.000839)		GGGGCCGAAGGGTCAGGGTCA	0.647																																						.											0													23.0	26.0	25.0					9																	140409846		2183	4289	6472	SO:0001583	missense	375775			AK126267	CCDS7045.1, CCDS48070.1	9q34.3	2009-01-12	2006-06-12	2006-06-12	ENSG00000130653	ENSG00000130653		"""Patatin-like phospholipase domain containing"""	24768	protein-coding gene	gene with protein product		612122	"""chromosome 9 open reading frame 111"""	C9orf111		16799181, 12640454, 19029121	Standard	XM_005266082		Approved	FLJ43070, FLJ31318, FLJ44279, RP11-48C7.2, NTEL1, NTE-R1	uc010ncj.1	Q6ZV29	OTTHUMG00000020990	ENST00000277531.4:c.1135C>G	9.37:g.140409846G>C	ENSP00000277531:p.Pro379Ala	Somatic		WXS	Illumina HiSeq	Phase_I	B5MDD3|Q5T364|Q658X0|Q658Y3|Q6ZTS1|Q86YU8|Q8TAY5|Q96N75|Q9H7N5	Missense_Mutation	SNP	ENST00000277531.4	37	CCDS7045.1	.	.	.	.	.	.	.	.	.	.	g	1.074	-0.669022	0.03403	.	.	ENSG00000130653	ENST00000371446;ENST00000277531;ENST00000406427;ENST00000371451;ENST00000434090;ENST00000371450	T;T;T;T	0.57273	3.5;0.41;0.41;0.41	4.53	-1.66	0.08265	.	0.479528	0.20919	N	0.083313	T	0.34483	0.0899	L	0.57536	1.79	0.09310	N	1	B;B;B	0.20671	0.039;0.047;0.011	B;B;B	0.17722	0.016;0.019;0.009	T	0.20806	-1.0264	10	0.07990	T	0.79	0.3579	2.6459	0.04984	0.0946:0.2603:0.3661:0.2791	.	111;404;379	E2QRF8;Q6ZV29-5;Q6ZV29	.;.;PLPL7_HUMAN	A	111;379;404;379;370;404	ENSP00000360501:P111A;ENSP00000277531:P379A;ENSP00000384610:P404A;ENSP00000400582:P370A	ENSP00000277531:P379A	P	-	1	0	PNPLA7	139529667	0.001000	0.12720	0.001000	0.08648	0.493000	0.33554	0.070000	0.14573	0.001000	0.14605	0.437000	0.28790	CCT		0.647	PNPLA7-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254787.1	NM_152286	
TM9SF3	56889	ucsc.edu	37	10	98307653	98307653	+	Splice_Site	SNP	T	T	C			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr10:98307653T>C	ENST00000371142.4	-	8	1269	c.1053A>G	c.(1051-1053)ggA>ggG	p.G351G	TM9SF3_ENST00000490192.1_5'UTR	NM_020123.3	NP_064508.3	Q9HD45	TM9S3_HUMAN	transmembrane 9 superfamily member 3	351						integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|kidney(3)|large_intestine(6)|lung(2)|prostate(1)	15		Colorectal(252;0.158)		Epithelial(162;1.84e-09)|all cancers(201;2.84e-08)		GTAAGTTACCTCCTTGTCTAG	0.368																																						.											0													141.0	139.0	140.0					10																	98307653		2203	4300	6503	SO:0001630	splice_region_variant	56889			AF160213, AF269150	CCDS7450.1	10q24.2	2006-04-12			ENSG00000077147	ENSG00000077147			21529	protein-coding gene	gene with protein product						11530251, 11595169	Standard	NM_020123		Approved	SMBP	uc001kmm.4	Q9HD45	OTTHUMG00000018834	ENST00000371142.4:c.1054+1A>G	10.37:g.98307653T>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q5TB57|Q6UWE7|Q9NWL8|Q9P0G9|Q9UHW8	Silent	SNP	ENST00000371142.4	37	CCDS7450.1																																																																																				0.368	TM9SF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049610.2	NM_020123	Silent
WDR72	256764	ucsc.edu;mdanderson.org;bcgsc.ca	37	15	53908269	53908269	+	Missense_Mutation	SNP	C	C	A			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr15:53908269C>A	ENST00000396328.1	-	15	2373	c.2134G>T	c.(2134-2136)Gtc>Ttc	p.V712F	WDR72_ENST00000557913.1_Missense_Mutation_p.V709F|WDR72_ENST00000559418.1_Missense_Mutation_p.V722F|WDR72_ENST00000360509.5_Missense_Mutation_p.V712F	NM_001277176.1|NM_182758.2	NP_001264105.1|NP_877435.3	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	712										NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(18)|lung(29)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	71				all cancers(107;0.0511)		CTTCTCAGGACCTCACCACCA	0.448																																						.											0													103.0	90.0	95.0					15																	53908269		2194	4293	6487	SO:0001583	missense	256764			BX537884	CCDS10151.1, CCDS73730.1	15q21.3	2013-01-09			ENSG00000166415	ENSG00000166415		"""WD repeat domain containing"""	26790	protein-coding gene	gene with protein product		613214					Standard	NM_182758		Approved	FLJ38736	uc002acj.2	Q3MJ13	OTTHUMG00000131939	ENST00000396328.1:c.2134G>T	15.37:g.53908269C>A	ENSP00000379619:p.Val712Phe	Somatic		WXS	Illumina HiSeq	Phase_I	Q7Z3I3|Q8N8X2	Missense_Mutation	SNP	ENST00000396328.1	37	CCDS10151.1	.	.	.	.	.	.	.	.	.	.	C	4.185	0.032979	0.08101	.	.	ENSG00000166415	ENST00000396328;ENST00000360509	T;T	0.35236	1.32;1.32	5.63	0.289	0.15723	.	0.547874	0.18921	N	0.127463	T	0.10594	0.0259	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.19549	-1.0302	10	0.10111	T	0.7	.	1.2131	0.01908	0.1372:0.2327:0.1424:0.4877	.	712	Q3MJ13	WDR72_HUMAN	F	712	ENSP00000379619:V712F;ENSP00000353699:V712F	ENSP00000353699:V712F	V	-	1	0	WDR72	51695561	0.371000	0.25056	0.248000	0.24265	0.239000	0.25481	0.442000	0.21628	0.070000	0.16634	-0.471000	0.05019	GTC		0.448	WDR72-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254893.2	NM_182758	
ADAM21	8747	mdanderson.org	37	14	70924294	70924294	+	Silent	SNP	C	C	T	rs112060847		TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr14:70924294C>T	ENST00000603540.1	+	2	336	c.78C>T	c.(76-78)tcC>tcT	p.S26S	ADAM21_ENST00000267499.3_Silent_p.S26S|RP11-486O13.4_ENST00000556646.1_lincRNA	NM_003813.3	NP_003804.2	Q9UKJ8	ADA21_HUMAN	ADAM metallopeptidase domain 21	26					binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	axon (GO:0030424)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	31				all cancers(60;0.00326)|BRCA - Breast invasive adenocarcinoma(234;0.00646)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		TGTCTATTTCCGGCTACTGTC	0.542																																						.											0													101.0	110.0	107.0					14																	70924294		2203	4300	6503	SO:0001819	synonymous_variant	8747			AF029900	CCDS9804.1	14q24.1	2008-09-05	2005-08-18		ENSG00000139985	ENSG00000139985		"""ADAM metallopeptidase domain containing"""	200	protein-coding gene	gene with protein product		603713	"""a disintegrin and metalloproteinase domain 21"""			9469942	Standard	NM_003813		Approved	ADAM31	uc001xmd.3	Q9UKJ8		ENST00000603540.1:c.78C>T	14.37:g.70924294C>T		Somatic		WXS	Illumina HiSeq	Phase_I	O43507|Q2VPC6|Q32MR0	Silent	SNP	ENST00000603540.1	37	CCDS9804.1																																																																																				0.542	ADAM21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413008.3		
CD1A	909	mdanderson.org	37	1	158226667	158226667	+	Silent	SNP	C	C	T	rs1042388	byFrequency	TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr1:158226667C>T	ENST00000289429.5	+	4	1229	c.696C>T	c.(694-696)ccC>ccT	p.P232P		NM_001763.2	NP_001754.2	P06126	CD1A_HUMAN	CD1a molecule	232	Ig-like.				antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)				NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(14)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	32	all_hematologic(112;0.0378)				Antithymocyte globulin(DB00098)	ACCCAAAGCCCGTGTGGGTGA	0.627													c|||	169	0.033746	0.0129	0.049	5008	,	,		17473	0.0		0.0835	False		,,,				2504	0.0348					.											0								C		111,4295	84.8+/-123.5	4,103,2096	90.0	85.0	86.0		696	-7.6	0.0	1	dbSNP_86	86	768,7828	182.8+/-231.1	27,714,3557	no	coding-synonymous	CD1A	NM_001763.2		31,817,5653	TT,TC,CC		8.9344,2.5193,6.7605		232/328	158226667	879,12123	2203	4298	6501	SO:0001819	synonymous_variant	909			M28825	CCDS1174.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158477	ENSG00000158477		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1634	protein-coding gene	gene with protein product		188370	"""CD1A antigen, a polypeptide"", ""CD1a antigen"""	CD1		2447586, 2784820	Standard	NM_001763		Approved		uc001frt.3	P06126	OTTHUMG00000017512	ENST00000289429.5:c.696C>T	1.37:g.158226667C>T		Somatic		WXS	Illumina HiSeq	Phase_I	D3DVD7|Q13962|Q5TDJ8|Q9UMM4|Q9Y5M5	Silent	SNP	ENST00000289429.5	37	CCDS1174.1																																																																																				0.627	CD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046349.2	NM_001763	
COL6A5	256076	mdanderson.org	37	3	130113788	130113788	+	Silent	SNP	A	A	G			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr3:130113788A>G	ENST00000432398.2	+	8	3542	c.3048A>G	c.(3046-3048)gtA>gtG	p.V1016V	COL6A5_ENST00000265379.6_Silent_p.V1016V	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	1016	Nonhelical region.|VWFA 6. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						CTGACAGGGTATCTAATTCAG	0.348																																						.											0													85.0	72.0	76.0					3																	130113788		692	1591	2283	SO:0001819	synonymous_variant	256076			AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.3048A>G	3.37:g.130113788A>G		Somatic		WXS	Illumina HiSeq	Phase_I	A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Silent	SNP	ENST00000432398.2	37																																																																																					0.348	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_153264	
DDX11	1663	mdanderson.org	37	12	31244665	31244665	+	Missense_Mutation	SNP	C	C	T	rs201612562	byFrequency	TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr12:31244665C>T	ENST00000407793.2	+	10	1353	c.1102C>T	c.(1102-1104)Ccc>Tcc	p.P368S	DDX11_ENST00000251758.5_3'UTR|DDX11_ENST00000350437.4_Missense_Mutation_p.P368S|DDX11_ENST00000542838.1_Missense_Mutation_p.P368S|DDX11_ENST00000228264.6_Missense_Mutation_p.P342S|DDX11_ENST00000545668.1_Missense_Mutation_p.P368S	NM_030653.3|NM_152438.1	NP_085911.2|NP_689651.1	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11	368	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(11)|large_intestine(5)|lung(23)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	57	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					GGTGGTGCTGCCCTATCAGAT	0.662										Multiple Myeloma(12;0.14)			C|||	112	0.0223642	0.0189	0.0173	5008	,	,		18386	0.0337		0.0139	False		,,,				2504	0.0276					.											0													12.0	13.0	13.0					12																	31244665		2159	4229	6388	SO:0001583	missense	1663			U75969	CCDS8721.1, CCDS41767.1, CCDS44856.1, CCDS58224.1	12p11.21	2012-02-23	2012-02-23		ENSG00000013573	ENSG00000013573		"""DEAD-boxes"""	2736	protein-coding gene	gene with protein product	"""CHL1-like helicase homolog (S. cerevisiae)"""	601150	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (S.cerevisiae CHL1-like helicase)"", ""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11"""				Standard	NM_030653		Approved	CHLR1, KRG2, CHL1, ChlR1, WABS	uc001rjv.2	Q96FC9	OTTHUMG00000168435	ENST00000407793.2:c.1102C>T	12.37:g.31244665C>T	ENSP00000384703:p.Pro368Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	ENST00000407793.2	37	CCDS44856.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.966413	0.74131	.	.	ENSG00000013573	ENST00000542838;ENST00000407793;ENST00000404673;ENST00000228264;ENST00000545668;ENST00000350437	T;T;T;T;T	0.38401	1.14;1.14;1.14;1.14;1.14	3.05	3.05	0.35203	DEAD2 (1);Helicase-like, DEXD box c2 type (1);Helicase, superfamily 1/2, ATP-binding domain, DinG/Rad3-type (1);	0.114571	0.64402	D	0.000009	T	0.66528	0.2798	M	0.93283	3.4	0.80722	D	1	D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;1.0	D;D;D;D;D	0.87578	0.998;0.985;0.997;0.984;0.99	T	0.75260	-0.3380	10	0.72032	D	0.01	.	11.6158	0.51090	0.0:1.0:0.0:0.0	.	93;342;368;368;368	Q93000;Q96FC9-3;Q96FC9;Q96FC9-4;Q96FC9-2	.;.;DDX11_HUMAN;.;.	S	368;368;93;342;368;368	ENSP00000443426:P368S;ENSP00000384703:P368S;ENSP00000228264:P342S;ENSP00000440402:P368S;ENSP00000309965:P368S	ENSP00000228264:P342S	P	+	1	0	DDX11	31135932	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	6.995000	0.76257	1.535000	0.49220	0.505000	0.49811	CCC		0.662	DDX11-202	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000399728.1	NM_030653	
FAM83D	81610	mdanderson.org	37	20	37555116	37555116	+	Missense_Mutation	SNP	G	G	C	rs3752290	byFrequency	TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr20:37555116G>C	ENST00000217429.4	+	1	162	c.121G>C	c.(121-123)Gtg>Ctg	p.V41L		NM_030919.2	NP_112181.2	Q9H4H8	FA83D_HUMAN	family with sequence similarity 83, member D	11					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				endometrium(2)|kidney(2)|large_intestine(7)|lung(12)|ovary(4)|stomach(1)	28		Myeloproliferative disorder(115;0.00878)				CCTGGACGAGGTGCCCGCCGC	0.701													C|||	2010	0.401358	0.5076	0.3847	5008	,	,		10968	0.4157		0.3429	False		,,,				2504	0.3149					.											0								C	LEU/VAL	1601,2097		394,813,642	8.0	11.0	10.0		121	3.4	0.9	20	dbSNP_107	10	2399,5669		370,1659,2005	no	missense	FAM83D	NM_030919.2	32	764,2472,2647	CC,CG,GG		29.7348,43.2937,33.9963	benign	41/616	37555116	4000,7766	1849	4034	5883	SO:0001583	missense	81610			AL023803	CCDS42872.1	20q11.23	2014-03-13	2006-03-23	2006-03-23	ENSG00000101447	ENSG00000101447			16122	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 129"""	C20orf129		23205133	Standard	NM_030919		Approved	dJ616B8.3	uc002xjg.3	Q9H4H8	OTTHUMG00000032462	ENST00000217429.4:c.121G>C	20.37:g.37555116G>C	ENSP00000217429:p.Val41Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B4E1I7|Q5THR2|Q68EN1|Q6P457|Q7Z6H0|Q96DF5|Q96N89|Q9BVM8	Missense_Mutation	SNP	ENST00000217429.4	37	CCDS42872.1	870	0.3983516483516483	269	0.5467479674796748	136	0.3756906077348066	202	0.3531468531468531	263	0.3469656992084433	C	0.704	-0.789777	0.02884	0.432937	0.297348	ENSG00000101447	ENST00000217429;ENST00000424027	T	0.10477	2.87	5.48	3.44	0.39384	.	0.490125	0.16258	N	0.222396	T	0.00012	0.0000	N	0.02011	-0.69	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.38757	-0.9646	9	0.06891	T	0.86	.	7.0157	0.24887	0.0:0.4204:0.417:0.1626	rs3752290;rs17846649;rs17859744;rs3752290	11;11	Q9H4H8;Q9H4H8-2	FA83D_HUMAN;.	L	41;11	ENSP00000217429:V41L	ENSP00000217429:V41L	V	+	1	0	FAM83D	36988530	0.003000	0.15002	0.905000	0.35620	0.017000	0.09413	0.278000	0.18753	0.696000	0.31696	-0.120000	0.15030	GTG		0.701	FAM83D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079211.1		
FCGBP	8857	mdanderson.org	37	19	40376927	40376927	+	Missense_Mutation	SNP	G	G	A	rs146581881		TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr19:40376927G>A	ENST00000221347.6	-	24	11502	c.11495C>T	c.(11494-11496)cCg>cTg	p.P3832L	FCGBP_ENST00000595713.1_5'UTR	NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	3832	VWFD 9. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GGTGGGCGGCGGCAGGCAGGG	0.647																																						.											0								G	LEU/PRO	3,4323		1,1,2161	17.0	19.0	18.0		11495	0.9	0.0	19	dbSNP_134	18	0,8552		0,0,4276	no	missense	FCGBP	NM_003890.2	98	1,1,6437	AA,AG,GG		0.0,0.0693,0.0233	possibly-damaging	3832/5406	40376927	3,12875	2163	4276	6439	SO:0001583	missense	8857			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.11495C>T	19.37:g.40376927G>A	ENSP00000221347:p.Pro3832Leu	Somatic		WXS	Illumina HiSeq	Phase_I	O95784	Missense_Mutation	SNP	ENST00000221347.6	37	CCDS12546.1	.	.	.	.	.	.	.	.	.	.	g	12.14	1.850084	0.32699	6.93E-4	0.0	ENSG00000090920	ENST00000221347	T	0.18502	2.21	3.33	0.901	0.19284	von Willebrand factor, type D domain (1);	.	.	.	.	T	0.11793	0.0287	L	0.60845	1.875	0.09310	N	1	P	0.43352	0.804	B	0.27262	0.078	T	0.19451	-1.0305	9	0.33141	T	0.24	.	6.7765	0.23622	0.0:0.3655:0.4479:0.1865	.	3832	Q9Y6R7	FCGBP_HUMAN	L	3832	ENSP00000221347:P3832L	ENSP00000221347:P3832L	P	-	2	0	FCGBP	45068767	0.000000	0.05858	0.002000	0.10522	0.035000	0.12851	0.229000	0.17833	0.137000	0.18759	0.313000	0.20887	CCG		0.647	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
FKBP4	2288	mdanderson.org;bcgsc.ca	37	12	2907983	2907983	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr12:2907983A>G	ENST00000001008.4	+	4	692	c.505A>G	c.(505-507)Atc>Gtc	p.I169V	RP4-816N1.6_ENST00000547834.1_RNA|RP4-816N1.7_ENST00000547042.1_RNA	NM_002014.3	NP_002005.1	Q02790	FKBP4_HUMAN	FK506 binding protein 4, 59kDa	169	PPIase FKBP-type 2. {ECO:0000255|PROSITE- ProRule:PRU00277}.				androgen receptor signaling pathway (GO:0030521)|chaperone-mediated protein folding (GO:0061077)|copper ion transport (GO:0006825)|embryo implantation (GO:0007566)|male sex differentiation (GO:0046661)|negative regulation of microtubule polymerization (GO:0031115)|negative regulation of microtubule polymerization or depolymerization (GO:0031111)|negative regulation of neuron projection development (GO:0010977)|prostate gland development (GO:0030850)|protein complex localization (GO:0031503)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)|steroid hormone receptor complex assembly (GO:0006463)	axonal growth cone (GO:0044295)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|FK506 binding (GO:0005528)|GTP binding (GO:0005525)|heat shock protein binding (GO:0031072)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(2)|skin(1)	14			OV - Ovarian serous cystadenocarcinoma(31;0.00105)			TGAGGGTGCTATCGTGGAGGG	0.493																																						.											0													100.0	88.0	92.0					12																	2907983		2203	4300	6503	SO:0001583	missense	2288			M88279	CCDS8512.1	12p13.33	2013-01-10	2002-08-29		ENSG00000004478	ENSG00000004478		"""Tetratricopeptide (TTC) repeat domain containing"""	3720	protein-coding gene	gene with protein product		600611	"""FK506-binding protein 4 (59kD)"""			1279700	Standard	NM_002014		Approved	FKBP59, FKBP52	uc001qkz.3	Q02790	OTTHUMG00000090429	ENST00000001008.4:c.505A>G	12.37:g.2907983A>G	ENSP00000001008:p.Ile169Val	Somatic		WXS	Illumina HiSeq	Phase_I	D3DUQ1|Q9UCP1|Q9UCV7	Missense_Mutation	SNP	ENST00000001008.4	37	CCDS8512.1	.	.	.	.	.	.	.	.	.	.	A	5.452	0.268424	0.10349	.	.	ENSG00000004478	ENST00000001008	D	0.85258	-1.96	5.08	-4.03	0.04021	Peptidyl-prolyl cis-trans isomerase, FKBP-type, domain (2);	1.031610	0.07658	N	0.933160	T	0.63462	0.2513	N	0.04355	-0.22	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.53078	-0.8489	10	0.09590	T	0.72	0.0032	9.1629	0.37035	0.2291:0.5673:0.2036:0.0	.	169	Q02790	FKBP4_HUMAN	V	169	ENSP00000001008:I169V	ENSP00000001008:I169V	I	+	1	0	FKBP4	2778244	0.000000	0.05858	0.002000	0.10522	0.139000	0.21198	-0.714000	0.05002	-1.127000	0.02925	-0.468000	0.05107	ATC		0.493	FKBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206861.1		
FMNL1	752	mdanderson.org	37	17	43319770	43319770	+	Silent	SNP	C	C	T	rs1801353	byFrequency	TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr17:43319770C>T	ENST00000331495.3	+	16	2284	c.1948C>T	c.(1948-1950)Ctg>Ttg	p.L650L	CTD-2020K17.3_ENST00000393507.2_RNA|FMNL1_ENST00000587489.1_Silent_p.L228L|FMNL1_ENST00000328118.3_Silent_p.L650L|CTD-2020K17.3_ENST00000587534.1_RNA|CTD-2020K17.4_ENST00000420431.2_RNA	NM_005892.3	NP_005883	O95466	FMNL_HUMAN	formin-like 1	650	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin filament severing (GO:0051014)|cortical actin cytoskeleton organization (GO:0030866)|regulation of cell shape (GO:0008360)|substrate-dependent cell migration (GO:0006929)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|GTPase activating protein binding (GO:0032794)|Rac GTPase binding (GO:0048365)			biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(12)|pancreas(1)|skin(1)|urinary_tract(2)	33						CTGGGTGGCACTGAAACCCAG	0.602													C|||	1608	0.321086	0.1036	0.4265	5008	,	,		17304	0.2837		0.4483	False		,,,				2504	0.4479				GBM(164;1247 1997 8702 11086 51972)	.											0								C		706,3700	294.7+/-283.3	60,586,1557	90.0	73.0	79.0		1948	1.7	1.0	17	dbSNP_89	79	4305,4295	576.8+/-390.4	1079,2147,1074	no	coding-synonymous	FMNL1	NM_005892.3		1139,2733,2631	TT,TC,CC		49.9419,16.0236,38.5284		650/1101	43319770	5011,7995	2203	4300	6503	SO:0001819	synonymous_variant	752			AJ008112	CCDS11497.1	17q21.31	2008-05-14	2003-12-02	2003-12-03		ENSG00000184922			1212	protein-coding gene	gene with protein product		604656	"""formin-like"""	C17orf1B, FMNL		9799091	Standard	NM_005892		Approved	C17orf1	uc002iin.3	O95466		ENST00000331495.3:c.1948C>T	17.37:g.43319770C>T		Somatic		WXS	Illumina HiSeq	Phase_I	D2DGW2|Q6DKG5|Q6IBP3|Q86UH1|Q8N671|Q8TDH1|Q96H10	Silent	SNP	ENST00000331495.3	37	CCDS11497.1																																																																																				0.602	FMNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450198.1	NM_005892	
FUT3	2525	mdanderson.org	37	19	5843877	5843877	+	Missense_Mutation	SNP	G	G	A	rs28381969	byFrequency	TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr19:5843877G>A	ENST00000303225.6	-	3	1608	c.974C>T	c.(973-975)aCg>aTg	p.T325M	FUT3_ENST00000593144.1_5'Flank|FUT3_ENST00000458379.2_Missense_Mutation_p.T325M|FUT3_ENST00000589918.1_Missense_Mutation_p.T325M|FUT3_ENST00000589620.1_Missense_Mutation_p.T325M	NM_000149.3	NP_000140	P21217	FUT3_HUMAN	fucosyltransferase 3 (galactoside 3(4)-L-fucosyltransferase, Lewis blood group)	325			T -> M (in dbSNP:rs28381969). {ECO:0000269|Ref.5}.		cell-cell recognition (GO:0009988)|fucosylation (GO:0036065)|macromolecule glycosylation (GO:0043413)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity (GO:0017060)|alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(1)	14						AGGCCGCAGCGTCTCCCGCCA	0.637													G|||	37	0.00738818	0.025	0.0043	5008	,	,		19604	0.001		0.0	False		,,,				2504	0.0				Esophageal Squamous(82;745 1728 24593 44831)	.											0													42.0	45.0	44.0					19																	5843877		2203	4300	6503	SO:0001583	missense	2525				CCDS12153.1	19p13.3	2014-07-19	2006-01-12		ENSG00000171124	ENSG00000171124	2.4.1.65	"""CD molecules"", ""Blood group antigens"", ""Fucosyltransferases"""	4014	protein-coding gene	gene with protein product		111100	"""fucosyltransferase 3 (galactoside 3(4)-L-fucosyltransferase, Lewis blood group included)"""	LE		1977660, 1740457	Standard	NM_000149		Approved	CD174	uc002mdk.2	P21217	OTTHUMG00000180614	ENST00000303225.6:c.974C>T	19.37:g.5843877G>A	ENSP00000305603:p.Thr325Met	Somatic		WXS	Illumina HiSeq	Phase_I	B5U7U9|B5U7V0|Q32NE7|Q99448|Q99449	Missense_Mutation	SNP	ENST00000303225.6	37	CCDS12153.1	36	0.016483516483516484	18	0.036585365853658534	1	0.0027624309392265192	6	0.01048951048951049	11	0.014511873350923483	G	12.11	1.838692	0.32513	.	.	ENSG00000171124	ENST00000303225;ENST00000458379	T;T	0.24350	1.86;1.86	2.29	1.18	0.20946	.	0.943966	0.08680	N	0.909636	T	0.07413	0.0187	M	0.79805	2.47	0.09310	N	1	P;P;P;P	0.38617	0.64;0.483;0.483;0.483	B;B;B;B	0.36186	0.219;0.148;0.148;0.148	T	0.11494	-1.0585	10	0.37606	T	0.19	.	5.4124	0.16356	0.1897:0.0:0.8103:0.0	rs28381969	325;325;325;325	B3W6H0;A8K737;B3GVC1;P21217	.;.;.;FUT3_HUMAN	M	325	ENSP00000305603:T325M;ENSP00000416443:T325M	ENSP00000305603:T325M	T	-	2	0	FUT3	5794877	0.000000	0.05858	0.620000	0.29132	0.507000	0.33981	-1.150000	0.03178	0.242000	0.21303	0.194000	0.17425	ACG		0.637	FUT3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452204.1	NM_000149	
GNAQ	2776	mdanderson.org	37	9	80537095	80537095	+	Nonsense_Mutation	SNP	G	G	T	rs200106152		TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr9:80537095G>T	ENST00000286548.4	-	2	525	c.303C>A	c.(301-303)taC>taA	p.Y101*		NM_002072.3	NP_002063.2	P50148	GNAQ_HUMAN	guanine nucleotide binding protein (G protein), q polypeptide	101					action potential (GO:0001508)|activation of phospholipase C activity (GO:0007202)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|developmental pigmentation (GO:0048066)|embryonic digit morphogenesis (GO:0042733)|forebrain neuron development (GO:0021884)|glutamate receptor signaling pathway (GO:0007215)|heart development (GO:0007507)|maternal behavior (GO:0042711)|negative regulation of protein kinase activity (GO:0006469)|neuron remodeling (GO:0016322)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|platelet activation (GO:0030168)|positive regulation of GTPase activity (GO:0043547)|post-embryonic development (GO:0009791)|protein stabilization (GO:0050821)|regulation of catenin import into nucleus (GO:0035412)|regulation of melanocyte differentiation (GO:0045634)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)|type 2A serotonin receptor binding (GO:0031826)			NS(1)|endometrium(3)|eye(229)|kidney(1)|large_intestine(4)|lung(6)|meninges(11)|ovary(1)|prostate(1)|skin(44)|upper_aerodigestive_tract(1)	302						GCTCATACTTGTATGGGATCT	0.473			Mis		uveal melanoma																																	.		Dom	yes		9	9q21	2776	"""guanine nucleotide binding protein (G protein), q polypeptide"""		E	0													202.0	163.0	176.0					9																	80537095		2203	4300	6503	SO:0001587	stop_gained	2776				CCDS6658.1	9q21	2010-03-17			ENSG00000156052	ENSG00000156052			4390	protein-coding gene	gene with protein product		600998				8825633	Standard	NM_002072		Approved	G-ALPHA-q, GAQ	uc004akw.3	P50148	OTTHUMG00000020059	ENST00000286548.4:c.303C>A	9.37:g.80537095G>T	ENSP00000286548:p.Tyr101*	Somatic		WXS	Illumina HiSeq	Phase_I	O15108|Q13462|Q6NT27|Q92471|Q9BZB9	Nonsense_Mutation	SNP	ENST00000286548.4	37	CCDS6658.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	39	7.470181	0.98302	.	.	ENSG00000156052	ENST00000286548;ENST00000411677	.	.	.	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.877	0.96880	0.0:0.0:1.0:0.0	.	.	.	.	X	101;72	.	ENSP00000286548:Y101X	Y	-	3	2	GNAQ	79726915	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.743000	0.68655	2.696000	0.92011	0.650000	0.86243	TAC		0.473	GNAQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052761.1	NM_002072	
GNB2	2783	mdanderson.org	37	7	100276355	100276355	+	Silent	SNP	C	C	T	rs17850902	byFrequency	TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr7:100276355C>T	ENST00000303210.4	+	10	1436	c.954C>T	c.(952-954)ctC>ctT	p.L318L	GNB2_ENST00000419828.1_Silent_p.L218L|GNB2_ENST00000393926.1_Silent_p.L318L|GNB2_ENST00000424361.1_Silent_p.L274L|GNB2_ENST00000427895.1_Silent_p.L218L|GNB2_ENST00000436220.1_Silent_p.L274L|GNB2_ENST00000393924.1_Silent_p.L318L	NM_005273.3	NP_005264.2	P62879	GBB2_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 2	318					cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|GTP catabolic process (GO:0006184)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cell body (GO:0044297)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	calcium channel regulator activity (GO:0005246)|GTPase activity (GO:0003924)|GTPase binding (GO:0051020)|protein complex binding (GO:0032403)|signal transducer activity (GO:0004871)			endometrium(1)|lung(3)|ovary(2)|prostate(1)	7	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)	Ovarian(593;0.238)				TGAGCTGCCTCGGGGTCACCG	0.652													C|||	17	0.00339457	0.0008	0.0029	5008	,	,		16180	0.001		0.005	False		,,,				2504	0.0082					.											0								C		7,4399		0,7,2196	60.0	63.0	62.0		954	-6.0	0.9	7	dbSNP_123	62	76,8524		0,76,4224	no	coding-synonymous	GNB2	NM_005273.3		0,83,6420	TT,TC,CC		0.8837,0.1589,0.6382		318/341	100276355	83,12923	2203	4300	6503	SO:0001819	synonymous_variant	2783			M16514	CCDS5703.1	7q21.3-q22.1	2013-01-10			ENSG00000172354	ENSG00000172354		"""WD repeat domain containing"""	4398	protein-coding gene	gene with protein product	"""G protein, beta-2 subunit"", ""guanine nucleotide-binding protein G(I)/G(S)/G(T) beta subunit 2"", ""signal-transducing guanine nucleotide-binding regulatory protein beta subunit"", ""transducin beta chain 2"""	139390				9799793	Standard	NM_005273		Approved		uc003uwb.3	P62879	OTTHUMG00000137419	ENST00000303210.4:c.954C>T	7.37:g.100276355C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B3KPU1|P11016|P54312	Silent	SNP	ENST00000303210.4	37	CCDS5703.1																																																																																				0.652	GNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268391.2	NM_005273	
GOLGA8EP	390535	mdanderson.org	37	15	23441131	23441131	+	RNA	SNP	C	C	A	rs200358594	byFrequency	TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr15:23441131C>A	ENST00000526079.1	+	0	1210				RN7SL106P_ENST00000488468.2_RNA	NR_027407.1|NR_033350.1				golgin A8 family, member E, pseudogene																		CGGGTAGAGACGCTGGAGAGG	0.567																																						.											0													60.0	76.0	70.0					15																	23441131		1360	2534	3894			390535					15q11.2	2014-03-21	2012-10-05	2012-10-05	ENSG00000175676	ENSG00000175676			32377	pseudogene	pseudogene			"""golgi autoantigen, golgin subfamily a, 8E"", ""golgin A8 family, member E"""	GOLGA8E		12477932	Standard	NR_033350		Approved		uc001yvu.3		OTTHUMG00000167132		15.37:g.23441131C>A		Somatic		WXS	Illumina HiSeq	Phase_I		RNA	SNP	ENST00000526079.1	37																																																																																					0.567	GOLGA8EP-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000393312.1	NR_033350.1	
HS6ST1	9394	mdanderson.org	37	2	129025758	129025758	+	Missense_Mutation	SNP	C	C	A	rs142919429		TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr2:129025758C>A	ENST00000259241.6	-	2	1227	c.1214G>T	c.(1213-1215)aGc>aTc	p.S405I		NM_004807.2	NP_004798.3	O60243	H6ST1_HUMAN	heparan sulfate 6-O-sulfotransferase 1	405					angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|labyrinthine layer blood vessel development (GO:0060716)|lung alveolus development (GO:0048286)|neuron development (GO:0048666)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)	heparan sulfate 6-O-sulfotransferase activity (GO:0017095)|sulfotransferase activity (GO:0008146)			endometrium(3)|liver(1)|lung(7)|pancreas(1)|prostate(2)|skin(1)	15	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.117)		AATGATGTGGCTCATGTAGTC	0.662																																						.											0													10.0	11.0	11.0					2																	129025758		1890	4033	5923	SO:0001583	missense	9394			AB006179	CCDS42748.1	2q21	2010-03-19		2002-08-23	ENSG00000136720	ENSG00000136720		"""Sulfotransferases, membrane-bound"""	5201	protein-coding gene	gene with protein product		604846		HS6ST		9535912	Standard	NM_004807		Approved		uc002tpt.4	O60243	OTTHUMG00000153542	ENST00000259241.6:c.1214G>T	2.37:g.129025758C>A	ENSP00000259241:p.Ser405Ile	Somatic		WXS	Illumina HiSeq	Phase_I	B4DEP2|B4DJ29|Q53SL2|Q9BVI1	Missense_Mutation	SNP	ENST00000259241.6	37	CCDS42748.1	335	0.1533882783882784	57	0.11585365853658537	66	0.18232044198895028	83	0.1451048951048951	129	0.17018469656992086	C	14.89	2.670501	0.47781	.	.	ENSG00000136720	ENST00000259241	D	0.84223	-1.82	4.19	4.19	0.49359	.	0.086180	0.85682	D	0.000000	T	0.00580	0.0019	L	0.56769	1.78	0.22171	P	0.999317387	P	0.44578	0.838	B	0.35413	0.202	T	0.34650	-0.9820	8	.	.	.	-0.0214	16.8907	0.86086	0.0:1.0:0.0:0.0	.	405	O60243	H6ST1_HUMAN	I	405	ENSP00000259241:S405I	.	S	-	2	0	HS6ST1	128742228	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	3.206000	0.51098	2.054000	0.61138	0.313000	0.20887	AGC		0.662	HS6ST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331572.1	NM_004807	
HTRA3	94031	mdanderson.org	37	4	8294059	8294059	+	Silent	SNP	C	C	T			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr4:8294059C>T	ENST00000307358.2	+	5	1119	c.915C>T	c.(913-915)tcC>tcT	p.S305S	HTRA3_ENST00000382512.3_Silent_p.S305S	NM_053044.3	NP_444272.1	P83110	HTRA3_HUMAN	HtrA serine peptidase 3	305	Serine protease.				negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)	endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(6)|ovary(2)|prostate(1)|urinary_tract(1)	18						ACGGGAACTCCGGGGGACCAC	0.582																																						.											0													99.0	86.0	90.0					4																	8294059		2203	4300	6503	SO:0001819	synonymous_variant	94031			AY040094	CCDS3400.1, CCDS75105.1	4p16.1	2008-02-05			ENSG00000170801	ENSG00000170801			30406	protein-coding gene	gene with protein product	"""pregnancy-related serine protease"""	608785				12513693, 14500695	Standard	XM_005248040		Approved	Tasp, Prsp	uc003gla.3	P83110	OTTHUMG00000090561	ENST00000307358.2:c.915C>T	4.37:g.8294059C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q7Z7A2	Silent	SNP	ENST00000307358.2	37	CCDS3400.1																																																																																				0.582	HTRA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092669.1	NM_053044	
KRTAP5-5	439915	mdanderson.org	37	11	1651412	1651412	+	Silent	SNP	G	G	C	rs569811286		TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr11:1651412G>C	ENST00000399676.2	+	1	380	c.342G>C	c.(340-342)ggG>ggC	p.G114G		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	114	8 X 4 AA repeats of C-C-X-P.			Missing (in Ref. 1; BAD20201 and 2; CAF31639). {ECO:0000305}.		keratin filament (GO:0045095)		p.G114G(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CCTGTGGGGGGTCCAAGGGGG	0.706													N|||	1	0.000199681	0.0	0.0	5008	,	,		3556	0.001		0.0	False		,,,				2504	0.0					.											1	Substitution - coding silent(1)	prostate(1)											20.0	31.0	27.0					11																	1651412		2083	4147	6230	SO:0001819	synonymous_variant	439915			AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.342G>C	11.37:g.1651412G>C		Somatic		WXS	Illumina HiSeq	Phase_I	A8MWN2	Silent	SNP	ENST00000399676.2	37	CCDS41592.1																																																																																				0.706	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127919.1		
LILRA2	11027	mdanderson.org	37	19	55086949	55086949	+	Silent	SNP	A	A	G			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr19:55086949A>G	ENST00000251377.3	+	6	1015	c.882A>G	c.(880-882)agA>agG	p.R294R	LILRB1_ENST00000396321.2_Intron|LILRB1_ENST00000448689.1_Intron|LILRA2_ENST00000391738.3_Silent_p.R294R|LILRB1_ENST00000418536.2_Intron|LILRA2_ENST00000251376.3_Silent_p.R294R|LILRA2_ENST00000391737.1_Silent_p.R282R			Q8N149	LIRA2_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2	294	Ig-like C2-type 3.				defense response (GO:0006952)|immune system process (GO:0002376)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			breast(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(33)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50				GBM - Glioblastoma multiforme(193;0.0963)		GCCAGTACAGATGCTACAGTG	0.662																																						.											0													50.0	52.0	51.0					19																	55086949		2203	4299	6502	SO:0001819	synonymous_variant	11027			U82275	CCDS12900.1, CCDS46179.1, CCDS74453.1	19q13.4	2013-01-11			ENSG00000239998	ENSG00000239998		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6603	protein-coding gene	gene with protein product		604812				9079806, 9548455	Standard	XM_005258452		Approved	LIR-7, ILT1, CD85h, LIR7		Q8N149	OTTHUMG00000065703	ENST00000251377.3:c.882A>G	19.37:g.55086949A>G		Somatic		WXS	Illumina HiSeq	Phase_I	O75020	Silent	SNP	ENST00000251377.3	37	CCDS46179.1																																																																																				0.662	LILRA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140813.2		
MUC4	4585	mdanderson.org	37	3	195506387	195506387	+	Missense_Mutation	SNP	G	G	T	rs201542091	byFrequency	TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr3:195506387G>T	ENST00000463781.3	-	2	12523	c.12064C>A	c.(12064-12066)Cct>Act	p.P4022T	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.P4022T	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.P4022T(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GCTGAGGAAGGGCTGGTGACA	0.582													.|||	113	0.0225639	0.0189	0.0159	5008	,	,		11226	0.0089		0.0447	False		,,,				2504	0.0235					.											1	Substitution - Missense(1)	endometrium(1)											19.0	15.0	16.0					3																	195506387		649	1304	1953	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12064C>A	3.37:g.195506387G>T	ENSP00000417498:p.Pro4022Thr	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	2.915	-0.224485	0.06061	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.29655	1.56;1.56	.	.	.	.	0.000000	0.25517	N	0.030134	T	0.14700	0.0355	N	0.14661	0.345	0.09310	N	1	D	0.55385	0.971	P	0.46026	0.501	T	0.33007	-0.9885	8	.	.	.	.	6.041	0.19734	0.0:0.6792:0.3208:0.0	.	3894	E7ESK3	.	T	4022	ENSP00000417498:P4022T;ENSP00000420243:P4022T	.	P	-	1	0	MUC4	196991166	0.004000	0.15560	0.000000	0.03702	0.004000	0.04260	-2.457000	0.01001	-2.083000	0.00867	-2.366000	0.00237	CCT		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195508057	195508057	+	Missense_Mutation	SNP	G	G	A	rs199527570		TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr3:195508057G>A	ENST00000463781.3	-	2	10853	c.10394C>T	c.(10393-10395)gCa>gTa	p.A3465V	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.A3465V	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACCTGTGGATGCTGAGGAAGT	0.582																																						.											0													28.0	24.0	25.0					3																	195508057		682	1581	2263	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.10394C>T	3.37:g.195508057G>A	ENSP00000417498:p.Ala3465Val	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	4.788	0.146480	0.09134	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.38401	1.2;1.14	0.743	0.743	0.18347	.	.	.	.	.	T	0.26991	0.0661	N	0.08118	0	0.09310	N	1	P	0.42357	0.777	P	0.52710	0.707	T	0.22347	-1.0219	8	.	.	.	.	6.9051	0.24305	1.0E-4:0.0:0.9999:0.0	.	3337	E7ESK3	.	V	3465	ENSP00000417498:A3465V;ENSP00000420243:A3465V	.	A	-	2	0	MUC4	196992836	0.022000	0.18835	0.143000	0.22291	0.143000	0.21401	2.082000	0.41605	0.088000	0.17205	0.089000	0.15464	GCA		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195509080	195509080	+	Missense_Mutation	SNP	G	G	C	rs200289412		TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr3:195509080G>C	ENST00000463781.3	-	2	9830	c.9371C>G	c.(9370-9372)aCc>aGc	p.T3124S	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.T3124S	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGAAGTGTCGGTGACAGGAAG	0.587																																						.											0													13.0	8.0	9.0					3																	195509080		655	1526	2181	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9371C>G	3.37:g.195509080G>C	ENSP00000417498:p.Thr3124Ser	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	7.475	0.647536	0.14516	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.32988	1.43;1.49	.	.	.	.	.	.	.	.	T	0.16769	0.0403	N	0.19112	0.55	0.21579	N	0.99963	P	0.42584	0.784	B	0.39706	0.307	T	0.14559	-1.0468	7	.	.	.	.	5.8178	0.18506	0.001:0.0:0.999:0.0	.	2996	E7ESK3	.	S	3124	ENSP00000417498:T3124S;ENSP00000420243:T3124S	.	T	-	2	0	MUC4	196993859	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.437000	0.21543	-0.000000	0.14550	0.000000	0.15137	ACC		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195509606	195509606	+	Missense_Mutation	SNP	C	C	T	rs200244334		TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr3:195509606C>T	ENST00000463781.3	-	2	9304	c.8845G>A	c.(8845-8847)Gac>Aac	p.D2949N	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.D2949N	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGAAGTGTCGGTGACAGGA	0.592																																						.											0													10.0	8.0	9.0					3																	195509606		648	1501	2149	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8845G>A	3.37:g.195509606C>T	ENSP00000417498:p.Asp2949Asn	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	7.799	0.713161	0.15306	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.30182	1.54;1.54	.	.	.	.	.	.	.	.	T	0.11281	0.0275	N	0.19112	0.55	0.09310	N	1	P	0.50710	0.938	B	0.29663	0.105	T	0.19484	-1.0304	7	.	.	.	.	3.2503	0.06812	0.0:0.638:0.0:0.362	.	2821	E7ESK3	.	N	2949	ENSP00000417498:D2949N;ENSP00000420243:D2949N	.	D	-	1	0	MUC4	196994385	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.907000	0.04067	-0.000000	0.14550	0.000000	0.15137	GAC		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195511238	195511238	+	Missense_Mutation	SNP	C	C	T	rs3103956		TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr3:195511238C>T	ENST00000463781.3	-	2	7672	c.7213G>A	c.(7213-7215)Gac>Aac	p.D2405N	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.D2405N	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.D2405N(3)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGAAGTGTCGGTGACAGGA	0.592																																						.											3	Substitution - Missense(3)	NS(2)|endometrium(1)											36.0	38.0	37.0					3																	195511238		689	1587	2276	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.7213G>A	3.37:g.195511238C>T	ENSP00000417498:p.Asp2405Asn	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	C	7.494	0.651351	0.14516	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.30448	1.55;1.53	.	.	.	.	.	.	.	.	T	0.24967	0.0606	N	0.19112	0.55	0.09310	N	1	P	0.52577	0.954	P	0.55965	0.788	T	0.10590	-1.0623	7	.	.	.	.	2.1447	0.03784	0.0:0.3304:0.3444:0.3251	.	2405	E7ESK3	.	N	2405	ENSP00000417498:D2405N;ENSP00000420243:D2405N	.	D	-	1	0	MUC4	196995633	0.000000	0.05858	0.003000	0.11579	0.080000	0.17528	-0.920000	0.04013	-0.417000	0.07461	0.064000	0.15345	GAC		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195511910	195511910	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr3:195511910C>T	ENST00000463781.3	-	2	7000	c.6541G>A	c.(6541-6543)Gac>Aac	p.D2181N	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.D2181N	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGAAGTGTCGGTGACAGGA	0.592																																						.											0													8.0	13.0	12.0					3																	195511910		618	1492	2110	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6541G>A	3.37:g.195511910C>T	ENSP00000417498:p.Asp2181Asn	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	C	8.849	0.944015	0.18281	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.35236	1.4;1.32	.	.	.	.	.	.	.	.	T	0.14830	0.0358	N	0.19112	0.55	0.18873	N	0.999986	P	0.47409	0.895	B	0.33196	0.159	T	0.13019	-1.0525	7	.	.	.	.	2.6646	0.05037	0.0:0.5037:0.0:0.4962	.	2181	E7ESK3	.	N	2181	ENSP00000417498:D2181N;ENSP00000420243:D2181N	.	D	-	1	0	MUC4	196996305	0.041000	0.20044	0.024000	0.17045	0.044000	0.14063	-0.018000	0.12568	0.064000	0.16427	0.064000	0.15345	GAC		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
NR3C1	2908	mdanderson.org	37	5	142779662	142779662	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr5:142779662A>G	ENST00000343796.2	-	2	1736	c.743T>C	c.(742-744)cTc>cCc	p.L248P	NR3C1_ENST00000424646.2_Missense_Mutation_p.L248P|NR3C1_ENST00000394466.2_Missense_Mutation_p.L248P|NR3C1_ENST00000415690.2_Missense_Mutation_p.L248P|NR3C1_ENST00000231509.3_Missense_Mutation_p.L248P|NR3C1_ENST00000394464.2_Missense_Mutation_p.L248P|NR3C1_ENST00000504572.1_Missense_Mutation_p.L248P|NR3C1_ENST00000416954.2_Intron|NR3C1_ENST00000503201.1_Missense_Mutation_p.L248P	NM_001018074.1|NM_001018075.1|NM_001018077.1	NP_001018084.1|NP_001018085.1|NP_001018087.1	P04150	GCR_HUMAN	nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)	248	Modulating.				adrenal gland development (GO:0030325)|chromatin modification (GO:0016568)|gene expression (GO:0010467)|glucocorticoid metabolic process (GO:0008211)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of glucocorticoid mediated signaling pathway (GO:1900170)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of glucocorticoid biosynthetic process (GO:0031946)|regulation of gluconeogenesis (GO:0006111)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	glucocorticoid receptor activity (GO:0004883)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|zinc ion binding (GO:0008270)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(10)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	35		Acute lymphoblastic leukemia(2;3.2e-05)|all_hematologic(2;0.000361)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)		Alclometasone(DB00240)|Amcinonide(DB00288)|Beclomethasone(DB00394)|Betamethasone(DB00443)|Budesonide(DB01222)|Ciclesonide(DB01410)|Clobetasol propionate(DB01013)|Clocortolone(DB00838)|Cortisone acetate(DB01380)|Desonide(DB01260)|Desoximetasone(DB00547)|Dexamethasone(DB01234)|Diflorasone(DB00223)|Difluprednate(DB06781)|Fludrocortisone(DB00687)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Fluoxymesterone(DB01185)|Flurandrenolide(DB00846)|Fluticasone furoate(DB08906)|Fluticasone Propionate(DB00588)|Halobetasol Propionate(DB00596)|Hydrocortamate(DB00769)|Hydrocortisone(DB00741)|Loteprednol(DB00873)|Medrysone(DB00253)|Megestrol acetate(DB00351)|Methylprednisolone(DB00959)|Mifepristone(DB00834)|Mometasone(DB00764)|Paramethasone(DB01384)|Prednicarbate(DB01130)|Prednisolone(DB00860)|Prednisone(DB00635)|Rimexolone(DB00896)|Spironolactone(DB00421)|Triamcinolone(DB00620)	CGGTAAAATGAGAGGCTTGCA	0.423																																						.											0													115.0	120.0	118.0					5																	142779662		2203	4300	6503	SO:0001583	missense	2908			X03225	CCDS4278.1, CCDS34258.1, CCDS47298.1	5q31-q32	2013-01-16	2002-08-27		ENSG00000113580	ENSG00000113580		"""Nuclear hormone receptors"""	7978	protein-coding gene	gene with protein product		138040	"""nuclear receptor subfamily 3, group C, member 1"""	GRL		2867473	Standard	NM_001204258		Approved	GR	uc003lnb.3	P04150	OTTHUMG00000129677	ENST00000343796.2:c.743T>C	5.37:g.142779662A>G	ENSP00000343205:p.Leu248Pro	Somatic		WXS	Illumina HiSeq	Phase_I	A0ZXF9|B0LPG8|D3DQF4|P04151|Q53EP5|Q6N0A4	Missense_Mutation	SNP	ENST00000343796.2	37	CCDS4278.1	.	.	.	.	.	.	.	.	.	.	A	10.35	1.326693	0.24080	.	.	ENSG00000113580	ENST00000394464;ENST00000343796;ENST00000361001;ENST00000415690;ENST00000424646;ENST00000504572;ENST00000394466;ENST00000231509;ENST00000503201	T;T;T;T;T;T;T;T	0.32988	1.43;1.43;1.43;1.43;1.43;1.43;1.43;1.43	5.46	4.3	0.51218	.	0.422460	0.26086	N	0.026425	T	0.34193	0.0889	L	0.49455	1.56	0.80722	D	1	B;P;B	0.48589	0.001;0.912;0.002	B;P;B	0.50231	0.01;0.635;0.017	T	0.04454	-1.0950	10	0.34782	T	0.22	.	7.6771	0.28492	0.7903:0.0:0.2097:0.0	.	248;248;248	E5KQF5;P04150;E5KQF6	.;GCR_HUMAN;.	P	248	ENSP00000377977:L248P;ENSP00000343205:L248P;ENSP00000387672:L248P;ENSP00000405282:L248P;ENSP00000422518:L248P;ENSP00000377979:L248P;ENSP00000231509:L248P;ENSP00000427672:L248P	ENSP00000231509:L248P	L	-	2	0	NR3C1	142759855	0.948000	0.32251	0.887000	0.34795	0.995000	0.86356	1.994000	0.40757	0.898000	0.36418	0.528000	0.53228	CTC		0.423	NR3C1-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000370829.1		
OPN4	94233	mdanderson.org;bcgsc.ca	37	10	88423471	88423471	+	Missense_Mutation	SNP	G	G	T			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr10:88423471G>T	ENST00000241891.5	+	9	1477	c.1310G>T	c.(1309-1311)gGg>gTg	p.G437V	OPN4_ENST00000372071.2_Missense_Mutation_p.G448V	NM_033282.3	NP_150598.1	Q9UHM6	OPN4_HUMAN	opsin 4	437					phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)|rhodopsin mediated signaling pathway (GO:0016056)|rhythmic process (GO:0048511)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	11-cis retinal binding (GO:0005502)|G-protein coupled photoreceptor activity (GO:0008020)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(5)|ovary(3)	18						CAAGCAAATGGGCGGTCCCTC	0.637																																						.											0													55.0	45.0	48.0					10																	88423471		2198	4299	6497	SO:0001583	missense	94233			AF147788	CCDS7376.1, CCDS31237.1	10q22	2012-08-08	2008-04-16		ENSG00000122375	ENSG00000122375		"""GPCR / Class A : Opsin receptors"""	14449	protein-coding gene	gene with protein product	"""melanopsin"""	606665	"""opsin 4 (melanopsin)"""			10632589	Standard	NM_001030015		Approved	MOP, melanopsin	uc001kdp.3	Q9UHM6	OTTHUMG00000018654	ENST00000241891.5:c.1310G>T	10.37:g.88423471G>T	ENSP00000241891:p.Gly437Val	Somatic		WXS	Illumina HiSeq	Phase_I	B7ZLB3|Q14D01|Q2PP22|Q8NGQ9	Missense_Mutation	SNP	ENST00000241891.5	37	CCDS7376.1	.	.	.	.	.	.	.	.	.	.	G	13.44	2.238278	0.39598	.	.	ENSG00000122375	ENST00000372071;ENST00000241891;ENST00000443292	T;T;T	0.31510	1.49;1.49;1.49	4.69	2.81	0.32909	.	0.619008	0.15585	N	0.254662	T	0.40015	0.1100	M	0.68317	2.08	0.20403	N	0.999906	D;D;D	0.57571	0.966;0.966;0.98	P;P;P	0.55303	0.598;0.598;0.773	T	0.14980	-1.0453	10	0.42905	T	0.14	.	5.1951	0.15232	0.103:0.0:0.6912:0.2058	.	448;437;448	C9JWU6;Q9UHM6;Q9UHM6-2	.;OPN4_HUMAN;.	V	448;437;448	ENSP00000361141:G448V;ENSP00000241891:G437V;ENSP00000393132:G448V	ENSP00000241891:G437V	G	+	2	0	OPN4	88413451	0.007000	0.16637	0.038000	0.18304	0.004000	0.04260	1.744000	0.38268	1.305000	0.44909	-0.181000	0.13052	GGG		0.637	OPN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049158.2	NM_033282	
OR8H2	390151	mdanderson.org	37	11	55872876	55872876	+	Missense_Mutation	SNP	C	C	T	rs2512961	byFrequency	TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr11:55872876C>T	ENST00000313503.1	+	1	358	c.358C>T	c.(358-360)Cat>Tat	p.H120Y		NM_001005200.1	NP_001005200.1	Q8N162	OR8H2_HUMAN	olfactory receptor, family 8, subfamily H, member 2	120			H -> Y (in dbSNP:rs2512961).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(38)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	61	Esophageal squamous(21;0.00693)					CTCAATGGCCCATGATCGCTA	0.468										HNSCC(53;0.14)			t|||	4805	0.959465	0.9818	0.9553	5008	,	,		20869	0.999		0.9056	False		,,,				2504	0.9468					.											0								T	TYR/HIS	4276,126	92.5+/-131.2	2075,126,0	190.0	194.0	193.0		358	3.6	1.0	11	dbSNP_100	193	7895,693	170.4+/-221.6	3635,625,34	no	missense	OR8H2	NM_001005200.1	83	5710,751,34	TT,TC,CC		8.0694,2.8623,6.3048	benign	120/313	55872876	12171,819	2201	4294	6495	SO:0001583	missense	390151			AB065657	CCDS31518.1	11q11	2012-08-09			ENSG00000181767	ENSG00000181767		"""GPCR / Class A : Olfactory receptors"""	15308	protein-coding gene	gene with protein product							Standard	NM_001005200		Approved		uc010riy.2	Q8N162	OTTHUMG00000166832	ENST00000313503.1:c.358C>T	11.37:g.55872876C>T	ENSP00000323982:p.His120Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	Q6IFC1	Missense_Mutation	SNP	ENST00000313503.1	37	CCDS31518.1	2072	0.9487179487179487	477	0.9695121951219512	343	0.9475138121546961	568	0.993006993006993	684	0.9023746701846965	t	0.004	-2.255890	0.00265	0.971377	0.919306	ENSG00000181767	ENST00000313503	T	0.01323	5.01	3.58	3.58	0.41010	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47852	N	0.000204	T	0.00012	0.0000	N	0.00010	-3.035	0.58432	P	1.0000000000287557E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.19910	-1.0291	9	0.02654	T	1	.	9.4364	0.38641	0.0:0.0887:0.0:0.9113	rs2512961;rs7109885;rs2512961	120	Q8N162	OR8H2_HUMAN	Y	120	ENSP00000323982:H120Y	ENSP00000323982:H120Y	H	+	1	0	OR8H2	55629452	0.008000	0.16893	0.995000	0.50966	0.016000	0.09150	1.754000	0.38369	0.518000	0.28383	-0.692000	0.03713	CAT		0.468	OR8H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391540.1	NM_001005200	
OR5M1	390168	mdanderson.org	37	11	56380811	56380811	+	Silent	SNP	T	T	C			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr11:56380811T>C	ENST00000526538.1	-	1	167	c.168A>G	c.(166-168)caA>caG	p.Q56Q		NM_001004740.1	NP_001004740.1	Q8NGP8	OR5M1_HUMAN	olfactory receptor, family 5, subfamily M, member 1	56						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(7)|upper_aerodigestive_tract(1)	12						ACATGGGTGTTTGCAGGTGGG	0.453																																						.											0													181.0	178.0	179.0					11																	56380811		1990	4164	6154	SO:0001819	synonymous_variant	390168			AB065742	CCDS53631.1	11q11	2012-08-09				ENSG00000255012		"""GPCR / Class A : Olfactory receptors"""	8352	protein-coding gene	gene with protein product							Standard	NM_001004740		Approved	OST050	uc001nja.1	Q8NGP8		ENST00000526538.1:c.168A>G	11.37:g.56380811T>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q6IF60|Q96RB6	Silent	SNP	ENST00000526538.1	37	CCDS53631.1																																																																																				0.453	OR5M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391610.1	NM_001004740	
SDHA	6389	mdanderson.org	37	5	236642	236642	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr5:236642G>A	ENST00000264932.6	+	10	1475	c.1360G>A	c.(1360-1362)Gca>Aca	p.A454T	SDHA_ENST00000504309.1_Missense_Mutation_p.A454T|SDHA_ENST00000510361.1_Missense_Mutation_p.A406T	NM_004168.2	NP_004159.2	P31040	SDHA_HUMAN	succinate dehydrogenase complex, subunit A, flavoprotein (Fp)	454					cellular metabolic process (GO:0044237)|nervous system development (GO:0007399)|oxidation-reduction process (GO:0055114)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|tricarboxylic acid cycle (GO:0006099)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|succinate dehydrogenase (ubiquinone) activity (GO:0008177)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|liver(2)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	40			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	CCGCCTCGGGGCAAACTCGCT	0.602									Familial Paragangliomas																													.											0													89.0	80.0	83.0					5																	236642		2203	4300	6503	SO:0001583	missense	6389	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss	BC001380	CCDS3853.1	5p15	2014-09-17			ENSG00000073578	ENSG00000073578		"""Mitochondrial respiratory chain complex / Complex II"""	10680	protein-coding gene	gene with protein product		600857		SDH2		7798181	Standard	XM_005248329		Approved	FP, SDHF	uc003jao.4	P31040	OTTHUMG00000090275	ENST00000264932.6:c.1360G>A	5.37:g.236642G>A	ENSP00000264932:p.Ala454Thr	Somatic		WXS	Illumina HiSeq	Phase_I	A8K5J6|B4DJ60|E9PBJ5|Q16395|Q59GW8|Q8IW48|Q9UMY5	Missense_Mutation	SNP	ENST00000264932.6	37	CCDS3853.1	.	.	.	.	.	.	.	.	.	.	g	17.49	3.402253	0.62288	.	.	ENSG00000073578	ENST00000264932;ENST00000327872;ENST00000504309;ENST00000510361	T;T;T	0.70749	-0.51;-0.51;-0.51	5.01	5.01	0.66863	Fumarate reductase/succinate dehydrogenase flavoprotein, N-terminal (1);	0.136629	0.48767	U	0.000166	T	0.76681	0.4021	L	0.43598	1.365	0.80722	D	1	D;B;D;D;P	0.89917	0.998;0.361;1.0;1.0;0.762	D;B;D;D;P	0.97110	0.992;0.368;1.0;0.982;0.495	T	0.77032	-0.2738	10	0.56958	D	0.05	.	9.7585	0.40517	0.0953:0.0:0.9047:0.0	.	406;454;48;454;454	E9PBJ5;B4DYN5;B3KYA5;D6RFM5;P31040	.;.;.;.;DHSA_HUMAN	T	454;309;454;406	ENSP00000264932:A454T;ENSP00000426514:A454T;ENSP00000427703:A406T	ENSP00000264932:A454T	A	+	1	0	SDHA	289642	1.000000	0.71417	0.995000	0.50966	0.042000	0.13812	9.454000	0.97621	2.483000	0.83821	0.650000	0.86243	GCA		0.602	SDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206599.1	NM_004168	
SIGLEC5	8778	mdanderson.org	37	19	52132741	52132741	+	Silent	SNP	G	G	A	rs200210701	byFrequency	TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr19:52132741G>A	ENST00000534261.2	-	4	969	c.570C>T	c.(568-570)ccC>ccT	p.P190P	SIGLEC5_ENST00000222107.4_Silent_p.P190P|SIGLEC5_ENST00000429354.3_Silent_p.P190P|SIGLEC5_ENST00000599649.1_Silent_p.P190P|SIGLEC5_ENST00000570106.2_Silent_p.P190P			O15389	SIGL5_HUMAN	sialic acid binding Ig-like lectin 5	190	Ig-like C2-type 1.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|large_intestine(4)|lung(9)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27		all_neural(266;0.0726)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0218)		GGGTGGTCTCGGGGTCCAGGG	0.652													G|||	61	0.0121805	0.0159	0.0014	5008	,	,		15292	0.0288		0.002	False		,,,				2504	0.0082					.											0													16.0	16.0	16.0					19																	52132741		2201	4290	6491	SO:0001819	synonymous_variant	8778			U71383	CCDS33088.1	19q13.41	2013-01-29			ENSG00000105501	ENSG00000105501		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10874	protein-coding gene	gene with protein product		604200		CD33L2		10343116	Standard	NM_003830		Approved	OB-BP2, SIGLEC-5, CD170	uc002pxe.4	O15389	OTTHUMG00000165510	ENST00000534261.2:c.570C>T	19.37:g.52132741G>A		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000534261.2	37	CCDS33088.1																																																																																				0.652	SIGLEC5-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466897.2	NM_003830	
SPCS1	28972	mdanderson.org	37	3	52741725	52741725	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr3:52741725T>C	ENST00000602728.1	+	4	375	c.206T>C	c.(205-207)aTc>aCc	p.I69T	GLT8D1_ENST00000266014.5_5'Flank|SPCS1_ENST00000423431.1_Missense_Mutation_p.I47T|GLT8D1_ENST00000491606.1_5'Flank|GLT8D1_ENST00000407584.3_5'Flank|GLT8D1_ENST00000478968.2_5'Flank|SPCS1_ENST00000233025.7_Missense_Mutation_p.I136T			Q9Y6A9	SPCS1_HUMAN	signal peptidase complex subunit 1 homolog (S. cerevisiae)	69					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|proteolysis (GO:0006508)|regulation of insulin secretion (GO:0050796)|signal peptide processing (GO:0006465)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|signal peptidase complex (GO:0005787)	peptidase activity (GO:0008233)			kidney(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)	6				BRCA - Breast invasive adenocarcinoma(193;6.51e-05)|Kidney(197;0.000583)|KIRC - Kidney renal clear cell carcinoma(197;0.000751)|OV - Ovarian serous cystadenocarcinoma(275;0.0469)		CCATGGCCCATCTATCGCCGG	0.403																																						.											0													102.0	105.0	104.0					3																	52741725		2203	4300	6503	SO:0001583	missense	28972			AF092138	CCDS33769.2	3p21.31	2005-01-05			ENSG00000114902	ENSG00000114902			23401	protein-coding gene	gene with protein product		610358				8632014	Standard	NM_014041		Approved	SPC12, HSPC033, YJR010C-A, SPC1	uc011bei.2	Q9Y6A9	OTTHUMG00000154930	ENST00000602728.1:c.206T>C	3.37:g.52741725T>C	ENSP00000473265:p.Ile69Thr	Somatic		WXS	Illumina HiSeq	Phase_I	B3KNF8|Q9BVW1	Missense_Mutation	SNP	ENST00000602728.1	37		.	.	.	.	.	.	.	.	.	.	T	24.7	4.561854	0.86335	.	.	ENSG00000114902	ENST00000423431;ENST00000233025	T;T	0.80653	-1.4;-1.4	5.57	5.57	0.84162	.	0.042790	0.85682	D	0.000000	D	0.85057	0.5610	L	0.58510	1.815	0.46478	D	0.999061	P	0.52692	0.955	P	0.54759	0.76	D	0.86672	0.1911	10	0.72032	D	0.01	-36.8309	15.7316	0.77810	0.0:0.0:0.0:1.0	.	136	Q9Y6A9	SPCS1_HUMAN	T	47;136	ENSP00000391610:I47T;ENSP00000233025:I136T	ENSP00000233025:I136T	I	+	2	0	SPCS1	52716765	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	7.169000	0.77578	2.109000	0.64355	0.482000	0.46254	ATC		0.403	SPCS1-006	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000467759.1	NM_014041	
TCERG1	10915	mdanderson.org	37	5	145838659	145838659	+	Silent	SNP	C	C	T	rs111965890		TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr5:145838659C>T	ENST00000296702.5	+	4	689	c.651C>T	c.(649-651)gcC>gcT	p.A217A	TCERG1_ENST00000394421.2_Silent_p.A217A	NM_006706.3	NP_006697.2	O14776	TCRG1_HUMAN	transcription elongation regulator 1	217	Ala/Gln-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(18)|lung(9)|ovary(2)|prostate(3)|skin(1)	46		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			aggcccaggcccaggcccagg	0.731																																						.											0													10.0	14.0	13.0					5																	145838659		2185	4266	6451	SO:0001819	synonymous_variant	10915			AF017789	CCDS4282.1, CCDS43379.1	5q31	2010-01-25	2002-01-24	2002-01-25	ENSG00000113649	ENSG00000113649			15630	protein-coding gene	gene with protein product	"""transcription factor CA150"", ""co-activator of 150 kDa"", ""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"", ""TATA box-binding protein-associated factor 2S"""	605409	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"""	TAF2S		9315662, 11003711	Standard	XM_005268365		Approved	CA150, Urn1	uc003lob.3	O14776	OTTHUMG00000129683	ENST00000296702.5:c.651C>T	5.37:g.145838659C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q2NKN2|Q59EA1	Silent	SNP	ENST00000296702.5	37	CCDS4282.1																																																																																				0.731	TCERG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251886.1	NM_001040006	
ZNF208	7757	mdanderson.org	37	19	22156850	22156850	+	Missense_Mutation	SNP	A	A	G	rs199858837		TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr19:22156850A>G	ENST00000397126.4	-	4	1134	c.986T>C	c.(985-987)aTt>aCt	p.I329T	ZNF208_ENST00000601773.1_Intron|ZNF208_ENST00000599916.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	329					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				CTTATGTGTAATAAGGGTTGA	0.393																																						.											0													62.0	63.0	63.0					19																	22156850		1996	4092	6088	SO:0001583	missense	7757			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.986T>C	19.37:g.22156850A>G	ENSP00000380315:p.Ile329Thr	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000397126.4	37	CCDS54240.1	.	.	.	.	.	.	.	.	.	.	A	0.001	-3.776923	0.00004	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.37584	1.19	2.93	-5.86	0.02304	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.13457	0.0326	.	.	.	0.09310	N	1	B	0.14805	0.011	B	0.08055	0.003	T	0.06320	-1.0833	8	0.07030	T	0.85	.	5.0767	0.14634	0.3245:0.0:0.3073:0.3682	.	329	O43345	ZN208_HUMAN	T	329	ENSP00000380315:I329T	ENSP00000380315:I329T	I	-	2	0	ZNF208	21948690	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.811000	0.00755	-4.922000	0.00027	-4.087000	0.00011	ATT		0.393	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153	
ZNF208	7757	mdanderson.org	37	19	22156855	22156855	+	Silent	SNP	G	G	A	rs200969060	byFrequency	TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr19:22156855G>A	ENST00000397126.4	-	4	1129	c.981C>T	c.(979-981)acC>acT	p.T327T	ZNF208_ENST00000601773.1_Intron|ZNF208_ENST00000599916.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	327					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				GTGTAATAAGGGTTGAGACCT	0.398													g|||	404	0.0806709	0.0756	0.0836	5008	,	,		15360	0.0764		0.0666	False		,,,				2504	0.1043					.											0													65.0	67.0	66.0					19																	22156855		1945	3921	5866	SO:0001819	synonymous_variant	7757			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.981C>T	19.37:g.22156855G>A		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000397126.4	37	CCDS54240.1																																																																																				0.398	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153	
ZNF845	91664	mdanderson.org	37	19	53856761	53856761	+	Missense_Mutation	SNP	T	T	C	rs528924232		TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr19:53856761T>C	ENST00000595091.1	+	5	3052	c.2833T>C	c.(2833-2835)Tgt>Cgt	p.C945R	ZNF845_ENST00000458035.1_Missense_Mutation_p.C945R			Q96IR2	ZN845_HUMAN	zinc finger protein 845	945					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C945R(1)		endometrium(2)|kidney(10)|lung(7)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	26						ACCTTACAAGTGTAATGAATG	0.348																																						.											1	Substitution - Missense(1)	kidney(1)											25.0	23.0	24.0					19																	53856761		692	1590	2282	SO:0001583	missense	91664			BC007307	CCDS46170.1	19q13.42	2013-01-08			ENSG00000213799	ENSG00000213799		"""Zinc fingers, C2H2-type"", ""-"""	25112	protein-coding gene	gene with protein product							Standard	NM_138374		Approved		uc010ydv.1	Q96IR2		ENST00000595091.1:c.2833T>C	19.37:g.53856761T>C	ENSP00000470005:p.Cys945Arg	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000595091.1	37	CCDS46170.1	.	.	.	.	.	.	.	.	.	.	T	7.922	0.738844	0.15642	.	.	ENSG00000213799	ENST00000458035;ENST00000427984	D	0.85258	-1.96	2.04	0.921	0.19403	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.94417	0.8204	H	0.99336	4.52	0.38301	D	0.942985	D	0.89917	1.0	D	0.91635	0.999	D	0.91222	0.5007	9	0.66056	D	0.02	.	6.1858	0.20495	0.2258:0.0:0.0:0.7742	.	945	Q96IR2	ZN845_HUMAN	R	945;861	ENSP00000388311:C945R	ENSP00000412086:C861R	C	+	1	0	ZNF845	58548573	1.000000	0.71417	0.080000	0.20451	0.053000	0.15095	4.520000	0.60524	0.031000	0.15407	-0.871000	0.02989	TGT		0.348	ZNF845-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464359.1	XM_039908	
ZNF329	79673	mdanderson.org;bcgsc.ca	37	19	58639916	58639916	+	Nonsense_Mutation	SNP	C	C	A			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr19:58639916C>A	ENST00000598312.1	-	4	1188	c.955G>T	c.(955-957)Gaa>Taa	p.E319*	ZNF329_ENST00000358067.4_Nonsense_Mutation_p.E319*	NM_024620.3	NP_078896.3	Q86UD4	ZN329_HUMAN	zinc finger protein 329	319					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|large_intestine(10)|lung(5)|skin(3)|urinary_tract(1)	20		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.029)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.017)|Lung(386;0.216)		TTCCCACATTCGTTACATCTA	0.428																																						.											0													132.0	127.0	129.0					19																	58639916		2203	4300	6503	SO:0001587	stop_gained	79673			AK022648	CCDS12972.1	19q13.43	2013-01-08				ENSG00000181894		"""Zinc fingers, C2H2-type"""	14209	protein-coding gene	gene with protein product							Standard	XM_006723381		Approved	FLJ12586	uc002qrn.3	Q86UD4		ENST00000598312.1:c.955G>T	19.37:g.58639916C>A	ENSP00000470008:p.Glu319*	Somatic		WXS	Illumina HiSeq	Phase_I	B3KR32|Q9H9R7	Nonsense_Mutation	SNP	ENST00000598312.1	37	CCDS12972.1	.	.	.	.	.	.	.	.	.	.	C	17.61	3.431607	0.62844	.	.	ENSG00000181894	ENST00000358067;ENST00000500161	.	.	.	4.01	4.01	0.46588	.	0.000000	0.46758	D	0.000264	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-20.6342	16.1129	0.81275	0.0:1.0:0.0:0.0	.	.	.	.	X	319	.	ENSP00000350773:E319X	E	-	1	0	ZNF329	63331728	0.004000	0.15560	0.999000	0.59377	0.134000	0.20937	0.644000	0.24766	2.541000	0.85698	0.655000	0.94253	GAA		0.428	ZNF329-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466724.1	NM_024620	
TEDDM1	127670	bcgsc.ca	37	1	182368966	182368966	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr1:182368966A>G	ENST00000367565.1	-	1	785	c.655T>C	c.(655-657)Ttc>Ctc	p.F219L		NM_172000.3	NP_741997.3	Q5T9Z0	TEDM1_HUMAN	transmembrane epididymal protein 1	219						integral component of membrane (GO:0016021)				haematopoietic_and_lymphoid_tissue(1)|lung(4)|ovary(2)	7						AAGGAAGAGAAGCCATAGATT	0.478																																						.											0													85.0	76.0	79.0					1																	182368966		2203	4300	6503	SO:0001583	missense	127670			AJ515384	CCDS30953.1	1q25.3	2009-09-17		2005-08-09	ENSG00000203730	ENSG00000203730			30233	protein-coding gene	gene with protein product	"""putative membrane protein HE9"", ""transmembrane protein 45C"", ""epididymal protein 9"""						Standard	NM_172000		Approved	HE9, Epdd1, TMEM45C, EDDM9	uc001gpe.3	Q5T9Z0	OTTHUMG00000037398	ENST00000367565.1:c.655T>C	1.37:g.182368966A>G	ENSP00000356536:p.Phe219Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q8IVJ0	Missense_Mutation	SNP	ENST00000367565.1	37	CCDS30953.1	.	.	.	.	.	.	.	.	.	.	A	10.29	1.310316	0.23821	.	.	ENSG00000203730	ENST00000367565	T	0.39787	1.06	4.73	-3.63	0.04529	.	1.234140	0.05592	N	0.574800	T	0.14700	0.0355	N	0.03983	-0.305	0.09310	N	1	B	0.22480	0.07	B	0.23419	0.046	T	0.20940	-1.0260	10	0.02654	T	1	-19.7017	4.4093	0.11425	0.2002:0.5281:0.1634:0.1084	.	219	Q5T9Z0	TEDM1_HUMAN	L	219	ENSP00000356536:F219L	ENSP00000356536:F219L	F	-	1	0	TEDDM1	180635589	0.000000	0.05858	0.001000	0.08648	0.873000	0.50193	-2.654000	0.00855	-0.929000	0.03757	0.460000	0.39030	TTC		0.478	TEDDM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091029.1	NM_172000	
METTL15	196074	bcgsc.ca	37	11	28232628	28232628	+	Frame_Shift_Del	DEL	T	T	-			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr11:28232628delT	ENST00000407364.3	+	4	642	c.290delT	c.(289-291)tttfs	p.F97fs	METTL15_ENST00000406787.3_Frame_Shift_Del_p.F97fs|METTL15_ENST00000342303.5_Frame_Shift_Del_p.F97fs|METTL15_ENST00000303459.6_Frame_Shift_Del_p.F97fs			A6NJ78	MET15_HUMAN	methyltransferase like 15	97							methyltransferase activity (GO:0008168)			NS(1)|breast(1)|endometrium(4)|large_intestine(2)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	14						GATATGACATTTGGTTCGGGA	0.373																																						.											0													82.0	76.0	78.0					11																	28232628		2202	4298	6500	SO:0001589	frameshift_variant	196074			AL832668	CCDS31450.1, CCDS44559.1, CCDS73269.1	11p14.1	2011-03-02	2011-03-02	2011-03-02	ENSG00000169519	ENSG00000169519			26606	protein-coding gene	gene with protein product			"""methyltransferase 5 domain containing 1"""	METT5D1		12477932	Standard	NM_152636		Approved	FLJ33979	uc001msh.2	A6NJ78	OTTHUMG00000150448	ENST00000407364.3:c.290delT	11.37:g.28232628delT	ENSP00000384369:p.Phe97fs	Somatic		WXS	Illumina HiSeq	Phase_I	A8MRS5|B7WNU2|Q3MHD3|Q8N601|Q8NBA7	Frame_Shift_Del	DEL	ENST00000407364.3	37	CCDS44559.1																																																																																				0.373	METTL15-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318135.2	NM_152636	
AASDHPPT	60496	bcgsc.ca	37	11	105950206	105950206	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr11:105950206A>G	ENST00000278618.4	+	2	418	c.196A>G	c.(196-198)Atg>Gtg	p.M66V	KBTBD3_ENST00000526793.1_5'Flank|KBTBD3_ENST00000531837.1_5'Flank|KBTBD3_ENST00000534815.1_5'Flank	NM_015423.2	NP_056238.2	Q9NRN7	ADPPT_HUMAN	aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase	66					macromolecule biosynthetic process (GO:0009059)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	holo-[acyl-carrier-protein] synthase activity (GO:0008897)|magnesium ion binding (GO:0000287)			endometrium(3)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)	17		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)		BRCA - Breast invasive adenocarcinoma(274;5.78e-05)|Epithelial(105;0.00622)|all cancers(92;0.041)		TGGTCGTCTGATGATAAGGAA	0.353																																						.											0													45.0	43.0	44.0					11																	105950206		2201	4299	6500	SO:0001583	missense	60496			AF302110	CCDS31664.1	11q22	2010-12-09			ENSG00000149313	ENSG00000149313	1.2.1.31		14235	protein-coding gene	gene with protein product		607756				12815048, 11286508	Standard	NM_015423		Approved	LYS5, CGI-80, AASD-PPT	uc001pjc.1	Q9NRN7	OTTHUMG00000166253	ENST00000278618.4:c.196A>G	11.37:g.105950206A>G	ENSP00000278618:p.Met66Val	Somatic		WXS	Illumina HiSeq	Phase_I	B2R6D1|B4DDW7|Q9C068|Q9P0Q3|Q9UG80|Q9Y389	Missense_Mutation	SNP	ENST00000278618.4	37	CCDS31664.1	.	.	.	.	.	.	.	.	.	.	A	14.09	2.430530	0.43122	.	.	ENSG00000149313	ENST00000533423;ENST00000524411;ENST00000278618	.	.	.	5.91	4.72	0.59763	4&apos (1);-phosphopantetheinyl transferase (1);	0.055781	0.64402	D	0.000001	T	0.37320	0.0999	L	0.39514	1.22	0.39576	D	0.969351	P	0.35821	0.523	B	0.28305	0.088	T	0.43114	-0.9411	9	0.59425	D	0.04	.	7.0036	0.24823	0.6357:0.2457:0.0:0.1186	.	66	Q9NRN7	ADPPT_HUMAN	V	1;1;66	.	ENSP00000278618:M66V	M	+	1	0	AASDHPPT	105455416	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.921000	0.56454	2.254000	0.74563	0.533000	0.62120	ATG		0.353	AASDHPPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388734.1	NM_015423	
HYLS1	219844	bcgsc.ca	37	11	125770068	125770068	+	Missense_Mutation	SNP	G	G	C			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr11:125770068G>C	ENST00000425380.2	+	3	1586	c.805G>C	c.(805-807)Gag>Cag	p.E269Q	PUS3_ENST00000227474.3_Intron|HYLS1_ENST00000526028.1_Missense_Mutation_p.E269Q|HYLS1_ENST00000356438.3_Missense_Mutation_p.E269Q	NM_001134793.1	NP_001128265.1	Q96M11	HYLS1_HUMAN	hydrolethalus syndrome 1	269						centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|large_intestine(3)|skin(3)|upper_aerodigestive_tract(1)	9	all_hematologic(175;0.177)	Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.131)|all_lung(97;0.139)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0446)		AGTACCAACAGAGAAGAAAAG	0.468																																					Esophageal Squamous(172;2590 2636 8884 10471)	.											0													89.0	84.0	86.0					11																	125770068		2201	4299	6500	SO:0001583	missense	219844			AK057477	CCDS8467.1	11q24	2014-06-18				ENSG00000198331			26558	protein-coding gene	gene with protein product		610693				15843405	Standard	NM_145014		Approved	FLJ32915	uc009zbv.3	Q96M11		ENST00000425380.2:c.805G>C	11.37:g.125770068G>C	ENSP00000414884:p.Glu269Gln	Somatic		WXS	Illumina HiSeq	Phase_I	B3KXI8|Q96BX9	Missense_Mutation	SNP	ENST00000425380.2	37	CCDS8467.1	.	.	.	.	.	.	.	.	.	.	G	17.64	3.439812	0.63067	.	.	ENSG00000198331	ENST00000356438;ENST00000425380;ENST00000526028	T;T;T	0.78246	-1.16;-1.16;-1.16	6.02	4.93	0.64822	.	0.231743	0.33895	N	0.004450	T	0.81446	0.4824	L	0.48642	1.525	0.80722	D	1	D	0.61080	0.989	P	0.58266	0.836	T	0.80348	-0.1420	10	0.44086	T	0.13	.	14.9776	0.71286	0.1182:0.0:0.8818:0.0	.	269	Q96M11	HYLS1_HUMAN	Q	269	ENSP00000348815:E269Q;ENSP00000414884:E269Q;ENSP00000436833:E269Q	ENSP00000348815:E269Q	E	+	1	0	HYLS1	125275278	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	3.606000	0.54095	2.865000	0.98341	0.655000	0.94253	GAG		0.468	HYLS1-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386733.1	NM_145014	
ZMYM5	9205	bcgsc.ca	37	13	20426145	20426145	+	Missense_Mutation	SNP	T	T	A			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr13:20426145T>A	ENST00000337963.4	-	3	440	c.176A>T	c.(175-177)gAt>gTt	p.D59V	ZMYM5_ENST00000382907.4_Missense_Mutation_p.D59V|ZMYM5_ENST00000382905.4_Missense_Mutation_p.D59V	NM_001142684.1	NP_001136156.1	Q9UJ78	ZMYM5_HUMAN	zinc finger, MYM-type 5	59	Poly-Asp.					nucleus (GO:0005634)	zinc ion binding (GO:0008270)			kidney(1)|large_intestine(5)|lung(9)	15		all_cancers(29;2.96e-22)|all_epithelial(30;3.76e-20)|all_lung(29;4.38e-20)|Lung NSC(5;5.8e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.61e-05)|Epithelial(112;4.89e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00171)|Lung(94;0.00942)|LUSC - Lung squamous cell carcinoma(192;0.0431)		AAACACAAcatcatcatcatc	0.378																																						.											0													100.0	96.0	98.0					13																	20426145		2203	4300	6503	SO:0001583	missense	9205			AF161535	CCDS31942.1, CCDS31943.1	13q12	2013-01-08	2005-09-12	2005-09-12	ENSG00000132950	ENSG00000132950		"""Zinc fingers, MYM type"""	13029	protein-coding gene	gene with protein product			"""zinc finger protein 237"""	ZNF237			Standard	NM_001039650		Approved	ZNF198L1, MYM	uc010tcn.1	Q9UJ78	OTTHUMG00000016504	ENST00000337963.4:c.176A>T	13.37:g.20426145T>A	ENSP00000337034:p.Asp59Val	Somatic		WXS	Illumina HiSeq	Phase_I	B2R6V1|Q5T6E1|Q5T6E2|Q5T6E4|Q96IY6|Q9NZY5|Q9UBW0|Q9UJ77	Missense_Mutation	SNP	ENST00000337963.4	37		.	.	.	.	.	.	.	.	.	.	T	10.24	1.296635	0.23650	.	.	ENSG00000132950	ENST00000337963;ENST00000502168;ENST00000382907;ENST00000382905	T;T;T;T	0.33654	1.4;1.4;1.4;1.4	0.575	0.575	0.17374	.	.	.	.	.	T	0.54727	0.1876	M	0.73598	2.24	0.25900	N	0.983367	D;D;D	0.89917	0.994;1.0;0.999	D;D;D	0.87578	0.99;0.998;0.996	T	0.39057	-0.9632	8	0.49607	T	0.09	-11.1414	.	.	.	.	59;59;59	Q9UJ78;Q9UJ78-2;Q9UJ78-1	ZMYM5_HUMAN;.;.	V	59;49;59;59	ENSP00000337034:D59V;ENSP00000445779:D49V;ENSP00000372364:D59V;ENSP00000372361:D59V	ENSP00000337034:D59V	D	-	2	0	ZMYM5	19324145	0.999000	0.42202	0.998000	0.56505	0.918000	0.54935	0.221000	0.17680	0.554000	0.29061	0.219000	0.17774	GAT		0.378	ZMYM5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_014242	
SI	6476	bcgsc.ca	37	3	164776870	164776870	+	Splice_Site	SNP	C	C	A			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr3:164776870C>A	ENST00000264382.3	-	12	1341	c.1279G>T	c.(1279-1281)Gac>Tac	p.D427Y		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	427	Isomaltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	ATTGCAGGGTCCTAATAATAG	0.358										HNSCC(35;0.089)																												.											0													81.0	72.0	75.0					3																	164776870		2203	4299	6502	SO:0001630	splice_region_variant	6476			X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.1279-1G>T	3.37:g.164776870C>A		Somatic		WXS	Illumina HiSeq	Phase_I	A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	ENST00000264382.3	37	CCDS3196.1	.	.	.	.	.	.	.	.	.	.	C	19.94	3.920302	0.73098	.	.	ENSG00000090402	ENST00000264382	D	0.92752	-3.1	5.57	5.57	0.84162	Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	D	0.98160	0.9392	H	0.99545	4.62	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99709	1.1006	10	0.87932	D	0	.	18.5358	0.91010	0.0:1.0:0.0:0.0	.	427	P14410	SUIS_HUMAN	Y	427	ENSP00000264382:D427Y	ENSP00000264382:D427Y	D	-	1	0	SI	166259564	1.000000	0.71417	1.000000	0.80357	0.539000	0.34962	5.184000	0.65070	2.612000	0.88384	0.650000	0.86243	GAC		0.358	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041	Missense_Mutation
GNAQ	2776	bcgsc.ca	37	9	80537112	80537112	+	Missense_Mutation	SNP	T	T	A			TCGA-KL-8339-01A-11D-2310-10	TCGA-KL-8339-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88432832-7a50-48df-90d5-3a5b7e1f5595	cbaafe8b-1636-4107-aa92-de83895cabff	g.chr9:80537112T>A	ENST00000286548.4	-	2	508	c.286A>T	c.(286-288)Aca>Tca	p.T96S		NM_002072.3	NP_002063.2	P50148	GNAQ_HUMAN	guanine nucleotide binding protein (G protein), q polypeptide	96					action potential (GO:0001508)|activation of phospholipase C activity (GO:0007202)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|developmental pigmentation (GO:0048066)|embryonic digit morphogenesis (GO:0042733)|forebrain neuron development (GO:0021884)|glutamate receptor signaling pathway (GO:0007215)|heart development (GO:0007507)|maternal behavior (GO:0042711)|negative regulation of protein kinase activity (GO:0006469)|neuron remodeling (GO:0016322)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|platelet activation (GO:0030168)|positive regulation of GTPase activity (GO:0043547)|post-embryonic development (GO:0009791)|protein stabilization (GO:0050821)|regulation of catenin import into nucleus (GO:0035412)|regulation of melanocyte differentiation (GO:0045634)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)|type 2A serotonin receptor binding (GO:0031826)	p.T96S(1)		NS(1)|endometrium(3)|eye(229)|kidney(1)|large_intestine(4)|lung(6)|meninges(11)|ovary(1)|prostate(1)|skin(44)|upper_aerodigestive_tract(1)	302						ATCTTGAGTGTGTCCATGGCT	0.473			Mis		uveal melanoma																																	.		Dom	yes		9	9q21	2776	"""guanine nucleotide binding protein (G protein), q polypeptide"""		E	1	Substitution - Missense(1)	prostate(1)																																								SO:0001583	missense	2776				CCDS6658.1	9q21	2010-03-17			ENSG00000156052	ENSG00000156052			4390	protein-coding gene	gene with protein product		600998				8825633	Standard	NM_002072		Approved	G-ALPHA-q, GAQ	uc004akw.3	P50148	OTTHUMG00000020059	ENST00000286548.4:c.286A>T	9.37:g.80537112T>A	ENSP00000286548:p.Thr96Ser	Somatic		WXS	Illumina HiSeq	Phase_I	O15108|Q13462|Q6NT27|Q92471|Q9BZB9	Missense_Mutation	SNP	ENST00000286548.4	37	CCDS6658.1	.	.	.	.	.	.	.	.	.	.	T	13.12	2.141103	0.37825	.	.	ENSG00000156052	ENST00000286548;ENST00000411677	D;D	0.87809	-2.3;-2.3	5.86	5.86	0.93980	G protein alpha subunit, helical insertion (2);	0.000000	0.85682	D	0.000000	D	0.84170	0.5413	L	0.52126	1.63	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.79122	-0.1933	10	0.29301	T	0.29	.	16.2652	0.82574	0.0:0.0:0.0:1.0	.	96	P50148	GNAQ_HUMAN	S	96;67	ENSP00000286548:T96S;ENSP00000391501:T67S	ENSP00000286548:T96S	T	-	1	0	GNAQ	79726932	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.145000	0.64839	2.241000	0.73720	0.528000	0.53228	ACA		0.473	GNAQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052761.1	NM_002072	
