#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
APOA1	335	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	11	116707862	116707862	+	Missense_Mutation	SNP	G	G	A	rs371084971		TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr11:116707862G>A	ENST00000236850.4	-	3	420	c.55C>T	c.(55-57)Cgg>Tgg	p.R19W	AP006216.12_ENST00000444200.1_RNA|APOA1_ENST00000375323.1_Missense_Mutation_p.R19W|APOA1_ENST00000359492.2_Missense_Mutation_p.R19W|APOA1_ENST00000375329.2_Intron|APOA1_ENST00000375320.1_Missense_Mutation_p.R19W	NM_000039.1	NP_000030.1	P02647	APOA1_HUMAN	apolipoprotein A-I	19					adrenal gland development (GO:0030325)|blood coagulation (GO:0007596)|blood vessel endothelial cell migration (GO:0043534)|cellular lipid metabolic process (GO:0044255)|cholesterol biosynthetic process (GO:0006695)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol import (GO:0070508)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|endothelial cell proliferation (GO:0001935)|G-protein coupled receptor signaling pathway (GO:0007186)|glucocorticoid metabolic process (GO:0008211)|high-density lipoprotein particle assembly (GO:0034380)|high-density lipoprotein particle clearance (GO:0034384)|high-density lipoprotein particle remodeling (GO:0034375)|integrin-mediated signaling pathway (GO:0007229)|lipid storage (GO:0019915)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein metabolic process (GO:0042157)|negative chemotaxis (GO:0050919)|negative regulation of cell adhesion molecule production (GO:0060354)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of lipase activity (GO:0060192)|negative regulation of response to cytokine stimulus (GO:0060761)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|negative regulation of very-low-density lipoprotein particle remodeling (GO:0010903)|organ regeneration (GO:0031100)|peptidyl-methionine modification (GO:0018206)|peripheral nervous system axon regeneration (GO:0014012)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of hydrolase activity (GO:0051345)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of transferase activity (GO:0051347)|protein oxidation (GO:0018158)|protein stabilization (GO:0050821)|regulation of Cdc42 protein signal transduction (GO:0032489)|regulation of intestinal cholesterol absorption (GO:0030300)|regulation of protein phosphorylation (GO:0001932)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to nutrient (GO:0007584)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|triglyceride homeostasis (GO:0070328)	blood microparticle (GO:0072562)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule lumen (GO:0034774)|spherical high-density lipoprotein particle (GO:0034366)|very-low-density lipoprotein particle (GO:0034361)|vesicle (GO:0031982)	apolipoprotein A-I receptor binding (GO:0034191)|apolipoprotein receptor binding (GO:0034190)|beta-amyloid binding (GO:0001540)|chemorepellent activity (GO:0045499)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|enzyme binding (GO:0019899)|high-density lipoprotein particle binding (GO:0008035)|high-density lipoprotein particle receptor binding (GO:0070653)|identical protein binding (GO:0042802)|lipase inhibitor activity (GO:0055102)|phosphatidylcholine-sterol O-acyltransferase activator activity (GO:0060228)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)			cervix(1)|endometrium(1)|lung(4)|prostate(1)|skin(2)	9	all_hematologic(175;0.0487)	Breast(348;0.0126)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.0564)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|Epithelial(105;1.59e-05)|all cancers(92;0.000162)|OV - Ovarian serous cystadenocarcinoma(223;0.148)		CAGAAATGCCGAGCCTGGCTC	0.632																																						.											0								G	TRP/ARG	0,4402		0,0,2201	49.0	56.0	54.0		55	1.3	1.0	11		54	1,8589	1.2+/-3.3	0,1,4294	no	missense	APOA1	NM_000039.1	101	0,1,6495	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	19/268	116707862	1,12991	2201	4295	6496	SO:0001583	missense	335			X02162	CCDS8378.1	11q23-q24	2014-09-17			ENSG00000118137	ENSG00000118137		"""Apolipoproteins"""	600	protein-coding gene	gene with protein product		107680					Standard	NM_000039		Approved		uc001ppv.1	P02647	OTTHUMG00000046112	ENST00000236850.4:c.55C>T	11.37:g.116707862G>A	ENSP00000236850:p.Arg19Trp	Somatic		WXS	Illumina HiSeq	Phase_I	A8K866|Q6LDN9|Q6Q785|Q9UCS8|Q9UCT8	Missense_Mutation	SNP	ENST00000236850.4	37	CCDS8378.1	.	.	.	.	.	.	.	.	.	.	G	13.00	2.107700	0.37242	0.0	1.16E-4	ENSG00000118137	ENST00000375320;ENST00000359492;ENST00000375323;ENST00000236850	T;T;T;T	0.68903	-0.36;-0.36;-0.36;-0.36	4.76	1.33	0.21861	.	0.381500	0.17497	N	0.172134	T	0.51312	0.1667	L	0.59912	1.85	0.27392	N	0.955111	P	0.36959	0.575	B	0.24974	0.057	T	0.43278	-0.9401	10	0.40728	T	0.16	-18.0312	5.5232	0.16943	0.0771:0.1121:0.574:0.2368	.	19	P02647	APOA1_HUMAN	W	19	ENSP00000364469:R19W;ENSP00000352471:R19W;ENSP00000364472:R19W;ENSP00000236850:R19W	ENSP00000236850:R19W	R	-	1	2	APOA1	116213072	0.969000	0.33509	0.999000	0.59377	0.972000	0.66771	1.680000	0.37607	0.416000	0.25844	0.462000	0.41574	CGG		0.632	APOA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106281.2	NM_000039	
ACAP3	116983	hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	1	1235261	1235261	+	Missense_Mutation	SNP	C	C	G			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr1:1235261C>G	ENST00000354700.5	-	9	890	c.688G>C	c.(688-690)Gcg>Ccg	p.A230P	ACAP3_ENST00000353662.3_Missense_Mutation_p.A188P|ACAP3_ENST00000379037.2_5'Flank	NM_030649.2	NP_085152.2	Q96P50	ACAP3_HUMAN	ArfGAP with coiled-coil, ankyrin repeat and PH domains 3	230					regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			endometrium(3)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	14						TTTTCCACCGCAGAGTCGATC	0.687																																						.											0													22.0	24.0	24.0					1																	1235261		2178	4282	6460	SO:0001583	missense	116983			AF411981	CCDS19.2	1p36	2013-01-10	2008-09-22	2008-09-22	ENSG00000131584	ENSG00000131584		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16754	protein-coding gene	gene with protein product			"""centaurin, beta 5"""	CENTB5			Standard	NM_030649		Approved	KIAA1716	uc001aeb.2	Q96P50	OTTHUMG00000002235	ENST00000354700.5:c.688G>C	1.37:g.1235261C>G	ENSP00000346733:p.Ala230Pro	Somatic		WXS	Illumina HiSeq	Phase_I	B1AMF5|Q5TA42|Q5TA43|Q86UT3|Q9BSR9|Q9C0E7	Missense_Mutation	SNP	ENST00000354700.5	37	CCDS19.2	.	.	.	.	.	.	.	.	.	.	C	15.23	2.771765	0.49680	.	.	ENSG00000131584	ENST00000354700;ENST00000353662	T;T	0.04502	3.61;3.61	3.38	3.38	0.38709	.	0.000000	0.85682	D	0.000000	T	0.21186	0.0510	M	0.79926	2.475	0.41380	D	0.987541	D;D;D	0.71674	0.998;0.992;0.988	D;P;P	0.74348	0.983;0.828;0.839	T	0.05241	-1.0897	10	0.40728	T	0.16	.	16.0417	0.80687	0.0:1.0:0.0:0.0	.	270;230;188	Q5TA40;Q96P50;Q96P50-1	.;ACAP3_HUMAN;.	P	230;188	ENSP00000346733:A230P;ENSP00000321139:A188P	ENSP00000321139:A188P	A	-	1	0	ACAP3	1225124	1.000000	0.71417	0.828000	0.32881	0.773000	0.43773	7.108000	0.77055	2.201000	0.70794	0.313000	0.20887	GCG		0.687	ACAP3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006366.2	NM_030649	
SRGAP1	57522	hgsc.bcm.edu;ucsc.edu	37	12	64436722	64436722	+	Silent	SNP	T	T	A			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr12:64436722T>A	ENST00000355086.3	+	5	1166	c.642T>A	c.(640-642)tcT>tcA	p.S214S	SRGAP1_ENST00000357825.3_Silent_p.S214S|RP11-196H14.2_ENST00000535594.1_RNA|SRGAP1_ENST00000543397.1_Silent_p.S174S	NM_020762.2	NP_065813.1	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	214	F-BAR domain.				axon guidance (GO:0007411)|cell migration (GO:0016477)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)			breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	65			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		GGCGAAGCTCTGTAAAGAAAA	0.393																																						.											0													55.0	56.0	55.0					12																	64436722		2203	4300	6503	SO:0001819	synonymous_variant	57522			AB037725	CCDS8967.1	12q13.13	2011-07-04			ENSG00000196935	ENSG00000196935		"""Rho GTPase activating proteins"""	17382	protein-coding gene	gene with protein product		606523				11672528	Standard	NM_020762		Approved	KIAA1304, ARHGAP13	uc010ssp.1	Q7Z6B7	OTTHUMG00000168750	ENST00000355086.3:c.642T>A	12.37:g.64436722T>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q9H8A3|Q9P2P2	Silent	SNP	ENST00000355086.3	37	CCDS8967.1																																																																																				0.393	SRGAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400896.1		
CEP290	80184	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	12	88444148	88444148	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr12:88444148C>T	ENST00000552810.1	-	53	7535	c.7192G>A	c.(7192-7194)Gaa>Aaa	p.E2398K	CEP290_ENST00000547691.2_Missense_Mutation_p.E1458K|CEP290_ENST00000397838.3_Missense_Mutation_p.E1458K|CEP290_ENST00000309041.7_Missense_Mutation_p.E2400K|RNA5SP364_ENST00000516938.1_RNA	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa	2398					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)				breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						TGCTGCTTTTCTAGATCTGAC	0.299																																						.											0													90.0	79.0	82.0					12																	88444148		1808	4073	5881	SO:0001583	missense	80184			AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.7192G>A	12.37:g.88444148C>T	ENSP00000448012:p.Glu2398Lys	Somatic		WXS	Illumina HiSeq	Phase_I	Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Missense_Mutation	SNP	ENST00000552810.1	37	CCDS55858.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.435975	0.83885	.	.	ENSG00000198707	ENST00000547691;ENST00000552810;ENST00000309041;ENST00000397838	T;T;T;T	0.75704	-0.13;-0.96;-0.95;-0.13	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	T	0.77644	0.4161	M	0.73598	2.24	0.39180	D	0.962756	P	0.49862	0.929	P	0.46419	0.516	T	0.80576	-0.1321	10	0.40728	T	0.16	.	15.0296	0.71696	0.0:1.0:0.0:0.0	.	2398	O15078	CE290_HUMAN	K	1458;2398;2400;1458	ENSP00000446905:E1458K;ENSP00000448012:E2398K;ENSP00000308021:E2400K;ENSP00000380938:E1458K	ENSP00000308021:E2400K	E	-	1	0	CEP290	86968279	0.998000	0.40836	0.993000	0.49108	0.796000	0.44982	5.011000	0.64011	2.346000	0.79739	0.655000	0.94253	GAA		0.299	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406344.1	NM_025114	
TMEM132C	92293	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	12	129180458	129180458	+	Missense_Mutation	SNP	G	G	A	rs374244452		TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr12:129180458G>A	ENST00000435159.2	+	7	1739	c.1739G>A	c.(1738-1740)cGg>cAg	p.R580Q	TMEM132C_ENST00000315208.8_Missense_Mutation_p.R196Q|TMEM132C_ENST00000537538.1_5'UTR	NM_001136103.2	NP_001129575.2	Q8N3T6	T132C_HUMAN	transmembrane protein 132C	580						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(2)|prostate(2)|skin(1)	13						GCCACCGTGCGGGTCCTCACC	0.642																																						.											0								G	GLN/ARG	0,1384		0,0,692	59.0	62.0	61.0		1739	4.8	1.0	12		61	1,3181		0,1,1590	no	missense	TMEM132C	NM_001136103.2	43	0,1,2282	AA,AG,GG		0.0314,0.0,0.0219	probably-damaging	580/1109	129180458	1,4565	692	1591	2283	SO:0001583	missense	92293			AK126715		12q24.32	2014-06-13				ENSG00000181234			25436	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 152"""						Standard	NM_001136103		Approved	DKFZp761O2018, PPP1R152	uc021rgn.1	Q8N3T6		ENST00000435159.2:c.1739G>A	12.37:g.129180458G>A	ENSP00000410852:p.Arg580Gln	Somatic		WXS	Illumina HiSeq	Phase_I	Q69YX8	Missense_Mutation	SNP	ENST00000435159.2	37		.	.	.	.	.	.	.	.	.	.	G	21.1	4.105598	0.77096	0.0	3.14E-4	ENSG00000181234	ENST00000435159;ENST00000315208	T;T	0.54279	0.58;0.58	4.82	4.82	0.62117	.	0.000000	0.56097	D	0.000026	T	0.67859	0.2938	L	0.53249	1.67	0.53688	D	0.999974	D	0.89917	1.0	D	0.74348	0.983	T	0.66368	-0.5941	10	0.35671	T	0.21	.	17.9238	0.88976	0.0:0.0:1.0:0.0	.	580	Q8N3T6	T132C_HUMAN	Q	580;196	ENSP00000410852:R580Q;ENSP00000324458:R196Q	ENSP00000324458:R196Q	R	+	2	0	TMEM132C	127746411	1.000000	0.71417	0.997000	0.53966	0.991000	0.79684	5.105000	0.64591	2.210000	0.71456	0.655000	0.94253	CGG		0.642	TMEM132C-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		XM_044062	
ZNF106	64397	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	15	42742931	42742931	+	Silent	SNP	C	C	T			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr15:42742931C>T	ENST00000263805.4	-	2	1796	c.1470G>A	c.(1468-1470)tcG>tcA	p.S490S	ZNF106_ENST00000565611.1_Intron|ZNF106_ENST00000565380.1_Intron	NM_001284306.1|NM_001284307.1|NM_022473.1	NP_001271235.1|NP_001271236.1|NP_071918.1	Q9H2Y7	ZN106_HUMAN	zinc finger protein 106	490					insulin receptor signaling pathway (GO:0008286)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										TGGGCTTGTTCGAGGGATTTG	0.388																																						.											0													229.0	224.0	225.0					15																	42742931		2203	4299	6502	SO:0001819	synonymous_variant	64397			AF205632	CCDS32208.1, CCDS61602.1, CCDS61603.1	15q15.1	2012-11-27	2012-11-27		ENSG00000103994	ENSG00000103994		"""Zinc fingers, C2H2-type"""	12886	protein-coding gene	gene with protein product	"""SH3-domain binding protein 3"""		"""zinc finger protein 106 homolog (mouse)"""	ZFP106			Standard	XM_005254591		Approved	ZNF474, SH3BP3	uc001zpw.3	Q9H2Y7	OTTHUMG00000173244	ENST00000263805.4:c.1470G>A	15.37:g.42742931C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B4DZ40|E9PE29|Q6NSD9|Q6PEK1|Q86T43|Q86T45|Q86T50|Q86T58|Q86TA9|Q96M37|Q9H7B8	Silent	SNP	ENST00000263805.4	37	CCDS32208.1																																																																																				0.388	ZNF106-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422587.1	NM_022473	
DTWD1	56986	hgsc.bcm.edu	37	15	49926993	49926994	+	Splice_Site	INS	-	-	A	rs111446752	byFrequency	TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr15:49926993_49926994insA	ENST00000251250.6	+	5	874		c.e5+2		DTWD1_ENST00000558653.1_Splice_Site|DTWD1_ENST00000403028.3_Splice_Site|DTWD1_ENST00000415425.1_Splice_Site	NM_020234.5	NP_064619.2	Q8N5C7	DTWD1_HUMAN	DTW domain containing 1									p.?(1)		endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	9		all_lung(180;0.0384)		all cancers(107;3.27e-08)|GBM - Glioblastoma multiforme(94;7.6e-05)		GACTTCAAGGTAAAAAAAAAAT	0.327																																						.											1	Unknown(1)	ovary(1)																																								SO:0001630	splice_region_variant	56986			BC032535	CCDS10132.1	15q21.2	2005-08-09			ENSG00000104047	ENSG00000104047			30926	protein-coding gene	gene with protein product							Standard	NM_020234		Approved	MDS009, MGC111207	uc001zxs.3	Q8N5C7	OTTHUMG00000131567	ENST00000251250.6:c.667+2->A	15.37:g.49927003_49927003dupA		Somatic		WXS	Illumina HiSeq	Phase_I	Q567Q3|Q8WVG9|Q9NRU6	Splice_Site	INS	ENST00000251250.6	37	CCDS10132.1																																																																																				0.327	DTWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254431.2	NM_020234	Intron
VPS13C	54832	hgsc.bcm.edu	37	15	62261606	62261606	+	Silent	SNP	G	G	A			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr15:62261606G>A	ENST00000261517.5	-	28	2876	c.2803C>T	c.(2803-2805)Cta>Tta	p.L935L	VPS13C_ENST00000395898.3_Silent_p.L892L|VPS13C_ENST00000249837.3_Silent_p.L892L|VPS13C_ENST00000395896.4_Silent_p.L935L	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)									p.L935V(1)		NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						TTAAATACTAGAATTGTATCT	0.299																																						.											1	Substitution - Missense(1)	ovary(1)											63.0	60.0	61.0					15																	62261606		2195	4281	6476	SO:0001819	synonymous_variant	54832			AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.2803C>T	15.37:g.62261606G>A		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000261517.5	37	CCDS32257.1																																																																																				0.299	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415997.1	NM_017684	
GDPGP1	390637	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	15	90784689	90784689	+	Silent	SNP	G	G	A	rs373465372		TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr15:90784689G>A	ENST00000558017.1	+	4	969	c.549G>A	c.(547-549)ccG>ccA	p.P183P	GDPGP1_ENST00000329600.6_Silent_p.P183P	NM_001013657.2	NP_001013679.2	Q6ZNW5	GDPP1_HUMAN	GDP-D-glucose phosphorylase 1	183					glucose metabolic process (GO:0006006)	cytoplasm (GO:0005737)	GDP-D-glucose phosphorylase activity (GO:0080048)|guanyl-nucleotide exchange factor activity (GO:0005085)|hydrolase activity (GO:0016787)|nucleotide binding (GO:0000166)|nucleotidyltransferase activity (GO:0016779)										GCCTGCTGCCGGGTGCACTGA	0.662																																						.											0													39.0	43.0	42.0					15																	90784689		2199	4298	6497	SO:0001819	synonymous_variant	390637				CCDS32327.1	15q26.1	2012-05-04	2012-05-04	2012-05-04	ENSG00000183208	ENSG00000183208	2.7.7.78		34360	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 58"""	C15orf58		21507950	Standard	NM_001013657		Approved		uc002bpc.3	Q6ZNW5		ENST00000558017.1:c.549G>A	15.37:g.90784689G>A		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000558017.1	37	CCDS32327.1																																																																																				0.662	GDPGP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416973.1	NM_001013657	
CCDC154	645811	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	16	1493884	1493884	+	Missense_Mutation	SNP	G	G	A	rs550754764		TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr16:1493884G>A	ENST00000389176.3	-	2	303	c.137C>T	c.(136-138)tCg>tTg	p.S46L	LA16c-390E6.5_ENST00000566287.1_RNA|CCDC154_ENST00000409671.1_5'UTR	NM_001143980.1	NP_001137452.1	A6NI56	CC154_HUMAN	coiled-coil domain containing 154	46						endosome (GO:0005768)				NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)	5						ATACCTCTCCGAGAGCTCCTC	0.672													G|||	1	0.000199681	0.0008	0.0	5008	,	,		14338	0.0		0.0	False		,,,				2504	0.0					.											0													43.0	51.0	49.0					16																	1493884		692	1590	2282	SO:0001583	missense	645811					16p13.3	2012-12-13			ENSG00000197599	ENSG00000197599			34454	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 29"""	C16orf29			Standard	NM_001143980		Approved	LOC645811	uc010uve.2	A6NI56	OTTHUMG00000154097	ENST00000389176.3:c.137C>T	16.37:g.1493884G>A	ENSP00000373828:p.Ser46Leu	Somatic		WXS	Illumina HiSeq	Phase_I	G9JV18	Missense_Mutation	SNP	ENST00000389176.3	37		.	.	.	.	.	.	.	.	.	.	G	17.62	3.434746	0.62955	.	.	ENSG00000197599	ENST00000389176	.	.	.	4.28	2.26	0.28386	.	0.000000	0.31113	N	0.008233	T	0.20251	0.0487	N	0.24115	0.695	0.09310	N	1	B	0.33135	0.399	B	0.27170	0.077	T	0.13899	-1.0492	9	0.72032	D	0.01	-4.6481	7.0553	0.25095	0.2001:0.0:0.7999:0.0	.	46	A6NI56	CC154_HUMAN	L	46	.	ENSP00000373828:S46L	S	-	2	0	CCDC154	1433885	0.031000	0.19500	0.001000	0.08648	0.005000	0.04900	0.573000	0.23699	0.427000	0.26145	0.549000	0.68633	TCG		0.672	CCDC154-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_001143980	
TSC2	7249	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	16	2113034	2113034	+	Missense_Mutation	SNP	A	A	T			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr16:2113034A>T	ENST00000219476.3	+	14	2053	c.1423A>T	c.(1423-1425)Atc>Ttc	p.I475F	TSC2_ENST00000439673.2_Missense_Mutation_p.I438F|TSC2_ENST00000350773.4_Missense_Mutation_p.I475F|TSC2_ENST00000401874.2_Missense_Mutation_p.I475F|TSC2_ENST00000382538.6_Missense_Mutation_p.I426F|TSC2_ENST00000353929.4_Missense_Mutation_p.I475F|TSC2_ENST00000568454.1_Missense_Mutation_p.I486F	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2	475					acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				TGTGCTGCTCATCAACAGGCA	0.672			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																													.	yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	0													78.0	60.0	66.0					16																	2113034		1992	3831	5823	SO:0001583	missense	7249	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.1423A>T	16.37:g.2113034A>T	ENSP00000219476:p.Ile475Phe	Somatic		WXS	Illumina HiSeq	Phase_I	A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Missense_Mutation	SNP	ENST00000219476.3	37	CCDS10458.1	.	.	.	.	.	.	.	.	.	.	.	27.0	4.794086	0.90453	.	.	ENSG00000103197	ENST00000219476;ENST00000401874;ENST00000353929;ENST00000439673;ENST00000382538;ENST00000350773	T;T;T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.29;-0.29;-0.29	5.24	5.24	0.73138	Armadillo-type fold (1);	0.108239	0.64402	D	0.000007	T	0.73869	0.3642	L	0.47716	1.5	0.51482	D	0.999929	D;D;D;D;D;D	0.69078	0.962;0.994;0.98;0.997;0.997;0.978	P;D;P;D;D;D	0.70227	0.756;0.947;0.759;0.947;0.968;0.942	T	0.74711	-0.3573	10	0.51188	T	0.08	-28.4526	10.37	0.44049	0.923:0.0:0.077:0.0	.	426;438;475;475;475;475	B4DIL8;P49815-6;P49815-4;P49815-3;P49815-5;P49815	.;.;.;.;.;TSC2_HUMAN	F	475;475;475;438;426;475	ENSP00000219476:I475F;ENSP00000384468:I475F;ENSP00000248099:I475F;ENSP00000399232:I438F;ENSP00000371978:I426F;ENSP00000344383:I475F	ENSP00000219476:I475F	I	+	1	0	TSC2	2053035	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.752000	0.74898	1.973000	0.57446	0.533000	0.62120	ATC		0.672	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250657.2	NM_000548	
TAS1R1	80835	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	1	6634949	6634949	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr1:6634949G>A	ENST00000333172.6	+	3	950	c.757G>A	c.(757-759)Gat>Aat	p.D253N	TAS1R1_ENST00000328191.4_Missense_Mutation_p.D253N|TAS1R1_ENST00000351136.3_Intron	NM_138697.3	NP_619642.2	Q7RTX1	TS1R1_HUMAN	taste receptor, type 1, member 1	253					detection of chemical stimulus involved in sensory perception of taste (GO:0050912)|sensory perception of umami taste (GO:0050917)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(13)|ovary(1)|skin(1)|urinary_tract(2)	29	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;8.73e-34)|all_epithelial(116;9.26e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Breast(487;0.000353)|Renal(390;0.0007)|Colorectal(325;0.00104)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00108)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)		CCAGGTGGGCGATGAGAGGAT	0.612																																						.											0													73.0	75.0	74.0					1																	6634949		2203	4300	6503	SO:0001583	missense	80835				CCDS81.1, CCDS82.1	1p36.23	2012-08-22	2003-03-24		ENSG00000173662	ENSG00000173662		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14448	protein-coding gene	gene with protein product		606225	"""G protein-coupled receptor 70"""	GPR70			Standard	NM_138697		Approved	T1R1, TR1	uc001ant.3	Q7RTX1	OTTHUMG00000001441	ENST00000333172.6:c.757G>A	1.37:g.6634949G>A	ENSP00000331867:p.Asp253Asn	Somatic		WXS	Illumina HiSeq	Phase_I	B2RMX0|Q5SY22|Q5SY24|Q8NGZ7|Q8TDJ7|Q8TDJ8|Q8TDJ9|Q8TDK0	Missense_Mutation	SNP	ENST00000333172.6	37	CCDS81.1	.	.	.	.	.	.	.	.	.	.	G	8.317	0.823442	0.16678	.	.	ENSG00000173662	ENST00000333172;ENST00000328191	D;D	0.83591	-1.74;-1.74	5.4	4.49	0.54785	Extracellular ligand-binding receptor (1);	1.286080	0.04829	N	0.438363	T	0.75170	0.3813	L	0.37800	1.135	0.09310	N	1	B;B	0.31879	0.171;0.344	B;B	0.27608	0.051;0.081	T	0.59974	-0.7353	10	0.18276	T	0.48	.	8.0489	0.30566	0.1913:0.0:0.8087:0.0	.	253;253	Q7RTX1-3;Q7RTX1	.;TS1R1_HUMAN	N	253	ENSP00000331867:D253N;ENSP00000327705:D253N	ENSP00000327705:D253N	D	+	1	0	TAS1R1	6557536	0.014000	0.17966	0.015000	0.15790	0.009000	0.06853	1.803000	0.38863	1.249000	0.43950	0.655000	0.94253	GAT		0.612	TAS1R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004211.1		
PKD1L2	114780	hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	16	81242140	81242140	+	RNA	SNP	G	G	A			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr16:81242140G>A	ENST00000525539.1	-	0	715				PKD1L2_ENST00000337114.4_RNA	NM_052892.3	NP_443124.3	Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						GCCCTGAGTCGGACACAGGTT	0.562																																						.											0													87.0	85.0	85.0					16																	81242140		2126	4222	6348			114780			AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81242140G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	Missense_Mutation	SNP	ENST00000525539.1	37		.	.	.	.	.	.	.	.	.	.	G	22.2	4.257915	0.80246	.	.	ENSG00000166473	ENST00000337114	T	0.18810	2.19	4.29	4.29	0.51040	D-galactoside/L-rhamnose binding SUEL lectin domain (2);	0.071096	0.56097	D	0.000024	T	0.48295	0.1492	.	.	.	0.43857	D	0.996451	D;D	0.89917	1.0;1.0	D;D	0.80764	0.99;0.994	T	0.56655	-0.7943	9	0.87932	D	0	-19.3424	16.3594	0.83251	0.0:0.0:1.0:0.0	.	239;239	Q7Z442-3;Q7Z442	.;PK1L2_HUMAN	L	239	ENSP00000337397:P239L	ENSP00000337397:P239L	P	-	2	0	PKD1L2	79799641	1.000000	0.71417	0.880000	0.34516	0.915000	0.54546	7.373000	0.79623	1.940000	0.56252	0.462000	0.41574	CCG		0.562	PKD1L2-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000387972.2		
KCNH4	23415	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	17	40321548	40321548	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr17:40321548G>A	ENST00000264661.3	-	9	1869	c.1537C>T	c.(1537-1539)Ctc>Ttc	p.L513F	KCNH4_ENST00000607371.1_Missense_Mutation_p.L513F	NM_012285.2	NP_036417.1	Q9UQ05	KCNH4_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 4	513					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(15)|skin(2)|urinary_tract(1)	32		all_cancers(22;1.24e-06)|all_epithelial(22;4.33e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		AAGTATTCGAGCATGCGCTGC	0.647																																					NSCLC(117;707 1703 2300 21308 31858)	.											0													79.0	72.0	74.0					17																	40321548		2203	4300	6503	SO:0001583	missense	23415			AB022698	CCDS11420.1	17q21	2012-07-05				ENSG00000089558		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6253	protein-coding gene	gene with protein product		604528				10455180, 16382104	Standard	NM_012285		Approved	Kv12.3, elk1	uc002hzb.2	Q9UQ05		ENST00000264661.3:c.1537C>T	17.37:g.40321548G>A	ENSP00000264661:p.Leu513Phe	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000264661.3	37	CCDS11420.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.675197	0.88445	.	.	ENSG00000089558	ENST00000264661	D	0.96967	-4.19	4.18	4.18	0.49190	Cyclic nucleotide-binding-like (1);	0.000000	0.34291	N	0.004085	D	0.97309	0.9120	M	0.71581	2.175	0.80722	D	1	D	0.63880	0.993	P	0.61477	0.889	D	0.96990	0.9721	10	0.39692	T	0.17	.	16.6694	0.85261	0.0:0.0:1.0:0.0	.	513	Q9UQ05	KCNH4_HUMAN	F	513	ENSP00000264661:L513F	ENSP00000264661:L513F	L	-	1	0	KCNH4	37575074	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	6.426000	0.73374	2.148000	0.66965	0.462000	0.41574	CTC		0.647	KCNH4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449791.2	NM_012285	
TP53	7157	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	17	7577064	7577064	+	Nonsense_Mutation	SNP	T	T	A			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr17:7577064T>A	ENST00000269305.4	-	8	1063	c.874A>T	c.(874-876)Aaa>Taa	p.K292*	TP53_ENST00000420246.2_Nonsense_Mutation_p.K292*|TP53_ENST00000455263.2_Nonsense_Mutation_p.K292*|TP53_ENST00000445888.2_Nonsense_Mutation_p.K292*|TP53_ENST00000359597.4_Nonsense_Mutation_p.K292*|TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	292	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		K -> E (in sporadic cancers; somatic mutation).|K -> G (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|K -> I (in LFS; germline mutation and in a sporadic cancer; somatic mutation). {ECO:0000269|PubMed:10484981}.|K -> N (in sporadic cancers; somatic mutation).|K -> Q (in a sporadic cancer; somatic mutation).|K -> R (in sporadic cancers; somatic mutation).|K -> T (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.K291fs*48(8)|p.0?(8)|p.?(2)|p.E294fs*51(2)|p.K292E(2)|p.K292*(2)|p.K292fs*13(1)|p.T284_G293del10(1)|p.L265_K305del41(1)|p.R290fs*12(1)|p.R290fs*50(1)|p.K291fs*12(1)|p.R290_P295>X(1)|p.E285fs*13(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCTCCCCTTTCTTGCGGAGA	0.577		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	33	Deletion - Frameshift(15)|Whole gene deletion(8)|Deletion - In frame(3)|Substitution - Nonsense(2)|Unknown(2)|Substitution - Missense(2)|Complex - deletion inframe(1)	upper_aerodigestive_tract(12)|urinary_tract(4)|bone(4)|haematopoietic_and_lymphoid_tissue(3)|stomach(2)|central_nervous_system(2)|breast(2)|salivary_gland(1)|large_intestine(1)|endometrium(1)|oesophagus(1)											104.0	89.0	94.0					17																	7577064		2203	4300	6503	SO:0001587	stop_gained	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.874A>T	17.37:g.7577064T>A	ENSP00000269305:p.Lys292*	Somatic		WXS	Illumina HiSeq	Phase_I	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	T	24.3	4.521424	0.85600	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	5.12	4.03	0.46877	.	0.183996	0.46145	D	0.000309	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-23.716	5.2408	0.15471	0.0:0.0898:0.182:0.7282	.	.	.	.	X	292;292;292;292;292;281;160	.	ENSP00000269305:K292X	K	-	1	0	TP53	7517789	0.998000	0.40836	0.909000	0.35828	0.257000	0.26127	1.203000	0.32284	0.944000	0.37579	0.459000	0.35465	AAA		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
PDK2	5164	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	17	48184157	48184157	+	Splice_Site	SNP	G	G	C			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr17:48184157G>C	ENST00000503176.1	+	5	678		c.e5-1		PDK2_ENST00000007708.3_Splice_Site	NM_002611.4	NP_002602.2	Q15119	PDK2_HUMAN	pyruvate dehydrogenase kinase, isozyme 2						cellular metabolic process (GO:0044237)|cellular response to nutrient (GO:0031670)|cellular response to reactive oxygen species (GO:0034614)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|protein phosphorylation (GO:0006468)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of cellular ketone metabolic process (GO:0010565)|regulation of gluconeogenesis (GO:0006111)|regulation of glucose metabolic process (GO:0010906)|regulation of pH (GO:0006885)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrial pyruvate dehydrogenase complex (GO:0005967)	ATP binding (GO:0005524)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|pyruvate dehydrogenase (acetyl-transferring) kinase activity (GO:0004740)			central_nervous_system(4)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	20						CCTGCCTGCAGCCCTCATCTT	0.582									Autosomal Dominant Polycystic Kidney Disease																													.											0													132.0	96.0	108.0					17																	48184157		2203	4300	6503	SO:0001630	splice_region_variant	5164	Familial Cancer Database	ADPKD	L42451	CCDS11559.1, CCDS56039.1	17q21.33	2012-07-18	2005-11-16		ENSG00000005882	ENSG00000005882			8810	protein-coding gene	gene with protein product		602525	"""pyruvate dehydrogenase kinase, isoenzyme 2"""			7499431	Standard	NM_001199898		Approved	PDHK2	uc002iqc.3	Q15119	OTTHUMG00000161948	ENST00000503176.1:c.518-1G>C	17.37:g.48184157G>C		Somatic		WXS	Illumina HiSeq	Phase_I	A8K3A7|B3KNW0|Q6P515|Q9BS05	Splice_Site	SNP	ENST00000503176.1	37	CCDS11559.1	.	.	.	.	.	.	.	.	.	.	G	16.50	3.141080	0.56936	.	.	ENSG00000005882	ENST00000007708;ENST00000508030;ENST00000503176;ENST00000503614;ENST00000505440;ENST00000510219	.	.	.	4.77	4.77	0.60923	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.7108	0.85385	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PDK2	45539156	1.000000	0.71417	1.000000	0.80357	0.613000	0.37349	9.601000	0.98297	2.475000	0.83589	0.455000	0.32223	.		0.582	PDK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366492.2	NM_002611	Intron
PALM3	342979	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	19	14164838	14164838	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr19:14164838G>A	ENST00000340790.4	-	6	1600	c.1601C>T	c.(1600-1602)aCg>aTg	p.T534M		NM_001145028.1	NP_001138500.1	A6NDB9	PALM3_HUMAN	paralemmin 3	534	Glu-rich.				negative regulation of cytokine-mediated signaling pathway (GO:0001960)|response to lipopolysaccharide (GO:0032496)|Toll signaling pathway (GO:0008063)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)			endometrium(1)|kidney(2)|pancreas(1)|skin(1)	5						ATCTCCCTCCGTCCCTTGGGT	0.547																																						.											0													183.0	158.0	165.0					19																	14164838		692	1591	2283	SO:0001583	missense	342979				CCDS46001.1	19p13.12	2010-04-15			ENSG00000187867	ENSG00000187867			33274	protein-coding gene	gene with protein product							Standard	NM_001145028		Approved		uc010xnk.1	A6NDB9		ENST00000340790.4:c.1601C>T	19.37:g.14164838G>A	ENSP00000344996:p.Thr534Met	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000340790.4	37	CCDS46001.1	.	.	.	.	.	.	.	.	.	.	c	10.22	1.290492	0.23478	.	.	ENSG00000187867	ENST00000340790	T	0.31510	1.49	4.87	-5.74	0.02391	.	.	.	.	.	T	0.11537	0.0281	N	0.08118	0	0.09310	N	1	B	0.17268	0.021	B	0.14578	0.011	T	0.25779	-1.0122	9	0.48119	T	0.1	.	2.9253	0.05783	0.3575:0.1133:0.4155:0.1137	.	534	A6NDB9	PALM3_HUMAN	M	534	ENSP00000344996:T534M	ENSP00000344996:T534M	T	-	2	0	PALM3	14025838	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.427000	0.06999	-0.525000	0.06391	0.305000	0.20034	ACG		0.547	PALM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458540.1	NM_001145028	
SLC9A8	23315	hgsc.bcm.edu;bcgsc.ca	37	20	48467342	48467342	+	Intron	SNP	T	T	C			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr20:48467342T>C	ENST00000361573.2	+	7	576				SLC9A8_ENST00000539601.1_Intron|SLC9A8_ENST00000541138.1_Intron|SLC9A8_ENST00000417961.1_Missense_Mutation_p.L193S			Q9Y2E8	SL9A8_HUMAN	solute carrier family 9, subfamily A (NHE8, cation proton antiporter 8), member 8						ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	potassium:proton antiporter activity (GO:0015386)|sodium:proton antiporter activity (GO:0015385)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	30			BRCA - Breast invasive adenocarcinoma(9;3.91e-07)			TGTTTTATTTTACAGGCTGAT	0.373																																						.											0													108.0	98.0	102.0					20																	48467342		2203	4300	6503	SO:0001627	intron_variant	23315			AB023156	CCDS13421.1, CCDS58774.1	20q13.13	2013-05-22	2012-03-22		ENSG00000197818	ENSG00000197818		"""Solute carriers"""	20728	protein-coding gene	gene with protein product		612730	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 8"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 8"""			12409279	Standard	NM_001260491		Approved	KIAA0939, NHE8	uc002xuv.2	Q9Y2E8	OTTHUMG00000032710	ENST00000361573.2:c.535-5T>C	20.37:g.48467342T>C		Somatic		WXS	Illumina HiSeq	Phase_I	B4DTQ8|Q2M1U9|Q68CZ8|Q9BX15|Q9Y507	Missense_Mutation	SNP	ENST00000361573.2	37	CCDS13421.1	.	.	.	.	.	.	.	.	.	.	T	15.36	2.809713	0.50421	.	.	ENSG00000197818	ENST00000417961	T	0.68025	-0.3	5.7	4.5	0.54988	.	.	.	.	.	T	0.67154	0.2863	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.65788	-0.6083	6	0.38643	T	0.18	.	7.6754	0.28481	0.135:0.0724:0.0:0.7926	.	.	.	.	S	193	ENSP00000416418:L193S	ENSP00000416418:L193S	L	+	2	0	SLC9A8	47900749	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.858000	0.39408	2.158000	0.67659	0.528000	0.53228	TTA		0.373	SLC9A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106483.3	XM_030524	
SYN3	8224	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	22	33327400	33327400	+	Missense_Mutation	SNP	C	C	T	rs200324473		TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr22:33327400C>T	ENST00000358763.2	-	4	678	c.436G>A	c.(436-438)Gtg>Atg	p.V146M	SYN3_ENST00000332840.5_Missense_Mutation_p.V146M	NM_001135774.1	NP_001129246.1	O14994	SYN3_HUMAN	synapsin III	146	C; actin-binding and synaptic-vesicle binding.				neurotransmitter secretion (GO:0007269)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)	p.V146M(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33						CCATTTCTCACGACCTGCATG	0.478																																						.											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)						C	MET/VAL,MET/VAL,MET/VAL	0,4406		0,0,2203	117.0	108.0	111.0		436,436,436	0.7	0.3	22		111	3,8597	3.0+/-9.4	0,3,4297	yes	missense,missense,missense	SYN3	NM_133633.2,NM_003490.3,NM_001135774.1	21,21,21	0,3,6500	TT,TC,CC		0.0349,0.0,0.0231	benign,benign,benign	146/445,146/581,146/580	33327400	3,13003	2203	4300	6503	SO:0001583	missense	8224			AF046873	CCDS13908.1	22q12.3	2008-05-14			ENSG00000185666	ENSG00000185666			11496	protein-coding gene	gene with protein product		602705				9539796	Standard	NM_003490		Approved		uc003amx.3	O14994	OTTHUMG00000031004	ENST00000358763.2:c.436G>A	22.37:g.33327400C>T	ENSP00000351614:p.Val146Met	Somatic		WXS	Illumina HiSeq	Phase_I	B1B1F9	Missense_Mutation	SNP	ENST00000358763.2	37	CCDS13908.1	.	.	.	.	.	.	.	.	.	.	C	11.06	1.527933	0.27299	0.0	3.49E-4	ENSG00000185666	ENST00000358763;ENST00000332840;ENST00000390686	T;T	0.31247	1.5;1.5	5.42	0.732	0.18283	Pre-ATP-grasp fold (1);PreATP-grasp-like fold (1);Synapsin, pre-ATP-grasp domain (1);	0.377447	0.25968	N	0.027143	T	0.08935	0.0221	N	0.00972	-1.085	0.27204	N	0.96008	B;B;B	0.06786	0.001;0.0;0.001	B;B;B	0.04013	0.0;0.001;0.0	T	0.29488	-1.0010	10	0.27082	T	0.32	.	8.2266	0.31572	0.0:0.2797:0.0:0.7203	.	146;146;146	Q17R54;B1B1F9;O14994	.;.;SYN3_HUMAN	M	146	ENSP00000351614:V146M;ENSP00000330219:V146M	ENSP00000330219:V146M	V	-	1	0	SYN3	31657400	0.022000	0.18835	0.263000	0.24496	0.725000	0.41563	-0.617000	0.05584	0.012000	0.14892	0.563000	0.77884	GTG		0.478	SYN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075892.4		
ERC2	26059	broad.mit.edu;hgsc.bcm.edu	37	3	55984500	55984502	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	CTT	CTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr3:55984500_55984502delCTT	ENST00000288221.6	-	13	2609_2611	c.2354_2356delAAG	c.(2353-2358)gaagtg>gtg	p.E785del		NM_015576.1	NP_056391.1	O15083	ERC2_HUMAN	ELKS/RAB6-interacting/CAST family member 2	785						cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|growth cone (GO:0030426)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)				breast(2)|endometrium(5)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|urinary_tract(1)	31				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		CGCCTGCGCACTTCTTCTAGTAA	0.433																																						.											0																																										SO:0001651	inframe_deletion	26059			AB002376	CCDS46851.1	3p14.3	2006-08-14			ENSG00000187672	ENSG00000187672			31922	protein-coding gene	gene with protein product							Standard	NM_015576		Approved	CAST, CAST1, KIAA0378, SPBC110, Spc110, ELKSL	uc003dhr.1	O15083	OTTHUMG00000158390	ENST00000288221.6:c.2354_2356delAAG	3.37:g.55984503_55984505delCTT	ENSP00000288221:p.Glu785del	Somatic		WXS	Illumina HiSeq	Phase_I	Q2T9F6|Q86TK4	In_Frame_Del	DEL	ENST00000288221.6	37	CCDS46851.1																																																																																				0.433	ERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350884.2	NM_015576	
HEG1	57493	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	3	124692706	124692706	+	Missense_Mutation	SNP	C	C	G			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr3:124692706C>G	ENST00000311127.4	-	16	3932	c.3865G>C	c.(3865-3867)Gat>Cat	p.D1289H		NM_020733.1	NP_065784.1	Q9ULI3	HEG1_HUMAN	heart development protein with EGF-like domains 1	1289					cardiac atrium morphogenesis (GO:0003209)|cell-cell junction assembly (GO:0007043)|endothelial cell morphogenesis (GO:0001886)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|lymph circulation (GO:0003017)|lymph vessel development (GO:0001945)|multicellular organism growth (GO:0035264)|pericardium development (GO:0060039)|post-embryonic development (GO:0009791)|regulation of body fluid levels (GO:0050878)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)|ventricular septum development (GO:0003281)	cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)	p.D1289Y(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(24)|ovary(2)|urinary_tract(4)	47						ATTTGGAAATCTCCACTTTTG	0.373																																						.											1	Substitution - Missense(1)	lung(1)											132.0	129.0	130.0					3																	124692706		1826	4087	5913	SO:0001583	missense	57493			AK074987	CCDS46898.1	3q21.2	2013-03-08	2013-03-08		ENSG00000173706	ENSG00000173706			29227	protein-coding gene	gene with protein product	"""heart of glass"""	614182	"""HEG homolog 1 (zebrafish)"""			10574462, 19151727, 23007647	Standard	NM_020733		Approved	KIAA1237, HEG	uc003ehs.4	Q9ULI3	OTTHUMG00000159486	ENST00000311127.4:c.3865G>C	3.37:g.124692706C>G	ENSP00000311502:p.Asp1289His	Somatic		WXS	Illumina HiSeq	Phase_I	Q6NX66|Q8NC40|Q9BSV0	Missense_Mutation	SNP	ENST00000311127.4	37	CCDS46898.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.491807	0.84962	.	.	ENSG00000173706	ENST00000311127;ENST00000487661	D;T	0.93247	-3.19;0.37	4.97	4.97	0.65823	.	0.000000	0.39834	U	0.001241	D	0.93956	0.8065	N	0.19112	0.55	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95217	0.8330	10	0.87932	D	0	.	18.4352	0.90643	0.0:1.0:0.0:0.0	.	1289	Q9ULI3	HEG1_HUMAN	H	1289;173	ENSP00000311502:D1289H;ENSP00000417648:D173H	ENSP00000311502:D1289H	D	-	1	0	HEG1	126175396	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.273000	0.78527	2.577000	0.86979	0.655000	0.94253	GAT		0.373	HEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355732.2	XM_087386	
GAK	2580	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	4	843563	843563	+	Splice_Site	SNP	C	C	T			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr4:843563C>T	ENST00000314167.4	-	28	3945		c.e28-1		GAK_ENST00000509566.1_Splice_Site|GAK_ENST00000511163.1_Splice_Site	NM_005255.2	NP_005246.2	O14976	GAK_HUMAN	cyclin G associated kinase						cell cycle (GO:0007049)|cell development (GO:0048468)|clathrin coat disassembly (GO:0072318)|clathrin-mediated endocytosis (GO:0072583)|endoplasmic reticulum organization (GO:0007029)|epidermal cell differentiation (GO:0009913)|establishment of skin barrier (GO:0061436)|forebrain morphogenesis (GO:0048853)|Golgi organization (GO:0007030)|intrahepatic bile duct development (GO:0035622)|positive regulation of neural precursor cell proliferation (GO:2000179)	cell junction (GO:0030054)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(16)|skin(7)|urinary_tract(2)	39				Colorectal(103;0.219)		GCCCCGCAGCCTATGGGTGAC	0.677																																						.											0													37.0	36.0	36.0					4																	843563		2202	4300	6502	SO:0001630	splice_region_variant	2580			D88435	CCDS3340.1	4p16	2011-09-07			ENSG00000178950	ENSG00000178950		"""Heat shock proteins / DNAJ (HSP40)"""	4113	protein-coding gene	gene with protein product	"""auxilin-2"""	602052				9299234	Standard	NM_005255		Approved	DNAJC26	uc003gbm.4	O14976	OTTHUMG00000088301	ENST00000314167.4:c.3835-1G>A	4.37:g.843563C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q5U4P5|Q9BVY6	Splice_Site	SNP	ENST00000314167.4	37	CCDS3340.1	.	.	.	.	.	.	.	.	.	.	C	12.19	1.864791	0.32977	.	.	ENSG00000178950	ENST00000398567;ENST00000314167;ENST00000511163;ENST00000511980	.	.	.	4.76	4.76	0.60689	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2715	0.73705	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GAK	833563	1.000000	0.71417	0.985000	0.45067	0.013000	0.08279	7.295000	0.78780	2.167000	0.68274	0.643000	0.83706	.		0.677	GAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239188.1	NM_005255	Intron
PCDH1	5097	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	5	141236865	141236865	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr5:141236865G>A	ENST00000287008.3	-	4	3418	c.3271C>T	c.(3271-3273)Cgc>Tgc	p.R1091C	PCDH1_ENST00000503492.1_Missense_Mutation_p.R359C	NM_032420.2	NP_115796.2	Q08174	PCDH1_HUMAN	protocadherin 1	0					cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(20)|ovary(5)|skin(3)|upper_aerodigestive_tract(1)	51		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)		GGGGTGGTGCGCTCATAGTGA	0.617																																					Ovarian(132;1609 1739 4190 14731 45037)	.											0													72.0	66.0	68.0					5																	141236865		2203	4300	6503	SO:0001583	missense	5097			AK075233	CCDS4267.1, CCDS43375.1	5q31.3	2010-01-26	2007-02-12		ENSG00000156453	ENSG00000156453		"""Cadherins / Protocadherins : Non-clustered"""	8655	protein-coding gene	gene with protein product		603626	"""protocadherin 1 (cadherin-like 1)"""			8508762	Standard	NM_032420		Approved	pc42	uc003llp.3	Q08174	OTTHUMG00000129661	ENST00000287008.3:c.3271C>T	5.37:g.141236865G>A	ENSP00000287008:p.Arg1091Cys	Somatic		WXS	Illumina HiSeq	Phase_I	Q8IUP2	Missense_Mutation	SNP	ENST00000287008.3	37	CCDS4267.1	.	.	.	.	.	.	.	.	.	.	G	17.27	3.346335	0.61073	.	.	ENSG00000156453	ENST00000503492;ENST00000287008	T;T	0.70045	-0.45;0.46	5.23	5.23	0.72850	.	0.000000	0.45361	U	0.000367	T	0.81113	0.4755	M	0.72118	2.19	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.83291	-0.0033	10	0.87932	D	0	.	16.2921	0.82757	0.0:0.0:1.0:0.0	.	1091	Q08174-2	.	C	359;1091	ENSP00000424667:R359C;ENSP00000287008:R1091C	ENSP00000287008:R1091C	R	-	1	0	PCDH1	141217049	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	4.912000	0.63335	2.433000	0.82419	0.455000	0.32223	CGC		0.617	PCDH1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320587.2	NM_032420	
NR2F1	7025	broad.mit.edu;hgsc.bcm.edu;mdanderson.org	37	5	92923831	92923831	+	Silent	SNP	G	G	A			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr5:92923831G>A	ENST00000327111.3	+	2	2359	c.672G>A	c.(670-672)gcG>gcA	p.A224A	NR2F1-AS1_ENST00000513055.1_RNA	NM_005654.4	NP_005645.1	P10589	COT1_HUMAN	nuclear receptor subfamily 2, group F, member 1	224					cerebral cortex regionalization (GO:0021796)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of neuron projection development (GO:0010977)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|retinoic acid-responsive element binding (GO:0044323)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(4)|large_intestine(6)|lung(2)|ovary(3)|prostate(1)|skin(1)|urinary_tract(2)	21		all_cancers(142;1.62e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0126)|Lung NSC(167;0.0155)|Ovarian(174;0.0218)|Prostate(281;0.173)|Colorectal(57;0.19)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0416)|all cancers(79;9.57e-18)		AGCTGGCCGCGCGCCTGCTCT	0.657																																						.											0													74.0	73.0	74.0					5																	92923831		2203	4300	6503	SO:0001819	synonymous_variant	7025			BC004154	CCDS4068.1	5q14	2013-01-16			ENSG00000175745	ENSG00000175745		"""Nuclear hormone receptors"""	7975	protein-coding gene	gene with protein product		132890		ERBAL3, TFCOUP1		8530078	Standard	NM_005654		Approved	EAR-3, COUP-TFI, TCFCOUP1, SVP44	uc003kkj.3	P10589	OTTHUMG00000119079	ENST00000327111.3:c.672G>A	5.37:g.92923831G>A		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000327111.3	37	CCDS4068.1																																																																																				0.657	NR2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239293.2	NM_005654	
ZFP62	643836	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	5	180276712	180276712	+	Nonsense_Mutation	SNP	C	C	A			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr5:180276712C>A	ENST00000502412.1	-	2	1840	c.1783G>T	c.(1783-1785)Gag>Tag	p.E595*	ZFP62_ENST00000359141.6_Nonsense_Mutation_p.E535*|ZFP62_ENST00000506377.1_Intron|ZFP62_ENST00000512132.1_Nonsense_Mutation_p.E562*	NM_001172638.1	NP_001166109.1	Q8NB50	ZFP62_HUMAN	ZFP62 zinc finger protein	595					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|endometrium(2)|pancreas(1)	4	all_cancers(89;4.01e-05)|all_epithelial(37;4.69e-06)|Renal(175;0.000159)|Lung NSC(126;0.0027)|all_lung(126;0.00469)|Breast(19;0.114)	all_cancers(40;0.00336)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)|all_lung(500;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AAGGCCTTCTCACACTCGTCA	0.413																																						.											0													153.0	129.0	136.0					5																	180276712		692	1591	2283	SO:0001587	stop_gained	643836			AK002206	CCDS47357.1, CCDS47357.2, CCDS54955.1	5q35.3	2013-01-08	2012-11-27			ENSG00000196670		"""Zinc fingers, C2H2-type"""	23241	protein-coding gene	gene with protein product		610281	"""zinc finger protein 62 homolog (mouse)"", ""zinc finger protein 62"""			8808410	Standard	NM_152283		Approved	FLJ34231, ZET, ZNF755	uc011dhf.2	Q8NB50		ENST00000502412.1:c.1783G>T	5.37:g.180276712C>A	ENSP00000423820:p.Glu595*	Somatic		WXS	Illumina HiSeq	Phase_I	B4DIP6|B4E0N3|B5MDX6|B7ZVZ2|B9EIP6|E9PFT8|J3QTA9	Nonsense_Mutation	SNP	ENST00000502412.1	37	CCDS54955.1	.	.	.	.	.	.	.	.	.	.	.	38	6.641596	0.97726	.	.	ENSG00000196670	ENST00000512132;ENST00000359141;ENST00000502412;ENST00000405851	.	.	.	4.56	4.56	0.56223	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	15.6487	0.77073	0.0:1.0:0.0:0.0	.	.	.	.	X	562;535;595;193	.	ENSP00000352053:E535X	E	-	1	0	ZFP62	180209318	1.000000	0.71417	1.000000	0.80357	0.525000	0.34531	5.894000	0.69806	2.817000	0.96982	0.563000	0.77884	GAG		0.413	ZFP62-002	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368386.2	NM_152283	
OR5V1	81696	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	6	29323612	29323612	+	Missense_Mutation	SNP	C	C	A			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr6:29323612C>A	ENST00000377154.1	-	4	660	c.361G>T	c.(361-363)Gat>Tat	p.D121Y	OR5V1_ENST00000543825.1_Missense_Mutation_p.D121Y			Q9UGF6	OR5V1_HUMAN	olfactory receptor, family 5, subfamily V, member 1	121						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.D121N(1)		breast(1)|kidney(3)|large_intestine(3)|liver(1)|lung(8)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						ATGTAACGATCATATGCCATT	0.403																																					Ovarian(32;43 883 21137 32120 42650)	.											1	Substitution - Missense(1)	skin(1)											68.0	69.0	69.0					6																	29323612		2203	4299	6502	SO:0001583	missense	81696				CCDS4657.1	6p22.1	2013-09-23				ENSG00000243729		"""GPCR / Class A : Olfactory receptors"""	13972	protein-coding gene	gene with protein product							Standard	NM_030876		Approved	hs6M1-21	uc011dlo.2	Q9UGF6		ENST00000377154.1:c.361G>T	6.37:g.29323612C>A	ENSP00000366359:p.Asp121Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	A2BDZ0|B0S860|Q5SQI9|Q6NTB5|Q8IVL3	Missense_Mutation	SNP	ENST00000377154.1	37	CCDS4657.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.113947	0.77210	.	.	ENSG00000243729	ENST00000377154;ENST00000377151;ENST00000543825	T;T	0.18338	2.22;2.22	4.37	4.37	0.52481	GPCR, rhodopsin-like superfamily (1);	0.000000	0.33875	N	0.004469	T	0.54679	0.1873	H	0.98682	4.3	0.54753	D	0.99998	D	0.89917	1.0	D	0.91635	0.999	T	0.75079	-0.3444	10	0.87932	D	0	-52.0337	17.0395	0.86484	0.0:1.0:0.0:0.0	.	121	Q9UGF6	OR5V1_HUMAN	Y	121	ENSP00000366359:D121Y;ENSP00000443309:D121Y	ENSP00000366356:D121Y	D	-	1	0	OR5V1	29431591	1.000000	0.71417	0.997000	0.53966	0.853000	0.48598	6.782000	0.75073	2.422000	0.82143	0.543000	0.68304	GAT		0.403	OR5V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076398.3		
VWA7	80737	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	6	31734079	31734079	+	Missense_Mutation	SNP	T	T	A			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr6:31734079T>A	ENST00000375688.4	-	15	2467	c.2267A>T	c.(2266-2268)gAt>gTt	p.D756V	SAPCD1-AS1_ENST00000419679.1_RNA|VWA7_ENST00000375686.3_Missense_Mutation_p.D756V|VWA7_ENST00000467576.1_5'UTR			Q9Y334	VWA7_HUMAN	von Willebrand factor A domain containing 7	756						extracellular region (GO:0005576)											AAGGTCAAGATCCTGAGGGCC	0.607																																						.											0													39.0	34.0	36.0					6																	31734079		1511	2709	4220	SO:0001583	missense	80737				CCDS4721.2	6p21	2011-12-13	2011-12-13	2011-12-13	ENSG00000204396	ENSG00000204396			13939	protein-coding gene	gene with protein product		609693	"""chromosome 6 open reading frame 27"""	C6orf27			Standard	NM_025258		Approved	G7c, NG37	uc011dog.2	Q9Y334	OTTHUMG00000031132	ENST00000375688.4:c.2267A>T	6.37:g.31734079T>A	ENSP00000364840:p.Asp756Val	Somatic		WXS	Illumina HiSeq	Phase_I	A2BEX8|A6NHR6|B0V041|Q5SSR5|Q96QC8|Q9UMP9	Missense_Mutation	SNP	ENST00000375688.4	37	CCDS4721.2	.	.	.	.	.	.	.	.	.	.	T	19.03	3.747583	0.69533	.	.	ENSG00000204396	ENST00000375688;ENST00000375686	T;T	0.16324	2.56;2.35	4.57	4.57	0.56435	.	0.389990	0.23887	N	0.043590	T	0.16385	0.0394	L	0.32530	0.975	0.80722	D	1	D	0.69078	0.997	P	0.62184	0.899	T	0.01283	-1.1396	10	0.62326	D	0.03	-8.1282	10.4849	0.44715	0.0:0.0:0.0:1.0	.	756	Q9Y334	G7C_HUMAN	V	756	ENSP00000364840:D756V;ENSP00000364838:D756V	ENSP00000364838:D756V	D	-	2	0	C6orf27	31842058	1.000000	0.71417	0.977000	0.42913	0.723000	0.41478	3.988000	0.56951	2.044000	0.60594	0.460000	0.39030	GAT		0.607	VWA7-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076233.2	NM_025258	
SLC29A4	222962	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	7	5334542	5334542	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr7:5334542C>T	ENST00000396872.3	+	6	757	c.596C>T	c.(595-597)aCg>aTg	p.T199M	SLC29A4_ENST00000297195.4_Missense_Mutation_p.T199M|SLC29A4_ENST00000406453.3_Missense_Mutation_p.T185M			Q7RTT9	S29A4_HUMAN	solute carrier family 29 (equilibrative nucleoside transporter), member 4	199					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	nucleoside transmembrane transporter activity (GO:0005337)			breast(1)|cervix(2)|kidney(7)|large_intestine(1)|liver(1)|lung(7)|urinary_tract(1)	20		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0903)|OV - Ovarian serous cystadenocarcinoma(56;2.65e-15)	Metformin(DB00331)	AAGCGGTACACGCAGGGGGTG	0.617																																						.											0													92.0	105.0	101.0					7																	5334542		2203	4300	6503	SO:0001583	missense	222962			AK075422	CCDS5340.1, CCDS75561.1	7p22.2	2013-07-17	2013-07-17		ENSG00000164638	ENSG00000164638		"""Solute carriers"""	23097	protein-coding gene	gene with protein product		609149	"""solute carrier family 29 (nucleoside transporters), member 4"""			12838422	Standard	NM_153247		Approved	FLJ34923, ENT4	uc003soc.3	Q7RTT9	OTTHUMG00000023797	ENST00000396872.3:c.596C>T	7.37:g.5334542C>T	ENSP00000380081:p.Thr199Met	Somatic		WXS	Illumina HiSeq	Phase_I	Q6PJ08|Q86WY8|Q8NAR3|Q8NBM2	Missense_Mutation	SNP	ENST00000396872.3	37	CCDS5340.1	.	.	.	.	.	.	.	.	.	.	.	22.7	4.326993	0.81690	.	.	ENSG00000164638	ENST00000396872;ENST00000297195;ENST00000406453	T;T;T	0.81163	-1.46;-1.46;-0.12	4.24	4.24	0.50183	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	D	0.85265	0.5657	L	0.42487	1.325	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.992;1.0	D	0.85837	0.1395	10	0.49607	T	0.09	-1.3588	14.4407	0.67314	0.0:1.0:0.0:0.0	.	185;199	Q7RTT9-2;Q7RTT9	.;S29A4_HUMAN	M	199;199;185	ENSP00000380081:T199M;ENSP00000297195:T199M;ENSP00000385845:T185M	ENSP00000297195:T199M	T	+	2	0	SLC29A4	5301068	1.000000	0.71417	0.971000	0.41717	0.739000	0.42172	5.379000	0.66196	1.920000	0.55613	0.561000	0.74099	ACG		0.617	SLC29A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060118.6	NM_153247	
TNRC18	84629	hgsc.bcm.edu	37	7	5428642	5428642	+	Silent	SNP	G	G	A	rs144662045	byFrequency	TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr7:5428642G>A	ENST00000430969.1	-	5	1161	c.813C>T	c.(811-813)acC>acT	p.T271T	TNRC18_ENST00000399537.4_Silent_p.T271T	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	271							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		CCGCATTCTTGGTCTTGGACT	0.756													G|||	148	0.0295527	0.0	0.0014	5008	,	,		4446	0.1369		0.003	False		,,,				2504	0.0061					.											0								G		1,3115		0,1,1557	3.0	3.0	3.0		813	0.2	0.0	7	dbSNP_134	3	6,7046		0,6,3520	no	coding-synonymous	TNRC18	NM_001080495.2		0,7,5077	AA,AG,GG		0.0851,0.0321,0.0688		271/2969	5428642	7,10161	1558	3526	5084	SO:0001819	synonymous_variant	84629			U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.813C>T	7.37:g.5428642G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A8MX41|Q96JH1|Q96K91	Silent	SNP	ENST00000430969.1	37	CCDS47534.1																																																																																				0.756	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
TAS2R38	5726	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	7	141672852	141672852	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr7:141672852G>A	ENST00000547270.1	-	1	721	c.638C>T	c.(637-639)tCt>tTt	p.S213F		NM_176817.4	NP_789787	P59533	T2R38_HUMAN	taste receptor, type 2, member 38	213					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			NS(2)|breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(7)|prostate(1)|skin(1)|stomach(1)	21	Melanoma(164;0.0171)					CAGCATCCCAGAAGAAACCAG	0.468																																						.											0													102.0	109.0	106.0					7																	141672852		2203	4300	6503	SO:0001583	missense	5726			AF494231	CCDS34765.1	7q34	2012-10-03	2003-05-29	2003-05-30	ENSG00000257138	ENSG00000257138		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	9584	protein-coding gene	gene with protein product		607751	"""phenylthiocarbamide tasting"""	PTC		12624758, 12584440	Standard	NM_176817		Approved	T2R61	uc003vwx.1	P59533	OTTHUMG00000158374	ENST00000547270.1:c.638C>T	7.37:g.141672852G>A	ENSP00000448219:p.Ser213Phe	Somatic		WXS	Illumina HiSeq	Phase_I	A4D1U6|P59552|Q2M3E8|Q645W3|Q86UK3	Missense_Mutation	SNP	ENST00000547270.1	37	CCDS34765.1	.	.	.	.	.	.	.	.	.	.	G	0.409	-0.914048	0.02415	.	.	ENSG00000257138	ENST00000547270	T	0.37584	1.19	5.0	2.01	0.26516	.	0.248085	0.33650	N	0.004690	T	0.38931	0.1059	L	0.41961	1.31	0.09310	N	1	D	0.69078	0.997	D	0.70227	0.968	T	0.31475	-0.9942	10	0.02654	T	1	.	7.1803	0.25768	0.0918:0.3262:0.582:0.0	.	213	P59533	T2R38_HUMAN	F	213	ENSP00000448219:S213F	ENSP00000331291:S213F	S	-	2	0	TAS2R38	141319321	0.008000	0.16893	0.098000	0.21074	0.345000	0.29048	0.699000	0.25586	0.672000	0.31204	0.655000	0.94253	TCT		0.468	TAS2R38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350810.2	NM_176817	
ZC3H3	23144	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	8	144550602	144550602	+	Silent	SNP	G	G	A			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr8:144550602G>A	ENST00000262577.5	-	7	2086	c.2055C>T	c.(2053-2055)ggC>ggT	p.G685G		NM_015117.2	NP_055932.2	Q8IXZ2	ZC3H3_HUMAN	zinc finger CCCH-type containing 3	685					mRNA polyadenylation (GO:0006378)|poly(A)+ mRNA export from nucleus (GO:0016973)|regulation of mRNA export from nucleus (GO:0010793)	nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	23	all_cancers(97;8.64e-11)|all_epithelial(106;6.43e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.107)			GGCAGCGCTCGCCACGGTTGC	0.672																																						.											0													32.0	34.0	33.0					8																	144550602		2193	4298	6491	SO:0001819	synonymous_variant	23144			D63484	CCDS6402.1	8q24.3	2012-07-05	2005-06-02	2005-06-02	ENSG00000014164	ENSG00000014164		"""Zinc fingers, CCCH-type domain containing"""	28972	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 3"""	ZC3HDC3		8590280	Standard	NM_015117		Approved	KIAA0150	uc003yyd.2	Q8IXZ2	OTTHUMG00000165127	ENST00000262577.5:c.2055C>T	8.37:g.144550602G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q14163|Q8N4E2|Q9BUS4	Silent	SNP	ENST00000262577.5	37	CCDS6402.1																																																																																				0.672	ZC3H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382011.2	NM_015117	
TAF9B	51616	hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	X	77395087	77395087	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chrX:77395087G>A	ENST00000341864.5	-	1	116	c.22C>T	c.(22-24)Cct>Tct	p.P8S		NM_015975.4	NP_057059.2	Q9HBM6	TAF9B_HUMAN	TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa	8					DNA-templated transcription, initiation (GO:0006352)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell growth (GO:0030307)|programmed cell death (GO:0012501)|protein stabilization (GO:0050821)|response to organic cyclic compound (GO:0014070)	transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	transcription corepressor activity (GO:0003714)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	14						TTCTTGGGAGGCGCCATCTTG	0.652																																						.											0													116.0	98.0	104.0					X																	77395087		2203	4296	6499	SO:0001583	missense	51616			AF220509	CCDS35340.1	Xq13.1-q21.1	2010-08-16	2006-01-04	2006-01-04	ENSG00000187325	ENSG00000187325			17306	protein-coding gene	gene with protein product		300754	"""TAF9-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa"""	TAF9L		15899866	Standard	XM_005262142		Approved	TAFII31L, DN-7, DN7, TFIID-31	uc004eda.3	Q9HBM6	OTTHUMG00000021887	ENST00000341864.5:c.22C>T	X.37:g.77395087G>A	ENSP00000339917:p.Pro8Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B2RUZ9|Q9Y2S3	Missense_Mutation	SNP	ENST00000341864.5	37	CCDS35340.1	.	.	.	.	.	.	.	.	.	.	G	3.298	-0.143546	0.06627	.	.	ENSG00000187325	ENST00000341864	T	0.38887	1.11	3.73	0.925	0.19424	.	0.440006	0.26163	N	0.025965	T	0.08891	0.0220	N	0.00707	-1.245	0.25701	N	0.985586	B	0.02656	0.0	B	0.08055	0.003	T	0.24190	-1.0167	10	0.07325	T	0.83	0.0098	1.6832	0.02836	0.1171:0.3115:0.3267:0.2448	.	8	Q9HBM6	TAF9B_HUMAN	S	8	ENSP00000339917:P8S	ENSP00000339917:P8S	P	-	1	0	TAF9B	77281743	1.000000	0.71417	0.987000	0.45799	0.983000	0.72400	1.743000	0.38258	0.060000	0.16281	0.600000	0.82982	CCT		0.652	TAF9B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057308.1	NM_015975	
PRR35	146325	broad.mit.edu;hgsc.bcm.edu;bcgsc.ca	37	16	613379	613379	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr16:613379C>T	ENST00000409413.3	+	2	364	c.85C>T	c.(85-87)Cgg>Tgg	p.R29W		NM_145270.2	NP_660313.1	P0CG20	PRR35_HUMAN		29										central_nervous_system(1)|endometrium(1)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	10						CTACATCCCGCGGCCCTGGGG	0.617																																						.											0													80.0	90.0	87.0					16																	613379		2043	4173	6216	SO:0001583	missense	146325																														ENST00000409413.3:c.85C>T	16.37:g.613379C>T	ENSP00000386499:p.Arg29Trp	Somatic		WXS	Illumina HiSeq	Phase_I	B8ZZ27|Q8N233|Q96AX3|Q96S23	Missense_Mutation	SNP	ENST00000409413.3	37	CCDS45365.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.988919	0.74589	.	.	ENSG00000161992	ENST00000409413	.	.	.	4.97	2.74	0.32292	.	0.000000	0.45361	D	0.000380	T	0.69584	0.3127	M	0.71581	2.175	0.31577	N	0.655637	D	0.89917	1.0	D	0.97110	1.0	T	0.75758	-0.3205	9	0.87932	D	0	.	13.8683	0.63603	0.3286:0.6714:0.0:0.0	.	29	P0CG20	CP011_HUMAN	W	29	.	ENSP00000386499:R29W	R	+	1	2	C16orf11	553380	0.016000	0.18221	0.926000	0.36857	0.996000	0.88848	0.287000	0.18920	1.064000	0.40671	0.563000	0.77884	CGG		0.617	C16orf11-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000333913.1		
LDLR	3949	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	19	11210912	11210912	+	Nonsense_Mutation	SNP	C	C	A	rs2228671	byFrequency	TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr19:11210912C>A	ENST00000558518.1	+	2	268	c.81C>A	c.(79-81)tgC>tgA	p.C27*	LDLR_ENST00000455727.2_Nonsense_Mutation_p.C27*|LDLR_ENST00000535915.1_Nonsense_Mutation_p.C27*|LDLR_ENST00000558013.1_Nonsense_Mutation_p.C27*|LDLR_ENST00000545707.1_Nonsense_Mutation_p.C27*|LDLR_ENST00000557933.1_Nonsense_Mutation_p.C27*	NM_000527.4|NM_001195798.1	NP_000518.1|NP_001182727.1	P01130	LDLR_HUMAN	low density lipoprotein receptor	27	LDL-receptor class A 1. {ECO:0000255|PROSITE-ProRule:PRU00124}.		C -> W (in San Francisco).		cholesterol homeostasis (GO:0042632)|cholesterol import (GO:0070508)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|endocytosis (GO:0006897)|intestinal cholesterol absorption (GO:0030299)|lipid metabolic process (GO:0006629)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|low-density lipoprotein particle clearance (GO:0034383)|phospholipid transport (GO:0015914)|phototransduction, visible light (GO:0007603)|positive regulation of triglyceride biosynthetic process (GO:0010867)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol homeostasis (GO:2000188)|regulation of phosphatidylcholine catabolic process (GO:0010899)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|low-density lipoprotein particle (GO:0034362)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|glycoprotein binding (GO:0001948)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|very-low-density lipoprotein particle receptor activity (GO:0030229)	p.?(1)		breast(2)|endometrium(2)|large_intestine(5)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Lung NSC(9;0.000245)|Renal(1328;0.0007)|Hepatocellular(1079;0.0524)		GBM - Glioblastoma multiforme(1328;1.36e-05)|STAD - Stomach adenocarcinoma(1328;0.000766)|Lung(535;0.197)	Porfimer(DB00707)	GCGACAGATGCGAAAGAAACG	0.522																																					GBM(18;201 575 7820 21545)	.											1	Unknown(1)	lung(1)	GRCh37	CM045064	LDLR	M	rs2228671						129.0	111.0	117.0					19																	11210912		2203	4300	6503	SO:0001587	stop_gained	3949			AY114155	CCDS12254.1, CCDS56083.1, CCDS56084.1, CCDS56085.1, CCDS58651.1	19p13.2	2014-09-17	2008-08-01		ENSG00000130164	ENSG00000130164		"""Low density lipoprotein receptors"""	6547	protein-coding gene	gene with protein product	"""familial hypercholesterolemia"""	606945					Standard	NM_000527		Approved	LDLCQ2	uc002mqk.4	P01130		ENST00000558518.1:c.81C>A	19.37:g.11210912C>A	ENSP00000454071:p.Cys27*	Somatic		WXS	Illumina HiSeq	Phase_I	B4DII3|B4DJZ8|B4DR00|B4DTQ3|C0JYY8|H0YLU8|H0YNT7|Q53ZD9|Q59FQ1|Q9UDH7	Nonsense_Mutation	SNP	ENST00000558518.1	37	CCDS12254.1	.	.	.	.	.	.	.	.	.	.	T	18.92	3.725318	0.68959	.	.	ENSG00000130164	ENST00000252444;ENST00000545707;ENST00000535915;ENST00000455727	.	.	.	5.51	-1.69	0.08186	.	0.000000	0.64402	D	0.000007	.	.	.	.	.	.	0.09310	P	1.0	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.7256	0.57168	0.0:0.4551:0.0:0.5449	.	.	.	.	X	27	.	ENSP00000252444:C27X	C	+	3	2	LDLR	11071912	0.022000	0.18835	0.000000	0.03702	0.375000	0.29983	0.018000	0.13422	-1.248000	0.02503	-0.352000	0.07741	TGC		0.522	LDLR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415973.2		
ENAM	10117	broad.mit.edu;hgsc.bcm.edu;mdanderson.org	37	4	71509879	71509879	+	Silent	SNP	C	C	T	rs143333113		TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr4:71509879C>T	ENST00000396073.3	+	9	3017	c.2736C>T	c.(2734-2736)gaC>gaT	p.D912D	ENAM_ENST00000472903.1_Intron	NM_031889.2	NP_114095.2	Q9NRM1	ENAM_HUMAN	enamelin	912					amelogenesis (GO:0097186)|biomineral tissue development (GO:0031214)	proteinaceous extracellular matrix (GO:0005578)		p.D912D(2)		haematopoietic_and_lymphoid_tissue(1)|ovary(3)|upper_aerodigestive_tract(2)	6			Lung(101;0.235)			TGTATACAGACGGTAGTCATA	0.493													C|||	1	0.000199681	0.0	0.0	5008	,	,		20689	0.001		0.0	False		,,,				2504	0.0					.											2	Substitution - coding silent(2)	large_intestine(1)|central_nervous_system(1)						C		0,4406		0,0,2203	98.0	86.0	90.0		2736	3.2	0.7	4	dbSNP_134	90	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ENAM	NM_031889.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		912/1143	71509879	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	10117			AF125373	CCDS3544.2	4q13.3	2008-02-05			ENSG00000132464	ENSG00000132464			3344	protein-coding gene	gene with protein product		606585	"""amelogenesis imperfecta 2, hypocalcification (autosomal dominant)"""	AIH2		11978766	Standard	NM_031889		Approved		uc011caw.1	Q9NRM1	OTTHUMG00000129914	ENST00000396073.3:c.2736C>T	4.37:g.71509879C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q17RI5|Q9H3D1	Silent	SNP	ENST00000396073.3	37	CCDS3544.2																																																																																				0.493	ENAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252166.3	NM_031889	
NDST4	64579	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	4	115998171	115998171	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr4:115998171G>A	ENST00000264363.2	-	2	700	c.22C>T	c.(22-24)Cgg>Tgg	p.R8W		NM_022569.1	NP_072091.1	Q9H3R1	NDST4_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4	8					heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)	p.R8W(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(43)|ovary(1)|prostate(7)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	81		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		AAACTTCTCCGAAGTTTCACA	0.348																																						.											1	Substitution - Missense(1)	cervix(1)											21.0	22.0	22.0					4																	115998171		2202	4299	6501	SO:0001583	missense	64579			AB036429	CCDS3706.1	4q26	2008-02-05			ENSG00000138653	ENSG00000138653		"""Sulfotransferases, membrane-bound"""	20779	protein-coding gene	gene with protein product		615039				11087757	Standard	NM_022569		Approved		uc003ibu.3	Q9H3R1	OTTHUMG00000132916	ENST00000264363.2:c.22C>T	4.37:g.115998171G>A	ENSP00000264363:p.Arg8Trp	Somatic		WXS	Illumina HiSeq	Phase_I	Q2KHM8	Missense_Mutation	SNP	ENST00000264363.2	37	CCDS3706.1	.	.	.	.	.	.	.	.	.	.	G	18.76	3.692943	0.68271	.	.	ENSG00000138653	ENST00000264363	T	0.38722	1.12	5.12	5.12	0.69794	.	0.263218	0.37669	N	0.001986	T	0.42471	0.1204	L	0.40543	1.245	0.80722	D	1	D	0.61697	0.99	P	0.48677	0.586	T	0.34625	-0.9821	10	0.52906	T	0.07	.	13.5255	0.61593	0.0:0.0:0.8439:0.1561	.	8	Q9H3R1	NDST4_HUMAN	W	8	ENSP00000264363:R8W	ENSP00000264363:R8W	R	-	1	2	NDST4	116217620	1.000000	0.71417	0.988000	0.46212	0.958000	0.62258	6.609000	0.74173	2.377000	0.81083	0.411000	0.27672	CGG		0.348	NDST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256427.1	NM_022569	
MUC17	140453	hgsc.bcm.edu;mdanderson.org	37	7	100681510	100681510	+	Silent	SNP	T	T	C	rs116767656		TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr7:100681510T>C	ENST00000306151.4	+	3	6877	c.6813T>C	c.(6811-6813)acT>acC	p.T2271T		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2271	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GCATACCAACTTCAACTCTTA	0.488																																						.											0													262.0	265.0	264.0					7																	100681510		2203	4300	6503	SO:0001819	synonymous_variant	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.6813T>C	7.37:g.100681510T>C		Somatic		WXS	Illumina HiSeq	Phase_I	O14761|Q685J2|Q8TDH7	Silent	SNP	ENST00000306151.4	37	CCDS34711.1																																																																																				0.488	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
G6PD	2539	broad.mit.edu;hgsc.bcm.edu;bcgsc.ca	37	X	153770612	153770612	+	Intron	SNP	G	G	C			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chrX:153770612G>C	ENST00000393564.2	-	2	233				G6PD_ENST00000369620.2_Intron|G6PD_ENST00000497281.1_Intron|IKBKG_ENST00000369609.5_Missense_Mutation_p.R45T|G6PD_ENST00000393562.2_Intron|IKBKG_ENST00000369607.1_Intron	NM_001042351.1	NP_001035810.1	P11413	G6PD_HUMAN	glucose-6-phosphate dehydrogenase						carbohydrate metabolic process (GO:0005975)|cellular response to oxidative stress (GO:0034599)|cholesterol biosynthetic process (GO:0006695)|cytokine production (GO:0001816)|erythrocyte maturation (GO:0043249)|glucose 6-phosphate metabolic process (GO:0051156)|glutathione metabolic process (GO:0006749)|lipid metabolic process (GO:0006629)|NADP metabolic process (GO:0006739)|NADPH regeneration (GO:0006740)|negative regulation of protein glutathionylation (GO:0010734)|oxidation-reduction process (GO:0055114)|pentose biosynthetic process (GO:0019322)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, oxidative branch (GO:0009051)|regulation of neuron apoptotic process (GO:0043523)|response to ethanol (GO:0045471)|response to food (GO:0032094)|response to organic cyclic compound (GO:0014070)|ribose phosphate biosynthetic process (GO:0046390)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	glucose binding (GO:0005536)|glucose-6-phosphate dehydrogenase activity (GO:0004345)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(3)|ovary(4)	18	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GGTGGGGAAAGATGCTGTTCC	0.572																																						.											0													63.0	54.0	57.0					X																	153770612		1568	3582	5150	SO:0001627	intron_variant	8517			X03674	CCDS14756.2, CCDS44023.1	Xq28	2014-09-17			ENSG00000160211	ENSG00000160211	1.1.1.49		4057	protein-coding gene	gene with protein product		305900				3012556, 2428611	Standard	NM_000402		Approved	G6PD1	uc004flx.1	P11413	OTTHUMG00000024237	ENST00000393564.2:c.120+3638C>G	X.37:g.153770612G>C		Somatic		WXS	Illumina HiSeq	Phase_I	D3DWX9|Q16000|Q16765|Q8IU70|Q8IU88|Q8IUA6|Q96PQ2	Missense_Mutation	SNP	ENST00000393564.2	37	CCDS44023.1	.	.	.	.	.	.	.	.	.	.	G	10.28	1.305731	0.23736	.	.	ENSG00000073009	ENST00000369609	D	0.91792	-2.91	2.67	0.872	0.19113	.	.	.	.	.	T	0.81616	0.4860	.	.	.	0.09310	N	0.999994	B	0.24483	0.104	B	0.26969	0.075	T	0.66114	-0.6004	8	0.14656	T	0.56	.	3.4967	0.07657	0.1619:0.2636:0.5745:0.0	.	45	Q9Y6K9-2	.	T	45	ENSP00000358622:R45T	ENSP00000358622:R45T	R	+	2	0	IKBKG	153423806	0.002000	0.14202	0.002000	0.10522	0.034000	0.12701	0.389000	0.20751	0.119000	0.18210	-0.333000	0.08304	AGA		0.572	G6PD-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061170.3	NM_000402	
PER3	8863	broad.mit.edu	37	1	7887663	7887663	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr1:7887663T>C	ENST00000361923.2	+	17	2825	c.2650T>C	c.(2650-2652)Tcg>Ccg	p.S884P	PER3_ENST00000377532.3_Missense_Mutation_p.S892P|RP3-467L1.4_ENST00000451646.1_RNA	NM_016831.1	NP_058515.1	P56645	PER3_HUMAN	period circadian clock 3	884	Pro-rich.				circadian regulation of gene expression (GO:0032922)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(4)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	39	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)		ACCCTCAATGTCGTCAGCAAT	0.567																																						.											0													123.0	117.0	119.0					1																	7887663		2203	4300	6503	SO:0001583	missense	8863			BC026102	CCDS89.1, CCDS72695.1	1p36.23	2012-12-13	2012-12-13		ENSG00000049246	ENSG00000049246			8847	protein-coding gene	gene with protein product		603427	"""period (Drosophila) homolog 3"", ""period homolog 3 (Drosophila)"""			9427249	Standard	XM_005263520		Approved		uc001aoo.3	P56645	OTTHUMG00000001216	ENST00000361923.2:c.2650T>C	1.37:g.7887663T>C	ENSP00000355031:p.Ser884Pro	Somatic		WXS	Illumina HiSeq	Phase_I	Q5H8X4|Q5H8X5|Q969K6|Q96S77|Q96S78|Q9C0J3|Q9NSP9|Q9UGU8	Missense_Mutation	SNP	ENST00000361923.2	37	CCDS89.1	.	.	.	.	.	.	.	.	.	.	T	3.590	-0.083812	0.07141	.	.	ENSG00000049246	ENST00000377532;ENST00000361923;ENST00000539773	T;T	0.09630	2.96;2.96	0.109	0.109	0.14578	.	124.353000	0.03105	U	0.161708	T	0.05868	0.0153	N	0.08118	0	0.09310	N	1	B;B;B;B	0.12013	0.005;0.003;0.005;0.005	B;B;B;B	0.12156	0.006;0.003;0.007;0.006	T	0.34675	-0.9819	9	0.23891	T	0.37	.	.	.	.	.	884;892;892;884	A2I2N5;A6H8X0;P56645-2;P56645	.;.;.;PER3_HUMAN	P	892;884;95	ENSP00000366755:S892P;ENSP00000355031:S884P	ENSP00000355031:S884P	S	+	1	0	PER3	7810250	0.001000	0.12720	0.001000	0.08648	0.004000	0.04260	0.198000	0.17217	0.156000	0.19299	0.155000	0.16302	TCG		0.567	PER3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000003607.1	NM_016831	
RERE	473	broad.mit.edu	37	1	8424203	8424203	+	Silent	SNP	C	C	T			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr1:8424203C>T	ENST00000337907.3	-	16	2287	c.1653G>A	c.(1651-1653)ccG>ccA	p.P551P	RERE_ENST00000400907.2_Intron|RERE_ENST00000460659.1_5'Flank|RERE_ENST00000476556.1_5'UTR|RERE_ENST00000400908.2_Silent_p.P551P|RERE_ENST00000377464.1_Silent_p.P283P	NM_012102.3	NP_036234.3	Q9P2R6	RERE_HUMAN	arginine-glutamic acid dipeptide (RE) repeats	551					chromatin remodeling (GO:0006338)|multicellular organismal development (GO:0007275)|NLS-bearing protein import into nucleus (GO:0006607)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|poly-glutamine tract binding (GO:0008267)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(16)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		TAAACGGTGGCGGGTCCACGG	0.602																																						.											0													85.0	81.0	82.0					1																	8424203		2203	4300	6503	SO:0001819	synonymous_variant	473			AF016005	CCDS95.1, CCDS41243.1	1p36.23	2013-01-25			ENSG00000142599	ENSG00000142599		"""GATA zinc finger domain containing"""	9965	protein-coding gene	gene with protein product		605226		ATN1L		10814707, 10729226	Standard	NM_012102		Approved	KIAA0458, ARP, ARG, DNB1	uc001apf.3	Q9P2R6	OTTHUMG00000001765	ENST00000337907.3:c.1653G>A	1.37:g.8424203C>T		Somatic		WXS	Illumina HiSeq	Phase_I	O43393|O75046|O75359|Q5VXL9|Q6P6B9|Q9Y2W4	Silent	SNP	ENST00000337907.3	37	CCDS95.1																																																																																				0.602	RERE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004916.1		
GALNT2	2590	broad.mit.edu;mdanderson.org	37	1	230372423	230372423	+	Silent	SNP	T	T	C			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr1:230372423T>C	ENST00000366672.4	+	6	631	c.559T>C	c.(559-561)Ttg>Ctg	p.L187L	GALNT2_ENST00000541865.1_Silent_p.L97L|GALNT2_ENST00000543760.1_Silent_p.L149L	NM_004481.3	NP_004472.1	Q10471	GALT2_HUMAN	polypeptide N-acetylgalactosaminyltransferase 2	187	Catalytic subdomain A.				cellular protein metabolic process (GO:0044267)|immunoglobulin biosynthetic process (GO:0002378)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|protein O-linked glycosylation via serine (GO:0018242)|protein O-linked glycosylation via threonine (GO:0018243)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|manganese ion binding (GO:0030145)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(5)|skin(2)	32	Breast(184;0.193)|Ovarian(103;0.249)	all_cancers(173;0.156)|Prostate(94;0.179)				CGGGGCTCTCTTGGGGAAAAT	0.413																																						.											0													97.0	99.0	98.0					1																	230372423		2203	4300	6503	SO:0001819	synonymous_variant	2590			BC041120	CCDS1582.1	1q41-q42	2014-03-13	2014-03-13		ENSG00000143641	ENSG00000143641	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4124	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 2"""	602274	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2)"""			9592121, 7592619	Standard	NM_004481		Approved	GalNAc-T2	uc010pwa.1	Q10471	OTTHUMG00000037771	ENST00000366672.4:c.559T>C	1.37:g.230372423T>C		Somatic		WXS	Illumina HiSeq	Phase_I	A8K1Y3|B7Z8V8|C5HU00|Q9NPY4	Silent	SNP	ENST00000366672.4	37	CCDS1582.1																																																																																				0.413	GALNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092158.1	NM_004481	
KCNMA1	3778	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	10	78649263	78649263	+	Missense_Mutation	SNP	C	C	A			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr10:78649263C>A	ENST00000286628.8	-	27	3406	c.3407G>T	c.(3406-3408)gGa>gTa	p.G1136V	KCNMA1_ENST00000372440.1_Missense_Mutation_p.G1078V|RP11-443A13.5_ENST00000595702.1_RNA|RP11-443A13.5_ENST00000458661.2_RNA|KCNMA1_ENST00000286627.5_Missense_Mutation_p.G1078V|KCNMA1_ENST00000354353.5_Missense_Mutation_p.G1139V|RP11-443A13.5_ENST00000429850.2_RNA|KCNMA1_ENST00000372443.1_Missense_Mutation_p.G1105V|KCNMA1_ENST00000404857.1_Missense_Mutation_p.G1119V|KCNMA1_ENST00000404771.3_Missense_Mutation_p.G1136V|KCNMA1_ENST00000406533.3_Missense_Mutation_p.G1140V|RP11-443A13.5_ENST00000609102.1_RNA	NM_001161352.1	NP_001154824.1	Q12791	KCMA1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, alpha member 1	1136					blood coagulation (GO:0007596)|cellular potassium ion homeostasis (GO:0030007)|micturition (GO:0060073)|negative regulation of cell volume (GO:0045794)|positive regulation of apoptotic process (GO:0043065)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|response to calcium ion (GO:0051592)|response to carbon monoxide (GO:0034465)|response to hypoxia (GO:0001666)|response to osmotic stress (GO:0006970)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	actin binding (GO:0003779)|calcium-activated potassium channel activity (GO:0015269)|large conductance calcium-activated potassium channel activity (GO:0060072)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(17)|lung(23)|ovary(2)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	68	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Chlorzoxazone(DB00356)|Cromoglicic acid(DB01003)|Diazoxide(DB01119)|Halothane(DB01159)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Miconazole(DB01110)|Procaine(DB00721)	CCGGTAAATTCCAAAACAAAG	0.443																																						.											0													88.0	87.0	87.0					10																	78649263		2203	4300	6503	SO:0001583	missense	3778			U11717	CCDS7352.1, CCDS60569.1, CCDS60571.1, CCDS60572.1, CCDS73156.1	10q22	2012-07-05			ENSG00000156113	ENSG00000156113		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6284	protein-coding gene	gene with protein product	"""BK channel alpha subunit"""	600150		SLO		7987297, 16382103	Standard	NM_002247		Approved	KCa1.1, mSLO1	uc001jxn.3	Q12791	OTTHUMG00000018543	ENST00000286628.8:c.3407G>T	10.37:g.78649263C>A	ENSP00000286628:p.Gly1136Val	Somatic		WXS	Illumina HiSeq	Phase_I	F8WA96|Q12886|Q12917|Q12921|Q12960|Q13150|Q5JQ23|Q5SQR9|Q96LG8|Q9UBB0|Q9UCX0|Q9UQK6	Missense_Mutation	SNP	ENST00000286628.8	37		.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	23.3|23.3|23.3	4.404355|4.404355|4.404355	0.83230|0.83230|0.83230	.|.|.	.|.|.	ENSG00000156113|ENSG00000156113|ENSG00000156113	ENST00000372403|ENST00000372440;ENST00000372408;ENST00000372437;ENST00000457953;ENST00000404771;ENST00000372443;ENST00000286627;ENST00000286628;ENST00000406533;ENST00000354353;ENST00000404857;ENST00000412708|ENST00000372421;ENST00000434208	.|D;D;D;D;D;D;D;D;D|.	.|0.95949|.	.|-3.77;-3.73;-3.79;-3.83;-3.71;-3.73;-3.86;-3.85;-3.69|.	6.17|6.17|6.17	5.27|5.27|5.27	0.74061|0.74061|0.74061	.|.|.	.|0.047500|.	.|0.85682|.	.|D|.	.|0.000000|.	.|T|T	.|0.74650|0.74650	.|0.3744|0.3744	M|M|M	0.76170|0.76170|0.76170	2.325|2.325|2.325	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|D;D;D;D;D;D;D;D|.	.|0.89917|.	.|1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0|.	.|D;D;D;D;D;D;D;D|.	.|0.97110|.	.|1.0;1.0;1.0;1.0;1.0;0.999;1.0;1.0|.	.|T|T	.|0.75687|0.75687	.|-0.3231|-0.3231	.|10|5	.|0.87932|.	.|D|.	.|0|.	-9.6059|-9.6059|-9.6059	15.336|15.336|15.336	0.74255|0.74255|0.74255	0.0:0.9338:0.0:0.0662|0.0:0.9338:0.0:0.0662|0.0:0.9338:0.0:0.0662	.|.|.	.|1107;1108;1119;1136;1078;889;1139;1105|.	.|Q12791-4;B7ZMF5;Q12791-2;Q12791;Q12791-5;C9JFZ9;F8WA96;Q5SVJ7|.	.|.;.;.;KCMA1_HUMAN;.;.;.;.|.	X|V|C	1029|1078;1015;1071;1110;1073;1105;1078;1110;1140;1139;1119;889|1066;785	.|ENSP00000361517:G1078V;ENSP00000361485:G1015V;ENSP00000361514:G1071V;ENSP00000396608:G1110V;ENSP00000361520:G1105V;ENSP00000286627:G1078V;ENSP00000385552:G1140V;ENSP00000346321:G1139V;ENSP00000385806:G1119V|.	.|ENSP00000286627:G1078V|.	E|G|W	-|-|-	1|2|3	0|0|0	KCNMA1|KCNMA1|KCNMA1	78319269|78319269|78319269	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.995000|0.995000|0.995000	0.86356|0.86356|0.86356	7.487000|7.487000|7.487000	0.81328|0.81328|0.81328	1.630000|1.630000|1.630000	0.50440|0.50440|0.50440	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	GAA|GGA|TGG		0.443	KCNMA1-009	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000048885.3	NM_002247	
PARVA	55742	broad.mit.edu	37	11	12399324	12399324	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr11:12399324A>G	ENST00000550549.1	+	1	179	c.130A>G	c.(130-132)Aag>Gag	p.K44E	PARVA_ENST00000334956.8_Missense_Mutation_p.K84E|PARVA_ENST00000539723.1_Missense_Mutation_p.K44E			Q9NVD7	PARVA_HUMAN	parvin, alpha	44					actin cytoskeleton reorganization (GO:0031532)|actin-mediated cell contraction (GO:0070252)|cell junction assembly (GO:0034329)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|heterotypic cell-cell adhesion (GO:0034113)|outflow tract septum morphogenesis (GO:0003148)|regulation of cell shape (GO:0008360)|smooth muscle cell chemotaxis (GO:0071670)|sprouting angiogenesis (GO:0002040)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)	11				Epithelial(150;0.00624)		GAAGAAAGCCAAGGAGGGTGA	0.716																																						.											0													10.0	12.0	11.0					11																	12399324		1818	4020	5838	SO:0001583	missense	55742			AF237771	CCDS44541.1, CCDS44541.2	11p15.3	2014-06-13	2005-05-26		ENSG00000197702	ENSG00000197702		"""Parvins"""	14652	protein-coding gene	gene with protein product		608120	"""matrix-remodelling associated 2"""	MXRA2		11171322	Standard	NM_018222		Approved	FLJ12254, FLJ10793	uc001mki.4	Q9NVD7	OTTHUMG00000165778	ENST00000550549.1:c.130A>G	11.37:g.12399324A>G	ENSP00000447198:p.Lys44Glu	Somatic		WXS	Illumina HiSeq	Phase_I	Q96C85|Q9HA48	Missense_Mutation	SNP	ENST00000550549.1	37		.	.	.	.	.	.	.	.	.	.	A	14.17	2.454402	0.43634	.	.	ENSG00000197702	ENST00000334956;ENST00000539723;ENST00000550549	T;T;T	0.42131	0.98;0.98;0.98	4.45	3.3	0.37823	Calponin homology domain (1);	0.134476	0.47852	D	0.000211	T	0.36663	0.0975	L	0.55213	1.73	0.80722	D	1	B;B	0.32753	0.002;0.383	B;B	0.32928	0.005;0.155	T	0.11916	-1.0568	10	0.42905	T	0.14	-5.5035	10.0079	0.41968	0.8485:0.0:0.0:0.1515	.	44;44	Q9NVD7;Q9NVD7-2	PARVA_HUMAN;.	E	84;44;44	ENSP00000334008:K84E;ENSP00000438967:K44E;ENSP00000447198:K44E	ENSP00000334008:K84E	K	+	1	0	PARVA	12355900	1.000000	0.71417	1.000000	0.80357	0.563000	0.35712	6.113000	0.71553	0.554000	0.29061	0.379000	0.24179	AAG		0.716	PARVA-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_018222	
CTC-497E21.3	0	broad.mit.edu	37	11	13031416	13031416	+	lincRNA	SNP	G	G	A			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr11:13031416G>A	ENST00000533002.1	-	0	0																											GAGAAGTGGCGCGGCTTTGAG	0.662																																						.											0													10.0	11.0	11.0					11																	13031416		2058	4192	6250			644943																															11.37:g.13031416G>A		Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000533002.1	37																																																																																					0.662	CTC-497E21.3-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000387000.1		
OR5AK2	390181	broad.mit.edu;ucsc.edu	37	11	56756940	56756940	+	Silent	SNP	T	T	A			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr11:56756940T>A	ENST00000326855.2	+	1	594	c.552T>A	c.(550-552)atT>atA	p.I184I		NM_001005323.1	NP_001005323.1	Q8NH90	O5AK2_HUMAN	olfactory receptor, family 5, subfamily AK, member 2	184						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(3)|endometrium(1)|large_intestine(4)|lung(3)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	21						TTCCCCCTATTCTTGCTCTTT	0.408																																						.											0													347.0	311.0	323.0					11																	56756940		2201	4296	6497	SO:0001819	synonymous_variant	390181			AB065496	CCDS31538.1	11q11	2012-08-09			ENSG00000181273	ENSG00000181273		"""GPCR / Class A : Olfactory receptors"""	15251	protein-coding gene	gene with protein product							Standard	NM_001005323		Approved		uc010rjp.2	Q8NH90	OTTHUMG00000167019	ENST00000326855.2:c.552T>A	11.37:g.56756940T>A		Somatic		WXS	Illumina HiSeq	Phase_I	B2RNZ9	Silent	SNP	ENST00000326855.2	37	CCDS31538.1																																																																																				0.408	OR5AK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392446.1	NM_001005323	
DLG2	1740	broad.mit.edu	37	11	84996301	84996301	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr11:84996301A>G	ENST00000376104.2	-	4	460	c.149T>C	c.(148-150)cTt>cCt	p.L50P	DLG2_ENST00000543673.1_Missense_Mutation_p.L50P	NM_001142699.1	NP_001136171.1	Q14168	MPP2_HUMAN	discs, large homolog 2 (Drosophila)	0	L27 1. {ECO:0000255|PROSITE- ProRule:PRU00365}.				nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(11)|lung(35)|ovary(3)|pancreas(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	71		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				GCACGGAGCAAGAAGGGATGT	0.368																																						.											0													229.0	204.0	212.0					11																	84996301		1568	3581	5149	SO:0001583	missense	1740			U32376	CCDS41696.1, CCDS44690.1, CCDS44691.1, CCDS44692.1, CCDS55782.1, CCDS73357.1	11q21	2012-04-17	2008-12-15		ENSG00000150672	ENSG00000150672		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	2901	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 58"""	603583	"""discs, large homolog 2, chapsyn-110 (Drosophila)"""			8755482, 9806853	Standard	NM_001142702		Approved	PSD-93, PSD93, chapsyn-110, PPP1R58	uc001pak.2	Q15700	OTTHUMG00000134309	ENST00000376104.2:c.149T>C	11.37:g.84996301A>G	ENSP00000365272:p.Leu50Pro	Somatic		WXS	Illumina HiSeq	Phase_I	B4DGE9|B4DRJ0|B7Z3G8|E7EV80|E7EV91|E7EX01|Q53ES9|Q5CZB9|Q9BQJ2	Missense_Mutation	SNP	ENST00000376104.2	37	CCDS44690.1	.	.	.	.	.	.	.	.	.	.	A	6.469	0.454637	0.12283	.	.	ENSG00000150672	ENST00000376104;ENST00000543673;ENST00000546021	T;T	0.13307	2.6;2.6	5.88	4.76	0.60689	.	0.859826	0.09766	N	0.758589	T	0.05640	0.0148	N	0.02802	-0.49	0.21386	N	0.999704	B	0.09022	0.002	B	0.06405	0.002	T	0.42932	-0.9422	9	.	.	.	.	5.9412	0.19194	0.715:0.1404:0.1446:0.0	.	50	Q15700-2	.	P	50	ENSP00000365272:L50P;ENSP00000441994:L50P	.	L	-	2	0	DLG2	84673949	0.992000	0.36948	0.279000	0.24732	0.289000	0.27227	0.970000	0.29383	1.050000	0.40346	-0.263000	0.10527	CTT		0.368	DLG2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000259245.3	NM_001364	
KDM5A	5927	broad.mit.edu;mdanderson.org	37	12	416696	416696	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr12:416696T>C	ENST00000399788.2	-	23	4216	c.3854A>G	c.(3853-3855)gAa>gGa	p.E1285G	KDM5A_ENST00000382815.4_Missense_Mutation_p.E1285G	NM_001042603.1	NP_001036068.1	P29375	KDM5A_HUMAN	lysine (K)-specific demethylase 5A	1285					chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|multicellular organismal development (GO:0007275)|negative regulation of histone deacetylase activity (GO:1901726)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			NS(2)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(29)|ovary(1)|prostate(5)|skin(6)|stomach(1)|urinary_tract(2)	77						AGCCGCCTGTTCCACCATACG	0.483			T	NUP98	AML																																	.		Dom	yes		12	12p11	5927	"""lysine (K)-specific demethylase 5A, JARID1A"""		L	0													99.0	96.0	97.0					12																	416696		2000	4188	6188	SO:0001583	missense	5927				CCDS41736.1	12p13.33	2013-01-28	2009-04-06	2009-04-06	ENSG00000073614	ENSG00000073614		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	9886	protein-coding gene	gene with protein product		180202	"""retinoblastoma-binding protein 2"", ""Jumonji, AT rich interactive domain 1A (RBBP2-like)"", ""jumonji, AT rich interactive domain 1A"""	RBBP2, JARID1A		1857421	Standard	NM_001042603		Approved		uc001qif.1	P29375	OTTHUMG00000168055	ENST00000399788.2:c.3854A>G	12.37:g.416696T>C	ENSP00000382688:p.Glu1285Gly	Somatic		WXS	Illumina HiSeq	Phase_I	A8MV76|Q4LE72|Q86XZ1	Missense_Mutation	SNP	ENST00000399788.2	37	CCDS41736.1	.	.	.	.	.	.	.	.	.	.	T	17.67	3.446132	0.63178	.	.	ENSG00000073614	ENST00000399788;ENST00000382815	D;D	0.85773	-2.03;-1.84	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.80303	0.4598	L	0.35854	1.095	0.80722	D	1	B;B	0.19935	0.04;0.029	B;B	0.22880	0.019;0.042	T	0.74979	-0.3479	10	0.31617	T	0.26	-23.6818	16.1762	0.81855	0.0:0.0:0.0:1.0	.	1285;1285	P29375;P29375-2	KDM5A_HUMAN;.	G	1285	ENSP00000382688:E1285G;ENSP00000372265:E1285G	ENSP00000372265:E1285G	E	-	2	0	KDM5A	286957	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.997000	0.88414	2.283000	0.76528	0.477000	0.44152	GAA		0.483	KDM5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397812.1	NM_005056	
SLC35E3	55508	broad.mit.edu;mdanderson.org	37	12	69140526	69140526	+	Silent	SNP	G	G	A			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr12:69140526G>A	ENST00000398004.2	+	1	641	c.369G>A	c.(367-369)caG>caA	p.Q123Q		NM_018656.2	NP_061126.2	Q7Z769	S35E3_HUMAN	solute carrier family 35, member E3	123						integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	12	Breast(13;2.31e-06)|Renal(347;0.0684)		Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00372)			TCTGCTACCAGAAAACCTTCT	0.567																																						.											0													108.0	113.0	112.0					12																	69140526		1948	4151	6099	SO:0001819	synonymous_variant	55508			AF148713, AY358943	CCDS41808.1	12q15	2014-09-04			ENSG00000175782	ENSG00000175782		"""Solute carriers"""	20864	protein-coding gene	gene with protein product						12975309	Standard	XM_005269006		Approved	BLOV1	uc001suh.3	Q7Z769	OTTHUMG00000169282	ENST00000398004.2:c.369G>A	12.37:g.69140526G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A8K0T0|Q0P5Y5|Q9P0V1	Silent	SNP	ENST00000398004.2	37	CCDS41808.1																																																																																				0.567	SLC35E3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403241.1	NM_018656	
ATP12A	479	broad.mit.edu;mdanderson.org;bcgsc.ca	37	13	25255781	25255781	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr13:25255781T>C	ENST00000381946.3	+	2	258	c.91T>C	c.(91-93)Tat>Cat	p.Y31H	ATP12A_ENST00000218548.6_Missense_Mutation_p.Y31H			P54707	AT12A_HUMAN	ATPase, H+/K+ transporting, nongastric, alpha polypeptide	31					ATP biosynthetic process (GO:0006754)|ion transmembrane transport (GO:0034220)|potassium ion homeostasis (GO:0055075)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|hydrogen:potassium-exchanging ATPase complex (GO:0005889)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|metal ion binding (GO:0046872)			breast(6)|central_nervous_system(4)|endometrium(3)|kidney(5)|large_intestine(23)|lung(23)|ovary(2)|pancreas(1)|prostate(2)|skin(5)	74		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)		CAAGGAGAAGTATAGGGGTCT	0.473																																					Pancreas(156;1582 1935 18898 22665 26498)	.											0													94.0	92.0	93.0					13																	25255781		2203	4300	6503	SO:0001583	missense	479			L42558	CCDS31948.1, CCDS53858.1	13q11-q12.1	2010-04-20	2002-02-25		ENSG00000075673	ENSG00000075673	3.6.3.10	"""ATPases / P-type"""	13816	protein-coding gene	gene with protein product	"""ATPase, Na+K+ transporting, alpha-1 polypeptide-like"", ""potassium-transporting ATPase alpha chain 2"", ""proton pump"", ""non-gastric H(+)/K(+) ATPase alpha subunit"", ""sodium/potassium ATPase, alpha polypeptide-like"""	182360	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 1"""	ATP1AL1		8838794, 2842249	Standard	NM_001676		Approved		uc010aaa.3	P54707	OTTHUMG00000016588	ENST00000381946.3:c.91T>C	13.37:g.25255781T>C	ENSP00000371372:p.Tyr31His	Somatic		WXS	Illumina HiSeq	Phase_I	Q13816|Q13817|Q16734|Q5W035|Q8N5U2	Missense_Mutation	SNP	ENST00000381946.3	37	CCDS31948.1	.	.	.	.	.	.	.	.	.	.	T	4.130	0.022384	0.08006	.	.	ENSG00000075673	ENST00000218548;ENST00000381946	D;D	0.92911	-3.13;-3.13	5.32	-2.04	0.07343	.	17.266700	0.00166	N	0.000000	T	0.79621	0.4477	N	0.08118	0	0.23371	N	0.997817	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.69316	-0.5177	10	0.18710	T	0.47	.	0.768	0.01018	0.2498:0.161:0.1322:0.457	.	31;31	P54707-2;P54707	.;AT12A_HUMAN	H	31	ENSP00000218548:Y31H;ENSP00000371372:Y31H	ENSP00000218548:Y31H	Y	+	1	0	ATP12A	24153781	0.921000	0.31238	0.386000	0.26170	0.231000	0.25187	0.416000	0.21198	-0.091000	0.12440	-0.336000	0.08194	TAT		0.473	ATP12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044199.1	NM_001676	
FNDC3A	22862	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	13	49771038	49771038	+	Missense_Mutation	SNP	A	A	T	rs368353457		TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr13:49771038A>T	ENST00000492622.2	+	20	2557	c.2252A>T	c.(2251-2253)gAt>gTt	p.D751V	FNDC3A_ENST00000398316.3_Missense_Mutation_p.D695V|FNDC3A_ENST00000541916.1_Missense_Mutation_p.D751V	NM_001079673.1	NP_001073141.1	Q9Y2H6	FND3A_HUMAN	fibronectin type III domain containing 3A	751	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				fertilization (GO:0009566)|Sertoli cell development (GO:0060009)|single organismal cell-cell adhesion (GO:0016337)|spermatid development (GO:0007286)	acrosomal vesicle (GO:0001669)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle membrane (GO:0012506)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|prostate(5)|skin(2)|urinary_tract(1)	41		all_lung(13;7.44e-08)|Lung NSC(96;4.08e-06)|Breast(56;0.000111)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.94e-09)		GAAAAATGTGATATTACTACA	0.388																																						.											0													98.0	93.0	95.0					13																	49771038		2203	4300	6503	SO:0001583	missense	22862			AB023187	CCDS9413.2, CCDS41886.1	13q14.12	2013-02-11	2005-01-20	2005-01-22	ENSG00000102531	ENSG00000102531		"""Fibronectin type III domain containing"""	20296	protein-coding gene	gene with protein product		615794	"""fibronectin type III domain containing 3"""	FNDC3			Standard	NM_001079673		Approved	bA203I16.5, KIAA0970	uc001vcm.3	Q9Y2H6	OTTHUMG00000016911	ENST00000492622.2:c.2252A>T	13.37:g.49771038A>T	ENSP00000417257:p.Asp751Val	Somatic		WXS	Illumina HiSeq	Phase_I	B4DYG1|Q5HYC9|Q5JVF8|Q5JVF9|Q6EVH3|Q6EVH4|Q6N020|Q6P9D5|Q6ZME4|Q9H1W1	Missense_Mutation	SNP	ENST00000492622.2	37	CCDS41886.1	.	.	.	.	.	.	.	.	.	.	A	13.21	2.168264	0.38315	.	.	ENSG00000102531	ENST00000492622;ENST00000337156;ENST00000541916;ENST00000398316	T;T;T	0.52057	0.68;0.68;0.68	5.26	5.26	0.73747	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.260892	0.31772	N	0.007085	T	0.30262	0.0759	N	0.12443	0.215	0.80722	D	1	B;B	0.06786	0.001;0.0	B;B	0.11329	0.006;0.001	T	0.09640	-1.0665	10	0.20519	T	0.43	-8.0455	14.3424	0.66636	1.0:0.0:0.0:0.0	.	695;751	Q9Y2H6-2;Q9Y2H6	.;FND3A_HUMAN	V	751;687;751;695	ENSP00000417257:D751V;ENSP00000441831:D751V;ENSP00000381362:D695V	ENSP00000338579:D687V	D	+	2	0	FNDC3A	48669039	1.000000	0.71417	0.989000	0.46669	0.866000	0.49608	8.730000	0.91510	1.984000	0.57885	0.379000	0.24179	GAT		0.388	FNDC3A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354845.2	NM_014923	
OR4M1	441670	broad.mit.edu;mdanderson.org	37	14	20248894	20248894	+	Missense_Mutation	SNP	G	G	A	rs373032779		TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr14:20248894G>A	ENST00000315957.4	+	1	494	c.413G>A	c.(412-414)cGa>cAa	p.R138Q		NM_001005500.1	NP_001005500.1	Q8NGD0	OR4M1_HUMAN	olfactory receptor, family 4, subfamily M, member 1	138						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(32)|prostate(1)|skin(2)	42	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		ATCATGAATCGACGTCTCTGC	0.522																																						.											0									GLN/ARG	0,4406		0,0,2203	262.0	271.0	268.0		413	0.2	0.8	14		268	1,8599		0,1,4299	no	missense	OR4M1	NM_001005500.1	43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	138/314	20248894	1,13005	2203	4300	6503	SO:0001583	missense	441670				CCDS32021.1	14q11.2	2013-09-23			ENSG00000176299	ENSG00000176299		"""GPCR / Class A : Olfactory receptors"""	14735	protein-coding gene	gene with protein product							Standard	NM_001005500		Approved		uc010tku.2	Q8NGD0	OTTHUMG00000170599	ENST00000315957.4:c.413G>A	14.37:g.20248894G>A	ENSP00000319654:p.Arg138Gln	Somatic		WXS	Illumina HiSeq	Phase_I	B9EH18|Q6IFA3	Missense_Mutation	SNP	ENST00000315957.4	37	CCDS32021.1	.	.	.	.	.	.	.	.	.	.	.	4.713	0.132514	0.09032	0.0	1.16E-4	ENSG00000176299	ENST00000315957	T	0.01347	4.99	4.33	0.153	0.14897	GPCR, rhodopsin-like superfamily (1);	0.433156	0.17204	N	0.183018	T	0.00967	0.0032	N	0.26042	0.785	0.09310	N	1	B	0.30709	0.291	B	0.15484	0.013	T	0.50591	-0.8810	10	0.25106	T	0.35	-0.216	6.2969	0.21091	0.1759:0.2841:0.54:0.0	.	138	Q8NGD0	OR4M1_HUMAN	Q	138	ENSP00000319654:R138Q	ENSP00000319654:R138Q	R	+	2	0	OR4M1	19318734	0.000000	0.05858	0.766000	0.31476	0.547000	0.35210	-0.556000	0.05992	0.218000	0.20820	-1.720000	0.00707	CGA		0.522	OR4M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409770.1		
OR4K17	390436	broad.mit.edu	37	14	20586424	20586424	+	Frame_Shift_Del	DEL	T	T	-			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr14:20586424delT	ENST00000315543.4	+	1	859	c.859delT	c.(859-861)tttfs	p.F287fs		NM_001004715.1	NP_001004715.1	Q8NGC6	OR4KH_HUMAN	olfactory receptor, family 4, subfamily K, member 17	259						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(4)|lung(12)|pancreas(1)|skin(3)	21	all_cancers(95;0.00108)		Epithelial(56;7.58e-07)|all cancers(55;3.77e-06)	GBM - Glioblastoma multiforme(265;0.0144)		CCCATGCATCTTTATCTACAT	0.423																																						.											0													116.0	105.0	108.0					14																	20586424		2203	4300	6503	SO:0001589	frameshift_variant	390436				CCDS32030.1	14q11.2	2013-09-23			ENSG00000176230	ENSG00000176230		"""GPCR / Class A : Olfactory receptors"""	15355	protein-coding gene	gene with protein product							Standard	NM_001004715		Approved		uc001vwo.1	Q8NGC6	OTTHUMG00000170783	ENST00000315543.4:c.859delT	14.37:g.20586424delT	ENSP00000319197:p.Phe287fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q6IF12	Frame_Shift_Del	DEL	ENST00000315543.4	37	CCDS32030.1																																																																																				0.423	OR4K17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410346.1		
CAPN3	825	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	15	42684852	42684852	+	Missense_Mutation	SNP	C	C	A			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr15:42684852C>A	ENST00000397163.3	+	7	1180	c.961C>A	c.(961-963)Cag>Aag	p.Q321K	CAPN3_ENST00000357568.3_Missense_Mutation_p.Q321K|RP11-164J13.1_ENST00000495723.1_RNA|CAPN3_ENST00000356316.3_Missense_Mutation_p.Q234K|CAPN3_ENST00000349748.3_Missense_Mutation_p.Q273K|CAPN3_ENST00000318023.7_Missense_Mutation_p.Q321K	NM_000070.2	NP_000061.1	P20807	CAN3_HUMAN	calpain 3, (p94)	321	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				apoptotic process (GO:0006915)|autolysis (GO:0001896)|cellular response to calcium ion (GO:0071277)|cellular response to salt stress (GO:0071472)|G1 to G0 transition involved in cell differentiation (GO:0070315)|muscle cell cellular homeostasis (GO:0046716)|muscle organ development (GO:0007517)|muscle structure development (GO:0061061)|myofibril assembly (GO:0030239)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of proteolysis (GO:0045862)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of satellite cell activation involved in skeletal muscle regeneration (GO:0014718)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein localization to membrane (GO:0072657)|proteolysis (GO:0006508)|regulation of catalytic activity (GO:0050790)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of myoblast differentiation (GO:0045661)|response to calcium ion (GO:0051592)|response to muscle activity (GO:0014850)|sarcomere organization (GO:0045214)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|myofibril (GO:0030016)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)|ligase regulator activity (GO:0055103)|peptidase activity (GO:0008233)|protein complex scaffold (GO:0032947)|signal transducer activity (GO:0004871)|sodium ion binding (GO:0031402)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	47		all_cancers(109;1.65e-16)|all_epithelial(112;8.34e-15)|Lung NSC(122;3.56e-09)|all_lung(180;1.68e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;7.36e-07)		CATTCCGGTTCAGTATGAGAC	0.547																																						.											0													83.0	71.0	75.0					15																	42684852		2203	4299	6502	SO:0001583	missense	825			X85030	CCDS10085.1, CCDS10086.1, CCDS32207.1, CCDS45245.1, CCDS45246.1	15q15.1	2014-09-17			ENSG00000092529	ENSG00000092529	3.4.22.52	"""EF-hand domain containing"""	1480	protein-coding gene	gene with protein product		114240		LGMD2, LGMD2A		2555341, 7720071	Standard	NM_024344		Approved	CANP3, p94, nCL-1	uc001zpn.1	P20807	OTTHUMG00000130619	ENST00000397163.3:c.961C>A	15.37:g.42684852C>A	ENSP00000380349:p.Gln321Lys	Somatic		WXS	Illumina HiSeq	Phase_I	A6H8K6|Q7L4R0|Q9BQC8|Q9BTU4|Q9Y5S6|Q9Y5S7	Missense_Mutation	SNP	ENST00000397163.3	37	CCDS45245.1	.	.	.	.	.	.	.	.	.	.	C	15.59	2.878045	0.51801	.	.	ENSG00000092529	ENST00000356316;ENST00000397163;ENST00000357568;ENST00000349748;ENST00000318023	D;D;D;D;D	0.87412	-2.25;-2.25;-2.25;-2.25;-2.25	5.37	5.37	0.77165	Peptidase C2, calpain, catalytic domain (3);	0.257775	0.33253	U	0.005112	T	0.80042	0.4551	N	0.05351	-0.065	0.80722	D	1	B;B;B;B;B;B	0.23990	0.018;0.095;0.009;0.077;0.095;0.021	B;B;B;B;B;B	0.33121	0.065;0.158;0.038;0.062;0.102;0.103	T	0.76780	-0.2833	10	0.51188	T	0.08	.	18.4966	0.90867	0.0:1.0:0.0:0.0	.	186;234;273;321;321;234	C6EVS4;C6EVS3;P20807-2;P20807-3;P20807;Q762C8	.;.;.;.;CAN3_HUMAN;.	K	234;321;321;273;321	ENSP00000348667:Q234K;ENSP00000380349:Q321K;ENSP00000350181:Q321K;ENSP00000183936:Q273K;ENSP00000326281:Q321K	ENSP00000326281:Q321K	Q	+	1	0	CAPN3	40472144	1.000000	0.71417	0.970000	0.41538	0.260000	0.26232	5.608000	0.67654	2.683000	0.91414	0.655000	0.94253	CAG		0.547	CAPN3-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000421075.1		
SLC12A1	6557	broad.mit.edu;mdanderson.org	37	15	48518686	48518686	+	Silent	SNP	C	C	G			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr15:48518686C>G	ENST00000558405.1	+	4	656	c.642C>G	c.(640-642)ctC>ctG	p.L214L	SLC12A1_ENST00000380993.3_Silent_p.L214L|SLC12A1_ENST00000559723.1_Intron|SLC12A1_ENST00000330289.6_Silent_p.L214L|SLC12A1_ENST00000396577.3_Intron			Q13621	S12A1_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 1	214					cell death (GO:0008219)|chemical homeostasis (GO:0048878)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|kidney development (GO:0001822)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:potassium:chloride symporter activity (GO:0008511)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|prostate(2)|skin(1)	59		all_lung(180;0.00219)		all cancers(107;1.76e-09)|GBM - Glioblastoma multiforme(94;1.48e-06)	Bumetanide(DB00887)|Chlormerodrin(DB00534)|Chlorthalidone(DB00310)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Potassium Chloride(DB00761)|Quinethazone(DB01325)|Torasemide(DB00214)|Trichlormethiazide(DB01021)	TTGGAGTTCTCATAATTCTTC	0.373																																						.											0													122.0	118.0	120.0					15																	48518686		1854	4097	5951	SO:0001819	synonymous_variant	6557				CCDS10129.2, CCDS53940.1	15q15-q21	2013-07-18	2013-07-18		ENSG00000074803	ENSG00000074803		"""Solute carriers"""	10910	protein-coding gene	gene with protein product		600839				8640224	Standard	NM_000338		Approved	NKCC2	uc010bem.3	Q13621	OTTHUMG00000131495	ENST00000558405.1:c.642C>G	15.37:g.48518686C>G		Somatic		WXS	Illumina HiSeq	Phase_I	A8JYA2|E9PDW4	Silent	SNP	ENST00000558405.1	37	CCDS10129.2																																																																																				0.373	SLC12A1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417131.1		
POLR2M	81488	broad.mit.edu;mdanderson.org	37	15	58004208	58004208	+	Missense_Mutation	SNP	C	C	G			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr15:58004208C>G	ENST00000299638.3	+	3	999	c.785C>G	c.(784-786)tCt>tGt	p.S262C	POLR2M_ENST00000380557.4_Missense_Mutation_p.S105C|GCOM1_ENST00000380569.2_Missense_Mutation_p.S444C|POLR2M_ENST00000380563.2_Missense_Mutation_p.S262C|GCOM1_ENST00000587652.1_Missense_Mutation_p.S659C|GCOM1_ENST00000484300.1_3'UTR|GCOM1_ENST00000380568.3_Intron	NM_015532.3	NP_056347.1	P0CAP2	GRL1A_HUMAN	polymerase (RNA) II (DNA directed) polypeptide M	262					maintenance of ER location (GO:0051685)	DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)	DNA-directed RNA polymerase activity (GO:0003899)										AATGATTCATCTAGTCATTGC	0.403																																						.											0													67.0	65.0	66.0					15																	58004208		2192	4292	6484	SO:0001583	missense	81488			AF326773	CCDS32252.1, CCDS42045.1	15q21.3	2013-01-21	2011-11-07	2011-11-07		ENSG00000255529		"""RNA polymerase subunits"""	14862	protein-coding gene	gene with protein product		606485	"""glutamate receptor, ionotropic, N-methyl D-aspartate-like 1A"""	GRINL1A		16769904, 22850672	Standard	NM_015532		Approved	Gdown, Gdown1, GCOM1	uc002aev.1	P0CAP2	OTTHUMG00000166486	ENST00000299638.3:c.785C>G	15.37:g.58004208C>G	ENSP00000299638:p.Ser262Cys	Somatic		WXS	Illumina HiSeq	Phase_I	Q6EER8|Q6EES2|Q6EEV3|Q6EF00|Q6EF01|Q6EF02|Q6EF46|Q6EFN8|Q6EM48|Q6K046|Q6K050|Q6K051|Q6ZQZ3|Q8NC58|Q8NCF3|Q96DI5|Q96JB7|Q96NF5|Q9Y3V6	Missense_Mutation	SNP	ENST00000299638.3	37	CCDS32252.1	.	.	.	.	.	.	.	.	.	.	C	14.82	2.648457	0.47258	.	.	ENSG00000137878;ENSG00000255529;ENSG00000255529;ENSG00000255529	ENST00000380569;ENST00000380563;ENST00000299638;ENST00000380557	T	0.29917	1.55	4.85	1.81	0.25067	.	0.777046	0.11914	N	0.517340	T	0.41719	0.1171	.	.	.	0.09310	N	1	P;D;P	0.67145	0.955;0.996;0.8	P;P;B	0.56216	0.707;0.794;0.421	T	0.19549	-1.0302	9	0.54805	T	0.06	3.5611	8.7103	0.34380	0.0:0.6569:0.2603:0.0828	.	105;262;444	P0CAP2-2;P0CAP2;P0CAP1-11	.;GRL1A_HUMAN;.	C	444;262;262;105	ENSP00000369943:S444C	ENSP00000369943:S444C	S	+	2	0	GCOM1;GRINL1A	55791500	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	0.855000	0.27805	0.308000	0.22923	0.655000	0.94253	TCT		0.403	POLR2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255719.2		
POLR2M	81488	broad.mit.edu;mdanderson.org	37	15	58004276	58004276	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr15:58004276C>T	ENST00000299638.3	+	3	1067	c.853C>T	c.(853-855)Ctt>Ttt	p.L285F	POLR2M_ENST00000380557.4_Missense_Mutation_p.L128F|GCOM1_ENST00000380569.2_Missense_Mutation_p.L467F|POLR2M_ENST00000380563.2_Missense_Mutation_p.L285F|GCOM1_ENST00000587652.1_Missense_Mutation_p.L682F|GCOM1_ENST00000484300.1_3'UTR|GCOM1_ENST00000380568.3_Intron	NM_015532.3	NP_056347.1	P0CAP2	GRL1A_HUMAN	polymerase (RNA) II (DNA directed) polypeptide M	285					maintenance of ER location (GO:0051685)	DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)	DNA-directed RNA polymerase activity (GO:0003899)										TAAGCAGCATCTTGATGACAT	0.488																																						.											0													57.0	56.0	57.0					15																	58004276		2192	4292	6484	SO:0001583	missense	81488			AF326773	CCDS32252.1, CCDS42045.1	15q21.3	2013-01-21	2011-11-07	2011-11-07		ENSG00000255529		"""RNA polymerase subunits"""	14862	protein-coding gene	gene with protein product		606485	"""glutamate receptor, ionotropic, N-methyl D-aspartate-like 1A"""	GRINL1A		16769904, 22850672	Standard	NM_015532		Approved	Gdown, Gdown1, GCOM1	uc002aev.1	P0CAP2	OTTHUMG00000166486	ENST00000299638.3:c.853C>T	15.37:g.58004276C>T	ENSP00000299638:p.Leu285Phe	Somatic		WXS	Illumina HiSeq	Phase_I	Q6EER8|Q6EES2|Q6EEV3|Q6EF00|Q6EF01|Q6EF02|Q6EF46|Q6EFN8|Q6EM48|Q6K046|Q6K050|Q6K051|Q6ZQZ3|Q8NC58|Q8NCF3|Q96DI5|Q96JB7|Q96NF5|Q9Y3V6	Missense_Mutation	SNP	ENST00000299638.3	37	CCDS32252.1	.	.	.	.	.	.	.	.	.	.	C	19.41	3.822039	0.71028	.	.	ENSG00000137878;ENSG00000255529;ENSG00000255529;ENSG00000255529	ENST00000380569;ENST00000380563;ENST00000299638;ENST00000380557	T	0.29142	1.58	4.76	4.76	0.60689	.	0.886809	0.09915	N	0.739245	T	0.51466	0.1676	.	.	.	0.33828	D	0.629945	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.997	T	0.57447	-0.7810	9	0.59425	D	0.04	-7.978	7.3211	0.26528	0.0:0.8194:0.0:0.1806	.	128;285;467	P0CAP2-2;P0CAP2;P0CAP1-11	.;GRL1A_HUMAN;.	F	467;285;285;128	ENSP00000369943:L467F	ENSP00000369943:L467F	L	+	1	0	GCOM1;GRINL1A	55791568	0.988000	0.35896	0.963000	0.40424	0.984000	0.73092	1.091000	0.30915	2.627000	0.88993	0.591000	0.81541	CTT		0.488	POLR2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255719.2		
POLR2M	81488	broad.mit.edu;mdanderson.org	37	15	58004287	58004287	+	Silent	SNP	C	C	T			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr15:58004287C>T	ENST00000299638.3	+	3	1078	c.864C>T	c.(862-864)atC>atT	p.I288I	POLR2M_ENST00000380557.4_Silent_p.I131I|GCOM1_ENST00000380569.2_Silent_p.I470I|POLR2M_ENST00000380563.2_Silent_p.I288I|GCOM1_ENST00000587652.1_Silent_p.I685I|GCOM1_ENST00000484300.1_3'UTR|GCOM1_ENST00000380568.3_Intron	NM_015532.3	NP_056347.1	P0CAP2	GRL1A_HUMAN	polymerase (RNA) II (DNA directed) polypeptide M	288					maintenance of ER location (GO:0051685)	DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)	DNA-directed RNA polymerase activity (GO:0003899)										TTGATGACATCACAGCAGCTC	0.483																																						.											0													55.0	54.0	55.0					15																	58004287		2192	4290	6482	SO:0001819	synonymous_variant	81488			AF326773	CCDS32252.1, CCDS42045.1	15q21.3	2013-01-21	2011-11-07	2011-11-07		ENSG00000255529		"""RNA polymerase subunits"""	14862	protein-coding gene	gene with protein product		606485	"""glutamate receptor, ionotropic, N-methyl D-aspartate-like 1A"""	GRINL1A		16769904, 22850672	Standard	NM_015532		Approved	Gdown, Gdown1, GCOM1	uc002aev.1	P0CAP2	OTTHUMG00000166486	ENST00000299638.3:c.864C>T	15.37:g.58004287C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q6EER8|Q6EES2|Q6EEV3|Q6EF00|Q6EF01|Q6EF02|Q6EF46|Q6EFN8|Q6EM48|Q6K046|Q6K050|Q6K051|Q6ZQZ3|Q8NC58|Q8NCF3|Q96DI5|Q96JB7|Q96NF5|Q9Y3V6	Silent	SNP	ENST00000299638.3	37	CCDS32252.1																																																																																				0.483	POLR2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255719.2		
FAM174B	400451	broad.mit.edu	37	15	93173567	93173567	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr15:93173567T>C	ENST00000327355.5	-	2	651	c.353A>G	c.(352-354)aAg>aGg	p.K118R	FAM174B_ENST00000555696.1_5'UTR|FAM174B_ENST00000555748.1_5'UTR|FAM174B_ENST00000553393.1_5'UTR|FAM174B_ENST00000555064.1_5'UTR	NM_207446.2	NP_997329.2	Q3ZCQ3	F174B_HUMAN	family with sequence similarity 174, member B	118						integral component of membrane (GO:0016021)				endometrium(2)|lung(1)	3						CTTTAACCTCTTTCCCGACCT	0.512																																						.											0													96.0	87.0	90.0					15																	93173567		2023	4188	6211	SO:0001583	missense	400451				CCDS45355.1	15q26.1	2012-10-03			ENSG00000185442	ENSG00000185442			34339	protein-coding gene	gene with protein product							Standard	NM_207446		Approved	LOC400451, MGC102891	uc010boe.3	Q3ZCQ3	OTTHUMG00000171744	ENST00000327355.5:c.353A>G	15.37:g.93173567T>C	ENSP00000329040:p.Lys118Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q3ZCR9|Q8NBH7	Missense_Mutation	SNP	ENST00000327355.5	37	CCDS45355.1	.	.	.	.	.	.	.	.	.	.	T	7.910	0.736234	0.15574	.	.	ENSG00000185442	ENST00000327355	T	0.38887	1.11	5.38	1.87	0.25490	.	0.063055	0.64402	D	0.000009	T	0.29588	0.0738	L	0.37630	1.12	0.80722	D	1	B	0.24426	0.103	B	0.23574	0.047	T	0.05007	-1.0912	10	0.36615	T	0.2	-15.2595	8.1803	0.31307	0.0:0.327:0.0:0.673	.	118	Q3ZCQ3	F174B_HUMAN	R	118	ENSP00000329040:K118R	ENSP00000329040:K118R	K	-	2	0	FAM174B	90974571	1.000000	0.71417	0.104000	0.21259	0.211000	0.24417	1.253000	0.32886	0.075000	0.16796	0.482000	0.46254	AAG		0.512	FAM174B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000414931.1	NM_207446	
ARHGAP17	55114	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	16	24950855	24950855	+	Missense_Mutation	SNP	G	G	T			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr16:24950855G>T	ENST00000289968.6	-	17	1623	c.1554C>A	c.(1552-1554)caC>caA	p.H518Q	ARHGAP17_ENST00000441763.2_3'UTR|ARHGAP17_ENST00000303665.5_Intron	NM_001006634.1	NP_001006635.1	Q68EM7	RHG17_HUMAN	Rho GTPase activating protein 17	518					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	GTPase activator activity (GO:0005096)			breast(2)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|urinary_tract(2)	30				GBM - Glioblastoma multiforme(48;0.0407)		CGGGGGATATGTGCTTTCTAT	0.592																																						.											0													26.0	27.0	27.0					16																	24950855		2195	4298	6493	SO:0001583	missense	55114			AJ306731	CCDS32408.1, CCDS32409.1	16p12.2-p12.1	2011-06-29				ENSG00000140750		"""Rho GTPase activating proteins"""	18239	protein-coding gene	gene with protein product		608293				10967100, 11431473	Standard	XM_005255413		Approved	RICH1, FLJ10308, NADRIN, FLJ13219, WBP15	uc002dnb.3	Q68EM7		ENST00000289968.6:c.1554C>A	16.37:g.24950855G>T	ENSP00000289968:p.His518Gln	Somatic		WXS	Illumina HiSeq	Phase_I	A8K6M6|Q6ZUS4|Q7Z2F2|Q8NDG2|Q96KS2|Q96KS3|Q96SS8|Q9BVF6|Q9H8U5|Q9NW54	Missense_Mutation	SNP	ENST00000289968.6	37	CCDS32409.1	.	.	.	.	.	.	.	.	.	.	G	11.48	1.652483	0.29336	.	.	ENSG00000140750	ENST00000289968;ENST00000455311	T	0.20463	2.07	5.0	2.99	0.34606	.	0.000000	0.46758	D	0.000262	T	0.35480	0.0933	M	0.63428	1.95	0.80722	D	1	B;D	0.89917	0.296;1.0	B;D	0.87578	0.046;0.998	T	0.11867	-1.0570	10	0.21014	T	0.42	.	7.2856	0.26337	0.2681:0.0:0.7319:0.0	.	518;51	Q68EM7;Q68EM7-7	RHG17_HUMAN;.	Q	518	ENSP00000289968:H518Q	ENSP00000289968:H518Q	H	-	3	2	ARHGAP17	24858356	1.000000	0.71417	0.991000	0.47740	0.975000	0.68041	4.165000	0.58196	1.334000	0.45468	-0.150000	0.13652	CAC		0.592	ARHGAP17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436548.3	NM_018054	
EIF3CL	728689	broad.mit.edu	37	16	28403353	28403355	+	In_Frame_Del	DEL	TCC	TCC	-			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	TCC	TCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr16:28403353_28403355delTCC	ENST00000398943.3	-	9	1021_1023	c.885_887delGGA	c.(883-888)gaggac>gac	p.E295del	EIF3CL_ENST00000380876.4_In_Frame_Del_p.E295del|EIF3CL_ENST00000398944.3_In_Frame_Del_p.E295del			B5ME19	EIFCL_HUMAN	eukaryotic translation initiation factor 3, subunit C-like	295					formation of translation preinitiation complex (GO:0001731)|regulation of translational initiation (GO:0006446)	eukaryotic 43S preinitiation complex (GO:0016282)|eukaryotic 48S preinitiation complex (GO:0033290)|eukaryotic translation initiation factor 3 complex (GO:0005852)	translation initiation factor activity (GO:0003743)										GCCTTCATTGTCCTCCTCCTCCT	0.547																																						.											0																																										SO:0001651	inframe_deletion	8663				CCDS42136.1	16p11.2	2008-10-28			ENSG00000205609	ENSG00000205609			26347	protein-coding gene	gene with protein product							Standard	NM_001099661		Approved			B5ME19	OTTHUMG00000097025	ENST00000398943.3:c.885_887delGGA	16.37:g.28403362_28403364delTCC	ENSP00000381916:p.Glu295del	Somatic		WXS	Illumina HiSeq	Phase_I		In_Frame_Del	DEL	ENST00000398943.3	37	CCDS42136.1																																																																																				0.547	EIF3CL-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214116.1		
SLC7A6	9057	broad.mit.edu;mdanderson.org	37	16	68325151	68325151	+	Silent	SNP	G	G	A			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr16:68325151G>A	ENST00000566454.1	+	7	1103	c.834G>A	c.(832-834)gtG>gtA	p.V278V	SLC7A6_ENST00000219343.6_Silent_p.V278V	NM_001076785.2	NP_001070253.1			solute carrier family 7 (amino acid transporter light chain, y+L system), member 6											breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|skin(1)	16		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.034)|Epithelial(162;0.0948)		TGCCAATTGTGACGCTCATCT	0.458																																						.											0													279.0	232.0	248.0					16																	68325151		2198	4300	6498	SO:0001819	synonymous_variant	9057			D87432	CCDS32470.1	16q22.1	2013-07-15	2011-07-12		ENSG00000103064	ENSG00000103064		"""Solute carriers"""	11064	protein-coding gene	gene with protein product		605641				9878049	Standard	NM_001076785		Approved	y+LAT-2, KIAA0245, LAT3, LAT-2	uc002evu.2	Q92536	OTTHUMG00000176544	ENST00000566454.1:c.834G>A	16.37:g.68325151G>A		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000566454.1	37	CCDS32470.1																																																																																				0.458	SLC7A6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432466.1	NM_003983	
PLGLA	285189	broad.mit.edu	37	2	107002809	107002809	+	RNA	DEL	G	G	-			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr2:107002809delG	ENST00000484422.1	+	0	41							Q15195	PLGA_HUMAN	plasminogen-like A (pseudogene)							extracellular region (GO:0005576)											AGAAGCAGCTGGGGGCAGGAA	0.488																																						.											0																																												285189			U67178, M86872, M86873		2q12.2	2013-03-28	2013-03-28	2008-02-07	ENSG00000240935	ENSG00000240935			9074	pseudogene	pseudogene		612212	"""plasminogen pseudogene 2"", ""plasminogen-like A1"", ""plasminogen-like A"""	PLGP2, PLGLA1		1986355	Standard	NR_003506		Approved		uc002tdp.4	Q15195	OTTHUMG00000153188		2.37:g.107002809delG		Somatic		WXS	Illumina HiSeq	Phase_I		RNA	DEL	ENST00000484422.1	37																																																																																					0.488	PLGLA-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000331219.1	NR_003506.2	
RANBP2	5903	broad.mit.edu	37	2	109383357	109383357	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr2:109383357A>G	ENST00000283195.6	+	20	6488	c.6362A>G	c.(6361-6363)cAg>cGg	p.Q2121R		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	2121	RanBD1 2. {ECO:0000255|PROSITE- ProRule:PRU00164}.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.Q2121R(6)	RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						AAACTAGAGCAGTTGGCAGCA	0.453																																						.											6	Substitution - Missense(6)	skin(6)											117.0	126.0	123.0					2																	109383357		2184	4241	6425	SO:0001583	missense	5903			D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.6362A>G	2.37:g.109383357A>G	ENSP00000283195:p.Gln2121Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q13074|Q15280|Q53TE2|Q59FH7	Missense_Mutation	SNP	ENST00000283195.6	37	CCDS2079.1	.	.	.	.	.	.	.	.	.	.	A	14.65	2.598113	0.46318	.	.	ENSG00000153201	ENST00000409491;ENST00000283195	T	0.46451	0.87	5.6	5.6	0.85130	Pleckstrin homology-type (1);Ran binding protein 1 (3);	.	.	.	.	T	0.58736	0.2143	L	0.51422	1.61	0.44098	D	0.996863	D	0.76494	0.999	D	0.83275	0.996	T	0.55611	-0.8114	9	0.35671	T	0.21	-3.8912	15.7943	0.78398	1.0:0.0:0.0:0.0	.	2121	P49792	RBP2_HUMAN	R	1145;2121	ENSP00000283195:Q2121R	ENSP00000283195:Q2121R	Q	+	2	0	RANBP2	108749789	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	9.339000	0.96797	2.119000	0.64992	0.455000	0.32223	CAG		0.453	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1	NM_006267	
ZDBF2	57683	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	2	207171302	207171302	+	Missense_Mutation	SNP	G	G	A			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr2:207171302G>A	ENST00000374423.3	+	5	2436	c.2050G>A	c.(2050-2052)Gaa>Aaa	p.E684K		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	684							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						TCAAGTAGCCGAAATAGAGCG	0.443																																						.											0													71.0	71.0	71.0					2																	207171302		1896	4124	6020	SO:0001583	missense	57683			AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.2050G>A	2.37:g.207171302G>A	ENSP00000363545:p.Glu684Lys	Somatic		WXS	Illumina HiSeq	Phase_I	Q6ZNP7|Q6ZSN8	Missense_Mutation	SNP	ENST00000374423.3	37	CCDS46501.1	.	.	.	.	.	.	.	.	.	.	G	9.409	1.079934	0.20309	.	.	ENSG00000204186	ENST00000374423	T	0.58652	0.32	3.75	1.97	0.26223	.	0.000000	0.39083	N	0.001470	T	0.31420	0.0796	L	0.31526	0.94	0.09310	N	1	P	0.38223	0.623	B	0.25405	0.06	T	0.15492	-1.0435	10	0.13853	T	0.58	.	6.1828	0.20480	0.2301:0.0:0.7699:0.0	.	684	Q9HCK1	ZDBF2_HUMAN	K	684	ENSP00000363545:E684K	ENSP00000363545:E684K	E	+	1	0	ZDBF2	206879547	0.616000	0.27035	0.003000	0.11579	0.001000	0.01503	1.340000	0.33896	0.585000	0.29608	-0.119000	0.15052	GAA		0.443	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336458.1	NM_020923	
SMARCAL1	50485	broad.mit.edu	37	2	217340073	217340073	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr2:217340073A>G	ENST00000357276.4	+	15	2656	c.2326A>G	c.(2326-2328)Agg>Ggg	p.R776G	SMARCAL1_ENST00000358207.5_Missense_Mutation_p.R776G	NM_014140.3	NP_054859.2	Q9NZC9	SMAL1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a-like 1	776	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA metabolic process (GO:0006259)|DNA strand renaturation (GO:0000733)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|replication fork processing (GO:0031297)	nucleus (GO:0005634)|site of double-strand break (GO:0035861)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(15)|ovary(3)|prostate(1)|skin(1)	42		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)		ACTGTCGGAGAGGCATGCTGT	0.607									Schimke Immuno-Osseous Dysplasia																													.											0													129.0	110.0	117.0					2																	217340073		2203	4300	6503	SO:0001583	missense	50485	Familial Cancer Database	SIOD	AF210833	CCDS2403.1	2q35	2014-09-17			ENSG00000138375	ENSG00000138375			11102	protein-coding gene	gene with protein product	"""HepA-related protein"", ""ATP-driven annealing helicase"""	606622				10713074, 10857751, 18974355	Standard	NM_014140		Approved	HHARP, HARP	uc002vgd.4	Q9NZC9	OTTHUMG00000133055	ENST00000357276.4:c.2326A>G	2.37:g.217340073A>G	ENSP00000349823:p.Arg776Gly	Somatic		WXS	Illumina HiSeq	Phase_I	A6NEH0|Q53R00|Q96AY1|Q9NXQ5|Q9UFH3|Q9UI93	Missense_Mutation	SNP	ENST00000357276.4	37	CCDS2403.1	.	.	.	.	.	.	.	.	.	.	A	3.685	-0.064660	0.07273	.	.	ENSG00000138375	ENST00000357276;ENST00000358207;ENST00000392128	D;D;T	0.91894	-2.93;-2.93;-0.91	5.06	1.2	0.21068	Helicase, C-terminal (3);	0.413963	0.27544	N	0.018889	T	0.76076	0.3937	N	0.04148	-0.265	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.61922	-0.6963	10	0.14252	T	0.57	-4.4374	4.8558	0.13559	0.6577:0.1566:0.1857:0.0	.	776	Q9NZC9	SMAL1_HUMAN	G	776;776;618	ENSP00000349823:R776G;ENSP00000350940:R776G;ENSP00000375974:R618G	ENSP00000349823:R776G	R	+	1	2	SMARCAL1	217048318	0.156000	0.22821	0.127000	0.21898	0.067000	0.16453	0.614000	0.24314	0.047000	0.15862	0.528000	0.53228	AGG		0.607	SMARCAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256671.2		
GLB1L	79411	broad.mit.edu;mdanderson.org	37	2	220102299	220102299	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr2:220102299A>G	ENST00000295759.7	-	16	1937	c.1624T>C	c.(1624-1626)Tcc>Ccc	p.S542P	GLB1L_ENST00000409640.1_Missense_Mutation_p.S452P|GLB1L_ENST00000497855.1_5'UTR|GLB1L_ENST00000356283.3_Missense_Mutation_p.S452P|GLB1L_ENST00000392089.2_Missense_Mutation_p.S542P			Q6UWU2	GLB1L_HUMAN	galactosidase, beta 1-like	542					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	beta-galactosidase activity (GO:0004565)			breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22		all_lung(227;1.19e-05)|Lung NSC(271;2.76e-05)|Medulloblastoma(418;0.0208)|Esophageal squamous(248;0.0559)		Epithelial(149;1.3e-11)|all cancers(144;2.07e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AATGTTTTGGAGTAGAATGTG	0.468																																						.											0													80.0	82.0	81.0					2																	220102299		2203	4300	6503	SO:0001583	missense	79411				CCDS2437.1, CCDS74657.1	2q36.1	2008-02-05			ENSG00000163521	ENSG00000163521			28129	protein-coding gene	gene with protein product						12975309	Standard	XM_005246850		Approved	MGC10771	uc002vkm.3	Q6UWU2	OTTHUMG00000133133	ENST00000295759.7:c.1624T>C	2.37:g.220102299A>G	ENSP00000295759:p.Ser542Pro	Somatic		WXS	Illumina HiSeq	Phase_I	Q96DR0	Missense_Mutation	SNP	ENST00000295759.7	37	CCDS2437.1	.	.	.	.	.	.	.	.	.	.	A	9.019	0.984337	0.18889	.	.	ENSG00000163521	ENST00000295759;ENST00000409640;ENST00000392089;ENST00000356283	D;D;D;D	0.94232	-3.38;-3.38;-3.38;-3.38	5.09	5.09	0.68999	Galactose-binding domain-like (1);	0.447334	0.23904	N	0.043415	D	0.94026	0.8086	L	0.54323	1.7	0.42832	D	0.994029	D;D	0.71674	0.998;0.965	P;P	0.62649	0.905;0.579	D	0.92708	0.6180	10	0.37606	T	0.19	-17.0788	8.4212	0.32700	0.7088:0.0:0.0:0.2912	.	452;542	Q6UWU2-2;Q6UWU2	.;GLB1L_HUMAN	P	542;452;542;452	ENSP00000295759:S542P;ENSP00000386354:S452P;ENSP00000375939:S542P;ENSP00000348628:S452P	ENSP00000295759:S542P	S	-	1	0	GLB1L	219810543	1.000000	0.71417	0.996000	0.52242	0.745000	0.42441	2.209000	0.42806	2.129000	0.65627	0.533000	0.62120	TCC		0.468	GLB1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256822.2	NM_024506	
NCOA6	23054	broad.mit.edu;mdanderson.org	37	20	33345744	33345744	+	Silent	SNP	C	C	T			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr20:33345744C>T	ENST00000374796.2	-	8	3377	c.807G>A	c.(805-807)caG>caA	p.Q269Q	NCOA6_ENST00000359003.2_Silent_p.Q269Q			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	269	CREBBP-binding region.|Gln-rich.|NCOA1-binding region.|TBP/GTF2A-binding region.				brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)	p.Q269Q(15)		NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						gctgctgctgctgttgttgtt	0.537																																						.											15	Substitution - coding silent(15)	lung(5)|prostate(4)|endometrium(3)|central_nervous_system(1)|urinary_tract(1)|kidney(1)											64.0	52.0	56.0					20																	33345744		2203	4300	6503	SO:0001819	synonymous_variant	23054			AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.807G>A	20.37:g.33345744C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Silent	SNP	ENST00000374796.2	37	CCDS13241.1																																																																																				0.537	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078811.2	NM_014071	
CABIN1	23523	broad.mit.edu;ucsc.edu;mdanderson.org	37	22	24472140	24472140	+	Silent	SNP	C	C	T			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr22:24472140C>T	ENST00000398319.2	+	19	3040	c.2655C>T	c.(2653-2655)ctC>ctT	p.L885L	CABIN1_ENST00000405822.2_Silent_p.L835L|CABIN1_ENST00000263119.5_Silent_p.L885L	NM_001199281.1	NP_001186210.1	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	885					cell surface receptor signaling pathway (GO:0007166)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of catalytic activity (GO:0043086)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(13)|liver(1)|lung(18)|ovary(5)|pancreas(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						CGCCCATGCTCCCATCCTCCC	0.582																																						.											0													111.0	85.0	94.0					22																	24472140		2203	4300	6503	SO:0001819	synonymous_variant	23523			AF072441	CCDS13823.1, CCDS74830.1	22q11.23	2008-09-16			ENSG00000099991	ENSG00000099991			24187	protein-coding gene	gene with protein product		604251				9655484, 9205841	Standard	NM_001199281		Approved	KIAA0330, PPP3IN	uc002zzi.1	Q9Y6J0	OTTHUMG00000150797	ENST00000398319.2:c.2655C>T	22.37:g.24472140C>T		Somatic		WXS	Illumina HiSeq	Phase_I	G5E9F3|Q6PHY0|Q9Y460	Silent	SNP	ENST00000398319.2	37	CCDS13823.1																																																																																				0.582	CABIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320161.2	NM_012295	
GADL1	339896	broad.mit.edu;mdanderson.org	37	3	30875422	30875422	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr3:30875422C>T	ENST00000282538.5	-	11	1123	c.973G>A	c.(973-975)Gac>Aac	p.D325N	GADL1_ENST00000454381.3_Missense_Mutation_p.D325N	NM_207359.2	NP_997242.2	Q6ZQY3	GADL1_HUMAN	glutamate decarboxylase-like 1	325					carboxylic acid metabolic process (GO:0019752)		aspartate 1-decarboxylase activity (GO:0004068)|pyridoxal phosphate binding (GO:0030170)|sulfinoalanine decarboxylase activity (GO:0004782)			breast(2)|endometrium(3)|kidney(2)|lung(17)|upper_aerodigestive_tract(1)	25						GCCACAGAGTCAGCCCTATTG	0.443																																						.											0													71.0	71.0	71.0					3																	30875422		2203	4300	6503	SO:0001583	missense	339896			AK128643	CCDS2649.2	3p23-p22	2009-01-14			ENSG00000144644	ENSG00000144644			27949	protein-coding gene	gene with protein product		615601					Standard	NM_207359		Approved		uc003cep.2	Q6ZQY3	OTTHUMG00000130621	ENST00000282538.5:c.973G>A	3.37:g.30875422C>T	ENSP00000282538:p.Asp325Asn	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000282538.5	37	CCDS2649.2	.	.	.	.	.	.	.	.	.	.	C	9.606	1.130022	0.21041	.	.	ENSG00000144644	ENST00000282538;ENST00000454381	T;T	0.59364	0.27;0.27	5.87	4.09	0.47781	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.158366	0.52532	N	0.000077	T	0.49406	0.1555	L	0.52011	1.625	0.37537	D	0.918172	B	0.13594	0.008	B	0.22753	0.041	T	0.50171	-0.8859	10	0.26408	T	0.33	.	10.3869	0.44145	0.0:0.7953:0.0:0.2047	.	325	Q6ZQY3	GADL1_HUMAN	N	325	ENSP00000282538:D325N;ENSP00000427059:D325N	ENSP00000282538:D325N	D	-	1	0	GADL1	30850426	0.745000	0.28261	0.989000	0.46669	0.920000	0.55202	0.951000	0.29135	1.498000	0.48600	-0.140000	0.14226	GAC		0.443	GADL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253106.2	NM_207359	
PIK3CB	5291	broad.mit.edu	37	3	138433374	138433374	+	Missense_Mutation	SNP	G	G	T			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr3:138433374G>T	ENST00000477593.1	-	8	1311	c.1238C>A	c.(1237-1239)aCg>aAg	p.T413K	PIK3CB_ENST00000544716.1_5'Flank|PIK3CB_ENST00000289153.2_Missense_Mutation_p.T413K			P42338	PK3CB_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta	413	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00880}.				activation of MAPK activity (GO:0000187)|autophagy (GO:0006914)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|embryonic cleavage (GO:0040016)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of autophagy (GO:0010508)|regulation of cell-matrix adhesion (GO:0001952)|regulation of clathrin-mediated endocytosis (GO:2000369)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)			NS(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	41					Caffeine(DB00201)	TGATTTCTTCGTTTTTACTTT	0.318																																						.											0													157.0	147.0	150.0					3																	138433374		2203	4300	6503	SO:0001583	missense	5291				CCDS3104.1	3q22.3	2013-09-19	2012-07-13		ENSG00000051382	ENSG00000051382	2.7.1.153		8976	protein-coding gene	gene with protein product		602925	"""phosphoinositide-3-kinase, catalytic, beta polypeptide"""	PIK3C1		8246984	Standard	NM_006219		Approved		uc011bmq.3	P42338	OTTHUMG00000159893	ENST00000477593.1:c.1238C>A	3.37:g.138433374G>T	ENSP00000418143:p.Thr413Lys	Somatic		WXS	Illumina HiSeq	Phase_I	D3DNF0|Q24JU2	Missense_Mutation	SNP	ENST00000477593.1	37	CCDS3104.1	.	.	.	.	.	.	.	.	.	.	G	11.55	1.672458	0.29693	.	.	ENSG00000051382	ENST00000477593;ENST00000289153	T;T	0.69040	-0.37;-0.37	5.46	4.59	0.56863	C2 calcium/lipid-binding domain, CaLB (1);Phosphoinositide 3-kinase, C2 (2);	0.229090	0.43416	D	0.000566	T	0.28499	0.0705	N	0.00642	-1.3	0.80722	D	1	B;B	0.06786	0.001;0.0	B;B	0.10450	0.005;0.002	T	0.30995	-0.9959	10	0.06099	T	0.92	-12.2416	8.7016	0.34329	0.0764:0.0:0.7742:0.1494	.	413;17	P42338;B4DZI3	PK3CB_HUMAN;.	K	413	ENSP00000418143:T413K;ENSP00000289153:T413K	ENSP00000289153:T413K	T	-	2	0	PIK3CB	139916064	1.000000	0.71417	0.992000	0.48379	0.996000	0.88848	5.529000	0.67135	1.437000	0.47472	0.650000	0.86243	ACG		0.318	PIK3CB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358019.1		
CPA3	1359	broad.mit.edu;mdanderson.org	37	3	148583133	148583133	+	Silent	SNP	T	T	C			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr3:148583133T>C	ENST00000296046.3	+	1	91	c.39T>C	c.(37-39)acT>acC	p.T13T	RP11-680B3.2_ENST00000488190.1_RNA	NM_001870.2	NP_001861.2	P15088	CBPA3_HUMAN	carboxypeptidase A3 (mast cell)	13					angiotensin maturation (GO:0002003)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|secretory granule (GO:0030141)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(1)|large_intestine(3)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	35			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			TTGCTACCACTCTTGCAATTG	0.458																																						.											0													239.0	201.0	214.0					3																	148583133		2203	4300	6503	SO:0001819	synonymous_variant	1359				CCDS3138.1	3q24	2012-02-10			ENSG00000163751	ENSG00000163751	3.4.17.1		2298	protein-coding gene	gene with protein product	"""mast cell carboxypeptidase A"", ""tissue carboxypeptidase A"""	114851					Standard	NM_001870		Approved		uc003ewm.3	P15088	OTTHUMG00000159526	ENST00000296046.3:c.39T>C	3.37:g.148583133T>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q96E94	Silent	SNP	ENST00000296046.3	37	CCDS3138.1																																																																																				0.458	CPA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355974.1	NM_001870	
DEPDC1B	55789	broad.mit.edu	37	5	59894911	59894911	+	Silent	SNP	T	T	C			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr5:59894911T>C	ENST00000265036.5	-	10	1486	c.1419A>G	c.(1417-1419)aaA>aaG	p.K473K	DEPDC1B_ENST00000545085.1_Intron|DEPDC1B_ENST00000453022.2_Intron	NM_018369.2	NP_060839.2	Q8WUY9	DEP1B_HUMAN	DEP domain containing 1B	473	Poly-Lys.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(2)|skin(2)	17		Lung NSC(810;0.000214)|Prostate(74;0.0147)|Breast(144;0.0991)|Ovarian(174;0.17)				CCTGCTTCAGTTTCTTCTTTT	0.343																																						.											0													73.0	70.0	71.0					5																	59894911		2203	4300	6503	SO:0001819	synonymous_variant	55789			AF303178	CCDS3977.1, CCDS47214.1	5q12	2008-02-05			ENSG00000035499	ENSG00000035499			24902	protein-coding gene	gene with protein product	"""breast cancer cell 3"""					12477932	Standard	NM_001145208		Approved	XTP1, BRCC3	uc003jsh.3	Q8WUY9	OTTHUMG00000097083	ENST00000265036.5:c.1419A>G	5.37:g.59894911T>C		Somatic		WXS	Illumina HiSeq	Phase_I	A8K3R9|B4DUT4|Q86WJ3|Q8IZY6|Q9NUN3|Q9NW57	Silent	SNP	ENST00000265036.5	37	CCDS3977.1																																																																																				0.343	DEPDC1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214207.1	NM_018369	
GABRP	2568	broad.mit.edu	37	5	170239019	170239019	+	Silent	SNP	C	C	T			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr5:170239019C>T	ENST00000518525.1	+	11	1544	c.1080C>T	c.(1078-1080)tcC>tcT	p.S360S	GABRP_ENST00000519385.1_3'UTR|GABRP_ENST00000265294.4_Silent_p.S360S			O00591	GBRP_HUMAN	gamma-aminobutyric acid (GABA) A receptor, pi	360					signal transduction (GO:0007165)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|breast(1)|cervix(1)|endometrium(5)|large_intestine(4)|lung(11)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	29	Renal(175;0.000159)|Lung NSC(126;0.0122)|all_lung(126;0.0193)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)		Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GCTCCATCTCCAGCTTTAAAC	0.403																																						.											0													123.0	114.0	117.0					5																	170239019		2203	4300	6503	SO:0001819	synonymous_variant	2568			U95367	CCDS4375.1, CCDS75368.1	5q35.1	2012-06-22			ENSG00000094755	ENSG00000094755		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4089	protein-coding gene	gene with protein product	"""GABA(A) receptor, pi"""	602729				9182563	Standard	NM_014211		Approved		uc003mau.3	O00591	OTTHUMG00000130443	ENST00000518525.1:c.1080C>T	5.37:g.170239019C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A8KA36|D3DQL2|Q32MJ1	Silent	SNP	ENST00000518525.1	37	CCDS4375.1																																																																																				0.403	GABRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252834.3	NM_014211	
KPNA5	3841	broad.mit.edu;mdanderson.org	37	6	117013533	117013533	+	Silent	SNP	A	A	G			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr6:117013533A>G	ENST00000368564.1	+	4	466	c.318A>G	c.(316-318)aaA>aaG	p.K106K	KPNA5_ENST00000356348.1_Silent_p.K106K			O15131	IMA6_HUMAN	karyopherin alpha 5 (importin alpha 6)	103					cytokine-mediated signaling pathway (GO:0019221)|NLS-bearing protein import into nucleus (GO:0006607)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)	protein transporter activity (GO:0008565)			breast(6)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0298)|all cancers(137;0.0461)|OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.212)		CAACACAGAAATTTAGAAAGC	0.274																																						.											0													70.0	74.0	73.0					6																	117013533		2203	4286	6489	SO:0001819	synonymous_variant	3841			AF005361	CCDS5111.1	6q22.2	2013-02-14			ENSG00000196911	ENSG00000196911		"""Importins"", ""Armadillo repeat containing"""	6398	protein-coding gene	gene with protein product		604545				9395085	Standard	NM_002269		Approved	SRP6, IPOA6	uc003pxh.3	O15131	OTTHUMG00000015448	ENST00000368564.1:c.318A>G	6.37:g.117013533A>G		Somatic		WXS	Illumina HiSeq	Phase_I	B2RAI5|Q86X23	Silent	SNP	ENST00000368564.1	37	CCDS5111.1																																																																																				0.274	KPNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041967.1	NM_002269	
SYNE1	23345	broad.mit.edu;bcgsc.ca	37	6	152642498	152642498	+	Nonsense_Mutation	SNP	G	G	A			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr6:152642498G>A	ENST00000367255.5	-	84	16712	c.16111C>T	c.(16111-16113)Cga>Tga	p.R5371*	SYNE1_ENST00000448038.1_Nonsense_Mutation_p.R5300*|SYNE1_ENST00000341594.5_Nonsense_Mutation_p.R5044*|SYNE1_ENST00000265368.4_Nonsense_Mutation_p.R5371*|SYNE1_ENST00000423061.1_Nonsense_Mutation_p.R5300*	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	5371					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		ATGTTCTGTCGGTGATTTGTG	0.388										HNSCC(10;0.0054)																												.											0													100.0	94.0	96.0					6																	152642498		2203	4300	6503	SO:0001587	stop_gained	23345			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.16111C>T	6.37:g.152642498G>A	ENSP00000356224:p.Arg5371*	Somatic		WXS	Illumina HiSeq	Phase_I	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Nonsense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	G	58	31.532104	0.99979	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	.	.	.	5.25	2.3	0.28687	.	0.425694	0.19668	N	0.108839	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.8923	0.63747	0.0:0.0:0.6078:0.3922	.	.	.	.	X	5371;5300;5371;5300;5044	.	ENSP00000265368:R5371X	R	-	1	2	SYNE1	152684191	1.000000	0.71417	0.994000	0.49952	0.984000	0.73092	2.424000	0.44714	0.149000	0.19098	0.563000	0.77884	CGA		0.388	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
GTF2IRD2P1	401375	broad.mit.edu	37	7	72658559	72658559	+	RNA	SNP	C	C	T			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr7:72658559C>T	ENST00000425256.1	-	0	1352									GTF2I repeat domain containing 2 pseudogene 1																		ccataagttcccagctaggtc	0.473																																						.											0																																												401375			AY312852		7q11.23	2010-03-19	2010-02-09	2010-02-09	ENSG00000214544	ENSG00000214544			33127	pseudogene	pseudogene			"""GTF2I repeat domain containing 2 pseudogene"""	GTF2IRD2P		15100712	Standard	NG_033736		Approved		uc003txs.1		OTTHUMG00000156803		7.37:g.72658559C>T		Somatic		WXS	Illumina HiSeq	Phase_I		RNA	SNP	ENST00000425256.1	37																																																																																					0.473	GTF2IRD2P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000345921.1	NR_002164	
ZAN	7455	broad.mit.edu	37	7	100349994	100349994	+	RNA	SNP	C	C	A	rs221829		TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr7:100349994C>A	ENST00000348028.3	+	0	2431				ZAN_ENST00000546292.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000421100.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.P756T(8)		NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			CACCATCTCCCCAGAAAAACC	0.517																																						.											8	Substitution - Missense(8)	endometrium(4)|lung(2)|skin(2)											119.0	132.0	128.0					7																	100349994		1818	4059	5877			7455			U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100349994C>A		Somatic		WXS	Illumina HiSeq	Phase_I	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Missense_Mutation	SNP	ENST00000348028.3	37		.	.	.	.	.	.	.	.	.	.	c	6.303	0.423974	0.11928	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585	T;T;T	0.60040	0.43;0.22;0.43	4.07	-8.15	0.01065	.	.	.	.	.	T	0.19046	0.0457	N	0.01140	-0.99	0.19575	N	0.999965	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.14062	-1.0486	9	0.26408	T	0.33	.	3.2868	0.06935	0.2668:0.4393:0.0778:0.2161	rs221829;rs2406149;rs221829	756;756	F5H0T8;Q9Y493	.;ZAN_HUMAN	T	756	ENSP00000445943:P756T;ENSP00000445091:P756T;ENSP00000444427:P756T	ENSP00000423579:P756T	P	+	1	0	ZAN	100187930	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.034000	0.03567	-1.458000	0.01916	-0.996000	0.02517	CCA		0.517	ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000347214.1	NM_003386	
ADAM28	10863	broad.mit.edu;ucsc.edu	37	8	24170913	24170913	+	Silent	SNP	T	T	C			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr8:24170913T>C	ENST00000265769.4	+	6	506	c.396T>C	c.(394-396)agT>agC	p.S132S	RP11-624C23.1_ENST00000523700.1_RNA|RP11-624C23.1_ENST00000523578.1_RNA|RP11-624C23.1_ENST00000519689.1_RNA|ADAM28_ENST00000397649.3_5'UTR|RP11-624C23.1_ENST00000518988.1_RNA|ADAM28_ENST00000540823.1_Intron|ADAM28_ENST00000437154.2_Silent_p.S132S	NM_014265.4	NP_055080.2	Q9UKQ2	ADA28_HUMAN	ADAM metallopeptidase domain 28	132					spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(7)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Prostate(55;0.0959)		Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0434)|BRCA - Breast invasive adenocarcinoma(99;0.175)		GCTACTTCAGTCAGGGGGATC	0.383																																					NSCLC(193;488 2149 22258 34798 40734)	.											0													73.0	70.0	71.0					8																	24170913		2203	4300	6503	SO:0001819	synonymous_variant	10863			AJ242015	CCDS34865.1, CCDS47830.1	8p21.2	2005-11-29	2005-08-18		ENSG00000042980	ENSG00000042980		"""ADAM metallopeptidase domain containing"""	206	protein-coding gene	gene with protein product		606188	"""a disintegrin and metalloproteinase domain 28"""				Standard	XM_005273378		Approved	eMDCII, MDC-Lm, MDC-Ls, ADAM23	uc003xdy.3	Q9UKQ2	OTTHUMG00000163780	ENST00000265769.4:c.396T>C	8.37:g.24170913T>C		Somatic		WXS	Illumina HiSeq	Phase_I	B2RMV5|Q9Y339|Q9Y3S0	Silent	SNP	ENST00000265769.4	37	CCDS34865.1																																																																																				0.383	ADAM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375441.2	NM_021778	
PABPC1	26986	broad.mit.edu	37	8	101733723	101733723	+	Frame_Shift_Del	DEL	T	T	-			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr8:101733723delT	ENST00000318607.5	-	1	1217	c.89delA	c.(88-90)aagfs	p.K30fs	PABPC1_ENST00000519004.1_Intron|PABPC1_ENST00000522387.1_Frame_Shift_Del_p.K30fs	NM_002568.3	NP_002559.2	P11940	PABP1_HUMAN	poly(A) binding protein, cytoplasmic 1	30	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|mRNA stabilization (GO:0048255)|negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|translation activator activity (GO:0008494)			breast(2)|endometrium(4)|kidney(15)|large_intestine(4)|lung(13)|prostate(1)|skin(1)	40	all_cancers(14;6.8e-05)|all_epithelial(15;3.16e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;6.37e-11)|all cancers(13;1.11e-08)|OV - Ovarian serous cystadenocarcinoma(57;3.91e-05)|STAD - Stomach adenocarcinoma(118;0.206)			CGGGCTGAACTTCTCGTAGAG	0.667																																						.											0													27.0	31.0	30.0					8																	101733723		2203	4299	6502	SO:0001589	frameshift_variant	26986			Y00345	CCDS6289.1	8q22.2-q23	2013-02-12	2004-04-20		ENSG00000070756	ENSG00000070756		"""RNA binding motif (RRM) containing"""	8554	protein-coding gene	gene with protein product		604679	"""poly(A)-binding protein, cytoplasmic 2"""	PAB1, PABPC2		2885805	Standard	XM_005250861		Approved	PABP1, PABPL1	uc003yjs.1	P11940	OTTHUMG00000164779	ENST00000318607.5:c.89delA	8.37:g.101733723delT	ENSP00000313007:p.Lys30fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q15097|Q93004	Frame_Shift_Del	DEL	ENST00000318607.5	37	CCDS6289.1																																																																																				0.667	PABPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380217.1	NM_002568	
RIMS2	9699	broad.mit.edu	37	8	104513292	104513292	+	Splice_Site	DEL	T	T	-			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr8:104513292delT	ENST00000406091.3	+	1	176		c.e1+2		RP11-1C8.4_ENST00000523422.1_RNA|RP11-1C8.4_ENST00000517376.1_RNA	NM_001100117.2	NP_001093587.1	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2						calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			CGTGCTCAAGTAAGGACCTGG	0.652										HNSCC(12;0.0054)																												.											0													29.0	34.0	33.0					8																	104513292		1977	4133	6110	SO:0001630	splice_region_variant	9699			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000406091.3:c.176+2T>-	8.37:g.104513292delT		Somatic		WXS	Illumina HiSeq	Phase_I	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Splice_Site	DEL	ENST00000406091.3	37	CCDS55269.1																																																																																				0.652	RIMS2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001100117	Intron
HAS2	3037	broad.mit.edu	37	8	122626903	122626903	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr8:122626903A>G	ENST00000303924.4	-	4	1642	c.1105T>C	c.(1105-1107)Ttt>Ctt	p.F369L		NM_005328.2	NP_005319.1	Q92819	HYAS2_HUMAN	hyaluronan synthase 2	369					atrioventricular canal development (GO:0036302)|bone morphogenesis (GO:0060349)|cellular response to fluid shear stress (GO:0071498)|cellular response to interleukin-1 (GO:0071347)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|cellular response to tumor necrosis factor (GO:0071356)|endocardial cushion to mesenchymal transition (GO:0090500)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|hyaluronan biosynthetic process (GO:0030213)|kidney development (GO:0001822)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of monocyte aggregation (GO:1900625)|positive regulation of urine volume (GO:0035810)|renal water absorption (GO:0070295)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	hyaluronan synthase activity (GO:0050501)		HAS2/PLAG1(10)	breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(19)|ovary(5)|skin(1)	38	Lung NSC(37;3.12e-08)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)|all_neural(195;0.142)		STAD - Stomach adenocarcinoma(47;0.00503)			TGTTTGTGAAACCACATTGCA	0.448																																						.											0													174.0	149.0	157.0					8																	122626903		2203	4300	6503	SO:0001583	missense	3037			U54804	CCDS6335.1	8q24.12	2013-02-22			ENSG00000170961	ENSG00000170961	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4819	protein-coding gene	gene with protein product		601636				9169154	Standard	NM_005328		Approved		uc003yph.2	Q92819	OTTHUMG00000164953	ENST00000303924.4:c.1105T>C	8.37:g.122626903A>G	ENSP00000306991:p.Phe369Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q32MM3	Missense_Mutation	SNP	ENST00000303924.4	37	CCDS6335.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.214257	0.79352	.	.	ENSG00000170961	ENST00000303924	T	0.58060	0.36	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	T	0.53610	0.1807	L	0.28014	0.82	0.80722	D	1	D	0.56287	0.975	P	0.58660	0.843	T	0.45205	-0.9277	10	0.09084	T	0.74	-22.3438	16.5427	0.84406	1.0:0.0:0.0:0.0	.	369	Q92819	HAS2_HUMAN	L	369	ENSP00000306991:F369L	ENSP00000306991:F369L	F	-	1	0	HAS2	122696084	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.318000	0.96334	2.309000	0.77851	0.448000	0.29417	TTT		0.448	HAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381150.2	NM_005328	
NUTM2G	441457	broad.mit.edu	37	9	99701229	99701231	+	In_Frame_Del	DEL	CTT	CTT	-	rs201499337|rs372223045		TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	CTT	CTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr9:99701229_99701231delCTT	ENST00000372322.3	+	7	2045_2047	c.2024_2026delCTT	c.(2023-2028)ccttct>cct	p.S676del	NUTM2G_ENST00000354649.3_Intron|HIATL2_ENST00000506067.1_Intron	NM_001170741.1	NP_001164212.1	Q5VZR2	NTM2G_HUMAN	NUT family member 2G	676																	AGCCCATCACCTTCTCCTGCCAG	0.611																																						.											0									,	59,2459		28,3,1228					,	-2.0	0.0			46	135,6387		64,7,3190	no	coding,intron	FAM22G	NM_001170741.1,NM_001045477.2	,	92,10,4418	A1A1,A1R,RR		2.0699,2.3431,2.146	,	,		194,8846				SO:0001651	inframe_deletion	441457				CCDS43854.1, CCDS55329.1	9q22.33	2013-05-02	2013-03-14	2013-05-02	ENSG00000188152	ENSG00000188152			23449	protein-coding gene	gene with protein product			"""family with sequence similarity 22, member G"""	FAM22G			Standard	NM_001045477		Approved			Q5VZR2	OTTHUMG00000020305	ENST00000372322.3:c.2024_2026delCTT	9.37:g.99701229_99701231delCTT	ENSP00000361397:p.Ser676del	Somatic		WXS	Illumina HiSeq	Phase_I	A6NNI5|Q5VZR3	In_Frame_Del	DEL	ENST00000372322.3	37	CCDS55329.1																																																																																				0.611	NUTM2G-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053291.2	NM_001170741	
OR13C2	392376	broad.mit.edu	37	9	107367738	107367738	+	Silent	SNP	G	G	C			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr9:107367738G>C	ENST00000542196.1	-	1	213	c.171C>G	c.(169-171)acC>acG	p.T57T		NM_001004481.1	NP_001004481.1	Q8NGS9	O13C2_HUMAN	olfactory receptor, family 13, subfamily C, member 2	57						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22						AGTACATAGGGGTGTGAAGGT	0.448																																						.											0													17.0	18.0	18.0					9																	107367738		2179	4273	6452	SO:0001819	synonymous_variant	392376				CCDS35092.1	9q31.1	2012-10-03			ENSG00000257019	ENSG00000276119		"""GPCR / Class A : Olfactory receptors"""	14701	protein-coding gene	gene with protein product							Standard	NM_001004481		Approved		uc011lvq.2	Q8NGS9	OTTHUMG00000020415	ENST00000542196.1:c.171C>G	9.37:g.107367738G>C		Somatic		WXS	Illumina HiSeq	Phase_I	B9EGV8|Q6IF54	Silent	SNP	ENST00000542196.1	37	CCDS35092.1																																																																																				0.448	OR13C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053489.2	NM_001004481	
ZFY	7544	broad.mit.edu;mdanderson.org;bcgsc.ca	37	Y	2829115	2829115	+	Splice_Site	SNP	G	G	A			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chrY:2829115G>A	ENST00000155093.3	+	3	383	c.62G>A	c.(61-63)gGa>gAa	p.G21E	ZFY_ENST00000449237.1_5'UTR|ZFY_ENST00000383052.1_Splice_Site_p.G21E|ZFY_ENST00000431102.1_Intron	NM_003411.3	NP_003402.2	P08048	ZFY_HUMAN	zinc finger protein, Y-linked	21					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			biliary_tract(1)|kidney(3)|large_intestine(1)|lung(3)	8						ATTCTTTAAGGAGCTGATGCT	0.318																																						.											0																																										SO:0001630	splice_region_variant	7544			L10393	CCDS14774.1, CCDS48200.1, CCDS48201.1	Yp11.3	2013-01-08			ENSG00000067646	ENSG00000067646		"""Zinc fingers, C2H2-type"""	12870	protein-coding gene	gene with protein product		490000				2497060	Standard	NM_001145275		Approved	ZNF911	uc004fqj.3	P08048	OTTHUMG00000036159	ENST00000155093.3:c.62-1G>A	Y.37:g.2829115G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B4DVF7|Q14021|Q15558|Q1RME9|Q24JR0|Q96TF3	Missense_Mutation	SNP	ENST00000155093.3	37	CCDS14774.1																																																																																				0.318	ZFY-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088063.1	NM_003411	Missense_Mutation
C1orf35	79169	broad.mit.edu	37	1	228289842	228289843	+	Frame_Shift_Ins	INS	-	-	C	rs1128456	byFrequency	TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr1:228289842_228289843insC	ENST00000272139.4	-	6	705_706	c.471_472insG	c.(469-474)gggcccfs	p.P158fs	C1orf35_ENST00000472617.1_5'UTR	NM_024319.2	NP_077295.1	Q9BU76	MMTA2_HUMAN	chromosome 1 open reading frame 35	158							poly(A) RNA binding (GO:0044822)			large_intestine(1)|lung(1)|skin(1)	3		Prostate(94;0.0488)				GAGGTCCCGGGCCCGCCGCTCT	0.743																																						.											0																																										SO:0001589	frameshift_variant	79169			AY137773	CCDS1566.1	1q42.13	2012-06-25			ENSG00000143793	ENSG00000143793			19032	protein-coding gene	gene with protein product	"""multiple myeloma tumor-associated protein 2"""					12545221	Standard	NM_024319		Approved	MGC4174, MMTAG2	uc001hrx.3	Q9BU76	OTTHUMG00000037793	ENST00000272139.4:c.472dupG	1.37:g.228289845_228289845dupC	ENSP00000272139:p.Pro158fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q6P5Y0|Q6ZTZ6|Q6ZWA6|Q8IZH3	Frame_Shift_Ins	INS	ENST00000272139.4	37	CCDS1566.1																																																																																				0.743	C1orf35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092245.1	NM_024319	
OR2T4	127074	broad.mit.edu	37	1	248524966	248524967	+	Frame_Shift_Ins	INS	-	-	G	rs561405021|rs200915140	byFrequency	TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr1:248524966_248524967insG	ENST00000366475.1	+	1	84_85	c.84_85insG	c.(85-87)atgfs	p.M29fs		NM_001004696.1	NP_001004696.1	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T, member 4	29						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(2)|lung(47)	56	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CCAAACATCCAATGGCCAATAT	0.5																																						.											0																																										SO:0001589	frameshift_variant	127074			BK004464	CCDS31113.1	1q44	2012-08-09			ENSG00000196944	ENSG00000196944		"""GPCR / Class A : Olfactory receptors"""	15016	protein-coding gene	gene with protein product							Standard	NM_001004696		Approved	OR2T4Q	uc001ieh.1	Q8NH00	OTTHUMG00000040453	Exception_encountered	1.37:g.248524966_248524967insG	ENSP00000355431:p.Met29fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q6IEZ8	Frame_Shift_Ins	INS	ENST00000366475.1	37	CCDS31113.1																																																																																				0.500	OR2T4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097349.2	NM_001004696	
KRT2	3849	broad.mit.edu	37	12	53045623	53045624	+	In_Frame_Ins	INS	-	-	GCC	rs56850150		TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr12:53045623_53045624insGCC	ENST00000309680.3	-	1	324_325	c.303_304insGGC	c.(301-306)agcttt>agcGGCttt	p.101_102SF>SGF		NM_000423.2	NP_000414.2	P35908	K22E_HUMAN	keratin 2	101	Head.		S -> G (in dbSNP:rs2634041). {ECO:0000269|PubMed:1380918, ECO:0000269|PubMed:9804344}.		epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte activation (GO:0032980)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(18)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32				BRCA - Breast invasive adenocarcinoma(357;0.19)		ccacctccaaagctgctgccgc	0.614																																						.											0																																										SO:0001652	inframe_insertion	3849				CCDS8835.1	12q13.13	2013-01-16	2008-08-01	2006-07-17	ENSG00000172867	ENSG00000172867		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6439	protein-coding gene	gene with protein product	"""epidermal ichthyosis bullosa of Siemens"""	600194	"""keratin 2A (epidermal ichthyosis bullosa of Siemens)"""	KRT2A		7524919, 16831889	Standard	NM_000423		Approved	KRTE	uc001sat.3	P35908	OTTHUMG00000169748	ENST00000309680.3:c.303_304insGGC	12.37:g.53045623_53045624insGCC	ENSP00000310861:p.Ser101_Phe102insGly	Somatic		WXS	Illumina HiSeq	Phase_I	Q4VAQ2	In_Frame_Ins	INS	ENST00000309680.3	37	CCDS8835.1																																																																																				0.614	KRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405704.1	NM_000423	
OR4K17	390436	broad.mit.edu	37	14	20586433	20586434	+	Frame_Shift_Ins	INS	-	-	T			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr14:20586433_20586434insT	ENST00000315543.4	+	1	868_869	c.868_869insT	c.(868-870)attfs	p.I290fs		NM_001004715.1	NP_001004715.1	Q8NGC6	OR4KH_HUMAN	olfactory receptor, family 4, subfamily K, member 17	262						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(4)|lung(12)|pancreas(1)|skin(3)	21	all_cancers(95;0.00108)		Epithelial(56;7.58e-07)|all cancers(55;3.77e-06)	GBM - Glioblastoma multiforme(265;0.0144)		CTTTATCTACATTTGGCCCTTC	0.421																																						.											0																																										SO:0001589	frameshift_variant	390436				CCDS32030.1	14q11.2	2013-09-23			ENSG00000176230	ENSG00000176230		"""GPCR / Class A : Olfactory receptors"""	15355	protein-coding gene	gene with protein product							Standard	NM_001004715		Approved		uc001vwo.1	Q8NGC6	OTTHUMG00000170783	ENST00000315543.4:c.871dupT	14.37:g.20586436_20586436dupT	ENSP00000319197:p.Ile290fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q6IF12	Frame_Shift_Ins	INS	ENST00000315543.4	37	CCDS32030.1																																																																																				0.421	OR4K17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410346.1		
LOC100289656	100289656	broad.mit.edu	37	15	29037099	29037100	+	RNA	INS	-	-	GG	rs201230722	byFrequency	TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr15:29037099_29037100insGG	ENST00000430589.1	+	0	895				RP11-578F21.12_ENST00000562423.1_RNA	NR_036475.2																						AAGCTGCAGGCGGGTGCTCTTG	0.396																																						.											0																																												0																															15.37:g.29037100_29037101dupGG		Somatic		WXS	Illumina HiSeq	Phase_I		RNA	INS	ENST00000430589.1	37																																																																																					0.396	RP11-578F21.10-002	PUTATIVE	basic	processed_transcript	pseudogene	OTTHUMT00000431786.1		
SNX1	6642	broad.mit.edu	37	15	64426911	64426912	+	Frame_Shift_Ins	INS	-	-	A			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr15:64426911_64426912insA	ENST00000559844.1	+	12	1284_1285	c.1270_1271insA	c.(1270-1272)caafs	p.Q424fs	SNX1_ENST00000561026.1_Frame_Shift_Ins_p.Q359fs|SNX1_ENST00000560829.1_Frame_Shift_Ins_p.Q206fs|SNX1_ENST00000353874.4_Intron|SNX1_ENST00000261889.5_Frame_Shift_Ins_p.Q424fs			Q13596	SNX1_HUMAN	sorting nexin 1	424	BAR.				early endosome to Golgi transport (GO:0034498)|intracellular protein transport (GO:0006886)|positive regulation of protein catabolic process (GO:0045732)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|protein complex (GO:0043234)|retromer complex (GO:0030904)	epidermal growth factor receptor binding (GO:0005154)|insulin receptor binding (GO:0005158)|leptin receptor binding (GO:1990460)|phosphatidylinositol binding (GO:0035091)|transferrin receptor binding (GO:1990459)			breast(1)|endometrium(1)|large_intestine(5)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	13						GCAGGATGCCCAAGCCACACTG	0.619																																						.											0																																										SO:0001589	frameshift_variant	6642			BC000357	CCDS32266.1, CCDS32268.1, CCDS58371.1	15q22.31	2011-05-03			ENSG00000028528	ENSG00000028528		"""Sorting nexins"""	11172	protein-coding gene	gene with protein product		601272				8638121	Standard	NM_003099		Approved	SNX1A, MGC8664, HsT17379, Vps5	uc010uio.2	Q13596		ENST00000559844.1:c.1272dupA	15.37:g.64426913_64426913dupA	ENSP00000453785:p.Gln424fs	Somatic		WXS	Illumina HiSeq	Phase_I	A6NM19|A8K6T7|H0Y2M5|O60750|O60751|Q6ZRJ8	Frame_Shift_Ins	INS	ENST00000559844.1	37	CCDS32266.1																																																																																				0.619	SNX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418559.1	NM_003099	
ZNF469	84627	broad.mit.edu	37	16	88505623	88505624	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr16:88505623_88505624insC	ENST00000437464.1	+	2	11661_11662	c.11661_11662insC	c.(11662-11664)cctfs	p.P3888fs	ZNF469_ENST00000565624.1_Frame_Shift_Ins_p.P3916fs	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	3888					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						ACGGTGCTGAACCTGCCGAGCC	0.634																																						.											0																																										SO:0001589	frameshift_variant	84627			AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.11663dupC	16.37:g.88505625_88505625dupC	ENSP00000402343:p.Pro3888fs	Somatic		WXS	Illumina HiSeq	Phase_I		Frame_Shift_Ins	INS	ENST00000437464.1	37	CCDS45544.1																																																																																				0.634	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NG_012236	
CCDC144B	284047	broad.mit.edu	37	17	18498496	18498497	+	RNA	INS	-	-	A	rs397961350|rs59933375	byFrequency	TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr17:18498496_18498497insA	ENST00000442583.1	-	0	749							Q3MJ40	C144B_HUMAN	coiled-coil domain containing 144B (pseudogene)											NS(3)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(6)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	36						TCTGCAGGCCTGAAAAAAAAAA	0.243																																						.											0																																												284047			AK093811		17p11.2	2012-11-19	2011-09-02		ENSG00000154874	ENSG00000154874			26704	pseudogene	pseudogene			"""coiled-coil domain containing 144B"""			11997339	Standard	NR_036647		Approved	FLJ36492	uc002guc.2	Q3MJ40	OTTHUMG00000059531		17.37:g.18498496_18498497insA		Somatic		WXS	Illumina HiSeq	Phase_I	Q6P5Q3|Q8N200	RNA	INS	ENST00000442583.1	37																																																																																					0.243	CCDC144B-006	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000132102.1	NM_182568	
MAPK11	5600	broad.mit.edu	37	22	50703803	50703804	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr22:50703803_50703804insC	ENST00000330651.6	-	11	1061_1062	c.961_962insG	c.(961-963)gagfs	p.E321fs	MAPK11_ENST00000495277.1_5'Flank	NM_002751.5	NP_002742.3	Q15759	MK11_HUMAN	mitogen-activated protein kinase 11	321					activation of MAPK activity (GO:0000187)|gene expression (GO:0010467)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mRNA metabolic process (GO:0016071)|muscle cell differentiation (GO:0042692)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of muscle cell differentiation (GO:0051149)|Ras protein signal transduction (GO:0007265)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|lung(4)	6		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)	Regorafenib(DB08896)	ATCATATGGCTCGGCCTCTGGC	0.653																																					GBM(9;634 739 50668)	.											0																																										SO:0001589	frameshift_variant	5600			Y14440	CCDS14090.1	22q13.33	2011-06-09			ENSG00000185386	ENSG00000185386	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6873	protein-coding gene	gene with protein product		602898		PRKM11		9218798	Standard	NM_002751		Approved	p38-2, p38Beta, SAPK2	uc003bkr.3	Q15759	OTTHUMG00000150226	ENST00000330651.6:c.962dupG	22.37:g.50703804_50703804dupC	ENSP00000333685:p.Glu321fs	Somatic		WXS	Illumina HiSeq	Phase_I	A8K730|B0LPG1|B7Z630|E7ETQ1|L7RT27|O00284|O15472|Q2XNF2	Frame_Shift_Ins	INS	ENST00000330651.6	37	CCDS14090.1																																																																																				0.653	MAPK11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316900.1		
MAML3	55534	broad.mit.edu	37	4	140811108	140811109	+	In_Frame_Ins	INS	-	-	TGT			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr4:140811108_140811109insTGT	ENST00000509479.2	-	2	2337_2338	c.1481_1482insACA	c.(1480-1482)cag>caACAg	p.494_494Q>QQ	MAML3_ENST00000327122.5_In_Frame_Ins_p.338_338Q>QQ|MAML3_ENST00000398940.1_In_Frame_Ins_p.33_33Q>QQ	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					gctgctgctgctgctgctgctg	0.54																																						.											0																																										SO:0001652	inframe_insertion	55534			AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.1481_1482insACA	4.37:g.140811108_140811109insTGT	ENSP00000421180:p.Gln510dup	Somatic		WXS	Illumina HiSeq	Phase_I		In_Frame_Ins	INS	ENST00000509479.2	37	CCDS54805.1																																																																																				0.540	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364934.2		
APC	324	broad.mit.edu	37	5	112155000	112155001	+	Frame_Shift_Ins	INS	-	-	G			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr5:112155000_112155001insG	ENST00000457016.1	+	10	1651_1652	c.1271_1272insG	c.(1270-1275)caggaafs	p.E425fs	APC_ENST00000508376.2_Frame_Shift_Ins_p.E425fs|APC_ENST00000257430.4_Frame_Shift_Ins_p.E425fs			P25054	APC_HUMAN	adenomatous polyposis coli	425	Leu-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)			NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TGGGAGTGGCAGGAAGCTCATG	0.436		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	.	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	0																																										SO:0001589	frameshift_variant	324	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.1273dupG	5.37:g.112155002_112155002dupG	ENSP00000413133:p.Glu425fs	Somatic		WXS	Illumina HiSeq	Phase_I	D3DT03|Q15162|Q15163|Q93042	Frame_Shift_Ins	INS	ENST00000457016.1	37	CCDS4107.1																																																																																				0.436	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
LINC00957	255031	broad.mit.edu	37	7	44081003	44081004	+	lincRNA	INS	-	-	C			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr7:44081003_44081004insC	ENST00000441052.1	+	0	1688_1689				RASA4CP_ENST00000446874.1_RNA					long intergenic non-protein coding RNA 957																		ACACACATTCTTTTGGGGGGGG	0.554																																						.											0																																												0			BC014556		7p13	2013-06-04			ENSG00000235314	ENSG00000235314		"""Long non-coding RNAs"""	22332	non-coding RNA	RNA, long non-coding							Standard	NR_015401		Approved				OTTHUMG00000155351		7.37:g.44081003_44081004insC		Somatic		WXS	Illumina HiSeq	Phase_I		RNA	INS	ENST00000441052.1	37																																																																																					0.554	LINC00957-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000339589.1		
PABPC1	26986	broad.mit.edu	37	8	101733701	101733702	+	Frame_Shift_Ins	INS	-	-	A	rs149111517		TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr8:101733701_101733702insA	ENST00000318607.5	-	1	1238_1239	c.110_111insT	c.(109-111)atcfs	p.I37fs	PABPC1_ENST00000519004.1_Intron|PABPC1_ENST00000522387.1_Frame_Shift_Ins_p.I37fs	NM_002568.3	NP_002559.2	P11940	PABP1_HUMAN	poly(A) binding protein, cytoplasmic 1	37	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|mRNA stabilization (GO:0048255)|negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|translation activator activity (GO:0008494)			breast(2)|endometrium(4)|kidney(15)|large_intestine(4)|lung(13)|prostate(1)|skin(1)	40	all_cancers(14;6.8e-05)|all_epithelial(15;3.16e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;6.37e-11)|all cancers(13;1.11e-08)|OV - Ovarian serous cystadenocarcinoma(57;3.91e-05)|STAD - Stomach adenocarcinoma(118;0.206)			GGATGGAGAGGATGGGCCCGGC	0.683																																						.											0																																										SO:0001589	frameshift_variant	26986			Y00345	CCDS6289.1	8q22.2-q23	2013-02-12	2004-04-20		ENSG00000070756	ENSG00000070756		"""RNA binding motif (RRM) containing"""	8554	protein-coding gene	gene with protein product		604679	"""poly(A)-binding protein, cytoplasmic 2"""	PAB1, PABPC2		2885805	Standard	XM_005250861		Approved	PABP1, PABPL1	uc003yjs.1	P11940	OTTHUMG00000164779	ENST00000318607.5:c.111dupT	8.37:g.101733702_101733702dupA	ENSP00000313007:p.Ile37fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q15097|Q93004	Frame_Shift_Ins	INS	ENST00000318607.5	37	CCDS6289.1																																																																																				0.683	PABPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380217.1	NM_002568	
PABPC1	26986	broad.mit.edu	37	8	101733702	101733703	+	Frame_Shift_Ins	INS	-	-	G			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr8:101733702_101733703insG	ENST00000318607.5	-	1	1237_1238	c.109_110insC	c.(109-111)atcfs	p.I37fs	PABPC1_ENST00000519004.1_Intron|PABPC1_ENST00000522387.1_Frame_Shift_Ins_p.I37fs	NM_002568.3	NP_002559.2	P11940	PABP1_HUMAN	poly(A) binding protein, cytoplasmic 1	37	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|mRNA stabilization (GO:0048255)|negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|translation activator activity (GO:0008494)			breast(2)|endometrium(4)|kidney(15)|large_intestine(4)|lung(13)|prostate(1)|skin(1)	40	all_cancers(14;6.8e-05)|all_epithelial(15;3.16e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;6.37e-11)|all cancers(13;1.11e-08)|OV - Ovarian serous cystadenocarcinoma(57;3.91e-05)|STAD - Stomach adenocarcinoma(118;0.206)			GATGGAGAGGATGGGCCCGGCC	0.683																																						.											0																																										SO:0001589	frameshift_variant	26986			Y00345	CCDS6289.1	8q22.2-q23	2013-02-12	2004-04-20		ENSG00000070756	ENSG00000070756		"""RNA binding motif (RRM) containing"""	8554	protein-coding gene	gene with protein product		604679	"""poly(A)-binding protein, cytoplasmic 2"""	PAB1, PABPC2		2885805	Standard	XM_005250861		Approved	PABP1, PABPL1	uc003yjs.1	P11940	OTTHUMG00000164779	ENST00000318607.5:c.109_110insC	8.37:g.101733702_101733703insG	ENSP00000313007:p.Ile37fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q15097|Q93004	Frame_Shift_Ins	INS	ENST00000318607.5	37	CCDS6289.1																																																																																				0.683	PABPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380217.1	NM_002568	
ABCC6	368	ucsc.edu;mdanderson.org;bcgsc.ca	37	16	16251599	16251599	+	Missense_Mutation	SNP	C	C	T	rs2238472	byFrequency	TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr16:16251599C>T	ENST00000205557.7	-	27	3832	c.3803G>A	c.(3802-3804)cGg>cAg	p.R1268Q		NM_001171.5	NP_001162	O95255	MRP6_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 6	1268	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.		R -> Q (associated with lower plasma triglycerides and higher plasma HDL cholesterol; dbSNP:rs2238472). {ECO:0000269|PubMed:10811882, ECO:0000269|PubMed:10913334, ECO:0000269|PubMed:11536079, ECO:0000269|PubMed:11776382, ECO:0000269|PubMed:16086317, ECO:0000269|PubMed:18987736}.		response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|skin(6)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)	Cisplatin(DB00515)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Etoposide(DB00773)|Indomethacin(DB00328)|Probenecid(DB01032)|Sulfinpyrazone(DB01138)|Teniposide(DB00444)|Vinblastine(DB00570)	CCCAAAGTCCCGGAACTCGAT	0.622													C|||	908	0.18131	0.0673	0.2983	5008	,	,		18599	0.125		0.3012	False		,,,				2504	0.1871					.											0			GRCh37	CM001044	ABCC6	M	rs2238472	C	GLN/ARG	473,3921	222.6+/-239.4	29,415,1753	52.0	45.0	48.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	3803	2.0	0.6	16	dbSNP_98	48	2437,6163	401.1+/-347.0	345,1747,2208	yes	missense	ABCC6	NM_001171.5	43	374,2162,3961	TT,TC,CC		28.3372,10.7647,22.395	benign	1268/1504	16251599	2910,10084	2197	4300	6497	SO:0001583	missense	368			AF076622	CCDS10568.1, CCDS58430.1	16p13.11	2013-01-08			ENSG00000091262	ENSG00000091262		"""ATP binding cassette transporters / subfamily C"""	57	protein-coding gene	gene with protein product		603234	"""pseudoxanthoma elasticum"""	ARA, PXE		9721217, 11439001	Standard	NM_001079528		Approved	MRP6, EST349056, MLP1, URG7	uc002den.4	O95255	OTTHUMG00000129967	ENST00000205557.7:c.3803G>A	16.37:g.16251599C>T	ENSP00000205557:p.Arg1268Gln	Somatic		WXS	Illumina HiSeq	Phase_I	A2RRN8|A8KIG6|A8Y988|E7ESW8|P78420|Q8TCY8|Q9UMZ7	Missense_Mutation	SNP	ENST00000205557.7	37	CCDS10568.1	423	0.1936813186813187	41	0.08333333333333333	90	0.24861878453038674	68	0.11888111888111888	224	0.2955145118733509	c	11.76	1.734060	0.30684	0.107647	0.283372	ENSG00000091262	ENST00000205557;ENST00000205558	D	0.90563	-2.69	5.09	2.01	0.26516	ABC transporter-like (1);	0.165125	0.27654	N	0.018411	T	0.00012	0.0000	N	0.17901	0.54	0.09310	P	0.9999999999913843	B	0.24576	0.106	B	0.12156	0.007	T	0.02639	-1.1130	9	0.25106	T	0.35	.	10.2379	0.43294	0.0:0.7787:0.0:0.2213	rs2238472;rs17289934;rs52824827;rs60072648;rs2238472	1268	O95255	MRP6_HUMAN	Q	1268;206	ENSP00000205557:R1268Q	ENSP00000205557:R1268Q	R	-	2	0	ABCC6	16159100	0.000000	0.05858	0.612000	0.29024	0.951000	0.60555	-0.326000	0.07965	0.191000	0.20236	0.530000	0.56133	CGG		0.622	ABCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252232.2		
CFHR3	10878	ucsc.edu	37	1	196759282	196759282	+	Missense_Mutation	SNP	C	C	T	rs138675433		TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr1:196759282C>T	ENST00000367425.4	+	5	813	c.721C>T	c.(721-723)Ccc>Tcc	p.P241S	CFHR3_ENST00000391985.3_Missense_Mutation_p.P180S	NM_021023.5	NP_066303.2	Q02985	FHR3_HUMAN	complement factor H-related 3	241	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.			P -> S (in Ref. 1; CAA48639). {ECO:0000305}.		blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.P241S(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	18						CCAATGCCAGCCCTACTATGA	0.428																																						.											1	Substitution - Missense(1)	prostate(1)											101.0	148.0	134.0					1																	196759282		1754	4010	5764	SO:0001583	missense	10878			X68679	CCDS30958.1, CCDS53453.1	1q32	2014-09-17		2006-02-28	ENSG00000116785	ENSG00000116785		"""Complement system"""	16980	protein-coding gene	gene with protein product	"""complement factor H related 3"""	605336		CFHL3		8428964, 10380701	Standard	NM_021023		Approved	FHR-3, HLF4, FHR3, DOWN16	uc001gtl.3	Q02985	OTTHUMG00000035929	ENST00000367425.4:c.721C>T	1.37:g.196759282C>T	ENSP00000356395:p.Pro241Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B4DPR0|Q9UJ16	Missense_Mutation	SNP	ENST00000367425.4	37	CCDS30958.1	487	0.222985347985348	102	0.2073170731707317	61	0.1685082872928177	231	0.40384615384615385	93	0.12269129287598944	T	0.008	-1.884513	0.00532	.	.	ENSG00000116785	ENST00000367425;ENST00000391985	T;T	0.65178	-0.14;-0.14	3.27	-6.54	0.01860	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.00012	0.0000	N	0.01668	-0.77	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.09377	0.002;0.004	T	0.02398	-1.1165	8	0.06757	T	0.87	.	1.7706	0.03011	0.5551:0.1977:0.1048:0.1423	.	180;241	B4DPR0;Q02985	.;FHR3_HUMAN	S	241;180	ENSP00000356395:P241S;ENSP00000375845:P180S	ENSP00000356395:P241S	P	+	1	0	CFHR3	195025905	0.000000	0.05858	0.001000	0.08648	0.042000	0.13812	-3.343000	0.00504	-3.939000	0.00089	-1.461000	0.01025	CCC		0.428	CFHR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087505.2	NM_021023	
DENND6A	201627	ucsc.edu;bcgsc.ca	37	3	57631404	57631404	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr3:57631404T>C	ENST00000311128.5	-	11	1091	c.1021A>G	c.(1021-1023)Acc>Gcc	p.T341A	RP11-755B10.2_ENST00000470427.1_RNA	NM_152678.2	NP_689891.1	Q8IWF6	DEN6A_HUMAN	DENN/MADD domain containing 6A	341					positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of Rab GTPase activity (GO:0032851)	cytoplasm (GO:0005737)|recycling endosome (GO:0055037)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)										TGGGTACGGGTAGTATATTCT	0.328																																						.											0													98.0	100.0	99.0					3																	57631404		2203	4299	6502	SO:0001583	missense	201627			AK074156	CCDS33773.1	3p14.3	2013-10-11	2012-10-03	2012-10-03	ENSG00000174839	ENSG00000174839		"""DENN/MADD domain containing"""	26635	protein-coding gene	gene with protein product			"""family with sequence similarity 116, member A"""	FAM116A		21330364	Standard	NM_152678		Approved	FLJ34969, AFI1A	uc003dja.3	Q8IWF6	OTTHUMG00000158639	ENST00000311128.5:c.1021A>G	3.37:g.57631404T>C	ENSP00000311401:p.Thr341Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q7Z5T4|Q8N235|Q8TEG8	Missense_Mutation	SNP	ENST00000311128.5	37	CCDS33773.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.92|16.92	3.256206|3.256206	0.59321|0.59321	.|.	.|.	ENSG00000174839|ENSG00000174839	ENST00000311128|ENST00000477344	.|.	.|.	.|.	6.06|6.06	6.06|6.06	0.98353|0.98353	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.69851|0.69851	0.3157|0.3157	L|L	0.53671|0.53671	1.685|1.685	0.80722|0.80722	D|D	1|1	D|.	0.54397|.	0.966|.	P|.	0.60117|.	0.869|.	T|T	0.67277|0.67277	-0.5711|-0.5711	9|5	0.25751|.	T|.	0.34|.	-28.4431|-28.4431	16.286|16.286	0.82722|0.82722	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	341|.	Q8IWF6|.	F116A_HUMAN|.	A|C	341|109	.|.	ENSP00000311401:T341A|.	T|Y	-|-	1|2	0|0	FAM116A|FAM116A	57606444|57606444	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.050000|7.050000	0.76620|0.76620	2.323000|2.323000	0.78572|0.78572	0.528000|0.528000	0.53228|0.53228	ACC|TAC		0.328	DENND6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351594.1	NM_152678	
LRP12	29967	ucsc.edu;bcgsc.ca	37	8	105510296	105510296	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr8:105510296C>T	ENST00000276654.5	-	5	592	c.484G>A	c.(484-486)Gag>Aag	p.E162K	LRP12_ENST00000424843.2_Missense_Mutation_p.E143K|LRP12_ENST00000518375.1_5'Flank	NM_013437.4	NP_038465.1	Q9Y561	LRP12_HUMAN	low density lipoprotein receptor-related protein 12	162					endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			TTTGGTTCCTCAGATTTCCCT	0.333																																						.											0													72.0	69.0	70.0					8																	105510296		2203	4300	6503	SO:0001583	missense	29967			AF166350	CCDS6303.1, CCDS47907.1	8q22.2	2013-02-27	2010-01-26		ENSG00000147650	ENSG00000147650		"""Low density lipoprotein receptors"""	31708	protein-coding gene	gene with protein product						12809483, 14676824	Standard	NM_013437		Approved	ST7, FLJ12929	uc003yma.3	Q9Y561	OTTHUMG00000164892	ENST00000276654.5:c.484G>A	8.37:g.105510296C>T	ENSP00000276654:p.Glu162Lys	Somatic		WXS	Illumina HiSeq	Phase_I	A8K137|B4DRQ2	Missense_Mutation	SNP	ENST00000276654.5	37	CCDS6303.1	.	.	.	.	.	.	.	.	.	.	C	11.34	1.611264	0.28712	.	.	ENSG00000147650	ENST00000424843;ENST00000276654	D;D	0.84442	-1.85;-1.78	5.5	5.5	0.81552	.	0.101931	0.64402	D	0.000002	T	0.78679	0.4321	L	0.40543	1.245	0.80722	D	1	B;B	0.20164	0.042;0.025	B;B	0.26310	0.068;0.031	T	0.71210	-0.4660	10	0.09590	T	0.72	-16.7257	13.6751	0.62449	0.0:0.9266:0.0:0.0734	.	143;162	Q9Y561-2;Q9Y561	.;LRP12_HUMAN	K	143;162	ENSP00000399148:E143K;ENSP00000276654:E162K	ENSP00000276654:E162K	E	-	1	0	LRP12	105579472	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.681000	0.61663	2.584000	0.87258	0.563000	0.77884	GAG		0.333	LRP12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380821.1	NM_013437	
NUAK2	81788	ucsc.edu;bcgsc.ca	37	1	205274455	205274455	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr1:205274455T>C	ENST00000367157.3	-	6	821	c.695A>G	c.(694-696)gAc>gGc	p.D232G		NM_030952.1	NP_112214.1			NUAK family, SNF1-like kinase, 2											breast(3)|kidney(3)|large_intestine(4)|lung(4)|ovary(3)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	23	Breast(84;0.186)		BRCA - Breast invasive adenocarcinoma(75;0.117)			GGACCAGCTGTCCACCTGAGA	0.552																																						.											0													58.0	51.0	53.0					1																	205274455		2203	4300	6503	SO:0001583	missense	81788			AK074830	CCDS1453.1	1q32.1	2008-02-05			ENSG00000163545	ENSG00000163545			29558	protein-coding gene	gene with protein product	"""SNF1/AMP activated protein kinase"""	608131				11230166	Standard	NM_030952		Approved	SNARK, FLJ90349	uc001hce.3	Q9H093	OTTHUMG00000037196	ENST00000367157.3:c.695A>G	1.37:g.205274455T>C	ENSP00000356125:p.Asp232Gly	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000367157.3	37	CCDS1453.1	.	.	.	.	.	.	.	.	.	.	T	28.8	4.951381	0.92660	.	.	ENSG00000163545	ENST00000367157	T	0.75589	-0.95	5.93	5.93	0.95920	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.47852	D	0.000215	D	0.92861	0.7729	H	0.99732	4.735	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95977	0.8974	10	0.87932	D	0	.	16.0444	0.80711	0.0:0.0:0.0:1.0	.	232	Q9H093	NUAK2_HUMAN	G	232	ENSP00000356125:D232G	ENSP00000356125:D232G	D	-	2	0	NUAK2	203541078	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	8.040000	0.89188	2.271000	0.75665	0.459000	0.35465	GAC		0.552	NUAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090390.1	NM_030952	
UCP2	7351	ucsc.edu;mdanderson.org;bcgsc.ca	37	11	73686146	73686146	+	Missense_Mutation	SNP	C	C	T	rs376686039		TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr11:73686146C>T	ENST00000310473.3	-	8	1678	c.836G>A	c.(835-837)cGc>cAc	p.R279H	UCP2_ENST00000536983.1_Missense_Mutation_p.A219T	NM_003355.2	NP_003346.2	P55851	UCP2_HUMAN	uncoupling protein 2 (mitochondrial, proton carrier)	279	Purine nucleotide binding. {ECO:0000250}.				aging (GO:0007568)|cellular metabolic process (GO:0044237)|cellular response to amino acid starvation (GO:0034198)|cellular response to glucose stimulus (GO:0071333)|cellular response to insulin stimulus (GO:0032869)|female pregnancy (GO:0007565)|liver regeneration (GO:0097421)|mitochondrial transport (GO:0006839)|negative regulation of apoptotic process (GO:0043066)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|positive regulation of cell death (GO:0010942)|proton transport (GO:0015992)|regulation of mitochondrial membrane potential (GO:0051881)|respiratory electron transport chain (GO:0022904)|response to fatty acid (GO:0070542)|response to hypoxia (GO:0001666)|response to superoxide (GO:0000303)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				large_intestine(1)|lung(3)|prostate(1)	5	Breast(11;0.000112)					GGAACCCAAGCGGAGAAAGGA	0.567																																					Colon(191;388 2040 43557 45622 48925)	.											0													85.0	71.0	75.0					11																	73686146		2200	4293	6493	SO:0001583	missense	7351			U76367	CCDS8228.1	11q13	2014-02-12						"""Solute carriers"""	12518	protein-coding gene	gene with protein product		601693	"""body mass index QTL 4"", ""body mass index quantitative trait 4"""	BMIQ4		9196039, 11381268	Standard	NM_003355		Approved	SLC25A8	uc001oup.1	P55851		ENST00000310473.3:c.836G>A	11.37:g.73686146C>T	ENSP00000312029:p.Arg279His	Somatic		WXS	Illumina HiSeq	Phase_I	Q4PJH8|Q53HM3	Missense_Mutation	SNP	ENST00000310473.3	37	CCDS8228.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.6|24.6	4.550502|4.550502	0.86127|0.86127	.|.	.|.	ENSG00000175567|ENSG00000175567	ENST00000536983|ENST00000310473;ENST00000544615	T|D;D	0.79653|0.81996	-1.29|-1.56;-1.56	5.43|5.43	5.43|5.43	0.79202|0.79202	.|Mitochondrial carrier domain (2);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.94637|0.94637	0.8271|0.8271	H|H	0.97874|0.97874	4.095|4.095	0.44104|0.44104	D|D	0.996874|0.996874	B|D	0.16802|0.76494	0.019|0.999	B|D	0.17722|0.71184	0.019|0.972	D|D	0.96186|0.96186	0.9134|0.9134	9|10	0.27082|0.87932	T|D	0.32|0	-2.7097|-2.7097	17.9618|17.9618	0.89087|0.89087	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	219|279	F5GX45|P55851	.|UCP2_HUMAN	T|H	219|279;252	ENSP00000441147:A219T|ENSP00000312029:R279H;ENSP00000439951:R252H	ENSP00000441147:A219T|ENSP00000312029:R279H	A|R	-|-	1|2	0|0	UCP2|UCP2	73363794|73363794	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.528000|7.528000	0.81941|0.81941	2.825000|2.825000	0.97269|0.97269	0.655000|0.655000	0.94253|0.94253	GCT|CGC		0.567	UCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398108.1	NM_003355	
AHNAK2	113146	mdanderson.org	37	14	105408107	105408107	+	Missense_Mutation	SNP	G	G	T	rs200549975		TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr14:105408107G>T	ENST00000333244.5	-	7	13800	c.13681C>A	c.(13681-13683)Ctc>Atc	p.L4561I	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	4561						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GGGCCCTTGAGGTCCACTTTG	0.617																																						.											0													153.0	161.0	159.0					14																	105408107		1903	4109	6012	SO:0001583	missense	113146			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.13681C>A	14.37:g.105408107G>T	ENSP00000353114:p.Leu4561Ile	Somatic		WXS	Illumina HiSeq	Phase_I	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	G	3.913	-0.019674	0.07634	.	.	ENSG00000185567	ENST00000333244	T	0.00628	6.11	3.09	-3.06	0.05379	.	2.229260	0.03962	U	0.290278	T	0.00552	0.0018	L	0.31120	0.905	0.09310	N	1	P	0.40032	0.699	B	0.40009	0.316	T	0.45644	-0.9247	10	0.13470	T	0.59	.	1.4002	0.02269	0.1996:0.1066:0.2206:0.4731	.	4561	Q8IVF2	AHNK2_HUMAN	I	4561	ENSP00000353114:L4561I	ENSP00000353114:L4561I	L	-	1	0	AHNAK2	104479152	0.000000	0.05858	0.010000	0.14722	0.232000	0.25224	-2.180000	0.01258	-0.335000	0.08451	0.306000	0.20318	CTC		0.617	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
AHNAK2	113146	mdanderson.org	37	14	105408140	105408140	+	Missense_Mutation	SNP	C	C	G	rs201663085		TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr14:105408140C>G	ENST00000333244.5	-	7	13767	c.13648G>C	c.(13648-13650)Gag>Cag	p.E4550Q	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	4550						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CTGGGCATCTCCACCTTGGGC	0.617																																						.											0																																										SO:0001583	missense	113146			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.13648G>C	14.37:g.105408140C>G	ENSP00000353114:p.Glu4550Gln	Somatic		WXS	Illumina HiSeq	Phase_I	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	G	0.009	-1.854353	0.00558	.	.	ENSG00000185567	ENST00000333244	T	0.00682	5.86	3.28	0.23	0.15372	.	0.471713	0.14436	N	0.319717	T	0.00356	0.0011	N	0.00855	-1.145	0.09310	N	1	B	0.24768	0.111	B	0.24541	0.054	T	0.43114	-0.9411	10	0.20046	T	0.44	.	7.373	0.26813	0.1694:0.4763:0.3543:0.0	.	4550	Q8IVF2	AHNK2_HUMAN	Q	4550	ENSP00000353114:E4550Q	ENSP00000353114:E4550Q	E	-	1	0	AHNAK2	104479185	0.090000	0.21635	0.084000	0.20598	0.107000	0.19398	-0.347000	0.07750	-0.126000	0.11682	-2.576000	0.00170	GAG		0.617	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
AHNAK2	113146	mdanderson.org	37	14	105415160	105415160	+	Missense_Mutation	SNP	C	C	G	rs201874096	byFrequency	TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr14:105415160C>G	ENST00000333244.5	-	7	6747	c.6628G>C	c.(6628-6630)Gtg>Ctg	p.V2210L	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2210						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TGGACCTTCACGTCGGCGGAA	0.637													.|||	169	0.033746	0.0787	0.0101	5008	,	,		18042	0.0347		0.001	False		,,,				2504	0.0225					.											0													112.0	108.0	109.0					14																	105415160		1938	4141	6079	SO:0001583	missense	113146			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.6628G>C	14.37:g.105415160C>G	ENSP00000353114:p.Val2210Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	N	0.153	-1.089039	0.01873	.	.	ENSG00000185567	ENST00000333244	T	0.01119	5.31	4.26	-0.475	0.12104	.	.	.	.	.	T	0.00666	0.0022	N	0.01454	-0.855	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.52041	-0.8628	9	0.05351	T	0.99	.	20.4837	0.99199	0.0:0.8803:0.1197:0.0	.	2210	Q8IVF2	AHNK2_HUMAN	L	2210	ENSP00000353114:V2210L	ENSP00000353114:V2210L	V	-	1	0	AHNAK2	104486205	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-1.060000	0.03475	-1.481000	0.01863	-0.332000	0.08345	GTG		0.637	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
AHNAK2	113146	mdanderson.org	37	14	105415166	105415166	+	Missense_Mutation	SNP	C	C	T	rs201667039		TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr14:105415166C>T	ENST00000333244.5	-	7	6741	c.6622G>A	c.(6622-6624)Gcc>Acc	p.A2208T	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2208						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TTCACGTCGGCGGAAAGGGGC	0.632																																						.											0													112.0	105.0	107.0					14																	105415166		1935	4135	6070	SO:0001583	missense	113146			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.6622G>A	14.37:g.105415166C>T	ENSP00000353114:p.Ala2208Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	9	0.004120879120879121	7	0.014227642276422764	0	0.0	2	0.0034965034965034965	0	0.0	N	8.172	0.791836	0.16258	.	.	ENSG00000185567	ENST00000333244	T	0.00912	5.55	4.26	-2.56	0.06268	.	.	.	.	.	T	0.00580	0.0019	L	0.45744	1.44	0.09310	N	1	P	0.45428	0.858	B	0.40009	0.316	T	0.40289	-0.9571	9	0.13470	T	0.59	.	1.7149	0.02899	0.1147:0.283:0.2021:0.4002	.	2208	Q8IVF2	AHNK2_HUMAN	T	2208	ENSP00000353114:A2208T	ENSP00000353114:A2208T	A	-	1	0	AHNAK2	104486211	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.254000	0.02874	-1.113000	0.02981	-1.166000	0.01754	GCC		0.632	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
AHNAK2	113146	mdanderson.org	37	14	105415171	105415171	+	Missense_Mutation	SNP	A	A	G	rs201552064		TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr14:105415171A>G	ENST00000333244.5	-	7	6736	c.6617T>C	c.(6616-6618)cTt>cCt	p.L2206P	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2206						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GTCGGCGGAAAGGGGCTGAAT	0.642																																						.											0													116.0	106.0	109.0					14																	105415171		1942	4131	6073	SO:0001583	missense	113146			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.6617T>C	14.37:g.105415171A>G	ENSP00000353114:p.Leu2206Pro	Somatic		WXS	Illumina HiSeq	Phase_I	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	N	8.966	0.971743	0.18736	.	.	ENSG00000185567	ENST00000333244	T	0.00448	7.38	4.26	4.26	0.50523	.	.	.	.	.	T	0.00073	0.0002	N	0.00012	-2.95	0.34200	D	0.67309	B	0.02656	0.0	B	0.06405	0.002	T	0.02161	-1.1203	9	0.02654	T	1	.	6.4926	0.22123	0.0959:0.0:0.7263:0.1777	.	2206	Q8IVF2	AHNK2_HUMAN	P	2206	ENSP00000353114:L2206P	ENSP00000353114:L2206P	L	-	2	0	AHNAK2	104486216	.	.	0.089000	0.20774	0.013000	0.08279	.	.	0.803000	0.34113	-0.330000	0.08379	CTT		0.642	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
AHNAK2	113146	mdanderson.org	37	14	105415196	105415196	+	Missense_Mutation	SNP	T	T	C	rs200598682		TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr14:105415196T>C	ENST00000333244.5	-	7	6711	c.6592A>G	c.(6592-6594)Acc>Gcc	p.T2198A	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2198						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			AGGTCAGTGGTCTTGAGGTCC	0.642																																						.											0													123.0	104.0	110.0					14																	105415196		1952	4126	6078	SO:0001583	missense	113146			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.6592A>G	14.37:g.105415196T>C	ENSP00000353114:p.Thr2198Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	N	9.313	1.056023	0.19907	.	.	ENSG00000185567	ENST00000333244	T	0.00711	5.8	4.41	-1.41	0.08941	.	.	.	.	.	T	0.00496	0.0016	N	0.12920	0.275	0.09310	N	1	B	0.11235	0.004	B	0.16722	0.016	T	0.43861	-0.9365	9	0.07030	T	0.85	.	4.5244	0.11975	0.0:0.3735:0.4008:0.2257	.	2198	Q8IVF2	AHNK2_HUMAN	A	2198	ENSP00000353114:T2198A	ENSP00000353114:T2198A	T	-	1	0	AHNAK2	104486241	0.000000	0.05858	0.000000	0.03702	0.096000	0.18686	-0.840000	0.04363	-0.183000	0.10585	0.397000	0.26171	ACC		0.642	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
AHNAK2	113146	mdanderson.org	37	14	105415200	105415200	+	Silent	SNP	G	G	C	rs10145566	byFrequency	TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr14:105415200G>C	ENST00000333244.5	-	7	6707	c.6588C>G	c.(6586-6588)ctC>ctG	p.L2196L	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2196						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CAGTGGTCTTGAGGTCCCCCT	0.637													.|||	1452	0.289936	0.1483	0.3213	5008	,	,		17263	0.1359		0.4891	False		,,,				2504	0.4131					.											0								G		553,3361		51,451,1455	123.0	103.0	110.0		6588	0.3	0.0	14	dbSNP_119	110	3961,4283		1006,1949,1167	no	coding-synonymous	AHNAK2	NM_138420.2		1057,2400,2622	CC,CG,GG		48.0471,14.1288,37.1278		2196/5796	105415200	4514,7644	1957	4122	6079	SO:0001819	synonymous_variant	113146			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.6588C>G	14.37:g.105415200G>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	ENST00000333244.5	37	CCDS45177.1																																																																																				0.637	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
AHNAK2	113146	mdanderson.org	37	14	105415737	105415737	+	Silent	SNP	C	C	T	rs541403583	byFrequency	TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr14:105415737C>T	ENST00000333244.5	-	7	6170	c.6051G>A	c.(6049-6051)aaG>aaA	p.K2017K	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2017						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CGGCCTCCACCTTGGGTGCAG	0.607													.|||	37	0.00738818	0.0121	0.0072	5008	,	,		16034	0.003		0.001	False		,,,				2504	0.0123					.											0													133.0	114.0	120.0					14																	105415737		1926	4060	5986	SO:0001819	synonymous_variant	113146			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.6051G>A	14.37:g.105415737C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	ENST00000333244.5	37	CCDS45177.1																																																																																				0.607	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
AHNAK2	113146	mdanderson.org	37	14	105415748	105415748	+	Missense_Mutation	SNP	G	G	A	rs118171013	byFrequency	TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr14:105415748G>A	ENST00000333244.5	-	7	6159	c.6040C>T	c.(6040-6042)Cct>Tct	p.P2014S	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2014						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TTGGGTGCAGGCACATCCACC	0.597													.|||	1504	0.300319	0.1377	0.3631	5008	,	,		15992	0.0903		0.5447	False		,,,				2504	0.4407					.											0								A	SER/PRO	806,3058		129,548,1255	138.0	119.0	125.0		6040	-7.4	0.0	14	dbSNP_132	125	4479,3641		1443,1593,1024	no	missense	AHNAK2	NM_138420.2	74	1572,2141,2279	AA,AG,GG		44.8399,20.8592,44.1005	benign	2014/5796	105415748	5285,6699	1932	4060	5992	SO:0001583	missense	113146			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.6040C>T	14.37:g.105415748G>A	ENSP00000353114:p.Pro2014Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	657	0.3008241758241758	79	0.16056910569105692	137	0.3784530386740331	35	0.06118881118881119	406	0.5356200527704486	-	0.114	-1.134216	0.01742	0.208592	0.551601	ENSG00000185567	ENST00000333244	T	0.04015	3.73	3.72	-7.44	0.01379	.	.	.	.	.	T	0.00012	0.0000	N	0.00019	-2.785	0.80722	P	0.0	B	0.09022	0.002	B	0.01281	0.0	T	0.49818	-0.8899	8	0.06891	T	0.86	-0.9503	1.4552	0.02383	0.2249:0.2846:0.3034:0.1871	.	2014	Q8IVF2	AHNK2_HUMAN	S	2014	ENSP00000353114:P2014S	ENSP00000353114:P2014S	P	-	1	0	AHNAK2	104486793	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	-3.592000	0.00421	-1.485000	0.01854	-2.164000	0.00325	CCT		0.597	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
ANKRD30BL	554226	mdanderson.org	37	2	132912316	132912316	+	Missense_Mutation	SNP	G	G	A	rs200558206		TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr2:132912316G>A	ENST00000409867.1	-	4	782	c.533C>T	c.(532-534)gCc>gTc	p.A178V	ANKRD30BL_ENST00000470729.1_5'UTR|RNU6-1132P_ENST00000459214.1_RNA			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like	178								p.A178V(2)		endometrium(1)|kidney(3)	4						TTTCCTTATGGCCAGTAAAAG	0.294																																						.											2	Substitution - Missense(2)	kidney(2)																																								SO:0001583	missense	554226					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.533C>T	2.37:g.132912316G>A	ENSP00000386398:p.Ala178Val	Somatic		WXS	Illumina HiSeq	Phase_I	B8ZZL7	RNA	SNP	ENST00000409867.1	37		.	.	.	.	.	.	.	.	.	.	.	14.64	2.594656	0.46214	.	.	ENSG00000163046	ENST00000409867	T	0.61627	0.09	0.569	0.569	0.17340	.	.	.	.	.	T	0.54046	0.1834	.	.	.	0.23581	N	0.997362	.	.	.	.	.	.	T	0.51228	-0.8732	5	0.66056	D	0.02	.	.	.	.	.	.	.	.	V	178	ENSP00000386398:A178V	ENSP00000295181:A178V	A	-	2	0	ANKRD30BL	132628786	0.014000	0.17966	0.261000	0.24466	0.477000	0.33069	0.281000	0.18810	0.567000	0.29293	0.184000	0.17185	GCC		0.294	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331353.2	NR_027019	
C5orf60	285679	mdanderson.org	37	5	179071836	179071836	+	Silent	SNP	C	C	T	rs4990391	byFrequency	TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr5:179071836C>T	ENST00000448248.2	-	1	211	c.186G>A	c.(184-186)ccG>ccA	p.P62P	C5orf60_ENST00000506142.1_Intron	NM_001142306.1	NP_001135778.1	A6NFR6	CE060_HUMAN	chromosome 5 open reading frame 60	62						integral component of membrane (GO:0016021)				NS(1)|breast(1)|kidney(5)	7						GCACTGAGGACGGCTCCCTGG	0.532													-|||	717	0.143171	0.171	0.0951	5008	,	,		22464	0.0546		0.2256	False		,,,				2504	0.1462					.											0													64.0	60.0	62.0					5																	179071836		692	1591	2283	SO:0001819	synonymous_variant	285679			BC043435	CCDS47353.1	5q35.3	2010-08-19			ENSG00000204661	ENSG00000204661			27753	protein-coding gene	gene with protein product						12477932	Standard	NM_001142306		Approved		uc003mki.3	A6NFR6	OTTHUMG00000163221	ENST00000448248.2:c.186G>A	5.37:g.179071836C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A1L488|B7ZM52|B7ZM53	Silent	SNP	ENST00000448248.2	37	CCDS47353.1																																																																																				0.532	C5orf60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372148.2	NM_001142306	
CCDC85C	317762	mdanderson.org	37	14	100070030	100070030	+	Silent	SNP	G	G	A	rs78667152	byFrequency	TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr14:100070030G>A	ENST00000380243.4	-	1	333	c.267C>T	c.(265-267)tgC>tgT	p.C89C	RP11-543C4.1_ENST00000502101.2_lincRNA	NM_001144995.1	NP_001138467.1	A6NKD9	CC85C_HUMAN	coiled-coil domain containing 85C	89					cerebral cortex development (GO:0021987)	apical junction complex (GO:0043296)|tight junction (GO:0005923)				endometrium(1)|skin(1)	2						CGTCGAGGAAGCAGCAGAGCT	0.716													g|||	954	0.190495	0.264	0.3069	5008	,	,		6915	0.3433		0.0199	False		,,,				2504	0.0266					.											0													2.0	5.0	4.0					14																	100070030		575	1385	1960	SO:0001819	synonymous_variant	317762				CCDS45161.1	14q32.31	2009-02-18				ENSG00000205476			35459	protein-coding gene	gene with protein product							Standard	NM_001144995		Approved		uc010avr.3	A6NKD9		ENST00000380243.4:c.267C>T	14.37:g.100070030G>A		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000380243.4	37	CCDS45161.1																																																																																				0.716	CCDC85C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413802.1	NM_001144995	
CLEC18C	283971	mdanderson.org	37	16	70211266	70211266	+	Silent	SNP	G	G	A			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr16:70211266G>A	ENST00000569347.2	+	3	593	c.339G>A	c.(337-339)ctG>ctA	p.L113L	CLEC18C_ENST00000561612.1_Intron|CLEC18C_ENST00000541793.2_Silent_p.L113L|CLEC18C_ENST00000536907.2_Silent_p.L113L|CLEC18C_ENST00000314151.8_Silent_p.L113L	NM_173619.2	NP_775890.2	Q8NCF0	CL18C_HUMAN	C-type lectin domain family 18, member C	113	SCP.					extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)			endometrium(3)|large_intestine(6)|lung(1)	10						TGCAGCTGCTGCCCGCGGGCT	0.652																																						.											0													43.0	51.0	49.0					16																	70211266		2196	4298	6494	SO:0001819	synonymous_variant	283971			AL833339	CCDS32473.1	16q22.1	2010-04-27	2009-03-10	2009-03-10		ENSG00000157335		"""C-type lectin domain containing"""	28538	protein-coding gene	gene with protein product						12477932	Standard	XM_005255906		Approved	MGC34761		Q8NCF0		ENST00000569347.2:c.339G>A	16.37:g.70211266G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q8IUW8	Silent	SNP	ENST00000569347.2	37	CCDS32473.1	.	.	.	.	.	.	.	.	.	.	g	1.109	-0.658906	0.03454	.	.	ENSG00000157335	ENST00000539438	.	.	.	4.32	4.32	0.51571	.	.	.	.	.	T	0.33876	0.0878	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.15235	-1.0444	5	0.02654	T	1	.	12.6961	0.57005	0.0:0.0:1.0:0.0	.	.	.	.	Y	110	.	ENSP00000445424:C110Y	C	+	2	0	CLEC18C	68768767	1.000000	0.71417	0.999000	0.59377	0.042000	0.13812	0.640000	0.24705	2.125000	0.65367	0.298000	0.19748	TGC		0.652	CLEC18C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000434588.2	NM_173619	
ACKR1	2532	mdanderson.org	37	1	159175354	159175354	+	Missense_Mutation	SNP	G	G	A	rs12075	byFrequency	TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr1:159175354G>A	ENST00000368122.2	+	2	804	c.125G>A	c.(124-126)gGt>gAt	p.G42D	DARC_ENST00000537147.1_Missense_Mutation_p.G42D|DARC_ENST00000368121.2_Missense_Mutation_p.G44D|CTA-134P22.2_ENST00000609696.1_RNA	NM_002036.3	NP_002027.2	Q16570	ACKR1_HUMAN		42			G -> D (antigen Fy(b); dbSNP:rs12075). {ECO:0000269|PubMed:7663520, ECO:0000269|PubMed:7705836, ECO:0000269|PubMed:8248172, ECO:0000269|PubMed:9731074, ECO:0000269|PubMed:9886340}.		chemokine-mediated signaling pathway (GO:0070098)|defense response (GO:0006952)|inflammatory response (GO:0006954)|regulation of chemokine production (GO:0032642)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	C-C chemokine binding (GO:0019957)|G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			large_intestine(2)|lung(1)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	8	all_hematologic(112;0.0429)					GGAGACTATGGTGCCAACCTG	0.527													A|||	2707	0.540535	0.9811	0.5389	5008	,	,		20455	0.0774		0.6024	False		,,,				2504	0.3599					.											0			GRCh37	CM950484	DARC	M	rs12075	A	ASP/GLY,ASP/GLY	4037,369	187.8+/-214.3	1849,339,15	95.0	87.0	90.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	131,125	-1.1	0.0	1	dbSNP_52	90	4967,3633	523.8+/-380.4	1441,2085,774	yes	missense,missense	DARC	NM_001122951.2,NM_002036.3	94,94	3290,2424,789	AA,AG,GG	http://www.ncbi.nlm.nih.gov/pubmed?term	42.2442,8.3749,30.7704	benign,benign	44/339,42/337	159175354	9004,4002	2203	4300	6503	SO:0001583	missense	2532																														ENST00000368122.2:c.125G>A	1.37:g.159175354G>A	ENSP00000357104:p.Gly42Asp	Somatic		WXS	Illumina HiSeq	Phase_I	A8YPG5|O75898|Q16300|Q8WWE3|Q9UJP0|Q9UKZ5|Q9UKZ6|Q9UQE1	Missense_Mutation	SNP	ENST00000368122.2	37	CCDS1183.1	1176	0.5384615384615384	474	0.9634146341463414	209	0.5773480662983426	47	0.08216783216783216	446	0.5883905013192612	A	0.168	-1.074849	0.01903	0.916251	0.577558	ENSG00000213088	ENST00000368122;ENST00000537147;ENST00000359381;ENST00000435307;ENST00000368121	T;T;T;T	0.22336	4.47;4.47;1.96;4.46	4.36	-1.07	0.09968	.	.	.	.	.	T	0.01287	0.0042	N	0.02916	-0.46	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.42396	-0.9454	8	0.02654	T	1	-10.5139	3.1012	0.06327	0.4283:0.0:0.1875:0.3841	rs12075;rs3171130;rs61460694;rs12075	44;42	Q5Y7A1;Q16570	.;DUFFY_HUMAN	D	42;42;42;44;44	ENSP00000357104:G42D;ENSP00000441985:G42D;ENSP00000398406:G44D;ENSP00000357103:G44D	ENSP00000352341:G42D	G	+	2	0	DARC	157441978	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.283000	0.18846	-0.484000	0.06763	-0.361000	0.07541	GGT		0.527	DARC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090338.2		
FAM81A	145773	mdanderson.org	37	15	59808946	59808946	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr15:59808946A>G	ENST00000288228.5	+	8	1076	c.889A>G	c.(889-891)Agg>Ggg	p.R297G		NM_152450.2	NP_689663.2	Q8TBF8	FA81A_HUMAN	family with sequence similarity 81, member A	297										endometrium(2)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	10						TCAGAGAACAAGGCAAGAAGA	0.463																																						.											0													109.0	105.0	106.0					15																	59808946		1957	4149	6106	SO:0001583	missense	145773				CCDS45269.1	15q22.2	2012-10-02			ENSG00000157470	ENSG00000157470			28379	protein-coding gene	gene with protein product							Standard	NM_152450		Approved	MGC26690	uc002agc.2	Q8TBF8	OTTHUMG00000171915	ENST00000288228.5:c.889A>G	15.37:g.59808946A>G	ENSP00000288228:p.Arg297Gly	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000288228.5	37	CCDS45269.1	.	.	.	.	.	.	.	.	.	.	A	8.480	0.859642	0.17178	.	.	ENSG00000157470	ENST00000288228	T	0.72942	-0.7	5.65	5.65	0.86999	.	0.157787	0.44902	D	0.000410	T	0.50565	0.1623	N	0.08118	0	0.09310	N	1	B	0.13145	0.007	B	0.16289	0.015	T	0.49072	-0.8977	10	0.87932	D	0	-26.1318	10.2736	0.43497	0.8346:0.1654:0.0:0.0	.	297	Q8TBF8	FA81A_HUMAN	G	297	ENSP00000288228:R297G	ENSP00000288228:R297G	R	+	1	2	FAM81A	57596238	0.988000	0.35896	0.453000	0.27007	0.106000	0.19336	4.474000	0.60203	2.281000	0.76405	0.528000	0.53228	AGG		0.463	FAM81A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415876.1	NM_152450	
HERC1	8925	mdanderson.org	37	15	64010819	64010819	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr15:64010819T>C	ENST00000443617.2	-	21	4019	c.3932A>G	c.(3931-3933)aAg>aGg	p.K1311R		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	1311					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						TTCAAGGTTCTTGCAAGCAAG	0.358																																						.											0													86.0	75.0	78.0					15																	64010819		1847	4098	5945	SO:0001583	missense	8925			U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.3932A>G	15.37:g.64010819T>C	ENSP00000390158:p.Lys1311Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q8IW65	Missense_Mutation	SNP	ENST00000443617.2	37	CCDS45277.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.019604	0.75275	.	.	ENSG00000103657	ENST00000443617	T	0.03580	3.88	5.5	4.36	0.52297	.	0.000000	0.85682	D	0.000000	T	0.04815	0.0130	L	0.50333	1.59	0.45452	D	0.998429	B	0.06786	0.001	B	0.04013	0.001	T	0.27331	-1.0077	10	0.59425	D	0.04	.	8.5418	0.33397	0.0:0.069:0.131:0.8	.	1311	Q15751	HERC1_HUMAN	R	1311	ENSP00000390158:K1311R	ENSP00000390158:K1311R	K	-	2	0	HERC1	61797872	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.962000	0.63687	0.899000	0.36444	0.533000	0.62120	AAG		0.358	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1	NM_003922	
HLA-G	3135	mdanderson.org	37	6	29797430	29797430	+	Silent	SNP	G	G	T			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr6:29797430G>T	ENST00000360323.6	+	4	879	c.855G>T	c.(853-855)gtG>gtT	p.V285V	HLA-G_ENST00000376818.3_Silent_p.V193V|HLA-G_ENST00000376815.3_Intron|HLA-G_ENST00000428701.1_Silent_p.V285V|HLA-G_ENST00000376828.2_Silent_p.V290V			P17693	HLAG_HUMAN	major histocompatibility complex, class I, G	285	Alpha-3.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular defense response (GO:0006968)|cytokine-mediated signaling pathway (GO:0019221)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell tolerance induction (GO:0002666)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)	early endosome membrane (GO:0031901)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(4)|ovary(3)|pancreas(1)|prostate(5)|skin(1)	21						CGTGCCATGTGCAGCATGAGG	0.592																																						.											0													58.0	58.0	58.0					6																	29797430		2203	4300	6503	SO:0001819	synonymous_variant	3135				CCDS4668.1	6p21.3	2013-01-11	2007-12-12		ENSG00000204632	ENSG00000204632		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4964	protein-coding gene	gene with protein product	"""b2 microglobulin"""	142871	"""HLA-G histocompatibility antigen, class I, G"""				Standard	NM_002127		Approved		uc003nnw.2	P17693	OTTHUMG00000031157	ENST00000360323.6:c.855G>T	6.37:g.29797430G>T		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000360323.6	37	CCDS4668.1																																																																																				0.592	HLA-G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076286.2	NM_002127	
KLF10	7071	mdanderson.org	37	8	103663512	103663512	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr8:103663512A>G	ENST00000285407.6	-	3	1348	c.1048T>C	c.(1048-1050)Ttt>Ctt	p.F350L	KLF10_ENST00000395884.3_Missense_Mutation_p.F339L	NM_005655.2	NP_005646.1	Q13118	KLF10_HUMAN	Kruppel-like factor 10	350					bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|cellular response to peptide (GO:1901653)|cellular response to starvation (GO:0009267)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of osteoclast differentiation (GO:0045672)|regulation of circadian rhythm (GO:0042752)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|prostate(3)	18	all_epithelial(15;5.63e-07)|Lung NSC(17;8.18e-05)|all_lung(17;0.000169)		OV - Ovarian serous cystadenocarcinoma(57;0.000112)|STAD - Stomach adenocarcinoma(118;0.0826)			GAAGGGGAAAACCCAGGAGCA	0.517																																					Esophageal Squamous(16;495 519 2144 16528 44005)	.											0													82.0	94.0	90.0					8																	103663512		2203	4300	6503	SO:0001583	missense	7071			U21847	CCDS6294.1, CCDS47905.1	8q22.3	2014-09-17	2004-11-29	2004-12-01	ENSG00000155090	ENSG00000155090		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	11810	protein-coding gene	gene with protein product		601878	"""TGFB inducible early growth response"""	TIEG		8584037, 9721211	Standard	NM_001032282		Approved	EGRA, TIEG1	uc011lhk.1	Q13118	OTTHUMG00000164735	ENST00000285407.6:c.1048T>C	8.37:g.103663512A>G	ENSP00000285407:p.Phe350Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A8MVH0|B2R794|L0R4P6|L0R679|O75411|Q503B2	Missense_Mutation	SNP	ENST00000285407.6	37	CCDS6294.1	.	.	.	.	.	.	.	.	.	.	A	12.48	1.950337	0.34377	.	.	ENSG00000155090	ENST00000285407;ENST00000395884	T;T	0.13089	2.62;2.68	5.5	4.35	0.52113	.	0.151335	0.47852	N	0.000211	T	0.12732	0.0309	M	0.64997	1.995	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.001;0.002	T	0.33033	-0.9884	10	0.15499	T	0.54	.	6.6187	0.22790	0.7913:0.0:0.0722:0.1366	.	350;339	Q13118;O75411	KLF10_HUMAN;.	L	350;339	ENSP00000285407:F350L;ENSP00000379222:F339L	ENSP00000285407:F350L	F	-	1	0	KLF10	103732688	0.947000	0.32204	0.179000	0.23059	0.987000	0.75469	3.510000	0.53393	1.033000	0.39918	0.533000	0.62120	TTT		0.517	KLF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379967.1		
KRTAP5-4	387267	mdanderson.org	37	11	1642989	1642989	+	Missense_Mutation	SNP	C	C	A	rs184758001		TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr11:1642989C>A	ENST00000399682.1	-	1	379	c.335G>T	c.(334-336)gGc>gTc	p.G112V		NM_001012709.1	NP_001012727	Q6L8H1	KRA54_HUMAN	keratin associated protein 5-4	0	9 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)		p.G112V(3)		NS(1)|endometrium(9)|kidney(2)|lung(2)|pancreas(1)|prostate(3)|skin(2)	20		all_epithelial(84;0.00819)|Breast(177;0.00832)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CCCACAGGAGCCACAGCCCCC	0.677																																						.											3	Substitution - Missense(3)	skin(2)|NS(1)											8.0	18.0	15.0					11																	1642989		664	1524	2188	SO:0001583	missense	387267			AB126073		11p15.5	2012-04-19			ENSG00000241598	ENSG00000241598		"""Keratin associated proteins"""	23599	protein-coding gene	gene with protein product						15144888	Standard	NM_001012709		Approved	KRTAP5.4	uc009ycy.1	Q6L8H1	OTTHUMG00000057553	ENST00000399682.1:c.335G>T	11.37:g.1642989C>A	ENSP00000382590:p.Gly112Val	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000399682.1	37		48	0.02197802197802198	13	0.026422764227642278	8	0.022099447513812154	6	0.01048951048951049	21	0.027704485488126648	C	2.407	-0.336332	0.05278	.	.	ENSG00000241598	ENST00000399682;ENST00000328953	T	0.00760	5.73	3.38	3.38	0.38709	.	.	.	.	.	T	0.01092	0.0036	M	0.76574	2.34	0.42892	D	0.994203	D	0.89917	1.0	D	0.80764	0.994	T	0.60342	-0.7282	9	0.32370	T	0.25	.	12.5747	0.56357	0.0:1.0:0.0:0.0	.	172	Q6L8H1	KRA54_HUMAN	V	112	ENSP00000382590:G112V	ENSP00000331603:G112V	G	-	2	0	KRTAP5-4	1599565	0.183000	0.23186	0.998000	0.56505	0.059000	0.15707	0.616000	0.24344	1.573000	0.49748	0.579000	0.79373	GGC		0.677	KRTAP5-4-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000127918.1	NM_001012709	
LILRA1	11024	mdanderson.org	37	19	55107397	55107397	+	Missense_Mutation	SNP	G	G	A	rs149029653	byFrequency	TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr19:55107397G>A	ENST00000251372.3	+	6	1137	c.955G>A	c.(955-957)Gca>Aca	p.A319T	LILRB1_ENST00000418536.2_Intron|LILRB1_ENST00000448689.1_Intron|LILRB1_ENST00000396321.2_Intron|LILRA1_ENST00000453777.1_Intron|LILRA1_ENST00000473156.1_3'UTR	NM_006863.2	NP_006854.1	O75019	LIRA1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 1	319					cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	47				GBM - Glioblastoma multiforme(193;0.0348)		CATCCTGATCGCAGGTGAGGA	0.682													a|||	17	0.00339457	0.0106	0.0	5008	,	,		14307	0.001		0.001	False		,,,				2504	0.001					.											0													19.0	28.0	25.0					19																	55107397		2190	4285	6475	SO:0001583	missense	11024			AF025530	CCDS12901.1, CCDS62802.1	19q13.4	2013-01-11			ENSG00000104974	ENSG00000104974		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6602	protein-coding gene	gene with protein product		604810				9548455	Standard	NM_006863		Approved	LIR-6, CD85i, LIR6	uc002qgh.2	O75019	OTTHUMG00000065701	ENST00000251372.3:c.955G>A	19.37:g.55107397G>A	ENSP00000251372:p.Ala319Thr	Somatic		WXS	Illumina HiSeq	Phase_I	O75018|Q3MJA6	Missense_Mutation	SNP	ENST00000251372.3	37	CCDS12901.1	.	.	.	.	.	.	.	.	.	.	g	0.012	-1.690489	0.00738	.	.	ENSG00000104974	ENST00000251372	T	0.00637	6.05	1.73	-3.45	0.04781	Immunoglobulin subtype (1);	0.886112	0.09212	N	0.833168	T	0.00356	0.0011	N	0.02391	-0.57	0.09310	N	1	B	0.26081	0.141	B	0.24848	0.056	T	0.42749	-0.9433	10	0.14656	T	0.56	.	8.3553	0.32327	0.7419:0.0:0.2581:0.0	.	319	O75019	LIRA1_HUMAN	T	319	ENSP00000251372:A319T	ENSP00000251372:A319T	A	+	1	0	LILRA1	59799209	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-5.248000	0.00138	-1.641000	0.01523	-1.031000	0.02408	GCA		0.682	LILRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140807.2	NM_006863	
MAGEC1	9947	mdanderson.org	37	X	140994320	140994320	+	Missense_Mutation	SNP	G	G	T	rs7063168		TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chrX:140994320G>T	ENST00000285879.4	+	4	1416	c.1130G>T	c.(1129-1131)gGg>gTg	p.G377V	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	377										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					CAGATTCCTGGGAGCCCCTCC	0.478										HNSCC(15;0.026)			-|||	115	0.0304636	0.0552	0.0173	3775	,	,		13319	0.0079		0.0159	False		,,,				2504	0.0061					.											0													103.0	108.0	107.0					X																	140994320		2201	4289	6490	SO:0001583	missense	9947			AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.1130G>T	X.37:g.140994320G>T	ENSP00000285879:p.Gly377Val	Somatic		WXS	Illumina HiSeq	Phase_I	A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	ENST00000285879.4	37	CCDS35417.1	.	.	.	.	.	.	.	.	.	.	t	0.026	-1.372325	0.01214	.	.	ENSG00000155495	ENST00000285879	T	0.02446	4.29	.	.	.	.	.	.	.	.	T	0.01320	0.0043	N	0.08118	0	0.80722	P	0.0	B	0.06786	0.001	B	0.01281	0.0	T	0.45848	-0.9233	7	0.26408	T	0.33	.	4.0922	0.09975	0.0:0.0:0.3553:0.6447	.	377	O60732	MAGC1_HUMAN	V	377	ENSP00000285879:G377V	ENSP00000285879:G377V	G	+	2	0	MAGEC1	140821986	0.001000	0.12720	0.007000	0.13788	0.007000	0.05969	-2.809000	0.00756	-2.298000	0.00660	-2.354000	0.00241	GGG		0.478	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462	
MBD3L2	125997	mdanderson.org	37	19	7051608	7051608	+	Missense_Mutation	SNP	G	G	A	rs1610758	byFrequency	TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr19:7051608G>A	ENST00000381393.3	+	2	655	c.602G>A	c.(601-603)cGg>cAg	p.R201Q		NM_144614.3	NP_653215.2	Q8NHZ7	MB3L2_HUMAN	methyl-CpG binding domain protein 3-like 2	201										endometrium(1)	1	all_hematologic(4;0.166)			Lung(535;0.179)		CTGGCCAGGCGGGCAGAAATG	0.542													-|||	67	0.0133786	0.0431	0.0043	5008	,	,		21183	0.002		0.0	False		,,,				2504	0.0051					.											0													13.0	13.0	13.0					19																	7051608		1852	3950	5802	SO:0001583	missense	125997			AF503919	CCDS42483.1	19p13.3	2011-01-31			ENSG00000230522	ENSG00000230522			18532	protein-coding gene	gene with protein product		607964					Standard	NM_144614		Approved		uc010dvf.1	Q8NHZ7		ENST00000381393.3:c.602G>A	19.37:g.7051608G>A	ENSP00000370800:p.Arg201Gln	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000381393.3	37	CCDS42483.1	9	0.004120879120879121	7	0.014227642276422764	1	0.0027624309392265192	1	0.0017482517482517483	0	0.0	.	5.253	0.232100	0.09969	.	.	ENSG00000230522	ENST00000412046;ENST00000381393	.	.	.	0.791	0.791	0.18619	.	0.500961	0.14905	N	0.291589	T	0.04363	0.0120	N	0.00538	-1.39	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.33394	-0.9870	9	0.14252	T	0.57	-22.1657	3.0133	0.06051	0.6914:0.0:0.3086:0.0	rs1610758;rs4029962;rs4031051;rs4031058	201	Q8NHZ7	MB3L2_HUMAN	Q	201	.	ENSP00000370800:R201Q	R	+	2	0	MBD3L2	7002608	0.049000	0.20398	0.023000	0.16930	0.007000	0.05969	0.153000	0.16323	-0.181000	0.10619	-0.616000	0.04050	CGG		0.542	MBD3L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458499.1	NM_144614	
MUC17	140453	mdanderson.org	37	7	100681917	100681917	+	Missense_Mutation	SNP	T	T	C	rs111633703	byFrequency	TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr7:100681917T>C	ENST00000306151.4	+	3	7284	c.7220T>C	c.(7219-7221)aTg>aCg	p.M2407T		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2407	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GTCAGCACCATGCCGGTGGTC	0.507																																						.											0													383.0	363.0	370.0					7																	100681917		2203	4300	6503	SO:0001583	missense	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.7220T>C	7.37:g.100681917T>C	ENSP00000302716:p.Met2407Thr	Somatic		WXS	Illumina HiSeq	Phase_I	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	N	0.006	-2.095493	0.00364	.	.	ENSG00000169876	ENST00000306151	T	0.02197	4.4	0.679	-1.36	0.09085	.	.	.	.	.	T	0.00875	0.0029	N	0.02247	-0.625	0.09310	N	1	B	0.09022	0.002	B	0.01281	0.0	T	0.45323	-0.9269	9	0.02654	T	1	.	7.4277	0.27109	0.0:0.7775:0.0:0.2225	.	2407	Q685J3	MUC17_HUMAN	T	2407	ENSP00000302716:M2407T	ENSP00000302716:M2407T	M	+	2	0	MUC17	100468637	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.128000	0.10531	-1.293000	0.02362	-1.602000	0.00811	ATG		0.507	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
MUC17	140453	mdanderson.org	37	7	100681951	100681951	+	Silent	SNP	C	C	A			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr7:100681951C>A	ENST00000306151.4	+	3	7318	c.7254C>A	c.(7252-7254)tcC>tcA	p.S2418S		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2418	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GCACCCATTCCACAACTCCTG	0.512																																						.											0													380.0	365.0	370.0					7																	100681951		2203	4300	6503	SO:0001819	synonymous_variant	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.7254C>A	7.37:g.100681951C>A		Somatic		WXS	Illumina HiSeq	Phase_I	O14761|Q685J2|Q8TDH7	Silent	SNP	ENST00000306151.4	37	CCDS34711.1																																																																																				0.512	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
MUC2	4583	mdanderson.org	37	11	1092459	1092459	+	Silent	SNP	C	C	A	rs374506032		TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr11:1092459C>A	ENST00000441003.2	+	30	4305	c.4278C>A	c.(4276-4278)acC>acA	p.T1426T	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_Silent_p.T1427T|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	4232	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	gccctccaaccaccaccacaa	0.617																																						.											0													126.0	187.0	167.0					11																	1092459		1722	3421	5143	SO:0001819	synonymous_variant	4583			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4278C>A	11.37:g.1092459C>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q14878	Silent	SNP	ENST00000441003.2	37																																																																																					0.617	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC2	4583	mdanderson.org	37	11	1092953	1092953	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr11:1092953C>T	ENST00000441003.2	+	30	4799	c.4772C>T	c.(4771-4773)aCg>aTg	p.T1591M	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_Splice_Site_p.T1592M|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.T1592M(1)|p.T1591M(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	accaccactacggtgacccca	0.627																																						.											2	Substitution - Missense(2)	endometrium(2)											54.0	86.0	74.0					11																	1092953		1812	3313	5125	SO:0001583	missense	4583			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4772C>T	11.37:g.1092953C>T	ENSP00000415183:p.Thr1591Met	Somatic		WXS	Illumina HiSeq	Phase_I	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	3.179	-0.168424	0.06461	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.16743	2.32;2.56	1.75	-0.619	0.11572	.	6.725620	0.00827	U	0.001636	T	0.08846	0.0219	.	.	.	0.09310	N	1	D	0.60575	0.988	B	0.34489	0.184	T	0.24548	-1.0157	9	0.32370	T	0.25	.	3.3423	0.07123	0.2481:0.5888:0.0:0.163	.	1591	E7EUV1	.	M	1591;1592	ENSP00000415183:T1591M;ENSP00000351956:T1592M	ENSP00000351956:T1592M	T	+	2	0	MUC2	1082953	0.064000	0.20934	0.000000	0.03702	0.189000	0.23516	1.615000	0.36922	-0.313000	0.08728	0.121000	0.15741	ACG		0.627	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC4	4585	mdanderson.org	37	3	195507502	195507502	+	Missense_Mutation	SNP	A	A	G	rs113781173		TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr3:195507502A>G	ENST00000463781.3	-	2	11408	c.10949T>C	c.(10948-10950)cTt>cCt	p.L3650P	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.L3650P	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTCGGTGACAAGAAGAGGGGT	0.582																																						.											0													22.0	16.0	18.0					3																	195507502		599	1484	2083	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.10949T>C	3.37:g.195507502A>G	ENSP00000417498:p.Leu3650Pro	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	a	1.868	-0.461025	0.04508	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.39229	1.09;1.23	.	.	.	.	.	.	.	.	T	0.13713	0.0332	N	0.03608	-0.345	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.16394	-1.0404	7	.	.	.	.	2.8016	0.05416	0.2507:0.0:0.4948:0.2544	.	3522	E7ESK3	.	P	3650	ENSP00000417498:L3650P;ENSP00000420243:L3650P	.	L	-	2	0	MUC4	196992281	0.000000	0.05858	0.019000	0.16419	0.019000	0.09904	-1.892000	0.01610	-1.986000	0.00983	-1.973000	0.00462	CTT		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC6	4588	mdanderson.org	37	11	1018031	1018031	+	Silent	SNP	G	G	A	rs10751678	byFrequency	TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr11:1018031G>A	ENST00000421673.2	-	31	4820	c.4770C>T	c.(4768-4770)ccC>ccT	p.P1590P		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1590	Pro-rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TTGCCGTCATGGGACCTGTGG	0.582																																						.											0													259.0	261.0	260.0					11																	1018031		2159	4236	6395	SO:0001819	synonymous_variant	4588			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.4770C>T	11.37:g.1018031G>A		Somatic		WXS	Illumina HiSeq	Phase_I	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Silent	SNP	ENST00000421673.2	37	CCDS44513.1																																																																																				0.582	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
MYH7	4625	mdanderson.org	37	14	23885477	23885477	+	Silent	SNP	C	C	T			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr14:23885477C>T	ENST00000355349.3	-	34	4851	c.4689G>A	c.(4687-4689)ctG>ctA	p.L1563L	CTD-2201G16.1_ENST00000557368.1_RNA|MIR208B_ENST00000401172.1_RNA	NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1563					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		GGTTGAACTCCAGCTGGGCCC	0.647																																						.											0													124.0	123.0	123.0					14																	23885477		2203	4300	6503	SO:0001819	synonymous_variant	4625			M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.4689G>A	14.37:g.23885477C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Silent	SNP	ENST00000355349.3	37	CCDS9601.1																																																																																				0.647	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257	
MYH7	4625	mdanderson.org	37	14	23886718	23886718	+	Silent	SNP	G	G	A	rs182311329	byFrequency	TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr14:23886718G>A	ENST00000355349.3	-	31	4509	c.4347C>T	c.(4345-4347)ttC>ttT	p.F1449F	CTD-2201G16.1_ENST00000557368.1_RNA|MIR208B_ENST00000401172.1_RNA	NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1449					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		CCACCTTGTCGAAGTTCCTCT	0.622													G|||	2	0.000399361	0.0008	0.0	5008	,	,		16915	0.001		0.0	False		,,,				2504	0.0					.											0																																										SO:0001819	synonymous_variant	4625			M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.4347C>T	14.37:g.23886718G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Silent	SNP	ENST00000355349.3	37	CCDS9601.1																																																																																				0.622	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257	
MYH7	4625	mdanderson.org	37	14	23886724	23886724	+	Silent	SNP	C	C	T			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr14:23886724C>T	ENST00000355349.3	-	31	4503	c.4341G>A	c.(4339-4341)agG>agA	p.R1447R	CTD-2201G16.1_ENST00000557368.1_RNA|MIR208B_ENST00000401172.1_RNA	NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1447					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		TGTCGAAGTTCCTCTGCTTCT	0.612																																						.											0													99.0	94.0	96.0					14																	23886724		2203	4300	6503	SO:0001819	synonymous_variant	4625			M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.4341G>A	14.37:g.23886724C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Silent	SNP	ENST00000355349.3	37	CCDS9601.1																																																																																				0.612	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257	
MYO5B	4645	mdanderson.org	37	18	47364066	47364067	+	Missense_Mutation	DNP	GC	GC	AT			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr18:47364066_47364067GC>AT	ENST00000285039.7	-	37	5257_5258	c.4958_4959GC>AT	c.(4957-4959)tGC>tAT	p.C1653Y	SCARNA17_ENST00000589499.1_RNA|MYO5B_ENST00000324581.6_Missense_Mutation_p.C768Y|RP11-886H22.1_ENST00000590532.2_5'Flank|MYO5B_ENST00000592688.1_Missense_Mutation_p.C223Y	NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	1653	Dilute. {ECO:0000255|PROSITE- ProRule:PRU00503}.				endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		TAGCTTCCAGGCAGTATGAGTT	0.52																																						.											0																																										SO:0001583	missense	4645			AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.4958_4959delinsAT	18.37:g.47364066_47364067delinsAT	ENSP00000285039:p.Cys1653Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	B0I1R3|Q0P656|Q9H6Y6	Missense_Mutation	DNP	ENST00000285039.7	37	CCDS42436.1																																																																																				0.520	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448515.2		
OR2AG1	144125	mdanderson.org	37	11	6806963	6806963	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr11:6806963A>G	ENST00000307401.4	+	1	716	c.695A>G	c.(694-696)gAg>gGg	p.E232G		NM_001004489.2	NP_001004489.1	Q9H205	O2AG1_HUMAN	olfactory receptor, family 2, subfamily AG, member 1	232						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(13)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	26		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)		Epithelial(150;2.19e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		CCATCAAATGAGGGGAGGAAG	0.488																																						.											0													191.0	167.0	175.0					11																	6806963		2201	4296	6497	SO:0001583	missense	144125			AB065823	CCDS31414.1	11p15.4	2012-08-09			ENSG00000170803	ENSG00000170803		"""GPCR / Class A : Olfactory receptors"""	15142	protein-coding gene	gene with protein product				OR2AG3			Standard	NM_001004489		Approved		uc001mer.2	Q9H205	OTTHUMG00000165735	ENST00000307401.4:c.695A>G	11.37:g.6806963A>G	ENSP00000307447:p.Glu232Gly	Somatic		WXS	Illumina HiSeq	Phase_I	B9EKV7|Q6IFG7|Q96R26	Missense_Mutation	SNP	ENST00000307401.4	37	CCDS31414.1	.	.	.	.	.	.	.	.	.	.	A	10.81	1.455720	0.26161	.	.	ENSG00000170803	ENST00000307401	T	0.00207	8.55	4.32	3.18	0.36537	GPCR, rhodopsin-like superfamily (1);	0.262449	0.27262	N	0.020175	T	0.00178	0.0005	L	0.46567	1.45	0.09310	N	1	B	0.23540	0.087	B	0.33799	0.17	T	0.32322	-0.9911	10	0.66056	D	0.02	.	5.2013	0.15267	0.6326:0.1874:0.0:0.1801	.	232	Q9H205	O2AG1_HUMAN	G	232	ENSP00000307447:E232G	ENSP00000307447:E232G	E	+	2	0	OR2AG1	6763539	0.000000	0.05858	0.752000	0.31206	0.992000	0.81027	0.285000	0.18883	0.800000	0.34041	0.533000	0.62120	GAG		0.488	OR2AG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385980.1	NM_001004489	
OR4K5	79317	mdanderson.org	37	14	20389305	20389305	+	Silent	SNP	T	T	C			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr14:20389305T>C	ENST00000315915.4	+	1	565	c.540T>C	c.(538-540)gaT>gaC	p.D180D		NM_001005483.1	NP_001005483.1	Q8NGD3	OR4K5_HUMAN	olfactory receptor, family 4, subfamily K, member 5	180						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|liver(1)|lung(27)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	47	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TTTTTTGTGATCTTCCTCGAG	0.423																																						.											0													249.0	263.0	258.0					14																	20389305		2203	4300	6503	SO:0001819	synonymous_variant	79317			BK004355	CCDS32024.1	14q11.22	2012-08-09				ENSG00000176281		"""GPCR / Class A : Olfactory receptors"""	14745	protein-coding gene	gene with protein product						14983052	Standard	NM_001005483		Approved		uc010tkw.2	Q8NGD3		ENST00000315915.4:c.540T>C	14.37:g.20389305T>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q6IFA7	Silent	SNP	ENST00000315915.4	37	CCDS32024.1																																																																																				0.423	OR4K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409867.1	NM_001005483	
OR5AK2	390181	mdanderson.org	37	11	56756940	56756941	+	Missense_Mutation	DNP	TC	TC	AT			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	TC	TC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr11:56756940_56756941TC>AT	ENST00000326855.2	+	1	594_595	c.552_553TC>AT	c.(550-555)atTCtt>atATtt	p.L185F		NM_001005323.1	NP_001005323.1	Q8NH90	O5AK2_HUMAN	olfactory receptor, family 5, subfamily AK, member 2	185						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(3)|endometrium(1)|large_intestine(4)|lung(3)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	21						TTCCCCCTATTCTTGCTCTTTC	0.406																																						.											0																																										SO:0001583	missense	390181			AB065496	CCDS31538.1	11q11	2012-08-09			ENSG00000181273	ENSG00000181273		"""GPCR / Class A : Olfactory receptors"""	15251	protein-coding gene	gene with protein product							Standard	NM_001005323		Approved		uc010rjp.2	Q8NH90	OTTHUMG00000167019	Exception_encountered	11.37:g.56756940_56756941delinsAT	ENSP00000322784:p.Leu185Phe	Somatic		WXS	Illumina HiSeq	Phase_I	B2RNZ9	Missense_Mutation	DNP	ENST00000326855.2	37	CCDS31538.1																																																																																				0.406	OR5AK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392446.1	NM_001005323	
OR5H6	79295	mdanderson.org	37	3	97983602	97983602	+	Silent	SNP	T	T	C	rs75354046	byFrequency	TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr3:97983602T>C	ENST00000383696.2	+	1	515	c.474T>C	c.(472-474)atT>atC	p.I158I	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005479.1	NP_001005479.1	Q8NGV6	OR5H6_HUMAN	olfactory receptor, family 5, subfamily H, member 6 (gene/pseudogene)	158						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(2)|endometrium(1)|large_intestine(4)|lung(20)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						AACTATGCATTCAGCTATTAG	0.358																																						.											0													109.0	102.0	104.0					3																	97983602		2203	4299	6502	SO:0001819	synonymous_variant	79295			BK004374	CCDS33800.1	3q12.1	2013-10-10	2013-10-10		ENSG00000230301	ENSG00000230301		"""GPCR / Class A : Olfactory receptors"""	14767	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily H, member 6"""				Standard	NM_001005479		Approved		uc003dsi.1	Q8NGV6	OTTHUMG00000160078	ENST00000383696.2:c.474T>C	3.37:g.97983602T>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q6IF88	Silent	SNP	ENST00000383696.2	37	CCDS33800.1																																																																																				0.358	OR5H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359111.2		
PCDHB4	56131	mdanderson.org	37	5	140503002	140503002	+	Silent	SNP	C	C	A			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr5:140503002C>A	ENST00000194152.1	+	1	1422	c.1422C>A	c.(1420-1422)gcC>gcA	p.A474A	AC005754.8_ENST00000606030.1_lincRNA	NM_018938.2	NP_061761.1	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4	474	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A474A(1)		autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	67			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GTGTCAGCGCCACAGACAGAG	0.662																																						.											1	Substitution - coding silent(1)	skin(1)											48.0	52.0	51.0					5																	140503002		2201	4295	6496	SO:0001819	synonymous_variant	56131			AF152497	CCDS4246.1	5q31	2010-01-26			ENSG00000081818	ENSG00000081818		"""Cadherins / Protocadherins : Clustered"""	8689	other	protocadherin		606330				10380929	Standard	NM_018938		Approved	PCDH-BETA4	uc003lip.1	Q9Y5E5	OTTHUMG00000129617	ENST00000194152.1:c.1422C>A	5.37:g.140503002C>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q4V761	Silent	SNP	ENST00000194152.1	37	CCDS4246.1																																																																																				0.662	PCDHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251812.2	NM_018938	
PDIA2	64714	mdanderson.org	37	16	334732	334732	+	Silent	SNP	C	C	T	rs45593734	byFrequency	TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr16:334732C>T	ENST00000219406.6	+	3	498	c.480C>T	c.(478-480)gaC>gaT	p.D160D	PDIA2_ENST00000404312.1_Silent_p.D160D	NM_006849.2	NP_006840.2	Q13087	PDIA2_HUMAN	protein disulfide isomerase family A, member 2	160					cell redox homeostasis (GO:0045454)|peptidyl-proline hydroxylation (GO:0019511)|protein folding (GO:0006457)|protein retention in ER lumen (GO:0006621)|regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902175)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)	protein disulfide isomerase activity (GO:0003756)|steroid binding (GO:0005496)			breast(1)|central_nervous_system(4)|kidney(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	17		all_cancers(16;6.71e-07)|all_epithelial(16;1.59e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00769)|all_lung(18;0.0186)				GGCTGGAGGACGAGGCGGCCG	0.716													c|||	640	0.127796	0.0862	0.0994	5008	,	,		12306	0.0962		0.16	False		,,,				2504	0.2035					.											0								C		328,3770		14,300,1735	8.0	14.0	12.0		480	-3.5	0.3	16	dbSNP_127	12	1280,6964		99,1082,2941	no	coding-synonymous	PDIA2	NM_006849.2		113,1382,4676	TT,TC,CC		15.5264,8.0039,13.0287		160/526	334732	1608,10734	2049	4122	6171	SO:0001819	synonymous_variant	64714			U19948	CCDS42089.1	16p13.3	2009-11-20	2005-06-29	2005-03-03	ENSG00000185615	ENSG00000185615	5.3.4.1	"""Protein disulfide isomerases"""	14180	protein-coding gene	gene with protein product		608012	"""protein disulfide isomerase, pancreatic"", ""protein disulfide isomerase-associated 2"""	PDIP		8561901	Standard	NM_006849		Approved	PDA2, PDI, PDIR	uc002cgo.1	Q13087	OTTHUMG00000064891	ENST00000219406.6:c.480C>T	16.37:g.334732C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A6ZJ64|B4DI27|Q2WGM4|Q4TT67|Q6B010|Q96KJ6|Q9BW95	Silent	SNP	ENST00000219406.6	37	CCDS42089.1	245	0.11217948717948718	33	0.06707317073170732	40	0.11049723756906077	54	0.0944055944055944	118	0.15567282321899736	c	0.097	-1.157292	0.01686	0.080039	0.155264	ENSG00000185615	ENST00000456379	.	.	.	3.75	-3.55	0.04639	.	.	.	.	.	T	0.00109	0.0003	.	.	.	0.44485	P	0.00257099999999999	.	.	.	.	.	.	T	0.21008	-1.0258	3	.	.	.	.	3.4234	0.07401	0.1195:0.1343:0.119:0.6272	rs45593734;rs62032217	.	.	.	M	157	.	.	T	+	2	0	PDIA2	274733	0.000000	0.05858	0.349000	0.25694	0.141000	0.21300	-2.516000	0.00954	-0.782000	0.04541	0.457000	0.33378	ACG		0.716	PDIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139315.3	NM_006849	
POM121	9883	mdanderson.org	37	7	72412591	72412591	+	Missense_Mutation	SNP	G	G	A	rs201184041	byFrequency	TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr7:72412591G>A	ENST00000434423.2	+	11	2059	c.2059G>A	c.(2059-2061)Gct>Act	p.A687T	POM121_ENST00000358357.3_Missense_Mutation_p.A422T|POM121_ENST00000446813.1_Missense_Mutation_p.A422T|POM121_ENST00000257622.4_Missense_Mutation_p.A422T|POM121_ENST00000395270.1_Missense_Mutation_p.A422T			Q96HA1	P121A_HUMAN	POM121 transmembrane nucleoporin	687	Pore side. {ECO:0000255}.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|breast(1)|endometrium(9)|kidney(4)|large_intestine(6)|lung(12)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Lung NSC(55;0.163)				GGCAGAGACGGCTACCAAACC	0.617																																						.											0													64.0	73.0	70.0					7																	72412591		2197	4295	6492	SO:0001583	missense	9883			AB014518	CCDS5542.1, CCDS59059.1	7q11.23	2013-01-08	2012-03-13		ENSG00000196313	ENSG00000196313		"""-"""	19702	protein-coding gene	gene with protein product		615753	"""POM121 membrane glycoprotein (rat)"", ""POM121 membrane glycoprotein"""			8335683, 9734811, 17900573	Standard	NM_172020		Approved	KIAA0618, DKFZP586G1822, DKFZP586P2220, POM121A	uc003twk.2	Q96HA1	OTTHUMG00000023527	ENST00000434423.2:c.2059G>A	7.37:g.72412591G>A	ENSP00000405562:p.Ala687Thr	Somatic		WXS	Illumina HiSeq	Phase_I	A6NFS9|A8CDT4|A8K933|A8MXF9|O75115|Q96DI0|Q9H9X1|Q9Y2N3|Q9Y4S7	Missense_Mutation	SNP	ENST00000434423.2	37		.	.	.	.	.	.	.	.	.	.	G	11.45	1.643085	0.29246	.	.	ENSG00000196313	ENST00000446813;ENST00000257622;ENST00000395270;ENST00000358357;ENST00000434423	T;T;T;T;T	0.05447	3.44;3.45;3.44;3.45;3.68	2.33	-2.14	0.07123	.	1.146690	0.06730	N	0.776488	T	0.04182	0.0116	N	0.25647	0.755	0.09310	N	1	P;B	0.34587	0.458;0.452	B;B	0.35039	0.194;0.164	T	0.41270	-0.9518	10	0.25751	T	0.34	.	3.0328	0.06112	0.0:0.2841:0.2415:0.4744	.	422;687	A8MXF9;Q96HA1	.;P121A_HUMAN	T	422;422;422;422;687	ENSP00000393020:A422T;ENSP00000257622:A422T;ENSP00000378687:A422T;ENSP00000351124:A422T;ENSP00000405562:A687T	ENSP00000257622:A422T	A	+	1	0	POM121	72050527	0.000000	0.05858	0.000000	0.03702	0.323000	0.28346	-0.717000	0.04986	-0.647000	0.05444	0.173000	0.16961	GCT		0.617	POM121-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000347344.1		
POTEE	445582	mdanderson.org	37	2	132021815	132021815	+	Silent	SNP	G	G	A	rs369764537	byFrequency	TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr2:132021815G>A	ENST00000356920.5	+	15	2881	c.2787G>A	c.(2785-2787)acG>acA	p.T929T	PLEKHB2_ENST00000404460.1_Intron|POTEE_ENST00000358087.5_3'UTR|PLEKHB2_ENST00000303908.3_Intron	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	929	Actin-like.				retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)											AGATGGCCACGGCGGCCTCCA	0.617													.|||	283	0.0565096	0.0893	0.0447	5008	,	,		43636	0.0069		0.0795	False		,,,				2504	0.0481					.											0													141.0	156.0	151.0					2																	132021815		2201	4297	6498	SO:0001819	synonymous_variant	445582			AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.2787G>A	2.37:g.132021815G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q6S8J4|Q6S8J5|Q6S8J8	Silent	SNP	ENST00000356920.5	37	CCDS46414.1																																																																																				0.617	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001083538	
PRSS1	5644	mdanderson.org	37	7	142460752	142460752	+	Missense_Mutation	SNP	C	C	G	rs140793689		TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr7:142460752C>G	ENST00000311737.7	+	5	631	c.625C>G	c.(625-627)Cag>Gag	p.Q209E	PRSS1_ENST00000486171.1_Missense_Mutation_p.Q223E	NM_002769.4	NP_002760.1	P07477	TRY1_HUMAN	protease, serine, 1 (trypsin 1)	209	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(24)|prostate(2)	38	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		Aprotinin(DB06692)	CTGCAATGGACAGCTCCAAGG	0.498																																						.											0													81.0	82.0	82.0					7																	142460752		2203	4300	6503	SO:0001583	missense	5644			M22612	CCDS5872.1	7q34	2012-10-02			ENSG00000204983	ENSG00000204983	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9475	protein-coding gene	gene with protein product		276000		TRY1			Standard	NM_002769		Approved		uc003wak.2	P07477	OTTHUMG00000158923	ENST00000311737.7:c.625C>G	7.37:g.142460752C>G	ENSP00000308720:p.Gln209Glu	Somatic		WXS	Illumina HiSeq	Phase_I	A1A509|A6NJ71|B2R5I5|Q5NV57|Q7M4N3|Q7M4N4|Q92955|Q9HAN4|Q9HAN5|Q9HAN6|Q9HAN7	Missense_Mutation	SNP	ENST00000311737.7	37	CCDS5872.1	.	.	.	.	.	.	.	.	.	.	C	0.001	-3.193364	0.00026	.	.	ENSG00000204983	ENST00000486171;ENST00000311737;ENST00000529243	D;D	0.92752	-3.1;-3.1	3.18	-6.37	0.01963	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.378699	0.32671	N	0.005798	T	0.78142	0.4237	N	0.11818	0.18	0.23758	N	0.996928	B;B	0.02656	0.0;0.0	B;B	0.09377	0.004;0.003	T	0.62539	-0.6833	10	0.02654	T	1	.	15.6905	0.77446	0.0827:0.7314:0.186:0.0	.	223;209	E7EQ64;P07477	.;TRY1_HUMAN	E	223;209;199	ENSP00000417854:Q223E;ENSP00000308720:Q209E	ENSP00000308720:Q209E	Q	+	1	0	PRSS1	142140326	0.000000	0.05858	0.024000	0.17045	0.003000	0.03518	-1.756000	0.01813	-1.839000	0.01186	0.195000	0.17529	CAG		0.498	PRSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352538.2		
RNF145	153830	mdanderson.org	37	5	158595995	158595995	+	Missense_Mutation	SNP	A	A	G			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr5:158595995A>G	ENST00000424310.2	-	8	1366	c.1007T>C	c.(1006-1008)gTt>gCt	p.V336A	RNF145_ENST00000274542.2_Missense_Mutation_p.V364A|RNF145_ENST00000520638.1_Missense_Mutation_p.V350A|RNF145_ENST00000518802.1_Missense_Mutation_p.V366A|RNF145_ENST00000519865.1_Missense_Mutation_p.V336A|RNF145_ENST00000521606.2_Missense_Mutation_p.V353A	NM_001199383.1	NP_001186312.1	Q96MT1	RN145_HUMAN	ring finger protein 145	336						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(7)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	30	Renal(175;0.00196)	Medulloblastoma(196;0.0523)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TGCCCGATGAACAACCTGCAG	0.413																																						.											0													128.0	130.0	129.0					5																	158595995		2203	4300	6503	SO:0001583	missense	153830			BC042684	CCDS4344.1, CCDS56390.1, CCDS56391.1, CCDS56392.1, CCDS56393.1	5q33.3	2013-01-09			ENSG00000145860	ENSG00000145860		"""RING-type (C3HC4) zinc fingers"""	20853	protein-coding gene	gene with protein product							Standard	NM_001199380		Approved	FLJ31951	uc003lxo.2	Q96MT1	OTTHUMG00000130306	ENST00000424310.2:c.1007T>C	5.37:g.158595995A>G	ENSP00000409064:p.Val336Ala	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z903|B7Z949|E7EVI7|Q8IVP7	Missense_Mutation	SNP	ENST00000424310.2	37	CCDS56390.1	.	.	.	.	.	.	.	.	.	.	A	14.47	2.545766	0.45280	.	.	ENSG00000145860	ENST00000274542;ENST00000519865;ENST00000424310;ENST00000521606;ENST00000413445;ENST00000518802;ENST00000535312;ENST00000520638	T;T;T;T;T;T;T	0.77098	-1.07;-1.06;-1.06;-1.07;-1.06;-1.07;-1.07	5.08	5.08	0.68730	.	0.051325	0.85682	D	0.000000	T	0.64800	0.2631	N	0.22421	0.69	0.52501	D	0.999957	B;B;B;P;B	0.35124	0.425;0.425;0.425;0.485;0.372	B;B;B;B;B	0.34652	0.131;0.131;0.182;0.187;0.114	T	0.62642	-0.6811	10	0.15499	T	0.54	-21.9966	15.1444	0.72637	1.0:0.0:0.0:0.0	.	353;350;366;336;364	B7Z949;B7Z903;E7EVI7;Q96MT1;Q96MT1-2	.;.;.;RN145_HUMAN;.	A	364;336;336;352;353;366;336;350	ENSP00000274542:V364A;ENSP00000430397:V336A;ENSP00000409064:V336A;ENSP00000430753:V352A;ENSP00000445115:V353A;ENSP00000430955:V366A;ENSP00000429071:V350A	ENSP00000274542:V364A	V	-	2	0	RNF145	158528573	1.000000	0.71417	0.888000	0.34837	0.907000	0.53573	9.188000	0.94921	2.035000	0.60131	0.477000	0.44152	GTT		0.413	RNF145-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374048.1	NM_144726	
SLC25A51	92014	mdanderson.org	37	9	37888331	37888331	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr9:37888331T>C	ENST00000377716.2	-	3	960	c.217A>G	c.(217-219)Aga>Gga	p.R73G	SLC25A51_ENST00000380590.3_Missense_Mutation_p.R73G|SLC25A51_ENST00000496760.1_Intron|SLC25A51_ENST00000242275.6_Missense_Mutation_p.R73G|RP11-613M10.9_ENST00000540557.1_Intron			Q9H1U9	S2551_HUMAN	solute carrier family 25, member 51	73					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)											CCATCCCTTCTCAACTGAAGT	0.438																																						.											0													113.0	101.0	105.0					9																	37888331		2203	4300	6503	SO:0001583	missense	92014			BC008500	CCDS6614.1	9p13.3-p12	2013-05-22	2012-03-29	2012-03-29	ENSG00000122696	ENSG00000122696		"""Solute carriers"""	23323	protein-coding gene	gene with protein product			"""mitochondrial carrier triple repeat 1"""	MCART1		12477932	Standard	NM_033412		Approved	MGC14836, CG7943	uc004aav.2	Q9H1U9	OTTHUMG00000019935	ENST00000377716.2:c.217A>G	9.37:g.37888331T>C	ENSP00000366945:p.Arg73Gly	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000377716.2	37	CCDS6614.1	.	.	.	.	.	.	.	.	.	.	.	15.70	2.910659	0.52439	.	.	ENSG00000122696	ENST00000380590;ENST00000377716;ENST00000242275	T;T;T	0.80480	-1.38;-1.38;-1.38	5.18	-0.605	0.11623	Mitochondrial carrier domain (2);	0.207650	0.39687	N	0.001283	D	0.83018	0.5163	M	0.82132	2.575	0.36010	D	0.838007	B	0.20780	0.048	B	0.38020	0.263	D	0.84228	0.0465	10	0.62326	D	0.03	.	13.6954	0.62575	0.0:0.0:0.6378:0.3622	.	73	Q9H1U9	MCAR1_HUMAN	G	73	ENSP00000369964:R73G;ENSP00000366945:R73G;ENSP00000242275:R73G	ENSP00000242275:R73G	R	-	1	2	MCART1	37878331	1.000000	0.71417	0.951000	0.38953	0.903000	0.53119	2.106000	0.41835	0.278000	0.22164	0.477000	0.44152	AGA		0.438	SLC25A51-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313746.1	NM_033412	
TAS2R4	50832	mdanderson.org	37	7	141478800	141478800	+	Missense_Mutation	SNP	G	G	A	rs2234002	byFrequency	TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr7:141478800G>A	ENST00000247881.2	+	1	559	c.512G>A	c.(511-513)aGt>aAt	p.S171N	SSBP1_ENST00000465582.1_Intron	NM_016944.1	NP_058640.1	Q9NYW5	TA2R4_HUMAN	taste receptor, type 2, member 4	171			S -> N (in dbSNP:rs2234002).		detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|respiratory gaseous exchange (GO:0007585)|sensory perception of taste (GO:0050909)|signal transduction (GO:0007165)	cilium (GO:0005929)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			endometrium(1)|large_intestine(4)|lung(2)	7	Melanoma(164;0.0171)			BRCA - Breast invasive adenocarcinoma(188;0.196)		TTTAATATCAGTGAGGGCATC	0.423													g|||	2461	0.491414	0.1929	0.5663	5008	,	,		22114	0.745		0.4722	False		,,,				2504	0.6002					.											0								A	ASN/SER	1106,3300	398.5+/-330.9	147,812,1244	263.0	256.0	259.0		512	-8.9	0.0	7	dbSNP_98	259	4271,4329	574.9+/-390.1	1053,2165,1082	yes	missense	TAS2R4	NM_016944.1	46	1200,2977,2326	AA,AG,GG		49.6628,25.1021,41.3425	benign	171/300	141478800	5377,7629	2203	4300	6503	SO:0001583	missense	50832			AF227131	CCDS5868.1	7q31.3-q32	2012-08-22			ENSG00000127364	ENSG00000127364		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14911	protein-coding gene	gene with protein product		604869				10761934, 10761935	Standard	NM_016944		Approved	T2R4	uc003vwq.1	Q9NYW5	OTTHUMG00000157634	ENST00000247881.2:c.512G>A	7.37:g.141478800G>A	ENSP00000247881:p.Ser171Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q645W5|Q75MV8	Missense_Mutation	SNP	ENST00000247881.2	37	CCDS5868.1	1081	0.49496336996337	103	0.20934959349593496	198	0.5469613259668509	427	0.7465034965034965	353	0.4656992084432718	g	0.003	-2.486927	0.00161	0.251021	0.496628	ENSG00000127364	ENST00000247881	T	0.00768	5.72	5.06	-8.91	0.00778	.	1.458410	0.03642	N	0.239661	T	0.00012	0.0000	N	0.10760	0.04	0.80722	P	0.0	B	0.02656	0.0	B	0.08055	0.003	T	0.43294	-0.9400	9	0.02654	T	1	.	10.909	0.47097	0.2401:0.2116:0.5482:0.0	rs2234002;rs3735277;rs17523587;rs52816893;rs60480904;rs2234002	171	Q9NYW5	TA2R4_HUMAN	N	171	ENSP00000247881:S171N	ENSP00000247881:S171N	S	+	2	0	TAS2R4	141125269	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.744000	0.04839	-1.732000	0.01359	-0.508000	0.04489	AGT		0.423	TAS2R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349285.1		
UBR5	51366	mdanderson.org;bcgsc.ca	37	8	103277497	103277497	+	Nonsense_Mutation	SNP	G	G	A			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr8:103277497G>A	ENST00000520539.1	-	53	8038	c.7432C>T	c.(7432-7434)Cga>Tga	p.R2478*	UBR5_ENST00000518205.1_Nonsense_Mutation_p.R206*|UBR5_ENST00000220959.4_Nonsense_Mutation_p.R2477*|UBR5_ENST00000521922.1_Nonsense_Mutation_p.R2471*	NM_001282873.1|NM_015902.5	NP_001269802.1|NP_056986.2	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin 5	2478	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of protein import into nucleus, translocation (GO:0033160)|progesterone receptor signaling pathway (GO:0050847)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-ubiquitin ligase activity (GO:0034450)|zinc ion binding (GO:0008270)			NS(1)|breast(13)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(19)|liver(1)|lung(51)|ovary(6)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	124	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			TGGCGCTTTCGGTTTTCCTGC	0.393																																					Ovarian(131;96 1741 5634 7352 27489)	.											0													73.0	73.0	73.0					8																	103277497		2203	4300	6503	SO:0001587	stop_gained	51366			AF006010	CCDS34933.1, CCDS64946.1	8q22	2008-06-23	2007-06-19	2007-06-19	ENSG00000104517	ENSG00000104517		"""Ubiquitin protein ligase E3 component n-recognins"""	16806	protein-coding gene	gene with protein product		608413	"""E3 ubiquitin protein ligase, HECT domain containing, 1"""	EDD1		10030672, 16055722	Standard	NM_015902		Approved	DD5, HYD, EDD, KIAA0896	uc003ykr.2	O95071	OTTHUMG00000164755	ENST00000520539.1:c.7432C>T	8.37:g.103277497G>A	ENSP00000429084:p.Arg2478*	Somatic		WXS	Illumina HiSeq	Phase_I	B2RP24|J3KMW7|O94970|Q9NPL3	Nonsense_Mutation	SNP	ENST00000520539.1	37	CCDS34933.1	.	.	.	.	.	.	.	.	.	.	G	51	18.249704	0.99902	.	.	ENSG00000104517	ENST00000520539;ENST00000220959;ENST00000518205;ENST00000521922	.	.	.	5.27	3.33	0.38152	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.3267	0.60463	0.0:0.0:0.6066:0.3934	.	.	.	.	X	2478;2477;206;2471	.	ENSP00000220959:R2477X	R	-	1	2	UBR5	103346673	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	2.583000	0.46094	1.179000	0.42884	0.655000	0.94253	CGA		0.393	UBR5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380075.2	NM_015902	
ZCWPW2	152098	mdanderson.org;bcgsc.ca	37	3	28533617	28533617	+	Splice_Site	SNP	G	G	A			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr3:28533617G>A	ENST00000383768.2	+	6	798		c.e6-1		ZCWPW2_ENST00000421010.1_Splice_Site			Q504Y3	ZCPW2_HUMAN	zinc finger, CW type with PWWP domain 2								zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(6)|ovary(2)	17						TTGTCTTACAGATAAATCCGA	0.294																																						.											0													54.0	53.0	53.0					3																	28533617		2203	4300	6503	SO:0001630	splice_region_variant	152098			BC065764	CCDS33723.1	3p23	2005-08-22			ENSG00000206559	ENSG00000206559			23574	protein-coding gene	gene with protein product						14607086	Standard	XM_005264892		Approved	ZCW2	uc003cei.3	Q504Y3	OTTHUMG00000155705	ENST00000383768.2:c.611-1G>A	3.37:g.28533617G>A		Somatic		WXS	Illumina HiSeq	Phase_I		Splice_Site	SNP	ENST00000383768.2	37	CCDS33723.1	.	.	.	.	.	.	.	.	.	.	G	13.11	2.140642	0.37825	.	.	ENSG00000206559	ENST00000383768;ENST00000421010;ENST00000419130	.	.	.	4.96	4.96	0.65561	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.0497	0.64727	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ZCWPW2	28508621	1.000000	0.71417	1.000000	0.80357	0.369000	0.29798	4.393000	0.59665	2.444000	0.82710	0.650000	0.86243	.		0.294	ZCWPW2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341318.1	XM_087384	Intron
ZCWPW2	152098	mdanderson.org	37	3	28533652	28533652	+	Silent	SNP	G	G	A			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr3:28533652G>A	ENST00000383768.2	+	6	833	c.645G>A	c.(643-645)ctG>ctA	p.L215L	ZCWPW2_ENST00000421010.1_Silent_p.L215L			Q504Y3	ZCPW2_HUMAN	zinc finger, CW type with PWWP domain 2	215							zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(6)|ovary(2)	17						TTGCTGCACTGGTCAAGAAAA	0.274																																						.											0													50.0	48.0	49.0					3																	28533652		2203	4300	6503	SO:0001819	synonymous_variant	152098			BC065764	CCDS33723.1	3p23	2005-08-22			ENSG00000206559	ENSG00000206559			23574	protein-coding gene	gene with protein product						14607086	Standard	XM_005264892		Approved	ZCW2	uc003cei.3	Q504Y3	OTTHUMG00000155705	ENST00000383768.2:c.645G>A	3.37:g.28533652G>A		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000383768.2	37	CCDS33723.1	.	.	.	.	.	.	.	.	.	.	G	0.010	-1.746957	0.00669	.	.	ENSG00000206559	ENST00000419130	.	.	.	4.72	-1.03	0.10102	.	.	.	.	.	T	0.21427	0.0516	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.26258	-1.0108	4	.	.	.	-0.0659	3.4655	0.07548	0.4763:0.0:0.3375:0.1862	.	.	.	.	S	100	.	.	G	+	1	0	ZCWPW2	28508656	0.200000	0.23398	0.055000	0.19348	0.007000	0.05969	0.266000	0.18534	-0.063000	0.13065	-0.175000	0.13238	GGT		0.274	ZCWPW2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341318.1	XM_087384	
ZYG11A	440590	mdanderson.org	37	1	53320274	53320274	+	Missense_Mutation	SNP	G	G	T	rs480299	byFrequency	TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr1:53320274G>T	ENST00000371528.1	+	2	376	c.228G>T	c.(226-228)gaG>gaT	p.E76D	ZYG11A_ENST00000371532.1_5'UTR	NM_001004339.2	NP_001004339.2	Q6WRX3	ZY11A_HUMAN	zyg-11 family member A, cell cycle regulator	76										breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|skin(1)	10						AAGTAGCCGAGCGATTTCTCA	0.438													T|||	2951	0.589257	0.8979	0.4424	5008	,	,		19841	0.2292		0.6461	False		,,,				2504	0.589					.											0													127.0	119.0	121.0					1																	53320274		692	1591	2283	SO:0001583	missense	440590				CCDS44148.1	1p32.3	2013-01-17	2012-12-10		ENSG00000203995	ENSG00000203995		"""ZYG11 cell cycle regulator family"""	32058	protein-coding gene	gene with protein product			"""zyg-11 homolog A (C. elegans)"""				Standard	NM_001004339		Approved	ZYG11	uc001cuk.2	Q6WRX3	OTTHUMG00000008923	ENST00000371528.1:c.228G>T	1.37:g.53320274G>T	ENSP00000360583:p.Glu76Asp	Somatic		WXS	Illumina HiSeq	Phase_I	A6NCK5	Missense_Mutation	SNP	ENST00000371528.1	37	CCDS44148.1	1262	0.5778388278388278	431	0.8760162601626016	183	0.505524861878453	160	0.27972027972027974	488	0.6437994722955145	T	0.093	-1.163433	0.01673	.	.	ENSG00000203995	ENST00000371528	T	0.38887	1.11	5.4	0.36	0.16097	.	0.000000	0.85682	N	0.000000	T	0.00012	0.0000	N	0.02539	-0.55	0.54753	P	1.3000000000040757E-5	B	0.02656	0.0	B	0.04013	0.001	T	0.36089	-0.9762	9	0.02654	T	1	-2.953	5.3962	0.16271	0.0:0.2649:0.2522:0.4829	rs480299;rs17192606;rs56637852;rs57065373;rs480299	76	Q6WRX3	ZY11A_HUMAN	D	76	ENSP00000360583:E76D	ENSP00000360583:E76D	E	+	3	2	ZYG11A	53092862	0.992000	0.36948	0.773000	0.31616	0.153000	0.21895	0.233000	0.17911	-0.382000	0.07870	-0.335000	0.08231	GAG		0.438	ZYG11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024856.3	NM_001004339	
TCHH	7062	bcgsc.ca	37	1	152082364	152082364	+	Missense_Mutation	SNP	C	C	T	rs372810614		TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr1:152082364C>T	ENST00000368804.1	-	2	3328	c.3329G>A	c.(3328-3330)tGt>tAt	p.C1110Y		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	1110	10 X 30 AA tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)	p.C1110Y(1)		NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ttcctccCGACATTGCCTCTC	0.597																																						.											1	Substitution - Missense(1)	endometrium(1)											94.0	95.0	94.0					1																	152082364		1970	4147	6117	SO:0001583	missense	7062			L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.3329G>A	1.37:g.152082364C>T	ENSP00000357794:p.Cys1110Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	Q5VUI3	Missense_Mutation	SNP	ENST00000368804.1	37	CCDS41396.1	.	.	.	.	.	.	.	.	.	.	c	4.077	0.012201	0.07912	.	.	ENSG00000159450	ENST00000368804	T	0.04454	3.62	2.96	-4.42	0.03579	.	.	.	.	.	T	0.00328	0.0010	N	0.01576	-0.805	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43702	-0.9375	9	0.02654	T	1	.	3.7854	0.08698	0.4847:0.1083:0.0:0.407	.	1110	Q07283	TRHY_HUMAN	Y	1110	ENSP00000357794:C1110Y	ENSP00000357794:C1110Y	C	-	2	0	TCHH	150348988	0.002000	0.14202	0.000000	0.03702	0.001000	0.01503	0.189000	0.17037	-1.366000	0.02155	-0.598000	0.04106	TGT		0.597	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113	
OR2T4	127074	bcgsc.ca	37	1	248524967	248524967	+	Missense_Mutation	SNP	A	A	C	rs200915140	byFrequency	TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr1:248524967A>C	ENST00000366475.1	+	1	85	c.85A>C	c.(85-87)Atg>Ctg	p.M29L		NM_001004696.1	NP_001004696.1	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T, member 4	29						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(2)|lung(47)	56	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CAAACATCCAATGGCCAATAT	0.498																																						.											0													108.0	92.0	98.0					1																	248524967		2200	4243	6443	SO:0001583	missense	127074			BK004464	CCDS31113.1	1q44	2012-08-09			ENSG00000196944	ENSG00000196944		"""GPCR / Class A : Olfactory receptors"""	15016	protein-coding gene	gene with protein product							Standard	NM_001004696		Approved	OR2T4Q	uc001ieh.1	Q8NH00	OTTHUMG00000040453	ENST00000366475.1:c.85A>C	1.37:g.248524967A>C	ENSP00000355431:p.Met29Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q6IEZ8	Missense_Mutation	SNP	ENST00000366475.1	37	CCDS31113.1	.	.	.	.	.	.	.	.	.	.	A	7.539	0.660235	0.14645	.	.	ENSG00000196944	ENST00000366475	T	0.01505	4.82	1.03	1.03	0.20045	.	0.000000	0.50627	D	0.000118	T	0.01287	0.0042	L	0.27053	0.805	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.47142	-0.9140	10	0.59425	D	0.04	.	1.7485	0.02967	0.4978:0.0:0.2193:0.2829	.	29	Q8NH00	OR2T4_HUMAN	L	29	ENSP00000355431:M29L	ENSP00000355431:M29L	M	+	1	0	OR2T4	246591590	0.804000	0.28969	0.451000	0.26982	0.234000	0.25298	0.925000	0.28791	0.382000	0.24878	0.076000	0.15429	ATG		0.498	OR2T4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097349.2	NM_001004696	
OR5AK2	390181	bcgsc.ca	37	11	56756941	56756941	+	Missense_Mutation	SNP	C	C	T			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr11:56756941C>T	ENST00000326855.2	+	1	595	c.553C>T	c.(553-555)Ctt>Ttt	p.L185F		NM_001005323.1	NP_001005323.1	Q8NH90	O5AK2_HUMAN	olfactory receptor, family 5, subfamily AK, member 2	185						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(3)|endometrium(1)|large_intestine(4)|lung(3)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	21						TCCCCCTATTCTTGCTCTTTC	0.408																																						.											0													348.0	311.0	324.0					11																	56756941		2201	4296	6497	SO:0001583	missense	390181			AB065496	CCDS31538.1	11q11	2012-08-09			ENSG00000181273	ENSG00000181273		"""GPCR / Class A : Olfactory receptors"""	15251	protein-coding gene	gene with protein product							Standard	NM_001005323		Approved		uc010rjp.2	Q8NH90	OTTHUMG00000167019	ENST00000326855.2:c.553C>T	11.37:g.56756941C>T	ENSP00000322784:p.Leu185Phe	Somatic		WXS	Illumina HiSeq	Phase_I	B2RNZ9	Missense_Mutation	SNP	ENST00000326855.2	37	CCDS31538.1	.	.	.	.	.	.	.	.	.	.	C	7.340	0.620621	0.14193	.	.	ENSG00000181273	ENST00000326855	T	0.00325	8.1	3.85	0.549	0.17213	GPCR, rhodopsin-like superfamily (1);	0.222920	0.22703	N	0.056674	T	0.00440	0.0014	M	0.64676	1.99	0.09310	N	1	D	0.67145	0.996	D	0.70716	0.97	T	0.48614	-0.9020	10	0.56958	D	0.05	-30.6449	8.696	0.34296	0.1499:0.5052:0.3448:0.0	.	185	Q8NH90	O5AK2_HUMAN	F	185	ENSP00000322784:L185F	ENSP00000322784:L185F	L	+	1	0	OR5AK2	56513517	0.000000	0.05858	0.188000	0.23233	0.040000	0.13550	-1.136000	0.03222	0.014000	0.14944	0.194000	0.17425	CTT		0.408	OR5AK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392446.1	NM_001005323	
OR4K17	390436	bcgsc.ca	37	14	20586425	20586425	+	Frame_Shift_Del	DEL	T	T	-			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr14:20586425delT	ENST00000315543.4	+	1	860	c.860delT	c.(859-861)tttfs	p.F287fs		NM_001004715.1	NP_001004715.1	Q8NGC6	OR4KH_HUMAN	olfactory receptor, family 4, subfamily K, member 17	259						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(4)|lung(12)|pancreas(1)|skin(3)	21	all_cancers(95;0.00108)		Epithelial(56;7.58e-07)|all cancers(55;3.77e-06)	GBM - Glioblastoma multiforme(265;0.0144)		CCATGCATCTTTATCTACATT	0.423																																						.											0													114.0	104.0	107.0					14																	20586425		2203	4300	6503	SO:0001589	frameshift_variant	390436				CCDS32030.1	14q11.2	2013-09-23			ENSG00000176230	ENSG00000176230		"""GPCR / Class A : Olfactory receptors"""	15355	protein-coding gene	gene with protein product							Standard	NM_001004715		Approved		uc001vwo.1	Q8NGC6	OTTHUMG00000170783	ENST00000315543.4:c.860delT	14.37:g.20586425delT	ENSP00000319197:p.Phe287fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q6IF12	Frame_Shift_Del	DEL	ENST00000315543.4	37	CCDS32030.1																																																																																				0.423	OR4K17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410346.1		
ERC2	26059	bcgsc.ca	37	3	55984501	55984503	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	CTT	CTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr3:55984501_55984503delCTT	ENST00000288221.6	-	13	2608_2610	c.2353_2355delAAG	c.(2353-2355)aagdel	p.K785del		NM_015576.1	NP_056391.1	O15083	ERC2_HUMAN	ELKS/RAB6-interacting/CAST family member 2	785						cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|growth cone (GO:0030426)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)				breast(2)|endometrium(5)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|urinary_tract(1)	31				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		GCCTGCGCACTTCTTCTAGTAAC	0.433																																						.											0																																										SO:0001651	inframe_deletion	26059			AB002376	CCDS46851.1	3p14.3	2006-08-14			ENSG00000187672	ENSG00000187672			31922	protein-coding gene	gene with protein product							Standard	NM_015576		Approved	CAST, CAST1, KIAA0378, SPBC110, Spc110, ELKSL	uc003dhr.1	O15083	OTTHUMG00000158390	ENST00000288221.6:c.2353_2355delAAG	3.37:g.55984501_55984503delCTT	ENSP00000288221:p.Lys785del	Somatic		WXS	Illumina HiSeq	Phase_I	Q2T9F6|Q86TK4	In_Frame_Del	DEL	ENST00000288221.6	37	CCDS46851.1																																																																																				0.433	ERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350884.2	NM_015576	
MCM9	254394	bcgsc.ca	37	6	119136171	119136171	+	Missense_Mutation	SNP	T	T	C			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr6:119136171T>C	ENST00000316316.6	-	13	3534	c.3248A>G	c.(3247-3249)gAg>gGg	p.E1083G		NM_017696.2	NP_060166.2	Q9NXL9	MCM9_HUMAN	minichromosome maintenance complex component 9	1083					cellular response to DNA damage stimulus (GO:0006974)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|female gamete generation (GO:0007292)	MCM8-MCM9 complex (GO:0097362)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		all_cancers(87;0.122)|all_epithelial(87;0.179)		GBM - Glioblastoma multiforme(226;0.0676)|OV - Ovarian serous cystadenocarcinoma(136;0.194)		TGGGCCTCTCTCACCTCGGTT	0.502																																						.											0																																										SO:0001583	missense	254394			BC031658	CCDS5121.1, CCDS56447.1	6q22.31	2009-11-16	2007-04-04	2007-04-04	ENSG00000111877	ENSG00000111877			21484	protein-coding gene	gene with protein product		610098	"""minichromosome maintenance deficient domain containing 1"", ""chromosome 6 open reading frame 61"""	MCMDC1, C6orf61		16226853, 15850810, 16495042	Standard	NM_153255		Approved	MGC35304, dJ329L24.3, FLJ20170	uc021zeh.1	Q9NXL9	OTTHUMG00000015468	ENST00000316316.6:c.3248A>G	6.37:g.119136171T>C	ENSP00000314505:p.Glu1083Gly	Somatic		WXS	Illumina HiSeq	Phase_I	B4DR30|B9DI77|Q2KHJ0|Q8N5S5|Q9HCV5	Missense_Mutation	SNP	ENST00000316316.6	37	CCDS56447.1	.	.	.	.	.	.	.	.	.	.	T	13.38	2.219151	0.39201	.	.	ENSG00000111877	ENST00000316316	T	0.04194	3.68	6.08	0.734	0.18294	.	8.553310	0.00575	U	0.000315	T	0.01287	0.0042	L	0.31294	0.92	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.44817	-0.9303	10	0.28530	T	0.3	.	5.9011	0.18967	0.0:0.1353:0.2613:0.6034	.	1083	Q9NXL9	MCM9_HUMAN	G	1083	ENSP00000314505:E1083G	ENSP00000314505:E1083G	E	-	2	0	MCM9	119242874	0.000000	0.05858	0.003000	0.11579	0.043000	0.13939	0.032000	0.13732	0.178000	0.19917	0.533000	0.62120	GAG		0.502	MCM9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042005.4	NM_153255	
MT-ND6	4541	bcgsc.ca	37	M	14159	14159	+	Missense_Mutation	SNP	C	C	A			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chrM:14159C>A	ENST00000361681.2	-	1	514	c.515G>T	c.(514-516)cGg>cTg	p.R172L	MT-TH_ENST00000387441.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TL2_ENST00000387456.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TP_ENST00000387461.2_RNA			P03923	NU6M_HUMAN	mitochondrially encoded NADH dehydrogenase 6	172					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain (GO:0070469)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(10)|kidney(17)|urinary_tract(1)	29						ACCTATTCCCCCGAGCAATCT	0.403																																						.											0																																										SO:0001583	missense	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198695	ENSG00000198695	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7462	protein-coding gene	gene with protein product	"""complex I ND6 subunit"", ""NADH-ubiquinone oxidoreductase chain 6"""	516006	"""NADH dehydrogenase 6"""	MTND6			Standard			Approved	NAD6, ND6		P03923		ENST00000361681.2:c.515G>T	M.37:g.14159C>A	ENSP00000354665:p.Arg172Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q34774|Q8HG30	Missense_Mutation	SNP	ENST00000361681.2	37																																																																																					0.403	MT-ND6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024037	
OR4K17	390436	bcgsc.ca	37	14	20586434	20586435	+	Frame_Shift_Ins	INS	-	-	T			TCGA-KL-8341-01A-11D-2310-10	TCGA-KL-8341-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e9032df3-8692-4146-a867-b9b64c9b310a	9f1b349f-503a-4237-8da4-9100de610e1e	g.chr14:20586434_20586435insT	ENST00000315543.4	+	1	869_870	c.869_870insT	c.(868-873)atttggfs	p.W291fs		NM_001004715.1	NP_001004715.1	Q8NGC6	OR4KH_HUMAN	olfactory receptor, family 4, subfamily K, member 17	263						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(4)|lung(12)|pancreas(1)|skin(3)	21	all_cancers(95;0.00108)		Epithelial(56;7.58e-07)|all cancers(55;3.77e-06)	GBM - Glioblastoma multiforme(265;0.0144)		TTTATCTACATTTGGCCCTTCG	0.426																																						.											0																																										SO:0001589	frameshift_variant	390436				CCDS32030.1	14q11.2	2013-09-23			ENSG00000176230	ENSG00000176230		"""GPCR / Class A : Olfactory receptors"""	15355	protein-coding gene	gene with protein product							Standard	NM_001004715		Approved		uc001vwo.1	Q8NGC6	OTTHUMG00000170783	ENST00000315543.4:c.871dupT	14.37:g.20586436_20586436dupT	ENSP00000319197:p.Trp291fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q6IF12	Frame_Shift_Ins	INS	ENST00000315543.4	37	CCDS32030.1																																																																																				0.426	OR4K17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410346.1		
