#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SKIDA1	387640	hgsc.bcm.edu	37	10	21805486	21805486	+	Silent	SNP	C	C	T			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr10:21805486C>T	ENST00000449193.2	-	4	3518	c.1266G>A	c.(1264-1266)gaG>gaA	p.E422E	SKIDA1_ENST00000444772.3_Silent_p.E343E|SKIDA1_ENST00000487107.1_5'Flank	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	341						nucleus (GO:0005634)		p.E422E(2)									cctcttcctcctcctcctcct	0.632																																						.											2	Substitution - coding silent(2)	large_intestine(2)											5.0	6.0	6.0					10																	21805486		1988	4108	6096	SO:0001819	synonymous_variant	387640			AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.1266G>A	10.37:g.21805486C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B1ANA5|Q6ZMX4|Q8N3C3	Silent	SNP	ENST00000449193.2	37	CCDS44363.1																																																																																				0.632	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286950.2	NM_207371	
MTOR	2475	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	1	11187847	11187847	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr1:11187847A>G	ENST00000361445.4	-	44	6126	c.6050T>C	c.(6049-6051)aTc>aCc	p.I2017T	MTOR_ENST00000376838.1_Missense_Mutation_p.I222T	NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	2017	Sufficient for interaction with the FKBP1A/rapamycin complex. {ECO:0000250}.				cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	GGCCACTCGGATCAGCTCCTC	0.498																																						.											0													155.0	161.0	159.0					1																	11187847		2203	4300	6503	SO:0001583	missense	2475			L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.6050T>C	1.37:g.11187847A>G	ENSP00000354558:p.Ile2017Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	ENST00000361445.4	37	CCDS127.1	.	.	.	.	.	.	.	.	.	.	A	24.0	4.480085	0.84747	.	.	ENSG00000198793	ENST00000361445;ENST00000376838	T;T	0.12039	2.91;2.72	5.8	5.8	0.92144	FKBP12-rapamycin-associated protein, FKBP12-rapamycin-binding (1);	0.000000	0.85682	D	0.000000	T	0.49541	0.1563	M	0.93854	3.465	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.63368	-0.6653	10	0.87932	D	0	-10.5918	16.1549	0.81657	1.0:0.0:0.0:0.0	.	2017	P42345	MTOR_HUMAN	T	2017;222	ENSP00000354558:I2017T;ENSP00000366034:I222T	ENSP00000354558:I2017T	I	-	2	0	MTOR	11110434	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.923000	0.92808	2.209000	0.71365	0.533000	0.62120	ATC		0.498	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1	NM_004958	
PAMR1	25891	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	11	35492290	35492290	+	Missense_Mutation	SNP	C	C	T			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr11:35492290C>T	ENST00000378880.2	-	5	1016	c.571G>A	c.(571-573)Gat>Aat	p.D191N	PAMR1_ENST00000534803.1_5'UTR|PAMR1_ENST00000378878.3_Intron|PAMR1_ENST00000278360.3_Missense_Mutation_p.D191N|PAMR1_ENST00000532848.1_Missense_Mutation_p.D151N	NM_001001991.1	NP_001001991.1	Q6UXH9	PAMR1_HUMAN	peptidase domain containing associated with muscle regeneration 1	191	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	26						ATCTGGCCATCGCGGTTGTCT	0.542																																						.											0													141.0	107.0	119.0					11																	35492290		2202	4298	6500	SO:0001583	missense	25891				CCDS7898.1, CCDS31460.1, CCDS60759.1, CCDS60760.1	11p13	2009-09-30			ENSG00000149090	ENSG00000149090			24554	protein-coding gene	gene with protein product	"""regeneration-associated muscle protease"""					15111323	Standard	NM_001282675		Approved	RAMP, DKFZP586H2123	uc001mwf.3	Q6UXH9	OTTHUMG00000166328	ENST00000378880.2:c.571G>A	11.37:g.35492290C>T	ENSP00000368158:p.Asp191Asn	Somatic		WXS	Illumina HiSeq	Phase_I	A8MQ58|B7ZA73|Q5EBL7|Q5JPI4|Q6N062|Q71RE9|Q96JW2|Q9Y432	Missense_Mutation	SNP	ENST00000378880.2	37	CCDS31460.1	.	.	.	.	.	.	.	.	.	.	C	1.701	-0.501550	0.04261	.	.	ENSG00000149090	ENST00000278360;ENST00000378880;ENST00000532848;ENST00000527605	T;T;T;T	0.18016	2.24;2.24;2.24;2.24	5.39	3.43	0.39272	CUB (5);	0.199701	0.52532	N	0.000080	T	0.09905	0.0243	N	0.11756	0.17	0.80722	D	1	B;B	0.16802	0.019;0.015	B;B	0.15052	0.012;0.012	T	0.10567	-1.0624	10	0.87932	D	0	.	9.4997	0.39011	0.1413:0.7822:0.0:0.0765	.	191;191	Q6UXH9;Q6UXH9-2	PAMR1_HUMAN;.	N	191;191;151;151	ENSP00000278360:D191N;ENSP00000368158:D191N;ENSP00000433868:D151N;ENSP00000432591:D151N	ENSP00000278360:D191N	D	-	1	0	PAMR1	35448866	0.984000	0.35163	0.009000	0.14445	0.011000	0.07611	2.568000	0.45965	0.574000	0.29417	0.655000	0.94253	GAT		0.542	PAMR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389177.1	NM_015430	
STIL	6491	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	1	47717422	47717422	+	Nonsense_Mutation	SNP	G	G	A			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr1:47717422G>A	ENST00000360380.3	-	18	3613	c.3250C>T	c.(3250-3252)Cga>Tga	p.R1084*	STIL_ENST00000243182.6_Nonsense_Mutation_p.R1084*|STIL_ENST00000371877.3_Nonsense_Mutation_p.R1085*|STIL_ENST00000396221.2_Nonsense_Mutation_p.R1067*|STIL_ENST00000337817.5_Nonsense_Mutation_p.R1084*	NM_001282936.1	NP_001269865.1	Q15468	STIL_HUMAN	SCL/TAL1 interrupting locus	1084					cell proliferation (GO:0008283)|determination of left/right symmetry (GO:0007368)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|forebrain development (GO:0030900)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural tube closure (GO:0001843)|neural tube development (GO:0021915)|notochord development (GO:0030903)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	36		Acute lymphoblastic leukemia(5;0.00116)|all_hematologic(5;0.00444)				TGGTTCGATCGAGTGACAGAC	0.408																																						.											0													145.0	149.0	147.0					1																	47717422		2203	4300	6503	SO:0001587	stop_gained	6491			M74558	CCDS548.1, CCDS41329.1, CCDS72785.1, CCDS72786.1	1p32	2010-02-09	2005-11-29	2005-11-29	ENSG00000123473	ENSG00000123473			10879	protein-coding gene	gene with protein product		181590	"""TAL1 (SCL) interrupting locus"""	SIL		2209547	Standard	NM_003035		Approved	MCPH7	uc001crd.1	Q15468	OTTHUMG00000007851	ENST00000360380.3:c.3250C>T	1.37:g.47717422G>A	ENSP00000353544:p.Arg1084*	Somatic		WXS	Illumina HiSeq	Phase_I	Q5T0C5|Q68CN9	Nonsense_Mutation	SNP	ENST00000360380.3	37	CCDS548.1	.	.	.	.	.	.	.	.	.	.	G	42	9.376454	0.99153	.	.	ENSG00000123473	ENST00000360380;ENST00000337817;ENST00000371877;ENST00000396221;ENST00000243182	.	.	.	5.58	5.58	0.84498	.	0.406128	0.29760	N	0.011275	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.4228	19.5713	0.95421	0.0:0.0:1.0:0.0	.	.	.	.	X	1084;1084;1085;1067;1084	.	ENSP00000243182:R1084X	R	-	1	2	STIL	47490009	0.983000	0.35010	0.999000	0.59377	0.985000	0.73830	4.224000	0.58593	2.623000	0.88846	0.460000	0.39030	CGA		0.408	STIL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000021649.2	NM_003035	
EPHX1	2052	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	226027678	226027678	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr1:226027678T>C	ENST00000366837.4	+	6	1067	c.871T>C	c.(871-873)Tac>Cac	p.Y291H	RP11-285F7.2_ENST00000424332.1_RNA|EPHX1_ENST00000272167.5_Missense_Mutation_p.Y291H	NM_000120.3	NP_000111.1	P07099	HYEP_HUMAN	epoxide hydrolase 1, microsomal (xenobiotic)	291					aromatic compound catabolic process (GO:0019439)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	cis-stilbene-oxide hydrolase activity (GO:0033961)|epoxide hydrolase activity (GO:0004301)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(7)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	28	Breast(184;0.197)					GAAGGTATTCTACAGCCTGAT	0.602																																						.											0													143.0	124.0	130.0					1																	226027678		2203	4300	6503	SO:0001583	missense	2052			J03518	CCDS1547.1	1q42.1	2009-07-10			ENSG00000143819	ENSG00000143819	3.3.2.9		3401	protein-coding gene	gene with protein product		132810		EPHX		9925921	Standard	NM_000120		Approved		uc001hpk.3	P07099	OTTHUMG00000037743	ENST00000366837.4:c.871T>C	1.37:g.226027678T>C	ENSP00000355802:p.Tyr291His	Somatic		WXS	Illumina HiSeq	Phase_I	B2R8N0|Q5VTJ6|Q9NP75|Q9NPE7|Q9NQU6|Q9NQU7|Q9NQU8|Q9NQU9|Q9NQV0|Q9NQV1|Q9NQV2	Missense_Mutation	SNP	ENST00000366837.4	37	CCDS1547.1	.	.	.	.	.	.	.	.	.	.	T	10.73	1.432369	0.25813	.	.	ENSG00000143819	ENST00000272167;ENST00000366837	T;T	0.61510	0.1;0.1	5.57	3.13	0.36017	Alpha/beta hydrolase fold-1 (1);	0.477487	0.24198	N	0.040659	T	0.38268	0.1034	L	0.31420	0.93	0.09310	N	1	B	0.11235	0.004	B	0.21151	0.033	T	0.08659	-1.0711	10	0.17369	T	0.5	-21.0142	5.624	0.17473	0.2271:0.1197:0.0:0.6532	.	291	P07099	HYEP_HUMAN	H	291	ENSP00000272167:Y291H;ENSP00000355802:Y291H	ENSP00000272167:Y291H	Y	+	1	0	EPHX1	224094301	0.062000	0.20869	0.864000	0.33941	0.491000	0.33493	-0.281000	0.08456	2.126000	0.65437	0.482000	0.46254	TAC		0.602	EPHX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092064.1	NM_000120	
ITGAX	3687	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	16	31393193	31393193	+	Missense_Mutation	SNP	G	G	A			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr16:31393193G>A	ENST00000268296.4	+	30	3578	c.3457G>A	c.(3457-3459)Ggg>Agg	p.G1153R	ITGAX_ENST00000562522.1_Missense_Mutation_p.G1153R	NM_000887.3	NP_000878.2	P20702	ITAX_HUMAN	integrin, alpha X (complement component 3 receptor 4 subunit)	1153					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|organ morphogenesis (GO:0009887)	cell surface (GO:0009986)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(42)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	77						CCCAGAAAACGGGACACAGAC	0.537																																						.											0													137.0	145.0	142.0					16																	31393193		2197	4300	6497	SO:0001583	missense	3687			BC038237	CCDS10711.1, CCDS67014.1	16p11.2	2010-03-23	2006-02-10		ENSG00000140678	ENSG00000140678		"""CD molecules"", ""Complement system"", ""Integrins"""	6152	protein-coding gene	gene with protein product		151510	"""integrin, alpha X (antigen CD11C (p150), alpha polypeptide)"""	CD11C		3284962, 2303426	Standard	NM_001286375		Approved	CD11c	uc002ebu.1	P20702	OTTHUMG00000132465	ENST00000268296.4:c.3457G>A	16.37:g.31393193G>A	ENSP00000268296:p.Gly1153Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q8IVA6	Missense_Mutation	SNP	ENST00000268296.4	37	CCDS10711.1	.	.	.	.	.	.	.	.	.	.	G	11.00	1.511074	0.27036	.	.	ENSG00000140678	ENST00000268296	T	0.59772	0.24	5.41	3.45	0.39498	.	.	.	.	.	T	0.49355	0.1552	L	0.55990	1.75	0.09310	N	1	B;B	0.24258	0.022;0.1	B;B	0.15870	0.003;0.014	T	0.37753	-0.9692	9	0.36615	T	0.2	.	8.6787	0.34196	0.1788:0.0:0.8212:0.0	.	1153;338	P20702;Q8TES5	ITAX_HUMAN;.	R	1153	ENSP00000268296:G1153R	ENSP00000268296:G1153R	G	+	1	0	ITGAX	31300694	0.001000	0.12720	0.001000	0.08648	0.027000	0.11550	0.532000	0.23067	0.755000	0.32990	-0.216000	0.12614	GGG		0.537	ITGAX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255628.2	NM_000887	
GALNS	2588	broad.mit.edu;hgsc.bcm.edu	37	16	88908341	88908346	+	In_Frame_Del	DEL	TGCGGA	TGCGGA	-	rs118204441		TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	TGCGGA	TGCGGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr16:88908341_88908346delTGCGGA	ENST00000268695.5	-	3	366_371	c.278_283delTCCGCA	c.(277-285)atccgcaat>aat	p.IR93del	GALNS_ENST00000565364.1_5'UTR|GALNS_ENST00000542788.1_Intron	NM_000512.4	NP_000503.1	P34059	GALNS_HUMAN	galactosamine (N-acetyl)-6-sulfatase	93	Catalytic domain.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	metal ion binding (GO:0046872)|N-acetylgalactosamine-4-sulfatase activity (GO:0003943)|N-acetylgalactosamine-6-sulfatase activity (GO:0043890)|sulfuric ester hydrolase activity (GO:0008484)			breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(8)	22				BRCA - Breast invasive adenocarcinoma(80;0.0496)		TAGAAGCCATTGCGGATGGGTAGCCG	0.617																																					GBM(129;1929 2344 25209 33204)	.											0			GRCh37	CM054741|CM950526|CM950527	GALNS	M	rs118204441																																			SO:0001651	inframe_deletion	2588			D17629	CCDS10970.1	16q24.3	2014-07-03	2014-07-03		ENSG00000141012	ENSG00000141012	3.1.6.4	"""Arylsulfatase family"""	4122	protein-coding gene	gene with protein product	"""Morquio syndrome"", ""mucopolysaccharidosis type IVA"""	612222	"""galactosamine (N-acetyl)-6-sulfate sulfatase"""			1755850	Standard	NM_000512		Approved	GAS, GALNAC6S	uc002fly.4	P34059	OTTHUMG00000137862	ENST00000268695.5:c.278_283delTCCGCA	16.37:g.88908341_88908346delTGCGGA	ENSP00000268695:p.Ile93_Arg94del	Somatic		WXS	Illumina HiSeq	Phase_I	Q86VK3	In_Frame_Del	DEL	ENST00000268695.5	37	CCDS10970.1																																																																																				0.617	GALNS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269543.1		
SPATA20	64847	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	17	48629513	48629513	+	Silent	SNP	G	G	T			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr17:48629513G>T	ENST00000356488.4	+	13	1964	c.1881G>T	c.(1879-1881)ggG>ggT	p.G627G	SPATA20_ENST00000006658.6_Silent_p.G643G|SPATA20_ENST00000393244.3_Silent_p.G583G|SPATA20_ENST00000511937.1_3'UTR	NM_001258372.1	NP_001245301.1	Q8TB22	SPT20_HUMAN	spermatogenesis associated 20	627					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)	catalytic activity (GO:0003824)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;9.38e-09)			CTGAGCTGGGGGCTGGCCTGC	0.652																																						.											0													24.0	29.0	27.0					17																	48629513		2203	4300	6503	SO:0001819	synonymous_variant	64847				CCDS11571.1, CCDS58563.1, CCDS58564.1	17q21.33	2011-03-17			ENSG00000006282	ENSG00000006282			26125	protein-coding gene	gene with protein product	"""hypothetical protein FLJ21347"""	613939				12477932	Standard	NM_022827		Approved	FLJ21347, SSP411, Tisp78	uc002ird.3	Q8TB22	OTTHUMG00000162162	ENST00000356488.4:c.1881G>T	17.37:g.48629513G>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q2TA99|Q2XUZ6|Q6P0P1|Q8WVW3|Q9H747	Silent	SNP	ENST00000356488.4	37	CCDS58563.1																																																																																				0.652	SPATA20-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367651.1	NM_022827	
SIGLEC12	89858	hgsc.bcm.edu	37	19	52004795	52004796	+	Frame_Shift_Ins	INS	-	-	T	rs61742108|rs371016684	byFrequency	TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr19:52004795_52004796insT	ENST00000291707.3	-	1	247_248	c.192_193insA	c.(190-195)ttccggfs	p.R65fs	SIGLEC12_ENST00000598614.1_5'Flank	NM_053003.2	NP_443729.1	Q96PQ1	SIG12_HUMAN	sialic acid binding Ig-like lectin 12 (gene/pseudogene)	65	Ig-like V-type 1.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(2)|biliary_tract(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(1)|lung(23)|ovary(4)|prostate(2)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)	61		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.0102)		TCCCCTGCCCGGAACCAGTAGC	0.599																																						.											0										2425,1839		698,1029,405						-4.6	0.0		dbSNP_130	75	5278,2976		1674,1930,523	no	frameshift	SIGLEC12	NM_053003.2		2372,2959,928	A1A1,A1R,RR		36.0552,43.1285,38.4646				7703,4815				SO:0001589	frameshift_variant	89858			AF282256	CCDS12833.1, CCDS59416.1	19q13.41	2013-01-29	2011-06-29	2004-10-20	ENSG00000254521	ENSG00000254521		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15482	protein-coding gene	gene with protein product		606094	"""SIGLEC-like 1"", ""sialic acid binding Ig-like lectin 12"""	SIGLECL1		11409877, 11328818, 21555517	Standard	NM_053003		Approved	SLG, S2V, Siglec-XII, Siglec-12, Siglec-L1	uc002pwx.1	Q96PQ1	OTTHUMG00000165524	ENST00000291707.3:c.192_193insA	19.37:g.52004795_52004796insT	ENSP00000291707:p.Arg65fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q8IYH7	Frame_Shift_Ins	INS	ENST00000291707.3	37	CCDS12833.1																																																																																				0.599	SIGLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384641.2	NM_053003	
RASL11B	65997	hgsc.bcm.edu	37	4	53728693	53728694	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	AT	AT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr4:53728693_53728694delAT	ENST00000248706.3	+	1	237_238	c.19_20delAT	c.(19-21)atgfs	p.M7fs		NM_023940.2	NP_076429.1			RAS-like, family 11, member B											autonomic_ganglia(1)|central_nervous_system(1)|lung(5)|ovary(1)|stomach(1)	9			LUSC - Lung squamous cell carcinoma(32;0.0302)			CATTCAGAACATGTGCACCATC	0.733																																						.											0																																										SO:0001589	frameshift_variant	65997			BK001672	CCDS3490.1	4q12	2014-05-09			ENSG00000128045	ENSG00000128045			23804	protein-coding gene	gene with protein product		612404					Standard	NM_023940		Approved		uc003gzt.3	Q9BPW5	OTTHUMG00000102097	ENST00000248706.3:c.19_20delAT	4.37:g.53728693_53728694delAT	ENSP00000248706:p.Met7fs	Somatic		WXS	Illumina HiSeq	Phase_I		Frame_Shift_Del	DEL	ENST00000248706.3	37	CCDS3490.1																																																																																				0.733	RASL11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219931.2	NM_023940	
FAM160B2	64760	broad.mit.edu;hgsc.bcm.edu	37	8	21956855	21956855	+	Frame_Shift_Del	DEL	C	C	-			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr8:21956855delC	ENST00000289921.7	+	9	1181	c.1135delC	c.(1135-1137)cccfs	p.P379fs		NM_022749.5	NP_073586.5	Q86V87	F16B2_HUMAN	family with sequence similarity 160, member B2	379										endometrium(2)|kidney(1)|lung(2)|prostate(3)|urinary_tract(1)	9						GACCCTGCAGCCCCAGCTCCT	0.587																																						.											0													48.0	54.0	52.0					8																	21956855		2138	4235	6373	SO:0001589	frameshift_variant	64760			AK025454	CCDS6021.2	8p21.3	2012-11-30	2008-06-05	2008-06-05	ENSG00000158863	ENSG00000158863			16492	protein-coding gene	gene with protein product			"""retinoic acid induced 16"""	RAI16		22971576, 15626329	Standard	XR_247128		Approved	FLJ21801	uc011kyx.2	Q86V87	OTTHUMG00000097088	ENST00000289921.7:c.1135delC	8.37:g.21956855delC	ENSP00000289921:p.Pro379fs	Somatic		WXS	Illumina HiSeq	Phase_I	B2RDQ5|B3KNX1|Q2M211|Q71JB5|Q7L3J6|Q969T0|Q9H6W4	Frame_Shift_Del	DEL	ENST00000289921.7	37	CCDS6021.2																																																																																				0.587	FAM160B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375334.2		
BAG3	9531	broad.mit.edu;hgsc.bcm.edu;bcgsc.ca	37	10	121431909	121431909	+	Missense_Mutation	SNP	C	C	T			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr10:121431909C>T	ENST00000369085.3	+	3	956	c.650C>T	c.(649-651)aCc>aTc	p.T217I		NM_004281.3	NP_004272.2	O95817	BAG3_HUMAN	BCL2-associated athanogene 3	217					brain development (GO:0007420)|cellular response to mechanical stimulus (GO:0071260)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|negative regulation of apoptotic process (GO:0043066)|negative regulation of striated muscle cell apoptotic process (GO:0010664)|protein folding (GO:0006457)|protein stabilization (GO:0050821)|spinal cord development (GO:0021510)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|Z disc (GO:0030018)				endometrium(3)|kidney(1)|large_intestine(3)|liver(2)|lung(5)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	20		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.00187)|BRCA - Breast invasive adenocarcinoma(275;0.148)		CAGAACGTTACCCGGCCAGCA	0.647																																						.											0													85.0	83.0	83.0					10																	121431909		2203	4300	6503	SO:0001583	missense	9531			AF095193	CCDS7615.1	10q25.2-q26.2	2014-09-17			ENSG00000151929	ENSG00000151929			939	protein-coding gene	gene with protein product		603883				9873016, 18094623	Standard	XM_005270287		Approved		uc001lem.3	O95817	OTTHUMG00000019155	ENST00000369085.3:c.650C>T	10.37:g.121431909C>T	ENSP00000358081:p.Thr217Ile	Somatic		WXS	Illumina HiSeq	Phase_I	A8K5L8|Q3B763|Q9NT20|Q9P120	Missense_Mutation	SNP	ENST00000369085.3	37	CCDS7615.1	.	.	.	.	.	.	.	.	.	.	C	11.72	1.723148	0.30503	.	.	ENSG00000151929	ENST00000369085;ENST00000450186	T;T	0.74632	-0.86;-0.84	6.17	1.97	0.26223	.	0.855613	0.10915	N	0.620169	T	0.64057	0.2564	L	0.51422	1.61	0.09310	N	1	B;B	0.24823	0.112;0.112	B;B	0.19148	0.024;0.024	T	0.51756	-0.8665	10	0.33141	T	0.24	-2.95	6.1116	0.20104	0.2229:0.4998:0.2167:0.0607	.	217;217	O95817;Q53GY1	BAG3_HUMAN;.	I	217;159	ENSP00000358081:T217I;ENSP00000410036:T159I	ENSP00000358081:T217I	T	+	2	0	BAG3	121421899	0.000000	0.05858	0.562000	0.28370	0.963000	0.63663	-0.043000	0.12043	0.875000	0.35847	0.655000	0.94253	ACC		0.647	BAG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050662.1	NM_004281	
FOXJ3	22887	hgsc.bcm.edu	37	1	42693588	42693588	+	Missense_Mutation	SNP	G	G	A			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr1:42693588G>A	ENST00000372572.1	-	7	805	c.494C>T	c.(493-495)aCt>aTt	p.T165I	FOXJ3_ENST00000545068.1_Missense_Mutation_p.T165I|FOXJ3_ENST00000372573.1_Missense_Mutation_p.T165I|FOXJ3_ENST00000361346.1_Missense_Mutation_p.T165I|FOXJ3_ENST00000361776.1_Missense_Mutation_p.T165I	NM_001198851.1	NP_001185780.1	Q9UPW0	FOXJ3_HUMAN	forkhead box J3	165					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	18	Ovarian(52;0.01)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CTTTGGCCGAGTAGGCAGCAC	0.383																																						.											0													107.0	97.0	100.0					1																	42693588		2203	4300	6503	SO:0001583	missense	22887			AB028964	CCDS30689.1, CCDS55594.1	1p34.2	2008-04-10			ENSG00000198815	ENSG00000198815		"""Forkhead boxes"""	29178	protein-coding gene	gene with protein product							Standard	NM_014947		Approved	KIAA1041	uc001chf.3	Q9UPW0	OTTHUMG00000007026	ENST00000372572.1:c.494C>T	1.37:g.42693588G>A	ENSP00000361653:p.Thr165Ile	Somatic		WXS	Illumina HiSeq	Phase_I	A7MBL7|A7MD18|D3DPW2|Q9NSS7	Missense_Mutation	SNP	ENST00000372572.1	37	CCDS30689.1	.	.	.	.	.	.	.	.	.	.	G	18.53	3.644135	0.67244	.	.	ENSG00000198815	ENST00000372573;ENST00000372572;ENST00000361346;ENST00000361776;ENST00000545068;ENST00000445886	D;D;D;D;D;D	0.95447	-3.71;-3.71;-3.71;-3.71;-3.71;-3.71	5.68	5.68	0.88126	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (2);	0.121361	0.52532	D	0.000065	D	0.93621	0.7963	L	0.34521	1.04	0.54753	D	0.999985	B;P	0.35363	0.018;0.497	B;B	0.42188	0.053;0.379	D	0.92467	0.5982	10	0.36615	T	0.2	.	17.2843	0.87137	0.0:0.0:1.0:0.0	.	165;165	Q9UPW0-2;Q9UPW0	.;FOXJ3_HUMAN	I	165	ENSP00000361654:T165I;ENSP00000361653:T165I;ENSP00000354620:T165I;ENSP00000354449:T165I;ENSP00000439044:T165I;ENSP00000393408:T165I	ENSP00000354620:T165I	T	-	2	0	FOXJ3	42466175	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.932000	0.70121	2.666000	0.90696	0.655000	0.94253	ACT		0.383	FOXJ3-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000018310.1	NM_014947	
SECISBP2L	9728	hgsc.bcm.edu;bcgsc.ca	37	15	49304956	49304956	+	Missense_Mutation	SNP	T	T	A			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr15:49304956T>A	ENST00000559471.1	-	12	1883	c.1620A>T	c.(1618-1620)aaA>aaT	p.K540N	SECISBP2L_ENST00000261847.3_Missense_Mutation_p.K495N	NM_001193489.1	NP_001180418.1	Q93073	SBP2L_HUMAN	SECIS binding protein 2-like	540							poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(5)|kidney(8)|large_intestine(12)|lung(11)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	46						AGGGCTGACTTTTGGTTAAAG	0.363																																						.											0													111.0	117.0	115.0					15																	49304956		2197	4295	6492	SO:0001583	missense	9728			BC033001	CCDS32234.1, CCDS53942.1	15q21.1	2014-02-12				ENSG00000138593			28997	protein-coding gene	gene with protein product		615756					Standard	NM_001193489		Approved	KIAA0256	uc001zxe.2	Q93073		ENST00000559471.1:c.1620A>T	15.37:g.49304956T>A	ENSP00000453854:p.Lys540Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q8N767	Missense_Mutation	SNP	ENST00000559471.1	37	CCDS53942.1	.	.	.	.	.	.	.	.	.	.	T	16.71	3.198546	0.58126	.	.	ENSG00000138593	ENST00000261847;ENST00000380927	T	0.74209	-0.82	5.76	4.65	0.58169	.	0.146472	0.64402	D	0.000012	T	0.67655	0.2916	L	0.60455	1.87	0.38431	D	0.946435	P;P	0.39480	0.664;0.675	B;B	0.38106	0.157;0.265	T	0.70389	-0.4885	10	0.72032	D	0.01	.	6.2599	0.20893	0.0:0.2924:0.0:0.7076	.	540;495	Q93073;Q93073-2	SBP2L_HUMAN;.	N	495;540	ENSP00000261847:K495N	ENSP00000261847:K495N	K	-	3	2	SECISBP2L	47092248	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.105000	0.31086	1.026000	0.39733	0.528000	0.53228	AAA		0.363	SECISBP2L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417277.1	NM_014701	
ZNF440	126070	broad.mit.edu;hgsc.bcm.edu;bcgsc.ca	37	19	11942848	11942848	+	Missense_Mutation	SNP	G	G	A	rs373425213		TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr19:11942848G>A	ENST00000304060.5	+	4	1021	c.857G>A	c.(856-858)tGt>tAt	p.C286Y		NM_152357.2	NP_689570.2	Q8IYI8	ZN440_HUMAN	zinc finger protein 440	286					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(9)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27						GCTTATCAATGTAAGGAATGT	0.408																																						.											0													100.0	101.0	100.0					19																	11942848		2201	4299	6500	SO:0001583	missense	126070			AK095252	CCDS42503.1	19p13.13	2013-01-08	2006-08-14	2006-08-14	ENSG00000171295	ENSG00000171295		"""Zinc fingers, C2H2-type"", ""-"""	20874	protein-coding gene	gene with protein product							Standard	NM_152357		Approved	FLJ37933	uc002msp.1	Q8IYI8	OTTHUMG00000156403	ENST00000304060.5:c.857G>A	19.37:g.11942848G>A	ENSP00000305373:p.Cys286Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	Q8N1R9	Missense_Mutation	SNP	ENST00000304060.5	37	CCDS42503.1	.	.	.	.	.	.	.	.	.	.	g	14.74	2.624803	0.46840	.	.	ENSG00000171295	ENST00000304060	D	0.85088	-1.94	1.04	1.04	0.20106	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.92443	0.7601	M	0.91612	3.225	0.36272	D	0.855235	D	0.89917	1.0	D	0.91635	0.999	D	0.93193	0.6585	9	0.87932	D	0	.	9.6088	0.39650	0.0:0.0:1.0:0.0	.	286	Q8IYI8	ZN440_HUMAN	Y	286	ENSP00000305373:C286Y	ENSP00000305373:C286Y	C	+	2	0	ZNF440	11803848	1.000000	0.71417	0.010000	0.14722	0.019000	0.09904	7.104000	0.77024	0.865000	0.35603	0.205000	0.17691	TGT		0.408	ZNF440-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344508.1	NM_152357	
FASTKD1	79675	broad.mit.edu;hgsc.bcm.edu;bcgsc.ca	37	2	170428445	170428445	+	Missense_Mutation	SNP	C	C	T	rs376071696		TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr2:170428445C>T	ENST00000453153.2	-	2	441	c.95G>A	c.(94-96)cGa>cAa	p.R32Q	FASTKD1_ENST00000453929.2_Missense_Mutation_p.R32Q	NM_024622.3	NP_078898.3	Q53R41	FAKD1_HUMAN	FAST kinase domains 1	32					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)	p.R32Q(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(5)|large_intestine(10)|lung(9)|ovary(4)|prostate(3)	37						ACTGATGGGTCGAAATTGAAA	0.343																																						.											1	Substitution - Missense(1)	large_intestine(1)											73.0	70.0	71.0					2																	170428445		2203	4300	6503	SO:0001583	missense	79675			AL832058	CCDS33318.1, CCDS63051.1	2q31.1	2008-02-05			ENSG00000138399	ENSG00000138399			26150	protein-coding gene	gene with protein product						11347906	Standard	NM_024622		Approved	FLJ21901	uc002uev.4	Q53R41	OTTHUMG00000154953	ENST00000453153.2:c.95G>A	2.37:g.170428445C>T	ENSP00000400513:p.Arg32Gln	Somatic		WXS	Illumina HiSeq	Phase_I	Q8N583|Q8TEA9|Q96JM5|Q96N71|Q9H6T4	Missense_Mutation	SNP	ENST00000453153.2	37	CCDS33318.1	.	.	.	.	.	.	.	.	.	.	C	13.62	2.291846	0.40594	.	.	ENSG00000138399	ENST00000453153;ENST00000453929;ENST00000438035;ENST00000445210	T;T	0.20200	2.09;2.09	5.07	4.19	0.49359	.	0.372834	0.27981	N	0.017078	T	0.21550	0.0519	M	0.64997	1.995	0.39070	D	0.960702	P;D;P	0.53885	0.938;0.963;0.883	B;B;B	0.38500	0.142;0.275;0.082	T	0.12319	-1.0552	10	0.38643	T	0.18	-26.2444	13.6022	0.62026	0.0:0.9246:0.0:0.0754	.	32;32;32	D3DPC4;Q53R41-2;Q53R41	.;.;FAKD1_HUMAN	Q	32	ENSP00000400513:R32Q;ENSP00000403229:R32Q	ENSP00000396769:R32Q	R	-	2	0	FASTKD1	170136691	1.000000	0.71417	0.840000	0.33206	0.441000	0.31987	2.348000	0.44045	1.257000	0.44085	0.591000	0.81541	CGA		0.343	FASTKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337788.2	NM_024622	
C9orf43	257169	hgsc.bcm.edu;bcgsc.ca	37	9	116183413	116183413	+	Missense_Mutation	SNP	C	C	T			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr9:116183413C>T	ENST00000288462.4	+	5	822	c.376C>T	c.(376-378)Ctt>Ttt	p.L126F	C9orf43_ENST00000490544.1_3'UTR|C9orf43_ENST00000374165.1_Missense_Mutation_p.L126F	NM_152786.1	NP_689999.1	Q8TAL5	CI043_HUMAN	chromosome 9 open reading frame 43	126										breast(2)|large_intestine(6)|lung(2)|ovary(1)|pancreas(1)|prostate(3)	15						TGAGACGCAACTTCCCTGCCC	0.398																																						.											0													162.0	141.0	148.0					9																	116183413		2203	4300	6503	SO:0001583	missense	257169			BC026884	CCDS6796.1	9q33.1	2012-03-15			ENSG00000157653	ENSG00000157653			23570	protein-coding gene	gene with protein product						12477932	Standard	NM_152786		Approved	MGC17358	uc004bhp.3	Q8TAL5	OTTHUMG00000020526	ENST00000288462.4:c.376C>T	9.37:g.116183413C>T	ENSP00000288462:p.Leu126Phe	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000288462.4	37	CCDS6796.1	.	.	.	.	.	.	.	.	.	.	C	13.46	2.245199	0.39697	.	.	ENSG00000157653	ENST00000374165;ENST00000288462	T;T	0.56444	0.46;0.46	5.45	3.53	0.40419	.	0.576149	0.14604	N	0.309427	T	0.59018	0.2163	L	0.34521	1.04	0.23589	N	0.997348	D	0.67145	0.996	D	0.68943	0.961	T	0.49224	-0.8962	10	0.44086	T	0.13	-6.1702	11.0582	0.47931	0.367:0.633:0.0:0.0	.	126	Q8TAL5	CI043_HUMAN	F	126	ENSP00000363280:L126F;ENSP00000288462:L126F	ENSP00000288462:L126F	L	+	1	0	C9orf43	115223234	0.119000	0.22226	0.251000	0.24312	0.236000	0.25371	0.171000	0.16685	0.694000	0.31654	0.655000	0.94253	CTT		0.398	C9orf43-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053739.1	NM_152786	
FAM69A	388650	broad.mit.edu	37	1	93341936	93341936	+	Missense_Mutation	SNP	C	C	A			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr1:93341936C>A	ENST00000370310.4	-	2	176	c.106G>T	c.(106-108)Gtt>Ttt	p.V36F		NM_001006605.4|NM_001252269.1|NM_001252271.1	NP_001006606.2|NP_001239198.1|NP_001239200.1	Q5T7M9	FA69A_HUMAN	family with sequence similarity 69, member A	36						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)	4		all_lung(203;0.00265)|Lung NSC(277;0.00562)|all_neural(321;0.185)|Melanoma(281;0.192)|Glioma(108;0.203)		GBM - Glioblastoma multiforme(16;0.000563)|all cancers(265;0.000751)|Epithelial(280;0.127)		CCAACAAAAACCACTAACCAG	0.338																																						.											0													72.0	69.0	70.0					1																	93341936		1841	4095	5936	SO:0001583	missense	388650			AK027146	CCDS44173.1, CCDS72822.1, CCDS72823.1, CCDS72824.1, CCDS72825.1	1p22	2014-06-25			ENSG00000154511	ENSG00000154511			32213	protein-coding gene	gene with protein product		614542				21334309	Standard	NM_001006605		Approved	FLJ23493	uc001dpg.3	Q5T7M9	OTTHUMG00000010894	ENST00000370310.4:c.106G>T	1.37:g.93341936C>A	ENSP00000359333:p.Val36Phe	Somatic		WXS	Illumina HiSeq	Phase_I	Q6IRV2	Missense_Mutation	SNP	ENST00000370310.4	37	CCDS44173.1	.	.	.	.	.	.	.	.	.	.	C	18.35	3.604035	0.66445	.	.	ENSG00000154511	ENST00000370310;ENST00000401027	T	0.53423	0.62	5.48	5.48	0.80851	.	0.061173	0.64402	D	0.000004	T	0.60534	0.2276	L	0.54323	1.7	0.80722	D	1	D;D;D	0.89917	0.998;0.998;1.0	D;D;D	0.80764	0.994;0.994;0.989	T	0.62329	-0.6877	10	0.87932	D	0	-14.4428	19.2974	0.94128	0.0:1.0:0.0:0.0	.	29;36;36	B4E174;Q5T7M9;Q5T7M9-2	.;FA69A_HUMAN;.	F	36	ENSP00000359333:V36F	ENSP00000359333:V36F	V	-	1	0	FAM69A	93114524	1.000000	0.71417	0.938000	0.37757	0.492000	0.33523	4.552000	0.60747	2.724000	0.93272	0.655000	0.94253	GTT		0.338	FAM69A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030046.2	NM_001006605	
LINC00544	440131	broad.mit.edu	37	13	30524521	30524521	+	lincRNA	SNP	G	G	T			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr13:30524521G>T	ENST00000400540.1	+	0	927					NR_033889.1				long intergenic non-protein coding RNA 544																		AAAACCCAGAGGAAAGCTGTT	0.368																																						.											0																																												440131					13q12.3	2014-06-02			ENSG00000122043	ENSG00000122043		"""Long non-coding RNAs"""	43679	other	unknown							Standard	NR_033889		Approved		uc010aav.3		OTTHUMG00000016659		13.37:g.30524521G>T		Somatic		WXS	Illumina HiSeq	Phase_I		RNA	SNP	ENST00000400540.1	37																																																																																					0.368	LINC00544-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000044340.3	NR_033889	
OR4K5	79317	broad.mit.edu	37	14	20389392	20389392	+	Silent	SNP	C	C	T			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr14:20389392C>T	ENST00000315915.4	+	1	652	c.627C>T	c.(625-627)agC>agT	p.S209S		NM_001005483.1	NP_001005483.1	Q8NGD3	OR4K5_HUMAN	olfactory receptor, family 4, subfamily K, member 5	209						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|liver(1)|lung(27)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	47	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TTTCCCTAAGCACTTTCTCTC	0.428																																						.											0													266.0	276.0	273.0					14																	20389392		2203	4300	6503	SO:0001819	synonymous_variant	79317			BK004355	CCDS32024.1	14q11.22	2012-08-09				ENSG00000176281		"""GPCR / Class A : Olfactory receptors"""	14745	protein-coding gene	gene with protein product						14983052	Standard	NM_001005483		Approved		uc010tkw.2	Q8NGD3		ENST00000315915.4:c.627C>T	14.37:g.20389392C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q6IFA7	Silent	SNP	ENST00000315915.4	37	CCDS32024.1																																																																																				0.428	OR4K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409867.1	NM_001005483	
FLRT2	23768	broad.mit.edu	37	14	86088695	86088695	+	Silent	SNP	A	A	G			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr14:86088695A>G	ENST00000330753.4	+	2	1604	c.837A>G	c.(835-837)gaA>gaG	p.E279E	FLRT2_ENST00000554746.1_Silent_p.E279E	NM_013231.4	NP_037363.1	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	279					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)|regulation of neuron migration (GO:2001222)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(21)|lung(27)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	73				BRCA - Breast invasive adenocarcinoma(234;0.0319)		GTAAGCTGGAACGGCTGGATA	0.488																																						.											0													161.0	163.0	163.0					14																	86088695		2203	4300	6503	SO:0001819	synonymous_variant	23768			AF169676	CCDS9877.1	14q24-q32	2013-02-11				ENSG00000185070		"""Fibronectin type III domain containing"""	3761	protein-coding gene	gene with protein product		604807				10644439, 16872596	Standard	XM_005267490		Approved		uc001xvr.3	O43155		ENST00000330753.4:c.837A>G	14.37:g.86088695A>G		Somatic		WXS	Illumina HiSeq	Phase_I	A0AV84|B7ZLP3	Silent	SNP	ENST00000330753.4	37	CCDS9877.1																																																																																				0.488	FLRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413193.1		
PLD4	122618	broad.mit.edu	37	14	105393529	105393529	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr14:105393529A>G	ENST00000392593.4	+	2	220	c.52A>G	c.(52-54)Atg>Gtg	p.M18V	PLD4_ENST00000540372.1_Missense_Mutation_p.M25V	NM_138790.2	NP_620145.2	Q96BZ4	PLD4_HUMAN	phospholipase D family, member 4	18					glycerophospholipid biosynthetic process (GO:0046474)|hematopoietic progenitor cell differentiation (GO:0002244)|inositol phosphate metabolic process (GO:0043647)|lipid catabolic process (GO:0016042)|phagocytosis (GO:0006909)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|trans-Golgi network membrane (GO:0032588)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase D activity (GO:0004630)			central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	13		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.00067)|OV - Ovarian serous cystadenocarcinoma(23;0.00976)|Epithelial(46;0.0201)|GBM - Glioblastoma multiforme(11;0.116)			GCCATGCTCCATGCCGCCCCG	0.662																																						.											0													11.0	13.0	13.0					14																	105393529		1937	4121	6058	SO:0001583	missense	122618				CCDS9995.2	14q32.33	2014-01-28	2005-05-20	2005-05-20	ENSG00000166428	ENSG00000166428			23792	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 175"""	C14orf175			Standard	XM_006720024		Approved		uc001ypu.1	Q96BZ4	OTTHUMG00000144167	ENST00000392593.4:c.52A>G	14.37:g.105393529A>G	ENSP00000376372:p.Met18Val	Somatic		WXS	Illumina HiSeq	Phase_I	Q6UWD2	Missense_Mutation	SNP	ENST00000392593.4	37	CCDS9995.2	.	.	.	.	.	.	.	.	.	.	A	2.297	-0.361131	0.05103	.	.	ENSG00000166428	ENST00000540372;ENST00000392593;ENST00000557573	T;T;T	0.19669	2.13;2.13;2.13	2.57	-1.83	0.07833	.	.	.	.	.	T	0.06690	0.0171	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.37934	-0.9684	9	0.06757	T	0.87	-4.4028	2.3307	0.04235	0.4379:0.0:0.3314:0.2307	.	25;18	F5H2B5;Q96BZ4	.;PLD4_HUMAN	V	25;18;18	ENSP00000438677:M25V;ENSP00000376372:M18V;ENSP00000451278:M18V	ENSP00000376372:M18V	M	+	1	0	PLD4	104464574	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.225000	0.02956	-0.406000	0.07588	-0.385000	0.06624	ATG		0.662	PLD4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000291348.2	NM_138790	
SCAPER	49855	broad.mit.edu;bcgsc.ca	37	15	77046256	77046256	+	Missense_Mutation	SNP	G	G	T			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr15:77046256G>T	ENST00000563290.1	-	15	1854	c.1759C>A	c.(1759-1761)Cta>Ata	p.L587I	SCAPER_ENST00000324767.7_Missense_Mutation_p.L587I|SCAPER_ENST00000538941.2_Missense_Mutation_p.L341I			Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	587	Glu-rich.					endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(16)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	39						CGTTGATCTAGCAATTCTTCC	0.358																																						.											0													226.0	212.0	216.0					15																	77046256		1860	4098	5958	SO:0001583	missense	49855			AB040887, AF242528	CCDS53961.1, CCDS53962.1	15q24.3	2012-10-05	2009-03-11	2007-08-20	ENSG00000140386	ENSG00000140386		"""Zinc fingers, C2H2-type"""	13081	protein-coding gene	gene with protein product		611611	"""zinc finger protein 291"""	ZNF291		17698606	Standard	NM_020843		Approved	Zfp291	uc002bby.3	Q9BY12	OTTHUMG00000172655	ENST00000563290.1:c.1759C>A	15.37:g.77046256G>T	ENSP00000454973:p.Leu587Ile	Somatic		WXS	Illumina HiSeq	Phase_I	F5H7X8|H3BNR7|Q3B7X7|Q96BS9|Q9H3D8|Q9NT03|Q9P274	Missense_Mutation	SNP	ENST00000563290.1	37	CCDS53962.1	.	.	.	.	.	.	.	.	.	.	G	12.97	2.096071	0.36952	.	.	ENSG00000140386	ENST00000324767;ENST00000538941;ENST00000303521	T;T	0.23754	1.9;1.89	5.77	0.596	0.17496	.	0.000000	0.85682	D	0.000000	T	0.14098	0.0341	N	0.05441	-0.05	0.38119	D	0.937796	P;P	0.37276	0.539;0.589	B;B	0.41988	0.372;0.284	T	0.14144	-1.0483	10	0.33940	T	0.23	.	9.9934	0.41885	0.6168:0.0:0.3832:0.0	.	608;341	Q9BY12-2;F5H7X8	.;.	I	587;341;609	ENSP00000326924:L587I;ENSP00000442190:L341I	ENSP00000303560:L609I	L	-	1	2	SCAPER	74833311	0.924000	0.31332	0.810000	0.32431	0.962000	0.63368	0.245000	0.18142	-0.135000	0.11495	0.655000	0.94253	CTA		0.358	SCAPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419698.1	NM_020843	
ZNF668	79759	broad.mit.edu	37	16	31072731	31072731	+	Silent	SNP	A	A	C			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr16:31072731A>C	ENST00000538906.1	-	3	2302	c.1518T>G	c.(1516-1518)ggT>ggG	p.G506G	ZNF668_ENST00000426488.2_Silent_p.G529G|ZNF668_ENST00000300849.4_Silent_p.G506G|ZNF668_ENST00000535577.1_Silent_p.G506G|ZNF668_ENST00000539836.3_Silent_p.G529G|ZNF668_ENST00000417110.2_5'Flank|ZNF668_ENST00000394983.2_Silent_p.G506G	NM_001172668.1	NP_001166139	Q96K58	ZN668_HUMAN	zinc finger protein 668	506					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(6)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	27						CAGCCTCCTCACCCCCCGCCT	0.652																																					Colon(181;1111 1980 5060 10512 25785)	.											0													45.0	50.0	48.0					16																	31072731		2197	4300	6497	SO:0001819	synonymous_variant	79759				CCDS10701.1, CCDS54003.1	16p11.2	2013-01-08			ENSG00000167394	ENSG00000167394		"""Zinc fingers, C2H2-type"""	25821	protein-coding gene	gene with protein product						12477932	Standard	NM_024706		Approved	FLJ13479	uc021tgt.1	Q96K58	OTTHUMG00000047357	ENST00000538906.1:c.1518T>G	16.37:g.31072731A>C		Somatic		WXS	Illumina HiSeq	Phase_I	C9JHH8|F5H7E7|Q59EV1|Q8N669|Q9H8L4	Silent	SNP	ENST00000538906.1	37	CCDS10701.1																																																																																				0.652	ZNF668-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000108516.2	NM_024706	
SETD6	79918	broad.mit.edu;mdanderson.org;bcgsc.ca	37	16	58550764	58550764	+	Missense_Mutation	SNP	G	G	A	rs530582932		TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr16:58550764G>A	ENST00000219315.4	+	5	774	c.724G>A	c.(724-726)Gtg>Atg	p.V242M	SETD6_ENST00000394266.4_Missense_Mutation_p.V173M|SETD6_ENST00000310682.2_Missense_Mutation_p.V218M|SETD6_ENST00000418480.1_3'UTR			Q8TBK2	SETD6_HUMAN	SET domain containing 6	242	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				negative regulation of NF-kappaB transcription factor activity (GO:0032088)|peptidyl-lysine monomethylation (GO:0018026)|regulation of inflammatory response (GO:0050727)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	NF-kappaB binding (GO:0051059)|protein-lysine N-methyltransferase activity (GO:0016279)			endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	7						CAACTCCCCCGTGATGGTGCC	0.517													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19309	0.0		0.0	False		,,,				2504	0.0					.											0													200.0	199.0	200.0					16																	58550764		2198	4300	6498	SO:0001583	missense	79918			AK024801	CCDS10798.1, CCDS54013.1	16q21	2008-02-05			ENSG00000103037	ENSG00000103037			26116	protein-coding gene	gene with protein product						12477932	Standard	NM_024860		Approved	FLJ21148	uc002ens.3	Q8TBK2	OTTHUMG00000150276	ENST00000219315.4:c.724G>A	16.37:g.58550764G>A	ENSP00000219315:p.Val242Met	Somatic		WXS	Illumina HiSeq	Phase_I	A8K380|B5ME38|Q9H787	Missense_Mutation	SNP	ENST00000219315.4	37	CCDS54013.1	.	.	.	.	.	.	.	.	.	.	G	6.139	0.393900	0.11638	.	.	ENSG00000103037	ENST00000310682;ENST00000394266;ENST00000219315	T;T;T	0.14516	2.5;2.5;2.5	5.42	-1.46	0.08800	SET domain (2);	0.157090	0.51477	D	0.000082	T	0.02807	0.0084	N	0.01188	-0.97	0.24770	N	0.992877	B;B;B	0.22003	0.063;0.011;0.044	B;B;B	0.15484	0.013;0.006;0.002	T	0.32719	-0.9896	10	0.38643	T	0.18	-14.0441	0.105	0.00051	0.2572:0.1857:0.2408:0.3163	.	218;242;218	E9PC53;Q8TBK2;Q8TBK2-2	.;SETD6_HUMAN;.	M	218;173;242	ENSP00000310082:V218M;ENSP00000377809:V173M;ENSP00000219315:V242M	ENSP00000219315:V242M	V	+	1	0	SETD6	57108265	0.810000	0.29049	0.886000	0.34754	0.715000	0.41141	1.450000	0.35134	0.037000	0.15575	-0.500000	0.04577	GTG		0.517	SETD6-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000317274.2	NM_024860	
DCC	1630	broad.mit.edu	37	18	50734080	50734080	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr18:50734080T>C	ENST00000442544.2	+	11	2370	c.1754T>C	c.(1753-1755)cTg>cCg	p.L585P	DCC_ENST00000581580.1_Missense_Mutation_p.L240P|DCC_ENST00000412726.1_Missense_Mutation_p.L433P	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	585	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		TCTTATAAACTGGAAGGCCTG	0.378																																						.											0													129.0	138.0	135.0					18																	50734080		2203	4300	6503	SO:0001583	missense	1630			X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.1754T>C	18.37:g.50734080T>C	ENSP00000389140:p.Leu585Pro	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000442544.2	37	CCDS11952.1	.	.	.	.	.	.	.	.	.	.	T	13.22	2.170752	0.38315	.	.	ENSG00000187323	ENST00000442544;ENST00000304775;ENST00000412726	T;T	0.62639	0.01;0.01	5.83	5.83	0.93111	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.077446	0.51477	D	0.000084	D	0.84566	0.5500	H	0.94542	3.55	0.80722	D	1	D;D;D	0.71674	0.998;0.998;0.985	D;D;D	0.76071	0.987;0.987;0.956	D	0.88867	0.3330	10	0.87932	D	0	.	15.1823	0.72968	0.0:0.0:0.0:1.0	.	433;433;585	E7EQM8;B4DYX2;P43146	.;.;DCC_HUMAN	P	585;518;433	ENSP00000389140:L585P;ENSP00000397322:L433P	ENSP00000304146:L518P	L	+	2	0	DCC	48988078	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.587000	0.74071	2.240000	0.73641	0.528000	0.53228	CTG		0.378	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255996.3	NM_005215	
MUC16	94025	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	19	9002616	9002616	+	Missense_Mutation	SNP	G	G	T			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr19:9002616G>T	ENST00000397910.4	-	51	40403	c.40200C>A	c.(40198-40200)gaC>gaA	p.D13400E	MUC16_ENST00000380951.5_Missense_Mutation_p.D41E	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	13402	SEA 9. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GGCTTTTGGGGTCAGGACGAT	0.572																																						.											0													93.0	85.0	87.0					19																	9002616		2009	4180	6189	SO:0001583	missense	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.40200C>A	19.37:g.9002616G>T	ENSP00000381008:p.Asp13400Glu	Somatic		WXS	Illumina HiSeq	Phase_I	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	12.50|12.50	1.957435|1.957435	0.34565|0.34565	.|.	.|.	ENSG00000181143|ENSG00000181143	ENST00000397910;ENST00000380951|ENST00000542240	T;T|.	0.45668|.	0.89;0.89|.	2.75|2.75	-0.779|-0.779	0.10973|0.10973	SEA (1);|.	.|.	.|.	.|.	.|.	T|T	0.16685|0.16685	0.0401|0.0401	N|N	0.14661|0.14661	0.345|0.345	.|.	.|.	.|.	P;D|.	0.56035|.	0.945;0.974|.	P;D|.	0.72075|.	0.476;0.976|.	T|T	0.27331|0.27331	-1.0077|-1.0077	8|4	0.02654|.	T|.	1|.	-2.7307|-2.7307	2.3914|2.3914	0.04379|0.04379	0.2866:0.0:0.4754:0.238|0.2866:0.0:0.4754:0.238	.|.	21045;13400|.	Q8WXI7;B5ME49|.	MUC16_HUMAN;.|.	E|N	13400;41|240	ENSP00000381008:D13400E;ENSP00000370338:D41E|.	ENSP00000370338:D41E|.	D|T	-|-	3|2	2|0	MUC16|MUC16	8863616|8863616	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.002000|0.002000	0.02628|0.02628	-1.113000|-1.113000	0.03296|0.03296	-0.070000|-0.070000	0.12908|0.12908	-0.657000|-0.657000	0.03884|0.03884	GAC|ACC		0.572	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
DNAH1	25981	broad.mit.edu	37	3	52416340	52416340	+	Missense_Mutation	SNP	G	G	A			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr3:52416340G>A	ENST00000420323.2	+	50	8071	c.7810G>A	c.(7810-7812)Gag>Aag	p.E2604K		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	2604	AAA 4. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CTCCAGGGCCGAGTACGAGTG	0.567																																						.											0													126.0	130.0	128.0					3																	52416340		2132	4259	6391	SO:0001583	missense	25981			U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.7810G>A	3.37:g.52416340G>A	ENSP00000401514:p.Glu2604Lys	Somatic		WXS	Illumina HiSeq	Phase_I	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	ENST00000420323.2	37	CCDS46842.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.968473	0.74131	.	.	ENSG00000114841	ENST00000420323	T	0.39229	1.09	4.49	4.49	0.54785	.	0.000000	0.51477	D	0.000088	T	0.57636	0.2067	M	0.76838	2.35	0.47905	D	0.999541	D	0.63880	0.993	P	0.58620	0.842	T	0.56529	-0.7964	10	0.25751	T	0.34	.	13.1715	0.59602	0.0:0.1602:0.8398:0.0	.	2604	C9JXH6	.	K	2604	ENSP00000401514:E2604K	ENSP00000401514:E2604K	E	+	1	0	DNAH1	52391380	1.000000	0.71417	0.953000	0.39169	0.827000	0.46813	4.931000	0.63469	2.322000	0.78497	0.462000	0.41574	GAG		0.567	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	NM_015512	
HRG	3273	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	3	186395001	186395001	+	Nonsense_Mutation	SNP	G	G	T			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr3:186395001G>T	ENST00000232003.4	+	7	987	c.907G>T	c.(907-909)Gaa>Taa	p.E303*		NM_000412.2	NP_000403.1	P04196	HRG_HUMAN	histidine-rich glycoprotein	303	Pro-rich.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|chemotaxis (GO:0006935)|defense response to fungus (GO:0050832)|fibrinolysis (GO:0042730)|heme export (GO:0097037)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of apoptotic process (GO:0043065)|positive regulation of blood vessel remodeling (GO:2000504)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of immune response to tumor cell (GO:0002839)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of platelet activation (GO:0010543)|regulation of protein complex assembly (GO:0043254)|regulation of transcription from RNA polymerase II promoter in response to iron (GO:0034395)|response to organic cyclic compound (GO:0014070)	blood microparticle (GO:0072562)|endolysosome (GO:0036019)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|phagolysosome membrane (GO:0061474)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|heme binding (GO:0020037)|heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)|immunoglobulin binding (GO:0019865)|metal ion binding (GO:0046872)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(12)|lung(13)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	all_cancers(143;6.64e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.73e-20)	GBM - Glioblastoma multiforme(93;0.0683)		TCCTCCAGATGAAAGAGATCA	0.527																																						.											0													209.0	170.0	184.0					3																	186395001		2203	4300	6503	SO:0001587	stop_gained	3273				CCDS3280.1	3q27	2008-07-18			ENSG00000113905	ENSG00000113905			5181	protein-coding gene	gene with protein product	"""histidine-proline rich glycoprotein"", ""thrombophilia due to elevated HRG"""	142640				1678514	Standard	NM_000412		Approved	HRGP, HPRG	uc003fqq.3	P04196	OTTHUMG00000156578	ENST00000232003.4:c.907G>T	3.37:g.186395001G>T	ENSP00000232003:p.Glu303*	Somatic		WXS	Illumina HiSeq	Phase_I	B9EK35|D3DNU7	Nonsense_Mutation	SNP	ENST00000232003.4	37	CCDS3280.1	.	.	.	.	.	.	.	.	.	.	G	16.08	3.021615	0.54576	.	.	ENSG00000113905	ENST00000232003	.	.	.	3.76	1.92	0.25849	.	1.401000	0.04631	N	0.403727	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.08381	T	0.77	2.1006	5.4632	0.16627	0.1138:0.203:0.6831:0.0	.	.	.	.	X	303	.	ENSP00000232003:E303X	E	+	1	0	HRG	187877695	0.007000	0.16637	0.004000	0.12327	0.001000	0.01503	1.745000	0.38278	0.401000	0.25424	-0.226000	0.12346	GAA		0.527	HRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344655.1	NM_000412	
UGT2B7	7364	broad.mit.edu	37	4	69962648	69962648	+	Missense_Mutation	SNP	T	T	C	rs368476298		TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr4:69962648T>C	ENST00000508661.1	+	1	437	c.410T>C	c.(409-411)aTg>aCg	p.M137T	UGT2B7_ENST00000509763.1_Intron|UGT2B7_ENST00000305231.7_Missense_Mutation_p.M137T			P16662	UD2B7_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B7	137					androgen metabolic process (GO:0008209)|cellular glucuronidation (GO:0052695)|lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucuronosyltransferase activity (GO:0015020)			autonomic_ganglia(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	38					Atorvastatin(DB01076)|Carbamazepine(DB00564)|Chenodeoxycholic acid(DB06777)|Codeine(DB00318)|Dabigatran etexilate(DB06695)|Dapagliflozin(DB06292)|Diclofenac(DB00586)|Epirubicin(DB00445)|Etodolac(DB00749)|Ezetimibe(DB00973)|Flunitrazepam(DB01544)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Losartan(DB00678)|Lovastatin(DB00227)|Mitiglinide(DB01252)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Naproxen(DB00788)|Oxazepam(DB00842)|Pitavastatin(DB08860)|Silodosin(DB06207)|Simvastatin(DB00641)|Suprofen(DB00870)|Tapentadol(DB06204)|Valproic Acid(DB00313)|Zidovudine(DB00495)	AAGAAATTTATGAAAAAAGTA	0.323																																						.											0								T	THR/MET	0,4400		0,0,2200	70.0	71.0	70.0		410	2.5	0.0	4		70	1,8593	1.2+/-3.3	0,1,4296	no	missense	UGT2B7	NM_001074.2	81	0,1,6496	CC,CT,TT		0.0116,0.0,0.0077	possibly-damaging	137/530	69962648	1,12993	2200	4297	6497	SO:0001583	missense	7364			BC030974	CCDS3526.1	4q13	2008-02-05	2005-07-20		ENSG00000171234	ENSG00000171234		"""UDP glucuronosyltransferases"""	12554	protein-coding gene	gene with protein product		600068	"""UDP glycosyltransferase 2 family, polypeptide B7"""			2159463, 7835904	Standard	NM_001074		Approved	UGT2B9	uc003heg.4	P16662	OTTHUMG00000129404	ENST00000508661.1:c.410T>C	4.37:g.69962648T>C	ENSP00000427659:p.Met137Thr	Somatic		WXS	Illumina HiSeq	Phase_I	B2R810|Q6GTW0	Missense_Mutation	SNP	ENST00000508661.1	37		.	.	.	.	.	.	.	.	.	.	T	9.836	1.189712	0.21954	0.0	1.16E-4	ENSG00000171234	ENST00000305231;ENST00000508661	T;T	0.61510	0.1;0.1	2.54	2.54	0.30619	.	0.286793	0.30338	U	0.009850	T	0.64046	0.2563	M	0.90814	3.15	0.27669	N	0.946838	B;P	0.35192	0.087;0.489	B;B	0.39935	0.168;0.314	T	0.62144	-0.6916	9	.	.	.	.	8.5583	0.33494	0.0:0.0:0.0:1.0	.	137;137	E9PBP8;P16662	.;UD2B7_HUMAN	T	137	ENSP00000304811:M137T;ENSP00000427659:M137T	.	M	+	2	0	UGT2B7	69997237	0.436000	0.25586	0.007000	0.13788	0.014000	0.08584	3.768000	0.55295	1.157000	0.42530	0.260000	0.18958	ATG		0.323	UGT2B7-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000362103.1	NM_001074	
PLK4	10733	broad.mit.edu;bcgsc.ca	37	4	128814529	128814529	+	Missense_Mutation	SNP	A	A	C			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr4:128814529A>C	ENST00000270861.5	+	11	2552	c.2278A>C	c.(2278-2280)Agc>Cgc	p.S760R	PLK4_ENST00000513090.1_Missense_Mutation_p.S728R|PLK4_ENST00000507249.1_Missense_Mutation_p.S699R|PLK4_ENST00000514379.1_Missense_Mutation_p.S719R|RNU6-583P_ENST00000516012.1_RNA|PLK4_ENST00000515069.1_Missense_Mutation_p.S682R	NM_014264.4	NP_055079.3	O00444	PLK4_HUMAN	polo-like kinase 4	760					centriole replication (GO:0007099)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of centriole replication (GO:0046601)|protein phosphorylation (GO:0006468)|trophoblast giant cell differentiation (GO:0060707)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	31						TGAAGTTAATAGCTTGAAAGA	0.299																																					Colon(135;508 1718 19061 31832 42879)	.											0													81.0	85.0	84.0					4																	128814529		2202	4299	6501	SO:0001583	missense	10733			Y13115	CCDS3735.1, CCDS54803.1, CCDS54804.1	4q27-q28	2013-01-18	2010-06-24	2004-01-28	ENSG00000142731	ENSG00000142731			11397	protein-coding gene	gene with protein product		605031	"""serine/threonine kinase 18"", ""polo-like kinase 4 (Drosophila)"""	STK18			Standard	NM_014264		Approved	Sak	uc003ifo.3	O00444	OTTHUMG00000133301	ENST00000270861.5:c.2278A>C	4.37:g.128814529A>C	ENSP00000270861:p.Ser760Arg	Somatic		WXS	Illumina HiSeq	Phase_I	B2RAL0|B7Z837|B7Z8G7|Q8IYF0|Q96Q95|Q9UD84|Q9UDE2	Missense_Mutation	SNP	ENST00000270861.5	37	CCDS3735.1	.	.	.	.	.	.	.	.	.	.	A	17.46	3.395123	0.62066	.	.	ENSG00000142731	ENST00000270861;ENST00000515069;ENST00000513090;ENST00000507249;ENST00000514379	T;T;T;T;T	0.69306	-0.24;-0.24;-0.39;-0.24;-0.31	5.08	3.86	0.44501	.	0.293682	0.43260	D	0.000594	T	0.57403	0.2051	L	0.47716	1.5	0.27142	N	0.961622	P;P	0.48089	0.905;0.684	P;B	0.44518	0.452;0.265	T	0.57177	-0.7856	10	0.66056	D	0.02	-0.3977	4.2527	0.10702	0.7068:0.0:0.1166:0.1766	.	728;760	O00444-2;O00444	.;PLK4_HUMAN	R	760;682;728;699;719	ENSP00000270861:S760R;ENSP00000421774:S682R;ENSP00000427554:S728R;ENSP00000423412:S699R;ENSP00000423582:S719R	ENSP00000270861:S760R	S	+	1	0	PLK4	129033979	1.000000	0.71417	0.654000	0.29608	0.874000	0.50279	3.069000	0.50026	0.905000	0.36596	0.533000	0.62120	AGC		0.299	PLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257095.3		
FAM92A1P2	403315	broad.mit.edu	37	4	183959505	183959505	+	RNA	DEL	A	A	-			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr4:183959505delA	ENST00000502308.1	+	0	688					NR_003612.1				family with sequence similarity 92, member A1 pseudogene 2																		gtgaaatcccatctctactaa	0.488																																						.											0																																												403315			BC022019		4q35.1	2012-04-19	2012-04-19	2012-04-19	ENSG00000230219	ENSG00000230219			32287	pseudogene	pseudogene			"""family with sequence similarity 92, member A3"""	FAM92A3		12477932	Standard	NR_003612		Approved	MGC71735, MGC102964	uc003ivi.4		OTTHUMG00000160675		4.37:g.183959505delA		Somatic		WXS	Illumina HiSeq	Phase_I		RNA	DEL	ENST00000502308.1	37																																																																																					0.488	FAM92A1P2-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000361814.1		
MRPS10	55173	broad.mit.edu	37	6	42179589	42179589	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr6:42179589T>C	ENST00000053468.3	-	4	268	c.253A>G	c.(253-255)Aag>Gag	p.K85E		NM_018141.3	NP_060611.2	P82664	RT10_HUMAN	mitochondrial ribosomal protein S10	85						mitochondrion (GO:0005739)|ribosome (GO:0005840)				endometrium(1)|lung(1)	2	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|Epithelial(12;0.00528)			AATACAGCCTTATCGTGACCT	0.388																																						.											0													115.0	112.0	113.0					6																	42179589		2203	4300	6503	SO:0001583	missense	55173				CCDS4866.1	6p21.1	2012-09-13			ENSG00000048544	ENSG00000048544		"""Mitochondrial ribosomal proteins / small subunits"""	14502	protein-coding gene	gene with protein product		611976				11279123	Standard	NM_018141		Approved	FLJ10567	uc003osa.4	P82664	OTTHUMG00000014694	ENST00000053468.3:c.253A>G	6.37:g.42179589T>C	ENSP00000053468:p.Lys85Glu	Somatic		WXS	Illumina HiSeq	Phase_I	B2RE89|Q9H3E5|Q9NVR3	Missense_Mutation	SNP	ENST00000053468.3	37	CCDS4866.1	.	.	.	.	.	.	.	.	.	.	T	16.43	3.120923	0.56613	.	.	ENSG00000048544	ENST00000053468	.	.	.	5.78	4.58	0.56647	.	0.182436	0.64402	D	0.000017	T	0.42426	0.1202	L	0.43152	1.355	0.38608	D	0.950836	D	0.56746	0.977	P	0.54544	0.755	T	0.35176	-0.9799	9	0.33940	T	0.23	-11.204	11.2704	0.49136	0.1371:0.0:0.0:0.8629	.	85	P82664	RT10_HUMAN	E	85	.	ENSP00000053468:K85E	K	-	1	0	MRPS10	42287567	1.000000	0.71417	0.998000	0.56505	0.971000	0.66376	7.294000	0.78760	0.963000	0.38082	0.533000	0.62120	AAG		0.388	MRPS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040547.1		
GTF2IRD1	9569	broad.mit.edu	37	7	74016919	74016919	+	IGR	DEL	A	A	-	rs375971244|rs201863282		TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr7:74016919delA	ENST00000265755.3	+	0	3430				GTF2IRD1_ENST00000455841.2_3'UTR|GTF2IRD1_ENST00000424337.2_3'UTR	NM_005685.3|NM_016328.2	NP_005676.3|NP_057412.1	Q9UHL9	GT2D1_HUMAN	GTF2I repeat domain containing 1						multicellular organismal development (GO:0007275)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transition between slow and fast fiber (GO:0014886)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(19)|ovary(6)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						GTAAAAAAAGAAAAAAAAAAA	0.373																																						.											0																																										SO:0001628	intergenic_variant	9569			AF151354	CCDS5571.1, CCDS47613.1, CCDS56492.1	7q11.23	2008-04-18	2002-01-14		ENSG00000006704	ENSG00000006704			4661	protein-coding gene	gene with protein product	"""binding factor for early enhancer"""	604318	"""GTF2I repeat domain-containing 1"""	WBSCR11		9774679, 10198167	Standard	NM_016328		Approved	MusTRD1, RBAP2, GTF3, WBSCR12, BEN, Cream1	uc010lbq.3	Q9UHL9	OTTHUMG00000023782		7.37:g.74016919delA		Somatic		WXS	Illumina HiSeq	Phase_I	O95444|Q6DSU6|Q75MX7|Q86UM3|Q8WVC4|Q9UHK8|Q9UI91	Splice_Site	DEL	ENST00000265755.3	37	CCDS5571.1																																																																																				0.373	GTF2IRD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252654.2	NM_016328	
MEST	4232	broad.mit.edu;mdanderson.org;bcgsc.ca	37	7	130140638	130140638	+	Missense_Mutation	SNP	C	C	T			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr7:130140638C>T	ENST00000223215.4	+	9	877	c.656C>T	c.(655-657)cCa>cTa	p.P219L	MEST_ENST00000378576.4_Intron|MEST_ENST00000393187.1_Missense_Mutation_p.P210L|hsa-mir-335_ENST00000604666.1_RNA|MEST_ENST00000437945.1_Missense_Mutation_p.P219L|MEST_ENST00000462132.1_3'UTR|MEST_ENST00000416162.2_Intron|MEST_ENST00000341441.5_Missense_Mutation_p.P210L	NM_001253900.1|NM_002402.3	NP_001240829.1|NP_002393.2	Q5EB52	MEST_HUMAN	mesoderm specific transcript	219					mesoderm development (GO:0007498)|regulation of lipid storage (GO:0010883)|response to retinoic acid (GO:0032526)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)			breast(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(2)	12	Melanoma(18;0.0435)					AGTCTCACCCCAGTCTTTGGG	0.517																																					Colon(126;2182 2305 6517 35181)	.											0													62.0	55.0	57.0					7																	130140638		2203	4300	6503	SO:0001583	missense	4232				CCDS5822.1, CCDS5823.1, CCDS59081.1	7q32	2014-08-22	2012-12-07		ENSG00000106484	ENSG00000106484			7028	protein-coding gene	gene with protein product	"""Paternally-expressed gene 1"""	601029	"""mesoderm specific transcript (mouse) homolog"", ""mesoderm specific transcript homolog (mouse)"""			8884280	Standard	NM_002402		Approved	PEG1	uc003vqg.3	Q5EB52	OTTHUMG00000156661	ENST00000223215.4:c.656C>T	7.37:g.130140638C>T	ENSP00000223215:p.Pro219Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B2R6S1|O14973|O15007|Q6AI49|Q92571	Missense_Mutation	SNP	ENST00000223215.4	37	CCDS5822.1	.	.	.	.	.	.	.	.	.	.	C	14.44	2.536649	0.45176	.	.	ENSG00000106484	ENST00000341441;ENST00000393187;ENST00000223215;ENST00000437945	T;T;T;T	0.03801	3.8;3.8;3.8;3.8	5.95	3.9	0.45041	.	0.000000	0.52532	D	0.000067	T	0.04182	0.0116	L	0.39898	1.24	0.37717	D	0.924792	B;B;B	0.30146	0.021;0.27;0.042	B;B;B	0.24541	0.011;0.054;0.026	T	0.40079	-0.9582	10	0.30854	T	0.27	-8.4069	8.3751	0.32438	0.1582:0.755:0.0:0.0867	.	205;219;219	B4DQW6;C9JW74;Q5EB52	.;.;MEST_HUMAN	L	210;210;219;219	ENSP00000342749:P210L;ENSP00000376884:P210L;ENSP00000223215:P219L;ENSP00000401657:P219L	ENSP00000223215:P219L	P	+	2	0	MEST	129927874	0.913000	0.31002	0.971000	0.41717	0.992000	0.81027	1.823000	0.39062	2.821000	0.97095	0.561000	0.74099	CCA		0.517	MEST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345183.2	NM_002402	
MCM4	4173	broad.mit.edu	37	8	48882495	48882495	+	Nonsense_Mutation	SNP	C	C	T			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr8:48882495C>T	ENST00000262105.2	+	10	1521	c.1312C>T	c.(1312-1314)Cag>Tag	p.Q438*	MCM4_ENST00000518680.1_3'UTR|MCM4_ENST00000523944.1_Nonsense_Mutation_p.Q438*	NM_005914.3	NP_005905.2	P33991	MCM4_HUMAN	minichromosome maintenance complex component 4	438					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|single-stranded DNA binding (GO:0003697)			biliary_tract(1)|breast(1)|endometrium(7)|kidney(4)|large_intestine(5)|lung(16)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	44		all_cancers(86;0.026)|all_epithelial(80;0.000748)|Lung NSC(129;0.00327)|all_lung(136;0.00354)				AGAAGCAGAACAGAAACTTTT	0.413																																						.											0													150.0	146.0	147.0					8																	48882495		2203	4300	6503	SO:0001587	stop_gained	4173				CCDS6143.1	8q12-q13	2008-02-05	2007-04-04		ENSG00000104738	ENSG00000104738			6947	protein-coding gene	gene with protein product		602638	"""MCM4 minichromosome maintenance deficient 4 (S. cerevisiae)"""	CDC21		7601140	Standard	NM_005914		Approved	CDC54, hCdc21, P1-Cdc21, MGC33310	uc003xql.2	P33991	OTTHUMG00000164205	ENST00000262105.2:c.1312C>T	8.37:g.48882495C>T	ENSP00000262105:p.Gln438*	Somatic		WXS	Illumina HiSeq	Phase_I	Q8NEH1|Q99658	Nonsense_Mutation	SNP	ENST00000262105.2	37	CCDS6143.1	.	.	.	.	.	.	.	.	.	.	C	35	5.491914	0.96339	.	.	ENSG00000104738	ENST00000523944;ENST00000262105;ENST00000396826;ENST00000429229;ENST00000520637	.	.	.	6.17	6.17	0.99709	.	0.103011	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	-17.1867	20.8794	0.99867	0.0:1.0:0.0:0.0	.	.	.	.	X	438;438;425;398;156	.	ENSP00000262105:Q438X	Q	+	1	0	MCM4	49045048	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.416000	0.80143	2.941000	0.99782	0.655000	0.94253	CAG		0.413	MCM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377791.1	NM_005914	
PAPPA	5069	broad.mit.edu	37	9	118950340	118950340	+	Silent	SNP	C	C	T			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr9:118950340C>T	ENST00000328252.3	+	2	1692	c.1323C>T	c.(1321-1323)cgC>cgT	p.R441R	PAPPA_ENST00000534838.1_5'Flank	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	441	Metalloprotease.				cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.R441R(1)		NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						GGGATTGCCGCCACCTGCGCC	0.587																																						.											1	Substitution - coding silent(1)	lung(1)											76.0	56.0	63.0					9																	118950340		2203	4300	6503	SO:0001819	synonymous_variant	5069				CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.1323C>T	9.37:g.118950340C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B1AMF9|Q08371|Q68G52|Q9UDK7	Silent	SNP	ENST00000328252.3	37	CCDS6813.1																																																																																				0.587	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055546.1	NM_002581	
TKTL1	8277	broad.mit.edu;mdanderson.org;bcgsc.ca	37	X	153556232	153556232	+	Missense_Mutation	SNP	G	G	A			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chrX:153556232G>A	ENST00000369915.3	+	12	1735	c.1546G>A	c.(1546-1548)Gtc>Atc	p.V516I	TKTL1_ENST00000369912.2_Missense_Mutation_p.V460I|TKTL1_ENST00000217905.7_Missense_Mutation_p.V256I|TKTL1_ENST00000482044.1_3'UTR	NM_001145933.1|NM_012253.3	NP_001139405.1|NP_036385.3	P51854	TKTL1_HUMAN	transketolase-like 1	516					glucose catabolic process (GO:0006007)|thiamine metabolic process (GO:0006772)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|transketolase activity (GO:0004802)			NS(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(5)|prostate(1)|skin(1)|urinary_tract(2)	34	all_cancers(53;5.05e-16)|all_epithelial(53;1.82e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					ACCTCTGGATGTCGCCACCAT	0.473																																						.											0													214.0	188.0	197.0					X																	153556232		2203	4300	6503	SO:0001583	missense	8277			X91817	CCDS35448.1, CCDS55541.1	Xq28	2008-02-05			ENSG00000007350	ENSG00000007350			11835	protein-coding gene	gene with protein product		300044				8838793	Standard	NM_012253		Approved	TKR, TKT2	uc004fkg.3	P51854	OTTHUMG00000022707	ENST00000369915.3:c.1546G>A	X.37:g.153556232G>A	ENSP00000358931:p.Val516Ile	Somatic		WXS	Illumina HiSeq	Phase_I	A8K896|Q5TYJ8|Q5TYJ9|Q8TC75	Missense_Mutation	SNP	ENST00000369915.3	37	CCDS35448.1	.	.	.	.	.	.	.	.	.	.	G	5.168	0.216538	0.09810	.	.	ENSG00000007350	ENST00000369915;ENST00000441970;ENST00000217905;ENST00000369912	D;D;D	0.90676	-2.71;-2.71;-2.71	4.66	-4.45	0.03546	Transketolase, C-terminal (1);Transketolase, C-terminal/Pyruvate-ferredoxin oxidoreductase, domain II (1);Transketolase-like, C-terminal (1);	1.215660	0.06075	N	0.660761	T	0.78541	0.4299	N	0.16567	0.415	0.09310	N	1	B;B;B	0.17465	0.022;0.009;0.009	B;B;B	0.18263	0.021;0.014;0.014	T	0.62426	-0.6857	10	0.40728	T	0.16	0.082	1.7163	0.02902	0.3163:0.1073:0.379:0.1974	.	256;510;516	B7Z7M4;B7Z7I0;P51854	.;.;TKTL1_HUMAN	I	516;477;256;460	ENSP00000358931:V516I;ENSP00000217905:V256I;ENSP00000358928:V460I	ENSP00000217905:V256I	V	+	1	0	TKTL1	153209426	0.000000	0.05858	0.002000	0.10522	0.015000	0.08874	-0.398000	0.07259	-0.970000	0.03569	0.436000	0.28706	GTC		0.473	TKTL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058923.1	NM_012253	
MUC16	94025	broad.mit.edu	37	19	9066166	9066167	+	Frame_Shift_Ins	INS	-	-	G			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr19:9066166_9066167insG	ENST00000397910.4	-	3	21482_21483	c.21279_21280insC	c.(21277-21282)cccagcfs	p.S7094fs		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	7096	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GGGAGAGAGCTGGGATTTTCCA	0.51																																						.											0																																										SO:0001589	frameshift_variant	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.21280dupC	19.37:g.9066169_9066169dupG	ENSP00000381008:p.Ser7094fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q6ZQW5|Q96RK2	Frame_Shift_Ins	INS	ENST00000397910.4	37	CCDS54212.1																																																																																				0.510	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ABCD3	5825	ucsc.edu	37	1	94884103	94884103	+	Silent	SNP	C	C	T			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr1:94884103C>T	ENST00000370214.4	+	1	93	c.69C>T	c.(67-69)ctC>ctT	p.L23L	ABCD3_ENST00000394233.2_Silent_p.L23L|ABCD3_ENST00000454898.2_Silent_p.L23L|ABCD3_ENST00000315713.5_Silent_p.L23L|ABCD3_ENST00000536817.1_5'UTR	NM_002858.3	NP_002849.1	P28288	ABCD3_HUMAN	ATP-binding cassette, sub-family D (ALD), member 3	23	Interaction with PEX19.|Targeting to peroxisomes.				ATP catabolic process (GO:0006200)|fatty acid beta-oxidation (GO:0006635)|peroxisome organization (GO:0007031)|transmembrane transport (GO:0055085)|very long-chain fatty acid catabolic process (GO:0042760)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|liver(2)|lung(10)|ovary(1)|pancreas(1)|skin(2)	26		all_lung(203;0.000434)|Lung NSC(277;0.0019)		all cancers(265;0.0261)|Epithelial(280;0.165)		TCCTGCTGCTCTGCCTGCTCC	0.716																																						.											0													22.0	19.0	20.0					1																	94884103		2201	4291	6492	SO:0001819	synonymous_variant	5825			M81182	CCDS749.1, CCDS44175.1	1p21.3	2012-05-16			ENSG00000117528	ENSG00000117528		"""ATP binding cassette transporters / subfamily D"""	67	protein-coding gene	gene with protein product		170995		PXMP1		1301993, 8449508	Standard	NM_002858		Approved	PMP70, ZWS2	uc001dqn.4	P28288	OTTHUMG00000010717	ENST00000370214.4:c.69C>T	1.37:g.94884103C>T		Somatic		WXS	Illumina HiSeq	Phase_I	D3DT46|Q15271|Q6NUN5|Q96DA3|Q9H529	Silent	SNP	ENST00000370214.4	37	CCDS749.1																																																																																				0.716	ABCD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029597.1	NM_002858	
CNTN5	53942	ucsc.edu	37	11	100141946	100141946	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr11:100141946T>C	ENST00000524871.1	+	18	2577	c.2287T>C	c.(2287-2289)Tct>Cct	p.S763P	CNTN5_ENST00000524560.1_3'UTR|CNTN5_ENST00000418526.2_Missense_Mutation_p.S689P|CNTN5_ENST00000528682.1_Missense_Mutation_p.S763P|CNTN5_ENST00000279463.3_Missense_Mutation_p.S763P|CNTN5_ENST00000527185.1_Missense_Mutation_p.S763P	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	763	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		AAGCACCCCATCTCGAATGAT	0.453																																						.											0													95.0	92.0	93.0					11																	100141946		1931	4133	6064	SO:0001583	missense	53942			AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.2287T>C	11.37:g.100141946T>C	ENSP00000435637:p.Ser763Pro	Somatic		WXS	Illumina HiSeq	Phase_I	A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Missense_Mutation	SNP	ENST00000524871.1	37	CCDS53696.1	.	.	.	.	.	.	.	.	.	.	T	24.7	4.562517	0.86335	.	.	ENSG00000149972	ENST00000527185;ENST00000528682;ENST00000524871;ENST00000418526;ENST00000279463	T;T;T;T;T	0.55588	0.51;0.51;0.51;0.51;0.51	5.51	5.51	0.81932	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.83096	0.5180	H	0.98682	4.3	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.994	D	0.89696	0.3901	10	0.87932	D	0	.	14.8139	0.70017	0.0:0.0:0.0:1.0	.	689;763	O94779-2;O94779	.;CNTN5_HUMAN	P	763;763;763;689;763	ENSP00000433575:S763P;ENSP00000436185:S763P;ENSP00000435637:S763P;ENSP00000393229:S689P;ENSP00000279463:S763P	ENSP00000279463:S763P	S	+	1	0	CNTN5	99647156	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.589000	0.82641	2.094000	0.63399	0.383000	0.25322	TCT		0.453	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395148.2	NM_014361	
FOXB1	27023	ucsc.edu;bcgsc.ca	37	15	60297497	60297497	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr15:60297497T>C	ENST00000396057.4	+	2	814	c.335T>C	c.(334-336)cTt>cCt	p.L112P	FOXB1_ENST00000560857.1_Intron	NM_012182.2	NP_036314.2	Q99853	FOXB1_HUMAN	forkhead box B1	112					axon target recognition (GO:0007412)|cell migration in diencephalon (GO:0061381)|epithelial cell differentiation involved in mammary gland alveolus development (GO:0061030)|floor plate development (GO:0033504)|hypothalamus cell migration (GO:0021855)|inferior colliculus development (GO:0061379)|lactation (GO:0007595)|mammary gland lobule development (GO:0061377)|mammillary body development (GO:0021767)|mammillothalamic axonal tract development (GO:0061374)|midbrain development (GO:0030901)|negative regulation of neuron apoptotic process (GO:0043524)|somitogenesis (GO:0001756)|spinal cord development (GO:0021510)|telencephalon cell migration (GO:0022029)|thalamus development (GO:0021794)|transcription, DNA-templated (GO:0006351)|urogenital system development (GO:0001655)|visual learning (GO:0008542)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(1)|lung(3)|ovary(1)	6						TTCAAGGTGCTTAAGTCCGAC	0.697																																						.											0													16.0	18.0	17.0					15																	60297497		2201	4296	6497	SO:0001583	missense	27023			AF055080	CCDS32255.1	15q22.2	2014-09-09			ENSG00000171956	ENSG00000171956		"""Forkhead boxes"""	3799	protein-coding gene	gene with protein product							Standard	NM_012182		Approved	HFKH-5, FKH5	uc002agj.1	Q99853	OTTHUMG00000172011	ENST00000396057.4:c.335T>C	15.37:g.60297497T>C	ENSP00000379369:p.Leu112Pro	Somatic		WXS	Illumina HiSeq	Phase_I	O60652|O75917|Q14CL2	Missense_Mutation	SNP	ENST00000396057.4	37	CCDS32255.1	.	.	.	.	.	.	.	.	.	.	T	13.12	2.142675	0.37825	.	.	ENSG00000171956	ENST00000396057	D	0.95756	-3.8	3.72	3.72	0.42706	.	0.611409	0.14027	U	0.346420	D	0.88603	0.6481	N	0.11131	0.1	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.83225	-0.0066	10	0.27785	T	0.31	.	11.3903	0.49811	0.0:0.0:0.0:1.0	.	112	Q99853	FOXB1_HUMAN	P	112	ENSP00000379369:L112P	ENSP00000379369:L112P	L	+	2	0	FOXB1	58084789	0.210000	0.23517	0.998000	0.56505	0.951000	0.60555	2.577000	0.46042	1.529000	0.49120	0.528000	0.53228	CTT		0.697	FOXB1-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416378.1		
FOXM1	2305	ucsc.edu	37	12	2968317	2968317	+	Silent	SNP	T	T	C			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr12:2968317T>C	ENST00000359843.3	-	9	1847	c.1779A>G	c.(1777-1779)gaA>gaG	p.E593E	AC005841.1_ENST00000382678.3_5'Flank|FOXM1_ENST00000361953.3_Silent_p.E578E|ITFG2_ENST00000545509.1_Intron|FOXM1_ENST00000342628.2_Silent_p.E631E|Y_RNA_ENST00000410561.1_RNA	NM_021953.3	NP_068772.2	Q08050	FOXM1_HUMAN	forkhead box M1	593					cell cycle (GO:0007049)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|liver development (GO:0001889)|mitotic cell cycle (GO:0000278)|negative regulation of cell aging (GO:0090344)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle (GO:0051726)|regulation of cell cycle arrest (GO:0071156)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|regulation of Ras protein signal transduction (GO:0046578)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|skin(1)|urinary_tract(3)	24			OV - Ovarian serous cystadenocarcinoma(31;0.000622)			GTCCTCCCACTTCCTGGGAGT	0.602																																						.											0													49.0	57.0	54.0					12																	2968317		2194	4287	6481	SO:0001819	synonymous_variant	2305			Y12773	CCDS8515.1, CCDS8516.1, CCDS8517.1	12p13	2007-09-18			ENSG00000111206	ENSG00000111206		"""Forkhead boxes"""	3818	protein-coding gene	gene with protein product	"""M-phase phosphoprotein 2"""	602341		FKHL16		9032290, 9441747	Standard	NM_202002		Approved	HFH-11, trident, HNF-3, INS-1, MPP2, MPHOSPH2, TGT3	uc001qlf.3	Q08050	OTTHUMG00000168118	ENST00000359843.3:c.1779A>G	12.37:g.2968317T>C		Somatic		WXS	Illumina HiSeq	Phase_I	O43258|O43259|O43260|Q4ZGG7|Q9BRL2	Silent	SNP	ENST00000359843.3	37	CCDS8515.1																																																																																				0.602	FOXM1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000398272.1	NM_021953	
HNRNPM	4670	ucsc.edu	37	19	8550892	8550892	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr19:8550892T>C	ENST00000325495.4	+	14	1621	c.1580T>C	c.(1579-1581)cTg>cCg	p.L527P	HNRNPM_ENST00000348943.3_Missense_Mutation_p.L488P	NM_005968.4	NP_005959.2	P52272	HNRPM_HUMAN	heterogeneous nuclear ribonucleoprotein M	527	27 X 6 AA repeats of [GEVSTPAN]-[ILMV]- [DE]-[RH]-[MLVI]-[GAV].			L -> P (in Ref. 1 and 3). {ECO:0000305}.	alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|RNA binding (GO:0003723)			endometrium(5)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)	25						CGCATGGGCCTGAGCATGGAG	0.697																																						.											0													48.0	52.0	51.0					19																	8550892		2202	4298	6500	SO:0001583	missense	4670			L03532	CCDS12203.1, CCDS12204.1	19p13.2	2013-06-12		2008-04-18	ENSG00000099783	ENSG00000099783		"""RNA binding motif (RRM) containing"""	5046	protein-coding gene	gene with protein product	"""CEA receptor"""	160994		NAGR1, HNRPM		8441656, 7558047	Standard	NM_005968		Approved	HTGR1, HNRNPM4, HNRPM4, CEAR	uc010dwe.3	P52272	OTTHUMG00000182383	ENST00000325495.4:c.1580T>C	19.37:g.8550892T>C	ENSP00000325376:p.Leu527Pro	Somatic		WXS	Illumina HiSeq	Phase_I	Q15584|Q8WZ44|Q96H56|Q9BWL9|Q9Y492	Missense_Mutation	SNP	ENST00000325495.4	37	CCDS12203.1	.	.	.	.	.	.	.	.	.	.	T	18.22	3.574642	0.65878	.	.	ENSG00000099783	ENST00000325495;ENST00000348943;ENST00000544159;ENST00000539473	T;T	0.13901	2.55;2.85	5.43	5.43	0.79202	.	0.290726	0.35124	N	0.003425	T	0.19127	0.0459	L	0.28274	0.84	0.58432	D	0.999994	D;D;D;D	0.58620	0.976;0.971;0.983;0.98	P;P;P;B	0.56700	0.656;0.641;0.804;0.445	T	0.03103	-1.1072	10	0.28530	T	0.3	.	14.3119	0.66422	0.0:0.0:0.0:1.0	.	367;527;488;412	Q7KYM9;P52272;P52272-2;Q59ES8	.;HNRPM_HUMAN;.;.	P	527;488;412;84	ENSP00000325376:L527P;ENSP00000325732:L488P	ENSP00000325376:L527P	L	+	2	0	HNRNPM	8456892	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.076000	0.57591	2.053000	0.61076	0.482000	0.46254	CTG		0.697	HNRNPM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460894.1		
ISOC1	51015	ucsc.edu;mdanderson.org	37	5	128430757	128430757	+	Silent	SNP	T	T	C	rs1127827	byFrequency	TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr5:128430757T>C	ENST00000173527.5	+	1	314	c.298T>C	c.(298-300)Ttg>Ctg	p.L100L	MIR4633_ENST00000584064.1_RNA	NM_016048.2	NP_057132.2	Q96CN7	ISOC1_HUMAN	isochorismatase domain containing 1	100						extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)	catalytic activity (GO:0003824)			kidney(2)|lung(7)	9		all_cancers(142;0.0813)|Prostate(80;0.0865)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Epithelial(69;0.138)|OV - Ovarian serous cystadenocarcinoma(64;0.164)		CCTCGTGCCGTTGCAGATCCA	0.692													C|||	4039	0.80651	0.9682	0.7464	5008	,	,		11507	0.8661		0.6004	False		,,,				2504	0.7812					.											0								C		3754,388		1706,342,23	17.0	21.0	20.0		298	3.4	1.0	5	dbSNP_86	20	5111,3281		1551,2009,636	no	coding-synonymous	ISOC1	NM_016048.2		3257,2351,659	CC,CT,TT		39.0968,9.3675,29.2724		100/299	128430757	8865,3669	2071	4196	6267	SO:0001819	synonymous_variant	51015			AF151869	CCDS43357.1	5q22.1-q33.3	2010-03-19			ENSG00000066583	ENSG00000066583			24254	protein-coding gene	gene with protein product						10810093, 18566572	Standard	NM_016048		Approved	CGI-111	uc003kva.3	Q96CN7	OTTHUMG00000163144	ENST00000173527.5:c.298T>C	5.37:g.128430757T>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q7Z770	Silent	SNP	ENST00000173527.5	37	CCDS43357.1																																																																																				0.692	ISOC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371826.1	NM_016048	
NCK2	8440	ucsc.edu	37	2	106509538	106509538	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr2:106509538A>G	ENST00000233154.4	+	5	1491	c.1049A>G	c.(1048-1050)cAc>cGc	p.H350R	NCK2_ENST00000451463.2_3'UTR|NCK2_ENST00000522586.1_3'UTR|NCK2_ENST00000393349.2_Missense_Mutation_p.H350R	NM_003581.4	NP_003572.2	O43639	NCK2_HUMAN	NCK adaptor protein 2	350	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				actin filament organization (GO:0007015)|axon guidance (GO:0007411)|cell migration (GO:0016477)|epidermal growth factor receptor signaling pathway (GO:0007173)|lamellipodium assembly (GO:0030032)|negative regulation of cell proliferation (GO:0008285)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of translation (GO:0006417)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|vesicle membrane (GO:0012506)	cytoskeletal adaptor activity (GO:0008093)|receptor signaling complex scaffold activity (GO:0030159)			endometrium(1)|lung(3)|ovary(1)	5						CGGCGCTTCCACACCATGGAC	0.587																																						.											0													76.0	68.0	71.0					2																	106509538		2203	4300	6503	SO:0001583	missense	8440			AF043119	CCDS33266.1	2q12	2013-02-14			ENSG00000071051	ENSG00000071051		"""SH2 domain containing"""	7665	protein-coding gene	gene with protein product		604930				9737977, 16752908	Standard	NM_001004720		Approved	NCKbeta	uc002tdi.3	O43639	OTTHUMG00000153116	ENST00000233154.4:c.1049A>G	2.37:g.106509538A>G	ENSP00000233154:p.His350Arg	Somatic		WXS	Illumina HiSeq	Phase_I	D3DVK1|Q9BWN9|Q9UIC3	Missense_Mutation	SNP	ENST00000233154.4	37	CCDS33266.1	.	.	.	.	.	.	.	.	.	.	A	10.17	1.276996	0.23307	.	.	ENSG00000071051	ENST00000233154;ENST00000393349	T;T	0.62364	0.03;0.03	5.3	4.15	0.48705	SH2 motif (5);	0.303418	0.38663	N	0.001610	T	0.40423	0.1116	N	0.12887	0.27	0.80722	D	1	B	0.02656	0.0	B	0.08055	0.003	T	0.13522	-1.0506	10	0.17832	T	0.49	.	10.7944	0.46451	0.9258:0.0:0.0742:0.0	.	350	O43639	NCK2_HUMAN	R	350	ENSP00000233154:H350R;ENSP00000377018:H350R	ENSP00000233154:H350R	H	+	2	0	NCK2	105875970	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.954000	0.49113	0.875000	0.35847	0.459000	0.35465	CAC		0.587	NCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329634.1	NM_003581	
PDE6B	5158	ucsc.edu	37	4	656004	656004	+	Missense_Mutation	SNP	G	G	T			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr4:656004G>T	ENST00000496514.1	+	13	1717	c.1696G>T	c.(1696-1698)Gcc>Tcc	p.A566S	PDE6B_ENST00000429163.2_Missense_Mutation_p.A287S|RP11-1191J2.5_ENST00000609172.1_RNA|PDE6B_ENST00000255622.6_Missense_Mutation_p.A566S			P35913	PDE6B_HUMAN	phosphodiesterase 6B, cGMP-specific, rod, beta	566					cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)			NS(1)|breast(3)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|urinary_tract(1)	30					Caffeine(DB00201)	CTTCAACGTGGCCCAGACGAT	0.617																																					GBM(71;463 1194 9848 25922 46834)	.											0													47.0	36.0	40.0					4																	656004		2193	4293	6486	SO:0001583	missense	5158			BC000249	CCDS33932.1, CCDS46993.1, CCDS54703.1	4p16.3	2014-01-28	2008-07-31		ENSG00000133256	ENSG00000133256	3.1.4.17	"""Phosphodiesterases"""	8786	protein-coding gene	gene with protein product	"""congenital stationary night blindness 3, autosomal dominant"""	180072		PDEB		1313787	Standard	NM_001145292		Approved	CSNB3, rd1, RP40, CSNBAD2	uc003gap.3	P35913	OTTHUMG00000159909	ENST00000496514.1:c.1696G>T	4.37:g.656004G>T	ENSP00000420295:p.Ala566Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z9T9|E7ETT3|Q53XN5|Q9BWH5|Q9UD49	Missense_Mutation	SNP	ENST00000496514.1	37	CCDS33932.1	.	.	.	.	.	.	.	.	.	.	G	18.06	3.539461	0.65085	.	.	ENSG00000133256	ENST00000255622;ENST00000496514;ENST00000429163	T;T;T	0.77750	-1.12;-1.12;-1.12	4.41	4.41	0.53225	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.060860	0.64402	D	0.000004	T	0.69878	0.3160	L	0.28556	0.865	0.51012	D	0.999906	B;B	0.22983	0.078;0.063	B;B	0.29267	0.1;0.089	T	0.70396	-0.4883	10	0.66056	D	0.02	.	14.5094	0.67774	0.0:0.0:1.0:0.0	.	566;566	P35913;P35913-2	PDE6B_HUMAN;.	S	566;566;287	ENSP00000255622:A566S;ENSP00000420295:A566S;ENSP00000406334:A287S	ENSP00000255622:A566S	A	+	1	0	PDE6B	646004	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.246000	0.95438	2.001000	0.58596	0.558000	0.71614	GCC		0.617	PDE6B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358109.1	NM_000283	
SFI1	9814	ucsc.edu	37	22	32009705	32009705	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr22:32009705A>G	ENST00000400288.2	+	27	2965	c.2860A>G	c.(2860-2862)Acg>Gcg	p.T954A	SFI1_ENST00000414585.1_Missense_Mutation_p.T801A|SFI1_ENST00000443011.1_Missense_Mutation_p.T801A|SFI1_ENST00000400289.1_Missense_Mutation_p.T872A|SFI1_ENST00000432498.1_Missense_Mutation_p.T923A|SFI1_ENST00000443326.1_Missense_Mutation_p.T872A|SFI1_ENST00000540643.1_Missense_Mutation_p.T899A	NM_001007467.2	NP_001007468.1	A8K8P3	SFI1_HUMAN	Sfi1 homolog, spindle assembly associated (yeast)	954					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(2)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)	38						CAGGAAAGTGACGTTTGAGGG	0.657											OREG0003527	type=REGULATORY REGION|Gene=SFI1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																										.											0													25.0	29.0	28.0					22																	32009705		2014	4170	6184	SO:0001583	missense	9814			AB011114	CCDS43004.1, CCDS43005.1, CCDS58803.1, CCDS58804.1	22q12.2	2014-06-13			ENSG00000198089	ENSG00000198089			29064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 139"""	612765				14504268	Standard	NM_001007467		Approved	KIAA0542, PISD, PPP1R139	uc003ale.4	A8K8P3	OTTHUMG00000030249	ENST00000400288.2:c.2860A>G	22.37:g.32009705A>G	ENSP00000383145:p.Thr954Ala	Somatic	829	WXS	Illumina HiSeq	Phase_I	A1L373|A1L387|A2A2L2|B1AKL9|B5MDB7|B7Z1V6|B7Z8G3|B7ZBE2|B7ZBE3|O60289|Q2TAN8|Q5W1B5|Q86TK0|Q8N4U8|Q8N8C1|Q8WU14	Missense_Mutation	SNP	ENST00000400288.2	37	CCDS43004.1	.	.	.	.	.	.	.	.	.	.	A	15.54	2.865159	0.51482	.	.	ENSG00000198089	ENST00000432498;ENST00000540643;ENST00000443326;ENST00000421060;ENST00000414585;ENST00000443011;ENST00000400289;ENST00000400288;ENST00000417682	T;T;T;T;T;T;T;T	0.16897	2.9;2.9;2.75;2.73;2.75;2.75;2.9;2.31	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	T	0.13415	0.0325	N	0.08118	0	0.41984	D	0.990818	P;P;B;P;B	0.45044	0.849;0.837;0.143;0.72;0.231	P;B;B;P;B	0.47251	0.542;0.265;0.075;0.456;0.183	T	0.11567	-1.0582	10	0.72032	D	0.01	.	12.5779	0.56373	1.0:0.0:0.0:0.0	.	899;860;872;923;954	A8K8P3-9;A8K8P3-10;A8K8P3-3;A8K8P3-2;A8K8P3	.;.;.;.;SFI1_HUMAN	A	923;899;872;703;801;801;872;954;537	ENSP00000402679:T923A;ENSP00000443025:T899A;ENSP00000416469:T872A;ENSP00000397148:T801A;ENSP00000401199:T801A;ENSP00000383146:T872A;ENSP00000383145:T954A;ENSP00000398871:T537A	ENSP00000383145:T954A	T	+	1	0	SFI1	30339705	1.000000	0.71417	0.993000	0.49108	0.022000	0.10575	2.412000	0.44609	1.916000	0.55485	0.379000	0.24179	ACG		0.657	SFI1-023	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337180.3	NM_014775	
TANC1	85461	ucsc.edu	37	2	160031482	160031482	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr2:160031482T>C	ENST00000263635.6	+	12	1759	c.1522T>C	c.(1522-1524)Tgc>Cgc	p.C508R	TANC1_ENST00000454300.1_Missense_Mutation_p.C402R	NM_001145909.1|NM_033394.2	NP_001139381.1|NP_203752.2	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1	508					dendritic spine maintenance (GO:0097062)|myoblast fusion (GO:0007520)|visual learning (GO:0008542)	axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)				breast(3)|central_nervous_system(4)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(25)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	77						CTACCACTACTGCCAGGCTGA	0.572																																						.											0													290.0	292.0	291.0					2																	160031482		2149	4251	6400	SO:0001583	missense	85461			AB051515	CCDS42766.1	2q24.2	2013-01-11			ENSG00000115183	ENSG00000115183		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29364	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	611397				15673434	Standard	NM_033394		Approved	KIAA1728, ROLSB	uc002uag.3	Q9C0D5	OTTHUMG00000153945	ENST00000263635.6:c.1522T>C	2.37:g.160031482T>C	ENSP00000263635:p.Cys508Arg	Somatic		WXS	Illumina HiSeq	Phase_I	C9JD88|Q49AI8	Missense_Mutation	SNP	ENST00000263635.6	37	CCDS42766.1	.	.	.	.	.	.	.	.	.	.	T	24.1	4.492544	0.84962	.	.	ENSG00000115183	ENST00000454300;ENST00000263635	D;D	0.82984	-1.59;-1.67	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.91908	0.7438	M	0.84585	2.705	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.996;0.998;0.999	D	0.93127	0.6530	10	0.87932	D	0	.	15.9958	0.80243	0.0:0.0:0.0:1.0	.	500;402;508	B9EK39;Q9C0D5-2;Q9C0D5	.;.;TANC1_HUMAN	R	402;508	ENSP00000396339:C402R;ENSP00000263635:C508R	ENSP00000263635:C508R	C	+	1	0	TANC1	159739728	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.040000	0.89188	2.188000	0.69820	0.533000	0.62120	TGC		0.572	TANC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333135.1		
TGM6	343641	ucsc.edu	37	20	2381066	2381066	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr20:2381066A>G	ENST00000202625.2	+	7	1026	c.965A>G	c.(964-966)gAg>gGg	p.E322G	TGM6_ENST00000381423.1_Missense_Mutation_p.E322G|TGM6_ENST00000477505.1_3'UTR	NM_198994.2	NP_945345.2	O95932	TGM3L_HUMAN	transglutaminase 6	322					cell death (GO:0008219)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(1)|endometrium(6)|kidney(2)|large_intestine(2)|lung(32)|ovary(4)|prostate(1)|skin(4)	52					L-Glutamine(DB00130)	CGGACCCTGGAGGACCTGACA	0.602																																						.											0													99.0	87.0	91.0					20																	2381066		2203	4300	6503	SO:0001583	missense	343641			AF540970	CCDS13025.1, CCDS58761.1	20p13	2010-12-19	2004-07-05	2004-07-07	ENSG00000166948	ENSG00000166948		"""Transglutaminases"""	16255	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 35"""	613900	"""transglutaminase 3-like"""	TGM3L		11390390, 21106500	Standard	NM_198994		Approved	dJ734P14.3, TGY, SCA35	uc002wfy.1	O95932	OTTHUMG00000031692	ENST00000202625.2:c.965A>G	20.37:g.2381066A>G	ENSP00000202625:p.Glu322Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q5JXU4|Q5JXU5|Q719M2|Q719M3|Q9Y4U8	Missense_Mutation	SNP	ENST00000202625.2	37	CCDS13025.1	.	.	.	.	.	.	.	.	.	.	A	16.89	3.247643	0.59103	.	.	ENSG00000166948	ENST00000202625;ENST00000381423	D;D	0.95412	-3.7;-3.7	4.27	4.27	0.50696	Transglutaminase-like (2);	0.000000	0.52532	D	0.000080	D	0.90177	0.6930	L	0.33093	0.98	0.36318	D	0.858098	P;P	0.37781	0.554;0.608	B;B	0.37047	0.231;0.24	D	0.89656	0.3873	10	0.36615	T	0.2	-36.2913	6.5194	0.22266	0.892:0.0:0.108:0.0	.	322;322	O95932-2;O95932	.;TGM3L_HUMAN	G	322	ENSP00000202625:E322G;ENSP00000370831:E322G	ENSP00000202625:E322G	E	+	2	0	TGM6	2329066	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.803000	0.62546	1.939000	0.56221	0.379000	0.24179	GAG		0.602	TGM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077581.2	NM_198994	
ACAT1	38	mdanderson.org	37	11	107992346	107992346	+	Missense_Mutation	SNP	G	G	C	rs11540420|rs3741056	byFrequency	TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr11:107992346G>C	ENST00000265838.4	+	1	104	c.13G>C	c.(13-15)Gcg>Ccg	p.A5P	RP11-144G7.2_ENST00000525548.1_RNA|ACAT1_ENST00000299355.6_Missense_Mutation_p.A5P	NM_000019.3	NP_000010.1	P24752	THIL_HUMAN	acetyl-CoA acetyltransferase 1	5			A -> P (in dbSNP:rs3741056).		adipose tissue development (GO:0060612)|brain development (GO:0007420)|branched-chain amino acid catabolic process (GO:0009083)|cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|cellular nitrogen compound metabolic process (GO:0034641)|ketone body biosynthetic process (GO:0046951)|ketone body catabolic process (GO:0046952)|liver development (GO:0001889)|metanephric proximal convoluted tubule development (GO:0072229)|protein homooligomerization (GO:0051260)|response to hormone (GO:0009725)|response to organic cyclic compound (GO:0014070)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	acetyl-CoA C-acetyltransferase activity (GO:0003985)|coenzyme binding (GO:0050662)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|lung(3)|ovary(3)|prostate(2)	10		all_cancers(61;6.41e-10)|all_epithelial(67;2.83e-06)|Melanoma(852;1.46e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;2.96e-05)|Epithelial(105;4.35e-05)|all cancers(92;0.00108)|OV - Ovarian serous cystadenocarcinoma(223;0.192)	Sulfasalazine(DB00795)	GGCTGTGCTGGCGGCACTTCT	0.726													G|||	1662	0.331869	0.1293	0.4222	5008	,	,		13418	0.3601		0.3419	False		,,,				2504	0.502					.											0								G	PRO/ALA	498,3570		40,418,1576	7.0	7.0	7.0		13	0.2	0.0	11	dbSNP_107	7	2021,5923		259,1503,2210	yes	missense	ACAT1	NM_000019.3	27	299,1921,3786	CC,CG,GG		25.4406,12.2419,20.9707	possibly-damaging	5/428	107992346	2519,9493	2034	3972	6006	SO:0001583	missense	38			D90228	CCDS8339.1	11q22.3	2010-04-30	2010-04-30		ENSG00000075239	ENSG00000075239	2.3.1.9		93	protein-coding gene	gene with protein product	"""acetoacetyl Coenzyme A thiolase"""	607809	"""acetyl-Coenzyme A acetyltransferase 1"""	ACAT		1979337	Standard	NM_000019		Approved	THIL	uc001pjy.3	P24752	OTTHUMG00000166381	ENST00000265838.4:c.13G>C	11.37:g.107992346G>C	ENSP00000265838:p.Ala5Pro	Somatic		WXS	Illumina HiSeq	Phase_I	B2R6H1|G3XAB4|Q96FG8	Missense_Mutation	SNP	ENST00000265838.4	37	CCDS8339.1	677	0.309981684981685	73	0.1483739837398374	142	0.39226519337016574	210	0.36713286713286714	252	0.3324538258575198	G	16.39	3.111218	0.56398	0.122419	0.254406	ENSG00000075239	ENST00000265838;ENST00000299355	D;D	0.93906	-3.13;-3.31	3.31	0.195	0.15151	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	P;P	0.37864	0.61;0.514	B;B	0.35688	0.103;0.208	T	0.11792	-1.0573	8	0.66056	D	0.02	-1.264	2.6303	0.04942	0.2756:0.0:0.4998:0.2246	rs3741056;rs17800684;rs17845275;rs17858107;rs3741056	5;5	P24752;G3XAB4	THIL_HUMAN;.	P	5	ENSP00000265838:A5P;ENSP00000299355:A5P	ENSP00000265838:A5P	A	+	1	0	ACAT1	107497556	0.001000	0.12720	0.002000	0.10522	0.760000	0.43138	-0.118000	0.10692	0.050000	0.15949	-0.475000	0.04921	GCG		0.726	ACAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389474.1	NM_000019	
CCDC144NL	339184	mdanderson.org	37	17	20768730	20768730	+	Nonstop_Mutation	SNP	A	A	G	rs4605228	byFrequency	TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr17:20768730A>G	ENST00000327925.5	-	4	783	c.664T>C	c.(664-666)Taa>Caa	p.*222Q	CCDC144NL_ENST00000539484.1_Splice_Site	NM_001004306.1	NP_001004306.1	Q6NUI1	C144L_HUMAN	coiled-coil domain containing 144 family, N-terminal like	0										large_intestine(3)|lung(3)|skin(1)	7						GTGAATGTTTACCTTACAACA	0.358													N|||	51	0.0101837	0.0333	0.0029	5008	,	,		19241	0.0		0.001	False		,,,				2504	0.0041					.											0													101.0	93.0	96.0					17																	20768730		2203	4300	6503	SO:0001578	stop_lost	339184				CCDS32591.1	17p11.2	2009-01-15			ENSG00000205212	ENSG00000205212			33735	protein-coding gene	gene with protein product							Standard	NM_001004306		Approved	MGC87631	uc002gyf.3	Q6NUI1	OTTHUMG00000132271	ENST00000327925.5:c.664T>C	17.37:g.20768730A>G	ENSP00000328054:p.*222Gluext*26	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000327925.5	37	CCDS32591.1	.	.	.	.	.	.	.	.	.	.	N	0.770	-0.766154	0.02974	.	.	ENSG00000205212	ENST00000327925	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	rs4605228;rs52789726;rs4605228	.	.	.	Q	222	.	.	X	-	1	0	CCDC144NL	20709322	0.038000	0.19896	0.003000	0.11579	0.003000	0.03518	-1.896000	0.01605	-1.871000	0.01138	-1.895000	0.00532	TAA		0.358	CCDC144NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255361.2	NM_001004306	
FRG1B	284802	mdanderson.org	37	20	29624052	29624052	+	Missense_Mutation	SNP	C	C	G			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr20:29624052C>G	ENST00000278882.3	+	4	456	c.76C>G	c.(76-78)Cct>Gct	p.P26A	FRG1B_ENST00000439954.2_Missense_Mutation_p.P31A|FRG1B_ENST00000358464.4_Missense_Mutation_p.P26A			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	26										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						GGGCCCTAGTCCTCCAGAGCA	0.279																																						.											0																																										SO:0001583	missense	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.76C>G	20.37:g.29624052C>G	ENSP00000278882:p.Pro26Ala	Somatic		WXS	Illumina HiSeq	Phase_I	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	c	11.20	1.569321	0.28003	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.51817	0.69	1.91	1.91	0.25777	.	0.054688	0.85682	D	0.000000	T	0.51176	0.1659	.	.	.	0.53688	D	0.999971	.	.	.	.	.	.	T	0.50825	-0.8782	7	0.40728	T	0.16	.	9.8627	0.41125	0.0:1.0:0.0:0.0	.	.	.	.	A	26;31;26	ENSP00000408863:P31A	ENSP00000278882:P26A	P	+	1	0	FRG1B	28237713	1.000000	0.71417	1.000000	0.80357	0.408000	0.30992	6.195000	0.72088	1.383000	0.46405	0.184000	0.17185	CCT		0.279	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
FRG1B	284802	mdanderson.org	37	20	29624054	29624054	+	Silent	SNP	T	T	A			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr20:29624054T>A	ENST00000278882.3	+	4	458	c.78T>A	c.(76-78)ccT>ccA	p.P26P	FRG1B_ENST00000439954.2_Silent_p.P31P|FRG1B_ENST00000358464.4_Silent_p.P26P			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	26										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						GCCCTAGTCCTCCAGAGCAGT	0.279																																						.											0																																										SO:0001819	synonymous_variant	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.78T>A	20.37:g.29624054T>A		Somatic		WXS	Illumina HiSeq	Phase_I	C4AME5	RNA	SNP	ENST00000278882.3	37																																																																																					0.279	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
HYDIN	54768	mdanderson.org	37	16	71025245	71025245	+	Silent	SNP	C	C	T	rs1774516	byFrequency	TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr16:71025245C>T	ENST00000393567.2	-	25	3990	c.3840G>A	c.(3838-3840)acG>acA	p.T1280T		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	1280					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				TGGAAGCTTTCGTTTTTCTTA	0.463																																						.											0													130.0	119.0	122.0					16																	71025245		1909	4145	6054	SO:0001819	synonymous_variant	54768			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.3840G>A	16.37:g.71025245C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Silent	SNP	ENST00000393567.2	37	CCDS59269.1																																																																																				0.463	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3		
MEGF6	1953	mdanderson.org	37	1	3413868	3413868	+	Missense_Mutation	SNP	C	C	G	rs4648506	byFrequency	TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr1:3413868C>G	ENST00000356575.4	-	27	3636	c.3410G>C	c.(3409-3411)gGc>gCc	p.G1137A	MEGF6_ENST00000294599.4_Missense_Mutation_p.G946A	NM_001409.3	NP_001400.3	O75095	MEGF6_HUMAN	multiple EGF-like-domains 6	1137	EGF-like 21. {ECO:0000255|PROSITE- ProRule:PRU00076}.		G -> A (in dbSNP:rs4648506). {ECO:0000269|PubMed:9693030}.			extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			cervix(2)|endometrium(3)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)		GCAGGCAGCGCCAGGCGGGCA	0.716													C|||	1222	0.24401	0.146	0.3357	5008	,	,		12528	0.1865		0.3201	False		,,,				2504	0.2924				Ovarian(73;978 3658)	.											0								C	ALA/GLY	547,3569		48,451,1559	8.0	13.0	11.0		3410	0.1	0.0	1	dbSNP_111	11	2204,6092		339,1526,2283	no	missense	MEGF6	NM_001409.3	60	387,1977,3842	GG,GC,CC		26.567,13.2896,22.164	possibly-damaging	1137/1542	3413868	2751,9661	2058	4148	6206	SO:0001583	missense	1953			AB011539	CCDS41237.1	1p36.3	2008-02-05	2006-03-31	2006-03-31	ENSG00000162591	ENSG00000162591			3232	protein-coding gene	gene with protein product		604266	"""EGF-like-domain, multiple 3"""	EGFL3		9693030	Standard	NM_001409		Approved		uc001akl.3	O75095	OTTHUMG00000000611	ENST00000356575.4:c.3410G>C	1.37:g.3413868C>G	ENSP00000348982:p.Gly1137Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q4AC86|Q5VV39	Missense_Mutation	SNP	ENST00000356575.4	37	CCDS41237.1	532	0.24358974358974358	83	0.16869918699186992	101	0.27900552486187846	130	0.22727272727272727	218	0.287598944591029	C	12.32	1.903437	0.33628	0.132896	0.26567	ENSG00000162591	ENST00000294599;ENST00000356575	T;T	0.71934	-0.09;-0.61	4.36	0.0897	0.14460	EGF-like, laminin (2);Epidermal growth factor-like, type 3 (1);	0.182174	0.48286	N	0.000200	T	0.00012	0.0000	M	0.91663	3.23	0.40306	P	0.021338999999999997	P;P	0.51147	0.942;0.929	P;P	0.62435	0.902;0.841	T	0.05022	-1.0911	9	0.62326	D	0.03	-7.763	6.2955	0.21083	0.0:0.6314:0.1331:0.2355	rs4648506	1137;946	O75095;O75095-2	MEGF6_HUMAN;.	A	946;1137	ENSP00000294599:G946A;ENSP00000348982:G1137A	ENSP00000294599:G946A	G	-	2	0	MEGF6	3403728	0.002000	0.14202	0.000000	0.03702	0.135000	0.20990	0.253000	0.18296	-0.064000	0.13043	0.561000	0.74099	GGC		0.716	MEGF6-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354866.1	NM_001409	
PCMTD1	115294	mdanderson.org	37	8	52733016	52733016	+	Silent	SNP	T	T	C	rs117828481		TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr8:52733016T>C	ENST00000360540.5	-	7	1375	c.969A>G	c.(967-969)gcA>gcG	p.A323A	PCMTD1_ENST00000544451.1_Silent_p.A247A|PCMTD1_ENST00000519559.1_5'UTR|PCMTD1_ENST00000522514.1_Silent_p.A323A	NM_052937.2	NP_443169.2	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1	323						cytoplasm (GO:0005737)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)			NS(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(17)|prostate(2)|skin(8)|soft_tissue(1)	37		Lung NSC(129;0.0795)|all_lung(136;0.144)				CTGGCTTCATTGCTTCATTGT	0.393																																						.											0													100.0	84.0	89.0					8																	52733016		2203	4300	6503	SO:0001819	synonymous_variant	115294				CCDS6148.1, CCDS69480.1	8q11.23	2010-08-05			ENSG00000168300	ENSG00000168300			30483	protein-coding gene	gene with protein product							Standard	XM_005251146		Approved	FLJ10883	uc003xqx.4	Q96MG8	OTTHUMG00000164246	ENST00000360540.5:c.969A>G	8.37:g.52733016T>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q96FK9	Silent	SNP	ENST00000360540.5	37	CCDS6148.1																																																																																				0.393	PCMTD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377909.2	NM_052937	
SCAPER	49855	mdanderson.org	37	15	77046256	77046257	+	Missense_Mutation	DNP	GC	GC	TA			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr15:77046256_77046257GC>TA	ENST00000563290.1	-	15	1853_1854	c.1758_1759GC>TA	c.(1756-1761)ttGCta>ttTAta	p.586_587LL>FI	SCAPER_ENST00000324767.7_Missense_Mutation_p.586_587LL>FI|SCAPER_ENST00000538941.2_Missense_Mutation_p.340_341LL>FI			Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	586	Glu-rich.					endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(16)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	39						CGTTGATCTAGCAATTCTTCCT	0.361																																						.											0																																										SO:0001583	missense	49855			AB040887, AF242528	CCDS53961.1, CCDS53962.1	15q24.3	2012-10-05	2009-03-11	2007-08-20	ENSG00000140386	ENSG00000140386		"""Zinc fingers, C2H2-type"""	13081	protein-coding gene	gene with protein product		611611	"""zinc finger protein 291"""	ZNF291		17698606	Standard	NM_020843		Approved	Zfp291	uc002bby.3	Q9BY12	OTTHUMG00000172655	ENST00000563290.1:c.1758_1759delinsTA	15.37:g.77046256_77046257delinsTA	ENSP00000454973:p.L586_L587delinsFI	Somatic		WXS	Illumina HiSeq	Phase_I	F5H7X8|H3BNR7|Q3B7X7|Q96BS9|Q9H3D8|Q9NT03|Q9P274	Missense_Mutation	DNP	ENST00000563290.1	37	CCDS53962.1																																																																																				0.361	SCAPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419698.1	NM_020843	
SLC25A29	123096	mdanderson.org	37	14	100759046	100759046	+	Silent	SNP	C	C	A	rs3825555	byFrequency	TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr14:100759046C>A	ENST00000359232.3	-	4	786	c.486G>T	c.(484-486)acG>acT	p.T162T	SLC25A29_ENST00000392908.3_3'UTR|SLC25A29_ENST00000556505.1_Silent_p.T96T|RP11-638I2.6_ENST00000556458.1_lincRNA|AL157871.2_ENST00000553954.1_RNA|SLC25A29_ENST00000539621.1_Silent_p.T96T|SLC25A29_ENST00000555927.1_Silent_p.T96T|SLC25A29_ENST00000554912.1_Silent_p.T96T	NM_001039355.1	NP_001034444.1	Q8N8R3	MCATL_HUMAN	solute carrier family 25 (mitochondrial carnitine/acylcarnitine carrier), member 29	162						integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	acyl carnitine transmembrane transporter activity (GO:0015227)			NS(1)|endometrium(1)|ovary(1)	3		Melanoma(154;0.152)			L-Carnitine(DB00583)	CGAAGCTGGGCGTCTCACGCA	0.682													C|||	2656	0.530351	0.3865	0.6081	5008	,	,		13189	0.7083		0.5676	False		,,,				2504	0.4479					.											0								C		1913,2477		431,1051,713	29.0	19.0	22.0		486	1.1	1.0	14	dbSNP_107	22	4870,3718		1397,2076,821	no	coding-synonymous	SLC25A29	NM_001039355.1		1828,3127,1534	AA,AC,CC		43.293,43.5763,47.7346		162/304	100759046	6783,6195	2195	4294	6489	SO:0001819	synonymous_variant	123096			AK095532	CCDS32156.1	14q32.2	2013-05-22	2012-03-29	2004-01-21	ENSG00000197119	ENSG00000197119		"""Solute carriers"""	20116	protein-coding gene	gene with protein product		615064	"""chromosome 14 open reading frame 69"", ""solute carrier family 25, member 29"""	C14orf69			Standard	XM_005267343		Approved	FLJ38975	uc010twx.2	Q8N8R3	OTTHUMG00000171569	ENST00000359232.3:c.486G>T	14.37:g.100759046C>A		Somatic		WXS	Illumina HiSeq	Phase_I	A3KMR5|Q541V0	Silent	SNP	ENST00000359232.3	37	CCDS32156.1																																																																																				0.682	SLC25A29-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000072449.3		
VPS54	51542	mdanderson.org	37	2	64124722	64124722	+	Missense_Mutation	SNP	C	C	A	rs11558741	byFrequency	TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr2:64124722C>A	ENST00000272322.4	-	22	2890	c.2736G>T	c.(2734-2736)atG>atT	p.M912I	VPS54_ENST00000354504.3_Missense_Mutation_p.M759I|VPS54_ENST00000409558.4_Missense_Mutation_p.M900I			Q9P1Q0	VPS54_HUMAN	vacuolar protein sorting 54 homolog (S. cerevisiae)	912			M -> I (in dbSNP:rs11558741).		growth (GO:0040007)|homeostasis of number of cells within a tissue (GO:0048873)|musculoskeletal movement (GO:0050881)|neurofilament cytoskeleton organization (GO:0060052)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	GARP complex (GO:0000938)				endometrium(3)|kidney(4)|large_intestine(8)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	27						TTAAAAATAACATCTGAAAAA	0.254													C|||	691	0.137979	0.1611	0.1441	5008	,	,		16567	0.0813		0.164	False		,,,				2504	0.1339					.											0								C	ILE/MET,ILE/MET	600,3794		38,524,1635	53.0	55.0	54.0		2700,2736	4.7	1.0	2	dbSNP_120	54	1292,7294		118,1056,3119	yes	missense,missense	VPS54	NM_001005739.1,NM_016516.2	10,10	156,1580,4754	AA,AC,CC		15.0478,13.655,14.5763	benign,benign	900/966,912/978	64124722	1892,11088	2197	4293	6490	SO:0001583	missense	51542			AF102177	CCDS33208.1, CCDS46302.1	2p15-p14	2014-06-13	2006-12-19		ENSG00000143952	ENSG00000143952			18652	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 164"""	614633	"""vacuolar protein sorting 54 (yeast)"""			12039048	Standard	NM_016516		Approved	HCC8, PPP1R164	uc002scq.3	Q9P1Q0	OTTHUMG00000152627	ENST00000272322.4:c.2736G>T	2.37:g.64124722C>A	ENSP00000272322:p.Met912Ile	Somatic		WXS	Illumina HiSeq	Phase_I	Q5VIR5|Q86YF7|Q8N6G3|Q9NPV0|Q9NT07|Q9NUJ0	Missense_Mutation	SNP	ENST00000272322.4	37	CCDS33208.1	328	0.15018315018315018	96	0.1951219512195122	45	0.12430939226519337	54	0.0944055944055944	133	0.17546174142480211	C	13.89	2.373226	0.42105	0.13655	0.150478	ENSG00000143952	ENST00000354504;ENST00000272322;ENST00000409558;ENST00000483277;ENST00000394400	T;T;T	0.33438	1.41;1.42;1.42	5.58	4.69	0.59074	.	0.038119	0.85682	D	0.000000	T	0.00039	0.0001	L	0.47716	1.5	0.21652	P	0.999607941	B;B;B	0.09022	0.002;0.0;0.0	B;B;B	0.08055	0.001;0.0;0.003	T	0.10753	-1.0616	9	0.21540	T	0.41	.	9.7045	0.40207	0.1378:0.7903:0.0:0.072	rs11558741;rs17619976;rs60970434;rs17619976	759;912;900	Q9P1Q0-3;Q9P1Q0;Q9P1Q0-4	.;VPS54_HUMAN;.	I	759;912;900;900;912	ENSP00000346499:M759I;ENSP00000272322:M912I;ENSP00000386980:M900I	ENSP00000272322:M912I	M	-	3	0	VPS54	63978226	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	3.329000	0.52060	2.611000	0.88343	0.543000	0.68304	ATG		0.254	VPS54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327062.2	NM_016516	
SCAPER	49855	bcgsc.ca	37	15	77046257	77046257	+	Missense_Mutation	SNP	C	C	A			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr15:77046257C>A	ENST00000563290.1	-	15	1853	c.1758G>T	c.(1756-1758)ttG>ttT	p.L586F	SCAPER_ENST00000324767.7_Missense_Mutation_p.L586F|SCAPER_ENST00000538941.2_Missense_Mutation_p.L340F			Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	586	Glu-rich.					endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(16)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	39						GTTGATCTAGCAATTCTTCCT	0.363																																						.											0													225.0	211.0	215.0					15																	77046257		1860	4098	5958	SO:0001583	missense	49855			AB040887, AF242528	CCDS53961.1, CCDS53962.1	15q24.3	2012-10-05	2009-03-11	2007-08-20	ENSG00000140386	ENSG00000140386		"""Zinc fingers, C2H2-type"""	13081	protein-coding gene	gene with protein product		611611	"""zinc finger protein 291"""	ZNF291		17698606	Standard	NM_020843		Approved	Zfp291	uc002bby.3	Q9BY12	OTTHUMG00000172655	ENST00000563290.1:c.1758G>T	15.37:g.77046257C>A	ENSP00000454973:p.Leu586Phe	Somatic		WXS	Illumina HiSeq	Phase_I	F5H7X8|H3BNR7|Q3B7X7|Q96BS9|Q9H3D8|Q9NT03|Q9P274	Missense_Mutation	SNP	ENST00000563290.1	37	CCDS53962.1	.	.	.	.	.	.	.	.	.	.	c	17.66	3.445129	0.63178	.	.	ENSG00000140386	ENST00000324767;ENST00000538941;ENST00000303521	T;T	0.32753	1.48;1.44	5.77	-0.477	0.12097	.	0.000000	0.85682	D	0.000000	T	0.47248	0.1435	M	0.64170	1.965	0.43263	D	0.995206	D;D	0.89917	1.0;1.0	D;D	0.81914	0.992;0.995	T	0.29397	-1.0013	10	0.44086	T	0.13	.	12.4807	0.55839	0.0:0.4418:0.0:0.5582	.	607;340	Q9BY12-2;F5H7X8	.;.	F	586;340;608	ENSP00000326924:L586F;ENSP00000442190:L340F	ENSP00000303560:L608F	L	-	3	2	SCAPER	74833312	0.939000	0.31865	0.804000	0.32291	0.951000	0.60555	0.619000	0.24388	-0.346000	0.08312	-1.057000	0.02308	TTG		0.363	SCAPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419698.1	NM_020843	
TSC2	7249	bcgsc.ca	37	16	2131706	2131706	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr16:2131706T>C	ENST00000219476.3	+	31	4351	c.3721T>C	c.(3721-3723)Ttc>Ctc	p.F1241L	TSC2_ENST00000401874.2_Missense_Mutation_p.F1197L|TSC2_ENST00000568454.1_Missense_Mutation_p.F1208L|TSC2_ENST00000353929.4_Missense_Mutation_p.F1198L|TSC2_ENST00000439673.2_Missense_Mutation_p.F1161L|TSC2_ENST00000382538.6_Missense_Mutation_p.F1149L|TSC2_ENST00000350773.4_Missense_Mutation_p.F1241L	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2	1241					acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				GGCTGAGCGCTTCAAGGAGCA	0.627			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																													.	yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	0													74.0	62.0	66.0					16																	2131706		2198	4299	6497	SO:0001583	missense	7249	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.3721T>C	16.37:g.2131706T>C	ENSP00000219476:p.Phe1241Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Missense_Mutation	SNP	ENST00000219476.3	37	CCDS10458.1	.	.	.	.	.	.	.	.	.	.	T	14.28	2.486907	0.44249	.	.	ENSG00000103197	ENST00000219476;ENST00000401874;ENST00000353929;ENST00000439673;ENST00000382538;ENST00000350773	D;D;D;D;D	0.88277	-2.3;-2.3;-2.36;-2.34;-2.29	4.7	4.7	0.59300	.	0.199293	0.45126	D	0.000394	D	0.86514	0.5951	L	0.31294	0.92	0.37284	D	0.907948	B;B;B;B;B;D	0.54964	0.008;0.013;0.013;0.003;0.141;0.969	B;B;B;B;B;D	0.63381	0.019;0.043;0.043;0.043;0.049;0.914	T	0.83306	-0.0025	10	0.07175	T	0.84	-37.4738	7.2036	0.25895	0.0:0.1691:0.0:0.8309	.	1149;1161;1241;1197;1197;1241	B4DIL8;P49815-6;P49815-4;P49815-3;P49815-5;P49815	.;.;.;.;.;TSC2_HUMAN	L	1241;1198;1198;1161;1149;1241	ENSP00000219476:F1241L;ENSP00000248099:F1198L;ENSP00000399232:F1161L;ENSP00000371978:F1149L;ENSP00000344383:F1241L	ENSP00000219476:F1241L	F	+	1	0	TSC2	2071707	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	3.291000	0.51764	1.767000	0.52121	0.459000	0.35465	TTC		0.627	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250657.2	NM_000548	
GALNS	2588	bcgsc.ca	37	16	88908342	88908347	+	In_Frame_Del	DEL	TGCGGA	TGCGGA	-	rs118204441		TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	TGCGGA	TGCGGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr16:88908342_88908347delTGCGGA	ENST00000268695.5	-	3	365_370	c.277_282delTCCGCA	c.(277-282)tccgcadel	p.SA93del	GALNS_ENST00000565364.1_5'UTR|GALNS_ENST00000542788.1_Intron	NM_000512.4	NP_000503.1	P34059	GALNS_HUMAN	galactosamine (N-acetyl)-6-sulfatase	93	Catalytic domain.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	metal ion binding (GO:0046872)|N-acetylgalactosamine-4-sulfatase activity (GO:0003943)|N-acetylgalactosamine-6-sulfatase activity (GO:0043890)|sulfuric ester hydrolase activity (GO:0008484)			breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(8)	22				BRCA - Breast invasive adenocarcinoma(80;0.0496)		AGAAGCCATTGCGGATGGGTAGCCGT	0.621																																					GBM(129;1929 2344 25209 33204)	.											0			GRCh37	CM054741|CM950526|CM950527	GALNS	M	rs118204441																																			SO:0001651	inframe_deletion	2588			D17629	CCDS10970.1	16q24.3	2014-07-03	2014-07-03		ENSG00000141012	ENSG00000141012	3.1.6.4	"""Arylsulfatase family"""	4122	protein-coding gene	gene with protein product	"""Morquio syndrome"", ""mucopolysaccharidosis type IVA"""	612222	"""galactosamine (N-acetyl)-6-sulfate sulfatase"""			1755850	Standard	NM_000512		Approved	GAS, GALNAC6S	uc002fly.4	P34059	OTTHUMG00000137862	ENST00000268695.5:c.277_282delTCCGCA	16.37:g.88908342_88908347delTGCGGA	ENSP00000268695:p.Ser93_Ala94del	Somatic		WXS	Illumina HiSeq	Phase_I	Q86VK3	In_Frame_Del	DEL	ENST00000268695.5	37	CCDS10970.1																																																																																				0.621	GALNS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269543.1		
GALNS	2588	bcgsc.ca	37	16	88908355	88908355	+	Missense_Mutation	SNP	C	C	T			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr16:88908355C>T	ENST00000268695.5	-	3	357	c.269G>A	c.(268-270)cGg>cAg	p.R90Q	GALNS_ENST00000565364.1_5'UTR|GALNS_ENST00000542788.1_Intron	NM_000512.4	NP_000503.1	P34059	GALNS_HUMAN	galactosamine (N-acetyl)-6-sulfatase	90	Catalytic domain.		R -> W (in MPS4A; severe form). {ECO:0000269|PubMed:24726177, ECO:0000269|PubMed:7633425, ECO:0000269|PubMed:7668283}.		carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	metal ion binding (GO:0046872)|N-acetylgalactosamine-4-sulfatase activity (GO:0003943)|N-acetylgalactosamine-6-sulfatase activity (GO:0043890)|sulfuric ester hydrolase activity (GO:0008484)			breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(8)	22				BRCA - Breast invasive adenocarcinoma(80;0.0496)		GATGGGTAGCCGTCCTGTGAG	0.612																																					GBM(129;1929 2344 25209 33204)	.											0													156.0	115.0	129.0					16																	88908355		2194	4299	6493	SO:0001583	missense	2588			D17629	CCDS10970.1	16q24.3	2014-07-03	2014-07-03		ENSG00000141012	ENSG00000141012	3.1.6.4	"""Arylsulfatase family"""	4122	protein-coding gene	gene with protein product	"""Morquio syndrome"", ""mucopolysaccharidosis type IVA"""	612222	"""galactosamine (N-acetyl)-6-sulfate sulfatase"""			1755850	Standard	NM_000512		Approved	GAS, GALNAC6S	uc002fly.4	P34059	OTTHUMG00000137862	ENST00000268695.5:c.269G>A	16.37:g.88908355C>T	ENSP00000268695:p.Arg90Gln	Somatic		WXS	Illumina HiSeq	Phase_I	Q86VK3	Missense_Mutation	SNP	ENST00000268695.5	37	CCDS10970.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.41|17.41	3.382732|3.382732	0.61845|0.61845	.|.	.|.	ENSG00000141012|ENSG00000141012	ENST00000439266|ENST00000268695	.|D	.|0.98862	.|-5.19	5.24|5.24	5.24|5.24	0.73138|0.73138	.|Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	.|0.048636	.|0.85682	.|D	.|0.000000	D|D	0.98732|0.98732	0.9574|0.9574	L|L	0.52364|0.52364	1.645|1.645	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|0.999;1.0	.|D;D	.|0.97110	.|0.958;1.0	D|D	0.99327|0.99327	1.0908|1.0908	6|10	0.87932|0.40728	D|T	0|0.16	.|.	19.199|19.199	0.93701|0.93701	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|90;90	.|B2R6P1;P34059	.|.;GALNS_HUMAN	S|Q	49|90	.|ENSP00000268695:R90Q	ENSP00000402127:G49S|ENSP00000268695:R90Q	G|R	-|-	1|2	0|0	GALNS|GALNS	87435856|87435856	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.692000|0.692000	0.40212|0.40212	7.578000|7.578000	0.82498|0.82498	2.620000|2.620000	0.88729|0.88729	0.561000|0.561000	0.74099|0.74099	GGC|CGG		0.612	GALNS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269543.1		
MTMR14	64419	bcgsc.ca	37	3	9712769	9712769	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr3:9712769T>C	ENST00000296003.4	+	6	714	c.592T>C	c.(592-594)Tat>Cat	p.Y198H	MTMR14_ENST00000420925.1_Intron|MTMR14_ENST00000353332.5_Missense_Mutation_p.Y198H|MTMR14_ENST00000351233.5_Missense_Mutation_p.Y198H	NM_001077525.2	NP_001070993.1	Q8NCE2	MTMRE_HUMAN	myotubularin related protein 14	198					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(3)|kidney(2)|lung(10)|skin(3)|upper_aerodigestive_tract(2)	21	Medulloblastoma(99;0.227)					GGTCAGAGGCTATGACATCAA	0.473																																						.											0													142.0	135.0	137.0					3																	9712769		1999	4179	6178	SO:0001583	missense	64419			BC001674	CCDS43043.1, CCDS43044.1, CCDS43045.1	3p26	2011-06-09	2006-12-18	2006-12-18	ENSG00000163719	ENSG00000163719		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	26190	protein-coding gene	gene with protein product	"""egg-derived tyrosine phosphatase homolog (Drosophila)"""	611089	"""chromosome 3 open reading frame 29"""	C3orf29		15186772	Standard	NM_022485		Approved	FLJ22405, FLJ90311, hJumpy, hEDTP	uc003brz.3	Q8NCE2	OTTHUMG00000155111	ENST00000296003.4:c.592T>C	3.37:g.9712769T>C	ENSP00000296003:p.Tyr198His	Somatic		WXS	Illumina HiSeq	Phase_I	Q0JTH5|Q0JU83|Q6PIZ4|Q6QE21|Q86VK9|Q8IYK1|Q8TCM7|Q9H6C0	Missense_Mutation	SNP	ENST00000296003.4	37	CCDS43043.1	.	.	.	.	.	.	.	.	.	.	T	11.23	1.577865	0.28180	.	.	ENSG00000163719	ENST00000353332;ENST00000296003;ENST00000351233;ENST00000419048	D;D;D	0.89939	-2.59;-2.59;-2.59	5.91	4.87	0.63330	.	0.270310	0.42420	N	0.000717	T	0.64260	0.2582	N	0.00801	-1.175	0.35982	D	0.836093	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.58825	-0.7568	10	0.18276	T	0.48	-12.3384	3.5246	0.07755	0.0:0.5382:0.0:0.4617	.	198;198;198	Q8NCE2-3;Q8NCE2-2;Q8NCE2	.;.;MTMRE_HUMAN	H	198	ENSP00000323462:Y198H;ENSP00000296003:Y198H;ENSP00000334070:Y198H	ENSP00000296003:Y198H	Y	+	1	0	MTMR14	9687769	0.998000	0.40836	1.000000	0.80357	0.994000	0.84299	2.061000	0.41403	1.112000	0.41740	0.533000	0.62120	TAT		0.473	MTMR14-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338435.1	NM_022485	
ENPP6	133121	bcgsc.ca	37	4	185138788	185138788	+	Missense_Mutation	SNP	T	T	A			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr4:185138788T>A	ENST00000296741.2	-	1	326	c.185A>T	c.(184-186)tAc>tTc	p.Y62F		NM_153343.3	NP_699174.1	Q6UWR7	ENPP6_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 6	62					choline metabolic process (GO:0019695)|lipid catabolic process (GO:0016042)|lipid metabolic process (GO:0006629)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	glycerophosphocholine cholinephosphodiesterase activity (GO:0047390)|glycerophosphodiester phosphodiesterase activity (GO:0008889)|phosphoric diester hydrolase activity (GO:0008081)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|skin(2)	15		all_lung(41;7.99e-12)|Lung NSC(41;1.46e-11)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;4.98e-27)|Epithelial(43;3.15e-24)|OV - Ovarian serous cystadenocarcinoma(60;4.09e-12)|Colorectal(24;3.78e-05)|STAD - Stomach adenocarcinoma(60;4.5e-05)|COAD - Colon adenocarcinoma(29;0.000154)|GBM - Glioblastoma multiforme(59;0.000167)|BRCA - Breast invasive adenocarcinoma(30;0.000378)|LUSC - Lung squamous cell carcinoma(40;0.0151)		TGGAGTCAAGTAATCCACTTT	0.493																																						.											0													86.0	80.0	82.0					4																	185138788		2203	4300	6503	SO:0001583	missense	133121			AK057370	CCDS3834.1	4q35.1	2008-02-05			ENSG00000164303	ENSG00000164303			23409	protein-coding gene	gene with protein product							Standard	NM_153343		Approved	MGC33971	uc003iwc.3	Q6UWR7	OTTHUMG00000160617	ENST00000296741.2:c.185A>T	4.37:g.185138788T>A	ENSP00000296741:p.Tyr62Phe	Somatic		WXS	Illumina HiSeq	Phase_I	Q4W5Q1|Q96M57	Missense_Mutation	SNP	ENST00000296741.2	37	CCDS3834.1	.	.	.	.	.	.	.	.	.	.	T	16.90	3.248979	0.59103	.	.	ENSG00000164303	ENST00000296741	T	0.73789	-0.78	5.28	5.28	0.74379	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	T	0.77003	0.4067	L	0.60845	1.875	0.80722	D	1	P	0.46706	0.883	P	0.49887	0.625	T	0.74671	-0.3587	10	0.26408	T	0.33	-28.6202	15.3844	0.74684	0.0:0.0:0.0:1.0	.	62	Q6UWR7	ENPP6_HUMAN	F	62	ENSP00000296741:Y62F	ENSP00000296741:Y62F	Y	-	2	0	ENPP6	185375782	1.000000	0.71417	0.962000	0.40283	0.152000	0.21847	7.412000	0.80091	2.210000	0.71456	0.533000	0.62120	TAC		0.493	ENPP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361428.1	NM_153343	
PRDM13	59336	bcgsc.ca	37	6	100057081	100057081	+	Nonsense_Mutation	SNP	C	C	T			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr6:100057081C>T	ENST00000369215.4	+	3	600	c.295C>T	c.(295-297)Cga>Tga	p.R99*		NM_021620.3	NP_067633.2	Q9H4Q3	PRD13_HUMAN	PR domain containing 13	99	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurogenesis (GO:0022008)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(9)|prostate(1)	17		all_cancers(76;1.64e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0128)|Colorectal(196;0.069)|Lung NSC(302;0.186)		BRCA - Breast invasive adenocarcinoma(108;0.0598)		CCGAGCATTGCGAGACGTCCA	0.507																																						.											0													56.0	61.0	59.0					6																	100057081		2089	4228	6317	SO:0001587	stop_gained	59336			AY004253	CCDS43487.1	6q16.2	2012-03-28			ENSG00000112238	ENSG00000112238			13998	protein-coding gene	gene with protein product							Standard	NM_021620		Approved		uc003pqg.1	Q9H4Q3	OTTHUMG00000015269	ENST00000369215.4:c.295C>T	6.37:g.100057081C>T	ENSP00000358217:p.Arg99*	Somatic		WXS	Illumina HiSeq	Phase_I	Q5TGC1|Q5TGC2	Nonsense_Mutation	SNP	ENST00000369215.4	37	CCDS43487.1	.	.	.	.	.	.	.	.	.	.	C	38	7.278789	0.98182	.	.	ENSG00000112238	ENST00000369215;ENST00000369214	.	.	.	5.51	1.15	0.20763	.	0.000000	0.32372	N	0.006183	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.1248	14.7894	0.69827	0.597:0.403:0.0:0.0	.	.	.	.	X	99;109	.	ENSP00000358216:R109X	R	+	1	2	PRDM13	100163802	0.998000	0.40836	0.638000	0.29380	0.992000	0.81027	1.143000	0.31553	0.655000	0.30866	0.456000	0.33151	CGA		0.507	PRDM13-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041619.2		
FAM160B2	64760	bcgsc.ca	37	8	21956856	21956856	+	Frame_Shift_Del	DEL	C	C	-			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chr8:21956856delC	ENST00000289921.7	+	9	1182	c.1136delC	c.(1135-1137)cccfs	p.P379fs		NM_022749.5	NP_073586.5	Q86V87	F16B2_HUMAN	family with sequence similarity 160, member B2	379										endometrium(2)|kidney(1)|lung(2)|prostate(3)|urinary_tract(1)	9						ACCCTGCAGCCCCAGCTCCTG	0.582																																						.											0													49.0	54.0	52.0					8																	21956856		2138	4235	6373	SO:0001589	frameshift_variant	64760			AK025454	CCDS6021.2	8p21.3	2012-11-30	2008-06-05	2008-06-05	ENSG00000158863	ENSG00000158863			16492	protein-coding gene	gene with protein product			"""retinoic acid induced 16"""	RAI16		22971576, 15626329	Standard	XR_247128		Approved	FLJ21801	uc011kyx.2	Q86V87	OTTHUMG00000097088	ENST00000289921.7:c.1136delC	8.37:g.21956856delC	ENSP00000289921:p.Pro379fs	Somatic		WXS	Illumina HiSeq	Phase_I	B2RDQ5|B3KNX1|Q2M211|Q71JB5|Q7L3J6|Q969T0|Q9H6W4	Frame_Shift_Del	DEL	ENST00000289921.7	37	CCDS6021.2																																																																																				0.582	FAM160B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375334.2		
MT-CYB	4519	bcgsc.ca	37	M	15169	15170	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-KM-8441-01A-11D-2310-10	TCGA-KM-8441-10A-01D-2311-10	GA	GA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	97c1a300-978d-4df1-9e97-ce2f92b9eff1	ea82c301-a5be-463a-9549-b493cd5c95d8	g.chrM:15169_15170delGA	ENST00000361789.2	+	1	423_424	c.423_424delGA	c.(421-426)tggaggfs	p.R142fs	MT-ND6_ENST00000361681.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-TH_ENST00000387441.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b	142					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						ATATCATTCTGAGGGGCCACAG	0.475											OREG0007583	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																										.											0																																										SO:0001589	frameshift_variant	0					mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156		ENST00000361789.2:c.423_424delGA	M.37:g.15169_15170delGA	ENSP00000354554:p.Arg142fs	Somatic	585	WXS	Illumina HiSeq	Phase_I	Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	Frame_Shift_Del	DEL	ENST00000361789.2	37																																																																																					0.475	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024038	
