#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
OR4X1	390113	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	11	48285540	48285540	+	Missense_Mutation	SNP	T	T	C	rs144193033		TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr11:48285540T>C	ENST00000320048.1	+	1	128	c.128T>C	c.(127-129)aTt>aCt	p.I43T		NM_001004726.1	NP_001004726.1	Q8NH49	OR4X1_HUMAN	olfactory receptor, family 4, subfamily X, member 1 (gene/pseudogene)	43						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|stomach(1)	28						AATGGCCTCATTGTGGTGACC	0.478																																						.											0								T	THR/ILE	1,4401	2.1+/-5.4	0,1,2200	181.0	162.0	169.0		128	3.1	1.0	11	dbSNP_134	169	0,8596		0,0,4298	no	missense	OR4X1	NM_001004726.1	89	0,1,6498	CC,CT,TT		0.0,0.0227,0.0077	possibly-damaging	43/306	48285540	1,12997	2201	4298	6499	SO:0001583	missense	390113			AB065544	CCDS31487.1	11p11.2	2013-10-10	2013-10-10		ENSG00000176567	ENSG00000176567		"""GPCR / Class A : Olfactory receptors"""	14854	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily X, member 1"""				Standard	NM_001004726		Approved		uc010rht.2	Q8NH49	OTTHUMG00000165301	ENST00000320048.1:c.128T>C	11.37:g.48285540T>C	ENSP00000321506:p.Ile43Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q6IF74	Missense_Mutation	SNP	ENST00000320048.1	37	CCDS31487.1	.	.	.	.	.	.	.	.	.	.	T	10.68	1.419124	0.25552	2.27E-4	0.0	ENSG00000176567	ENST00000320048	T	0.00531	6.76	4.23	3.09	0.35607	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.01124	0.0037	M	0.84585	2.705	0.23221	N	0.998095	D	0.55800	0.973	P	0.51229	0.663	T	0.44236	-0.9341	9	0.54805	T	0.06	.	8.1785	0.31296	0.0:0.0987:0.0:0.9013	.	43	Q8NH49	OR4X1_HUMAN	T	43	ENSP00000321506:I43T	ENSP00000321506:I43T	I	+	2	0	OR4X1	48242116	0.081000	0.21417	0.996000	0.52242	0.048000	0.14542	2.657000	0.46724	0.757000	0.33036	-0.458000	0.05436	ATT		0.478	OR4X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383373.1	NM_001004726	
OR4C12	283093	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	11	50004015	50004015	+	Missense_Mutation	SNP	G	G	A			TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr11:50004015G>A	ENST00000335238.4	-	1	56	c.23C>T	c.(22-24)aCt>aTt	p.T8I		NM_001005270.2	NP_001005270.2	Q96R67	OR4CC_HUMAN	olfactory receptor, family 4, subfamily C, member 12	8						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|kidney(4)|large_intestine(3)|liver(1)|lung(19)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	36						AATGAATTCAGTCACATTCTT	0.338																																						.											0													48.0	44.0	45.0					11																	50004015		2201	4296	6497	SO:0001583	missense	283093			BK004413	CCDS31496.1	11p11.12	2012-08-09			ENSG00000221954	ENSG00000221954		"""GPCR / Class A : Olfactory receptors"""	15168	protein-coding gene	gene with protein product							Standard	NM_001005270		Approved		uc010ria.2	Q96R67	OTTHUMG00000166687	ENST00000335238.4:c.23C>T	11.37:g.50004015G>A	ENSP00000334418:p.Thr8Ile	Somatic		WXS	Illumina HiSeq	Phase_I	B2RNF0|Q6IF49	Missense_Mutation	SNP	ENST00000335238.4	37	CCDS31496.1	.	.	.	.	.	.	.	.	.	.	.	15.69	2.908473	0.52333	.	.	ENSG00000221954	ENST00000335238	T	0.02158	4.42	3.31	3.31	0.37934	.	0.000000	0.43260	U	0.000595	T	0.11879	0.0289	M	0.86028	2.79	0.26673	N	0.971689	D	0.63046	0.992	D	0.65010	0.931	T	0.00907	-1.1519	10	0.87932	D	0	.	12.6176	0.56586	0.0:0.0:1.0:0.0	.	8	Q96R67	OR4CC_HUMAN	I	8	ENSP00000334418:T8I	ENSP00000334418:T8I	T	-	2	0	OR4C12	49960591	0.000000	0.05858	0.983000	0.44433	0.764000	0.43329	0.307000	0.19296	1.878000	0.54408	0.398000	0.26397	ACT		0.338	OR4C12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391104.1	NM_001005270	
MPZL3	196264	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	11	118111082	118111082	+	Silent	SNP	G	G	A	rs565159411		TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr11:118111082G>A	ENST00000278949.4	-	2	139	c.84C>T	c.(82-84)atC>atT	p.I28I	MPZL3_ENST00000527472.1_Intron|MPZL3_ENST00000525386.1_Intron			Q6UWV2	MPZL3_HUMAN	myelin protein zero-like 3	28					cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|hair cycle (GO:0042633)	integral component of membrane (GO:0016021)				autonomic_ganglia(1)|endometrium(1)|large_intestine(1)|lung(2)|stomach(2)|upper_aerodigestive_tract(1)	8	all_hematologic(175;0.046)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)		AGGAAAAGACGATATAAACAC	0.388													G|||	1	0.000199681	0.0	0.0	5008	,	,		19877	0.0		0.0	False		,,,				2504	0.001					.											0													132.0	116.0	121.0					11																	118111082		2200	4296	6496	SO:0001819	synonymous_variant	196264			AK095399	CCDS8392.1, CCDS66241.1	11q23.3	2013-01-11			ENSG00000160588	ENSG00000160588		"""Immunoglobulin superfamily / V-set domain containing"""	27279	protein-coding gene	gene with protein product		611707				17273165	Standard	NM_198275		Approved		uc001psm.3	Q6UWV2	OTTHUMG00000166966	ENST00000278949.4:c.84C>T	11.37:g.118111082G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A8K025|B4DLD5|B4E2I8	Silent	SNP	ENST00000278949.4	37	CCDS8392.1																																																																																				0.388	MPZL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392109.1	NM_198275	
SNAPIN	23557	broad.mit.edu;hgsc.bcm.edu	37	1	153631301	153631301	+	Frame_Shift_Del	DEL	G	G	-	rs35903030		TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr1:153631301delG	ENST00000368685.5	+	1	172	c.82delG	c.(82-84)gggfs	p.G28fs	SNAPIN_ENST00000478558.1_3'UTR	NM_012437.5	NP_036569.1	O95295	SNAPN_HUMAN	SNAP-associated protein	28					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|endosome to lysosome transport (GO:0008333)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|negative regulation of neuron projection development (GO:0010977)|neuron projection development (GO:0031175)|neurotransmitter secretion (GO:0007269)|positive regulation of late endosome to lysosome transport (GO:1902824)|regulation of protein binding (GO:0043393)|synaptic vesicle exocytosis (GO:0016079)|synaptic vesicle fusion to presynaptic membrane (GO:0031629)|synaptic vesicle maturation (GO:0016188)|synaptic vesicle transport (GO:0048489)|terminal button organization (GO:0072553)|viral process (GO:0016032)	BLOC-1 complex (GO:0031083)|cell junction (GO:0030054)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleolus (GO:0005730)|perinuclear region of cytoplasm (GO:0048471)|secretory granule (GO:0030141)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	SNARE binding (GO:0000149)			lung(3)	3	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			TTTCGCCGAAGGGCTGCTGGA	0.692																																						.											0													10.0	13.0	12.0					1																	153631301		2167	4240	6407	SO:0001589	frameshift_variant	23557			AF086837	CCDS1049.1	1q22	2013-09-27		2007-11-14	ENSG00000143553	ENSG00000143553		"""Biogenesis of lysosomal organelles complex-1 subunits"""	17145	protein-coding gene	gene with protein product	"""snapin"", ""SNAP-25-binding protein"", ""biogenesis of lysosomal organelles complex-1, subunit 7"""	607007		SNAPAP		10195194, 12659861	Standard	NM_012437		Approved	BLOC1S7	uc001fcq.4	O95295	OTTHUMG00000037086	ENST00000368685.5:c.82delG	1.37:g.153631301delG	ENSP00000357674:p.Gly28fs	Somatic		WXS	Illumina HiSeq	Phase_I	D3DV56|Q5SXU8	Frame_Shift_Del	DEL	ENST00000368685.5	37	CCDS1049.1																																																																																				0.692	SNAPIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090036.1	NM_012437	
MORN1	79906	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	1	2268198	2268198	+	Silent	SNP	C	C	T			TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr1:2268198C>T	ENST00000378531.3	-	11	1301	c.1128G>A	c.(1126-1128)ccG>ccA	p.P376P	MORN1_ENST00000606372.1_5'UTR	NM_024848.1	NP_079124.1	Q5T089	MORN1_HUMAN	MORN repeat containing 1	376										breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(1)|ovary(2)	9	all_cancers(77;0.000194)|all_epithelial(69;9.96e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;3.3e-15)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;2.21e-37)|OV - Ovarian serous cystadenocarcinoma(86;5.01e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.00137)|BRCA - Breast invasive adenocarcinoma(365;0.00488)|STAD - Stomach adenocarcinoma(132;0.00665)|KIRC - Kidney renal clear cell carcinoma(229;0.0203)|Lung(427;0.212)		GGTACCCAGGCGGGGGCGGCC	0.682																																						.											0													20.0	22.0	21.0					1																	2268198		2196	4295	6491	SO:0001819	synonymous_variant	79906			AK024003	CCDS40.1, CCDS72688.1	1p36.33-p36.32	2008-02-05			ENSG00000116151	ENSG00000116151			25852	protein-coding gene	gene with protein product						12477932	Standard	XM_005244798		Approved	FLJ13941	uc001ajb.1	Q5T089	OTTHUMG00000001402	ENST00000378531.3:c.1128G>A	1.37:g.2268198C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A6NKZ6|Q8WW30|Q9H852	Silent	SNP	ENST00000378531.3	37	CCDS40.1																																																																																				0.682	MORN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000004055.1	NM_024848	
MAP3K10	4294	hgsc.bcm.edu;ucsc.edu	37	19	40719458	40719458	+	Silent	SNP	C	C	T			TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr19:40719458C>T	ENST00000253055.3	+	9	2160	c.1872C>T	c.(1870-1872)agC>agT	p.S624S		NM_002446.3	NP_002437.2	Q02779	M3K10_HUMAN	mitogen-activated protein kinase kinase kinase 10	624					activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|JNK cascade (GO:0007254)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|protein autophosphorylation (GO:0046777)|signal transduction (GO:0007165)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|bHLH transcription factor binding (GO:0043425)|JUN kinase kinase kinase activity (GO:0004706)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription corepressor activity (GO:0003714)			NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	24						GAGGCAGCAGCGTGCCCCCTT	0.726																																						.											0													16.0	18.0	17.0					19																	40719458		2200	4293	6493	SO:0001819	synonymous_variant	4294			X90846	CCDS12549.1	19q13.2	2014-08-12			ENSG00000130758		2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6849	protein-coding gene	gene with protein product	"""MKN28 kinase"", ""mixed lineage kinase 2"", ""MKN28 derived nonreceptor_type serine/threonine kinase"""	600137		MLK2		8536694, 7731697	Standard	NM_002446		Approved	MST, MEKK10	uc002ona.3	Q02779	OTTHUMG00000182591	ENST00000253055.3:c.1872C>T	19.37:g.40719458C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q12761|Q14871	Silent	SNP	ENST00000253055.3	37	CCDS12549.1																																																																																				0.726	MAP3K10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462552.1	NM_002446	
OCSTAMP	128506	hgsc.bcm.edu	37	20	45170431	45170431	+	Missense_Mutation	SNP	G	G	A	rs555741460	byFrequency	TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr20:45170431G>A	ENST00000279028.2	-	3	1196	c.1183C>T	c.(1183-1185)Cgg>Tgg	p.R395W		NM_080721.1	NP_542452.1	Q9BR26	OCSTP_HUMAN	osteoclast stimulatory transmembrane protein	395					cellular response to estrogen stimulus (GO:0071391)|cellular response to tumor necrosis factor (GO:0071356)|multinuclear osteoclast differentiation (GO:0072674)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of osteoclast proliferation (GO:0090290)	integral component of membrane (GO:0016021)				breast(1)|endometrium(1)	2						CGGGGACGCCGGGCGGGTAGC	0.746													G|||	3	0.000599042	0.0	0.0043	5008	,	,		12790	0.0		0.0	False		,,,				2504	0.0					.											0													6.0	6.0	6.0					20																	45170431		687	1578	2265	SO:0001583	missense	128506			AL034424	CCDS54468.1	20q13.12	2012-03-27	2012-03-27	2012-03-27	ENSG00000149635	ENSG00000149635			16116	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 123"""	C20orf123		18064667	Standard	NM_080721		Approved	dJ257E24.3	uc010zxu.2	Q9BR26	OTTHUMG00000032652	ENST00000279028.2:c.1183C>T	20.37:g.45170431G>A	ENSP00000279028:p.Arg395Trp	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000279028.2	37	CCDS54468.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.108385	0.77096	.	.	ENSG00000149635	ENST00000279028	T	0.32272	1.46	4.95	4.95	0.65309	Dendritic cell-specific transmembrane protein-like (1);	0.983100	0.08337	N	0.961405	T	0.34629	0.0904	N	0.14661	0.345	0.09310	N	1	D	0.76494	0.999	P	0.60609	0.877	T	0.25222	-1.0138	10	0.36615	T	0.2	-13.868	10.3186	0.43751	0.0:0.1451:0.705:0.1499	.	395	Q9BR26	CT123_HUMAN	W	395	ENSP00000279028:R395W	ENSP00000279028:R395W	R	-	1	2	C20orf123	44603838	0.324000	0.24652	0.442000	0.26870	0.374000	0.29953	1.535000	0.36061	2.555000	0.86185	0.655000	0.94253	CGG		0.746	OCSTAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079573.2	XM_496476	
MOV10L1	54456	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	22	50581577	50581577	+	Missense_Mutation	SNP	G	G	A	rs140536899		TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr22:50581577G>A	ENST00000262794.5	+	17	2368	c.2285G>A	c.(2284-2286)cGt>cAt	p.R762H	MOV10L1_ENST00000395858.3_Missense_Mutation_p.R762H|MOV10L1_ENST00000395843.1_5'UTR|MOV10L1_ENST00000545383.1_Missense_Mutation_p.R762H|MOV10L1_ENST00000540615.1_Missense_Mutation_p.R742H	NM_018995.2	NP_061868.1	Q9BXT6	M10L1_HUMAN	Mov10 RISC complex RNA helicase like 1	762					ATP catabolic process (GO:0006200)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	intracellular (GO:0005622)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|magnesium ion binding (GO:0000287)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|prostate(1)|skin(9)|stomach(4)|urinary_tract(3)	67		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		GGTGACTGCCGTCCCCTCCCG	0.468																																						.											0								G	HIS/ARG,HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	132.0	139.0	136.0		2285,2225,2285	5.6	1.0	22	dbSNP_134	136	0,8600		0,0,4300	no	missense,missense,missense	MOV10L1	NM_001164104.1,NM_001164105.1,NM_018995.2	29,29,29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging	762/1166,742/1166,762/1212	50581577	1,13005	2203	4300	6503	SO:0001583	missense	54456			AF285604	CCDS14084.1, CCDS54541.1, CCDS54542.1, CCDS54543.1	22q13.33	2014-07-02	2014-07-02		ENSG00000073146	ENSG00000073146			7201	protein-coding gene	gene with protein product	"""cardiac helicase activated by MEF2C protein"""	605794	"""Mov10 (mouse)-like 1"", ""Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse)"""			11279525	Standard	NM_018995		Approved	DJ402G11.8, DKFZp434B0717, CHAMP	uc003bjj.3	Q9BXT6	OTTHUMG00000044648	ENST00000262794.5:c.2285G>A	22.37:g.50581577G>A	ENSP00000262794:p.Arg762His	Somatic		WXS	Illumina HiSeq	Phase_I	A7E211|A8MXC6|B7WPP1|B7Z7R1|F5H403|Q5TGD5|Q8NBD4|Q9NXW3|Q9UFB3|Q9UGX9	Missense_Mutation	SNP	ENST00000262794.5	37	CCDS14084.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.252396	0.80135	2.27E-4	0.0	ENSG00000073146	ENST00000545383;ENST00000262794;ENST00000395858;ENST00000540615	D;D;D;D	0.86956	-2.01;-2.01;-1.61;-2.19	5.61	5.61	0.85477	.	0.049309	0.85682	D	0.000000	D	0.93096	0.7802	M	0.68728	2.09	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.999;0.999	D	0.93039	0.6455	10	0.62326	D	0.03	-19.6794	19.6476	0.95789	0.0:0.0:1.0:0.0	.	523;742;762;762	B7Z893;F5H403;A8MXC6;Q9BXT6	.;.;.;M10L1_HUMAN	H	762;762;762;742	ENSP00000438978:R762H;ENSP00000262794:R762H;ENSP00000379199:R762H;ENSP00000438542:R742H	ENSP00000262794:R762H	R	+	2	0	MOV10L1	48923704	1.000000	0.71417	1.000000	0.80357	0.139000	0.21198	7.388000	0.79795	2.647000	0.89833	0.655000	0.94253	CGT		0.468	MOV10L1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000075009.2	NM_018995	
C4orf6	10141	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	4	5527059	5527059	+	Start_Codon_SNP	SNP	T	T	C			TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr4:5527059T>C	ENST00000195455.2	+	1	177	c.2T>C	c.(1-3)aTg>aCg	p.M1T	C4orf6_ENST00000515342.1_Intron	NM_005750.2	NP_005741.1	Q99440	CD006_HUMAN	chromosome 4 open reading frame 6	1					nervous system development (GO:0007399)					large_intestine(1)|prostate(1)	2						caattaccaatggacacccag	0.353																																						.											0													28.0	31.0	30.0					4																	5527059		2172	4219	6391	SO:0001582	initiator_codon_variant	10141			D82070	CCDS3381.1	4p16	2012-02-24			ENSG00000082929	ENSG00000082929			13716	protein-coding gene	gene with protein product						9016955	Standard	NM_005750		Approved	aC1	uc003gii.3	Q99440	OTTHUMG00000125492	ENST00000195455.2:c.2T>C	4.37:g.5527059T>C	ENSP00000195455:p.Met1Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q17R65	Missense_Mutation	SNP	ENST00000195455.2	37	CCDS3381.1	.	.	.	.	.	.	.	.	.	.	T	0.689	-0.795070	0.02862	.	.	ENSG00000082929	ENST00000195455	T	0.51574	0.7	0.225	0.225	0.15325	.	.	.	.	.	T	0.36744	0.0978	.	.	.	0.80722	D	1	B	0.17038	0.02	B	0.08055	0.003	T	0.28038	-1.0056	7	0.87932	D	0	.	.	.	.	.	1	Q99440	CD006_HUMAN	T	1	ENSP00000195455:M1T	ENSP00000195455:M1T	M	+	2	0	C4orf6	5577960	0.319000	0.24607	0.333000	0.25482	0.338000	0.28826	0.286000	0.18902	0.257000	0.21650	0.254000	0.18369	ATG		0.353	C4orf6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246818.1	NM_005750	Missense_Mutation
PRDM9	56979	broad.mit.edu;hgsc.bcm.edu;mdanderson.org	37	5	23521146	23521146	+	Silent	SNP	G	G	A			TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr5:23521146G>A	ENST00000296682.3	+	6	548	c.366G>A	c.(364-366)gcG>gcA	p.A122A		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	122					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)	p.A122A(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						TGCCCAAGGCGTCATTCAGTA	0.398										HNSCC(3;0.000094)																												.											1	Substitution - coding silent(1)	endometrium(1)											81.0	77.0	78.0					5																	23521146		1874	4107	5981	SO:0001819	synonymous_variant	56979			AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.366G>A	5.37:g.23521146G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B4DX22|Q27Q50	Silent	SNP	ENST00000296682.3	37	CCDS43307.1																																																																																				0.398	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227	
ADAMTSL1	92949	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	9	18777867	18777867	+	Missense_Mutation	SNP	T	T	A			TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr9:18777867T>A	ENST00000380548.4	+	19	3979	c.3640T>A	c.(3640-3642)Tgg>Agg	p.W1214R		NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	1214	Ig-like C2-type 2.					proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.W1214R(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		TACCATCAGCTGGGCCAGGAA	0.612																																						.											1	Substitution - Missense(1)	endometrium(1)											50.0	51.0	51.0					9																	18777867		2030	4187	6217	SO:0001583	missense	92949			AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.3640T>A	9.37:g.18777867T>A	ENSP00000369921:p.Trp1214Arg	Somatic		WXS	Illumina HiSeq	Phase_I	A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Missense_Mutation	SNP	ENST00000380548.4	37	CCDS47954.1	.	.	.	.	.	.	.	.	.	.	T	18.95	3.730924	0.69074	.	.	ENSG00000178031	ENST00000380548	D	0.96300	-3.97	5.9	5.9	0.94986	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000004	D	0.98931	0.9637	H	0.98178	4.165	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99466	1.0944	10	0.87932	D	0	.	16.326	0.82979	0.0:0.0:0.0:1.0	.	1214	Q8N6G6	ATL1_HUMAN	R	1214	ENSP00000369921:W1214R	ENSP00000369921:W1214R	W	+	1	0	ADAMTSL1	18767867	1.000000	0.71417	1.000000	0.80357	0.809000	0.45718	5.568000	0.67385	2.258000	0.74832	0.528000	0.53228	TGG		0.612	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401206.1		
CACNA1F	778	broad.mit.edu;hgsc.bcm.edu;mdanderson.org	37	X	49084509	49084509	+	Silent	SNP	G	G	A			TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chrX:49084509G>A	ENST00000376265.2	-	8	1168	c.1107C>T	c.(1105-1107)ggC>ggT	p.G369G	CACNA1F_ENST00000323022.5_Silent_p.G369G|CACNA1F_ENST00000376251.1_Silent_p.G304G	NM_005183.2	NP_005174.2	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type, alpha 1F subunit	369			G -> D (in CSNB2A). {ECO:0000269|PubMed:11281458, ECO:0000269|PubMed:12111638, ECO:0000269|PubMed:9662399}.		axonogenesis (GO:0007409)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|dendrite morphogenesis (GO:0048813)|detection of light stimulus involved in visual perception (GO:0050908)|membrane depolarization during action potential (GO:0086010)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|perikaryon (GO:0043204)|photoreceptor outer segment (GO:0001750)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			autonomic_ganglia(1)|breast(8)|central_nervous_system(3)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(4)|urinary_tract(1)	85					Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	CACTCAGGACGCCAAGCACAA	0.552																																						.											0													115.0	72.0	87.0					X																	49084509		2203	4300	6503	SO:0001819	synonymous_variant	778			AA019975	CCDS35253.1, CCDS59166.1, CCDS59167.1	Xp11.23	2013-01-23	2007-02-16		ENSG00000102001	ENSG00000102001		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1393	protein-coding gene	gene with protein product		300110	"""Aland island eye disease (Forsius-Eriksson ocular albinism, ocular albinism type 2)"""	CSNB2, AIED		9344658, 9662400, 16382099, 12111638, 17525176	Standard	NM_005183		Approved	Cav1.4, JM8, JMC8, CSNBX2, CORDX3, CSNB2A, OA2	uc010nip.3	O60840	OTTHUMG00000022703	ENST00000376265.2:c.1107C>T	X.37:g.49084509G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A6NI29|F5CIQ9|O43901|O95226|Q9UHB1	Silent	SNP	ENST00000376265.2	37	CCDS35253.1																																																																																				0.552	CACNA1F-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358157.1	NM_005183	
SLC7A3	84889	hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	X	70145693	70145693	+	Missense_Mutation	SNP	A	A	T			TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chrX:70145693A>T	ENST00000374299.3	-	12	1974	c.1830T>A	c.(1828-1830)gaT>gaA	p.D610E	SLC7A3_ENST00000298085.4_Missense_Mutation_p.D610E			Q8WY07	CTR3_HUMAN	solute carrier family 7 (cationic amino acid transporter, y+ system), member 3	610					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	arginine transmembrane transporter activity (GO:0015181)|L-lysine transmembrane transporter activity (GO:0015189)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|liver(1)|lung(9)|ovary(1)|urinary_tract(1)	31	Renal(35;0.156)				L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	GAGTGCCGGGATCAAGGTCTA	0.502																																						.											0													247.0	189.0	208.0					X																	70145693		2203	4300	6503	SO:0001583	missense	84889			AF320612	CCDS14404.1	Xq12	2013-05-22			ENSG00000165349	ENSG00000165349		"""Solute carriers"""	11061	protein-coding gene	gene with protein product		300443				11591158	Standard	NM_001048164		Approved	CAT-3, ATRC3, FLJ14541	uc004dyn.3	Q8WY07	OTTHUMG00000021780	ENST00000374299.3:c.1830T>A	X.37:g.70145693A>T	ENSP00000363417:p.Asp610Glu	Somatic		WXS	Illumina HiSeq	Phase_I	D3DVU7|Q5JQR2|Q8N185|Q8NCA7|Q96SZ7	Missense_Mutation	SNP	ENST00000374299.3	37	CCDS14404.1	.	.	.	.	.	.	.	.	.	.	A	11.85	1.762611	0.31228	.	.	ENSG00000165349	ENST00000374299;ENST00000298085	D;D	0.87966	-2.32;-2.32	4.41	-3.07	0.05363	.	0.364776	0.31268	N	0.007942	T	0.61160	0.2325	N	0.08118	0	0.25017	N	0.991362	B	0.09022	0.002	B	0.10450	0.005	T	0.57254	-0.7843	10	0.02654	T	1	.	2.9368	0.05817	0.3414:0.0:0.3184:0.3402	.	610	Q8WY07	CTR3_HUMAN	E	610	ENSP00000363417:D610E;ENSP00000298085:D610E	ENSP00000298085:D610E	D	-	3	2	SLC7A3	70062418	0.950000	0.32346	0.771000	0.31576	0.057000	0.15508	0.389000	0.20751	-0.392000	0.07751	0.314000	0.21332	GAT		0.502	SLC7A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057080.1	NM_032803	
SRGAP1	57522	hgsc.bcm.edu	37	12	64536390	64536390	+	Missense_Mutation	SNP	A	A	C			TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr12:64536390A>C	ENST00000355086.3	+	22	3720	c.3196A>C	c.(3196-3198)Aat>Cat	p.N1066H	SRGAP1_ENST00000543397.1_Missense_Mutation_p.N1003H|SRGAP1_ENST00000357825.3_Missense_Mutation_p.N1043H	NM_020762.2	NP_065813.1	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	1066					axon guidance (GO:0007411)|cell migration (GO:0016477)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)			breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	65			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		TCCAAAAACAAATCCTACCAT	0.507																																						.											0													113.0	115.0	115.0					12																	64536390		2203	4300	6503	SO:0001583	missense	57522			AB037725	CCDS8967.1	12q13.13	2011-07-04			ENSG00000196935	ENSG00000196935		"""Rho GTPase activating proteins"""	17382	protein-coding gene	gene with protein product		606523				11672528	Standard	NM_020762		Approved	KIAA1304, ARHGAP13	uc010ssp.1	Q7Z6B7	OTTHUMG00000168750	ENST00000355086.3:c.3196A>C	12.37:g.64536390A>C	ENSP00000347198:p.Asn1066His	Somatic		WXS	Illumina HiSeq	Phase_I	Q9H8A3|Q9P2P2	Missense_Mutation	SNP	ENST00000355086.3	37	CCDS8967.1	.	.	.	.	.	.	.	.	.	.	A	20.5	4.003655	0.74932	.	.	ENSG00000196935	ENST00000355086;ENST00000357825;ENST00000543397	T;T;T	0.32272	1.46;1.46;1.46	5.91	4.75	0.60458	.	0.000000	0.37809	U	0.001926	T	0.36880	0.0983	L	0.38175	1.15	0.43355	D	0.995427	P;P	0.48764	0.511;0.915	B;P	0.53988	0.101;0.739	T	0.03863	-1.0997	9	.	.	.	.	13.3793	0.60759	0.8686:0.1314:0.0:0.0	.	1066;1003	Q7Z6B7;G5EA48	SRGP1_HUMAN;.	H	1066;1043;1003	ENSP00000347198:N1066H;ENSP00000350480:N1043H;ENSP00000437948:N1003H	.	N	+	1	0	SRGAP1	62822657	1.000000	0.71417	0.990000	0.47175	0.964000	0.63967	6.976000	0.76135	1.046000	0.40249	0.379000	0.24179	AAT		0.507	SRGAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400896.1		
CYP2A6	1548	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	19	41354576	41354576	+	Missense_Mutation	SNP	C	C	T	rs200793736		TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr19:41354576C>T	ENST00000301141.5	-	3	456	c.436G>A	c.(436-438)Gag>Aag	p.E146K	CTC-490E21.12_ENST00000601627.1_Intron	NM_000762.5	NP_000753	P11509	CP2A6_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 6	146					coumarin catabolic process (GO:0046226)|coumarin metabolic process (GO:0009804)|drug metabolic process (GO:0017144)|exogenous drug catabolic process (GO:0042738)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum membrane (GO:0005789)	coumarin 7-hydroxylase activity (GO:0008389)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(2)	37			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		Acetaminophen(DB00316)|Amiodarone(DB01118)|Amlodipine(DB00381)|Amobarbital(DB01351)|Amphetamine(DB00182)|Antipyrine(DB01435)|Arformoterol(DB01274)|Azelastine(DB00972)|Azithromycin(DB00207)|Buprenorphine(DB00921)|Bupropion(DB01156)|Chlorzoxazone(DB00356)|Cinnarizine(DB00568)|Cisapride(DB00604)|Clofibrate(DB00636)|Clomifene(DB00882)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cyclophosphamide(DB00531)|Dapagliflozin(DB06292)|Desipramine(DB01151)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Diethylstilbestrol(DB00255)|Dronabinol(DB00470)|Eletriptan(DB00216)|Ezogabine(DB04953)|Flunarizine(DB04841)|Flunitrazepam(DB01544)|Fluorouracil(DB00544)|Flurazepam(DB00690)|Fomepizole(DB01213)|Formoterol(DB00983)|Halothane(DB01159)|Ifosfamide(DB01181)|Isoniazid(DB00951)|Ketoconazole(DB01026)|Letrozole(DB01006)|Lidocaine(DB00281)|Lorcaserin(DB04871)|Memantine(DB01043)|Menadione(DB00170)|Methimazole(DB00763)|Methoxsalen(DB00553)|Methoxyflurane(DB01028)|Metyrapone(DB01011)|Miconazole(DB01110)|Montelukast(DB00471)|Nevirapine(DB00238)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Norfloxacin(DB01059)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Pilocarpine(DB01085)|Prednisolone(DB00860)|Progesterone(DB00396)|Propofol(DB00818)|Rifampicin(DB01045)|Rosiglitazone(DB00412)|Selegiline(DB01037)|Sevoflurane(DB01236)|Sulfaphenazole(DB06729)|Tamoxifen(DB00675)|Tranylcypromine(DB00752)|Tretinoin(DB00755)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Zidovudine(DB00495)	ATGCGCTCCTCGATGCCTCGC	0.692													.|||	1	0.000199681	0.0	0.0	5008	,	,		14358	0.0		0.001	False		,,,				2504	0.0					.											0													39.0	42.0	41.0					19																	41354576		2203	4299	6502	SO:0001583	missense	1548			AF182275	CCDS12568.1	19q13.2	2013-11-11	2003-01-14		ENSG00000255974	ENSG00000255974		"""Cytochrome P450s"""	2610	protein-coding gene	gene with protein product		122720	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 6"""	CYP2A3		7668294, 2748347	Standard	NM_000762		Approved	CPA6, CYP2A	uc002opl.4	P11509	OTTHUMG00000182713	ENST00000301141.5:c.436G>A	19.37:g.41354576C>T	ENSP00000301141:p.Glu146Lys	Somatic		WXS	Illumina HiSeq	Phase_I	A7YAE5|B2R7F6|P00190|P10890|Q16803|Q4VAT9|Q4VAU0|Q4VAU1|Q9H1Z7|Q9UCU0|Q9UK48	Missense_Mutation	SNP	ENST00000301141.5	37	CCDS12568.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	-	22.0	4.226482	0.79576	.	.	ENSG00000255974	ENST00000301141	T	0.71934	-0.61	2.95	0.646	0.17789	.	0.000000	0.85682	U	0.000000	T	0.75459	0.3852	M	0.88512	2.96	0.34218	D	0.675097	D	0.60575	0.988	P	0.49451	0.611	T	0.79543	-0.1760	10	0.87932	D	0	.	6.8491	0.24005	0.0:0.714:0.1771:0.1089	.	146	P11509	CP2A6_HUMAN	K	146	ENSP00000301141:E146K	ENSP00000301141:E146K	E	-	1	0	CYP2A6	46046416	0.919000	0.31177	0.236000	0.24074	0.340000	0.28889	2.445000	0.44899	0.023000	0.15187	-0.544000	0.04233	GAG		0.692	CYP2A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463259.1	NM_000762	
PIWIL3	440822	hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	22	25124310	25124310	+	Missense_Mutation	SNP	C	C	T	rs574938118		TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr22:25124310C>T	ENST00000332271.5	-	15	2182	c.1766G>A	c.(1765-1767)cGt>cAt	p.R589H	PIWIL3_ENST00000527701.1_Missense_Mutation_p.R471H|PIWIL3_ENST00000532537.2_5'UTR|PIWIL3_ENST00000533313.1_Missense_Mutation_p.R471H	NM_001008496.3|NM_001255975.1	NP_001008496.2|NP_001242904.1	Q7Z3Z3	PIWL3_HUMAN	piwi-like RNA-mediated gene silencing 3	589	Piwi. {ECO:0000255|PROSITE- ProRule:PRU00150}.		R -> C (in dbSNP:rs738826).		cell differentiation (GO:0030154)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	RNA binding (GO:0003723)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(15)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	50						GTCATATCTACGTTTGTCATC	0.403													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18874	0.0		0.0	False		,,,				2504	0.0					.											0													158.0	145.0	150.0					22																	25124310		2203	4300	6503	SO:0001583	missense	440822			AB079368	CCDS33623.1	22q11.23	2013-02-15	2013-02-15		ENSG00000184571	ENSG00000184571		"""Argonaute/PIWI family"""	18443	protein-coding gene	gene with protein product		610314	"""piwi-like 3 (Drosophila)"""			12906857	Standard	NM_001008496		Approved	HIWI3	uc003abd.2	Q7Z3Z3	OTTHUMG00000150788	ENST00000332271.5:c.1766G>A	22.37:g.25124310C>T	ENSP00000330031:p.Arg589His	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000332271.5	37	CCDS33623.1	.	.	.	.	.	.	.	.	.	.	C	10.29	1.309628	0.23821	.	.	ENSG00000184571	ENST00000332271;ENST00000533313;ENST00000527701	T;T;T	0.29655	1.56;1.56;1.56	2.71	0.392	0.16288	Stem cell self-renewal protein Piwi (3);Ribonuclease H-like (1);	0.394272	0.26352	N	0.024871	T	0.13457	0.0326	N	0.17631	0.505	0.19575	N	0.999967	P;B;B	0.35700	0.516;0.0;0.0	B;B;B	0.22152	0.038;0.0;0.0	T	0.13683	-1.0500	10	0.72032	D	0.01	0.0032	5.9588	0.19289	0.0:0.2603:0.0:0.7397	.	471;580;589	E9PIP6;B4DYF7;Q7Z3Z3	.;.;PIWL3_HUMAN	H	589;471;471	ENSP00000330031:R589H;ENSP00000431843:R471H;ENSP00000435718:R471H	ENSP00000330031:R589H	R	-	2	0	PIWIL3	23454310	0.960000	0.32886	0.000000	0.03702	0.001000	0.01503	1.185000	0.32065	-0.076000	0.12775	-0.458000	0.05436	CGT		0.403	PIWIL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320084.2	NM_001008496	
FRK	2444	hgsc.bcm.edu	37	6	116265504	116265504	+	Missense_Mutation	SNP	C	C	T	rs190064484	byFrequency	TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr6:116265504C>T	ENST00000606080.1	-	6	1489	c.1043G>A	c.(1042-1044)cGg>cAg	p.R348Q	FRK_ENST00000538210.1_Missense_Mutation_p.R206Q	NM_002031.2	NP_002022.1	P42685	FRK_HUMAN	fyn-related Src family tyrosine kinase	348	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|skin(1)|urinary_tract(1)	27		all_cancers(87;0.00559)|all_epithelial(87;0.00738)|Colorectal(196;0.0465)		all cancers(137;0.0128)|OV - Ovarian serous cystadenocarcinoma(136;0.0209)|GBM - Glioblastoma multiforme(226;0.0459)|Epithelial(106;0.0625)	Regorafenib(DB08896)	AATGTAGTTCCGAGACTCCAG	0.438													C|||	2	0.000399361	0.0	0.0	5008	,	,		15988	0.002		0.0	False		,,,				2504	0.0					.											0													93.0	90.0	91.0					6																	116265504		2203	4300	6503	SO:0001583	missense	2444			U00803	CCDS5103.1	6q21-q22.3	2014-06-25	2014-06-25		ENSG00000111816	ENSG00000111816	2.7.10.1	"""SH2 domain containing"""	3955	protein-coding gene	gene with protein product		606573	"""PTK5 protein tyrosine kinase 5"", ""fyn-related kinase"""	PTK5		7510261	Standard	NM_002031		Approved	RAK, GTK	uc003pwi.1	P42685	OTTHUMG00000015424	ENST00000606080.1:c.1043G>A	6.37:g.116265504C>T	ENSP00000476145:p.Arg348Gln	Somatic		WXS	Illumina HiSeq	Phase_I	B4DY49|Q13128|Q9NTR5	Missense_Mutation	SNP	ENST00000606080.1	37	CCDS5103.1	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	C	8.843	0.942704	0.18281	.	.	ENSG00000111816	ENST00000368626;ENST00000538210	D;D	0.82803	-1.65;-1.65	5.6	4.37	0.52481	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.113303	0.38436	N	0.001691	T	0.41282	0.1152	N	0.05592	-0.015	0.33879	D	0.635881	B	0.02656	0.0	B	0.01281	0.0	T	0.09314	-1.0680	10	0.05351	T	0.99	.	11.351	0.49587	0.0:0.0719:0.0:0.9281	.	348	P42685	FRK_HUMAN	Q	348;206	ENSP00000357615:R348Q;ENSP00000443075:R206Q	ENSP00000357615:R348Q	R	-	2	0	FRK	116372197	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	6.280000	0.72626	0.930000	0.37217	-0.423000	0.05987	CGG		0.438	FRK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041924.2	NM_002031	
CD5L	922	broad.mit.edu;mdanderson.org	37	1	157805633	157805633	+	Missense_Mutation	SNP	G	G	A	rs545632901		TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr1:157805633G>A	ENST00000368174.4	-	3	464	c.368C>T	c.(367-369)tCg>tTg	p.S123L	CD5L_ENST00000484609.1_5'Flank	NM_005894.2	NP_005885.1	O43866	CD5L_HUMAN	CD5 molecule-like	123	SRCR 1. {ECO:0000255|PROSITE- ProRule:PRU00196}.				apoptotic process (GO:0006915)|cellular defense response (GO:0006968)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	scavenger receptor activity (GO:0005044)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	52	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			ACTCTCACACGATGCCCCAGC	0.502													G|||	1	0.000199681	0.0	0.0014	5008	,	,		19102	0.0		0.0	False		,,,				2504	0.0					.											0													112.0	113.0	113.0					1																	157805633		2203	4300	6503	SO:0001583	missense	922			U82812	CCDS1171.1	1q21-q23	2008-02-05	2006-03-28		ENSG00000073754	ENSG00000073754			1690	protein-coding gene	gene with protein product		602592	"""apoptosis inhibitor 6"", ""CD5 antigen-like (scavenger receptor cysteine rich family)"""	API6		9045627	Standard	NM_005894		Approved	Spalpha	uc001frk.4	O43866	OTTHUMG00000022440	ENST00000368174.4:c.368C>T	1.37:g.157805633G>A	ENSP00000357156:p.Ser123Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A8K7M5|Q6UX63	Missense_Mutation	SNP	ENST00000368174.4	37	CCDS1171.1	.	.	.	.	.	.	.	.	.	.	G	7.764	0.705961	0.15172	.	.	ENSG00000073754	ENST00000368174	T	0.34472	1.36	4.68	-9.36	0.00629	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	4.788200	0.00508	N	0.000173	T	0.03348	0.0097	N	0.04686	-0.185	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.10451	-1.0629	10	0.19590	T	0.45	.	2.6374	0.04961	0.4919:0.0815:0.173:0.2536	.	123	O43866	CD5L_HUMAN	L	123	ENSP00000357156:S123L	ENSP00000357156:S123L	S	-	2	0	CD5L	156072257	0.000000	0.05858	0.000000	0.03702	0.036000	0.12997	-3.877000	0.00344	-2.411000	0.00571	-2.010000	0.00438	TCG		0.502	CD5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058346.1	NM_005894	
PPP1R15B	84919	broad.mit.edu	37	1	204379294	204379294	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr1:204379294A>G	ENST00000367188.4	-	1	1625	c.1246T>C	c.(1246-1248)Tct>Cct	p.S416P	RP11-739N20.2_ENST00000443515.1_RNA	NM_032833.3	NP_116222.3	Q5SWA1	PR15B_HUMAN	protein phosphatase 1, regulatory subunit 15B	416					ER overload response (GO:0006983)|regulation of translation (GO:0006417)|response to hydrogen peroxide (GO:0042542)	protein phosphatase type 1 complex (GO:0000164)	protein serine/threonine phosphatase activity (GO:0004722)			breast(3)|cervix(1)|kidney(4)|large_intestine(3)|lung(16)|ovary(1)|pancreas(2)|skin(1)|urinary_tract(3)	34	all_cancers(21;0.0032)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.179)|all_epithelial(62;0.193)|Prostate(682;0.227)		all cancers(3;1.14e-29)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.139)			GGTCTGGCAGAAATGGGAAGG	0.458																																						.											0													75.0	76.0	76.0					1																	204379294		2203	4300	6503	SO:0001583	missense	84919			AK027650	CCDS1445.1	1q32.1	2012-04-17	2011-10-04		ENSG00000158615	ENSG00000158615		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14951	protein-coding gene	gene with protein product		613257	"""protein phosphatase 1, regulatory (inhibitor) subunit 15B"""			11948623	Standard	XM_005245551		Approved	FLJ14744	uc001hav.4	Q5SWA1	OTTHUMG00000036105	ENST00000367188.4:c.1246T>C	1.37:g.204379294A>G	ENSP00000356156:p.Ser416Pro	Somatic		WXS	Illumina HiSeq	Phase_I	Q53GQ4|Q658M2|Q6P156|Q96SN1	Missense_Mutation	SNP	ENST00000367188.4	37	CCDS1445.1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.555518	0.86231	.	.	ENSG00000158615	ENST00000367188;ENST00000543650	T	0.29397	1.57	4.8	2.18	0.27775	Protein phosphatase 1, regulatory subunit 15A/B, C-terminal (1);	0.559998	0.18639	N	0.135345	T	0.46347	0.1388	M	0.70595	2.14	0.09310	N	1	D	0.53462	0.96	P	0.57776	0.827	T	0.29119	-1.0022	10	0.56958	D	0.05	-8.9052	10.7169	0.46017	0.5569:0.4431:0.0:0.0	.	416	Q5SWA1	PR15B_HUMAN	P	416;326	ENSP00000356156:S416P	ENSP00000356156:S416P	S	-	1	0	PPP1R15B	202645917	0.008000	0.16893	0.043000	0.18650	0.742000	0.42306	0.674000	0.25218	0.743000	0.32719	0.533000	0.62120	TCT		0.458	PPP1R15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087974.1	NM_032833	
CAPRIN1	4076	broad.mit.edu	37	11	34074126	34074126	+	Silent	SNP	C	C	T			TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr11:34074126C>T	ENST00000341394.4	+	2	348	c.159C>T	c.(157-159)gcC>gcT	p.A53A	CAPRIN1_ENST00000389645.3_Silent_p.A53A|CAPRIN1_ENST00000529307.1_5'Flank|CAPRIN1_ENST00000532820.1_Silent_p.A53A|CAPRIN1_ENST00000530820.1_Silent_p.A53A	NM_005898.4	NP_005889.3	Q14444	CAPR1_HUMAN	cell cycle associated protein 1	53					negative regulation of translation (GO:0017148)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)	18		Acute lymphoblastic leukemia(5;0.00045)|all_hematologic(20;0.0016)				AGACCGAGGCCATGAAGCAGA	0.692																																						.											0													15.0	16.0	16.0					11																	34074126		2181	4272	6453	SO:0001819	synonymous_variant	4076			BC001731	CCDS31453.1, CCDS31454.1	11p13	2010-08-03	2007-03-27	2007-03-27	ENSG00000135387	ENSG00000135387			6743	protein-coding gene	gene with protein product	"""cytoplasmic activation/proliferation-associated protein-1"""	601178	"""membrane component, chromosome 11, surface marker 1"", ""GPI-anchored membrane protein 1"""	M11S1, GPIAP1		7657653, 16177067, 17210633, 14764709, 15471883	Standard	NM_005898		Approved	caprin-1, RNG105	uc001mvh.1	Q14444	OTTHUMG00000166248	ENST00000341394.4:c.159C>T	11.37:g.34074126C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A6NMY7|D3DR06|Q15074|Q6IMN4|Q6IMN7|Q9BV09	Silent	SNP	ENST00000341394.4	37	CCDS31453.1																																																																																				0.692	CAPRIN1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000388680.2	NM_005898	
TPTE2P3	220115	broad.mit.edu	37	13	53157247	53157247	+	IGR	DEL	A	A	-			TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr13:53157247delA								RP11-78J21.4 (83807 upstream) : HNRNPA1L2 (34357 downstream)																							CATGACACTGAAACAGACAGG	0.373																																						.											0																																										SO:0001628	intergenic_variant	220115																															13.37:g.53157247delA		Somatic		WXS	Illumina HiSeq	Phase_I		RNA	DEL		37																																																																																				0	0.373								
PRMT5	10419	broad.mit.edu	37	14	23393288	23393288	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr14:23393288T>C	ENST00000324366.8	-	12	1527	c.1304A>G	c.(1303-1305)gAg>gGg	p.E435G	PRMT5-AS1_ENST00000590290.1_RNA|PRMT5_ENST00000397440.4_Missense_Mutation_p.E264G|PRMT5-AS1_ENST00000599580.2_RNA|PRMT5-AS1_ENST00000424245.2_RNA|PRMT5_ENST00000216350.8_Missense_Mutation_p.E374G|PRMT5_ENST00000397441.2_Missense_Mutation_p.E418G|PRMT5_ENST00000553897.1_Missense_Mutation_p.E391G|PRMT5-AS1_ENST00000587245.2_RNA|PRMT5-AS1_ENST00000595662.1_RNA|PRMT5-AS1_ENST00000457443.2_RNA|PRMT5_ENST00000538452.1_Missense_Mutation_p.E329G|PRMT5_ENST00000553641.1_5'Flank|PRMT5-AS1_ENST00000609885.1_RNA	NM_006109.3	NP_006100.2	O14744	ANM5_HUMAN	protein arginine methyltransferase 5	435	SAM-dependent MTase PRMT-type. {ECO:0000255|PROSITE-ProRule:PRU01015}.				cell proliferation (GO:0008283)|circadian regulation of gene expression (GO:0032922)|endothelial cell activation (GO:0042118)|gene expression (GO:0010467)|histone H4-R3 methylation (GO:0043985)|ncRNA metabolic process (GO:0034660)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-arginine methylation (GO:0018216)|peptidyl-arginine methylation, to symmetrical-dimethyl arginine (GO:0019918)|peptidyl-arginine N-methylation (GO:0035246)|regulation of mitosis (GO:0007088)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|spliceosomal snRNP assembly (GO:0000387)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|methylosome (GO:0034709)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|histone-arginine N-methyltransferase activity (GO:0008469)|methyltransferase activity (GO:0008168)|protein-arginine omega-N symmetric methyltransferase activity (GO:0035243)|ribonucleoprotein complex binding (GO:0043021)|transcription corepressor activity (GO:0003714)			endometrium(4)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	25	all_cancers(95;2.76e-05)			GBM - Glioblastoma multiforme(265;0.0126)		GCCCAGAAGCTCACTGACAAT	0.532																																						.											0													106.0	97.0	100.0					14																	23393288		2203	4300	6503	SO:0001583	missense	10419			AF015913	CCDS9579.1, CCDS41922.1, CCDS61394.1, CCDS61395.1, CCDS61396.1	14q11.2	2014-06-12	2006-02-16	2006-02-16	ENSG00000100462	ENSG00000100462	2.1.1.125	"""Protein arginine methyltransferases"""	10894	protein-coding gene	gene with protein product		604045	"""skb1 (S. pombe) homolog"", ""SKB1 homolog (S. pombe)"""	HRMT1L5, SKB1		9843966	Standard	NM_001282955		Approved	SKB1Hs	uc001whm.1	O14744	OTTHUMG00000028709	ENST00000324366.8:c.1304A>G	14.37:g.23393288T>C	ENSP00000319169:p.Glu435Gly	Somatic		WXS	Illumina HiSeq	Phase_I	A8MTP3|A8MZ91|B4DX49|B4DY30|B5BU10|D3DS33|E2QRE7|Q6IBR1|Q9UKH1	Missense_Mutation	SNP	ENST00000324366.8	37	CCDS9579.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.419250	0.83559	.	.	ENSG00000100462	ENST00000324366;ENST00000397441;ENST00000397440;ENST00000216350;ENST00000555454;ENST00000538452;ENST00000553897	T;T;T;T;T;T;T	0.23552	1.9;1.9;1.9;1.9;1.9;1.9;1.9	5.5	5.5	0.81552	.	0.089817	0.85682	D	0.000000	T	0.59797	0.2220	M	0.91196	3.185	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;0.999;1.0;0.999;1.0	T	0.69476	-0.5135	10	0.87932	D	0	-22.6753	14.731	0.69383	0.0:0.0:0.0:1.0	.	391;374;264;435;418	G3V5W5;B4DX49;A8MTP3;O14744;A8MZ91	.;.;.;ANM5_HUMAN;.	G	435;418;264;374;34;329;391	ENSP00000319169:E435G;ENSP00000380583:E418G;ENSP00000380582:E264G;ENSP00000216350:E374G;ENSP00000451245:E34G;ENSP00000444915:E329G;ENSP00000452555:E391G	ENSP00000216350:E374G	E	-	2	0	PRMT5	22463128	1.000000	0.71417	1.000000	0.80357	0.820000	0.46376	7.304000	0.78882	2.313000	0.78055	0.454000	0.30748	GAG		0.532	PRMT5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071674.3		
ARID4A	5926	broad.mit.edu	37	14	58831996	58831997	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr14:58831996_58831997delAG	ENST00000355431.3	+	20	3562_3563	c.3189_3190delAG	c.(3187-3192)caagagfs	p.E1064fs	ARID4A_ENST00000395168.3_Frame_Shift_Del_p.E1064fs|ARID4A_ENST00000431317.2_Frame_Shift_Del_p.E1064fs|ARID4A_ENST00000348476.3_Frame_Shift_Del_p.E1064fs	NM_002892.3	NP_002883.3	P29374	ARI4A_HUMAN	AT rich interactive domain 4A (RBP1-like)	1064					erythrocyte development (GO:0048821)|histone H3-K4 trimethylation (GO:0080182)|histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of gene expression by genetic imprinting (GO:0006349)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|central_nervous_system(1)|cervix(4)|endometrium(8)|kidney(2)|large_intestine(14)|lung(19)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						TAATTGTACAAGAGAGAGAGAG	0.381																																						.											0																																										SO:0001589	frameshift_variant	5926			S57153	CCDS9732.1, CCDS9733.1, CCDS45114.1	14q22.3	2013-02-07	2004-01-28	2004-01-28	ENSG00000032219	ENSG00000032219		"""-"""	9885	protein-coding gene	gene with protein product		180201	"""retinoblastoma-binding protein 1"""	RBBP1		1857421, 8455946	Standard	NM_023000		Approved	RBP1, RBP-1	uc001xdp.3	P29374	OTTHUMG00000140320	ENST00000355431.3:c.3189_3190delAG	14.37:g.58832006_58832007delAG	ENSP00000347602:p.Glu1064fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q15991|Q15992|Q15993	Frame_Shift_Del	DEL	ENST00000355431.3	37	CCDS9732.1																																																																																				0.381	ARID4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276927.2	NM_023001	
AHNAK2	113146	broad.mit.edu	37	14	105412335	105412335	+	Silent	SNP	C	C	T	rs202104959	byFrequency	TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr14:105412335C>T	ENST00000333244.5	-	7	9572	c.9453G>A	c.(9451-9453)ccG>ccA	p.P3151P	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3151						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.P3151P(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CCCCGAACGACGGCATCTTGA	0.602																																						.											1	Substitution - coding silent(1)	endometrium(1)											198.0	138.0	157.0					14																	105412335		1921	4005	5926	SO:0001819	synonymous_variant	113146			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.9453G>A	14.37:g.105412335C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	ENST00000333244.5	37	CCDS45177.1																																																																																				0.602	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
EIF2AK4	440275	broad.mit.edu	37	15	40257897	40257897	+	Silent	SNP	A	A	G			TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr15:40257897A>G	ENST00000263791.5	+	8	913	c.870A>G	c.(868-870)gaA>gaG	p.E290E	EIF2AK4_ENST00000382727.2_Silent_p.E290E|EIF2AK4_ENST00000559624.1_Silent_p.E290E	NM_001013703.2	NP_001013725.2	Q9P2K8	E2AK4_HUMAN	eukaryotic translation initiation factor 2 alpha kinase 4	290					cellular response to starvation (GO:0009267)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of translation (GO:0017148)|protein phosphorylation (GO:0006468)|regulation of translational initiation (GO:0006446)|regulation of translational initiation in response to stress (GO:0043558)	cytosolic ribosome (GO:0022626)	ATP binding (GO:0005524)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)	40		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)		GCAGTGATGAACAACTTGGAA	0.418																																						.											0													170.0	163.0	165.0					15																	40257897		1886	4125	6011	SO:0001819	synonymous_variant	440275			AB037759	CCDS42016.1	15q13.3	2008-08-18				ENSG00000128829			19687	protein-coding gene	gene with protein product		609280				10504407	Standard	XM_005254392		Approved	GCN2, KIAA1338	uc001zkm.1	Q9P2K8		ENST00000263791.5:c.870A>G	15.37:g.40257897A>G		Somatic		WXS	Illumina HiSeq	Phase_I	C9JEC4|Q69YL7|Q6DC97|Q96GN6|Q9H5K1|Q9NSQ3|Q9NSZ5|Q9UJ56	Silent	SNP	ENST00000263791.5	37	CCDS42016.1																																																																																				0.418	EIF2AK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418395.1		
FSD2	123722	broad.mit.edu;mdanderson.org	37	15	83451563	83451563	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr15:83451563T>C	ENST00000334574.8	-	4	1131	c.950A>G	c.(949-951)aAg>aGg	p.K317R	FSD2_ENST00000541889.1_Missense_Mutation_p.K317R			A1L4K1	FSD2_HUMAN	fibronectin type III and SPRY domain containing 2	317										breast(2)|central_nervous_system(1)|large_intestine(5)|lung(10)	18						GAAATCCACCTTCTCCTCGTG	0.378																																						.											0													266.0	253.0	257.0					15																	83451563		1926	4125	6051	SO:0001583	missense	123722			AK122875	CCDS45332.1, CCDS61738.1	15q25.2	2013-02-11	2006-01-11	2006-01-11		ENSG00000186628		"""Fibronectin type III domain containing"""	18024	protein-coding gene	gene with protein product			"""SPRY domain containing 1"""	SPRYD1			Standard	NM_001007122		Approved	RP11-127F21	uc002bjd.2	A1L4K1		ENST00000334574.8:c.950A>G	15.37:g.83451563T>C	ENSP00000335651:p.Lys317Arg	Somatic		WXS	Illumina HiSeq	Phase_I	B3KVG1|B7ZM02	Missense_Mutation	SNP	ENST00000334574.8	37	CCDS45332.1	.	.	.	.	.	.	.	.	.	.	T	21.9	4.211095	0.79240	.	.	ENSG00000186628	ENST00000334574;ENST00000541889	T;T	0.63580	0.43;-0.05	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	T	0.74382	0.3709	L	0.50333	1.59	0.37277	D	0.907671	P;D	0.89917	0.624;1.0	P;D	0.83275	0.599;0.996	T	0.76217	-0.3040	10	0.38643	T	0.18	-49.0724	15.7575	0.78046	0.0:0.0:0.0:1.0	.	317;317	B7ZM02;A1L4K1	.;FSD2_HUMAN	R	317	ENSP00000335651:K317R;ENSP00000444078:K317R	ENSP00000335651:K317R	K	-	2	0	FSD2	81248617	1.000000	0.71417	0.994000	0.49952	0.805000	0.45488	6.684000	0.74538	2.317000	0.78254	0.459000	0.35465	AAG		0.378	FSD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418385.1	NM_001007122	
FCGBP	8857	broad.mit.edu	37	19	40380652	40380652	+	Frame_Shift_Del	DEL	A	A	-			TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr19:40380652delA	ENST00000221347.6	-	23	10670	c.10663delT	c.(10663-10665)tgcfs	p.C3555fs	FCGBP_ENST00000595713.1_5'Flank	NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	3555	Cys-rich.|TIL 8.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			AGGCTCGGGCAGCTCCCAGGA	0.637																																						.											0													1.0	2.0	2.0					19																	40380652		246	1429	1675	SO:0001589	frameshift_variant	8857			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.10663delT	19.37:g.40380652delA	ENSP00000221347:p.Cys3555fs	Somatic		WXS	Illumina HiSeq	Phase_I	O95784	Frame_Shift_Del	DEL	ENST00000221347.6	37	CCDS12546.1																																																																																				0.637	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
SNRNP200	23020	broad.mit.edu;bcgsc.ca	37	2	96953605	96953605	+	Missense_Mutation	SNP	G	G	A			TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr2:96953605G>A	ENST00000323853.5	-	25	3438	c.3361C>T	c.(3361-3363)Cgc>Tgc	p.R1121C	SNRNP200_ENST00000349783.5_Intron	NM_014014.4	NP_054733.2	O75643	U520_HUMAN	small nuclear ribonucleoprotein 200kDa (U5)	1121	SEC63 1.				ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|lung(37)|ovary(7)|prostate(4)|skin(5)|stomach(1)|urinary_tract(1)	90						CCTTACATGCGTTTGTCGATC	0.547																																						.											0													163.0	140.0	148.0					2																	96953605		2203	4300	6503	SO:0001583	missense	23020			AL831994	CCDS2020.1	2q11.2	2013-05-13	2008-10-29	2008-10-29	ENSG00000144028	ENSG00000144028			30859	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 200 KD"""	601664	"""activating signal cointegrator 1 complex subunit 3-like 1"", ""retinitis pigmentosa 33 (autosomal dominant)"""	ASCC3L1, RP33		9872452, 8670905, 9774689, 9539711, 16612614, 19878916	Standard	NM_014014		Approved	U5-200KD, HELIC2, KIAA0788, BRR2	uc002svu.3	O75643	OTTHUMG00000130455	ENST00000323853.5:c.3361C>T	2.37:g.96953605G>A	ENSP00000317123:p.Arg1121Cys	Somatic		WXS	Illumina HiSeq	Phase_I	O94884|Q6NZY0|Q6PX59|Q8NBE6|Q96IF2|Q9H7S0	Missense_Mutation	SNP	ENST00000323853.5	37	CCDS2020.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.192973	0.78902	.	.	ENSG00000144028	ENST00000323853	T	0.65732	-0.17	5.3	5.3	0.74995	Sec63 domain (3);	0.000000	0.85682	D	0.000000	D	0.85155	0.5632	H	0.96861	3.895	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.88996	0.3418	10	0.87932	D	0	.	12.8995	0.58117	0.0:0.0:0.8373:0.1627	.	1121	O75643	U520_HUMAN	C	1121	ENSP00000317123:R1121C	ENSP00000317123:R1121C	R	-	1	0	SNRNP200	96317332	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	3.817000	0.55668	2.755000	0.94549	0.561000	0.74099	CGC		0.547	SNRNP200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252846.2	NM_014014	
DGCR8	54487	broad.mit.edu	37	22	20094117	20094117	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr22:20094117A>G	ENST00000351989.3	+	11	2321	c.1892A>G	c.(1891-1893)aAc>aGc	p.N631S	DGCR8_ENST00000407755.1_Missense_Mutation_p.N598S|DGCR8_ENST00000383024.2_Missense_Mutation_p.N598S	NM_022720.6	NP_073557.3	Q8WYQ5	DGCR8_HUMAN	DGCR8 microprocessor complex subunit	631	DRBM 2. {ECO:0000255|PROSITE- ProRule:PRU00266}.|Necessary for heme-binding and pri-miRNA processing.|Necessary for interaction with DROSHA.				gene expression (GO:0010467)|primary miRNA processing (GO:0031053)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)			NS(2)|breast(1)|endometrium(5)|large_intestine(5)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	22	Colorectal(54;0.0993)					TCTTAAAGAAACCATGGGATG	0.532																																						.											0													106.0	103.0	104.0					22																	20094117		2203	4300	6503	SO:0001583	missense	54487			AF165527, AB050770	CCDS13773.1, CCDS54501.1	22q11.2	2013-05-02	2013-05-02		ENSG00000128191	ENSG00000128191			2847	protein-coding gene	gene with protein product		609030	"""chromosome 22 open reading frame 12"", ""DiGeorge syndrome critical region gene 8"""	C22orf12		21454614	Standard	NM_001190326		Approved	DGCRK6, Gy1, pasha	uc002zri.3	Q8WYQ5	OTTHUMG00000150503	ENST00000351989.3:c.1892A>G	22.37:g.20094117A>G	ENSP00000263209:p.Asn631Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B2R8G1|Q6DCB2|Q6MZE9|Q6Y2L0|Q96G39|Q96GP8|Q9H6L8|Q9H6T7|Q9NRW2	Missense_Mutation	SNP	ENST00000351989.3	37	CCDS13773.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.093845	0.76870	.	.	ENSG00000128191	ENST00000351989;ENST00000383024;ENST00000407755	T;T;T	0.77229	-1.08;-1.08;-1.08	4.97	4.97	0.65823	Double-stranded RNA-binding (2);	0.000000	0.85682	D	0.000000	D	0.83755	0.5323	L	0.48642	1.525	0.80722	D	1	D;D	0.67145	0.996;0.987	D;D	0.77557	0.99;0.931	D	0.85377	0.1117	10	0.72032	D	0.01	-23.0085	13.7567	0.62942	1.0:0.0:0.0:0.0	.	598;631	Q8WYQ5-3;Q8WYQ5	.;DGCR8_HUMAN	S	631;598;598	ENSP00000263209:N631S;ENSP00000372488:N598S;ENSP00000384726:N598S	ENSP00000263209:N631S	N	+	2	0	DGCR8	18474117	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	8.420000	0.90256	2.084000	0.62774	0.383000	0.25322	AAC		0.532	DGCR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318654.1		
ANO10	55129	broad.mit.edu	37	3	43607195	43607195	+	Frame_Shift_Del	DEL	A	A	-			TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr3:43607195delA	ENST00000292246.3	-	8	1413	c.1243delT	c.(1243-1245)tcafs	p.S415fs	ANO10_ENST00000396091.3_Frame_Shift_Del_p.S349fs|ANO10_ENST00000350459.4_Frame_Shift_Del_p.S225fs|ANO10_ENST00000414522.2_Frame_Shift_Del_p.S415fs|ANO10_ENST00000451430.2_Frame_Shift_Del_p.S304fs	NM_018075.3	NP_060545.3	Q9NW15	ANO10_HUMAN	anoctamin 10	415					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cell death (GO:0008219)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)			NS(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(9)|ovary(3)|prostate(3)|skin(3)	29						TAGAAGAGTGAGGCAAAGCAA	0.333																																						.											0													41.0	39.0	40.0					3																	43607195		2200	4293	6493	SO:0001589	frameshift_variant	55129			AL832508	CCDS2710.2, CCDS56247.1, CCDS56248.1, CCDS56249.1, CCDS56250.1	3p22.1-p21.33	2014-04-09	2008-08-28	2008-08-28	ENSG00000160746	ENSG00000160746		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	25519	protein-coding gene	gene with protein product		613726	"""transmembrane protein 16K"""	TMEM16K		12477932, 24692353	Standard	NM_001204831		Approved	FLJ10375, MGC47890, SCAR10	uc003cmv.3	Q9NW15	OTTHUMG00000133044	ENST00000292246.3:c.1243delT	3.37:g.43607195delA	ENSP00000292246:p.Ser415fs	Somatic		WXS	Illumina HiSeq	Phase_I	A8K8K3|A8MV74|B3KTZ1|B3KY93|B4DJ83|B4DNK2|B7WP12|C9JHS1|Q8IXX9	Frame_Shift_Del	DEL	ENST00000292246.3	37	CCDS2710.2																																																																																				0.333	ANO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256649.2	NM_018075	
FLNB	2317	broad.mit.edu	37	3	58067357	58067357	+	Splice_Site	SNP	T	T	C			TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr3:58067357T>C	ENST00000295956.4	+	4	806	c.641T>C	c.(640-642)gTc>gCc	p.V214A	FLNB_ENST00000358537.3_Splice_Site_p.V214A|FLNB_ENST00000357272.4_Splice_Site_p.V214A|FLNB_ENST00000348383.5_Splice_Site_p.V214A|FLNB_ENST00000490882.1_Splice_Site_p.V214A|FLNB_ENST00000429972.2_Splice_Site_p.V214A|FLNB_ENST00000493452.1_Splice_Site_p.V45A|FLNB_ENST00000419752.2_Splice_Site_p.V45A	NM_001457.3	NP_001448.2	O75369	FLNB_HUMAN	filamin B, beta	214	Actin-binding.|CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|cytoskeletal anchoring at plasma membrane (GO:0007016)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin binding (GO:0003779)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(13)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(23)|liver(2)|lung(38)|ovary(6)|prostate(3)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(5)	120				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		TTATCCTAGGTCATCACTCCT	0.458																																						.											0													136.0	129.0	131.0					3																	58067357		2203	4300	6503	SO:0001630	splice_region_variant	2317			AF043045	CCDS2885.1, CCDS54599.1, CCDS54600.1, CCDS54601.1	3p14.3	2011-02-11	2009-07-23		ENSG00000136068	ENSG00000136068			3755	protein-coding gene	gene with protein product	"""actin binding protein 278"""	603381	"""filamin B, beta (actin binding protein 278)"", ""Larsen syndrome 1 (autosomal dominant)"""	FLN1L, LRS1		8327473, 10449914, 14991055, 16801345	Standard	NM_001457		Approved	TAP, TABP, ABP-278, FH1	uc010hne.2	O75369	OTTHUMG00000159158	ENST00000295956.4:c.640-1T>C	3.37:g.58067357T>C		Somatic		WXS	Illumina HiSeq	Phase_I	B2ZZ83|B2ZZ84|B2ZZ85|C9JKE6|C9JMC4|Q13706|Q59EC2|Q60FE7|Q6MZJ1|Q8WXS9|Q8WXT0|Q8WXT1|Q8WXT2|Q8WXT3|Q9NRB5|Q9NT26|Q9UEV9	Missense_Mutation	SNP	ENST00000295956.4	37	CCDS2885.1	.	.	.	.	.	.	.	.	.	.	T	33	5.207103	0.95033	.	.	ENSG00000136068	ENST00000295956;ENST00000490882;ENST00000358537;ENST00000429972;ENST00000348383;ENST00000357272;ENST00000493452;ENST00000419752	D;D;D;D;D;D;D;D	0.95482	-3.72;-3.72;-3.72;-3.72;-3.72;-3.72;-3.72;-3.72	5.86	5.86	0.93980	Calponin homology domain (5);	0.051658	0.85682	D	0.000000	D	0.98015	0.9346	M	0.88105	2.93	0.80722	D	1	P;D;P;P;P;P	0.69078	0.918;0.997;0.667;0.936;0.934;0.934	P;D;B;P;P;P	0.77004	0.703;0.989;0.24;0.72;0.804;0.804	D	0.98914	1.0781	10	0.87932	D	0	.	16.5602	0.84551	0.0:0.0:0.0:1.0	.	214;214;45;45;214;214	O75369-2;B2ZZ83;E7EN95;O75369-7;Q60FE7;O75369	.;.;.;.;.;FLNB_HUMAN	A	214;214;214;214;214;214;45;45	ENSP00000295956:V214A;ENSP00000420213:V214A;ENSP00000351339:V214A;ENSP00000415599:V214A;ENSP00000232447:V214A;ENSP00000349819:V214A;ENSP00000418510:V45A;ENSP00000414532:V45A	ENSP00000295956:V214A	V	+	2	0	FLNB	58042397	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.954000	0.87848	2.367000	0.80283	0.528000	0.53228	GTC		0.458	FLNB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353569.1	NM_001457	Missense_Mutation
NEDD9	4739	broad.mit.edu;mdanderson.org	37	6	11185614	11185614	+	Silent	SNP	C	C	T			TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr6:11185614C>T	ENST00000379446.5	-	7	2452	c.2286G>A	c.(2284-2286)acG>acA	p.T762T	NEDD9_ENST00000504387.1_Silent_p.T762T|RP3-510L9.1_ENST00000500636.2_RNA	NM_001271033.1|NM_006403.3	NP_001257962.1|NP_006394.1	Q14511	CASL_HUMAN	neural precursor cell expressed, developmentally down-regulated 9	762					actin filament bundle assembly (GO:0051017)|cell adhesion (GO:0007155)|cytoskeleton organization (GO:0007010)|integrin-mediated signaling pathway (GO:0007229)|mitotic nuclear division (GO:0007067)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle pole (GO:0000922)				endometrium(3)|kidney(2)|large_intestine(8)|liver(1)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	Breast(50;0.0768)|Ovarian(93;0.152)	all_hematologic(90;0.135)	Epithelial(50;0.0647)|all cancers(50;0.179)			GCCGTGTCAGCGTGTCTCCAA	0.537																																						.											0													189.0	156.0	167.0					6																	11185614		2203	4300	6503	SO:0001819	synonymous_variant	4739			L43821	CCDS4520.1, CCDS34340.1, CCDS47373.1, CCDS75400.1	6p25-p24	2011-04-13			ENSG00000111859	ENSG00000111859		"""Cas scaffolding proteins"""	7733	protein-coding gene	gene with protein product	"""Cas scaffolding protein family member 2"", ""Cas-like"""	602265					Standard	NM_182966		Approved	HEF1, CAS-L, CASS2	uc003mzv.2	Q14511	OTTHUMG00000014255	ENST00000379446.5:c.2286G>A	6.37:g.11185614C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A8K9G7|A8MSJ9|G5E9Y9|Q5T9R4|Q5XKI0	Silent	SNP	ENST00000379446.5	37	CCDS4520.1																																																																																				0.537	NEDD9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039853.2	NM_006403	
CREB5	9586	broad.mit.edu	37	7	28848967	28848967	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr7:28848967A>G	ENST00000357727.2	+	9	1580	c.1190A>G	c.(1189-1191)aAg>aGg	p.K397R	CREB5_ENST00000396299.2_Missense_Mutation_p.K364R|CREB5_ENST00000409603.1_Missense_Mutation_p.K364R|CREB5_ENST00000396298.2_Missense_Mutation_p.K258R|CREB5_ENST00000396300.2_Missense_Mutation_p.K390R	NM_182898.2	NP_878901.2	Q02930	CREB5_HUMAN	cAMP responsive element binding protein 5	397	Basic motif. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				adipose tissue development (GO:0060612)|fat cell differentiation (GO:0045444)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(7)|liver(1)|lung(13)|prostate(1)|skin(3)	32						CAGAAGAGGAAGGTCTGGGTG	0.592																																						.											0													45.0	51.0	49.0					7																	28848967		2203	4300	6503	SO:0001583	missense	9586			L05515	CCDS5417.1, CCDS5418.1, CCDS43562.1, CCDS43563.1	7p15	2013-01-10			ENSG00000146592	ENSG00000146592		"""basic leucine zipper proteins"""	16844	protein-coding gene	gene with protein product	"""cAMP response element binding protein CRE-Bpa"""					8378084, 8440710	Standard	XM_005249906		Approved	H_GS165L15.1, CRE-BPA	uc003szr.3	Q02930	OTTHUMG00000097081	ENST00000357727.2:c.1190A>G	7.37:g.28848967A>G	ENSP00000350359:p.Lys397Arg	Somatic		WXS	Illumina HiSeq	Phase_I	A8KA51|B4DU13|B5BUH3|C9JK47|Q05886|Q06246|Q75N02|Q86UJ9	Missense_Mutation	SNP	ENST00000357727.2	37	CCDS5417.1	.	.	.	.	.	.	.	.	.	.	A	34	5.314023	0.95655	.	.	ENSG00000146592	ENST00000396299;ENST00000357727;ENST00000396300;ENST00000409603;ENST00000396298	T;T;T;T;T	0.58210	0.35;0.35;0.35;0.35;0.35	5.99	5.99	0.97316	Basic-leucine zipper (bZIP) transcription factor (2);bZIP transcription factor, bZIP-1 (1);	0.000000	0.85682	D	0.000000	T	0.69369	0.3103	L	0.53617	1.68	0.58432	D	0.999996	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.999	T	0.71679	-0.4520	10	0.87932	D	0	-28.5584	16.4943	0.84223	1.0:0.0:0.0:0.0	.	258;397	B4DU13;Q02930	.;CREB5_HUMAN	R	364;397;390;364;258	ENSP00000379593:K364R;ENSP00000350359:K397R;ENSP00000379594:K390R;ENSP00000387197:K364R;ENSP00000379592:K258R	ENSP00000350359:K397R	K	+	2	0	CREB5	28815492	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.339000	0.96797	2.291000	0.77112	0.533000	0.62120	AAG		0.592	CREB5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214204.4	NM_004904	
ZAN	7455	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	7	100346036	100346036	+	RNA	SNP	G	G	A	rs574016648		TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr7:100346036G>A	ENST00000348028.3	+	0	1357				ZAN_ENST00000538115.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000421100.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			CTGGGCCCTCGGACATAAAAA	0.567													G|||	1	0.000199681	0.0	0.0014	5008	,	,		17018	0.0		0.0	False		,,,				2504	0.0					.											0													51.0	52.0	52.0					7																	100346036		1906	4111	6017			7455			U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100346036G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Missense_Mutation	SNP	ENST00000348028.3	37		.	.	.	.	.	.	.	.	.	.	G	16.16	3.045328	0.55110	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585	T;T;T	0.02140	4.43;4.43;4.43	4.81	2.99	0.34606	Concanavalin A-like lectin/glucanase (1);MAM domain (3);	0.000000	0.38605	N	0.001638	T	0.06826	0.0174	L	0.50847	1.595	0.20821	N	0.999845	D;D	0.89917	1.0;1.0	D;D	0.76575	0.98;0.988	T	0.08027	-1.0742	10	0.72032	D	0.01	.	6.3795	0.21525	0.2137:0.0:0.7863:0.0	.	398;398	F5H0T8;Q9Y493	.;ZAN_HUMAN	R	398	ENSP00000445943:G398R;ENSP00000445091:G398R;ENSP00000444427:G398R	ENSP00000423579:G398R	G	+	1	0	ZAN	100183972	0.009000	0.17119	0.103000	0.21229	0.027000	0.11550	1.225000	0.32551	1.340000	0.45581	0.555000	0.69702	GGA		0.567	ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000347214.1	NM_003386	
KMT2C	58508	broad.mit.edu;bcgsc.ca	37	7	151917680	151917680	+	Missense_Mutation	SNP	C	C	T			TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr7:151917680C>T	ENST00000262189.6	-	23	3858	c.3640G>A	c.(3640-3642)Gtg>Atg	p.V1214M	KMT2C_ENST00000355193.2_Missense_Mutation_p.V1214M	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	1214					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										AGGACGGCCACGCTATTCTGA	0.393																																						.											0													92.0	86.0	88.0					7																	151917680		2203	4300	6503	SO:0001583	missense	58508			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.3640G>A	7.37:g.151917680C>T	ENSP00000262189:p.Val1214Met	Somatic		WXS	Illumina HiSeq	Phase_I	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	C	17.47	3.398057	0.62177	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.84516	-1.85;-1.86	4.44	4.44	0.53790	.	0.000000	0.39210	U	0.001435	D	0.89993	0.6876	L	0.54323	1.7	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.67382	0.921;0.951	D	0.90635	0.4570	10	0.52906	T	0.07	.	17.4147	0.87496	0.0:1.0:0.0:0.0	.	1214;275	Q8NEZ4;Q8NEZ4-2	MLL3_HUMAN;.	M	1214	ENSP00000262189:V1214M;ENSP00000347325:V1214M	ENSP00000262189:V1214M	V	-	1	0	MLL3	151548613	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.392000	0.79840	2.161000	0.67846	0.484000	0.47621	GTG		0.393	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
CAMSAP1	157922	broad.mit.edu	37	9	138715800	138715800	+	Frame_Shift_Del	DEL	T	T	-			TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr9:138715800delT	ENST00000389532.4	-	10	1460	c.1396delA	c.(1396-1398)accfs	p.T466fs	CAMSAP1_ENST00000409386.3_Frame_Shift_Del_p.T477fs|CAMSAP1_ENST00000312405.6_Frame_Shift_Del_p.T188fs|CAMSAP1_ENST00000483991.1_5'UTR	NM_015447.3	NP_056262.3	Q5T5Y3	CAMP1_HUMAN	calmodulin regulated spectrin-associated protein 1	466					cytoskeleton organization (GO:0007010)|neuron projection development (GO:0031175)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|spectrin binding (GO:0030507)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(11)|lung(16)|ovary(3)|pancreas(1)|skin(1)	47				OV - Ovarian serous cystadenocarcinoma(145;1.4e-06)|Epithelial(140;1.11e-05)		ACTCACCTGGTTTTTTTTTCT	0.463																																						.											0										100,44,4118		0,0,100,9,26,1996	52.0	46.0	48.0			-3.4	0.0	9		48	225,85,7928		1,0,223,16,53,3826	no	codingComplex	CAMSAP1	NM_015447.3		1,0,323,25,79,5822	A1A1,A1A2,A1R,A2A2,A2R,RR		3.763,3.3787,3.632			138715800	325,129,12046	2202	4295	6497	SO:0001589	frameshift_variant	157922			AJ519841	CCDS35176.2	9q34.3	2008-02-05			ENSG00000130559	ENSG00000130559			19946	protein-coding gene	gene with protein product		613774				12477932	Standard	NM_015447		Approved	FLJ31228, DKFZp434F195	uc004cgr.4	Q5T5Y3	OTTHUMG00000020918	ENST00000389532.4:c.1396delA	9.37:g.138715800delT	ENSP00000374183:p.Thr466fs	Somatic		WXS	Illumina HiSeq	Phase_I	A1L4L2|B2REB2|B2REB3|Q70W33|Q8NCY0|Q96E80|Q96FM3|Q9UFJ5	Frame_Shift_Del	DEL	ENST00000389532.4	37	CCDS35176.2																																																																																				0.463	CAMSAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055024.2	XM_351857	
SPECC1	92521	broad.mit.edu	37	17	20224506	20224507	+	IGR	INS	-	-	T			TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr17:20224506_20224507insT	ENST00000395530.2	+	0	8133				U6_ENST00000517027.1_RNA|AC004702.2_ENST00000580225.1_lincRNA|CCDC144CP_ENST00000340196.4_RNA	NM_001033555.2	NP_001028727.1	Q5M775	CYTSB_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1						cell adhesion (GO:0007155)	nucleus (GO:0005634)				breast(1)|large_intestine(3)|ovary(4)	8				KIRC - Kidney renal clear cell carcinoma(2;0.166)|Kidney(2;0.196)		GCAGTGGTCGCTTGGCTTGGCG	0.599																																						.											0																																										SO:0001628	intergenic_variant	348254			AY816329, AB041533	CCDS32590.1, CCDS42280.1, CCDS42281.1, CCDS45628.1, CCDS58531.1	17p11.2	2012-11-19	2010-09-17	2010-09-17	ENSG00000128487	ENSG00000128487			30615	protein-coding gene	gene with protein product	"""sperm antigen HCMOGT 1"", ""cytokinesis and spindle organization B"", ""cytospin B"""	608793				15602574, 18763323, 15087372	Standard	NM_001033553		Approved	HCMOGT-1, FLJ36955, NSP, CYTSB	uc002gwq.3	Q5M775	OTTHUMG00000179808		17.37:g.20224508_20224508dupT		Somatic		WXS	Illumina HiSeq	Phase_I	B4DHH0|B7WNS8|Q5IBP1|Q5IBP2|Q5IBP3|Q5IBP4|Q5M772|Q5M773|Q5M774|Q86XT8|Q8N4U4|Q8WU84|Q9HCQ3	RNA	INS	ENST00000395530.2	37	CCDS42281.1																																																																																				0.599	SPECC1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000132368.3	NM_152904	
SON	6651	broad.mit.edu	37	21	34927419	34927420	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr21:34927419_34927420insC	ENST00000356577.4	+	3	6357_6358	c.5882_5883insC	c.(5881-5886)agccgcfs	p.R1962fs	SON_ENST00000300278.4_Frame_Shift_Ins_p.R1962fs|SON_ENST00000290239.6_Frame_Shift_Ins_p.R1962fs|SON_ENST00000381692.2_Intron|SON_ENST00000381679.4_Frame_Shift_Ins_p.R1962fs	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	1962	2 X 19 AA repeats of P-S-R-R-R-R-S-R-S-V- V-R-R-R-S-F-S-I-S.|7 X 7 AA repeats of P-S-R-R-S-R-[TS].				cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						cgcacccccagccgccgcagcc	0.713																																						.											0																																										SO:0001589	frameshift_variant	6651			AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.5884dupC	21.37:g.34927421_34927421dupC	ENSP00000348984:p.Arg1962fs	Somatic		WXS	Illumina HiSeq	Phase_I	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Frame_Shift_Ins	INS	ENST00000356577.4	37	CCDS13629.1																																																																																				0.713	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140978.2	NM_138927	
KCNH2	3757	broad.mit.edu	37	7	150642468	150642469	+	Frame_Shift_Ins	INS	-	-	G			TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr7:150642468_150642469insG	ENST00000262186.5	-	15	3865_3866	c.3464_3465insC	c.(3463-3465)tcgfs	p.S1155fs	KCNH2_ENST00000330883.4_Frame_Shift_Ins_p.S815fs|KCNH2_ENST00000392968.2_Frame_Shift_Ins_p.S1059fs	NM_000238.3	NP_000229.1	Q12809	KCNH2_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 2	1155					cardiac muscle contraction (GO:0060048)|cellular response to drug (GO:0035690)|membrane depolarization during action potential (GO:0086010)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion export (GO:1902303)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|identical protein binding (GO:0042802)|inward rectifier potassium channel activity (GO:0005242)|phosphorelay sensor kinase activity (GO:0000155)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)			NS(1)|cervix(1)|endometrium(10)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	42	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)	TGCCCGGGTCCGAGCCGTGTCT	0.718																																					GBM(137;110 1844 13671 20123 45161)	.											0																																										SO:0001589	frameshift_variant	3757			U04270	CCDS5910.1, CCDS5911.1	7q36.1	2014-09-17			ENSG00000055118	ENSG00000055118		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6251	protein-coding gene	gene with protein product		152427		LQT2		18616963, 7842012, 8159766, 16382104	Standard	NM_000238		Approved	Kv11.1, HERG, erg1	uc003wic.3	Q12809	OTTHUMG00000158341	ENST00000262186.5:c.3465dupC	7.37:g.150642469_150642469dupG	ENSP00000262186:p.Ser1155fs	Somatic		WXS	Illumina HiSeq	Phase_I	A5H1P7|C4PFH9|D3DX04|O75418|O75680|Q708S9|Q9BT72|Q9BUT7|Q9H3P0	Frame_Shift_Ins	INS	ENST00000262186.5	37	CCDS5910.1																																																																																				0.718	KCNH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350741.2	NM_000238	
ADAMTS7	11173	ucsc.edu;mdanderson.org	37	15	79092750	79092750	+	Silent	SNP	G	G	C	rs7173267	byFrequency	TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr15:79092750G>C	ENST00000388820.4	-	2	450	c.240C>G	c.(238-240)gcC>gcG	p.A80A	ADAMTS7_ENST00000566303.1_5'UTR	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	80					cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						GCTCGTAGAAGGCGGGCGCGT	0.692													G|||	1245	0.248602	0.1044	0.2968	5008	,	,		12618	0.1518		0.4284	False		,,,				2504	0.3241					.											0								G		628,3716		55,518,1599	11.0	12.0	11.0		240	1.1	0.9	15	dbSNP_116	11	3580,4914		781,2018,1448	no	coding-synonymous	ADAMTS7	NM_014272.3		836,2536,3047	CC,CG,GG		42.1474,14.4567,32.7777		80/1687	79092750	4208,8630	2172	4247	6419	SO:0001819	synonymous_variant	11173			AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.240C>G	15.37:g.79092750G>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q14F51|Q6P7J9	Silent	SNP	ENST00000388820.4	37	CCDS32303.1																																																																																				0.692	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272	
ARMC2	84071	ucsc.edu;bcgsc.ca	37	6	109232139	109232139	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr6:109232139A>G	ENST00000392644.4	+	9	1229	c.1061A>G	c.(1060-1062)aAa>aGa	p.K354R	ARMC2_ENST00000368972.3_Missense_Mutation_p.K189R	NM_032131.4	NP_115507.4	Q8NEN0	ARMC2_HUMAN	armadillo repeat containing 2	354										endometrium(3)|large_intestine(8)|lung(10)|ovary(1)|prostate(1)|skin(1)	24		all_cancers(87;1.14e-07)|Acute lymphoblastic leukemia(125;2.3e-10)|all_hematologic(75;3.3e-08)|all_epithelial(87;0.000111)|Colorectal(196;0.03)|all_lung(197;0.11)		Epithelial(106;0.000197)|BRCA - Breast invasive adenocarcinoma(108;0.000236)|all cancers(137;0.000279)|OV - Ovarian serous cystadenocarcinoma(136;0.00434)		AATGTCTGCAAACTTATATTT	0.328																																						.											0													41.0	42.0	42.0					6																	109232139		2201	4294	6495	SO:0001583	missense	84071			BC030603	CCDS5069.2, CCDS69168.1	6q21	2013-02-14			ENSG00000118690	ENSG00000118690		"""Armadillo repeat containing"""	23045	protein-coding gene	gene with protein product							Standard	XM_005267154		Approved	DKFZp434P0714, bA787I22.1	uc003pss.4	Q8NEN0	OTTHUMG00000015335	ENST00000392644.4:c.1061A>G	6.37:g.109232139A>G	ENSP00000376417:p.Lys354Arg	Somatic		WXS	Illumina HiSeq	Phase_I	A8K8Y4|B4DGF5|G5E993|Q5VVY8|Q9H0K9	Missense_Mutation	SNP	ENST00000392644.4	37	CCDS5069.2	.	.	.	.	.	.	.	.	.	.	A	21.8	4.208748	0.79240	.	.	ENSG00000118690	ENST00000368972;ENST00000392644	T;T	0.46819	0.86;0.86	5.19	5.19	0.71726	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.59959	0.2232	M	0.83012	2.62	0.49915	D	0.999838	D	0.69078	0.997	P	0.59546	0.859	T	0.67313	-0.5702	10	0.56958	D	0.05	.	15.0498	0.71858	1.0:0.0:0.0:0.0	.	354	Q8NEN0	ARMC2_HUMAN	R	189;354	ENSP00000357968:K189R;ENSP00000376417:K354R	ENSP00000357968:K189R	K	+	2	0	ARMC2	109338832	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	6.658000	0.74407	1.939000	0.56221	0.482000	0.46254	AAA		0.328	ARMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041732.2	NM_032131	
C1QTNF9B	387911	ucsc.edu	37	13	24465600	24465600	+	Missense_Mutation	SNP	C	C	T	rs3864969	byFrequency	TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr13:24465600C>T	ENST00000382140.2	-	5	890	c.830G>A	c.(829-831)aGa>aAa	p.R277K	C1QTNF9B_ENST00000382137.3_Missense_Mutation_p.R277K|C1QTNF9B_ENST00000556521.1_5'UTR|MIPEP_ENST00000382172.3_5'Flank|C1QTNF9B-AS1_ENST00000435039.2_RNA|C1QTNF9B-AS1_ENST00000417034.1_RNA|C1QTNF9B-AS1_ENST00000382133.4_RNA|C1QTNF9B_ENST00000382145.1_3'UTR|MIPEP_ENST00000469167.1_5'Flank			B2RNN3	C1T9B_HUMAN	C1q and tumor necrosis factor related protein 9B	277	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.					collagen trimer (GO:0005581)|extracellular vesicular exosome (GO:0070062)				breast(1)|central_nervous_system(1)|large_intestine(3)|lung(1)	6						GTAAGCATCTCTGGTGTGCAG	0.512													T|||	68	0.0135783	0.0348	0.0115	5008	,	,		17990	0.0		0.0089	False		,,,				2504	0.0051					.											0													124.0	107.0	113.0					13																	24465600		2188	4275	6463	SO:0001583	missense	387911			BC110413	CCDS31947.1	13q12.12	2011-05-08			ENSG00000205863	ENSG00000205863			34072	protein-coding gene	gene with protein product		614148				17544811	Standard	NM_001007537		Approved	CTRP9B	uc010tcv.1	B2RNN3	OTTHUMG00000016570	ENST00000382140.2:c.830G>A	13.37:g.24465600C>T	ENSP00000371575:p.Arg277Lys	Somatic		WXS	Illumina HiSeq	Phase_I	A2A3T6|B9EH31|Q0VGC5|Q5VX65|Q5VX66|Q8IUU4	Missense_Mutation	SNP	ENST00000382140.2	37	CCDS31947.1	58	0.026556776556776556	31	0.06300813008130081	8	0.022099447513812154	1	0.0017482517482517483	18	0.023746701846965697	t	3.628	-0.076110	0.07184	.	.	ENSG00000205863	ENST00000382137;ENST00000382140	T;T	0.74632	-0.86;-0.86	3.96	3.96	0.45880	Tumour necrosis factor-like (2);Complement C1q protein (3);	0.107337	0.64402	N	0.000004	T	0.06872	0.0175	N	0.02721	-0.515	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.03453	-1.1035	10	0.25751	T	0.34	.	1.5902	0.02653	0.1778:0.0991:0.1595:0.5636	rs3864969;rs52833573;rs3864969	277	B2RNN3	C1T9B_HUMAN	K	277	ENSP00000371572:R277K;ENSP00000371575:R277K	ENSP00000371572:R277K	R	-	2	0	C1QTNF9B	23363600	0.993000	0.37304	0.983000	0.44433	0.120000	0.20174	1.648000	0.37271	0.533000	0.28675	-0.535000	0.04281	AGA		0.512	C1QTNF9B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044162.3	NM_001007537	
ELMOD3	84173	ucsc.edu	37	2	85604502	85604502	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr2:85604502T>C	ENST00000409890.2	+	11	1310	c.643T>C	c.(643-645)Ttc>Ctc	p.F215L	ELMOD3_ENST00000409013.3_Missense_Mutation_p.F215L|ELMOD3_ENST00000393852.4_Missense_Mutation_p.F215L|ELMOD3_ENST00000428955.2_Missense_Mutation_p.F215L|ELMOD3_ENST00000490508.1_3'UTR|ELMOD3_ENST00000315658.7_Missense_Mutation_p.F215L|ELMOD3_ENST00000409344.3_Missense_Mutation_p.F215L			Q96FG2	ELMD3_HUMAN	ELMO/CED-12 domain containing 3	215	ELMO. {ECO:0000255|PROSITE- ProRule:PRU00664}.				phagocytosis (GO:0006909)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)	12						AGGCGCAGGCTTCCTTGCCCT	0.582																																						.											0													102.0	80.0	88.0					2																	85604502		2203	4300	6503	SO:0001583	missense	84173			AF258573	CCDS1973.1, CCDS46352.1	2p11.2	2014-01-28	2008-08-14	2008-08-14	ENSG00000115459	ENSG00000115459		"""RNA binding motif (RRM) containing"""	26158	protein-coding gene	gene with protein product		615427	"""RNA binding motif protein 29"", ""RNA binding motif and ELMO/CED-12 domain 1"", ""deafness, autosomal recessive 88"""	RBM29, RBED1, DFNB88		24039609	Standard	NM_032213		Approved	FLJ21977	uc010ysn.2	Q96FG2	OTTHUMG00000130170	ENST00000409890.2:c.643T>C	2.37:g.85604502T>C	ENSP00000386304:p.Phe215Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B8ZZD6|D6W5K4|Q2M1K3|Q2XSU3|Q2XSU4|Q8NAC1|Q8TCK4|Q8WV70|Q8WY75|Q9H6Q8	Missense_Mutation	SNP	ENST00000409890.2	37	CCDS46352.1	.	.	.	.	.	.	.	.	.	.	T	19.81	3.895893	0.72639	.	.	ENSG00000115459	ENST00000409013;ENST00000409890;ENST00000409344;ENST00000393852;ENST00000428955;ENST00000315658	T;T;T;T;T;T	0.26223	1.75;1.75;1.75;1.75;1.75;1.75	5.76	5.76	0.90799	Engulfment/cell motility, ELMO (2);	0.051461	0.85682	D	0.000000	T	0.18130	0.0435	N	0.20483	0.58	0.47214	D	0.999357	P;B	0.40619	0.724;0.143	B;B	0.43155	0.41;0.134	T	0.07693	-1.0759	10	0.23302	T	0.38	-32.5968	8.55	0.33447	0.0:0.0852:0.0:0.9148	.	215;215	Q96FG2-6;Q96FG2	.;ELMD3_HUMAN	L	215	ENSP00000387139:F215L;ENSP00000386304:F215L;ENSP00000386248:F215L;ENSP00000377434:F215L;ENSP00000412692:F215L;ENSP00000318264:F215L	ENSP00000318264:F215L	F	+	1	0	ELMOD3	85458013	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.129000	0.57957	2.207000	0.71202	0.533000	0.62120	TTC		0.582	ELMOD3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329124.1	NM_032213	
ELOVL7	79993	ucsc.edu	37	5	60067915	60067915	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr5:60067915T>C	ENST00000508821.1	-	4	384	c.70A>G	c.(70-72)Aga>Gga	p.R24G	ELOVL7_ENST00000425382.1_Missense_Mutation_p.R24G|ELOVL7_ENST00000505959.1_Missense_Mutation_p.R11G|ELOVL7_ENST00000438340.1_Missense_Mutation_p.R24G	NM_024930.2	NP_079206.2	A1L3X0	ELOV7_HUMAN	ELOVL fatty acid elongase 7	24					cellular lipid metabolic process (GO:0044255)|fatty acid elongation, polyunsaturated fatty acid (GO:0034626)|fatty acid elongation, saturated fatty acid (GO:0019367)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transferase activity (GO:0016740)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)|urinary_tract(1)	9		Lung NSC(810;2.56e-06)|Prostate(74;0.0115)|Breast(144;0.0244)|Ovarian(174;0.0481)				TCTTCAACTCTTGGATCTAAG	0.443																																						.											0													41.0	38.0	39.0					5																	60067915		2203	4300	6503	SO:0001583	missense	79993			AK027216	CCDS34164.1	5q12	2011-05-25	2011-05-25			ENSG00000164181			26292	protein-coding gene	gene with protein product		614451	"""ELOVL family member 7, elongation of long chain fatty acids (yeast)"""			19826053	Standard	NM_024930		Approved	FLJ23563	uc010iwk.3	A1L3X0		ENST00000508821.1:c.70A>G	5.37:g.60067915T>C	ENSP00000424123:p.Arg24Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q589T3|Q9H5D0|Q9NT66	Missense_Mutation	SNP	ENST00000508821.1	37	CCDS34164.1	.	.	.	.	.	.	.	.	.	.	T	17.78	3.473027	0.63737	.	.	ENSG00000164181	ENST00000508821;ENST00000438340;ENST00000425382;ENST00000505959;ENST00000507047;ENST00000511799	T;T;T;T	0.26957	1.74;1.74;1.74;1.7	5.73	3.11	0.35812	.	0.000000	0.85682	D	0.000000	T	0.60274	0.2256	H	0.94345	3.525	0.54753	D	0.999982	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.72253	-0.4347	10	0.87932	D	0	-17.6806	12.9079	0.58162	0.0:0.0:0.3725:0.6275	.	11;24	D6RHD0;A1L3X0	.;ELOV7_HUMAN	G	24;24;24;11;24;24	ENSP00000424123:R24G;ENSP00000411255:R24G;ENSP00000402634:R24G;ENSP00000421043:R11G	ENSP00000402634:R24G	R	-	1	2	ELOVL7	60103672	0.988000	0.35896	0.994000	0.49952	0.997000	0.91878	1.989000	0.40707	1.062000	0.40625	0.454000	0.30748	AGA		0.443	ELOVL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368195.1		
GFAP	2670	ucsc.edu	37	17	42985455	42985455	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr17:42985455T>C	ENST00000253408.5	-	8	1299	c.1234A>G	c.(1234-1236)Acc>Gcc	p.T412A	GFAP_ENST00000588735.1_Missense_Mutation_p.T38A	NM_002055.4	NP_002046.1	P14136	GFAP_HUMAN	glial fibrillary acidic protein	412	Tail.				astrocyte development (GO:0014002)|Bergmann glial cell differentiation (GO:0060020)|extracellular matrix organization (GO:0030198)|intermediate filament organization (GO:0045109)|long-term synaptic potentiation (GO:0060291)|negative regulation of neuron projection development (GO:0010977)|neuron projection regeneration (GO:0031102)|positive regulation of Schwann cell proliferation (GO:0010625)|regulation of neurotransmitter uptake (GO:0051580)|response to wounding (GO:0009611)	astrocyte projection (GO:0097449)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament (GO:0005882)|membrane (GO:0016020)	structural constituent of cytoskeleton (GO:0005200)			endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(11)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	23		Prostate(33;0.0959)				ATCTCCACGGTCTTCACCACG	0.587																																						.											0													233.0	199.0	211.0					17																	42985455		2203	4300	6503	SO:0001583	missense	2670			S40719	CCDS11491.1, CCDS45708.1, CCDS59296.1	17q21	2013-01-16						"""Intermediate filaments type III"""	4235	protein-coding gene	gene with protein product	"""intermediate filament protein"""	137780				9693047	Standard	NM_002055		Approved	FLJ45472	uc002ihq.3	P14136		ENST00000253408.5:c.1234A>G	17.37:g.42985455T>C	ENSP00000253408:p.Thr412Ala	Somatic		WXS	Illumina HiSeq	Phase_I	B2RD44|D3DX59|E9PAX3|Q53H98|Q5D055|Q6ZQS3|Q7Z5J6|Q7Z5J7|Q96KS4|Q96P18|Q9UFD0	Missense_Mutation	SNP	ENST00000253408.5	37	CCDS11491.1	.	.	.	.	.	.	.	.	.	.	T	26.7	4.766810	0.90020	.	.	ENSG00000131095	ENST00000253408;ENST00000421021	D	0.99515	-6.06	5.13	5.13	0.70059	.	0.058374	0.64402	D	0.000002	D	0.99281	0.9749	M	0.80847	2.515	0.80722	D	1	P	0.34837	0.472	P	0.48089	0.566	D	0.99376	1.0921	10	0.87932	D	0	.	15.1002	0.72269	0.0:0.0:0.0:1.0	.	412	P14136	GFAP_HUMAN	A	412;387	ENSP00000253408:T412A	ENSP00000253408:T412A	T	-	1	0	GFAP	40340981	1.000000	0.71417	0.997000	0.53966	0.987000	0.75469	5.782000	0.68973	2.163000	0.67991	0.448000	0.29417	ACC		0.587	GFAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448701.1	NM_002055	
KDM3A	55818	ucsc.edu;mdanderson.org	37	2	86693720	86693720	+	Silent	SNP	T	T	G			TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr2:86693720T>G	ENST00000409556.1	+	11	1598	c.1233T>G	c.(1231-1233)acT>acG	p.T411T	KDM3A_ENST00000542128.1_Silent_p.T359T|KDM3A_ENST00000409064.1_Silent_p.T411T|KDM3A_ENST00000312912.5_Silent_p.T411T			Q9Y4C1	KDM3A_HUMAN	lysine (K)-specific demethylase 3A	411					androgen receptor signaling pathway (GO:0030521)|formaldehyde biosynthetic process (GO:0046293)|histone H3-K9 demethylation (GO:0033169)|histone H3-K9 dimethylation (GO:0036123)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of histone H3-K9 methylation (GO:0051573)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatid nucleus elongation (GO:0007290)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|dioxygenase activity (GO:0051213)|iron ion binding (GO:0005506)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|liver(1)|lung(13)|ovary(1)|prostate(3)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	47						AAGCATTGACTGGCCTTCCTA	0.453																																					NSCLC(96;1150 1523 6936 46253 49736)	.											0													161.0	148.0	152.0					2																	86693720		2203	4300	6503	SO:0001819	synonymous_variant	55818			AB018285	CCDS1990.1	2p11.2	2011-07-01	2009-04-06	2009-04-06	ENSG00000115548	ENSG00000115548		"""Chromatin-modifying enzymes / K-demethylases"""	20815	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 2A"""	611512	"""jumonji domain containing 1"", ""jumonji domain containing 1A"""	JMJD1, JMJD1A		9872452	Standard	NM_018433		Approved	TSGA, KIAA0742, JHMD2A	uc010ytj.2	Q9Y4C1	OTTHUMG00000130204	ENST00000409556.1:c.1233T>G	2.37:g.86693720T>G		Somatic		WXS	Illumina HiSeq	Phase_I	D6W5M3|Q53S72|Q68D47|Q68UT9|Q6N050|Q8IY08	Silent	SNP	ENST00000409556.1	37	CCDS1990.1																																																																																				0.453	KDM3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252522.2	NM_018433	
KIAA1217	56243	ucsc.edu	37	10	24790406	24790406	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr10:24790406A>G	ENST00000376454.3	+	9	1963	c.1933A>G	c.(1933-1935)Agc>Ggc	p.S645G	KIAA1217_ENST00000376462.1_Missense_Mutation_p.S565G|KIAA1217_ENST00000376452.3_Missense_Mutation_p.S610G|KIAA1217_ENST00000396445.1_Missense_Mutation_p.S328G|KIAA1217_ENST00000396446.1_Missense_Mutation_p.S328G|KIAA1217_ENST00000307544.6_Missense_Mutation_p.S328G|KIAA1217_ENST00000430453.2_Missense_Mutation_p.S531G|KIAA1217_ENST00000458595.1_Missense_Mutation_p.S610G|KIAA1217_ENST00000376451.2_Missense_Mutation_p.S328G	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	645					embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)				breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						CATCCACATGAGCCTGCTTGA	0.637																																						.											0													77.0	68.0	71.0					10																	24790406		2203	4300	6503	SO:0001583	missense	56243			BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.1933A>G	10.37:g.24790406A>G	ENSP00000365637:p.Ser645Gly	Somatic		WXS	Illumina HiSeq	Phase_I	A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Missense_Mutation	SNP	ENST00000376454.3	37	CCDS31165.1	.	.	.	.	.	.	.	.	.	.	A	19.85	3.902898	0.72754	.	.	ENSG00000120549	ENST00000376462;ENST00000376456;ENST00000458595;ENST00000442879;ENST00000376454;ENST00000376452;ENST00000438429;ENST00000430453;ENST00000307544;ENST00000450158;ENST00000396445;ENST00000376451;ENST00000396446	T;T;T;T;T;T;T;T;T;T;T	0.49720	0.77;0.77;0.77;0.77;0.77;0.77;0.77;0.77;0.77;0.77;0.77	5.71	5.71	0.89125	.	0.160790	0.64402	D	0.000002	T	0.64494	0.2603	L	0.60455	1.87	0.50467	D	0.999877	D;D;D;D;D;D;D;D	0.76494	0.999;0.973;0.999;0.984;0.999;0.999;0.992;0.975	D;P;D;P;D;D;D;P	0.85130	0.991;0.633;0.99;0.798;0.997;0.991;0.986;0.647	T	0.60637	-0.7224	10	0.27785	T	0.31	.	15.9709	0.80019	1.0:0.0:0.0:0.0	.	610;610;328;328;328;328;645;645	Q5T5P2-7;A6NLF3;Q5T5P2-4;Q5T5P2-8;Q5T5P2-3;Q5T5P2-6;Q5T5P2;Q5T5P2-2	.;.;.;.;.;.;SKT_HUMAN;.	G	565;610;610;328;645;610;460;531;328;328;328;328;328	ENSP00000365645:S565G;ENSP00000365639:S610G;ENSP00000392625:S610G;ENSP00000365637:S645G;ENSP00000365635:S610G;ENSP00000404798:S460G;ENSP00000389680:S531G;ENSP00000302343:S328G;ENSP00000379722:S328G;ENSP00000365634:S328G;ENSP00000379723:S328G	ENSP00000302343:S328G	S	+	1	0	KIAA1217	24830412	1.000000	0.71417	0.976000	0.42696	0.577000	0.36160	6.249000	0.72427	2.182000	0.69389	0.533000	0.62120	AGC		0.637	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047223.2	NM_019590	
P2RY2	5029	ucsc.edu;mdanderson.org	37	11	72945651	72945651	+	Silent	SNP	C	C	T	rs147817701	byFrequency	TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr11:72945651C>T	ENST00000311131.2	+	3	914	c.447C>T	c.(445-447)taC>taT	p.Y149Y	P2RY2_ENST00000393596.2_Silent_p.Y149Y|P2RY2_ENST00000393597.2_Silent_p.Y149Y	NM_002564.2|NM_176072.1	NP_002555|NP_788086	P41231	P2RY2_HUMAN	purinergic receptor P2Y, G-protein coupled, 2	149					cellular ion homeostasis (GO:0006873)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of mucus secretion (GO:0070257)|regulation of vasodilation (GO:0042312)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|receptor activity (GO:0004872)			endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(2)|urinary_tract(2)	25					Suramin(DB04786)	GGGCCCGCTACGCTCGCCGGG	0.697													C|||	29	0.00579073	0.0008	0.0	5008	,	,		14981	0.0		0.002	False		,,,				2504	0.0266					.											0								C	,,	3,4397	6.2+/-15.9	0,3,2197	37.0	38.0	38.0		447,447,447	-9.3	0.8	11	dbSNP_134	38	12,8572	9.1+/-34.3	0,12,4280	no	coding-synonymous,coding-synonymous,coding-synonymous	P2RY2	NM_002564.2,NM_176071.1,NM_176072.1	,,	0,15,6477	TT,TC,CC		0.1398,0.0682,0.1155	,,	149/378,149/378,149/378	72945651	15,12969	2200	4292	6492	SO:0001819	synonymous_variant	5029			U07225	CCDS8219.1	11q13.5-q14.1	2012-08-08				ENSG00000175591		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8541	protein-coding gene	gene with protein product		600041				8159738, 9286708	Standard	NM_002564		Approved	P2U	uc001otj.4	P41231		ENST00000311131.2:c.447C>T	11.37:g.72945651C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B2R9W3|Q96EM8	Silent	SNP	ENST00000311131.2	37	CCDS8219.1																																																																																				0.697	P2RY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397336.1	NM_176072	
EIF4EBP3	8637	ucsc.edu	37	5	139931629	139931629	+	IGR	SNP	C	C	G	rs5871740|rs368142622|rs202193903	byFrequency	TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr5:139931629C>G	ENST00000310331.2	+	0	691				SRA1_ENST00000336283.6_Missense_Mutation_p.V110L|SRA1_ENST00000520427.1_5'UTR	NM_003732.2	NP_003723.1	O60516	4EBP3_HUMAN	eukaryotic translation initiation factor 4E binding protein 3						negative regulation of translational initiation (GO:0045947)	eukaryotic translation initiation factor 4F complex (GO:0016281)|membrane (GO:0016020)	translation repressor activity (GO:0030371)			endometrium(1)|ovary(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCTCCATCACAGCCTCAGAC	0.592																																						.											0													82.0	59.0	67.0					5																	139931629		2202	4295	6497	SO:0001628	intergenic_variant	10011			AF038869	CCDS4226.1	5q31.3	2007-07-18			ENSG00000243056	ENSG00000243056			3290	protein-coding gene	gene with protein product		603483				9593750	Standard	NM_003732		Approved	4E-BP3	uc003lfy.1	O60516	OTTHUMG00000129498		5.37:g.139931629C>G		Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000310331.2	37	CCDS4226.1	.	.	.	.	.	.	.	.	.	.	C	4.980	0.181983	0.09495	.	.	ENSG00000213523	ENST00000336283;ENST00000520427	T	0.40476	1.03	5.75	1.75	0.24633	.	0.938709	0.08826	N	0.888002	T	0.11196	0.0273	N	0.00560	-1.38	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.32052	-0.9921	9	.	.	.	.	3.3903	0.07286	0.0902:0.3003:0.4378:0.1718	.	110	Q9HD15	SRA1_HUMAN	L	110;36	ENSP00000337513:V110L	.	V	-	1	0	SRA1	139911813	0.037000	0.19845	0.998000	0.56505	0.973000	0.67179	-0.239000	0.08965	0.800000	0.34041	-0.211000	0.12701	GTG		0.592	EIF4EBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251668.2	NM_003732	
AQP7	364	mdanderson.org;bcgsc.ca	37	9	33385808	33385808	+	Missense_Mutation	SNP	G	G	T	rs62542744		TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr9:33385808G>T	ENST00000537089.1	-	6	624	c.306C>A	c.(304-306)aaC>aaA	p.N102K	AQP7_ENST00000541274.1_Missense_Mutation_p.Q63K|AQP7_ENST00000539936.1_Missense_Mutation_p.N194K|AQP7_ENST00000377425.4_Missense_Mutation_p.N137K			O14520	AQP7_HUMAN	aquaporin 7	194					excretion (GO:0007588)|generation of precursor metabolites and energy (GO:0006091)|glycerol transport (GO:0015793)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glycerol channel activity (GO:0015254)|water channel activity (GO:0015250)			NS(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(4)|skin(2)|stomach(1)	17			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		GTGCTGGGTTGTTCTCCTGGT	0.607																																						.											0													122.0	107.0	112.0					9																	33385808		2203	4300	6503	SO:0001583	missense	364			AB006190	CCDS6541.1	9p13	2008-02-05			ENSG00000165269	ENSG00000165269		"""Ion channels / Aquaporins"""	640	protein-coding gene	gene with protein product		602974		AQP7L		9252401	Standard	NM_001170		Approved	AQP9, AQPap	uc003zst.3	O14520	OTTHUMG00000019773	ENST00000537089.1:c.306C>A	9.37:g.33385808G>T	ENSP00000441619:p.Asn102Lys	Somatic		WXS	Illumina HiSeq	Phase_I	Q08E94|Q5T5L9|Q8NHM3	Missense_Mutation	SNP	ENST00000537089.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	15.08|15.08	2.727222|2.727222	0.48833|0.48833	.|.	.|.	ENSG00000165269|ENSG00000165269	ENST00000537089;ENST00000379507;ENST00000447660;ENST00000297988;ENST00000377425;ENST00000439678;ENST00000379506;ENST00000539936;ENST00000379503|ENST00000541274	D;D;D;D;D;D;D;D;D|T	0.83755|0.43688	-1.76;-1.76;-1.76;-1.76;-1.76;-1.76;-1.76;-1.76;-1.76|0.94	5.02|5.02	4.12|4.12	0.48240|0.48240	Aquaporin-like (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.54711|0.54711	0.1875|0.1875	L|L	0.56396|0.56396	1.775|1.775	0.80722|0.80722	D|D	1|1	D;D;D;D|D	0.89917|0.76494	1.0;0.999;1.0;1.0|0.999	D;D;D;D|D	0.87578|0.72338	0.995;0.995;0.993;0.998|0.977	T|T	0.53143|0.53143	-0.8480|-0.8480	10|8	0.87932|.	D|.	0|.	-24.7401|-24.7401	7.8517|7.8517	0.29459|0.29459	0.1855:0.0:0.8145:0.0|0.1855:0.0:0.8145:0.0	rs62542744|rs62542744	193;194;137;194|63	Q5T5M0;B7Z4U2;Q6P5T0;O14520|B7Z7F6	.;.;.;AQP7_HUMAN|.	K|K	102;193;62;194;137;102;193;194;130|63	ENSP00000441619:N102K;ENSP00000368821:N193K;ENSP00000412868:N62K;ENSP00000297988:N194K;ENSP00000396111:N137K;ENSP00000410138:N102K;ENSP00000368820:N193K;ENSP00000439534:N194K;ENSP00000368817:N130K|ENSP00000438860:Q63K	ENSP00000297988:N194K|.	N|Q	-|-	3|1	2|0	AQP7|AQP7	33375808|33375808	1.000000|1.000000	0.71417|0.71417	0.740000|0.740000	0.30986|0.30986	0.116000|0.116000	0.19942|0.19942	2.130000|2.130000	0.42064|0.42064	1.319000|1.319000	0.45190|0.45190	0.645000|0.645000	0.84053|0.84053	AAC|CAA		0.607	AQP7-202	KNOWN	basic	protein_coding	protein_coding		NM_001170	
BAGE2	85319	mdanderson.org	37	21	11058197	11058197	+	RNA	SNP	G	G	A			TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr21:11058197G>A	ENST00000470054.1	-	0	450							Q86Y30	BAGE2_HUMAN	B melanoma antigen family, member 2							extracellular region (GO:0005576)								Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TCTGGACAAAGCAGGAAGATG	0.393																																						.											0													87.0	71.0	76.0					21																	11058197		692	1591	2283			85319			AF218570		21p	2009-03-13			ENSG00000187172	ENSG00000187172			15723	protein-coding gene	gene with protein product	"""cancer/testis antigen family 2, member 2"""					12461691	Standard	NM_182482		Approved	CT2.2		Q86Y30	OTTHUMG00000074128		21.37:g.11058197G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A8K925|Q08ER0	Silent	SNP	ENST00000470054.1	37																																																																																					0.393	BAGE2-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000157417.3	NM_182482	
C20orf166	128826	mdanderson.org	37	20	61162267	61162267	+	Missense_Mutation	SNP	T	T	C	rs6062251	byFrequency	TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr20:61162267T>C	ENST00000370527.3	+	3	859	c.80T>C	c.(79-81)gTg>gCg	p.V27A	C20orf166_ENST00000370524.2_Intron|MIR133A2_ENST00000347538.2_RNA|C20orf166_ENST00000370523.1_Intron	NM_178463.3	NP_848558.1			chromosome 20 open reading frame 166											endometrium(1)|kidney(1)|lung(2)	4	Breast(26;1.04e-08)		BRCA - Breast invasive adenocarcinoma(19;7.17e-06)			ACCCAGCAGGTGGCGCGGGGA	0.677													C|||	2888	0.576677	0.7042	0.5605	5008	,	,		12968	0.3284		0.6243	False		,,,				2504	0.6227					.											0								C	ALA/VAL	2917,1443		1016,885,279	11.0	12.0	12.0		80	-7.9	0.0	20	dbSNP_114	12	5233,3313		1652,1929,692	yes	missense	C20orf166	NM_178463.3	64	2668,2814,971	CC,CT,TT		38.7667,33.0963,36.8511	benign	27/118	61162267	8150,4756	2180	4273	6453	SO:0001583	missense	128826			AL449263	CCDS46627.1	20q13.33	2014-01-21			ENSG00000174407	ENSG00000174407			16159	protein-coding gene	gene with protein product	"""MIR133A2 host gene"""						Standard	NM_178463		Approved	dJ353C17.1, MIR1-1HG, MIR133A2HG	uc011aaj.2	Q9H1L0	OTTHUMG00000048000	ENST00000370527.3:c.80T>C	20.37:g.61162267T>C	ENSP00000359558:p.Val27Ala	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000370527.3	37	CCDS46627.1	1208	0.5531135531135531	341	0.693089430894309	211	0.5828729281767956	191	0.3339160839160839	465	0.6134564643799473	C	9.871	1.198845	0.22121	0.669037	0.612333	ENSG00000174407	ENST00000370527	T	0.36520	1.25	3.93	-7.86	0.01187	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.39522	-0.9610	8	0.09084	T	0.74	.	3.8336	0.08885	0.2485:0.1229:0.4735:0.1551	rs6062251;rs7268727	27	Q9H1L0	CT166_HUMAN	A	27	ENSP00000359558:V27A	ENSP00000359558:V27A	V	+	2	0	C20orf166	60572712	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-2.298000	0.01140	-1.689000	0.01434	-0.320000	0.08662	GTG		0.677	C20orf166-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109262.1	NM_178463	
CACNA1H	8912	mdanderson.org	37	16	1252259	1252259	+	Silent	SNP	A	A	G	rs9934839	byFrequency	TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr16:1252259A>G	ENST00000348261.5	+	9	2057	c.1809A>G	c.(1807-1809)agA>agG	p.R603R	CACNA1H_ENST00000358590.4_Silent_p.R603R|CACNA1H_ENST00000565831.1_Silent_p.R603R	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	603					aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	CCAGCCTCAGACTGGCCACAG	0.677													G|||	1986	0.396565	0.5877	0.379	5008	,	,		14978	0.119		0.4901	False		,,,				2504	0.3405					.											0			GRCh37	CM071579	CACNA1H	M	rs9934839	G	,	2248,1408		734,780,314	5.0	6.0	6.0		1809,1809	2.3	0.9	16	dbSNP_119	6	4058,3834		1155,1748,1043	no	coding-synonymous,coding-synonymous	CACNA1H	NM_001005407.1,NM_021098.2	,	1889,2528,1357	GG,GA,AA		48.5808,38.512,45.3931	,	603/2348,603/2354	1252259	6306,5242	1828	3946	5774	SO:0001819	synonymous_variant	8912			AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.1809A>G	16.37:g.1252259A>G		Somatic		WXS	Illumina HiSeq	Phase_I	B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Silent	SNP	ENST00000348261.5	37	CCDS45375.1																																																																																				0.677	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000421601.1	NM_001005407	
CRIPAK	285464	mdanderson.org	37	4	1389161	1389161	+	Missense_Mutation	SNP	A	A	G	rs71614973	byFrequency	TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr4:1389161A>G	ENST00000324803.4	+	1	3822	c.862A>G	c.(862-864)Agt>Ggt	p.S288G		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	288					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			GCCGATGTGGAGTGCCCGCCT	0.687													A|||	1051	0.209864	0.1362	0.2983	5008	,	,		13955	0.0536		0.3748	False		,,,				2504	0.2382					.											0													127.0	128.0	128.0					4																	1389161		2202	4298	6500	SO:0001583	missense	285464			AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.862A>G	4.37:g.1389161A>G	ENSP00000323978:p.Ser288Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q8NB03	Missense_Mutation	SNP	ENST00000324803.4	37	CCDS3349.1	.	.	.	.	.	.	.	.	.	.	A	1.586	-0.530434	0.04112	.	.	ENSG00000179979	ENST00000324803;ENST00000382944	T	0.21734	1.99	0.815	-1.63	0.08345	.	.	.	.	.	T	0.06917	0.0176	N	0.08118	0	0.80722	P	0.0	B	0.10296	0.003	B	0.04013	0.001	T	0.39761	-0.9598	8	0.07175	T	0.84	.	2.8991	0.05700	0.2283:0.0:0.4427:0.329	.	288	Q8N1N5	CRPAK_HUMAN	G	288;230	ENSP00000323978:S288G	ENSP00000323978:S288G	S	+	1	0	CRIPAK	1379161	0.046000	0.20272	0.000000	0.03702	0.001000	0.01503	-1.350000	0.02624	-1.564000	0.01678	-0.530000	0.04314	AGT		0.687	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
CSPG4	1464	mdanderson.org	37	15	75981976	75981976	+	Missense_Mutation	SNP	C	C	T	rs200493777		TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr15:75981976C>T	ENST00000308508.5	-	3	1522	c.1430G>A	c.(1429-1431)cGc>cAc	p.R477H		NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	477	Globular or compact configuration stabilized by disulfide bonds.|Neurite growth inhibition. {ECO:0000250}.			RH -> HY (in Ref. 1; CAA65529). {ECO:0000305}.	activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)	p.R477H(1)		breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						CTCGCCATGGCGTGCCCCTCG	0.637																																						.											1	Substitution - Missense(1)	kidney(1)											67.0	61.0	63.0					15																	75981976		2197	4291	6488	SO:0001583	missense	1464			X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.1430G>A	15.37:g.75981976C>T	ENSP00000312506:p.Arg477His	Somatic		WXS	Illumina HiSeq	Phase_I	D3DW77|Q92675	Missense_Mutation	SNP	ENST00000308508.5	37	CCDS10284.1	.	.	.	.	.	.	.	.	.	.	.	9.517	1.107225	0.20714	.	.	ENSG00000173546	ENST00000308508	T	0.19532	2.14	5.12	4.19	0.49359	.	0.096704	0.44483	D	0.000447	T	0.17746	0.0426	L	0.57536	1.79	0.27465	N	0.953023	P	0.35628	0.513	B	0.27380	0.079	T	0.14783	-1.0460	10	0.41790	T	0.15	.	9.3594	0.38186	0.0:0.8315:0.0:0.1685	.	477	Q6UVK1	CSPG4_HUMAN	H	477	ENSP00000312506:R477H	ENSP00000312506:R477H	R	-	2	0	CSPG4	73769031	0.038000	0.19896	0.145000	0.22337	0.035000	0.12851	1.407000	0.34657	2.375000	0.81037	0.555000	0.69702	CGC		0.637	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286472.1	NM_001897	
CYP4V2	285440	mdanderson.org	37	4	187113041	187113041	+	Missense_Mutation	SNP	C	C	G	rs1055138	byFrequency	TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr4:187113041C>G	ENST00000378802.4	+	1	368	c.64C>G	c.(64-66)Ctt>Gtt	p.L22V	AC110771.1_ENST00000596414.1_5'Flank	NM_207352.3	NP_997235.3	Q6ZWL3	CP4V2_HUMAN	cytochrome P450, family 4, subfamily V, polypeptide 2	22			L -> V (in dbSNP:rs1055138). {ECO:0000269|Ref.3}.		fatty acid omega-oxidation (GO:0010430)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|skin(1)|stomach(2)	20		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.33e-10)|BRCA - Breast invasive adenocarcinoma(30;3.84e-05)|GBM - Glioblastoma multiforme(59;0.000132)|STAD - Stomach adenocarcinoma(60;0.000293)|LUSC - Lung squamous cell carcinoma(40;0.00242)|READ - Rectum adenocarcinoma(43;0.17)		GGCGAGTGCCCTTTCCCTGGC	0.731													G|||	2052	0.409744	0.4327	0.438	5008	,	,		10614	0.2748		0.5239	False		,,,				2504	0.3804					.											0								G	VAL/LEU	1786,2542		418,950,796	14.0	15.0	15.0		64	0.7	0.0	4	dbSNP_86	15	4174,4354		1064,2046,1154	yes	missense	CYP4V2	NM_207352.3	32	1482,2996,1950	GG,GC,CC		48.9447,41.2662,46.3597	possibly-damaging	22/526	187113041	5960,6896	2164	4264	6428	SO:0001583	missense	285440			AK022114	CCDS34119.1	4q35.2	2004-07-05			ENSG00000145476	ENSG00000145476		"""Cytochrome P450s"""	23198	protein-coding gene	gene with protein product		608614				15042513	Standard	NM_207352		Approved	CYP4AH1	uc003iyw.4	Q6ZWL3	OTTHUMG00000160379	ENST00000378802.4:c.64C>G	4.37:g.187113041C>G	ENSP00000368079:p.Leu22Val	Somatic		WXS	Illumina HiSeq	Phase_I	B7U6W2|Q6ZTM4	Missense_Mutation	SNP	ENST00000378802.4	37	CCDS34119.1	958	0.43864468864468864	211	0.42886178861788615	171	0.4723756906077348	169	0.29545454545454547	407	0.5369393139841688	G	0.008	-1.922890	0.00498	0.412662	0.489447	ENSG00000145476	ENST00000378802;ENST00000274118	T	0.65916	-0.18	3.89	0.679	0.17975	.	1.335020	0.05117	N	0.489936	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.42137	-0.9469	9	0.14656	T	0.56	.	7.1201	0.25440	0.1277:0.4839:0.3883:0.0	rs1055138;rs3087670;rs3175018;rs60467258	22;22	Q6UWV9;Q6ZWL3	.;CP4V2_HUMAN	V	22	ENSP00000368079:L22V	ENSP00000274118:L22V	L	+	1	0	CYP4V2	187350035	0.000000	0.05858	0.002000	0.10522	0.024000	0.10985	-1.333000	0.02667	-0.003000	0.14444	-0.444000	0.05651	CTT		0.731	CYP4V2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360398.1	XM_209612	
FAM131C	348487	mdanderson.org	37	1	16388642	16388642	+	Missense_Mutation	SNP	G	G	A	rs79991837	byFrequency	TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr1:16388642G>A	ENST00000375662.4	-	4	403	c.220C>T	c.(220-222)Cgc>Tgc	p.R74C	FAM131C_ENST00000494078.1_5'UTR	NM_182623.2	NP_872429.2	Q96AQ9	F131C_HUMAN	family with sequence similarity 131, member C	74										large_intestine(2)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	8		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.32e-08)|COAD - Colon adenocarcinoma(227;5.56e-06)|BRCA - Breast invasive adenocarcinoma(304;9.12e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00656)|READ - Rectum adenocarcinoma(331;0.0649)		TTGCCGGGGCGGGATCTGGAG	0.657													G|||	33	0.00658946	0.0189	0.0072	5008	,	,		15581	0.0		0.0	False		,,,				2504	0.0031					.											0													77.0	78.0	78.0					1																	16388642		2054	4180	6234	SO:0001583	missense	348487				CCDS41270.1	1p36.13	2008-02-05	2007-03-20	2007-03-20	ENSG00000185519	ENSG00000185519			26717	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 117"""	C1orf117		12477932	Standard	NM_182623		Approved	FLJ36766	uc001axz.4	Q96AQ9	OTTHUMG00000009525	ENST00000375662.4:c.220C>T	1.37:g.16388642G>A	ENSP00000364814:p.Arg74Cys	Somatic		WXS	Illumina HiSeq	Phase_I	Q5T5Q5|Q8N3X3|Q8N9P9	Missense_Mutation	SNP	ENST00000375662.4	37	CCDS41270.1	.	.	.	.	.	.	.	.	.	.	G	1.551	-0.539233	0.04053	.	.	ENSG00000185519	ENST00000375662	T	0.22336	1.96	4.64	2.3	0.28687	.	0.351936	0.26571	N	0.023632	T	0.04137	0.0115	N	0.00146	-1.995	0.28188	N	0.927865	B	0.02656	0.0	B	0.01281	0.0	T	0.31641	-0.9936	10	0.48119	T	0.1	-23.3619	6.0703	0.19885	0.7858:0.0:0.2142:0.0	.	74	Q96AQ9	F131C_HUMAN	C	74	ENSP00000364814:R74C	ENSP00000364814:R74C	R	-	1	0	FAM131C	16261229	0.996000	0.38824	0.987000	0.45799	0.549000	0.35272	1.524000	0.35942	0.186000	0.20125	-0.487000	0.04747	CGC		0.657	FAM131C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026319.1	NM_182623	
CYP4Z1	199974	mdanderson.org	37	1	47548113	47548113	+	Missense_Mutation	SNP	G	G	A	rs200076743		TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr1:47548113G>A	ENST00000334194.3	+	4	475	c.472G>A	c.(472-474)Gag>Aag	p.E158K		NM_178134.2	NP_835235.1	Q86W10	CP4Z1_HUMAN	cytochrome P450, family 4, subfamily Z, polypeptide 1	158						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			cervix(1)|large_intestine(4)|lung(4)|skin(1)|stomach(1)	11						CATGATGTCTGAGAGTGTTCG	0.478																																						.											0													91.0	82.0	85.0					1																	47548113		2203	4300	6503	SO:0001583	missense	199974			AY262056	CCDS545.1	1p33	2008-02-05			ENSG00000186160	ENSG00000186160		"""Cytochrome P450s"""	20583	protein-coding gene	gene with protein product						15059886	Standard	NM_178134		Approved	CYP4A20	uc001cqu.1	Q86W10	OTTHUMG00000008019	ENST00000334194.3:c.472G>A	1.37:g.47548113G>A	ENSP00000334246:p.Glu158Lys	Somatic		WXS	Illumina HiSeq	Phase_I	Q5VVE4	Missense_Mutation	SNP	ENST00000334194.3	37	CCDS545.1	.	.	.	.	.	.	.	.	.	.	-	9.782	1.175656	0.21704	.	.	ENSG00000186160	ENST00000334194	T	0.70631	-0.5	2.4	-4.81	0.03180	.	0.343662	0.18958	U	0.126486	T	0.47563	0.1452	N	0.17764	0.52	0.09310	N	1	B	0.28470	0.213	B	0.28784	0.094	T	0.32981	-0.9886	10	0.25751	T	0.34	.	10.5223	0.44927	0.0:0.2112:0.6769:0.1119	.	158	Q86W10	CP4Z1_HUMAN	K	158	ENSP00000334246:E158K	ENSP00000334246:E158K	E	+	1	0	CYP4Z1	47320700	0.001000	0.12720	0.000000	0.03702	0.089000	0.18198	0.708000	0.25719	-1.026000	0.03330	-0.673000	0.03796	GAG		0.478	CYP4Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022020.1	NM_178134	
FLG	2312	mdanderson.org	37	1	152278689	152278689	+	Silent	SNP	C	C	A	rs57672167	byFrequency	TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr1:152278689C>A	ENST00000368799.1	-	3	8708	c.8673G>T	c.(8671-8673)gtG>gtT	p.V2891V	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2891	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGTCCTGGCTCACACTGGATC	0.552									Ichthyosis				A|||	1985	0.396366	0.3147	0.4337	5008	,	,		31121	0.6101		0.171	False		,,,				2504	0.4918					.											0								A		847,3219		243,361,1429	85.0	137.0	120.0		8673	-5.2	0.0	1	dbSNP_129	120	1434,7156		126,1182,2987	no	coding-synonymous	FLG	NM_002016.1		369,1543,4416	AA,AC,CC		16.6938,20.8313,18.0231		2891/4062	152278689	2281,10375	2033	4295	6328	SO:0001819	synonymous_variant	2312	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.8673G>T	1.37:g.152278689C>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q01720|Q5T583|Q9UC71	Silent	SNP	ENST00000368799.1	37	CCDS30860.1																																																																																				0.552	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
FLG	2312	mdanderson.org	37	1	152278814	152278814	+	Missense_Mutation	SNP	C	C	T	rs2184952	byFrequency	TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr1:152278814C>T	ENST00000368799.1	-	3	8583	c.8548G>A	c.(8548-8550)Ggc>Agc	p.G2850S	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2850	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGCCTGGAGCCGTCTCCTGAT	0.572									Ichthyosis																													.											0								C	SER/GLY	329,3957	110.8+/-149.0	6,317,1820	409.0	615.0	546.0		8548	-3.9	0.0	1	dbSNP_96	546	448,8152	117.0+/-176.6	0,448,3852	no	missense	FLG	NM_002016.1	56	6,765,5672	TT,TC,CC		5.2093,7.6762,6.0298	benign	2850/4062	152278814	777,12109	2143	4300	6443	SO:0001583	missense	2312	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.8548G>A	1.37:g.152278814C>T	ENSP00000357789:p.Gly2850Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	C	12.10	1.837373	0.32513	0.076762	0.052093	ENSG00000143631	ENST00000368799;ENST00000368796	T	0.00824	5.65	3.42	-3.91	0.04168	.	.	.	.	.	T	0.00384	0.0012	M	0.63843	1.955	0.09310	N	1	B	0.28760	0.221	B	0.30855	0.121	T	0.33189	-0.9878	9	0.14656	T	0.56	-0.2526	8.0549	0.30600	0.0:0.2837:0.0:0.7163	.	2850	P20930	FILA_HUMAN	S	2850;112	ENSP00000357789:G2850S	ENSP00000357786:G112S	G	-	1	0	FLG	150545438	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.534000	0.00941	-0.915000	0.03823	0.306000	0.20318	GGC		0.572	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
FRG1B	284802	mdanderson.org	37	20	29624054	29624054	+	Silent	SNP	T	T	A			TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr20:29624054T>A	ENST00000278882.3	+	4	458	c.78T>A	c.(76-78)ccT>ccA	p.P26P	FRG1B_ENST00000439954.2_Silent_p.P31P|FRG1B_ENST00000358464.4_Silent_p.P26P			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	26										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						GCCCTAGTCCTCCAGAGCAGT	0.279																																						.											0																																										SO:0001819	synonymous_variant	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.78T>A	20.37:g.29624054T>A		Somatic		WXS	Illumina HiSeq	Phase_I	C4AME5	RNA	SNP	ENST00000278882.3	37																																																																																					0.279	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
GOLGA8F	100132565	mdanderson.org	37	15	28632800	28632800	+	Missense_Mutation	SNP	T	T	G	rs564926438	byFrequency	TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr15:28632800T>G	ENST00000450328.2	+	14	1612	c.714T>G	c.(712-714)atT>atG	p.I238M	GOLGA8F_ENST00000526619.2_Missense_Mutation_p.I242M|GOLGA8F_ENST00000337838.7_Intron|RN7SL238P_ENST00000465782.2_RNA|GOLGA8F_ENST00000532622.2_Missense_Mutation_p.I456M|AC091304.1_ENST00000408123.1_RNA			Q08AF8	GOG8F_HUMAN	golgin A8 family, member F	238						Golgi apparatus (GO:0005794)				lung(4)	4						CTCGGCCCATTCCTAGCATCC	0.622													t|||	8	0.00159744	0.003	0.0	5008	,	,		24067	0.0		0.001	False		,,,				2504	0.0031					.											0													24.0	66.0	54.0					15																	28632800		619	1580	2199	SO:0001583	missense	100132565					15q13.1	2013-01-17	2010-02-12		ENSG00000153684	ENSG00000153684			32378	other	unknown			"""golgi autoantigen, golgin subfamily a, 8F"""			12477932	Standard	NR_033351		Approved	DKFZp434P162	uc010uag.1	Q08AF8	OTTHUMG00000167129	ENST00000450328.2:c.714T>G	15.37:g.28632800T>G	ENSP00000455253:p.Ile238Met	Somatic		WXS	Illumina HiSeq	Phase_I	A4FTY1|Q1A5X9|Q8NDK0	RNA	SNP	ENST00000450328.2	37																																																																																					0.622	GOLGA8F-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NR_033351.1	
HELZ2	85441	mdanderson.org	37	20	62195087	62195087	+	Silent	SNP	A	A	G	rs310630	byFrequency	TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr20:62195087A>G	ENST00000467148.1	-	8	5157	c.5088T>C	c.(5086-5088)tcT>tcC	p.S1696S	HELZ2_ENST00000427522.2_Silent_p.S1127S	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	1696					cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										CAGAGTAGGCAGAGCCCCCAT	0.677													G|||	2264	0.452077	0.7141	0.4409	5008	,	,		15038	0.1567		0.4732	False		,,,				2504	0.3885					.											0								G	,	2906,1454		977,952,251	13.0	14.0	14.0		5088,3381	-2.3	0.0	20	dbSNP_79	14	3958,4606		948,2062,1272	no	coding-synonymous,coding-synonymous	PRIC285	NM_001037335.2,NM_033405.3	,	1925,3014,1523	GG,GA,AA		46.2167,33.3486,46.8895	,	1696/2650,1127/2081	62195087	6864,6060	2180	4282	6462	SO:0001819	synonymous_variant	85441			AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.5088T>C	20.37:g.62195087A>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Silent	SNP	ENST00000467148.1	37	CCDS33508.1																																																																																				0.677	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354127.1	NM_001037335	
HLA-DQA2	3118	mdanderson.org	37	6	32709265	32709266	+	Missense_Mutation	DNP	TG	TG	CA	rs201984640|rs200986700	byFrequency	TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	TG	TG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr6:32709265_32709266TG>CA	ENST00000374940.3	+	1	147_148	c.45_46TG>CA	c.(43-48)acTGcc>acCAcc	p.A16T		NM_020056.4	NP_064440.1	P01906	DQA2_HUMAN	major histocompatibility complex, class II, DQ alpha 2	16					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)			endometrium(2)|large_intestine(3)|lung(7)|skin(1)	13					"""""""Insulin(DB00071)"""	TCGCCCTGACTGCCGTGATGAG	0.505																																						.											0																																										SO:0001583	missense	3118				CCDS4753.1	6p21.3	2013-01-11			ENSG00000237541	ENSG00000237541		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4943	protein-coding gene	gene with protein product		613503		HLA-DXA			Standard	NM_020056		Approved		uc003obx.3	P01906	OTTHUMG00000031108	Exception_encountered	6.37:g.32709265_32709266delinsCA	ENSP00000364076:p.Ala16Thr	Somatic		WXS	Illumina HiSeq	Phase_I	A2BF37|B0V0E7|O19789|Q5SQ94|Q5SR04	Missense_Mutation	DNP	ENST00000374940.3	37	CCDS4753.1																																																																																				0.505	HLA-DQA2-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076179.2	NM_020056	
IL12RB1	3594	mdanderson.org;bcgsc.ca	37	19	18188408	18188408	+	Missense_Mutation	SNP	C	C	T	rs11575926	byFrequency	TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr19:18188408C>T	ENST00000600835.2	-	6	765	c.467G>A	c.(466-468)cGt>cAt	p.R156H	IL12RB1_ENST00000322153.7_Missense_Mutation_p.R156H|IL12RB1_ENST00000593993.2_Missense_Mutation_p.R156H			P42701	I12R1_HUMAN	interleukin 12 receptor, beta 1	156	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.		R -> H (in dbSNP:rs11575926). {ECO:0000269|Ref.3}.		cellular response to interferon-gamma (GO:0071346)|cytokine-mediated signaling pathway (GO:0019221)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-23-mediated signaling pathway (GO:0038155)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 cell lineage commitment (GO:2000330)|positive regulation of T-helper 17 type immune response (GO:2000318)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|interleukin-12 receptor complex (GO:0042022)|interleukin-23 receptor complex (GO:0072536)	cytokine receptor activity (GO:0004896)			endometrium(1)|kidney(1)|lung(3)|pancreas(1)|skin(2)	8						CCACTCCATACGCAGCTGCCC	0.582													C|||	280	0.0559105	0.0068	0.0692	5008	,	,		16517	0.001		0.1551	False		,,,				2504	0.0675					.											0								C	HIS/ARG,HIS/ARG	158,4248	107.8+/-146.2	3,152,2048	65.0	54.0	58.0		467,467	-7.8	0.0	19	dbSNP_120	58	1494,7106	283.3+/-296.1	127,1240,2933	no	missense,missense	IL12RB1	NM_005535.1,NM_153701.1	29,29	130,1392,4981	TT,TC,CC		17.3721,3.586,12.7018	benign,benign	156/663,156/382	18188408	1652,11354	2203	4300	6503	SO:0001583	missense	3594			U03187	CCDS32957.1, CCDS54232.1	19p13.1	2014-09-17						"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	5971	protein-coding gene	gene with protein product		601604		IL12RB		9284929	Standard	XM_005259893		Approved	CD212	uc002nhw.1	P42701		ENST00000600835.2:c.467G>A	19.37:g.18188408C>T	ENSP00000470788:p.Arg156His	Somatic		WXS	Illumina HiSeq	Phase_I	A8K308|B2RPF1|B7ZKK3|Q8N6Q7	Missense_Mutation	SNP	ENST00000600835.2	37	CCDS54232.1	146	0.06684981684981685	2	0.0040650406504065045	26	0.0718232044198895	1	0.0017482517482517483	117	0.15435356200527706	C	9.619	1.133424	0.21041	0.03586	0.173721	ENSG00000096996	ENST00000430026;ENST00000322153	T;D	0.85955	-1.49;-2.05	3.9	-7.79	0.01218	Immunoglobulin-like fold (1);	1.817980	0.03453	N	0.210996	T	0.00440	0.0014	L	0.29908	0.895	0.09310	N	1	B;B;B	0.29862	0.025;0.259;0.014	B;B;B	0.17433	0.007;0.018;0.003	T	0.18023	-1.0350	10	0.30854	T	0.27	-1.1907	6.7248	0.23350	0.6568:0.1478:0.0:0.1953	rs11575926;rs17884715	156;156;156	P42701-2;P42701-3;P42701	.;.;I12R1_HUMAN	H	156	ENSP00000403103:R156H;ENSP00000314425:R156H	ENSP00000314425:R156H	R	-	2	0	IL12RB1	18049408	0.000000	0.05858	0.001000	0.08648	0.015000	0.08874	-1.507000	0.02268	-1.510000	0.01796	-0.302000	0.09304	CGT		0.582	IL12RB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466525.3		
KRT6A	3853	mdanderson.org	37	12	52886641	52886641	+	Missense_Mutation	SNP	C	C	T	rs681063	byFrequency	TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr12:52886641C>T	ENST00000330722.6	-	1	400	c.332G>A	c.(331-333)gGt>gAt	p.G111D		NM_005554.3	NP_005545.1	P02538	K2C6A_HUMAN	keratin 6A	111	Head.		G -> D (in dbSNP:rs681063).		cell differentiation (GO:0030154)|positive regulation of cell proliferation (GO:0008284)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	39				BRCA - Breast invasive adenocarcinoma(357;0.189)		ACCACCCAGACCAAAGCCAAT	0.647																																						.											0													30.0	33.0	32.0					12																	52886641		2200	4271	6471	SO:0001583	missense	3853			BC014152, L42593, L42610	CCDS41786.1	12q13.13	2013-01-16			ENSG00000205420	ENSG00000205420		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6443	protein-coding gene	gene with protein product		148041	"""keratin 6C"", ""keratin 6D"""	KRT6C, KRT6D		1713141, 16831889	Standard	NM_005554		Approved	CK6C, K6C, CK6D, K6D	uc001sam.3	P02538	OTTHUMG00000169597	ENST00000330722.6:c.332G>A	12.37:g.52886641C>T	ENSP00000369317:p.Gly111Asp	Somatic		WXS	Illumina HiSeq	Phase_I	A4QPC1|P48667|Q08AR4|Q6NT67|Q96CL4	Missense_Mutation	SNP	ENST00000330722.6	37	CCDS41786.1	.	.	.	.	.	.	.	.	.	.	C	13.97	2.396691	0.42512	.	.	ENSG00000205420	ENST00000330722;ENST00000452121	D	0.97941	-4.62	5.24	5.24	0.73138	.	0.000000	0.50627	D	0.000103	D	0.99048	0.9674	M	0.93328	3.405	0.48452	D	0.999659	D	0.89917	1.0	D	0.71414	0.973	D	0.99116	1.0848	10	0.49607	T	0.09	.	19.2638	0.93979	0.0:1.0:0.0:0.0	rs681063	111	P02538	K2C6A_HUMAN	D	111;67	ENSP00000369317:G111D	ENSP00000369317:G111D	G	-	2	0	KRT6A	51172908	0.999000	0.42202	0.995000	0.50966	0.400000	0.30750	5.876000	0.69667	2.626000	0.88956	0.549000	0.68633	GGT		0.647	KRT6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404978.2	NM_005554	
KRTAP4-3	85290	mdanderson.org	37	17	39324139	39324139	+	Silent	SNP	T	T	G	rs12603046		TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr17:39324139T>G	ENST00000391356.2	-	1	285	c.286A>C	c.(286-288)Agg>Cgg	p.R96R		NM_033187.1	NP_149443.1	Q9BYR4	KRA43_HUMAN	keratin associated protein 4-3	96	29 X 5 AA repeats of C-C-[GIKRQVH]-[SPT]- [STA].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	12		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			CAGGTGGTCCTgcagcagctg	0.612																																						.											0													8.0	11.0	10.0					17																	39324139		2005	4178	6183	SO:0001819	synonymous_variant	85290			AJ406935	CCDS42331.1	17q21.2	2013-06-25			ENSG00000196156	ENSG00000196156		"""Keratin associated proteins"""	18908	protein-coding gene	gene with protein product							Standard	NM_033187		Approved	KAP4.3	uc010cxl.3	Q9BYR4	OTTHUMG00000133639	ENST00000391356.2:c.286A>C	17.37:g.39324139T>G		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000391356.2	37	CCDS42331.1																																																																																				0.612	KRTAP4-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257784.1		
MUC4	4585	mdanderson.org	37	3	195512505	195512505	+	Silent	SNP	G	G	A			TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr3:195512505G>A	ENST00000463781.3	-	2	6405	c.5946C>T	c.(5944-5946)gcC>gcT	p.A1982A	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Silent_p.A1982A	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAAGAGGGGTGGCGTGACCTG	0.607																																						.											0													51.0	42.0	44.0					3																	195512505		690	1590	2280	SO:0001819	synonymous_variant	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.5946C>T	3.37:g.195512505G>A		Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																				0.607	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195515141	195515141	+	Missense_Mutation	SNP	A	A	G	rs71321850		TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr3:195515141A>G	ENST00000463781.3	-	2	3769	c.3310T>C	c.(3310-3312)Tct>Cct	p.S1104P	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.S1104P	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	536					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACAGGAAGAGAGGTGGCGTGA	0.577																																						.											0													9.0	7.0	8.0					3																	195515141		652	1501	2153	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.3310T>C	3.37:g.195515141A>G	ENSP00000417498:p.Ser1104Pro	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	2.903	-0.226978	0.06022	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.30448	1.54;1.53	0.814	-1.63	0.08345	.	.	.	.	.	T	0.14743	0.0356	N	0.19112	0.55	0.09310	N	1	B	0.18013	0.025	B	0.17979	0.02	T	0.27331	-1.0077	8	.	.	.	.	3.2893	0.06943	0.3417:0.453:0.2052:0.0	.	1104	E7ESK3	.	P	1104	ENSP00000417498:S1104P;ENSP00000420243:S1104P	.	S	-	1	0	MUC4	196999536	0.000000	0.05858	0.000000	0.03702	0.233000	0.25261	-2.301000	0.01137	-1.323000	0.02275	0.055000	0.15244	TCT		0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
NME3	4832	mdanderson.org	37	16	1820992	1820992	+	Silent	SNP	T	T	A	rs11890	byFrequency	TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr16:1820992T>A	ENST00000219302.3	-	4	477	c.282A>T	c.(280-282)gtA>gtT	p.V94V	EME2_ENST00000307394.7_5'Flank|EME2_ENST00000568449.1_5'Flank|NME3_ENST00000563498.1_Silent_p.V10V	NM_002513.2	NP_002504.2	Q13232	NDK3_HUMAN	NME/NM23 nucleoside diphosphate kinase 3	94					apoptotic process (GO:0006915)|CTP biosynthetic process (GO:0006241)|GTP biosynthetic process (GO:0006183)|UTP biosynthetic process (GO:0006228)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|nucleoside diphosphate kinase activity (GO:0004550)			lung(1)	1						GCCCCTGCCATACCTGTGCGG	0.741													T|||	3824	0.763578	0.848	0.8761	5008	,	,		10226	0.6369		0.7903	False		,,,				2504	0.6728					.											0								T		3531,581		1515,501,40	9.0	12.0	11.0		282	1.4	1.0	16	dbSNP_52	11	6820,1398		2822,1176,111	no	coding-synonymous	NME3	NM_002513.2		4337,1677,151	AA,AT,TT		17.0114,14.1294,16.0503		94/170	1820992	10351,1979	2056	4109	6165	SO:0001819	synonymous_variant	4832			U29656	CCDS10443.1	16q13.3	2013-04-29	2012-05-18		ENSG00000103024	ENSG00000103024			7851	protein-coding gene	gene with protein product		601817	"""non-metastatic cells 3, protein expressed in"""			9067290, 19852809	Standard	NM_002513		Approved	DR-nm23, NM23-H3, NDPKC	uc002cmm.3	Q13232	OTTHUMG00000128635	ENST00000219302.3:c.282A>T	16.37:g.1820992T>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q9BWH4	Silent	SNP	ENST00000219302.3	37	CCDS10443.1																																																																																				0.741	NME3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250505.2	NM_002513	
OR5M9	390162	mdanderson.org;bcgsc.ca	37	11	56230678	56230678	+	Missense_Mutation	SNP	G	G	A	rs61902871	byFrequency	TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr11:56230678G>A	ENST00000279791.1	-	1	199	c.200C>T	c.(199-201)gCg>gTg	p.A67V		NM_001004743.1	NP_001004743.1	Q8NGP3	OR5M9_HUMAN	olfactory receptor, family 5, subfamily M, member 9	67						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(4)|urinary_tract(2)	36	Esophageal squamous(21;0.00448)					GCACACGTCCGCAAAAGACAG	0.428													a|||	519	0.103634	0.2481	0.062	5008	,	,		21278	0.001		0.0934	False		,,,				2504	0.0542					.											0								A	VAL/ALA	946,3456	735.1+/-410.6	118,710,1373	80.0	82.0	81.0		200	3.7	1.0	11	dbSNP_129	81	698,7894	787.4+/-407.6	35,628,3633	yes	missense	OR5M9	NM_001004743.1	64	153,1338,5006	AA,AG,GG		8.1238,21.4902,12.652	benign	67/311	56230678	1644,11350	2201	4296	6497	SO:0001583	missense	390162			AB065747	CCDS31531.1	11q11	2012-08-09			ENSG00000150269	ENSG00000150269		"""GPCR / Class A : Olfactory receptors"""	15294	protein-coding gene	gene with protein product							Standard	NM_001004743		Approved		uc010rjj.2	Q8NGP3	OTTHUMG00000166874	ENST00000279791.1:c.200C>T	11.37:g.56230678G>A	ENSP00000279791:p.Ala67Val	Somatic		WXS	Illumina HiSeq	Phase_I	Q6IEW5|Q96RB9	Missense_Mutation	SNP	ENST00000279791.1	37	CCDS31531.1	236	0.10805860805860806	146	0.2967479674796748	20	0.055248618784530384	0	0.0	70	0.09234828496042216	A	0.026	-1.372847	0.01214	0.214902	0.081238	ENSG00000150269	ENST00000279791	T	0.02837	4.14	4.85	3.72	0.42706	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41194	N	0.000938	T	0.00012	0.0000	N	0.00602	-1.34	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.44251	-0.9340	9	0.02654	T	1	-16.2914	6.9898	0.24750	0.7313:0.0:0.2687:0.0	rs61902871	67	Q8NGP3	OR5M9_HUMAN	V	67	ENSP00000279791:A67V	ENSP00000279791:A67V	A	-	2	0	OR5M9	55987254	0.000000	0.05858	0.971000	0.41717	0.666000	0.39218	0.408000	0.21065	0.296000	0.22592	-1.839000	0.00587	GCG		0.428	OR5M9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391638.1	NM_001004743	
PCDH11X	27328	mdanderson.org	37	X	91134112	91134112	+	Missense_Mutation	SNP	C	C	T			TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chrX:91134112C>T	ENST00000373094.1	+	2	3718	c.2873C>T	c.(2872-2874)tCg>tTg	p.S958L	PCDH11X_ENST00000373097.1_Missense_Mutation_p.S958L|PCDH11X_ENST00000361724.1_Missense_Mutation_p.S958L|PCDH11X_ENST00000361655.2_Missense_Mutation_p.S958L|PCDH11X_ENST00000406881.1_Missense_Mutation_p.S958L|PCDH11X_ENST00000395337.2_Missense_Mutation_p.S958L|PCDH11X_ENST00000373088.1_Missense_Mutation_p.S958L|PCDH11X_ENST00000504220.2_Missense_Mutation_p.S958L|PCDH11X_ENST00000298274.8_Missense_Mutation_p.S958L	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	958					homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						CCCCTGAATTCGAAGCACCAC	0.507																																					NSCLC(38;925 1092 2571 38200 45895)	.											0													252.0	207.0	222.0					X																	91134112		2203	4300	6503	SO:0001583	missense	27328			AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.2873C>T	X.37:g.91134112C>T	ENSP00000362186:p.Ser958Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Missense_Mutation	SNP	ENST00000373094.1	37	CCDS14461.1	.	.	.	.	.	.	.	.	.	.	C	10.16	1.272807	0.23221	.	.	ENSG00000102290	ENST00000395337;ENST00000373094;ENST00000373097;ENST00000361724;ENST00000373088;ENST00000504220;ENST00000361655;ENST00000406881;ENST00000356934;ENST00000298274	T;T;T;T;T;T;T;T;T	0.30981	1.51;1.51;1.51;1.51;1.51;1.51;1.51;1.51;1.51	4.82	3.06	0.35304	Protocadherin (1);	0.195197	0.44285	N	0.000476	T	0.30230	0.0758	M	0.65498	2.005	0.30108	N	0.806795	B;B;B;B;B;B;B;B	0.19073	0.027;0.027;0.027;0.027;0.027;0.033;0.027;0.027	B;B;B;B;B;B;B;B	0.18263	0.013;0.013;0.013;0.013;0.013;0.021;0.013;0.013	T	0.20907	-1.0261	10	0.39692	T	0.17	.	9.5293	0.39185	0.0:0.8253:0.0:0.1747	.	958;958;958;958;958;958;958;958	Q9BZA7-6;Q9BZA7-5;Q9BZA7-4;Q9BZA7-8;Q9BZA7-3;Q9BZA7;Q9BZA7-7;Q9BZA7-2	.;.;.;.;.;PC11X_HUMAN;.;.	L	958	ENSP00000378746:S958L;ENSP00000362186:S958L;ENSP00000362189:S958L;ENSP00000355040:S958L;ENSP00000362180:S958L;ENSP00000423762:S958L;ENSP00000355105:S958L;ENSP00000384758:S958L;ENSP00000298274:S958L	ENSP00000298274:S958L	S	+	2	0	PCDH11X	91020768	1.000000	0.71417	0.880000	0.34516	0.809000	0.45718	3.614000	0.54160	0.460000	0.27045	-0.192000	0.12808	TCG		0.507	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057436.1	NM_032969	
PHF10	55274	mdanderson.org	37	6	170115851	170115851	+	Missense_Mutation	SNP	G	G	A	rs77919800		TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr6:170115851G>A	ENST00000339209.4	-	6	769	c.646C>T	c.(646-648)Cgg>Tgg	p.R216W	PHF10_ENST00000464779.1_5'Flank|PHF10_ENST00000366780.4_Missense_Mutation_p.R214W	NM_018288.3|NM_133325.2	NP_060758.2|NP_579866.2	Q8WUB8	PHF10_HUMAN	PHD finger protein 10	216	SAY.				nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	npBAF complex (GO:0071564)	zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|liver(3)|lung(4)|prostate(2)|urinary_tract(1)	14		Breast(66;5.08e-05)|Ovarian(120;0.208)		OV - Ovarian serous cystadenocarcinoma(33;1.4e-21)|BRCA - Breast invasive adenocarcinoma(81;1.4e-07)|GBM - Glioblastoma multiforme(31;0.00176)		ATGCGTTCCCGGTTTAAGTTG	0.358																																						.											0													120.0	123.0	122.0					6																	170115851		2203	4300	6503	SO:0001583	missense	55274			AF338735	CCDS5308.2, CCDS5309.2	6q27	2014-05-13			ENSG00000130024	ENSG00000130024		"""Zinc fingers, PHD-type"""	18250	protein-coding gene	gene with protein product		613069				11827455	Standard	NM_018288		Approved	FLJ10975, XAP135, BAF45a	uc011egy.2	Q8WUB8	OTTHUMG00000016058	ENST00000339209.4:c.646C>T	6.37:g.170115851G>A	ENSP00000341805:p.Arg216Trp	Somatic		WXS	Illumina HiSeq	Phase_I	Q2YDA3|Q53HG8|Q9BXD2|Q9NV26	Missense_Mutation	SNP	ENST00000339209.4	37	CCDS5308.2	.	.	.	.	.	.	.	.	.	.	G	24.2	4.501168	0.85176	.	.	ENSG00000130024	ENST00000366780;ENST00000339209	T;T	0.32272	1.46;1.46	5.91	5.91	0.95273	.	0.052032	0.85682	D	0.000000	T	0.49321	0.1550	M	0.62723	1.935	0.58432	D	0.999999	D;D;D	0.89917	0.996;1.0;0.999	P;D;P	0.85130	0.702;0.997;0.794	T	0.46679	-0.9174	10	0.87932	D	0	-20.118	19.2865	0.94077	0.0:0.0:1.0:0.0	.	128;214;216	Q5T069;Q8WUB8-2;Q8WUB8	.;.;PHF10_HUMAN	W	214;216	ENSP00000355743:R214W;ENSP00000341805:R216W	ENSP00000341805:R216W	R	-	1	2	PHF10	169857776	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.685000	0.54678	2.802000	0.96397	0.655000	0.94253	CGG		0.358	PHF10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346732.1	NM_018288	
PHF10	55274	mdanderson.org	37	6	170115857	170115857	+	Missense_Mutation	SNP	A	A	C	rs144595699		TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr6:170115857A>C	ENST00000339209.4	-	6	763	c.640T>G	c.(640-642)Tta>Gta	p.L214V	PHF10_ENST00000464779.1_5'Flank|PHF10_ENST00000366780.4_Missense_Mutation_p.L212V	NM_018288.3|NM_133325.2	NP_060758.2|NP_579866.2	Q8WUB8	PHF10_HUMAN	PHD finger protein 10	214	SAY.				nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	npBAF complex (GO:0071564)	zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|liver(3)|lung(4)|prostate(2)|urinary_tract(1)	14		Breast(66;5.08e-05)|Ovarian(120;0.208)		OV - Ovarian serous cystadenocarcinoma(33;1.4e-21)|BRCA - Breast invasive adenocarcinoma(81;1.4e-07)|GBM - Glioblastoma multiforme(31;0.00176)		TCCCGGTTTAAGTTGCTATTA	0.373																																						.											0																																										SO:0001583	missense	55274			AF338735	CCDS5308.2, CCDS5309.2	6q27	2014-05-13			ENSG00000130024	ENSG00000130024		"""Zinc fingers, PHD-type"""	18250	protein-coding gene	gene with protein product		613069				11827455	Standard	NM_018288		Approved	FLJ10975, XAP135, BAF45a	uc011egy.2	Q8WUB8	OTTHUMG00000016058	ENST00000339209.4:c.640T>G	6.37:g.170115857A>C	ENSP00000341805:p.Leu214Val	Somatic		WXS	Illumina HiSeq	Phase_I	Q2YDA3|Q53HG8|Q9BXD2|Q9NV26	Missense_Mutation	SNP	ENST00000339209.4	37	CCDS5308.2	.	.	.	.	.	.	.	.	.	.	A	19.89	3.910262	0.72983	.	.	ENSG00000130024	ENST00000366780;ENST00000339209	T;T	0.32272	1.46;1.46	5.91	-0.532	0.11890	.	0.058333	0.64402	D	0.000001	T	0.18002	0.0432	M	0.65975	2.015	0.42139	D	0.991505	P;P;P	0.52316	0.894;0.739;0.952	B;B;B	0.43990	0.438;0.225;0.437	T	0.07028	-1.0794	10	0.62326	D	0.03	-9.8963	9.7614	0.40534	0.6235:0.0:0.3765:0.0	.	126;212;214	Q5T069;Q8WUB8-2;Q8WUB8	.;.;PHF10_HUMAN	V	212;214	ENSP00000355743:L212V;ENSP00000341805:L214V	ENSP00000341805:L214V	L	-	1	2	PHF10	169857782	0.998000	0.40836	0.488000	0.27440	0.991000	0.79684	0.855000	0.27805	-0.303000	0.08856	0.533000	0.62120	TTA		0.373	PHF10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346732.1	NM_018288	
PHF10	55274	mdanderson.org	37	6	170115864	170115864	+	Silent	SNP	A	A	G			TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr6:170115864A>G	ENST00000339209.4	-	6	756	c.633T>C	c.(631-633)aaT>aaC	p.N211N	PHF10_ENST00000464779.1_5'Flank|PHF10_ENST00000366780.4_Silent_p.N209N	NM_018288.3|NM_133325.2	NP_060758.2|NP_579866.2	Q8WUB8	PHF10_HUMAN	PHD finger protein 10	211	SAY.				nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	npBAF complex (GO:0071564)	zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|liver(3)|lung(4)|prostate(2)|urinary_tract(1)	14		Breast(66;5.08e-05)|Ovarian(120;0.208)		OV - Ovarian serous cystadenocarcinoma(33;1.4e-21)|BRCA - Breast invasive adenocarcinoma(81;1.4e-07)|GBM - Glioblastoma multiforme(31;0.00176)		TTAAGTTGCTATTAAATTCTG	0.363																																						.											0													111.0	113.0	112.0					6																	170115864		2203	4300	6503	SO:0001819	synonymous_variant	55274			AF338735	CCDS5308.2, CCDS5309.2	6q27	2014-05-13			ENSG00000130024	ENSG00000130024		"""Zinc fingers, PHD-type"""	18250	protein-coding gene	gene with protein product		613069				11827455	Standard	NM_018288		Approved	FLJ10975, XAP135, BAF45a	uc011egy.2	Q8WUB8	OTTHUMG00000016058	ENST00000339209.4:c.633T>C	6.37:g.170115864A>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q2YDA3|Q53HG8|Q9BXD2|Q9NV26	Silent	SNP	ENST00000339209.4	37	CCDS5308.2																																																																																				0.363	PHF10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346732.1	NM_018288	
PHF10	55274	mdanderson.org	37	6	170115873	170115873	+	Silent	SNP	T	T	A			TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr6:170115873T>A	ENST00000339209.4	-	6	747	c.624A>T	c.(622-624)gcA>gcT	p.A208A	PHF10_ENST00000464779.1_5'Flank|PHF10_ENST00000366780.4_Silent_p.A206A	NM_018288.3|NM_133325.2	NP_060758.2|NP_579866.2	Q8WUB8	PHF10_HUMAN	PHD finger protein 10	208	SAY.				nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	npBAF complex (GO:0071564)	zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|liver(3)|lung(4)|prostate(2)|urinary_tract(1)	14		Breast(66;5.08e-05)|Ovarian(120;0.208)		OV - Ovarian serous cystadenocarcinoma(33;1.4e-21)|BRCA - Breast invasive adenocarcinoma(81;1.4e-07)|GBM - Glioblastoma multiforme(31;0.00176)		TATTAAATTCTGCTGCTTTTT	0.363																																						.											0													106.0	108.0	108.0					6																	170115873		2203	4300	6503	SO:0001819	synonymous_variant	55274			AF338735	CCDS5308.2, CCDS5309.2	6q27	2014-05-13			ENSG00000130024	ENSG00000130024		"""Zinc fingers, PHD-type"""	18250	protein-coding gene	gene with protein product		613069				11827455	Standard	NM_018288		Approved	FLJ10975, XAP135, BAF45a	uc011egy.2	Q8WUB8	OTTHUMG00000016058	ENST00000339209.4:c.624A>T	6.37:g.170115873T>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q2YDA3|Q53HG8|Q9BXD2|Q9NV26	Silent	SNP	ENST00000339209.4	37	CCDS5308.2																																																																																				0.363	PHF10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346732.1	NM_018288	
POTEC	388468	mdanderson.org	37	18	14513764	14513764	+	Missense_Mutation	SNP	C	C	T	rs201788045		TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr18:14513764C>T	ENST00000358970.5	-	10	1429	c.1430G>A	c.(1429-1431)cGg>cAg	p.R477Q		NM_001137671.1	NP_001131143.1	B2RU33	POTEC_HUMAN	POTE ankyrin domain family, member C	477								p.R477Q(12)		NS(2)|breast(1)|endometrium(9)|kidney(13)|lung(14)|prostate(3)|skin(6)|soft_tissue(1)|urinary_tract(3)	52						AAGTTGTTTCCGGGTATCATT	0.358																																						.											12	Substitution - Missense(12)	endometrium(4)|kidney(3)|urinary_tract(2)|prostate(2)|soft_tissue(1)											13.0	9.0	10.0					18																	14513764		683	1543	2226	SO:0001583	missense	388468			BX649118	CCDS45835.1	18p11.21	2013-01-10	2008-11-26	2008-11-26	ENSG00000183206	ENSG00000183206		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33894	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 6"""		"""ANKRD26-like family B, member 2"""	A26B2			Standard	NM_001137671		Approved	POTE18, POTE-18, DKFZp686J0529, CT104.6	uc010dln.3	B2RU33	OTTHUMG00000162963	ENST00000358970.5:c.1430G>A	18.37:g.14513764C>T	ENSP00000351856:p.Arg477Gln	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000358970.5	37	CCDS45835.1	492	0.22527472527472528	61	0.12398373983739837	82	0.2265193370165746	187	0.3269230769230769	162	0.21372031662269128	c	0.001	-3.539655	0.00009	.	.	ENSG00000183206	ENST00000358970	T	0.20881	2.04	1.34	0.0657	0.14358	.	.	.	.	.	T	0.00012	0.0000	N	0.00116	-2.08	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.42430	-0.9452	9	0.06757	T	0.87	.	3.4153	0.07373	0.0:0.2473:0.0:0.7527	.	477	B2RU33	POTEC_HUMAN	Q	477	ENSP00000351856:R477Q	ENSP00000351856:R477Q	R	-	2	0	POTEC	14503764	0.885000	0.30320	0.063000	0.19743	0.005000	0.04900	1.581000	0.36558	0.005000	0.14708	-1.615000	0.00797	CGG		0.358	POTEC-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371179.1	XM_496269	
POTEE	445582	mdanderson.org	37	2	132021629	132021629	+	Missense_Mutation	SNP	G	G	T	rs7424029		TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr2:132021629G>T	ENST00000356920.5	+	15	2695	c.2601G>T	c.(2599-2601)gaG>gaT	p.E867D	POTEE_ENST00000358087.5_3'UTR|PLEKHB2_ENST00000404460.1_Intron|PLEKHB2_ENST00000303908.3_Intron	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	867	Actin-like.				retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)											CCATCTATGAGGGGAATGCCC	0.617																																						.											0													33.0	34.0	34.0					2																	132021629		2168	4216	6384	SO:0001583	missense	445582			AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.2601G>T	2.37:g.132021629G>T	ENSP00000439189:p.Glu867Asp	Somatic		WXS	Illumina HiSeq	Phase_I	Q6S8J4|Q6S8J5|Q6S8J8	Missense_Mutation	SNP	ENST00000356920.5	37	CCDS46414.1	.	.	.	.	.	.	.	.	.	.	.	7.447	0.641908	0.14451	.	.	ENSG00000188219	ENST00000356920	D	0.94497	-3.44	.	.	.	.	.	.	.	.	D	0.91764	0.7395	M	0.79805	2.47	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	D	0.84711	0.0734	8	0.48119	T	0.1	.	2.6649	0.05041	0.4877:0.0:0.5123:0.0	rs7424029	867	Q6S8J3	POTEE_HUMAN	D	867	ENSP00000439189:E867D	ENSP00000439189:E867D	E	+	3	2	AC131180.1	131738099	1.000000	0.71417	0.130000	0.21974	0.132000	0.20833	2.624000	0.46444	0.119000	0.18210	0.121000	0.15741	GAG		0.617	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001083538	
PRR21	643905	mdanderson.org	37	2	240982080	240982080	+	Missense_Mutation	SNP	C	C	G	rs143810849	byFrequency	TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr2:240982080C>G	ENST00000408934.1	-	1	319	c.320G>C	c.(319-321)cGt>cCt	p.R107P		NM_001080835.1	NP_001074304.1	Q8WXC7	PRR21_HUMAN	proline rich 21	107	Pro-rich.							p.R107P(2)		NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(5)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)	29						GAGGCATGGACGAAGGGCCGT	0.617													-|||	1250	0.249601	0.2201	0.2608	5008	,	,		21906	0.3284		0.2913	False		,,,				2504	0.1575					.											2	Substitution - Missense(2)	prostate(2)											32.0	33.0	33.0					2																	240982080		2124	4240	6364	SO:0001583	missense	643905			AF453950	CCDS33417.1	2q37.3	2009-04-20			ENSG00000221961	ENSG00000221961			33866	protein-coding gene	gene with protein product							Standard	NM_001080835		Approved		uc010zod.2	Q8WXC7	OTTHUMG00000159174	ENST00000408934.1:c.320G>C	2.37:g.240982080C>G	ENSP00000386166:p.Arg107Pro	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000408934.1	37	CCDS33417.1	.	.	.	.	.	.	.	.	.	.	-	2.575	-0.298847	0.05532	.	.	ENSG00000221961	ENST00000408934;ENST00000486799	T;T	0.13657	2.57;2.57	1.79	-3.59	0.04583	.	.	.	.	.	T	0.05318	0.0141	N	0.08118	0	0.09310	N	1	B	0.15141	0.012	B	0.01281	0.0	T	0.39121	-0.9629	9	0.26408	T	0.33	.	5.3415	0.15986	0.0:0.5523:0.1504:0.2974	.	107	Q8WXC7	PRR21_HUMAN	P	107	ENSP00000386166:R107P;ENSP00000418240:R107P	ENSP00000386166:R107P	R	-	2	0	PRR21	240630753	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-5.287000	0.00134	-1.262000	0.02459	-1.689000	0.00729	CGT		0.617	PRR21-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001080835	
PRSS3	5646	mdanderson.org	37	9	33796801	33796801	+	Splice_Site	SNP	G	G	A	rs143707562		TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr9:33796801G>A	ENST00000361005.5	+	2	371		c.e2+1		PRSS3_ENST00000379405.3_Splice_Site|RP11-133O22.6_ENST00000454429.2_RNA|PRSS3_ENST00000429677.3_Splice_Site|PRSS3_ENST00000342836.4_Splice_Site	NM_007343.3	NP_031369	P35030	TRY3_HUMAN	protease, serine, 3						cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|endothelial cell migration (GO:0043542)|innate immune response (GO:0045087)|proteolysis (GO:0006508)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	13			LUSC - Lung squamous cell carcinoma(29;0.0176)			GCTACAAGACGTAAGTGTGGG	0.597													G|||	1	0.000199681	0.0	0.0	5008	,	,		18879	0.001		0.0	False		,,,				2504	0.0					.											0													70.0	70.0	70.0					9																	33796801		2203	4300	6503	SO:0001630	splice_region_variant	5646				CCDS6545.1, CCDS47958.1, CCDS56570.1, CCDS56571.1	9p13	2010-05-07	2008-03-11		ENSG00000010438	ENSG00000010438	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9486	protein-coding gene	gene with protein product	"""mesotrypsin"""	613578	"""protease, serine, 4 (trypsin 4, brain)"", ""protease, serine, 3 (mesotrypsin)"""	PRSS4		2326201, 8294000	Standard	NM_002771		Approved	TRY3, TRY4	uc003ztj.4	P35030	OTTHUMG00000019798	ENST00000361005.5:c.371+1G>A	9.37:g.33796801G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A8CED1|A8CED3|A9Z1Y4|E7ES07|F8W7P3|P15951|Q15665|Q5VXV0|Q6ISJ4|Q9UQV3	Splice_Site	SNP	ENST00000361005.5	37	CCDS47958.1	.	.	.	.	.	.	.	.	.	.	G	7.509	0.654290	0.14580	.	.	ENSG00000010438	ENST00000361005;ENST00000457896;ENST00000342836;ENST00000429677;ENST00000379405	.	.	.	3.21	2.29	0.28610	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.1922	0.31374	0.1286:0.0:0.8714:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PRSS3	33786801	1.000000	0.71417	0.775000	0.31657	0.032000	0.12392	8.277000	0.89896	0.482000	0.27582	0.306000	0.20318	.		0.597	PRSS3-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052121.1	NM_002771	Intron
RGPD2	729857	mdanderson.org	37	2	88125234	88125234	+	Silent	SNP	T	T	C	rs550032815	byFrequency	TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr2:88125234T>C	ENST00000398146.3	-	1	237	c.15A>G	c.(13-15)aaA>aaG	p.K5K	RGPD2_ENST00000420840.2_Intron|RGPD2_ENST00000327544.6_5'UTR			P0DJD1	RGPD2_HUMAN	RANBP2-like and GRIP domain containing 2	5					protein targeting to Golgi (GO:0000042)					breast(1)|pancreas(1)	2						CCCCGTAGGCTTTGCTGCGCC	0.667													.|||	4	0.000798722	0.0	0.0	5008	,	,		10105	0.0		0.002	False		,,,				2504	0.002					.											0													36.0	56.0	50.0					2																	88125234		692	1591	2283	SO:0001819	synonymous_variant	729857				CCDS42710.1, CCDS42710.2	2p11.2	2013-01-10			ENSG00000185304	ENSG00000185304		"""Tetratricopeptide (TTC) repeat domain containing"""	32415	protein-coding gene	gene with protein product		612705				15710750, 15815621	Standard	NM_001078170		Approved	RGP2, RANBP2L2		P0DJD1	OTTHUMG00000153276	ENST00000398146.3:c.15A>G	2.37:g.88125234T>C		Somatic		WXS	Illumina HiSeq	Phase_I	P0C839|Q68DN6|Q6V1X0	Silent	SNP	ENST00000398146.3	37	CCDS42710.2																																																																																				0.667	RGPD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330534.2	NM_001078170	
SPEG	10290	mdanderson.org	37	2	220350135	220350135	+	Silent	SNP	G	G	T			TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr2:220350135G>T	ENST00000312358.7	+	31	7809	c.7677G>T	c.(7675-7677)tcG>tcT	p.S2559S	SPEG_ENST00000485813.1_3'UTR|AC053503.11_ENST00000429882.1_RNA	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	2559					cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		AGGGGTTATCGCCACCAAACC	0.617																																						.											0													56.0	63.0	61.0					2																	220350135		2123	4220	6343	SO:0001819	synonymous_variant	10290			BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.7677G>T	2.37:g.220350135G>T		Somatic		WXS	Illumina HiSeq	Phase_I	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Silent	SNP	ENST00000312358.7	37	CCDS42824.1																																																																																				0.617	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130252.2	NM_005876	
TCF3	6929	mdanderson.org	37	19	1622116	1622116	+	Silent	SNP	G	G	A	rs2240590	byFrequency	TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr19:1622116G>A	ENST00000262965.5	-	10	1103	c.759C>T	c.(757-759)agC>agT	p.S253S	TCF3_ENST00000453954.2_Silent_p.S169S|TCF3_ENST00000395423.3_Silent_p.S202S|TCF3_ENST00000588136.1_Silent_p.S253S|TCF3_ENST00000344749.5_Silent_p.S253S	NM_003200.3	NP_003191.1	Q9HCS4	TF7L1_HUMAN	transcription factor 3	0	Pro-rich.				anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16		Acute lymphoblastic leukemia(61;5.94e-12)|all_hematologic(61;1.27e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCACCGGGCCGCTACCGGGCG	0.741			T	"""PBX1, HLF, TFPT"""	pre B-ALL								g|||	1698	0.339058	0.593	0.2925	5008	,	,		10107	0.244		0.1163	False		,,,				2504	0.3558					.		Dom	yes		19	19p13.3	6929	transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)		L	0								G	,	1908,2318		433,1042,638	6.0	7.0	7.0		759,759	2.7	0.2	19	dbSNP_98	7	1001,7343		85,831,3256	no	coding-synonymous,coding-synonymous	TCF3	NM_001136139.2,NM_003200.3	,	518,1873,3894	AA,AG,GG		11.9966,45.1491,23.1424	,	253/652,253/655	1622116	2909,9661	2113	4172	6285	SO:0001819	synonymous_variant	6929			M65214	CCDS12074.1, CCDS45899.1	19p13.3	2014-02-13	2013-02-26		ENSG00000071564	ENSG00000071564		"""Basic helix-loop-helix proteins"""	11633	protein-coding gene	gene with protein product	"""transcription factor E2-alpha"", ""immunoglobulin transcription factor 1"", ""kappa-E2-binding factor"", ""E2A immunoglobulin enhancer-binding factor E12/E47"", ""VDR interacting repressor"""	147141				2308859, 1967983	Standard	NM_003200		Approved	E2A, ITF1, MGC129647, MGC129648, bHLHb21, VDIR, E47	uc002ltt.4	P15923	OTTHUMG00000180031	ENST00000262965.5:c.759C>T	19.37:g.1622116G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q53R97|Q6PD70|Q9NP00	Silent	SNP	ENST00000262965.5	37	CCDS12074.1																																																																																				0.741	TCF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449367.1	NM_003200	
TMEM70	54968	mdanderson.org	37	8	74888616	74888616	+	Missense_Mutation	SNP	G	G	C	rs8075	byFrequency	TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr8:74888616G>C	ENST00000312184.5	+	1	173	c.100G>C	c.(100-102)Gcc>Ccc	p.A34P	TMEM70_ENST00000517439.1_Missense_Mutation_p.A34P|TMEM70_ENST00000523794.1_3'UTR	NM_001040613.2|NM_017866.5	NP_001035703.1|NP_060336.3	Q9BUB7	TMM70_HUMAN	transmembrane protein 70	34			A -> P (in dbSNP:rs8075).		mitochondrial proton-transporting ATP synthase complex assembly (GO:0033615)	integral component of mitochondrial membrane (GO:0032592)|mitochondrial inner membrane (GO:0005743)				breast(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|skin(1)	8	Breast(64;0.0311)		Epithelial(68;0.0186)|BRCA - Breast invasive adenocarcinoma(89;0.0499)|all cancers(69;0.0564)			AGGTCCCCGGGCCTCTGTCTC	0.731													G|||	882	0.176118	0.2595	0.1715	5008	,	,		10013	0.1171		0.1491	False		,,,				2504	0.1554					.											0								G	PRO/ALA,PRO/ALA	1119,3259		156,807,1226	12.0	13.0	13.0		100,100	2.7	0.0	8	dbSNP_52	13	1112,7432		88,936,3248	no	missense,missense	TMEM70	NM_001040613.2,NM_017866.5	27,27	244,1743,4474	CC,CG,GG		13.015,25.5596,17.2651	probably-damaging,probably-damaging	34/108,34/261	74888616	2231,10691	2189	4272	6461	SO:0001583	missense	54968			BC002748	CCDS6215.1, CCDS47876.1	8q21.11	2013-05-23				ENSG00000175606			26050	protein-coding gene	gene with protein product		612418				21945727, 22986587	Standard	NM_017866		Approved	FLJ20533	uc003yab.3	Q9BUB7		ENST00000312184.5:c.100G>C	8.37:g.74888616G>C	ENSP00000312599:p.Ala34Pro	Somatic		WXS	Illumina HiSeq	Phase_I	E9PDY9|Q9NWY5	Missense_Mutation	SNP	ENST00000312184.5	37	CCDS6215.1	377	0.17261904761904762	154	0.3130081300813008	63	0.17403314917127072	63	0.11013986013986014	97	0.1279683377308707	G	18.66	3.671897	0.67928	0.255596	0.13015	ENSG00000175606	ENST00000517439;ENST00000312184	T;T	0.50001	0.76;1.09	3.61	2.71	0.32032	.	1.008340	0.07980	N	0.985433	T	0.00012	0.0000	N	0.24115	0.695	0.80722	P	0.0	D;P	0.55385	0.971;0.917	P;B	0.55391	0.775;0.445	T	0.24512	-1.0158	9	0.38643	T	0.18	-1.4075	7.4815	0.27408	0.122:0.0:0.878:0.0	rs8075;rs3193742;rs17295004;rs17349529	34;34	E9PDY9;Q9BUB7	.;TMM70_HUMAN	P	34	ENSP00000429467:A34P;ENSP00000312599:A34P	ENSP00000312599:A34P	A	+	1	0	TMEM70	75051170	0.013000	0.17824	0.002000	0.10522	0.009000	0.06853	1.407000	0.34657	1.077000	0.40990	0.491000	0.48974	GCC		0.731	TMEM70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379028.1	NM_017866	
TTBK1	84630	mdanderson.org	37	6	43252029	43252029	+	Missense_Mutation	SNP	T	T	C	rs3800298	byFrequency	TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr6:43252029T>C	ENST00000259750.4	+	14	3634	c.3551T>C	c.(3550-3552)tTg>tCg	p.L1184S		NM_032538.1	NP_115927.1	Q5TCY1	TTBK1_HUMAN	tau tubulin kinase 1	1184			L -> S (in dbSNP:rs3800298). {ECO:0000269|PubMed:17344846}.		substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(10)|liver(1)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)			GCCCCAGCATTGGACACAGCC	0.682													C|||	1827	0.364816	0.5628	0.2378	5008	,	,		16925	0.3849		0.2515	False		,,,				2504	0.2832					.											0								C	SER/LEU	1274,1956		249,776,590	12.0	14.0	13.0		3551	4.8	0.2	6	dbSNP_107	13	1385,5175		125,1135,2020	yes	missense	TTBK1	NM_032538.1	145	374,1911,2610	CC,CT,TT		21.1128,39.4427,27.1604	benign	1184/1322	43252029	2659,7131	1615	3280	4895	SO:0001583	missense	84630			AB058758	CCDS34455.1	6p21.1	2008-02-05			ENSG00000146216	ENSG00000146216			19140	protein-coding gene	gene with protein product						11347906	Standard	XM_006715229		Approved	KIAA1855	uc003ouq.1	Q5TCY1	OTTHUMG00000014725	ENST00000259750.4:c.3551T>C	6.37:g.43252029T>C	ENSP00000259750:p.Leu1184Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A2A2U5|Q2L6C6|Q6ZNH0|Q8N444|Q96JH2	Missense_Mutation	SNP	ENST00000259750.4	37	CCDS34455.1	773	0.35393772893772896	282	0.573170731707317	94	0.2596685082872928	207	0.3618881118881119	190	0.25065963060686014	C	0.003	-2.531159	0.00145	0.394427	0.211128	ENSG00000146216	ENST00000259750	T	0.51574	0.7	4.77	4.77	0.60923	.	0.586807	0.15128	N	0.278991	T	0.04724	0.0128	N	0.00621	-1.32	0.58432	P	2.9999999999752447E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.34976	-0.9807	9	0.08381	T	0.77	.	7.4137	0.27032	0.0:0.808:0.0:0.192	rs3800298;rs58957853;rs3800298	1184	Q5TCY1	TTBK1_HUMAN	S	1184	ENSP00000259750:L1184S	ENSP00000259750:L1184S	L	+	2	0	TTBK1	43360007	0.001000	0.12720	0.242000	0.24170	0.258000	0.26162	1.185000	0.32065	1.258000	0.44101	-0.215000	0.12644	TTG		0.682	TTBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040584.3		
USP42	84132	mdanderson.org	37	7	6194266	6194266	+	Silent	SNP	G	G	C	rs7784072	byFrequency	TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr7:6194266G>C	ENST00000306177.5	+	15	3239	c.3081G>C	c.(3079-3081)ggG>ggC	p.G1027G		NM_032172.2	NP_115548.1	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	1027	Arg-rich.				cell differentiation (GO:0030154)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(2)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	35		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		ACCGGAGCGGGGTGGAGCTGG	0.721													G|||	188	0.0375399	0.0703	0.0072	5008	,	,		7903	0.0665		0.0189	False		,,,				2504	0.0041					.											0								G		185,3859		4,177,1841	8.0	11.0	10.0		3081	-10.8	0.0	7	dbSNP_116	10	37,8295		1,35,4130	yes	coding-synonymous	USP42	NM_032172.2		5,212,5971	CC,CG,GG		0.4441,4.5747,1.7938		1027/1317	6194266	222,12154	2022	4166	6188	SO:0001819	synonymous_variant	84132			AK022759	CCDS47535.1	7p22.2	2005-08-08	2005-08-08		ENSG00000106346	ENSG00000106346		"""Ubiquitin-specific peptidases"""	20068	protein-coding gene	gene with protein product			"""ubiquitin specific protease 42"""			12838346	Standard	NM_032172		Approved	FLJ12697	uc011jwp.2	Q9H9J4	OTTHUMG00000151888	ENST00000306177.5:c.3081G>C	7.37:g.6194266G>C		Somatic		WXS	Illumina HiSeq	Phase_I	A2RUE3|B5MDA5|Q0VIN8|Q3C166|Q6P9B4	Silent	SNP	ENST00000306177.5	37	CCDS47535.1																																																																																				0.721	USP42-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324262.3	XM_166526	
USP42	84132	mdanderson.org	37	7	6194274	6194274	+	Missense_Mutation	SNP	T	T	C	rs6463529	byFrequency	TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr7:6194274T>C	ENST00000306177.5	+	15	3247	c.3089T>C	c.(3088-3090)cTg>cCg	p.L1030P		NM_032172.2	NP_115548.1	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	1030	Arg-rich.		L -> P (in dbSNP:rs6463529).		cell differentiation (GO:0030154)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(2)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	35		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		GGGGTGGAGCTGGACTGGGTC	0.701													C|||	2360	0.471246	0.6747	0.2767	5008	,	,		7893	0.7282		0.171	False		,,,				2504	0.3783					.											0								C	PRO/LEU	2212,1862		592,1028,417	9.0	11.0	10.0		3089	4.5	0.6	7	dbSNP_116	10	1238,7100		113,1012,3044	yes	missense	USP42	NM_032172.2	98	705,2040,3461	CC,CT,TT		14.8477,45.7045,27.7957	benign	1030/1317	6194274	3450,8962	2037	4169	6206	SO:0001583	missense	84132			AK022759	CCDS47535.1	7p22.2	2005-08-08	2005-08-08		ENSG00000106346	ENSG00000106346		"""Ubiquitin-specific peptidases"""	20068	protein-coding gene	gene with protein product			"""ubiquitin specific protease 42"""			12838346	Standard	NM_032172		Approved	FLJ12697	uc011jwp.2	Q9H9J4	OTTHUMG00000151888	ENST00000306177.5:c.3089T>C	7.37:g.6194274T>C	ENSP00000301962:p.Leu1030Pro	Somatic		WXS	Illumina HiSeq	Phase_I	A2RUE3|B5MDA5|Q0VIN8|Q3C166|Q6P9B4	Missense_Mutation	SNP	ENST00000306177.5	37	CCDS47535.1	958	0.43864468864468864	302	0.6138211382113821	87	0.24033149171270718	439	0.7674825174825175	130	0.17150395778364116	C	4.103	0.017211	0.07959	0.542955	0.148477	ENSG00000106346	ENST00000306177;ENST00000426246	T;T	0.41065	1.01;1.01	5.66	4.51	0.55191	.	0.264966	0.33327	N	0.005023	T	0.00012	0.0000	N	0.08118	0	0.58432	P	6.999999999979245E-6	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.27400	-1.0075	9	0.26408	T	0.33	.	8.4494	0.32862	0.5191:0.3648:0.0:0.1161	rs6463529;rs9640020;rs9791885;rs10371676;rs6463529	926;1030;1030	A4D2N7;Q9H9J4-2;Q9H9J4	.;.;UBP42_HUMAN	P	1030;876	ENSP00000301962:L1030P;ENSP00000408217:L876P	ENSP00000301962:L1030P	L	+	2	0	USP42	6160799	.	.	0.604000	0.28916	0.007000	0.05969	.	.	0.429000	0.26202	-1.068000	0.02270	CTG		0.701	USP42-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324262.3	XM_166526	
WFIKKN1	117166	mdanderson.org	37	16	681284	681284	+	Silent	SNP	C	C	T	rs8062289	byFrequency	TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr16:681284C>T	ENST00000319070.2	+	1	353	c.31C>T	c.(31-33)Ctg>Ttg	p.L11L		NM_053284.2	NP_444514.1	Q96NZ8	WFKN1_HUMAN	WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 1	11					muscle fiber development (GO:0048747)|negative regulation of DNA binding (GO:0043392)|negative regulation of protein binding (GO:0032091)|palate development (GO:0060021)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(1)|prostate(1)|upper_aerodigestive_tract(1)	4		Hepatocellular(780;0.00335)				CCTGCCGCTCCTGCTCCTCCT	0.741													c|||	1093	0.218251	0.3986	0.0965	5008	,	,		11117	0.0357		0.1859	False		,,,				2504	0.2822					.											0										1488,2824		287,914,955	10.0	11.0	11.0		31	0.8	0.0	16	dbSNP_116	11	1579,6943		165,1249,2847	no	coding-synonymous	WFIKKN1	NM_053284.2		452,2163,3802	TT,TC,CC		18.5285,34.5083,23.8975		11/549	681284	3067,9767	2156	4261	6417	SO:0001819	synonymous_variant	117166			AK075356	CCDS10414.1	16p13	2013-01-21			ENSG00000127578	ENSG00000127578		"""Immunoglobulin superfamily / I-set domain containing"", ""WAP four-disulfide core domain containing"""	30912	protein-coding gene	gene with protein product	"""WAP four-disulfide core domain 20A"""	608021	"""chromosome 16 open reading frame 12"""	C16orf12		11274388, 11928817	Standard	NM_053284		Approved	RJD2, WFIKKN, WFDC20A	uc002cht.1	Q96NZ8	OTTHUMG00000090359	ENST00000319070.2:c.31C>T	16.37:g.681284C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q7LDW0|Q8NBQ1|Q96S20	Silent	SNP	ENST00000319070.2	37	CCDS10414.1																																																																																				0.741	WFIKKN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206731.2	NM_053284	
NBPF10	100132406	bcgsc.ca	37	1	145296448	145296448	+	Missense_Mutation	SNP	T	T	A	rs4996268		TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr1:145296448T>A	ENST00000342960.5	+	3	405	c.370T>A	c.(370-372)Tat>Aat	p.Y124N	NBPF10_ENST00000369339.3_Intron|NBPF10_ENST00000369338.1_Intron|RP11-458D21.5_ENST00000468030.1_3'UTR	NM_001039703.4	NP_001034792.4	Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	124						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.Y124N(2)		NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		CCGCTCATTGTATGAGCATCT	0.562																																						.											2	Substitution - Missense(2)	kidney(2)																																								SO:0001583	missense	100132406			BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000342960.5:c.370T>A	1.37:g.145296448T>A	ENSP00000345684:p.Tyr124Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q5RHC0|Q9NWN6	Missense_Mutation	SNP	ENST00000342960.5	37	CCDS53355.1	.	.	.	.	.	.	.	.	.	.	.	0.001	-2.880827	0.00061	.	.	ENSG00000163386	ENST00000369339;ENST00000448873;ENST00000342960	T	0.02552	4.25	1.04	-2.09	0.07232	.	.	.	.	.	T	0.00109	0.0003	N	0.00075	-2.25	0.09310	N	1	.	.	.	.	.	.	T	0.35351	-0.9792	7	0.02654	T	1	.	3.206	0.06666	0.3078:0.4616:0.0:0.2307	rs4996268	.	.	.	N	124;49;124	ENSP00000345684:Y124N	ENSP00000345684:Y124N	Y	+	1	0	NBPF10	144007805	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.048000	0.14078	-3.520000	0.00148	-3.904000	0.00016	TAT		0.562	NBPF10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001039703	
SNAPIN	23557	bcgsc.ca	37	1	153631302	153631302	+	Frame_Shift_Del	DEL	G	G	-			TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr1:153631302delG	ENST00000368685.5	+	1	173	c.83delG	c.(82-84)gggfs	p.G28fs	SNAPIN_ENST00000478558.1_3'UTR	NM_012437.5	NP_036569.1	O95295	SNAPN_HUMAN	SNAP-associated protein	28					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|endosome to lysosome transport (GO:0008333)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|negative regulation of neuron projection development (GO:0010977)|neuron projection development (GO:0031175)|neurotransmitter secretion (GO:0007269)|positive regulation of late endosome to lysosome transport (GO:1902824)|regulation of protein binding (GO:0043393)|synaptic vesicle exocytosis (GO:0016079)|synaptic vesicle fusion to presynaptic membrane (GO:0031629)|synaptic vesicle maturation (GO:0016188)|synaptic vesicle transport (GO:0048489)|terminal button organization (GO:0072553)|viral process (GO:0016032)	BLOC-1 complex (GO:0031083)|cell junction (GO:0030054)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleolus (GO:0005730)|perinuclear region of cytoplasm (GO:0048471)|secretory granule (GO:0030141)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	SNARE binding (GO:0000149)			lung(3)	3	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			TTCGCCGAAGGGCTGCTGGAG	0.692																																						.											0													10.0	13.0	12.0					1																	153631302		2167	4241	6408	SO:0001589	frameshift_variant	23557			AF086837	CCDS1049.1	1q22	2013-09-27		2007-11-14	ENSG00000143553	ENSG00000143553		"""Biogenesis of lysosomal organelles complex-1 subunits"""	17145	protein-coding gene	gene with protein product	"""snapin"", ""SNAP-25-binding protein"", ""biogenesis of lysosomal organelles complex-1, subunit 7"""	607007		SNAPAP		10195194, 12659861	Standard	NM_012437		Approved	BLOC1S7	uc001fcq.4	O95295	OTTHUMG00000037086	ENST00000368685.5:c.83delG	1.37:g.153631302delG	ENSP00000357674:p.Gly28fs	Somatic		WXS	Illumina HiSeq	Phase_I	D3DV56|Q5SXU8	Frame_Shift_Del	DEL	ENST00000368685.5	37	CCDS1049.1																																																																																				0.692	SNAPIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090036.1	NM_012437	
ZRANB1	54764	bcgsc.ca	37	10	126631811	126631811	+	Frame_Shift_Del	DEL	A	A	-			TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr10:126631811delA	ENST00000359653.4	+	1	1120	c.749delA	c.(748-750)aaafs	p.K251fs	RP11-298J20.4_ENST00000508096.1_RNA|RP11-298J20.3_ENST00000449984.1_RNA	NM_017580.2	NP_060050.2	Q9UGI0	ZRAN1_HUMAN	zinc finger, RAN-binding domain containing 1	251					cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|positive regulation of Wnt signaling pathway (GO:0030177)|protein deubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0071947)|protein K29-linked deubiquitination (GO:0035523)|protein K33-linked deubiquitination (GO:1990168)|protein K63-linked deubiquitination (GO:0070536)|regulation of cell morphogenesis (GO:0022604)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	K63-linked polyubiquitin binding (GO:0070530)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(2)|lung(3)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	23		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.172)		Colorectal(40;0.113)|COAD - Colon adenocarcinoma(40;0.119)		GTAGACTTTAAAAAACTAAAG	0.413																																						.											0													43.0	47.0	46.0					10																	126631811		2203	4300	6503	SO:0001589	frameshift_variant	54764			AJ252060	CCDS7642.1	10q26.12	2014-02-24			ENSG00000019995	ENSG00000019995		"""Zinc fingers, RAN-binding domain containing"", ""OTU domain containing"""	18224	protein-coding gene	gene with protein product		611749				11463333	Standard	NM_017580		Approved	TRABID	uc001lic.3	Q9UGI0	OTTHUMG00000019223	ENST00000359653.4:c.749delA	10.37:g.126631811delA	ENSP00000352676:p.Lys251fs	Somatic		WXS	Illumina HiSeq	Phase_I	B4DZ98|D3DRF4|Q5SQP6|Q69YK3	Frame_Shift_Del	DEL	ENST00000359653.4	37	CCDS7642.1																																																																																				0.413	ZRANB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050898.1	NM_017580	
TRIM49B	283116	bcgsc.ca	37	11	49055821	49055821	+	Nonsense_Mutation	SNP	C	C	T			TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr11:49055821C>T	ENST00000332682.7	+	4	659	c.631C>T	c.(631-633)Cga>Tga	p.R211*		NM_001206626.1	NP_001193555.1	A6NDI0	TR49B_HUMAN	tripartite motif containing 49B	211						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			lung(8)	8						TATTTTTCATCGACTTCATTT	0.383																																						.											0																																										SO:0001587	stop_gained	283116				CCDS55762.1	11p11.12	2014-02-17			ENSG00000182053	ENSG00000182053		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	42955	protein-coding gene	gene with protein product							Standard	NM_001206626		Approved		uc021qix.1	A6NDI0		ENST00000332682.7:c.631C>T	11.37:g.49055821C>T	ENSP00000330216:p.Arg211*	Somatic		WXS	Illumina HiSeq	Phase_I		Nonsense_Mutation	SNP	ENST00000332682.7	37	CCDS55762.1	.	.	.	.	.	.	.	.	.	.	C	7.992	0.753493	0.15778	.	.	ENSG00000182053	ENST00000332682	.	.	.	0.689	0.689	0.18033	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11182	T	0.66	.	.	.	.	.	.	.	.	X	211	.	ENSP00000330216:R211X	R	+	1	2	AC084851.1	49012397	0.000000	0.05858	0.014000	0.15608	0.003000	0.03518	-0.778000	0.04664	0.644000	0.30656	0.184000	0.17185	CGA		0.383	TRIM49B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
DPP8	54878	bcgsc.ca	37	15	65743404	65743404	+	Missense_Mutation	SNP	A	A	G			TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr15:65743404A>G	ENST00000341861.5	-	19	4087	c.2507T>C	c.(2506-2508)gTc>gCc	p.V836A	DPP8_ENST00000339244.5_Missense_Mutation_p.V663A|DPP8_ENST00000559233.1_Missense_Mutation_p.V836A|DPP8_ENST00000560048.2_5'UTR|DPP8_ENST00000300141.6_Missense_Mutation_p.V820A|DPP8_ENST00000358939.4_Missense_Mutation_p.V720A|DPP8_ENST00000321118.7_Missense_Mutation_p.V787A|DPP8_ENST00000321147.6_Missense_Mutation_p.V785A	NM_197960.2	NP_932064.1	Q6V1X1	DPP8_HUMAN	dipeptidyl-peptidase 8	836					immune response (GO:0006955)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(2)|endometrium(3)|large_intestine(11)|lung(11)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						TGCAAAATGGACATTCTCATC	0.363																																						.											0													136.0	146.0	143.0					15																	65743404		2201	4299	6500	SO:0001583	missense	54878			AF221634	CCDS10207.1, CCDS10208.1, CCDS10209.1, CCDS10210.1	15q22	2008-07-18	2006-01-12		ENSG00000074603	ENSG00000074603			16490	protein-coding gene	gene with protein product	"""dipeptidyl peptidase VIII"", ""dipeptidyl peptidase IV-related protein-1"", ""prolyl dipeptidase DPP8"""	606819	"""dipeptidylpeptidase 8"""			11012666	Standard	XM_005254500		Approved	DP8, DPRP1, MSTP141, FLJ14920, FLJ20283, MGC26191	uc002aox.3	Q6V1X1	OTTHUMG00000133150	ENST00000341861.5:c.2507T>C	15.37:g.65743404A>G	ENSP00000339208:p.Val836Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q7Z4C8|Q7Z4D3|Q7Z4E1|Q8IWG7|Q8NEM5|Q96JX1|Q9HBM2|Q9HBM3|Q9HBM4|Q9HBM5|Q9NXF4	Missense_Mutation	SNP	ENST00000341861.5	37	CCDS10207.1	.	.	.	.	.	.	.	.	.	.	A	20.0	3.930737	0.73327	.	.	ENSG00000074603	ENST00000341861;ENST00000358939;ENST00000300141;ENST00000321147;ENST00000321118;ENST00000339244	T;T;T;T;T;T	0.49432	0.78;0.78;0.78;0.78;0.78;0.78	5.31	5.31	0.75309	Peptidase S9, prolyl oligopeptidase, catalytic domain (1);	0.000000	0.64402	D	0.000006	T	0.73210	0.3558	M	0.89478	3.035	0.58432	D	0.999999	D;D;D;D;D	0.89917	1.0;1.0;0.99;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;0.98;1.0;1.0	T	0.79420	-0.1811	10	0.87932	D	0	-14.4712	14.4796	0.67573	1.0:0.0:0.0:0.0	.	787;820;720;785;836	Q6V1X1-5;Q6V1X1-3;Q6V1X1-4;Q6V1X1-2;Q6V1X1	.;.;.;.;DPP8_HUMAN	A	836;720;820;785;787;663	ENSP00000339208:V836A;ENSP00000351817:V720A;ENSP00000300141:V820A;ENSP00000318111:V785A;ENSP00000316373:V787A;ENSP00000341230:V663A	ENSP00000300141:V820A	V	-	2	0	DPP8	63530457	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.332000	0.96446	2.009000	0.58944	0.528000	0.53228	GTC		0.363	DPP8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256847.1	NM_017743	
AVL9	23080	bcgsc.ca	37	7	32591845	32591845	+	Missense_Mutation	SNP	T	T	C			TCGA-KM-8442-01A-11D-2310-10	TCGA-KM-8442-10A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9fb73d89-f7c4-47b2-810b-3ce37cd8a3c9	6fc570c7-dca7-4892-bbf8-94afd186a057	g.chr7:32591845T>C	ENST00000318709.4	+	6	688	c.467T>C	c.(466-468)cTt>cCt	p.L156P	AVL9_ENST00000404479.1_Missense_Mutation_p.L156P|AVL9_ENST00000409301.1_Missense_Mutation_p.L156P	NM_015060.1	NP_055875.1	Q8NBF6	AVL9_HUMAN	AVL9 homolog (S. cerevisiase)	156					cell migration (GO:0016477)	integral component of membrane (GO:0016021)|recycling endosome (GO:0055037)				endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						TTATAGGAGCTTTATGAACAT	0.313																																						.											0													38.0	40.0	39.0					7																	32591845		2202	4298	6500	SO:0001583	missense	23080			D87682	CCDS34613.1	7p14.3	2013-05-01	2008-10-03	2008-10-03	ENSG00000105778	ENSG00000105778			28994	protein-coding gene	gene with protein product		612927	"""KIAA0241"""	KIAA0241		17229886, 22595670	Standard	XM_005249668		Approved		uc003tcv.1	Q8NBF6	OTTHUMG00000152929	ENST00000318709.4:c.467T>C	7.37:g.32591845T>C	ENSP00000315568:p.Leu156Pro	Somatic		WXS	Illumina HiSeq	Phase_I	Q92573	Missense_Mutation	SNP	ENST00000318709.4	37	CCDS34613.1	.	.	.	.	.	.	.	.	.	.	T	21.8	4.208264	0.79240	.	.	ENSG00000105778	ENST00000318709;ENST00000409301;ENST00000329714;ENST00000404479;ENST00000446718	T;T;T;T	0.53206	0.63;0.63;0.63;0.63	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.70762	0.3261	M	0.81802	2.56	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.73864	-0.3848	10	0.54805	T	0.06	-14.4166	16.1864	0.81955	0.0:0.0:0.0:1.0	.	156;156	Q8N6Z3;Q8NBF6	.;AVL9_HUMAN	P	156;156;156;156;87	ENSP00000315568:L156P;ENSP00000387011:L156P;ENSP00000385242:L156P;ENSP00000395134:L87P	ENSP00000315568:L156P	L	+	2	0	AVL9	32558370	1.000000	0.71417	0.991000	0.47740	0.931000	0.56810	7.467000	0.80930	2.281000	0.76405	0.528000	0.53228	CTT		0.313	AVL9-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328643.1	NM_015060	
