#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
FLAD1	80308	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	1	154965424	154965424	+	Missense_Mutation	SNP	C	C	G			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr1:154965424C>G	ENST00000292180.3	+	7	1997	c.1675C>G	c.(1675-1677)Ctg>Gtg	p.L559V	FLAD1_ENST00000368432.1_3'UTR|LENEP_ENST00000392487.1_5'Flank|FLAD1_ENST00000295530.2_3'UTR|FLAD1_ENST00000405236.2_3'UTR|FLAD1_ENST00000368428.1_Missense_Mutation_p.L100V|FLAD1_ENST00000315144.10_Missense_Mutation_p.L462V	NM_025207.4	NP_079483.3	Q8NFF5	FAD1_HUMAN	flavin adenine dinucleotide synthetase 1	559					FAD biosynthetic process (GO:0006747)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|riboflavin metabolic process (GO:0006771)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|FMN adenylyltransferase activity (GO:0003919)			endometrium(3)|kidney(4)|large_intestine(2)|lung(7)|ovary(3)|skin(3)	22	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			GAACCCGGCCCTGAAGTGCCT	0.607																																						.											0													74.0	64.0	67.0					1																	154965424		2203	4300	6503	SO:0001583	missense	80308				CCDS1078.1, CCDS1079.1, CCDS53371.1, CCDS53372.1	1q22	2013-03-05	2013-03-05		ENSG00000160688	ENSG00000160688	2.7.7.2		24671	protein-coding gene	gene with protein product		610595	"""Fad1, flavin adenine dinucleotide synthetase, homolog (yeast)"", ""FAD1 flavin adenine dinucleotide synthetase homolog (S. cerevisiae)"", ""flavin adenine dinucleotide synthetase"""				Standard	NM_001184891		Approved	PP591, FAD1	uc001fgf.2	Q8NFF5	OTTHUMG00000037416	ENST00000292180.3:c.1675C>G	1.37:g.154965424C>G	ENSP00000292180:p.Leu559Val	Somatic		WXS	Illumina HiSeq	Phase_I	Q8N5J1|Q8N686|Q8WU93|Q8WUJ4|Q96CR8|Q99764|Q9HBN6	Missense_Mutation	SNP	ENST00000292180.3	37	CCDS1078.1	.	.	.	.	.	.	.	.	.	.	C	12.56	1.973492	0.34848	.	.	ENSG00000160688	ENST00000315144;ENST00000292180;ENST00000368428	.	.	.	5.2	2.23	0.28157	.	0.000000	0.64402	D	0.000001	T	0.76371	0.3978	M	0.91300	3.195	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.81189	-0.1046	9	0.87932	D	0	-12.7998	12.1264	0.53919	0.0:0.7294:0.0:0.2706	.	559	Q8NFF5	FAD1_HUMAN	V	462;559;100	.	ENSP00000292180:L559V	L	+	1	2	FLAD1	153232048	1.000000	0.71417	0.991000	0.47740	0.030000	0.12068	3.914000	0.56401	0.380000	0.24823	-1.203000	0.01651	CTG		0.607	FLAD1-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000091089.1	NM_025207	
ARHGEF2	9181	hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	1	155932493	155932493	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr1:155932493G>A	ENST00000361247.4	-	9	1091	c.992C>T	c.(991-993)gCg>gTg	p.A331V	ARHGEF2_ENST00000368315.4_Missense_Mutation_p.A332V|ARHGEF2_ENST00000477754.2_Intron|ARHGEF2_ENST00000313695.7_Missense_Mutation_p.A303V|ARHGEF2_ENST00000462460.2_Missense_Mutation_p.A376V|ARHGEF2_ENST00000313667.4_Missense_Mutation_p.A330V|ARHGEF2_ENST00000368316.1_Missense_Mutation_p.A303V	NM_001162383.1|NM_001162384.1	NP_001155855.1|NP_001155856.1	Q92974	ARHG2_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 2	331	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin filament organization (GO:0007015)|apoptotic signaling pathway (GO:0097190)|cell morphogenesis (GO:0000902)|cellular hyperosmotic response (GO:0071474)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to tumor necrosis factor (GO:0071356)|establishment of mitotic spindle orientation (GO:0000132)|innate immune response (GO:0045087)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of intrinsic apoptotic signaling pathway in response to osmotic stress (GO:1902219)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of necroptotic process (GO:0060546)|negative regulation of neurogenesis (GO:0050768)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cell proliferation (GO:0042127)|regulation of Rho protein signal transduction (GO:0035023)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|Rac GTPase binding (GO:0048365)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho GTPase binding (GO:0017048)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(4)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|skin(2)	40	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					CATCTGCTCCGCACTAGGACC	0.537																																					Melanoma(178;35 2768 6610 28839)	.											0													70.0	68.0	68.0					1																	155932493		2203	4300	6503	SO:0001583	missense	9181			AB014551	CCDS1125.1, CCDS53375.1, CCDS53376.1	1q21-q22	2013-01-10	2009-06-12		ENSG00000116584	ENSG00000116584		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	682	protein-coding gene	gene with protein product		607560	"""rho/rac guanine nucleotide exchange factor (GEF) 2"""			9857026, 9734811	Standard	NM_004723		Approved	LFP40, GEF-H1, KIAA0651, P40	uc001fmt.2	Q92974	OTTHUMG00000017464	ENST00000361247.4:c.992C>T	1.37:g.155932493G>A	ENSP00000354837:p.Ala331Val	Somatic		WXS	Illumina HiSeq	Phase_I	D3DVA6|O75142|Q15079|Q5VY92|Q8TDA3|Q8WUG4|Q9H023	Missense_Mutation	SNP	ENST00000361247.4	37	CCDS53376.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.951615	0.73787	.	.	ENSG00000116584	ENST00000313695;ENST00000361247;ENST00000368315;ENST00000368316;ENST00000435736;ENST00000543433;ENST00000313667	T;T;T;T;T	0.69435	-0.4;-0.4;-0.4;-0.4;-0.4	5.08	5.08	0.68730	Dbl homology (DH) domain (5);	0.000000	0.47852	D	0.000207	T	0.79131	0.4394	M	0.82056	2.57	0.53005	D	0.999967	D;D;P;D	0.76494	0.999;0.997;0.455;0.985	D;P;B;P	0.69142	0.962;0.875;0.151;0.71	T	0.81055	-0.1106	10	0.72032	D	0.01	-16.4095	16.3414	0.83083	0.0:0.0:1.0:0.0	.	376;375;331;330	B7Z977;D3DVA5;Q92974;Q92974-2	.;.;ARHG2_HUMAN;.	V	303;331;332;303;376;304;330	ENSP00000315325:A303V;ENSP00000354837:A331V;ENSP00000357298:A332V;ENSP00000357299:A303V;ENSP00000314787:A330V	ENSP00000314787:A330V	A	-	2	0	ARHGEF2	154199117	1.000000	0.71417	0.342000	0.25602	0.665000	0.39181	4.965000	0.63708	2.803000	0.96430	0.609000	0.83330	GCG		0.537	ARHGEF2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046204.2	NM_004723	
OR52N1	79473	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	11	5809593	5809593	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr11:5809593G>A	ENST00000317078.1	-	1	453	c.454C>T	c.(454-456)Ctt>Ttt	p.L152F	TRIM5_ENST00000380027.1_Intron	NM_001001913.1	NP_001001913.1	Q8NH53	O52N1_HUMAN	olfactory receptor, family 52, subfamily N, member 1	152						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(15)|prostate(2)|skin(3)	31		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.05e-11)|LUSC - Lung squamous cell carcinoma(625;0.112)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.195)		ACACCCCTAAGAAAAGTGAGG	0.522																																						.											0													121.0	104.0	110.0					11																	5809593		2201	4296	6497	SO:0001583	missense	79473			AB065538	CCDS31398.1	11p15.4	2012-08-09			ENSG00000181001	ENSG00000181001		"""GPCR / Class A : Olfactory receptors"""	14853	protein-coding gene	gene with protein product							Standard	NM_001001913		Approved		uc010qzo.2	Q8NH53	OTTHUMG00000168800	ENST00000317078.1:c.454C>T	11.37:g.5809593G>A	ENSP00000322823:p.Leu152Phe	Somatic		WXS	Illumina HiSeq	Phase_I	Q6IFF6	Missense_Mutation	SNP	ENST00000317078.1	37	CCDS31398.1	.	.	.	.	.	.	.	.	.	.	G	1.194	-0.634327	0.03584	.	.	ENSG00000181001	ENST00000317078	T	0.41758	0.99	4.59	2.53	0.30540	GPCR, rhodopsin-like superfamily (1);	0.498524	0.16680	N	0.203974	T	0.33352	0.0860	L	0.48877	1.53	0.09310	N	1	B	0.18968	0.032	B	0.27170	0.077	T	0.25187	-1.0139	10	0.35671	T	0.21	.	5.4489	0.16552	0.1029:0.0:0.4403:0.4568	.	152	Q8NH53	O52N1_HUMAN	F	152	ENSP00000322823:L152F	ENSP00000322823:L152F	L	-	1	0	OR52N1	5766169	0.000000	0.05858	0.033000	0.17914	0.082000	0.17680	-2.660000	0.00851	0.531000	0.28639	-0.466000	0.05196	CTT		0.522	OR52N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401142.1	NM_001001913	
FERMT3	83706	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	11	63988121	63988121	+	Nonsense_Mutation	SNP	C	C	T	rs121918295		TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr11:63988121C>T	ENST00000279227.5	+	12	1632	c.1537C>T	c.(1537-1539)Cga>Tga	p.R513*	FERMT3_ENST00000345728.5_Nonsense_Mutation_p.R509*	NM_178443.2	NP_848537.1	Q86UX7	URP2_HUMAN	fermitin family member 3	513	FERM.				integrin activation (GO:0033622)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|platelet aggregation (GO:0070527)|regulation of cell-cell adhesion mediated by integrin (GO:0033632)|substrate adhesion-dependent cell spreading (GO:0034446)	cell junction (GO:0030054)|cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|podosome (GO:0002102)	integrin binding (GO:0005178)			breast(1)|cervix(1)|endometrium(4)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	18						CCGTTTCCAGCGAAAGTTCAA	0.652																																						.											0													15.0	14.0	14.0					11																	63988121		2195	4291	6486	SO:0001587	stop_gained	83706			L25343	CCDS8059.1, CCDS8060.1	11q13.1	2014-09-17	2010-06-24		ENSG00000149781	ENSG00000149781		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	23151	protein-coding gene	gene with protein product	"""kindlin-3"""	607901	"""fermitin family homolog 3 (Drosophila)"""				Standard	NM_178443		Approved	URP2, KIND3, MIG2B, MGC10966, MIG-2, UNC112C	uc001nym.2	Q86UX7	OTTHUMG00000167790	ENST00000279227.5:c.1537C>T	11.37:g.63988121C>T	ENSP00000279227:p.Arg513*	Somatic		WXS	Illumina HiSeq	Phase_I	Q8IUA1|Q8N207|Q9BT48	Nonsense_Mutation	SNP	ENST00000279227.5	37	CCDS8060.1	.	.	.	.	.	.	.	.	.	.	C	36	5.881654	0.97062	.	.	ENSG00000149781	ENST00000345728;ENST00000279227	.	.	.	4.21	3.29	0.37713	.	0.071181	0.53938	D	0.000043	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14656	T	0.56	-14.009	10.2263	0.43227	0.4891:0.5109:0.0:0.0	.	.	.	.	X	509;513	.	ENSP00000279227:R513X	R	+	1	2	FERMT3	63744697	1.000000	0.71417	0.995000	0.50966	0.878000	0.50629	3.997000	0.57016	1.108000	0.41662	0.491000	0.48974	CGA		0.652	FERMT3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000396297.1	NM_031471	
SUSD4	55061	hgsc.bcm.edu;ucsc.edu	37	1	223465989	223465989	+	Silent	SNP	G	G	A			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr1:223465989G>A	ENST00000343846.3	-	2	786	c.153C>T	c.(151-153)ttC>ttT	p.F51F	SUSD4_ENST00000478605.1_5'UTR|SUSD4_ENST00000366878.4_Silent_p.F51F|SUSD4_ENST00000344029.6_Silent_p.F51F|SUSD4_ENST00000484758.2_Intron|SUSD4_ENST00000454695.2_5'UTR|SUSD4_ENST00000494793.2_Silent_p.F51F			Q5VX71	SUSD4_HUMAN	sushi domain containing 4	51						integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|liver(1)|lung(5)|skin(1)	17				GBM - Glioblastoma multiforme(131;0.0611)		GAAGGTCATCGAACCCTACAT	0.502																																						.											0													48.0	53.0	52.0					1																	223465989		2203	4300	6503	SO:0001819	synonymous_variant	55061			AK096265	CCDS31034.1, CCDS41471.1	1q41	2008-05-14			ENSG00000143502	ENSG00000143502			25470	protein-coding gene	gene with protein product		615827				12477932	Standard	NM_017982		Approved	FLJ10052	uc001hny.4	Q5VX71	OTTHUMG00000037936	ENST00000343846.3:c.153C>T	1.37:g.223465989G>A		Somatic		WXS	Illumina HiSeq	Phase_I	D3DTB9|Q6UX62|Q9BSR0|Q9NWG0	Silent	SNP	ENST00000343846.3	37	CCDS41471.1																																																																																				0.502	SUSD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092592.2	NM_017982	
WNT1	7471	broad.mit.edu;hgsc.bcm.edu	37	12	49373357	49373365	+	In_Frame_Del	DEL	CTGATACGC	CTGATACGC	-			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	CTGATACGC	CTGATACGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr12:49373357_49373365delCTGATACGC	ENST00000293549.3	+	2	247_255	c.211_219delCTGATACGC	c.(211-219)ctgatacgcdel	p.LIR71del		NM_005430.3	NP_005421.1	P04628	WNT1_HUMAN	wingless-type MMTV integration site family, member 1	71					bone development (GO:0060348)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to peptide hormone stimulus (GO:0071375)|central nervous system morphogenesis (GO:0021551)|cerebellum formation (GO:0021588)|diencephalon development (GO:0021536)|embryonic axis specification (GO:0000578)|forebrain anterior/posterior pattern specification (GO:0021797)|hematopoietic stem cell proliferation (GO:0071425)|hepatocyte differentiation (GO:0070365)|inner ear morphogenesis (GO:0042472)|midbrain development (GO:0030901)|midbrain-hindbrain boundary maturation during brain development (GO:0022004)|myoblast fusion (GO:0007520)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell aging (GO:0090344)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron differentiation (GO:0030182)|neuron fate determination (GO:0048664)|organ regeneration (GO:0031100)|positive regulation of cell proliferation (GO:0008284)|positive regulation of dermatome development (GO:0061184)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to wounding (GO:0009611)|signal transduction in response to DNA damage (GO:0042770)|Spemann organizer formation (GO:0060061)|spinal cord association neuron differentiation (GO:0021527)|T cell differentiation in thymus (GO:0033077)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|transcription regulatory region DNA binding (GO:0044212)			endometrium(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)	11				BRCA - Breast invasive adenocarcinoma(357;0.244)		ACAGCGGCGTCTGATACGCCAAAATCCGG	0.603																																						.											0																																										SO:0001651	inframe_deletion	7471			X03072	CCDS8776.1	12q13	2013-02-28				ENSG00000125084		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12774	protein-coding gene	gene with protein product		164820		INT1		2998762, 3281802	Standard	NM_005430		Approved		uc001rsu.3	P04628	OTTHUMG00000170403	ENST00000293549.3:c.211_219delCTGATACGC	12.37:g.49373357_49373365delCTGATACGC	ENSP00000293549:p.Leu71_Arg73del	Somatic		WXS	Illumina HiSeq	Phase_I	Q5U0N2	In_Frame_Del	DEL	ENST00000293549.3	37	CCDS8776.1																																																																																				0.603	WNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408937.1		
N4BP2L2	10443	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	13	33016882	33016882	+	Missense_Mutation	SNP	A	A	C			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr13:33016882A>C	ENST00000504114.1	-	6	1838	c.1747T>G	c.(1747-1749)Ttt>Gtt	p.F583V	N4BP2L2_ENST00000357505.6_Missense_Mutation_p.F583V|N4BP2L2_ENST00000446957.2_Intron|N4BP2L2_ENST00000399396.3_Missense_Mutation_p.F598V|N4BP2L2_ENST00000380121.3_5'UTR			Q92802	N42L2_HUMAN	NEDD4 binding protein 2-like 2	33					negative regulation of hematopoietic stem cell differentiation (GO:1902037)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of hematopoietic stem cell proliferation (GO:1902035)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|transcriptional repressor complex (GO:0017053)	enzyme binding (GO:0019899)|RNA polymerase II transcription corepressor activity (GO:0001106)			kidney(4)|large_intestine(3)|liver(1)|lung(6)|skin(1)|urinary_tract(1)	16		Lung SC(185;0.0262)		all cancers(112;9.5e-07)|Epithelial(112;5.07e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00196)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.243)		TGTAGCACAAAAGAAGGAATA	0.323																																						.											0													33.0	34.0	34.0					13																	33016882		1820	4072	5892	SO:0001583	missense	10443			U50532	CCDS9346.1, CCDS45024.1, CCDS61307.1	13q13.1	2010-12-02			ENSG00000244754	ENSG00000244754			26916	protein-coding gene	gene with protein product	"""phosphonoformate immuno-associated protein 5"""	615788				8812419	Standard	NM_014887		Approved	CG005, PFAAP5	uc010abe.1	Q92802	OTTHUMG00000016700	ENST00000504114.1:c.1747T>G	13.37:g.33016882A>C	ENSP00000427477:p.Phe583Val	Somatic		WXS	Illumina HiSeq	Phase_I	A3KME8	Missense_Mutation	SNP	ENST00000504114.1	37		.	.	.	.	.	.	.	.	.	.	A	10.17	1.275345	0.23307	.	.	ENSG00000139617;ENSG00000139617;ENSG00000244754;ENSG00000244754;ENSG00000244754	ENST00000380121;ENST00000503296;ENST00000504114;ENST00000357505;ENST00000399396	.	.	.	4.19	2.34	0.29019	.	0.431030	0.19579	N	0.110903	T	0.22399	0.0540	N	0.08118	0	0.09310	N	1	B;B;B;B	0.11235	0.004;0.004;0.002;0.002	B;B;B;B	0.11329	0.004;0.004;0.006;0.006	T	0.21314	-1.0249	9	0.72032	D	0.01	-1.6649	8.8591	0.35247	0.1856:0.0:0.8144:0.0	.	583;598;481;481	B4DPY1;Q92802-3;Q96KV2;Q9Y3H6	.;.;.;.	V	481;510;583;583;598	.	ENSP00000350104:F583V	F	-	1	0	N4BP2L2;RP11-298P3.4	31914882	0.609000	0.26975	0.004000	0.12327	0.032000	0.12392	1.209000	0.32357	0.476000	0.27440	-0.345000	0.07892	TTT		0.323	N4BP2L2-004	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000361380.1	NM_014887	
ESR2	2100	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	14	64727212	64727212	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr14:64727212C>T	ENST00000341099.4	-	5	1324	c.907G>A	c.(907-909)Gac>Aac	p.D303N	ESR2_ENST00000555483.1_5'UTR|ESR2_ENST00000358599.5_Missense_Mutation_p.D303N|ESR2_ENST00000553796.1_Missense_Mutation_p.D303N|ESR2_ENST00000357782.2_Missense_Mutation_p.D303N|ESR2_ENST00000554572.1_Missense_Mutation_p.D303N|ESR2_ENST00000555278.1_Missense_Mutation_p.D303N|ESR2_ENST00000353772.3_Missense_Mutation_p.D303N|ESR2_ENST00000557772.1_Missense_Mutation_p.D303N|ESR2_ENST00000267525.6_Missense_Mutation_p.D303N|ESR2_ENST00000542956.1_Missense_Mutation_p.D303N	NM_001437.2	NP_001428.1	Q92731	ESR2_HUMAN	estrogen receptor 2 (ER beta)	303	Steroid-binding.				brain development (GO:0007420)|cell-cell signaling (GO:0007267)|epithelial cell maturation involved in prostate gland development (GO:0060743)|extracellular negative regulation of signal transduction (GO:1900116)|gene expression (GO:0010467)|hormone-mediated apoptotic signaling pathway (GO:0008628)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|ovarian follicle development (GO:0001541)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|uterus development (GO:0060065)|vagina development (GO:0060068)	extracellular region (GO:0005576)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|estrogen receptor activity (GO:0030284)|estrogen response element binding (GO:0034056)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|receptor antagonist activity (GO:0048019)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	23				all cancers(60;0.00916)|OV - Ovarian serous cystadenocarcinoma(108;0.0111)|BRCA - Breast invasive adenocarcinoma(234;0.0437)	Diethylstilbestrol(DB00255)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estropipate(DB04574)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Trilostane(DB01108)	AACTCCTTGTCGGCCAACTTG	0.582																																						.											0													102.0	103.0	103.0					14																	64727212		2203	4300	6503	SO:0001583	missense	2100			X99101	CCDS9762.1, CCDS32096.1, CCDS55920.1, CCDS61469.1, CCDS61470.1	14q21-q22	2013-01-16			ENSG00000140009	ENSG00000140009		"""Nuclear hormone receptors"""	3468	protein-coding gene	gene with protein product		601663				8769313	Standard	NM_001214902		Approved	NR3A2, Erb	uc001xha.1	Q92731	OTTHUMG00000141306	ENST00000341099.4:c.907G>A	14.37:g.64727212C>T	ENSP00000343925:p.Asp303Asn	Somatic		WXS	Illumina HiSeq	Phase_I	A8K8K5|G3V5M5|O60608|O60685|O60702|O60703|O75583|O75584|Q0MWT5|Q0MWT6|Q86Z31|Q9UEV6|Q9UHD3|Q9UQK9	Missense_Mutation	SNP	ENST00000341099.4	37	CCDS9762.1	.	.	.	.	.	.	.	.	.	.	C	36	5.714190	0.96830	.	.	ENSG00000140009	ENST00000556275;ENST00000542956;ENST00000554572;ENST00000353772;ENST00000358599;ENST00000555278;ENST00000553796;ENST00000357782;ENST00000557772;ENST00000341099;ENST00000267525	D;D;D;D;D;D;D;D;D;D;T	0.96685	-4.09;-4.09;-4.09;-4.09;-4.09;-4.09;-4.09;-4.09;-4.09;-4.09;0.62	5.83	5.83	0.93111	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	D	0.98302	0.9437	M	0.84219	2.685	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.998;1.0	D;D;D;P;D	0.97110	1.0;0.999;0.972;0.883;0.984	D	0.98691	1.0696	10	0.72032	D	0.01	.	20.1374	0.98035	0.0:1.0:0.0:0.0	.	303;303;303;303;303	Q92731-7;Q92731;Q92731-6;Q92731-5;F1D8N3	.;ESR2_HUMAN;.;.;.	N	303	ENSP00000452485:D303N;ENSP00000441792:D303N;ENSP00000450699:D303N;ENSP00000335551:D303N;ENSP00000351412:D303N;ENSP00000450488:D303N;ENSP00000452426:D303N;ENSP00000350427:D303N;ENSP00000451582:D303N;ENSP00000343925:D303N;ENSP00000267525:D303N	ENSP00000267525:D303N	D	-	1	0	ESR2	63796965	1.000000	0.71417	0.994000	0.49952	0.972000	0.66771	7.726000	0.84824	2.763000	0.94921	0.563000	0.77884	GAC		0.582	ESR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280621.1		
CD276	80381	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	15	73995325	73995325	+	Missense_Mutation	SNP	G	G	T			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr15:73995325G>T	ENST00000318443.5	+	4	933	c.631G>T	c.(631-633)Gtg>Ttg	p.V211L	CD276_ENST00000564751.1_Intron|CD276_ENST00000537340.2_Missense_Mutation_p.V65L|CD276_ENST00000561213.1_Missense_Mutation_p.V211L|CD276_ENST00000318424.5_Intron	NM_001024736.1	NP_001019907.1	Q5ZPR3	CD276_HUMAN	CD276 molecule	211	Ig-like C2-type 1.				cell proliferation (GO:0008283)|immune response (GO:0006955)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interleukin-2 biosynthetic process (GO:0045085)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of bone mineralization (GO:0030501)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-2 secretion (GO:1900042)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of T cell proliferation (GO:0042102)|regulation of immune response (GO:0050776)|T cell activation (GO:0042110)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor binding (GO:0005102)			endometrium(3)|lung(5)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	13						CCTGCGGGTGGTGCTGGGTGC	0.632																																						.											0													97.0	78.0	85.0					15																	73995325		2198	4297	6495	SO:0001583	missense	80381			AF302102	CCDS10251.1, CCDS32288.1	15q23-q24	2013-01-11	2006-03-28		ENSG00000103855	ENSG00000103855		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	19137	protein-coding gene	gene with protein product		605715	"""CD276 antigen"""			11224528, 12055244	Standard	XM_005254699		Approved	B7-H3, B7H3, B7RP-2	uc002avv.1	Q5ZPR3	OTTHUMG00000137585	ENST00000318443.5:c.631G>T	15.37:g.73995325G>T	ENSP00000320084:p.Val211Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q6P5Y4|Q6UXI2|Q8NBI8|Q8NC34|Q8NCB6|Q9BXR1	Missense_Mutation	SNP	ENST00000318443.5	37	CCDS32288.1	.	.	.	.	.	.	.	.	.	.	G	5.969	0.362837	0.11296	.	.	ENSG00000103855	ENST00000318443;ENST00000379823;ENST00000537340	T;T	0.76709	-1.04;-1.04	3.29	1.34	0.21922	Immunoglobulin subtype 2 (1);CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.56156	0.1966	N	0.13235	0.315	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.08055	0.002;0.003;0.002	T	0.48490	-0.9031	9	0.41790	T	0.15	.	4.3949	0.11358	0.3111:0.177:0.5119:0.0	.	157;211;211	B4DK26;Q5ZPR3;Q5ZPR3-4	.;CD276_HUMAN;.	L	211;211;65	ENSP00000320084:V211L;ENSP00000441087:V65L	ENSP00000320084:V211L	V	+	1	0	CD276	71782378	0.996000	0.38824	1.000000	0.80357	0.135000	0.20990	0.346000	0.19997	0.712000	0.32039	0.313000	0.20887	GTG		0.632	CD276-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268979.1	NM_025240	
ZNF592	9640	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	15	85334093	85334093	+	Missense_Mutation	SNP	A	A	G	rs370083133		TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr15:85334093A>G	ENST00000560079.2	+	5	2666	c.2378A>G	c.(2377-2379)tAt>tGt	p.Y793C	ZNF592_ENST00000299927.3_Missense_Mutation_p.Y793C	NM_014630.2	NP_055445.2	Q92610	ZN592_HUMAN	zinc finger protein 592	793					cell death (GO:0008219)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|kidney(1)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(143;0.0587)			TGCCTGCACTATGCCCGCAAG	0.562																																						.											0								A	CYS/TYR	1,4405	2.1+/-5.4	0,1,2202	102.0	86.0	92.0		2378	5.6	1.0	15		92	0,8598		0,0,4299	no	missense	ZNF592	NM_014630.2	194	0,1,6501	GG,GA,AA		0.0,0.0227,0.0077	probably-damaging	793/1268	85334093	1,13003	2203	4299	6502	SO:0001583	missense	9640			D86966	CCDS32317.1	15q25.2	2011-03-15				ENSG00000166716		"""Zinc fingers, C2H2-type"""	28986	protein-coding gene	gene with protein product		613624	"""spinocerebellar ataxia, autosomal recessive 5"""	SCAR5		9039502, 12030328, 20531441	Standard	NM_014630		Approved	KIAA0211, CAMOS	uc002bld.3	Q92610		ENST00000560079.2:c.2378A>G	15.37:g.85334093A>G	ENSP00000452877:p.Tyr793Cys	Somatic		WXS	Illumina HiSeq	Phase_I	Q2M1T2|Q504Y9	Missense_Mutation	SNP	ENST00000560079.2	37	CCDS32317.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.198225	0.79015	2.27E-4	0.0	ENSG00000166716	ENST00000299927	T	0.03035	4.07	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.13713	0.0332	L	0.52011	1.625	0.53688	D	0.999975	D	0.89917	1.0	D	0.91635	0.999	T	0.00300	-1.1835	10	0.72032	D	0.01	-16.0348	13.7682	0.63008	1.0:0.0:0.0:0.0	.	793	Q92610	ZN592_HUMAN	C	793	ENSP00000299927:Y793C	ENSP00000299927:Y793C	Y	+	2	0	ZNF592	83135097	1.000000	0.71417	1.000000	0.80357	0.878000	0.50629	5.104000	0.64584	2.138000	0.66242	0.460000	0.39030	TAT		0.562	ZNF592-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418779.2	NM_014630	
ARL6IP1	23204	hgsc.bcm.edu	37	16	18806888	18806888	+	Silent	SNP	C	C	T	rs201647214		TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr16:18806888C>T	ENST00000304414.7	-	4	517	c.306G>A	c.(304-306)caG>caA	p.Q102Q	RP11-1035H13.3_ENST00000567078.2_Silent_p.Q102Q|ARL6IP1_ENST00000562819.1_Intron|ARL6IP1_ENST00000546206.2_Silent_p.Q73Q	NM_015161.1	NP_055976.1	Q15041	AR6P1_HUMAN	ADP-ribosylation factor-like 6 interacting protein 1	102					cell death (GO:0008219)|cotranslational protein targeting to membrane (GO:0006613)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|Sec61 translocon complex (GO:0005784)				breast(1)|large_intestine(2)|lung(6)|pancreas(1)|prostate(1)	11						GGAATCTTTGCTGTTGTTCAG	0.383																																						.											0													77.0	69.0	72.0					16																	18806888		2197	4300	6497	SO:0001819	synonymous_variant	23204			BC010281	CCDS10572.1	16p12-p11.2	2014-03-12	2006-09-26	2006-09-26	ENSG00000170540	ENSG00000170540			697	protein-coding gene	gene with protein product		607669	"""ADP-ribosylation factor-like 6 interacting protein"""	ARL6IP		24482476	Standard	NM_015161		Approved	AIP1, ARMER, KIAA0069, SPG61	uc002dfl.1	Q15041	OTTHUMG00000131367	ENST00000304414.7:c.306G>A	16.37:g.18806888C>T		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000304414.7	37	CCDS10572.1																																																																																				0.383	ARL6IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254156.2	NM_015161	
INADL	10207	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	1	62380292	62380292	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr1:62380292A>G	ENST00000371158.2	+	26	3640	c.3526A>G	c.(3526-3528)Atc>Gtc	p.I1176V	INADL_ENST00000316485.6_Missense_Mutation_p.I1176V	NM_176877.2	NP_795352	Q8NI35	INADL_HUMAN	InaD-like (Drosophila)	1176					cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|intracellular signal transduction (GO:0035556)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(8)|liver(1)|lung(51)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)	103						GGCCAACAAAATCACCGGTAA	0.358																																						.											0													92.0	98.0	96.0					1																	62380292		2203	4300	6503	SO:0001583	missense	10207			AB044807	CCDS617.2	1p31	2008-02-05			ENSG00000132849	ENSG00000132849			28881	protein-coding gene	gene with protein product		603199				9280290, 11374908	Standard	NM_176877		Approved	Cipp, PATJ	uc001dab.3	Q8NI35	OTTHUMG00000008560	ENST00000371158.2:c.3526A>G	1.37:g.62380292A>G	ENSP00000360200:p.Ile1176Val	Somatic		WXS	Illumina HiSeq	Phase_I	O15249|O43742|O60833|Q5VUA5|Q5VUA6|Q5VUA7|Q5VUA8|Q5VUA9|Q5VUB0|Q8WU78|Q9H3N9	Missense_Mutation	SNP	ENST00000371158.2	37	CCDS617.2	.	.	.	.	.	.	.	.	.	.	A	0.171	-1.071684	0.01918	.	.	ENSG00000132849	ENST00000371158;ENST00000316485;ENST00000371156;ENST00000395513	T;T	0.11604	2.89;2.76	4.69	-2.35	0.06684	.	0.883263	0.09789	N	0.755596	T	0.07503	0.0189	L	0.43152	1.355	0.09310	N	1	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.06405	0.002;0.001;0.002	T	0.44667	-0.9313	10	0.15499	T	0.54	.	5.5168	0.16912	0.3216:0.3144:0.364:0.0	.	1176;1176;1176	F8W8T2;Q8NI35;Q8NI35-4	.;INADL_HUMAN;.	V	1176	ENSP00000360200:I1176V;ENSP00000326199:I1176V	ENSP00000326199:I1176V	I	+	1	0	INADL	62152880	0.001000	0.12720	0.001000	0.08648	0.017000	0.09413	0.124000	0.15728	-0.165000	0.10908	-0.370000	0.07254	ATC		0.358	INADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023639.2	NM_170605	
LEPR	3953	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	1	66102278	66102278	+	Missense_Mutation	SNP	T	T	G	rs34130975		TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr1:66102278T>G	ENST00000349533.6	+	20	3263	c.3078T>G	c.(3076-3078)aaT>aaG	p.N1026K	LEPR_ENST00000406510.3_Missense_Mutation_p.N93K	NM_002303.5	NP_002294.2	O15243	OBRG_HUMAN	leptin receptor	0					negative regulation of growth hormone receptor signaling pathway (GO:0060400)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of protein localization to cell surface (GO:2000009)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(22)|skin(2)	36				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		CTTTCTCTAATAGCTCATGGG	0.398																																						.											0													76.0	84.0	81.0					1																	66102278		2200	4297	6497	SO:0001583	missense	3953			U43168	CCDS631.1, CCDS30740.1, CCDS30741.1, CCDS55604.1	1p31	2014-09-17			ENSG00000116678	ENSG00000116678		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6554	protein-coding gene	gene with protein product		601007				8548812, 8812446	Standard	NM_001003680		Approved	OBR, CD295	uc001dci.3	P48357	OTTHUMG00000009115	ENST00000349533.6:c.3078T>G	1.37:g.66102278T>G	ENSP00000330393:p.Asn1026Lys	Somatic		WXS	Illumina HiSeq	Phase_I	Q6FHL5	Missense_Mutation	SNP	ENST00000349533.6	37	CCDS631.1	.	.	.	.	.	.	.	.	.	.	T	4.357	0.065741	0.08388	.	.	ENSG00000116678	ENST00000349533;ENST00000406510	T	0.55760	0.5	5.4	-2.75	0.05914	.	0.793868	0.12345	N	0.477125	T	0.16514	0.0397	L	0.33485	1.01	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.27938	-1.0059	10	0.44086	T	0.13	-0.5985	7.554	0.27814	0.0:0.4301:0.2383:0.3316	.	1026	P48357	LEPR_HUMAN	K	1026;93	ENSP00000330393:N1026K	ENSP00000330393:N1026K	N	+	3	2	LEPR	65874866	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.591000	0.05753	-0.675000	0.05246	-1.133000	0.01973	AAT		0.398	LEPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025275.1	NM_002303	
FANCA	2175	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	16	89838101	89838101	+	Silent	SNP	C	C	T			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr16:89838101C>T	ENST00000389301.3	-	23	2166	c.2136G>A	c.(2134-2136)gaG>gaA	p.E712E	FANCA_ENST00000567284.2_5'UTR|FANCA_ENST00000568369.1_Silent_p.E712E	NM_000135.2	NP_000126.2	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A	712					DNA repair (GO:0006281)|female gonad development (GO:0008585)|male gonad development (GO:0008584)|male meiosis (GO:0007140)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(5)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|urinary_tract(3)	47		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		GTTCCCGTGGCTCCAGTCTCG	0.517			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													.	yes	Rec		Fanconi anaemia A	16	16q24.3	2175	"""Fanconi anemia, complementation group A"""		L	0													172.0	142.0	152.0					16																	89838101		2198	4300	6498	SO:0001819	synonymous_variant	2175	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	Z83067	CCDS32515.1, CCDS42221.1, CCDS67099.1	16q24.3	2014-09-17			ENSG00000187741	ENSG00000187741		"""Fanconi anemia, complementation groups"""	3582	protein-coding gene	gene with protein product		607139		FACA, FANCH		7581462, 9382107	Standard	NM_001286167		Approved	FAA, FA-H, FAH	uc002fou.1	O15360		ENST00000389301.3:c.2136G>A	16.37:g.89838101C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A5D923|B4DRI7|H3BSR5|O75266|Q6PL10|Q92497|Q96H18|Q9UEA5|Q9UEL8|Q9UEL9|Q9UPK3|Q9Y6M2	Silent	SNP	ENST00000389301.3	37	CCDS32515.1																																																																																				0.517	FANCA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000421927.1		
SUPT6H	6830	hgsc.bcm.edu;bcgsc.ca	37	17	27028052	27028052	+	Nonsense_Mutation	SNP	C	C	T			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr17:27028052C>T	ENST00000314616.6	+	36	5183	c.4900C>T	c.(4900-4902)Cag>Tag	p.Q1634*	SUPT6H_ENST00000347486.4_Nonsense_Mutation_p.Q1634*	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	1634	Interaction with histone H2B and H3.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					CACCACCCCTCAGTACCACCA	0.642																																						.											0													185.0	172.0	176.0					17																	27028052		2203	4300	6503	SO:0001587	stop_gained	6830			U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.4900C>T	17.37:g.27028052C>T	ENSP00000319104:p.Gln1634*	Somatic		WXS	Illumina HiSeq	Phase_I	A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Nonsense_Mutation	SNP	ENST00000314616.6	37	CCDS32596.1	.	.	.	.	.	.	.	.	.	.	C	46	12.401632	0.99664	.	.	ENSG00000109111	ENST00000314616;ENST00000347486	.	.	.	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.7182	18.8074	0.92043	0.0:1.0:0.0:0.0	.	.	.	.	X	1634;634	.	ENSP00000319104:Q1634X	Q	+	1	0	SUPT6H	24052179	1.000000	0.71417	0.988000	0.46212	0.899000	0.52679	7.209000	0.77916	2.465000	0.83290	0.650000	0.86243	CAG		0.642	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446422.2	NM_003170	
SCN4A	6329	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	17	62021160	62021160	+	Silent	SNP	G	G	A			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr17:62021160G>A	ENST00000435607.1	-	22	4039	c.3963C>T	c.(3961-3963)aaC>aaT	p.N1321N	SCN4A_ENST00000578147.1_Silent_p.N1321N	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	1321					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TCTTCATGGCGTTATAGTATT	0.547																																						.											0													98.0	99.0	99.0					17																	62021160		2157	4294	6451	SO:0001819	synonymous_variant	6329			U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.3963C>T	17.37:g.62021160G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q15478|Q16447|Q7Z6B1	Silent	SNP	ENST00000435607.1	37	CCDS45761.1																																																																																				0.547	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_000334	
CAPNS1	826	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	19	36632120	36632120	+	Silent	SNP	C	C	T			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr19:36632120C>T	ENST00000246533.3	+	2	805	c.207C>T	c.(205-207)atC>atT	p.I69I	AD001527.7_ENST00000604228.1_RNA|CAPNS1_ENST00000588780.1_Silent_p.I69I|CAPNS1_ENST00000587718.1_Silent_p.I69I|CAPNS1_ENST00000589146.1_Intron|CAPNS1_ENST00000588815.1_Silent_p.I69I|CAPNS1_ENST00000590874.1_Silent_p.I69I	NM_001003962.1|NM_001749.2	NP_001003962.1|NP_001740.1	P04632	CPNS1_HUMAN	calpain, small subunit 1	69					extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell proliferation (GO:0008284)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			cervix(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	5	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			TCAGCGCCATCAGGTAAGGCG	0.692																																					Esophageal Squamous(129;1541 1691 5780 18353 34150)	.											0													10.0	9.0	9.0					19																	36632120		2183	4282	6465	SO:0001819	synonymous_variant	826			X04106	CCDS12489.1	19q13.1	2013-01-10		2001-08-10	ENSG00000126247	ENSG00000126247	3.4.22.52	"""EF-hand domain containing"""	1481	protein-coding gene	gene with protein product		114170		CAPN4		3024120, 3016651	Standard	NM_001003962		Approved	CANP, CANPS, 30K, CDPS	uc002odj.3	P04632		ENST00000246533.3:c.207C>T	19.37:g.36632120C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A8K0P1|Q8WTX3|Q96EW0	Silent	SNP	ENST00000246533.3	37	CCDS12489.1																																																																																				0.692	CAPNS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457411.2		
KCNN4	3783	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	19	44276195	44276195	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr19:44276195C>T	ENST00000262888.3	-	4	1171	c.776G>A	c.(775-777)gGc>gAc	p.G259D		NM_002250.2	NP_002241.1	O15554	KCNN4_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4	259					calcium ion transport (GO:0006816)|cell volume homeostasis (GO:0006884)|defense response (GO:0006952)|immune system process (GO:0002376)|phospholipid translocation (GO:0045332)|positive regulation of protein secretion (GO:0050714)|positive regulation of T cell receptor signaling pathway (GO:0050862)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|saliva secretion (GO:0046541)|stabilization of membrane potential (GO:0030322)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|Intermediate conductance calcium-activated potassium channel activity (GO:0022894)|protein phosphatase binding (GO:0019903)			biliary_tract(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	15		Prostate(69;0.0352)			Clotrimazole(DB00257)|Enflurane(DB00228)|Halothane(DB01159)|Miconazole(DB01110)|Procaine(DB00721)|Quinine(DB00468)	CCACATGGTGCCCGGCACCAC	0.572																																						.											0													150.0	114.0	126.0					19																	44276195		2203	4300	6503	SO:0001583	missense	3783			AF022797	CCDS12630.1	19q13.2	2012-07-05				ENSG00000104783		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6293	protein-coding gene	gene with protein product		602754				9380751, 9407042, 16382103	Standard	NM_002250		Approved	KCa3.1, hSK4, hKCa4, hIKCa1	uc002oxl.3	O15554		ENST00000262888.3:c.776G>A	19.37:g.44276195C>T	ENSP00000262888:p.Gly259Asp	Somatic		WXS	Illumina HiSeq	Phase_I	Q53XR4	Missense_Mutation	SNP	ENST00000262888.3	37	CCDS12630.1	.	.	.	.	.	.	.	.	.	.	C	15.91	2.972251	0.53614	.	.	ENSG00000104783	ENST00000262888;ENST00000407385	T	0.23552	1.9	5.28	5.28	0.74379	Ion transport 2 (1);	0.399496	0.28125	N	0.016502	T	0.18551	0.0445	N	0.11756	0.17	0.46478	D	0.999061	D;D	0.53312	0.959;0.959	P;P	0.47251	0.542;0.542	T	0.01280	-1.1397	10	0.51188	T	0.08	-20.4112	10.2688	0.43470	0.0:0.9096:0.0:0.0904	.	153;259	D1MQ10;O15554	.;KCNN4_HUMAN	D	259;127	ENSP00000262888:G259D	ENSP00000262888:G259D	G	-	2	0	KCNN4	48968035	0.551000	0.26497	0.990000	0.47175	0.990000	0.78478	1.525000	0.35953	2.648000	0.89879	0.561000	0.74099	GGC		0.572	KCNN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463598.1	NM_002250	
KIR3DL1	3811	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	19	55285024	55285024	+	Intron	SNP	G	G	C			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr19:55285024G>C	ENST00000538269.1	+	2	61				KIR2DL1_ENST00000336077.6_Missense_Mutation_p.V104L|KIR2DL1_ENST00000291633.7_Missense_Mutation_p.V104L|KIR3DL1_ENST00000541392.1_Intron|CTB-61M7.1_ENST00000400864.3_RNA|KIR3DL1_ENST00000402254.2_Intron|KIR2DL4_ENST00000396284.2_Intron|KIR2DL3_ENST00000434419.2_Intron			P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1						immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(193;0.0192)		CTACGGTTCTGTTACTCACTC	0.532																																						.											0													272.0	244.0	254.0					19																	55285024		2177	4210	6387	SO:0001627	intron_variant	3802			L41269	CCDS42621.1	19q13.4	2014-05-22			ENSG00000167633	ENSG00000167633		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6338	protein-coding gene	gene with protein product		604946		KIR		7716543, 7749980	Standard	NM_013289		Approved	cl-2, NKB1, cl-11, nkat3, NKB1B, AMB11, CD158e1/2, CD158E1, CD158e2		P43629	OTTHUMG00000065933	ENST00000538269.1:c.35-43965G>C	19.37:g.55285024G>C		Somatic		WXS	Illumina HiSeq	Phase_I	O43473|Q14946|Q16541	Missense_Mutation	SNP	ENST00000538269.1	37		.	.	.	.	.	.	.	.	.	.	g	0.614	-0.823718	0.02755	.	.	ENSG00000125498	ENST00000336077;ENST00000291633	T;T	0.00717	5.79;5.79	1.24	-2.48	0.06423	.	.	.	.	.	T	0.00637	0.0021	L	0.29908	0.895	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.51647	-0.8679	9	0.51188	T	0.08	.	1.1611	0.01806	0.1669:0.2905:0.3355:0.2071	.	104;104	Q6IST4;Q6H2H3	.;.	L	104	ENSP00000336769:V104L;ENSP00000291633:V104L	ENSP00000291633:V104L	V	+	1	0	KIR2DL1	59976836	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.538000	0.00438	-4.634000	0.00038	-3.779000	0.00021	GTT		0.532	KIR3DL1-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_013289	
SULF2	55959	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	20	46313215	46313215	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr20:46313215C>T	ENST00000359930.4	-	6	1699	c.848G>A	c.(847-849)cGc>cAc	p.R283H	SULF2_ENST00000361612.4_Missense_Mutation_p.R283H|CTD-2653D5.1_ENST00000526566.2_RNA|SULF2_ENST00000467815.1_Missense_Mutation_p.R283H|SULF2_ENST00000484875.1_Missense_Mutation_p.R283H	NM_018837.3	NP_061325.1	Q8IWU5	SULF2_HUMAN	sulfatase 2	283					bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|endometrium(4)|kidney(1)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	54						GGTCTGCAAGCGCTTCCGCTG	0.627																																						.											0													122.0	91.0	102.0					20																	46313215		2203	4300	6503	SO:0001583	missense	55959			AY101176	CCDS13408.1, CCDS13409.1, CCDS13409.2	20q13.12-q13.13	2008-05-14			ENSG00000196562	ENSG00000196562			20392	protein-coding gene	gene with protein product		610013				12368295	Standard	NM_018837		Approved	KIAA1247, HSULF-2, SULF-2	uc002xto.3	Q8IWU5	OTTHUMG00000032675	ENST00000359930.4:c.848G>A	20.37:g.46313215C>T	ENSP00000353007:p.Arg283His	Somatic		WXS	Illumina HiSeq	Phase_I	E1P5U6|Q5JYE1|Q6UX86|Q96SG2|Q9H1H0|Q9UJR3|Q9ULH3	Missense_Mutation	SNP	ENST00000359930.4	37	CCDS13408.1	.	.	.	.	.	.	.	.	.	.	c	35	5.558879	0.96514	.	.	ENSG00000196562	ENST00000359930;ENST00000484875;ENST00000361612;ENST00000467815	D;D;D;D	0.98684	-5.07;-5.07;-5.07;-5.07	4.76	4.76	0.60689	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.050148	0.85682	D	0.000000	D	0.99387	0.9784	H	0.94847	3.59	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.78314	0.927;0.991	D	0.98567	1.0644	10	0.87932	D	0	-23.6	18.0184	0.89248	0.0:1.0:0.0:0.0	.	283;283	Q8IWU5-2;Q8IWU5	.;SULF2_HUMAN	H	283	ENSP00000353007:R283H;ENSP00000418290:R283H;ENSP00000354662:R283H;ENSP00000418442:R283H	ENSP00000353007:R283H	R	-	2	0	SULF2	45746622	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.600000	0.82769	2.489000	0.83994	0.537000	0.68136	CGC		0.627	SULF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079606.1	NM_018837	
KRTAP10-4	386672	hgsc.bcm.edu;mdanderson.org	37	21	45993747	45993747	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr21:45993747G>A	ENST00000400374.3	+	1	142	c.112G>A	c.(112-114)Gag>Aag	p.E38K	TSPEAR_ENST00000323084.4_Intron|TSPEAR_ENST00000397916.1_5'Flank	NM_198687.1	NP_941960.1	P60372	KR104_HUMAN	keratin associated protein 10-4	38	36 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				NS(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(9)|pancreas(1)|prostate(1)	18						GAGCTGCTGCGAGCCCCCCTG	0.697																																						.											0													38.0	42.0	41.0					21																	45993747		1969	4113	6082	SO:0001583	missense	386672			AB076351	CCDS42957.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000215454	ENSG00000215454		"""Keratin associated proteins"""	20521	protein-coding gene	gene with protein product			"""keratin associated protein 18-4"""	KRTAP18-4			Standard	NM_198687		Approved	KRTAP18.4, KAP10.4	uc002zfk.1	P60372	OTTHUMG00000057641	ENST00000400374.3:c.112G>A	21.37:g.45993747G>A	ENSP00000383225:p.Glu38Lys	Somatic		WXS	Illumina HiSeq	Phase_I	Q08AS0	Missense_Mutation	SNP	ENST00000400374.3	37	CCDS42957.1	.	.	.	.	.	.	.	.	.	.	N	16.62	3.175003	0.57692	.	.	ENSG00000215454	ENST00000400374;ENST00000334871	T	0.14766	2.48	4.69	3.8	0.43715	.	.	.	.	.	T	0.28466	0.0704	M	0.76170	2.325	0.24203	N	0.995509	D	0.76494	0.999	P	0.57911	0.829	T	0.08994	-1.0695	9	0.54805	T	0.06	.	6.9169	0.24365	0.0961:0.1791:0.7249:0.0	.	38	P60372	KR104_HUMAN	K	38;27	ENSP00000383225:E38K	ENSP00000333987:E27K	E	+	1	0	KRTAP10-4	44818175	0.116000	0.22171	0.987000	0.45799	0.411000	0.31082	1.362000	0.34148	1.080000	0.41073	-0.458000	0.05436	GAG		0.697	KRTAP10-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128045.1	NM_198687	
ZNF142	7701	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	2	219513452	219513452	+	Missense_Mutation	SNP	C	C	G			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr2:219513452C>G	ENST00000449707.1	-	6	1600	c.1179G>C	c.(1177-1179)aaG>aaC	p.K393N	ZNF142_ENST00000411696.2_Missense_Mutation_p.K393N	NM_001105537.1	NP_001099007.1	P52746	ZN142_HUMAN	zinc finger protein 142	393					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(7)|endometrium(7)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38		Renal(207;0.0474)		Epithelial(149;5.21e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		gagcaTGCATCTTGCCTACAT	0.542											OREG0015202	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Colon(170;867 1942 8995 15834 18053)	.											0													96.0	90.0	92.0					2																	219513452		2076	4224	6300	SO:0001583	missense	7701			U09849	CCDS42817.1	2q35	2013-01-08	2006-06-13		ENSG00000115568	ENSG00000115568		"""Zinc fingers, C2H2-type"""	12927	protein-coding gene	gene with protein product		604083	"""zinc finger protein 142 (clone pHZ-49)"""				Standard	NM_001105537		Approved	KIAA0236, pHZ-49	uc002vin.4	P52746	OTTHUMG00000154736	ENST00000449707.1:c.1179G>C	2.37:g.219513452C>G	ENSP00000408643:p.Lys393Asn	Somatic	2259	WXS	Illumina HiSeq	Phase_I	Q92510	Missense_Mutation	SNP	ENST00000449707.1	37	CCDS42817.1	.	.	.	.	.	.	.	.	.	.	C	16.42	3.118889	0.56505	.	.	ENSG00000115568	ENST00000449707;ENST00000411696	T;T	0.14144	2.53;2.53	5.87	4.99	0.66335	Zinc finger, C2H2-like (1);	0.091759	0.85682	D	0.000000	T	0.31544	0.0800	M	0.72894	2.215	0.41280	D	0.986901	D;P	0.54964	0.969;0.955	P;P	0.57468	0.711;0.821	T	0.01162	-1.1432	10	0.72032	D	0.01	-6.4339	14.7909	0.69841	0.0:0.9311:0.0:0.0689	.	393;230	P52746;A8MWU9	ZN142_HUMAN;.	N	393	ENSP00000408643:K393N;ENSP00000398798:K393N	ENSP00000398798:K393N	K	-	3	2	ZNF142	219221696	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.872000	0.48467	2.941000	0.99782	0.655000	0.94253	AAG		0.542	ZNF142-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336833.1	NM_005081	
ALPPL2	251	hgsc.bcm.edu;mdanderson.org	37	2	233274094	233274094	+	Silent	SNP	C	C	T	rs563231782	byFrequency	TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr2:233274094C>T	ENST00000295453.3	+	10	1288	c.1236C>T	c.(1234-1236)taC>taT	p.Y412Y		NM_031313.2	NP_112603.2	P10696	PPBN_HUMAN	alkaline phosphatase, placental-like 2	412					dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|metal ion binding (GO:0046872)			breast(2)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|skin(1)	13		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)	Amifostine(DB01143)	TCCTCCTATACGGAAACGGTC	0.662													c|||	2	0.000399361	0.0	0.0029	5008	,	,		12898	0.0		0.0	False		,,,				2504	0.0					.											0													14.0	12.0	13.0					2																	233274094		2132	4175	6307	SO:0001819	synonymous_variant	251			J04948	CCDS2491.1	2q37	2008-05-20			ENSG00000163286	ENSG00000163286			441	protein-coding gene	gene with protein product		171810					Standard	NM_031313		Approved		uc002vss.4	P10696	OTTHUMG00000133257	ENST00000295453.3:c.1236C>T	2.37:g.233274094C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A8KAF2|Q16727|Q53S81|Q96CM1	Silent	SNP	ENST00000295453.3	37	CCDS2491.1																																																																																				0.662	ALPPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257034.2	NM_031313	
PHF5A	84844	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	22	41863526	41863526	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr22:41863526G>A	ENST00000216252.3	-	3	240	c.169C>T	c.(169-171)Cgc>Tgc	p.R57C	ACO2_ENST00000396512.3_5'Flank|ACO2_ENST00000216254.4_5'Flank|PHF5A_ENST00000491254.1_5'UTR	NM_032758.3	NP_116147.1	Q7RTV0	PHF5A_HUMAN	PHD finger protein 5A	57					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of transcription, DNA-templated (GO:0045893)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|U12-type spliceosomal complex (GO:0005689)|U2 snRNP (GO:0005686)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R57S(1)		central_nervous_system(1)|large_intestine(2)|lung(1)	4						ATCACACAGCGCCCCTGGTAA	0.507																																					Ovarian(15;130 571 1826 2981 46141)	.											1	Substitution - Missense(1)	central_nervous_system(1)											104.0	85.0	91.0					22																	41863526		2203	4300	6503	SO:0001583	missense	84844			BC007321	CCDS14016.1	22q13.2	2014-02-14			ENSG00000100410	ENSG00000100410		"""Zinc fingers, PHD-type"""	18000	protein-coding gene	gene with protein product	"""splicing factor 3b, subunit 7"""					12054543, 12234937, 18076038	Standard	NM_032758		Approved	MGC1346, SF3b14b, INI, bK223H9.2, Rds3, SAP14b, SF3B7	uc003bab.3	Q7RTV0	OTTHUMG00000150966	ENST00000216252.3:c.169C>T	22.37:g.41863526G>A	ENSP00000216252:p.Arg57Cys	Somatic		WXS	Illumina HiSeq	Phase_I	Q9UH06	Missense_Mutation	SNP	ENST00000216252.3	37	CCDS14016.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.704285	0.88924	.	.	ENSG00000100410	ENST00000216252	.	.	.	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.79707	0.4492	M	0.89658	3.05	0.80722	D	1	B	0.27229	0.172	B	0.31245	0.126	T	0.79035	-0.1968	9	0.51188	T	0.08	-18.9427	19.8379	0.96666	0.0:0.0:1.0:0.0	.	57	Q7RTV0	PHF5A_HUMAN	C	57	.	ENSP00000216252:R57C	R	-	1	0	PHF5A	40193472	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	9.547000	0.98100	2.765000	0.95021	0.655000	0.94253	CGC		0.507	PHF5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320686.1	NM_032758	
ODF3B	440836	hgsc.bcm.edu	37	22	50970068	50970068	+	Missense_Mutation	SNP	C	C	T	rs141953471	byFrequency	TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr22:50970068C>T	ENST00000428989.2	-	2	243	c.244G>A	c.(244-246)Gac>Aac	p.D82N	TYMP_ENST00000395681.1_5'Flank|TYMP_ENST00000252029.3_5'Flank|ODF3B_ENST00000401779.1_Missense_Mutation_p.R58Q|TYMP_ENST00000395678.3_5'Flank|TYMP_ENST00000395680.1_5'Flank|ODF3B_ENST00000329363.4_Missense_Mutation_p.D82N|ODF3B_ENST00000405135.1_Missense_Mutation_p.D82N|ODF3B_ENST00000403326.1_Intron			A8MYP8	ODF3B_HUMAN	outer dense fiber of sperm tails 3B	82										lung(2)	2						GGGGCGCCGTCGGTGCCGCGC	0.761													C|||	91	0.0181709	0.0159	0.0144	5008	,	,		9314	0.0		0.0487	False		,,,				2504	0.0112					.											0								C	ASN/ASP	68,3178		1,66,1556	3.0	5.0	5.0		244	3.1	0.0	22	dbSNP_134	5	281,6899		5,271,3314	no	missense	ODF3B	NM_001014440.3	23	6,337,4870	TT,TC,CC		3.9136,2.0949,3.3474	possibly-damaging	82/254	50970068	349,10077	1623	3590	5213	SO:0001583	missense	440836				CCDS43039.1	22q13.33	2008-10-24			ENSG00000177989	ENSG00000177989			34388	protein-coding gene	gene with protein product							Standard	NM_001014440		Approved		uc003bmh.2	A8MYP8	OTTHUMG00000150334	ENST00000428989.2:c.244G>A	22.37:g.50970068C>T	ENSP00000390712:p.Asp82Asn	Somatic		WXS	Illumina HiSeq	Phase_I	A0PK18	Missense_Mutation	SNP	ENST00000428989.2	37	CCDS43039.1	58|58	0.026556776556776556|0.026556776556776556	15|15	0.03048780487804878|0.03048780487804878	8|8	0.022099447513812154|0.022099447513812154	0|0	0.0|0.0	35|35	0.04617414248021108|0.04617414248021108	C|C	13.50|13.50	2.254753|2.254753	0.39896|0.39896	0.020949|0.020949	0.039136|0.039136	ENSG00000177989|ENSG00000177989	ENST00000329363;ENST00000405135;ENST00000428989|ENST00000401779;ENST00000438960	T;T;T|.	0.34472|.	1.39;1.36;1.39|.	4.1|4.1	3.06|3.06	0.35304|0.35304	.|.	.|.	.|.	.|.	.|.	T|T	0.09379|0.09379	0.0231|0.0231	M|M	0.75615|0.75615	2.305|2.305	0.09310|0.09310	N|N	1|1	P|P	0.44090|0.46020	0.826|0.871	B|B	0.37047|0.39258	0.24|0.295	T|T	0.06588|0.06588	-1.0818|-1.0818	9|8	0.34782|0.56958	T|D	0.22|0.05	-5.2376|-5.2376	9.2168|9.2168	0.37353|0.37353	0.2168:0.7832:0.0:0.0|0.2168:0.7832:0.0:0.0	.|.	82|58	A8MYP8|B5MD02	ODF3B_HUMAN|.	N|Q	82|58;48	ENSP00000382804:D82N;ENSP00000384012:D82N;ENSP00000390712:D82N|.	ENSP00000382804:D82N|ENSP00000384310:R58Q	D|R	-|-	1|2	0|0	ODF3B|ODF3B	49316934|49316934	0.945000|0.945000	0.32115|0.32115	0.004000|0.004000	0.12327|0.12327	0.192000|0.192000	0.23643|0.23643	2.862000|2.862000	0.48388|0.48388	1.033000|1.033000	0.39918|0.39918	0.462000|0.462000	0.41574|0.41574	GAC|CGA		0.761	ODF3B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317626.2		
HNRNPLL	92906	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	2	38818735	38818735	+	Missense_Mutation	SNP	C	C	A			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr2:38818735C>A	ENST00000449105.3	-	2	584	c.245G>T	c.(244-246)gGa>gTa	p.G82V	HNRNPLL_ENST00000378915.3_Missense_Mutation_p.G82V|HNRNPLL_ENST00000409636.1_Missense_Mutation_p.G77V|HNRNPLL_ENST00000608859.1_Missense_Mutation_p.G82V|HNRNPLL_ENST00000409328.1_Missense_Mutation_p.G82V|HNRNPLL_ENST00000410076.1_Missense_Mutation_p.G77V|HNRNPLL_ENST00000498516.1_5'UTR|HNRNPLL_ENST00000358367.4_Missense_Mutation_p.G82V			Q8WVV9	HNRLL_HUMAN	heterogeneous nuclear ribonucleoprotein L-like	82	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|positive regulation of RNA splicing (GO:0033120)	membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)										TTCACAGAGTCCTCGAACATG	0.403																																						.											0													125.0	120.0	122.0					2																	38818735		2203	4300	6503	SO:0001583	missense	92906			BC008217	CCDS46261.1, CCDS1796.2	2p22	2014-02-10		2013-06-12	ENSG00000143889	ENSG00000143889		"""RNA binding motif (RRM) containing"""	25127	protein-coding gene	gene with protein product		611208		HNRPLL		18669861	Standard	NM_138394		Approved		uc021vgc.1	Q8WVV9	OTTHUMG00000102075	ENST00000449105.3:c.245G>T	2.37:g.38818735C>A	ENSP00000390625:p.Gly82Val	Somatic		WXS	Illumina HiSeq	Phase_I	Q53T80|Q5JB51|Q5JB52|Q659B9|Q8IVH5|Q8IVH6|Q96HR5	Missense_Mutation	SNP	ENST00000449105.3	37		.	.	.	.	.	.	.	.	.	.	C	34	5.354370	0.95830	.	.	ENSG00000143889	ENST00000449105;ENST00000409636;ENST00000378915;ENST00000409328;ENST00000358367;ENST00000410076;ENST00000425682	T;T;T;T;T;T;T	0.12361	2.69;2.69;2.69;2.69;2.69;2.69;2.69	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.48926	0.1527	M	0.89715	3.055	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.56153	-0.8026	10	0.87932	D	0	.	20.1992	0.98252	0.0:1.0:0.0:0.0	.	77;82	C9J9G0;D6W592	.;.	V	82;77;82;82;82;77;21	ENSP00000390625:G82V;ENSP00000387088:G77V;ENSP00000368195:G82V;ENSP00000386575:G82V;ENSP00000351136:G82V;ENSP00000386695:G77V;ENSP00000396669:G21V	ENSP00000351136:G82V	G	-	2	0	HNRPLL	38672239	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.515000	0.81761	2.775000	0.95449	0.650000	0.86243	GGA		0.403	HNRNPLL-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000219887.2	NM_138394	
SRSF7	6432	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	2	38978394	38978394	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr2:38978394G>A	ENST00000313117.6	-	1	242	c.5C>T	c.(4-6)tCg>tTg	p.S2L	SRSF7_ENST00000446327.2_Missense_Mutation_p.S2L|SRSF7_ENST00000409276.1_Missense_Mutation_p.S2L|GEMIN6_ENST00000409011.1_5'Flank	NM_001031684.2|NM_001195446.1	NP_001026854.1|NP_001182375.1	Q16629	SRSF7_HUMAN	serine/arginine-rich splicing factor 7	2					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12						CCCGTAACGCGACATGATGAC	0.627																																						.											0													188.0	146.0	160.0					2																	38978394		2203	4300	6503	SO:0001583	missense	6432			L41887	CCDS33183.1, CCDS56115.1	2p22.1	2013-02-12	2010-06-22	2010-06-22	ENSG00000115875	ENSG00000115875		"""Zinc fingers, CCHC domain containing"", ""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10789	protein-coding gene	gene with protein product	"""SR splicing factor 7"""	600572	"""splicing factor, arginine/serine-rich 7 (35kD)"", ""splicing factor, arginine/serine-rich 7, 35kDa"""	SFRS7		8013463, 20516191	Standard	NM_001031684		Approved	9G8, ZCRB2, HSSG1, AAG3, RBM37, ZCCHC20	uc002rqz.3	Q16629	OTTHUMG00000102076	ENST00000313117.6:c.5C>T	2.37:g.38978394G>A	ENSP00000325905:p.Ser2Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B4DLU6|G5E9M3|Q564D3	Missense_Mutation	SNP	ENST00000313117.6	37	CCDS33183.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.846108	0.91277	.	.	ENSG00000115875	ENST00000313117;ENST00000446327;ENST00000409276	T;T;T	0.26957	1.77;1.7;2.38	4.98	4.98	0.66077	.	0.610527	0.14490	N	0.316430	T	0.47002	0.1422	M	0.82323	2.585	0.80722	D	1	P;P	0.51449	0.945;0.909	P;B	0.50314	0.637;0.434	T	0.54510	-0.8283	10	0.72032	D	0.01	.	17.4054	0.87472	0.0:0.0:1.0:0.0	.	2;2	G5E9M3;Q16629	.;SRSF7_HUMAN	L	2	ENSP00000325905:S2L;ENSP00000402264:S2L;ENSP00000386806:S2L	ENSP00000325905:S2L	S	-	2	0	SRSF7	38831898	1.000000	0.71417	1.000000	0.80357	0.762000	0.43233	6.372000	0.73123	2.574000	0.86865	0.561000	0.74099	TCG		0.627	SRSF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219889.2	NM_001031684	
EIF4EBP3	8637	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	5	139928655	139928655	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr5:139928655A>G	ENST00000310331.2	+	2	340	c.268A>G	c.(268-270)Ata>Gta	p.I90V	ANKHD1_ENST00000297183.6_Missense_Mutation_p.D2615G|ANKHD1-EIF4EBP3_ENST00000532219.1_Missense_Mutation_p.D2615G|SRA1_ENST00000520427.1_5'Flank	NM_003732.2	NP_003723.1	O60516	4EBP3_HUMAN	eukaryotic translation initiation factor 4E binding protein 3	90					negative regulation of translational initiation (GO:0045947)	eukaryotic translation initiation factor 4F complex (GO:0016281)|membrane (GO:0016020)	translation repressor activity (GO:0030371)			endometrium(1)|ovary(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGAGGAAGAGATACCCGGTAA	0.557																																						.											0													48.0	50.0	49.0					5																	139928655		2203	4300	6503	SO:0001583	missense	404734			AF038869	CCDS4226.1	5q31.3	2007-07-18			ENSG00000243056	ENSG00000243056			3290	protein-coding gene	gene with protein product		603483				9593750	Standard	NM_003732		Approved	4E-BP3	uc003lfy.1	O60516	OTTHUMG00000129498	ENST00000310331.2:c.268A>G	5.37:g.139928655A>G	ENSP00000308472:p.Ile90Val	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000310331.2	37	CCDS4226.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.54|18.54	3.646949|3.646949	0.67358|0.67358	.|.	.|.	ENSG00000131503;ENSG00000254996;ENSG00000254996|ENSG00000243056	ENST00000297183;ENST00000532219;ENST00000437495|ENST00000310331	T;T;T|.	0.73258|.	-0.73;-0.73;0.58|.	5.49|5.49	5.49|5.49	0.81192|0.81192	.|.	.|.	.|.	.|.	.|.	T|T	0.40222|0.40222	0.1108|0.1108	N|N	0.17474|0.17474	0.49|0.49	0.39119|0.39119	D|D	0.961632|0.961632	B|B	0.12013|0.06786	0.005|0.001	B|B	0.14023|0.04013	0.01|0.001	T|T	0.32666|0.32666	-0.9898|-0.9898	8|7	.|.	.|.	.|.	.|.	12.9688|12.9688	0.58501|0.58501	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	2615|90	Q8IWZ2|O60516	.|4EBP3_HUMAN	G|V	2615;2615;634|90	ENSP00000297183:D2615G;ENSP00000432016:D2615G;ENSP00000396882:D634G|.	.|.	D|I	+|+	2|1	0|0	ANKHD1-EIF4EBP3;ANKHD1|EIF4EBP3	139908839|139908839	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	3.202000|3.202000	0.51067|0.51067	2.091000|2.091000	0.63221|0.63221	0.533000|0.533000	0.62120|0.62120	GAT|ATA		0.557	EIF4EBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251668.2	NM_003732	
MTCH1	23787	broad.mit.edu;hgsc.bcm.edu	37	6	36938223	36938223	+	Frame_Shift_Del	DEL	G	G	-			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr6:36938223delG	ENST00000373627.5	-	10	1105	c.981delC	c.(979-981)cccfs	p.P327fs	MTCH1_ENST00000538808.1_Frame_Shift_Del_p.P154fs|MTCH1_ENST00000471737.1_5'UTR|MTCH1_ENST00000373616.5_Frame_Shift_Del_p.P310fs	NM_001271641.1	NP_001258570.1	Q9NZJ7	MTCH1_HUMAN	mitochondrial carrier 1	327					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|neuronal ion channel clustering (GO:0045161)|positive regulation of apoptotic process (GO:0043065)|regulation of signal transduction (GO:0009966)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)				endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)	6						CTAGCAGGAAGGGGTAGGTCA	0.622																																						.											0													87.0	79.0	82.0					6																	36938223		2203	4300	6503	SO:0001589	frameshift_variant	23787			AF151822	CCDS4828.1, CCDS64411.1	6p21.2	2013-05-22	2011-05-19		ENSG00000137409	ENSG00000137409		"""Solute carriers"""	17586	protein-coding gene	gene with protein product	"""solute carrier family 25, member 49"""	610449	"""mitochondrial carrier homolog 1 (C. elegans)"""			12377771	Standard	NM_014341		Approved	CGI-64, PSAP, SLC25A49	uc003ond.2	Q9NZJ7	OTTHUMG00000014614	ENST00000373627.5:c.981delC	6.37:g.36938223delG	ENSP00000362730:p.Pro327fs	Somatic		WXS	Illumina HiSeq	Phase_I	A8KAX5|B2RCE3|Q6PK60|Q6UX45|Q7L465|Q9BW23|Q9NZR6|Q9UJZ5	Frame_Shift_Del	DEL	ENST00000373627.5	37																																																																																					0.622	MTCH1-008	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000040396.1	NM_014341	
KCNQ5	56479	hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	6	73787542	73787542	+	Missense_Mutation	SNP	G	G	T			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr6:73787542G>T	ENST00000370398.1	+	5	959	c.850G>T	c.(850-852)Gtc>Ttc	p.V284F	KCNQ5_ENST00000402622.2_Missense_Mutation_p.V284F|KCNQ5_ENST00000403813.2_Missense_Mutation_p.V284F|KCNQ5_ENST00000370392.1_Missense_Mutation_p.V284F|KCNQ5_ENST00000355635.3_Missense_Mutation_p.V284F|KCNQ5_ENST00000355194.4_Missense_Mutation_p.V284F|KCNQ5_ENST00000414165.2_Missense_Mutation_p.V284F|KCNQ5_ENST00000342056.2_Missense_Mutation_p.V284F	NM_019842.3	NP_062816.2	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 5	284					protein complex assembly (GO:0006461)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|inward rectifier potassium channel activity (GO:0005242)			breast(1)|cervix(1)|endometrium(6)|kidney(7)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	57		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)	Ezogabine(DB04953)	GTCTTTCCTTGTCTATCTGGT	0.333																																					GBM(142;1375 1859 14391 23261 44706)	.											0													130.0	112.0	118.0					6																	73787542		2203	4300	6503	SO:0001583	missense	56479			AF202977	CCDS4976.1, CCDS55034.1	6q14	2012-07-05			ENSG00000185760	ENSG00000185760		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6299	protein-coding gene	gene with protein product		607357				10787416, 10816588, 16382104	Standard	NM_019842		Approved	Kv7.5	uc011dyh.2	Q9NR82	OTTHUMG00000015020	ENST00000370398.1:c.850G>T	6.37:g.73787542G>T	ENSP00000359425:p.Val284Phe	Somatic		WXS	Illumina HiSeq	Phase_I	A6NKT6|A6PVT6|A8MSQ5|B4DS33|B5MC83|B7ZL37|F5GZV0|Q17RE1|Q5VVP3|Q86W40|Q9NRN0|Q9NYA6	Missense_Mutation	SNP	ENST00000370398.1	37	CCDS4976.1	.	.	.	.	.	.	.	.	.	.	G	29.9	5.043519	0.93685	.	.	ENSG00000185760	ENST00000342056;ENST00000451840;ENST00000355194;ENST00000370398;ENST00000370392;ENST00000402622;ENST00000355635;ENST00000403813;ENST00000414165	D;D;D;D;D;D;D;D	0.96745	-4.11;-4.11;-4.11;-4.11;-4.11;-4.11;-4.11;-4.11	5.86	5.86	0.93980	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.97272	0.9108	L	0.48260	1.515	0.80722	D	1	D;D;D;D;D;D	0.89917	0.998;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.87578	0.976;0.986;0.998;0.996;0.997;0.991	D	0.97750	1.0214	10	0.87932	D	0	.	20.1823	0.98208	0.0:0.0:1.0:0.0	.	284;284;284;284;284;284	F5GZV0;Q9NR82-3;A6PVT6;Q9NR82-2;Q9NR82;Q9NR82-4	.;.;.;.;KCNQ5_HUMAN;.	F	284	ENSP00000345055:V284F;ENSP00000347326:V284F;ENSP00000359425:V284F;ENSP00000359419:V284F;ENSP00000385501:V284F;ENSP00000347853:V284F;ENSP00000384453:V284F;ENSP00000409861:V284F	ENSP00000345055:V284F	V	+	1	0	KCNQ5	73844263	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.771000	0.95319	0.650000	0.86243	GTC		0.333	KCNQ5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041198.3	NM_019842	
AHR	196	hgsc.bcm.edu;ucsc.edu	37	7	17369578	17369578	+	Silent	SNP	T	T	A			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr7:17369578T>A	ENST00000242057.4	+	5	1096	c.453T>A	c.(451-453)tcT>tcA	p.S151S		NM_001621.4	NP_001612.1	P35869	AHR_HUMAN	aryl hydrocarbon receptor	151	PAS 1. {ECO:0000255|PROSITE- ProRule:PRU00140}.				apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|cell cycle (GO:0007049)|circadian regulation of gene expression (GO:0032922)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|regulation of B cell proliferation (GO:0030888)|regulation of gene expression (GO:0010468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to toxic substance (GO:0009636)|response to xenobiotic stimulus (GO:0009410)|transcription from RNA polymerase II promoter (GO:0006366)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosolic aryl hydrocarbon receptor complex (GO:0034752)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|Hsp90 protein binding (GO:0051879)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(11)|ovary(1)|pancreas(1)|urinary_tract(3)	33	Lung NSC(10;0.0392)|all_lung(11;0.0754)				Atorvastatin(DB01076)|Flutamide(DB00499)|Ginseng(DB01404)|Leflunomide(DB01097)|Mexiletine(DB00379)|Nimodipine(DB00393)	TTCTTTAGTCTGATGTCATAC	0.358																																						.											0													68.0	69.0	69.0					7																	17369578		2203	4300	6503	SO:0001819	synonymous_variant	196			L19872	CCDS5366.1	7p15	2013-05-21			ENSG00000106546	ENSG00000106546		"""Basic helix-loop-helix proteins"""	348	protein-coding gene	gene with protein product		600253				8125016	Standard	NM_001621		Approved	bHLHe76	uc011jxz.1	P35869	OTTHUMG00000149967	ENST00000242057.4:c.453T>A	7.37:g.17369578T>A		Somatic		WXS	Illumina HiSeq	Phase_I	A4D130|Q13728|Q13803|Q13804	Silent	SNP	ENST00000242057.4	37	CCDS5366.1																																																																																				0.358	AHR-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314620.2	NM_001621	
IKZF1	10320	broad.mit.edu;hgsc.bcm.edu;mdanderson.org	37	7	50444370	50444370	+	Silent	SNP	C	C	T			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr7:50444370C>T	ENST00000331340.3	+	4	455	c.300C>T	c.(298-300)ggC>ggT	p.G100G	IKZF1_ENST00000439701.1_Silent_p.G100G|IKZF1_ENST00000343574.5_Intron|IKZF1_ENST00000438033.1_Intron|IKZF1_ENST00000440768.2_Silent_p.G100G|IKZF1_ENST00000359197.5_Silent_p.G100G|IKZF1_ENST00000357364.4_Silent_p.G100G|IKZF1_ENST00000346667.4_Intron|IKZF1_ENST00000349824.4_Silent_p.G100G	NM_001220769.1|NM_001220772.1|NM_001220773.1|NM_001220775.1|NM_006060.4	NP_001207698.1|NP_001207701.1|NP_001207702.1|NP_001207704.1|NP_006051.1	Q13422	IKZF1_HUMAN	IKAROS family zinc finger 1 (Ikaros)	100					B cell differentiation (GO:0030183)|cell cycle (GO:0007049)|chromatin modification (GO:0016568)|forebrain development (GO:0030900)|lymph node development (GO:0048535)|mesoderm development (GO:0007498)|natural killer cell differentiation (GO:0001779)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Peyer's patch development (GO:0048541)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neutrophil differentiation (GO:0045660)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|T cell differentiation (GO:0030217)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.?(131)		haematopoietic_and_lymphoid_tissue(275)|lung(1)	276	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;7.29e-10)|all_hematologic(4;4.8e-07)				GGGACCAAGGCAGCTCGGCTT	0.512			"""D,T"""	BCL6	"""ALL, DLBCL"""																																	.		"""Rec,Dom"""	yes		7	7p12.2	10320	IKAROS family zinc finger 1		L	131	Unknown(131)	haematopoietic_and_lymphoid_tissue(131)											91.0	98.0	96.0					7																	50444370		1949	4133	6082	SO:0001819	synonymous_variant	10320			U40462	CCDS59055.1, CCDS69299.1, CCDS75596.1, CCDS75597.1	7p12.2	2014-06-12	2006-08-25	2006-08-25	ENSG00000185811	ENSG00000185811		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13176	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 92"""	603023	"""zinc finger protein, subfamily 1A, 1 (Ikaros)"""	ZNFN1A1		1439790, 7935426	Standard	NM_006060		Approved	hIk-1, LyF-1, Hs.54452, IKAROS, PPP1R92	uc003tow.4	Q13422	OTTHUMG00000155907	ENST00000331340.3:c.300C>T	7.37:g.50444370C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A4D260|B4E0Z1|D3DVM5|O00598|Q53XL2|Q69BM4|Q8WVA3	Silent	SNP	ENST00000331340.3	37																																																																																					0.512	IKZF1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000342242.1	NM_006060	
GTF2IRD2B	389524	hgsc.bcm.edu	37	7	74563945	74563945	+	Silent	SNP	C	C	A			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr7:74563945C>A	ENST00000312575.7	+	16	1867	c.1692C>A	c.(1690-1692)gcC>gcA	p.A564A	GTF2IRD2B_ENST00000418185.2_Silent_p.A111A	NM_001003795.2	NP_001003795.1	Q6EKJ0	GTD2B_HUMAN	GTF2I repeat domain containing 2B	564					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|ovary(2)|prostate(1)	4						cccagttggccatattcatcc	0.438																																						.											0													12.0	13.0	13.0					7																	74563945		2195	4276	6471	SO:0001819	synonymous_variant	389524			AY312850	CCDS34659.1	7q11.23	2014-05-06			ENSG00000174428	ENSG00000174428			33125	protein-coding gene	gene with protein product		608900				15100712	Standard	XM_005277580		Approved		uc003ubt.3	Q6EKJ0	OTTHUMG00000181534	ENST00000312575.7:c.1692C>A	7.37:g.74563945C>A		Somatic		WXS	Illumina HiSeq	Phase_I	B2RNE9|Q69GU6|Q8N979|Q9H739	Silent	SNP	ENST00000312575.7	37	CCDS34659.1																																																																																				0.438	GTF2IRD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342728.1	NM_001003795	
TLE1	7088	broad.mit.edu;hgsc.bcm.edu	37	9	84303155	84303155	+	Start_Codon_SNP	SNP	T	T	A			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr9:84303155T>A	ENST00000376499.3	-	1	1065	c.1A>T	c.(1-3)Atg>Ttg	p.M1L	TLE1_ENST00000376463.1_5'Flank|RP11-154D17.1_ENST00000437181.1_lincRNA|TLE1_ENST00000376472.1_5'UTR	NM_005077.3	NP_005068.2	Q04724	TLE1_HUMAN	transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)	1	Gln-rich.				multicellular organismal development (GO:0007275)|negative regulation of anoikis (GO:2000811)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation of gene expression (GO:0010628)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription factor binding (GO:0008134)			NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	29						TGCGGGAACATCGCTCTGGCG	0.652																																					NSCLC(155;1437 1995 30668 39354 45875)|Melanoma(16;266 781 14000 47728 51870)	.											0													13.0	19.0	17.0					9																	84303155		2195	4287	6482	SO:0001582	initiator_codon_variant	7088				CCDS6661.1	9q21.32	2013-01-10	2001-11-28		ENSG00000196781	ENSG00000196781		"""WD repeat domain containing"""	11837	protein-coding gene	gene with protein product	"""enhancer of split groucho 1"""	600189	"""transducin-like enhancer of split 1, homolog of Drosophila E(sp1)"""			8365415, 8808280	Standard	NM_005077		Approved	ESG1, GRG1, ESG	uc004aly.3	Q04724	OTTHUMG00000021008	ENST00000376499.3:c.1A>T	9.37:g.84303155T>A	ENSP00000365682:p.Met1Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A8K495|Q5T3G4|Q969V9	Missense_Mutation	SNP	ENST00000376499.3	37	CCDS6661.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.984164	0.74474	.	.	ENSG00000196781	ENST00000376499;ENST00000355002;ENST00000418319	T;T	0.53423	0.62;1.28	3.73	3.73	0.42828	Groucho/TLE, N-terminal Q-rich domain (1);	0.000000	0.85682	D	0.000000	T	0.53818	0.1820	.	.	.	0.80722	D	1	B;B;B;P;B;B	0.42010	0.128;0.001;0.41;0.768;0.41;0.044	B;B;P;P;P;B	0.48627	0.22;0.009;0.579;0.584;0.579;0.144	T	0.59852	-0.7376	9	0.72032	D	0.01	-16.5529	12.2638	0.54665	0.0:0.0:0.0:1.0	.	1;1;1;28;1;1	B4E345;B4DEF9;A6NFH2;Q59EF7;Q5T3G3;Q04724	.;.;.;.;.;TLE1_HUMAN	L	1	ENSP00000365682:M1L;ENSP00000391347:M1L	ENSP00000347102:M1L	M	-	1	0	TLE1	83492975	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.659000	0.68010	1.530000	0.49136	0.368000	0.22195	ATG		0.652	TLE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055407.1	NM_005077	Missense_Mutation
RAD23B	5887	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	9	110068852	110068852	+	Missense_Mutation	SNP	A	A	T			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr9:110068852A>T	ENST00000358015.3	+	4	772	c.421A>T	c.(421-423)Agt>Tgt	p.S141C	RAD23B_ENST00000416373.2_Missense_Mutation_p.S69C	NM_001244713.1|NM_002874.4	NP_001231642.1|NP_002865.1	P54727	RD23B_HUMAN	RAD23 homolog B (S. cerevisiae)	141					DNA repair (GO:0006281)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage recognition (GO:0000715)|nucleotide-excision repair, DNA damage removal (GO:0000718)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|XPC complex (GO:0071942)	damaged DNA binding (GO:0003684)|polyubiquitin binding (GO:0031593)|single-stranded DNA binding (GO:0003697)			breast(3)|cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14						TGCACCTGCTAGTGCAGCTAA	0.552								Direct reversal of damage;Nucleotide excision repair (NER)																														.											0													69.0	68.0	68.0					9																	110068852		2203	4300	6503	SO:0001583	missense	5887				CCDS6769.1, CCDS59138.1	9q31.2	2008-07-21	2001-11-28		ENSG00000119318	ENSG00000119318			9813	protein-coding gene	gene with protein product	"""XP-C repair complementing protein"", ""XP-C repair complementing complex 58 kDa"""	600062	"""RAD23 (S. cerevisiae) homolog B"""			7851894, 8168482	Standard	NM_002874		Approved	HHR23B, P58, HR23B	uc004bde.3	P54727	OTTHUMG00000020446	ENST00000358015.3:c.421A>T	9.37:g.110068852A>T	ENSP00000350708:p.Ser141Cys	Somatic		WXS	Illumina HiSeq	Phase_I	B3KWK8|G5E9P0|Q7Z5K8|Q8WUB0	Missense_Mutation	SNP	ENST00000358015.3	37	CCDS6769.1	.	.	.	.	.	.	.	.	.	.	A	19.41	3.821602	0.71028	.	.	ENSG00000119318	ENST00000419616;ENST00000358015;ENST00000374678;ENST00000416373	T;T;T	0.48836	0.8;2.16;2.12	5.61	3.31	0.37934	.	0.388826	0.31188	N	0.008099	T	0.43787	0.1263	L	0.47716	1.5	0.34108	D	0.662702	P;D;P	0.57257	0.454;0.979;0.454	B;P;B	0.46975	0.241;0.533;0.159	T	0.59941	-0.7359	10	0.66056	D	0.02	-12.6394	8.892	0.35439	0.8468:0.0:0.1532:0.0	.	120;141;141	B7Z4W4;B4DEA3;P54727	.;.;RD23B_HUMAN	C	141;141;69;69	ENSP00000416868:S141C;ENSP00000350708:S141C;ENSP00000405623:S69C	ENSP00000350708:S141C	S	+	1	0	RAD23B	109108673	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.045000	0.49838	0.969000	0.38237	0.460000	0.39030	AGT		0.552	RAD23B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053548.1	NM_002874	
EIF2S3	1968	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	X	24075766	24075766	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chrX:24075766A>G	ENST00000253039.4	+	4	531	c.278A>G	c.(277-279)gAc>gGc	p.D93G		NM_001415.3	NP_001406.1	P41091	IF2G_HUMAN	eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa	93	tr-type G. {ECO:0000255|PROSITE- ProRule:PRU01059}.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			breast(1)|cervix(1)|endometrium(4)|large_intestine(1)|lung(4)|ovary(1)	12						AAGCTTGATGACCCAAGTTGC	0.383																																						.											0													64.0	65.0	65.0					X																	24075766		2203	4300	6503	SO:0001583	missense	1968			L19161	CCDS14210.1	Xp22.2-p22.1	2008-07-31	2002-08-29		ENSG00000130741	ENSG00000130741			3267	protein-coding gene	gene with protein product	"""eukaryotic translation initiation factor 2G"""	300161	"""eukaryotic translation initiation factor 2, subunit 3 (gamma, 52kD)"""	EIF2G		8106381, 9736774	Standard	NM_001415		Approved	EIF2gamma, EIF2	uc004dbc.3	P41091	OTTHUMG00000021262	ENST00000253039.4:c.278A>G	X.37:g.24075766A>G	ENSP00000253039:p.Asp93Gly	Somatic		WXS	Illumina HiSeq	Phase_I	B5BTZ4	Missense_Mutation	SNP	ENST00000253039.4	37	CCDS14210.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.25|16.25	3.071171|3.071171	0.55646|0.55646	.|.	.|.	ENSG00000130741|ENSG00000130741	ENST00000253039|ENST00000423068	T|.	0.64803|.	-0.12|.	5.03|5.03	5.03|5.03	0.67393|0.67393	Protein synthesis factor, GTP-binding (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.74898|.	0.3777|.	M|M	0.78916|0.78916	2.43|2.43	0.80722|0.80722	D|D	1|1	B|.	0.06786|.	0.001|.	B|.	0.10450|.	0.005|.	T|.	0.76498|.	-0.2937|.	10|.	0.54805|.	T|.	0.06|.	.|.	14.0831|14.0831	0.64937|0.64937	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	93|.	P41091|.	IF2G_HUMAN|.	G|W	93|92	ENSP00000253039:D93G|.	ENSP00000253039:D93G|.	D|X	+|+	2|3	0|0	EIF2S3|EIF2S3	23985687|23985687	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	8.806000|8.806000	0.91930|0.91930	1.771000|1.771000	0.52183|0.52183	0.417000|0.417000	0.27973|0.27973	GAC|TGA		0.383	EIF2S3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056079.1	NM_001415	
MAGED2	10916	broad.mit.edu;hgsc.bcm.edu;mdanderson.org	37	X	54837700	54837700	+	Silent	SNP	G	G	A			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chrX:54837700G>A	ENST00000375068.1	+	5	1097	c.864G>A	c.(862-864)aaG>aaA	p.K288K	MAGED2_ENST00000375058.1_Silent_p.K288K|MAGED2_ENST00000375062.4_Silent_p.K203K|MAGED2_ENST00000347546.4_Silent_p.K270K|MAGED2_ENST00000218439.4_Silent_p.K288K|MAGED2_ENST00000375053.2_Silent_p.K288K|MAGED2_ENST00000396224.1_Silent_p.K288K|MAGED2_ENST00000375060.1_Silent_p.K203K			Q9UNF1	MAGD2_HUMAN	melanoma antigen family D, 2	288	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.					membrane (GO:0016020)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	26						ATTTGGTGAAGTACCTTTTGG	0.478																																						.											0													131.0	115.0	121.0					X																	54837700		2203	4300	6503	SO:0001819	synonymous_variant	10916			AF128527	CCDS14362.1	Xp11.2	2008-08-01			ENSG00000102316	ENSG00000102316			16353	protein-coding gene	gene with protein product	"""hepatocellular carcinoma associated protein"", ""breast cancer associated gene 1"", ""melanoma-associated antigen D2"", ""hepatocellular carcinoma-associated protein HCA10"""	300470					Standard	NM_014599		Approved	JCL-1, BCG1, 11B6, MAGE-D2, HCA10, MAGED, MGC8386	uc004dtk.1	Q9UNF1	OTTHUMG00000021638	ENST00000375068.1:c.864G>A	X.37:g.54837700G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A6NMX0|O76058|Q5BJF3|Q8NAL6|Q9H218|Q9P0U9|Q9UM52	Silent	SNP	ENST00000375068.1	37	CCDS14362.1																																																																																				0.478	MAGED2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056821.2	NM_014599	
PLCE1	51196	broad.mit.edu;hgsc.bcm.edu;bcgsc.ca	37	10	95891977	95891977	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr10:95891977C>T	ENST00000371380.3	+	2	1488	c.1253C>T	c.(1252-1254)tCt>tTt	p.S418F	PLCE1_ENST00000371375.1_Missense_Mutation_p.S110F|PLCE1_ENST00000371385.3_Missense_Mutation_p.S110F|PLCE1_ENST00000260766.3_Missense_Mutation_p.S418F			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1	418					activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)			liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				ACAGTTGGATCTCTACTCCAT	0.428																																						.											0													131.0	133.0	133.0					10																	95891977		2003	4165	6168	SO:0001583	missense	51196				CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.1253C>T	10.37:g.95891977C>T	ENSP00000360431:p.Ser418Phe	Somatic		WXS	Illumina HiSeq	Phase_I	A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	Missense_Mutation	SNP	ENST00000371380.3	37	CCDS41552.1	.	.	.	.	.	.	.	.	.	.	C	13.17	2.157637	0.38119	.	.	ENSG00000138193	ENST00000260766;ENST00000371380;ENST00000371385;ENST00000371375	T;T;T;T	0.72725	-0.68;-0.68;-0.68;-0.68	5.08	4.11	0.48088	Ras guanine nucleotide exchange factor, domain (1);	0.773966	0.11722	N	0.535812	T	0.51041	0.1651	N	0.24115	0.695	0.29947	N	0.820542	B;B;B	0.14438	0.003;0.01;0.001	B;B;B	0.13407	0.002;0.009;0.002	T	0.43523	-0.9386	10	0.10902	T	0.67	.	6.5663	0.22513	0.2799:0.6291:0.0:0.091	.	418;110;418	B7ZM61;Q9P212-2;Q9P212	.;.;PLCE1_HUMAN	F	418;418;110;110	ENSP00000260766:S418F;ENSP00000360431:S418F;ENSP00000360438:S110F;ENSP00000360426:S110F	ENSP00000260766:S418F	S	+	2	0	PLCE1	95881967	0.999000	0.42202	1.000000	0.80357	0.926000	0.56050	1.272000	0.33109	2.512000	0.84698	0.563000	0.77884	TCT		0.428	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049469.3	NM_016341	
FLI1	2313	broad.mit.edu;hgsc.bcm.edu;bcgsc.ca	37	11	128679073	128679073	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr11:128679073C>T	ENST00000527786.2	+	8	1292	c.803C>T	c.(802-804)cCg>cTg	p.P268L	FLI1_ENST00000281428.8_Missense_Mutation_p.P202L|FLI1_ENST00000344954.6_Missense_Mutation_p.P235L|FLI1_ENST00000534087.2_Missense_Mutation_p.P235L|FLI1_ENST00000525560.1_Missense_Mutation_p.P75L	NM_001271010.1|NM_002017.4	NP_001257939.1|NP_002008.2	Q01543	FLI1_HUMAN	Fli-1 proto-oncogene, ETS transcription factor	268					blood circulation (GO:0008015)|cell differentiation (GO:0030154)|hemostasis (GO:0007599)|megakaryocyte development (GO:0035855)|organ morphogenesis (GO:0009887)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)		EWSR1/FLI1(2569)	NS(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(14)|ovary(3)|prostate(2)	31	all_hematologic(175;0.0641)	Lung NSC(97;0.00588)|all_lung(97;0.00764)|Breast(109;0.0115)|Medulloblastoma(222;0.0523)|all_neural(223;0.0862)|all_hematologic(192;0.182)		OV - Ovarian serous cystadenocarcinoma(99;0.01)|LUSC - Lung squamous cell carcinoma(976;0.0324)|Lung(977;0.0327)		ATCCTGGGCCCGACCAGCAGT	0.423			T	EWSR1	Ewing sarcoma																																	.		Dom	yes		11	11q24	2313	Friend leukemia virus integration 1		M	0													86.0	84.0	84.0					11																	128679073		1841	4087	5928	SO:0001583	missense	2313			M98833	CCDS44768.1, CCDS53725.1, CCDS59230.1, CCDS59231.1	11q24.1-q24.3	2014-09-17	2013-08-07		ENSG00000151702	ENSG00000151702			3749	protein-coding gene	gene with protein product		193067	"""Friend leukemia virus integration 1"""			1765382	Standard	NM_001167681		Approved	SIC-1, EWSR2	uc010sbu.2	Q01543	OTTHUMG00000165792	ENST00000527786.2:c.803C>T	11.37:g.128679073C>T	ENSP00000433488:p.Pro268Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B2R8H2|B4DFV4|B4DTC6|G3V183|Q14319|Q92480|Q9UE07	Missense_Mutation	SNP	ENST00000527786.2	37	CCDS44768.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.643889	0.87859	.	.	ENSG00000151702	ENST00000525560;ENST00000344954;ENST00000429175;ENST00000534087;ENST00000281428	T;T;T;T;T	0.26810	1.71;2.25;2.26;2.25;2.26	5.69	5.69	0.88448	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.41511	0.1162	M	0.74647	2.275	0.80722	D	1	P;D;D	0.57257	0.953;0.979;0.971	B;B;P	0.47573	0.348;0.406;0.55	T	0.41574	-0.9501	10	0.66056	D	0.02	.	19.8045	0.96525	0.0:1.0:0.0:0.0	.	268;75;202	Q01543;B4DFV4;Q01543-2	FLI1_HUMAN;.;.	L	75;235;268;235;202	ENSP00000437124:P75L;ENSP00000339627:P235L;ENSP00000399985:P268L;ENSP00000432950:P235L;ENSP00000281428:P202L	ENSP00000281428:P202L	P	+	2	0	FLI1	128184283	1.000000	0.71417	0.944000	0.38274	0.991000	0.79684	7.722000	0.84778	2.676000	0.91093	0.655000	0.94253	CCG		0.423	FLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386226.2	NM_002017	
HIPK1	204851	hgsc.bcm.edu;bcgsc.ca	37	1	114483037	114483037	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr1:114483037C>T	ENST00000369558.1	+	2	264	c.32C>T	c.(31-33)cCa>cTa	p.P11L	HIPK1_ENST00000369554.2_Missense_Mutation_p.P11L|HIPK1_ENST00000369559.4_Missense_Mutation_p.P11L|HIPK1_ENST00000369555.2_Missense_Mutation_p.P11L|HIPK1_ENST00000426820.2_Missense_Mutation_p.P11L|HIPK1_ENST00000369561.4_Missense_Mutation_p.P11L			Q86Z02	HIPK1_HUMAN	homeodomain interacting protein kinase 1	11					anterior/posterior pattern specification (GO:0009952)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway (GO:0097191)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|neuron differentiation (GO:0030182)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)|retina layer formation (GO:0010842)|smoothened signaling pathway (GO:0007224)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|prostate(2)	39	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TTTTCGCCCCCATCAGTGTCG	0.433																																						.											0													146.0	158.0	154.0					1																	114483037		2203	4300	6503	SO:0001583	missense	204851			AB089957	CCDS867.1, CCDS868.1, CCDS869.1, CCDS41370.1	1p13.1	2008-02-05			ENSG00000163349	ENSG00000163349			19006	protein-coding gene	gene with protein product		608003					Standard	NM_198268		Approved	KIAA0630, Myak, MGC26642, Nbak2, MGC33446, MGC33548	uc001eem.3	Q86Z02	OTTHUMG00000011983	ENST00000369558.1:c.32C>T	1.37:g.114483037C>T	ENSP00000358571:p.Pro11Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A6NJ34|O75125|Q5SQL2|Q5SQL4|Q5SQL5|Q8IYD7|Q8NDN5|Q8NEB6|Q8TBZ1	Missense_Mutation	SNP	ENST00000369558.1	37	CCDS867.1	.	.	.	.	.	.	.	.	.	.	C	12.25	1.881132	0.33255	.	.	ENSG00000163349	ENST00000426820;ENST00000369559;ENST00000443627;ENST00000369554;ENST00000369555;ENST00000369558;ENST00000369561;ENST00000514621;ENST00000503968	T;T;T;T;T;T;T;T;T	0.48836	0.8;0.8;0.83;0.83;0.83;0.83;0.84;0.84;0.83	4.78	4.78	0.61160	.	0.090347	0.48286	D	0.000197	T	0.26882	0.0658	L	0.32530	0.975	0.80722	D	1	B;B	0.30281	0.18;0.275	B;B	0.27796	0.038;0.083	T	0.20273	-1.0280	10	0.56958	D	0.05	.	17.834	0.88691	0.0:1.0:0.0:0.0	.	11;11	Q86Z02;Q86Z02-2	HIPK1_HUMAN;.	L	82;11;11;11;11;11;11;11;11	ENSP00000407442:P82L;ENSP00000358572:P11L;ENSP00000409673:P11L;ENSP00000358567:P11L;ENSP00000358568:P11L;ENSP00000358571:P11L;ENSP00000358574:P11L;ENSP00000422322:P11L;ENSP00000426695:P11L	ENSP00000358567:P11L	P	+	2	0	HIPK1	114284560	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.224000	0.42945	2.182000	0.69389	0.650000	0.86243	CCA		0.433	HIPK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000033127.1	NM_198268	
UBQLN3	50613	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	11	5530008	5530008	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr11:5530008T>C	ENST00000311659.4	-	2	928	c.781A>G	c.(781-783)Att>Gtt	p.I261V	HBG2_ENST00000380259.2_Intron	NM_017481.2	NP_059509.1	Q9H347	UBQL3_HUMAN	ubiquilin 3	261										NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|prostate(1)|skin(2)	39		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGGTCCATAATATCTGTGTAC	0.517																																					Ovarian(72;684 1260 12332 41642 52180)	.											0													112.0	101.0	105.0					11																	5530008		2201	4297	6498	SO:0001583	missense	50613			AF230481	CCDS7758.1	11p15	2013-02-12			ENSG00000175520	ENSG00000175520		"""Ubiquilin family"""	12510	protein-coding gene	gene with protein product		605473				10831842	Standard	NM_017481		Approved	TUP-1	uc001may.1	Q9H347	OTTHUMG00000066886	ENST00000311659.4:c.781A>G	11.37:g.5530008T>C	ENSP00000347997:p.Ile261Val	Somatic		WXS	Illumina HiSeq	Phase_I	Q9NRE0	Missense_Mutation	SNP	ENST00000311659.4	37	CCDS7758.1	.	.	.	.	.	.	.	.	.	.	t	13.37	2.216064	0.39201	.	.	ENSG00000175520	ENST00000311659	T	0.35789	1.29	5.63	4.49	0.54785	.	0.149702	0.30901	N	0.008646	T	0.22627	0.0546	N	0.16656	0.425	0.32801	D	0.500105	B	0.10296	0.003	B	0.12837	0.008	T	0.17379	-1.0371	10	0.45353	T	0.12	-9.1027	10.2748	0.43504	0.0:0.0823:0.0:0.9177	.	261	Q9H347	UBQL3_HUMAN	V	261	ENSP00000347997:I261V	ENSP00000347997:I261V	I	-	1	0	UBQLN3	5486584	0.997000	0.39634	1.000000	0.80357	0.980000	0.70556	1.572000	0.36461	2.262000	0.75019	0.478000	0.44815	ATT		0.517	UBQLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143348.1	NM_017481	
ATG2A	23130	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	11	64676833	64676833	+	Missense_Mutation	SNP	T	T	C	rs148849835		TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr11:64676833T>C	ENST00000377264.3	-	15	2226	c.2114A>G	c.(2113-2115)tAt>tGt	p.Y705C	ATG2A_ENST00000421419.2_Missense_Mutation_p.Y705C	NM_015104.2	NP_055919.2	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A	705					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(19)|ovary(3)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	55						TCCATCTTCATAGATACCTGG	0.587																																						.											0													42.0	41.0	41.0					11																	64676833		2201	4295	6496	SO:0001583	missense	23130				CCDS31602.1	11q13.1	2014-02-12	2012-06-06		ENSG00000110046	ENSG00000110046			29028	protein-coding gene	gene with protein product			"""ATG2 autophagy related 2 homolog A (S. cerevisiae)"""			21887408	Standard	NM_015104		Approved	KIAA0404	uc001obx.3	Q2TAZ0	OTTHUMG00000066831	ENST00000377264.3:c.2114A>G	11.37:g.64676833T>C	ENSP00000366475:p.Tyr705Cys	Somatic		WXS	Illumina HiSeq	Phase_I	O43154|Q14DM2|Q6ZTV2|Q7Z6K8|Q8IVY5|Q8TAI8|Q96HH7	Missense_Mutation	SNP	ENST00000377264.3	37	CCDS31602.1	.	.	.	.	.	.	.	.	.	.	T	16.85	3.235828	0.58886	.	.	ENSG00000110046	ENST00000421419;ENST00000377264	T;T	0.11063	2.81;2.81	5.3	5.3	0.74995	.	0.325293	0.29722	N	0.011371	T	0.27765	0.0683	L	0.55481	1.735	0.52099	D	0.999942	D	0.76494	0.999	D	0.73380	0.98	T	0.00807	-1.1558	10	0.87932	D	0	.	13.511	0.61513	0.0:0.0:0.0:1.0	.	705	Q2TAZ0	ATG2A_HUMAN	C	705	ENSP00000410522:Y705C;ENSP00000366475:Y705C	ENSP00000366475:Y705C	Y	-	2	0	ATG2A	64433409	0.966000	0.33281	0.468000	0.27192	0.753000	0.42808	1.740000	0.38228	2.129000	0.65627	0.533000	0.62120	TAT		0.587	ATG2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000143224.1	NM_015104	
RAPGEFL1	51195	broad.mit.edu;hgsc.bcm.edu;bcgsc.ca	37	17	38346943	38346943	+	Nonsense_Mutation	SNP	C	C	T			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr17:38346943C>T	ENST00000456989.2	+	8	857	c.811C>T	c.(811-813)Cga>Tga	p.R271*	RAPGEFL1_ENST00000264644.6_Nonsense_Mutation_p.R216*|RAPGEFL1_ENST00000540388.1_3'UTR|RAPGEFL1_ENST00000436615.3_Nonsense_Mutation_p.R216*|RAPGEFL1_ENST00000544503.1_Nonsense_Mutation_p.R265*			Q9UHV5	RPGFL_HUMAN	Rap guanine nucleotide exchange factor (GEF)-like 1	422					G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|positive regulation of GTPase activity (GO:0043547)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(2)|skin(1)	15						AGAGATCCACCGAGTGGAGCC	0.647																																					Esophageal Squamous(28;274 750 6870 14218 42203)	.											0													132.0	115.0	121.0					17																	38346943		2203	4300	6503	SO:0001587	stop_gained	51195			AF117946	CCDS11363.1	17q21.2	2006-08-01	2004-03-26		ENSG00000108352	ENSG00000108352			17428	protein-coding gene	gene with protein product	"""Link guanine nucleotide exchange factor II"""		"""RAP guanine-nucleotide-exchange factor (GEF)-like 1"""				Standard	NM_016339		Approved	Link-GEFII	uc010cwu.1	Q9UHV5	OTTHUMG00000133325	ENST00000456989.2:c.811C>T	17.37:g.38346943C>T	ENSP00000394530:p.Arg271*	Somatic		WXS	Illumina HiSeq	Phase_I		Nonsense_Mutation	SNP	ENST00000456989.2	37		.	.	.	.	.	.	.	.	.	.	C	41	8.578792	0.98870	.	.	ENSG00000108352	ENST00000456989;ENST00000544503;ENST00000537255;ENST00000264644;ENST00000436615	.	.	.	5.31	5.31	0.75309	.	0.402136	0.23380	N	0.048804	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	.	13.1138	0.59289	0.1606:0.8394:0.0:0.0	.	.	.	.	X	271;265;216;421;216	.	ENSP00000264644:R421X	R	+	1	2	RAPGEFL1	35600469	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.201000	0.58439	2.635000	0.89317	0.591000	0.81541	CGA		0.647	RAPGEFL1-005	PUTATIVE	non_canonical_conserved|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000397518.1	NM_016339	
ANGPTL4	51129	hgsc.bcm.edu;mdanderson.org	37	19	8429323	8429323	+	Missense_Mutation	SNP	G	G	A	rs116843064	byFrequency	TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr19:8429323G>A	ENST00000301455.2	+	1	289	c.118G>A	c.(118-120)Gag>Aag	p.E40K	ANGPTL4_ENST00000541807.1_5'UTR|ANGPTL4_ENST00000393962.2_Missense_Mutation_p.E40K	NM_139314.1	NP_647475.1	Q9BY76	ANGL4_HUMAN	angiopoietin-like 4	40			E -> K (associated with lower plasma levels of triglyceride and higher levels of HDL cholesterol; dbSNP:rs116843064). {ECO:0000269|PubMed:17322881}.		angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|cellular lipid metabolic process (GO:0044255)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of lipoprotein lipase activity (GO:0051005)|positive regulation of angiogenesis (GO:0045766)|protein homooligomerization (GO:0051260)|response to hypoxia (GO:0001666)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	enzyme inhibitor activity (GO:0004857)			large_intestine(1)|lung(1)|ovary(2)|skin(2)	6						GTCCTGGGACGAGATGAATGT	0.721													g|||	47	0.00938498	0.003	0.0245	5008	,	,		12942	0.0		0.0258	False		,,,				2504	0.0					.											0			GRCh37	CM071551	ANGPTL4	M	rs116843064		LYS/GLU,LYS/GLU	4,4192		0,4,2094	7.0	5.0	6.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	118,118	4.9	1.0	19	dbSNP_132	6	132,8100		1,130,3985	yes	missense,missense	ANGPTL4	NM_001039667.1,NM_139314.1	56,56	1,134,6079	AA,AG,GG		1.6035,0.0953,1.0943	probably-damaging,probably-damaging	40/369,40/407	8429323	136,12292	2098	4116	6214	SO:0001583	missense	51129			AF202636	CCDS12200.1, CCDS42493.1	19p13.3	2013-10-07				ENSG00000167772		"""Fibrinogen C domain containing"""	16039	protein-coding gene	gene with protein product	"""fasting-induced adipose factor"", ""hepatic angiopoietin-related protein"", ""PPARG angiopoietin related protein"", ""hepatic fibrinogen/angiopoietin-related protein"", ""peroxisome proliferator-activated receptor (PPAR) gamma induced angiopoietin-related protein"", ""angiopoietin-related protein 4"""	605910				10698685, 10866690, 23960078	Standard	NM_139314		Approved	pp1158, PGAR, ARP4, HFARP, FIAF, NL2	uc002mjq.1	Q9BY76		ENST00000301455.2:c.118G>A	19.37:g.8429323G>A	ENSP00000301455:p.Glu40Lys	Somatic		WXS	Illumina HiSeq	Phase_I	A8MY84|B4E089|D6W670|F5H0I2|Q53HQ6|Q53HU1|Q6UXN0|Q9HBV4|Q9NZU4|Q9Y5B3	Missense_Mutation	SNP	ENST00000301455.2	37	CCDS12200.1	33	0.01510989010989011	2	0.0040650406504065045	9	0.024861878453038673	0	0.0	22	0.029023746701846966	G	37	6.185911	0.97357	9.53E-4	0.016035	ENSG00000167772	ENST00000301455;ENST00000393962	T;T	0.60672	0.17;0.17	4.95	4.95	0.65309	.	0.244919	0.39210	U	0.001425	T	0.47600	0.1454	L	0.59436	1.845	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.63033	0.91;0.91	T	0.66337	-0.5949	10	0.72032	D	0.01	.	15.7013	0.77544	0.0:0.0:1.0:0.0	.	40;40	A8MY84;Q9BY76	.;ANGL4_HUMAN	K	40	ENSP00000301455:E40K;ENSP00000377534:E40K	ENSP00000301455:E40K	E	+	1	0	ANGPTL4	8335323	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	6.344000	0.72991	2.295000	0.77249	0.486000	0.48141	GAG		0.721	ANGPTL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460322.1	NM_139314	
RLN3	117579	hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	19	14139176	14139176	+	Nonsense_Mutation	SNP	C	C	T			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr19:14139176C>T	ENST00000431365.2	+	1	217	c.160C>T	c.(160-162)Cga>Tga	p.R54*	CTB-55O6.4_ENST00000590528.1_RNA|RLN3_ENST00000585987.1_Nonsense_Mutation_p.R54*	NM_080864.2	NP_543140.1	Q8WXF3	REL3_HUMAN	relaxin 3	54						extracellular region (GO:0005576)				endometrium(1)|lung(4)	5						CCGGTGGAGACGATCAGACAT	0.642																																						.											0													46.0	49.0	48.0					19																	14139176		2203	4299	6502	SO:0001587	stop_gained	117579			AF447451	CCDS12302.1	19p13.2	2013-02-26	2004-11-15					"""Endogenous ligands"""	17135	protein-coding gene	gene with protein product	"""prorelaxin H3"""	606855	"""relaxin 3 (H3)"""				Standard	NM_080864		Approved	ZINS4, RXN3, H3	uc002mxw.1	Q8WXF3		ENST00000431365.2:c.160C>T	19.37:g.14139176C>T	ENSP00000397415:p.Arg54*	Somatic		WXS	Illumina HiSeq	Phase_I	Q6UXW5	Nonsense_Mutation	SNP	ENST00000431365.2	37	CCDS12302.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.029163	0.75504	.	.	ENSG00000171136	ENST00000431365	.	.	.	4.27	4.27	0.50696	.	0.128902	0.46442	D	0.000290	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-30.5073	13.9885	0.64350	0.0:1.0:0.0:0.0	.	.	.	.	X	54	.	ENSP00000397415:R54X	R	+	1	2	RLN3	14000176	1.000000	0.71417	0.650000	0.29550	0.202000	0.24057	3.267000	0.51577	2.093000	0.63338	0.491000	0.48974	CGA		0.642	RLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458529.1		
NPY1R	4886	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	4	164247528	164247528	+	Missense_Mutation	SNP	G	G	C			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr4:164247528G>C	ENST00000296533.2	-	2	710	c.179C>G	c.(178-180)gCc>gGc	p.A60G	NPY1R_ENST00000509586.1_Intron	NM_000909.5	NP_000900.1	P25929	NPY1R_HUMAN	neuropeptide Y receptor Y1	60					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose metabolic process (GO:0006006)|locomotory behavior (GO:0007626)|neuropeptide signaling pathway (GO:0007218)|outflow tract morphogenesis (GO:0003151)|regulation of blood pressure (GO:0008217)|regulation of multicellular organism growth (GO:0040014)|sensory perception of pain (GO:0019233)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)|pancreatic polypeptide receptor activity (GO:0001602)|peptide YY receptor activity (GO:0001601)			breast(1)|cervix(1)|large_intestine(4)|lung(18)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)	30	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				TATGATCAAGGCCAGGTTTCC	0.408																																						.											0													126.0	114.0	118.0					4																	164247528		2203	4300	6503	SO:0001583	missense	4886				CCDS34089.1	4q31.3-q32	2012-08-08				ENSG00000164128		"""GPCR / Class A : Neuropeptide receptors : Y"""	7956	protein-coding gene	gene with protein product		162641		NPYR		8095935	Standard	NM_000909		Approved		uc003iqm.2	P25929		ENST00000296533.2:c.179C>G	4.37:g.164247528G>C	ENSP00000354652:p.Ala60Gly	Somatic		WXS	Illumina HiSeq	Phase_I	B2R6H5	Missense_Mutation	SNP	ENST00000296533.2	37	CCDS34089.1	.	.	.	.	.	.	.	.	.	.	G	17.03	3.283635	0.59867	.	.	ENSG00000164128	ENST00000296533;ENST00000504790;ENST00000515701	T	0.72505	-0.66	5.56	5.56	0.83823	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.66446	0.2790	L	0.31420	0.93	0.80722	D	1	P	0.44521	0.837	B	0.43990	0.438	T	0.67632	-0.5621	10	0.45353	T	0.12	.	19.5226	0.95192	0.0:0.0:1.0:0.0	.	60	P25929	NPY1R_HUMAN	G	60	ENSP00000354652:A60G	ENSP00000354652:A60G	A	-	2	0	NPY1R	164466978	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	6.145000	0.71769	2.617000	0.88574	0.585000	0.79938	GCC		0.408	NPY1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364685.1		
SDHA	6389	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	5	235341	235341	+	Missense_Mutation	SNP	A	A	T			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr5:235341A>T	ENST00000264932.6	+	9	1262	c.1147A>T	c.(1147-1149)Att>Ttt	p.I383F	SDHA_ENST00000510361.1_Missense_Mutation_p.I335F|SDHA_ENST00000504309.1_Missense_Mutation_p.I383F	NM_004168.2	NP_004159.2	P31040	SDHA_HUMAN	succinate dehydrogenase complex, subunit A, flavoprotein (Fp)	383					cellular metabolic process (GO:0044237)|nervous system development (GO:0007399)|oxidation-reduction process (GO:0055114)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|tricarboxylic acid cycle (GO:0006099)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|succinate dehydrogenase (ubiquinone) activity (GO:0008177)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|liver(2)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	40			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	CCTGCCTGGCATTTCAGAGAC	0.592									Familial Paragangliomas																													.											0													65.0	59.0	61.0					5																	235341		2203	4300	6503	SO:0001583	missense	6389	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss	BC001380	CCDS3853.1	5p15	2014-09-17			ENSG00000073578	ENSG00000073578		"""Mitochondrial respiratory chain complex / Complex II"""	10680	protein-coding gene	gene with protein product		600857		SDH2		7798181	Standard	XM_005248329		Approved	FP, SDHF	uc003jao.4	P31040	OTTHUMG00000090275	ENST00000264932.6:c.1147A>T	5.37:g.235341A>T	ENSP00000264932:p.Ile383Phe	Somatic		WXS	Illumina HiSeq	Phase_I	A8K5J6|B4DJ60|E9PBJ5|Q16395|Q59GW8|Q8IW48|Q9UMY5	Missense_Mutation	SNP	ENST00000264932.6	37	CCDS3853.1	.	.	.	.	.	.	.	.	.	.	N	24.4	4.530122	0.85706	.	.	ENSG00000073578	ENST00000264932;ENST00000327872;ENST00000504309;ENST00000510361	T;T;T	0.70399	-0.48;-0.48;-0.48	5.12	5.12	0.69794	Fumarate reductase/succinate dehydrogenase flavoprotein, N-terminal (1);	0.000000	0.85682	U	0.000000	D	0.90160	0.6925	H	0.98936	4.375	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.998;1.0;0.998;0.998	D	0.93509	0.6851	10	0.87932	D	0	.	13.1683	0.59583	1.0:0.0:0.0:0.0	.	335;383;383;383;389	E9PBJ5;B4DYN5;D6RFM5;P31040;Q59GW8	.;.;.;DHSA_HUMAN;.	F	383;238;383;335	ENSP00000264932:I383F;ENSP00000426514:I383F;ENSP00000427703:I335F	ENSP00000264932:I383F	I	+	1	0	SDHA	288341	1.000000	0.71417	0.995000	0.50966	0.738000	0.42128	8.509000	0.90529	2.055000	0.61198	0.455000	0.32223	ATT		0.592	SDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206599.1	NM_004168	
TMEM51	55092	broad.mit.edu	37	1	15545898	15545898	+	Missense_Mutation	SNP	A	A	T			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr1:15545898A>T	ENST00000428417.1	+	3	867	c.421A>T	c.(421-423)Aac>Tac	p.N141Y	TMEM51_ENST00000434578.2_3'UTR|TMEM51_ENST00000376008.2_Missense_Mutation_p.N141Y|TMEM51_ENST00000376014.3_Missense_Mutation_p.N141Y|TMEM51_ENST00000400796.3_Missense_Mutation_p.N141Y	NM_001136217.1	NP_001129689.1	Q9NW97	TMM51_HUMAN	transmembrane protein 51	141						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(3)|large_intestine(2)|lung(5)|prostate(2)	14		Renal(390;0.00145)|Breast(348;0.00186)|Colorectal(325;0.00215)|all_lung(284;0.00459)|Lung NSC(340;0.0104)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;2.07e-06)|COAD - Colon adenocarcinoma(227;7.14e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000175)|KIRC - Kidney renal clear cell carcinoma(229;0.00141)|STAD - Stomach adenocarcinoma(313;0.00644)|READ - Rectum adenocarcinoma(331;0.0751)		GATGAACACAAACTACTCAGA	0.557																																						.											0													94.0	90.0	91.0					1																	15545898		2203	4300	6503	SO:0001583	missense	55092			AK098467	CCDS154.1	1p36.21	2008-02-05	2005-05-22	2005-05-22	ENSG00000171729	ENSG00000171729			25488	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 72"""	C1orf72		12477932	Standard	NM_018022		Approved	FLJ10199	uc001avx.3	Q9NW97	OTTHUMG00000002046	ENST00000428417.1:c.421A>T	1.37:g.15545898A>T	ENSP00000394899:p.Asn141Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	A8K819	Missense_Mutation	SNP	ENST00000428417.1	37	CCDS154.1	.	.	.	.	.	.	.	.	.	.	A	15.89	2.965433	0.53507	.	.	ENSG00000171729	ENST00000428417;ENST00000376014;ENST00000451326;ENST00000434578;ENST00000400796;ENST00000376008;ENST00000303840	T;T;T;T	0.31247	1.5;1.5;1.5;1.5	5.63	2.01	0.26516	.	0.282098	0.44285	D	0.000471	T	0.29652	0.0740	L	0.44542	1.39	0.23366	N	0.997829	P	0.48016	0.904	P	0.47251	0.542	T	0.11179	-1.0598	10	0.72032	D	0.01	1.1303	8.5456	0.33419	0.5697:0.0:0.4303:0.0	.	141	Q9NW97	TMM51_HUMAN	Y	141	ENSP00000394899:N141Y;ENSP00000365182:N141Y;ENSP00000383600:N141Y;ENSP00000365176:N141Y	ENSP00000303666:N141Y	N	+	1	0	TMEM51	15418485	0.984000	0.35163	0.961000	0.40146	0.964000	0.63967	2.179000	0.42528	0.092000	0.17331	0.454000	0.30748	AAC		0.557	TMEM51-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005699.3	NM_018022	
IGSF21	84966	broad.mit.edu;mdanderson.org	37	1	18692186	18692186	+	Missense_Mutation	SNP	C	C	T	rs374130273		TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr1:18692186C>T	ENST00000251296.1	+	6	1393	c.1010C>T	c.(1009-1011)aCg>aTg	p.T337M		NM_032880.4	NP_116269.3	Q96ID5	IGS21_HUMAN	immunoglobin superfamily, member 21	337						extracellular region (GO:0005576)				endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(16)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	40		Colorectal(325;0.000147)|Renal(390;0.00145)|all_lung(284;0.00366)|Lung NSC(340;0.00376)|Breast(348;0.00387)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0121)|BRCA - Breast invasive adenocarcinoma(304;5.52e-05)|Kidney(64;0.00103)|KIRC - Kidney renal clear cell carcinoma(64;0.0102)|STAD - Stomach adenocarcinoma(196;0.0118)|READ - Rectum adenocarcinoma(331;0.157)		GCAGAGGTCACGCTGGGTAAG	0.612													C|||	1	0.000199681	0.0	0.0	5008	,	,		19210	0.0		0.001	False		,,,				2504	0.0					.											0								C	MET/THR	1,4403	2.1+/-5.4	0,1,2201	46.0	38.0	41.0		1010	2.6	1.0	1		41	0,8600		0,0,4300	no	missense	IGSF21	NM_032880.4	81	0,1,6501	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	337/468	18692186	1,13003	2202	4300	6502	SO:0001583	missense	84966			AK075316	CCDS184.1	1p36.13	2013-01-29			ENSG00000117154	ENSG00000117154		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28246	protein-coding gene	gene with protein product						12477932	Standard	NM_032880		Approved	MGC15730, RP11-121A23.1	uc001bau.2	Q96ID5	OTTHUMG00000002432	ENST00000251296.1:c.1010C>T	1.37:g.18692186C>T	ENSP00000251296:p.Thr337Met	Somatic		WXS	Illumina HiSeq	Phase_I	Q8NBR8	Missense_Mutation	SNP	ENST00000251296.1	37	CCDS184.1	.	.	.	.	.	.	.	.	.	.	C	17.00	3.277902	0.59758	2.27E-4	0.0	ENSG00000117154	ENST00000251296	T	0.33654	1.4	4.53	2.6	0.31112	Immunoglobulin-like fold (1);	0.209202	0.49305	D	0.000158	T	0.38719	0.1051	L	0.27053	0.805	0.51767	D	0.999934	D	0.89917	1.0	D	0.63192	0.912	T	0.08722	-1.0708	10	0.35671	T	0.21	-18.4742	9.5314	0.39196	0.0:0.82:0.0:0.18	.	337	Q96ID5	IGS21_HUMAN	M	337	ENSP00000251296:T337M	ENSP00000251296:T337M	T	+	2	0	IGSF21	18564773	0.997000	0.39634	1.000000	0.80357	0.963000	0.63663	2.192000	0.42649	1.025000	0.39708	0.491000	0.48974	ACG		0.612	IGSF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006924.1	NM_032880	
RGL1	23179	broad.mit.edu	37	1	183885724	183885724	+	Silent	SNP	G	G	A			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr1:183885724G>A	ENST00000360851.3	+	16	2071	c.1893G>A	c.(1891-1893)acG>acA	p.T631T	RGL1_ENST00000536277.1_Silent_p.T629T|RGL1_ENST00000539189.1_Silent_p.T602T|RGL1_ENST00000304685.4_Silent_p.T666T			Q9NZL6	RGL1_HUMAN	ral guanine nucleotide dissociation stimulator-like 1	631					cellular lipid metabolic process (GO:0044255)|positive regulation of Ral GTPase activity (GO:0032852)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	Ral guanyl-nucleotide exchange factor activity (GO:0008321)			breast(5)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(17)|ovary(4)|prostate(3)|stomach(1)	51						TCTCGGTGACGTCCATTACCT	0.498																																						.											0													197.0	180.0	186.0					1																	183885724		2203	4300	6503	SO:0001819	synonymous_variant	23179			AF186780	CCDS1359.1, CCDS72992.1	1q25.2	2008-02-05			ENSG00000143344	ENSG00000143344			30281	protein-coding gene	gene with protein product		605667				10760592, 10231032	Standard	XM_005245010		Approved	RGL	uc001gqm.3	Q9NZL6	OTTHUMG00000035328	ENST00000360851.3:c.1893G>A	1.37:g.183885724G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q5SXQ2|Q5SXQ6|Q9HBY3|Q9HBY4|Q9NZL5|Q9UG43|Q9Y2G6	Silent	SNP	ENST00000360851.3	37																																																																																					0.498	RGL1-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000085742.1	NM_015149	
KIF21B	23046	broad.mit.edu;mdanderson.org;bcgsc.ca	37	1	200943959	200943959	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr1:200943959G>A	ENST00000422435.2	-	34	5013	c.4697C>T	c.(4696-4698)gCg>gTg	p.A1566V	KIF21B_ENST00000332129.2_Missense_Mutation_p.A1553V|KIF21B_ENST00000461742.2_Missense_Mutation_p.A1566V|KIF21B_ENST00000360529.5_Missense_Mutation_p.A1553V	NM_001252100.1	NP_001239029.1	O75037	KI21B_HUMAN	kinesin family member 21B	1566					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(4)|large_intestine(8)|liver(1)|lung(27)|ovary(3)|pancreas(1)|prostate(5)|skin(8)|stomach(2)|urinary_tract(2)	83						GATGACACCCGCACGGCAGGC	0.607																																						.											0													195.0	172.0	180.0					1																	200943959		2203	4300	6503	SO:0001583	missense	23046			BC031927	CCDS30965.1, CCDS58054.1, CCDS58055.1, CCDS58056.1	1q32.1	2013-01-10			ENSG00000116852	ENSG00000116852		"""Kinesins"", ""WD repeat domain containing"""	29442	protein-coding gene	gene with protein product		608322				9455484	Standard	NM_001252100		Approved	DKFZP434J212, KIAA0449	uc001gvs.2	O75037	OTTHUMG00000035787	ENST00000422435.2:c.4697C>T	1.37:g.200943959G>A	ENSP00000411831:p.Ala1566Val	Somatic		WXS	Illumina HiSeq	Phase_I	B2RP62|B7ZMI0|Q5T4J3	Missense_Mutation	SNP	ENST00000422435.2	37	CCDS58056.1	.	.	.	.	.	.	.	.	.	.	G	16.20	3.056322	0.55325	.	.	ENSG00000116852	ENST00000332129;ENST00000360529;ENST00000461742;ENST00000422435;ENST00000539858	T;T;T;T	0.59906	0.23;0.23;0.23;0.23	4.48	2.48	0.30137	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.211121	0.39146	N	0.001442	T	0.50905	0.1643	L	0.51422	1.61	0.29302	N	0.868603	P;P;P;P	0.49253	0.921;0.845;0.921;0.903	B;B;B;B	0.41135	0.348;0.348;0.348;0.236	T	0.56523	-0.7965	10	0.72032	D	0.01	.	13.2708	0.60159	0.0:0.6602:0.3398:0.0	.	1553;1566;1566;1553	B7ZMI0;B2RP62;O75037;O75037-2	.;.;KI21B_HUMAN;.	V	1553;1553;1566;1566;1566	ENSP00000328494:A1553V;ENSP00000353724:A1553V;ENSP00000433808:A1566V;ENSP00000411831:A1566V	ENSP00000328494:A1553V	A	-	2	0	KIF21B	199210582	0.999000	0.42202	0.024000	0.17045	0.930000	0.56654	3.649000	0.54417	0.840000	0.34995	0.561000	0.74099	GCG		0.607	KIF21B-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382635.1	XM_371332	
CAPN2	824	broad.mit.edu	37	1	223936794	223936794	+	Silent	SNP	G	G	C			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr1:223936794G>C	ENST00000295006.5	+	6	1092	c.783G>C	c.(781-783)ggG>ggC	p.G261G	CAPN2_ENST00000433674.2_Silent_p.G183G	NM_001748.4	NP_001739	P17655	CAN2_HUMAN	calpain 2, (m/II) large subunit	261	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				blastocyst development (GO:0001824)|cellular response to amino acid stimulus (GO:0071230)|myoblast fusion (GO:0007520)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of cytoskeleton organization (GO:0051493)|response to hypoxia (GO:0001666)	chromatin (GO:0000785)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cysteine-type peptidase activity (GO:0008234)|cytoskeletal protein binding (GO:0008092)			breast(3)|endometrium(1)|kidney(1)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|stomach(3)	29				GBM - Glioblastoma multiforme(131;0.109)		TGGTGAAGGGGCACGCGTACT	0.647											OREG0014276	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										.											0													62.0	55.0	57.0					1																	223936794		2203	4300	6503	SO:0001819	synonymous_variant	824			J04700	CCDS31035.1, CCDS53478.1	1q41-q42	2013-01-10			ENSG00000162909	ENSG00000162909	3.4.22.52	"""EF-hand domain containing"""	1479	protein-coding gene	gene with protein product		114230				2852952, 2539381	Standard	NM_001748		Approved	mCANP, CANPml, CANPL2	uc001hob.4	P17655	OTTHUMG00000037376	ENST00000295006.5:c.783G>C	1.37:g.223936794G>C		Somatic	2293	WXS	Illumina HiSeq	Phase_I	A6NDG7|B7ZA96|E7ES58|Q16738|Q6PJT3|Q8WU26|Q9HBB1	Silent	SNP	ENST00000295006.5	37	CCDS31035.1																																																																																				0.647	CAPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090973.1	NM_001748	
OBSCN	84033	broad.mit.edu	37	1	228432096	228432096	+	Frame_Shift_Del	DEL	A	A	-			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr1:228432096delA	ENST00000422127.1	+	11	3349	c.3305delA	c.(3304-3306)cagfs	p.Q1102fs	OBSCN_ENST00000570156.2_Frame_Shift_Del_p.Q1194fs|OBSCN_ENST00000366709.4_5'UTR|OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000284548.11_Frame_Shift_Del_p.Q1102fs	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	1102	Ig-like 11.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GCCCAGGCCCAGACGGAGGTG	0.597																																						.											0													85.0	82.0	83.0					1																	228432096		2033	4172	6205	SO:0001589	frameshift_variant	84033			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.3305delA	1.37:g.228432096delA	ENSP00000409493:p.Gln1102fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Frame_Shift_Del	DEL	ENST00000422127.1	37	CCDS58065.1																																																																																				0.597	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
HNRNPU	3192	broad.mit.edu	37	1	245025801	245025803	+	In_Frame_Del	DEL	TCT	TCT	-	rs538951206		TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	TCT	TCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr1:245025801_245025803delTCT	ENST00000283179.9	-	3	1000_1002	c.837_839delAGA	c.(835-840)gaagat>gat	p.E279del	RP11-11N7.4_ENST00000610145.1_lincRNA|HNRNPU_ENST00000444376.2_In_Frame_Del_p.E260del			Q00839	HNRPU_HUMAN	heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A)	279	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				CRD-mediated mRNA stabilization (GO:0070934)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|CRD-mediated mRNA stability complex (GO:0070937)|cytoplasmic ribonucleoprotein granule (GO:0036464)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|endometrium(2)|large_intestine(1)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20	all_cancers(71;6.97e-06)|all_epithelial(71;0.000104)|all_neural(11;0.0269)|Breast(184;0.0545)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0989)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.00868)			GAAGTGTTCATCTTCTTCTTCAA	0.394																																					NSCLC(33;911 1010 3329 23631 49995)	.											0																																										SO:0001651	inframe_deletion	3192			X65488	CCDS31081.1, CCDS41479.1	1q44	2011-10-24		2007-08-16	ENSG00000153187	ENSG00000153187			5048	protein-coding gene	gene with protein product		602869		HNRPU		7509195, 8068679	Standard	NM_031844		Approved	SAF-A, hnRNPU	uc001iaz.1	Q00839	OTTHUMG00000040396	ENST00000283179.9:c.837_839delAGA	1.37:g.245025807_245025809delTCT	ENSP00000283179:p.Glu279del	Somatic		WXS	Illumina HiSeq	Phase_I	O75507|Q8N174|Q96HY9|Q9BQ09	In_Frame_Del	DEL	ENST00000283179.9	37	CCDS41479.1																																																																																				0.394	HNRNPU-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000097163.3	NM_031844	
CNST	163882	broad.mit.edu	37	1	246811292	246811292	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr1:246811292A>G	ENST00000366513.4	+	9	2058	c.1789A>G	c.(1789-1791)Agc>Ggc	p.S597G	CNST_ENST00000483271.1_3'UTR|CNST_ENST00000366512.3_Missense_Mutation_p.S597G	NM_152609.2	NP_689822.2	Q6PJW8	CNST_HUMAN	consortin, connexin sorting protein	597					negative regulation of phosphatase activity (GO:0010923)|positive regulation of Golgi to plasma membrane protein transport (GO:0042998)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|trans-Golgi network (GO:0005802)|transport vesicle (GO:0030133)	connexin binding (GO:0071253)|phosphatase binding (GO:0019902)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|prostate(1)|urinary_tract(2)	28						TTCTGATGAGAGCTGTCTTTC	0.388																																						.											0													83.0	87.0	86.0					1																	246811292		2203	4300	6503	SO:0001583	missense	163882			AK056563	CCDS1628.1, CCDS44343.1	1q44	2012-04-17	2009-11-03	2009-11-03	ENSG00000162852	ENSG00000162852		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	26486	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 64"""	613439	"""chromosome 1 open reading frame 71"""	C1orf71		19864490	Standard	NM_152609		Approved	FLJ32001, PPP1R64	uc001ibp.3	Q6PJW8	OTTHUMG00000040090	ENST00000366513.4:c.1789A>G	1.37:g.246811292A>G	ENSP00000355470:p.Ser597Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q5VSY9|Q5VTM7|Q8IYA9|Q8N3L5|Q8NB09|Q8TEI2|Q96MR5	Missense_Mutation	SNP	ENST00000366513.4	37	CCDS1628.1	.	.	.	.	.	.	.	.	.	.	A	16.18	3.051141	0.55218	.	.	ENSG00000162852	ENST00000366513;ENST00000366512	T;T	0.25912	2.05;1.77	5.62	1.8	0.24995	.	0.454768	0.26082	N	0.026447	T	0.26159	0.0638	M	0.77103	2.36	0.09310	N	0.999997	B;B	0.27997	0.096;0.197	B;B	0.25614	0.039;0.062	T	0.26087	-1.0113	10	0.72032	D	0.01	-27.1833	5.9865	0.19436	0.7426:0.0:0.1354:0.1219	.	597;597	Q6PJW8;Q6PJW8-2	CNST_HUMAN;.	G	597	ENSP00000355470:S597G;ENSP00000355469:S597G	ENSP00000355469:S597G	S	+	1	0	CNST	244877915	0.974000	0.33945	0.007000	0.13788	0.744000	0.42396	2.531000	0.45650	0.498000	0.27948	0.383000	0.25322	AGC		0.388	CNST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096780.1	NM_152609	
FAM21C	253725	broad.mit.edu;mdanderson.org	37	10	46248632	46248632	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr10:46248632A>G	ENST00000336378.4	+	13	1245	c.1127A>G	c.(1126-1128)gAc>gGc	p.D376G	FAM21C_ENST00000540872.1_Missense_Mutation_p.D376G|FAM21C_ENST00000537517.1_Missense_Mutation_p.D352G|FAM21C_ENST00000359860.4_Missense_Mutation_p.D320G|FAM21C_ENST00000374362.2_Missense_Mutation_p.D376G	NM_015262.2	NP_056077.2	Q9Y4E1	FA21C_HUMAN	family with sequence similarity 21, member C	376					retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|endosome (GO:0005768)|plasma membrane (GO:0005886)|WASH complex (GO:0071203)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	28						AACCAGAGTGACCTCTTCACG	0.473																																						.											0													37.0	40.0	39.0					10																	46248632		1230	3396	4626	SO:0001583	missense	253725				CCDS44374.1, CCDS44374.2, CCDS53528.1, CCDS53529.1	10q11.22	2014-05-09			ENSG00000172661	ENSG00000172661			23414	protein-coding gene	gene with protein product		613631				20498093	Standard	NM_015262		Approved	Em:AC012044.3, KIAA0592	uc001jcu.3	Q9Y4E1	OTTHUMG00000018089	ENST00000336378.4:c.1127A>G	10.37:g.46248632A>G	ENSP00000337541:p.Asp376Gly	Somatic		WXS	Illumina HiSeq	Phase_I	B4DZQ6|B9EK53|F5H0J6|F5H871|Q5SQU4|Q5SQU5|Q7L521|Q9UG79	Missense_Mutation	SNP	ENST00000336378.4	37		.	.	.	.	.	.	.	.	.	.	A	16.46	3.128197	0.56721	.	.	ENSG00000172661	ENST00000336378;ENST00000540872;ENST00000537517;ENST00000374362;ENST00000399588;ENST00000359860;ENST00000436993	.	.	.	3.23	3.23	0.37069	.	0.000000	0.85682	D	0.000000	T	0.69593	0.3128	M	0.71581	2.175	0.50813	D	0.999894	D;D;D;D	0.89917	0.998;1.0;1.0;1.0	D;D;D;D	0.97110	0.995;1.0;1.0;0.999	T	0.67998	-0.5525	9	0.37606	T	0.19	-18.0159	8.1116	0.30917	1.0:0.0:0.0:0.0	.	352;376;376;321	F5H871;Q9Y4E1-4;Q9Y4E1;Q9Y4E1-3	.;.;FA21C_HUMAN;.	G	376;376;352;376;376;320;288	.	ENSP00000337541:D376G	D	+	2	0	FAM21C	45568638	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	3.870000	0.56070	1.486000	0.48398	0.491000	0.48974	GAC		0.473	FAM21C-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding			
SWAP70	23075	broad.mit.edu	37	11	9735070	9735070	+	Frame_Shift_Del	DEL	A	A	-			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr11:9735070delA	ENST00000318950.6	+	3	401	c.298delA	c.(298-300)aaafs	p.K101fs	SWAP70_ENST00000447399.2_Intron	NM_015055.2	NP_055870.2	Q9UH65	SWP70_HUMAN	SWAP switching B-cell complex 70kDa subunit	101					isotype switching (GO:0045190)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|DNA binding (GO:0003677)			NS(1)|breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|ovary(2)|pancreas(1)	11				all cancers(16;1.21e-10)|Epithelial(150;2.81e-09)|BRCA - Breast invasive adenocarcinoma(625;0.00649)		CCTCTGTGTCAAAAAAAACCT	0.343																																						.											0													85.0	91.0	89.0					11																	9735070		2201	4294	6495	SO:0001589	frameshift_variant	23075			AB014540	CCDS31426.1, CCDS73257.1	11p15	2013-01-10			ENSG00000133789	ENSG00000133789		"""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"""	17070	protein-coding gene	gene with protein product		604762				9734811, 10681448	Standard	XM_005252829		Approved	KIAA0640, SWAP-70	uc001mhw.3	Q9UH65	OTTHUMG00000165865	ENST00000318950.6:c.298delA	11.37:g.9735070delA	ENSP00000315630:p.Lys101fs	Somatic		WXS	Illumina HiSeq	Phase_I	D3DQV1|O75135|Q7LCY6|Q9P061|Q9P0Z8	Frame_Shift_Del	DEL	ENST00000318950.6	37	CCDS31426.1																																																																																				0.343	SWAP70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386766.2	NM_015055	
SLC38A1	81539	broad.mit.edu	37	12	46633473	46633473	+	Silent	SNP	A	A	G			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr12:46633473A>G	ENST00000398637.5	-	3	805	c.111T>C	c.(109-111)ggT>ggC	p.G37G	SLC38A1_ENST00000439706.1_Silent_p.G37G|SLC38A1_ENST00000549049.1_Silent_p.G37G|SLC38A1_ENST00000549633.1_Intron|SLC38A1_ENST00000552197.1_Silent_p.G37G|SLC38A1_ENST00000546893.1_Silent_p.G37G	NM_001077484.1|NM_001278387.1|NM_001278388.1|NM_001278389.1|NM_030674.3	NP_001070952.1|NP_001265316.1|NP_001265317.1|NP_001265318.1|NP_109599.3	Q9H2H9	S38A1_HUMAN	solute carrier family 38, member 1	37					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|neutral amino acid transport (GO:0015804)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neutral amino acid transmembrane transporter activity (GO:0015175)|sodium:amino acid symporter activity (GO:0005283)			NS(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(2)	23	Lung SC(27;0.137)|Renal(347;0.236)		all cancers(1;0.00805)|OV - Ovarian serous cystadenocarcinoma(5;0.0106)|Epithelial(2;0.0344)			TATTTATCTGACCATTTTCTA	0.418																																						.											0													151.0	140.0	144.0					12																	46633473		1874	4124	5998	SO:0001819	synonymous_variant	81539			AF271070	CCDS41774.1, CCDS61106.1	12q13.11	2013-05-22				ENSG00000111371		"""Solute carriers"""	13447	protein-coding gene	gene with protein product		608490				10891391	Standard	NM_030674		Approved	ATA1, NAT2, SAT1	uc001rpc.3	Q9H2H9		ENST00000398637.5:c.111T>C	12.37:g.46633473A>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q8NC61|Q8NCF8|Q96JX2|Q9H2Q2	Silent	SNP	ENST00000398637.5	37	CCDS41774.1																																																																																				0.418	SLC38A1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404218.2		
PCDH8	5100	broad.mit.edu	37	13	53420463	53420465	+	In_Frame_Del	DEL	GGT	GGT	-			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	GGT	GGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr13:53420463_53420465delGGT	ENST00000377942.3	-	1	2310_2312	c.2107_2109delACC	c.(2107-2109)accdel	p.T703del	PCDH8_ENST00000338862.4_In_Frame_Del_p.T703del	NM_002590.3	NP_002581.2	O95206	PCDH8_HUMAN	protocadherin 8	703	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|morphogenesis of embryonic epithelium (GO:0016331)|somitogenesis (GO:0001756)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(23)|ovary(1)|skin(1)|urinary_tract(1)	36		Lung NSC(96;0.0019)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.19e-08)		TGACAGTTGCGGTGGTGGTGAGC	0.714																																					GBM(36;25 841 9273 49207)	.											0																																										SO:0001651	inframe_deletion	5100			AF061573	CCDS9438.1, CCDS9439.1	13q21.1	2010-02-22			ENSG00000136099	ENSG00000136099		"""Cadherins / Protocadherins : Non-clustered"""	8660	protein-coding gene	gene with protein product		603580				9787079, 9315676	Standard	NM_002590		Approved	PAPC, ARCADLIN	uc001vhi.3	O95206	OTTHUMG00000016979	ENST00000377942.3:c.2107_2109delACC	13.37:g.53420469_53420471delGGT	ENSP00000367177:p.Thr703del	Somatic		WXS	Illumina HiSeq	Phase_I	B4DMV7|Q5TAN1|Q5TAN2|Q8IYE9|Q96SF1	In_Frame_Del	DEL	ENST00000377942.3	37	CCDS9438.1																																																																																				0.714	PCDH8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045108.2	NM_002590	
VRTN	55237	broad.mit.edu;mdanderson.org;bcgsc.ca	37	14	74824716	74824716	+	Missense_Mutation	SNP	G	G	C			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr14:74824716G>C	ENST00000256362.4	+	2	1471	c.1230G>C	c.(1228-1230)gaG>gaC	p.E410D		NM_018228.2	NP_060698.2	Q9H8Y1	VRTN_HUMAN	vertebrae development associated	410					transposition, DNA-mediated (GO:0006313)		sequence-specific DNA binding (GO:0043565)|transposase activity (GO:0004803)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(15)|ovary(5)|prostate(2)|skin(1)|urinary_tract(1)	41						TGTACCTGGAGCATTGCATCT	0.577																																						.											0													116.0	103.0	108.0					14																	74824716		2203	4300	6503	SO:0001583	missense	55237			AK001673	CCDS9830.1	14q24.2	2012-12-07	2012-12-07	2010-10-20	ENSG00000133980	ENSG00000133980			20223	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 115"", ""vertebrae development homolog (pig)"""	C14orf115		21232157	Standard	NM_018228		Approved	FLJ10811, vertnin	uc001xpw.4	Q9H8Y1	OTTHUMG00000171208	ENST00000256362.4:c.1230G>C	14.37:g.74824716G>C	ENSP00000256362:p.Glu410Asp	Somatic		WXS	Illumina HiSeq	Phase_I	Q9NVC7	Missense_Mutation	SNP	ENST00000256362.4	37	CCDS9830.1	.	.	.	.	.	.	.	.	.	.	G	16.99	3.273359	0.59649	.	.	ENSG00000133980	ENST00000256362	T	0.50001	0.76	4.59	4.59	0.56863	.	0.072575	0.56097	D	0.000031	T	0.48169	0.1485	L	0.27053	0.805	0.31311	N	0.687184	D	0.67145	0.996	P	0.58266	0.836	T	0.54603	-0.8269	10	0.62326	D	0.03	-6.1439	10.3686	0.44039	0.09:0.0:0.91:0.0	.	410	Q9H8Y1	VRTN_HUMAN	D	410	ENSP00000256362:E410D	ENSP00000256362:E410D	E	+	3	2	VRTN	73894469	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	1.475000	0.35409	2.371000	0.80710	0.561000	0.74099	GAG		0.577	VRTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412339.1	NM_018228	
CEP170B	283638	broad.mit.edu	37	14	105359440	105359440	+	Missense_Mutation	SNP	A	A	C			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr14:105359440A>C	ENST00000414716.3	+	14	4234	c.4006A>C	c.(4006-4008)Acc>Ccc	p.T1336P	CEP170B_ENST00000453495.1_Missense_Mutation_p.T1372P|CEP170B_ENST00000556508.1_Missense_Mutation_p.T1301P|CEP170B_ENST00000418279.1_Missense_Mutation_p.T1266P	NM_001112726.2	NP_001106197.1	Q9Y4F5	C170B_HUMAN	centrosomal protein 170B	1371						cytoplasm (GO:0005737)|microtubule (GO:0005874)											CATGCCCAGCACCCCCGCCTC	0.687																																						.											0													16.0	25.0	22.0					14																	105359440		2084	4203	6287	SO:0001583	missense	283638			AB006622	CCDS45175.1, CCDS45176.1, CCDS45176.2	14q32.33	2014-02-20	2012-11-30	2012-11-30	ENSG00000099814	ENSG00000099814			20362	protein-coding gene	gene with protein product	"""Cep170-related"""		"""KIAA0284"""	KIAA0284		23087211	Standard	NM_015005		Approved	FAM68C, Cep170R	uc010axb.4	Q9Y4F5	OTTHUMG00000170763	ENST00000414716.3:c.4006A>C	14.37:g.105359440A>C	ENSP00000404151:p.Thr1336Pro	Somatic		WXS	Illumina HiSeq	Phase_I	Q2KHR7|Q86TI7	Missense_Mutation	SNP	ENST00000414716.3	37	CCDS45175.1	.	.	.	.	.	.	.	.	.	.	A	18.15	3.559308	0.65538	.	.	ENSG00000099814	ENST00000556508;ENST00000414716;ENST00000453495;ENST00000418279;ENST00000429757	T;T;T;T	0.56103	0.5;0.62;0.48;0.63	4.45	3.25	0.37280	.	0.337000	0.26919	N	0.021828	T	0.57844	0.2081	M	0.71581	2.175	0.36088	D	0.843223	P;P;B	0.43169	0.776;0.8;0.429	P;B;B	0.47626	0.552;0.261;0.326	T	0.67122	-0.5750	10	0.87932	D	0	-24.8257	10.0086	0.41972	0.8482:0.0:0.0:0.1518	.	1336;1371;1266	Q9Y4F5-2;Q9Y4F5;E9PFC1	.;K0284_HUMAN;.	P	1301;1336;1372;1266;4	ENSP00000451249:T1301P;ENSP00000404151:T1336P;ENSP00000407238:T1372P;ENSP00000415006:T1266P	ENSP00000404151:T1336P	T	+	1	0	KIAA0284	104430485	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	4.006000	0.57083	0.527000	0.28560	0.347000	0.21830	ACC		0.687	CEP170B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000410289.2	NM_001112726	
SQRDL	58472	broad.mit.edu;mdanderson.org;bcgsc.ca	37	15	45954211	45954211	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr15:45954211C>T	ENST00000260324.7	+	3	679	c.293C>T	c.(292-294)tCa>tTa	p.S98L	SQRDL_ENST00000568606.1_Missense_Mutation_p.S98L|RP11-96O20.4_ENST00000564080.1_Missense_Mutation_p.S98L	NM_021199.3	NP_067022.1	Q9Y6N5	SQRD_HUMAN	sulfide quinone reductase-like (yeast)	98					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|sulfide oxidation, using sulfide:quinone oxidoreductase (GO:0070221)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)	mitochondrial inner membrane (GO:0005743)	sulfide:quinone oxidoreductase activity (GO:0070224)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)	11		Lung NSC(122;0.000117)|all_lung(180;0.000737)|Melanoma(134;0.0417)		all cancers(107;5.89e-18)|GBM - Glioblastoma multiforme(94;1.21e-06)|COAD - Colon adenocarcinoma(120;0.17)|Colorectal(133;0.188)		CAATTGTCCTCATCTGGTCGT	0.443																																						.											0													115.0	94.0	101.0					15																	45954211		2198	4297	6495	SO:0001583	missense	58472			AF042284	CCDS10127.1	15q21.1	2010-08-05			ENSG00000137767	ENSG00000137767			20390	protein-coding gene	gene with protein product						10810093, 10224084	Standard	NM_021199		Approved	CGI-44	uc001zvu.4	Q9Y6N5	OTTHUMG00000131476	ENST00000260324.7:c.293C>T	15.37:g.45954211C>T	ENSP00000260324:p.Ser98Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q9UQM8	Missense_Mutation	SNP	ENST00000260324.7	37	CCDS10127.1	.	.	.	.	.	.	.	.	.	.	C	7.286	0.610024	0.14066	.	.	ENSG00000137767	ENST00000260324	T	0.50277	0.75	5.52	2.58	0.30949	Pyridine nucleotide-disulphide oxidoreductase, FAD/NAD(P)-binding domain (1);	0.422413	0.26646	N	0.023238	T	0.39835	0.1093	M	0.71581	2.175	0.18873	N	0.999982	B	0.06786	0.001	B	0.13407	0.009	T	0.37361	-0.9709	10	0.37606	T	0.19	.	2.3248	0.04220	0.1332:0.5191:0.1299:0.2178	.	98	Q9Y6N5	SQRD_HUMAN	L	98	ENSP00000260324:S98L	ENSP00000260324:S98L	S	+	2	0	SQRDL	43741503	0.001000	0.12720	0.280000	0.24747	0.020000	0.10135	1.158000	0.31737	0.277000	0.22141	-0.140000	0.14226	TCA		0.443	SQRDL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254319.2		
TRPM7	54822	broad.mit.edu;mdanderson.org	37	15	50884111	50884111	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr15:50884111C>T	ENST00000313478.7	-	26	4602	c.4321G>A	c.(4321-4323)Gta>Ata	p.V1441I	TRPM7_ENST00000560955.1_Missense_Mutation_p.V1441I	NM_017672.4	NP_060142.3	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel, subfamily M, member 7	1441					actomyosin structure organization (GO:0031032)|calcium ion transmembrane transport (GO:0070588)|calcium-dependent cell-matrix adhesion (GO:0016340)|cellular magnesium ion homeostasis (GO:0010961)|ion transmembrane transport (GO:0034220)|necroptotic process (GO:0070266)|protein autophosphorylation (GO:0046777)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(17)|lung(13)|ovary(4)|pancreas(1)|skin(4)|stomach(3)	52				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		AACTTACCTACAAATGCTCCA	0.318																																						.											0													74.0	69.0	71.0					15																	50884111		1799	4066	5865	SO:0001583	missense	54822			AF346629	CCDS42035.1, CCDS73725.1	15q21	2011-12-14				ENSG00000092439		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17994	protein-coding gene	gene with protein product		605692				11161216, 11385574, 16382100	Standard	XM_005254486		Approved	CHAK1, LTRPC7, TRP-PLIK	uc001zyt.4	Q96QT4		ENST00000313478.7:c.4321G>A	15.37:g.50884111C>T	ENSP00000320239:p.Val1441Ile	Somatic		WXS	Illumina HiSeq	Phase_I	Q6ZMF5|Q86VJ4|Q8NBW2|Q9BXB2|Q9NXQ2	Missense_Mutation	SNP	ENST00000313478.7	37	CCDS42035.1	.	.	.	.	.	.	.	.	.	.	C	16.29	3.081246	0.55753	.	.	ENSG00000092439	ENST00000313478	T	0.56611	0.45	5.91	4.05	0.47172	.	0.337756	0.27315	N	0.019932	T	0.37237	0.0996	N	0.24115	0.695	0.44668	D	0.997658	B	0.27229	0.172	B	0.25140	0.058	T	0.09840	-1.0656	10	0.27082	T	0.32	.	12.4344	0.55590	0.0:0.8654:0.0:0.1346	.	1441	Q96QT4	TRPM7_HUMAN	I	1441	ENSP00000320239:V1441I	ENSP00000320239:V1441I	V	-	1	0	TRPM7	48671403	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	3.988000	0.56951	0.861000	0.35504	-0.259000	0.10710	GTA		0.318	TRPM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418604.1	NM_017672	
CALB2	794	broad.mit.edu;ucsc.edu	37	16	71419536	71419536	+	Silent	SNP	C	C	T	rs139080757		TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr16:71419536C>T	ENST00000302628.4	+	10	761	c.684C>T	c.(682-684)taC>taT	p.Y228Y	CALB2_ENST00000349553.5_3'UTR	NM_001740.4	NP_001731.2	P22676	CALB2_HUMAN	calbindin 2	228	EF-hand 5. {ECO:0000255|PROSITE- ProRule:PRU00448}.				cytosolic calcium ion homeostasis (GO:0051480)	cytoplasm (GO:0005737)|gap junction (GO:0005921)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	18		Ovarian(137;0.125)				AGGATCTGTACGAGAAAAACA	0.577																																						.											0								C	,	1,4395		0,1,2197	51.0	47.0	48.0		684,	-4.6	0.8	16	dbSNP_134	48	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,utr-3	CALB2	NM_001740.4,NM_007088.3	,	0,2,6496	TT,TC,CC		0.0116,0.0227,0.0154	,	228/272,	71419536	2,12994	2198	4300	6498	SO:0001819	synonymous_variant	794			X56667	CCDS10899.1	16q22.2	2013-01-10	2008-05-19		ENSG00000172137	ENSG00000172137		"""EF-hand domain containing"""	1435	protein-coding gene	gene with protein product	"""calretinin"""	114051	"""calbindin 2, 29kDa (calretinin)"""			1906795	Standard	NM_001740		Approved	CAL2	uc002faa.4	P22676	OTTHUMG00000137589	ENST00000302628.4:c.684C>T	16.37:g.71419536C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A8K4Y1|Q53HD2|Q96BK4	Silent	SNP	ENST00000302628.4	37	CCDS10899.1																																																																																				0.577	CALB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268988.1	NM_001740	
STAT5B	6777	broad.mit.edu	37	17	40364022	40364022	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr17:40364022A>G	ENST00000293328.3	-	13	1828	c.1660T>C	c.(1660-1662)Tcc>Ccc	p.S554P		NM_012448.3	NP_036580.2	P51692	STA5B_HUMAN	signal transducer and activator of transcription 5B	554					2-oxoglutarate metabolic process (GO:0006103)|acute-phase response (GO:0006953)|allantoin metabolic process (GO:0000255)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hormone stimulus (GO:0032870)|citrate metabolic process (GO:0006101)|creatine metabolic process (GO:0006600)|creatinine metabolic process (GO:0046449)|development of secondary female sexual characteristics (GO:0046543)|development of secondary male sexual characteristics (GO:0046544)|fatty acid metabolic process (GO:0006631)|female pregnancy (GO:0007565)|isoleucine metabolic process (GO:0006549)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|lipid storage (GO:0019915)|liver development (GO:0001889)|luteinization (GO:0001553)|natural killer cell differentiation (GO:0001779)|negative regulation of apoptotic process (GO:0043066)|negative regulation of erythrocyte differentiation (GO:0045647)|oxaloacetate metabolic process (GO:0006107)|Peyer's patch development (GO:0048541)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of cellular component movement (GO:0051272)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|progesterone metabolic process (GO:0042448)|prolactin signaling pathway (GO:0038161)|regulation of cell adhesion (GO:0030155)|regulation of epithelial cell differentiation (GO:0030856)|regulation of multicellular organism growth (GO:0040014)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to lipopolysaccharide (GO:0032496)|succinate metabolic process (GO:0006105)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|taurine metabolic process (GO:0019530)|transcription from RNA polymerase II promoter (GO:0006366)|valine metabolic process (GO:0006573)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|glucocorticoid receptor binding (GO:0035259)|protein dimerization activity (GO:0046983)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_cancers(22;4.15e-07)|all_epithelial(22;2.83e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.135)	Dasatinib(DB01254)	TGGGACCAGGACACAGACAGG	0.607																																						.											0													63.0	50.0	54.0					17																	40364022		2203	4300	6503	SO:0001583	missense	6777			BC065227	CCDS11423.1	17q11.2	2014-09-17			ENSG00000173757	ENSG00000173757		"""SH2 domain containing"""	11367	protein-coding gene	gene with protein product		604260				8631883	Standard	NM_012448		Approved		uc002hzh.3	P51692	OTTHUMG00000150724	ENST00000293328.3:c.1660T>C	17.37:g.40364022A>G	ENSP00000293328:p.Ser554Pro	Somatic		WXS	Illumina HiSeq	Phase_I	Q8WWS8	Missense_Mutation	SNP	ENST00000293328.3	37	CCDS11423.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.128074	0.77549	.	.	ENSG00000173757	ENST00000293328	D	0.88664	-2.41	5.42	5.42	0.78866	STAT transcription factor, DNA-binding (1);p53-like transcription factor, DNA-binding (1);EF-hand-like domain (1);	0.095971	0.64402	D	0.000001	D	0.91935	0.7446	L	0.45422	1.42	0.52501	D	0.999959	D	0.64830	0.994	D	0.71184	0.972	D	0.92839	0.6287	10	0.87932	D	0	-3.9242	15.6229	0.76820	1.0:0.0:0.0:0.0	.	554	P51692	STA5B_HUMAN	P	554	ENSP00000293328:S554P	ENSP00000293328:S554P	S	-	1	0	STAT5B	37617548	1.000000	0.71417	1.000000	0.80357	0.773000	0.43773	5.667000	0.68067	2.279000	0.76181	0.402000	0.26972	TCC		0.607	STAT5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319797.1	NM_012448	
CCDC137	339230	broad.mit.edu;bcgsc.ca	37	17	79633801	79633801	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr17:79633801C>T	ENST00000329214.8	+	1	408	c.5C>T	c.(4-6)gCg>gTg	p.A2V	OXLD1_ENST00000374741.3_5'Flank|OXLD1_ENST00000573786.1_5'Flank|OXLD1_ENST00000571503.1_5'Flank	NM_199287.2	NP_954981.1	Q6PK04	CC137_HUMAN	coiled-coil domain containing 137	2							poly(A) RNA binding (GO:0044822)			NS(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(2)	12	all_neural(118;0.0878)|all_lung(278;0.23)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			GTGGAGATGGCGGGAGCTGGT	0.716																																						.											0													15.0	23.0	20.0					17																	79633801		2120	4226	6346	SO:0001583	missense	339230			BC009369	CCDS42400.1	17q25.3	2008-07-04				ENSG00000185298			33451	protein-coding gene	gene with protein product		614271					Standard	NM_199287		Approved	MGC16597	uc002kbc.4	Q6PK04		ENST00000329214.8:c.5C>T	17.37:g.79633801C>T	ENSP00000329360:p.Ala2Val	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000329214.8	37	CCDS42400.1	.	.	.	.	.	.	.	.	.	.	C	14.41	2.527202	0.44969	.	.	ENSG00000185298	ENST00000329214	T	0.22336	1.96	3.0	0.871	0.19107	.	0.877314	0.09590	N	0.781616	T	0.21718	0.0523	L	0.51422	1.61	0.22531	N	0.999019	D	0.63880	0.993	P	0.46452	0.517	T	0.19647	-1.0299	10	0.30078	T	0.28	.	7.5055	0.27542	0.4677:0.5323:0.0:0.0	.	2	Q6PK04	CC137_HUMAN	V	2	ENSP00000329360:A2V	ENSP00000329360:A2V	A	+	2	0	CCDC137	77244206	0.000000	0.05858	0.345000	0.25642	0.004000	0.04260	-2.213000	0.01224	0.269000	0.21961	-0.311000	0.09066	GCG		0.716	CCDC137-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440387.1		
TRAPPC8	22878	broad.mit.edu	37	18	29450409	29450409	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr18:29450409T>C	ENST00000283351.4	-	16	2649	c.2314A>G	c.(2314-2316)Act>Gct	p.T772A	TRAPPC8_ENST00000582539.1_Missense_Mutation_p.T718A	NM_014939.3	NP_055754	Q9Y2L5	TPPC8_HUMAN	trafficking protein particle complex 8	772					vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(7)|liver(2)|lung(13)|ovary(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						GACAAATCAGTCAACAAAAGT	0.289																																						.											0													62.0	63.0	63.0					18																	29450409		2202	4297	6499	SO:0001583	missense	22878			AB023229	CCDS11901.1	18q12.1	2011-10-10	2010-06-29	2010-06-29	ENSG00000153339	ENSG00000153339		"""Trafficking protein particle complex"""	29169	protein-coding gene	gene with protein product	"""general sporulation gene 1 homolog (S. cerevisiae)"""	614136	"""KIAA1012"""	KIAA1012		10231032, 11230166	Standard	NM_014939		Approved	HsT2706, TRS85, GSG1	uc002kxc.4	Q9Y2L5	OTTHUMG00000132267	ENST00000283351.4:c.2314A>G	18.37:g.29450409T>C	ENSP00000283351:p.Thr772Ala	Somatic		WXS	Illumina HiSeq	Phase_I	A0JP15|B3KME5|Q9H0L2	Missense_Mutation	SNP	ENST00000283351.4	37	CCDS11901.1	.	.	.	.	.	.	.	.	.	.	T	11.99	1.803684	0.31869	.	.	ENSG00000153339	ENST00000283351	T	0.08282	3.11	5.98	4.8	0.61643	.	0.099720	0.64402	D	0.000001	T	0.09598	0.0236	L	0.45581	1.43	0.80722	D	1	B	0.09022	0.002	B	0.09377	0.004	T	0.06162	-1.0842	10	0.42905	T	0.14	.	12.2287	0.54476	0.1311:0.0:0.0:0.8689	.	772	Q9Y2L5	TPPC8_HUMAN	A	772	ENSP00000283351:T772A	ENSP00000283351:T772A	T	-	1	0	TRAPPC8	27704407	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	2.958000	0.49145	1.042000	0.40150	0.528000	0.53228	ACT		0.289	TRAPPC8-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255355.1	NM_014939	
MALT1	10892	broad.mit.edu	37	18	56414969	56414969	+	Silent	SNP	C	C	T	rs200126163		TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr18:56414969C>T	ENST00000348428.3	+	17	2628	c.2370C>T	c.(2368-2370)ttC>ttT	p.F790F	RP11-126O1.4_ENST00000588835.1_RNA|MALT1_ENST00000345724.3_Silent_p.F779F	NM_006785.2|NM_173844.1	NP_006776.1|NP_776216.1	Q9UDY8	MALT1_HUMAN	mucosa associated lymphoid tissue lymphoma translocation gene 1	790					activation of NF-kappaB-inducing kinase activity (GO:0007250)|B-1 B cell differentiation (GO:0001923)|defense response (GO:0006952)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|nuclear export (GO:0051168)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|protein oligomerization (GO:0051259)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of T cell receptor signaling pathway (GO:0050856)|response to fungus (GO:0009620)|response to molecule of bacterial origin (GO:0002237)|T cell proliferation (GO:0042098)|T cell receptor signaling pathway (GO:0050852)	CBM complex (GO:0032449)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	cysteine-type endopeptidase activity (GO:0004197)|peptidase activity (GO:0008233)|protein self-association (GO:0043621)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(1)|large_intestine(7)|lung(1)|ovary(2)|skin(1)	12						TTTCAAGTTTCGCTCACCATG	0.403			T	BIRC3	MALT								C|||	1	0.000199681	0.0008	0.0	5008	,	,		21654	0.0		0.0	False		,,,				2504	0.0					.		Dom	yes		18	18q21	10892	mucosa associated lymphoid tissue lymphoma translocation gene 1		L	0								C	,	0,4406		0,0,2203	157.0	154.0	155.0		2370,2337	-7.5	0.0	18		155	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous,coding-synonymous	MALT1	NM_006785.2,NM_173844.1	,	0,3,6500	TT,TC,CC		0.0349,0.0,0.0231	,	790/825,779/814	56414969	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	10892				CCDS11967.1, CCDS11968.1	18q21	2013-01-11			ENSG00000172175	ENSG00000172175		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6819	protein-coding gene	gene with protein product	"""paracaspase"""	604860		MLT		10339464, 10406266, 10523859	Standard	NM_006785		Approved		uc002lhm.1	Q9UDY8	OTTHUMG00000132761	ENST00000348428.3:c.2370C>T	18.37:g.56414969C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q9NTB7|Q9ULX4	Silent	SNP	ENST00000348428.3	37	CCDS11967.1																																																																																				0.403	MALT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256132.2		
NUCB1	4924	broad.mit.edu	37	19	49425109	49425111	+	In_Frame_Del	DEL	AGC	AGC	-			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	AGC	AGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr19:49425109_49425111delAGC	ENST00000405315.4	+	12	1533_1535	c.1199_1201delAGC	c.(1198-1203)aagcag>aag	p.Q407del	NUCB1-AS1_ENST00000416432.1_RNA|NUCB1_ENST00000407032.1_In_Frame_Del_p.Q407del|NUCB1_ENST00000263273.5_In_Frame_Del_p.Q407del|NUCB1_ENST00000485798.1_3'UTR	NM_006184.5	NP_006175.2	Q02818	NUCB1_HUMAN	nucleobindin 1	407	Poly-Gln.					endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)			cervix(1)|endometrium(4)|large_intestine(4)|lung(8)	17		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000171)|all cancers(93;0.000333)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0244)		Gagcagcggaagcagcagcagca	0.64																																						.											0																																										SO:0001651	inframe_deletion	4924			BC002356	CCDS12740.1	19q13.33	2013-01-10			ENSG00000104805	ENSG00000104805		"""EF-hand domain containing"""	8043	protein-coding gene	gene with protein product		601323				8661046	Standard	NM_006184		Approved	NUC, Calnuc	uc002plb.4	Q02818	OTTHUMG00000152514	ENST00000405315.4:c.1199_1201delAGC	19.37:g.49425118_49425120delAGC	ENSP00000385923:p.Gln407del	Somatic		WXS	Illumina HiSeq	Phase_I	B2RD64|Q15838|Q7Z4J7|Q9BUR1	In_Frame_Del	DEL	ENST00000405315.4	37	CCDS12740.1																																																																																				0.640	NUCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326545.2	NM_006184	
ZNF264	9422	broad.mit.edu	37	19	57724079	57724079	+	Silent	SNP	C	C	T			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr19:57724079C>T	ENST00000263095.6	+	4	2028	c.1614C>T	c.(1612-1614)ccC>ccT	p.P538P	ZNF264_ENST00000536056.1_Silent_p.P538P	NM_003417.4	NP_003408.1	O43296	ZN264_HUMAN	zinc finger protein 264	538					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(8)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	27		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0135)		GAGAGAAGCCCTATAAATGTA	0.463																																						.											0													101.0	99.0	100.0					19																	57724079		2203	4300	6503	SO:0001819	synonymous_variant	9422			AB007872	CCDS33127.1	19q13.4	2013-01-08				ENSG00000083844		"""Zinc fingers, C2H2-type"", ""-"""	13057	protein-coding gene	gene with protein product		604668				9455477	Standard	NM_003417		Approved	KIAA0412	uc002qob.3	O43296		ENST00000263095.6:c.1614C>T	19.37:g.57724079C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A8K8Y9|Q9P1V0	Silent	SNP	ENST00000263095.6	37	CCDS33127.1																																																																																				0.463	ZNF264-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465080.1		
XDH	7498	broad.mit.edu	37	2	31590910	31590910	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr2:31590910T>C	ENST00000379416.3	-	20	2162	c.2114A>G	c.(2113-2115)aAc>aGc	p.N705S		NM_000379.3	NP_000370.2	P47989	XDH_HUMAN	xanthine dehydrogenase	705					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|lactation (GO:0007595)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of gene expression (GO:0010629)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|negative regulation of vasculogenesis (GO:2001213)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)|xanthine catabolic process (GO:0009115)	cytosol (GO:0005829)|extracellular space (GO:0005615)|peroxisome (GO:0005777)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|protein homodimerization activity (GO:0042803)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)|xanthine oxidase activity (GO:0004855)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(31)|ovary(1)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(1)	74	Acute lymphoblastic leukemia(172;0.155)				Aldesleukin(DB00041)|Allopurinol(DB00437)|Azathioprine(DB00993)|Carboplatin(DB00958)|Carvedilol(DB01136)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Doxorubicin(DB00997)|Flavin adenine dinucleotide(DB03147)|L-Carnitine(DB00583)|Menadione(DB00170)|Mercaptopurine(DB01033)|Nitrofural(DB00336)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Spermine(DB00127)|Trifluoperazine(DB00831)	AAAGGAGTTGTTCTTTATAGC	0.438																																					Colon(66;682 1445 30109 40147)	.											0													157.0	148.0	151.0					2																	31590910		2203	4300	6503	SO:0001583	missense	7498			D11456	CCDS1775.1	2p23.1	2009-07-10	2003-03-20		ENSG00000158125	ENSG00000158125	1.17.1.4		12805	protein-coding gene	gene with protein product		607633	"""xanthene dehydrogenase"""			8224915	Standard	NM_000379		Approved	XOR, XO	uc002rnv.1	P47989	OTTHUMG00000099385	ENST00000379416.3:c.2114A>G	2.37:g.31590910T>C	ENSP00000368727:p.Asn705Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q16681|Q16712|Q4PJ16	Missense_Mutation	SNP	ENST00000379416.3	37	CCDS1775.1	.	.	.	.	.	.	.	.	.	.	T	15.87	2.961610	0.53400	.	.	ENSG00000158125	ENST00000379416	T	0.38077	1.16	6.02	6.02	0.97574	Aldehyde oxidase/xanthine dehydrogenase, molybdopterin binding (3);	0.371642	0.33457	N	0.004886	T	0.31575	0.0801	L	0.28556	0.865	0.34950	D	0.751198	B	0.22080	0.064	B	0.27170	0.077	T	0.39761	-0.9598	10	0.59425	D	0.04	.	14.4967	0.67694	0.0:0.0:0.0:1.0	.	705	P47989	XDH_HUMAN	S	705	ENSP00000368727:N705S	ENSP00000368727:N705S	N	-	2	0	XDH	31444414	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	3.093000	0.50217	2.311000	0.77944	0.533000	0.62120	AAC		0.438	XDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216840.1	NM_000379	
ANKRD36BP2	645784	broad.mit.edu	37	2	89104362	89104362	+	RNA	SNP	C	C	T	rs62158694		TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr2:89104362C>T	ENST00000393525.3	+	0	4836									ankyrin repeat domain 36B pseudogene 2																		CCAAATTGAGCGACTTGAGAA	0.323																																						.											0																																												645784					2q11.2	2010-09-30			ENSG00000230006	ENSG00000230006			33607	pseudogene	pseudogene							Standard	NR_015424		Approved		uc010fhg.4		OTTHUMG00000151690		2.37:g.89104362C>T		Somatic		WXS	Illumina HiSeq	Phase_I		RNA	SNP	ENST00000393525.3	37																																																																																					0.323	ANKRD36BP2-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000323523.1		
WASH2P	375260	broad.mit.edu	37	2	114355200	114355200	+	RNA	SNP	A	A	G	rs200864112	byFrequency	TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr2:114355200A>G	ENST00000538033.2	+	0	2139							Q6VEQ5	WASH2_HUMAN	WAS protein family homolog 2 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)										gaagaagcagaaggagcagga	0.652																																						.											0																																												375260					2q13	2010-07-08	2008-01-16	2008-01-16	ENSG00000146556	ENSG00000146556		"""WAS protein homologs"""	33145	pseudogene	pseudogene			"""family with sequence similarity 39, member B"""	FAM39B		18159949	Standard	NR_024077		Approved	MGC52000	uc002tkh.3	Q6VEQ5	OTTHUMG00000047822		2.37:g.114355200A>G		Somatic		WXS	Illumina HiSeq	Phase_I		RNA	SNP	ENST00000538033.2	37																																																																																					0.652	WASH2P-002	KNOWN	mRNA_end_NF|basic	retained_intron	pseudogene	OTTHUMT00000467782.1	NM_198943	
MCM6	4175	broad.mit.edu	37	2	136614368	136614368	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr2:136614368T>C	ENST00000264156.2	-	11	1616	c.1556A>G	c.(1555-1557)aAt>aGt	p.N519S	MCM6_ENST00000492091.1_Intron	NM_005915.5	NP_005906.2	Q14566	MCM6_HUMAN	minichromosome maintenance complex component 6	519	MCM.				DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	MCM complex (GO:0042555)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|identical protein binding (GO:0042802)|single-stranded DNA binding (GO:0003697)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(15)|prostate(2)|skin(1)	29				BRCA - Breast invasive adenocarcinoma(221;0.166)		CAAATTTATATTCTGTTTCAA	0.423																																					Ovarian(196;141 2104 8848 24991 25939)	.											0													133.0	127.0	129.0					2																	136614368		2203	4300	6503	SO:0001583	missense	4175				CCDS2179.1	2q14-q21	2008-02-05	2007-04-04		ENSG00000076003	ENSG00000076003			6949	protein-coding gene	gene with protein product	"""MIS5 homolog (S.pombe)"""	601806	"""minichromosome maintenance deficient (mis5, S. pombe) 6"", ""MCM6 minichromosome maintenance deficient 6 (MIS5 homolog, S. pombe) (S. cerevisiae)"", ""minichromosome maintenance deficient 6 homolog (S. cerevisiae)"""				Standard	NM_005915		Approved	Mis5	uc002tuw.4	Q14566	OTTHUMG00000131739	ENST00000264156.2:c.1556A>G	2.37:g.136614368T>C	ENSP00000264156:p.Asn519Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B2R6H2|Q13504|Q99859	Missense_Mutation	SNP	ENST00000264156.2	37	CCDS2179.1	.	.	.	.	.	.	.	.	.	.	T	26.5	4.742623	0.89573	.	.	ENSG00000076003	ENST00000264156	T	0.09255	3.0	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.48892	0.1525	H	0.97103	3.94	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.67268	-0.5713	10	0.87932	D	0	-24.3423	15.8953	0.79329	0.0:0.0:0.0:1.0	.	519	Q14566	MCM6_HUMAN	S	519	ENSP00000264156:N519S	ENSP00000264156:N519S	N	-	2	0	MCM6	136330838	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.902000	0.87389	2.158000	0.67659	0.482000	0.46254	AAT		0.423	MCM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254658.1	NM_005915	
LRP2	4036	broad.mit.edu	37	2	169999257	169999257	+	Silent	SNP	T	T	C			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr2:169999257T>C	ENST00000263816.3	-	71	13320	c.13035A>G	c.(13033-13035)agA>agG	p.R4345R		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	4345	EGF-like 16. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	ATCCTCCAGGTCTCAGAAGGC	0.537																																						.											0													109.0	104.0	105.0					2																	169999257		2203	4300	6503	SO:0001819	synonymous_variant	4036				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.13035A>G	2.37:g.169999257T>C		Somatic		WXS	Illumina HiSeq	Phase_I	O00711|Q16215	Silent	SNP	ENST00000263816.3	37	CCDS2232.1																																																																																				0.537	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
UNC80	285175	broad.mit.edu	37	2	210836958	210836958	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr2:210836958A>G	ENST00000439458.1	+	54	8172	c.8092A>G	c.(8092-8094)Atc>Gtc	p.I2698V	UNC80_ENST00000272845.6_Missense_Mutation_p.I2693V|UNC80_ENST00000539183.1_Missense_Mutation_p.I144V	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	2698					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						AAGCCATGTGATCTCCCCATT	0.393																																						.											0													190.0	158.0	168.0					2																	210836958		692	1591	2283	SO:0001583	missense	285175			AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.8092A>G	2.37:g.210836958A>G	ENSP00000391088:p.Ile2698Val	Somatic		WXS	Illumina HiSeq	Phase_I	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	ENST00000439458.1	37	CCDS46504.1	.	.	.	.	.	.	.	.	.	.	A	12.74	2.028284	0.35797	.	.	ENSG00000144406	ENST00000439458;ENST00000272845;ENST00000333907;ENST00000539183	T;T	0.30981	1.51;1.51	6.17	6.17	0.99709	.	.	.	.	.	T	0.23410	0.0566	L	0.34521	1.04	0.36159	D	0.847955	B;B	0.06786	0.001;0.001	B;B	0.12156	0.007;0.007	T	0.21827	-1.0234	9	0.21540	T	0.41	.	11.338	0.49516	0.9251:0.0:0.0749:0.0	.	2693;2698	C9J1U3;Q8N2C7	.;UNC80_HUMAN	V	2698;2693;224;144	ENSP00000391088:I2698V;ENSP00000272845:I2693V	ENSP00000272845:I2693V	I	+	1	0	UNC80	210545203	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.532000	0.81985	2.371000	0.80710	0.533000	0.62120	ATC		0.393	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_182587	
OBSL1	23363	broad.mit.edu	37	2	220432822	220432822	+	Missense_Mutation	SNP	C	C	T	rs2292359		TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr2:220432822C>T	ENST00000404537.1	-	2	1293	c.1237G>A	c.(1237-1239)Gag>Aag	p.E413K	OBSL1_ENST00000373876.1_Missense_Mutation_p.E413K|OBSL1_ENST00000265318.4_Missense_Mutation_p.E413K|OBSL1_ENST00000289656.3_5'UTR|OBSL1_ENST00000491370.1_5'Flank|OBSL1_ENST00000603926.1_Missense_Mutation_p.E413K|OBSL1_ENST00000373873.4_Missense_Mutation_p.E413K	NM_015311.2	NP_056126.1	O75147	OBSL1_HUMAN	obscurin-like 1	413	Ig-like 4.				cardiac myofibril assembly (GO:0055003)|cytoskeleton organization (GO:0007010)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|positive regulation of dendrite morphogenesis (GO:0050775)|protein localization to Golgi apparatus (GO:0034067)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|M band (GO:0031430)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)						Renal(207;0.0376)		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)		CCCCGCATCTCGCACAGGTAG	0.637											OREG0003988	type=REGULATORY REGION|Gene=OBSL1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																										.											0													71.0	78.0	76.0					2																	220432822		2129	4236	6365	SO:0001583	missense	23363			BC007201	CCDS46520.1, CCDS54433.1, CCDS63134.1	2q35	2013-01-29			ENSG00000124006	ENSG00000124006		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29092	protein-coding gene	gene with protein product		610991				9734811	Standard	NM_015311		Approved	KIAA0657	uc010fwk.3	O75147	OTTHUMG00000059157	ENST00000404537.1:c.1237G>A	2.37:g.220432822C>T	ENSP00000385636:p.Glu413Lys	Somatic	2266	WXS	Illumina HiSeq	Phase_I	A4KVA4|A4KVA5|Q96IW3|S4R3M6	Missense_Mutation	SNP	ENST00000404537.1	37	CCDS46520.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.389568	0.82902	.	.	ENSG00000124006	ENST00000265318;ENST00000404537;ENST00000373876;ENST00000373873	T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15	5.17	5.17	0.71159	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.75860	0.3907	M	0.65677	2.01	0.49483	D	0.999798	D;D	0.89917	1.0;0.998	D;P	0.87578	0.998;0.85	T	0.73072	-0.4098	9	0.33141	T	0.24	.	14.4333	0.67266	0.0:0.7489:0.2511:0.0	rs2292359	413;413	O75147;O75147-2	OBSL1_HUMAN;.	K	413	ENSP00000265318:E413K;ENSP00000385636:E413K;ENSP00000362983:E413K;ENSP00000362980:E413K	ENSP00000265318:E413K	E	-	1	0	OBSL1	220141066	0.999000	0.42202	1.000000	0.80357	0.893000	0.52053	3.913000	0.56394	2.694000	0.91930	0.650000	0.86243	GAG		0.637	OBSL1-014	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322012.1		
SLA2	84174	broad.mit.edu;mdanderson.org;bcgsc.ca	37	20	35260999	35260999	+	Splice_Site	SNP	T	T	A			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr20:35260999T>A	ENST00000262866.4	-	5	803	c.381A>T	c.(379-381)agA>agT	p.R127S	SLA2_ENST00000360672.2_Splice_Site_p.R127S	NM_032214.3|NM_175077.2	NP_115590.1|NP_778252.1	Q9H6Q3	SLAP2_HUMAN	Src-like-adaptor 2	127	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				antigen receptor-mediated signaling pathway (GO:0050851)|B cell mediated immunity (GO:0019724)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of B cell activation (GO:0050869)|negative regulation of calcium-mediated signaling (GO:0050849)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of signal transduction (GO:0009967)|regulation of immune response (GO:0050776)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome membrane (GO:0010008)|late endosome (GO:0005770)|plasma membrane (GO:0005886)	protein N-terminus binding (GO:0047485)|SH3/SH2 adaptor activity (GO:0005070)			endometrium(1)|lung(2)|skin(2)	5	Breast(12;0.114)	Myeloproliferative disorder(115;0.00878)				CTTACTCACCTCTCCTGGTCT	0.597																																					Ovarian(59;720 1165 26994 46188 51693)	.											0													64.0	59.0	61.0					20																	35260999		2203	4300	6503	SO:0001630	splice_region_variant	84174			AF326353	CCDS13282.1, CCDS13283.1	20q11.23	2013-02-14			ENSG00000101082	ENSG00000101082		"""SH2 domain containing"""	17329	protein-coding gene	gene with protein product		606577		C20orf156		11696592	Standard	NM_032214		Approved	FLJ21992, SLAP-2	uc002xfv.3	Q9H6Q3	OTTHUMG00000032393	ENST00000262866.4:c.382+1A>T	20.37:g.35260999T>A		Somatic		WXS	Illumina HiSeq	Phase_I	A8K648|E1P5U1|E1P5U2|Q5TH27|Q5TH28|Q8WY18|Q96QI4|Q9H135	Missense_Mutation	SNP	ENST00000262866.4	37	CCDS13282.1	.	.	.	.	.	.	.	.	.	.	T	13.41	2.227592	0.39399	.	.	ENSG00000101082	ENST00000262866;ENST00000360672	D;D	0.88277	-2.36;-2.36	4.53	4.53	0.55603	SH2 motif (5);	0.378993	0.26948	N	0.021691	D	0.82733	0.5101	N	0.17248	0.465	0.37013	D	0.895848	B;B	0.32382	0.368;0.167	B;B	0.42386	0.386;0.138	D	0.83450	0.0048	10	0.52906	T	0.07	-13.4373	7.4364	0.27158	0.1929:0.0:0.0:0.8071	.	127;127	Q9H6Q3;Q9H6Q3-2	SLAP2_HUMAN;.	S	127	ENSP00000262866:R127S;ENSP00000353890:R127S	ENSP00000262866:R127S	R	-	3	2	SLA2	34694413	1.000000	0.71417	1.000000	0.80357	0.695000	0.40330	4.214000	0.58527	1.898000	0.54952	0.459000	0.35465	AGA		0.597	SLA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079037.2	NM_175077	Missense_Mutation
DHX35	60625	broad.mit.edu	37	20	37621034	37621034	+	Missense_Mutation	SNP	T	T	G	rs200532343		TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr20:37621034T>G	ENST00000252011.3	+	7	581	c.548T>G	c.(547-549)tTg>tGg	p.L183W	DHX35_ENST00000373325.2_Missense_Mutation_p.L183W|DHX35_ENST00000373323.4_Missense_Mutation_p.L152W	NM_021931.3	NP_068750.2	Q9H5Z1	DHX35_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 35	183	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(13)|ovary(1)|skin(2)|stomach(1)|urinary_tract(2)	40		Myeloproliferative disorder(115;0.00878)				GAGAGGACCTTGTACACTGAC	0.413																																						.											0													229.0	204.0	213.0					20																	37621034		2203	4300	6503	SO:0001583	missense	60625			AK026412	CCDS13310.1, CCDS54463.1	20q11.22-q12	2003-06-13	2003-06-13	2003-06-13	ENSG00000101452	ENSG00000101452		"""DEAH-boxes"""	15861	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 35"""	C20orf15, DDX35			Standard	NM_001190809		Approved	FLJ22759, KAIA0875	uc002xjh.3	Q9H5Z1	OTTHUMG00000032463	ENST00000252011.3:c.548T>G	20.37:g.37621034T>G	ENSP00000252011:p.Leu183Trp	Somatic		WXS	Illumina HiSeq	Phase_I	A2RTX3|B4E0J0|F5GXM6|Q5THR0|Q9H4H7|Q9H6T6	Missense_Mutation	SNP	ENST00000252011.3	37	CCDS13310.1	.	.	.	.	.	.	.	.	.	.	T	26.1	4.700696	0.88924	.	.	ENSG00000101452	ENST00000373325;ENST00000252011;ENST00000373323;ENST00000441485	T;T;T;T	0.08546	3.08;3.08;3.08;3.08	5.72	5.72	0.89469	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.42381	0.1200	H	0.95151	3.63	0.58432	D	0.999993	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.96	T	0.59273	-0.7485	10	0.87932	D	0	.	15.6818	0.77376	0.0:0.0:0.0:1.0	.	152;183	F5GXM6;Q9H5Z1	.;DHX35_HUMAN	W	183;183;152;148	ENSP00000362422:L183W;ENSP00000252011:L183W;ENSP00000362420:L152W;ENSP00000414630:L148W	ENSP00000252011:L183W	L	+	2	0	DHX35	37054448	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	6.825000	0.75293	2.174000	0.68829	0.533000	0.62120	TTG		0.413	DHX35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079212.2	NM_021931	
KRTAP10-12	386685	broad.mit.edu	37	21	46117243	46117243	+	Missense_Mutation	SNP	G	G	A	rs199900483		TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr21:46117243G>A	ENST00000400365.3	+	1	157	c.127G>A	c.(127-129)Gcc>Acc	p.A43T	TSPEAR_ENST00000323084.4_Intron	NM_198699.1	NP_941972.1	P60413	KR10C_HUMAN	keratin associated protein 10-12	43	19 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				large_intestine(1)|lung(8)	9						CCCCTGCTGCGCCCCGGCCCC	0.677																																						.											0								G	,THR/ALA	0,4172		0,0,2086	44.0	52.0	49.0		,127	0.5	0.7	21		49	2,8452		0,2,4225	no	intron,missense	TSPEAR,KRTAP10-12	NM_144991.2,NM_198699.1	,58	0,2,6311	AA,AG,GG		0.0237,0.0,0.0158	,probably-damaging	,43/246	46117243	2,12624	2086	4227	6313	SO:0001583	missense	386685			AB076364	CCDS42967.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000189169	ENSG00000189169		"""Keratin associated proteins"""	20533	protein-coding gene	gene with protein product			"""keratin associated protein 18-12"""	KRTAP18-12			Standard	NM_198699		Approved	KRTAP18.12, KAP10.12	uc002zfw.1	P60413	OTTHUMG00000057629	ENST00000400365.3:c.127G>A	21.37:g.46117243G>A	ENSP00000383216:p.Ala43Thr	Somatic		WXS	Illumina HiSeq	Phase_I	B2RPA3	Missense_Mutation	SNP	ENST00000400365.3	37	CCDS42967.1	.	.	.	.	.	.	.	.	.	.	N	7.053	0.564762	0.13498	0.0	2.37E-4	ENSG00000189169	ENST00000400365	T	0.04654	3.58	3.61	0.506	0.16961	.	.	.	.	.	T	0.03305	0.0096	N	0.20986	0.625	0.22446	N	0.999096	B	0.09022	0.002	B	0.04013	0.001	T	0.43861	-0.9365	9	0.39692	T	0.17	.	4.6012	0.12354	0.216:0.3464:0.4376:0.0	.	43	P60413	KR10C_HUMAN	T	43	ENSP00000383216:A43T	ENSP00000383216:A43T	A	+	1	0	KRTAP10-12	44941671	.	.	0.700000	0.30305	0.237000	0.25408	.	.	-0.159000	0.11021	-0.736000	0.03550	GCC		0.677	KRTAP10-12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128032.1	NM_198699	
PPP6R2	9701	broad.mit.edu;mdanderson.org;bcgsc.ca	37	22	50875453	50875453	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr22:50875453G>A	ENST00000216061.5	+	16	2009	c.1639G>A	c.(1639-1641)Gag>Aag	p.E547K	PPP6R2_ENST00000395744.3_Intron|PPP6R2_ENST00000359139.3_Intron|PPP6R2_ENST00000395741.3_Intron			O75170	PP6R2_HUMAN	protein phosphatase 6, regulatory subunit 2	547						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	22						AAGTGAGGACGAGGACATTGA	0.657																																						.											0													8.0	7.0	7.0					22																	50875453		869	1979	2848	SO:0001583	missense	9701			AB014585	CCDS33681.1, CCDS56235.1, CCDS56236.1, CCDS74881.1	22q13.33	2012-04-17	2010-06-28	2010-06-28	ENSG00000100239	ENSG00000100239		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	19253	protein-coding gene	gene with protein product		610877	"""KIAA0685"", ""SAPS domain family, member 2"""	KIAA0685, SAPS2		16769727	Standard	NM_014678		Approved	dJ579N16.1, SAP190	uc003blc.3	O75170	OTTHUMG00000150199	ENST00000216061.5:c.1639G>A	22.37:g.50875453G>A	ENSP00000216061:p.Glu547Lys	Somatic		WXS	Illumina HiSeq	Phase_I	A6PVG3|B7Z7T3|Q5U5P3|Q7Z2L2|Q7Z5G5|Q7Z731|Q9UGB9	Missense_Mutation	SNP	ENST00000216061.5	37		.	.	.	.	.	.	.	.	.	.	G	34	5.400583	0.96030	.	.	ENSG00000100239	ENST00000216061	T	0.34667	1.35	5.06	5.06	0.68205	.	0.180712	0.47852	D	0.000216	T	0.41926	0.1180	L	0.52011	1.625	0.28994	N	0.887875	D;D	0.67145	0.996;0.992	P;B	0.49561	0.615;0.41	T	0.44787	-0.9305	10	0.66056	D	0.02	-22.9825	13.9299	0.63989	0.0:0.0:1.0:0.0	.	547;547	O75170-5;O75170	.;PP6R2_HUMAN	K	547	ENSP00000216061:E547K	ENSP00000216061:E547K	E	+	1	0	PPP6R2	49222319	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.258000	0.95555	2.363000	0.80096	0.462000	0.41574	GAG		0.657	PPP6R2-004	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000316809.1	NM_014678	
ABHD14A	25864	broad.mit.edu;mdanderson.org;bcgsc.ca	37	3	52014444	52014444	+	Missense_Mutation	SNP	A	A	C			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr3:52014444A>C	ENST00000273596.3	+	4	501	c.433A>C	c.(433-435)Aca>Cca	p.T145P	ABHD14B_ENST00000483233.1_Intron|ABHD14A-ACY1_ENST00000463937.1_Intron|ACY1_ENST00000458031.2_Intron|ABHD14A_ENST00000491470.1_Intron	NM_015407.4	NP_056222.2	Q9BUJ0	ABHEA_HUMAN	abhydrolase domain containing 14A	145						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|stomach(1)	6				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000541)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		GGAGGCAAGCACAGAGGCAGG	0.642																																						.											0													41.0	47.0	45.0					3																	52014444		2203	4300	6503	SO:0001583	missense	25864			AY358201	CCDS2843.1	3p21.1	2011-02-14			ENSG00000248487	ENSG00000248487		"""Abhydrolase domain containing"""	24538	protein-coding gene	gene with protein product							Standard	NM_015407		Approved	DKFZP564O243, DORZ1	uc003dco.3	Q9BUJ0	OTTHUMG00000157818	ENST00000273596.3:c.433A>C	3.37:g.52014444A>C	ENSP00000273596:p.Thr145Pro	Somatic		WXS	Illumina HiSeq	Phase_I	Q6UXU8|Q9Y3T7	Missense_Mutation	SNP	ENST00000273596.3	37	CCDS2843.1	.	.	.	.	.	.	.	.	.	.	A	17.75	3.465322	0.63513	.	.	ENSG00000248487	ENST00000497864;ENST00000494478;ENST00000273596;ENST00000538216	T;T;T	0.34472	1.36;1.36;1.93	5.69	5.69	0.88448	.	.	.	.	.	T	0.35885	0.0947	L	0.56396	1.775	0.80722	D	1	B	0.16166	0.016	B	0.17433	0.018	T	0.11717	-1.0576	9	0.24483	T	0.36	.	14.1954	0.65667	1.0:0.0:0.0:0.0	.	145	Q9BUJ0	ABHEA_HUMAN	P	210;140;145;103	ENSP00000418242:T210P;ENSP00000420475:T140P;ENSP00000273596:T145P	ENSP00000273596:T145P	T	+	1	0	ABHD14A	51989484	0.998000	0.40836	0.998000	0.56505	0.825000	0.46686	4.292000	0.59031	2.170000	0.68504	0.460000	0.39030	ACA		0.642	ABHD14A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349689.1	NM_015407	
SNTN	132203	broad.mit.edu;bcgsc.ca	37	3	63649637	63649637	+	Nonsense_Mutation	SNP	A	A	T			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr3:63649637A>T	ENST00000343837.3	+	4	330	c.310A>T	c.(310-312)Aga>Tga	p.R104*	SNTN_ENST00000496807.1_Intron	NM_001080537.1	NP_001074006.1	A6NMZ2	SNTAN_HUMAN	sentan, cilia apical structure protein	104						cilium (GO:0005929)	calcium ion binding (GO:0005509)			endometrium(2)|ovary(1)	3						GCCAAAATACAGAGAGATCCT	0.358																																						.											0													104.0	99.0	101.0					3																	63649637		2203	4300	6503	SO:0001587	stop_gained	132203			AK126350	CCDS33779.1	3p14.2	2009-03-10	2009-03-10		ENSG00000188817	ENSG00000188817			33706	protein-coding gene	gene with protein product	"""S100A-like protein"""					18829862	Standard	NM_001080537		Approved	FLJ44379, S100AL	uc003dlr.3	A6NMZ2	OTTHUMG00000158766	ENST00000343837.3:c.310A>T	3.37:g.63649637A>T	ENSP00000341442:p.Arg104*	Somatic		WXS	Illumina HiSeq	Phase_I	B7FF65	Nonsense_Mutation	SNP	ENST00000343837.3	37	CCDS33779.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.110024	0.77210	.	.	ENSG00000188817	ENST00000343837;ENST00000469440	.	.	.	5.6	4.5	0.54988	.	0.722044	0.13102	N	0.413673	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	-0.7598	10.5063	0.44836	0.7943:0.2057:0.0:0.0	.	.	.	.	X	104;134	.	ENSP00000341442:R104X	R	+	1	2	SNTN	63624677	1.000000	0.71417	0.207000	0.23584	0.947000	0.59692	1.480000	0.35464	1.049000	0.40321	0.482000	0.46254	AGA		0.358	SNTN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352094.1	NM_001080537	
MCM2	4171	broad.mit.edu	37	3	127323460	127323460	+	Silent	SNP	C	C	T	rs186022338		TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr3:127323460C>T	ENST00000265056.7	+	3	490	c.246C>T	c.(244-246)cgC>cgT	p.R82R		NM_004526.2	NP_004517.2	P49736	MCM2_HUMAN	minichromosome maintenance complex component 2	82	Interaction with KAT7. {ECO:0000250}.				cell cycle (GO:0007049)|cellular response to interleukin-4 (GO:0071353)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|MCM complex (GO:0042555)|microtubule cytoskeleton (GO:0015630)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA replication origin binding (GO:0003688)|metal ion binding (GO:0046872)			ovary(3)|skin(2)|stomach(1)	6						GGGACTACCGCGCCATCCCAG	0.592													C|||	1	0.000199681	0.0	0.0	5008	,	,		19091	0.001		0.0	False		,,,				2504	0.0					.											0								C		0,4406		0,0,2203	50.0	54.0	53.0		246	-10.6	0.4	3		53	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	MCM2	NM_004526.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		82/905	127323460	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	4171			X67334	CCDS3043.1	3q21	2007-04-04	2007-04-04		ENSG00000073111	ENSG00000073111			6944	protein-coding gene	gene with protein product	"""mitotin"""	116945	"""minichromosome maintenance deficient (S. cerevisiae) 2 (mitotin)"", ""MCM2 minichromosome maintenance deficient 2, mitotin (S. cerevisiae)"""	CCNL1, CDCL1		1710453, 8258304	Standard	NM_004526		Approved	D3S3194, KIAA0030, BM28, cdc19	uc003ejp.4	P49736	OTTHUMG00000159637	ENST00000265056.7:c.246C>T	3.37:g.127323460C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q14577|Q15023|Q8N2V1|Q969W7|Q96AE1|Q9BRM7	Silent	SNP	ENST00000265056.7	37	CCDS3043.1																																																																																				0.592	MCM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356612.1		
IGSF10	285313	broad.mit.edu	37	3	151163769	151163769	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr3:151163769T>C	ENST00000282466.3	-	4	3999	c.4000A>G	c.(4000-4002)Acc>Gcc	p.T1334A		NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	1334					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TCTGTTTGGGTTTCATAAGTG	0.418																																						.											0													326.0	309.0	315.0					3																	151163769		2203	4300	6503	SO:0001583	missense	285313			AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.4000A>G	3.37:g.151163769T>C	ENSP00000282466:p.Thr1334Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q86YJ9|Q8N772|Q8NA84	Missense_Mutation	SNP	ENST00000282466.3	37	CCDS3160.1	.	.	.	.	.	.	.	.	.	.	T	6.485	0.457729	0.12342	.	.	ENSG00000152580	ENST00000282466	T	0.70516	-0.49	4.51	3.34	0.38264	.	0.434043	0.19170	N	0.120951	T	0.47154	0.1430	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.36237	-0.9756	10	0.46703	T	0.11	.	7.0675	0.25159	0.0:0.1882:0.0:0.8118	.	1334	Q6WRI0	IGS10_HUMAN	A	1334	ENSP00000282466:T1334A	ENSP00000282466:T1334A	T	-	1	0	IGSF10	152646459	0.010000	0.17322	0.157000	0.22605	0.025000	0.11179	0.441000	0.21611	0.695000	0.31675	0.482000	0.46254	ACC		0.418	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357782.1	NM_178822	
FRYL	285527	broad.mit.edu;mdanderson.org	37	4	48513002	48513002	+	Splice_Site	SNP	C	C	G			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr4:48513002C>G	ENST00000503238.1	-	55	8145		c.e55-1		FRYL_ENST00000358350.4_Splice_Site|FRYL_ENST00000537810.1_Splice_Site|FRYL_ENST00000264319.7_Splice_Site|FRYL_ENST00000507873.2_Splice_Site			O94915	FRYL_HUMAN	FRY-like						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						TTTGAATTGTCTATGGAGAAA	0.328																																						.											0													57.0	52.0	54.0					4																	48513002		1845	4085	5930	SO:0001630	splice_region_variant	285527			AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.8146-1G>C	4.37:g.48513002C>G		Somatic		WXS	Illumina HiSeq	Phase_I	O95640|Q8WTZ5|Q9NT40	Splice_Site	SNP	ENST00000503238.1	37	CCDS43227.1	.	.	.	.	.	.	.	.	.	.	C	13.37	2.216286	0.39201	.	.	ENSG00000075539	ENST00000503238;ENST00000358350;ENST00000537810;ENST00000264319;ENST00000507873	.	.	.	5.73	5.73	0.89815	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.27	0.98469	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	FRYL	48207759	1.000000	0.71417	0.998000	0.56505	0.058000	0.15608	7.194000	0.77789	2.854000	0.98071	0.655000	0.94253	.		0.328	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369265.2		Intron
LRRC66	339977	broad.mit.edu;mdanderson.org	37	4	52861445	52861445	+	Silent	SNP	G	G	A	rs187026269		TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr4:52861445G>A	ENST00000343457.3	-	4	1749	c.1743C>T	c.(1741-1743)tcC>tcT	p.S581S		NM_001024611.1	NP_001019782.1	Q68CR7	LRC66_HUMAN	leucine rich repeat containing 66	581						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(8)|lung(34)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	58						TTATTTCTCCGGAGAGGGAAG	0.498													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19676	0.0		0.0	False		,,,				2504	0.0					.											0													103.0	110.0	108.0					4																	52861445		2124	4276	6400	SO:0001819	synonymous_variant	339977			BC040414	CCDS43229.1	4q12	2008-08-08			ENSG00000188993	ENSG00000188993			34299	protein-coding gene	gene with protein product							Standard	XM_005265739		Approved		uc003gzi.3	Q68CR7	OTTHUMG00000160623	ENST00000343457.3:c.1743C>T	4.37:g.52861445G>A		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000343457.3	37	CCDS43229.1																																																																																				0.498	LRRC66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361473.1	NM_001024611	
MUC7	4589	broad.mit.edu	37	4	71347311	71347311	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr4:71347311C>T	ENST00000304887.5	+	3	1040	c.850C>T	c.(850-852)Cca>Tca	p.P284S	MUC7_ENST00000456088.1_Missense_Mutation_p.P284S|MUC7_ENST00000413702.1_Missense_Mutation_p.P284S	NM_152291.2	NP_689504.2	Q8TAX7	MUC7_HUMAN	mucin 7, secreted	284	Thr-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(2)|lung(23)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	42			Lung(101;0.211)			CACAGCTGCCCCACCCACACC	0.577																																						.											0													408.0	367.0	381.0					4																	71347311		2203	4300	6503	SO:0001583	missense	4589			BC025688	CCDS3541.1	4q13.3	2008-02-05	2006-03-14		ENSG00000171195	ENSG00000171195		"""Mucins"""	7518	protein-coding gene	gene with protein product		158375	"""mucin 7, salivary"""			8838308	Standard	NM_152291		Approved	FLJ27047, MG2	uc003hfj.3	Q8TAX7	OTTHUMG00000129916	ENST00000304887.5:c.850C>T	4.37:g.71347311C>T	ENSP00000302021:p.Pro284Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q9UCD7|Q9UCD8	Missense_Mutation	SNP	ENST00000304887.5	37	CCDS3541.1	.	.	.	.	.	.	.	.	.	.	C	6.574	0.474257	0.12521	.	.	ENSG00000171195	ENST00000413702;ENST00000456088;ENST00000304887	T;T;T	0.64085	-0.08;-0.08;-0.08	1.95	1.09	0.20402	.	.	.	.	.	T	0.36936	0.0985	N	0.19112	0.55	0.09310	N	1	P	0.41784	0.762	B	0.35655	0.207	T	0.15350	-1.0440	8	.	.	.	.	2.6366	0.04959	0.2801:0.5462:0.0:0.1737	.	284	Q8TAX7	MUC7_HUMAN	S	284	ENSP00000407422:P284S;ENSP00000400585:P284S;ENSP00000302021:P284S	.	P	+	1	0	MUC7	71381900	0.003000	0.15002	0.001000	0.08648	0.004000	0.04260	0.878000	0.28126	0.357000	0.24183	0.603000	0.83216	CCA		0.577	MUC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252168.2	NM_152291	
MTTP	4547	broad.mit.edu	37	4	100503089	100503091	+	In_Frame_Del	DEL	ATG	ATG	-			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	ATG	ATG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr4:100503089_100503091delATG	ENST00000265517.5	+	2	292_294	c.89_91delATG	c.(88-93)aatgac>aac	p.D31del	MTTP_ENST00000457717.1_In_Frame_Del_p.D31del|MTTP_ENST00000422897.2_In_Frame_Del_p.D31del|MTTP_ENST00000511045.1_In_Frame_Del_p.D58del			P55157	MTP_HUMAN	microsomal triglyceride transfer protein	31	Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.				cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|protein lipidation (GO:0006497)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|microvillus membrane (GO:0031528)|receptor complex (GO:0043235)|rough endoplasmic reticulum (GO:0005791)	lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(14)|lung(19)|ovary(4)|prostate(5)|skin(1)|urinary_tract(1)	57				OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	Hesperetin(DB01094)|Lomitapide(DB08827)	TCATTAAATAATGACCGGCTGTA	0.458																																						.											0																																										SO:0001651	inframe_deletion	4547				CCDS3651.1, CCDS75169.1	4q24	2008-02-05	2005-11-04	2005-11-04	ENSG00000138823	ENSG00000138823			7467	protein-coding gene	gene with protein product		157147	"""microsomal triglyceride transfer protein (large polypeptide, 88kD)"", ""microsomal triglyceride transfer protein (large polypeptide, 88kDa)"""	MTP		8111381	Standard	XM_005263025		Approved	ABL	uc003hvc.4	P55157	OTTHUMG00000131023	ENST00000265517.5:c.89_91delATG	4.37:g.100503089_100503091delATG	ENSP00000265517:p.Asp31del	Somatic		WXS	Illumina HiSeq	Phase_I	A8K428|Q08AM4|Q6P5T3	In_Frame_Del	DEL	ENST00000265517.5	37	CCDS3651.1																																																																																				0.458	MTTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253662.3		
TKTL2	84076	broad.mit.edu	37	4	164393866	164393866	+	Missense_Mutation	SNP	C	C	A			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr4:164393866C>A	ENST00000280605.3	-	1	1181	c.1021G>T	c.(1021-1023)Gtt>Ttt	p.V341F		NM_032136.4	NP_115512.3	Q9H0I9	TKTL2_HUMAN	transketolase-like 2	341						cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|transketolase activity (GO:0004802)			breast(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(42)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	70	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				CCACTCAGaacaataactctt	0.433																																						.											0													120.0	117.0	118.0					4																	164393866		2203	4300	6503	SO:0001583	missense	84076			BC028707	CCDS3805.1	4q32.2	2009-10-06			ENSG00000151005	ENSG00000151005			25313	protein-coding gene	gene with protein product	"""similar to transketolase"""					11230166	Standard	NM_032136		Approved	FLJ32975, DKFZP434L1717	uc003iqp.4	Q9H0I9	OTTHUMG00000161527	ENST00000280605.3:c.1021G>T	4.37:g.164393866C>A	ENSP00000280605:p.Val341Phe	Somatic		WXS	Illumina HiSeq	Phase_I	A4FVB4|Q8NCT0|Q96M82	Missense_Mutation	SNP	ENST00000280605.3	37	CCDS3805.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.441919	0.83993	.	.	ENSG00000151005	ENST00000280605	D	0.92249	-3.0	4.3	4.3	0.51218	Transketolase-like, pyrimidine-binding domain (2);	0.133117	0.48286	D	0.000182	D	0.95787	0.8629	M	0.83603	2.65	0.45005	D	0.998025	D	0.61697	0.99	D	0.69142	0.962	D	0.96047	0.9028	10	0.87932	D	0	-19.7279	15.0576	0.71927	0.0:1.0:0.0:0.0	.	341	Q9H0I9	TKTL2_HUMAN	F	341	ENSP00000280605:V341F	ENSP00000280605:V341F	V	-	1	0	TKTL2	164613316	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.325000	0.79124	2.672000	0.90937	0.655000	0.94253	GTT		0.433	TKTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365207.1	NM_032136	
SOWAHA	134548	broad.mit.edu	37	5	132149586	132149590	+	Frame_Shift_Del	DEL	ACCCT	ACCCT	-			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	ACCCT	ACCCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr5:132149586_132149590delACCCT	ENST00000378693.2	+	1	554_558	c.273_277delACCCT	c.(271-279)gcacccttcfs	p.PF92fs		NM_175873.4	NP_787069.3	Q2M3V2	SWAHA_HUMAN	sosondowah ankyrin repeat domain family member A	92	Pro-rich.																CCGAGCCCGCACCCTTCGGCCCCCC	0.712																																						.											0																																										SO:0001589	frameshift_variant	134548			AK090823	CCDS43361.1	5q23.3	2013-01-10	2012-01-12	2012-01-12	ENSG00000198944	ENSG00000198944		"""Ankyrin repeat domain containing"""	27033	protein-coding gene	gene with protein product			"""ankyrin repeat domain 43"""	ANKRD43		22234889	Standard	NM_175873		Approved		uc003kxw.3	Q2M3V2	OTTHUMG00000059844	ENST00000378693.2:c.273_277delACCCT	5.37:g.132149586_132149590delACCCT	ENSP00000367965:p.Pro92fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q8NAE7	Frame_Shift_Del	DEL	ENST00000378693.2	37	CCDS43361.1																																																																																				0.712	SOWAHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133062.1	NM_175873	
LAMA4	3910	broad.mit.edu;mdanderson.org	37	6	112480083	112480083	+	Splice_Site	SNP	C	C	G			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr6:112480083C>G	ENST00000230538.7	-	14	2066		c.e14-1		RP1-142L7.5_ENST00000425503.1_RNA|RP1-142L7.5_ENST00000585373.1_RNA|LAMA4_ENST00000522006.1_Splice_Site|LAMA4_ENST00000424408.2_Splice_Site|LAMA4_ENST00000389463.4_Splice_Site	NM_001105206.2	NP_001098676.2	Q16363	LAMA4_HUMAN	laminin, alpha 4						blood vessel development (GO:0001568)|brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(42)|ovary(4)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(8)	100		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		CTGACGCATTCTAAAGAAAAA	0.308																																						.											0													75.0	70.0	71.0					6																	112480083		2202	4300	6502	SO:0001630	splice_region_variant	3910				CCDS34514.1, CCDS43491.1, CCDS43492.1	6q21	2014-09-17			ENSG00000112769	ENSG00000112769		"""Laminins"""	6484	protein-coding gene	gene with protein product		600133				7959779	Standard	NM_001105206		Approved	LAMA3	uc003pvu.3	Q16363	OTTHUMG00000015386	ENST00000230538.7:c.1669-1G>C	6.37:g.112480083C>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q14731|Q14735|Q15335|Q4LE44|Q5SZG8|Q9BTB8|Q9UE18|Q9UJN9	Splice_Site	SNP	ENST00000230538.7	37	CCDS43491.1	.	.	.	.	.	.	.	.	.	.	C	16.85	3.237236	0.58886	.	.	ENSG00000112769	ENST00000230538;ENST00000522006;ENST00000389463;ENST00000424408	.	.	.	5.68	5.68	0.88126	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.695	0.85333	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	LAMA4	112586776	1.000000	0.71417	0.997000	0.53966	0.815000	0.46073	4.452000	0.60054	2.668000	0.90789	0.591000	0.81541	.		0.308	LAMA4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041876.2	NM_001105206	Intron
MED23	9439	broad.mit.edu	37	6	131919846	131919846	+	Frame_Shift_Del	DEL	T	T	-			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr6:131919846delT	ENST00000368068.3	-	19	2455	c.2276delA	c.(2275-2277)aatfs	p.N759fs	MED23_ENST00000368053.4_Frame_Shift_Del_p.N765fs|MED23_ENST00000368060.3_Frame_Shift_Del_p.N759fs|MED23_ENST00000403834.3_Frame_Shift_Del_p.N765fs|MED23_ENST00000354577.4_Frame_Shift_Del_p.N765fs|MED23_ENST00000540546.1_Frame_Shift_Del_p.N765fs|MED23_ENST00000479213.1_5'Flank|MED23_ENST00000545957.1_Frame_Shift_Del_p.N400fs|MED23_ENST00000368058.1_Frame_Shift_Del_p.N765fs	NM_004830.3	NP_004821.2	Q9ULK4	MED23_HUMAN	mediator complex subunit 23	759					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)	p.N759fs*7(1)|p.N765fs*7(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(12)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	44	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0115)|OV - Ovarian serous cystadenocarcinoma(155;0.0608)		CTCCTCCACATTTTTTTTCAG	0.378																																						.											2	Insertion - Frameshift(2)	large_intestine(2)											154.0	151.0	152.0					6																	131919846		2203	4300	6503	SO:0001589	frameshift_variant	9439			AF104255	CCDS5146.1, CCDS5147.1, CCDS59039.1	6q22.33-q24.1	2008-02-05	2007-08-08	2007-07-30	ENSG00000112282	ENSG00000112282			2372	protein-coding gene	gene with protein product		605042	"""cofactor required for Sp1 transcriptional activation, subunit 3, 130kDa"""	CRSP3		9989412	Standard	NM_004830		Approved	CRSP130, DRIP130, Sur2	uc003qcs.2	Q9ULK4	OTTHUMG00000015565	ENST00000368068.3:c.2276delA	6.37:g.131919846delT	ENSP00000357047:p.Asn759fs	Somatic		WXS	Illumina HiSeq	Phase_I	B9TX55|O95403|Q5JWT3|Q5JWT4|Q6P9H6|Q9H0J2|Q9NTT9|Q9NTU0|Q9Y5P7|Q9Y667	Frame_Shift_Del	DEL	ENST00000368068.3	37	CCDS5147.1																																																																																				0.378	MED23-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042215.1		
TAAR2	9287	broad.mit.edu	37	6	132945376	132945376	+	Missense_Mutation	SNP	G	G	C			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr6:132945376G>C	ENST00000367931.1	-	1	38	c.39C>G	c.(37-39)ttC>ttG	p.F13L	TAAR2_ENST00000537809.1_5'UTR			Q9P1P5	TAAR2_HUMAN	trace amine associated receptor 2	13					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|trace-amine receptor activity (GO:0001594)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(1)	23	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00608)|GBM - Glioblastoma multiforme(226;0.0151)		GTGTTCTTTTGAAATGTGAAA	0.378																																						.											0													163.0	139.0	147.0					6																	132945376		2203	4300	6503	SO:0001583	missense	9287			AF112460	CCDS34541.1, CCDS5157.1	6q24	2012-08-08	2005-02-23	2005-02-24	ENSG00000146378	ENSG00000146378		"""GPCR / Class A : Trace amine associated receptors"""	4514	protein-coding gene	gene with protein product		604849	"""G protein-coupled receptor 58"""	GPR58		10684976, 15718104	Standard	NM_014626		Approved		uc003qdl.1	Q9P1P5	OTTHUMG00000015585	ENST00000367931.1:c.39C>G	6.37:g.132945376G>C	ENSP00000356908:p.Phe13Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q5QD02|Q6NWS1|Q6NWS2|Q6NWS3	Missense_Mutation	SNP	ENST00000367931.1	37	CCDS34541.1	.	.	.	.	.	.	.	.	.	.	G	10.65	1.411143	0.25465	.	.	ENSG00000146378	ENST00000367931	T	0.58797	0.31	3.9	-0.907	0.10521	.	4.101820	0.00541	N	0.000221	T	0.08758	0.0217	N	0.08118	0	0.20926	N	0.999828	B	0.02656	0.0	B	0.01281	0.0	T	0.08229	-1.0732	10	0.02654	T	1	-3.0145	0.5532	0.00666	0.1716:0.2031:0.2155:0.4097	.	13	Q9P1P5	TAAR2_HUMAN	L	13	ENSP00000356908:F13L	ENSP00000356908:F13L	F	-	3	2	TAAR2	132987069	0.001000	0.12720	0.003000	0.11579	0.183000	0.23260	-0.531000	0.06171	-0.161000	0.10983	0.650000	0.86243	TTC		0.378	TAAR2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000390735.1	NM_014626	
XKR6	286046	broad.mit.edu	37	8	10755515	10755515	+	Missense_Mutation	SNP	A	A	C			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr8:10755515A>C	ENST00000416569.2	-	3	1899	c.1873T>G	c.(1873-1875)Tat>Gat	p.Y625D	XKR6_ENST00000304437.2_Missense_Mutation_p.Y346D	NM_173683.3	NP_775954.2	Q5GH73	XKR6_HUMAN	XK, Kell blood group complex subunit-related family, member 6	625						integral component of membrane (GO:0016021)				breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(8)|ovary(2)|prostate(1)|skin(3)	31				Lung(29;0.0407)|COAD - Colon adenocarcinoma(149;0.0555)		CCGTCTCGATATCGAATGCCT	0.468																																						.											0													125.0	116.0	119.0					8																	10755515		2203	4300	6503	SO:0001583	missense	286046			BC024146	CCDS5978.2	8p23.1	2009-05-27	2006-01-12	2005-07-28	ENSG00000171044	ENSG00000171044			27806	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 7"", ""chromosome 8 open reading frame 21"", ""X Kell blood group precursor-related family, member 6"", ""chromosome 8 open reading frame 5"""	C8orf7, C8orf21, C8orf5			Standard	NM_173683		Approved		uc003wtk.1	Q5GH73	OTTHUMG00000129351	ENST00000416569.2:c.1873T>G	8.37:g.10755515A>C	ENSP00000416707:p.Tyr625Asp	Somatic		WXS	Illumina HiSeq	Phase_I	Q8TBA0	Missense_Mutation	SNP	ENST00000416569.2	37	CCDS5978.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.93|15.93	2.978415|2.978415	0.53720|0.53720	.|.	.|.	ENSG00000171044|ENSG00000171044	ENST00000382461|ENST00000304437;ENST00000416569	.|D;D	.|0.94000	.|-3.11;-3.33	4.55|4.55	4.55|4.55	0.56014|0.56014	.|.	.|0.135739	.|0.51477	.|D	.|0.000086	D|D	0.96037|0.96037	0.8709|0.8709	M|M	0.73962|0.73962	2.25|2.25	0.58432|0.58432	D|D	0.999991|0.999991	.|D	.|0.76494	.|0.999	.|D	.|0.80764	.|0.994	D|D	0.96450|0.96450	0.9333|0.9333	5|10	.|0.87932	.|D	.|0	-7.7754|-7.7754	13.2781|13.2781	0.60198|0.60198	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|625	.|Q5GH73	.|XKR6_HUMAN	E|D	401|346;625	.|ENSP00000307120:Y346D;ENSP00000416707:Y625D	.|ENSP00000307120:Y346D	D|Y	-|-	3|1	2|0	XKR6|XKR6	10792925|10792925	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	9.123000|9.123000	0.94387|0.94387	1.911000|1.911000	0.55334|0.55334	0.449000|0.449000	0.29647|0.29647	GAT|TAT		0.468	XKR6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383958.1	NM_173683	
INTS10	55174	broad.mit.edu	37	8	19680921	19680921	+	Silent	SNP	T	T	C			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr8:19680921T>C	ENST00000397977.3	+	6	1031	c.633T>C	c.(631-633)acT>acC	p.T211T		NM_018142.2	NP_060612.2	Q9NVR2	INT10_HUMAN	integrator complex subunit 10	211					snRNA processing (GO:0016180)	integrator complex (GO:0032039)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	20				Colorectal(111;0.057)|COAD - Colon adenocarcinoma(73;0.215)		ATTATGTCACTAGGTCTACTC	0.323																																						.											0													93.0	87.0	89.0					8																	19680921		1824	4075	5899	SO:0001819	synonymous_variant	55174			AK001431	CCDS6011.2	8p21.3	2006-04-26	2006-03-15	2006-03-15	ENSG00000104613	ENSG00000104613			25548	protein-coding gene	gene with protein product		611353	"""chromosome 8 open reading frame 35"""	C8orf35		16239144	Standard	XM_005273558		Approved	FLJ10569, INT10	uc003wzj.3	Q9NVR2	OTTHUMG00000131065	ENST00000397977.3:c.633T>C	8.37:g.19680921T>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q6IA93|Q7L538|Q7L8C8|Q9H3W8	Silent	SNP	ENST00000397977.3	37	CCDS6011.2	.	.	.	.	.	.	.	.	.	.	T	9.641	1.138867	0.21123	.	.	ENSG00000104613	ENST00000523846	.	.	.	5.38	-3.37	0.04898	.	.	.	.	.	T	0.39809	0.1092	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.34453	-0.9828	4	.	.	.	-18.7854	2.7856	0.05373	0.1213:0.3811:0.2493:0.2483	.	.	.	.	P	8	.	.	L	+	2	0	INTS10	19725201	0.444000	0.25649	0.939000	0.37840	0.952000	0.60782	-0.305000	0.08188	-0.481000	0.06792	0.379000	0.24179	CTA		0.323	INTS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253724.2	NM_018142	
KIAA1429	25962	broad.mit.edu;bcgsc.ca	37	8	95539559	95539559	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr8:95539559C>T	ENST00000297591.5	-	8	988	c.913G>A	c.(913-915)Gaa>Aaa	p.E305K	KIAA1429_ENST00000437199.1_Missense_Mutation_p.E305K|KIAA1429_ENST00000421249.2_Missense_Mutation_p.E305K	NM_015496.4	NP_056311.2	Q69YN4	VIR_HUMAN	KIAA1429	305	Glu-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(16)|lung(28)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	66	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			ATTCCATCTTCATCACTGGAA	0.318																																						.											0													54.0	54.0	54.0					8																	95539559		2203	4300	6503	SO:0001583	missense	25962			AB037850	CCDS34923.1, CCDS47894.1	8q22.1	2008-11-25			ENSG00000164944	ENSG00000164944			24500	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 121"""					10718198	Standard	NM_015496		Approved	DKFZP434I116, fSAP121	uc003ygo.2	Q69YN4	OTTHUMG00000164426	ENST00000297591.5:c.913G>A	8.37:g.95539559C>T	ENSP00000297591:p.Glu305Lys	Somatic		WXS	Illumina HiSeq	Phase_I	Q2M1N0|Q6AHX9|Q6NT78|Q7Z6C7|Q8IXH4|Q9BTH4|Q9H9C9|Q9NWR3|Q9P2B8|Q9UFW1	Missense_Mutation	SNP	ENST00000297591.5	37	CCDS34923.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.584510	0.86748	.	.	ENSG00000164944	ENST00000297591;ENST00000437199;ENST00000421249	T;T;T	0.55052	0.56;0.57;0.54	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.72811	0.3507	M	0.66939	2.045	0.80722	D	1	D;D	0.67145	0.996;0.996	D;D	0.76071	0.987;0.987	T	0.73997	-0.3806	10	0.72032	D	0.01	-17.3179	19.8292	0.96628	0.0:1.0:0.0:0.0	.	305;305	Q69YN4-4;Q69YN4	.;VIR_HUMAN	K	305	ENSP00000297591:E305K;ENSP00000395600:E305K;ENSP00000398390:E305K	ENSP00000297591:E305K	E	-	1	0	KIAA1429	95608735	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.487000	0.81328	2.689000	0.91719	0.491000	0.48974	GAA		0.318	KIAA1429-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378720.2	NM_015496	
TYRP1	7306	broad.mit.edu;mdanderson.org;bcgsc.ca	37	9	12695641	12695641	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr9:12695641G>A	ENST00000388918.5	+	3	641	c.512G>A	c.(511-513)gGg>gAg	p.G171E	TYRP1_ENST00000381137.2_5'UTR|TYRP1_ENST00000381136.2_5'Flank	NM_000550.2	NP_000541.1	P17643	TYRP1_HUMAN	tyrosinase-related protein 1	171					acetoacetic acid metabolic process (GO:0043438)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome organization (GO:0032438)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)|melanosome membrane (GO:0033162)	copper ion binding (GO:0005507)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, another compound as one donor, and incorporation of one atom of oxygen (GO:0016716)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|stomach(1)	22		all_cancers(3;3.1e-05)|all_lung(3;1.7e-06)|Lung NSC(3;2.09e-06)|all_epithelial(3;0.000695)|all_hematologic(3;0.0033)|Acute lymphoblastic leukemia(23;0.0744)		GBM - Glioblastoma multiforme(50;9.85e-06)		GAAATACTGGGGCCAGATGGC	0.433									Oculocutaneous Albinism																													.											0													110.0	104.0	106.0					9																	12695641		2203	4300	6503	SO:0001583	missense	7306	Familial Cancer Database		L33830	CCDS34990.1	9p23	2013-01-08			ENSG00000107165	ENSG00000107165			12450	protein-coding gene	gene with protein product		115501		TYRP, CAS2		9434945	Standard	NM_000550		Approved	GP75, CATB, TRP, b-PROTEIN, OCA3	uc003zkv.4	P17643	OTTHUMG00000021034	ENST00000388918.5:c.512G>A	9.37:g.12695641G>A	ENSP00000373570:p.Gly171Glu	Somatic		WXS	Illumina HiSeq	Phase_I	P78468|P78469|Q13721|Q15679	Missense_Mutation	SNP	ENST00000388918.5	37	CCDS34990.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.532938	0.85812	.	.	ENSG00000107165	ENST00000388918	D	0.85484	-1.99	5.5	5.5	0.81552	Uncharacterised domain, di-copper centre (2);	0.097018	0.64402	D	0.000001	D	0.90614	0.7057	M	0.83384	2.64	0.80722	D	1	D	0.54601	0.967	P	0.56434	0.798	D	0.91438	0.5171	10	0.72032	D	0.01	-9.7978	13.0431	0.58910	0.0739:0.0:0.9261:0.0	.	171	P17643	TYRP1_HUMAN	E	171	ENSP00000373570:G171E	ENSP00000373570:G171E	G	+	2	0	TYRP1	12685641	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.632000	0.83247	2.739000	0.93911	0.467000	0.42956	GGG		0.433	TYRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055502.3	NM_000550	
CORO2A	7464	broad.mit.edu;bcgsc.ca	37	9	100888937	100888937	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr9:100888937T>C	ENST00000343933.5	-	11	1597	c.1340A>G	c.(1339-1341)gAg>gGg	p.E447G	CORO2A_ENST00000375077.4_Missense_Mutation_p.E447G	NM_003389.3	NP_003380.3	Q92828	COR2A_HUMAN	coronin, actin binding protein, 2A	447					actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)	actin cytoskeleton (GO:0015629)|transcriptional repressor complex (GO:0017053)	actin filament binding (GO:0051015)			endometrium(2)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|skin(4)|urinary_tract(1)	26		Acute lymphoblastic leukemia(62;0.0559)				TGGCATCTTCTCCTCCAACAG	0.542																																						.											0													142.0	145.0	144.0					9																	100888937		2203	4300	6503	SO:0001583	missense	7464			U57057	CCDS6735.1	9q22.3	2013-01-10	2001-11-28		ENSG00000106789	ENSG00000106789		"""Coronins"", ""WD repeat domain containing"""	2255	protein-coding gene	gene with protein product	"""coronin 2A"", ""coronin-like protein B"", ""WD protein IR10"", ""WD-repeat protein 2"""	602159	"""coronin, actin-binding protein, 2A"""			8985118	Standard	NM_052820		Approved	IR10, WDR2	uc004aym.3	Q92828	OTTHUMG00000020340	ENST00000343933.5:c.1340A>G	9.37:g.100888937T>C	ENSP00000343746:p.Glu447Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q5TBR5|Q92829|Q9BWS5	Missense_Mutation	SNP	ENST00000343933.5	37	CCDS6735.1	.	.	.	.	.	.	.	.	.	.	T	8.352	0.831191	0.16820	.	.	ENSG00000106789	ENST00000343933;ENST00000375077	T;T	0.72835	-0.69;-0.69	5.36	1.71	0.24356	.	0.368808	0.29602	N	0.011696	T	0.59018	0.2163	L	0.52573	1.65	0.36267	D	0.854913	B;B	0.26318	0.146;0.146	B;B	0.24974	0.057;0.038	T	0.53294	-0.8459	10	0.27082	T	0.32	-17.8995	7.7838	0.29080	0.0:0.2385:0.0:0.7615	.	447;447	Q92828;A8K9S3	COR2A_HUMAN;.	G	447	ENSP00000343746:E447G;ENSP00000364218:E447G	ENSP00000343746:E447G	E	-	2	0	CORO2A	99928758	0.311000	0.24536	0.926000	0.36857	0.170000	0.22686	1.294000	0.33365	0.048000	0.15891	0.418000	0.28097	GAG		0.542	CORO2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053357.1	NM_003389	
FAM47C	442444	broad.mit.edu	37	X	37028121	37028121	+	Silent	SNP	C	C	T			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chrX:37028121C>T	ENST00000358047.3	+	1	1690	c.1638C>T	c.(1636-1638)ctC>ctT	p.L546L		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	546										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						TATCTCATCTCCGCCCAGAGC	0.607																																						.											0													70.0	74.0	72.0					X																	37028121		2202	4300	6502	SO:0001819	synonymous_variant	442444			AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.1638C>T	X.37:g.37028121C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q6ZU46	Silent	SNP	ENST00000358047.3	37	CCDS35227.1																																																																																				0.607	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	NM_001013736	
TAS2R30	259293	broad.mit.edu	37	12	11286136	11286137	+	Frame_Shift_Ins	INS	-	-	A			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr12:11286136_11286137insA	ENST00000539585.1	-	1	1106_1107	c.707_708insT	c.(706-708)ctgfs	p.L236fs	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_001097643.1	NP_001091112.1	P59541	T2R30_HUMAN	taste receptor, type 2, member 30	236					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|skin(1)	13						TGGCACATAACAGAAGAAAGGA	0.411																																						.											0																																										SO:0001589	frameshift_variant	259293			AX097746, AF494233	CCDS53750.1	12p13.2	2012-08-22				ENSG00000256188		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19112	protein-coding gene	gene with protein product		613963	"""taste receptor, type 2, member 47"""	TAS2R47			Standard	NM_001097643		Approved	T2R30	uc009zhs.1	P59541		ENST00000539585.1:c.708dupT	12.37:g.11286137_11286137dupA	ENSP00000444736:p.Leu236fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q645X7	Frame_Shift_Ins	INS	ENST00000539585.1	37	CCDS53750.1																																																																																				0.411	TAS2R30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400238.1	NM_001097643	
BAI1	575	ucsc.edu;bcgsc.ca	37	8	143603450	143603450	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr8:143603450G>A	ENST00000517894.1	+	21	4043	c.3149G>A	c.(3148-3150)cGc>cAc	p.R1050H	BAI1_ENST00000323289.5_Missense_Mutation_p.R1050H			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	1050					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					CGCCTCATCCGCAAGCGCTTC	0.652																																						.											0													30.0	40.0	37.0					8																	143603450		2200	4299	6499	SO:0001583	missense	575			AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.3149G>A	8.37:g.143603450G>A	ENSP00000430945:p.Arg1050His	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000517894.1	37		.	.	.	.	.	.	.	.	.	.	G	28.6	4.933063	0.92458	.	.	ENSG00000181790	ENST00000517894;ENST00000323289	T;T	0.39787	1.06;1.06	3.78	3.78	0.43462	.	0.156800	0.43110	U	0.000612	T	0.51024	0.1650	L	0.46947	1.48	0.58432	D	0.999997	D	0.60160	0.987	P	0.56648	0.803	T	0.57493	-0.7802	10	0.87932	D	0	.	14.6053	0.68475	0.0:0.0:1.0:0.0	.	1050	E9PBK0	.	H	1050	ENSP00000430945:R1050H;ENSP00000313046:R1050H	ENSP00000313046:R1050H	R	+	2	0	BAI1	143600452	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	7.618000	0.83043	1.641000	0.50575	0.305000	0.20034	CGC		0.652	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000379963.3	NM_001702	
CAPN13	92291	ucsc.edu;bcgsc.ca	37	2	30953639	30953639	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr2:30953639A>G	ENST00000295055.8	-	22	2173	c.1997T>C	c.(1996-1998)gTc>gCc	p.V666A	CAPN13_ENST00000534090.2_Missense_Mutation_p.V666A	NM_144575.2	NP_653176.2	Q6MZZ7	CAN13_HUMAN	calpain 13	666	EF-hand 2.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(1)	30	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.155)					GTTGTACATGACCAGGCTCAT	0.478																																						.											0													129.0	129.0	129.0					2																	30953639		1977	4150	6127	SO:0001583	missense	92291				CCDS46252.1	2p22-p21	2008-02-05			ENSG00000162949	ENSG00000162949			16663	protein-coding gene	gene with protein product		610228				11675017	Standard	NM_144575		Approved	FLJ23523	uc021vfm.1	Q6MZZ7	OTTHUMG00000152053	ENST00000295055.8:c.1997T>C	2.37:g.30953639A>G	ENSP00000295055:p.Val666Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q17RF0|Q580X1|Q8TE80	Missense_Mutation	SNP	ENST00000295055.8	37	CCDS46252.1	.	.	.	.	.	.	.	.	.	.	A	14.50	2.554372	0.45487	.	.	ENSG00000162949	ENST00000295055;ENST00000534090	T;T	0.31769	1.48;1.48	4.79	2.48	0.30137	EF-hand-like domain (1);	0.654613	0.16302	N	0.220413	T	0.19167	0.0460	L	0.29908	0.895	0.32415	N	0.550165	P	0.50710	0.938	B	0.40329	0.326	T	0.25082	-1.0142	10	0.56958	D	0.05	.	5.5473	0.17071	0.7872:0.0:0.2128:0.0	.	666	Q6MZZ7	CAN13_HUMAN	A	666	ENSP00000295055:V666A;ENSP00000431298:V666A	ENSP00000295055:V666A	V	-	2	0	CAPN13	30807143	1.000000	0.71417	1.000000	0.80357	0.495000	0.33615	1.684000	0.37649	0.940000	0.37473	0.533000	0.62120	GTC		0.478	CAPN13-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325101.2	NM_144575	
RTP5	285093	ucsc.edu;bcgsc.ca	37	2	242815181	242815181	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr2:242815181T>C	ENST00000343216.3	+	2	1502	c.1474T>C	c.(1474-1476)Tac>Cac	p.Y492H		NM_173821.2	NP_776182.2																					CCACGTTGCCTACGGCCCCCA	0.632																																						.											0													67.0	80.0	76.0					2																	242815181		2078	4195	6273	SO:0001583	missense	285093																														ENST00000343216.3:c.1474T>C	2.37:g.242815181T>C	ENSP00000345374:p.Tyr492His	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000343216.3	37	CCDS42843.1	.	.	.	.	.	.	.	.	.	.	.	10.51	1.369156	0.24771	.	.	ENSG00000188011	ENST00000343216	T	0.24151	1.87	1.96	-0.631	0.11526	.	.	.	.	.	T	0.08626	0.0214	N	0.08118	0	0.09310	N	1	P	0.46020	0.871	B	0.34242	0.178	T	0.19484	-1.0304	9	0.87932	D	0	-7.1084	1.7057	0.02881	0.5123:0.0:0.1891:0.2986	.	492	Q14D33	CB085_HUMAN	H	492	ENSP00000345374:Y492H	ENSP00000345374:Y492H	Y	+	1	0	C2orf85	242463854	0.000000	0.05858	0.000000	0.03702	0.688000	0.40055	-1.805000	0.01737	-0.153000	0.11137	0.165000	0.16767	TAC		0.632	CXXC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322310.1		
EIF2AK4	440275	ucsc.edu	37	15	40235659	40235659	+	Silent	SNP	A	A	G			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr15:40235659A>G	ENST00000263791.5	+	3	376	c.333A>G	c.(331-333)gaA>gaG	p.E111E	EIF2AK4_ENST00000382727.2_Silent_p.E111E|EIF2AK4_ENST00000560648.1_Silent_p.E111E|EIF2AK4_ENST00000559624.1_Silent_p.E111E	NM_001013703.2	NP_001013725.2	Q9P2K8	E2AK4_HUMAN	eukaryotic translation initiation factor 2 alpha kinase 4	111	RWD. {ECO:0000255|PROSITE- ProRule:PRU00179}.				cellular response to starvation (GO:0009267)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of translation (GO:0017148)|protein phosphorylation (GO:0006468)|regulation of translational initiation (GO:0006446)|regulation of translational initiation in response to stress (GO:0043558)	cytosolic ribosome (GO:0022626)	ATP binding (GO:0005524)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)	40		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)		CTCGCCTAGAAGAACTGGCCA	0.338																																						.											0													108.0	104.0	105.0					15																	40235659		1818	4085	5903	SO:0001819	synonymous_variant	440275			AB037759	CCDS42016.1	15q13.3	2008-08-18				ENSG00000128829			19687	protein-coding gene	gene with protein product		609280				10504407	Standard	XM_005254392		Approved	GCN2, KIAA1338	uc001zkm.1	Q9P2K8		ENST00000263791.5:c.333A>G	15.37:g.40235659A>G		Somatic		WXS	Illumina HiSeq	Phase_I	C9JEC4|Q69YL7|Q6DC97|Q96GN6|Q9H5K1|Q9NSQ3|Q9NSZ5|Q9UJ56	Silent	SNP	ENST00000263791.5	37	CCDS42016.1																																																																																				0.338	EIF2AK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418395.1		
EPSTI1	94240	ucsc.edu;bcgsc.ca	37	13	43469222	43469222	+	Nonsense_Mutation	SNP	G	G	A	rs201385523		TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr13:43469222G>A	ENST00000398762.3	-	11	870	c.871C>T	c.(871-873)Cga>Tga	p.R291*	EPSTI1_ENST00000313640.7_Nonsense_Mutation_p.R291*|EPSTI1_ENST00000313624.7_Nonsense_Mutation_p.R280*			Q96J88	ESIP1_HUMAN	epithelial stromal interaction 1 (breast)	291										endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|skin(1)	17		Lung NSC(96;3.6e-06)|Breast(139;0.00869)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		GBM - Glioblastoma multiforme(144;0.000528)|BRCA - Breast invasive adenocarcinoma(63;0.0858)		CCTTGGAGTCGGTCCAGAAAA	0.413																																						.											0								G	stop/ARG,stop/ARG	0,4406		0,0,2203	62.0	60.0	60.0		871,838	5.7	1.0	13		60	2,8598	3.0+/-9.4	0,2,4298	yes	stop-gained,stop-gained	EPSTI1	NM_001002264.1,NM_033255.2	,	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	,	291/411,280/308	43469222	2,13004	2203	4300	6503	SO:0001587	stop_gained	94240			AF396928	CCDS9387.1, CCDS31964.1	13q13.3	2011-06-27			ENSG00000133106	ENSG00000133106			16465	protein-coding gene	gene with protein product	"""epithelial stromal interaction protein 1"""	607441				11991720	Standard	NM_033255		Approved	BRESI1, MGC29634	uc001uyw.2	Q96J88	OTTHUMG00000016814	ENST00000398762.3:c.871C>T	13.37:g.43469222G>A	ENSP00000381746:p.Arg291*	Somatic		WXS	Illumina HiSeq	Phase_I	Q8IVC7|Q8NDQ7	Nonsense_Mutation	SNP	ENST00000398762.3	37	CCDS9387.1	.	.	.	.	.	.	.	.	.	.	G	28.1	4.895090	0.91962	0.0	2.33E-4	ENSG00000133106	ENST00000313640;ENST00000313624;ENST00000398762	.	.	.	5.71	5.71	0.89125	.	0.195514	0.32884	N	0.005535	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.6042	12.3473	0.55128	0.0:0.0:0.8316:0.1684	.	.	.	.	X	291;280;291	.	ENSP00000318643:R280X	R	-	1	2	EPSTI1	42367222	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.439000	0.44846	2.691000	0.91804	0.561000	0.74099	CGA		0.413	EPSTI1-010	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000400321.1	NM_001002264	
NLRC5	84166	ucsc.edu;bcgsc.ca	37	16	57057697	57057697	+	Splice_Site	SNP	G	G	T			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr16:57057697G>T	ENST00000262510.6	+	5	581	c.356G>T	c.(355-357)gGc>gTc	p.G119V	NLRC5_ENST00000539144.1_Splice_Site_p.G119V|NLRC5_ENST00000436936.1_Splice_Site_p.G119V|NLRC5_ENST00000308149.7_Splice_Site_p.G119V	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5	119					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)			NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				GCTTTTTCAGGCCTGAAGCGC	0.592																																						.											0													44.0	40.0	41.0					16																	57057697		2198	4300	6498	SO:0001630	splice_region_variant	84166			AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.356-1G>T	16.37:g.57057697G>T		Somatic		WXS	Illumina HiSeq	Phase_I	B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Missense_Mutation	SNP	ENST00000262510.6	37	CCDS10773.1	.	.	.	.	.	.	.	.	.	.	G	11.19	1.564515	0.27915	.	.	ENSG00000140853	ENST00000262510;ENST00000308149;ENST00000436936;ENST00000539144	T;T;T;T	0.75050	-0.7;-0.71;-0.9;-0.71	4.62	2.64	0.31445	.	0.000000	0.33005	N	0.005397	T	0.64034	0.2562	L	0.56769	1.78	0.45995	D	0.998801	B	0.26195	0.144	B	0.20955	0.032	T	0.54951	-0.8216	9	.	.	.	.	6.2817	0.21011	0.1009:0.1866:0.7125:0.0	.	119	Q86WI3	NLRC5_HUMAN	V	119	ENSP00000262510:G119V;ENSP00000308886:G119V;ENSP00000389739:G119V;ENSP00000441727:G119V	.	G	+	2	0	NLRC5	55615198	0.743000	0.28239	0.804000	0.32291	0.857000	0.48899	0.785000	0.26830	0.557000	0.29117	0.557000	0.71058	GGC		0.592	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257346.1	NM_032206	Missense_Mutation
SHISA7	729956	ucsc.edu	37	19	55953906	55953906	+	Missense_Mutation	SNP	T	T	G			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr19:55953906T>G	ENST00000376325.4	-	1	324	c.325A>C	c.(325-327)Acc>Ccc	p.T109P		NM_001145176.1	NP_001138648.1	A6NL88	SHSA7_HUMAN	shisa family member 7	109						integral component of membrane (GO:0016021)				skin(1)	1						TAGTGGCAGGTGCCACAGCAG	0.682																																						.											0													13.0	24.0	21.0					19																	55953906		681	1561	2242	SO:0001583	missense	729956				CCDS46193.1	19q13.42	2013-07-31	2013-07-31					"""Shisa homologs"""	35409	protein-coding gene	gene with protein product			"""shisa homolog 7 (Xenopus laevis)"""				Standard	NM_001145176		Approved		uc002qkz.3	A6NL88		ENST00000376325.4:c.325A>C	19.37:g.55953906T>G	ENSP00000365503:p.Thr109Pro	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000376325.4	37	CCDS46193.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.085716	0.76642	.	.	ENSG00000187902	ENST00000376325	T	0.56444	0.46	3.49	3.49	0.39957	.	.	.	.	.	T	0.70649	0.3248	M	0.82193	2.58	0.52099	D	0.999947	D	0.89917	1.0	D	0.72982	0.979	T	0.73030	-0.4111	8	.	.	.	.	10.2747	0.43504	0.0:0.0:0.0:1.0	.	109	A6NL88	SHSA7_HUMAN	P	109	ENSP00000365503:T109P	.	T	-	1	0	SHISA7	60645718	1.000000	0.71417	1.000000	0.80357	0.859000	0.49053	6.629000	0.74267	1.384000	0.46424	0.248000	0.18094	ACC		0.682	SHISA7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334533.2	NM_001145176	
SOX8	30812	ucsc.edu	37	16	1034902	1034902	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr16:1034902A>G	ENST00000293894.3	+	3	972	c.857A>G	c.(856-858)gAc>gGc	p.D286G		NM_014587.3	NP_055402.2	P57073	SOX8_HUMAN	SRY (sex determining region Y)-box 8	286					adipose tissue development (GO:0060612)|astrocyte fate commitment (GO:0060018)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|enteric nervous system development (GO:0048484)|fat cell differentiation (GO:0045444)|in utero embryonic development (GO:0001701)|male gonad development (GO:0008584)|metanephric nephron tubule formation (GO:0072289)|morphogenesis of a branching epithelium (GO:0061138)|negative regulation of apoptotic process (GO:0043066)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell migration (GO:0001755)|oligodendrocyte differentiation (GO:0048709)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of gliogenesis (GO:0014015)|positive regulation of kidney development (GO:0090184)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hormone levels (GO:0010817)|renal vesicle induction (GO:0072034)|retina development in camera-type eye (GO:0060041)|retinal rod cell differentiation (GO:0060221)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)|spermatogenesis (GO:0007283)|ureter morphogenesis (GO:0072197)	cytoplasm (GO:0005737)|nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|kidney(1)|lung(5)|prostate(2)|skin(1)	10		Hepatocellular(780;0.00308)				CACGAGTTCGACCAGTACCTG	0.692																																						.											0													24.0	24.0	24.0					16																	1034902		2194	4295	6489	SO:0001583	missense	30812			AF164104	CCDS10428.1	16p13.3	2008-05-23			ENSG00000005513	ENSG00000005513		"""SRY (sex determining region Y)-boxes"""	11203	protein-coding gene	gene with protein product		605923				10662550, 10684944	Standard	NM_014587		Approved		uc002ckn.3	P57073	OTTHUMG00000122101	ENST00000293894.3:c.857A>G	16.37:g.1034902A>G	ENSP00000293894:p.Asp286Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q9NZW2	Missense_Mutation	SNP	ENST00000293894.3	37	CCDS10428.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.096470	0.76870	.	.	ENSG00000005513	ENST00000293894	T	0.79033	-1.23	4.17	4.17	0.49024	.	0.000000	0.85682	D	0.000000	D	0.89781	0.6814	M	0.92833	3.35	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.91611	0.5303	10	0.62326	D	0.03	.	12.6002	0.56492	1.0:0.0:0.0:0.0	.	286	P57073	SOX8_HUMAN	G	286	ENSP00000293894:D286G	ENSP00000293894:D286G	D	+	2	0	SOX8	974903	1.000000	0.71417	0.998000	0.56505	0.951000	0.60555	7.015000	0.76387	1.751000	0.51876	0.529000	0.55759	GAC		0.692	SOX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242867.1		
STK3	6788	ucsc.edu	37	8	99779547	99779547	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr8:99779547C>T	ENST00000419617.2	-	3	300	c.160G>A	c.(160-162)Gca>Aca	p.A54T	STK3_ENST00000523601.1_Missense_Mutation_p.A82T	NM_006281.3	NP_006272.2	Q13188	STK3_HUMAN	serine/threonine kinase 3	54	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell differentiation involved in embryonic placenta development (GO:0060706)|central nervous system development (GO:0007417)|endocardium development (GO:0003157)|hepatocyte apoptotic process (GO:0097284)|hippo signaling (GO:0035329)|intracellular signal transduction (GO:0035556)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of organ growth (GO:0046621)|neural tube formation (GO:0001841)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|primitive hemopoiesis (GO:0060215)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein dimerization activity (GO:0046983)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)	p.A54T(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	17	Breast(36;2.4e-06)	Breast(495;0.106)	OV - Ovarian serous cystadenocarcinoma(57;0.0382)	KIRC - Kidney renal clear cell carcinoma(542;9.44e-06)		TGTTTAATTGCGACAACTTGA	0.323																																						.											1	Substitution - Missense(1)	large_intestine(1)											108.0	100.0	103.0					8																	99779547		1877	4142	6019	SO:0001583	missense	6788			BC010640	CCDS47900.1, CCDS59108.1, CCDS75774.1	8q22.2	2011-05-24	2010-06-25		ENSG00000104375	ENSG00000104375			11406	protein-coding gene	gene with protein product		605030	"""serine/threonine kinase 3 (Ste20, yeast homolog)"""			8816758	Standard	NM_006281		Approved	MST2, KRS1	uc003yip.4	Q13188	OTTHUMG00000164651	ENST00000419617.2:c.160G>A	8.37:g.99779547C>T	ENSP00000390500:p.Ala54Thr	Somatic		WXS	Illumina HiSeq	Phase_I	A8K722|B3KYA7|Q15445|Q15801|Q96FM6	Missense_Mutation	SNP	ENST00000419617.2	37	CCDS47900.1	.	.	.	.	.	.	.	.	.	.	C	34	5.319913	0.95682	.	.	ENSG00000104375	ENST00000419617;ENST00000523601;ENST00000518165	T;T;T	0.41758	0.99;0.99;1.53	5.67	5.67	0.87782	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.77308	0.4111	H	0.95950	3.745	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.77004	0.978;0.989;0.985	D	0.84472	0.0600	10	0.87932	D	0	.	19.7782	0.96405	0.0:1.0:0.0:0.0	.	54;54;82	E5RFQ9;Q13188;B3KYA7	.;STK3_HUMAN;.	T	54;82;54	ENSP00000390500:A54T;ENSP00000429744:A82T;ENSP00000428014:A54T	ENSP00000390500:A54T	A	-	1	0	STK3	99848723	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.776000	0.85560	2.667000	0.90743	0.561000	0.74099	GCA		0.323	STK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379635.1	NM_006281	
TG	7038	ucsc.edu	37	8	133911147	133911147	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr8:133911147T>C	ENST00000220616.4	+	14	3362	c.3322T>C	c.(3322-3324)Tgc>Cgc	p.C1108R	TG_ENST00000377869.1_Missense_Mutation_p.C1108R	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	1108	Thyroglobulin type-1 9. {ECO:0000255|PROSITE-ProRule:PRU00500}.				hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		CGTCCCAGCCTGCCTAGAAGT	0.493																																						.											0													54.0	45.0	48.0					8																	133911147		2203	4300	6503	SO:0001583	missense	7038			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.3322T>C	8.37:g.133911147T>C	ENSP00000220616:p.Cys1108Arg	Somatic		WXS	Illumina HiSeq	Phase_I	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	ENST00000220616.4	37	CCDS34944.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.81|16.81	3.226747|3.226747	0.58668|0.58668	.|.	.|.	ENSG00000042832|ENSG00000042832	ENST00000377869;ENST00000220616|ENST00000543313	D;D|.	0.87491|.	-2.26;-2.26|.	5.74|5.74	5.74|5.74	0.90152|0.90152	Thyroglobulin type-1 (6);|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|T	0.73721|0.73721	0.3623|0.3623	M|M	0.75264|0.75264	2.295|2.295	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.79108|.	0.992|.	T|T	0.74578|0.74578	-0.3619|-0.3619	10|5	0.87932|.	D|.	0|.	.|.	13.4199|13.4199	0.60992|0.60992	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	1108|.	P01266|.	THYG_HUMAN|.	R|P	1108|15	ENSP00000367100:C1108R;ENSP00000220616:C1108R|.	ENSP00000220616:C1108R|.	C|L	+|+	1|2	0|0	TG|TG	133980329|133980329	1.000000|1.000000	0.71417|0.71417	0.990000|0.990000	0.47175|0.47175	0.437000|0.437000	0.31866|0.31866	4.466000|4.466000	0.60148|0.60148	2.182000|2.182000	0.69389|0.69389	0.533000|0.533000	0.62120|0.62120	TGC|CTG		0.493	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1	NM_003235	
VHL	7428	ucsc.edu;bcgsc.ca	37	3	10183608	10183608	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr3:10183608A>G	ENST00000256474.2	+	1	917	c.77A>G	c.(76-78)gAa>gGa	p.E26G	VHL_ENST00000345392.2_Missense_Mutation_p.E26G|snoU13_ENST00000458986.1_RNA	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	26	8 X 5 AA tandem repeats of G-[PAVG]-E-E- [DAYSLE].				cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.E26G(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		TACGGCCCTGAAGAAGACGGC	0.731		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																													.	yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	1	Substitution - Missense(1)	kidney(1)											9.0	12.0	11.0					3																	10183608		1937	3843	5780	SO:0001583	missense	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.77A>G	3.37:g.10183608A>G	ENSP00000256474:p.Glu26Gly	Somatic		WXS	Illumina HiSeq	Phase_I	B2RE45|Q13599|Q6PDA9	Missense_Mutation	SNP	ENST00000256474.2	37	CCDS2597.1	.	.	.	.	.	.	.	.	.	.	A	14.31	2.495981	0.44352	.	.	ENSG00000134086	ENST00000256474;ENST00000345392;ENST00000450183	D;D	0.85013	-1.93;-1.93	3.41	-0.726	0.11170	.	0.806388	0.09846	N	0.748190	T	0.69378	0.3104	N	0.14661	0.345	0.09310	N	1	B;B	0.11235	0.004;0.002	B;B	0.11329	0.006;0.003	T	0.57365	-0.7824	10	0.87932	D	0	-2.5634	3.318	0.07040	0.5484:0.2091:0.2425:0.0	.	26;26	P40337-2;P40337	.;VHL_HUMAN	G	26	ENSP00000256474:E26G;ENSP00000344757:E26G	ENSP00000256474:E26G	E	+	2	0	VHL	10158608	0.001000	0.12720	0.000000	0.03702	0.048000	0.14542	0.232000	0.17891	-0.217000	0.10033	-0.572000	0.04151	GAA		0.731	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1	NM_000551	
VPS13B	157680	ucsc.edu;bcgsc.ca	37	8	100533136	100533136	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr8:100533136C>T	ENST00000358544.2	+	30	4829	c.4718C>T	c.(4717-4719)gCa>gTa	p.A1573V	VPS13B_ENST00000357162.2_Missense_Mutation_p.A1548V|VPS13B_ENST00000395996.1_3'UTR	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	1573					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			GCTAATCAGGCAGCAAAAGAA	0.418																																					Colon(161;2205 2542 7338 31318)	.											0													126.0	113.0	117.0					8																	100533136		2203	4300	6503	SO:0001583	missense	157680			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.4718C>T	8.37:g.100533136C>T	ENSP00000351346:p.Ala1573Val	Somatic		WXS	Illumina HiSeq	Phase_I	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	ENST00000358544.2	37	CCDS6280.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.90|10.90	1.480516|1.480516	0.26598|0.26598	.|.	.|.	ENSG00000132549|ENSG00000132549	ENST00000357162;ENST00000358544|ENST00000521559	T;T|.	0.69685|.	-0.42;-0.41|.	5.65|5.65	3.78|3.78	0.43462|0.43462	.|.	0.685114|.	0.14477|.	N|.	0.317196|.	T|.	0.38746|.	0.1052|.	L|L	0.44542|0.44542	1.39|1.39	0.09310|0.09310	N|N	0.999991|0.999991	B;B|.	0.19200|.	0.034;0.02|.	B;B|.	0.18561|.	0.022;0.01|.	T|.	0.21484|.	-1.0244|.	10|.	0.30854|.	T|.	0.27|.	.|.	8.2142|8.2142	0.31501|0.31501	0.3052:0.6236:0.0:0.0712|0.3052:0.6236:0.0:0.0712	.|.	1548;1573|.	Q7Z7G8-2;Q7Z7G8|.	.;VP13B_HUMAN|.	V|X	1548;1573|4	ENSP00000349685:A1548V;ENSP00000351346:A1573V|.	ENSP00000349685:A1548V|.	A|Q	+|+	2|1	0|0	VPS13B|VPS13B	100602312|100602312	1.000000|1.000000	0.71417|0.71417	0.780000|0.780000	0.31762|0.31762	0.896000|0.896000	0.52359|0.52359	2.548000|2.548000	0.45794|0.45794	0.648000|0.648000	0.30732|0.30732	0.557000|0.557000	0.71058|0.71058	GCA|CAG		0.418	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042	
VWC2	375567	ucsc.edu	37	7	49815089	49815089	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr7:49815089T>C	ENST00000340652.4	+	2	614	c.58T>C	c.(58-60)Tgc>Cgc	p.C20R		NM_198570.3	NP_940972.2	Q2TAL6	VWC2_HUMAN	von Willebrand factor C domain containing 2	20					negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of neuron differentiation (GO:0045666)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|basement membrane (GO:0005604)|cell junction (GO:0030054)|extracellular space (GO:0005615)|interstitial matrix (GO:0005614)|synapse (GO:0045202)				cervix(1)|endometrium(2)|large_intestine(1)|lung(3)|prostate(1)	8						CCTGGTCACCTGCTGCCTGAT	0.711																																						.											0													22.0	17.0	19.0					7																	49815089		2200	4299	6499	SO:0001583	missense	375567			AY358393	CCDS5508.1	7p12.3-p12.2	2007-07-19			ENSG00000188730	ENSG00000188730			30200	protein-coding gene	gene with protein product	"""brorin"", ""brain-specific chordin-like"""	611108				17400546	Standard	NM_198570		Approved	PSST739, UNQ739	uc003tot.1	Q2TAL6	OTTHUMG00000129265	ENST00000340652.4:c.58T>C	7.37:g.49815089T>C	ENSP00000341819:p.Cys20Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q6UXE2	Missense_Mutation	SNP	ENST00000340652.4	37	CCDS5508.1	.	.	.	.	.	.	.	.	.	.	T	16.31	3.086076	0.55861	.	.	ENSG00000188730	ENST00000340652	T	0.33654	1.4	4.53	3.34	0.38264	.	0.159801	0.43747	D	0.000532	T	0.16981	0.0408	N	0.08118	0	0.47547	D	0.999459	P	0.41041	0.736	B	0.32465	0.146	T	0.06481	-1.0824	10	0.87932	D	0	-12.7074	11.0243	0.47736	0.0:0.0:0.1567:0.8433	.	20	Q2TAL6	VWC2_HUMAN	R	20	ENSP00000341819:C20R	ENSP00000341819:C20R	C	+	1	0	VWC2	49785635	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.836000	0.62789	0.538000	0.28769	0.454000	0.30748	TGC		0.711	VWC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251375.2	NM_198570	
ANKRD30BL	554226	mdanderson.org	37	2	132912312	132912312	+	Missense_Mutation	SNP	T	T	C	rs199906464	byFrequency	TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr2:132912312T>C	ENST00000409867.1	-	4	786	c.537A>G	c.(535-537)atA>atG	p.I179M	ANKRD30BL_ENST00000470729.1_5'UTR|RNU6-1132P_ENST00000459214.1_RNA			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like	179										endometrium(1)|kidney(3)	4						TTCTTTTCCTTATGGCCAGTA	0.294																																						.											0																																										SO:0001583	missense	554226					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.537A>G	2.37:g.132912312T>C	ENSP00000386398:p.Ile179Met	Somatic		WXS	Illumina HiSeq	Phase_I	B8ZZL7	RNA	SNP	ENST00000409867.1	37		.	.	.	.	.	.	.	.	.	.	.	11.67	1.708267	0.30322	.	.	ENSG00000163046	ENST00000409867	T	0.68025	-0.3	0.569	0.569	0.17340	.	.	.	.	.	T	0.63768	0.2539	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.57906	-0.7730	5	0.72032	D	0.01	.	.	.	.	.	.	.	.	M	179	ENSP00000386398:I179M	ENSP00000295181:I179M	I	-	3	3	ANKRD30BL	132628782	0.000000	0.05858	0.157000	0.22605	0.428000	0.31595	-0.675000	0.05227	0.477000	0.27464	0.155000	0.16302	ATA		0.294	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331353.2	NR_027019	
ANP32E	81611	mdanderson.org	37	1	150199057	150199057	+	Silent	SNP	C	C	T			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr1:150199057C>T	ENST00000314136.8	-	5	933	c.564G>A	c.(562-564)gaG>gaA	p.E188E	ANP32E_ENST00000369115.2_Silent_p.E56E|ANP32E_ENST00000369119.3_Silent_p.E140E|ANP32E_ENST00000369116.4_Silent_p.E56E|ANP32E_ENST00000436748.2_Silent_p.E147E|ANP32E_ENST00000533654.1_Missense_Mutation_p.R133K|ANP32E_ENST00000369114.5_Intron	NM_001136478.2|NM_001280559.1|NM_030920.3	NP_001129950.1|NP_001267488.1|NP_112182.1	Q9BTT0	AN32E_HUMAN	acidic (leucine-rich) nuclear phosphoprotein 32 family, member E	188	Asp/Glu-rich (highly acidic).				histone exchange (GO:0043486)|negative regulation of catalytic activity (GO:0043086)	cytoplasmic membrane-bounded vesicle (GO:0016023)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	histone binding (GO:0042393)|phosphatase inhibitor activity (GO:0019212)			breast(3)|endometrium(3)|lung(7)|skin(1)|urinary_tract(1)	15	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			cctcttcctcctcctcttcct	0.438																																						.											0													238.0	207.0	217.0					1																	150199057		2203	4300	6503	SO:0001819	synonymous_variant	81611			AK092672	CCDS946.1, CCDS44214.1, CCDS44215.1, CCDS60245.1	1q22	2008-02-05			ENSG00000143401	ENSG00000143401		"""ANP32 acidic nuclear phosphoproteins"""	16673	protein-coding gene	gene with protein product		609611				12438741	Standard	NM_030920		Approved	LANPL, MGC5350, LANP-L	uc001etw.3	Q9BTT0	OTTHUMG00000012547	ENST00000314136.8:c.564G>A	1.37:g.150199057C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B4E0I6|E9PEA6|Q5TB18|Q5TB20|Q8N1S4|Q8WWW9	Silent	SNP	ENST00000314136.8	37	CCDS946.1	.	.	.	.	.	.	.	.	.	.	C	2.195	-0.384257	0.04966	.	.	ENSG00000143401	ENST00000533654	T	0.00282	8.31	5.31	-2.29	0.06805	.	.	.	.	.	T	0.00039	0.0001	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.08055	0.003	T	0.02385	-1.1167	8	0.28530	T	0.3	.	0.7934	0.01061	0.2726:0.2404:0.1094:0.3777	.	133	E9PLC4	.	K	133	ENSP00000435215:R133K	ENSP00000435215:R133K	R	-	2	0	ANP32E	148465681	0.560000	0.26570	0.552000	0.28243	0.061000	0.15899	-0.914000	0.04038	-0.093000	0.12396	0.561000	0.74099	AGG		0.438	ANP32E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035056.1	NM_030920	
FAM205A	259308	mdanderson.org	37	9	34725432	34725432	+	Missense_Mutation	SNP	C	C	T	rs77610593		TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr9:34725432C>T	ENST00000378788.3	-	4	1844	c.1805G>A	c.(1804-1806)cGc>cAc	p.R602H		NM_001141917.1	NP_001135389.1	Q6ZU69	F205A_HUMAN	family with sequence similarity 205, member A	602				R -> H (in Ref. 1; BAC86357). {ECO:0000305}.		integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(1)	4						CCAGCGATGGCGAATCAACTG	0.567																																						.											0													31.0	18.0	22.0					9																	34725432		676	1221	1897	SO:0001583	missense	259308				CCDS55305.1	9p13.3	2014-05-16			ENSG00000205108	ENSG00000205108			41911	protein-coding gene	gene with protein product							Standard	NM_001141917		Approved	C9orf144B	uc011lor.2	Q6ZU69	OTTHUMG00000000448	ENST00000378788.3:c.1805G>A	9.37:g.34725432C>T	ENSP00000417711:p.Arg602His	Somatic		WXS	Illumina HiSeq	Phase_I	A8MVW7	Missense_Mutation	SNP	ENST00000378788.3	37	CCDS55305.1	335	0.1533882783882784	8	0.016260162601626018	73	0.20165745856353592	117	0.20454545454545456	137	0.18073878627968337	T	0.824	-0.747613	0.03065	.	.	ENSG00000205108	ENST00000378788	T	0.06687	3.27	4.28	4.28	0.50868	.	.	.	.	.	T	0.00012	0.0000	N	0.01352	-0.895	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.42649	-0.9439	8	0.02654	T	1	.	6.916	0.24359	0.0:0.11:0.0:0.89	.	602	Q6ZU69	F205A_HUMAN	H	602	ENSP00000417711:R602H	ENSP00000417711:R602H	R	-	2	0	RP11-195F19.10	34715432	0.150000	0.22732	0.084000	0.20598	0.770000	0.43624	0.762000	0.26503	0.599000	0.29845	-0.381000	0.06696	CGC		0.567	FAM205A-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001150.2	NM_001141917	
FRG1B	284802	mdanderson.org	37	20	29625877	29625877	+	Missense_Mutation	SNP	G	G	A	rs7266938	byFrequency	TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr20:29625877G>A	ENST00000278882.3	+	5	501	c.121G>A	c.(121-123)Gcc>Acc	p.A41T	FRG1B_ENST00000358464.4_Missense_Mutation_p.A41T|FRG1B_ENST00000439954.2_Missense_Mutation_p.A46T			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	41								p.A41T(2)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						GTACAGAATCGCCCTGAAATC	0.358																																						.											2	Substitution - Missense(2)	urinary_tract(2)																																								SO:0001583	missense	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.121G>A	20.37:g.29625877G>A	ENSP00000278882:p.Ala41Thr	Somatic		WXS	Illumina HiSeq	Phase_I	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	g	8.740	0.918766	0.17982	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.62498	0.02	1.68	1.68	0.24146	.	0.000000	0.85682	D	0.000000	T	0.48277	0.1491	.	.	.	0.52099	D	0.999942	B	0.24186	0.099	B	0.27715	0.082	T	0.43956	-0.9359	9	0.33940	T	0.23	.	9.3557	0.38164	0.0:0.0:1.0:0.0	rs7266938;rs7266938	46	F5H5R5	.	T	41;46;41	ENSP00000408863:A46T	ENSP00000278882:A41T	A	+	1	0	FRG1B	28239538	1.000000	0.71417	0.993000	0.49108	0.033000	0.12548	5.232000	0.65332	1.250000	0.43966	0.184000	0.17185	GCC		0.358	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
HLA-DQA2	3118	mdanderson.org	37	6	32714168	32714168	+	Silent	SNP	A	A	G	rs9276437	byFrequency	TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr6:32714168A>G	ENST00000374940.3	+	4	867	c.765A>G	c.(763-765)ttA>ttG	p.L255L		NM_020056.4	NP_064440.1	P01906	DQA2_HUMAN	major histocompatibility complex, class II, DQ alpha 2	255					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)			endometrium(2)|large_intestine(3)|lung(7)|skin(1)	13					"""""""Insulin(DB00071)"""	AAGGGCTCTTATGAATCCCAT	0.517													.|||	786	0.156949	0.3033	0.219	5008	,	,		21502	0.0655		0.1153	False		,,,				2504	0.0521					.											0								G		751,2271		79,593,839	119.0	121.0	120.0		765	1.1	0.1	6	dbSNP_118	120	527,4891		14,499,2196	no	coding-synonymous	HLA-DQA2	NM_020056.4		93,1092,3035	GG,GA,AA		9.7268,24.8511,15.1422		255/256	32714168	1278,7162	1511	2709	4220	SO:0001819	synonymous_variant	3118				CCDS4753.1	6p21.3	2013-01-11			ENSG00000237541	ENSG00000237541		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4943	protein-coding gene	gene with protein product		613503		HLA-DXA			Standard	NM_020056		Approved		uc003obx.3	P01906	OTTHUMG00000031108	ENST00000374940.3:c.765A>G	6.37:g.32714168A>G		Somatic		WXS	Illumina HiSeq	Phase_I	A2BF37|B0V0E7|O19789|Q5SQ94|Q5SR04	Silent	SNP	ENST00000374940.3	37	CCDS4753.1																																																																																				0.517	HLA-DQA2-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076179.2	NM_020056	
KRT6B	3854	mdanderson.org	37	12	52845665	52845665	+	Silent	SNP	G	G	T	rs141114189		TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr12:52845665G>T	ENST00000252252.3	-	1	245	c.198C>A	c.(196-198)ggC>ggA	p.G66G		NM_005555.3	NP_005546.2	P04259	K2C6B_HUMAN	keratin 6B	66	Head.				ectoderm development (GO:0007398)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(19)|ovary(4)|prostate(2)	40				BRCA - Breast invasive adenocarcinoma(357;0.083)		TCCTCTTGGAGCCCCCCAGGC	0.657																																						.											0													21.0	24.0	23.0					12																	52845665		1932	3915	5847	SO:0001819	synonymous_variant	3854			BC034535	CCDS8828.1	12q13.13	2013-01-16	2004-08-11		ENSG00000185479	ENSG00000185479		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6444	protein-coding gene	gene with protein product		148042	"""keratin-like 1 (a type II keratin sequence)"""	KRTL1		1713141, 16831889	Standard	NM_005555		Approved		uc001sak.3	P04259	OTTHUMG00000169593	ENST00000252252.3:c.198C>A	12.37:g.52845665G>T		Somatic		WXS	Illumina HiSeq	Phase_I	P48669	Silent	SNP	ENST00000252252.3	37	CCDS8828.1																																																																																				0.657	KRT6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404969.1	NM_005555	
KRTAP10-6	386674	mdanderson.org	37	21	46011324	46011324	+	Missense_Mutation	SNP	T	T	C	rs1785472		TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr21:46011324T>C	ENST00000400368.1	-	1	1062	c.1042A>G	c.(1042-1044)Atg>Gtg	p.M348V	TSPEAR_ENST00000323084.4_Intron	NM_198688.2	NP_941961.2	P60371	KR106_HUMAN	keratin associated protein 10-6	348						keratin filament (GO:0045095)		p.M348V(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(6)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	23						CGGGAGCACATGGGGCGGCAG	0.682																																						.											1	Substitution - Missense(1)	prostate(1)											47.0	59.0	55.0					21																	46011324		2197	4300	6497	SO:0001583	missense	386674			AB076353	CCDS42959.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000188155	ENSG00000188155		"""Keratin associated proteins"""	20523	protein-coding gene	gene with protein product			"""keratin associated protein 18-6"""	KRTAP18-6			Standard	NM_198688		Approved	KRTAP18.6, KAP18.6, KAP10.6	uc002zfm.3	P60371	OTTHUMG00000057634	ENST00000400368.1:c.1042A>G	21.37:g.46011324T>C	ENSP00000383219:p.Met348Val	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000400368.1	37	CCDS42959.1	.	.	.	.	.	.	.	.	.	.	c	0.001	-3.992851	0.00002	.	.	ENSG00000188155	ENST00000400368	T	0.00686	5.85	2.84	-5.55	0.02536	.	.	.	.	.	T	0.00210	0.0006	N	0.00230	-1.795	0.09310	N	1	B	0.14805	0.011	B	0.01281	0.0	T	0.38672	-0.9650	9	0.02654	T	1	.	1.9179	0.03301	0.1134:0.3558:0.2249:0.306	.	348	P60371	KR106_HUMAN	V	348	ENSP00000383219:M348V	ENSP00000383219:M348V	M	-	1	0	KRTAP10-6	44835752	0.000000	0.05858	0.002000	0.10522	0.006000	0.05464	-4.157000	0.00283	-1.772000	0.01292	-2.665000	0.00146	ATG		0.682	KRTAP10-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128037.1	NM_198688	
KMT2C	58508	mdanderson.org	37	7	151962294	151962294	+	Splice_Site	SNP	G	G	A			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr7:151962294G>A	ENST00000262189.6	-	8	1231	c.1013C>T	c.(1012-1014)tCg>tTg	p.S338L	KMT2C_ENST00000355193.2_Splice_Site_p.S338L	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	338					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										ATCTTCCTTCGCTATAATTAA	0.368																																						.											0													67.0	63.0	64.0					7																	151962294		2203	4299	6502	SO:0001630	splice_region_variant	58508			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.1013-1C>T	7.37:g.151962294G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	G	10.41	1.342287	0.24339	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.98862	-5.19;-5.19	4.65	4.65	0.58169	Zinc finger, RING/FYVE/PHD-type (1);Protein kinase C-like, phorbol ester/diacylglycerol binding (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.36482	U	0.002566	D	0.98024	0.9349	L	0.29908	0.895	0.80722	D	1	D	0.76494	0.999	D	0.72625	0.978	D	0.97032	0.9751	10	0.11794	T	0.64	.	17.9157	0.88950	0.0:0.0:1.0:0.0	.	338	Q8NEZ4	MLL3_HUMAN	L	338	ENSP00000262189:S338L;ENSP00000347325:S338L	ENSP00000262189:S338L	S	-	2	0	MLL3	151593227	1.000000	0.71417	0.997000	0.53966	0.003000	0.03518	7.569000	0.82380	2.271000	0.75665	0.557000	0.71058	TCG		0.368	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		Missense_Mutation
MR1	3140	mdanderson.org;bcgsc.ca	37	1	181021437	181021437	+	Missense_Mutation	SNP	C	C	A			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr1:181021437C>A	ENST00000367580.5	+	4	676	c.671C>A	c.(670-672)gCt>gAt	p.A224D	MR1_ENST00000438435.2_Intron|MR1_ENST00000367579.3_Missense_Mutation_p.A179D|MR1_ENST00000282990.6_Intron|MR1_ENST00000434571.2_Intron	NM_001531.2	NP_001522.1	Q95460	HMR1_HUMAN	major histocompatibility complex, class I-related	224	Alpha-3.|Ig-like C1-type.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|innate immune response (GO:0045087)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	MHC class I receptor activity (GO:0032393)|peptide antigen binding (GO:0042605)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(2)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	18					Antithymocyte globulin(DB00098)	TTCTGCAAAGCTCATGGCTTT	0.428																																					Colon(174;1412 1962 45296 46549 47110)	.											0													55.0	55.0	55.0					1																	181021437		2203	4300	6503	SO:0001583	missense	3140			AF010446	CCDS1342.1, CCDS53440.1, CCDS53441.1, CCDS53442.1	1q25.3	2013-01-11	2003-03-05	2003-03-07	ENSG00000153029	ENSG00000153029		"""Immunoglobulin superfamily / C1-set domain containing"""	4975	protein-coding gene	gene with protein product		600764	"""major histocompatibility complex, class I-like sequence"""	HLALS		7624800, 9784382	Standard	NM_001194999		Approved		uc001goq.2	Q95460	OTTHUMG00000035175	ENST00000367580.5:c.671C>A	1.37:g.181021437C>A	ENSP00000356552:p.Ala224Asp	Somatic		WXS	Illumina HiSeq	Phase_I	A8K2V9|B4E3B1|O97985|O97986|Q53GM1|Q95HB8|Q9MY23|Q9NPL2|Q9TQB3|Q9TQB9|Q9TQK3	Missense_Mutation	SNP	ENST00000367580.5	37	CCDS1342.1	.	.	.	.	.	.	.	.	.	.	C	18.93	3.727807	0.69074	.	.	ENSG00000153029	ENST00000367580;ENST00000367579	T;T	0.21734	1.99;1.99	4.52	3.57	0.40892	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	0.116516	0.38326	N	0.001730	T	0.56499	0.1989	H	0.96833	3.89	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.74023	0.982;0.981	T	0.66512	-0.5905	10	0.87932	D	0	.	9.5573	0.39346	0.0:0.8917:0.0:0.1083	.	179;224	Q95460-2;Q95460	.;HMR1_HUMAN	D	224;179	ENSP00000356552:A224D;ENSP00000356551:A179D	ENSP00000356551:A179D	A	+	2	0	MR1	179288060	0.477000	0.25909	0.999000	0.59377	0.874000	0.50279	0.758000	0.26447	1.056000	0.40484	0.655000	0.94253	GCT		0.428	MR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085134.2	NM_001531	
MUC4	4585	mdanderson.org	37	3	195506091	195506091	+	Silent	SNP	A	A	C	rs74941663	byFrequency	TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr3:195506091A>C	ENST00000463781.3	-	2	12819	c.12360T>G	c.(12358-12360)tcT>tcG	p.S4120S	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Silent_p.S4120S	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CTGTGGATGCAGAGGAAGTGT	0.587																																						.											0													12.0	9.0	10.0					3																	195506091		524	1351	1875	SO:0001819	synonymous_variant	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12360T>G	3.37:g.195506091A>C		Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																				0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195507221	195507221	+	Missense_Mutation	SNP	G	G	A	rs200315207		TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr3:195507221G>A	ENST00000463781.3	-	2	11689	c.11230C>T	c.(11230-11232)Cct>Tct	p.P3744S	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.P3744S	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACAGGAAGAGGGGTGACGTGA	0.587																																						.											0													30.0	27.0	28.0					3																	195507221		683	1583	2266	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11230C>T	3.37:g.195507221G>A	ENSP00000417498:p.Pro3744Ser	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	5.907	0.351407	0.11182	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.68181	0.0;-0.31	0.885	-1.47	0.08772	.	0.555598	0.09973	N	0.732028	T	0.43500	0.1250	N	0.19112	0.55	0.09310	N	1	B	0.13145	0.007	B	0.06405	0.002	T	0.23013	-1.0200	9	.	.	.	.	5.3432	0.15994	0.0:0.0:0.6784:0.3215	.	3616	E7ESK3	.	S	3744	ENSP00000417498:P3744S;ENSP00000420243:P3744S	.	P	-	1	0	MUC4	196992000	0.021000	0.18746	0.023000	0.16930	0.046000	0.14306	-0.242000	0.08928	0.413000	0.25759	0.064000	0.15345	CCT		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195509573	195509573	+	Missense_Mutation	SNP	A	A	G	rs28510889	byFrequency	TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr3:195509573A>G	ENST00000463781.3	-	2	9337	c.8878T>C	c.(8878-8880)Tct>Cct	p.S2960P	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.S2960P	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACAGGAAGAGAGGTGGCGTGA	0.587													.|||	1699	0.339257	0.534	0.2522	5008	,	,		9438	0.128		0.4433	False		,,,				2504	0.2485					.											0													8.0	8.0	8.0					3																	195509573		598	1431	2029	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8878T>C	3.37:g.195509573A>G	ENSP00000417498:p.Ser2960Pro	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	5.006	0.186772	0.09547	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.37411	1.2;1.27	.	.	.	.	.	.	.	.	T	0.17195	0.0413	N	0.14661	0.345	0.09310	N	1	B	0.31599	0.33	B	0.31547	0.132	T	0.19778	-1.0295	7	.	.	.	.	3.1064	0.06344	0.6149:0.0:0.0:0.385	.	2832	E7ESK3	.	P	2960	ENSP00000417498:S2960P;ENSP00000420243:S2960P	.	S	-	1	0	MUC4	196994352	0.026000	0.19158	0.007000	0.13788	0.000000	0.00434	-2.277000	0.01160	0.402000	0.25451	0.000000	0.15137	TCT		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195509603	195509603	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr3:195509603T>C	ENST00000463781.3	-	2	9307	c.8848A>G	c.(8848-8850)Act>Gct	p.T2950A	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.T2950A	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GCTGAGGAAGTGTCGGTGACA	0.587																																						.											0													10.0	8.0	9.0					3																	195509603		642	1496	2138	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8848A>G	3.37:g.195509603T>C	ENSP00000417498:p.Thr2950Ala	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	9.324	1.058736	0.19987	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.32515	1.47;1.45	.	.	.	.	.	.	.	.	T	0.16041	0.0386	N	0.19112	0.55	0.09310	N	1	B	0.22346	0.068	B	0.23018	0.043	T	0.30736	-0.9968	7	.	.	.	.	5.3345	0.15949	0.0:1.0E-4:0.0:0.9999	.	2822	E7ESK3	.	A	2950	ENSP00000417498:T2950A;ENSP00000420243:T2950A	.	T	-	1	0	MUC4	196994382	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	-0.312000	0.08113	0.000000	0.14550	0.000000	0.15137	ACT		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195510162	195510162	+	Silent	SNP	T	T	G			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr3:195510162T>G	ENST00000463781.3	-	2	8748	c.8289A>C	c.(8287-8289)acA>acC	p.T2763T	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Silent_p.T2763T	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGGCGTGACCTGTGGATGCTG	0.577																																						.											0													27.0	16.0	19.0					3																	195510162		685	1523	2208	SO:0001819	synonymous_variant	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8289A>C	3.37:g.195510162T>G		Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																				0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
OR1S2	219958	mdanderson.org	37	11	57970981	57970981	+	Missense_Mutation	SNP	C	C	T	rs11229278|rs34249289	byFrequency	TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr11:57970981C>T	ENST00000302592.6	-	1	672	c.673G>A	c.(673-675)Gta>Ata	p.V225I		NM_001004459.1	NP_001004459.1	Q8NGQ3	OR1S2_HUMAN	olfactory receptor, family 1, subfamily S, member 2	225			V -> A (in dbSNP:rs11229277).|V -> I (in dbSNP:rs11229278).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(11)|kidney(1)|large_intestine(4)|lung(23)|ovary(2)|skin(2)|stomach(2)|urinary_tract(1)	46		Breast(21;0.0589)				AAGATGAGTACAAAGGGGAAG	0.458													C|||	426	0.0850639	0.0265	0.1138	5008	,	,		23191	0.0556		0.1083	False		,,,				2504	0.1503					.											0													165.0	137.0	146.0					11																	57970981		2201	4296	6497	SO:0001583	missense	219958			BK004297	CCDS31545.1	11q12.1	2012-08-09			ENSG00000197887	ENSG00000197887		"""GPCR / Class A : Olfactory receptors"""	15141	protein-coding gene	gene with protein product							Standard	NM_001004459		Approved		uc010rkb.2	Q8NGQ3	OTTHUMG00000167541	ENST00000302592.6:c.673G>A	11.37:g.57970981C>T	ENSP00000305469:p.Val225Ile	Somatic		WXS	Illumina HiSeq	Phase_I	Q6IFG5|Q96R85	Missense_Mutation	SNP	ENST00000302592.6	37	CCDS31545.1	109	0.04990842490842491	13	0.026422764227642278	27	0.07458563535911603	19	0.033216783216783216	50	0.06596306068601583	C	0.180	-1.063021	0.01950	.	.	ENSG00000197887	ENST00000302592	T	0.36699	1.24	4.75	2.83	0.33086	GPCR, rhodopsin-like superfamily (1);	0.471664	0.17897	N	0.158338	T	0.01387	0.0045	N	0.05383	-0.06	0.80722	P	0.0	B	0.14805	0.011	B	0.23852	0.049	T	0.12426	-1.0548	9	0.17369	T	0.5	.	12.7854	0.57502	0.2978:0.7022:0.0:0.0	rs11229278;rs52811080;rs11229278	225	Q8NGQ3	OR1S2_HUMAN	I	225	ENSP00000305469:V225I	ENSP00000305469:V225I	V	-	1	0	OR1S2	57727557	0.000000	0.05858	0.426000	0.26672	0.853000	0.48598	-1.185000	0.03073	0.691000	0.31592	0.655000	0.94253	GTA		0.458	OR1S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394703.2	NM_001004459	
OR5H14	403273	mdanderson.org	37	3	97868588	97868588	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr3:97868588A>G	ENST00000437310.1	+	1	419	c.359A>G	c.(358-360)tAt>tGt	p.Y120C	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005514.1	NP_001005514.1	A6NHG9	O5H14_HUMAN	olfactory receptor, family 5, subfamily H, member 14	120						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	31						ACAATGGCATATGATCGCTAT	0.403																																						.											0													118.0	130.0	126.0					3																	97868588		2203	4299	6502	SO:0001583	missense	403273				CCDS33798.1	3q11.2	2013-09-23			ENSG00000236032	ENSG00000236032		"""GPCR / Class A : Olfactory receptors"""	31286	protein-coding gene	gene with protein product							Standard	NM_001005514		Approved		uc003dsg.1	A6NHG9	OTTHUMG00000160079	ENST00000437310.1:c.359A>G	3.37:g.97868588A>G	ENSP00000401706:p.Tyr120Cys	Somatic		WXS	Illumina HiSeq	Phase_I	B9EH15	Missense_Mutation	SNP	ENST00000437310.1	37	CCDS33798.1	.	.	.	.	.	.	.	.	.	.	A	3.665	-0.068796	0.07228	.	.	ENSG00000236032	ENST00000437310	T	0.01347	4.99	2.49	2.49	0.30216	GPCR, rhodopsin-like superfamily (1);	0.000000	0.42420	D	0.000704	T	0.02807	0.0084	M	0.84683	2.71	0.22581	N	0.998966	B	0.33280	0.405	B	0.30782	0.12	T	0.23440	-1.0188	10	0.72032	D	0.01	.	8.4219	0.32705	1.0:0.0:0.0:0.0	.	120	A6NHG9	O5H14_HUMAN	C	120	ENSP00000401706:Y120C	ENSP00000401706:Y120C	Y	+	2	0	OR5H14	99351278	1.000000	0.71417	0.963000	0.40424	0.048000	0.14542	3.811000	0.55620	1.132000	0.42129	0.164000	0.16699	TAT		0.403	OR5H14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359112.1		
PRSS3	5646	mdanderson.org	37	9	33797978	33797978	+	Missense_Mutation	SNP	G	G	A	rs145485932		TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr9:33797978G>A	ENST00000361005.5	+	3	523	c.523G>A	c.(523-525)Gtc>Atc	p.V175I	PRSS3_ENST00000429677.3_Missense_Mutation_p.V111I|PRSS3_ENST00000379405.3_Missense_Mutation_p.V118I|RP11-133O22.6_ENST00000454429.2_RNA|PRSS3_ENST00000342836.4_Missense_Mutation_p.V132I	NM_007343.3	NP_031369	P35030	TRY3_HUMAN	protease, serine, 3	175	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|endothelial cell migration (GO:0043542)|innate immune response (GO:0045087)|proteolysis (GO:0006508)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	13			LUSC - Lung squamous cell carcinoma(29;0.0176)			CTCACCTGCCGTCATCAATGC	0.562																																						.											0													252.0	190.0	211.0					9																	33797978		2203	4300	6503	SO:0001583	missense	5646				CCDS6545.1, CCDS47958.1, CCDS56570.1, CCDS56571.1	9p13	2010-05-07	2008-03-11		ENSG00000010438	ENSG00000010438	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9486	protein-coding gene	gene with protein product	"""mesotrypsin"""	613578	"""protease, serine, 4 (trypsin 4, brain)"", ""protease, serine, 3 (mesotrypsin)"""	PRSS4		2326201, 8294000	Standard	NM_002771		Approved	TRY3, TRY4	uc003ztj.4	P35030	OTTHUMG00000019798	ENST00000361005.5:c.523G>A	9.37:g.33797978G>A	ENSP00000354280:p.Val175Ile	Somatic		WXS	Illumina HiSeq	Phase_I	A8CED1|A8CED3|A9Z1Y4|E7ES07|F8W7P3|P15951|Q15665|Q5VXV0|Q6ISJ4|Q9UQV3	Missense_Mutation	SNP	ENST00000361005.5	37	CCDS47958.1	13	0.005952380952380952	5	0.01016260162601626	4	0.011049723756906077	0	0.0	4	0.005277044854881266	G	9.092	1.002042	0.19121	.	.	ENSG00000010438	ENST00000361005;ENST00000457896;ENST00000342836;ENST00000429677;ENST00000379405	D;D;D;D;D	0.88509	-2.39;-2.39;-2.39;-2.39;-2.39	3.62	-4.24	0.03777	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	2.578480	0.00881	N	0.002127	T	0.75273	0.3827	L	0.28458	0.855	0.09310	N	1	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.04013	0.0;0.001;0.0	T	0.63422	-0.6641	10	0.41790	T	0.15	.	4.242	0.10652	0.4472:0.0:0.3013:0.2515	.	118;175;132	P35030-3;P35030;P35030-4	.;TRY3_HUMAN;.	I	175;130;132;111;118	ENSP00000354280:V175I;ENSP00000401249:V130I;ENSP00000340889:V132I;ENSP00000401828:V111I;ENSP00000368715:V118I	ENSP00000340889:V132I	V	+	1	0	PRSS3	33787978	0.000000	0.05858	0.000000	0.03702	0.050000	0.14768	-2.290000	0.01148	-0.947000	0.03673	-0.643000	0.03959	GTC		0.562	PRSS3-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052121.1	NM_002771	
PRSS3	5646	mdanderson.org	37	9	33797991	33797991	+	Missense_Mutation	SNP	G	G	A	rs146966861	byFrequency	TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr9:33797991G>A	ENST00000361005.5	+	3	536	c.536G>A	c.(535-537)cGc>cAc	p.R179H	PRSS3_ENST00000429677.3_Missense_Mutation_p.R115H|PRSS3_ENST00000379405.3_Missense_Mutation_p.R122H|RP11-133O22.6_ENST00000454429.2_RNA|PRSS3_ENST00000342836.4_Missense_Mutation_p.R136H	NM_007343.3	NP_031369	P35030	TRY3_HUMAN	protease, serine, 3	179	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|endothelial cell migration (GO:0043542)|innate immune response (GO:0045087)|proteolysis (GO:0006508)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.R179H(1)|p.R122H(1)		large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	13			LUSC - Lung squamous cell carcinoma(29;0.0176)			ATCAATGCCCGCGTGTCCACC	0.572																																						.											2	Substitution - Missense(2)	prostate(2)											220.0	166.0	185.0					9																	33797991		2203	4300	6503	SO:0001583	missense	5646				CCDS6545.1, CCDS47958.1, CCDS56570.1, CCDS56571.1	9p13	2010-05-07	2008-03-11		ENSG00000010438	ENSG00000010438	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9486	protein-coding gene	gene with protein product	"""mesotrypsin"""	613578	"""protease, serine, 4 (trypsin 4, brain)"", ""protease, serine, 3 (mesotrypsin)"""	PRSS4		2326201, 8294000	Standard	NM_002771		Approved	TRY3, TRY4	uc003ztj.4	P35030	OTTHUMG00000019798	ENST00000361005.5:c.536G>A	9.37:g.33797991G>A	ENSP00000354280:p.Arg179His	Somatic		WXS	Illumina HiSeq	Phase_I	A8CED1|A8CED3|A9Z1Y4|E7ES07|F8W7P3|P15951|Q15665|Q5VXV0|Q6ISJ4|Q9UQV3	Missense_Mutation	SNP	ENST00000361005.5	37	CCDS47958.1	.	.	.	.	.	.	.	.	.	.	G	7.750	0.703204	0.15172	.	.	ENSG00000010438	ENST00000361005;ENST00000457896;ENST00000342836;ENST00000429677;ENST00000379405	T;T;D;T;D	0.92699	0.32;0.24;-3.09;0.32;-3.09	3.62	-0.17	0.13335	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.319904	0.34507	N	0.003909	T	0.79353	0.4431	N	0.17379	0.485	0.09310	N	1	B;B;B	0.12013	0.001;0.005;0.0	B;B;B	0.06405	0.001;0.002;0.0	T	0.62987	-0.6737	10	0.16420	T	0.52	.	4.4554	0.11640	0.4098:0.1669:0.4233:0.0	.	122;179;136	P35030-3;P35030;P35030-4	.;TRY3_HUMAN;.	H	179;134;136;115;122	ENSP00000354280:R179H;ENSP00000401249:R134H;ENSP00000340889:R136H;ENSP00000401828:R115H;ENSP00000368715:R122H	ENSP00000340889:R136H	R	+	2	0	PRSS3	33787991	0.000000	0.05858	0.003000	0.11579	0.080000	0.17528	0.574000	0.23714	0.009000	0.14813	0.313000	0.20887	CGC		0.572	PRSS3-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052121.1	NM_002771	
RBMX	27316	mdanderson.org	37	X	135960230	135960230	+	Missense_Mutation	SNP	C	C	T	rs199717308		TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chrX:135960230C>T	ENST00000320676.7	-	4	386	c.232G>A	c.(232-234)Gcc>Acc	p.A78T	RBMX_ENST00000431446.3_Intron|RBMX_ENST00000565438.1_5'UTR|RBMX_ENST00000570135.1_Intron|RBMX_ENST00000562646.1_Missense_Mutation_p.A78T|SNORD61_ENST00000384252.1_RNA	NM_002139.3	NP_002130.2	P38159	RBMX_HUMAN	RNA binding motif protein, X-linked	78	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cellular response to interleukin-1 (GO:0071347)|gene expression (GO:0010467)|membrane protein ectodomain proteolysis (GO:0006509)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|osteoblast differentiation (GO:0001649)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homooligomerization (GO:0051260)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|supraspliceosomal complex (GO:0044530)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.A78T(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(2)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|urinary_tract(1)	33	Acute lymphoblastic leukemia(192;0.000127)					ACCTTGATGGCTTTTCCATCT	0.398																																						.											1	Substitution - Missense(1)	prostate(1)											30.0	27.0	28.0					X																	135960230		2203	4300	6503	SO:0001583	missense	27316				CCDS14661.1, CCDS55510.1	Xq26	2013-05-23	2003-09-12		ENSG00000147274	ENSG00000147274		"""RNA binding motif (RRM) containing"""	9910	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein G"""	300199	"""RNA binding motif protein, X chromosome"""			10391206, 10391207	Standard	NM_002139		Approved	RNMX, hnRNP-G, HNRNPG	uc004fae.2	P38159	OTTHUMG00000022517	ENST00000320676.7:c.232G>A	X.37:g.135960230C>T	ENSP00000359645:p.Ala78Thr	Somatic		WXS	Illumina HiSeq	Phase_I	B4E3U4|D3DWH0|E9PG86|Q5JQ67|Q8N8Y7|Q969R3	Missense_Mutation	SNP	ENST00000320676.7	37	CCDS14661.1	.	.	.	.	.	.	.	.	.	.	.	11.06	1.528254	0.27299	.	.	ENSG00000147274	ENST00000320676;ENST00000449161	T	0.15139	2.45	5.15	4.19	0.49359	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.364756	0.24165	U	0.040949	T	0.06781	0.0173	N	0.01168	-0.975	0.80722	D	1	B;B	0.11235	0.001;0.004	B;B	0.14023	0.01;0.01	T	0.28170	-1.0052	10	0.35671	T	0.21	.	13.8269	0.63357	0.1641:0.8359:0.0:0.0	.	78;65	P38159;Q8N8Y7	HNRPG_HUMAN;.	T	78;65	ENSP00000359645:A78T	ENSP00000359645:A78T	A	-	1	0	RBMX	135787896	1.000000	0.71417	1.000000	0.80357	0.810000	0.45777	3.150000	0.50662	2.132000	0.65825	0.504000	0.49776	GCC		0.398	RBMX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058507.1	NM_002139	
RBMXL1	494115	mdanderson.org	37	1	89448623	89448623	+	Missense_Mutation	SNP	A	A	G	rs141468346		TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr1:89448623A>G	ENST00000321792.5	-	2	1314	c.887T>C	c.(886-888)cTt>cCt	p.L296P	CCBL2_ENST00000446900.2_Intron|RBMXL1_ENST00000413769.1_5'Flank|CCBL2_ENST00000370491.3_Intron|CCBL2_ENST00000370485.2_Intron|CCBL2_ENST00000260508.4_Intron|RBMXL1_ENST00000399794.2_Missense_Mutation_p.L296P	NM_019610.5	NP_062556.2	Q96E39	RMXL1_HUMAN	RNA binding motif protein, X-linked-like 1	296	Ser-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)										CCCTCGTGTAAGTGGAGCACT	0.473																																						.											0													179.0	176.0	177.0					1																	89448623		2203	4300	6503	SO:0001583	missense	494115			BC012942	CCDS716.1	1p22.2	2013-02-12	2007-01-04	2007-01-04	ENSG00000213516	ENSG00000213516		"""RNA binding motif (RRM) containing"""	25073	protein-coding gene	gene with protein product	"""kynurenine aminotransferase III"""					10441733	Standard	NM_019610		Approved	KAT3	uc001dms.3	Q96E39	OTTHUMG00000010661	ENST00000321792.5:c.887T>C	1.37:g.89448623A>G	ENSP00000318415:p.Leu296Pro	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000321792.5	37	CCDS716.1	.	.	.	.	.	.	.	.	.	.	A	0.070	-1.203792	0.01581	.	.	ENSG00000213516	ENST00000321792;ENST00000399794	T;T	0.71461	-0.57;-0.57	1.89	0.914	0.19360	.	0.000000	0.85682	N	0.000000	T	0.07279	0.0184	N	0.00075	-2.25	0.41802	D	0.989928	B	0.02656	0.0	B	0.01281	0.0	T	0.44817	-0.9303	10	0.02654	T	1	-8.7659	6.5352	0.22350	0.1727:0.0:0.8273:0.0	.	296	Q96E39	RBMXL_HUMAN	P	296	ENSP00000318415:L296P;ENSP00000446099:L296P	ENSP00000318415:L296P	L	-	2	0	RBMXL1	89221211	1.000000	0.71417	0.995000	0.50966	0.881000	0.50899	4.582000	0.60957	0.129000	0.18514	-0.814000	0.03130	CTT		0.473	RBMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029403.3	NM_019610	
SLTM	79811	mdanderson.org	37	15	59191919	59191919	+	Silent	SNP	C	C	A			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr15:59191919C>A	ENST00000380516.2	-	7	894	c.807G>T	c.(805-807)gtG>gtT	p.V269V	SLTM_ENST00000536328.1_Intron|SLTM_ENST00000557950.1_5'Flank	NM_001013843.1|NM_024755.2	NP_001013865.1|NP_079031.2	Q9NWH9	SLTM_HUMAN	SAFB-like, transcription modulator	269					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						CTGTAATTTTCACATTTTTAC	0.453																																						.											0													157.0	147.0	150.0					15																	59191919		2192	4292	6484	SO:0001819	synonymous_variant	79811			BC046119	CCDS10168.2	15q21.3	2013-02-12			ENSG00000137776	ENSG00000137776		"""RNA binding motif (RRM) containing"""	20709	protein-coding gene	gene with protein product							Standard	XR_243128		Approved	Met, FLJ13213	uc002afp.3	Q9NWH9	OTTHUMG00000074033	ENST00000380516.2:c.807G>T	15.37:g.59191919C>A		Somatic		WXS	Illumina HiSeq	Phase_I	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Silent	SNP	ENST00000380516.2	37	CCDS10168.2																																																																																				0.453	SLTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157124.1	NM_024755	
TUBA3D	113457	mdanderson.org	37	2	132236921	132236921	+	Silent	SNP	G	G	A	rs4065352	byFrequency	TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr2:132236921G>A	ENST00000321253.6	+	3	374	c.267G>A	c.(265-267)ccG>ccA	p.P89P	TUBA3D_ENST00000409047.2_3'UTR	NM_080386.3	NP_525125.2	Q13748	TBA3C_HUMAN	tubulin, alpha 3d	89					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	32				BRCA - Breast invasive adenocarcinoma(221;0.13)		TCTTCCACCCGGAGCAGCTGA	0.532																																					Ovarian(137;2059 2432 35543 39401)	.											0													137.0	125.0	129.0					2																	132236921		2203	4300	6503	SO:0001819	synonymous_variant	113457			K03460	CCDS33290.1	2q21.1	2007-03-16			ENSG00000075886	ENSG00000075886		"""Tubulins"""	24071	protein-coding gene	gene with protein product	"""alpha-tubulin isotype H2-alpha"""					3785200	Standard	NM_080386		Approved	H2-ALPHA	uc002tsu.4	Q13748	OTTHUMG00000153600	ENST00000321253.6:c.267G>A	2.37:g.132236921G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A6NJQ0|Q5W099|Q6PEY3|Q96F18	Silent	SNP	ENST00000321253.6	37	CCDS33290.1																																																																																				0.532	TUBA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331800.2	NM_080386	
ZNF354A	6940	mdanderson.org	37	5	178139379	178139380	+	Missense_Mutation	DNP	CC	CC	GT	rs199632980|rs201342253	byFrequency	TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	CC	CC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr5:178139379_178139380CC>GT	ENST00000335815.2	-	5	1696_1697	c.1499_1500GG>AC	c.(1498-1500)gGG>gAC	p.G500D		NM_005649.2	NP_005640.2	O60765	Z354A_HUMAN	zinc finger protein 354A	500					regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|large_intestine(7)|lung(3)|ovary(2)|skin(2)|stomach(2)	19	all_cancers(89;0.000536)|Renal(175;0.000159)|all_epithelial(37;0.000221)|Lung NSC(126;0.00308)|all_lung(126;0.00536)	all_cancers(40;0.0452)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.185)		TGAATGTTTTCCCACACTCGTT	0.391																																						.											0																																										SO:0001583	missense	6940			AF116030	CCDS4438.1	5q35.3	2013-01-08		2001-11-23	ENSG00000169131	ENSG00000169131		"""Zinc fingers, C2H2-type"", ""-"""	11628	protein-coding gene	gene with protein product		602444		TCF17		9465904	Standard	NM_005649		Approved	KID-1, EZNF, HKL1, KID1	uc003mjj.3	O60765	OTTHUMG00000130895	ENST00000335815.2:c.1499_1500delinsGT	5.37:g.178139379_178139380delinsGT	ENSP00000337122:p.Gly500Asp	Somatic		WXS	Illumina HiSeq	Phase_I	Q9UNJ8	Missense_Mutation	DNP	ENST00000335815.2	37	CCDS4438.1																																																																																				0.391	ZNF354A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253481.1	NM_005649	
ZNF354A	6940	mdanderson.org	37	5	178139385	178139385	+	Silent	SNP	C	C	T	rs199620032	byFrequency	TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr5:178139385C>T	ENST00000335815.2	-	5	1691	c.1494G>A	c.(1492-1494)gaG>gaA	p.E498E		NM_005649.2	NP_005640.2	O60765	Z354A_HUMAN	zinc finger protein 354A	498					regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|large_intestine(7)|lung(3)|ovary(2)|skin(2)|stomach(2)	19	all_cancers(89;0.000536)|Renal(175;0.000159)|all_epithelial(37;0.000221)|Lung NSC(126;0.00308)|all_lung(126;0.00536)	all_cancers(40;0.0452)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.185)		TTTTCCCACACTCGTTACATT	0.388																																						.											0													122.0	119.0	120.0					5																	178139385		2203	4300	6503	SO:0001819	synonymous_variant	6940			AF116030	CCDS4438.1	5q35.3	2013-01-08		2001-11-23	ENSG00000169131	ENSG00000169131		"""Zinc fingers, C2H2-type"", ""-"""	11628	protein-coding gene	gene with protein product		602444		TCF17		9465904	Standard	NM_005649		Approved	KID-1, EZNF, HKL1, KID1	uc003mjj.3	O60765	OTTHUMG00000130895	ENST00000335815.2:c.1494G>A	5.37:g.178139385C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q9UNJ8	Silent	SNP	ENST00000335815.2	37	CCDS4438.1																																																																																				0.388	ZNF354A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253481.1	NM_005649	
PITRM1	10531	bcgsc.ca	37	10	3186494	3186494	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr10:3186494T>C	ENST00000224949.4	-	22	2556	c.2522A>G	c.(2521-2523)aAg>aGg	p.K841R	PITRM1_ENST00000451104.2_Missense_Mutation_p.K743R|PITRM1-AS1_ENST00000441377.1_RNA|PITRM1-AS1_ENST00000598280.1_RNA|PITRM1-AS1_ENST00000601046.1_RNA|PITRM1_ENST00000464395.1_5'UTR|PITRM1_ENST00000380994.1_Missense_Mutation_p.K399R|PITRM1_ENST00000380989.2_Missense_Mutation_p.K842R			Q5JRX3	PREP_HUMAN	pitrilysin metallopeptidase 1	841					positive regulation of catalytic activity (GO:0043085)|proteolysis (GO:0006508)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	enzyme activator activity (GO:0008047)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|urinary_tract(3)	33						CATGACCAGCTTCCTAATGAC	0.542																																						.											0													28.0	34.0	32.0					10																	3186494		1976	4136	6112	SO:0001583	missense	10531			AB029027	CCDS55699.1, CCDS55700.1, CCDS59208.1	10p15.2	2008-07-30	2005-08-17		ENSG00000107959	ENSG00000107959			17663	protein-coding gene	gene with protein product	"""PreP peptidasome"""		"""pitrilysin metalloproteinase 1"""			1036083, 10470851, 16849325	Standard	NM_014889		Approved	MP1, KIAA1104, hMP1, PreP	uc009xhv.2	Q5JRX3	OTTHUMG00000017557	ENST00000224949.4:c.2522A>G	10.37:g.3186494T>C	ENSP00000224949:p.Lys841Arg	Somatic		WXS	Illumina HiSeq	Phase_I	B3KMJ6|B4E0J8|C9JSL2|E7ES23|O95204|Q2M2G6|Q4VBR1|Q5JRW7|Q7L5Z7|Q9BSI6|Q9BVJ5|Q9UPP8	Missense_Mutation	SNP	ENST00000224949.4	37	CCDS59208.1	.	.	.	.	.	.	.	.	.	.	t	9.334	1.061380	0.19987	.	.	ENSG00000107959	ENST00000224949;ENST00000380980;ENST00000380989;ENST00000380994;ENST00000451104;ENST00000455371;ENST00000424714	T;T;T;T;T;T	0.56275	3.12;3.12;3.12;3.12;1.72;0.47	4.63	3.49	0.39957	Peptidase M16, C-terminal (1);	0.095516	0.64402	D	0.000001	T	0.42539	0.1207	L	0.42245	1.32	0.36616	D	0.8755	B;B;B;B;B	0.26120	0.002;0.007;0.142;0.142;0.019	B;B;B;B;B	0.31686	0.007;0.021;0.134;0.134;0.038	T	0.40869	-0.9540	10	0.31617	T	0.26	-29.364	7.2853	0.26335	0.0:0.1041:0.0:0.8959	.	834;743;842;841;834	E9PDX6;E7ES23;C9JSL2;Q5JRX3;B4DH07	.;.;.;PREP_HUMAN;.	R	841;834;842;399;743;22;60	ENSP00000224949:K841R;ENSP00000370377:K842R;ENSP00000370382:K399R;ENSP00000401201:K743R;ENSP00000399307:K22R;ENSP00000402072:K60R	ENSP00000224949:K841R	K	-	2	0	PITRM1	3176494	1.000000	0.71417	0.962000	0.40283	0.031000	0.12232	1.381000	0.34362	0.880000	0.35969	0.379000	0.24179	AAG		0.542	PITRM1-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000046469.2		
WNT1	7471	bcgsc.ca	37	12	49373358	49373366	+	In_Frame_Del	DEL	CTGATACGC	CTGATACGC	-			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	CTGATACGC	CTGATACGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr12:49373358_49373366delCTGATACGC	ENST00000293549.3	+	2	248_256	c.212_220delCTGATACGC	c.(211-222)cctgatacgcaa>caa	p.PDT71del		NM_005430.3	NP_005421.1	P04628	WNT1_HUMAN	wingless-type MMTV integration site family, member 1	71					bone development (GO:0060348)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to peptide hormone stimulus (GO:0071375)|central nervous system morphogenesis (GO:0021551)|cerebellum formation (GO:0021588)|diencephalon development (GO:0021536)|embryonic axis specification (GO:0000578)|forebrain anterior/posterior pattern specification (GO:0021797)|hematopoietic stem cell proliferation (GO:0071425)|hepatocyte differentiation (GO:0070365)|inner ear morphogenesis (GO:0042472)|midbrain development (GO:0030901)|midbrain-hindbrain boundary maturation during brain development (GO:0022004)|myoblast fusion (GO:0007520)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell aging (GO:0090344)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron differentiation (GO:0030182)|neuron fate determination (GO:0048664)|organ regeneration (GO:0031100)|positive regulation of cell proliferation (GO:0008284)|positive regulation of dermatome development (GO:0061184)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to wounding (GO:0009611)|signal transduction in response to DNA damage (GO:0042770)|Spemann organizer formation (GO:0060061)|spinal cord association neuron differentiation (GO:0021527)|T cell differentiation in thymus (GO:0033077)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|transcription regulatory region DNA binding (GO:0044212)			endometrium(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)	11				BRCA - Breast invasive adenocarcinoma(357;0.244)		CAGCGGCGTCTGATACGCCAAAATCCGGG	0.608																																						.											0																																										SO:0001651	inframe_deletion	7471			X03072	CCDS8776.1	12q13	2013-02-28				ENSG00000125084		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12774	protein-coding gene	gene with protein product		164820		INT1		2998762, 3281802	Standard	NM_005430		Approved		uc001rsu.3	P04628	OTTHUMG00000170403	ENST00000293549.3:c.212_220delCTGATACGC	12.37:g.49373358_49373366delCTGATACGC	ENSP00000293549:p.Pro71_Thr73del	Somatic		WXS	Illumina HiSeq	Phase_I	Q5U0N2	In_Frame_Del	DEL	ENST00000293549.3	37	CCDS8776.1																																																																																				0.608	WNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408937.1		
ERBB2	2064	bcgsc.ca	37	17	37881117	37881117	+	Missense_Mutation	SNP	C	C	T	rs542027040		TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr17:37881117C>T	ENST00000269571.5	+	20	2605	c.2446C>T	c.(2446-2448)Cgc>Tgc	p.R816C	ERBB2_ENST00000540147.1_Missense_Mutation_p.R786C|ERBB2_ENST00000541774.1_Missense_Mutation_p.R801C|ERBB2_ENST00000445658.2_Missense_Mutation_p.R540C|ERBB2_ENST00000584450.1_Missense_Mutation_p.R816C|ERBB2_ENST00000406381.2_Missense_Mutation_p.R786C|ERBB2_ENST00000584601.1_Missense_Mutation_p.R786C|MIR4728_ENST00000580969.1_RNA			P04626	ERBB2_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2	816	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|enzyme linked receptor protein signaling pathway (GO:0007167)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of angiogenesis (GO:0045765)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of microtubule-based process (GO:0032886)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|ErbB-3 class receptor binding (GO:0043125)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|RNA polymerase I core binding (GO:0001042)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(16)|central_nervous_system(17)|endometrium(6)|haematopoietic_and_lymphoid_tissue(8)|kidney(4)|large_intestine(16)|liver(3)|lung(125)|ovary(18)|pancreas(1)|prostate(4)|skin(1)|stomach(14)|upper_aerodigestive_tract(9)|urinary_tract(4)	247	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Lapatinib(DB01259)|Pertuzumab(DB06366)|Trastuzumab(DB00072)	AAACCGCGGACGCCTGGGCTC	0.592		1	"""A, Mis, O"""		"""breast, ovarian, other tumour types, NSCLC, gastric"""					TCGA GBM(5;<1E-08)			C|||	1	0.000199681	0.0	0.0	5008	,	,		18540	0.0		0.0	False		,,,				2504	0.001					.		Dom	yes		17	17q21.1	2064	"""v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)"""		E	0													55.0	54.0	54.0					17																	37881117		2203	4300	6503	SO:0001583	missense	2064			X03363	CCDS32642.1, CCDS45667.1, CCDS74052.1	17q11.2-q12	2014-09-17	2013-07-09			ENSG00000141736		"""CD molecules"""	3430	protein-coding gene	gene with protein product	"""neuro/glioblastoma derived oncogene homolog"""	164870	"""v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2 (neuro/glioblastoma derived oncogene homolog)"""	NGL			Standard	XM_005257140		Approved	NEU, HER-2, CD340, HER2	uc002hso.3	P04626		ENST00000269571.5:c.2446C>T	17.37:g.37881117C>T	ENSP00000269571:p.Arg816Cys	Somatic		WXS	Illumina HiSeq	Phase_I	B2RZG3|B4DHN3|Q14256|Q6LDV1|Q9UMK4|X5D2V5	Missense_Mutation	SNP	ENST00000269571.5	37	CCDS32642.1	.	.	.	.	.	.	.	.	.	.	C	13.25	2.181207	0.38511	.	.	ENSG00000141736	ENST00000406381;ENST00000541774;ENST00000445658;ENST00000269571;ENST00000540147	D;D;D;D;D	0.83250	-1.7;-1.7;-1.7;-1.7;-1.7	5.15	4.14	0.48551	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	D	0.89033	0.6600	M	0.62088	1.915	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.76071	0.974;0.987;0.974	D	0.89754	0.3942	9	0.62326	D	0.03	.	14.6498	0.68789	0.1461:0.8539:0.0:0.0	.	540;801;816	B4DTR1;P04626-4;P04626	.;.;ERBB2_HUMAN	C	786;801;540;816;786	ENSP00000385185:R786C;ENSP00000446466:R801C;ENSP00000404047:R540C;ENSP00000269571:R816C;ENSP00000443562:R786C	ENSP00000269571:R816C	R	+	1	0	ERBB2	35134643	0.730000	0.28100	0.949000	0.38748	0.972000	0.66771	0.936000	0.28938	2.397000	0.81536	0.563000	0.77884	CGC		0.592	ERBB2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445621.2		
ITM2C	81618	bcgsc.ca	37	2	231741668	231741668	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr2:231741668C>T	ENST00000326427.6	+	4	673	c.547C>T	c.(547-549)Ctc>Ttc	p.L183F	ITM2C_ENST00000335005.6_Missense_Mutation_p.L136F|ITM2C_ENST00000409704.2_Missense_Mutation_p.L121F|ITM2C_ENST00000326407.6_Intron|ITM2C_ENST00000492029.1_3'UTR	NM_030926.4	NP_112188.1	Q9NQX7	ITM2C_HUMAN	integral membrane protein 2C	183	BRICHOS. {ECO:0000255|PROSITE- ProRule:PRU00255}.				negative regulation of neuron projection development (GO:0010977)|neuron differentiation (GO:0030182)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|beta-amyloid binding (GO:0001540)			cervix(2)|lung(1)|ovary(1)|skin(1)	5		Renal(207;0.0112)|all_lung(227;0.0741)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)|Lung NSC(271;0.204)		Epithelial(121;8.47e-12)|all cancers(144;3.44e-09)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0142)		CTGGGAGCTCCTCATGAACGT	0.577																																						.											0													107.0	105.0	106.0					2																	231741668		2203	4300	6503	SO:0001583	missense	81618			AF038953	CCDS2479.1, CCDS33395.1, CCDS33396.1, CCDS74665.1	2q37	2012-10-10			ENSG00000135916	ENSG00000135916		"""BRICHOS domain containing"""	6175	protein-coding gene	gene with protein product	"""BRICHOS domain containing 2C"""	609554				9653160	Standard	NM_030926		Approved	BRI3, E25, hRPC.1050_D_4, ITM3, BRICD2C	uc002vqz.3	Q9NQX7	OTTHUMG00000133219	ENST00000326427.6:c.547C>T	2.37:g.231741668C>T	ENSP00000322730:p.Leu183Phe	Somatic		WXS	Illumina HiSeq	Phase_I	B3KPG4|Q4G0A8|Q53H84|Q6IAE7|Q86VK5|Q8N288|Q8TAW0|Q9BUP8	Missense_Mutation	SNP	ENST00000326427.6	37	CCDS2479.1	.	.	.	.	.	.	.	.	.	.	C	19.50	3.838631	0.71373	.	.	ENSG00000135916	ENST00000541852;ENST00000326427;ENST00000335005;ENST00000543957;ENST00000409704;ENST00000418408	T;T;T;T;T;T	0.79454	-1.27;-1.27;-1.27;-1.27;-1.27;-1.27	5.8	5.8	0.92144	BRICHOS (2);	0.000000	0.85682	D	0.000000	D	0.84642	0.5517	L	0.49513	1.565	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.994;0.999	T	0.83072	-0.0142	9	.	.	.	-27.6121	15.5632	0.76266	0.0:1.0:0.0:0.0	.	136;183	Q9NQX7-2;Q9NQX7	.;ITM2C_HUMAN	F	121;183;136;121;121;121	ENSP00000440295:L121F;ENSP00000322730:L183F;ENSP00000335121:L136F;ENSP00000444899:L121F;ENSP00000387242:L121F;ENSP00000403257:L121F	.	L	+	1	0	ITM2C	231449912	0.998000	0.40836	1.000000	0.80357	0.993000	0.82548	2.967000	0.49216	2.735000	0.93741	0.655000	0.94253	CTC		0.577	ITM2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256954.2	NM_030926	
UGT1A1	54658	bcgsc.ca	37	2	234669525	234669542	+	In_Frame_Del	DEL	CTCCTCTCATTCAGATCA	CTCCTCTCATTCAGATCA	-	rs199675631|rs550460320		TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	CTCCTCTCATTCAGATCA	CTCCTCTCATTCAGATCA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr2:234669525_234669542delCTCCTCTCATTCAGATCA	ENST00000608383.1	+	1	592_609	c.592_609delCTCCTCTCATTCAGATCA	c.(592-609)ctcctctcattcagatcadel	p.LLSFRS198del	UGT1A3_ENST00000482026.1_Intron|UGT1A6_ENST00000406651.1_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A5_ENST00000373414.3_Intron|UGT1A1_ENST00000609637.1_Intron|UGT1A1_ENST00000608381.1_Intron|UGT1A9_ENST00000354728.4_Intron|UGT1A1_ENST00000609767.1_Intron|UGT1A4_ENST00000373409.3_Intron|UGT1A7_ENST00000373426.3_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A6_ENST00000305139.6_Intron|UGT1A1_ENST00000373450.4_Intron|UGT1A1_ENST00000360418.3_In_Frame_Del_p.LLSFRS198del|UGT1A6_ENST00000373424.1_Intron|UGT1A8_ENST00000305208.5_In_Frame_Del_p.LLSFRS198del			P22309	UD11_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A1	198					acute-phase response (GO:0006953)|bilirubin conjugation (GO:0006789)|biphenyl catabolic process (GO:0070980)|cellular glucuronidation (GO:0052695)|cellular response to ethanol (GO:0071361)|cellular response to glucocorticoid stimulus (GO:0071385)|digestion (GO:0007586)|drug metabolic process (GO:0017144)|estrogen metabolic process (GO:0008210)|flavone metabolic process (GO:0051552)|flavonoid glucuronidation (GO:0052696)|heme catabolic process (GO:0042167)|heterocycle metabolic process (GO:0046483)|liver development (GO:0001889)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cellular glucuronidation (GO:2001030)|negative regulation of steroid metabolic process (GO:0045939)|organ regeneration (GO:0031100)|porphyrin-containing compound metabolic process (GO:0006778)|response to drug (GO:0042493)|response to lipopolysaccharide (GO:0032496)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|retinoic acid metabolic process (GO:0042573)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic glucuronidation (GO:0052697)|xenobiotic metabolic process (GO:0006805)	cytochrome complex (GO:0070069)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)|steroid binding (GO:0005496)			breast(1)|central_nervous_system(2)|endometrium(7)|large_intestine(5)|lung(9)|skin(4)|urinary_tract(2)	30		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0461)|Lung SC(224;0.128)		Epithelial(121;4.1e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000435)|Lung(119;0.00211)|LUSC - Lung squamous cell carcinoma(224;0.0054)	Abacavir(DB01048)|Acetaminophen(DB00316)|Adenine(DB00173)|Atorvastatin(DB01076)|Axitinib(DB06626)|Diclofenac(DB00586)|Dolutegravir(DB08930)|Eltrombopag(DB06210)|Erlotinib(DB00530)|Estradiol(DB00783)|Etoposide(DB00773)|Ezetimibe(DB00973)|Ezogabine(DB04953)|Flunitrazepam(DB01544)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Ibuprofen(DB01050)|Indacaterol(DB05039)|Indomethacin(DB00328)|Irinotecan(DB00762)|Losartan(DB00678)|Lovastatin(DB00227)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Naltrexone(DB00704)|Naproxen(DB00788)|Nilotinib(DB04868)|Pazopanib(DB06589)|Propofol(DB00818)|Raltegravir(DB06817)|Regorafenib(DB08896)|Rifampicin(DB01045)|Simvastatin(DB00641)|Sorafenib(DB00398)|Suprofen(DB00870)|Testosterone Propionate(DB01420)	CAGGCCTCTCTCCTCTCATTCAGATCACATGACCTTCC	0.523																																						.											0																																										SO:0001651	inframe_deletion	54658			M57899	CCDS2510.1	2q37.1	2014-09-17	2005-07-20		ENSG00000242366	ENSG00000242366	2.4.1.17	"""UDP glucuronosyltransferases"""	12530	other	complex locus constituent		191740	"""UDP glycosyltransferase 1 family, polypeptide A1"""	UGT1, GNT1		9295054, 9535849	Standard	NM_000463		Approved	UGT1A		P22309	OTTHUMG00000059117	ENST00000608383.1:c.592_609delCTCCTCTCATTCAGATCA	2.37:g.234669525_234669542delCTCCTCTCATTCAGATCA	ENSP00000476741:p.Leu198_Ser203del	Somatic		WXS	Illumina HiSeq	Phase_I	A6NJC3|B8K286	In_Frame_Del	DEL	ENST00000608383.1	37	CCDS2510.1																																																																																				0.523	UGT1A1-203	KNOWN	basic|CCDS	protein_coding	protein_coding			
MTCH1	23787	bcgsc.ca	37	6	36938224	36938224	+	Frame_Shift_Del	DEL	G	G	-			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr6:36938224delG	ENST00000373627.5	-	10	1104	c.980delC	c.(979-981)cccfs	p.P327fs	MTCH1_ENST00000538808.1_Frame_Shift_Del_p.P154fs|MTCH1_ENST00000471737.1_5'UTR|MTCH1_ENST00000373616.5_Frame_Shift_Del_p.P310fs	NM_001271641.1	NP_001258570.1	Q9NZJ7	MTCH1_HUMAN	mitochondrial carrier 1	327					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|neuronal ion channel clustering (GO:0045161)|positive regulation of apoptotic process (GO:0043065)|regulation of signal transduction (GO:0009966)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)				endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)	6						TAGCAGGAAGGGGTAGGTCAG	0.617																																						.											0													87.0	78.0	81.0					6																	36938224		2203	4300	6503	SO:0001589	frameshift_variant	23787			AF151822	CCDS4828.1, CCDS64411.1	6p21.2	2013-05-22	2011-05-19		ENSG00000137409	ENSG00000137409		"""Solute carriers"""	17586	protein-coding gene	gene with protein product	"""solute carrier family 25, member 49"""	610449	"""mitochondrial carrier homolog 1 (C. elegans)"""			12377771	Standard	NM_014341		Approved	CGI-64, PSAP, SLC25A49	uc003ond.2	Q9NZJ7	OTTHUMG00000014614	ENST00000373627.5:c.980delC	6.37:g.36938224delG	ENSP00000362730:p.Pro327fs	Somatic		WXS	Illumina HiSeq	Phase_I	A8KAX5|B2RCE3|Q6PK60|Q6UX45|Q7L465|Q9BW23|Q9NZR6|Q9UJZ5	Frame_Shift_Del	DEL	ENST00000373627.5	37																																																																																					0.617	MTCH1-008	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000040396.1	NM_014341	
RNF8	9025	bcgsc.ca	37	6	37336717	37336717	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chr6:37336717A>G	ENST00000373479.4	+	3	891	c.698A>G	c.(697-699)gAg>gGg	p.E233G	RNF8_ENST00000469731.1_Missense_Mutation_p.E233G|RNF8_ENST00000479516.1_3'UTR	NM_003958.3|NM_183078.2	NP_003949.1|NP_898901.1	O76064	RNF8_HUMAN	ring finger protein 8, E3 ubiquitin protein ligase	233					cellular response to DNA damage stimulus (GO:0006974)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|histone exchange (GO:0043486)|histone H2A K63-linked ubiquitination (GO:0070535)|histone H2A ubiquitination (GO:0033522)|histone H2B ubiquitination (GO:0033523)|interstrand cross-link repair (GO:0036297)|isotype switching (GO:0045190)|mitotic nuclear division (GO:0007067)|negative regulation of translational elongation (GO:0045900)|positive regulation of DNA repair (GO:0045739)|protein autoubiquitination (GO:0051865)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked ubiquitination (GO:0070534)|response to ionizing radiation (GO:0010212)|spermatid development (GO:0007286)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromosome, telomeric region (GO:0000781)|nucleolus (GO:0005730)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)|ubiquitin ligase complex (GO:0000151)	acid-amino acid ligase activity (GO:0016881)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|urinary_tract(1)	13						GTTCATCATGAGCAGAAAGCC	0.463																																						.											0													93.0	98.0	97.0					6																	37336717		2203	4300	6503	SO:0001583	missense	9025			AB012770	CCDS4833.1, CCDS4834.1	6p21.3	2013-01-09	2012-02-23		ENSG00000112130	ENSG00000112130		"""RING-type (C3HC4) zinc fingers"""	10071	protein-coding gene	gene with protein product		611685	"""ring finger protein (C3HC4 type) 8"", ""ring finger protein 8"""			9734811, 9852682	Standard	NM_003958		Approved	KIAA0646	uc003onq.4	O76064	OTTHUMG00000014620	ENST00000373479.4:c.698A>G	6.37:g.37336717A>G	ENSP00000362578:p.Glu233Gly	Somatic		WXS	Illumina HiSeq	Phase_I	A6NN24|A8MYC0|B4DPG0|Q53H16|Q5NKW5	Missense_Mutation	SNP	ENST00000373479.4	37	CCDS4834.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	11.90|11.90	1.777999|1.777999	0.31502|0.31502	.|.	.|.	ENSG00000112130|ENSG00000112130	ENST00000373479;ENST00000487950;ENST00000469731|ENST00000498460	D;T;T|.	0.82893|.	-1.66;0.84;0.86|.	6.07|6.07	6.07|6.07	0.98685|0.98685	.|.	1.171240|.	0.06183|.	N|.	0.679756|.	T|.	0.35098|.	0.0920|.	N|N	0.14661|0.14661	0.345|0.345	0.49915|0.49915	D|D	0.999837|0.999837	B;B|.	0.23937|.	0.094;0.039|.	B;B|.	0.16722|.	0.016;0.016|.	T|.	0.34875|.	-0.9811|.	10|.	0.54805|.	T|.	0.06|.	-0.8433|-0.8433	15.8218|15.8218	0.78654|0.78654	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	176;233|.	C9J858;O76064|.	.;RNF8_HUMAN|.	G|W	233;176;233|22	ENSP00000362578:E233G;ENSP00000417736:E176G;ENSP00000418879:E233G|.	ENSP00000362578:E233G|.	E|X	+|+	2|3	0|0	RNF8|RNF8	37444695|37444695	1.000000|1.000000	0.71417|0.71417	0.949000|0.949000	0.38748|0.38748	0.413000|0.413000	0.31143|0.31143	2.544000|2.544000	0.45761|0.45761	2.326000|2.326000	0.78906|0.78906	0.533000|0.533000	0.62120|0.62120	GAG|TGA		0.463	RNF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040403.2		
MT-CO1	4512	bcgsc.ca	37	M	6490	6490	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chrM:6490T>C	ENST00000361624.2	+	1	587	c.587T>C	c.(586-588)cTc>cCc	p.L196P	MT-CO2_ENST00000361739.1_5'Flank|MT-TI_ENST00000387365.1_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-TN_ENST00000387400.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-TY_ENST00000387409.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TQ_ENST00000387372.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	196			L -> I (in MT-C4D). {ECO:0000269|PubMed:12140182}.		aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						AGTCCTACTTCTCCTATCTCT	0.498																																						.											0																																										SO:0001583	missense	5742					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.587T>C	M.37:g.6490T>C	ENSP00000354499:p.Leu196Pro	Somatic		WXS	Illumina HiSeq	Phase_I	Q34770	Missense_Mutation	SNP	ENST00000361624.2	37																																																																																					0.498	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024028	
FAM47A	158724	bcgsc.ca	37	X	34148877	34148877	+	Missense_Mutation	SNP	C	C	G	rs5973088		TCGA-KN-8432-01A-11D-2310-10	TCGA-KN-8432-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85ed2434-da94-4333-90ca-6ca4691cbdd3	7d556f90-8997-4e2f-9f30-23814aa3c222	g.chrX:34148877C>G	ENST00000346193.3	-	1	1570	c.1519G>C	c.(1519-1521)Gag>Cag	p.E507Q		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	507			Missing. {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.					p.E507Q(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						TTGGGAGGCTCCGAGCGGAGA	0.647																																						.											1	Substitution - Missense(1)	kidney(1)											29.0	29.0	29.0					X																	34148877		2181	4247	6428	SO:0001583	missense	158724			BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.1519G>C	X.37:g.34148877C>G	ENSP00000345029:p.Glu507Gln	Somatic		WXS	Illumina HiSeq	Phase_I	A8K8I9|Q8TAA0	Missense_Mutation	SNP	ENST00000346193.3	37	CCDS43926.1	6	0.003616636528028933	2	0.0040650406504065045	3	0.008287292817679558	0	0.0	2	0.002638522427440633	c	9.299	1.052687	0.19907	.	.	ENSG00000185448	ENST00000346193	T	0.14391	2.51	0.226	0.226	0.15353	.	.	.	.	.	T	0.05227	0.0139	L	0.27053	0.805	0.09310	N	1	B	0.24483	0.104	B	0.16722	0.016	T	0.41466	-0.9507	8	0.17832	T	0.49	.	.	.	.	rs5973088	507	Q5JRC9	FA47A_HUMAN	Q	507	ENSP00000345029:E507Q	ENSP00000345029:E507Q	E	-	1	0	FAM47A	34058798	0.053000	0.20554	0.000000	0.03702	0.001000	0.01503	1.713000	0.37951	0.283000	0.22279	0.287000	0.19450	GAG		0.647	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408	
