#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PERM1	84808	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	915233	915233	+	Missense_Mutation	SNP	G	G	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr1:915233G>T	ENST00000341290.2	-	3	870	c.835C>A	c.(835-837)Cca>Aca	p.P279T	C1orf170_ENST00000433179.2_Missense_Mutation_p.P299T			Q5SV97	PERM1_HUMAN		393					regulation of transcription, DNA-templated (GO:0006355)|response to muscle activity (GO:0014850)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)											TCCAATTGTGGCTTGGAGATG	0.577																																					.													.	C1orf170-68	0			.						.																																			SO:0001583	missense	84808	.			ATTGTGGCTTGGA																												ENST00000341290.2:c.835C>A	1.37:g.915233G>T	ENSP00000343864:p.Pro279Thr	Somatic	93	0		WXS	Illumina HiSeq	Phase_I	126	13	.	0	0	0	0	0	Q6ZVZ7|Q9BRF2|S5G239	RNA	SNP	ENST00000341290.2	37		.	.	.	.	.	.	.	.	.	.	.	8.462	0.855594	0.17106	.	.	ENSG00000187642	ENST00000433179;ENST00000341290	T;T	0.63096	-0.02;-0.02	3.57	-7.14	0.01527	.	0.218953	0.16851	U	0.196946	T	0.34019	0.0883	.	.	.	0.09310	N	1	B	0.17268	0.021	B	0.14023	0.01	T	0.09228	-1.0684	9	0.30854	T	0.27	0.3413	1.9428	0.03350	0.4035:0.2164:0.2715:0.1087	.	299	Q5SV97	CA170_HUMAN	T	299;279	ENSP00000414022:P299T;ENSP00000343864:P279T	ENSP00000343864:P279T	P	-	1	0	C1orf170	905096	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.883000	0.04170	-1.693000	0.01427	-0.436000	0.05848	CCA	.		0.577	C1orf170-001	PUTATIVE	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000097943.2		
CASZ1	54897	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	10700024	10700024	+	Missense_Mutation	SNP	C	C	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr1:10700024C>A	ENST00000377022.3	-	21	4572	c.4255G>T	c.(4255-4257)Gcg>Tcg	p.A1419S	RP4-734G22.3_ENST00000606802.1_RNA	NM_001079843.2	NP_001073312.1	Q86V15	CASZ1_HUMAN	castor zinc finger 1	1419					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|large_intestine(13)|lung(18)|ovary(2)|prostate(5)|skin(2)|urinary_tract(1)	54	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		CGGGAGGACGCCGTCTTCCGC	0.617																																					p.A1419S													.	CASZ1-113	0			c.G4255T						.						39.0	45.0	43.0					1																	10700024		2097	4204	6301	SO:0001583	missense	54897	exon21			AGGACGCCGTCTT	AK000328	CCDS120.2, CCDS41246.1	1p36.22	2013-01-07	2007-02-02		ENSG00000130940	ENSG00000130940		"""Zinc fingers, C2H2-type"""	26002	protein-coding gene	gene with protein product	"""zinc finger protein 693"", ""survival related gene"""	609895	"""castor homolog 1, zinc finger (Drosophila)"""			16631614, 21252912	Standard	NM_001079843		Approved	FLJ20321, ZNF693, castor, cst, SRG	uc001aro.4	Q86V15	OTTHUMG00000002035	ENST00000377022.3:c.4255G>T	1.37:g.10700024C>A	ENSP00000366221:p.Ala1419Ser	Somatic	80	1		WXS	Illumina HiSeq	Phase_I	95	22	NM_001079843	0	0	0	0	0	Q078S9|Q2EN02|Q5T9S1|Q6ZNM8|Q8WX49|Q8WX50|Q9BT16|Q9NXC6	Missense_Mutation	SNP	ENST00000377022.3	37	CCDS41246.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.513284	0.85389	.	.	ENSG00000130940	ENST00000377022	.	.	.	5.23	5.23	0.72850	.	0.000000	0.45606	U	0.000359	T	0.30039	0.0752	N	0.08118	0	0.80722	D	1	P	0.52316	0.952	B	0.43251	0.413	T	0.12734	-1.0536	9	0.08599	T	0.76	-17.5652	18.7817	0.91934	0.0:1.0:0.0:0.0	.	1419	Q86V15	CASZ1_HUMAN	S	1419	.	ENSP00000366221:A1419S	A	-	1	0	CASZ1	10622611	0.995000	0.38212	0.937000	0.37676	0.969000	0.65631	3.242000	0.51384	2.435000	0.82474	0.460000	0.39030	GCG	.		0.617	CASZ1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005673.2	NM_017766	
FBXO6	26270	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	11728776	11728776	+	Missense_Mutation	SNP	C	C	G			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr1:11728776C>G	ENST00000376753.4	+	2	196	c.61C>G	c.(61-63)Ctg>Gtg	p.L21V		NM_018438.5	NP_060908.1	Q9NRD1	FBX6_HUMAN	F-box protein 6	21	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.				DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|glycoprotein catabolic process (GO:0006516)|proteolysis (GO:0006508)|response to unfolded protein (GO:0006986)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)	carbohydrate binding (GO:0030246)|glycoprotein binding (GO:0001948)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|large_intestine(1)|lung(1)|ovary(1)|upper_aerodigestive_tract(2)	6	Ovarian(185;0.249)	Lung NSC(185;4.15e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.25e-06)|COAD - Colon adenocarcinoma(227;0.000251)|BRCA - Breast invasive adenocarcinoma(304;0.000297)|Kidney(185;0.000747)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00727)|READ - Rectum adenocarcinoma(331;0.0649)		CGAGAACATCCTGCTGGAGCT	0.632																																					p.L21V	NSCLC(54;506 1562 46490 51389)												.	FBXO6-226	0			c.C61G						.						54.0	57.0	56.0					1																	11728776		2203	4300	6503	SO:0001583	missense	26270	exon2			AACATCCTGCTGG	AF129536	CCDS133.1	1p36.22	2008-05-14	2004-06-15		ENSG00000116663	ENSG00000116663		"""F-boxes /  ""other"""""	13585	protein-coding gene	gene with protein product		605647	"""F-box only protein 6"""			10531035, 10945468	Standard	NM_018438		Approved	FBX6, FBG2, FBS2, Fbx6b	uc001aso.3	Q9NRD1	OTTHUMG00000002229	ENST00000376753.4:c.61C>G	1.37:g.11728776C>G	ENSP00000365944:p.Leu21Val	Somatic	105	1		WXS	Illumina HiSeq	Phase_I	114	36	NM_018438	0	0	47	47	0	B1AK42|B2RC88|Q9UKT3	Missense_Mutation	SNP	ENST00000376753.4	37	CCDS133.1	.	.	.	.	.	.	.	.	.	.	C	12.25	1.881321	0.33255	.	.	ENSG00000116663	ENST00000376753	T	0.68331	-0.32	5.15	3.27	0.37495	F-box domain, cyclin-like (2);F-box domain, Skp2-like (1);	0.244528	0.34435	N	0.003979	T	0.76212	0.3956	M	0.65677	2.01	0.37077	D	0.898797	D	0.76494	0.999	D	0.85130	0.997	T	0.76296	-0.3011	10	0.37606	T	0.19	-6.9754	8.6849	0.34232	0.0:0.821:0.0:0.179	.	21	Q9NRD1	FBX6_HUMAN	V	21	ENSP00000365944:L21V	ENSP00000365944:L21V	L	+	1	2	FBXO6	11651363	0.953000	0.32496	1.000000	0.80357	0.718000	0.41266	1.306000	0.33505	0.679000	0.31345	0.650000	0.86243	CTG	.		0.632	FBXO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006332.1	NM_018438	
AADACL4	343066	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	12711237	12711237	+	Silent	SNP	G	G	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr1:12711237G>T	ENST00000376221.1	+	2	264	c.264G>T	c.(262-264)gtG>gtT	p.V88V		NM_001013630.1	NP_001013652.1	Q5VUY2	ADCL4_HUMAN	arylacetamide deacetylase-like 4	88						integral component of membrane (GO:0016021)	carboxylic ester hydrolase activity (GO:0052689)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(6)|prostate(1)	17	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.000937)|all_lung(284;0.00122)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.81e-07)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.00217)|KIRC - Kidney renal clear cell carcinoma(229;0.00579)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0384)		CTGAACTTGTGGTGACCGACC	0.498																																					p.V88V		.											.	AADACL4-68	0			c.G264T						.						98.0	96.0	97.0					1																	12711237		2203	4300	6503	SO:0001819	synonymous_variant	343066	exon2			ACTTGTGGTGACC		CCDS30590.1	1p36.21	2010-12-14			ENSG00000204518	ENSG00000204518			32038	protein-coding gene	gene with protein product							Standard	XM_006710608		Approved	OTTHUMG00000001889	uc001auf.3	Q5VUY2	OTTHUMG00000001889	ENST00000376221.1:c.264G>T	1.37:g.12711237G>T		Somatic	121	0		WXS	Illumina HiSeq	Phase_I	120	66	NM_001013630	0	0	0	0	0		Silent	SNP	ENST00000376221.1	37	CCDS30590.1																																																																																			.		0.498	AADACL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005328.1	NM_001013630	
RHD	6007	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	25628090	25628090	+	Silent	SNP	G	G	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr1:25628090G>A	ENST00000328664.4	+	5	869	c.714G>A	c.(712-714)gtG>gtA	p.V238V	RHD_ENST00000357542.4_Silent_p.V238V|RHD_ENST00000342055.5_Silent_p.V238V|RHD_ENST00000423810.2_Silent_p.V238V|RHD_ENST00000423253.1_3'UTR|RHD_ENST00000417538.2_Silent_p.V238V|RHD_ENST00000454452.2_Silent_p.V238V|RHD_ENST00000568195.1_Silent_p.V238V	NM_001282867.1|NM_016124.3	NP_001269796.1|NP_057208	Q02161	RHD_HUMAN	Rh blood group, D antigen	238			V -> M (in RhDVa(TO) and RhDVa(TT); dbSNP:rs1053360). {ECO:0000269|Ref.9}.			integral component of plasma membrane (GO:0005887)	ammonium transmembrane transporter activity (GO:0008519)			breast(2)|large_intestine(4)|lung(7)|prostate(1)	14		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;7.39e-27)|Colorectal(126;8.83e-09)|COAD - Colon adenocarcinoma(152;6.43e-07)|STAD - Stomach adenocarcinoma(196;0.000332)|BRCA - Breast invasive adenocarcinoma(304;0.000438)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|GBM - Glioblastoma multiforme(114;0.000908)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		AGAATGCCGTGTTCAACACCT	0.562																																					p.V238V		.											.	RHD-153	0			c.G714A						.						199.0	154.0	171.0					1																	25628090		2122	3769	5891	SO:0001819	synonymous_variant	6007	exon5			TGCCGTGTTCAAC	AB012623	CCDS262.1, CCDS53285.1, CCDS60027.1, CCDS60028.1, CCDS60029.1, CCDS60030.1, CCDS60031.1	1p36.11	2014-07-19	2013-10-02		ENSG00000187010	ENSG00000187010		"""CD molecules"", ""Blood group antigens"""	10009	protein-coding gene	gene with protein product		111680	"""Rhesus blood group, D antigen"", ""Rh blood group, D antigen"""	RH		8220426	Standard	NM_016124		Approved	Rh30a, Rh4, RhPI, RhII, DIIIc, CD240D	uc001bjz.3	Q02161	OTTHUMG00000003476	ENST00000328664.4:c.714G>A	1.37:g.25628090G>A		Somatic	87	0		WXS	Illumina HiSeq	Phase_I	134	123	NM_001127691	0	0	0	0	0	Q02162|Q07618|Q16147|Q16235|Q16355|Q5VSK0|Q5XLS9|Q5XLT1|Q5XLT2|Q9NPK0|Q9UQ20|Q9UQ21|Q9UQ22|Q9UQ23	Silent	SNP	ENST00000328664.4	37	CCDS262.1																																																																																			.		0.562	RHD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009660.5	NM_016124	
CSMD2	114784	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	34015918	34015918	+	Missense_Mutation	SNP	G	G	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr1:34015918G>T	ENST00000373381.4	-	56	8952	c.8776C>A	c.(8776-8778)Cac>Aac	p.H2926N		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	2901	Sushi 21. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				ATCTGGGAGTGAGGCGGGGAG	0.572																																					p.H2782N		.											.	CSMD2-103	0			c.C8344A						.						58.0	57.0	57.0					1																	34015918		2203	4300	6503	SO:0001583	missense	114784	exon55			GGGAGTGAGGCGG	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.8776C>A	1.37:g.34015918G>T	ENSP00000362479:p.His2926Asn	Somatic	109	0		WXS	Illumina HiSeq	Phase_I	186	106	NM_052896	0	0	0	0	0	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000373381.4	37		.	.	.	.	.	.	.	.	.	.	G	0.673	-0.801317	0.02841	.	.	ENSG00000121904	ENST00000373381	T	0.64618	-0.11	5.71	5.71	0.89125	Complement control module (2);Sushi/SCR/CCP (3);	0.060404	0.64402	D	0.000002	T	0.27241	0.0668	N	0.00661	-1.28	0.80722	D	1	B;B	0.09022	0.002;0.001	B;B	0.14023	0.01;0.01	T	0.43294	-0.9400	10	0.02654	T	1	.	13.8354	0.63406	0.0:0.0:0.8474:0.1526	.	2782;2926	Q7Z408;E7EUA6	CSMD2_HUMAN;.	N	2926	ENSP00000362479:H2926N	ENSP00000241312:H2782N	H	-	1	0	CSMD2	33788505	1.000000	0.71417	0.982000	0.44146	0.320000	0.28249	3.614000	0.54160	2.720000	0.93068	0.650000	0.86243	CAC	.		0.572	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052896	
AGO3	192669	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	36479547	36479547	+	Missense_Mutation	SNP	T	T	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr1:36479547T>A	ENST00000373191.4	+	11	1653	c.1304T>A	c.(1303-1305)gTa>gAa	p.V435E	RP4-665N4.8_ENST00000466576.2_RNA|AGO3_ENST00000246314.6_Missense_Mutation_p.V201E|RP4-665N4.8_ENST00000479395.2_RNA	NM_024852.3	NP_079128.2	Q9H9G7	AGO3_HUMAN	argonaute RISC catalytic component 3	435					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA catabolic process (GO:0006402)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of stem cell proliferation (GO:0072091)	cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|RISC complex (GO:0016442)	miRNA binding (GO:0035198)|poly(A) RNA binding (GO:0044822)										AGCCATGGAGTATGGGACATG	0.398																																					p.V435E													.	.	0			c.T1304A						.						127.0	117.0	120.0					1																	36479547		2203	4300	6503	SO:0001583	missense	192669	exon11			ATGGAGTATGGGA	AB046787	CCDS399.1, CCDS400.1	1p34	2013-06-03	2013-02-15	2013-02-15	ENSG00000126070	ENSG00000126070		"""Argonaute/PIWI family"""	18421	protein-coding gene	gene with protein product	"""argonaute 3"""	607355	"""eukaryotic translation initiation factor 2C, 3"""	EIF2C3		12906857	Standard	NM_024852		Approved	hAGO3, FLJ12765	uc001bzp.3	Q9H9G7	OTTHUMG00000184172	ENST00000373191.4:c.1304T>A	1.37:g.36479547T>A	ENSP00000362287:p.Val435Glu	Somatic	369	2		WXS	Illumina HiSeq	Phase_I	366	38	NM_024852	0	0	2	2	0	B1ALI0|Q5TA55|Q9H1U6	Missense_Mutation	SNP	ENST00000373191.4	37	CCDS399.1	.	.	.	.	.	.	.	.	.	.	T	18.81	3.703233	0.68501	.	.	ENSG00000126070	ENST00000373191;ENST00000246314	T;T	0.05447	3.44;3.44	5.65	5.65	0.86999	.	0.055978	0.64402	D	0.000001	T	0.16769	0.0403	M	0.90922	3.16	0.80722	D	1	B	0.23891	0.093	B	0.34452	0.183	T	0.28964	-1.0027	10	0.06891	T	0.86	-12.758	15.9324	0.79675	0.0:0.0:0.0:1.0	.	435	Q9H9G7	AGO3_HUMAN	E	435;201	ENSP00000362287:V435E;ENSP00000246314:V201E	ENSP00000246314:V201E	V	+	2	0	EIF2C3	36252134	1.000000	0.71417	1.000000	0.80357	0.702000	0.40608	8.031000	0.88826	2.169000	0.68431	0.529000	0.55759	GTA	.		0.398	AGO3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019831.4	NM_024852	
MACF1	23499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	39853737	39853737	+	Missense_Mutation	SNP	G	G	C			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr1:39853737G>C	ENST00000372915.3	+	57	15325	c.15238G>C	c.(15238-15240)Ggt>Cgt	p.G5080R	MACF1_ENST00000564288.1_Missense_Mutation_p.G5075R|MACF1_ENST00000539005.1_Missense_Mutation_p.G2992R|MACF1_ENST00000317713.7_Missense_Mutation_p.G3013R|MACF1_ENST00000567887.1_Missense_Mutation_p.G5112R|MACF1_ENST00000545844.1_Missense_Mutation_p.G3013R|MACF1_ENST00000289893.4_Missense_Mutation_p.G3515R|MACF1_ENST00000361689.2_Missense_Mutation_p.G3013R			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	5080					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CTTTACTCAGGGTCTGGTAGA	0.502																																					p.G3013R		.											.	MACF1-165	0			c.G9037C						.						51.0	52.0	52.0					1																	39853737		2203	4300	6503	SO:0001583	missense	23499	exon54			ACTCAGGGTCTGG	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.15238G>C	1.37:g.39853737G>C	ENSP00000362006:p.Gly5080Arg	Somatic	139	0		WXS	Illumina HiSeq	Phase_I	138	42	NM_012090	0	0	4	5	1	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.13|17.13	3.311133|3.311133	0.60414|0.60414	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000372925|ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893	.|T;T;T;T;T;T	.|0.32272	.|1.46;1.46;1.46;1.46;1.46;1.46	6.03|6.03	6.03|6.03	0.97812|0.97812	.|.	0.000000|0.000000	0.64402|0.64402	D|D	0.000005|0.000005	T|T	0.55273|0.55273	0.1910|0.1910	L|L	0.58101|0.58101	1.795|1.795	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;0.99;0.991	.|D;D;D	.|0.97110	.|1.0;0.952;0.962	T|T	0.43475|0.43475	-0.9389|-0.9389	6|10	.|0.44086	.|T	.|0.13	.|.	20.5568|20.5568	0.99304|0.99304	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|5080;3013;2957	.|Q9UPN3;F8W8Q1;Q9UPN3-3	.|MACF1_HUMAN;.;.	A|R	2125|3013;5080;3013;3013;2992;3515	.|ENSP00000439537:G3013R;ENSP00000362006:G5080R;ENSP00000354573:G3013R;ENSP00000313438:G3013R;ENSP00000444364:G2992R;ENSP00000289893:G3515R	.|ENSP00000289893:G3515R	G|G	+|+	2|1	0|0	MACF1|MACF1	39626324|39626324	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.947000|0.947000	0.59692|0.59692	9.869000|9.869000	0.99810|0.99810	2.861000|2.861000	0.98227|0.98227	0.655000|0.655000	0.94253|0.94253	GGG|GGT	.		0.502	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044	
ITGB3BP	23421	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	63974218	63974218	+	Missense_Mutation	SNP	T	T	G			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr1:63974218T>G	ENST00000271002.10	-	2	110	c.29A>C	c.(28-30)gAt>gCt	p.D10A	ITGB3BP_ENST00000283568.8_Missense_Mutation_p.D10A|ITGB3BP_ENST00000371092.3_Missense_Mutation_p.D49A	NM_014288.4	NP_055103.3	Q13352	CENPR_HUMAN	integrin beta 3 binding protein (beta3-endonexin)	10					apoptotic signaling pathway (GO:0097190)|cell adhesion (GO:0007155)|CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleosome assembly (GO:0006334)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)|signal transducer activity (GO:0004871)	p.D10G(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|upper_aerodigestive_tract(1)	9						TAACAGACCATCCAACTTCAG	0.259																																					p.D49A													.	ITGB3BP-90	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)	c.A146C						.						28.0	28.0	28.0					1																	63974218		2149	4215	6364	SO:0001583	missense	23421	exon3			AGACCATCCAACT	U37139	CCDS30736.1, CCDS55603.1	1p31.3	2013-11-05			ENSG00000142856	ENSG00000142856			6157	protein-coding gene	gene with protein product	"""centromere protein R"""	605494				7593198, 10490654	Standard	NM_014288		Approved	NRIF3, HSU37139, TAP20, CENPR	uc001dbb.2	Q13352	OTTHUMG00000013364	ENST00000271002.10:c.29A>C	1.37:g.63974218T>G	ENSP00000271002:p.Asp10Ala	Somatic	292	2		WXS	Illumina HiSeq	Phase_I	201	53	NM_001206739	0	0	7	10	3	B2R7D8|Q13353|Q5RJ42|Q5RJ44|Q5RJ45|Q7KYX2|Q96CD5|Q9UKB6	Missense_Mutation	SNP	ENST00000271002.10	37	CCDS30736.1	.	.	.	.	.	.	.	.	.	.	T	3.341	-0.134587	0.06711	.	.	ENSG00000142856	ENST00000271002;ENST00000371092;ENST00000283568	T;T;T	0.67698	-0.27;0.25;-0.28	4.91	3.79	0.43588	.	0.260117	0.25997	N	0.026964	T	0.46073	0.1374	N	0.19112	0.55	0.38496	D	0.948093	P;P;P	0.51537	0.944;0.946;0.78	P;P;B	0.50825	0.651;0.592;0.265	T	0.53947	-0.8366	10	0.66056	D	0.02	-2.1447	10.3835	0.44125	0.0:0.0772:0.0:0.9228	.	10;49;10	Q13352-2;Q13352-5;Q13352	.;.;CENPR_HUMAN	A	10;49;10	ENSP00000271002:D10A;ENSP00000360133:D49A;ENSP00000283568:D10A	ENSP00000271002:D10A	D	-	2	0	ITGB3BP	63746806	1.000000	0.71417	0.469000	0.27204	0.029000	0.11900	5.252000	0.65445	0.732000	0.32470	-0.256000	0.11100	GAT	.		0.259	ITGB3BP-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000037242.2	NM_014288	
GNG12	55970	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	68171150	68171150	+	Missense_Mutation	SNP	G	G	C			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr1:68171150G>C	ENST00000370982.3	-	4	402	c.203C>G	c.(202-204)aCt>aGt	p.T68S		NM_018841.5	NP_061329.3	Q9UBI6	GBG12_HUMAN	guanine nucleotide binding protein (G protein), gamma 12	68					cellular response to glucagon stimulus (GO:0071377)|cerebral cortex development (GO:0021987)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|phosphate ion binding (GO:0042301)|signal transducer activity (GO:0004871)			lung(3)	3						GATGATGCAAGTTTTTTTATC	0.433																																					p.T68S		.											.	GNG12-227	0			c.C203G						.						173.0	163.0	167.0					1																	68171150		2203	4300	6503	SO:0001583	missense	55970	exon4			ATGCAAGTTTTTT	AF119663	CCDS30749.1	1p31.2	2008-02-05			ENSG00000172380	ENSG00000172380			19663	protein-coding gene	gene with protein product		615405				10819326	Standard	NM_018841		Approved		uc001dea.2	Q9UBI6	OTTHUMG00000009545	ENST00000370982.3:c.203C>G	1.37:g.68171150G>C	ENSP00000360021:p.Thr68Ser	Somatic	73	0		WXS	Illumina HiSeq	Phase_I	89	43	NM_018841	0	0	14	40	26	Q69YP5|Q9BRV5	Missense_Mutation	SNP	ENST00000370982.3	37	CCDS30749.1	.	.	.	.	.	.	.	.	.	.	G	17.02	3.282741	0.59867	.	.	ENSG00000172380	ENST00000370982	T	0.20200	2.09	5.79	5.79	0.91817	G-protein gamma domain (3);	0.054877	0.85682	D	0.000000	T	0.05502	0.0145	.	.	.	0.41685	D	0.98931	B	0.27625	0.183	B	0.31495	0.131	T	0.08146	-1.0736	9	0.02654	T	1	-5.209	18.8047	0.92032	0.0:0.0:1.0:0.0	.	68	Q9UBI6	GBG12_HUMAN	S	68	ENSP00000360021:T68S	ENSP00000360021:T68S	T	-	2	0	GNG12	67943738	1.000000	0.71417	0.993000	0.49108	0.993000	0.82548	7.072000	0.76777	2.749000	0.94314	0.491000	0.48974	ACT	.		0.433	GNG12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026355.2		
GNAI3	2773	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	110125084	110125084	+	Missense_Mutation	SNP	T	T	G			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr1:110125084T>G	ENST00000369851.4	+	5	597	c.487T>G	c.(487-489)Tcc>Gcc	p.S163A		NM_006496.3	NP_006487.1	P08754	GNAI3_HUMAN	guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3	163					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cell division (GO:0051301)|negative regulation of adenylate cyclase activity (GO:0007194)|platelet activation (GO:0030168)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vesicle fusion (GO:0006906)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|heterotrimeric G-protein complex (GO:0005834)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane raft (GO:0045121)|midbody (GO:0030496)|plasma membrane (GO:0005886)|zymogen granule (GO:0042588)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled serotonin receptor binding (GO:0031821)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			NS(1)|endometrium(2)|kidney(1)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	12		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Lung(183;0.046)|Colorectal(144;0.119)|Epithelial(280;0.139)|all cancers(265;0.147)|LUSC - Lung squamous cell carcinoma(189;0.237)		GGATAGAATATCCCAGTCTAA	0.368																																					p.S163A													.	GNAI3-228	0			c.T487G						.						113.0	107.0	109.0					1																	110125084		2203	4300	6503	SO:0001583	missense	2773	exon5			AGAATATCCCAGT	M27543	CCDS802.1	1p13	2012-10-02			ENSG00000065135	ENSG00000065135			4387	protein-coding gene	gene with protein product		139370				3109953	Standard	NM_006496		Approved	87U6	uc001dxz.3	P08754	OTTHUMG00000011648	ENST00000369851.4:c.487T>G	1.37:g.110125084T>G	ENSP00000358867:p.Ser163Ala	Somatic	210	1		WXS	Illumina HiSeq	Phase_I	213	46	NM_006496	0	0	48	55	7	P17539|Q5TZX1	Missense_Mutation	SNP	ENST00000369851.4	37	CCDS802.1	.	.	.	.	.	.	.	.	.	.	T	7.473	0.646985	0.14516	.	.	ENSG00000065135	ENST00000369851	D	0.87412	-2.25	5.92	4.78	0.61160	G protein alpha subunit, helical insertion (2);	0.050812	0.85682	D	0.000000	T	0.47358	0.1441	N	0.03115	-0.41	0.47905	D	0.999546	B	0.02656	0.0	B	0.09377	0.004	T	0.53851	-0.8380	10	0.02654	T	1	.	7.964	0.30087	0.0:0.0706:0.1352:0.7942	.	163	P08754	GNAI3_HUMAN	A	163	ENSP00000358867:S163A	ENSP00000358867:S163A	S	+	1	0	GNAI3	109926607	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	3.446000	0.52928	2.255000	0.74692	0.533000	0.62120	TCC	.		0.368	GNAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032222.1	NM_006496	
KCNA2	3737	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	111147091	111147091	+	Missense_Mutation	SNP	G	G	C			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr1:111147091G>C	ENST00000485317.1	-	3	987	c.314C>G	c.(313-315)cCc>cGc	p.P105R	KCNA2_ENST00000440270.1_Missense_Mutation_p.P105R|KCNA2_ENST00000369770.3_Missense_Mutation_p.P105R|KCNA2_ENST00000525120.1_Intron|KCNA2_ENST00000316361.4_Missense_Mutation_p.P105R			P16389	KCNA2_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 2	105					optic nerve structural organization (GO:0021633)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	juxtaparanode region of axon (GO:0044224)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			endometrium(1)|kidney(1)|large_intestine(6)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	32		all_cancers(81;5.55e-06)|all_epithelial(167;1.87e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Colorectal(144;0.00878)|Lung(183;0.0234)|all cancers(265;0.0492)|Epithelial(280;0.0529)|COAD - Colon adenocarcinoma(174;0.131)|LUSC - Lung squamous cell carcinoma(189;0.133)|READ - Rectum adenocarcinoma(129;0.191)	Dalfampridine(DB06637)	TATATCTAAGGGCACATTCAC	0.473																																					p.P105R	Pancreas(18;568 735 10587 23710 36357)												.	KCNA2-91	0			c.C314G						.						43.0	46.0	45.0					1																	111147091		2203	4300	6503	SO:0001583	missense	3737	exon3			TCTAAGGGCACAT	L02752	CCDS827.1, CCDS55625.1	1p13	2012-07-05			ENSG00000177301	ENSG00000177301		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6220	protein-coding gene	gene with protein product		176262				16382104	Standard	NM_004974		Approved	Kv1.2, HK4	uc009wfw.3	P16389	OTTHUMG00000011567	ENST00000485317.1:c.314C>G	1.37:g.111147091G>C	ENSP00000433109:p.Pro105Arg	Somatic	84	1		WXS	Illumina HiSeq	Phase_I	73	47	NM_001204269	0	0	0	0	0	Q86XG6	Missense_Mutation	SNP	ENST00000485317.1	37	CCDS827.1	.	.	.	.	.	.	.	.	.	.	G	16.13	3.035653	0.54896	.	.	ENSG00000177301	ENST00000369770;ENST00000485317;ENST00000440270;ENST00000316361	T;T;T;T	0.76316	-1.01;-1.01;-1.01;-1.01	6.02	5.11	0.69529	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.112102	0.64402	D	0.000009	D	0.90195	0.6935	H	0.96048	3.76	0.80722	D	1	D;D	0.76494	0.999;0.995	D;D	0.76071	0.987;0.913	D	0.93211	0.6600	10	0.66056	D	0.02	.	15.1629	0.72798	0.0674:0.0:0.9326:0.0	.	105;105	Q86XG6;P16389	.;KCNA2_HUMAN	R	105	ENSP00000358785:P105R;ENSP00000433109:P105R;ENSP00000415257:P105R;ENSP00000314520:P105R	ENSP00000314520:P105R	P	-	2	0	KCNA2	110948614	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.807000	0.99171	1.551000	0.49450	0.655000	0.94253	CCC	.		0.473	KCNA2-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128001.2	NM_004974	
KCNN3	3782	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	154841897	154841897	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr1:154841897C>T	ENST00000271915.4	-	1	859	c.544G>A	c.(544-546)Ggt>Agt	p.G182S	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	187					potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	ATGACCCCACCGCTATACTTG	0.672																																					p.G182S													.	KCNN3-91	0			c.G544A						.						41.0	45.0	43.0					1																	154841897		2203	4300	6503	SO:0001583	missense	3782	exon1			CCCCACCGCTATA	AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.544G>A	1.37:g.154841897C>T	ENSP00000271915:p.Gly182Ser	Somatic	64	1		WXS	Illumina HiSeq	Phase_I	100	34	NM_001204087	0	0	0	0	0	B1ANX0|O43517|Q86VF9|Q8WXG7	Missense_Mutation	SNP	ENST00000271915.4	37	CCDS30880.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.553945	0.86231	.	.	ENSG00000143603	ENST00000271915	D	0.99578	-6.21	4.75	4.75	0.60458	.	0.315768	0.23144	N	0.051433	D	0.98896	0.9626	N	0.14661	0.345	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.99894	1.1143	10	0.87932	D	0	-8.6442	15.2952	0.73898	0.0:1.0:0.0:0.0	.	188;187	Q6JXY2;Q9UGI6	.;KCNN3_HUMAN	S	182	ENSP00000271915:G182S	ENSP00000271915:G182S	G	-	1	0	KCNN3	153108521	1.000000	0.71417	0.989000	0.46669	0.993000	0.82548	7.464000	0.80887	2.461000	0.83175	0.563000	0.77884	GGT	.		0.672	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090688.3	NM_002249	
ZBTB7B	51043	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	154987232	154987232	+	Missense_Mutation	SNP	C	C	G			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr1:154987232C>G	ENST00000368426.3	+	3	233	c.96C>G	c.(94-96)caC>caG	p.H32Q	ZBTB7B_ENST00000487542.1_3'UTR|ZBTB7B_ENST00000417934.2_Missense_Mutation_p.H66Q|ZBTB7B_ENST00000292176.2_Missense_Mutation_p.H32Q|ZBTB7B_ENST00000535420.1_Missense_Mutation_p.H32Q	NM_001256455.1	NP_001243384.1	O15156	ZBT7B_HUMAN	zinc finger and BTB domain containing 7B	32					cell differentiation (GO:0030154)|ectoderm development (GO:0007398)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(14)|ovary(1)|prostate(3)|skin(3)	29	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			AGCTGGGCCACCTATGTGACC	0.587																																					p.H66Q		.											.	ZBTB7B-90	0			c.C198G						.						68.0	69.0	69.0					1																	154987232		2203	4300	6503	SO:0001583	missense	51043	exon4			GGGCCACCTATGT	AF007833	CCDS1081.1, CCDS58030.1	1q21.2	2013-01-08		2005-04-07	ENSG00000160685	ENSG00000160685		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	18668	protein-coding gene	gene with protein product	"""zinc finger and BTB domain containing 15"""	607646	"""zinc finger protein 67 homolog (mouse)"""	ZFP67		9370309, 7937772	Standard	NR_045515		Approved	ZBTB15, c-Krox, hcKrox, ZNF857B	uc010peq.3	O15156	OTTHUMG00000037414	ENST00000368426.3:c.96C>G	1.37:g.154987232C>G	ENSP00000357411:p.His32Gln	Somatic	77	0		WXS	Illumina HiSeq	Phase_I	80	26	NM_001252406	0	0	5	14	9	B4E3K5|D3DV83|J3KQQ3|Q68DR2|Q96EP2	Missense_Mutation	SNP	ENST00000368426.3	37	CCDS1081.1	.	.	.	.	.	.	.	.	.	.	C	10.76	1.439712	0.25900	.	.	ENSG00000160685	ENST00000535420;ENST00000368426;ENST00000417934;ENST00000292176	T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2	3.59	-1.19	0.09585	BTB/POZ (1);BTB/POZ fold (2);	0.413847	0.21695	N	0.070510	T	0.12561	0.0305	N	0.02539	-0.55	0.27857	N	0.940546	B;B;B	0.09022	0.002;0.001;0.002	B;B;B	0.08055	0.003;0.002;0.003	T	0.21075	-1.0256	10	0.66056	D	0.02	.	5.0228	0.14370	0.0:0.4765:0.1713:0.3521	.	32;32;66	A8K6F4;O15156;B4E3K5	.;ZBT7B_HUMAN;.	Q	32;32;66;32	ENSP00000438647:H32Q;ENSP00000357411:H32Q;ENSP00000406286:H66Q;ENSP00000292176:H32Q	ENSP00000292176:H32Q	H	+	3	2	ZBTB7B	153253856	0.762000	0.28451	0.963000	0.40424	0.981000	0.71138	-0.185000	0.09684	-0.072000	0.12864	-0.379000	0.06801	CAC	.		0.587	ZBTB7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091083.1	NM_015872	
KLHDC8A	55220	bcgsc.ca	37	1	205306599	205306599	+	Nonsense_Mutation	SNP	G	G	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr1:205306599G>T	ENST00000367156.3	-	9	1797	c.981C>A	c.(979-981)tgC>tgA	p.C327*	KLHDC8A_ENST00000367155.3_Nonsense_Mutation_p.C327*|KLHDC8A_ENST00000537168.1_Nonsense_Mutation_p.C214*|KLHDC8A_ENST00000539253.1_Nonsense_Mutation_p.C327*|KLHDC8A_ENST00000460687.1_Nonsense_Mutation_p.C193*	NM_001271863.1	NP_001258792.1	Q8IYD2	KLD8A_HUMAN	kelch domain containing 8A	327										breast(1)|endometrium(3)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	14	Breast(84;0.23)		BRCA - Breast invasive adenocarcinoma(75;0.117)			CGGCGAGGAGGCAGTTCTTGA	0.602																																					p.C327X													.	KLHDC8A-91	0			c.C981A						.						215.0	199.0	204.0					1																	205306599		2203	4300	6503	SO:0001587	stop_gained	55220	exon6			GAGGAGGCAGTTC		CCDS30985.1	1q32.1	2008-02-05			ENSG00000162873	ENSG00000162873			25573	protein-coding gene	gene with protein product		614503					Standard	NM_018203		Approved	FLJ10748	uc031prx.1	Q8IYD2	OTTHUMG00000037199	ENST00000367156.3:c.981C>A	1.37:g.205306599G>T	ENSP00000356124:p.Cys327*	Somatic	106	3		WXS	Illumina HiSeq	Phase_1	102	59	NM_018203	0	0	0	0	0	B3KU70|Q9NVG5	Nonsense_Mutation	SNP	ENST00000367156.3	37	CCDS30985.1	.	.	.	.	.	.	.	.	.	.	G	36	5.757579	0.96898	.	.	ENSG00000162873	ENST00000367155;ENST00000367156;ENST00000539253;ENST00000537168	.	.	.	5.43	3.46	0.39613	.	0.049173	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	-27.1551	5.738	0.18077	0.1704:0.0:0.6798:0.1498	.	.	.	.	X	327;327;327;214	.	ENSP00000356123:C327X	C	-	3	2	KLHDC8A	203573222	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	1.937000	0.40193	1.185000	0.42971	0.591000	0.81541	TGC	.		0.602	KLHDC8A-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090397.1	NM_018203	
RCOR3	55758	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	211462545	211462545	+	Missense_Mutation	SNP	C	C	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr1:211462545C>A	ENST00000367005.4	+	7	713	c.572C>A	c.(571-573)aCt>aAt	p.T191N	RCOR3_ENST00000367006.4_Missense_Mutation_p.T249N|RCOR3_ENST00000452621.2_Missense_Mutation_p.T249N|RCOR3_ENST00000419091.2_Missense_Mutation_p.T249N	NM_018254.3	NP_060724.1	Q9P2K3	RCOR3_HUMAN	REST corepressor 3	191					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(81;0.00961)|all cancers(67;0.0999)|Epithelial(68;0.171)		CCTGTCCAAACTAGCAAGATT	0.378																																					p.T249N		.											.	RCOR3-91	0			c.C746A						.						127.0	113.0	118.0					1																	211462545		2203	4300	6503	SO:0001583	missense	55758	exon8			TCCAAACTAGCAA	AK001738	CCDS31016.1, CCDS44312.1, CCDS44313.1, CCDS44314.1	1q32.3	2008-02-05			ENSG00000117625	ENSG00000117625			25594	protein-coding gene	gene with protein product						10718198	Standard	NM_018254		Approved	FLJ10876	uc010psw.2	Q9P2K3	OTTHUMG00000036996	ENST00000367005.4:c.572C>A	1.37:g.211462545C>A	ENSP00000355972:p.Thr191Asn	Somatic	181	0		WXS	Illumina HiSeq	Phase_I	244	26	NM_001136223	0	0	18	19	1	B3KYA2|B4DYY7|Q5VT47|Q7L9I5|Q8N5U3|Q9NV83	Missense_Mutation	SNP	ENST00000367005.4	37	CCDS31016.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.33|13.33	2.205841|2.205841	0.39003|0.39003	.|.	.|.	ENSG00000117625|ENSG00000117625	ENST00000534460|ENST00000367006;ENST00000452621;ENST00000419091;ENST00000367005;ENST00000529763	.|T;T;T;T	.|0.28454	.|1.61;1.61;1.61;1.61	5.62|5.62	4.7|4.7	0.59300|0.59300	.|.	.|0.488580	.|0.25119	.|N	.|0.032996	T|T	0.17874|0.17874	0.0429|0.0429	N|N	0.11201|0.11201	0.11|0.11	0.38814|0.38814	D|D	0.955493|0.955493	.|B;B;B;B	.|0.17268	.|0.002;0.0;0.021;0.018	.|B;B;B;B	.|0.15052	.|0.003;0.001;0.006;0.012	T|T	0.06250|0.06250	-1.0837|-1.0837	5|10	.|0.14252	.|T	.|0.57	-7.2822|-7.2822	16.1088|16.1088	0.81244|0.81244	0.0:0.8548:0.1452:0.0|0.0:0.8548:0.1452:0.0	.|.	.|249;191;249;249	.|Q9P2K3-3;Q9P2K3;Q9P2K3-2;Q9P2K3-4	.|.;RCOR3_HUMAN;.;.	K|N	35|249;249;249;191;9	.|ENSP00000355973:T249N;ENSP00000398558:T249N;ENSP00000413929:T249N;ENSP00000355972:T191N	.|ENSP00000355972:T191N	N|T	+|+	3|2	2|0	RCOR3|RCOR3	209529168|209529168	0.981000|0.981000	0.34729|0.34729	0.995000|0.995000	0.50966|0.50966	0.997000|0.997000	0.91878|0.91878	2.148000|2.148000	0.42235|0.42235	1.335000|1.335000	0.45486|0.45486	0.655000|0.655000	0.94253|0.94253	AAC|ACT	.		0.378	RCOR3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000089821.1	NM_018254	
AKT3	10000	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	243800913	243800913	+	Splice_Site	SNP	C	C	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr1:243800913C>T	ENST00000366539.1	-	6	761	c.561G>A	c.(559-561)aaG>aaA	p.K187K	AKT3_ENST00000263826.5_Splice_Site_p.K187K|AKT3_ENST00000366540.1_Splice_Site_p.K187K|AKT3_ENST00000336199.5_Splice_Site_p.K187K			Q9Y243	AKT3_HUMAN	v-akt murine thymoma viral oncogene homolog 3	187	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				mitochondrial genome maintenance (GO:0000002)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|skin(3)|stomach(1)	26	all_cancers(71;0.000307)|all_epithelial(71;0.000374)|all_lung(81;0.0323)|Ovarian(71;0.0619)|all_neural(11;0.101)|Lung NSC(105;0.168)	all_cancers(173;0.0274)	all cancers(7;4.3e-08)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00196)			AATCAGTTACCTTTGCAATAA	0.328																																					p.K187K		.											.	AKT3-1423	0			c.G561A						.						81.0	81.0	81.0					1																	243800913		2202	4295	6497	SO:0001630	splice_region_variant	10000	exon6			AGTTACCTTTGCA	AF124141	CCDS31076.1, CCDS31077.1	1q44	2013-07-09	2013-07-09		ENSG00000117020	ENSG00000117020	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	393	protein-coding gene	gene with protein product	"""protein kinase B, gamma"""	611223				10092583, 10208883	Standard	NM_005465		Approved	PKBG, RAC-gamma, PRKBG	uc001iab.2	Q9Y243	OTTHUMG00000039994	ENST00000366539.1:c.561+1G>A	1.37:g.243800913C>T		Somatic	75	0		WXS	Illumina HiSeq	Phase_I	42	6	NM_001206729	0	0	0	0	0	Q0VAA6|Q5VTI1|Q5VTI2|Q96QV3|Q9UFP5	Silent	SNP	ENST00000366539.1	37	CCDS31077.1																																																																																			.		0.328	AKT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096479.1	NM_181690	Silent
OR2C3	81472	broad.mit.edu	37	1	247694872	247694872	+	Silent	SNP	T	T	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr1:247694872T>A	ENST00000366487.3	-	2	1303	c.942A>T	c.(940-942)gcA>gcT	p.A314A	GCSAML_ENST00000531662.1_Intron|GCSAML_ENST00000527541.1_Intron|GCSAML_ENST00000366490.3_Intron|GCSAML_ENST00000527084.1_Intron|GCSAML_ENST00000366489.1_Intron|GCSAML_ENST00000366491.2_Intron|GCSAML_ENST00000463359.1_Intron	NM_198074.4	NP_932340	Q8N628	OR2C3_HUMAN	olfactory receptor, family 2, subfamily C, member 3	314						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|large_intestine(2)|lung(31)|ovary(1)|prostate(1)|skin(2)	43	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0242)	OV - Ovarian serous cystadenocarcinoma(106;0.0241)			CCAGCTTGCCTGCAGAGCCAC	0.517																																					p.A314A													.	OR2C3-70	0			c.A942T						.						58.0	54.0	56.0					1																	247694872		2203	4300	6503	SO:0001819	synonymous_variant	81472	exon2			CTTGCCTGCAGAG	BC030717	CCDS1634.2	1q44	2014-02-19	2002-02-28		ENSG00000196242	ENSG00000196242		"""GPCR / Class A : Olfactory receptors"""	15005	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily C, member 4"""	OR2C4, OR2C5P			Standard	NM_198074		Approved	OST742	uc009xgy.3	Q8N628	OTTHUMG00000040579	ENST00000366487.3:c.942A>T	1.37:g.247694872T>A		Somatic	99	0		WXS	Illumina HiSeq	Phase_I	150	5	NM_198074	0	0	0	0	0	Q5JQS4|Q6IEZ1|Q8NGW7	Silent	SNP	ENST00000366487.3	37	CCDS1634.2																																																																																			.		0.517	OR2C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097626.2	NM_198074	
OPTN	10133	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	13160994	13160994	+	Nonsense_Mutation	SNP	C	C	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr10:13160994C>T	ENST00000378748.3	+	8	1095	c.733C>T	c.(733-735)Cag>Tag	p.Q245*	OPTN_ENST00000378747.3_Nonsense_Mutation_p.Q245*|OPTN_ENST00000378764.2_Nonsense_Mutation_p.Q239*|OPTN_ENST00000378757.2_Nonsense_Mutation_p.Q245*|OPTN_ENST00000263036.5_Nonsense_Mutation_p.Q245*|OPTN_ENST00000378752.3_Nonsense_Mutation_p.Q239*	NM_001008211.1|NM_001008213.1	NP_001008212|NP_001008214	Q96CV9	OPTN_HUMAN	optineurin	245					cell death (GO:0008219)|defense response to Gram-negative bacterium (GO:0050829)|G2/M transition of mitotic cell cycle (GO:0000086)|Golgi organization (GO:0007030)|Golgi ribbon formation (GO:0090161)|Golgi to plasma membrane protein transport (GO:0043001)|macroautophagy (GO:0016236)|mitotic cell cycle (GO:0000278)|negative regulation of receptor recycling (GO:0001920)|protein targeting to Golgi (GO:0000042)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	polyubiquitin binding (GO:0031593)|protein C-terminus binding (GO:0008022)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(2)|large_intestine(5)|lung(9)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22						GGAAGGGAATCAGAAGGTGGA	0.428																																					p.Q245X		.											.	OPTN-70	0			c.C733T						.						93.0	91.0	91.0					10																	13160994		2203	4300	6503	SO:0001587	stop_gained	10133	exon7			GGGAATCAGAAGG	AF420371	CCDS7094.1	10p14	2014-01-28	2003-09-08		ENSG00000123240	ENSG00000123240			17142	protein-coding gene	gene with protein product		602432	"""glaucoma 1, open angle, E (adult-onset)"""	GLC1E		11834836, 9488477	Standard	NM_001008211		Approved	FIP2, HYPL, FIP-2, TFIIIA-INTP, NRP, HIP7	uc001ilx.1	Q96CV9	OTTHUMG00000017690	ENST00000378748.3:c.733C>T	10.37:g.13160994C>T	ENSP00000368022:p.Gln245*	Somatic	199	0		WXS	Illumina HiSeq	Phase_I	175	100	NM_001008212	0	0	41	42	1	B3KP00|D3DRS4|D3DRS8|Q5T672|Q5T673|Q5T674|Q5T675|Q7LDL9|Q8N562|Q9UET9|Q9UEV4|Q9Y218	Nonsense_Mutation	SNP	ENST00000378748.3	37	CCDS7094.1	.	.	.	.	.	.	.	.	.	.	C	39	7.381482	0.98248	.	.	ENSG00000123240	ENST00000263036;ENST00000378764;ENST00000378757;ENST00000378752;ENST00000378748;ENST00000378747	.	.	.	6.16	6.16	0.99307	.	0.099240	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	-22.7994	19.6313	0.95704	0.0:1.0:0.0:0.0	.	.	.	.	X	245;239;245;239;245;245	.	ENSP00000263036:Q245X	Q	+	1	0	OPTN	13201000	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	2.672000	0.46850	2.937000	0.99478	0.650000	0.86243	CAG	.		0.428	OPTN-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046834.1	NM_021980	
KIAA1462	57608	broad.mit.edu;bcgsc.ca	37	10	30336674	30336674	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr10:30336674C>T	ENST00000375377.1	-	2	169	c.68G>A	c.(67-69)cGc>cAc	p.R23H		NM_020848.2	NP_065899.1	Q9P266	JCAD_HUMAN	KIAA1462	23					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)				breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(23)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	75						GTTATCCTCGCGTGATGCTGG	0.607																																					p.R23H													.	KIAA1462-72	0			c.G68A						.						73.0	79.0	77.0					10																	30336674		2036	4192	6228	SO:0001583	missense	57608	exon2			TCCTCGCGTGATG	AB040895	CCDS41500.1	10p12.1	2013-04-23			ENSG00000165757	ENSG00000165757			29283	protein-coding gene	gene with protein product	"""junctional protein associated with coronary artery disease"""	614398				10819331, 21884682	Standard	NM_020848		Approved	JCAD	uc001iux.3	Q9P266	OTTHUMG00000017885	ENST00000375377.1:c.68G>A	10.37:g.30336674C>T	ENSP00000364526:p.Arg23His	Somatic	116	0		WXS	Illumina HiSeq	Phase_I	128	6	NM_020848	0	0	0	0	0	Q5HYA7|Q5T992|Q86WZ9|Q9BYJ2	Missense_Mutation	SNP	ENST00000375377.1	37	CCDS41500.1	.	.	.	.	.	.	.	.	.	.	C	7.772	0.707679	0.15239	.	.	ENSG00000165757	ENST00000375377	T	0.11604	2.76	5.3	-1.25	0.09405	.	0.823638	0.10809	N	0.631817	T	0.03434	0.0099	N	0.03115	-0.41	0.09310	N	1	B	0.11235	0.004	B	0.08055	0.003	T	0.46992	-0.9151	10	0.11794	T	0.64	-5.5506	5.0393	0.14451	0.0:0.4095:0.1523:0.4382	.	23	Q9P266	K1462_HUMAN	H	23	ENSP00000364526:R23H	ENSP00000364526:R23H	R	-	2	0	KIAA1462	30376680	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.154000	0.10130	-0.048000	0.13401	-0.373000	0.07131	CGC	.		0.607	KIAA1462-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047409.1	NM_020848	
MICU1	10367	bcgsc.ca	37	10	74135633	74135633	+	Intron	SNP	G	G	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr10:74135633G>A	ENST00000361114.5	-	11	1277				MICU1_ENST00000398763.4_Intron|MICU1_ENST00000398761.4_Intron|MICU1_ENST00000401998.3_Intron|MICU1_ENST00000418483.2_Intron	NM_001195518.1|NM_006077.3	NP_001182447.1|NP_006068.2	Q9BPX6	MICU1_HUMAN	mitochondrial calcium uptake 1						calcium ion import (GO:0070509)|calcium ion transmembrane import into mitochondrion (GO:0036444)|defense response (GO:0006952)|mitochondrial calcium ion homeostasis (GO:0051560)|mitochondrial calcium ion transport (GO:0006851)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|protein homooligomerization (GO:0051260)	calcium channel complex (GO:0034704)|integral component of mitochondrial membrane (GO:0032592)|intracellular (GO:0005622)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|uniplex complex (GO:1990246)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)										CATGGTCACTGAAAAAAGAAA	0.458																																					.													.	.	0			.						.						54.0	53.0	54.0					10																	74135633		2061	4195	6256	SO:0001627	intron_variant	100302155	.			GTCACTGAAAAAA	Y17711	CCDS55714.1, CCDS55715.1	10q22.1	2013-01-10	2011-06-23	2011-06-23	ENSG00000107745	ENSG00000107745		"""EF-hand domain containing"""	1530	protein-coding gene	gene with protein product		605084	"""calcium binding atopy-related autoantigen 1"""	CBARA1		9806765, 20693986	Standard	NM_006077		Approved	CALC, EFHA3, FLJ12684	uc001jtb.2	Q9BPX6	OTTHUMG00000018437	ENST00000361114.5:c.1181-3C>T	10.37:g.74135633G>A		Somatic	77	0		WXS	Illumina HiSeq	Phase_1	74	43	.	0	0	0	1	1	A8MV96|B3KN20|B4DJH9|B4DPI1|B5MBY3|D3YTJ3|O75785|Q9H9N6|Q9UFX0	RNA	SNP	ENST00000361114.5	37	CCDS55715.1																																																																																			.		0.458	MICU1-002	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048586.1	NM_006077	
ZNF518A	9849	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	97917491	97917491	+	RNA	SNP	G	G	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr10:97917491G>T	ENST00000534948.1	+	0	2269							Q6AHZ1	Z518A_HUMAN	zinc finger protein 518A						transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|urinary_tract(2)	24		Colorectal(252;0.0815)		Epithelial(162;4.23e-08)|all cancers(201;1.85e-06)		TGTTCACCAGGCTCACAGTCA	0.398																																					.													.	ZNF518A-23	0			.						.						115.0	114.0	114.0					10																	97917491		1879	4103	5982			9849	.			CACCAGGCTCACA	AB002333	CCDS73170.1	10q23.33	2012-08-08	2007-12-07	2007-12-07	ENSG00000177853	ENSG00000177853		"""Zinc fingers, C2H2-type"""	29009	protein-coding gene	gene with protein product			"""zinc finger protein 518"""	ZNF518		9205841	Standard	NM_014803		Approved	KIAA0335	uc001klp.3	Q6AHZ1	OTTHUMG00000018828		10.37:g.97917491G>T		Somatic	218	0		WXS	Illumina HiSeq	Phase_I	216	120	.	0	0	2	2	0	A0PJI5|O15044|Q32MP4	Missense_Mutation	SNP	ENST00000534948.1	37																																																																																				.		0.398	ZNF518A-202	KNOWN	basic	processed_transcript	processed_transcript		NM_014803	
KNDC1	85442	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	135013012	135013012	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr10:135013012G>A	ENST00000304613.3	+	15	2830	c.2809G>A	c.(2809-2811)Gcc>Acc	p.A937T	KNDC1_ENST00000368572.2_Missense_Mutation_p.A939T|KNDC1_ENST00000368571.2_Missense_Mutation_p.A872T			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	937					cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)	p.A937T(1)		NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		TTTCTGTGGCGCCATTTCCGA	0.532																																					p.A937T		.											.	KNDC1-229	1	Substitution - Missense(1)	large_intestine(1)	c.G2809A						.						177.0	150.0	159.0					10																	135013012		2203	4300	6503	SO:0001583	missense	85442	exon15			TGTGGCGCCATTT	AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.2809G>A	10.37:g.135013012G>A	ENSP00000304437:p.Ala937Thr	Somatic	151	0		WXS	Illumina HiSeq	Phase_I	192	14	NM_152643	0	0	0	0	0	B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Missense_Mutation	SNP	ENST00000304613.3	37	CCDS7674.1	.	.	.	.	.	.	.	.	.	.	G	16.88	3.244556	0.59103	.	.	ENSG00000171798	ENST00000304613;ENST00000368572;ENST00000368571	T;T;T	0.12984	2.63;2.63;2.63	3.99	3.99	0.46301	.	0.479232	0.18727	N	0.132851	T	0.34571	0.0902	M	0.66939	2.045	0.41003	D	0.984944	D;D;D	0.89917	0.993;1.0;0.997	D;D;P	0.72338	0.919;0.977;0.74	T	0.18116	-1.0347	10	0.72032	D	0.01	-25.397	13.9012	0.63804	0.0:0.0:1.0:0.0	.	937;872;937	Q76NI1-4;Q76NI1-2;Q76NI1	.;.;VKIND_HUMAN	T	937;939;872	ENSP00000304437:A937T;ENSP00000357561:A939T;ENSP00000357560:A872T	ENSP00000304437:A937T	A	+	1	0	KNDC1	134863002	0.937000	0.31787	0.821000	0.32701	0.124000	0.20399	2.706000	0.47135	1.957000	0.56846	0.313000	0.20887	GCC	.		0.532	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277044.3	NM_152643	
OR51D1	390038	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	4661643	4661643	+	Missense_Mutation	SNP	A	A	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr11:4661643A>T	ENST00000357605.2	+	1	699	c.623A>T	c.(622-624)aAt>aTt	p.N208I		NM_001004751.2	NP_001004751.1	Q8NGF3	O51D1_HUMAN	olfactory receptor, family 51, subfamily D, member 1	208						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|liver(2)|lung(14)|prostate(1)|skin(2)|urinary_tract(1)	27		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;2.74e-13)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|GBM - Glioblastoma multiforme(2;0.0841)|LUSC - Lung squamous cell carcinoma(625;0.19)		ACCAGGGTCAATGTGGTTTAT	0.468																																					p.N208I		.											.	OR51D1-68	0			c.A623T						.						290.0	242.0	259.0					11																	4661643		2201	4298	6499	SO:0001583	missense	390038	exon1			GGGTCAATGTGGT	AB065855	CCDS31357.1	11p15.4	2012-08-09			ENSG00000197428	ENSG00000197428		"""GPCR / Class A : Olfactory receptors"""	15193	protein-coding gene	gene with protein product							Standard	NM_001004751		Approved	OR51D1Q	uc010qyk.2	Q8NGF3	OTTHUMG00000165724	ENST00000357605.2:c.623A>T	11.37:g.4661643A>T	ENSP00000350222:p.Asn208Ile	Somatic	141	0		WXS	Illumina HiSeq	Phase_I	172	74	NM_001004751	0	0	0	0	0	B9EIK4	Missense_Mutation	SNP	ENST00000357605.2	37	CCDS31357.1	.	.	.	.	.	.	.	.	.	.	A	11.92	1.781247	0.31502	.	.	ENSG00000197428	ENST00000357605	T	0.00231	8.49	4.29	3.13	0.36017	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48286	D	0.000197	T	0.00580	0.0019	M	0.88906	2.99	0.43330	D	0.995366	P	0.44877	0.845	D	0.63793	0.918	T	0.66272	-0.5965	10	0.87932	D	0	.	9.16	0.37016	0.9102:0.0:0.0898:0.0	.	208	Q8NGF3	O51D1_HUMAN	I	208	ENSP00000350222:N208I	ENSP00000350222:N208I	N	+	2	0	OR51D1	4618219	0.644000	0.27277	0.752000	0.31206	0.008000	0.06430	1.567000	0.36407	0.752000	0.32923	0.460000	0.39030	AAT	.		0.468	OR51D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385956.1	NM_001004751	
EIF4G2	1982	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	10820842	10820842	+	Missense_Mutation	SNP	T	T	G			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr11:10820842T>G	ENST00000526148.1	-	20	2964	c.2454A>C	c.(2452-2454)aaA>aaC	p.K818N	SNORD97_ENST00000459187.1_RNA|EIF4G2_ENST00000525681.1_Missense_Mutation_p.K818N|RP11-685M7.5_ENST00000532365.1_RNA|EIF4G2_ENST00000396525.2_Missense_Mutation_p.K780N|EIF4G2_ENST00000339995.5_Missense_Mutation_p.K818N	NM_001172705.1	NP_001166176			eukaryotic translation initiation factor 4 gamma, 2											NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	43				all cancers(16;2.8e-07)|Epithelial(150;4.18e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		CATGAAGAAATTTCTGCATTA	0.443																																					p.K818N		.											.	EIF4G2-91	0			c.A2454C						.						154.0	144.0	148.0					11																	10820842		2201	4294	6495	SO:0001583	missense	1982	exon20			AAGAAATTTCTGC	U73824	CCDS31428.1, CCDS41618.1	11p15	2005-09-29			ENSG00000110321	ENSG00000110321			3297	protein-coding gene	gene with protein product		602325				9030685, 9032289	Standard	NM_001042559		Approved	DAP5, NAT1, p97	uc001mjc.3	P78344	OTTHUMG00000165823	ENST00000526148.1:c.2454A>C	11.37:g.10820842T>G	ENSP00000433664:p.Lys818Asn	Somatic	101	0		WXS	Illumina HiSeq	Phase_I	120	61	NM_001172705	0	0	339	624	285		Missense_Mutation	SNP	ENST00000526148.1	37	CCDS31428.1	.	.	.	.	.	.	.	.	.	.	T	19.81	3.896251	0.72639	.	.	ENSG00000110321	ENST00000526148;ENST00000525681;ENST00000339995;ENST00000396525;ENST00000429377;ENST00000528839;ENST00000379653	T;T;T;T	0.22743	1.94;1.94;1.94;1.96	6.07	0.912	0.19349	eIF4-gamma/eIF5/eIF2-epsilon (2);Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.000000	0.85682	D	0.000000	T	0.31040	0.0784	M	0.76727	2.345	0.53005	D	0.999965	P;D	0.63880	0.949;0.993	P;P	0.52109	0.493;0.69	T	0.47086	-0.9144	9	0.59425	D	0.04	-9.3023	8.4006	0.32583	0.0:0.5799:0.0:0.4201	.	818;891	P78344;B4DZF2	IF4G2_HUMAN;.	N	818;818;818;780;891;166;200	ENSP00000433664:K818N;ENSP00000433371:K818N;ENSP00000340281:K818N;ENSP00000379778:K780N	ENSP00000340281:K818N	K	-	3	2	EIF4G2	10777418	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	0.781000	0.26774	0.149000	0.19098	0.533000	0.62120	AAA	.		0.443	EIF4G2-006	KNOWN	alternative_5_UTR|non_ATG_start|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000386603.1	NM_001418	
SPON1	10418	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	14063070	14063070	+	RNA	SNP	C	C	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr11:14063070C>T	ENST00000310358.7	+	0	886							Q9HCB6	SPON1_HUMAN	spondin 1, extracellular matrix protein						cell adhesion (GO:0007155)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|endometrium(1)|large_intestine(5)|lung(11)|prostate(2)|upper_aerodigestive_tract(1)	21				Epithelial(150;0.00898)		TTCCGTAGATCATAGACGAAG	0.418																																					.													.	SPON1-1	0			.						.						174.0	172.0	173.0					11																	14063070		1901	4123	6024			10418	.			GTAGATCATAGAC	AB018305	CCDS73262.1	11p15.2	2014-05-06	2004-03-05		ENSG00000152268	ENSG00000262655			11252	protein-coding gene	gene with protein product		604989	"""spondin 1, (f-spondin) extracellular matrix protein"""			9872452	Standard	NM_006108		Approved	KIAA0762, f-spondin	uc001mle.3	Q9HCB6	OTTHUMG00000181576		11.37:g.14063070C>T		Somatic	48	0		WXS	Illumina HiSeq	Phase_I	72	22	.	0	0	0	0	0	A8K6W5|O94862|Q8NCD7|Q8WUR5	Silent	SNP	ENST00000310358.7	37																																																																																				.		0.418	SPON1-201	KNOWN	basic	processed_transcript	processed_transcript		NM_145584	
CKAP5	9793	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	46799004	46799004	+	Silent	SNP	G	G	C			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr11:46799004G>C	ENST00000529230.1	-	23	2893	c.2847C>G	c.(2845-2847)gtC>gtG	p.V949V	CKAP5_ENST00000415402.1_Silent_p.V949V|CKAP5_ENST00000354558.3_Silent_p.V949V|CKAP5_ENST00000312055.5_Silent_p.V949V			Q14008	CKAP5_HUMAN	cytoskeleton associated protein 5	949					centrosome organization (GO:0051297)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|RNA transport (GO:0050658)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|protein complex (GO:0043234)|spindle pole (GO:0000922)				breast(1)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	43						TGTCTCCAAGGACTGTGATGA	0.413																																					p.V949V	Ovarian(4;85 273 2202 4844 13323)	.											.	CKAP5-92	0			c.C2847G						.						137.0	125.0	129.0					11																	46799004		2201	4299	6500	SO:0001819	synonymous_variant	9793	exon23			TCCAAGGACTGTG		CCDS7924.1, CCDS31477.1	11p11.2	2006-09-20			ENSG00000175216	ENSG00000175216			28959	protein-coding gene	gene with protein product		611142				7788527, 8536682	Standard	NM_014756		Approved	ch-TOG, KIAA0097, TOG, TOGp	uc001ndi.2	Q14008	OTTHUMG00000166599	ENST00000529230.1:c.2847C>G	11.37:g.46799004G>C		Somatic	81	0		WXS	Illumina HiSeq	Phase_I	104	43	NM_001008938	0	0	7	11	4	Q05D70|Q0VAX7|Q0VAX8|Q14668|Q2TA89|Q6NSH4	Silent	SNP	ENST00000529230.1	37	CCDS31477.1																																																																																			.		0.413	CKAP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390679.1	NM_014756	
NUP160	23279	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	47837537	47837537	+	Silent	SNP	A	A	G			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr11:47837537A>G	ENST00000378460.2	-	12	1522	c.1476T>C	c.(1474-1476)agT>agC	p.S492S	NUP160_ENST00000528071.1_Silent_p.S378S|NUP160_ENST00000530326.1_Silent_p.S378S|NUP160_ENST00000531016.1_5'UTR|NUP160_ENST00000528501.1_Silent_p.S56S	NM_015231.1	NP_056046.1	Q12769	NU160_HUMAN	nucleoporin 160kDa	492					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)			NS(1)|biliary_tract(2)|breast(7)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(6)|prostate(2)|skin(2)|urinary_tract(2)	53						TCTTCAGTTCACTCCAGGAAA	0.363																																					p.S492S		.											.	NUP160-209	0			c.T1476C						.						92.0	89.0	90.0					11																	47837537		2201	4298	6499	SO:0001819	synonymous_variant	23279	exon12			CAGTTCACTCCAG	D83781	CCDS31484.1	11p11.12	2008-07-21	2002-08-29		ENSG00000030066	ENSG00000030066			18017	protein-coding gene	gene with protein product		607614	"""nucleoporin 160kD"""			11684705	Standard	NM_015231		Approved	KIAA0197, FLJ22583	uc001ngm.3	Q12769	OTTHUMG00000166534	ENST00000378460.2:c.1476T>C	11.37:g.47837537A>G		Somatic	264	0		WXS	Illumina HiSeq	Phase_I	361	175	NM_015231	0	0	6	14	8	B4DYE8|B4E2J9|Q08AD3|Q7Z5X6|Q96GB3|Q9H660	Silent	SNP	ENST00000378460.2	37	CCDS31484.1																																																																																			.		0.363	NUP160-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390239.2	NM_015231	
PTPRJ	5795	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	48142728	48142728	+	Missense_Mutation	SNP	T	T	G			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr11:48142728T>G	ENST00000418331.2	+	4	878	c.526T>G	c.(526-528)Tta>Gta	p.L176V	PTPRJ_ENST00000440289.2_Missense_Mutation_p.L176V	NM_002843.3	NP_002834.3	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J	176	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				contact inhibition (GO:0060242)|heart development (GO:0007507)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of vascular permeability (GO:0043116)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of cell adhesion (GO:0045785)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion (GO:0030155)|vasculogenesis (GO:0001570)	cell projection (GO:0042995)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|mitogen-activated protein kinase binding (GO:0051019)|phosphatase activity (GO:0016791)|platelet-derived growth factor receptor binding (GO:0005161)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|endometrium(7)|kidney(7)|large_intestine(5)|lung(15)|ovary(1)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						CATCACAGGCTTACGTCCAGC	0.423																																					p.L176V		.											.	PTPRJ-541	0			c.T526G						.						163.0	147.0	153.0					11																	48142728		2201	4298	6499	SO:0001583	missense	5795	exon4			ACAGGCTTACGTC	U10886	CCDS7945.1, CCDS44596.1	11p11.2	2013-02-11			ENSG00000149177	ENSG00000149177		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9673	protein-coding gene	gene with protein product		600925				7937872, 7994032	Standard	NM_001098503		Approved	DEP1, HPTPeta, CD148	uc001ngp.4	Q12913	OTTHUMG00000166573	ENST00000418331.2:c.526T>G	11.37:g.48142728T>G	ENSP00000400010:p.Leu176Val	Somatic	282	1		WXS	Illumina HiSeq	Phase_I	323	131	NM_001098503	0	0	7	11	4	Q15255|Q6P4H4|Q8NHM2|Q9UDA9	Missense_Mutation	SNP	ENST00000418331.2	37	CCDS7945.1	.	.	.	.	.	.	.	.	.	.	T	16.53	3.149018	0.57151	.	.	ENSG00000149177	ENST00000278456;ENST00000418331;ENST00000440289;ENST00000534219	D;D;D	0.84800	-1.9;-1.9;-1.9	5.41	1.8	0.24995	Fibronectin, type III (4);Immunoglobulin-like fold (1);	.	.	.	.	D	0.89894	0.6847	M	0.75615	2.305	0.09310	N	1	D;D	0.71674	0.992;0.998	P;D	0.72338	0.908;0.977	T	0.78858	-0.2038	9	0.72032	D	0.01	.	6.633	0.22867	0.0:0.2796:0.0:0.7204	.	176;176	Q12913;Q6P4H4	PTPRJ_HUMAN;.	V	176;176;176;97	ENSP00000400010:L176V;ENSP00000409733:L176V;ENSP00000432686:L97V	ENSP00000278456:L176V	L	+	1	2	PTPRJ	48099304	0.000000	0.05858	0.014000	0.15608	0.075000	0.17131	-0.197000	0.09518	0.346000	0.23899	0.482000	0.46254	TTA	.		0.423	PTPRJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390525.1		
ANKK1	255239	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	113265705	113265705	+	Missense_Mutation	SNP	A	A	C			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr11:113265705A>C	ENST00000303941.3	+	3	629	c.535A>C	c.(535-537)Atc>Ctc	p.I179L		NM_178510.1	NP_848605.1	Q8NFD2	ANKK1_HUMAN	ankyrin repeat and kinase domain containing 1	179	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(14)|ovary(1)|stomach(1)	29		all_cancers(61;1.53e-11)|all_epithelial(67;3e-06)|Melanoma(852;4.04e-05)|all_hematologic(158;0.000315)|Acute lymphoblastic leukemia(157;0.000966)|Breast(348;0.0461)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Prostate(24;0.194)		BRCA - Breast invasive adenocarcinoma(274;4.82e-06)|Epithelial(105;5.41e-05)|all cancers(92;0.000442)|OV - Ovarian serous cystadenocarcinoma(223;0.238)		GATGCAGTACATCGAGAGGTC	0.552																																					p.I179L		.											.	ANKK1-628	0			c.A535C						.						52.0	51.0	51.0					11																	113265705		2003	4170	6173	SO:0001583	missense	255239	exon3			CAGTACATCGAGA	AJ541797	CCDS44734.1	11q23.2	2013-01-10			ENSG00000170209	ENSG00000170209		"""Ankyrin repeat domain containing"""	21027	protein-coding gene	gene with protein product		608774				15146457	Standard	NM_178510		Approved	X-kinase	uc001pny.3	Q8NFD2	OTTHUMG00000167715	ENST00000303941.3:c.535A>C	11.37:g.113265705A>C	ENSP00000306678:p.Ile179Leu	Somatic	113	0		WXS	Illumina HiSeq	Phase_I	192	87	NM_178510	0	0	0	0	0		Missense_Mutation	SNP	ENST00000303941.3	37	CCDS44734.1	.	.	.	.	.	.	.	.	.	.	A	7.078	0.569692	0.13560	.	.	ENSG00000170209	ENST00000303941	D	0.82167	-1.58	4.25	3.11	0.35812	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.52532	U	0.000079	T	0.76786	0.4036	L	0.27053	0.805	0.42141	D	0.991513	P	0.43231	0.801	P	0.48089	0.566	T	0.72301	-0.4334	10	0.34782	T	0.22	-24.2177	9.4598	0.38778	0.8415:0.0:0.0:0.1585	.	179	Q8NFD2	ANKK1_HUMAN	L	179	ENSP00000306678:I179L	ENSP00000306678:I179L	I	+	1	0	ANKK1	112770915	0.995000	0.38212	0.250000	0.24296	0.020000	0.10135	3.696000	0.54757	0.654000	0.30846	-1.026000	0.02426	ATC	.		0.552	ANKK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395830.1	NM_178510	
B4GALNT3	283358	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	660177	660177	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr12:660177C>T	ENST00000266383.5	+	11	1100	c.1087C>T	c.(1087-1089)Cgc>Tgc	p.R363C		NM_173593.3	NP_775864.3	Q6L9W6	B4GN3_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 3	363					metabolic process (GO:0008152)	Golgi cisterna membrane (GO:0032580)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity (GO:0033842)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	all_cancers(10;0.0158)|all_epithelial(11;0.0274)|Ovarian(42;0.0512)|all_lung(10;0.154)|Lung NSC(10;0.215)		OV - Ovarian serous cystadenocarcinoma(31;0.00018)|BRCA - Breast invasive adenocarcinoma(9;0.0262)			TCCTCTGCAGCGCTACCAGGG	0.607																																					p.R363C		.											.	B4GALNT3-92	0			c.C1087T						.						172.0	151.0	158.0					12																	660177		2203	4300	6503	SO:0001583	missense	283358	exon11			CTGCAGCGCTACC	AB089940	CCDS8504.1	12p13.33	2013-02-19			ENSG00000139044	ENSG00000139044	2.4.1.-	"""Beta 4-glycosyltransferases"""	24137	protein-coding gene	gene with protein product		612220				12966086	Standard	NM_173593		Approved	B4GalNac-T3, FLJ16224, FLJ40362	uc001qii.1	Q6L9W6	OTTHUMG00000129283	ENST00000266383.5:c.1087C>T	12.37:g.660177C>T	ENSP00000266383:p.Arg363Cys	Somatic	105	0		WXS	Illumina HiSeq	Phase_I	163	37	NM_173593	0	0	0	0	0	Q6ZNC1|Q8N7T6	Missense_Mutation	SNP	ENST00000266383.5	37	CCDS8504.1	.	.	.	.	.	.	.	.	.	.	C	31	5.064455	0.93898	.	.	ENSG00000139044	ENST00000266383;ENST00000322843	T;T	0.72725	-0.68;-0.68	5.22	5.22	0.72569	.	0.107194	0.64402	D	0.000004	D	0.84428	0.5470	M	0.77313	2.365	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.68621	0.959;0.926	D	0.86089	0.1549	10	0.87932	D	0	-22.1916	18.9627	0.92682	0.0:1.0:0.0:0.0	.	265;363	E9PHD9;Q6L9W6	.;B4GN3_HUMAN	C	363;265	ENSP00000266383:R363C;ENSP00000322953:R265C	ENSP00000266383:R363C	R	+	1	0	B4GALNT3	530438	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.267000	0.65530	2.715000	0.92844	0.655000	0.94253	CGC	.		0.607	B4GALNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251406.2	NM_173593	
LRTM2	654429	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	1940301	1940301	+	Missense_Mutation	SNP	A	A	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr12:1940301A>T	ENST00000543818.1	+	4	1110	c.268A>T	c.(268-270)Aac>Tac	p.N90Y	LRTM2_ENST00000543730.1_Intron|CACNA2D4_ENST00000585708.1_Intron|LRTM2_ENST00000299194.1_Missense_Mutation_p.N90Y|CACNA2D4_ENST00000585732.1_Intron|CACNA2D4_ENST00000382722.5_Intron|CACNA2D4_ENST00000586184.1_Intron|CACNA2D4_ENST00000587995.1_Intron|LRTM2_ENST00000535041.1_Missense_Mutation_p.N90Y|CACNA2D4_ENST00000588077.1_Intron	NM_001039029.2|NM_001163925.1|NM_001163926.1	NP_001034118.1|NP_001157397.1|NP_001157398.1	Q8N967	LRTM2_HUMAN	leucine-rich repeats and transmembrane domains 2	90						integral component of membrane (GO:0016021)				NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	20	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.000834)			GGCTTTCGCCAACCTCTCCAG	0.617																																					p.N90Y		.											.	LRTM2-135	0			c.A268T						.						57.0	65.0	62.0					12																	1940301		2203	4300	6503	SO:0001583	missense	654429	exon4			TTCGCCAACCTCT	AK095610	CCDS31726.1	12p13.33	2008-02-05				ENSG00000166159			32443	protein-coding gene	gene with protein product							Standard	NM_001039029		Approved		uc010sdx.1	Q8N967		ENST00000543818.1:c.268A>T	12.37:g.1940301A>T	ENSP00000446278:p.Asn90Tyr	Somatic	47	0		WXS	Illumina HiSeq	Phase_I	59	30	NM_001039029	0	0	0	0	0	A7E2U6	Missense_Mutation	SNP	ENST00000543818.1	37	CCDS31726.1	.	.	.	.	.	.	.	.	.	.	A	17.40	3.379726	0.61845	.	.	ENSG00000166159	ENST00000543818;ENST00000299194;ENST00000535041;ENST00000546167;ENST00000543694	T;T;T;D;D	0.85013	0.52;0.52;0.52;-1.93;-1.93	5.04	3.87	0.44632	.	0.000000	0.85682	D	0.000000	D	0.88224	0.6379	L	0.54323	1.7	0.58432	D	0.999996	D	0.59357	0.985	P	0.61328	0.887	D	0.87459	0.2406	10	0.62326	D	0.03	.	10.9074	0.47088	0.925:0.0:0.075:0.0	.	90	Q8N967	LRTM2_HUMAN	Y	90	ENSP00000446278:N90Y;ENSP00000299194:N90Y;ENSP00000444737:N90Y;ENSP00000438678:N90Y;ENSP00000444104:N90Y	ENSP00000299194:N90Y	N	+	1	0	LRTM2	1810562	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.182000	0.58310	0.748000	0.32831	0.459000	0.35465	AAC	.		0.617	LRTM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398055.1		
MANSC1	54682	broad.mit.edu	37	12	12483849	12483849	+	Silent	SNP	G	G	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr12:12483849G>T	ENST00000535902.1	-	4	971	c.408C>A	c.(406-408)ccC>ccA	p.P136P	MANSC1_ENST00000396349.3_Silent_p.P102P|MANSC1_ENST00000545735.1_Silent_p.P55P			Q9H8J5	MANS1_HUMAN	MANSC domain containing 1	136						integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|skin(1)|stomach(4)	23		Prostate(47;0.0865)		BRCA - Breast invasive adenocarcinoma(232;0.185)		AATCTTCCTGGGGTAACTCTT	0.423																																					p.P136P													.	MANSC1-90	0			c.C408A						.						101.0	97.0	99.0					12																	12483849		2203	4300	6503	SO:0001819	synonymous_variant	54682	exon4			TTCCTGGGGTAAC	AK001160	CCDS8648.1	12p13.2	2006-04-12				ENSG00000111261			25505	protein-coding gene	gene with protein product						12975309	Standard	NM_018050		Approved	FLJ10298, LOH12CR3	uc001rai.1	Q9H8J5		ENST00000535902.1:c.408C>A	12.37:g.12483849G>T		Somatic	87	0		WXS	Illumina HiSeq	Phase_I	143	4	NM_018050	0	0	28	28	0	Q8NEC1|Q9NW60	Silent	SNP	ENST00000535902.1	37	CCDS8648.1																																																																																			.		0.423	MANSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400144.1	NM_018050	
WBP11	51729	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	14943406	14943406	+	Silent	SNP	A	A	G			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr12:14943406A>G	ENST00000261167.2	-	10	1526	c.1293T>C	c.(1291-1293)ccT>ccC	p.P431P		NM_016312.2	NP_057396.1	Q9Y2W2	WBP11_HUMAN	WW domain binding protein 11	431	Pro-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein phosphatase type 1 regulator activity (GO:0008599)|single-stranded DNA binding (GO:0003697)|WW domain binding (GO:0050699)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)	30						GTGGACCAGGAGGAAGGCCTG	0.473																																					p.P431P		.											.	WBP11-92	0			c.T1293C						.						99.0	103.0	102.0					12																	14943406		2203	4300	6503	SO:0001819	synonymous_variant	51729	exon10			ACCAGGAGGAAGG	AB029309	CCDS8666.1	12p12.3	2014-06-13			ENSG00000084463	ENSG00000084463			16461	protein-coding gene	gene with protein product	"""splicing factor, PQBP1 and PP1 interacting"", ""protein phosphatase 1, regulatory subunit 165"""					10593949	Standard	NM_016312		Approved	NPWBP, SIPP1, PPP1R165	uc001rci.3	Q9Y2W2	OTTHUMG00000168737	ENST00000261167.2:c.1293T>C	12.37:g.14943406A>G		Somatic	97	0		WXS	Illumina HiSeq	Phase_I	134	24	NM_016312	0	0	41	54	13	Q96AY8	Silent	SNP	ENST00000261167.2	37	CCDS8666.1																																																																																			.		0.473	WBP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400850.1	NM_016312	
KCNH3	23416	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	12	49944077	49944077	+	Missense_Mutation	SNP	A	A	C			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr12:49944077A>C	ENST00000257981.6	+	10	2143	c.1883A>C	c.(1882-1884)gAg>gCg	p.E628A		NM_012284.1	NP_036416.1	Q9ULD8	KCNH3_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 3	628					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(20)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	36						GGCTCCATGGAGGTGCTCAAG	0.647																																					p.E628A		.											.	KCNH3-90	0			c.A1883C						.						73.0	66.0	68.0					12																	49944077		2203	4300	6503	SO:0001583	missense	23416	exon10			CCATGGAGGTGCT	AB022696	CCDS8786.1	12q13	2012-07-05				ENSG00000135519		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6252	protein-coding gene	gene with protein product		604527				10455180, 16382104	Standard	NM_012284		Approved	Kv12.2, BEC1, elk2	uc001ruh.1	Q9ULD8	OTTHUMG00000169517	ENST00000257981.6:c.1883A>C	12.37:g.49944077A>C	ENSP00000257981:p.Glu628Ala	Somatic	17	0		WXS	Illumina HiSeq	Phase_I	93	48	NM_012284	0	0	1	1	0	Q9UQ06	Missense_Mutation	SNP	ENST00000257981.6	37	CCDS8786.1	.	.	.	.	.	.	.	.	.	.	A	31	5.069017	0.93950	.	.	ENSG00000135519	ENST00000257981	D	0.93307	-3.2	5.48	5.48	0.80851	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.000000	0.48767	D	0.000161	D	0.96620	0.8897	M	0.84219	2.685	0.58432	D	0.999997	D	0.76494	0.999	D	0.87578	0.998	D	0.97133	0.9819	10	0.87932	D	0	.	13.8224	0.63331	1.0:0.0:0.0:0.0	.	628	Q9ULD8	KCNH3_HUMAN	A	628	ENSP00000257981:E628A	ENSP00000257981:E628A	E	+	2	0	KCNH3	48230344	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.339000	0.96797	2.224000	0.72417	0.533000	0.62120	GAG	.		0.647	KCNH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404571.2	NM_012284	
CSAD	51380	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	53554015	53554015	+	Missense_Mutation	SNP	T	T	C			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr12:53554015T>C	ENST00000444623.1	-	14	1322	c.1055A>G	c.(1054-1056)aAg>aGg	p.K352R	CSAD_ENST00000453446.2_Missense_Mutation_p.K352R|CSAD_ENST00000379846.1_Missense_Mutation_p.K205R|CSAD_ENST00000267085.4_Missense_Mutation_p.K379R|CSAD_ENST00000379843.3_Missense_Mutation_p.K205R|RP11-1136G11.8_ENST00000550908.1_lincRNA	NM_001244705.1	NP_001231634.1	Q9Y600	CSAD_HUMAN	cysteine sulfinic acid decarboxylase	352					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)|taurine biosynthetic process (GO:0042412)		pyridoxal phosphate binding (GO:0030170)|sulfinoalanine decarboxylase activity (GO:0004782)			kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(4)	14					L-Cysteine(DB00151)	CTGCACCACCTTGTCTCCCGT	0.612																																					p.K379R	Ovarian(109;252 1546 16882 28524 44645)	.											.	CSAD-91	0			c.A1136G						.						117.0	104.0	108.0					12																	53554015		2203	4300	6503	SO:0001583	missense	51380	exon14			ACCACCTTGTCTC	AB044561	CCDS8848.2, CCDS58235.1	12q13.11-q14.3	2008-08-04			ENSG00000139631	ENSG00000139631			18966	protein-coding gene	gene with protein product	"""P-selectin cytoplasmic tail-associated protein"""					15489334	Standard	NM_015989		Approved	PCAP, CSD	uc001sbz.3	Q9Y600	OTTHUMG00000048076	ENST00000444623.1:c.1055A>G	12.37:g.53554015T>C	ENSP00000415485:p.Lys352Arg	Somatic	63	0		WXS	Illumina HiSeq	Phase_I	120	60	NM_015989	0	0	4	6	2	A8K0U4|Q4QQH9|Q9UNJ5|Q9Y601	Missense_Mutation	SNP	ENST00000444623.1	37	CCDS58235.1	.	.	.	.	.	.	.	.	.	.	T	33	5.207752	0.95033	.	.	ENSG00000139631	ENST00000308926;ENST00000379843;ENST00000267085;ENST00000379846;ENST00000444623;ENST00000398047;ENST00000453446	T;T;T;T;T	0.40225	1.04;1.04;1.04;1.04;1.04	4.67	4.67	0.58626	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.047421	0.85682	D	0.000000	T	0.59376	0.2189	L	0.61387	1.9	0.80722	D	1	D;D;P	0.69078	0.997;0.994;0.871	D;D;B	0.68765	0.96;0.96;0.247	T	0.62062	-0.6933	10	0.56958	D	0.05	-26.8125	13.5402	0.61671	0.0:0.0:0.0:1.0	.	379;352;205	Q9Y600-3;Q9Y600;Q9Y600-2	.;CSAD_HUMAN;.	R	441;205;379;205;352;313;352	ENSP00000369172:K205R;ENSP00000267085:K379R;ENSP00000369175:K205R;ENSP00000415485:K352R;ENSP00000410648:K352R	ENSP00000267085:K379R	K	-	2	0	CSAD	51840282	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.430000	0.80321	2.100000	0.63781	0.533000	0.62120	AAG	.		0.612	CSAD-017	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343697.1	NM_015989	
GPR84	53831	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	54756649	54756649	+	Silent	SNP	G	G	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr12:54756649G>A	ENST00000551809.1	-	1	1622	c.987C>T	c.(985-987)gcC>gcT	p.A329A	RP11-753H16.3_ENST00000550474.1_RNA|RP11-753H16.5_ENST00000552785.1_RNA|GPR84_ENST00000267015.3_Silent_p.A329A			Q9NQS5	GPR84_HUMAN	G protein-coupled receptor 84	329						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(2)|kidney(2)|large_intestine(6)|lung(5)|skin(1)|urinary_tract(1)	18						TGTAGCTCAGGGCAAAGCAGA	0.537																																					p.A329A		.											.	GPR84-523	0			c.C987T						.						139.0	138.0	138.0					12																	54756649		2203	4300	6503	SO:0001819	synonymous_variant	53831	exon2			GCTCAGGGCAAAG	AF237762	CCDS8878.1	12q13.13	2012-08-20						"""GPCR / Class A : Fatty acid receptors"""	4535	protein-coding gene	gene with protein product		606383				11273702	Standard	NM_020370		Approved	EX33	uc001sfu.3	Q9NQS5		ENST00000551809.1:c.987C>T	12.37:g.54756649G>A		Somatic	153	0		WXS	Illumina HiSeq	Phase_I	202	15	NM_020370	0	0	2	2	0	B6V9G7	Silent	SNP	ENST00000551809.1	37	CCDS8878.1																																																																																			.		0.537	GPR84-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406156.1		
SMARCC2	6601	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	56578005	56578005	+	Missense_Mutation	SNP	G	G	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr12:56578005G>T	ENST00000267064.4	-	6	602	c.516C>A	c.(514-516)aaC>aaA	p.N172K	SMARCC2_ENST00000394023.3_Missense_Mutation_p.N172K|SMARCC2_ENST00000347471.4_Missense_Mutation_p.N172K|SMARCC2_ENST00000550164.1_Missense_Mutation_p.N172K|RP11-977G19.5_ENST00000553176.1_RNA|SMARCC2_ENST00000550859.1_5'UTR	NM_003075.3	NP_003066.2	Q8TAQ2	SMRC2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2	172					ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome disassembly (GO:0006337)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(3)|lung(20)|ovary(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(18;0.123)			GGGAGGCATTGTTCTTATCCT	0.498																																					p.N172K		.											.	SMARCC2-229	0			c.C516A						.						116.0	94.0	101.0					12																	56578005		2203	4300	6503	SO:0001583	missense	6601	exon6			GGCATTGTTCTTA	U66616	CCDS8907.1, CCDS8908.1, CCDS55835.1	12q13.2	2008-05-14				ENSG00000139613			11105	protein-coding gene	gene with protein product		601734				8804307, 9693044	Standard	NM_001130420		Approved	BAF170, Rsc8, CRACC2	uc001skb.3	Q8TAQ2	OTTHUMG00000170288	ENST00000267064.4:c.516C>A	12.37:g.56578005G>T	ENSP00000267064:p.Asn172Lys	Somatic	136	0		WXS	Illumina HiSeq	Phase_I	135	55	NM_139067	0	0	14	30	16	F8VTJ5|Q59GV3|Q92923|Q96E12|Q96GY4	Missense_Mutation	SNP	ENST00000267064.4	37	CCDS8907.1	.	.	.	.	.	.	.	.	.	.	G	12.74	2.028067	0.35797	.	.	ENSG00000139613	ENST00000394023;ENST00000550164;ENST00000347471;ENST00000267064	T;T;T;T	0.56941	0.43;0.43;0.43;0.43	5.38	4.49	0.54785	BRCT (1);	0.717108	0.14170	N	0.336810	T	0.28067	0.0692	N	0.04508	-0.205	0.22610	N	0.998937	B;B;B;B;B	0.18310	0.016;0.027;0.016;0.016;0.027	B;B;B;B;B	0.17098	0.007;0.017;0.007;0.007;0.017	T	0.14504	-1.0470	10	0.25751	T	0.34	-3.7705	7.6019	0.28081	0.2492:0.0:0.7508:0.0	.	61;172;177;172;172	B4DF22;F8VTJ5;Q59G16;Q8TAQ2;Q8TAQ2-2	.;.;.;SMRC2_HUMAN;.	K	172	ENSP00000377591:N172K;ENSP00000449396:N172K;ENSP00000302919:N172K;ENSP00000267064:N172K	ENSP00000267064:N172K	N	-	3	2	SMARCC2	54864272	0.956000	0.32656	0.998000	0.56505	0.994000	0.84299	1.519000	0.35888	1.412000	0.46977	0.561000	0.74099	AAC	.		0.498	SMARCC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408370.1		
R3HDM2	22864	ucsc.edu;bcgsc.ca	37	12	57674168	57674168	+	Silent	SNP	T	T	C			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr12:57674168T>C	ENST00000347140.3	-	14	1665	c.1275A>G	c.(1273-1275)ccA>ccG	p.P425P	R3HDM2_ENST00000413953.2_Silent_p.P152P|R3HDM2_ENST00000403821.2_Silent_p.P425P|RP11-123K3.4_ENST00000548184.1_3'UTR|R3HDM2_ENST00000402412.1_Silent_p.P439P|R3HDM2_ENST00000358907.2_Silent_p.P425P|R3HDM2_ENST00000441731.2_Silent_p.P86P			Q9Y2K5	R3HD2_HUMAN	R3H domain containing 2	425	Gln-rich.					nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	22						TATTCAAGGGTGGCTGTTGCT	0.542																																					p.P425P													.	R3HDM2-92	0			c.A1275G						.						197.0	177.0	184.0					12																	57674168		2203	4300	6503	SO:0001819	synonymous_variant	22864	exon12			CAAGGGTGGCTGT	AB023219	CCDS8937.2	12q13.3	2012-11-19			ENSG00000179912	ENSG00000179912			29167	protein-coding gene	gene with protein product							Standard	NM_014925		Approved	KIAA1002	uc009zpm.1	Q9Y2K5	OTTHUMG00000171568	ENST00000347140.3:c.1275A>G	12.37:g.57674168T>C		Somatic	93	2		WXS	Illumina HiSeq		144	24	NM_014925	0	0	25	30	5	Q2M1T9|Q3ZCT5	Silent	SNP	ENST00000347140.3	37	CCDS8937.2	.	.	.	.	.	.	.	.	.	.	T	14.23	2.472998	0.43942	.	.	ENSG00000179912	ENST00000466401	.	.	.	4.8	0.768	0.18487	.	.	.	.	.	T	0.42359	0.1199	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.21999	-1.0229	4	.	.	.	-6.0267	1.5745	0.02621	0.1636:0.1072:0.1705:0.5587	.	.	.	.	R	23	.	.	H	-	2	0	R3HDM2	55960435	0.998000	0.40836	0.998000	0.56505	0.998000	0.95712	0.140000	0.16056	-0.023000	0.13963	0.459000	0.35465	CAC	.		0.542	R3HDM2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326570.2	NM_014925	
METTL21B	25895	broad.mit.edu;bcgsc.ca	37	12	58165807	58165807	+	5'Flank	SNP	G	G	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr12:58165807G>A	ENST00000300209.8	+	0	0				METTL1_ENST00000548681.1_5'UTR|METTL21B_ENST00000548256.1_Intron|RP11-571M6.15_ENST00000471530.1_5'Flank|AC025165.1_ENST00000582738.1_RNA|METTL21B_ENST00000333012.5_5'Flank|METTL21B_ENST00000551420.1_5'Flank|METTL1_ENST00000257848.7_Silent_p.Y20Y|METTL1_ENST00000324871.7_Silent_p.Y20Y	NM_015433.2	NP_056248.2	Q96AZ1	MT21B_HUMAN	methyltransferase like 21B							cytoplasm (GO:0005737)|intracellular (GO:0005622)	methyltransferase activity (GO:0008168)			endometrium(1)|lung(1)	2						GTTGCCGGTAGTAGCGCTTCT	0.642																																					p.Y20Y													.	METTL1-492	0			c.C60T						.						71.0	69.0	70.0					12																	58165807		2203	4300	6503	SO:0001631	upstream_gene_variant	4234	exon1			CCGGTAGTAGCGC	AL050100, AF455816	CCDS8957.1, CCDS31848.1	12q14.1	2011-03-03	2011-03-03	2011-03-03	ENSG00000123427	ENSG00000123427			24936	protein-coding gene	gene with protein product		615258	"""family with sequence similarity 119, member B"""	FAM119B		12477932	Standard	NM_015433		Approved	DKFZP586D0919	uc001sqg.3	Q96AZ1	OTTHUMG00000170459		12.37:g.58165807G>A	Exception_encountered	Somatic	71	2		WXS	Illumina HiSeq	Phase_I	128	50	NM_023033	0	0	16	22	6	Q9H749|Q9Y3W2	Silent	SNP	ENST00000300209.8	37	CCDS8957.1																																																																																			.		0.642	METTL21B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409268.1	NM_015433	
APAF1	317	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	99093184	99093184	+	Splice_Site	SNP	A	A	C			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr12:99093184A>C	ENST00000551964.1	+	17	3040		c.e17-1		APAF1_ENST00000552268.1_Intron|APAF1_ENST00000549007.1_Splice_Site|APAF1_ENST00000339433.3_Splice_Site|APAF1_ENST00000357310.1_Splice_Site|APAF1_ENST00000547045.1_Splice_Site|APAF1_ENST00000550527.1_Splice_Site|APAF1_ENST00000359972.2_Splice_Site|APAF1_ENST00000333991.1_Intron	NM_181861.1	NP_863651.1	O14727	APAF_HUMAN	apoptotic peptidase activating factor 1						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|apoptotic process (GO:0006915)|forebrain development (GO:0030900)|intrinsic apoptotic signaling pathway (GO:0097193)|nervous system development (GO:0007399)|neural tube closure (GO:0001843)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|regulation of apoptotic DNA fragmentation (GO:1902510)|regulation of apoptotic process (GO:0042981)|response to G1 DNA damage checkpoint signaling (GO:0072432)	apoptosome (GO:0043293)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(1)	42					Adenosine triphosphate(DB00171)	TTTAATTCAAAGCTTTGGGAT	0.323																																					.		.											.	APAF1-229	0			c.2272-2A>C						.						52.0	51.0	51.0					12																	99093184		2203	4300	6503	SO:0001630	splice_region_variant	317	exon17			ATTCAAAGCTTTG	AF013263	CCDS9069.1, CCDS9070.1, CCDS9071.1, CCDS55862.1, CCDS55863.1	12q23	2013-01-10	2006-10-23			ENSG00000120868		"""WD repeat domain containing"""	576	protein-coding gene	gene with protein product		602233	"""apoptotic protease activating factor"", ""apoptotic peptidase activating factor"""			9267021, 10702682	Standard	NM_181861		Approved	CED4, APAF-1	uc001tfz.3	O14727	OTTHUMG00000170214	ENST00000551964.1:c.2305-1A>C	12.37:g.99093184A>C		Somatic	54	0		WXS	Illumina HiSeq	Phase_I	58	22	NM_001160	0	0	0	0	0	B2RMX8|O43297|Q7Z438|Q9BXZ6|Q9UBZ5|Q9UGN8|Q9UGN9|Q9UGP0|Q9UJ58|Q9UJ59|Q9UJ60|Q9UJ61|Q9UJ62|Q9UJ63|Q9UJ64|Q9UJ65|Q9UJ66|Q9UJ67|Q9UNC9	Splice_Site	SNP	ENST00000551964.1	37	CCDS9069.1	.	.	.	.	.	.	.	.	.	.	A	14.65	2.598135	0.46318	.	.	ENSG00000120868	ENST00000551964;ENST00000359972;ENST00000357310;ENST00000339433;ENST00000550527;ENST00000547045;ENST00000549007	.	.	.	5.74	5.74	0.90152	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.5583	0.61773	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	APAF1	97617315	1.000000	0.71417	0.949000	0.38748	0.676000	0.39594	7.031000	0.76491	2.186000	0.69663	0.533000	0.62120	.	.		0.323	APAF1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408006.1	NM_181861.1	Intron
DAO	1610	broad.mit.edu	37	12	109290784	109290784	+	Silent	SNP	G	G	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr12:109290784G>T	ENST00000228476.3	+	8	819	c.615G>T	c.(613-615)gtG>gtT	p.V205V	DAO_ENST00000551281.1_Silent_p.V139V	NM_001917.4	NP_001908.3	P14920	OXDA_HUMAN	D-amino-acid oxidase	205					cellular nitrogen compound metabolic process (GO:0034641)|D-alanine catabolic process (GO:0055130)|D-serine catabolic process (GO:0036088)|D-serine metabolic process (GO:0070178)|dopamine biosynthetic process (GO:0042416)|glyoxylate metabolic process (GO:0046487)|leucine metabolic process (GO:0006551)|proline catabolic process (GO:0006562)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	cofactor binding (GO:0048037)|D-amino-acid oxidase activity (GO:0003884)|FAD binding (GO:0071949)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|prostate(2)|skin(1)	26					Flavin adenine dinucleotide(DB03147)	ATCAACAGGTGGACGCCCCTT	0.542																																					p.V205V													.	DAO-92	0			c.G615T						.						134.0	104.0	115.0					12																	109290784		2203	4300	6503	SO:0001819	synonymous_variant	1610	exon8			ACAGGTGGACGCC	D11370	CCDS9122.1	12q24.11	2013-09-20			ENSG00000110887	ENSG00000110887	1.4.3.3		2671	protein-coding gene	gene with protein product		124050				1356107, 8182053	Standard	NM_001917		Approved	DAMOX	uc001tnr.4	P14920	OTTHUMG00000169360	ENST00000228476.3:c.615G>T	12.37:g.109290784G>T		Somatic	74	0		WXS	Illumina HiSeq	Phase_I	105	4	NM_001917	0	0	0	0	0	B2R7I5|Q16758|Q8N6R2	Silent	SNP	ENST00000228476.3	37	CCDS9122.1																																																																																			.		0.542	DAO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403682.1		
LHX5	64211	hgsc.bcm.edu	37	12	113901232	113901232	+	Silent	SNP	T	T	C	rs202131487	byFrequency	TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr12:113901232T>C	ENST00000261731.3	-	5	1545	c.972A>G	c.(970-972)ggA>ggG	p.G324G		NM_022363.2	NP_071758.1	Q9H2C1	LHX5_HUMAN	LIM homeobox 5	324					cell proliferation in forebrain (GO:0021846)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellar Purkinje cell-granule cell precursor cell signaling involved in regulation of granule cell precursor cell proliferation (GO:0021937)|forebrain neuron differentiation (GO:0021879)|hippocampus development (GO:0021766)|positive regulation of transcription, DNA-templated (GO:0045893)|spinal cord association neuron differentiation (GO:0021527)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|skin(1)	10						GTTCCAGCGCTCCCAGCGGCG	0.736													G|||	18	0.00359425	0.0008	0.0029	5008	,	,		9203	0.001		0.0099	False		,,,				2504	0.0041				p.G324G		.											.	LHX5-90	0			c.A972G						.	G		3,4059		0,3,2028	7.0	10.0	9.0		972	-1.0	1.0	12		9	56,7872		0,56,3908	no	coding-synonymous	LHX5	NM_022363.2		0,59,5936	CC,CT,TT		0.7064,0.0739,0.4921		324/403	113901232	59,11931	2031	3964	5995	SO:0001819	synonymous_variant	64211	exon5			CAGCGCTCCCAGC	AF291181	CCDS9171.1	12q24.13	2014-01-15			ENSG00000089116	ENSG00000089116		"""Homeoboxes / LIM class"""	14216	protein-coding gene	gene with protein product		605992					Standard	NM_022363		Approved		uc001tvj.1	Q9H2C1	OTTHUMG00000169552	ENST00000261731.3:c.972A>G	12.37:g.113901232T>C		Somatic	1	0		WXS	Illumina HiSeq	Phase_I	34	14	NM_022363	0	0	0	0	0	Q32MA4	Silent	SNP	ENST00000261731.3	37	CCDS9171.1																																																																																			.		0.736	LHX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404788.3	NM_022363	
CHFR	55743	broad.mit.edu	37	12	133430112	133430112	+	Missense_Mutation	SNP	G	G	T	rs374229656		TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr12:133430112G>T	ENST00000432561.2	-	11	1386	c.1313C>A	c.(1312-1314)gCg>gAg	p.A438E	CHFR_ENST00000315585.7_Missense_Mutation_p.A397E|CHFR_ENST00000541837.2_5'UTR|CHFR_ENST00000537522.1_Missense_Mutation_p.A60E|CHFR_ENST00000443047.2_Missense_Mutation_p.A346E|CHFR_ENST00000450056.2_Missense_Mutation_p.A426E|CHFR_ENST00000266880.7_Missense_Mutation_p.A438E			Q96EP1	CHFR_HUMAN	checkpoint with forkhead and ring finger domains, E3 ubiquitin protein ligase	438					mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|modification-dependent protein catabolic process (GO:0019941)|protein polyubiquitination (GO:0000209)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)|PML body (GO:0016605)	ligase activity (GO:0016874)|nucleotide binding (GO:0000166)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.00552)|all_epithelial(31;0.226)		OV - Ovarian serous cystadenocarcinoma(86;2.59e-08)|Epithelial(86;6.38e-07)|all cancers(50;1.56e-05)		AGGCTGCGCCGCCTGCCTTCT	0.682																																					p.A438E													.	CHFR-227	0			c.C1313A						.						16.0	16.0	16.0					12																	133430112		2126	4164	6290	SO:0001583	missense	55743	exon11			TGCGCCGCCTGCC	AK001658	CCDS31937.1, CCDS53847.1, CCDS53848.1, CCDS53849.1	12q24.33	2012-02-23	2012-02-23			ENSG00000072609		"""RING-type (C3HC4) zinc fingers"""	20455	protein-coding gene	gene with protein product		605209	"""checkpoint with forkhead and ring finger domains"""			10935642, 11807090	Standard	NM_001161344		Approved	FLJ10796, RNF196	uc001ulf.2	Q96EP1		ENST00000432561.2:c.1313C>A	12.37:g.133430112G>T	ENSP00000392395:p.Ala438Glu	Somatic	27	0		WXS	Illumina HiSeq	Phase_I	161	4	NM_001161344	0	0	15	15	0	A6NEN5|B4DZ77|B4E2L6|Q96SL3|Q9NRT4|Q9NT32|Q9NVD5	Missense_Mutation	SNP	ENST00000432561.2	37	CCDS53849.1	.	.	.	.	.	.	.	.	.	.	G	3.829	-0.036126	0.07497	.	.	ENSG00000072609	ENST00000315585;ENST00000443047;ENST00000450056;ENST00000266880;ENST00000537522;ENST00000541228;ENST00000432561	T;T;T;T;T;T	0.31247	2.47;2.21;2.49;2.19;1.5;2.5	4.39	-5.95	0.02241	.	1.192850	0.05624	N	0.580503	T	0.19967	0.0480	L	0.36672	1.1	0.09310	N	1	B;B;B;B;P	0.35124	0.403;0.009;0.005;0.009;0.485	B;B;B;B;B	0.37692	0.256;0.019;0.009;0.007;0.244	T	0.16571	-1.0398	10	0.27082	T	0.32	-12.7448	3.1221	0.06395	0.367:0.1758:0.3682:0.089	.	346;438;438;426;397	Q96EP1-5;Q96EP1-4;Q96EP1;Q96EP1-2;Q96EP1-3	.;.;CHFR_HUMAN;.;.	E	397;346;426;438;60;238;438	ENSP00000320557:A397E;ENSP00000416431:A346E;ENSP00000398735:A426E;ENSP00000266880:A438E;ENSP00000442327:A60E;ENSP00000392395:A438E	ENSP00000266880:A438E	A	-	2	0	CHFR	131940185	0.000000	0.05858	0.001000	0.08648	0.016000	0.09150	0.254000	0.18314	-1.584000	0.01636	-2.048000	0.00412	GCG	.		0.682	CHFR-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397130.2		
DCLK1	9201	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	36383187	36383187	+	Silent	SNP	A	A	G			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr13:36383187A>G	ENST00000360631.3	-	13	1945	c.1734T>C	c.(1732-1734)taT>taC	p.Y578Y	DCLK1_ENST00000255448.4_Silent_p.Y578Y|DCLK1_ENST00000379893.1_Silent_p.Y271Y			O15075	DCLK1_HUMAN	doublecortin-like kinase 1	578	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon extension (GO:0048675)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|forebrain development (GO:0030900)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(18)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(6)|urinary_tract(1)	64		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		ACAGCAGGATATAAGTGATTA	0.473																																					p.Y578Y		.											.	DCLK1-826	0			c.T1734C						.						101.0	88.0	92.0					13																	36383187		2203	4300	6503	SO:0001819	synonymous_variant	9201	exon13			CAGGATATAAGTG	AB002367	CCDS9354.1, CCDS55895.1, CCDS73561.1	13q13.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000133083	ENSG00000133083			2700	protein-coding gene	gene with protein product		604742	"""doublecortin and CaM kinase-like 1"""	DCAMKL1		9747029, 10036192	Standard	NM_004734		Approved	KIAA0369, DCLK, DCDC3A	uc001uvf.3	O15075	OTTHUMG00000016729	ENST00000360631.3:c.1734T>C	13.37:g.36383187A>G		Somatic	93	0		WXS	Illumina HiSeq	Phase_I	150	51	NM_004734	0	0	2	5	3	B7Z3E9|Q5VZY8|Q5VZZ0|Q5VZZ1	Silent	SNP	ENST00000360631.3	37																																																																																				.		0.473	DCLK1-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000044487.1	NM_004734	
UGGT2	55757	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	96684163	96684163	+	Missense_Mutation	SNP	A	A	G			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr13:96684163A>G	ENST00000376747.3	-	2	291	c.221T>C	c.(220-222)tTa>tCa	p.L74S	UGGT2_ENST00000376714.3_Missense_Mutation_p.L74S|UGGT2_ENST00000376712.4_Missense_Mutation_p.L74S|UGGT2_ENST00000397618.3_Missense_Mutation_p.L74S	NM_020121.3	NP_064506.3	Q9NYU1	UGGG2_HUMAN	UDP-glucose glycoprotein glucosyltransferase 2	74					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-glucosylation (GO:0097359)	endoplasmic reticulum lumen (GO:0005788)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(17)|lung(20)|ovary(3)|pancreas(1)|prostate(4)|urinary_tract(2)	60						ATAAATTGCTAATTCTTGCAC	0.259																																					p.L74S		.											.	UGGT2-92	0			c.T221C						.						59.0	62.0	61.0					13																	96684163		2198	4277	6475	SO:0001583	missense	55757	exon2			ATTGCTAATTCTT	AF227906	CCDS9480.1	13q32.1	2009-07-23	2009-07-23	2009-07-23	ENSG00000102595	ENSG00000102595			15664	protein-coding gene	gene with protein product	"""UDP-glucose:glycoprotein glucosyltransferase 2"""	605898	"""UDP-glucose ceramide glucosyltransferase-like 2"""	UGCGL2		10694380	Standard	NM_020121		Approved	FLJ11485, HUGT2, FLJ10873, MGC150689, MGC87276, MGC117360	uc001vmt.3	Q9NYU1	OTTHUMG00000017230	ENST00000376747.3:c.221T>C	13.37:g.96684163A>G	ENSP00000365938:p.Leu74Ser	Somatic	103	0		WXS	Illumina HiSeq	Phase_I	102	38	NM_020121	0	0	4	9	5	A6NKL4|Q08AD0|Q5JQR8|Q8N5K0|Q9UFC4	Missense_Mutation	SNP	ENST00000376747.3	37	CCDS9480.1	.	.	.	.	.	.	.	.	.	.	A	18.23	3.578856	0.65878	.	.	ENSG00000102595	ENST00000376747;ENST00000376722;ENST00000376714;ENST00000397618;ENST00000376712	T;T	0.32272	3.07;1.46	5.93	5.93	0.95920	.	0.075675	0.56097	D	0.000039	T	0.61565	0.2357	M	0.84683	2.71	0.53688	D	0.999975	D;D;P	0.89917	1.0;1.0;0.937	D;D;P	0.91635	0.999;0.999;0.512	T	0.67772	-0.5584	10	0.87932	D	0	-7.6383	16.3943	0.83563	1.0:0.0:0.0:0.0	.	74;74;74	Q2TAA6;E7EMU6;Q9NYU1	.;.;UGGG2_HUMAN	S	74	ENSP00000365938:L74S;ENSP00000380743:L74S	ENSP00000365902:L74S	L	-	2	0	UGGT2	95482164	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.701000	0.84566	2.281000	0.76405	0.533000	0.62120	TTA	.		0.259	UGGT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045507.1	NM_020121	
UPF3A	65110	broad.mit.edu	37	13	115047559	115047559	+	Silent	SNP	C	C	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr13:115047559C>T	ENST00000375299.3	+	2	327	c.271C>T	c.(271-273)Ctg>Ttg	p.L91L	UPF3A_ENST00000351487.5_Silent_p.L91L	NM_023011.3	NP_075387.1	Q9H1J1	REN3A_HUMAN	UPF3 regulator of nonsense transcripts homolog A (yeast)	91	Required for interaction with UPF2.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nucleocytoplasmic transport (GO:0006913)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.L91L(8)		autonomic_ganglia(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	16	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)	OV - Ovarian serous cystadenocarcinoma(48;0.195)|Epithelial(10;0.2)		GCTGCGCCCGCTGCCAGCACA	0.731																																					p.L91L													.	UPF3A-91	8	Substitution - coding silent(8)	lung(2)|prostate(2)|kidney(2)|central_nervous_system(2)	c.C271T						.						4.0	4.0	4.0					13																	115047559		1902	3804	5706	SO:0001819	synonymous_variant	65110	exon2			CGCCCGCTGCCAG	AF318575	CCDS9543.1, CCDS9544.1	13q34	2010-04-30			ENSG00000169062	ENSG00000169062			20332	protein-coding gene	gene with protein product		605530				11113196, 11163187	Standard	NM_023011		Approved	RENT3A, UPF3, HUPF3A	uc001vup.3	Q9H1J1	OTTHUMG00000017403	ENST00000375299.3:c.271C>T	13.37:g.115047559C>T		Somatic	16	0		WXS	Illumina HiSeq	Phase_I	58	5	NM_080687	0	0	15	15	0	A2A366|Q5T8C3|Q5T8C9|Q7Z6N3|Q86YK1|Q9BZI8	Silent	SNP	ENST00000375299.3	37	CCDS9543.1																																																																																			.		0.731	UPF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045968.2		
RPGRIP1	57096	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	21769308	21769308	+	Silent	SNP	C	C	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr14:21769308C>T	ENST00000400017.2	+	3	402	c.402C>T	c.(400-402)gcC>gcT	p.A134A	RPGRIP1_ENST00000557771.1_Silent_p.A134A|RPGRIP1_ENST00000556336.1_Silent_p.A134A|RPGRIP1_ENST00000206660.6_Silent_p.A134A	NM_020366.3	NP_065099.3	Q96KN7	RPGR1_HUMAN	retinitis pigmentosa GTPase regulator interacting protein 1	134					eye photoreceptor cell development (GO:0042462)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	axoneme (GO:0005930)|nonmotile primary cilium (GO:0031513)				breast(3)|endometrium(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(4)|pancreas(1)|prostate(3)|stomach(1)	39	all_cancers(95;0.0017)	all_cancers(140;0.0973)	Epithelial(56;6.24e-07)|all cancers(55;6.56e-06)	GBM - Glioblastoma multiforme(265;0.00888)		TCGGCCCTGCCAGCCCCCGCC	0.682																																					p.A134A		.											.	RPGRIP1-140	0			c.C402T						.						10.0	14.0	13.0					14																	21769308		1990	4127	6117	SO:0001819	synonymous_variant	57096	exon3			CCCTGCCAGCCCC	AF227257	CCDS45080.1	14q11.2	2013-06-06			ENSG00000092200	ENSG00000092200			13436	protein-coding gene	gene with protein product		605446		RPGRIP		10958647, 10958648	Standard	NM_020366		Approved	RGI1, LCA6, CORD13	uc001wag.3	Q96KN7	OTTHUMG00000170758	ENST00000400017.2:c.402C>T	14.37:g.21769308C>T		Somatic	114	0		WXS	Illumina HiSeq	Phase_I	229	57	NM_020366	0	0	0	0	0	Q7Z2W6|Q8IXV5|Q96QA8|Q9HB94|Q9HB95|Q9HBK6|Q9NR40	Silent	SNP	ENST00000400017.2	37	CCDS45080.1																																																																																			.		0.682	RPGRIP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410258.1	NM_020366	
SLC7A7	9056	broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	23240479	23240479	+	IGR	SNP	T	T	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr14:23240479T>A	ENST00000397532.3	-	0	2447				OXA1L_ENST00000412791.1_Intron|OXA1L_ENST00000285848.5_Missense_Mutation_p.W429R|OXA1L_ENST00000604262.1_Missense_Mutation_p.W369R|SLC7A7_ENST00000554061.1_5'Flank|OXA1L_ENST00000358043.5_Missense_Mutation_p.W353R			Q9UM01	YLAT1_HUMAN	solute carrier family 7 (amino acid transporter light chain, y+L system), member 7						amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|leukocyte migration (GO:0050900)|protein complex assembly (GO:0006461)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(2)	20	all_cancers(95;8.44e-05)			GBM - Glioblastoma multiforme(265;0.00741)		TTACACAGGCTGGAAAAATGC	0.473																																					p.W429R													.	OXA1L-204	0			c.T1285A						.						61.0	64.0	63.0					14																	23240479		2203	4300	6503	SO:0001628	intergenic_variant	5018	exon9			ACAGGCTGGAAAA	AF092032	CCDS9574.1	14q11.2	2014-09-17	2011-07-12		ENSG00000155465	ENSG00000155465		"""Solute carriers"""	11065	protein-coding gene	gene with protein product		603593		LPI		9829974	Standard	NM_001126106		Approved	y+LAT-1	uc001wgs.4	Q9UM01	OTTHUMG00000028692		14.37:g.23240479T>A		Somatic	91	1		WXS	Illumina HiSeq	Phase_I	82	45	NM_005015	0	0	0	0	0	B2RAU0|D3DS26|O95984|Q53XC1|Q86U07|Q9P2V5	Missense_Mutation	SNP	ENST00000397532.3	37	CCDS9574.1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.565970	0.86439	.	.	ENSG00000155463	ENST00000285848;ENST00000358043	T;T	0.34667	1.35;1.4	5.71	5.71	0.89125	.	0.112616	0.64402	D	0.000004	T	0.58750	0.2144	M	0.83012	2.62	0.80722	D	1	P;D	0.65815	0.942;0.995	P;P	0.59012	0.818;0.85	T	0.65619	-0.6124	10	0.87932	D	0	-9.9776	13.4947	0.61419	0.0:0.0:0.0:1.0	.	369;429	Q15070;Q2M1J6	OXA1L_HUMAN;.	R	429;353	ENSP00000285848:W429R;ENSP00000350740:W353R	ENSP00000285848:W429R	W	+	1	0	OXA1L	22310319	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	5.969000	0.70422	2.162000	0.67917	0.496000	0.49642	TGG	.		0.473	SLC7A7-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071636.3		
EFS	10278	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	23828918	23828918	+	Silent	SNP	G	G	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr14:23828918G>A	ENST00000216733.3	-	4	1376	c.769C>T	c.(769-771)Ctg>Ttg	p.L257L	EFS_ENST00000351354.3_Silent_p.L164L|EFS_ENST00000429593.2_Intron|RP11-124D2.3_ENST00000554010.1_RNA	NM_005864.2	NP_005855.1	O43281	EFS_HUMAN	embryonal Fyn-associated substrate	257	Pro-rich.				cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)	protein domain specific binding (GO:0019904)			endometrium(2)|kidney(1)|large_intestine(1)|liver(1)|lung(5)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)	16	all_cancers(95;7.12e-06)			GBM - Glioblastoma multiforme(265;0.00649)		GGCCCCAGCAGAGGCACATCG	0.642																																					p.L257L		.											.	EFS-153	0			c.C769T						.						37.0	45.0	42.0					14																	23828918		2203	4300	6503	SO:0001819	synonymous_variant	10278	exon4			CCAGCAGAGGCAC	AB001466	CCDS9595.1, CCDS9596.1, CCDS61404.1	14q11.2-q12	2011-04-13			ENSG00000100842	ENSG00000100842		"""Cas scaffolding proteins"""	16898	protein-coding gene	gene with protein product	"""Cas scaffolding protein family member 3"""	609906				9349509	Standard	NM_005864		Approved	EFS2, EFS1, HEFS, SIN, CASS3	uc001wjo.4	O43281	OTTHUMG00000028741	ENST00000216733.3:c.769C>T	14.37:g.23828918G>A		Somatic	50	0		WXS	Illumina HiSeq	Phase_I	62	19	NM_005864	0	0	0	0	0	B2RAJ7|B4DJ56|E9PGU2|O43282	Silent	SNP	ENST00000216733.3	37	CCDS9595.1																																																																																			.		0.642	EFS-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071770.2		
LRR1	122769	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	50081041	50081041	+	Missense_Mutation	SNP	G	G	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr14:50081041G>T	ENST00000298288.6	+	4	1396	c.1072G>T	c.(1072-1074)Gtt>Ttt	p.V358F	LRR1_ENST00000318317.4_Missense_Mutation_p.C117F	NM_152329.3	NP_689542.2	Q96L50	LLR1_HUMAN	leucine rich repeat protein 1	358					protein ubiquitination (GO:0016567)					kidney(2)|large_intestine(1)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						AAAAATTTGTGTTTGTGGAAG	0.368																																					p.V358F		.											.	LRR1-227	0			c.G1072T						.						117.0	111.0	113.0					14																	50081041		2203	4300	6503	SO:0001583	missense	122769	exon4			ATTTGTGTTTGTG	BC030142	CCDS9686.1, CCDS9687.1	14q21.3	2011-02-02	2011-02-02	2011-02-02	ENSG00000165501	ENSG00000165501			19742	protein-coding gene	gene with protein product	"""LRR-repeat protein 1"""	609193	"""peptidylprolyl isomerase (cyclophilin)-like 5"""	PPIL5		11804328, 21074724	Standard	NR_037792		Approved	MGC20689, LRR-1	uc001wwn.3	Q96L50	OTTHUMG00000140273	ENST00000298288.6:c.1072G>T	14.37:g.50081041G>T	ENSP00000298288:p.Val358Phe	Somatic	61	0		WXS	Illumina HiSeq	Phase_I	53	11	NM_152329	0	0	6	8	2	A5D6X3|B4DDE0|Q52M24|Q86SZ1|Q8N6H9	Missense_Mutation	SNP	ENST00000298288.6	37	CCDS9686.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.98|12.98	2.100514|2.100514	0.37048|0.37048	.|.	.|.	ENSG00000165501|ENSG00000165501	ENST00000318317|ENST00000298288	.|T	.|0.42513	.|0.97	5.55|5.55	3.74|3.74	0.42951|0.42951	.|.	.|0.342603	.|0.30820	.|N	.|0.008808	T|T	0.29850|0.29850	0.0746|0.0746	L|L	0.48642|0.48642	1.525|1.525	0.23050|0.23050	N|N	0.998374|0.998374	P|P	0.48503|0.37864	0.911|0.61	B|B	0.42282|0.30646	0.382|0.118	T|T	0.12785|0.12785	-1.0534|-1.0534	7|10	.|0.33940	.|T	.|0.23	-1.8537|-1.8537	8.4558|8.4558	0.32899|0.32899	0.149:0.1617:0.6893:0.0|0.149:0.1617:0.6893:0.0	.|.	117|358	Q96L50-2|Q96L50	.|LLR1_HUMAN	F|F	117|358	.|ENSP00000298288:V358F	.|ENSP00000298288:V358F	C|V	+|+	2|1	0|0	LRR1|LRR1	49150791|49150791	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.566000|0.566000	0.35808|0.35808	4.799000|4.799000	0.62517|0.62517	0.839000|0.839000	0.34971|0.34971	-0.142000|-0.142000	0.14014|0.14014	TGT|GTT	.		0.368	LRR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410790.1	NM_203467	
ZC2HC1C	79696	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	75537677	75537677	+	Missense_Mutation	SNP	G	G	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr14:75537677G>T	ENST00000524913.1	+	2	890	c.401G>T	c.(400-402)gGa>gTa	p.G134V	ACYP1_ENST00000555463.1_5'Flank|ZC2HC1C_ENST00000439583.2_Missense_Mutation_p.G134V|ZC2HC1C_ENST00000238686.8_Missense_Mutation_p.G134V|ZC2HC1C_ENST00000526748.1_Intron	NM_024643.2	NP_078919.2	Q53FD0	ZC21C_HUMAN	zinc finger, C2HC-type containing 1C	134							metal ion binding (GO:0046872)										AAACGAGTTGGAGTGGACCGG	0.522																																					p.G134V		.											.	.	0			c.G401T						.						98.0	96.0	97.0					14																	75537677		1869	4100	5969	SO:0001583	missense	79696	exon2			GAGTTGGAGTGGA	AK026746	CCDS41972.1, CCDS45138.1	14q24.3	2013-01-10	2012-02-03	2012-02-03	ENSG00000119703	ENSG00000119703		"""Zinc fingers, C2HC-type containing"""	20354	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 140"", ""family with sequence similarity 164, member C"""	C14orf140, FAM164C			Standard	XM_005268062		Approved		uc001xrh.3	Q53FD0	OTTHUMG00000167439	ENST00000524913.1:c.401G>T	14.37:g.75537677G>T	ENSP00000435550:p.Gly134Val	Somatic	96	0		WXS	Illumina HiSeq	Phase_I	95	31	NM_024643	0	0	1	4	3	E9PJQ0|Q9BTA8|Q9H5S9	Missense_Mutation	SNP	ENST00000524913.1	37	CCDS41972.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.02|15.02	2.709290|2.709290	0.48517|0.48517	.|.	.|.	ENSG00000119703|ENSG00000119703	ENST00000532198|ENST00000524913;ENST00000238686;ENST00000554763;ENST00000439583;ENST00000526130	.|T	.|0.76578	.|-1.03	4.53|4.53	4.53|4.53	0.55603|0.55603	.|.	.|0.080328	.|0.49916	.|D	.|0.000121	.|D	.|0.87111	.|0.6096	M|M	0.72118|0.72118	2.19|2.19	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.97110	.|1.0;0.997	.|D	.|0.87264	.|0.2281	.|9	.|.	.|.	.|.	-17.5211|-17.5211	17.4741|17.4741	0.87655|0.87655	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|134;134	.|Q53FD0;E9PJQ0	.|F164C_HUMAN;.	X|V	1|134	.|ENSP00000435550:G134V	.|.	E|G	+|+	1|2	0|0	FAM164C|FAM164C	74607430|74607430	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.325000|0.325000	0.28411|0.28411	6.888000|6.888000	0.75622|0.75622	2.356000|2.356000	0.79943|0.79943	0.557000|0.557000	0.71058|0.71058	GAG|GGA	.		0.522	ZC2HC1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394616.4	NM_001042430	
CIPC	85457	broad.mit.edu	37	14	77580242	77580242	+	Missense_Mutation	SNP	T	T	C	rs74069038		TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr14:77580242T>C	ENST00000361786.2	+	4	1098	c.781T>C	c.(781-783)Tcc>Ccc	p.S261P	RP11-463C8.4_ENST00000557752.1_Intron	NM_033426.2	NP_219494.2	Q9C0C6	CIPC_HUMAN		261					negative regulation of circadian rhythm (GO:0042754)|negative regulation of transcription, DNA-templated (GO:0045892)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				endometrium(2)|lung(4)|prostate(3)	9			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0284)		GACCTTCGCTTCCCCCGCCAG	0.562																																					p.S261P													.	KIAA1737-90	0			c.T781C						.						88.0	74.0	79.0					14																	77580242		2203	4300	6503	SO:0001583	missense	85457	exon4			TTCGCTTCCCCCG																												ENST00000361786.2:c.781T>C	14.37:g.77580242T>C	ENSP00000355319:p.Ser261Pro	Somatic	50	4		WXS	Illumina HiSeq	Phase_I	68	18	NM_033426	0	0	3	3	0	B2RCI1|Q8N389|Q8NDZ1	Missense_Mutation	SNP	ENST00000361786.2	37	CCDS9855.1	.	.	.	.	.	.	.	.	.	.	T	15.35	2.807816	0.50421	.	.	ENSG00000198894	ENST00000361786	T	0.32988	1.43	5.58	2.99	0.34606	.	0.707769	0.14711	N	0.302928	T	0.30103	0.0754	L	0.51422	1.61	0.19300	N	0.999979	P;P	0.34757	0.467;0.467	B;B	0.37888	0.26;0.133	T	0.13710	-1.0499	10	0.42905	T	0.14	-7.2446	10.5458	0.45060	0.0:0.0:0.3101:0.6899	.	261;163	Q9C0C6;B3KU75	K1737_HUMAN;.	P	261	ENSP00000355319:S261P	ENSP00000355319:S261P	S	+	1	0	KIAA1737	76649995	0.055000	0.20627	0.472000	0.27241	0.974000	0.67602	1.196000	0.32198	1.019000	0.39547	0.454000	0.30748	TCC	T|0.500;C|0.500		0.562	KIAA1737-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414278.1		
DYNC1H1	1778	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	102478240	102478240	+	Missense_Mutation	SNP	T	T	C			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr14:102478240T>C	ENST00000360184.4	+	33	6811	c.6647T>C	c.(6646-6648)aTc>aCc	p.I2216T		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	2216	AAA 2. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						ATCACCCAGATCAATCATGGC	0.602																																					p.I2216T		.											.	DYNC1H1-98	0			c.T6647C						.						86.0	74.0	78.0					14																	102478240		2203	4300	6503	SO:0001583	missense	1778	exon33			CCCAGATCAATCA	AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.6647T>C	14.37:g.102478240T>C	ENSP00000348965:p.Ile2216Thr	Somatic	80	0		WXS	Illumina HiSeq	Phase_I	87	27	NM_001376	0	0	12	19	7	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	ENST00000360184.4	37	CCDS9966.1	.	.	.	.	.	.	.	.	.	.	T	18.82	3.705776	0.68615	.	.	ENSG00000197102	ENST00000360184	T	0.27402	1.67	5.8	5.8	0.92144	ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	T	0.33265	0.0857	L	0.44542	1.39	0.80722	D	1	P	0.45348	0.856	P	0.44394	0.448	T	0.03423	-1.1038	10	0.40728	T	0.16	.	16.1547	0.81649	0.0:0.0:0.0:1.0	.	2216	Q14204	DYHC1_HUMAN	T	2216	ENSP00000348965:I2216T	ENSP00000348965:I2216T	I	+	2	0	DYNC1H1	101547993	1.000000	0.71417	0.998000	0.56505	0.984000	0.73092	7.991000	0.88244	2.221000	0.72209	0.528000	0.53228	ATC	.		0.602	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376	
PACS2	23241	broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	105833603	105833603	+	Silent	SNP	C	C	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr14:105833603C>T	ENST00000325438.8	+	5	981	c.477C>T	c.(475-477)atC>atT	p.I159I	PACS2_ENST00000458164.2_Silent_p.I159I|PACS2_ENST00000447393.1_Silent_p.I159I|PACS2_ENST00000547217.1_Silent_p.I129I|PACS2_ENST00000430725.2_Silent_p.I92I			Q86VP3	PACS2_HUMAN	phosphofurin acidic cluster sorting protein 2	159					apoptotic process (GO:0006915)|autophagic vacuole assembly (GO:0000045)|protein localization to pre-autophagosomal structure (GO:0034497)|protein targeting to plasma membrane (GO:0072661)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)				endometrium(2)|kidney(2)|lung(7)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	21		all_cancers(154;0.0351)|all_epithelial(191;0.153)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.0145)|Epithelial(46;0.036)	Epithelial(152;0.138)		GCAGCAGCATCAAGGAGGCCC	0.647																																					p.I159I													.	PACS2-69	0			c.C477T						.						51.0	56.0	54.0					14																	105833603		2203	4300	6503	SO:0001819	synonymous_variant	23241	exon5			CAGCATCAAGGAG	AB011174	CCDS32168.1, CCDS45178.1, CCDS45178.2, CCDS58339.1	14q32	2005-02-15	2005-02-15	2005-02-15		ENSG00000179364			23794	protein-coding gene	gene with protein product		610423	"""phosphofurin acidic cluster sorting protein 1-like"""	PACS1L		15692567	Standard	NM_001100913		Approved	KIAA0602	uc001yqu.3	Q86VP3	OTTHUMG00000170450	ENST00000325438.8:c.477C>T	14.37:g.105833603C>T		Somatic	148	1		WXS	Illumina HiSeq	Phase_I	210	60	NM_001100913	0	0	17	32	15	A2VDJ9|G8JLK3|O60342|Q6P191|Q96FL7	Silent	SNP	ENST00000325438.8	37	CCDS32168.1																																																																																			.		0.647	PACS2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000409209.1	XM_377355	
HERC2	8924	broad.mit.edu;ucsc.edu	37	15	28437274	28437274	+	Missense_Mutation	SNP	G	G	C	rs543946257		TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr15:28437274G>C	ENST00000261609.7	-	53	8392	c.8284C>G	c.(8284-8286)Cgt>Ggt	p.R2762G		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2									p.R2762G(3)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		TTTCCAGAACGGCCACAAAAT	0.493											OREG0022997	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	1	0.000199681	0.0008	0.0	5008	,	,		17962	0.0		0.0	False		,,,				2504	0.0				p.R2762G													.	HERC2-234	3	Substitution - Missense(3)	ovary(1)|NS(1)|central_nervous_system(1)	c.C8284G						.						97.0	96.0	96.0					15																	28437274		2203	4300	6503	SO:0001583	missense	8924	exon53			CAGAACGGCCACA	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.8284C>G	15.37:g.28437274G>C	ENSP00000261609:p.Arg2762Gly	Somatic	34	0	801	WXS	Illumina HiSeq	Phase_I	67	5	NM_004667	0	0	5	8	3		Missense_Mutation	SNP	ENST00000261609.7	37	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	G	19.69	3.874685	0.72180	.	.	ENSG00000128731	ENST00000261609	T	0.62788	0.0	5.67	5.67	0.87782	Anaphase-promoting complex, subunit 10/DOC domain (1);Galactose-binding domain-like (1);	0.054132	0.85682	D	0.000000	T	0.77157	0.4089	L	0.53249	1.67	0.80722	D	1	D;D	0.69078	0.997;0.987	D;D	0.76071	0.987;0.953	T	0.77861	-0.2430	10	0.72032	D	0.01	.	19.7646	0.96335	0.0:0.0:1.0:0.0	.	229;2762	A8KAQ8;O95714	.;HERC2_HUMAN	G	2762	ENSP00000261609:R2762G	ENSP00000261609:R2762G	R	-	1	0	HERC2	26110869	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.808000	0.99193	2.675000	0.91044	0.471000	0.43371	CGT	.		0.493	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	
TRIM69	140691	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	45048565	45048565	+	Splice_Site	SNP	G	G	C			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr15:45048565G>C	ENST00000559390.1	+	4	1411		c.e4-1		TRIM69_ENST00000558329.1_Splice_Site|TRIM69_ENST00000329464.4_Splice_Site|TRIM69_ENST00000558173.1_Splice_Site|TRIM69_ENST00000560442.1_Splice_Site|TRIM69_ENST00000561043.1_Splice_Site|TRIM69_ENST00000338264.4_Splice_Site			Q86WT6	TRI69_HUMAN	tripartite motif containing 69						apoptotic process (GO:0006915)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(9)|skin(1)	20		all_cancers(109;2.47e-13)|all_epithelial(112;2.84e-11)|Lung NSC(122;2.23e-07)|all_lung(180;1.81e-06)|Melanoma(134;0.0122)		all cancers(107;5.5e-19)|GBM - Glioblastoma multiforme(94;1.07e-06)|Colorectal(105;0.138)|COAD - Colon adenocarcinoma(120;0.141)		GATATTCCCAGGAGGAGCTTG	0.488																																					.	Pancreas(84;519 1450 1802 20427 34706)	.											.	TRIM69-90	0			c.7-1G>C						.						41.0	39.0	40.0					15																	45048565		1927	3624	5551	SO:0001630	splice_region_variant	140691	exon2			TTCCCAGGAGGAG	AF302088	CCDS10114.1, CCDS32220.1, CCDS73719.1	15q15-q21	2013-01-09	2011-01-25	2006-09-26	ENSG00000185880	ENSG00000185880		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	17857	protein-coding gene	gene with protein product			"""ring finger protein 36"", ""tripartite motif-containing 69"""	RNF36			Standard	XM_005254162		Approved	Trif, TRIMLESS	uc001zug.1	Q86WT6	OTTHUMG00000131246	ENST00000559390.1:c.484-1G>C	15.37:g.45048565G>C		Somatic	93	0		WXS	Illumina HiSeq	Phase_I	130	61	NM_080745	0	0	0	0	0	A8MX03|Q309B0|Q4G1A5|Q6W897|Q8IYY3|Q8WY16|Q8WY17	Splice_Site	SNP	ENST00000559390.1	37	CCDS32220.1	.	.	.	.	.	.	.	.	.	.	G	10.44	1.350808	0.24512	.	.	ENSG00000185880	ENST00000329464;ENST00000338264	.	.	.	5.34	4.43	0.53597	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.9849	0.53142	0.0847:0.0:0.9153:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TRIM69	42835857	1.000000	0.71417	0.995000	0.50966	0.200000	0.23975	4.849000	0.62882	1.391000	0.46566	0.655000	0.94253	.	.		0.488	TRIM69-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416171.1		Intron
FBN1	2200	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	48748937	48748937	+	Silent	SNP	G	G	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr15:48748937G>T	ENST00000316623.5	-	44	5774	c.5319C>A	c.(5317-5319)atC>atA	p.I1773I		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	1773	EGF-like 29; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		AGACCCCTGGGATCTCCCGGC	0.468																																					p.I1773I		.											.	FBN1-92	0			c.C5319A						.						112.0	99.0	103.0					15																	48748937		2198	4296	6494	SO:0001819	synonymous_variant	2200	exon44			CCCTGGGATCTCC	X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.5319C>A	15.37:g.48748937G>T		Somatic	70	0		WXS	Illumina HiSeq	Phase_I	112	44	NM_000138	0	0	0	0	0	B2RUU0|D2JYH6|Q15972|Q75N87	Silent	SNP	ENST00000316623.5	37	CCDS32232.1																																																																																			.		0.468	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417355.1		
CILP	8483	broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	65494241	65494241	+	Silent	SNP	C	C	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr15:65494241C>A	ENST00000261883.4	-	8	1321	c.1155G>T	c.(1153-1155)gtG>gtT	p.V385V		NM_003613.3	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein, nucleotide pyrophosphohydrolase	385	Ig-like C2-type.				negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(17)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	55						CCTTGGACTTCACAGCCCCAG	0.587																																					p.V385V													.	CILP-97	0			c.G1155T						.						74.0	66.0	68.0					15																	65494241		2202	4299	6501	SO:0001819	synonymous_variant	8483	exon8			GGACTTCACAGCC	AY358904	CCDS10203.1	15q22	2013-01-14			ENSG00000138615	ENSG00000138615		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1980	protein-coding gene	gene with protein product		603489				9722584, 9722583	Standard	NM_003613		Approved	HsT18872	uc002aon.2	O75339	OTTHUMG00000133140	ENST00000261883.4:c.1155G>T	15.37:g.65494241C>A		Somatic	68	1		WXS	Illumina HiSeq	Phase_I	109	42	NM_003613	0	0	0	0	0	B2R8F7|Q6UW99|Q8IYI5	Silent	SNP	ENST00000261883.4	37	CCDS10203.1																																																																																			.		0.587	CILP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256829.1	NM_003613	
SLC24A1	9187	bcgsc.ca	37	15	65917018	65917018	+	Nonsense_Mutation	SNP	C	C	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr15:65917018C>A	ENST00000261892.6	+	2	887	c.600C>A	c.(598-600)taC>taA	p.Y200*	SLC24A1_ENST00000546330.1_Nonsense_Mutation_p.Y200*|SLC24A1_ENST00000339868.6_Nonsense_Mutation_p.Y200*|SLC24A1_ENST00000544319.2_Nonsense_Mutation_p.Y200*|SLC24A1_ENST00000537259.1_Nonsense_Mutation_p.Y200*|SLC24A1_ENST00000399033.4_Nonsense_Mutation_p.Y200*	NM_001254740.1|NM_004727.2	NP_001241669.1|NP_004718.1	O60721	NCKX1_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 1	200					calcium ion transport (GO:0006816)|ion transport (GO:0006811)|phototransduction, visible light (GO:0007603)|response to light intensity (GO:0009642)|rhodopsin mediated signaling pathway (GO:0016056)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|outer membrane (GO:0019867)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)			breast(2)|endometrium(7)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23						TAGGCACTTACGTGCCGTCCA	0.483																																					p.Y200X													.	.	0			c.C600A						.						39.0	38.0	38.0					15																	65917018		1990	4165	6155	SO:0001587	stop_gained	9187	exon2			CACTTACGTGCCG	AF062922	CCDS45284.1, CCDS73742.1, CCDS73743.1, CCDS73744.1	15q22.31	2014-01-28			ENSG00000074621	ENSG00000074621		"""Solute carriers"""	10975	protein-coding gene	gene with protein product		603617				9856482	Standard	NM_004727		Approved	NCKX1, NCKX, RODX, KIAA0702, HsT17412, CSNB1D	uc010ujf.2	O60721	OTTHUMG00000167960	ENST00000261892.6:c.600C>A	15.37:g.65917018C>A	ENSP00000261892:p.Tyr200*	Somatic	90	2		WXS	Illumina HiSeq	Phase_1	141	62	NM_004727	0	0	1	4	3	O43485|O75184|Q17RM9	Nonsense_Mutation	SNP	ENST00000261892.6	37	CCDS45284.1	.	.	.	.	.	.	.	.	.	.	C	12.20	1.866018	0.32977	.	.	ENSG00000074621	ENST00000537259;ENST00000261892;ENST00000339868;ENST00000544319;ENST00000399033;ENST00000546330	.	.	.	4.86	-3.5	0.04710	.	2.099530	0.02129	N	0.056221	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.2443	0.15488	0.0:0.4023:0.3219:0.2758	.	.	.	.	X	200	.	ENSP00000261892:Y200X	Y	+	3	2	SLC24A1	63704071	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.885000	0.04161	-0.305000	0.08831	-0.290000	0.09829	TAC	.		0.483	SLC24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397304.1	NM_004727	
SV2B	9899	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	91811781	91811781	+	Missense_Mutation	SNP	T	T	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr15:91811781T>A	ENST00000394232.1	+	9	1789	c.1319T>A	c.(1318-1320)aTc>aAc	p.I440N	SV2B_ENST00000545111.2_Missense_Mutation_p.I289N|SV2B_ENST00000330276.4_Missense_Mutation_p.I440N	NM_014848.4	NP_055663.1	Q7L1I2	SV2B_HUMAN	synaptic vesicle glycoprotein 2B	440					neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	transmembrane transporter activity (GO:0022857)			NS(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(17)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	42	Lung NSC(78;0.0987)|all_lung(78;0.172)		BRCA - Breast invasive adenocarcinoma(143;0.0895)			GGCGCCACAATCAACTTCACG	0.428																																					p.I440N		.											.	SV2B-97	0			c.T1319A						.						139.0	136.0	137.0					15																	91811781		2198	4298	6496	SO:0001583	missense	9899	exon10			CCACAATCAACTT	AB018278	CCDS10370.1, CCDS53972.1	15q26.1	2005-01-10			ENSG00000185518	ENSG00000185518			16874	protein-coding gene	gene with protein product		185861				9872452, 7681585	Standard	NM_014848		Approved	KIAA0735, HsT19680	uc002bqv.3	Q7L1I2	OTTHUMG00000149833	ENST00000394232.1:c.1319T>A	15.37:g.91811781T>A	ENSP00000377779:p.Ile440Asn	Somatic	176	0		WXS	Illumina HiSeq	Phase_I	271	21	NM_014848	0	0	0	0	0	B4DH30|C6G489|O94840|Q6IAR8	Missense_Mutation	SNP	ENST00000394232.1	37	CCDS10370.1	.	.	.	.	.	.	.	.	.	.	T	24.7	4.561903	0.86335	.	.	ENSG00000185518	ENST00000545111;ENST00000394232;ENST00000330276	T;T;T	0.61980	0.06;0.06;0.06	5.49	5.49	0.81192	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.043947	0.85682	D	0.000000	T	0.55273	0.1910	L	0.34521	1.04	0.43761	D	0.99627	P	0.41159	0.74	B	0.43386	0.418	T	0.52260	-0.8599	10	0.24483	T	0.36	-35.1417	14.7146	0.69257	0.0:0.0:0.0:1.0	.	440	Q7L1I2	SV2B_HUMAN	N	289;440;440	ENSP00000443243:I289N;ENSP00000377779:I440N;ENSP00000332818:I440N	ENSP00000332818:I440N	I	+	2	0	SV2B	89612785	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	7.750000	0.85110	2.212000	0.71576	0.533000	0.62120	ATC	.		0.428	SV2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313494.3	NM_014848	
PGPEP1L	145814	hgsc.bcm.edu	37	15	99544418	99544418	+	Missense_Mutation	SNP	C	C	T	rs149174294	byFrequency	TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr15:99544418C>T	ENST00000378919.6	-	2	224	c.19G>A	c.(19-21)Gtg>Atg	p.V7M	PGPEP1L_ENST00000535714.1_Intron|RP11-654A16.3_ENST00000559468.1_RNA	NM_001102612.2	NP_001096082.2	A6NFU8	PGPIL_HUMAN	pyroglutamyl-peptidase I-like	7							cysteine-type peptidase activity (GO:0008234)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(2)|skin(1)|stomach(1)	14						acactcaccacgagagtccgc	0.458													C|||	773	0.154353	0.0469	0.17	5008	,	,		20819	0.3502		0.0457	False		,,,				2504	0.1984				p.V7M		.											.	.	0			c.G19A						.						1.0	1.0	1.0					15																	99544418		193	151	344	SO:0001583	missense	145814	exon2			TCACCACGAGAGT		CCDS53977.1, CCDS58400.1	15q26.3	2010-02-16			ENSG00000183571	ENSG00000183571			27080	protein-coding gene	gene with protein product							Standard	NM_001102612		Approved		uc002bum.3	A6NFU8		ENST00000378919.6:c.19G>A	15.37:g.99544418C>T	ENSP00000368199:p.Val7Met	Somatic	0	0		WXS	Illumina HiSeq	Phase_I	4	4	NM_001102612	0	0	1	1	0	H0YF86	Missense_Mutation	SNP	ENST00000378919.6	37	CCDS53977.1	325	0.1488095238095238	28	0.056910569105691054	49	0.13535911602209943	211	0.3688811188811189	37	0.048812664907651716	C	1.763	-0.486281	0.04352	.	.	ENSG00000183571	ENST00000378919	T	0.31510	1.49	.	.	.	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.09022	0.002	B	0.01281	0.0	T	0.45190	-0.9278	6	0.49607	T	0.09	-8.6959	.	.	.	.	7	A6NFU8	PGPIL_HUMAN	M	7	ENSP00000368199:V7M	ENSP00000368199:V7M	V	-	1	0	PGPEP1L	97361941	0.007000	0.16637	0.018000	0.16275	0.019000	0.09904	0.145000	0.16157	0.119000	0.18210	0.121000	0.15741	GTG	C|0.851;T|0.149		0.458	PGPEP1L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415703.1	NM_001102612.2	
WFIKKN1	117166	broad.mit.edu	37	16	683832	683832	+	Silent	SNP	C	C	A	rs541743223		TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr16:683832C>A	ENST00000319070.2	+	2	1744	c.1422C>A	c.(1420-1422)ggC>ggA	p.G474G		NM_053284.2	NP_444514.1	Q96NZ8	WFKN1_HUMAN	WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 1	474	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				muscle fiber development (GO:0048747)|negative regulation of DNA binding (GO:0043392)|negative regulation of protein binding (GO:0032091)|palate development (GO:0060021)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(1)|prostate(1)|upper_aerodigestive_tract(1)	4		Hepatocellular(780;0.00335)				AGTTCTTGGGCACCAAGTACC	0.677																																					p.G474G													.	WFIKKN1-90	0			c.C1422A						.						76.0	42.0	53.0					16																	683832		2178	4291	6469	SO:0001819	synonymous_variant	117166	exon2			CTTGGGCACCAAG	AK075356	CCDS10414.1	16p13	2013-01-21			ENSG00000127578	ENSG00000127578		"""Immunoglobulin superfamily / I-set domain containing"", ""WAP four-disulfide core domain containing"""	30912	protein-coding gene	gene with protein product	"""WAP four-disulfide core domain 20A"""	608021	"""chromosome 16 open reading frame 12"""	C16orf12		11274388, 11928817	Standard	NM_053284		Approved	RJD2, WFIKKN, WFDC20A	uc002cht.1	Q96NZ8	OTTHUMG00000090359	ENST00000319070.2:c.1422C>A	16.37:g.683832C>A		Somatic	68	1		WXS	Illumina HiSeq	Phase_I	235	8	NM_053284	0	0	0	0	0	Q7LDW0|Q8NBQ1|Q96S20	Silent	SNP	ENST00000319070.2	37	CCDS10414.1																																																																																			.		0.677	WFIKKN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206731.2	NM_053284	
RPL3L	6123	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	1995884	1995884	+	Silent	SNP	C	C	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr16:1995884C>T	ENST00000268661.7	-	8	1093	c.999G>A	c.(997-999)ctG>ctA	p.L333L	MSRB1_ENST00000399753.2_5'Flank|MSRB1_ENST00000361871.3_5'Flank|MSRB1_ENST00000564908.1_5'Flank	NM_005061.2	NP_005052.1	Q92901	RL3L_HUMAN	ribosomal protein L3-like	333					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)|ribosome (GO:0005840)	RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	17						TACAACCCTTCAGCATGACGA	0.602																																					p.L333L		.											.	RPL3L-90	0			c.G999A						.						164.0	138.0	147.0					16																	1995884		2199	4300	6499	SO:0001819	synonymous_variant	6123	exon8			ACCCTTCAGCATG	U65581	CCDS10450.1	16p13.3	2008-02-05			ENSG00000140986	ENSG00000140986		"""L ribosomal proteins"""	10351	protein-coding gene	gene with protein product						8921388	Standard	NM_005061		Approved		uc002cnh.3	Q92901	OTTHUMG00000128685	ENST00000268661.7:c.999G>A	16.37:g.1995884C>T		Somatic	35	0		WXS	Illumina HiSeq	Phase_I	74	5	NM_005061	0	0	0	0	0		Silent	SNP	ENST00000268661.7	37	CCDS10450.1																																																																																			.		0.602	RPL3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250582.2	NM_005061	
PKMYT1	9088	hgsc.bcm.edu	37	16	3025761	3025761	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr16:3025761G>A	ENST00000262300.8	-	4	939	c.431C>T	c.(430-432)cCa>cTa	p.P144L	PKMYT1_ENST00000573944.1_Missense_Mutation_p.P135L|PKMYT1_ENST00000440027.2_Missense_Mutation_p.P144L|PKMYT1_ENST00000431515.2_Missense_Mutation_p.P144L|PKMYT1_ENST00000574730.1_Missense_Mutation_p.P75L|PKMYT1_ENST00000574385.1_Missense_Mutation_p.P135L	NM_001258450.1|NM_004203.4|NM_182687.2	NP_001245379.1|NP_004194.3|NP_872629.1	Q99640	PMYT1_HUMAN	protein kinase, membrane associated tyrosine/threonine 1	144	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	10						GCCCCGGAATGGTGACATGGA	0.667																																					p.P144L		.											.	PKMYT1-765	0			c.C431T						.						25.0	27.0	26.0					16																	3025761		2153	4235	6388	SO:0001583	missense	9088	exon4			CGGAATGGTGACA	AK097642	CCDS10486.1, CCDS45391.1, CCDS58414.1, CCDS58415.1	16p13.3	2014-06-13			ENSG00000127564	ENSG00000127564			29650	protein-coding gene	gene with protein product	"""membrane-associated tyrosine- and threonine-specific cdc2-inhibitory kinase"", ""protein phosphatase 1, regulatory subunit 126"""	602474				9001210, 12606722	Standard	NM_004203		Approved	MYT1, PPP1R126	uc002csn.3	Q99640	OTTHUMG00000128975	ENST00000262300.8:c.431C>T	16.37:g.3025761G>A	ENSP00000262300:p.Pro144Leu	Somatic	5	0		WXS	Illumina HiSeq	Phase_I	86	33	NM_182687	0	0	1	1	0	B3KUN8|B4DXD4|D3DUA4|F8W164|I3L1V2|O14731|Q7LE24|Q8TCM9	Missense_Mutation	SNP	ENST00000262300.8	37	CCDS10486.1	.	.	.	.	.	.	.	.	.	.	G	15.79	2.938404	0.52972	.	.	ENSG00000127564	ENST00000431515;ENST00000262300;ENST00000440027;ENST00000402679;ENST00000382240	T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15	5.69	5.69	0.88448	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.059815	0.64402	D	0.000002	T	0.47266	0.1436	N	0.11818	0.18	0.80722	D	1	P;P;P;P	0.43701	0.56;0.704;0.56;0.815	B;B;B;B	0.39068	0.217;0.217;0.217;0.289	T	0.56498	-0.7969	10	0.66056	D	0.02	-14.3456	17.2983	0.87175	0.0:0.0:1.0:0.0	.	135;75;144;144	A6NHV6;B4DXD4;Q99640;F8W164	.;.;PMYT1_HUMAN;.	L	144;144;144;144;135	ENSP00000392855:P144L;ENSP00000262300:P144L;ENSP00000397739:P144L;ENSP00000371675:P135L	ENSP00000262300:P144L	P	-	2	0	PKMYT1	2965762	1.000000	0.71417	0.237000	0.24090	0.956000	0.61745	4.915000	0.63355	2.676000	0.91093	0.655000	0.94253	CCA	.		0.667	PKMYT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250963.2	NM_004203	
NLRC3	197358	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	3614323	3614323	+	RNA	SNP	G	G	C			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr16:3614323G>C	ENST00000301749.7	-	0	1020				NLRC3_ENST00000448023.2_RNA|NLRC3_ENST00000359128.5_RNA|NLRC3_ENST00000419350.2_RNA|NLRC3_ENST00000603507.1_RNA|NLRC3_ENST00000324659.8_RNA	NM_178844.2	NP_849172.2	Q7RTR2	NLRC3_HUMAN	NLR family, CARD domain containing 3						I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|regulation of protein ubiquitination (GO:0031396)|response to lipopolysaccharide (GO:0032496)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(16)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CCACCGCCAGGCTGGGCTCCC	0.662																																					p.S205R		.											.	NLRC3-96	0			c.C615G						.						31.0	37.0	35.0					16																	3614323		2003	4170	6173			197358	exon5			CGCCAGGCTGGGC	BK001112	CCDS73817.1	16p13.3	2014-03-25			ENSG00000167984	ENSG00000167984		"""Nucleotide-binding domain and leucine rich repeat containing"""	29889	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 3"", ""NOD-like receptor C3"""	615648				15705585, 12766759	Standard	NM_178844		Approved	CLR16.2, FLJ00348, NOD3	uc010btn.3	Q7RTR2	OTTHUMG00000177561		16.37:g.3614323G>C		Somatic	57	0		WXS	Illumina HiSeq	Phase_I	95	32	NM_178844	0	0	0	0	0	Q5EY36|Q8NF48|Q8NI01|Q8NI02|Q8TEL3	Missense_Mutation	SNP	ENST00000301749.7	37		.	.	.	.	.	.	.	.	.	.	G	1.295	-0.606481	0.03717	.	.	ENSG00000167984	ENST00000419350;ENST00000301749;ENST00000359128;ENST00000448023;ENST00000324659	T;T;T;T	0.79033	-1.23;-1.23;-1.23;-1.23	4.84	0.17	0.15021	.	0.625501	0.16533	N	0.210300	T	0.55625	0.1932	.	.	.	0.09310	N	1	B	0.10296	0.003	B	0.15870	0.014	T	0.32107	-0.9919	9	0.17832	T	0.49	.	4.5952	0.12325	0.0829:0.2788:0.4949:0.1434	.	252	C9JLH9	.	R	205;205;205;252;187	ENSP00000301749:S205R;ENSP00000352039:S205R;ENSP00000414415:S252R;ENSP00000323897:S187R	ENSP00000301749:S205R	S	-	3	2	NLRC3	3554324	0.000000	0.05858	0.004000	0.12327	0.008000	0.06430	0.471000	0.22100	0.074000	0.16767	0.655000	0.94253	AGC	.		0.662	NLRC3-201	KNOWN	basic|appris_principal	protein_coding	polymorphic_pseudogene		NM_178844	
CREBBP	1387	hgsc.bcm.edu;broad.mit.edu	37	16	3779018	3779018	+	Silent	SNP	C	C	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr16:3779018C>T	ENST00000262367.5	-	31	6839	c.6030G>A	c.(6028-6030)ggG>ggA	p.G2010G	CREBBP_ENST00000382070.3_Silent_p.G1972G	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	2010					cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		GCATGACGGGCCCGCTCACCT	0.692			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																														p.G2010G		.		Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	.	CREBBP-1807	0			c.G6030A						.						12.0	14.0	13.0					16																	3779018		2185	4287	6472	SO:0001819	synonymous_variant	1387	exon31			GACGGGCCCGCTC	U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.6030G>A	16.37:g.3779018C>T		Somatic	14	0		WXS	Illumina HiSeq	Phase_I	58	18	NM_004380	0	0	10	16	6	D3DUC9|O00147|Q16376|Q4LE28	Silent	SNP	ENST00000262367.5	37	CCDS10509.1																																																																																			.		0.692	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380	
METTL22	79091	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	8736394	8736394	+	Missense_Mutation	SNP	T	T	C			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr16:8736394T>C	ENST00000381920.3	+	9	1240	c.982T>C	c.(982-984)Tgc>Cgc	p.C328R	METTL22_ENST00000568967.1_3'UTR|METTL22_ENST00000561758.1_Missense_Mutation_p.C272R	NM_024109.2	NP_077014.2	Q9BUU2	MET22_HUMAN	methyltransferase like 22	328						nucleus (GO:0005634)	methyltransferase activity (GO:0008168)			large_intestine(5)|lung(4)	9						GAAAAATGCCTGCACAGCCAT	0.532																																					p.C328R		.											.	METTL22-90	0			c.T982C						.						124.0	139.0	134.0					16																	8736394		2055	4190	6245	SO:0001583	missense	79091	exon9			AATGCCTGCACAG	AK022495	CCDS10533.2	16p13.2	2014-07-15	2011-03-03	2011-03-03	ENSG00000067365	ENSG00000067365			28368	protein-coding gene	gene with protein product		615261	"""chromosome 16 open reading frame 68"""	C16orf68		24140279	Standard	XM_005255570		Approved	FLJ12433,MGC2654	uc002cyz.3	Q9BUU2	OTTHUMG00000129694	ENST00000381920.3:c.982T>C	16.37:g.8736394T>C	ENSP00000371345:p.Cys328Arg	Somatic	103	0		WXS	Illumina HiSeq	Phase_I	157	65	NM_024109	0	0	20	32	12	B2RD29|D3DUF2|Q6XYB4|Q9HA03	Missense_Mutation	SNP	ENST00000381920.3	37	CCDS10533.2	.	.	.	.	.	.	.	.	.	.	T	10.28	1.307330	0.23821	.	.	ENSG00000067365	ENST00000381920	T	0.40756	1.02	5.18	5.18	0.71444	.	0.177884	0.49305	D	0.000145	T	0.43590	0.1254	L	0.41710	1.295	0.80722	D	1	D;P	0.53462	0.96;0.752	P;P	0.54312	0.748;0.469	T	0.19976	-1.0289	10	0.14252	T	0.57	-39.2838	11.4298	0.50034	0.0:0.0:0.0:1.0	.	103;328	Q9BUU2-3;Q9BUU2	.;MET22_HUMAN	R	328	ENSP00000371345:C328R	ENSP00000371345:C328R	C	+	1	0	METTL22	8643895	1.000000	0.71417	1.000000	0.80357	0.286000	0.27126	2.384000	0.44362	1.956000	0.56807	0.533000	0.62120	TGC	.		0.532	METTL22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251901.1	NM_024109	
ERN2	10595	broad.mit.edu;ucsc.edu	37	16	23713536	23713536	+	Silent	SNP	C	C	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr16:23713536C>T	ENST00000457008.2	-	11	1178	c.1140G>A	c.(1138-1140)ctG>ctA	p.L380L	ERN2_ENST00000256797.4_Silent_p.L428L					endoplasmic reticulum to nucleus signaling 2											large_intestine(2)|lung(2)|ovary(2)	6				GBM - Glioblastoma multiforme(48;0.0156)		TTCCACTCCCCAGGGTGGGAT	0.607																																					p.L428L													.	ERN2-322	0			c.G1284A						.						90.0	95.0	94.0					16																	23713536		2197	4300	6497	SO:0001819	synonymous_variant	10595	exon11			ACTCCCCAGGGTG	AA527544	CCDS32407.1	16p12.2	2008-02-05	2007-08-14			ENSG00000134398			16942	protein-coding gene	gene with protein product		604034	"""ER to nucleus signalling 2"""			9755171, 11175748	Standard	NM_033266		Approved	IRE1b	uc002dma.4	Q76MJ5		ENST00000457008.2:c.1140G>A	16.37:g.23713536C>T		Somatic	45	1		WXS	Illumina HiSeq	Phase_I	80	15	NM_033266	0	0	0	0	0		Silent	SNP	ENST00000457008.2	37																																																																																				.		0.607	ERN2-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000434886.1		
CETP	1071	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	57012127	57012127	+	Missense_Mutation	SNP	G	G	A	rs144949752		TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr16:57012127G>A	ENST00000566128.1	+	11	1178	c.911G>A	c.(910-912)cGc>cAc	p.R304H	CETP_ENST00000200676.3_Missense_Mutation_p.R369H|CETP_ENST00000379780.2_Missense_Mutation_p.R309H					cholesteryl ester transfer protein, plasma											NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(4)|skin(3)	23						CTCTTTCCACGCCCAGACCAG	0.542																																					p.R369H													.	CETP-91	0			c.G1106A						.	G	HIS/ARG	1,4395	2.1+/-5.4	0,1,2197	165.0	149.0	155.0		1106	-6.8	0.0	16	dbSNP_134	155	0,8600		0,0,4300	no	missense	CETP	NM_000078.2	29	0,1,6497	AA,AG,GG		0.0,0.0227,0.0077	benign	369/494	57012127	1,12995	2198	4300	6498	SO:0001583	missense	1071	exon11			TTCCACGCCCAGA	M30185	CCDS10772.1, CCDS67032.1	16q13	2012-10-02			ENSG00000087237	ENSG00000087237		"""BPI fold containing"""	1869	protein-coding gene	gene with protein product	"""BPI fold containing family F"""	118470				3600759, 2334701	Standard	NM_000078		Approved	BPIFF	uc002eki.2	P11597	OTTHUMG00000133279	ENST00000566128.1:c.911G>A	16.37:g.57012127G>A	ENSP00000456276:p.Arg304His	Somatic	144	1		WXS	Illumina HiSeq	Phase_I	198	21	NM_000078	0	0	9	9	0		Missense_Mutation	SNP	ENST00000566128.1	37		.	.	.	.	.	.	.	.	.	.	G	7.501	0.652743	0.14580	2.27E-4	0.0	ENSG00000087237	ENST00000200676;ENST00000379780	T;T	0.09445	2.98;2.98	4.23	-6.83	0.01693	Lipid-binding serum glycoprotein, C-terminal (2);Bactericidal permeability-increasing protein, alpha/beta domain (1);	1.648930	0.03515	N	0.220082	T	0.05410	0.0143	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.36456	-0.9747	10	0.35671	T	0.21	-6.9101	9.1715	0.37083	0.5114:0.0989:0.3897:0.0	.	309;369	P11597-2;P11597	.;CETP_HUMAN	H	369;309	ENSP00000200676:R369H;ENSP00000369106:R309H	ENSP00000200676:R369H	R	+	2	0	CETP	55569628	0.000000	0.05858	0.000000	0.03702	0.161000	0.22273	-1.331000	0.02672	-1.478000	0.01869	-0.252000	0.11476	CGC	G|1.000;A|0.000		0.542	CETP-003	PUTATIVE	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000432305.1	NM_000078	
ZNF469	84627	broad.mit.edu;ucsc.edu	37	16	88497843	88497843	+	Missense_Mutation	SNP	G	G	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr16:88497843G>T	ENST00000437464.1	+	2	3881	c.3881G>T	c.(3880-3882)cGc>cTc	p.R1294L	ZNF469_ENST00000565624.1_Missense_Mutation_p.R1322L	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	1294	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						CCCCCTGCCCGCCAGCCTGGA	0.632																																					p.R1294L													.	.	0			c.G3881T						.						15.0	16.0	16.0					16																	88497843		691	1587	2278	SO:0001583	missense	84627	exon2			CTGCCCGCCAGCC	AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.3881G>T	16.37:g.88497843G>T	ENSP00000402343:p.Arg1294Leu	Somatic	70	1		WXS	Illumina HiSeq	Phase_I	110	13	NM_001127464	0	0	0	0	0		Missense_Mutation	SNP	ENST00000437464.1	37	CCDS45544.1	.	.	.	.	.	.	.	.	.	.	G	2.973	-0.211962	0.06140	.	.	ENSG00000225614	ENST00000437464	T	0.05319	3.46	4.53	-9.06	0.00727	.	.	.	.	.	T	0.03348	0.0097	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44452	-0.9327	9	0.62326	D	0.03	.	8.4762	0.33014	0.1077:0.5335:0.2786:0.0802	.	1294	Q96JG9	ZN469_HUMAN	L	1294	ENSP00000402343:R1294L	ENSP00000402343:R1294L	R	+	2	0	ZNF469	87025344	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-2.443000	0.01013	-4.511000	0.00045	-3.170000	0.00057	CGC	.		0.632	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NG_012236	
DHRS7C	201140	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	9683157	9683157	+	Missense_Mutation	SNP	T	T	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr17:9683157T>A	ENST00000330255.5	-	3	478	c.466A>T	c.(466-468)Atc>Ttc	p.I156F	DHRS7C_ENST00000571134.1_Missense_Mutation_p.I155F	NM_001105571.2|NM_001220493.1	NP_001099041.1|NP_001207422.1	A6NNS2	DRS7C_HUMAN	dehydrogenase/reductase (SDR family) member 7C	156					regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	extracellular region (GO:0005576)|longitudinal sarcoplasmic reticulum (GO:0014801)|sarcoplasmic reticulum membrane (GO:0033017)	retinol dehydrogenase activity (GO:0004745)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)	15						GTCAATGTGATGGGGCCAAAG	0.478																																					p.I156F		.											.	.	0			c.A466T						.						49.0	47.0	47.0					17																	9683157		1906	4125	6031	SO:0001583	missense	201140	exon3			ATGTGATGGGGCC		CCDS56020.1, CCDS58517.1	17p13.1	2011-09-20				ENSG00000184544		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	32423	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 32C, member 2"""					19027726	Standard	NM_001105571		Approved	SDR32C2	uc010vvb.2	A6NNS2		ENST00000330255.5:c.466A>T	17.37:g.9683157T>A	ENSP00000327975:p.Ile156Phe	Somatic	95	0		WXS	Illumina HiSeq	Phase_I	108	8	NM_001220493	0	0	0	0	0	B7ZW74|B9EJH3	Missense_Mutation	SNP	ENST00000330255.5	37	CCDS56020.1	.	.	.	.	.	.	.	.	.	.	T	13.39	2.223879	0.39300	.	.	ENSG00000184544	ENST00000330255	D	0.86865	-2.18	5.75	5.75	0.90469	NAD(P)-binding domain (1);	0.045861	0.85682	D	0.000000	D	0.90000	0.6878	L	0.37630	1.12	0.47511	D	0.999443	D;D	0.71674	0.998;0.998	D;D	0.71184	0.972;0.94	D	0.91167	0.4965	10	0.87932	D	0	.	15.0365	0.71751	0.0:0.0:0.0:1.0	.	156;152	A6NNS2;B9EJH3	DRS7C_HUMAN;.	F	156	ENSP00000327975:I156F	ENSP00000327975:I156F	I	-	1	0	DHRS7C	9623882	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	5.823000	0.69272	2.193000	0.70182	0.533000	0.62120	ATC	.		0.478	DHRS7C-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439863.1	XM_113912	
COX10	1352	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	13980322	13980322	+	Missense_Mutation	SNP	G	G	C			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr17:13980322G>C	ENST00000261643.3	+	3	525	c.448G>C	c.(448-450)Gtg>Ctg	p.V150L	COX10_ENST00000429152.2_Missense_Mutation_p.V150L|COX10_ENST00000536205.1_5'UTR|COX10_ENST00000537334.1_Intron	NM_001303.3	NP_001294.2	Q12887	COX10_HUMAN	cytochrome c oxidase assembly homolog 10 (yeast)	150					aerobic respiration (GO:0009060)|cellular respiration (GO:0045333)|heme a biosynthetic process (GO:0006784)|heme biosynthetic process (GO:0006783)|heme O biosynthetic process (GO:0048034)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|mitochondrial fission (GO:0000266)|porphyrin-containing compound metabolic process (GO:0006778)|respiratory chain complex IV assembly (GO:0008535)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	farnesyltranstransferase activity (GO:0004311)|protoheme IX farnesyltransferase activity (GO:0008495)			cervix(1)|endometrium(3)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14		all_lung(20;0.06)|Lung SC(565;0.168)		UCEC - Uterine corpus endometrioid carcinoma (92;0.106)		GAAGCTGCAAGTGTATGATTT	0.368																																					p.V150L		.											.	COX10-226	0			c.G448C						.						83.0	88.0	87.0					17																	13980322		2203	4300	6503	SO:0001583	missense	1352	exon3			CTGCAAGTGTATG	U09466	CCDS11166.1	17p12	2013-05-24	2012-10-15		ENSG00000006695	ENSG00000006695		"""Mitochondrial respiratory chain complex assembly factors"""	2260	protein-coding gene	gene with protein product	"""heme A: farnesyltransferase"", ""protoheme IX farnesyltransferase, mitochondrial"", ""heme O synthase"""	602125	"""COX10 (yeast) homolog, cytochrome c oxidase assembly protein (heme A: farnesyltransferase)"", ""COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast)"""			9177788, 12928484	Standard	NM_001303		Approved		uc002gof.4	Q12887	OTTHUMG00000058814	ENST00000261643.3:c.448G>C	17.37:g.13980322G>C	ENSP00000261643:p.Val150Leu	Somatic	146	0		WXS	Illumina HiSeq	Phase_I	161	69	NM_001303	0	0	9	22	13	B2R6U5|B4DJ50|O15334|Q969F7	Missense_Mutation	SNP	ENST00000261643.3	37	CCDS11166.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.143|0.143	-1.100268|-1.100268	0.01843|0.01843	.|.	.|.	ENSG00000006695|ENSG00000006695	ENST00000429152|ENST00000261643	T|T	0.37235|0.61980	1.21|0.06	5.35|5.35	-6.73|-6.73	0.01749|0.01749	.|.	.|1.554890	.|0.03407	.|N	.|0.204147	T|T	0.36880|0.36880	0.0983|0.0983	N|N	0.25890|0.25890	0.77|0.77	0.34746|0.34746	D|D	0.731242|0.731242	.|B	.|0.02656	.|0.0	.|B	.|0.04013	.|0.001	T|T	0.49978|0.49978	-0.8881|-0.8881	6|10	.|0.02654	.|T	.|1	0.0067|0.0067	3.698|3.698	0.08372|0.08372	0.2638:0.4606:0.1338:0.1418|0.2638:0.4606:0.1338:0.1418	.|.	.|150	.|Q12887	.|COX10_HUMAN	T|L	110|150	ENSP00000397750:S110T|ENSP00000261643:V150L	.|ENSP00000261643:V150L	S|V	+|+	2|1	0|0	COX10|COX10	13921047|13921047	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.223000|0.223000	0.24884|0.24884	-0.888000|-0.888000	0.04148|0.04148	-0.666000|-0.666000	0.05310|0.05310	0.655000|0.655000	0.94253|0.94253	AGT|GTG	.		0.368	COX10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130003.1	NM_001303	
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y|TVP23C_ENST00000519970.1_Intron|TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y|TVP23C_ENST00000584811.1_5'UTR|TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y|TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y													.	.	0			c.G152A						.						274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	201158	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr	Somatic	254	27		WXS	Illumina HiSeq		388	34	NM_145301	0	0	10	40	30	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT	.		0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130705.2	NM_145301	
SLFN12L	100506736	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	33807110	33807110	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr17:33807110G>A	ENST00000260908.7	-	2	236	c.119C>T	c.(118-120)aCt>aTt	p.T40I	SLFN12L_ENST00000449046.1_Missense_Mutation_p.T71I|SLFN12L_ENST00000361112.4_Missense_Mutation_p.T69I|RP11-686D22.9_ENST00000587076.1_RNA	NM_001195790.1	NP_001182719.1	Q6IEE8	SN12L_HUMAN	schlafen family member 12-like	40						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)			breast(1)|endometrium(4)|kidney(5)|large_intestine(2)|lung(3)|ovary(1)	16						CTCTCCAAGAGTGACTCTTCC	0.403																																					p.T40I		.											.	SLFN12L-23	0			c.C119T						.						57.0	44.0	48.0					17																	33807110		692	1591	2283	SO:0001583	missense	100506736	exon2			CCAAGAGTGACTC	AK172761	CCDS56026.1	17q12	2011-05-24				ENSG00000205045			33920	protein-coding gene	gene with protein product		614956				9846487	Standard	NM_001195790		Approved		uc021tuy.1	Q6IEE8		ENST00000260908.7:c.119C>T	17.37:g.33807110G>A	ENSP00000437635:p.Thr40Ile	Somatic	74	0		WXS	Illumina HiSeq	Phase_I	103	8	NM_001195790	0	0	0	0	0	F5H6G3	Missense_Mutation	SNP	ENST00000260908.7	37	CCDS56026.1	.	.	.	.	.	.	.	.	.	.	G	15.90	2.968021	0.53507	.	.	ENSG00000205045	ENST00000260908;ENST00000361112;ENST00000449046	T;T;T	0.06528	3.32;3.64;3.29	2.72	2.72	0.32119	.	.	.	.	.	T	0.16599	0.0399	L	0.57536	1.79	0.09310	N	1	D	0.65815	0.995	D	0.63703	0.917	T	0.03993	-1.0986	9	0.48119	T	0.1	.	8.9486	0.35773	0.0:0.0:1.0:0.0	.	69	Q6IEE8-2	.	I	40;69;71	ENSP00000437635:T40I;ENSP00000354412:T69I;ENSP00000389348:T71I	ENSP00000437635:T40I	T	-	2	0	SLFN12L	30831223	0.000000	0.05858	0.017000	0.16124	0.662000	0.39071	-0.169000	0.09911	1.504000	0.48704	0.205000	0.17691	ACT	.		0.403	SLFN12L-004	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000395748.2	XM_496206	
KRT38	8687	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	39596920	39596920	+	Missense_Mutation	SNP	A	A	C			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr17:39596920A>C	ENST00000246646.3	-	1	253	c.254T>G	c.(253-255)aTt>aGt	p.I85S		NM_006771.3	NP_006762.3	O76015	KRT38_HUMAN	keratin 38	85	Head.					extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	29		Breast(137;0.000496)				GTTGCCAGGAATGTGGCAGGT	0.607																																					p.I85S		.											.	KRT38-92	0			c.T254G						.						73.0	68.0	70.0					17																	39596920		2203	4300	6503	SO:0001583	missense	8687	exon1			CCAGGAATGTGGC	Y16794	CCDS11392.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000171360	ENSG00000171360		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6456	protein-coding gene	gene with protein product		604542	"""keratin, hair, acidic, 8"""	KRTHA8		9756910, 16831889	Standard	NM_006771		Approved		uc002hwq.1	O76015	OTTHUMG00000133439	ENST00000246646.3:c.254T>G	17.37:g.39596920A>C	ENSP00000246646:p.Ile85Ser	Somatic	109	0		WXS	Illumina HiSeq	Phase_I	212	88	NM_006771	0	0	0	0	0	A2RRM5|Q6A164	Missense_Mutation	SNP	ENST00000246646.3	37	CCDS11392.1	.	.	.	.	.	.	.	.	.	.	A	13.77	2.337461	0.41398	.	.	ENSG00000171360	ENST00000246646	D	0.82167	-1.58	4.89	3.82	0.43975	.	0.130125	0.34460	N	0.003941	D	0.84511	0.5488	L	0.50333	1.59	0.09310	N	1	D	0.89917	1.0	D	0.69307	0.963	T	0.72830	-0.4174	10	0.28530	T	0.3	.	5.4631	0.16627	0.6239:0.2845:0.0915:0.0	.	85	O76015	KRT38_HUMAN	S	85	ENSP00000246646:I85S	ENSP00000246646:I85S	I	-	2	0	KRT38	36850446	0.089000	0.21612	0.031000	0.17742	0.359000	0.29487	1.205000	0.32308	0.906000	0.36621	0.528000	0.53228	ATT	.		0.607	KRT38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257307.2	NM_006771	
JUP	3728	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	39925817	39925817	+	Missense_Mutation	SNP	C	C	G			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr17:39925817C>G	ENST00000393931.3	-	3	439	c.321G>C	c.(319-321)gaG>gaC	p.E107D	JUP_ENST00000393930.1_Missense_Mutation_p.E107D|JUP_ENST00000310706.5_Missense_Mutation_p.E107D|JUP_ENST00000540235.1_Missense_Mutation_p.E107D	NM_002230.2	NP_002221.1	P14923	PLAK_HUMAN	junction plakoglobin	107					adherens junction organization (GO:0034332)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell-cell junction organization (GO:0045216)|cellular response to indole-3-methanol (GO:0071681)|cytoskeletal anchoring at plasma membrane (GO:0007016)|desmosome assembly (GO:0002159)|detection of mechanical stimulus (GO:0050982)|ectoderm development (GO:0007398)|endothelial cell-cell adhesion (GO:0071603)|establishment of protein localization to plasma membrane (GO:0090002)|gastrulation (GO:0007369)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of Wnt signaling pathway involved in heart development (GO:0003308)|nervous system development (GO:0007399)|oocyte development (GO:0048599)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein heterooligomerization (GO:0051291)|regulation of cell proliferation (GO:0042127)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|skin development (GO:0043588)|ventricular cardiac muscle cell action potential (GO:0086005)	actin cytoskeleton (GO:0015629)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|gamma-catenin-TCF7L2 complex (GO:0071665)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|cadherin binding (GO:0045296)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|structural constituent of cell wall (GO:0005199)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	23		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)		TGGCCTGCCCCTCCACCTGGG	0.647																																					p.E107D	Colon(16;42 520 6044 17852 28530)	.											.	JUP-479	0			c.G321C						.						31.0	29.0	29.0					17																	39925817		2201	4297	6498	SO:0001583	missense	3728	exon3			CTGCCCCTCCACC	AF233882	CCDS11407.1	17q21	2014-09-17	2004-08-09		ENSG00000173801	ENSG00000173801		"""Armadillo repeat containing"""	6207	protein-coding gene	gene with protein product		173325	"""catenin (cadherin-associated protein), gamma 80kDa"""	CTNNG		1889810, 7604000	Standard	NM_021991		Approved	DP3, PDGB, PKGB, DPIII	uc002hxs.2	P14923	OTTHUMG00000133494	ENST00000393931.3:c.321G>C	17.37:g.39925817C>G	ENSP00000377508:p.Glu107Asp	Somatic	67	0		WXS	Illumina HiSeq	Phase_I	123	27	NM_021991	0	0	133	169	36	Q15093|Q15151|Q7L3S5|Q86W21|Q9BWC4|Q9HCX9	Missense_Mutation	SNP	ENST00000393931.3	37	CCDS11407.1	.	.	.	.	.	.	.	.	.	.	c	8.550	0.875277	0.17395	.	.	ENSG00000173801	ENST00000540235;ENST00000393930;ENST00000310706;ENST00000393931;ENST00000449889;ENST00000437187;ENST00000420370;ENST00000424457	T;T;T;T;T;T;T;T	0.63744	-0.06;-0.06;-0.06;-0.06;-0.06;-0.06;-0.06;-0.06	5.52	-7.03	0.01584	.	0.239681	0.42053	D	0.000764	T	0.27454	0.0674	N	0.08118	0	0.22591	N	0.998951	D;B	0.54207	0.965;0.001	B;B	0.43950	0.437;0.003	T	0.51663	-0.8677	10	0.22109	T	0.4	-21.4947	1.588	0.02648	0.2613:0.236:0.089:0.4138	.	107;107	B4DE59;P14923	.;PLAK_HUMAN	D	107	ENSP00000441751:E107D;ENSP00000377507:E107D;ENSP00000311113:E107D;ENSP00000377508:E107D;ENSP00000389886:E107D;ENSP00000394146:E107D;ENSP00000411449:E107D;ENSP00000401034:E107D	ENSP00000311113:E107D	E	-	3	2	JUP	37179343	0.000000	0.05858	0.979000	0.43373	0.992000	0.81027	-4.131000	0.00289	-0.505000	0.06568	0.556000	0.70494	GAG	.		0.647	JUP-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257406.1		
ERN1	2081	broad.mit.edu	37	17	62152600	62152600	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr17:62152600G>A	ENST00000433197.3	-	5	385	c.290C>T	c.(289-291)cCt>cTt	p.P97L	ERN1_ENST00000577567.1_5'UTR	NM_001433.3	NP_001424.3			endoplasmic reticulum to nucleus signaling 1											central_nervous_system(4)|kidney(1)|lung(2)|ovary(1)|stomach(1)	9						GATGGTAAAAGGAAGTTTCTT	0.358																																					p.P97L													.	ERN1-784	0			c.C290T						.						15.0	14.0	14.0					17																	62152600		1561	3443	5004	SO:0001583	missense	2081	exon5			GTAAAAGGAAGTT	AF059198	CCDS45762.1	17q23	2011-08-12	2007-08-14			ENSG00000178607			3449	protein-coding gene	gene with protein product	"""inositol-requiring enzyme 1"""	604033	"""ER to nucleus signalling 1"""			9637683	Standard	NM_001433		Approved	IRE1, IRE1P	uc002jdz.2	O75460		ENST00000433197.3:c.290C>T	17.37:g.62152600G>A	ENSP00000401445:p.Pro97Leu	Somatic	63	4		WXS	Illumina HiSeq	Phase_I	69	10	NM_001433	0	0	0	0	0		Missense_Mutation	SNP	ENST00000433197.3	37	CCDS45762.1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.859641	0.91433	.	.	ENSG00000178607	ENST00000433197	T	0.29397	1.57	5.87	5.87	0.94306	Quinonprotein alcohol dehydrogenase-like (2);	0.000000	0.85682	D	0.000000	T	0.64382	0.2593	M	0.86651	2.83	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.68108	-0.5496	10	0.66056	D	0.02	-24.3325	20.1991	0.98252	0.0:0.0:1.0:0.0	.	97	O75460	ERN1_HUMAN	L	97	ENSP00000401445:P97L	ENSP00000401445:P97L	P	-	2	0	ERN1	59506332	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	9.476000	0.97823	2.775000	0.95449	0.650000	0.86243	CCT	.		0.358	ERN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443734.2	NM_001433	
HELZ	9931	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	65105385	65105385	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr17:65105385C>T	ENST00000358691.5	-	29	4502	c.4336G>A	c.(4336-4338)Gaa>Aaa	p.E1446K	HELZ_ENST00000580168.1_Missense_Mutation_p.E1447K	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	1446						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					ATTACAGCTTCTGCAGGAGGA	0.547																																					p.E1446K		.											.	HELZ-92	0			c.G4336A						.						65.0	73.0	70.0					17																	65105385		2028	4202	6230	SO:0001583	missense	9931	exon29			CAGCTTCTGCAGG	D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.4336G>A	17.37:g.65105385C>T	ENSP00000351524:p.Glu1446Lys	Somatic	105	0		WXS	Illumina HiSeq	Phase_I	111	43	NM_014877	0	0	7	11	4	I6L9H4	Missense_Mutation	SNP	ENST00000358691.5	37	CCDS42374.1	.	.	.	.	.	.	.	.	.	.	C	14.99	2.701438	0.48307	.	.	ENSG00000198265	ENST00000358691	D	0.83419	-1.72	5.9	4.92	0.64577	.	0.199043	0.53938	D	0.000060	T	0.74801	0.3764	N	0.19112	0.55	0.43777	D	0.996308	B;B	0.20261	0.043;0.043	B;B	0.19391	0.025;0.025	T	0.70945	-0.4734	10	0.62326	D	0.03	-11.4842	16.9692	0.86294	0.0:0.8723:0.1277:0.0	.	1447;1446	B7ZLW2;P42694	.;HELZ_HUMAN	K	1446	ENSP00000351524:E1446K	ENSP00000351524:E1446K	E	-	1	0	HELZ	62535847	0.991000	0.36638	0.996000	0.52242	0.966000	0.64601	2.728000	0.47319	1.460000	0.47911	0.549000	0.68633	GAA	.		0.547	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000447068.1	NM_014877	
EXOC7	23265	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	17	74081440	74081440	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr17:74081440G>A	ENST00000335146.7	-	16	1873	c.1820C>T	c.(1819-1821)tCc>tTc	p.S607F	EXOC7_ENST00000591724.1_5'Flank|EXOC7_ENST00000467929.2_Missense_Mutation_p.S528F|EXOC7_ENST00000405575.4_Missense_Mutation_p.S579F|EXOC7_ENST00000589210.1_Missense_Mutation_p.S556F|EXOC7_ENST00000411744.2_Missense_Mutation_p.S548F|EXOC7_ENST00000332065.5_Missense_Mutation_p.S525F|EXOC7_ENST00000607838.1_Missense_Mutation_p.S579F			Q9UPT5	EXOC7_HUMAN	exocyst complex component 7	607					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	centriolar satellite (GO:0034451)|exocyst (GO:0000145)|growth cone membrane (GO:0032584)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)				NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|skin(1)	14			LUSC - Lung squamous cell carcinoma(166;0.187)			CTCCCGGTAGGAGCGCTCAGC	0.637																																					p.S607F		.											.	EXOC7-90	0			c.C1820T						.						57.0	47.0	50.0					17																	74081440		2202	4300	6502	SO:0001583	missense	23265	exon16			CGGTAGGAGCGCT	BC029432	CCDS11741.1, CCDS32738.1, CCDS45781.1, CCDS45782.1, CCDS45784.1, CCDS74164.1	17q25.3	2013-01-22			ENSG00000182473	ENSG00000182473			23214	protein-coding gene	gene with protein product		608163				12477932	Standard	NM_001013839		Approved	EXO70, KIAA1067, YJL085W, Exo70p	uc010wsw.2	Q9UPT5	OTTHUMG00000150720	ENST00000335146.7:c.1820C>T	17.37:g.74081440G>A	ENSP00000334100:p.Ser607Phe	Somatic	30	0		WXS	Illumina HiSeq	Phase_I	45	4	NM_001145297	0	0	77	93	16	B5MC69|B8XXP2|Q8ND93|Q8WV91|Q96FF0|Q9H8C3|Q9H9X3|Q9HA32	Missense_Mutation	SNP	ENST00000335146.7	37	CCDS45782.1	.	.	.	.	.	.	.	.	.	.	g	11.91	1.778418	0.31502	.	.	ENSG00000182473	ENST00000332065;ENST00000351709;ENST00000405575;ENST00000335146;ENST00000357231;ENST00000425372;ENST00000411744	.	.	.	4.43	4.43	0.53597	Cullin repeat-like-containing domain (1);	0.133958	0.50627	D	0.000114	T	0.54615	0.1869	L	0.40543	1.245	0.80722	D	1	P;B;P;B;P;P;P	0.51653	0.947;0.006;0.844;0.059;0.918;0.809;0.578	B;B;P;B;B;B;B	0.46389	0.283;0.028;0.515;0.028;0.384;0.317;0.129	T	0.54200	-0.8329	9	0.30078	T	0.28	-19.663	17.099	0.86644	0.0:0.0:1.0:0.0	.	548;579;528;493;607;525;556	Q9UPT5-5;Q9UPT5-6;B4DJ07;F5H1P1;Q9UPT5;Q9UPT5-2;Q9UPT5-1	.;.;.;.;EXOC7_HUMAN;.;.	F	525;445;579;607;556;493;548	.	ENSP00000333806:S525F	S	-	2	0	EXOC7	71593035	1.000000	0.71417	1.000000	0.80357	0.878000	0.50629	6.700000	0.74619	2.035000	0.60131	0.479000	0.44913	TCC	.		0.637	EXOC7-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000319768.2	NM_015219	
RNF138	51444	broad.mit.edu	37	18	29709106	29709106	+	Missense_Mutation	SNP	C	C	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr18:29709106C>A	ENST00000261593.3	+	8	1152	c.694C>A	c.(694-696)Caa>Aaa	p.Q232K	RNF138_ENST00000257190.5_Missense_Mutation_p.Q138K	NM_001191324.1|NM_016271.4	NP_001178253.2|NP_057355.2	Q8WVD3	RN138_HUMAN	ring finger protein 138, E3 ubiquitin protein ligase	232					protein ubiquitination (GO:0016567)|Wnt signaling pathway (GO:0016055)	nucleus (GO:0005634)	ligase activity (GO:0016874)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(6)|skin(1)	12						TGAAGAAACCCAATACCAAAC	0.358																																					p.Q232K													.	RNF138-226	0			c.C694A						.						151.0	148.0	149.0					18																	29709106		2203	4300	6503	SO:0001583	missense	51444	exon7			GAAACCCAATACC	AF162680	CCDS11903.1, CCDS11904.1	18q12.1	2013-01-28	2012-02-23		ENSG00000134758	ENSG00000134758		"""RING-type (C3HC4) zinc fingers"""	17765	protein-coding gene	gene with protein product	"""nemo-like kinase associated ring finger protein"""		"""ring finger protein 138"""			22155992, 16714285	Standard	NM_016271		Approved	STRIN, NARF	uc021uip.2	Q8WVD3	OTTHUMG00000132265	ENST00000261593.3:c.694C>A	18.37:g.29709106C>A	ENSP00000261593:p.Gln232Lys	Somatic	59	0		WXS	Illumina HiSeq	Phase_I	40	3	NM_001191324	0	0	5	5	0	B2RE17|Q9H8K2|Q9UF87|Q9UKI6	Missense_Mutation	SNP	ENST00000261593.3	37	CCDS11903.1	.	.	.	.	.	.	.	.	.	.	C	16.42	3.119150	0.56505	.	.	ENSG00000134758	ENST00000261593;ENST00000257190	D	0.87491	-2.26	5.37	5.37	0.77165	.	0.000000	0.64402	D	0.000001	D	0.89928	0.6857	M	0.64997	1.995	0.80722	D	1	D;D	0.61697	0.99;0.976	P;P	0.53146	0.719;0.629	D	0.87443	0.2396	10	0.25751	T	0.34	-4.4744	19.4797	0.95005	0.0:1.0:0.0:0.0	.	138;232	Q8WVD3-2;Q8WVD3	.;RN138_HUMAN	K	232;138	ENSP00000261593:Q232K	ENSP00000257190:Q138K	Q	+	1	0	RNF138	27963104	0.997000	0.39634	0.993000	0.49108	0.845000	0.48019	4.841000	0.62824	2.684000	0.91462	0.650000	0.86243	CAA	.		0.358	RNF138-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255352.2	NM_016271	
SETBP1	26040	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	42533244	42533244	+	Silent	SNP	C	C	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr18:42533244C>T	ENST00000282030.5	+	4	4235	c.3939C>T	c.(3937-3939)gaC>gaT	p.D1313D		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	1313						nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		GGGAAAAGGACATCCAAGCCT	0.443									Schinzel-Giedion syndrome																												p.D1313D		.											.	SETBP1-155	0			c.C3939T						.						130.0	120.0	123.0					18																	42533244		2203	4300	6503	SO:0001819	synonymous_variant	26040	exon4	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome	AAAGGACATCCAA	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.3939C>T	18.37:g.42533244C>T		Somatic	158	0		WXS	Illumina HiSeq	Phase_I	144	38	NM_015559	0	0	0	0	0	A6H8W5|Q6P6C3|Q9UEF3	Silent	SNP	ENST00000282030.5	37	CCDS11923.2																																																																																			.		0.443	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255854.4	NM_001130110	
KIAA1468	57614	broad.mit.edu	37	18	59919898	59919898	+	Splice_Site	SNP	C	C	A	rs386352321		TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr18:59919898C>A	ENST00000398130.2	+	12	1967	c.1735C>A	c.(1735-1737)Caa>Aaa	p.Q579K	KIAA1468_ENST00000256858.6_Splice_Site_p.Q579K	NM_020854.3	NP_065905.2	Q9P260	K1468_HUMAN	KIAA1468	579								p.Q579K(3)		autonomic_ganglia(1)|breast(4)|endometrium(4)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47		Colorectal(73;0.186)				ATTTTTCAGGCAAATGATACT	0.383																																					p.Q579K													.	KIAA1468-158	3	Substitution - Missense(3)	lung(1)|endometrium(1)|kidney(1)	c.C1735A						.						101.0	94.0	96.0					18																	59919898		2203	4300	6503	SO:0001630	splice_region_variant	57614	exon12			TTCAGGCAAATGA	BC011992	CCDS11979.2	18q21.33	2005-11-03			ENSG00000134444	ENSG00000134444			29289	protein-coding gene	gene with protein product						11973628	Standard	NM_020854		Approved	HsT885, HsT3308, FLJ33841	uc002lil.3	Q9P260	OTTHUMG00000132780	ENST00000398130.2:c.1734-1C>A	18.37:g.59919898C>A		Somatic	55	0		WXS	Illumina HiSeq	Phase_I	67	6	NM_020854	0	0	0	0	0		Missense_Mutation	SNP	ENST00000398130.2	37	CCDS11979.2	.	.	.	.	.	.	.	.	.	.	C	15.86	2.958076	0.53400	.	.	ENSG00000134444	ENST00000398130;ENST00000256858	T;T	0.40476	1.03;1.03	5.81	5.81	0.92471	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.57388	0.2050	L	0.41710	1.295	0.80722	D	1	B;D;D	0.76494	0.007;0.999;0.998	B;D;D	0.71184	0.059;0.972;0.969	T	0.49143	-0.8970	9	.	.	.	-11.5654	20.0621	0.97678	0.0:1.0:0.0:0.0	.	579;579;223	Q9P260-2;Q9P260;B2RD46	.;K1468_HUMAN;.	K	579	ENSP00000381198:Q579K;ENSP00000256858:Q579K	.	Q	+	1	0	KIAA1468	58070878	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	5.830000	0.69324	2.750000	0.94351	0.655000	0.94253	CAA	.		0.383	KIAA1468-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256187.1	NM_020854	Missense_Mutation
PTPRS	5802	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	5286082	5286082	+	Missense_Mutation	SNP	C	C	A	rs200430287	byFrequency	TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr19:5286082C>A	ENST00000587303.1	-	1	169	c.70G>T	c.(70-72)Gtt>Ttt	p.V24F	PTPRS_ENST00000588552.1_5'UTR|PTPRS_ENST00000262963.6_Missense_Mutation_p.V24F|PTPRS_ENST00000372412.4_Missense_Mutation_p.V24F|PTPRS_ENST00000590509.1_Missense_Mutation_p.V24F|PTPRS_ENST00000588012.1_Missense_Mutation_p.V24F|PTPRS_ENST00000592099.1_Missense_Mutation_p.V24F|PTPRS_ENST00000348075.2_Missense_Mutation_p.V24F|PTPRS_ENST00000353284.2_Missense_Mutation_p.V24F|PTPRS_ENST00000357368.4_Missense_Mutation_p.V24F			Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type, S	24					cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|corpus callosum development (GO:0022038)|extracellular matrix organization (GO:0030198)|hippocampus development (GO:0021766)|peptidyl-tyrosine dephosphorylation (GO:0035335)|spinal cord development (GO:0021510)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(9)|ovary(4)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)	61				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)	Alendronate(DB00630)|Etidronic acid(DB01077)	CAGCCTCCAACGAGCAGGACC	0.617																																					p.V24F		.											.	PTPRS-357	0			c.G70T						.						52.0	46.0	48.0					19																	5286082		2203	4299	6502	SO:0001583	missense	5802	exon2			CTCCAACGAGCAG	U35234	CCDS12139.1, CCDS12140.1, CCDS45930.1, CCDS74265.1	19p13.3	2013-02-11				ENSG00000105426		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9681	protein-coding gene	gene with protein product		601576				8954782, 8524829	Standard	NM_002850		Approved		uc002mbv.3	Q13332		ENST00000587303.1:c.70G>T	19.37:g.5286082C>A	ENSP00000467537:p.Val24Phe	Somatic	150	0		WXS	Illumina HiSeq	Phase_I	160	81	NM_130854	0	0	1	5	4	O75255|O75870|Q15718|Q16341|Q2M3R7	Missense_Mutation	SNP	ENST00000587303.1	37	CCDS45930.1	.	.	.	.	.	.	.	.	.	.	C	6.878	0.531372	0.13127	.	.	ENSG00000105426	ENST00000536396;ENST00000372412;ENST00000357368;ENST00000355005;ENST00000356037;ENST00000262963;ENST00000348075;ENST00000355322;ENST00000544524;ENST00000353284	T;T;T;T;T	0.56776	0.62;0.61;0.57;0.44;0.53	4.14	1.83	0.25207	.	1.741500	0.04678	U	0.411808	T	0.32971	0.0847	N	0.08118	0	0.09310	N	0.999997	B;B;B;B;P;B;B	0.34462	0.275;0.207;0.275;0.275;0.454;0.089;0.18	B;B;B;B;B;B;B	0.34138	0.091;0.176;0.091;0.091;0.045;0.017;0.025	T	0.35251	-0.9796	10	0.59425	D	0.04	.	5.1867	0.15187	0.0:0.6502:0.2297:0.1202	.	24;24;24;24;24;24;50	F8W800;Q8NHS7;Q13332-7;F5H2T4;Q13332-6;Q13332;Q59FX6	.;.;.;.;.;PTPRS_HUMAN;.	F	50;24;24;24;24;24;24;24;24;24	ENSP00000361489:V24F;ENSP00000349932:V24F;ENSP00000262963:V24F;ENSP00000269907:V24F;ENSP00000327313:V24F	ENSP00000262963:V24F	V	-	1	0	PTPRS	5237082	0.861000	0.29849	0.878000	0.34440	0.011000	0.07611	1.123000	0.31308	0.973000	0.38340	-0.362000	0.07510	GTT	C|0.999;T|0.001		0.617	PTPRS-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450762.2		
KEAP1	9817	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	10610178	10610178	+	Nonsense_Mutation	SNP	G	G	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr19:10610178G>A	ENST00000171111.5	-	2	1079	c.532C>T	c.(532-534)Cag>Tag	p.Q178*	KEAP1_ENST00000588024.1_5'UTR|KEAP1_ENST00000393623.2_Nonsense_Mutation_p.Q178*	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	178					cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)				breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	GGGTCCAGCTGCTGCACCAGG	0.572																																					p.Q178X		.											.	KEAP1-637	0			c.C532T						.						137.0	109.0	118.0					19																	10610178		2203	4300	6503	SO:0001587	stop_gained	9817	exon2			CCAGCTGCTGCAC	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.532C>T	19.37:g.10610178G>A	ENSP00000171111:p.Gln178*	Somatic	141	1		WXS	Illumina HiSeq	Phase_I	104	91	NM_012289	0	0	3	12	9	B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Nonsense_Mutation	SNP	ENST00000171111.5	37	CCDS12239.1	.	.	.	.	.	.	.	.	.	.	G	38	6.966030	0.97967	.	.	ENSG00000079999	ENST00000171111;ENST00000393623	.	.	.	4.81	4.81	0.61882	.	0.116198	0.64402	D	0.000012	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	15.3825	0.74669	0.0:0.0:1.0:0.0	.	.	.	.	X	178	.	ENSP00000171111:Q178X	Q	-	1	0	KEAP1	10471178	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.704000	0.84595	2.232000	0.73038	0.561000	0.74099	CAG	.		0.572	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289	
BRD4	23476	bcgsc.ca	37	19	15353721	15353721	+	Silent	SNP	G	G	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr19:15353721G>T	ENST00000263377.2	-	14	3380	c.3159C>A	c.(3157-3159)ccC>ccA	p.P1053P		NM_058243.2	NP_490597.1	O60885	BRD4_HUMAN	bromodomain containing 4	1053	C-terminal (CTD) region.				cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|chromosome segregation (GO:0007059)|histone H3-K14 acetylation (GO:0044154)|histone H4-K12 acetylation (GO:0043983)|inner cell mass cell proliferation (GO:0001833)|negative regulation of DNA damage checkpoint (GO:2000002)|positive regulation of DNA binding (GO:0043388)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of phosphorylation of RNA polymerase II C-terminal domain (GO:1901407)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|positive transcription elongation factor complex b (GO:0008024)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(3;3.02e-24)|Epithelial(3;4.71e-20)|all cancers(3;2.26e-18)			CGGTTGAGTAGGGGTCCGACT	0.622			T	C15orf55	lethal midline carcinoma of young people																																p.P1053P				Dom	yes		19	19p13.1	23476	bromodomain containing 4		E	.	BRD4-767	0			c.C3159A						.						42.0	31.0	35.0					19																	15353721		2194	4299	6493	SO:0001819	synonymous_variant	23476	exon14			TGAGTAGGGGTCC	Y12059	CCDS12328.1, CCDS46004.1	19p13.12	2013-09-20	2002-01-14		ENSG00000141867	ENSG00000141867			13575	protein-coding gene	gene with protein product	"""chromosome-associated protein"""	608749	"""bromodomain-containing 4"""			10938129	Standard	NM_058243		Approved	HUNKI, MCAP, CAP, HUNK1	uc002nar.3	O60885	OTTHUMG00000183252	ENST00000263377.2:c.3159C>A	19.37:g.15353721G>T		Somatic	104	2		WXS	Illumina HiSeq	Phase_1	96	82	NM_058243	0	0	0	0	0	O60433|Q4G0X8|Q86YS8|Q96PD3	Silent	SNP	ENST00000263377.2	37	CCDS12328.1																																																																																			.		0.622	BRD4-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465800.3	NM_058243	
TSHZ3	57616	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	31769094	31769094	+	Missense_Mutation	SNP	G	G	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr19:31769094G>T	ENST00000240587.4	-	2	1932	c.1605C>A	c.(1603-1605)aaC>aaA	p.N535K		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	535					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					TCTGGGCCTTGTTGATTGCGG	0.522																																					p.N535K													.	TSHZ3-232	0			c.C1605A						.						138.0	137.0	138.0					19																	31769094		2203	4300	6503	SO:0001583	missense	57616	exon2			GGCCTTGTTGATT	AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.1605C>A	19.37:g.31769094G>T	ENSP00000240587:p.Asn535Lys	Somatic	121	1		WXS	Illumina HiSeq	Phase_I	125	25	NM_020856	0	0	0	0	0	Q9H0G6|Q9P254	Missense_Mutation	SNP	ENST00000240587.4	37	CCDS12421.2	.	.	.	.	.	.	.	.	.	.	G	15.18	2.755931	0.49362	.	.	ENSG00000121297	ENST00000240587	T	0.47177	0.85	5.4	2.05	0.26809	.	0.000000	0.85682	D	0.000000	T	0.60599	0.2281	M	0.64404	1.975	0.58432	D	0.999998	D	0.63880	0.993	D	0.72982	0.979	T	0.57533	-0.7795	10	0.52906	T	0.07	-48.9465	9.5255	0.39162	0.3438:0.0:0.6562:0.0	.	535	Q63HK5	TSH3_HUMAN	K	535	ENSP00000240587:N535K	ENSP00000240587:N535K	N	-	3	2	TSHZ3	36460934	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.160000	0.42348	0.245000	0.21373	0.655000	0.94253	AAC	.		0.522	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856	
SLC7A9	11136	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	33350841	33350841	+	Missense_Mutation	SNP	A	A	G			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr19:33350841A>G	ENST00000023064.4	-	8	970	c.779T>C	c.(778-780)aTc>aCc	p.I260T	SLC7A9_ENST00000590341.1_Missense_Mutation_p.I260T|RN7SKP22_ENST00000365097.1_RNA|SLC7A9_ENST00000587772.1_Missense_Mutation_p.I260T	NM_001126335.1|NM_001243036.1|NM_014270.4	NP_001119807.1|NP_001229965.1|NP_055085.1	P82251	BAT1_HUMAN	solute carrier family 7 (amino acid transporter light chain, bo,+ system), member 9	260					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|L-cystine transport (GO:0015811)|leukocyte migration (GO:0050900)|neutral amino acid transport (GO:0015804)|protein complex assembly (GO:0006461)|transmembrane transport (GO:0055085)|transport (GO:0006810)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|L-cystine transmembrane transporter activity (GO:0015184)|neutral amino acid transmembrane transporter activity (GO:0015175)|peptide antigen binding (GO:0042605)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	32	Esophageal squamous(110;0.137)				L-Cystine(DB00138)	CACCAGGGGGATCCCGATGAT	0.607																																					p.I260T	GBM(181;1335 2108 9644 44178 46689)	.											.	SLC7A9-91	0			c.T779C						.						100.0	82.0	88.0					19																	33350841		2203	4300	6503	SO:0001583	missense	11136	exon8			AGGGGGATCCCGA	AF141289	CCDS12425.1	19q13.11	2013-07-19	2013-07-19		ENSG00000021488	ENSG00000021488		"""Solute carriers"""	11067	protein-coding gene	gene with protein product		604144		CSNU3		10471498	Standard	NM_014270		Approved		uc021usa.1	P82251	OTTHUMG00000180287	ENST00000023064.4:c.779T>C	19.37:g.33350841A>G	ENSP00000023064:p.Ile260Thr	Somatic	185	0		WXS	Illumina HiSeq	Phase_I	210	108	NM_001243036	0	0	42	117	75	B2R9A6	Missense_Mutation	SNP	ENST00000023064.4	37	CCDS12425.1	.	.	.	.	.	.	.	.	.	.	A	19.17	3.776707	0.70107	.	.	ENSG00000021488	ENST00000023064	D	0.90620	-2.7	5.64	5.64	0.86602	Amino acid permease domain (1);	0.000000	0.85682	D	0.000000	D	0.95799	0.8633	M	0.87547	2.89	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.995	D	0.96469	0.9347	10	0.87932	D	0	.	15.8639	0.79047	1.0:0.0:0.0:0.0	.	260;260	Q53FY4;P82251	.;BAT1_HUMAN	T	260	ENSP00000023064:I260T	ENSP00000023064:I260T	I	-	2	0	SLC7A9	38042681	1.000000	0.71417	1.000000	0.80357	0.388000	0.30384	9.192000	0.94947	2.161000	0.67846	0.379000	0.24179	ATC	.		0.607	SLC7A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450585.1		
CEBPA	1050	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	33793108	33793108	+	Silent	SNP	G	G	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr19:33793108G>T	ENST00000498907.2	-	1	362	c.213C>A	c.(211-213)gcC>gcA	p.A71A	CEBPA-AS1_ENST00000592982.2_RNA|CTD-2540B15.9_ENST00000593041.1_lincRNA|CTD-2540B15.11_ENST00000589932.1_RNA|CTD-2540B15.7_ENST00000587312.1_RNA	NM_004364.3	NP_004355.2	P49715	CEBPA_HUMAN	CCAAT/enhancer binding protein (C/EBP), alpha	71					acute-phase response (GO:0006953)|brown fat cell differentiation (GO:0050873)|cell maturation (GO:0048469)|cellular response to lithium ion (GO:0071285)|cellular response to organic cyclic compound (GO:0071407)|cholesterol metabolic process (GO:0008203)|cytokine-mediated signaling pathway (GO:0019221)|embryonic placenta development (GO:0001892)|generation of precursor metabolites and energy (GO:0006091)|inner ear development (GO:0048839)|liver development (GO:0001889)|lung development (GO:0030324)|macrophage differentiation (GO:0030225)|mitochondrion organization (GO:0007005)|myeloid cell differentiation (GO:0030099)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ regeneration (GO:0031100)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|response to glucocorticoid (GO:0051384)|response to vitamin B2 (GO:0033274)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|urea cycle (GO:0000050)|viral process (GO:0016032)|white fat cell differentiation (GO:0050872)	nuclear matrix (GO:0016363)|nucleus (GO:0005634)|Rb-E2F complex (GO:0035189)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.A72fs*89(1)|p.Y7_G130del(1)|p.A72fs*90(1)|p.A72fs*37(1)|p.S61fs*88(1)		cervix(1)|haematopoietic_and_lymphoid_tissue(912)|lung(5)|prostate(1)|stomach(1)	920	Esophageal squamous(110;0.137)					CGTTGAAGGCGGCCGGGTCGA	0.751			"""Mis, N, F"""		"""AML, MDS"""				Acute Myeloid Leukemia, Familial, associated with CEBPA germline mutation																												p.A71A		.		Dom	yes		19	19q13.1	1050	"""CCAAT/enhancer binding protein (C/EBP), alpha"""		L	.	CEBPA-7558	5	Insertion - Frameshift(3)|Deletion - Frameshift(1)|Deletion - In frame(1)	haematopoietic_and_lymphoid_tissue(5)	c.C213A						.						4.0	5.0	4.0					19																	33793108		1229	2522	3751	SO:0001819	synonymous_variant	1050	exon1	Familial Cancer Database	Familial AML	GAAGGCGGCCGGG	M37197	CCDS54243.1	19q13.1	2014-09-17				ENSG00000245848		"""basic leucine zipper proteins"""	1833	protein-coding gene	gene with protein product		116897		CEBP		1535333, 1840554	Standard	NM_004364		Approved	C/EBP-alpha	uc002nun.3	P49715		ENST00000498907.2:c.213C>A	19.37:g.33793108G>T		Somatic	26	0		WXS	Illumina HiSeq	Phase_I	83	30	NM_004364	0	0	0	0	0	A7LNP2|P78319|Q05CA4	Silent	SNP	ENST00000498907.2	37	CCDS54243.1																																																																																			.		0.751	CEBPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365012.1	NM_004364	
CEBPA	1050	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	33793120	33793120	+	Nonsense_Mutation	SNP	G	G	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr19:33793120G>T	ENST00000498907.2	-	1	350	c.201C>A	c.(199-201)taC>taA	p.Y67*	CEBPA-AS1_ENST00000592982.2_RNA|CTD-2540B15.9_ENST00000593041.1_lincRNA|CTD-2540B15.11_ENST00000589932.1_RNA|CTD-2540B15.7_ENST00000587312.1_RNA	NM_004364.3	NP_004355.2	P49715	CEBPA_HUMAN	CCAAT/enhancer binding protein (C/EBP), alpha	67					acute-phase response (GO:0006953)|brown fat cell differentiation (GO:0050873)|cell maturation (GO:0048469)|cellular response to lithium ion (GO:0071285)|cellular response to organic cyclic compound (GO:0071407)|cholesterol metabolic process (GO:0008203)|cytokine-mediated signaling pathway (GO:0019221)|embryonic placenta development (GO:0001892)|generation of precursor metabolites and energy (GO:0006091)|inner ear development (GO:0048839)|liver development (GO:0001889)|lung development (GO:0030324)|macrophage differentiation (GO:0030225)|mitochondrion organization (GO:0007005)|myeloid cell differentiation (GO:0030099)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ regeneration (GO:0031100)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|response to glucocorticoid (GO:0051384)|response to vitamin B2 (GO:0033274)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|urea cycle (GO:0000050)|viral process (GO:0016032)|white fat cell differentiation (GO:0050872)	nuclear matrix (GO:0016363)|nucleus (GO:0005634)|Rb-E2F complex (GO:0035189)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.I68fs*41(4)|p.Y67fs*92(2)|p.S61fs*88(1)|p.Y67fs*95(1)|p.I68fs*39(1)|p.Y7_G130del(1)|p.Y67fs*42(1)|p.Y67fs*37(1)		cervix(1)|haematopoietic_and_lymphoid_tissue(912)|lung(5)|prostate(1)|stomach(1)	920	Esophageal squamous(110;0.137)					CCGGGTCGATGTAGGCGCTGA	0.751			"""Mis, N, F"""		"""AML, MDS"""				Acute Myeloid Leukemia, Familial, associated with CEBPA germline mutation																												p.Y67X		.		Dom	yes		19	19q13.1	1050	"""CCAAT/enhancer binding protein (C/EBP), alpha"""		L	.	CEBPA-7558	12	Insertion - Frameshift(6)|Deletion - Frameshift(5)|Deletion - In frame(1)	haematopoietic_and_lymphoid_tissue(12)	c.C201A						.						4.0	5.0	5.0					19																	33793120		1255	2546	3801	SO:0001587	stop_gained	1050	exon1	Familial Cancer Database	Familial AML	GTCGATGTAGGCG	M37197	CCDS54243.1	19q13.1	2014-09-17				ENSG00000245848		"""basic leucine zipper proteins"""	1833	protein-coding gene	gene with protein product		116897		CEBP		1535333, 1840554	Standard	NM_004364		Approved	C/EBP-alpha	uc002nun.3	P49715		ENST00000498907.2:c.201C>A	19.37:g.33793120G>T	ENSP00000427514:p.Tyr67*	Somatic	26	0		WXS	Illumina HiSeq	Phase_I	84	29	NM_004364	0	0	0	0	0	A7LNP2|P78319|Q05CA4	Nonsense_Mutation	SNP	ENST00000498907.2	37	CCDS54243.1	.	.	.	.	.	.	.	.	.	.	g	33	5.204863	0.95033	.	.	ENSG00000245848	ENST00000498907	.	.	.	3.93	2.89	0.33648	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.1768	0.25749	0.2127:0.0:0.7873:0.0	.	.	.	.	X	67	.	ENSP00000427514:Y67X	Y	-	3	2	CEBPA	38484960	1.000000	0.71417	1.000000	0.80357	0.663000	0.39108	5.273000	0.65564	0.631000	0.30412	0.282000	0.19409	TAC	.		0.751	CEBPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365012.1	NM_004364	
WTIP	126374	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	34991065	34991065	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr19:34991065G>A	ENST00000590071.2	+	8	1521	c.1184G>A	c.(1183-1185)gGa>gAa	p.G395E	WTIP_ENST00000270288.6_Missense_Mutation_p.G619E	NM_001080436.1	NP_001073905.1	A6NIX2	WTIP_HUMAN	Wilms tumor 1 interacting protein	395	LIM zinc-binding 3. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cytoskeleton organization (GO:0007010)|gene silencing by miRNA (GO:0035195)|negative regulation of hippo signaling (GO:0035331)|positive regulation of gene silencing by miRNA (GO:2000637)|regulation of cell morphogenesis (GO:0022604)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasmic mRNA processing body (GO:0000932)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(2)|lung(1)	4	all_lung(56;5.94e-07)|Lung NSC(56;9.35e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.211)			GGGGAGGAGGGACGCCGTTGC	0.667																																					p.G395E		.											.	WTIP-68	0			c.G1184A						.						32.0	40.0	38.0					19																	34991065		2142	4235	6377	SO:0001583	missense	126374	exon8			AGGAGGGACGCCG	AK130059	CCDS59375.1	19q13.11	2012-03-16			ENSG00000142279	ENSG00000142279			20964	protein-coding gene	gene with protein product	"""WT1-interacting protein"""	614790				14736876	Standard	NM_001080436		Approved		uc002nvm.3	A6NIX2		ENST00000590071.2:c.1184G>A	19.37:g.34991065G>A	ENSP00000466953:p.Gly395Glu	Somatic	21	0		WXS	Illumina HiSeq	Phase_I	41	20	NM_001080436	0	0	2	6	4		Missense_Mutation	SNP	ENST00000590071.2	37	CCDS59375.1	.	.	.	.	.	.	.	.	.	.	G	17.23	3.337153	0.60963	.	.	ENSG00000142279	ENST00000270288	T	0.63580	-0.05	4.35	4.35	0.52113	Zinc finger, LIM-type (4);	0.000000	0.85682	D	0.000000	T	0.72835	0.3510	M	0.76838	2.35	0.80722	D	1	P	0.37370	0.592	P	0.47528	0.549	T	0.77760	-0.2467	10	0.66056	D	0.02	.	15.9833	0.80130	0.0:0.0:1.0:0.0	.	619	A6NIX2	WTIP_HUMAN	E	619	ENSP00000270288:G619E	ENSP00000270288:G619E	G	+	2	0	WTIP	39682905	1.000000	0.71417	0.991000	0.47740	0.294000	0.27393	9.098000	0.94202	2.101000	0.63845	0.305000	0.20034	GGA	.		0.667	WTIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459381.3	XM_059037	
LSR	51599	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	35758028	35758028	+	Silent	SNP	C	C	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr19:35758028C>A	ENST00000361790.3	+	9	1464	c.1305C>A	c.(1303-1305)acC>acA	p.T435T	LSR_ENST00000427250.1_Silent_p.T279T|USF2_ENST00000595068.1_5'Flank|LSR_ENST00000602122.1_Silent_p.T415T|USF2_ENST00000343550.5_5'Flank|USF2_ENST00000222305.3_5'Flank|LSR_ENST00000347609.4_Silent_p.T377T|USF2_ENST00000379134.3_5'Flank|LSR_ENST00000354900.3_Silent_p.T416T|AD000684.2_ENST00000602262.1_RNA|USF2_ENST00000594064.1_5'Flank|LSR_ENST00000360798.3_Silent_p.T367T	NM_205834.3	NP_991403.1	Q86X29	LSR_HUMAN	lipolysis stimulated lipoprotein receptor	435					embryo development (GO:0009790)|liver development (GO:0001889)	chylomicron (GO:0042627)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|low-density lipoprotein particle (GO:0034362)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)				breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	13	all_lung(56;3.91e-09)|Lung NSC(56;5.64e-09)|Esophageal squamous(110;0.162)		Epithelial(14;1.33e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.29e-18)|all cancers(14;7.11e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)			GTGAAGTCACCTCCCTCCACG	0.677																																					p.T435T		.											.	LSR-90	0			c.C1305A						.						31.0	40.0	37.0					19																	35758028		2134	4246	6380	SO:0001819	synonymous_variant	51599	exon9			AGTCACCTCCCTC	AF130366	CCDS12449.1, CCDS12450.1, CCDS12451.1, CCDS59376.1	19q13.12	2013-01-11			ENSG00000105699	ENSG00000105699		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29572	protein-coding gene	gene with protein product	"""lipolysis-stimulated remnant"", ""immunoglobulin-like domain containing receptor 3"""					10224102	Standard	NM_015925		Approved	LISCH7, ILDR3	uc002nyl.3	Q86X29		ENST00000361790.3:c.1305C>A	19.37:g.35758028C>A		Somatic	110	0		WXS	Illumina HiSeq	Phase_I	161	93	NM_205834	0	0	19	104	85	A6NDW3|B4DKL4|E9PHD4|O00112|O00426|Q6ZT80|Q8NBM0|Q9BT33|Q9UQL3	Silent	SNP	ENST00000361790.3	37	CCDS12450.1																																																																																			.		0.677	LSR-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465513.2	NM_015925	
ARHGAP33	115703	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	36279064	36279064	+	Silent	SNP	C	C	T	rs182833371		TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr19:36279064C>T	ENST00000007510.4	+	21	3741	c.3597C>T	c.(3595-3597)ccC>ccT	p.P1199P	ARHGAP33_ENST00000378944.5_Silent_p.P1035P|ARHGAP33_ENST00000314737.5_Silent_p.P1038P|AC002398.5_ENST00000433059.1_lincRNA			O14559	RHG33_HUMAN	Rho GTPase activating protein 33	1199					protein transport (GO:0015031)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|Rac GTPase activator activity (GO:0030675)			endometrium(7)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	37						GTTCAGATCCCGGTCCCCCAG	0.687													C|||	0	0.0	0.0	0.0	5008	,	,		10087	0.0		0.0	False		,,,				2504	0.0				p.P1038P		.											.	ARHGAP33-229	0			c.C3114T						.						23.0	30.0	27.0					19																	36279064		2187	4285	6472	SO:0001819	synonymous_variant	115703	exon21			AGATCCCGGTCCC	AY044864	CCDS12477.1, CCDS54254.1	19q13.13	2011-06-29	2010-02-19	2010-02-19		ENSG00000004777		"""Rho GTPase activating proteins"""	23085	protein-coding gene	gene with protein product		614902	"""sorting nexin 26"""	SNX26		12297274, 12461558	Standard	NM_052948		Approved	FLJ39019, TCGAP	uc002obs.2	O14559		ENST00000007510.4:c.3597C>T	19.37:g.36279064C>T		Somatic	43	0		WXS	Illumina HiSeq	Phase_I	50	17	NM_052948	0	0	3	4	1	O14552|O14560|Q6ZSP6|Q96CP3|Q9NT23	Silent	SNP	ENST00000007510.4	37																																																																																				C|0.999;T|0.000		0.687	ARHGAP33-201	KNOWN	basic	protein_coding	protein_coding		NM_052948	
FCGBP	8857	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	40357745	40357745	+	Missense_Mutation	SNP	G	G	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr19:40357745G>T	ENST00000221347.6	-	34	15575	c.15568C>A	c.(15568-15570)Ctg>Atg	p.L5190M		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	5190	Cys-rich.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			TCTGAGGTCAGCAGGGAGGAG	0.577																																					p.L5190M		.											.	FCGBP-98	0			c.C15568A						.						52.0	48.0	49.0					19																	40357745		2203	4300	6503	SO:0001583	missense	8857	exon34			AGGTCAGCAGGGA	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.15568C>A	19.37:g.40357745G>T	ENSP00000221347:p.Leu5190Met	Somatic	166	0		WXS	Illumina HiSeq	Phase_I	199	23	NM_003890	0	0	15	15	0	O95784	Missense_Mutation	SNP	ENST00000221347.6	37	CCDS12546.1	.	.	.	.	.	.	.	.	.	.	G	13.72	2.321017	0.41096	.	.	ENSG00000090920	ENST00000221347	T	0.05649	3.41	4.69	1.09	0.20402	.	0.754197	0.11458	N	0.562013	T	0.07728	0.0194	L	0.28694	0.88	0.22796	N	0.99872	P	0.46395	0.877	P	0.51016	0.656	T	0.39702	-0.9601	10	0.23302	T	0.38	.	7.3143	0.26491	0.0:0.3807:0.4452:0.1741	.	5190	Q9Y6R7	FCGBP_HUMAN	M	5190	ENSP00000221347:L5190M	ENSP00000221347:L5190M	L	-	1	2	FCGBP	45049585	0.892000	0.30473	0.997000	0.53966	0.846000	0.48090	0.111000	0.15458	0.563000	0.29222	0.655000	0.94253	CTG	.		0.577	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
NUP62	23636	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	50412996	50412996	+	Silent	SNP	C	C	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr19:50412996C>T	ENST00000596217.1	-	2	1956	c.69G>A	c.(67-69)acG>acA	p.T23T	NUP62_ENST00000422090.2_Silent_p.T23T|NUP62_ENST00000597029.1_Silent_p.T23T|CTC-326K19.6_ENST00000451973.1_3'UTR|NUP62_ENST00000413454.1_Silent_p.T23T|IL4I1_ENST00000595948.1_Intron|NUP62_ENST00000352066.3_Silent_p.T23T|NUP62_ENST00000600583.1_5'UTR|IL4I1_ENST00000341114.3_Intron|NUP62_ENST00000597723.1_Silent_p.T23T			P37198	NUP62_HUMAN	nucleoporin 62kDa	23	15 X 9 AA approximate repeats.|Thr-rich.				carbohydrate metabolic process (GO:0005975)|cell aging (GO:0007569)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|hormone-mediated signaling pathway (GO:0009755)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of programmed cell death (GO:0043069)|negative regulation of Ras protein signal transduction (GO:0046580)|nucleocytoplasmic transport (GO:0006913)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription, DNA-templated (GO:0045893)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|regulation of Ras protein signal transduction (GO:0046578)|regulation of signal transduction (GO:0009966)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleocytoplasmic shuttling complex (GO:0031074)|pore complex (GO:0046930)|ribonucleoprotein complex (GO:0030529)	chromatin binding (GO:0003682)|receptor signaling complex scaffold activity (GO:0030159)|SH2 domain binding (GO:0042169)|structural constituent of nuclear pore (GO:0017056)|thyroid hormone receptor binding (GO:0046966)|ubiquitin binding (GO:0043130)			breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|stomach(1)|urinary_tract(2)	19		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00242)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		TGGTTGTTGCCGTCTTTGCAG	0.567																																					p.T23T		.											.	NUP62-615	0			c.G69A						.						48.0	55.0	53.0					19																	50412996		2203	4300	6503	SO:0001819	synonymous_variant	23636	exon3			TGTTGCCGTCTTT	X58521	CCDS12788.1	19q13.33	2013-09-20	2002-08-29		ENSG00000213024	ENSG00000213024			8066	protein-coding gene	gene with protein product	"""nuclear pore glycoprotein p62"""	605815	"""nucleoporin 62kD"""			1915414	Standard	NM_016553		Approved	p62, DKFZp547L134, IBSN, SNDI, MGC841, FLJ20822, FLJ43869	uc002pqx.3	P37198	OTTHUMG00000183077	ENST00000596217.1:c.69G>A	19.37:g.50412996C>T		Somatic	82	0		WXS	Illumina HiSeq	Phase_I	88	50	NM_153719	0	0	11	32	21	B3KWU5|Q503A4|Q6GTM2|Q96C43|Q9NSL1	Silent	SNP	ENST00000596217.1	37	CCDS12788.1																																																																																			.		0.567	NUP62-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464991.1	NM_153719	
MBOAT7	79143	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	54687463	54687463	+	Missense_Mutation	SNP	T	T	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr19:54687463T>A	ENST00000245615.1	-	5	914	c.434A>T	c.(433-435)gAc>gTc	p.D145V	MBOAT7_ENST00000431666.2_Missense_Mutation_p.D72V|MBOAT7_ENST00000338624.6_Missense_Mutation_p.D72V|MBOAT7_ENST00000391754.1_Missense_Mutation_p.D145V|MBOAT7_ENST00000474910.1_5'UTR	NM_024298.3	NP_077274.3	Q96N66	MBOA7_HUMAN	membrane bound O-acyltransferase domain containing 7	145					glycerophospholipid biosynthetic process (GO:0046474)|layer formation in cerebral cortex (GO:0021819)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|ventricular system development (GO:0021591)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	lysophospholipid acyltransferase activity (GO:0071617)			endometrium(4)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	10	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					GGAGGGCACGTCGGGCAGCAG	0.617																																					p.D145V	NSCLC(97;826 2151 10470 22540)	.											.	MBOAT7-68	0			c.A434T						.						105.0	84.0	91.0					19																	54687463		2203	4300	6503	SO:0001583	missense	79143	exon5			GGCACGTCGGGCA	AF211969	CCDS12883.1, CCDS54315.1, CCDS54316.1	19q13.4	2008-12-15	2008-01-17	2008-01-17	ENSG00000125505	ENSG00000125505			15505	protein-coding gene	gene with protein product	"""lysophosphatidylinositol acyltransferase"""	606048	"""leukocyte receptor cluster (LRC) member 4"""	LENG4		10941842, 8702217, 18094042	Standard	NM_024298		Approved	BB1, hMBOA-7, LPIAT	uc002qdr.3	Q96N66	OTTHUMG00000066516	ENST00000245615.1:c.434A>T	19.37:g.54687463T>A	ENSP00000245615:p.Asp145Val	Somatic	101	0		WXS	Illumina HiSeq	Phase_I	97	52	NM_001146082	0	0	10	40	30	A9C4B6|B0V3I5|B4DQ87|Q05DF0|Q7L5N2|Q99908|Q9BPV2|Q9BRE9	Missense_Mutation	SNP	ENST00000245615.1	37	CCDS12883.1	.	.	.	.	.	.	.	.	.	.	T	8.074	0.770996	0.15983	.	.	ENSG00000125505	ENST00000431666;ENST00000338624;ENST00000245615;ENST00000449249;ENST00000391754;ENST00000414665;ENST00000453320	T;T;T;T;T	0.72835	-0.69;-0.69;-0.69;-0.69;-0.69	4.2	1.95	0.26073	.	0.659654	0.15733	N	0.247337	T	0.46718	0.1407	N	0.20685	0.6	0.09310	N	1	B;B;B	0.30973	0.033;0.302;0.033	B;B;B	0.21917	0.023;0.037;0.023	T	0.28650	-1.0037	10	0.40728	T	0.16	-2.1121	4.0508	0.09795	0.0:0.1914:0.1877:0.6209	.	127;72;145	B4DDH8;Q96N66-2;Q96N66	.;.;MBOA7_HUMAN	V	72;72;145;97;145;145;145	ENSP00000410503:D72V;ENSP00000344377:D72V;ENSP00000245615:D145V;ENSP00000375634:D145V;ENSP00000388250:D145V	ENSP00000245615:D145V	D	-	2	0	MBOAT7	59379275	0.001000	0.12720	0.058000	0.19502	0.792000	0.44763	1.025000	0.30090	1.714000	0.51371	0.363000	0.22086	GAC	.		0.617	MBOAT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142203.1	NM_024298	
PTPRH	5794	broad.mit.edu	37	19	55716805	55716805	+	Missense_Mutation	SNP	G	G	A	rs200319382		TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr19:55716805G>A	ENST00000376350.3	-	4	530	c.508C>T	c.(508-510)Cac>Tac	p.H170Y	PTPRH_ENST00000263434.5_Intron|PTPRH_ENST00000588559.1_5'UTR	NM_002842.3	NP_002833.3	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H	170	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic process (GO:0006915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(8)|lung(27)|ovary(2)|prostate(5)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	67		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		ATGTTAGTGTGTGCTGTGCTT	0.567													t|||	1	0.000199681	0.0	0.0	5008	,	,		19765	0.001		0.0	False		,,,				2504	0.0				p.H170Y													.	PTPRH-138	0			c.C508T						.						162.0	144.0	150.0					19																	55716805		2203	4299	6502	SO:0001583	missense	5794	exon4			TAGTGTGTGCTGT		CCDS33110.1, CCDS54321.1	19q13.4	2013-02-11				ENSG00000080031		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9672	protein-coding gene	gene with protein product		602510				8294459	Standard	XM_006723312		Approved	SAP-1	uc002qjq.3	Q9HD43		ENST00000376350.3:c.508C>T	19.37:g.55716805G>A	ENSP00000365528:p.His170Tyr	Somatic	196	1		WXS	Illumina HiSeq	Phase_I	254	7	NM_002842	0	0	0	0	0	C9JCH2|Q15426|Q2NKN9|Q2NKP0	Missense_Mutation	SNP	ENST00000376350.3	37	CCDS33110.1	.	.	.	.	.	.	.	.	.	.	t	14.77	2.635065	0.47049	.	.	ENSG00000080031	ENST00000376350	T	0.57436	0.4	3.93	-1.55	0.08558	Fibronectin, type III (4);Immunoglobulin-like fold (1);	3.173960	0.01664	N	0.025272	T	0.37046	0.0989	N	0.14661	0.345	0.09310	N	1	B	0.31519	0.327	B	0.35607	0.206	T	0.21759	-1.0236	10	0.51188	T	0.08	.	4.2695	0.10780	0.0:0.3384:0.3199:0.3416	.	170	Q9HD43	PTPRH_HUMAN	Y	170	ENSP00000365528:H170Y	ENSP00000365528:H170Y	H	-	1	0	PTPRH	60408617	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.994000	0.00656	-0.644000	0.05465	-2.191000	0.00312	CAC	.		0.567	PTPRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452649.1		
KCNS3	3790	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	18113163	18113163	+	Missense_Mutation	SNP	G	G	C			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr2:18113163G>C	ENST00000403915.1	+	3	1339	c.888G>C	c.(886-888)agG>agC	p.R296S	KCNS3_ENST00000465292.1_Intron|KCNS3_ENST00000304101.4_Missense_Mutation_p.R296S	NM_001282428.1	NP_001269357.1	Q9BQ31	KCNS3_HUMAN	potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3	296					energy reserve metabolic process (GO:0006112)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel regulator activity (GO:0015459)			endometrium(5)|kidney(1)|large_intestine(7)|lung(11)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					GGCTTATGAGGATTTTCCGAA	0.502																																					p.R296S		.											.	KCNS3-94	0			c.G888C						.						109.0	107.0	108.0					2																	18113163		2203	4300	6503	SO:0001583	missense	3790	exon3			TATGAGGATTTTC	AF043472	CCDS1692.1	2p24	2011-07-05			ENSG00000170745	ENSG00000170745		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6302	protein-coding gene	gene with protein product		603888				10484328, 16382104	Standard	NM_002252		Approved	Kv9.3	uc002rcw.3	Q9BQ31	OTTHUMG00000044150	ENST00000403915.1:c.888G>C	2.37:g.18113163G>C	ENSP00000385968:p.Arg296Ser	Somatic	161	0		WXS	Illumina HiSeq	Phase_I	220	83	NM_002252	0	0	6	18	12	D6W520|O43651|Q4ZFY1|Q96B56	Missense_Mutation	SNP	ENST00000403915.1	37	CCDS1692.1	.	.	.	.	.	.	.	.	.	.	G	15.35	2.808968	0.50421	.	.	ENSG00000170745	ENST00000403915;ENST00000304101	D;D	0.99594	-6.25;-6.25	5.86	1.98	0.26296	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99638	0.9867	H	0.96301	3.8	0.52099	D	0.999942	D	0.76494	0.999	D	0.85130	0.997	D	0.99194	1.0871	10	0.87932	D	0	.	6.5286	0.22314	0.2607:0.1183:0.621:0.0	.	296	Q9BQ31	KCNS3_HUMAN	S	296	ENSP00000385968:R296S;ENSP00000305824:R296S	ENSP00000305824:R296S	R	+	3	2	KCNS3	17976644	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.263000	0.33004	0.374000	0.24650	0.655000	0.94253	AGG	.		0.502	KCNS3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323808.1	NM_002252	
KHK	3795	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	27315218	27315218	+	Missense_Mutation	SNP	G	G	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr2:27315218G>T	ENST00000260599.6	+	2	624	c.111G>T	c.(109-111)tgG>tgT	p.W37C	KHK_ENST00000490823.1_3'UTR|KHK_ENST00000260598.5_Missense_Mutation_p.W37C	NM_000221.2	NP_000212.1	P50053	KHK_HUMAN	ketohexokinase (fructokinase)	37					carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose catabolic process (GO:0006001)|regulation of glycogen metabolic process (GO:0070873)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ketohexokinase activity (GO:0004454)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(2)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCCAGAGATGGCAGCGCGGAG	0.607																																					p.W37C		.											.	KHK-115	0			c.G111T						.						91.0	80.0	84.0					2																	27315218		2203	4300	6503	SO:0001583	missense	3795	exon2			GAGATGGCAGCGC		CCDS1734.1, CCDS1735.1	2p23.3-p23.2	2008-02-05			ENSG00000138030	ENSG00000138030	2.7.1.3		6315	protein-coding gene	gene with protein product		614058				7833921	Standard	NM_000221		Approved		uc002rim.2	P50053	OTTHUMG00000097077	ENST00000260599.6:c.111G>T	2.37:g.27315218G>T	ENSP00000260599:p.Trp37Cys	Somatic	32	0		WXS	Illumina HiSeq	Phase_I	65	31	NM_006488	0	0	89	197	108	Q6IBK2|Q99532|Q9BRJ3|Q9UMN1	Missense_Mutation	SNP	ENST00000260599.6	37	CCDS1734.1	.	.	.	.	.	.	.	.	.	.	G	15.16	2.750913	0.49257	.	.	ENSG00000138030	ENST00000260599;ENST00000260598;ENST00000429697	T;T;T	0.75938	-0.98;-0.98;-0.98	5.5	5.5	0.81552	Carbohydrate/purine kinase (1);	0.000000	0.85682	D	0.000000	D	0.88377	0.6420	M	0.90082	3.085	0.80722	D	1	D;P;D	0.76494	0.999;0.495;0.999	D;B;D	0.75020	0.985;0.122;0.985	D	0.89208	0.3562	10	0.46703	T	0.11	-18.2402	16.8828	0.86067	0.0:0.0:1.0:0.0	.	37;37;37	Q6IBK2;P50053-2;P50053	.;.;KHK_HUMAN	C	37	ENSP00000260599:W37C;ENSP00000260598:W37C;ENSP00000404741:W37C	ENSP00000260598:W37C	W	+	3	0	KHK	27168722	1.000000	0.71417	1.000000	0.80357	0.325000	0.28411	8.964000	0.93389	2.595000	0.87683	0.462000	0.41574	TGG	.		0.607	KHK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214196.1		
ERLEC1	27248	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	54028861	54028861	+	Missense_Mutation	SNP	C	C	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr2:54028861C>A	ENST00000185150.4	+	8	892	c.761C>A	c.(760-762)tCt>tAt	p.S254Y	ASB3_ENST00000498475.2_Intron|ASB3_ENST00000406625.2_Intron|GPR75-ASB3_ENST00000352846.3_Intron|ERLEC1_ENST00000378239.5_Missense_Mutation_p.S254Y|ERLEC1_ENST00000405123.3_Missense_Mutation_p.S254Y	NM_015701.4	NP_056516.2	Q96DZ1	ERLEC_HUMAN	endoplasmic reticulum lectin 1	254					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	endoplasmic reticulum lumen (GO:0005788)	glycoprotein binding (GO:0001948)			endometrium(2)|large_intestine(4)|lung(8)|ovary(2)|stomach(1)|urinary_tract(1)	18						TTCAGAGCATCTCCTGTGAAT	0.418																																					p.S254Y		.											.	ERLEC1-92	0			c.C761A						.						102.0	92.0	96.0					2																	54028861		2203	4300	6503	SO:0001583	missense	27248	exon8			GAGCATCTCCTGT	AF131849	CCDS1848.1, CCDS46283.1, CCDS46284.1	2p16	2010-03-19	2009-08-26	2009-08-26	ENSG00000068912	ENSG00000068912			25222	protein-coding gene	gene with protein product	"""erlectin 1"""	611229	"""chromosome 2 open reading frame 30"""	C2orf30		9110174, 8619474, 16531414, 18264092	Standard	NM_015701		Approved	CL25084, XTP3TPB, XTP3-B, ERLECTIN	uc002rxl.3	Q96DZ1	OTTHUMG00000129281	ENST00000185150.4:c.761C>A	2.37:g.54028861C>A	ENSP00000185150:p.Ser254Tyr	Somatic	122	0		WXS	Illumina HiSeq	Phase_I	128	61	NM_015701	0	0	0	0	0	B2RDB4|B5MC72|O95901|Q6UWN7|Q9NUY7|Q9UQL4	Missense_Mutation	SNP	ENST00000185150.4	37	CCDS1848.1	.	.	.	.	.	.	.	.	.	.	C	28.3	4.909863	0.92107	.	.	ENSG00000068912	ENST00000405123;ENST00000185150;ENST00000378239	T;T	0.47528	0.84;0.84	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.71350	0.3329	.	.	.	0.80722	D	1	D;P;D	0.71674	0.997;0.756;0.998	D;B;D	0.69479	0.964;0.283;0.931	T	0.72567	-0.4254	9	0.72032	D	0.01	-13.4706	20.4024	0.99000	0.0:1.0:0.0:0.0	.	254;254;254	Q96DZ1-2;B5MC72;Q96DZ1	.;.;ERLEC_HUMAN	Y	254	ENSP00000385629:S254Y;ENSP00000185150:S254Y	ENSP00000185150:S254Y	S	+	2	0	ERLEC1	53882365	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.827000	0.97445	0.650000	0.86243	TCT	.		0.418	ERLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251404.1	NM_015701	
NAGK	55577	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	71304704	71304704	+	Missense_Mutation	SNP	A	A	G			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr2:71304704A>G	ENST00000244204.6	+	9	844	c.782A>G	c.(781-783)aAg>aGg	p.K261R	NAGK_ENST00000443938.2_Missense_Mutation_p.K257R|NAGK_ENST00000418807.3_Missense_Mutation_p.K210R|NAGK_ENST00000443872.2_Missense_Mutation_p.K113R|NAGK_ENST00000455662.2_Missense_Mutation_p.K307R			Q9UJ70	NAGK_HUMAN	N-acetylglucosamine kinase	261					carbohydrate phosphorylation (GO:0046835)|N-acetylglucosamine metabolic process (GO:0006044)|N-acetylmannosamine metabolic process (GO:0006051)|N-acetylneuraminate catabolic process (GO:0019262)	extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|N-acetylglucosamine kinase activity (GO:0045127)			breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(7)|urinary_tract(1)	18					N-Acetyl-D-glucosamine(DB00141)	TTCCAGGGCAAGATTGGACTC	0.602																																					p.K307R		.											.	NAGK-115	0			c.A920G						.						66.0	53.0	57.0					2																	71304704		2203	4300	6503	SO:0001583	missense	55577	exon9			AGGGCAAGATTGG	AJ242910	CCDS33220.1, CCDS33220.2	2p24.3-p24.1	2008-02-05			ENSG00000124357	ENSG00000124357	2.7.1.59		17174	protein-coding gene	gene with protein product		606828				10824116	Standard	NM_017567		Approved	GNK	uc002shp.4	Q9UJ70	OTTHUMG00000153239	ENST00000244204.6:c.782A>G	2.37:g.71304704A>G	ENSP00000244204:p.Lys261Arg	Somatic	59	0		WXS	Illumina HiSeq	Phase_I	99	38	NM_017567	0	0	150	244	94	B4DLZ5|Q53HD5|Q6IA84|Q9BS29|Q9BVP0|Q9NV37	Missense_Mutation	SNP	ENST00000244204.6	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	11.73|11.73	1.724892|1.724892	0.30593|0.30593	.|.	.|.	ENSG00000124357|ENSG00000124357	ENST00000244204;ENST00000455662;ENST00000418807|ENST00000443938	T;T;T|.	0.44083|.	1.52;1.49;0.93|.	5.63|5.63	1.85|1.85	0.25348|0.25348	ATPase, BadF/BadG/BcrA/BcrD type (1);|.	0.811995|.	0.11191|.	N|.	0.589950|.	T|T	0.17619|0.17619	0.0423|0.0423	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	1|1	B|.	0.02656|.	0.0|.	B|.	0.04013|.	0.001|.	T|T	0.18398|0.18398	-1.0338|-1.0338	10|5	0.18276|.	T|.	0.48|.	-17.2471|-17.2471	2.0065|2.0065	0.03478|0.03478	0.4877:0.2795:0.0916:0.1411|0.4877:0.2795:0.0916:0.1411	.|.	261|.	Q9UJ70|.	NAGK_HUMAN|.	R|G	261;307;210|279	ENSP00000244204:K261R;ENSP00000389087:K307R;ENSP00000396070:K210R|.	ENSP00000244204:K261R|.	K|R	+|+	2|1	0|2	NAGK|NAGK	71158212|71158212	0.037000|0.037000	0.19845|0.19845	0.003000|0.003000	0.11579|0.11579	0.043000|0.043000	0.13939|0.13939	1.412000|1.412000	0.34714|0.34714	0.937000|0.937000	0.37394|0.37394	-0.336000|-0.336000	0.08194|0.08194	AAG|AGA	.		0.602	NAGK-032	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000471889.1		
UGGT1	56886	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	128941262	128941262	+	Missense_Mutation	SNP	G	G	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr2:128941262G>T	ENST00000259253.6	+	38	4305	c.4258G>T	c.(4258-4260)Gtg>Ttg	p.V1420L	UGGT1_ENST00000375990.3_Missense_Mutation_p.V1396L	NM_020120.3	NP_064505.1	Q9NYU2	UGGG1_HUMAN	UDP-glucose glycoprotein glucosyltransferase 1	1420	Glucosyltransferase. {ECO:0000250}.				'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)|unfolded protein binding (GO:0051082)			NS(1)|breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(14)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						ACTATATGTTGTGGATCTGAA	0.438																																					p.V1420L		.											.	UGGT1-91	0			c.G4258T						.						107.0	102.0	104.0					2																	128941262		2203	4300	6503	SO:0001583	missense	56886	exon38			TATGTTGTGGATC	AF227905	CCDS2154.1	2q14.3	2009-07-23	2009-07-23	2009-07-23	ENSG00000136731	ENSG00000136731			15663	protein-coding gene	gene with protein product		605897	"""UDP-glucose ceramide glucosyltransferase-like 1"""	UGCGL1		10694380	Standard	NM_020120		Approved	HUGT1	uc002tps.3	Q9NYU2	OTTHUMG00000131570	ENST00000259253.6:c.4258G>T	2.37:g.128941262G>T	ENSP00000259253:p.Val1420Leu	Somatic	140	0		WXS	Illumina HiSeq	Phase_I	141	59	NM_020120	0	0	24	39	15	Q53QP2|Q53SL3|Q8IW30|Q9H8I4	Missense_Mutation	SNP	ENST00000259253.6	37	CCDS2154.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.733269	0.89482	.	.	ENSG00000136731	ENST00000375990;ENST00000259253	T;T	0.37411	1.2;1.2	4.66	4.66	0.58398	.	0.000000	0.85682	D	0.000000	T	0.71978	0.3404	H	0.96175	3.78	0.80722	D	1	D	0.71674	0.998	D	0.69307	0.963	T	0.82600	-0.0377	9	.	.	.	.	18.0955	0.89488	0.0:0.0:1.0:0.0	.	1420	Q9NYU2	UGGG1_HUMAN	L	1396;1420	ENSP00000365158:V1396L;ENSP00000259253:V1420L	.	V	+	1	0	UGGT1	128657732	1.000000	0.71417	0.994000	0.49952	0.844000	0.47949	9.090000	0.94144	2.577000	0.86979	0.563000	0.77884	GTG	.		0.438	UGGT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254435.2	NM_020120	
MAP3K19	80122	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	135744072	135744072	+	Missense_Mutation	SNP	C	C	G			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr2:135744072C>G	ENST00000375845.3	-	7	2400	c.2370G>C	c.(2368-2370)caG>caC	p.Q790H	MAP3K19_ENST00000392918.3_Intron|MAP3K19_ENST00000315513.3_5'UTR|MAP3K19_ENST00000375844.3_Intron|MAP3K19_ENST00000392917.3_Intron|MAP3K19_ENST00000358371.4_Missense_Mutation_p.Q677H|MAP3K19_ENST00000392915.1_Missense_Mutation_p.Q807H	NM_001018044.2|NM_025052.3	NP_001018054.1|NP_079328.3	Q56UN5	M3K19_HUMAN	mitogen-activated protein kinase kinase kinase 19	790							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)										GCTCAGGTGTCTGAGCCAAGT	0.398																																					p.Q790H		.											.	.	0			c.G2370C						.						65.0	65.0	65.0					2																	135744072		2203	4300	6503	SO:0001583	missense	80122	exon7			AGGTGTCTGAGCC	AK026727	CCDS2176.2, CCDS33293.1, CCDS63021.1, CCDS63020.1, CCDS63022.1	2q21.3	2012-10-16	2012-10-16	2012-10-16	ENSG00000176601	ENSG00000176601		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	26249	protein-coding gene	gene with protein product			"""Yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)"""	YSK4		12477932	Standard	NM_001282883		Approved	FLJ23074	uc002tue.1	Q56UN5	OTTHUMG00000074083	ENST00000375845.3:c.2370G>C	2.37:g.135744072C>G	ENSP00000365005:p.Gln790His	Somatic	80	0		WXS	Illumina HiSeq	Phase_I	112	40	NM_025052	0	0	0	0	0	B2RP57|B7ZMH9|E2QRE3|Q56UN1|Q56UN2|Q56UN3|Q56UN4|Q8N4E9|Q9H5T2	Missense_Mutation	SNP	ENST00000375845.3	37	CCDS2176.2	.	.	.	.	.	.	.	.	.	.	C	0.926	-0.714163	0.03206	.	.	ENSG00000176601	ENST00000375845;ENST00000358371;ENST00000392915;ENST00000437365	T;T;T;T	0.72615	-0.53;-0.53;1.83;-0.67	4.61	0.257	0.15574	.	0.519636	0.16240	N	0.223204	T	0.48607	0.1509	N	0.17082	0.46	0.09310	N	0.999998	B;B;B	0.23854	0.023;0.092;0.014	B;B;B	0.22880	0.028;0.042;0.013	T	0.31971	-0.9924	10	0.35671	T	0.21	.	6.5935	0.22659	0.0:0.5532:0.2308:0.2159	.	677;807;790	Q56UN5-3;A8MWG7;Q56UN5	.;.;YSK4_HUMAN	H	790;677;807;180	ENSP00000365005:Q790H;ENSP00000351140:Q677H;ENSP00000376647:Q807H;ENSP00000392827:Q180H	ENSP00000351140:Q677H	Q	-	3	2	YSK4	135460542	0.000000	0.05858	0.005000	0.12908	0.148000	0.21650	-0.294000	0.08309	0.133000	0.18654	0.407000	0.27541	CAG	.		0.398	MAP3K19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000158244.1	NM_025052	
GCA	25801	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	163208899	163208899	+	Missense_Mutation	SNP	A	A	C			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr2:163208899A>C	ENST00000437150.2	+	3	405	c.244A>C	c.(244-246)Att>Ctt	p.I82L	GCA_ENST00000429691.2_Missense_Mutation_p.I63L|GCA_ENST00000233612.4_Missense_Mutation_p.I63L|GCA_ENST00000473240.1_3'UTR	NM_012198.3	NP_036330.1	P28676	GRAN_HUMAN	grancalcin, EF-hand calcium binding protein	82	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				membrane fusion (GO:0061025)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|lung(4)|ovary(1)	9						ACAGTCTGGAATTAATGGAAC	0.308																																					p.I82L		.											.	GCA-90	0			c.A244C						.						175.0	175.0	175.0					2																	163208899		2203	4300	6503	SO:0001583	missense	25801	exon3			TCTGGAATTAATG	M81637	CCDS2218.1	2q24.2	2013-01-10	2001-11-28		ENSG00000115271	ENSG00000115271		"""EF-hand domain containing"""	15990	protein-coding gene	gene with protein product		607030	"""grancalcin, EF-hand calcium-binding protein"""			1737748, 1530588, 12804766	Standard	NM_012198		Approved	GCL	uc002ucg.3	P28676	OTTHUMG00000132057	ENST00000437150.2:c.244A>C	2.37:g.163208899A>C	ENSP00000394842:p.Ile82Leu	Somatic	111	0		WXS	Illumina HiSeq	Phase_I	119	58	NM_012198	0	0	19	31	12	B2R5X3|Q53TB5|Q59EP3	Missense_Mutation	SNP	ENST00000437150.2	37	CCDS2218.1	.	.	.	.	.	.	.	.	.	.	A	15.48	2.845886	0.51164	.	.	ENSG00000115271	ENST00000446271;ENST00000429691;ENST00000437150;ENST00000453113;ENST00000233612	T;T;T;T;T	0.75260	-0.92;-0.92;-0.92;-0.92;-0.92	5.19	5.19	0.71726	EF-hand-like domain (1);	0.726139	0.12958	N	0.425264	T	0.77471	0.4135	M	0.72118	2.19	0.52501	D	0.999952	B	0.33940	0.433	B	0.43536	0.423	T	0.69892	-0.5022	10	0.09843	T	0.71	.	14.0628	0.64810	1.0:0.0:0.0:0.0	.	82	P28676	GRAN_HUMAN	L	108;63;82;63;63	ENSP00000393218:I108L;ENSP00000412899:I63L;ENSP00000394842:I82L;ENSP00000403805:I63L;ENSP00000233612:I63L	ENSP00000233612:I63L	I	+	1	0	GCA	162917145	1.000000	0.71417	1.000000	0.80357	0.797000	0.45037	6.473000	0.73572	1.951000	0.56629	0.528000	0.53228	ATT	.		0.308	GCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255080.3	NM_012198	
XIRP2	129446	broad.mit.edu;bcgsc.ca	37	2	168102112	168102112	+	Missense_Mutation	SNP	C	C	G			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr2:168102112C>G	ENST00000409195.1	+	9	4299	c.4210C>G	c.(4210-4212)Cat>Gat	p.H1404D	XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409273.1_Missense_Mutation_p.H1182D|XIRP2_ENST00000295237.9_Missense_Mutation_p.H1404D|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000420519.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	1229					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						TGAAGAATCACATAATATTAT	0.338																																					p.H1404D													.	XIRP2-104	0			c.C4210G						.						63.0	58.0	60.0					2																	168102112		1838	4095	5933	SO:0001583	missense	129446	exon9			GAATCACATAATA	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.4210C>G	2.37:g.168102112C>G	ENSP00000386840:p.His1404Asp	Somatic	177	1		WXS	Illumina HiSeq	Phase_I	198	82	NM_152381	0	0	0	0	0	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	37	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	C	1.094	-0.663261	0.03428	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.02395	4.31;4.31;4.31	5.67	3.71	0.42584	.	0.488681	0.22341	N	0.061335	T	0.02156	0.0067	L	0.34521	1.04	0.09310	N	1	P;P;B	0.37864	0.475;0.61;0.137	B;B;B	0.32864	0.073;0.154;0.037	T	0.48103	-0.9064	10	0.22109	T	0.4	-0.0519	6.3874	0.21568	0.3388:0.5672:0.0:0.094	.	1229;1229;1182	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	D	1404;1404;1182	ENSP00000386840:H1404D;ENSP00000295237:H1404D;ENSP00000387255:H1182D	ENSP00000295237:H1404D	H	+	1	0	XIRP2	167810358	0.000000	0.05858	0.004000	0.12327	0.096000	0.18686	1.193000	0.32162	1.407000	0.46875	-0.253000	0.11424	CAT	.		0.338	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381	
SPC25	57405	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	169746011	169746011	+	Missense_Mutation	SNP	C	C	G			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr2:169746011C>G	ENST00000282074.2	-	2	160	c.19G>C	c.(19-21)Gca>Cca	p.A7P	SPC25_ENST00000472216.2_5'UTR	NM_020675.3	NP_065726.1	Q9HBM1	SPC25_HUMAN	SPC25, NDC80 kinetochore complex component	7	Interaction with the N-terminus of SPBC24.|Interaction with the NDC80-NUF2 subcomplex.				chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)	condensed chromosome kinetochore (GO:0000777)|cytosol (GO:0005829)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)				central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(3)|urinary_tract(1)	9						TCGAAAAGTGCCAGTTCGTCC	0.368																																					p.A7P		.											.	SPC25-226	0			c.G19C						.						59.0	55.0	57.0					2																	169746011		2203	4300	6503	SO:0001583	missense	57405	exon2			AAAGTGCCAGTTC	AF225416	CCDS2229.1	2q31.1	2013-06-05	2013-06-05	2007-03-02	ENSG00000152253	ENSG00000152253			24031	protein-coding gene	gene with protein product		609395	"""spindle pole body component 25 homolog (S. cerevisiae)"", ""SPC25, NDC80 kinetochore complex component, homolog (S. cerevisiae)"""	SPBC25		12477932	Standard	NM_020675		Approved	MGC22228, AD024	uc002uel.3	Q9HBM1	OTTHUMG00000132181	ENST00000282074.2:c.19G>C	2.37:g.169746011C>G	ENSP00000282074:p.Ala7Pro	Somatic	59	0		WXS	Illumina HiSeq	Phase_I	44	18	NM_020675	0	0	0	0	0	A8K4X8|D3DPC0	Missense_Mutation	SNP	ENST00000282074.2	37	CCDS2229.1	.	.	.	.	.	.	.	.	.	.	C	8.902	0.956561	0.18507	.	.	ENSG00000152253	ENST00000282074;ENST00000451987	.	.	.	6.16	3.38	0.38709	.	0.449522	0.26963	N	0.021614	T	0.18257	0.0438	L	0.27053	0.805	0.26399	N	0.976457	P	0.43169	0.8	B	0.37943	0.261	T	0.08330	-1.0727	9	0.46703	T	0.11	0.0356	6.4946	0.22136	0.0:0.693:0.1487:0.1583	.	7	Q9HBM1	SPC25_HUMAN	P	7	.	ENSP00000282074:A7P	A	-	1	0	SPC25	169454257	0.107000	0.21998	0.161000	0.22692	0.012000	0.07955	0.142000	0.16096	0.469000	0.27268	-0.142000	0.14014	GCA	.		0.368	SPC25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255233.2	NM_020675	
METTL5	29081	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	170677784	170677784	+	Splice_Site	SNP	C	C	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr2:170677784C>A	ENST00000260953.5	-	3	541		c.e3-1		METTL5_ENST00000308099.3_Splice_Site|METTL5_ENST00000392640.2_Splice_Site|METTL5_ENST00000409340.1_Intron|METTL5_ENST00000409965.1_Splice_Site|METTL5_ENST00000409837.1_Splice_Site|METTL5_ENST00000410097.1_Splice_Site	NM_014168.2	NP_054887.2	Q9NRN9	METL5_HUMAN	methyltransferase like 5								methyltransferase activity (GO:0008168)|nucleic acid binding (GO:0003676)			breast(2)|central_nervous_system(1)|large_intestine(5)|lung(1)|prostate(1)	10						AACACACAACCTATAAATACA	0.299																																					.		.											.	METTL5-90	0			c.225-1G>T						.						75.0	75.0	75.0					2																	170677784		2203	4298	6501	SO:0001630	splice_region_variant	29081	exon4			CACAACCTATAAA	AF201938	CCDS33320.1	2q31.1	2011-01-28			ENSG00000138382	ENSG00000138382			25006	protein-coding gene	gene with protein product						11042152	Standard	XM_005246478		Approved	HSPC133	uc002ufn.3	Q9NRN9	OTTHUMG00000154117	ENST00000260953.5:c.225-1G>T	2.37:g.170677784C>A		Somatic	82	0		WXS	Illumina HiSeq	Phase_I	114	39	NM_014168	0	0	0	0	0	D3DPC9|Q9NVX1	Splice_Site	SNP	ENST00000260953.5	37	CCDS33320.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.065087	0.76187	.	.	ENSG00000138382	ENST00000409837;ENST00000540464;ENST00000260953;ENST00000409965;ENST00000392640;ENST00000308099;ENST00000410097	.	.	.	5.04	5.04	0.67666	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.7542	0.91826	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	METTL5	170386030	1.000000	0.71417	0.932000	0.37286	0.983000	0.72400	7.590000	0.82653	2.490000	0.84030	0.655000	0.94253	.	.		0.299	METTL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333957.1	NM_014168	Intron
NHEJ1	79840	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	220022946	220022946	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr2:220022946C>T	ENST00000356853.5	-	2	272	c.139G>A	c.(139-141)Gaa>Aaa	p.E47K	NHEJ1_ENST00000409720.1_Missense_Mutation_p.E47K	NM_024782.2	NP_079058.1	Q9H9Q4	NHEJ1_HUMAN	nonhomologous end-joining factor 1	47	Globular head.				B cell differentiation (GO:0030183)|central nervous system development (GO:0007417)|DNA recombination (GO:0006310)|double-strand break repair via nonhomologous end joining (GO:0006303)|positive regulation of ligase activity (GO:0051351)|response to ionizing radiation (GO:0010212)|T cell differentiation (GO:0030217)	nonhomologous end joining complex (GO:0070419)|nucleus (GO:0005634)	DNA binding (GO:0003677)			kidney(1)|large_intestine(3)|lung(5)|prostate(1)|skin(2)	12		Renal(207;0.0915)		Epithelial(149;2.15e-06)|all cancers(144;0.000339)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(261;0.0112)		TCCACCTGTTCATGCCACACC	0.527								Non-homologous end-joining																													p.E47K		.											.	NHEJ1-227	0			c.G139A						.						158.0	135.0	143.0					2																	220022946		2203	4300	6503	SO:0001583	missense	79840	exon2			CCTGTTCATGCCA	AJ972687	CCDS2432.1	2q35	2014-09-17			ENSG00000187736	ENSG00000187736			25737	protein-coding gene	gene with protein product		611290				16439204, 16439205	Standard	NM_024782		Approved	Cernunnos, XLF, FLJ12610	uc002vjp.4	Q9H9Q4	OTTHUMG00000133127	ENST00000356853.5:c.139G>A	2.37:g.220022946C>T	ENSP00000349313:p.Glu47Lys	Somatic	76	0		WXS	Illumina HiSeq	Phase_I	112	47	NM_024782	0	0	12	28	16	B8ZZA4|Q4ZFW7|Q6IA64|Q96JS9	Missense_Mutation	SNP	ENST00000356853.5	37	CCDS2432.1	.	.	.	.	.	.	.	.	.	.	C	34	5.320702	0.95682	.	.	ENSG00000187736	ENST00000409720;ENST00000356853;ENST00000457600	T;T;T	0.71698	-0.59;-0.59;-0.59	5.7	5.7	0.88788	DNA double-strand break repair and VJ recombination XRCC4, N-terminal (1);	0.000000	0.85682	U	0.000000	D	0.85414	0.5691	M	0.77103	2.36	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86392	0.1736	10	0.87932	D	0	0.2919	19.8022	0.96513	0.0:1.0:0.0:0.0	.	47	Q9H9Q4	NHEJ1_HUMAN	K	47	ENSP00000387290:E47K;ENSP00000349313:E47K;ENSP00000407201:E47K	ENSP00000349313:E47K	E	-	1	0	NHEJ1	219731190	0.998000	0.40836	1.000000	0.80357	0.994000	0.84299	4.959000	0.63666	2.683000	0.91414	0.655000	0.94253	GAA	.		0.527	NHEJ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256817.2	NM_024782	
LOC151174	151174	broad.mit.edu;bcgsc.ca	37	2	239140742	239140742	+	5'Flank	SNP	T	T	C			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr2:239140742T>C	ENST00000409070.1	-	0	0				AC016757.3_ENST00000409376.1_5'Flank|AC016757.3_ENST00000334973.4_5'Flank|AC016757.3_ENST00000470346.1_5'Flank|AC016757.3_ENST00000409942.1_5'Flank|AC096574.4_ENST00000456601.1_RNA																							CCGGTGTATGTTGTCAACTAT	0.468																																					.													.	.	0			.						.																																			SO:0001631	upstream_gene_variant	0	.			TGTATGTTGTCAA																													2.37:g.239140742T>C	Exception_encountered	Somatic	131	0		WXS	Illumina HiSeq	Phase_I	171	81	.	0	0	0	0	0		RNA	SNP	ENST00000409070.1	37																																																																																				.		0.468	AC016757.3-006	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000328480.1		
FRG1B	284802	bcgsc.ca	37	20	29623218	29623218	+	Silent	SNP	A	A	G	rs368763678	byFrequency	TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr20:29623218A>G	ENST00000278882.3	+	3	410	c.30A>G	c.(28-30)acA>acG	p.T10T	FRG1B_ENST00000358464.4_Silent_p.T10T|FRG1B_ENST00000439954.2_Missense_Mutation_p.N12D			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	10								p.T10T(4)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TGCACTCGACAATGGTCTTTT	0.408													.|||	318	0.0634984	0.0212	0.0692	5008	,	,		48514	0.0228		0.1431	False		,,,				2504	0.0767				.													.	FRG1B-22	4	Substitution - coding silent(4)	endometrium(2)|kidney(2)	.						.																																			SO:0001819	synonymous_variant	284802	.			CTCGACAATGGTC			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.30A>G	20.37:g.29623218A>G		Somatic	861	24		WXS	Illumina HiSeq	Phase_1	927	44	.	0	0	104	125	21	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	a	9.656	1.142954	0.21205	.	.	ENSG00000149531	ENST00000439954	T	0.51817	0.69	1.93	1.93	0.25924	.	.	.	.	.	T	0.50803	0.1637	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50242	-0.8851	6	0.48119	T	0.1	.	7.8149	0.29254	1.0:0.0:0.0:0.0	.	.	.	.	D	12	ENSP00000408863:N12D	ENSP00000408863:N12D	N	+	1	0	FRG1B	28236879	1.000000	0.71417	1.000000	0.80357	0.105000	0.19272	7.836000	0.86788	1.147000	0.42369	0.347000	0.21830	AAT	.		0.408	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
FRG1B	284802	bcgsc.ca	37	20	29633902	29633902	+	Missense_Mutation	SNP	C	C	A	rs145072022		TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr20:29633902C>A	ENST00000278882.3	+	9	921	c.541C>A	c.(541-543)Cca>Aca	p.P181T	FRG1B_ENST00000358464.4_Missense_Mutation_p.P181T			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	181								p.P181T(2)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						AACAAGAGAACCAAATTGAAA	0.274																																					.													.	FRG1B-22	2	Substitution - Missense(2)	endometrium(2)	.						.																																			SO:0001583	missense	284802	.			AGAGAACCAAATT			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.541C>A	20.37:g.29633902C>A	ENSP00000278882:p.Pro181Thr	Somatic	307	3		WXS	Illumina HiSeq	Phase_1	235	11	.	0	0	0	0	0	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	c	4.973	0.180670	0.09443	.	.	ENSG00000149531	ENST00000278882;ENST00000358464	.	.	.	1.62	1.62	0.23740	.	.	.	.	.	T	0.42063	0.1186	.	.	.	0.20074	N	0.999938	.	.	.	.	.	.	T	0.34527	-0.9825	5	0.52906	T	0.07	.	9.2539	0.37571	0.0:1.0:0.0:0.0	.	.	.	.	T	181	.	ENSP00000278882:P181T	P	+	1	0	FRG1B	28247563	1.000000	0.71417	1.000000	0.80357	0.811000	0.45836	3.567000	0.53813	1.206000	0.43276	0.502000	0.49764	CCA	.		0.274	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
RIMS4	140730	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	43378853	43378853	+	IGR	SNP	G	G	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr20:43378853G>A	ENST00000372851.3	-	0	5203				KCNK15_ENST00000372861.3_Missense_Mutation_p.V123I	NM_001205317.1|NM_182970.3	NP_001192246.1|NP_892015.1	Q9H426	RIMS4_HUMAN	regulating synaptic membrane exocytosis 4						exocytosis (GO:0006887)|neurotransmitter transport (GO:0006836)|regulation of membrane potential (GO:0042391)	cell junction (GO:0030054)|presynaptic active zone (GO:0048786)|synaptic membrane (GO:0097060)				central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(11)|ovary(5)|urinary_tract(1)	29		Myeloproliferative disorder(115;0.0122)				GCTGACGCTGGTCACTTTCCA	0.682																																					p.V123I		.											.	KCNK15-90	0			c.G367A						.						35.0	31.0	33.0					20																	43378853		2203	4300	6503	SO:0001628	intergenic_variant	60598	exon2			ACGCTGGTCACTT		CCDS13338.1, CCDS56191.1	20q13.12	2005-02-03	2003-06-18	2003-06-20	ENSG00000101098	ENSG00000101098			16183	protein-coding gene	gene with protein product		611601	"""chromosome 20 open reading frame 190"""	C20orf190		12620390	Standard	NM_182970		Approved	dJ781B1.3	uc010ggu.3	Q9H426	OTTHUMG00000032546		20.37:g.43378853G>A		Somatic	61	0		WXS	Illumina HiSeq	Phase_I	136	40	NM_022358	0	0	0	1	1	A4FU94|E1P613|Q3MI44|Q5JWT7	Missense_Mutation	SNP	ENST00000372851.3	37	CCDS13338.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.418600	0.83559	.	.	ENSG00000124249	ENST00000372861	T	0.28454	1.61	4.08	4.08	0.47627	Ion transport 2 (1);	0.000000	0.64402	U	0.000004	T	0.43100	0.1232	L	0.31578	0.945	0.54753	D	0.999989	D	0.69078	0.997	D	0.72075	0.976	T	0.38351	-0.9665	10	0.45353	T	0.12	.	16.4786	0.84151	0.0:0.0:1.0:0.0	.	123	Q9H427	KCNKF_HUMAN	I	123	ENSP00000361952:V123I	ENSP00000361952:V123I	V	+	1	0	KCNK15	42812267	1.000000	0.71417	0.999000	0.59377	0.904000	0.53231	6.347000	0.73004	2.095000	0.63458	0.655000	0.94253	GTC	.		0.682	RIMS4-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000101027.2	NM_182970	
EYA2	2139	bcgsc.ca	37	20	45801422	45801422	+	Missense_Mutation	SNP	G	G	C			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr20:45801422G>C	ENST00000327619.5	+	12	1479	c.1105G>C	c.(1105-1107)Ggc>Cgc	p.G369R	EYA2_ENST00000357410.3_Missense_Mutation_p.G369R|EYA2_ENST00000317304.6_Missense_Mutation_p.G339R	NM_005244.4	NP_005235.3	O00167	EYA2_HUMAN	EYA transcriptional coactivator and phosphatase 2	369					DNA repair (GO:0006281)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|histone dephosphorylation (GO:0016576)|mesodermal cell fate specification (GO:0007501)|mitochondrial outer membrane permeabilization (GO:0097345)|peptidyl-tyrosine dephosphorylation (GO:0035335)|regulation of transcription, DNA-templated (GO:0006355)|striated muscle tissue development (GO:0014706)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	magnesium ion binding (GO:0000287)|protein tyrosine phosphatase activity (GO:0004725)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0241)				CCTGGGCTCTGGCGTGCACGG	0.597																																					p.G369R	Pancreas(120;56 1725 18501 25218 43520)												.	EYA2-523	0			c.G1105C						.						116.0	94.0	101.0					20																	45801422		2203	4300	6503	SO:0001583	missense	2139	exon12			GGCTCTGGCGTGC		CCDS13403.1, CCDS54471.1	20q13.1	2014-06-19	2014-06-19		ENSG00000064655	ENSG00000064655		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3520	protein-coding gene	gene with protein product		601654	"""eyes absent (Drosophila) homolog 2"", ""eyes absent homolog 2 (Drosophila)"""			9020840	Standard	NM_005244		Approved	EAB1	uc002xsm.3	O00167	OTTHUMG00000033041	ENST00000327619.5:c.1105G>C	20.37:g.45801422G>C	ENSP00000333640:p.Gly369Arg	Somatic	90	2		WXS	Illumina HiSeq	Phase_1	152	39	NM_172110	0	0	3	7	4	Q5JSW8|Q86U84|Q96CV6|Q96H97|Q99503|Q99812|Q9BWF6|Q9H4S3|Q9H4S9|Q9NPZ4|Q9UIX7	Missense_Mutation	SNP	ENST00000327619.5	37	CCDS13403.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.006264	0.74932	.	.	ENSG00000064655	ENST00000327619;ENST00000357410;ENST00000484200;ENST00000317304	D;D;D	0.82081	-1.57;-1.57;-1.57	5.59	3.66	0.41972	EYA (1);Haloacid dehalogenase-like hydrolase (1);	0.052802	0.85682	N	0.000000	D	0.91150	0.7213	M	0.86864	2.845	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.91363	0.5113	10	0.87932	D	0	-14.6465	11.6637	0.51363	0.1423:0.0:0.8577:0.0	.	369;339;369;369	O00167-3;E7ETN2;A8KAG7;O00167	.;.;.;EYA2_HUMAN	R	369;369;339;339	ENSP00000333640:G369R;ENSP00000349986:G369R;ENSP00000321590:G339R	ENSP00000321590:G339R	G	+	1	0	EYA2	45234829	1.000000	0.71417	0.016000	0.15963	0.779000	0.44077	9.719000	0.98760	0.733000	0.32492	0.655000	0.94253	GGC	.		0.597	EYA2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080326.2	NM_005244	
LIPI	149998	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	15554119	15554119	+	Silent	SNP	C	C	T	rs368826576		TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr21:15554119C>T	ENST00000536861.1	-	4	602	c.603G>A	c.(601-603)acG>acA	p.T201T	LIPI_ENST00000344577.2_Silent_p.T222T			Q6XZB0	LIPI_HUMAN	lipase, member I	201					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|phospholipase activity (GO:0004620)			endometrium(1)|kidney(13)|large_intestine(9)|liver(3)|lung(24)|ovary(3)|urinary_tract(1)	54				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.0015)|Colorectal(24;0.00693)|Lung(58;0.166)		ACTTTGCATCCGTGTAATCTA	0.388																																					p.T222T		.											.	LIPI-70	0			c.G666A						.	A		0,4406		0,0,2203	104.0	98.0	100.0		666	-5.4	0.9	21		100	1,8599		0,1,4299	no	coding-synonymous	LIPI	NM_198996.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		222/482	15554119	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	149998	exon4			TGCATCCGTGTAA	BC028732	CCDS13564.1	21q11.2	2012-07-31			ENSG00000188992	ENSG00000188992			18821	protein-coding gene	gene with protein product	"""membrane-associated phospholipase A1 beta"", ""cancer/testis antigen 17"""	609252				12719377	Standard	XM_005260924		Approved	PRED5, LPDL, CT17, mPA-PLA1beta, PLA1C	uc002yjm.3	Q6XZB0	OTTHUMG00000074258	ENST00000536861.1:c.603G>A	21.37:g.15554119C>T		Somatic	52	0		WXS	Illumina HiSeq	Phase_I	66	18	NM_198996	0	0	0	0	0	G1JSG3|G1JSG4|G1JSG5|G1JSG6|G1JSG7|G1JSG8|G1JSG9	Silent	SNP	ENST00000536861.1	37		.	.	.	.	.	.	.	.	.	.	A	8.536	0.872084	0.17322	0.0	1.16E-4	ENSG00000188992	ENST00000400211	.	.	.	5.46	-5.41	0.02648	.	.	.	.	.	T	0.35508	0.0934	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.36648	-0.9739	4	.	.	.	.	1.1112	0.01704	0.2909:0.094:0.2357:0.3795	.	.	.	.	R	81	.	.	G	-	1	0	LIPI	14475990	0.021000	0.18746	0.905000	0.35620	0.056000	0.15407	-0.820000	0.04457	-1.108000	0.03000	-4.655000	0.00004	GGA	.		0.388	LIPI-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_198996	
NCAM2	4685	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	22906941	22906941	+	Missense_Mutation	SNP	A	A	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr21:22906941A>T	ENST00000400546.1	+	17	2615	c.2366A>T	c.(2365-2367)aAt>aTt	p.N789I	NCAM2_ENST00000284894.7_Missense_Mutation_p.N647I	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2	789					axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		AGCCCAGTAAATGAGCCAAAT	0.393																																					p.N789I		.											.	NCAM2-94	0			c.A2366T						.						113.0	108.0	109.0					21																	22906941		1920	4124	6044	SO:0001583	missense	4685	exon17			CAGTAAATGAGCC		CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.2366A>T	21.37:g.22906941A>T	ENSP00000383392:p.Asn789Ile	Somatic	132	0		WXS	Illumina HiSeq	Phase_I	122	35	NM_004540	0	0	0	0	0	A8MQ06|B7Z841|Q7Z7F2	Missense_Mutation	SNP	ENST00000400546.1	37	CCDS42910.1	.	.	.	.	.	.	.	.	.	.	A	20.1	3.935591	0.73442	.	.	ENSG00000154654	ENST00000400546;ENST00000284894	T;T	0.44083	0.93;0.93	5.49	5.49	0.81192	.	0.210687	0.48286	D	0.000186	T	0.49729	0.1574	L	0.41236	1.265	0.80722	D	1	D;D	0.61697	0.99;0.985	P;P	0.56398	0.797;0.724	T	0.49978	-0.8881	10	0.54805	T	0.06	-29.9197	14.4086	0.67101	1.0:0.0:0.0:0.0	.	647;789	B7Z5K2;O15394	.;NCAM2_HUMAN	I	789;647	ENSP00000383392:N789I;ENSP00000284894:N647I	ENSP00000284894:N647I	N	+	2	0	NCAM2	21828812	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	6.778000	0.75043	2.088000	0.63022	0.377000	0.23210	AAT	.		0.393	NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000170915.1	NM_004540	
BACE2	25825	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	42551431	42551431	+	Intron	SNP	C	C	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr21:42551431C>T	ENST00000330333.6	+	1	775				PLAC4_ENST00000414699.1_RNA|PLAC4_ENST00000430327.2_RNA|BACE2-IT1_ENST00000433378.1_RNA|BACE2_ENST00000347667.5_Intron|PLAC4_ENST00000440221.2_RNA|PLAC4_ENST00000536486.1_RNA|BACE2_ENST00000328735.6_Intron	NM_012105.3	NP_036237.2	Q9Y5Z0	BACE2_HUMAN	beta-site APP-cleaving enzyme 2						membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	aspartic-type endopeptidase activity (GO:0004190)			endometrium(2)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14		Prostate(19;1.57e-07)|all_epithelial(19;0.0251)				GTGACGGTGTCTGGGGTGAGT	0.607																																					p.R42K		.											.	.	0			c.G125A						.						125.0	109.0	114.0					21																	42551431		2196	4274	6470	SO:0001627	intron_variant	191585	exon1			CGGTGTCTGGGGT	AF117892	CCDS13668.1, CCDS13669.1, CCDS13670.1	21q22.3	2011-08-11			ENSG00000182240	ENSG00000182240			934	protein-coding gene	gene with protein product		605668		AEPLC		10965118, 10830953	Standard	NM_138991		Approved	CEAP1, DRAP, ALP56	uc002yyw.3	Q9Y5Z0	OTTHUMG00000086742	ENST00000330333.6:c.312+10929C>T	21.37:g.42551431C>T		Somatic	137	0		WXS	Illumina HiSeq	Phase_I	179	49	NM_182832	0	0	0	0	0	A8K7P1|Q5DIH8|Q8N2D4|Q9H2V8|Q9NZL1|Q9NZL2|Q9UJT6	Missense_Mutation	SNP	ENST00000330333.6	37	CCDS13668.1																																																																																			.		0.607	BACE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195056.1		
NEFH	4744	hgsc.bcm.edu	37	22	29885562	29885562	+	Missense_Mutation	SNP	G	G	A	rs370929798		TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr22:29885562G>A	ENST00000310624.6	+	4	1966	c.1933G>A	c.(1933-1935)Gaa>Aaa	p.E645K		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	645	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						AACGAAGGAGGAAGCAAAGTC	0.562																																					p.E645K		.											.	NEFH-90	0			c.G1933A						.						82.0	88.0	86.0					22																	29885562		2203	4300	6503	SO:0001583	missense	4744	exon4			AAGGAGGAAGCAA		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1933G>A	22.37:g.29885562G>A	ENSP00000311997:p.Glu645Lys	Somatic	140	0		WXS	Illumina HiSeq	Phase_I	180	9	NM_021076	0	0	0	0	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Missense_Mutation	SNP	ENST00000310624.6	37	CCDS13858.1	.	.	.	.	.	.	.	.	.	.	G	9.212	1.031217	0.19590	.	.	ENSG00000100285	ENST00000328842;ENST00000310624	D	0.83914	-1.78	4.97	4.97	0.65823	.	0.115504	0.38778	N	0.001569	D	0.87783	0.6264	L	0.61218	1.895	0.29104	N	0.881289	P	0.36712	0.566	P	0.52267	0.694	D	0.83526	0.0088	10	0.44086	T	0.13	.	16.1111	0.81263	0.0:0.0:1.0:0.0	.	645	P12036	NFH_HUMAN	K	645	ENSP00000311997:E645K	ENSP00000311997:E645K	E	+	1	0	NEFH	28215562	0.001000	0.12720	0.367000	0.25926	0.091000	0.18340	0.923000	0.28757	2.745000	0.94114	0.491000	0.48974	GAA	.		0.562	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
CHADL	150356	broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	41633556	41633556	+	Missense_Mutation	SNP	T	T	C			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr22:41633556T>C	ENST00000216241.9	-	3	1572	c.1520A>G	c.(1519-1521)aAc>aGc	p.N507S		NM_138481.1	NP_612490.1	Q6NUI6	CHADL_HUMAN	chondroadherin-like	507						proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(1)|skin(1)	4						CAGGAAACGGTTGCGTTCTAG	0.672																																					p.N507S													.	CHADL-68	0			c.A1520G						.						4.0	6.0	5.0					22																	41633556		644	1499	2143	SO:0001583	missense	150356	exon3			AAACGGTTGCGTT	BC012882	CCDS46715.1	22q13.2	2008-10-31			ENSG00000100399	ENSG00000100399			25165	protein-coding gene	gene with protein product						12477932	Standard	NM_138481		Approved	SLRR4B	uc003azq.4	Q6NUI6	OTTHUMG00000150936	ENST00000216241.9:c.1520A>G	22.37:g.41633556T>C	ENSP00000216241:p.Asn507Ser	Somatic	109	1		WXS	Illumina HiSeq	Phase_I	255	31	NM_138481	0	0	4	4	0	Q05CY2|Q4G0S0|Q5JY13|Q86XY1|Q96E60	Missense_Mutation	SNP	ENST00000216241.9	37	CCDS46715.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.80|16.80	3.222940|3.222940	0.58668|0.58668	.|.	.|.	ENSG00000100399|ENSG00000100399	ENST00000216241|ENST00000417999	T|.	0.72615|.	-0.67|.	4.68|4.68	4.68|4.68	0.58851|0.58851	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.80560|0.80560	0.4646|0.4646	M|M	0.89840|0.89840	3.065|3.065	0.39676|0.39676	D|D	0.970835|0.970835	D;D|.	0.89917|.	0.999;1.0|.	D;D|.	0.85130|.	0.987;0.997|.	D|D	0.85586|0.85586	0.1243|0.1243	10|5	0.72032|.	D|.	0.01|.	.|.	14.4837|14.4837	0.67599|0.67599	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	507;507|.	Q6NUI6-2;Q6NUI6|.	.;CHADL_HUMAN|.	S|A	507|505	ENSP00000216241:N507S|.	ENSP00000216241:N507S|.	N|T	-|-	2|1	0|0	CHADL|CHADL	39963502|39963502	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.521000|0.521000	0.34408|0.34408	4.978000|4.978000	0.63799|0.63799	1.888000|1.888000	0.54679|0.54679	0.454000|0.454000	0.30748|0.30748	AAC|ACC	.		0.672	CHADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320597.1	NM_138481	
SHANK3	85358	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	51160316	51160316	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr22:51160316C>T	ENST00000414786.2	+	21	4240	c.4013C>T	c.(4012-4014)gCa>gTa	p.A1338V	SHANK3_ENST00000445220.2_Missense_Mutation_p.A1354V|SHANK3_ENST00000262795.3_Missense_Mutation_p.A1368V			Q9BYB0	SHAN3_HUMAN	SH3 and multiple ankyrin repeat domains 3	1352	Pro-rich.				adult behavior (GO:0030534)|alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|brain morphogenesis (GO:0048854)|dendritic spine morphogenesis (GO:0060997)|guanylate kinase-associated protein clustering (GO:0097117)|learning (GO:0007612)|MAPK cascade (GO:0000165)|memory (GO:0007613)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of actin filament bundle assembly (GO:0032232)|negative regulation of cell volume (GO:0045794)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of glutamate receptor signaling pathway (GO:1900451)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse structural plasticity (GO:0051835)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density assembly (GO:0097107)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of long term synaptic depression (GO:1900452)|regulation of long-term synaptic potentiation (GO:1900271)|social behavior (GO:0035176)|striatal medium spiny neuron differentiation (GO:0021773)|synapse assembly (GO:0007416)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|neuron spine (GO:0044309)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(5)	8		all_cancers(38;3.75e-11)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.22)		CCTGAGTCTGCAGCCGACTCT	0.701																																					p.A1338V		.											.	SHANK3-69	0			c.C4013T						.						9.0	11.0	10.0					22																	51160316		1919	4032	5951	SO:0001583	missense	85358	exon21			AGTCTGCAGCCGA	AB051437		22q13.3	2013-11-14			ENSG00000251322	ENSG00000251322		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14294	protein-coding gene	gene with protein product	"""proline rich synapse associated protein 2"", ""shank postsynaptic density protein"""	606230				11258795, 11431708, 10806096, 17173049	Standard	NM_033517		Approved	SPANK-2, prosap2, KIAA1650, PSAP2	uc031ryd.1	Q9BYB0	OTTHUMG00000150169	ENST00000414786.2:c.4013C>T	22.37:g.51160316C>T	ENSP00000464552:p.Ala1338Val	Somatic	30	0		WXS	Illumina HiSeq	Phase_I	87	53	NM_033517	0	0	1	5	4	D7UT47|Q8TET3	Missense_Mutation	SNP	ENST00000414786.2	37		.	.	.	.	.	.	.	.	.	.	C	8.474	0.858312	0.17178	.	.	ENSG00000251322	ENST00000262795;ENST00000445220	T;T	0.13089	2.62;2.62	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	T	0.13543	0.0328	N	0.24115	0.695	0.27140	N	0.961671	D;P;D	0.56521	0.97;0.941;0.976	P;B;B	0.51895	0.683;0.43;0.441	T	0.12837	-1.0532	10	0.02654	T	1	.	16.0382	0.80645	0.0:1.0:0.0:0.0	.	1352;1353;1368	D7UT47;Q9BYB0;F2Z3L0	.;SHAN3_HUMAN;.	V	1368;1354	ENSP00000442518:A1368V;ENSP00000446078:A1354V	ENSP00000442518:A1368V	A	+	2	0	SHANK3	49507182	1.000000	0.71417	0.900000	0.35374	0.856000	0.48823	5.501000	0.66950	2.381000	0.81170	0.462000	0.41574	GCA	.		0.701	SHANK3-001	KNOWN	non_canonical_polymorphism|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000316674.2	NM_001080420	
SETD5	55209	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	9475587	9475587	+	Missense_Mutation	SNP	A	A	G			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr3:9475587A>G	ENST00000406341.1	+	3	320	c.130A>G	c.(130-132)Aat>Gat	p.N44D	SETD5_ENST00000402198.1_Missense_Mutation_p.N44D|SETD5_ENST00000402466.1_5'UTR|SETD5_ENST00000302463.6_5'UTR|SETD5_ENST00000407969.1_Missense_Mutation_p.N44D			Q9C0A6	SETD5_HUMAN	SET domain containing 5	44										NS(2)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(3)|prostate(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.112)		TTCCACTCATAATTATGGGAC	0.468																																					p.N44D		.											.	SETD5-70	0			c.A130G						.						204.0	200.0	201.0					3																	9475587		2010	4171	6181	SO:0001583	missense	55209	exon4			ACTCATAATTATG	BC020956	CCDS46741.1, CCDS74892.1	3p25.3	2011-12-13			ENSG00000168137	ENSG00000168137			25566	protein-coding gene	gene with protein product		615743				11214970	Standard	XM_005265299		Approved	FLJ10707	uc003brt.3	Q9C0A6	OTTHUMG00000150491	ENST00000406341.1:c.130A>G	3.37:g.9475587A>G	ENSP00000383939:p.Asn44Asp	Somatic	168	0		WXS	Illumina HiSeq	Phase_I	155	41	NM_001080517	0	0	1	3	2	Q6AI17|Q8WUB6|Q9H3X4|Q9H6V7|Q9H7S3|Q9NVI9	Missense_Mutation	SNP	ENST00000406341.1	37	CCDS46741.1	.	.	.	.	.	.	.	.	.	.	A	11.09	1.537828	0.27475	.	.	ENSG00000168137	ENST00000450326;ENST00000402198;ENST00000406341;ENST00000407969	T;D;D;D	0.90261	1.45;-2.64;-2.64;-2.59	6.07	6.07	0.98685	.	.	.	.	.	D	0.82986	0.5156	L	0.47716	1.5	0.80722	D	1	P	0.38922	0.651	B	0.30401	0.115	T	0.79579	-0.1745	9	0.11485	T	0.65	-13.9018	9.0586	0.36421	0.8937:0.0:0.1063:0.0	.	44	Q9C0A6	SETD5_HUMAN	D	44	ENSP00000413786:N44D;ENSP00000385852:N44D;ENSP00000383939:N44D;ENSP00000384114:N44D	ENSP00000385852:N44D	N	+	1	0	SETD5	9450587	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.856000	0.75450	2.330000	0.79161	0.477000	0.44152	AAT	.		0.468	SETD5-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318425.1	XM_371614	
DNAH1	25981	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	52428521	52428521	+	Missense_Mutation	SNP	T	T	C			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr3:52428521T>C	ENST00000420323.2	+	67	10928	c.10667T>C	c.(10666-10668)aTc>aCc	p.I3556T		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	3621					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		TCCATCTCGATCATGACTGAG	0.622																																					p.I3556T		.											.	DNAH1-67	0			c.T10667C						.						72.0	79.0	77.0					3																	52428521		2065	4195	6260	SO:0001583	missense	25981	exon67			TCTCGATCATGAC	U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.10667T>C	3.37:g.52428521T>C	ENSP00000401514:p.Ile3556Thr	Somatic	109	0		WXS	Illumina HiSeq	Phase_I	115	58	NM_015512	0	0	0	4	4	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	ENST00000420323.2	37	CCDS46842.1	.	.	.	.	.	.	.	.	.	.	T	1.598	-0.527373	0.04141	.	.	ENSG00000114841	ENST00000420323;ENST00000273600	D	0.87103	-2.21	5.27	-5.01	0.02991	.	1.697270	0.03317	N	0.191372	T	0.70996	0.3288	N	0.12569	0.235	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.56721	-0.7932	10	0.33141	T	0.24	.	2.3064	0.04175	0.1418:0.4088:0.1794:0.27	.	3556;3621	C9JXH6;Q9P2D7-2	.;.	T	3556;309	ENSP00000401514:I3556T	ENSP00000273600:I309T	I	+	2	0	DNAH1	52403561	0.000000	0.05858	0.000000	0.03702	0.215000	0.24574	-0.451000	0.06795	-0.554000	0.06150	-0.274000	0.10170	ATC	.		0.622	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	NM_015512	
ABHD6	57406	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	58242370	58242370	+	Silent	SNP	A	A	T	rs11544005		TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr3:58242370A>T	ENST00000478253.1	+	3	558	c.57A>T	c.(55-57)ccA>ccT	p.P19P	ABHD6_ENST00000295962.4_Silent_p.P19P			Q9BV23	ABHD6_HUMAN	abhydrolase domain containing 6	19					long term synaptic depression (GO:0060292)|negative regulation of cell migration (GO:0030336)|regulation of endocannabinoid signaling pathway (GO:2000124)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	acylglycerol lipase activity (GO:0047372)			NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(1)	16				BRCA - Breast invasive adenocarcinoma(55;0.000225)|KIRC - Kidney renal clear cell carcinoma(284;0.0471)|Kidney(284;0.0589)|OV - Ovarian serous cystadenocarcinoma(275;0.209)		TGGCCATCCCAATCCTGGCAT	0.463																																					p.P19P		.											.	ABHD6-92	0			c.A57T						.						174.0	165.0	168.0					3																	58242370		2203	4300	6503	SO:0001819	synonymous_variant	57406	exon2			CATCCCAATCCTG	AF225418	CCDS2887.1	3p21.2	2006-03-10			ENSG00000163686	ENSG00000163686		"""Abhydrolase domain containing"""	21398	protein-coding gene	gene with protein product							Standard	NM_020676		Approved		uc003djs.4	Q9BV23	OTTHUMG00000159150	ENST00000478253.1:c.57A>T	3.37:g.58242370A>T		Somatic	106	0		WXS	Illumina HiSeq	Phase_I	103	23	NM_020676	0	0	22	31	9	B2R7Y9|Q6ZMF7	Silent	SNP	ENST00000478253.1	37	CCDS2887.1																																																																																			.		0.463	ABHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353511.1	NM_020676	
ZNF654	55279	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	88189810	88189810	+	Missense_Mutation	SNP	T	T	G			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr3:88189810T>G	ENST00000309495.5	+	1	1557	c.1350T>G	c.(1348-1350)atT>atG	p.I450M	CGGBP1_ENST00000462901.1_Intron	NM_018293.2	NP_060763.2	Q8IZM8	ZN654_HUMAN	zinc finger protein 654	450					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|large_intestine(2)|lung(1)|ovary(2)|pancreas(1)|prostate(3)	12		Lung NSC(201;0.0283)		UCEC - Uterine corpus endometrioid carcinoma (27;0.194)|LUSC - Lung squamous cell carcinoma(29;0.00353)|Lung(72;0.00661)		CTTTGAAAATTGATACAAACA	0.383																																					p.I450M													.	ZNF654-69	0			c.T1350G						.						85.0	83.0	83.0					3																	88189810		1881	4102	5983	SO:0001583	missense	55279	exon1			GAAAATTGATACA	AF543494	CCDS46874.1	3p11.1	2005-01-10			ENSG00000175105	ENSG00000175105			25612	protein-coding gene	gene with protein product							Standard	NM_018293		Approved	FLJ10997, FLJ21142	uc003dqv.3	Q8IZM8	OTTHUMG00000159097	ENST00000309495.5:c.1350T>G	3.37:g.88189810T>G	ENSP00000312141:p.Ile450Met	Somatic	223	1		WXS	Illumina HiSeq	Phase_I	236	86	NM_018293	0	0	1	1	0	Q9H791|Q9NV14	Missense_Mutation	SNP	ENST00000309495.5	37	CCDS46874.1	.	.	.	.	.	.	.	.	.	.	t	0.623	-0.820178	0.02755	.	.	ENSG00000175105	ENST00000309495	T	0.10005	2.92	5.23	-2.35	0.06684	.	.	.	.	.	T	0.04907	0.0132	N	0.14661	0.345	0.09310	N	0.99999	B	0.02656	0.0	B	0.04013	0.001	T	0.39941	-0.9589	9	0.44086	T	0.13	.	2.3057	0.04173	0.233:0.0753:0.3389:0.3529	.	450	Q8IZM8	ZN654_HUMAN	M	450	ENSP00000312141:I450M	ENSP00000312141:I450M	I	+	3	3	ZNF654	88272500	0.029000	0.19370	0.803000	0.32268	0.354000	0.29330	0.080000	0.14802	-0.023000	0.13963	-0.420000	0.06012	ATT	.		0.383	ZNF654-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353285.2	NM_018293	
CBLB	868	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	105572285	105572285	+	Missense_Mutation	SNP	C	C	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr3:105572285C>A	ENST00000264122.4	-	3	713	c.392G>T	c.(391-393)aGa>aTa	p.R131I	CBLB_ENST00000394027.3_Missense_Mutation_p.R153I|CBLB_ENST00000403724.1_Missense_Mutation_p.R131I|CBLB_ENST00000545639.1_Missense_Mutation_p.R153I|CBLB_ENST00000405772.1_Missense_Mutation_p.R131I	NM_170662.3	NP_733762.2	Q13191	CBLB_HUMAN	Cbl proto-oncogene B, E3 ubiquitin protein ligase	131	4H.|Cbl-PTB. {ECO:0000255|PROSITE- ProRule:PRU00839}.				cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of alpha-beta T cell proliferation (GO:0046642)|negative regulation of T cell receptor signaling pathway (GO:0050860)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of T cell anergy (GO:0002669)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(2)|urinary_tract(2)	49						TTCATACATTCTCTCCTTGCC	0.343			Mis S		AML																																p.R131I	GBM(93;588 1337 9788 29341 43499)	.		Rec	yes		3	3q13.11	868	Cas-Br-M (murine) ecotropic retroviral transforming sequence b		L	.	CBLB-849	0			c.G392T						.						240.0	242.0	241.0					3																	105572285		2203	4300	6503	SO:0001583	missense	868	exon3			TACATTCTCTCCT	U26710	CCDS2948.1	3q	2013-07-09	2013-07-09		ENSG00000114423	ENSG00000114423		"""RING-type (C3HC4) zinc fingers"""	1542	protein-coding gene	gene with protein product		604491	"""Cas-Br-M (murine) ectropic retroviral transforming sequence b"", ""Cas-Br-M (murine) ecotropic retroviral transforming sequence b"""			7784085	Standard	XM_005247853		Approved	RNF56, Cbl-b	uc003dwc.3	Q13191	OTTHUMG00000150654	ENST00000264122.4:c.392G>T	3.37:g.105572285C>A	ENSP00000264122:p.Arg131Ile	Somatic	145	0		WXS	Illumina HiSeq	Phase_I	135	33	NM_170662	0	0	4	7	3	A8K9S7|B7WNM4|Q13192|Q13193|Q3LIC0|Q63Z43|Q8IVC5	Missense_Mutation	SNP	ENST00000264122.4	37	CCDS2948.1	.	.	.	.	.	.	.	.	.	.	C	33	5.280158	0.95489	.	.	ENSG00000114423	ENST00000264122;ENST00000394027;ENST00000403724;ENST00000405772;ENST00000545639;ENST00000438603;ENST00000447441;ENST00000443752	T;T;T;T;T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16;-1.16;-1.16;-1.16;-1.16	5.69	5.69	0.88448	Adaptor protein Cbl, N-terminal helical (3);Adaptor protein Cbl, PTB domain (1);	0.000000	0.85682	D	0.000000	D	0.85991	0.5826	L	0.50333	1.59	0.80722	D	1	D;D;D	0.69078	0.997;0.997;0.997	D;D;D	0.74348	0.983;0.972;0.937	D	0.86563	0.1842	10	0.87932	D	0	-13.8454	19.8034	0.96518	0.0:1.0:0.0:0.0	.	153;131;131	E7ENW2;Q13191-3;Q13191	.;.;CBLB_HUMAN	I	131;153;131;131;153;153;131;131	ENSP00000264122:R131I;ENSP00000377595:R153I;ENSP00000384816:R131I;ENSP00000384938:R131I;ENSP00000446116:R153I;ENSP00000409750:R153I;ENSP00000400949:R131I;ENSP00000393906:R131I	ENSP00000264122:R131I	R	-	2	0	CBLB	107054975	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.603000	0.82811	2.669000	0.90835	0.655000	0.94253	AGA	.		0.343	CBLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319417.2	NM_170662	
EAF2	55840	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	121554190	121554190	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr3:121554190G>A	ENST00000273668.2	+	1	129	c.58G>A	c.(58-60)Ggg>Agg	p.G20R	EAF2_ENST00000465664.1_3'UTR|EAF2_ENST00000451944.2_Missense_Mutation_p.G20R|IQCB1_ENST00000310864.6_5'Flank|IQCB1_ENST00000349820.6_5'Flank	NM_018456.4	NP_060926.2	Q96CJ1	EAF2_HUMAN	ELL associated factor 2	20	Necessary for interaction with ELL.				apoptotic process (GO:0006915)|negative regulation of cell growth (GO:0030308)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	ELL-EAF complex (GO:0032783)|transcription elongation factor complex (GO:0008023)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|prostate(1)	9				GBM - Glioblastoma multiforme(114;0.0972)		TCTCAAGTTAGGGGAGAGTTT	0.592																																					p.G20R	Esophageal Squamous(194;1942 2097 24663 29345 31866)	.											.	EAF2-90	0			c.G58A						.						60.0	57.0	58.0					3																	121554190		2203	4300	6503	SO:0001583	missense	55840	exon1			AAGTTAGGGGAGA	AF517829	CCDS3006.1	3q21.1	2007-08-01			ENSG00000145088	ENSG00000145088			23115	protein-coding gene	gene with protein product		607659				12446457, 12907652	Standard	NM_018456		Approved	BM040, TRAITS, U19	uc003een.3	Q96CJ1	OTTHUMG00000159424	ENST00000273668.2:c.58G>A	3.37:g.121554190G>A	ENSP00000273668:p.Gly20Arg	Somatic	75	0		WXS	Illumina HiSeq	Phase_I	97	9	NM_018456	0	0	12	14	2	Q9NZ82	Missense_Mutation	SNP	ENST00000273668.2	37	CCDS3006.1	.	.	.	.	.	.	.	.	.	.	G	36	5.612769	0.96637	.	.	ENSG00000145088	ENST00000273668;ENST00000451944	.	.	.	5.95	5.95	0.96441	Transcription elognation factor  Eaf, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.84238	0.5428	M	0.85945	2.785	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.85853	0.1405	9	0.87932	D	0	-12.3041	17.8686	0.88804	0.0:0.0:1.0:0.0	.	20	Q96CJ1	EAF2_HUMAN	R	20	.	ENSP00000273668:G20R	G	+	1	0	EAF2	123036880	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.606000	0.82863	2.817000	0.96982	0.563000	0.77884	GGG	.		0.592	EAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355247.1	NM_018456	
PARP14	54625	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	122436993	122436993	+	Nonsense_Mutation	SNP	C	C	G			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr3:122436993C>G	ENST00000474629.2	+	13	4342	c.4076C>G	c.(4075-4077)tCa>tGa	p.S1359*		NM_017554.2	NP_060024.2	Q460N5	PAR14_HUMAN	poly (ADP-ribose) polymerase family, member 14	1359	Macro 3. {ECO:0000255|PROSITE- ProRule:PRU00490}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(2)|breast(5)|cervix(2)|endometrium(7)|kidney(5)|large_intestine(8)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	50				GBM - Glioblastoma multiforme(114;0.0531)		CAGAAAGGATCAGCCCAGTCT	0.388																																					p.S1359X		.											.	PARP14-525	0			c.C4076G						.						88.0	82.0	84.0					3																	122436993		1860	4108	5968	SO:0001587	stop_gained	54625	exon13			AAGGATCAGCCCA	AB033094	CCDS46894.1	3q21	2010-02-16			ENSG00000173193	ENSG00000173193		"""Poly (ADP-ribose) polymerases"""	29232	protein-coding gene	gene with protein product		610028				15273990	Standard	NM_017554		Approved	KIAA1268, pART8	uc003efq.4	Q460N5	OTTHUMG00000159552	ENST00000474629.2:c.4076C>G	3.37:g.122436993C>G	ENSP00000418194:p.Ser1359*	Somatic	165	0		WXS	Illumina HiSeq	Phase_I	185	102	NM_017554	0	0	4	4	0	B4E2H0|Q460N4|Q8J027|Q9H9X9|Q9NV60|Q9ULF2	Nonsense_Mutation	SNP	ENST00000474629.2	37	CCDS46894.1	.	.	.	.	.	.	.	.	.	.	C	40	8.082615	0.98646	.	.	ENSG00000173193	ENST00000474629;ENST00000398162;ENST00000398157	.	.	.	5.28	-1.14	0.09741	.	1.436610	0.04490	N	0.379296	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	.	5.3252	0.15903	0.1259:0.4927:0.0:0.3814	.	.	.	.	X	1359;1278;355	.	ENSP00000381224:S355X	S	+	2	0	PARP14	123919683	0.000000	0.05858	0.000000	0.03702	0.971000	0.66376	0.777000	0.26718	-0.442000	0.07190	0.650000	0.86243	TCA	.		0.388	PARP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356173.2	NM_017554	
RBP2	5948	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	139195286	139195286	+	Missense_Mutation	SNP	T	T	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr3:139195286T>A	ENST00000232217.2	-	1	72	c.16A>T	c.(16-18)Aat>Tat	p.N6Y	RP11-319G6.1_ENST00000515247.1_RNA	NM_004164.2	NP_004155.2	P50120	RET2_HUMAN	retinol binding protein 2, cellular	6					epidermis development (GO:0008544)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|vitamin A metabolic process (GO:0006776)	cytosol (GO:0005829)	retinal binding (GO:0016918)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|transporter activity (GO:0005215)			breast(1)|large_intestine(1)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	12					Vitamin A(DB00162)	CAGGTTCCATTCTGGTCCCTT	0.537																																					p.N6Y		.											.	RBP2-91	0			c.A16T						.						154.0	132.0	139.0					3																	139195286		2203	4300	6503	SO:0001583	missense	5948	exon1			TTCCATTCTGGTC	U13831	CCDS3109.1	3q23	2013-03-01	2001-11-28		ENSG00000114113	ENSG00000114113		"""Fatty acid binding protein family"""	9920	protein-coding gene	gene with protein product		180280	"""retinol-binding protein 2, cellular"""			7657783, 10072590	Standard	NM_004164		Approved	CRBP2, RBPC2, CRBPII, CRABP-II	uc003eth.3	P50120	OTTHUMG00000159956	ENST00000232217.2:c.16A>T	3.37:g.139195286T>A	ENSP00000232217:p.Asn6Tyr	Somatic	76	0		WXS	Illumina HiSeq	Phase_I	74	11	NM_004164	0	0	0	0	0	A8K7G3|Q6ISQ9|Q6ISS7	Missense_Mutation	SNP	ENST00000232217.2	37	CCDS3109.1	.	.	.	.	.	.	.	.	.	.	T	21.4	4.138577	0.77775	.	.	ENSG00000114113	ENST00000232217;ENST00000511956;ENST00000506825	T;T	0.08102	3.13;3.13	5.44	5.44	0.79542	Calycin-like (1);Cytosolic fatty-acid binding (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	0.550372	0.21049	N	0.081028	T	0.17023	0.0409	L	0.29908	0.895	0.54753	D	0.999987	D	0.76494	0.999	D	0.68039	0.955	T	0.01666	-1.1300	10	0.44086	T	0.13	.	13.5403	0.61671	0.0:0.0:0.0:1.0	.	6	P50120	RET2_HUMAN	Y	6	ENSP00000232217:N6Y;ENSP00000424333:N6Y	ENSP00000232217:N6Y	N	-	1	0	RBP2	140677976	1.000000	0.71417	0.998000	0.56505	0.970000	0.65996	3.604000	0.54081	2.194000	0.70268	0.460000	0.39030	AAT	.		0.537	RBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358490.1	NM_004164	
U2SURP	23350	bcgsc.ca	37	3	142762057	142762057	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr3:142762057C>T	ENST00000473835.2	+	24	2573	c.2483C>T	c.(2482-2484)tCt>tTt	p.S828F	U2SURP_ENST00000493598.2_Missense_Mutation_p.S827F|U2SURP_ENST00000397933.2_Missense_Mutation_p.S419F	NM_001080415.1	NP_001073884.1	O15042	SR140_HUMAN	U2 snRNP-associated SURP domain containing	828	Glu-rich.				RNA processing (GO:0006396)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	31						ATGACTGAGTCTAAGTTCTCT	0.353																																					p.S828F													.	U2SURP-71	0			c.C2483T						.						69.0	61.0	64.0					3																	142762057		1861	4102	5963	SO:0001583	missense	23350	exon24			CTGAGTCTAAGTT	BK000564	CCDS46928.1	3q23	2013-02-12			ENSG00000163714	ENSG00000163714		"""RNA binding motif (RRM) containing"""	30855	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein a"", ""Ser/Arg-rich domain protein, 140 kDa"", ""U2 associated SR140 protein"""					9205841, 12234937	Standard	NM_001080415		Approved	fSAPa, SR140	uc003evh.1	O15042	OTTHUMG00000159323	ENST00000473835.2:c.2483C>T	3.37:g.142762057C>T	ENSP00000418563:p.Ser828Phe	Somatic	591	4		WXS	Illumina HiSeq	Phase_1	550	319	NM_001080415	0	0	6	20	14	A0PJ60|Q0D2M1|Q2NKQ7|Q9BR70	Missense_Mutation	SNP	ENST00000473835.2	37	CCDS46928.1	.	.	.	.	.	.	.	.	.	.	C	14.64	2.595735	0.46318	.	.	ENSG00000163714	ENST00000473835;ENST00000319822;ENST00000397933;ENST00000493598;ENST00000480029	T;T;T;D	0.97505	0.89;0.89;0.89;-4.41	5.65	5.65	0.86999	.	0.107341	0.64402	D	0.000004	D	0.93331	0.7874	N	0.14661	0.345	0.52501	D	0.999956	B;B;B	0.10296	0.003;0.001;0.001	B;B;B	0.09377	0.004;0.002;0.001	D	0.88459	0.3054	10	0.37606	T	0.19	-8.4043	19.7129	0.96103	0.0:1.0:0.0:0.0	.	827;419;828	O15042-2;O15042-3;O15042	.;.;SR140_HUMAN	F	828;828;419;827;395	ENSP00000418563:S828F;ENSP00000381027:S419F;ENSP00000422011:S827F;ENSP00000417441:S395F	ENSP00000322376:S828F	S	+	2	0	U2SURP	144244747	0.991000	0.36638	1.000000	0.80357	0.981000	0.71138	3.465000	0.53064	2.658000	0.90341	0.650000	0.86243	TCT	.		0.353	U2SURP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354603.2	NM_001080415	
PLD1	5337	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	171395429	171395429	+	Silent	SNP	G	G	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr3:171395429G>A	ENST00000351298.4	-	17	2049	c.1923C>T	c.(1921-1923)acC>acT	p.T641T	PLD1_ENST00000340989.4_Silent_p.T641T|PLD1_ENST00000342215.6_Missense_Mutation_p.P532L|PLD1_ENST00000356327.5_Silent_p.T603T	NM_002662.4	NP_002653.1	Q13393	PLD1_HUMAN	phospholipase D1, phosphatidylcholine-specific	641	Catalytic.				chemotaxis (GO:0006935)|defense response to Gram-positive bacterium (GO:0050830)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|Ras protein signal transduction (GO:0007265)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol binding (GO:0035091)|phospholipase D activity (GO:0004630)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|lung(27)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	63	all_cancers(22;4.53e-19)|Ovarian(172;0.00197)|Breast(254;0.186)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		Choline(DB00122)	GCCAGAATCTGGTTTCCCCAT	0.498																																					p.T641T	NSCLC(149;2174 3517 34058)	.											.	PLD1-660	0			c.C1923T						.						169.0	150.0	157.0					3																	171395429		2203	4300	6503	SO:0001819	synonymous_variant	5337	exon17			GAATCTGGTTTCC	U38545	CCDS3216.1, CCDS46957.1	3q26	2013-01-10	2006-02-17		ENSG00000075651	ENSG00000075651	3.1.4.4	"""Pleckstrin homology (PH) domain containing"""	9067	protein-coding gene	gene with protein product	"""choline phosphatase 1"""	602382				9858822, 8530346	Standard	NM_002662		Approved		uc003fhs.3	Q13393	OTTHUMG00000156947	ENST00000351298.4:c.1923C>T	3.37:g.171395429G>A		Somatic	141	0		WXS	Illumina HiSeq	Phase_I	118	31	NM_002662	0	0	10	12	2		Silent	SNP	ENST00000351298.4	37	CCDS3216.1	.	.	.	.	.	.	.	.	.	.	G	13.30	2.196234	0.38806	.	.	ENSG00000075651	ENST00000342215	T	0.34072	1.38	6.16	0.406	0.16366	.	.	.	.	.	T	0.25827	0.0629	.	.	.	0.30550	N	0.765587	.	.	.	.	.	.	T	0.31110	-0.9955	6	0.27785	T	0.31	-24.3912	4.8638	0.13598	0.1371:0.3306:0.4295:0.1029	.	.	.	.	L	532	ENSP00000339936:P532L	ENSP00000339936:P532L	P	-	2	0	PLD1	172878123	0.948000	0.32251	0.748000	0.31131	0.981000	0.71138	0.123000	0.15708	0.117000	0.18138	0.650000	0.86243	CCA	.		0.498	PLD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000346730.2	NM_002662	
RFC4	5984	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	186508173	186508173	+	Missense_Mutation	SNP	T	T	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr3:186508173T>A	ENST00000392481.2	-	9	1105	c.824A>T	c.(823-825)gAt>gTt	p.D275V	RFC4_ENST00000296273.2_Missense_Mutation_p.D275V|SNORA4_ENST00000584302.1_RNA|SNORA63_ENST00000363450.1_RNA|RFC4_ENST00000433496.1_Intron	NM_181573.2	NP_853551.1	P35249	RFC4_HUMAN	replication factor C (activator 1) 4, 37kDa	275					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor C complex (GO:0005663)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)	p.D275G(1)		breast(3)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26	all_cancers(143;2.92e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)	GBM - Glioblastoma multiforme(93;0.0739)		AAATACTCCATCAATTTTCTC	0.428																																					p.D275V		.											.	RFC4-291	1	Substitution - Missense(1)	kidney(1)	c.A824T						.						112.0	112.0	112.0					3																	186508173		2203	4300	6503	SO:0001583	missense	5984	exon9			ACTCCATCAATTT		CCDS3283.1	3q27	2010-04-21	2002-08-29		ENSG00000163918	ENSG00000163918		"""ATPases / AAA-type"""	9972	protein-coding gene	gene with protein product	"""A1 37 kDa subunit"", ""activator 1 37 kDa subunit"", ""RFC 37 kDa subunit"""	102577	"""replication factor C (activator 1) 4 (37kD)"""			7774928	Standard	NM_181573		Approved	A1, RFC37	uc003fqz.3	P35249	OTTHUMG00000156515	ENST00000392481.2:c.824A>T	3.37:g.186508173T>A	ENSP00000376272:p.Asp275Val	Somatic	182	0		WXS	Illumina HiSeq	Phase_I	144	36	NM_181573	0	0	9	13	4	B4DM41|D3DNV2|Q6FHX7	Missense_Mutation	SNP	ENST00000392481.2	37	CCDS3283.1	.	.	.	.	.	.	.	.	.	.	T	11.55	1.670832	0.29693	.	.	ENSG00000163918	ENST00000392481;ENST00000296273;ENST00000417876	T;T;T	0.44083	0.93;0.93;0.93	5.32	2.79	0.32731	Replication factor C (1);DNA polymerase III, clamp loader complex, gamma/delta/delta subunit, C-terminal (1);	0.428568	0.30538	N	0.009405	T	0.44808	0.1311	M	0.84326	2.69	0.80722	D	1	B	0.18013	0.025	B	0.27887	0.084	T	0.46373	-0.9196	10	0.54805	T	0.06	.	6.9715	0.24652	0.0:0.0842:0.1493:0.7664	.	275	P35249	RFC4_HUMAN	V	275;275;50	ENSP00000376272:D275V;ENSP00000296273:D275V;ENSP00000401429:D50V	ENSP00000296273:D275V	D	-	2	0	RFC4	187990867	0.999000	0.42202	0.697000	0.30258	0.437000	0.31866	2.471000	0.45127	0.970000	0.38263	0.459000	0.35465	GAT	.		0.428	RFC4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344471.1	NM_002916	
IDUA	3425	broad.mit.edu	37	4	996204	996204	+	Missense_Mutation	SNP	A	A	C			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr4:996204A>C	ENST00000247933.4	+	8	1208	c.1120A>C	c.(1120-1122)Acc>Ccc	p.T374P	IDUA_ENST00000514224.1_Missense_Mutation_p.T242P|IDUA_ENST00000453894.1_Missense_Mutation_p.T396P	NM_000203.3	NP_000194.2	P35475	IDUA_HUMAN	iduronidase, alpha-L-	374					carbohydrate metabolic process (GO:0005975)|cell morphogenesis (GO:0000902)|chemical homeostasis (GO:0048878)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate catabolic process (GO:0030209)|disaccharide metabolic process (GO:0005984)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|limb morphogenesis (GO:0035108)|lysosome organization (GO:0007040)|skeletal system morphogenesis (GO:0048705)|small molecule metabolic process (GO:0044281)	coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	L-iduronidase activity (GO:0003940)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			GGTCAACAACACCCGCCCGCC	0.711																																					p.T374P													.	IDUA-91	0			c.A1120C						.						26.0	28.0	27.0					4																	996204		2185	4282	6467	SO:0001583	missense	3425	exon8			AACAACACCCGCC	M74715	CCDS3343.1	4p16.3	2012-10-02			ENSG00000127415	ENSG00000127415	3.2.1.76		5391	protein-coding gene	gene with protein product		252800				1832239	Standard	NM_000203		Approved	MPS1	uc003gby.3	P35475	OTTHUMG00000088901	ENST00000247933.4:c.1120A>C	4.37:g.996204A>C	ENSP00000247933:p.Thr374Pro	Somatic	74	19		WXS	Illumina HiSeq	Phase_I	180	85	NM_000203	0	0	3	4	1	B3KWK6	Missense_Mutation	SNP	ENST00000247933.4	37	CCDS3343.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.117066	0.77323	.	.	ENSG00000127415	ENST00000247933;ENST00000453894;ENST00000514224	D;D;D	0.94280	-3.39;-3.39;-3.39	5.31	5.31	0.75309	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.156849	0.56097	D	0.000026	D	0.96611	0.8894	M	0.86178	2.8	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.995	D	0.96508	0.9376	10	0.46703	T	0.11	-7.29	13.2474	0.60029	1.0:0.0:0.0:0.0	.	396;374	B3KWK6;P35475	.;IDUA_HUMAN	P	374;396;242	ENSP00000247933:T374P;ENSP00000396458:T396P;ENSP00000425081:T242P	ENSP00000247933:T374P	T	+	1	0	IDUA	986204	1.000000	0.71417	0.995000	0.50966	0.426000	0.31534	5.967000	0.70403	2.024000	0.59613	0.454000	0.30748	ACC	.		0.711	IDUA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000201812.1	NM_000203	
HTT	3064	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	3162057	3162057	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr4:3162057C>T	ENST00000355072.5	+	29	3947	c.3802C>T	c.(3802-3804)Cgc>Tgc	p.R1268C		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	1268					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		AGGGTTTCTCCGCTCAGCCTT	0.512																																					p.R1268C		.											.	HTT-281	0			c.C3802T						.																																			SO:0001583	missense	3064	exon29			TTTCTCCGCTCAG	L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.3802C>T	4.37:g.3162057C>T	ENSP00000347184:p.Arg1268Cys	Somatic	173	0		WXS	Illumina HiSeq	Phase_I	181	67	NM_002111	0	0	0	3	3	Q9UQB7	Missense_Mutation	SNP	ENST00000355072.5	37	CCDS43206.1	.	.	.	.	.	.	.	.	.	.	C	11.56	1.674542	0.29693	.	.	ENSG00000197386	ENST00000355072	T	0.65916	-0.18	4.27	4.27	0.50696	.	0.000000	0.85682	D	0.000000	T	0.57740	0.2074	L	0.52364	1.645	0.80722	D	1	B	0.18166	0.026	B	0.11329	0.006	T	0.57946	-0.7723	10	0.44086	T	0.13	.	16.6252	0.84968	0.0:1.0:0.0:0.0	.	1268	P42858	HD_HUMAN	C	1268	ENSP00000347184:R1268C	ENSP00000347184:R1268C	R	+	1	0	HTT	3131855	1.000000	0.71417	1.000000	0.80357	0.221000	0.24807	4.125000	0.57931	2.069000	0.61940	0.563000	0.77884	CGC	.		0.512	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358234.2	NM_002111	
CCDC149	91050	broad.mit.edu	37	4	24838061	24838061	+	Nonsense_Mutation	SNP	G	G	T	rs189623642		TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr4:24838061G>T	ENST00000389609.4	-	8	875	c.732C>A	c.(730-732)taC>taA	p.Y244*	CCDC149_ENST00000428116.2_Intron|CCDC149_ENST00000502801.1_Intron|CCDC149_ENST00000504487.1_Nonsense_Mutation_p.Y244*	NM_173463.4	NP_775734.2	Q6ZUS6	CC149_HUMAN	coiled-coil domain containing 149	189										cervix(1)|endometrium(1)|large_intestine(2)|lung(3)	7		Breast(46;0.173)				TTGCTACCTTGTATTTGGCAA	0.348																																					p.Y244X													.	CCDC149-68	0			c.C732A						.						285.0	261.0	269.0					4																	24838061		2203	4300	6503	SO:0001587	stop_gained	91050	exon8			TACCTTGTATTTG		CCDS33967.1, CCDS47036.1, CCDS33967.2	4p15.2	2008-03-03				ENSG00000181982			25405	protein-coding gene	gene with protein product						17457313	Standard	NM_173463		Approved	DKFZp761B107	uc003grc.3	Q6ZUS6		ENST00000389609.4:c.732C>A	4.37:g.24838061G>T	ENSP00000374260:p.Tyr244*	Somatic	133	0		WXS	Illumina HiSeq	Phase_I	136	3	NM_173463	0	0	0	0	0	A6NJE7|B4DK90|B4DZG3|G5EA04|Q6NW41|Q8N3K8	Nonsense_Mutation	SNP	ENST00000389609.4	37	CCDS33967.2	.	.	.	.	.	.	.	.	.	.	G	21.9	4.213945	0.79352	.	.	ENSG00000181982	ENST00000504487;ENST00000389609;ENST00000382116;ENST00000503881	.	.	.	4.56	2.64	0.31445	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.9336	9.4249	0.38574	0.2483:0.0:0.7517:0.0	.	.	.	.	X	244;244;168;189	.	ENSP00000371550:Y168X	Y	-	3	2	CCDC149	24447159	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	3.292000	0.51772	1.119000	0.41883	0.650000	0.86243	TAC	G|0.999;A|0.000		0.348	CCDC149-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000360157.1	NM_173463	
PI4K2B	55300	hgsc.bcm.edu	37	4	25235821	25235821	+	Silent	SNP	C	C	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr4:25235821C>A	ENST00000264864.6	+	1	225	c.36C>A	c.(34-36)tcC>tcA	p.S12S	PI4K2B_ENST00000512921.1_Intron	NM_018323.3	NP_060793.2	Q8TCG2	P4K2B_HUMAN	phosphatidylinositol 4-kinase type 2 beta	12					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(3)|skin(3)	15		Breast(46;0.173)				GGTTGGCGTCCGCGGACGGCG	0.731																																					p.S12S		.											.	PI4K2B-229	0			c.C36A						.						3.0	3.0	3.0					4																	25235821		1446	3354	4800	SO:0001819	synonymous_variant	55300	exon1			GGCGTCCGCGGAC	AK001967	CCDS3433.1	4p15.31	2009-05-07			ENSG00000038210	ENSG00000038210			18215	protein-coding gene	gene with protein product		612101				11923287	Standard	NM_018323		Approved	PI4KIIB, FLJ11105, PIK42B	uc003grk.2	Q8TCG2	OTTHUMG00000128564	ENST00000264864.6:c.36C>A	4.37:g.25235821C>A		Somatic	7	0		WXS	Illumina HiSeq	Phase_I	44	13	NM_018323	0	0	3	4	1	Q9NUW2	Silent	SNP	ENST00000264864.6	37	CCDS3433.1																																																																																			.		0.731	PI4K2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250415.1	NM_018323	
ARAP2	116984	broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	36152575	36152575	+	Silent	SNP	G	G	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr4:36152575G>T	ENST00000303965.4	-	16	3333	c.2844C>A	c.(2842-2844)atC>atA	p.I948I		NM_015230.3	NP_056045.2	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2	948	PH 3. {ECO:0000255|PROSITE- ProRule:PRU00145}.				regulation of ARF GTPase activity (GO:0032312)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(32)|ovary(2)|pancreas(1)|prostate(3)|skin(7)|urinary_tract(1)	82						TAACTTCATTGATATTAATGG	0.343																																					p.I948I													.	ARAP2-93	0			c.C2844A						.						169.0	174.0	172.0					4																	36152575		2203	4298	6501	SO:0001819	synonymous_variant	116984	exon16			TTCATTGATATTA	AF411982	CCDS3441.1	4p15.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000047365	ENSG00000047365		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16924	protein-coding gene	gene with protein product		606645	"""centaurin, delta 1"""	CENTD1			Standard	NM_015230		Approved	PARX	uc003gsq.2	Q8WZ64	OTTHUMG00000097811	ENST00000303965.4:c.2844C>A	4.37:g.36152575G>T		Somatic	121	1		WXS	Illumina HiSeq	Phase_I	115	36	NM_015230	0	0	1	1	0	Q4W5D2|Q7Z2L5|Q96L70|Q96P49|Q9Y4E4	Silent	SNP	ENST00000303965.4	37	CCDS3441.1																																																																																			.		0.343	ARAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215074.2	NM_015230	
DSPP	1834	bcgsc.ca	37	4	88536999	88536999	+	Missense_Mutation	SNP	A	A	G	rs202222170		TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr4:88536999A>G	ENST00000282478.7	+	4	3218	c.3185A>G	c.(3184-3186)gAc>gGc	p.D1062G	DSPP_ENST00000399271.1_Missense_Mutation_p.D1062G|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1062	Asp/Ser-rich.			D -> G (in Ref. 1; AAF42472). {ECO:0000305}.	biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gacagcagtgacagcagcgac	0.532																																					p.D1062G													.	DSPP-90	0			c.A3185G						.						48.0	61.0	56.0					4																	88536999		1554	2803	4357	SO:0001583	missense	1834	exon5			GCAGTGACAGCAG	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3185A>G	4.37:g.88536999A>G	ENSP00000282478:p.Asp1062Gly	Somatic	309	0		WXS	Illumina HiSeq	Phase_1	317	14	NM_014208	0	0	0	0	0	A8MUI0|O95815	Missense_Mutation	SNP	ENST00000282478.7	37	CCDS43248.1	.	.	.	.	.	.	.	.	.	.	a	6.732	0.503863	0.12822	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.88975	-2.45;-2.45	1.51	1.51	0.23008	.	.	.	.	.	D	0.87716	0.6247	L	0.29908	0.895	0.21762	N	0.99955	D	0.76494	0.999	D	0.74023	0.982	T	0.76072	-0.3093	9	0.24483	T	0.36	.	5.1866	0.15187	1.0:0.0:0.0:0.0	.	1062	Q9NZW4	DSPP_HUMAN	G	1062	ENSP00000382213:D1062G;ENSP00000282478:D1062G	ENSP00000282478:D1062G	D	+	2	0	DSPP	88756023	0.386000	0.25180	0.936000	0.37596	0.006000	0.05464	2.307000	0.43682	0.963000	0.38082	0.242000	0.17961	GAC	.		0.532	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
MMRN1	22915	broad.mit.edu;bcgsc.ca	37	4	90857474	90857474	+	Missense_Mutation	SNP	A	A	C			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr4:90857474A>C	ENST00000394980.1	+	7	2962	c.2643A>C	c.(2641-2643)aaA>aaC	p.K881N	MMRN1_ENST00000394981.1_Intron|MMRN1_ENST00000264790.2_Missense_Mutation_p.K881N|MMRN1_ENST00000508372.1_Missense_Mutation_p.K623N			Q13201	MMRN1_HUMAN	multimerin 1	881					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)				breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|liver(2)|lung(34)|ovary(5)|prostate(1)|skin(6)|stomach(1)|urinary_tract(2)	72		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.96e-05)		TTTCAGTTAAAAAAGGCAGTG	0.353																																					p.K881N													.	MMRN1-94	0			c.A2643C						.						41.0	45.0	44.0					4																	90857474		2192	4293	6485	SO:0001583	missense	22915	exon6			AGTTAAAAAAGGC	U27109	CCDS3635.1	4q22	2008-02-05	2004-03-02	2004-03-02	ENSG00000138722	ENSG00000138722		"""EMI domain containing"""	7178	protein-coding gene	gene with protein product	"""glycoprotein Ia*"""	601456	"""multimerin"""	MMRN		7629143, 10828608	Standard	NM_007351		Approved	ECM, EMILIN4, GPIa*	uc003hst.3	Q13201	OTTHUMG00000130947	ENST00000394980.1:c.2643A>C	4.37:g.90857474A>C	ENSP00000378431:p.Lys881Asn	Somatic	155	0		WXS	Illumina HiSeq	Phase_I	148	5	NM_007351	0	0	0	0	0	Q4W5L1|Q6P3T8|Q6ZUL9	Missense_Mutation	SNP	ENST00000394980.1	37	CCDS3635.1	.	.	.	.	.	.	.	.	.	.	A	10.47	1.358105	0.24598	.	.	ENSG00000138722	ENST00000394980;ENST00000264790;ENST00000508372	T;T;T	0.71103	-0.24;-0.24;-0.54	5.3	2.83	0.33086	.	0.063651	0.64402	D	0.000005	T	0.63745	0.2537	M	0.66939	2.045	0.80722	D	1	B	0.19583	0.037	B	0.17433	0.018	T	0.58381	-0.7646	10	0.46703	T	0.11	.	6.1628	0.20373	0.7239:0.1367:0.1393:0.0	.	881	Q13201	MMRN1_HUMAN	N	881;881;623	ENSP00000378431:K881N;ENSP00000264790:K881N;ENSP00000426461:K623N	ENSP00000264790:K881N	K	+	3	2	MMRN1	91076497	1.000000	0.71417	0.910000	0.35882	0.768000	0.43524	0.904000	0.28491	0.514000	0.28300	-0.291000	0.09656	AAA	.		0.353	MMRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253546.2	NM_007351	
SYNPO2	171024	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	119952707	119952707	+	Missense_Mutation	SNP	A	A	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr4:119952707A>T	ENST00000429713.2	+	4	2959	c.2777A>T	c.(2776-2778)aAt>aTt	p.N926I	SYNPO2_ENST00000307142.4_Missense_Mutation_p.N926I|SYNPO2_ENST00000434046.2_Missense_Mutation_p.N926I|SYNPO2_ENST00000448416.2_Intron	NM_001128933.1	NP_001122405.1	Q9UMS6	SYNP2_HUMAN	synaptopodin 2	926						actin cytoskeleton (GO:0015629)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|Z disc (GO:0030018)	14-3-3 protein binding (GO:0071889)|muscle alpha-actinin binding (GO:0051371)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(18)|ovary(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						GTGGCCTATAATCCTATCCAC	0.572																																					p.N926I		.											.	SYNPO2-92	0			c.A2777T						.						87.0	83.0	84.0					4																	119952707		2203	4300	6503	SO:0001583	missense	171024	exon4			CCTATAATCCTAT	AJ010482	CCDS34054.1, CCDS47128.1, CCDS47129.1, CCDS75185.1, CCDS75186.1	4q26	2008-08-29			ENSG00000172403	ENSG00000172403			17732	protein-coding gene	gene with protein product						11673475, 17828378	Standard	NM_133477		Approved	MYOPODIN	uc010inb.3	Q9UMS6	OTTHUMG00000161165	ENST00000429713.2:c.2777A>T	4.37:g.119952707A>T	ENSP00000395143:p.Asn926Ile	Somatic	58	0		WXS	Illumina HiSeq	Phase_I	78	11	NM_001128934	0	0	0	0	0	B2RWP6|B2Y8J9|Q9UK89|S5XAM4	Missense_Mutation	SNP	ENST00000429713.2	37	CCDS47129.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	20.9|20.9	4.067512|4.067512	0.76301|0.76301	.|.	.|.	ENSG00000172403|ENSG00000172403	ENST00000307142;ENST00000429713;ENST00000434046|ENST00000504178	T;T;T|.	0.14893|.	2.47;2.58;2.47|.	5.66|5.66	5.66|5.66	0.87406|0.87406	.|.	0.000000|.	0.64402|.	D|.	0.000002|.	T|.	0.77239|.	0.4101|.	M|M	0.80982|0.80982	2.52|2.52	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;1.0;0.999;0.997|.	D;D;D;D|.	0.91635|.	0.998;0.999;0.997;0.972|.	T|.	0.78874|.	-0.2032|.	9|.	.|.	.|.	.|.	-24.3416|-24.3416	15.8861|15.8861	0.79251|0.79251	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	926;926;926;926|.	B9EG60;Q9UMS6-2;E9PEM2;Q9UMS6|.	.;.;.;SYNP2_HUMAN|.	I|Y	926|877	ENSP00000306015:N926I;ENSP00000395143:N926I;ENSP00000390965:N926I|.	.|.	N|X	+|+	2|3	0|2	SYNPO2|SYNPO2	120172155|120172155	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.914000|0.914000	0.54420|0.54420	9.339000|9.339000	0.96797|0.96797	2.156000|2.156000	0.67533|0.67533	0.533000|0.533000	0.62120|0.62120	AAT|TAA	.		0.572	SYNPO2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364020.1		
IQGAP2	10788	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	75888702	75888702	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr5:75888702G>A	ENST00000274364.6	+	9	1156	c.859G>A	c.(859-861)Gaa>Aaa	p.E287K	IQGAP2_ENST00000379730.3_5'UTR	NM_006633.2	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	287					negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microvillus (GO:0005902)	actin binding (GO:0003779)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(23)|ovary(6)|prostate(1)|skin(3)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	68		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		TGCTTATGAAGAACTGCTGAC	0.323																																					p.E287K		.											.	IQGAP2-96	0			c.G859A						.						138.0	145.0	142.0					5																	75888702		2203	4300	6503	SO:0001583	missense	10788	exon9			TATGAAGAACTGC	U51903	CCDS34188.1, CCDS68897.1, CCDS68898.1, CCDS75262.1	5q	2008-07-18			ENSG00000145703	ENSG00000145703			6111	protein-coding gene	gene with protein product		605401				8756646	Standard	XM_005248409		Approved		uc003kek.3	Q13576	OTTHUMG00000162432	ENST00000274364.6:c.859G>A	5.37:g.75888702G>A	ENSP00000274364:p.Glu287Lys	Somatic	316	0		WXS	Illumina HiSeq	Phase_I	466	78	NM_006633	0	0	13	13	0	A8K4V1|B7Z8A4|J3KR91	Missense_Mutation	SNP	ENST00000274364.6	37	CCDS34188.1	.	.	.	.	.	.	.	.	.	.	G	32	5.141279	0.94560	.	.	ENSG00000145703	ENST00000274364;ENST00000514350;ENST00000505766	T;T;T	0.39787	4.12;1.06;4.13	5.83	5.83	0.93111	.	0.100666	0.64402	D	0.000002	T	0.54287	0.1849	M	0.80616	2.505	0.80722	D	1	P	0.42483	0.781	P	0.44732	0.459	T	0.50988	-0.8762	10	0.21540	T	0.41	-17.3562	20.1863	0.98216	0.0:0.0:1.0:0.0	.	287	Q13576	IQGA2_HUMAN	K	287;260;237	ENSP00000274364:E287K;ENSP00000423672:E260K;ENSP00000421097:E237K	ENSP00000274364:E287K	E	+	1	0	IQGAP2	75924458	1.000000	0.71417	0.998000	0.56505	0.979000	0.70002	9.798000	0.99111	2.781000	0.95711	0.650000	0.86243	GAA	.		0.323	IQGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368877.1	NM_006633	
IQGAP2	10788	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	75888710	75888710	+	Silent	SNP	G	G	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr5:75888710G>A	ENST00000274364.6	+	9	1164	c.867G>A	c.(865-867)ctG>ctA	p.L289L	IQGAP2_ENST00000379730.3_5'UTR	NM_006633.2	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	289					negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microvillus (GO:0005902)	actin binding (GO:0003779)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(23)|ovary(6)|prostate(1)|skin(3)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	68		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		AAGAACTGCTGACACAAGCAG	0.333																																					p.L289L		.											.	IQGAP2-96	0			c.G867A						.						145.0	152.0	149.0					5																	75888710		2203	4300	6503	SO:0001819	synonymous_variant	10788	exon9			ACTGCTGACACAA	U51903	CCDS34188.1, CCDS68897.1, CCDS68898.1, CCDS75262.1	5q	2008-07-18			ENSG00000145703	ENSG00000145703			6111	protein-coding gene	gene with protein product		605401				8756646	Standard	XM_005248409		Approved		uc003kek.3	Q13576	OTTHUMG00000162432	ENST00000274364.6:c.867G>A	5.37:g.75888710G>A		Somatic	344	0		WXS	Illumina HiSeq	Phase_I	484	78	NM_006633	0	0	20	20	0	A8K4V1|B7Z8A4|J3KR91	Silent	SNP	ENST00000274364.6	37	CCDS34188.1																																																																																			.		0.333	IQGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368877.1	NM_006633	
IQGAP2	10788	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	75973147	75973147	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr5:75973147C>T	ENST00000274364.6	+	28	3929	c.3632C>T	c.(3631-3633)tCa>tTa	p.S1211L	IQGAP2_ENST00000502745.1_Missense_Mutation_p.S707L|IQGAP2_ENST00000396234.3_Missense_Mutation_p.S707L|IQGAP2_ENST00000379730.3_Missense_Mutation_p.S713L	NM_006633.2	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	1211					negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microvillus (GO:0005902)	actin binding (GO:0003779)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(23)|ovary(6)|prostate(1)|skin(3)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	68		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		ATTTATATTTCAATTGAAGAA	0.393																																					p.S1211L		.											.	IQGAP2-96	0			c.C3632T						.						65.0	66.0	65.0					5																	75973147		2203	4300	6503	SO:0001583	missense	10788	exon28			ATATTTCAATTGA	U51903	CCDS34188.1, CCDS68897.1, CCDS68898.1, CCDS75262.1	5q	2008-07-18			ENSG00000145703	ENSG00000145703			6111	protein-coding gene	gene with protein product		605401				8756646	Standard	XM_005248409		Approved		uc003kek.3	Q13576	OTTHUMG00000162432	ENST00000274364.6:c.3632C>T	5.37:g.75973147C>T	ENSP00000274364:p.Ser1211Leu	Somatic	88	0		WXS	Illumina HiSeq	Phase_I	95	11	NM_006633	0	0	33	33	0	A8K4V1|B7Z8A4|J3KR91	Missense_Mutation	SNP	ENST00000274364.6	37	CCDS34188.1	.	.	.	.	.	.	.	.	.	.	C	32	5.108409	0.94292	.	.	ENSG00000145703	ENST00000274364;ENST00000379730;ENST00000505766;ENST00000396234;ENST00000502745	T;T;T;T;T	0.54071	0.59;0.59;0.59;0.59;0.59	4.98	4.98	0.66077	Rho GTPase activation protein (1);Ras GTPase-activating protein (1);	0.329934	0.33144	N	0.005221	T	0.73094	0.3543	M	0.84326	2.69	0.80722	D	1	D;D;P	0.65815	0.995;0.995;0.792	P;P;B	0.60609	0.877;0.877;0.322	T	0.77910	-0.2411	10	0.72032	D	0.01	-12.9253	18.4229	0.90597	0.0:1.0:0.0:0.0	.	713;707;1211	F5H7S7;Q13576-2;Q13576	.;.;IQGA2_HUMAN	L	1211;713;1161;707;707	ENSP00000274364:S1211L;ENSP00000442313:S713L;ENSP00000421097:S1161L;ENSP00000379535:S707L;ENSP00000426027:S707L	ENSP00000274364:S1211L	S	+	2	0	IQGAP2	76008903	1.000000	0.71417	0.991000	0.47740	0.986000	0.74619	7.557000	0.82243	2.597000	0.87782	0.591000	0.81541	TCA	.		0.393	IQGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368877.1	NM_006633	
REEP5	7905	broad.mit.edu;bcgsc.ca	37	5	112257770	112257770	+	Splice_Site	SNP	C	C	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr5:112257770C>A	ENST00000379638.4	-	1	466	c.118G>T	c.(118-120)Ggt>Tgt	p.G40C	REEP5_ENST00000545426.1_Splice_Site_p.G40C|REEP5_ENST00000513339.1_Splice_Site_p.G40C|REEP5_ENST00000474542.2_5'Flank|REEP5_ENST00000504247.1_Splice_Site_p.G40C	NM_005669.4	NP_005660.4	Q00765	REEP5_HUMAN	receptor accessory protein 5	40						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(1)|ovary(1)	5		all_cancers(142;4.41e-05)|all_epithelial(76;3.65e-07)|Colorectal(10;0.00115)|Prostate(80;0.00133)|Ovarian(225;0.0443)		Epithelial(69;1.3e-09)|OV - Ovarian serous cystadenocarcinoma(64;1.26e-08)|all cancers(49;3.56e-07)|Colorectal(14;0.00778)|COAD - Colon adenocarcinoma(37;0.013)		GGCCACCCACCAAGAGCGATG	0.657																																					p.G40C													.	REEP5-280	0			c.G118T						.						49.0	52.0	51.0					5																	112257770		2202	4300	6502	SO:0001630	splice_region_variant	7905	exon1			ACCCACCAAGAGC	BC000232	CCDS4109.2	5q22-q23	2008-02-05	2006-02-07	2006-02-07	ENSG00000129625	ENSG00000129625		"""Receptor accessory proteins"""	30077	protein-coding gene	gene with protein product	"""deleted in polyposis 1"", ""polyposis locus protein 1"", ""polyposis coli region hypothetical protein DP1"""	125265	"""chromosome 5 open reading frame 18"""	C5orf18		16271481, 15550249	Standard	NM_005669		Approved	DP1, TB2, D5S346	uc003kqe.1	Q00765	OTTHUMG00000128807	ENST00000379638.4:c.118+1G>T	5.37:g.112257770C>A		Somatic	66	1		WXS	Illumina HiSeq	Phase_I	217	81	NM_005669	0	0	0	48	48	B7Z681|D3DT04|Q04198|Q5QGT0|Q9BWH9	Missense_Mutation	SNP	ENST00000379638.4	37	CCDS4109.2	.	.	.	.	.	.	.	.	.	.	C	17.63	3.436733	0.62955	.	.	ENSG00000129625	ENST00000379638;ENST00000513339;ENST00000545426;ENST00000504247	T;T;T;T	0.53423	0.62;0.62;0.62;0.62	4.17	4.17	0.49024	.	0.119316	0.53938	D	0.000045	T	0.73682	0.3618	M	0.89715	3.055	0.80722	D	1	D;D	0.89917	1.0;0.988	D;P	0.76575	0.988;0.843	T	0.80812	-0.1215	9	.	.	.	-39.0882	16.0678	0.80897	0.0:1.0:0.0:0.0	.	40;40	B7Z510;Q00765	.;REEP5_HUMAN	C	40	ENSP00000368959:G40C;ENSP00000425901:G40C;ENSP00000442940:G40C;ENSP00000421881:G40C	.	G	-	1	0	REEP5	112285669	1.000000	0.71417	0.997000	0.53966	0.043000	0.13939	6.323000	0.72891	1.861000	0.53984	0.563000	0.77884	GGT	.		0.657	REEP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250739.2	NM_005669	Missense_Mutation
FNIP1	96459	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	131007961	131007961	+	Missense_Mutation	SNP	C	C	T	rs367969091		TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr5:131007961C>T	ENST00000510461.1	-	14	2271	c.2176G>A	c.(2176-2178)Gga>Aga	p.G726R	FNIP1_ENST00000307954.8_Missense_Mutation_p.G681R|FNIP1_ENST00000307968.7_Missense_Mutation_p.G698R|CTC-432M15.3_ENST00000514667.1_Intron	NM_133372.2	NP_588613	Q8TF40	FNIP1_HUMAN	folliculin interacting protein 1	726					cellular response to starvation (GO:0009267)|immature B cell differentiation (GO:0002327)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell apoptotic process (GO:0002904)|positive regulation of GTPase activity (GO:0043547)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein phosphorylation (GO:0001934)|regulation of pro-B cell differentiation (GO:2000973)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(11)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34		all_cancers(142;0.00347)|Lung NSC(810;0.106)|all_lung(232;0.123)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0665)		ACAACCATTCCTGTGGATCTC	0.448																																					p.G726R		.											.	FNIP1-92	0			c.G2176A						.	C	ARG/GLY,ARG/GLY	1,4405	2.1+/-5.4	0,1,2202	218.0	207.0	211.0		2092,2176	4.9	1.0	5		211	0,8600		0,0,4300	no	missense,missense	FNIP1	NM_001008738.2,NM_133372.2	125,125	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	698/1139,726/1167	131007961	1,13005	2203	4300	6503	SO:0001583	missense	96459	exon14			CCATTCCTGTGGA	DQ145719	CCDS34226.1, CCDS34227.1	5q23.3	2014-01-28				ENSG00000217128			29418	protein-coding gene	gene with protein product		610594				11853319, 17028174	Standard	NM_001008738		Approved	KIAA1961		Q8TF40		ENST00000510461.1:c.2176G>A	5.37:g.131007961C>T	ENSP00000421985:p.Gly726Arg	Somatic	82	0		WXS	Illumina HiSeq	Phase_I	109	63	NM_133372	0	0	3	5	2	D6RJH5|Q86T47|Q9BUT0	Missense_Mutation	SNP	ENST00000510461.1	37	CCDS34227.1	.	.	.	.	.	.	.	.	.	.	C	16.76	3.212357	0.58452	2.27E-4	0.0	ENSG00000217128	ENST00000307968;ENST00000307954;ENST00000544351;ENST00000510461	T;T;T	0.42131	0.98;0.98;0.98	5.76	4.89	0.63831	.	.	.	.	.	T	0.45538	0.1347	L	0.43152	1.355	0.80722	D	1	P;P;P	0.46512	0.879;0.879;0.773	P;P;B	0.50708	0.648;0.494;0.414	T	0.31420	-0.9944	9	0.49607	T	0.09	-8.8964	12.306	0.54902	0.0:0.8667:0.0:0.1333	.	726;698;726	A8K8V8;Q8TF40-3;Q8TF40	.;.;FNIP1_HUMAN	R	698;681;478;726	ENSP00000309266:G698R;ENSP00000310453:G681R;ENSP00000421985:G726R	ENSP00000310453:G681R	G	-	1	0	FNIP1	131035860	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.191000	0.58372	2.726000	0.93360	0.655000	0.94253	GGA	.		0.448	FNIP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370077.1	NM_133372	
NSD1	64324	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	176721020	176721020	+	Missense_Mutation	SNP	G	G	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr5:176721020G>T	ENST00000439151.2	+	23	6696	c.6651G>T	c.(6649-6651)gaG>gaT	p.E2217D	NSD1_ENST00000354179.4_Missense_Mutation_p.E1948D|NSD1_ENST00000347982.4_Missense_Mutation_p.E1948D|NSD1_ENST00000361032.4_Missense_Mutation_p.E2114D	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	2217	Pro-rich.				gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		AACCTGGGGAGATCCGTGAGT	0.562			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																											p.E2217D		.		Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	.	NSD1-188	0			c.G6651T						.						81.0	80.0	81.0					5																	176721020		2203	4300	6503	SO:0001583	missense	64324	exon23	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	TGGGGAGATCCGT	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.6651G>T	5.37:g.176721020G>T	ENSP00000395929:p.Glu2217Asp	Somatic	91	0		WXS	Illumina HiSeq	Phase_I	120	46	NM_022455	0	0	11	24	13	Q96PD8|Q96RN7	Missense_Mutation	SNP	ENST00000439151.2	37	CCDS4412.1	.	.	.	.	.	.	.	.	.	.	G	19.51	3.840800	0.71488	.	.	ENSG00000165671	ENST00000354179;ENST00000439151;ENST00000347982;ENST00000361032	D;D;D;D	0.81996	-1.56;-1.56;-1.56;-1.56	6.17	6.17	0.99709	.	0.000000	0.64402	D	0.000002	D	0.84419	0.5468	L	0.27053	0.805	0.53688	D	0.999975	D;D	0.76494	0.999;0.999	D;D	0.71870	0.975;0.933	D	0.84097	0.0393	10	0.51188	T	0.08	.	11.9775	0.53100	0.1325:0.0:0.8675:0.0	.	1948;2217	Q96L73-2;Q96L73	.;NSD1_HUMAN	D	1948;2217;1948;2114	ENSP00000346111:E1948D;ENSP00000395929:E2217D;ENSP00000343209:E1948D;ENSP00000354310:E2114D	ENSP00000343209:E1948D	E	+	3	2	NSD1	176653626	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.583000	0.53928	2.941000	0.99782	0.655000	0.94253	GAG	.		0.562	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253412.2	NM_172349	
CLK4	57396	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	178050363	178050363	+	Nonsense_Mutation	SNP	C	C	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr5:178050363C>A	ENST00000316308.4	-	2	223	c.55G>T	c.(55-57)Gga>Tga	p.G19*	CLK4_ENST00000520957.1_Nonsense_Mutation_p.G19*	NM_020666.2	NP_065717.1	Q9HAZ1	CLK4_HUMAN	CDC-like kinase 4	19					protein autophosphorylation (GO:0046777)|regulation of RNA splicing (GO:0043484)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(2)	21	all_cancers(89;0.000969)|Renal(175;0.000159)|all_epithelial(37;0.000451)|Lung NSC(126;0.00545)|all_lung(126;0.00918)	all_cancers(40;0.0272)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.235)		CTTTCATGTCCCCAGCTTTCT	0.438																																					p.G19X		.											.	CLK4-359	0			c.G55T						.						207.0	181.0	190.0					5																	178050363		2203	4300	6503	SO:0001587	stop_gained	57396	exon2			CATGTCCCCAGCT	AF294429	CCDS4437.1	5q35	2008-05-02			ENSG00000113240	ENSG00000113240		"""CDC-like kinases"""	13659	protein-coding gene	gene with protein product		607969				11170754	Standard	NM_020666		Approved		uc003mjf.1	Q9HAZ1	OTTHUMG00000130893	ENST00000316308.4:c.55G>T	5.37:g.178050363C>A	ENSP00000316948:p.Gly19*	Somatic	83	0		WXS	Illumina HiSeq	Phase_I	135	60	NM_020666	0	0	0	7	7		Nonsense_Mutation	SNP	ENST00000316308.4	37	CCDS4437.1	.	.	.	.	.	.	.	.	.	.	C	38	7.083910	0.98051	.	.	ENSG00000113240	ENST00000316308;ENST00000536763;ENST00000520957	.	.	.	5.83	4.97	0.65823	.	0.325167	0.32548	N	0.005960	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	.	10.8916	0.46998	0.0:0.9136:0.0:0.0864	.	.	.	.	X	19	.	ENSP00000316948:G19X	G	-	1	0	CLK4	177982969	0.989000	0.36119	0.999000	0.59377	0.962000	0.63368	2.363000	0.44178	1.477000	0.48234	0.491000	0.48974	GGA	.		0.438	CLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253479.2		
PRPF4B	8899	broad.mit.edu;bcgsc.ca	37	6	4060772	4060772	+	Missense_Mutation	SNP	G	G	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr6:4060772G>T	ENST00000337659.6	+	15	3046	c.2946G>T	c.(2944-2946)caG>caT	p.Q982H	PRPF4B_ENST00000494674.1_3'UTR|PRPF4B_ENST00000538861.1_Missense_Mutation_p.Q968H	NM_003913.4	NP_003904.3	Q13523	PRP4B_HUMAN	pre-mRNA processing factor 4B	982	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				mRNA splicing, via spliceosome (GO:0000398)|protein phosphorylation (GO:0006468)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|chromosome (GO:0005694)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(6)|endometrium(3)|large_intestine(5)|lung(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	22	Ovarian(93;0.0925)	all_hematologic(90;0.0895)				TGTTGGACCAGATTCTGATGT	0.448																																					p.Q982H													.	PRPF4B-1308	0			c.G2946T						.						74.0	65.0	68.0					6																	4060772		2203	4300	6503	SO:0001583	missense	8899	exon15			GGACCAGATTCTG	U48736	CCDS4488.1	6p24.2	2013-10-03	2013-10-03		ENSG00000112739	ENSG00000112739			17346	protein-coding gene	gene with protein product		602338	"""PRP4 pre-mRNA processing factor 4 homolog B (yeast)"""			9628581, 11418604	Standard	XR_241936		Approved	Prp4, PR4H, KIAA0536	uc003mvv.3	Q13523	OTTHUMG00000014157	ENST00000337659.6:c.2946G>T	6.37:g.4060772G>T	ENSP00000337194:p.Gln982His	Somatic	237	0		WXS	Illumina HiSeq	Phase_I	255	7	NM_003913	0	0	26	26	0	A8K5C9|Q5D0F6|Q5TAY8|Q8IVC3|Q8TDP2|Q96QT7|Q9UEE6	Missense_Mutation	SNP	ENST00000337659.6	37	CCDS4488.1	.	.	.	.	.	.	.	.	.	.	G	12.13	1.845731	0.32606	.	.	ENSG00000112739	ENST00000337659;ENST00000538861	T;T	0.66280	-0.2;-0.2	5.3	5.3	0.74995	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000008	T	0.59459	0.2195	L	0.35341	1.055	0.80722	D	1	D	0.61697	0.99	P	0.56343	0.796	T	0.61436	-0.7063	10	0.48119	T	0.1	.	18.9491	0.92635	0.0:0.0:1.0:0.0	.	982	Q13523	PRP4B_HUMAN	H	982;968	ENSP00000337194:Q982H;ENSP00000439331:Q968H	ENSP00000337194:Q982H	Q	+	3	2	PRPF4B	4005771	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.912000	0.69948	2.451000	0.82905	0.655000	0.94253	CAG	.		0.448	PRPF4B-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314018.2		
ZSCAN23	222696	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	28402345	28402345	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr6:28402345G>A	ENST00000289788.4	-	4	1212	c.1067C>T	c.(1066-1068)aCt>aTt	p.T356I	ZSCAN23_ENST00000486481.1_5'Flank	NM_001012455.1	NP_001012458.1	Q3MJ62	ZSC23_HUMAN	zinc finger and SCAN domain containing 23	356					transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|prostate(1)|stomach(2)	4						TCTCTCTCCAGTGTGAATTCT	0.448																																					p.T356I		.											.	ZSCAN23-68	0			c.C1067T						.						158.0	136.0	142.0					6																	28402345		692	1591	2283	SO:0001583	missense	222696	exon4			TCTCCAGTGTGAA	AK092117	CCDS47393.1	6p21.33	2013-01-08	2007-02-20	2007-02-20	ENSG00000187987	ENSG00000187987		"""-"", ""Zinc fingers, C2H2-type"""	21193	protein-coding gene	gene with protein product			"""zinc finger protein 453"", ""zinc finger protein 390"""	ZNF453, ZNF390			Standard	NM_001012455		Approved	dJ29K1.3.1	uc003nli.4	Q3MJ62	OTTHUMG00000016346	ENST00000289788.4:c.1067C>T	6.37:g.28402345G>A	ENSP00000289788:p.Thr356Ile	Somatic	99	0		WXS	Illumina HiSeq	Phase_I	110	61	NM_001012455	0	0	1	1	0	Q96KV9	Missense_Mutation	SNP	ENST00000289788.4	37	CCDS47393.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.245900	0.80024	.	.	ENSG00000187987	ENST00000289788	T	0.25749	1.78	3.93	3.93	0.45458	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.39909	N	0.001229	T	0.36386	0.0965	M	0.80183	2.485	0.34741	D	0.730734	D	0.55385	0.971	P	0.56788	0.806	T	0.46541	-0.9184	10	0.87932	D	0	.	13.4765	0.61312	0.0:0.0:1.0:0.0	.	356	Q3MJ62	ZSC23_HUMAN	I	356	ENSP00000289788:T356I	ENSP00000289788:T356I	T	-	2	0	ZSCAN23	28510324	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.856000	0.69518	2.007000	0.58848	0.650000	0.86243	ACT	.		0.448	ZSCAN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043751.2	XM_167147	
TNXB	7148	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	32016288	32016288	+	Silent	SNP	C	C	T	rs373655652		TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr6:32016288C>T	ENST00000375244.3	-	29	10098	c.9897G>A	c.(9895-9897)gcG>gcA	p.A3299A	TNXB_ENST00000375247.2_Silent_p.A3297A|TNXB_ENST00000451343.1_5'Flank			P22105	TENX_HUMAN	tenascin XB	3344	Fibronectin type-III 24. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						GCTGCCCCTGCGCGTCCCTGT	0.687																																					p.A3297A		.											.	TNXB-90	0			c.G9891A						.	C		0,3902		0,0,1951	17.0	21.0	19.0		9891	-7.3	0.0	6		19	3,8267		0,3,4132	no	coding-synonymous	TNXB	NM_019105.6		0,3,6083	TT,TC,CC		0.0363,0.0,0.0246		3297/4243	32016288	3,12169	1951	4135	6086	SO:0001819	synonymous_variant	7148	exon29			CCCCTGCGCGTCC	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.9897G>A	6.37:g.32016288C>T		Somatic	97	0		WXS	Illumina HiSeq	Phase_I	173	105	NM_019105	0	0	0	0	0	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Silent	SNP	ENST00000375244.3	37																																																																																				.		0.687	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000268927.2	NM_019105	
TNXB	7148	broad.mit.edu;bcgsc.ca	37	6	32063589	32063589	+	Missense_Mutation	SNP	C	C	G			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr6:32063589C>G	ENST00000479795.1	-	3	2181	c.2041G>C	c.(2041-2043)Gaa>Caa	p.E681Q	TNXB_ENST00000375247.2_Missense_Mutation_p.E681Q|TNXB_ENST00000375244.3_Missense_Mutation_p.E681Q			P22105	TENX_HUMAN	tenascin XB	681					actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						GGAGGCTCTTCCTGCCCGCAG	0.701																																					p.E681Q													.	TNXB-90	0			c.G2041C						.						16.0	20.0	18.0					6																	32063589		2114	4231	6345	SO:0001583	missense	7148	exon3			GCTCTTCCTGCCC	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000479795.1:c.2041G>C	6.37:g.32063589C>G	ENSP00000418248:p.Glu681Gln	Somatic	109	0		WXS	Illumina HiSeq	Phase_I	291	13	NM_019105	0	0	0	0	0	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	ENST00000479795.1	37		.	.	.	.	.	.	.	.	.	.	C	20.2	3.955354	0.73902	.	.	ENSG00000168477	ENST00000375244;ENST00000375247;ENST00000479795	T;T;T	0.08546	3.08;3.08;3.08	4.78	4.78	0.61160	.	0.000000	0.45126	D	0.000397	T	0.08088	0.0202	L	0.37750	1.13	0.26200	N	0.979459	D	0.65815	0.995	P	0.61477	0.889	T	0.19549	-1.0302	10	0.30078	T	0.28	.	13.3295	0.60479	0.0:1.0:0.0:0.0	.	681	P22105-3	.	Q	681	ENSP00000364393:E681Q;ENSP00000364396:E681Q;ENSP00000418248:E681Q	ENSP00000364393:E681Q	E	-	1	0	TNXB	32171567	0.970000	0.33590	0.850000	0.33497	0.919000	0.55068	0.746000	0.26275	2.198000	0.70561	0.563000	0.77884	GAA	.		0.701	TNXB-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000357059.1	NM_019105	
CUL9	23113	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	43155541	43155541	+	Missense_Mutation	SNP	A	A	G			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr6:43155541A>G	ENST00000252050.4	+	7	1756	c.1672A>G	c.(1672-1674)Agc>Ggc	p.S558G	CUL9_ENST00000372647.2_Missense_Mutation_p.S558G|CUL9_ENST00000354495.3_Missense_Mutation_p.S448G	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	558					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						ATTTGAGGGCAGCACTCTCAA	0.517																																					p.S558G		.											.	CUL9-529	0			c.A1672G						.						122.0	121.0	121.0					6																	43155541		2203	4300	6503	SO:0001583	missense	23113	exon7			GAGGGCAGCACTC	AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.1672A>G	6.37:g.43155541A>G	ENSP00000252050:p.Ser558Gly	Somatic	84	0		WXS	Illumina HiSeq	Phase_I	84	19	NM_015089	0	0	7	9	2	O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Missense_Mutation	SNP	ENST00000252050.4	37	CCDS4890.1	.	.	.	.	.	.	.	.	.	.	A	13.47	2.245727	0.39697	.	.	ENSG00000112659	ENST00000252050;ENST00000354495;ENST00000372647	T;T;T	0.77489	-1.1;-0.91;-1.0	5.5	4.35	0.52113	.	0.665930	0.17251	N	0.181151	T	0.50343	0.1610	L	0.43152	1.355	0.27626	N	0.948198	B;B;B	0.16603	0.018;0.018;0.003	B;B;B	0.16722	0.016;0.016;0.002	T	0.40794	-0.9544	10	0.48119	T	0.1	-13.3974	4.4793	0.11759	0.702:0.0:0.1464:0.1516	.	558;558;558	E9PEZ1;Q8IWT3;Q05C85	.;CUL9_HUMAN;.	G	558;448;558	ENSP00000252050:S558G;ENSP00000346490:S448G;ENSP00000361730:S558G	ENSP00000252050:S558G	S	+	1	0	CUL9	43263519	0.994000	0.37717	1.000000	0.80357	0.943000	0.58893	1.801000	0.38843	2.090000	0.63153	0.383000	0.25322	AGC	.		0.517	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040582.2	NM_015089	
PKHD1	5314	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	6	51586795	51586795	+	Intron	SNP	T	T	G			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr6:51586795T>G	ENST00000371117.3	-	60	10432				PKHD1_ENST00000340994.4_Missense_Mutation_p.I3394L	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)						cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					TATTCTGAAATCTTCAAAGCC	0.448																																					p.I3394L		.											.	PKHD1-603	0			c.A10180C						.						71.0	70.0	70.0					6																	51586795		2203	4300	6503	SO:0001627	intron_variant	5314	exon61			CTGAAATCTTCAA	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.10156+22387A>C	6.37:g.51586795T>G		Somatic	92	0		WXS	Illumina HiSeq	Phase_I	76	32	NM_170724	0	0	0	0	0	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	37	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	T	11.62	1.692382	0.30052	.	.	ENSG00000170927	ENST00000340994	D	0.86627	-2.15	3.72	-0.352	0.12598	.	.	.	.	.	T	0.61949	0.2388	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.54275	-0.8318	8	0.54805	T	0.06	.	4.5853	0.12279	0.0:0.1103:0.3908:0.4988	.	3394	P08F94-2	.	L	3394	ENSP00000341097:I3394L	ENSP00000341097:I3394L	I	-	1	0	PKHD1	51694754	0.000000	0.05858	0.000000	0.03702	0.220000	0.24768	0.004000	0.13106	-0.046000	0.13446	0.379000	0.24179	ATT	.		0.448	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
COL21A1	81578	hgsc.bcm.edu;bcgsc.ca	37	6	55933890	55933890	+	Missense_Mutation	SNP	G	G	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr6:55933890G>T	ENST00000244728.5	-	22	2442	c.2045C>A	c.(2044-2046)cCa>cAa	p.P682Q	COL21A1_ENST00000370808.2_Missense_Mutation_p.P82Q|COL21A1_ENST00000370819.1_Missense_Mutation_p.P679Q|COL21A1_ENST00000535941.1_Missense_Mutation_p.P682Q|COL21A1_ENST00000467045.1_5'UTR	NM_030820.3	NP_110447.2	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1	682	Collagen-like 4.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|prostate(2)	41	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			TGGTTCTCCTGGGGAACCCGT	0.423																																					p.P682Q		.											.	COL21A1-24	0			c.C2045A						.						62.0	62.0	62.0					6																	55933890		1831	4076	5907	SO:0001583	missense	81578	exon22			TCTCCTGGGGAAC	AF330693	CCDS55025.1	6p12.3-p11.2	2013-01-16			ENSG00000124749	ENSG00000124749		"""Collagens"""	17025	protein-coding gene	gene with protein product		610002				11566190	Standard	XR_241922		Approved		uc003pcs.3	Q96P44	OTTHUMG00000014907	ENST00000244728.5:c.2045C>A	6.37:g.55933890G>T	ENSP00000244728:p.Pro682Gln	Somatic	84	0		WXS	Illumina HiSeq	Phase_I	95	5	NM_030820	0	0	0	0	0	A6NIX5|B2R8J9|Q49A51|Q71RF4|Q8WXV8|Q9H0V3	Missense_Mutation	SNP	ENST00000244728.5	37	CCDS55025.1	.	.	.	.	.	.	.	.	.	.	G	13.12	2.143568	0.37825	.	.	ENSG00000124749	ENST00000244728;ENST00000370819;ENST00000535941;ENST00000370811;ENST00000370808	D;D;D;D	0.97752	-4.52;-4.52;-4.52;-4.52	4.38	3.48	0.39840	.	0.000000	0.49305	U	0.000144	D	0.95968	0.8687	L	0.28192	0.835	0.47407	D	0.999413	P;P;D	0.89917	0.886;0.77;1.0	B;P;D	0.97110	0.381;0.515;1.0	D	0.94500	0.7709	10	0.27785	T	0.31	.	12.3453	0.55118	0.0:0.0:0.8294:0.1705	.	82;682;682	Q96P44-2;B7ZLK3;Q96P44	.;.;COLA1_HUMAN	Q	682;679;682;679;82	ENSP00000244728:P682Q;ENSP00000359855:P679Q;ENSP00000444384:P682Q;ENSP00000359844:P82Q	ENSP00000244728:P682Q	P	-	2	0	COL21A1	56041849	1.000000	0.71417	0.163000	0.22734	0.829000	0.46940	4.396000	0.59684	0.905000	0.36596	0.557000	0.71058	CCA	.		0.423	COL21A1-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041004.2		
UBE3D	90025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	83767555	83767555	+	Missense_Mutation	SNP	T	T	G			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr6:83767555T>G	ENST00000369747.3	-	2	386	c.264A>C	c.(262-264)aaA>aaC	p.K88N		NM_198920.1	NP_944602.1	Q7Z6J8	UBE3D_HUMAN	ubiquitin protein ligase E3D	88					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)										TTGTGCCTAATTTTGCTTGCG	0.443											OREG0017549	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.K88N		.											.	.	0			c.A264C						.						67.0	68.0	68.0					6																	83767555		2203	4300	6503	SO:0001583	missense	90025	exon2			GCCTAATTTTGCT	AL137544	CCDS34491.1	6q15	2012-02-24	2012-02-24	2012-02-24	ENSG00000118420	ENSG00000118420			21381	protein-coding gene	gene with protein product	"""UBCH10 binding protein with a hect-like domain"""	612495	"""chromosome 6 open reading frame 157"", ""ubiquitin-conjugating enzyme E2C binding protein"""	C6orf157, UBE2CBP		15749827	Standard	NM_198920		Approved	DKFZp434A1520, H10BH, YJR141W	uc003pjp.2	Q7Z6J8	OTTHUMG00000015108	ENST00000369747.3:c.264A>C	6.37:g.83767555T>G	ENSP00000358762:p.Lys88Asn	Somatic	83	0	1224	WXS	Illumina HiSeq	Phase_I	78	39	NM_198920	0	0	0	0	0	B4DP63|Q5T4W2|Q6IPR4|Q75UG0|Q9NT42	Missense_Mutation	SNP	ENST00000369747.3	37	CCDS34491.1	.	.	.	.	.	.	.	.	.	.	T	10.93	1.490288	0.26686	.	.	ENSG00000118420	ENST00000369747	T	0.30714	1.52	5.27	-10.5	0.00291	.	0.631105	0.16070	N	0.231043	T	0.02767	0.0083	N	0.08118	0	0.09310	N	0.999998	B;B	0.20164	0.042;0.002	B;B	0.18871	0.023;0.002	T	0.20009	-1.0288	10	0.33141	T	0.24	-18.3097	5.2116	0.15320	0.1807:0.4793:0.1961:0.1438	.	88;88	D6RD24;Q7Z6J8	.;UB2CB_HUMAN	N	88	ENSP00000358762:K88N	ENSP00000358762:K88N	K	-	3	2	UBE2CBP	83824274	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.412000	0.02476	-2.085000	0.00864	-0.911000	0.02809	AAA	.		0.443	UBE3D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041347.7	NM_198920	
COQ3	51805	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	99823846	99823846	+	Silent	SNP	T	T	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr6:99823846T>A	ENST00000254759.3	-	5	723	c.699A>T	c.(697-699)acA>acT	p.T233T	COQ3_ENST00000369240.1_Intron|COQ3_ENST00000369242.1_Intron|COQ3_ENST00000479163.1_5'Flank	NM_017421.3	NP_059117.3	Q9NZJ6	COQ3_HUMAN	coenzyme Q3 methyltransferase	233					glycerol metabolic process (GO:0006071)|small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	2-polyprenyl-6-methoxy-1,4-benzoquinone methyltransferase activity (GO:0008425)|3-demethylubiquinone-9 3-O-methyltransferase activity (GO:0008689)|hexaprenyldihydroxybenzoate methyltransferase activity (GO:0004395)|O-methyltransferase activity (GO:0008171)			cervix(1)|lung(5)|upper_aerodigestive_tract(2)	8		all_cancers(76;1.24e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.00716)|Colorectal(196;0.0691)|Lung NSC(302;0.186)		BRCA - Breast invasive adenocarcinoma(108;0.0625)		ACTGTAAAAATGTTTCTAGAT	0.368																																					p.T233T		.											.	COQ3-91	0			c.A699T						.						154.0	149.0	151.0					6																	99823846		2203	4300	6503	SO:0001819	synonymous_variant	51805	exon5			TAAAAATGTTTCT	AF193016	CCDS5042.1	6q21	2013-05-01	2013-05-01		ENSG00000132423	ENSG00000132423	2.1.1.114		18175	protein-coding gene	gene with protein product	"""polyprenyldihydroxybenzoate methyltransferase"""	605196	"""coenzyme Q3 homolog, methyltransferase (yeast)"", ""coenzyme Q3 homolog, methyltransferase (S. cerevisiae)"""			10777520	Standard	NM_017421		Approved	bA9819.1	uc003ppk.3	Q9NZJ6	OTTHUMG00000015264	ENST00000254759.3:c.699A>T	6.37:g.99823846T>A		Somatic	114	0		WXS	Illumina HiSeq	Phase_I	79	26	NM_017421	0	0	5	7	2	B3KPX0|Q5T061|Q6P4F0|Q8IXG6|Q96BG1|Q9H0N1	Silent	SNP	ENST00000254759.3	37	CCDS5042.1																																																																																			.		0.368	COQ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041602.1	NM_017421	
LATS1	9113	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	149997827	149997827	+	Silent	SNP	C	C	G			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr6:149997827C>G	ENST00000543571.1	-	6	3187	c.2640G>C	c.(2638-2640)ggG>ggC	p.G880G	LATS1_ENST00000542747.1_5'UTR|LATS1_ENST00000253339.5_Silent_p.G880G	NM_004690.3	NP_004681.1			large tumor suppressor kinase 1											central_nervous_system(1)|lung(5)	6		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;6.93e-13)|GBM - Glioblastoma multiforme(68;0.116)		TTGAGGGATCCCCCCATTCAT	0.473																																					p.G880G		.											.	LATS1-992	0			c.G2640C						.						73.0	63.0	66.0					6																	149997827		2203	4300	6503	SO:0001819	synonymous_variant	9113	exon6			GGGATCCCCCCAT	AF104413	CCDS34551.1, CCDS59040.1	6q25.1	2013-04-25	2013-04-25		ENSG00000131023	ENSG00000131023			6514	protein-coding gene	gene with protein product		603473	"""LATS (large tumor suppressor, Drosophila) homolog 1"", ""LATS, large tumor suppressor, homolog 1 (Drosophila)"""			9988268, 15122335	Standard	NM_004690		Approved	WARTS	uc003qmu.2	O95835	OTTHUMG00000016437	ENST00000543571.1:c.2640G>C	6.37:g.149997827C>G		Somatic	59	0		WXS	Illumina HiSeq	Phase_I	71	20	NM_004690	0	0	0	0	0		Silent	SNP	ENST00000543571.1	37	CCDS34551.1																																																																																			.		0.473	LATS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043923.4	NM_004690	
C6orf99	100130967	bcgsc.ca	37	6	159316252	159316252	+	Splice_Site	SNP	G	G	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr6:159316252G>A	ENST00000608817.1	+	3	216		c.e3-1		C6orf99_ENST00000367072.1_Splice_Site|C6orf99_ENST00000367073.4_Splice_Site			Q4VX62	CF099_HUMAN	chromosome 6 open reading frame 99																		TTTGTTGGCAGAACAGGTGGA	0.433																																					.													.	.	0			.						.																																			SO:0001630	splice_region_variant	100130967	.			TTGGCAGAACAGG		CCDS55073.1	6q25.3	2011-12-14			ENSG00000203711	ENSG00000203711			21179	protein-coding gene	gene with protein product							Standard	NM_001195032		Approved	yR211F11.1	uc021zhp.1	Q4VX62	OTTHUMG00000015921	ENST00000608817.1:c.217-1G>A	6.37:g.159316252G>A		Somatic	107	1		WXS	Illumina HiSeq	Phase_1	81	24	.	0	0	0	0	0	Q4VX61	Splice_Site	SNP	ENST00000608817.1	37		.	.	.	.	.	.	.	.	.	.	G	6.034	0.374717	0.11409	.	.	ENSG00000203711	ENST00000367073	.	.	.	3.2	0.183	0.15082	.	.	.	.	.	.	.	.	.	.	.	0.35969	D	0.835198	.	.	.	.	.	.	.	.	.	.	.	.	.	.	1.8025	0.03074	0.1233:0.2044:0.4625:0.2098	.	.	.	.	.	-1	.	.	.	+	.	.	C6orf99	159236240	0.236000	0.23804	0.288000	0.24862	0.030000	0.12068	0.202000	0.17295	0.016000	0.14998	-0.293000	0.09583	.	.		0.433	C6orf99-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_001195032	Intron
RNF216	54476	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	5781127	5781127	+	Nonsense_Mutation	SNP	G	G	C			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr7:5781127G>C	ENST00000425013.2	-	4	574	c.350C>G	c.(349-351)tCa>tGa	p.S117*	RNF216_ENST00000389902.3_Nonsense_Mutation_p.S174*	NM_207111.3|NM_207116.2	NP_996994.1|NP_996999.1	Q9NWF9	RN216_HUMAN	ring finger protein 216	117					apoptotic process (GO:0006915)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|regulation of defense response to virus by host (GO:0050691)|regulation of interferon-beta production (GO:0032648)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)		FBXL18/RNF216(2)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)|skin(1)|urinary_tract(4)	33		Ovarian(82;0.07)		UCEC - Uterine corpus endometrioid carcinoma (126;0.135)|OV - Ovarian serous cystadenocarcinoma(56;2.69e-13)		TTTCTGCTCTGATCTGGGGTT	0.463																																					p.S174X		.											.	RNF216-274	0			c.C521G						.						267.0	250.0	256.0					7																	5781127		2203	4300	6503	SO:0001587	stop_gained	54476	exon4			TGCTCTGATCTGG	AY062174	CCDS34594.1, CCDS34595.1	7p22.1	2014-02-12	2007-08-20		ENSG00000011275	ENSG00000011275		"""RING-type (C3HC4) zinc fingers"""	21698	protein-coding gene	gene with protein product		609948					Standard	NM_207111		Approved	TRIAD3, UBCE7IP1, ZIN	uc003sox.2	Q9NWF9	OTTHUMG00000155500	ENST00000425013.2:c.350C>G	7.37:g.5781127G>C	ENSP00000404602:p.Ser117*	Somatic	139	0		WXS	Illumina HiSeq	Phase_I	147	74	NM_207111	0	0	11	12	1	Q6Y691|Q75ML7|Q7Z2H7|Q7Z7C1|Q8NHW7|Q9NYT1	Nonsense_Mutation	SNP	ENST00000425013.2	37	CCDS34595.1	.	.	.	.	.	.	.	.	.	.	G	18.19	3.567910	0.65651	.	.	ENSG00000011275	ENST00000425013;ENST00000389902	.	.	.	5.97	3.93	0.45458	.	0.519284	0.17997	N	0.155007	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.19147	T	0.46	-4.5609	7.8068	0.29206	0.2458:0.0:0.7542:0.0	.	.	.	.	X	117;174	.	ENSP00000374550:S117X	S	-	2	0	RNF216	5747653	0.000000	0.05858	0.995000	0.50966	0.994000	0.84299	0.252000	0.18278	1.509000	0.48786	0.561000	0.74099	TCA	.		0.463	RNF216-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000340374.1	NM_207111	
STAG3L4	64940	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	66774599	66774599	+	RNA	SNP	T	T	G			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr7:66774599T>G	ENST00000416602.2	+	0	616					NR_040586.1		Q8TBR4	ST3L4_HUMAN	stromal antigen 3-like 4 (pseudogene)											endometrium(2)|lung(5)	7		Lung NSC(55;0.0839)|all_lung(88;0.181)				CAACTGAGTCTGCACGAAGAT	0.483																																					.													.	STAG3L4-68	0			.						.						131.0	138.0	136.0					7																	66774599		2203	4300	6503			64940	.			TGAGTCTGCACGA			7q11.21	2013-06-26	2013-06-26		ENSG00000106610	ENSG00000106610			33887	pseudogene	pseudogene			"""stromal antigen 3-like 4"""				Standard	NR_040585		Approved	FLJ13195, STAG3L4P	uc010laj.3	Q8TBR4	OTTHUMG00000156920		7.37:g.66774599T>G		Somatic	62	0		WXS	Illumina HiSeq	Phase_I	92	34	.	0	0	0	13	13	Q9H8W0	RNA	SNP	ENST00000416602.2	37		.	.	.	.	.	.	.	.	.	.	t	7.912	0.736640	0.15574	.	.	ENSG00000106610	ENST00000416602;ENST00000437742	.	.	.	0.524	0.524	0.17066	STAG (1);	0.297117	0.24136	N	0.041215	T	0.45696	0.1355	.	.	.	.	.	.	P	0.47034	0.889	P	0.50270	0.636	T	0.53927	-0.8369	7	0.49607	T	0.09	.	5.3623	0.16095	0.0:2.0E-4:0.0:0.9998	.	114	Q8TBR4	STG34_HUMAN	R	114	.	ENSP00000408597:L114R	L	+	2	0	STAG3L4	66412034	0.998000	0.40836	0.719000	0.30619	0.035000	0.12851	5.174000	0.65015	0.472000	0.27344	0.113000	0.15668	CTG	.		0.483	STAG3L4-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000346611.1	NM_022906	
SEMA3A	10371	broad.mit.edu	37	7	83739849	83739849	+	Silent	SNP	G	G	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr7:83739849G>A	ENST00000265362.4	-	4	704	c.390C>T	c.(388-390)taC>taT	p.Y130Y	SEMA3A_ENST00000436949.1_Silent_p.Y130Y	NM_006080.2	NP_006071.1	Q14563	SEM3A_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A	130	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				apoptotic process (GO:0006915)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|dendrite morphogenesis (GO:0048813)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of epithelial cell migration (GO:0010633)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neural crest cell migration involved in sympathetic nervous system development (GO:1903045)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of male gonad development (GO:2000020)|positive regulation of neuron migration (GO:2001224)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of heart rate (GO:0002027)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sensory system development (GO:0048880)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular region (GO:0005576)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|neuropilin binding (GO:0038191)|receptor activity (GO:0004872)	p.Y130Y(1)		breast(3)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53						TTCCACAGGCGTACAAGTGAG	0.383																																					p.Y130Y													.	SEMA3A-156	1	Substitution - coding silent(1)	breast(1)	c.C390T						.						126.0	116.0	120.0					7																	83739849		2203	4300	6503	SO:0001819	synonymous_variant	10371	exon4			ACAGGCGTACAAG	L26081	CCDS5599.1	7p12.1	2013-01-11			ENSG00000075213	ENSG00000075213		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10723	protein-coding gene	gene with protein product	"""sema III"""	603961		SEMAD		8269517, 7748561	Standard	NM_006080		Approved	SEMA1, SemD, coll-1, Hsema-I	uc003uhz.3	Q14563	OTTHUMG00000023443	ENST00000265362.4:c.390C>T	7.37:g.83739849G>A		Somatic	176	0		WXS	Illumina HiSeq	Phase_I	154	5	NM_006080	0	0	0	0	0		Silent	SNP	ENST00000265362.4	37	CCDS5599.1																																																																																			.		0.383	SEMA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253355.2	NM_006080	
AKAP9	10142	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	91632281	91632281	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr7:91632281G>A	ENST00000359028.2	+	9	3311	c.3086G>A	c.(3085-3087)aGc>aAc	p.S1029N	AKAP9_ENST00000356239.3_Missense_Mutation_p.S1017N|AKAP9_ENST00000358100.2_Missense_Mutation_p.S1029N			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	1029					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)			NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			ACTCAAGTAAGCTCTTTATTA	0.358			T	BRAF	papillary thyroid																																p.S1017N				Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	.	AKAP9-755	0			c.G3050A						.						86.0	86.0	86.0					7																	91632281		2202	4299	6501	SO:0001583	missense	10142	exon8			AAGTAAGCTCTTT	AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.3086G>A	7.37:g.91632281G>A	ENSP00000351922:p.Ser1029Asn	Somatic	160	1		WXS	Illumina HiSeq	Phase_I	140	81	NM_005751	0	0	0	0	0	A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Missense_Mutation	SNP	ENST00000359028.2	37		.	.	.	.	.	.	.	.	.	.	G	8.175	0.792556	0.16258	.	.	ENSG00000127914	ENST00000356239;ENST00000359028;ENST00000358100;ENST00000413120;ENST00000394565	T;T;T	0.03441	3.94;3.93;3.93	5.72	2.61	0.31194	.	0.622892	0.14300	N	0.328352	T	0.04407	0.0121	L	0.54323	1.7	0.09310	N	1	B;B;B;B	0.13145	0.001;0.007;0.001;0.001	B;B;B;B	0.08055	0.001;0.003;0.002;0.003	T	0.45234	-0.9275	10	0.15499	T	0.54	.	9.0655	0.36460	0.423:0.0:0.577:0.0	.	1029;1017;1017;1029	Q99996;Q99996-2;Q99996-3;A4D1E4	AKAP9_HUMAN;.;.;.	N	1017;1029;1029;1029;1029	ENSP00000348573:S1017N;ENSP00000351922:S1029N;ENSP00000350813:S1029N	ENSP00000348573:S1017N	S	+	2	0	AKAP9	91470217	0.000000	0.05858	0.001000	0.08648	0.015000	0.08874	0.613000	0.24299	0.274000	0.22072	0.650000	0.86243	AGC	.		0.358	AKAP9-202	KNOWN	basic	protein_coding	protein_coding		NM_005751	
ZNF655	79027	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	99158261	99158261	+	Silent	SNP	C	C	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr7:99158261C>T	ENST00000394163.2	+	2	262	c.79C>T	c.(79-81)Ctg>Ttg	p.L27L	GS1-259H13.10_ENST00000486324.1_3'UTR|ZNF655_ENST00000425063.1_Silent_p.L27L|ZNF655_ENST00000440391.1_Silent_p.L27L|ZNF655_ENST00000449244.1_Silent_p.L27L|GS1-259H13.10_ENST00000455905.1_Silent_p.L27L|ZNF655_ENST00000454654.1_Silent_p.L27L|ZNF655_ENST00000357864.2_Silent_p.L27L|ZNF655_ENST00000252713.4_Silent_p.L27L|ZNF655_ENST00000493277.1_Silent_p.L27L|ZNF655_ENST00000320583.5_Silent_p.L27L|ZNF655_ENST00000424881.1_Silent_p.L27L	NM_001009960.1|NM_138494.2	NP_001009960.1|NP_612503.1	Q8N720	ZN655_HUMAN	zinc finger protein 655	27					negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	16	all_epithelial(64;3.19e-09)|Lung NSC(181;0.0066)|all_lung(186;0.011)|Esophageal squamous(72;0.0166)					GTCTGAGTGTCTGTCCCCAGA	0.567																																					p.L27L		.											.	ZNF655-91	0			c.C79T						.						118.0	113.0	114.0					7																	99158261		2203	4300	6503	SO:0001819	synonymous_variant	79027	exon2			GAGTGTCTGTCCC	AY099353	CCDS5669.1, CCDS5670.1, CCDS34695.1, CCDS47655.1	7q22.1	2013-01-08			ENSG00000197343	ENSG00000197343		"""Zinc fingers, C2H2-type"", ""-"""	30899	protein-coding gene	gene with protein product						11179890, 15558030	Standard	NM_001083956		Approved	VIK-1, VIK	uc010lgc.3	Q8N720	OTTHUMG00000156637	ENST00000394163.2:c.79C>T	7.37:g.99158261C>T		Somatic	69	0		WXS	Illumina HiSeq	Phase_I	79	21	NM_024061	0	0	7	13	6	A4D291|A6NGD3|B4E3M4|B7Z9Q9|D6W5T4|Q8IV00|Q8TA89|Q96EZ3|Q9BQ85	Silent	SNP	ENST00000394163.2	37	CCDS5669.1																																																																																			.		0.567	ZNF655-009	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000344929.1	NM_138494	
DLD	1738	broad.mit.edu	37	7	107545820	107545820	+	Silent	SNP	T	T	C			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr7:107545820T>C	ENST00000205402.5	+	7	734	c.453T>C	c.(451-453)aaT>aaC	p.N151N	DLD_ENST00000494441.1_3'UTR|DLD_ENST00000537148.1_Silent_p.N52N|DLD_ENST00000437604.2_Intron|DLD_ENST00000440410.1_Silent_p.N128N	NM_000108.3	NP_000099.2	P09622	DLDH_HUMAN	dihydrolipoamide dehydrogenase	151					branched-chain amino acid catabolic process (GO:0009083)|cell redox homeostasis (GO:0045454)|cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|gastrulation (GO:0007369)|lysine catabolic process (GO:0006554)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|proteolysis (GO:0006508)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of membrane potential (GO:0042391)|small molecule metabolic process (GO:0044281)|sperm capacitation (GO:0048240)|tricarboxylic acid cycle (GO:0006099)	acrosomal matrix (GO:0043159)|cilium (GO:0005929)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	dihydrolipoyl dehydrogenase activity (GO:0004148)|flavin adenine dinucleotide binding (GO:0050660)			NS(1)|breast(1)|central_nervous_system(1)|kidney(5)|large_intestine(1)|lung(10)|prostate(1)	20					Flavin adenine dinucleotide(DB03147)	TTCATGTCAATGGATATGGAA	0.313																																					p.N151N													.	DLD-226	0			c.T453C						.						79.0	76.0	77.0					7																	107545820		2203	4300	6503	SO:0001819	synonymous_variant	1738	exon7			TGTCAATGGATAT	AB209703	CCDS5749.1	7q31-q32	2006-05-22	2006-05-22		ENSG00000091140	ENSG00000091140	1.8.1.4		2898	protein-coding gene	gene with protein product	"""E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate complex, branched chain keto acid dehydrogenase complex"""	238331	"""dihydrolipoamide dehydrogenase (E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate complex, branched chain keto acid dehydrogenase complex)"""	LAD, GCSL			Standard	NM_000108		Approved	DLDH	uc003vet.3	P09622	OTTHUMG00000154813	ENST00000205402.5:c.453T>C	7.37:g.107545820T>C		Somatic	80	0		WXS	Illumina HiSeq	Phase_I	42	3	NM_000108	0	0	115	115	0	B2R5X0|B4DHG0|B4DT69|Q14131|Q14167|Q59EV8|Q8WTS4	Silent	SNP	ENST00000205402.5	37	CCDS5749.1																																																																																			.		0.313	DLD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337194.3	NM_000108	
SSMEM1	136263	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	129856036	129856036	+	Missense_Mutation	SNP	A	A	T	rs144099660		TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr7:129856036A>T	ENST00000297819.3	+	3	512	c.461A>T	c.(460-462)gAg>gTg	p.E154V		NM_145268.3	NP_660311.1	Q8WWF3	SSMM1_HUMAN	serine-rich single-pass membrane protein 1	154						integral component of membrane (GO:0016021)											GGCAGTGAAGAGTCTAACTCA	0.478																																					p.E154V		.											.	.	0			c.A461T						.						98.0	99.0	99.0					7																	129856036		2203	4300	6503	SO:0001583	missense	0	exon3			GTGAAGAGTCTAA	AK097635	CCDS5816.1	7q32.2	2013-03-08	2013-03-08	2013-03-08	ENSG00000165120	ENSG00000165120			29580	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 45"""	C7orf45		12477932	Standard	NM_145268		Approved	FLJ40316	uc003vpp.3	Q8WWF3	OTTHUMG00000157844	ENST00000297819.3:c.461A>T	7.37:g.129856036A>T	ENSP00000297819:p.Glu154Val	Somatic	171	0		WXS	Illumina HiSeq	Phase_I	185	48	NM_145268	0	0	0	0	0		Missense_Mutation	SNP	ENST00000297819.3	37	CCDS5816.1	.	.	.	.	.	.	.	.	.	.	A	15.74	2.921732	0.52653	.	.	ENSG00000165120	ENST00000297819	T	0.55052	0.54	5.56	3.09	0.35607	.	0.365080	0.26103	N	0.026340	T	0.48589	0.1508	M	0.63428	1.95	0.32923	D	0.516117	B	0.20671	0.047	B	0.24541	0.054	T	0.56044	-0.8044	10	0.87932	D	0	-6.405	8.8929	0.35446	0.702:0.0:0.0:0.2979	.	154	Q8WWF3	CG045_HUMAN	V	154	ENSP00000297819:E154V	ENSP00000297819:E154V	E	+	2	0	C7orf45	129643272	0.962000	0.33011	0.961000	0.40146	0.396000	0.30629	2.242000	0.43106	0.352000	0.24053	0.402000	0.26972	GAG	A|1.000;C|0.000		0.478	SSMEM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349768.1	NM_145268	
HIPK2	28996	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	7	139258060	139258060	+	Silent	SNP	C	C	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr7:139258060C>A	ENST00000406875.3	-	15	3304	c.3210G>T	c.(3208-3210)ccG>ccT	p.P1070P	HIPK2_ENST00000428878.2_Silent_p.P1043P	NM_022740.4	NP_073577.3	Q9H2X6	HIPK2_HUMAN	homeodomain interacting protein kinase 2	1070	Autoinhibitory domain (AID).				adult walking behavior (GO:0007628)|anterior/posterior pattern specification (GO:0009952)|cellular response to hypoxia (GO:0071456)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|erythrocyte differentiation (GO:0030218)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|PML body organization (GO:0030578)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|retina layer formation (GO:0010842)|SMAD protein signal transduction (GO:0060395)|smoothened signaling pathway (GO:0007224)|transforming growth factor beta receptor signaling pathway (GO:0007179)|voluntary musculoskeletal movement (GO:0050882)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)|virion binding (GO:0046790)			breast(4)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(5)|lung(11)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Melanoma(164;0.205)					GGAAGGAGTACGGAGCCTGGG	0.682																																					p.P1070P		.											.	HIPK2-785	0			c.G3210T						.						84.0	104.0	97.0					7																	139258060		2181	4276	6457	SO:0001819	synonymous_variant	28996	exon15			GGAGTACGGAGCC	AF208291	CCDS75666.1, CCDS75667.1	7q32-q34	2004-01-29	2001-11-29		ENSG00000064393	ENSG00000064393			14402	protein-coding gene	gene with protein product		606868	"""homeodomain-interacting protein kinase 2"""			11120354	Standard	NM_001113239		Approved		uc003vvf.4	Q9H2X6	OTTHUMG00000157704	ENST00000406875.3:c.3210G>T	7.37:g.139258060C>A		Somatic	12	0		WXS	Illumina HiSeq	Phase_I	37	12	NM_022740	0	0	7	8	1	Q75MR7|Q8WWI4|Q9H2Y1	Silent	SNP	ENST00000406875.3	37																																																																																				.		0.682	HIPK2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000349430.3	NM_022740	
CRISPLD1	83690	ucsc.edu;bcgsc.ca	37	8	75932278	75932278	+	Missense_Mutation	SNP	T	T	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr8:75932278T>A	ENST00000262207.4	+	12	1676	c.1208T>A	c.(1207-1209)cTc>cAc	p.L403H	CRISPLD1_ENST00000523524.1_Missense_Mutation_p.L215H|CRISPLD1_ENST00000517786.1_Missense_Mutation_p.L217H	NM_031461.5	NP_113649.1	Q9H336	CRLD1_HUMAN	cysteine-rich secretory protein LCCL domain containing 1	403	LCCL 2. {ECO:0000255|PROSITE- ProRule:PRU00123}.				face morphogenesis (GO:0060325)	extracellular vesicular exosome (GO:0070062)				biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(7)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(64;0.0799)		Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)			GTGGAACAGCTCTGTCCATTT	0.413																																					p.L403H													.	CRISPLD1-91	0			c.T1208A						.						135.0	123.0	127.0					8																	75932278		2203	4300	6503	SO:0001583	missense	83690	exon12			AACAGCTCTGTCC	AL834301	CCDS6219.1, CCDS69497.1, CCDS75754.1	8q21.13	2005-09-23	2005-02-16	2005-02-16	ENSG00000121005	ENSG00000121005			18206	protein-coding gene	gene with protein product			"""LCCL domain containing cysteine-rich secretory protein 1"""	LCRISP1			Standard	NM_031461		Approved	Cocoacrisp, DKFZp762F133	uc003yan.3	Q9H336	OTTHUMG00000164529	ENST00000262207.4:c.1208T>A	8.37:g.75932278T>A	ENSP00000262207:p.Leu403His	Somatic	137	2		WXS	Illumina HiSeq		115	55	NM_031461	0	0	0	1	1	B2RA60|B7Z929	Missense_Mutation	SNP	ENST00000262207.4	37	CCDS6219.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.610809	0.87258	.	.	ENSG00000121005	ENST00000262207;ENST00000523524;ENST00000517786	D;D;D	0.90004	-2.6;-2.6;-2.6	5.44	5.44	0.79542	LCCL (5);	0.074942	0.49305	D	0.000149	D	0.93367	0.7885	L	0.61387	1.9	0.52501	D	0.999953	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.934	D	0.94015	0.7287	10	0.87932	D	0	.	15.6638	0.77209	0.0:0.0:0.0:1.0	.	217;403	B7Z929;Q9H336	.;CRLD1_HUMAN	H	403;215;217	ENSP00000262207:L403H;ENSP00000430105:L215H;ENSP00000429746:L217H	ENSP00000262207:L403H	L	+	2	0	CRISPLD1	76094833	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.493000	0.81493	2.285000	0.76669	0.528000	0.53228	CTC	.		0.413	CRISPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379117.1	NM_031461	
LRRCC1	85444	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	86057651	86057651	+	Nonsense_Mutation	SNP	G	G	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr8:86057651G>T	ENST00000360375.3	+	19	3153	c.3004G>T	c.(3004-3006)Gaa>Taa	p.E1002*	LRRCC1_ENST00000414626.2_Nonsense_Mutation_p.E982*	NM_033402.4	NP_208325.3	Q9C099	LRCC1_HUMAN	leucine rich repeat and coiled-coil centrosomal protein 1	1002					mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(4)|kidney(9)|large_intestine(7)|lung(16)|skin(1)|upper_aerodigestive_tract(2)	43						AGAAATGCGTGAACTTTTGGA	0.269																																					p.E1002X		.											.	LRRCC1-90	0			c.G3004T						.						49.0	45.0	46.0					8																	86057651		1795	4056	5851	SO:0001587	stop_gained	85444	exon19			ATGCGTGAACTTT	BC030701	CCDS43750.1	8q21.2	2012-04-10	2012-04-10		ENSG00000133739	ENSG00000133739			29373	protein-coding gene	gene with protein product	"""centrosomal leucine-rich repeat and coiled-coil containing protein"", ""variable number of flagella 1 homolog (Chlamydomonas)"""		"""leucine rich repeat and coiled-coil domain containing 1"""			11214970, 18728398	Standard	NM_033402		Approved	KIAA1764, CLERC, VFL1	uc003ycw.3	Q9C099	OTTHUMG00000164784	ENST00000360375.3:c.3004G>T	8.37:g.86057651G>T	ENSP00000353538:p.Glu1002*	Somatic	335	0		WXS	Illumina HiSeq	Phase_I	275	71	NM_033402	0	0	7	12	5	B4DYX6|B5RI11|Q8N768|Q96DK7|Q96N01	Nonsense_Mutation	SNP	ENST00000360375.3	37	CCDS43750.1	.	.	.	.	.	.	.	.	.	.	G	38	6.807978	0.97853	.	.	ENSG00000133739	ENST00000360375;ENST00000414626	.	.	.	4.97	4.06	0.47325	.	0.467007	0.15962	N	0.236193	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.16896	T	0.51	-1.6865	14.481	0.67582	0.0:0.2766:0.7234:0.0	.	.	.	.	X	1002;982	.	ENSP00000353538:E1002X	E	+	1	0	LRRCC1	86244903	1.000000	0.71417	0.956000	0.39512	0.626000	0.37791	3.387000	0.52501	2.567000	0.86603	0.491000	0.48974	GAA	.		0.269	LRRCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380267.1	NM_033402	
CSMD3	114788	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	113678545	113678545	+	Missense_Mutation	SNP	T	T	G			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr8:113678545T>G	ENST00000297405.5	-	17	3021	c.2777A>C	c.(2776-2778)gAa>gCa	p.E926A	CSMD3_ENST00000455883.2_Missense_Mutation_p.E822A|CSMD3_ENST00000352409.3_Missense_Mutation_p.E926A|CSMD3_ENST00000343508.3_Missense_Mutation_p.E886A	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	926	CUB 5. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						AGGTTCAGCTTCAATCACCCA	0.388										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.E926A		.											.	CSMD3-1132	0			c.A2777C						.						66.0	64.0	65.0					8																	113678545		2203	4300	6503	SO:0001583	missense	114788	exon17			TCAGCTTCAATCA	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.2777A>C	8.37:g.113678545T>G	ENSP00000297405:p.Glu926Ala	Somatic	145	0		WXS	Illumina HiSeq	Phase_I	141	90	NM_198123	0	0	0	0	0	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	T	25.3	4.621461	0.87460	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.18502	2.21;2.21;2.21;2.21;2.21	5.97	5.97	0.96955	CUB (5);	0.000000	0.64402	D	0.000001	T	0.38214	0.1032	L	0.58428	1.81	0.46028	D	0.998827	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.91635	0.997;0.998;0.999	T	0.03374	-1.1043	10	0.25751	T	0.34	.	16.4523	0.83996	0.0:0.0:0.0:1.0	.	822;926;886	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	A	886;926;266;822;926	ENSP00000345799:E886A;ENSP00000297405:E926A;ENSP00000341558:E266A;ENSP00000412263:E822A;ENSP00000343124:E926A	ENSP00000297405:E926A	E	-	2	0	CSMD3	113747721	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.286000	0.76751	0.455000	0.32223	GAA	.		0.388	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
IFNE	338376	ucsc.edu;bcgsc.ca	37	9	21482028	21482028	+	5'UTR	SNP	G	G	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr9:21482028G>A	ENST00000448696.3	-	0	284				MIR31HG_ENST00000304425.3_RNA	NM_176891.4	NP_795372.1	Q86WN2	IFNE_HUMAN	interferon, epsilon						adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)	extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)			large_intestine(2)|lung(1)|skin(1)	4						AAGTTTCACTGAACACAATGT	0.274																																					.													.	IFNE-492	0			.						.																																			SO:0001623	5_prime_UTR_variant	338376	.			TTCACTGAACACA	AY190045	CCDS34997.1	9p21.1	2008-12-12			ENSG00000184995	ENSG00000184995			18163	protein-coding gene	gene with protein product		615223				15546383, 17287131	Standard	NM_176891		Approved	IFNE1	uc003zpg.3	Q86WN2	OTTHUMG00000019672	ENST00000448696.3:c.-335C>T	9.37:g.21482028G>A		Somatic	80	0		WXS	Illumina HiSeq		63	17	.	0	0	0	0	0		RNA	SNP	ENST00000448696.3	37	CCDS34997.1																																																																																			.		0.274	IFNE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051901.2	NM_176891	
PLAA	9373	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	26925951	26925951	+	Silent	SNP	C	C	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr9:26925951C>A	ENST00000397292.3	-	6	1158	c.741G>T	c.(739-741)gtG>gtT	p.V247V	PLAA_ENST00000520884.1_Silent_p.V247V	NM_001031689.2	NP_001026859.1	Q9Y263	PLAP_HUMAN	phospholipase A2-activating protein	247					inflammatory response (GO:0006954)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)	phospholipase A2 activator activity (GO:0016005)			breast(1)|endometrium(7)|kidney(2)|large_intestine(3)|lung(3)|prostate(1)	17		all_neural(3;3.53e-10)|Glioma(3;2.71e-09)		Lung(218;1.32e-05)|LUSC - Lung squamous cell carcinoma(38;0.00011)		CTGCTGTTGTCACAAAGTCTA	0.373																																					p.V247V	Melanoma(175;2670 2735 14091 35526)	.											.	PLAA-514	0			c.G741T						.						90.0	80.0	83.0					9																	26925951		2203	4300	6503	SO:0001819	synonymous_variant	9373	exon6			TGTTGTCACAAAG	AF083395	CCDS35000.1	9p21	2013-01-10			ENSG00000137055	ENSG00000137055		"""WD repeat domain containing"""	9043	protein-coding gene	gene with protein product	"""DOA1 homolog (S. cerevisiae)"""	603873				9931468, 10644453	Standard	NM_001031689		Approved	PLAP, PLA2P, FLJ11281, FLJ12699, DOA1	uc003zqd.3	Q9Y263	OTTHUMG00000019708	ENST00000397292.3:c.741G>T	9.37:g.26925951C>A		Somatic	92	0		WXS	Illumina HiSeq	Phase_I	81	48	NM_001031689	0	0	0	0	0	Q53EU5|Q5VY33|Q9NUL8|Q9NVE9|Q9UF53|Q9Y5L1	Silent	SNP	ENST00000397292.3	37	CCDS35000.1	.	.	.	.	.	.	.	.	.	.	C	6.836	0.523440	0.13066	.	.	ENSG00000137055	ENST00000523212	.	.	.	4.07	3.16	0.36331	.	.	.	.	.	T	0.47710	0.1460	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.35871	-0.9771	4	.	.	.	-2.2178	4.411	0.11432	0.1594:0.5773:0.0:0.2632	.	.	.	.	Y	224	.	.	D	-	1	0	PLAA	26915951	0.997000	0.39634	1.000000	0.80357	0.994000	0.84299	0.336000	0.19823	0.817000	0.34445	0.585000	0.79938	GAC	.		0.373	PLAA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051958.2	NM_001031689	
TLN1	7094	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	35711276	35711276	+	Missense_Mutation	SNP	T	T	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr9:35711276T>A	ENST00000314888.9	-	30	4348	c.3995A>T	c.(3994-3996)aAg>aTg	p.K1332M	TLN1_ENST00000540444.1_Missense_Mutation_p.K1332M	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	1332	Interaction with SYNM.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			CAGCTGACTCTTGAGGTTAGG	0.562																																					p.K1332M		.											.	TLN1-609	0			c.A3995T						.						51.0	49.0	50.0					9																	35711276		2203	4300	6503	SO:0001583	missense	7094	exon30			TGACTCTTGAGGT	AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.3995A>T	9.37:g.35711276T>A	ENSP00000316029:p.Lys1332Met	Somatic	61	0		WXS	Illumina HiSeq	Phase_I	57	21	NM_006289	0	0	40	40	0	A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Missense_Mutation	SNP	ENST00000314888.9	37	CCDS35009.1	.	.	.	.	.	.	.	.	.	.	T	26.8	4.775730	0.90195	.	.	ENSG00000137076	ENST00000314888;ENST00000540444	T;T	0.18810	2.19;2.19	5.82	5.82	0.92795	Vinculin-binding site-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.44138	0.1279	M	0.83953	2.67	0.80722	D	1	P	0.52316	0.952	P	0.53954	0.738	T	0.48234	-0.9053	10	0.62326	D	0.03	-24.4418	16.1778	0.81874	0.0:0.0:0.0:1.0	.	1332	Q9Y490	TLN1_HUMAN	M	1332	ENSP00000316029:K1332M;ENSP00000442981:K1332M	ENSP00000316029:K1332M	K	-	2	0	TLN1	35701276	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	8.040000	0.89188	2.225000	0.72522	0.459000	0.35465	AAG	.		0.562	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052353.2	NM_006289	
ANKRD18A	253650	broad.mit.edu;bcgsc.ca	37	9	38577964	38577964	+	Missense_Mutation	SNP	T	T	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr9:38577964T>A	ENST00000399703.5	-	13	2803	c.2429A>T	c.(2428-2430)gAa>gTa	p.E810V	ANKRD18A_ENST00000607974.1_5'Flank|ANKRD18A_ENST00000313339.3_5'Flank|ANKRD18A_ENST00000566717.2_5'Flank|ANKRD18A_ENST00000357072.5_5'Flank	NM_147195.2	NP_671728.2	Q8IVF6	AN18A_HUMAN	ankyrin repeat domain 18A	810										NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|prostate(1)|skin(2)|stomach(1)	16						CATATCTTTTTCCATATGTGT	0.313																																					p.E810V													.	ANKRD18A-92	0			c.A2429T						.						17.0	13.0	14.0					9																	38577964		687	1579	2266	SO:0001583	missense	253650	exon13			TCTTTTTCCATAT	AB095935	CCDS55311.1	9p13.1	2013-01-10			ENSG00000180071	ENSG00000180071		"""Ankyrin repeat domain containing"""	23643	protein-coding gene	gene with protein product							Standard	NM_147195		Approved	KIAA2015, FLJ35740	uc004abg.4	Q8IVF6	OTTHUMG00000019950	ENST00000399703.5:c.2429A>T	9.37:g.38577964T>A	ENSP00000382610:p.Glu810Val	Somatic	106	2		WXS	Illumina HiSeq	Phase_I	125	65	NM_147195	0	0	0	0	0	A7MD11|A8MVU5|Q5SY86|Q7Z468|Q8NA88	Missense_Mutation	SNP	ENST00000399703.5	37	CCDS55311.1	.	.	.	.	.	.	.	.	.	.	T	1.044	-0.678040	0.03378	.	.	ENSG00000180071	ENST00000399703	T	0.38560	1.13	1.53	0.338	0.15974	.	.	.	.	.	T	0.56543	0.1992	M	0.77616	2.38	0.09310	N	1	D	0.69078	0.997	D	0.68192	0.956	T	0.44081	-0.9351	9	0.87932	D	0	.	3.3918	0.07291	0.0:0.2356:0.0:0.7644	.	810	Q8IVF6	AN18A_HUMAN	V	810	ENSP00000382610:E810V	ENSP00000382610:E810V	E	-	2	0	ANKRD18A	38567964	0.313000	0.24554	0.005000	0.12908	0.007000	0.05969	3.519000	0.53458	0.079000	0.16929	-0.548000	0.04221	GAA	.		0.313	ANKRD18A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052506.3		
WNK2	65268	broad.mit.edu	37	9	96030146	96030146	+	Missense_Mutation	SNP	A	A	C			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr9:96030146A>C	ENST00000297954.4	+	16	3815	c.3815A>C	c.(3814-3816)gAc>gCc	p.D1272A	WNK2_ENST00000356055.3_5'UTR|WNK2_ENST00000349097.3_Missense_Mutation_p.D884A|WNK2_ENST00000395477.2_Missense_Mutation_p.D1272A|WNK2_ENST00000427277.2_Missense_Mutation_p.D884A|WNK2_ENST00000395475.2_3'UTR	NM_001282394.1	NP_001269323.1	Q9Y3S1	WNK2_HUMAN	WNK lysine deficient protein kinase 2	1272					intracellular signal transduction (GO:0035556)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(11)|kidney(4)|large_intestine(5)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)	54						CGTGGCTCCGACCCAGGGACC	0.647																																					p.D1272A													.	WNK2-765	0			c.A3815C						.						37.0	34.0	35.0					9																	96030146		2203	4300	6503	SO:0001583	missense	65268	exon16			GCTCCGACCCAGG	AJ242724	CCDS75858.1	9q22.3	2008-02-05	2003-06-23	2005-01-22	ENSG00000165238	ENSG00000165238			14542	protein-coding gene	gene with protein product		606249	"""serologically defined colon cancer antigen 43"""	SDCCAG43, PRKWNK2		9610721, 11571656	Standard	NM_006648		Approved	NY-CO-43, KIAA1760	uc004atj.3	Q9Y3S1	OTTHUMG00000020247	ENST00000297954.4:c.3815A>C	9.37:g.96030146A>C	ENSP00000297954:p.Asp1272Ala	Somatic	119	26		WXS	Illumina HiSeq	Phase_I	162	30	NM_006648	0	0	0	0	0	Q5VWF1|Q5VWF2|Q8IY36|Q9C0A3|Q9H3P4	Missense_Mutation	SNP	ENST00000297954.4	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.77|17.77	3.471405|3.471405	0.63737|0.63737	.|.	.|.	ENSG00000165238|ENSG00000165238	ENST00000297954;ENST00000395477;ENST00000349097;ENST00000427277|ENST00000432730;ENST00000448251	T;T;T;T|.	0.33216|.	1.42;1.42;1.42;1.42|.	5.47|5.47	5.47|5.47	0.80525|0.80525	.|.	0.119947|.	0.53938|.	D|.	0.000041|.	T|T	0.63022|0.63022	0.2476|0.2476	L|L	0.47716|0.47716	1.5|1.5	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;0.999|.	D;D;D;D|.	0.87578|.	0.998;0.965;0.984;0.994|.	T|T	0.60301|0.60301	-0.7290|-0.7290	10|5	0.59425|.	D|.	0.04|.	.|.	15.846|15.846	0.78890|0.78890	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	1272;875;1272;1272|.	Q9Y3S1-2;A6PVR4;F8W9F9;Q9Y3S1|.	.;.;.;WNK2_HUMAN|.	A|P	1272;1272;884;884|1268;69	ENSP00000297954:D1272A;ENSP00000378860:D1272A;ENSP00000297876:D884A;ENSP00000411181:D884A|.	ENSP00000297954:D1272A|.	D|T	+|+	2|1	0|0	WNK2|WNK2	95069967|95069967	1.000000|1.000000	0.71417|0.71417	0.956000|0.956000	0.39512|0.39512	0.086000|0.086000	0.17979|0.17979	7.075000|7.075000	0.76798|0.76798	2.190000|2.190000	0.69967|0.69967	0.528000|0.528000	0.53228|0.53228	GAC|ACC	.		0.647	WNK2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000317359.1	NM_006648	
RNF20	56254	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	104302538	104302538	+	Missense_Mutation	SNP	G	G	C			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr9:104302538G>C	ENST00000389120.3	+	3	273	c.183G>C	c.(181-183)atG>atC	p.M61I	RNF20_ENST00000481046.1_3'UTR	NM_019592.5	NP_062538.5	Q5VTR2	BRE1A_HUMAN	ring finger protein 20, E3 ubiquitin protein ligase	61					histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|negative regulation of cell migration (GO:0030336)|positive regulation of histone methylation (GO:0031062)|positive regulation of transcription, DNA-templated (GO:0045893)|protein polyubiquitination (GO:0000209)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)	HULC complex (GO:0033503)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|ligase activity (GO:0016874)|p53 binding (GO:0002039)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|kidney(6)|large_intestine(7)|lung(23)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_hematologic(171;8.99e-06)|Acute lymphoblastic leukemia(62;0.000365)|Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.88e-19)|STAD - Stomach adenocarcinoma(157;0.00311)		TGGCAGAAATGTTGGATCAGC	0.438																																					p.M61I		.											.	RNF20-231	0			c.G183C						.						98.0	88.0	92.0					9																	104302538		2203	4300	6503	SO:0001583	missense	56254	exon3			AGAAATGTTGGAT	AF265230	CCDS35084.1	9q22	2012-02-23	2012-02-23	2008-12-12	ENSG00000155827	ENSG00000155827		"""RING-type (C3HC4) zinc fingers"""	10062	protein-coding gene	gene with protein product	"""BRE1 E3 ubiquitin ligase homolog (S. cerevisiae)"""	607699	"""ring finger protein 20"""			16337599, 12876294, 18832071, 19037095	Standard	NM_019592		Approved	FLJ20382, FLJ11189, KAIA2779, BRE1A, hBRE1, BRE1	uc004bbn.3	Q5VTR2	OTTHUMG00000020385	ENST00000389120.3:c.183G>C	9.37:g.104302538G>C	ENSP00000373772:p.Met61Ile	Somatic	92	0		WXS	Illumina HiSeq	Phase_I	76	48	NM_019592	0	0	2	13	11	A7MCT5|Q2TB34|Q69YL5|Q6P527|Q8N3J4|Q96JD3|Q9H9Y7|Q9HA51|Q9NUR4|Q9NWQ3|Q9NX83	Missense_Mutation	SNP	ENST00000389120.3	37	CCDS35084.1	.	.	.	.	.	.	.	.	.	.	G	13.05	2.120440	0.37436	.	.	ENSG00000155827	ENST00000389120;ENST00000478347;ENST00000488264;ENST00000374819;ENST00000479306;ENST00000466817	T	0.29655	1.56	4.17	3.28	0.37604	.	0.193183	0.56097	D	0.000035	T	0.21387	0.0515	N	0.22421	0.69	0.36185	D	0.849654	B	0.02656	0.0	B	0.01281	0.0	T	0.16453	-1.0402	10	0.87932	D	0	-19.2966	11.9251	0.52814	0.0866:0.0:0.9134:0.0	.	61	Q5VTR2	BRE1A_HUMAN	I	61;49;47;61;61;61	ENSP00000373772:M61I	ENSP00000363952:M61I	M	+	3	0	RNF20	103342359	1.000000	0.71417	1.000000	0.80357	0.812000	0.45895	4.058000	0.57463	1.125000	0.41998	-0.379000	0.06801	ATG	.		0.438	RNF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356402.1	NM_019592	
ABCA1	19	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	107573100	107573100	+	Missense_Mutation	SNP	C	C	G			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr9:107573100C>G	ENST00000374736.3	-	29	4550	c.4156G>C	c.(4156-4158)Gaa>Caa	p.E1386Q		NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	1386					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	GTGTACTGTTCGTTGTACATC	0.507																																					p.E1386Q		.											.	ABCA1-1016	0			c.G4156C						.						198.0	175.0	183.0					9																	107573100		2203	4300	6503	SO:0001583	missense	19	exon29			ACTGTTCGTTGTA	AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.4156G>C	9.37:g.107573100C>G	ENSP00000363868:p.Glu1386Gln	Somatic	103	0		WXS	Illumina HiSeq	Phase_I	146	24	NM_005502	0	0	6	9	3	Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Missense_Mutation	SNP	ENST00000374736.3	37	CCDS6762.1	.	.	.	.	.	.	.	.	.	.	C	12.90	2.077801	0.36662	.	.	ENSG00000165029	ENST00000374736	D	0.92299	-3.01	5.55	5.55	0.83447	.	0.095616	0.64402	D	0.000001	D	0.88840	0.6546	L	0.37466	1.105	0.80722	D	1	B	0.21309	0.054	B	0.26416	0.069	D	0.83736	0.0201	10	0.15499	T	0.54	.	19.8667	0.96806	0.0:1.0:0.0:0.0	.	1386	O95477	ABCA1_HUMAN	Q	1386	ENSP00000363868:E1386Q	ENSP00000363868:E1386Q	E	-	1	0	ABCA1	106612921	1.000000	0.71417	0.988000	0.46212	0.947000	0.59692	6.015000	0.70791	2.773000	0.95371	0.655000	0.94253	GAA	.		0.507	ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053491.1	NM_005502	
RPL7A	6130	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	136216489	136216489	+	Missense_Mutation	SNP	C	C	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr9:136216489C>A	ENST00000323345.6	+	3	238	c.208C>A	c.(208-210)Ctc>Atc	p.L70I	MED22_ENST00000371999.1_5'Flank|MED22_ENST00000471524.1_5'Flank|MED22_ENST00000476080.1_5'Flank|SNORD36A_ENST00000362874.1_RNA|SNORD24_ENST00000383884.1_RNA|SNORD36B_ENST00000363961.1_RNA|MED22_ENST00000491289.1_5'Flank|MED22_ENST00000343730.5_5'Flank|SNORD36C_ENST00000516733.1_RNA|MED22_ENST00000344469.5_5'Flank|SURF1_ENST00000495952.1_5'Flank|RPL7A_ENST00000463740.1_3'UTR|RPL7A_ENST00000315731.4_Intron	NM_000972.2	NP_000963.1	P62424	RL7A_HUMAN	ribosomal protein L7a	70					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosome biogenesis (GO:0042254)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			cervix(1)|endometrium(1)|kidney(1)|lung(3)|upper_aerodigestive_tract(1)	7				OV - Ovarian serous cystadenocarcinoma(145;4.93e-07)|Epithelial(140;4.09e-06)|all cancers(34;3.78e-05)		GAGAGCCATCCTCTATAAGCG	0.552																																					p.L70I		.											.	RPL7A-90	0			c.C208A						.						43.0	48.0	46.0					9																	136216489		2203	4294	6497	SO:0001583	missense	6130	exon3			GCCATCCTCTATA	BC005128	CCDS6965.1	9q34	2011-04-06			ENSG00000148303	ENSG00000148303		"""L ribosomal proteins"""	10364	protein-coding gene	gene with protein product	"""surfeit 3"", ""PLA-X polypeptide"", ""surfeit locus protein 3"", ""60S ribosomal protein L7a"", "";"", ""thyroid hormone receptor uncoupling protein"""	185640				2403926, 2966065	Standard	NM_000972		Approved	SURF3, TRUP, L7A	uc004cde.1	P62424	OTTHUMG00000020864	ENST00000323345.6:c.208C>A	9.37:g.136216489C>A	ENSP00000361076:p.Leu70Ile	Somatic	80	0		WXS	Illumina HiSeq	Phase_I	88	31	NM_000972	0	1	1247	1825	577	P11518|Q5T8U4	Missense_Mutation	SNP	ENST00000323345.6	37	CCDS6965.1	.	.	.	.	.	.	.	.	.	.	C	16.56	3.158547	0.57368	.	.	ENSG00000148303	ENST00000323345;ENST00000426651	T;T	0.70164	-0.46;-0.13	4.03	4.03	0.46877	.	0.000000	0.85682	D	0.000000	T	0.75539	0.3863	M	0.89287	3.02	0.80722	D	1	B	0.22604	0.072	B	0.34346	0.18	T	0.78841	-0.2045	10	0.66056	D	0.02	.	15.1827	0.72972	0.0:1.0:0.0:0.0	.	70	P62424	RL7A_HUMAN	I	70;97	ENSP00000361076:L70I;ENSP00000416638:L97I	ENSP00000361076:L70I	L	+	1	0	RPL7A	135206310	1.000000	0.71417	0.648000	0.29521	0.115000	0.19883	5.276000	0.65580	1.816000	0.52996	0.313000	0.20887	CTC	.		0.552	RPL7A-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054869.1	NM_000972	
LHX3	8022	hgsc.bcm.edu	37	9	139089398	139089398	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr9:139089398C>T	ENST00000371748.5	-	6	1063	c.967G>A	c.(967-969)Gcc>Acc	p.A323T	LHX3_ENST00000371746.3_Missense_Mutation_p.A328T	NM_178138.4	NP_835258.1	Q9UBR4	LHX3_HUMAN	LIM homeobox 3	323					inner ear development (GO:0048839)|lung development (GO:0030324)|medial motor column neuron differentiation (GO:0021526)|motor neuron axon guidance (GO:0008045)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|pituitary gland development (GO:0021983)|placenta development (GO:0001890)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|spinal cord association neuron differentiation (GO:0021527)|spinal cord motor neuron cell fate specification (GO:0021520)|ventral spinal cord interneuron specification (GO:0021521)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			large_intestine(2)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	8		Myeloproliferative disorder(178;0.0511)		Epithelial(140;8.43e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.26e-07)		CTCTGCGGGGCGGCGGGGGAT	0.736																																					p.A328T		.											.	LHX3-91	0			c.G982A						.						2.0	2.0	2.0					9																	139089398		1495	3217	4712	SO:0001583	missense	8022	exon6			GCGGGGCGGCGGG	AF096169	CCDS6994.1, CCDS6995.1	9q34.3	2011-06-20			ENSG00000107187	ENSG00000107187		"""Homeoboxes / LIM class"""	6595	protein-coding gene	gene with protein product		600577				10598593, 10717474	Standard	NM_178138		Approved		uc004cgz.3	Q9UBR4	OTTHUMG00000020924	ENST00000371748.5:c.967G>A	9.37:g.139089398C>T	ENSP00000360813:p.Ala323Thr	Somatic	7	0		WXS	Illumina HiSeq	Phase_I	12	6	NM_014564	0	0	0	0	0	Q5TB39|Q5TB40|Q9NZB5|Q9P0I8|Q9P0I9	Missense_Mutation	SNP	ENST00000371748.5	37	CCDS6994.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	6.336|6.336	0.430180|0.430180	0.12045|0.12045	.|.	.|.	ENSG00000107187|ENSG00000107187	ENST00000371748;ENST00000371746|ENST00000325195	D;D|.	0.88818|.	-2.27;-2.43|.	4.04|4.04	1.96|1.96	0.26148|0.26148	.|.	0.152719|.	0.45361|.	N|.	0.000361|.	T|T	0.28433|0.28433	0.0703|0.0703	L|L	0.36672|0.36672	1.1|1.1	0.22961|0.22961	N|N	0.998502|0.998502	B;P|.	0.34462|.	0.308;0.454|.	B;B|.	0.29942|.	0.109;0.075|.	T|T	0.20371|0.20371	-1.0277|-1.0277	10|6	0.17369|0.33940	T|T	0.5|0.23	.|.	4.7565|4.7565	0.13086|0.13086	0.3922:0.4882:0.0:0.1196|0.3922:0.4882:0.0:0.1196	.|.	323;328|.	Q9UBR4;F1T0D9|.	LHX3_HUMAN;.|.	T|H	323;328|324	ENSP00000360813:A323T;ENSP00000360811:A328T|.	ENSP00000360811:A328T|ENSP00000319224:R324H	A|R	-|-	1|2	0|0	LHX3|LHX3	138229219|138229219	0.831000|0.831000	0.29352|0.29352	0.042000|0.042000	0.18584|0.18584	0.173000|0.173000	0.22820|0.22820	1.670000|1.670000	0.37502|0.37502	0.891000|0.891000	0.36235|0.36235	0.491000|0.491000	0.48974|0.48974	GCC|CGC	.		0.736	LHX3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055048.3		
DMD	1756	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	32305751	32305751	+	Missense_Mutation	SNP	G	G	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chrX:32305751G>T	ENST00000357033.4	-	43	6391	c.6185C>A	c.(6184-6186)gCa>gAa	p.A2062E	DMD_ENST00000378677.2_Missense_Mutation_p.A2058E	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	2062					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				ACTTTGCAATGCTGCTGTCTT	0.368																																					p.A2062E		.											.	DMD-265	0			c.C6185A						.						131.0	105.0	114.0					X																	32305751		2202	4300	6502	SO:0001583	missense	1756	exon43			TGCAATGCTGCTG	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.6185C>A	X.37:g.32305751G>T	ENSP00000354923:p.Ala2062Glu	Somatic	31	0		WXS	Illumina HiSeq	Phase_I	29	28	NM_004006	0	0	0	0	0	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	37	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	G	8.237	0.805865	0.16467	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	T;T	0.35048	1.33;1.33	4.36	2.59	0.31030	.	0.000000	0.36778	U	0.002408	T	0.28830	0.0715	L	0.53249	1.67	0.80722	D	1	B;P;B;B;B	0.38677	0.275;0.642;0.322;0.259;0.44	B;B;B;B;B	0.34418	0.088;0.182;0.144;0.138;0.096	T	0.05835	-1.0861	10	0.72032	D	0.01	.	7.2118	0.25937	0.3674:0.0:0.6326:0.0	.	2054;2062;2058;721;718	P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6	.;DMD_HUMAN;.;.;.	E	2054;721;718;2058;2062;2062;1939	ENSP00000367948:A2058E;ENSP00000354923:A2062E	ENSP00000354923:A2062E	A	-	2	0	DMD	32215672	0.996000	0.38824	0.224000	0.23877	0.172000	0.22775	2.060000	0.41394	0.416000	0.25844	-0.191000	0.12829	GCA	.		0.368	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
BMP15	9210	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	50658768	50658768	+	Missense_Mutation	SNP	A	A	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chrX:50658768A>T	ENST00000252677.3	+	2	340	c.340A>T	c.(340-342)Ata>Tta	p.I114L		NM_005448.2	NP_005439.2	O95972	BMP15_HUMAN	bone morphogenetic protein 15	114					female gamete generation (GO:0007292)|granulosa cell development (GO:0060016)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)				NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|skin(1)	26	Ovarian(276;0.236)					TACCTGGCATATACAGATCCT	0.438																																					p.I114L		.											.	BMP15-132	0			c.A340T						.						95.0	90.0	91.0					X																	50658768		2203	4299	6502	SO:0001583	missense	9210	exon2			TGGCATATACAGA	AF082349	CCDS14334.1	Xp11.2	2013-02-06			ENSG00000130385	ENSG00000130385		"""Bone morphogenetic proteins"""	1068	protein-coding gene	gene with protein product		300247				9849956	Standard	NM_005448		Approved	GDF9B	uc011mnw.2	O95972	OTTHUMG00000021525	ENST00000252677.3:c.340A>T	X.37:g.50658768A>T	ENSP00000252677:p.Ile114Leu	Somatic	81	0		WXS	Illumina HiSeq	Phase_I	113	108	NM_005448	0	0	0	0	0	Q17RM6|Q5JST1|Q9UMS1	Missense_Mutation	SNP	ENST00000252677.3	37	CCDS14334.1	.	.	.	.	.	.	.	.	.	.	a	2.291	-0.362548	0.05103	.	.	ENSG00000130385	ENST00000252677	T	0.77489	-1.1	5.42	-3.73	0.04398	.	1.153060	0.05985	N	0.645013	T	0.69006	0.3063	M	0.65975	2.015	0.09310	N	1	B	0.19583	0.037	B	0.16289	0.015	T	0.49214	-0.8963	10	0.10377	T	0.69	.	6.9598	0.24591	0.3592:0.0:0.4995:0.1413	.	114	O95972	BMP15_HUMAN	L	114	ENSP00000252677:I114L	ENSP00000252677:I114L	I	+	1	0	BMP15	50675508	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.129000	0.10515	-0.754000	0.04715	-0.670000	0.03821	ATA	.		0.438	BMP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056572.1	NM_005448	
ATRX	546	bcgsc.ca	37	X	76777834	76777834	+	Silent	SNP	C	C	A			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chrX:76777834C>A	ENST00000373344.5	-	32	7096	c.6882G>T	c.(6880-6882)ggG>ggT	p.G2294G	ATRX_ENST00000395603.3_Silent_p.G2256G|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	2294					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						GTAAATTGGTCCCAGTTGGTA	0.388			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																														p.G2294G				Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	.	ATRX-248	0			c.G6882T						.						90.0	85.0	87.0					X																	76777834		2203	4296	6499	SO:0001819	synonymous_variant	546	exon32			ATTGGTCCCAGTT	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.6882G>T	X.37:g.76777834C>A		Somatic	101	3		WXS	Illumina HiSeq	Phase_1	118	106	NM_000489	0	0	0	25	25	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Silent	SNP	ENST00000373344.5	37	CCDS14434.1																																																																																			.		0.388	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058860.2	NM_000489	
MAST2	23139	hgsc.bcm.edu;bcgsc.ca	37	1	46496701	46496702	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	TC	TC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr1:46496701_46496702delTC	ENST00000361297.2	+	23	3014_3015	c.2731_2732delTC	c.(2731-2733)tctfs	p.S911fs	MAST2_ENST00000372009.2_Frame_Shift_Del_p.S841fs	NM_015112.2	NP_055927.2			microtubule associated serine/threonine kinase 2											breast(1)|lung(3)|ovary(5)|stomach(2)	11	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)					GCTGTCGGTGTCTGAGTCATCC	0.629																																					p.911_911del		.											.	MAST2-581	0			c.2731_2732del						.																																			SO:0001589	frameshift_variant	23139	exon23			.	AB047005	CCDS41326.1	1p34.1	2008-02-05			ENSG00000086015	ENSG00000086015			19035	protein-coding gene	gene with protein product		612257					Standard	NM_015112		Approved	MAST205, KIAA0807	uc001cov.3	Q6P0Q8	OTTHUMG00000008007	ENST00000361297.2:c.2731_2732delTC	1.37:g.46496701_46496702delTC	ENSP00000354671:p.Ser911fs	Somatic	111	0		WXS	Illumina HiSeq	Phase_I	99	34	NM_015112	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000361297.2	37	CCDS41326.1																																																																																			.		0.629	MAST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021977.1	NM_015112	
PCSK9	255738	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	55529096	55529096	+	Frame_Shift_Del	DEL	G	G	-			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr1:55529096delG	ENST00000302118.5	+	12	2208	c.1918delG	c.(1918-1920)gggfs	p.G640fs	PCSK9_ENST00000490692.1_3'UTR|PCSK9_ENST00000543384.1_3'UTR	NM_174936.3	NP_777596.2	Q8NBP7	PCSK9_HUMAN	proprotein convertase subtilisin/kexin type 9	640	C-terminal domain.				apoptotic process (GO:0006915)|cellular response to insulin stimulus (GO:0032869)|cellular response to starvation (GO:0009267)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|kidney development (GO:0001822)|lipoprotein metabolic process (GO:0042157)|liver development (GO:0001889)|low-density lipoprotein particle receptor catabolic process (GO:0032802)|lysosomal transport (GO:0007041)|negative regulation of low-density lipoprotein particle clearance (GO:0010989)|negative regulation of receptor recycling (GO:0001920)|neurogenesis (GO:0022008)|neuron differentiation (GO:0030182)|phospholipid metabolic process (GO:0006644)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of receptor internalization (GO:0002092)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)|regulation of low-density lipoprotein particle receptor catabolic process (GO:0032803)|regulation of neuron apoptotic process (GO:0043523)|regulation of receptor activity (GO:0010469)|triglyceride metabolic process (GO:0006641)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|extracellular space (GO:0005615)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|lysosome (GO:0005764)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	apolipoprotein binding (GO:0034185)|apolipoprotein receptor binding (GO:0034190)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein particle receptor binding (GO:0050750)|poly(A) RNA binding (GO:0044822)|protein self-association (GO:0043621)|serine-type endopeptidase activity (GO:0004252)|sodium channel inhibitor activity (GO:0019871)|very-low-density lipoprotein particle binding (GO:0034189)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(2)|breast(2)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(1)|liver(2)|lung(4)|ovary(3)|prostate(3)|skin(1)|urinary_tract(1)	32						TGCCCTCCCTGGGACCTCCCA	0.662																																					p.G640fs	Pancreas(137;1454 1827 5886 22361 42375)	.											.	PCSK9-93	0			c.1918delG						.						34.0	34.0	34.0					1																	55529096		2203	4300	6503	SO:0001589	frameshift_variant	255738	exon12			.	AX207686	CCDS603.1	1p34.1-p32	2014-09-17	2003-05-13		ENSG00000169174	ENSG00000169174			20001	protein-coding gene	gene with protein product		607786	"""hypercholesterolemia, autosomal dominant 3"""	HCHOLA3		12552133, 12730697	Standard	NM_174936		Approved	NARC-1, FH3	uc001cyf.2	Q8NBP7	OTTHUMG00000008136	ENST00000302118.5:c.1918delG	1.37:g.55529096delG	ENSP00000303208:p.Gly640fs	Somatic	177	0		WXS	Illumina HiSeq	Phase_I	232	129	NM_174936	0	0	0	0	0	A8T640|C0JYY9|Q5PSM5|Q5SZQ2	Frame_Shift_Del	DEL	ENST00000302118.5	37	CCDS603.1																																																																																			.		0.662	PCSK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022280.1	NM_174936	
TYSND1	219743	hgsc.bcm.edu	37	10	71905802	71905819	+	In_Frame_Del	DEL	CTCTCAGTTGATCCGCCT	CTCTCAGTTGATCCGCCT	-	rs370610523|rs572542997|rs562289648|rs553877350	byFrequency	TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	CTCTCAGTTGATCCGCCT	CTCTCAGTTGATCCGCCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr10:71905802_71905819delCTCTCAGTTGATCCGCCT	ENST00000287078.6	-	1	523_540	c.524_541delAGGCGGATCAACTGAGAG	c.(523-543)gaggcggatcaactgagagcg>gcg	p.EADQLR175del	TYSND1_ENST00000494143.1_5'Flank|TYSND1_ENST00000335494.5_In_Frame_Del_p.EADQLR175del	NM_173555.2	NP_775826.2	Q2T9J0	TYSD1_HUMAN	trypsin domain containing 1	175					protein homooligomerization (GO:0051260)|protein processing (GO:0016485)|proteolysis (GO:0006508)|regulation of fatty acid beta-oxidation (GO:0031998)	membrane (GO:0016020)|peroxisome (GO:0005777)	identical protein binding (GO:0042802)|protease binding (GO:0002020)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|large_intestine(2)|liver(1)|lung(3)|prostate(1)	9						CAGCCCAGCGCTCTCAGTTGATCCGCCTCCTCGTCCTC	0.711														5	0.000998403	0.0008	0.0	5008	,	,		14648	0.002		0.0	False		,,,				2504	0.002				p.175_181del		.											.	TYSND1-135	0			c.524_541del						.		,	1,4251		0,1,2125					,	3.9	1.0			26	18,8216		0,18,4099	no	coding,coding	TYSND1	NM_173555.2,NM_001040273.1	,	0,19,6224	A1A1,A1R,RR		0.2186,0.0235,0.1522	,	,		19,12467				SO:0001651	inframe_deletion	219743	exon1			.	BC016840	CCDS31213.1, CCDS31214.1	10q22.1	2009-11-06		2006-09-21	ENSG00000156521	ENSG00000156521			28531	protein-coding gene	gene with protein product		611017				17255948	Standard	NM_173555		Approved	MGC34695, NET41	uc001jqr.4	Q2T9J0	OTTHUMG00000018397	ENST00000287078.6:c.524_541delAGGCGGATCAACTGAGAG	10.37:g.71905802_71905819delCTCTCAGTTGATCCGCCT	ENSP00000287078:p.Glu175_Arg180del	Somatic	24	0		WXS	Illumina HiSeq	Phase_I	112	32	NM_173555	0	0	0	0	0	Q5SQT4|Q5SQU1|Q8N6H2|Q96AR5	In_Frame_Del	DEL	ENST00000287078.6	37	CCDS31213.1																																																																																			.		0.711	TYSND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048483.1	NM_173555	
FAM186A	121006	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	50748961	50748961	+	Frame_Shift_Del	DEL	G	G	-	rs564349682		TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr12:50748961delG	ENST00000327337.5	-	4	1653	c.1654delC	c.(1654-1656)cgtfs	p.R552fs	FAM186A_ENST00000543111.1_Frame_Shift_Del_p.R552fs	NM_001145475.1	NP_001138947.1	A6NE01	F186A_HUMAN	family with sequence similarity 186, member A	552																	GGAGATTCACGTTTGACCTTC	0.413																																					p.R552fs	NSCLC(138;1796 1887 12511 19463 37884)	.											.	FAM186A-68	0			c.1654delC						.						158.0	122.0	133.0					12																	50748961		692	1591	2283	SO:0001589	frameshift_variant	121006	exon4			.		CCDS44878.1	12q13.13	2009-04-22			ENSG00000185958	ENSG00000185958			26980	protein-coding gene	gene with protein product							Standard	NM_001145475		Approved	LOC121006	uc001rwl.2	A6NE01	OTTHUMG00000167889	ENST00000327337.5:c.1654delC	12.37:g.50748961delG	ENSP00000329995:p.Arg552fs	Somatic	129	0		WXS	Illumina HiSeq	Phase_I	141	53	NM_001145475	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000327337.5	37	CCDS44878.1																																																																																			.		0.413	FAM186A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396838.1	XM_001718353	
MLEC	9761	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	121132908	121132908	+	Frame_Shift_Del	DEL	A	A	-			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr12:121132908delA	ENST00000228506.3	+	4	1030	c.602delA	c.(601-603)gacfs	p.D201fs	RP11-173P15.3_ENST00000541383.1_RNA|MLEC_ENST00000412616.2_Intron	NM_014730.2	NP_055545.1	Q14165	MLEC_HUMAN	malectin	201					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|enzyme binding (GO:0019899)	p.D201G(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)	16						GGGTACTATGACAATCCCAAG	0.498																																					p.D201fs		.											.	MLEC-91	1	Substitution - Missense(1)	lung(1)	c.602delA						.						381.0	352.0	362.0					12																	121132908		2203	4300	6503	SO:0001589	frameshift_variant	9761	exon4			.	BC000371	CCDS9206.1	12q24.31	2013-03-06	2008-11-05	2008-11-05	ENSG00000110917	ENSG00000110917			28973	protein-coding gene	gene with protein product	"""oligosaccharyltransferase complex subunit (non-catalytic)"""	613802	"""KIAA0152"""	KIAA0152		18524852	Standard	NM_014730		Approved		uc001tyy.1	Q14165	OTTHUMG00000169187	ENST00000228506.3:c.602delA	12.37:g.121132908delA	ENSP00000228506:p.Asp201fs	Somatic	123	0		WXS	Illumina HiSeq	Phase_I	162	72	NM_014730	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000228506.3	37	CCDS9206.1																																																																																			.		0.498	MLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402781.2	NM_014730	
PPP2R5E	5529	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	63881922	63881922	+	Frame_Shift_Del	DEL	A	A	-			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr14:63881922delA	ENST00000337537.3	-	5	1087	c.485delT	c.(484-486)ttgfs	p.L162fs	PPP2R5E_ENST00000555899.1_Frame_Shift_Del_p.L162fs|PPP2R5E_ENST00000553266.1_5'UTR|PPP2R5E_ENST00000422769.2_Frame_Shift_Del_p.L86fs	NM_001282179.1|NM_001282180.1|NM_001282181.1|NM_001282182.1|NM_006246.2	NP_001269108.1|NP_001269109.1|NP_001269110.1|NP_001269111.1|NP_006237.1	Q16537	2A5E_HUMAN	protein phosphatase 2, regulatory subunit B', epsilon isoform	162					regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			endometrium(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|soft_tissue(1)	15				OV - Ovarian serous cystadenocarcinoma(108;0.00197)|all cancers(60;0.0153)|BRCA - Breast invasive adenocarcinoma(234;0.128)		TTGGCTTTCCAAAAATCGTAT	0.313																																					p.L162fs		.											.	PPP2R5E-658	0			c.485delT						.						87.0	91.0	90.0					14																	63881922		2202	4298	6500	SO:0001589	frameshift_variant	5529	exon5			.	L76703	CCDS9758.1, CCDS61467.1, CCDS61468.1	14q23.2	2010-06-18	2007-01-22		ENSG00000154001	ENSG00000154001		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9313	protein-coding gene	gene with protein product		601647	"""protein phosphatase 2, regulatory subunit B (B56), epsilon isoform"""			7592815	Standard	NM_006246		Approved		uc001xgd.1	Q16537	OTTHUMG00000140341	ENST00000337537.3:c.485delT	14.37:g.63881922delA	ENSP00000337641:p.Leu162fs	Somatic	113	0		WXS	Illumina HiSeq	Phase_I	95	51	NM_006246	0	0	0	0	0	A4FU37|B7ZAW5|B7ZKK8|B7ZKK9|J3KQN6|Q52LW4	Frame_Shift_Del	DEL	ENST00000337537.3	37	CCDS9758.1																																																																																			.		0.313	PPP2R5E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276973.1	NM_006246	
AKT2	208	hgsc.bcm.edu;bcgsc.ca	37	19	40788466	40788466	+	Intron	DEL	A	A	-			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr19:40788466delA	ENST00000392038.2	-	1	215				MIR641_ENST00000384899.1_RNA|AKT2_ENST00000581582.1_Intron|AKT2_ENST00000579047.1_Intron	NM_001243027.1|NM_001243028.1|NM_001626.4	NP_001229956.1|NP_001229957.1|NP_001617.1	P31751	AKT2_HUMAN	v-akt murine thymoma viral oncogene homolog 2						activation of Ral GTPase activity (GO:0032859)|apoptotic process (GO:0006915)|carbohydrate transport (GO:0008643)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|fat cell differentiation (GO:0045444)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|insulin receptor signaling pathway (GO:0008286)|intracellular protein transmembrane transport (GO:0065002)|mammary gland epithelial cell differentiation (GO:0060644)|membrane organization (GO:0061024)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|peripheral nervous system myelin maintenance (GO:0032287)|positive regulation of cell motility (GO:2000147)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)|protein localization to plasma membrane (GO:0072659)|regulation of cell cycle arrest (GO:0071156)|regulation of cell migration (GO:0030334)|regulation of translation (GO:0006417)|signal transduction (GO:0007165)	cell cortex (GO:0005938)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|kidney(3)|large_intestine(9)|lung(10)|prostate(2)|skin(1)	27			Lung(22;0.000499)			AAGAGGAAGGAAAGACATAGG	0.542			A		"""ovarian, pancreatic """																																.		.		Dom	yes		19	19q13.1-q13.2	208	v-akt murine thymoma viral oncogene homolog 2		E	.	.	0			.						.						48.0	49.0	49.0					19																	40788466		1568	3582	5150	SO:0001627	intron_variant	693226	.			.	M77198	CCDS12552.1	19q13.1-q13.2	2013-01-10			ENSG00000105221	ENSG00000105221	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	392	protein-coding gene	gene with protein product		164731				1409633	Standard	NM_001626		Approved		uc002onf.3	P31751	OTTHUMG00000137375	ENST00000392038.2:c.83+2621T>-	19.37:g.40788466delA		Somatic	47	0		WXS	Illumina HiSeq	Phase_I	56	17	.	0	0	0	0	0	B2RBD8|Q05BV0|Q0VAN0|Q0VAN1|Q68GC0	RNA	DEL	ENST00000392038.2	37	CCDS12552.1																																																																																			.		0.542	AKT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268029.1	NM_001626	
ZNF814	730051	bcgsc.ca	37	19	58385280	58385281	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	TG	TG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr19:58385280_58385281delTG	ENST00000435989.2	-	3	1711_1712	c.1477_1478delCA	c.(1477-1479)cagfs	p.Q493fs	ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000597832.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	493					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						TTCTCCACACTGATAAGGTCTT	0.47																																					p.493_493del													.	.	0			c.1477_1478del						.																																			SO:0001589	frameshift_variant	730051	exon3			CCACACTGATAAG		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.1477_1478delCA	19.37:g.58385280_58385281delTG	ENSP00000410545:p.Gln493fs	Somatic	130	0		WXS	Illumina HiSeq	Phase_1	125	12	NM_001144989	0	0	0	0	0	A6NF35	Frame_Shift_Del	DEL	ENST00000435989.2	37	CCDS46212.1																																																																																			.		0.470	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
RAPH1	65059	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	204304774	204304775	+	Frame_Shift_Del	DEL	AC	AC	-	rs201752703		TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	AC	AC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr2:204304774_204304775delAC	ENST00000319170.5	-	14	3437_3438	c.3138_3139delGT	c.(3136-3141)gtgtcafs	p.S1047fs	ABI2_ENST00000295851.5_3'UTR|RAPH1_ENST00000374493.3_Frame_Shift_Del_p.S1099fs|RAPH1_ENST00000457812.1_Intron	NM_213589.1	NP_998754.1	Q70E73	RAPH1_HUMAN	Ras association (RalGDS/AF-6) and pleckstrin homology domains 1	1047					axon extension (GO:0048675)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				breast(5)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						GCTTTTGCTGACACACACCCTT	0.545																																					p.1046_1047del		.											.	RAPH1-1151	0			c.3138_3139del						.																																			SO:0001589	frameshift_variant	65059	exon14			.	AJ584699	CCDS2359.1, CCDS2360.1	2q33	2013-01-10	2003-11-25	2003-11-26	ENSG00000173166	ENSG00000173166		"""Pleckstrin homology (PH) domain containing"""	14436	protein-coding gene	gene with protein product	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 18"""	609035	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 9"""	ALS2CR9, ALS2CR18			Standard	NM_203365		Approved	KIAA1681	uc002vad.3	Q70E73	OTTHUMG00000132876	ENST00000319170.5:c.3138_3139delGT	2.37:g.204304780_204304781delAC	ENSP00000316543:p.Ser1047fs	Somatic	75	0		WXS	Illumina HiSeq	Phase_I	79	37	NM_213589	0	0	0	0	0	Q96Q37|Q9C0I2	Frame_Shift_Del	DEL	ENST00000319170.5	37	CCDS2359.1																																																																																			.		0.545	RAPH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256363.2	NM_025252	
SPEG	10290	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	220354060	220354064	+	Frame_Shift_Del	DEL	TCTTC	TCTTC	-	rs78622154	byFrequency	TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	TCTTC	TCTTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr2:220354060_220354064delTCTTC	ENST00000312358.7	+	36	8452_8456	c.8320_8324delTCTTC	c.(8320-8325)tcttcafs	p.SS2774fs	SPEG_ENST00000485813.1_3'UTR|AC053503.11_ENST00000429882.1_RNA	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	2774	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		TCTCTTAGATTCTTCAGCTGTGCCA	0.62																																					p.2774_2775del		.											.	SPEG-383	0			c.8320_8324del						.																																			SO:0001589	frameshift_variant	10290	exon36			.	BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.8320_8324delTCTTC	2.37:g.220354060_220354064delTCTTC	ENSP00000311684:p.Ser2774fs	Somatic	54	0		WXS	Illumina HiSeq	Phase_I	61	25	NM_005876	0	0	0	0	0	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Frame_Shift_Del	DEL	ENST00000312358.7	37	CCDS42824.1																																																																																			.		0.620	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130252.2	NM_005876	
TWF2	11344	broad.mit.edu;bcgsc.ca	37	3	52265541	52265541	+	Frame_Shift_Del	DEL	C	C	-			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr3:52265541delC	ENST00000305533.5	-	4	540	c.297delG	c.(295-297)atgfs	p.M99fs	TWF2_ENST00000499914.2_Frame_Shift_Del_p.M99fs|TLR9_ENST00000597542.1_5'UTR|TLR9_ENST00000494383.1_5'Flank	NM_007284.3	NP_009215.1	Q6IBS0	TWF2_HUMAN	twinfilin actin-binding protein 2	99	ADF-H 1. {ECO:0000255|PROSITE- ProRule:PRU00599}.				barbed-end actin filament capping (GO:0051016)|cell projection organization (GO:0030030)|cellular response to growth factor stimulus (GO:0071363)|cellular response to retinoic acid (GO:0071300)|negative regulation of actin filament polymerization (GO:0030837)|positive regulation of axon extension (GO:0045773)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of microvillus length (GO:0032532)|sequestering of actin monomers (GO:0042989)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|myofibril (GO:0030016)|perinuclear region of cytoplasm (GO:0048471)|stereocilium (GO:0032420)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|poly(A) RNA binding (GO:0044822)|protein kinase C binding (GO:0005080)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|stomach(1)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;2.43e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		CCGCGTACAGCATCTTCAGCC	0.597											OREG0015610	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.M99fs													.	TWF2-757	0			c.297delG						.						101.0	94.0	96.0					3																	52265541		2203	4300	6503	SO:0001589	frameshift_variant	11344	exon4			GTACAGCATCTTC	Y17169	CCDS2849.1	3p21.1	2013-04-25	2013-04-25	2006-11-13	ENSG00000247596	ENSG00000247596			9621	protein-coding gene	gene with protein product		607433	"""protein tyrosine kinase 9-like (A6-related protein)"", ""PTK9L protein tyrosine kinase 9-like (A6-related protein)"", ""twinfilin, actin-binding protein, homolog 2 (Drosophila)"""	PTK9L		10406962, 12807912	Standard	NM_007284		Approved	A6RP, A6r		Q6IBS0	OTTHUMG00000158105	ENST00000305533.5:c.297delG	3.37:g.52265541delC	ENSP00000303908:p.Met99fs	Somatic	52	0	983	WXS	Illumina HiSeq	Phase_I	29	7	NM_007284	0	0	0	0	0	Q9Y3F5	Frame_Shift_Del	DEL	ENST00000305533.5	37	CCDS2849.1																																																																																			.		0.597	TWF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350199.2		
TWF2	11344	broad.mit.edu;bcgsc.ca	37	3	52265543	52265555	+	Splice_Site	DEL	TCTTCAGCCGCAC	TCTTCAGCCGCAC	-	rs199817219		TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	TCTTCAGCCGCAC	TCTTCAGCCGCAC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr3:52265543_52265555delTCTTCAGCCGCAC	ENST00000305533.5	-	4	526_538	c.283_295delGTGCGGCTGAAGA	c.(283-297)gtgcggctgaagatg>tg	p.VRLKM95fs	TWF2_ENST00000499914.2_Splice_Site_p.VRLKM95fs|TLR9_ENST00000597542.1_5'UTR|TLR9_ENST00000494383.1_5'Flank	NM_007284.3	NP_009215.1	Q6IBS0	TWF2_HUMAN	twinfilin actin-binding protein 2	95	ADF-H 1. {ECO:0000255|PROSITE- ProRule:PRU00599}.				barbed-end actin filament capping (GO:0051016)|cell projection organization (GO:0030030)|cellular response to growth factor stimulus (GO:0071363)|cellular response to retinoic acid (GO:0071300)|negative regulation of actin filament polymerization (GO:0030837)|positive regulation of axon extension (GO:0045773)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of microvillus length (GO:0032532)|sequestering of actin monomers (GO:0042989)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|myofibril (GO:0030016)|perinuclear region of cytoplasm (GO:0048471)|stereocilium (GO:0032420)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|poly(A) RNA binding (GO:0044822)|protein kinase C binding (GO:0005080)	p.R96G(1)		breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|stomach(1)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;2.43e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		GCGTACAGCATCTTCAGCCGCACCTGAAGGGCA	0.606											OREG0015610	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.95_99del													.	TWF2-757	1	Substitution - Missense(1)	lung(1)	c.283_295del						.																																			SO:0001630	splice_region_variant	11344	exon4			ACAGCATCTTCAG	Y17169	CCDS2849.1	3p21.1	2013-04-25	2013-04-25	2006-11-13	ENSG00000247596	ENSG00000247596			9621	protein-coding gene	gene with protein product		607433	"""protein tyrosine kinase 9-like (A6-related protein)"", ""PTK9L protein tyrosine kinase 9-like (A6-related protein)"", ""twinfilin, actin-binding protein, homolog 2 (Drosophila)"""	PTK9L		10406962, 12807912	Standard	NM_007284		Approved	A6RP, A6r		Q6IBS0	OTTHUMG00000158105	ENST00000305533.5:c.283-1GTGCGGCTGAAGA>-	3.37:g.52265543_52265555delTCTTCAGCCGCAC		Somatic	50	0	983	WXS	Illumina HiSeq	Phase_I	29	7	NM_007284	0	0	0	0	0	Q9Y3F5	Frame_Shift_Del	DEL	ENST00000305533.5	37	CCDS2849.1																																																																																			.		0.606	TWF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350199.2		Frame_Shift_Del
ZBTB38	253461	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	141162052	141162058	+	Frame_Shift_Del	DEL	TTCGGAT	TTCGGAT	-	rs549239683		TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	TTCGGAT	TTCGGAT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr3:141162052_141162058delTTCGGAT	ENST00000514251.1	+	4	1101_1107	c.822_828delTTCGGAT	c.(820-828)gattcggatfs	p.DSD274fs	ZBTB38_ENST00000321464.5_Frame_Shift_Del_p.DSD275fs|ZBTB38_ENST00000441582.2_Frame_Shift_Del_p.DSD274fs					zinc finger and BTB domain containing 38											breast(3)|cervix(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	41						TACCACAGGATTCGGATTCAGCCACAG	0.459																																					p.274_276del		.											.	ZBTB38-25	0			c.822_828del						.																																			SO:0001589	frameshift_variant	253461	exon8			.	BC015444	CCDS43157.1	3q23	2014-06-13			ENSG00000177311	ENSG00000177311		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	26636	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 171"""	612218				12477932	Standard	NM_001080412		Approved	FLJ35036, CIBZ, ZNF921, PPP1R171	uc003etw.3	Q8NAP3	OTTHUMG00000160128	ENST00000514251.1:c.822_828delTTCGGAT	3.37:g.141162052_141162058delTTCGGAT	ENSP00000426387:p.Asp274fs	Somatic	74	0		WXS	Illumina HiSeq	Phase_I	65	14	NM_001080412	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000514251.1	37	CCDS43157.1																																																																																			.		0.459	ZBTB38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359329.2		
RCHY1	25898	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	76416940	76416940	+	Frame_Shift_Del	DEL	A	A	-			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr4:76416940delA	ENST00000324439.5	-	6	901	c.503delT	c.(502-504)ttafs	p.L168fs	RCHY1_ENST00000451788.1_Frame_Shift_Del_p.L168fs|RCHY1_ENST00000514021.1_5'Flank|RCHY1_ENST00000512706.1_Frame_Shift_Del_p.L146fs|RCHY1_ENST00000380840.2_Frame_Shift_Del_p.L128fs|RCHY1_ENST00000513257.1_Frame_Shift_Del_p.L168fs	NM_001278536.1|NM_001278538.1|NM_001278539.1	NP_001265465.1|NP_001265467.1|NP_001265468.1	Q96PM5	ZN363_HUMAN	ring finger and CHY zinc finger domain containing 1, E3 ubiquitin protein ligase	168					positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|p53 binding (GO:0002039)|protein homodimerization activity (GO:0042803)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(2)|pancreas(1)	3			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			TTACCTATGTAAAAGATGTCC	0.308																																					p.L168fs		.											.	RCHY1-228	0			c.503delT						.						59.0	59.0	59.0					4																	76416940		2203	4297	6500	SO:0001589	frameshift_variant	25898	exon6			.	AF255666	CCDS3567.1, CCDS34012.1, CCDS63990.1, CCDS63991.1, CCDS63992.1	4q21.1-q21.3	2014-02-17	2012-02-23	2004-03-30	ENSG00000163743	ENSG00000163743		"""RING-type (C3HC4) zinc fingers"""	17479	protein-coding gene	gene with protein product	"""androgen-receptor N-terminal-interacting protein"", ""p53-induced protein with a RING-H2 domain"", ""zinc finger, CHY-type"""	607680	"""zinc finger protein 363"", ""ring finger and CHY zinc finger domain containing 1"""	ZNF363		12654245	Standard	NM_015436		Approved	CHIMP, DKFZp586C1620, PRO1996, RNF199, ARNIP, PIRH2, ZCHY	uc003hik.3	Q96PM5	OTTHUMG00000130105	ENST00000324439.5:c.503delT	4.37:g.76416940delA	ENSP00000321239:p.Leu168fs	Somatic	282	0		WXS	Illumina HiSeq	Phase_I	221	125	NM_001008925	0	0	0	0	0	B3KRG3|C7E541|C7E542|C7E543|D3YRV2|E7EMC8|E7ETW5|J3KPI0|Q2KN33|Q59GN7|Q86X26|Q96PR5	Frame_Shift_Del	DEL	ENST00000324439.5	37	CCDS3567.1																																																																																			.		0.308	RCHY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252411.2	NM_015436	
DNAH8	1769	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	38818063	38818080	+	In_Frame_Del	DEL	ATAAAAATAATGCAGCGA	ATAAAAATAATGCAGCGA	-	rs200056261|rs201568629|rs547165959		TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	ATAAAAATAATGCAGCGA	ATAAAAATAATGCAGCGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr6:38818063_38818080delATAAAAATAATGCAGCGA	ENST00000359357.3	+	36	4839_4856	c.4585_4602delATAAAAATAATGCAGCGA	c.(4585-4602)ataaaaataatgcagcgadel	p.IKIMQR1529del	DNAH8_ENST00000449981.2_In_Frame_Del_p.IKIMQR1746del|DNAH8_ENST00000441566.1_In_Frame_Del_p.IKIMQR1529del			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	1529					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.I1529I(2)		NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						CAAGTCTTGGATAAAAATAATGCAGCGAGCTCATGAGA	0.362																																					p.1746_1751del		.											.	DNAH8-615	2	Substitution - coding silent(2)	lung(2)	c.5236_5253del						.																																			SO:0001651	inframe_deletion	1769	exon38			.	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.4585_4602delATAAAAATAATGCAGCGA	6.37:g.38818063_38818080delATAAAAATAATGCAGCGA	ENSP00000352312:p.Ile1529_Arg1534del	Somatic	89	0		WXS	Illumina HiSeq	Phase_I	65	25	NM_001206927	0	0	0	0	0	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	In_Frame_Del	DEL	ENST00000359357.3	37																																																																																				.		0.362	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
HECA	51696	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	139487930	139487930	+	Frame_Shift_Del	DEL	G	G	-			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr6:139487930delG	ENST00000367658.2	+	2	1066	c.781delG	c.(781-783)ggtfs	p.G261fs	RP1-225E12.2_ENST00000588529.1_RNA|RP1-225E12.2_ENST00000589192.1_RNA|RP1-225E12.2_ENST00000587577.1_RNA|RP1-225E12.2_ENST00000590679.1_RNA|RP1-225E12.2_ENST00000586229.1_RNA|RP1-225E12.2_ENST00000588638.1_RNA|RP1-225E12.2_ENST00000591102.1_RNA|RP1-225E12.2_ENST00000415194.2_RNA|RP1-225E12.2_ENST00000586266.1_RNA|RP1-225E12.3_ENST00000585874.1_RNA	NM_016217.2	NP_057301.1	Q9UBI9	HDC_HUMAN	headcase homolog (Drosophila)	261					respiratory tube development (GO:0030323)	membrane (GO:0016020)				endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(1)	15				GBM - Glioblastoma multiforme(68;0.000252)|OV - Ovarian serous cystadenocarcinoma(155;0.000387)		CGCAGCCTACGGTGCCCGTTC	0.682																																					p.G261fs		.											.	HECA-90	0			c.781delG						.						15.0	18.0	17.0					6																	139487930		2203	4297	6500	SO:0001589	frameshift_variant	51696	exon2			.	AB033492	CCDS5194.1	6q23-q24	2010-11-25			ENSG00000112406	ENSG00000112406			21041	protein-coding gene	gene with protein product		607977				11696983, 19643820	Standard	NM_016217		Approved	HDCL, hHDC, HDC, dJ225E12.1	uc003qin.3	Q9UBI9	OTTHUMG00000015686	ENST00000367658.2:c.781delG	6.37:g.139487930delG	ENSP00000356630:p.Gly261fs	Somatic	75	0		WXS	Illumina HiSeq	Phase_I	66	21	NM_016217	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000367658.2	37	CCDS5194.1																																																																																			.		0.682	HECA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042456.1	NM_016217	
RBAK	57786	hgsc.bcm.edu;bcgsc.ca	37	7	5104550	5104550	+	Frame_Shift_Del	DEL	G	G	-			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr7:5104550delG	ENST00000353796.3	+	6	1787	c.1463delG	c.(1462-1464)agtfs	p.S488fs	RBAK-RBAKDN_ENST00000407184.1_Intron|RBAK_ENST00000396912.1_Frame_Shift_Del_p.S488fs|RBAK-RBAKDN_ENST00000396904.2_Intron	NM_001204456.1	NP_001191385.1	Q9NYW8	RBAK_HUMAN	RB-associated KRAB zinc finger	488	Interaction with AR.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(2)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	10		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0916)|OV - Ovarian serous cystadenocarcinoma(56;2.44e-14)		CATGAATGTAGTGAATGTGGA	0.373																																					p.S488fs		.											.	RBAK-653	0			c.1463delG						.						64.0	64.0	64.0					7																	5104550		2203	4299	6502	SO:0001589	frameshift_variant	57786	exon6			.	AF226869	CCDS5337.1	7p22.1	2013-01-08			ENSG00000146587	ENSG00000146587		"""Zinc fingers, C2H2-type"", ""-"""	17680	protein-coding gene	gene with protein product		608191					Standard	NM_021163		Approved	ZNF769	uc003sns.1	Q9NYW8	OTTHUMG00000121155	ENST00000353796.3:c.1463delG	7.37:g.5104550delG	ENSP00000275423:p.Ser488fs	Somatic	114	0		WXS	Illumina HiSeq	Phase_I	105	58	NM_001204456	0	0	0	0	0	A6NDF2|A8KAK4|B2RN44|B9EGS1|F8W6M7	Frame_Shift_Del	DEL	ENST00000353796.3	37	CCDS5337.1																																																																																			.		0.373	RBAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241640.2	NM_021163	
VSTM2A	222008	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	54612346	54612346	+	Frame_Shift_Del	DEL	G	G	-			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr7:54612346delG	ENST00000407838.3	+	2	517	c.111delG	c.(109-111)acgfs	p.T37fs	VSTM2A_ENST00000302287.3_Frame_Shift_Del_p.T37fs|VSTM2A_ENST00000402613.3_Frame_Shift_Del_p.T37fs|VSTM2A_ENST00000404951.1_Frame_Shift_Del_p.T37fs|VSTM2A_ENST00000402026.2_Frame_Shift_Del_p.T36fs	NM_182546.2	NP_872352.2	Q8TAG5	VTM2A_HUMAN	V-set and transmembrane domain containing 2A	37	Ig-like V-type.					extracellular region (GO:0005576)				endometrium(1)|large_intestine(2)|lung(12)|prostate(1)	16			STAD - Stomach adenocarcinoma(5;0.0525)			GGAACGTGACGGCGACCGAGG	0.577																																					p.T37fs		.											.	.	0			c.111delG						.						61.0	60.0	60.0					7																	54612346		2203	4300	6503	SO:0001589	frameshift_variant	222008	exon2			.	BC028404	CCDS5512.2, CCDS75604.1	7p11.2	2013-01-11	2007-08-10	2007-08-10	ENSG00000170419	ENSG00000170419		"""Immunoglobulin superfamily / V-set domain containing"""	28499	protein-coding gene	gene with protein product			"""V-set and transmembrane domain containing 2"""	VSTM2		12477932	Standard	XM_006715663		Approved	MGC33530	uc010kzf.3	Q8TAG5	OTTHUMG00000129271	ENST00000407838.3:c.111delG	7.37:g.54612346delG	ENSP00000384967:p.Thr37fs	Somatic	128	0		WXS	Illumina HiSeq	Phase_I	167	50	NM_182546	0	0	0	0	0	A4D2E9|B5MC94	Frame_Shift_Del	DEL	ENST00000407838.3	37	CCDS5512.2																																																																																			.		0.577	VSTM2A-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318694.1	NM_182546	
RUSC2	9853	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	35547875	35547875	+	Frame_Shift_Del	DEL	G	G	-	rs375840925		TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr9:35547875delG	ENST00000455600.1	+	2	1926	c.1357delG	c.(1357-1359)gtcfs	p.V453fs		NM_001135999.1	NP_001129471	Q8N2Y8	RUSC2_HUMAN	RUN and SH3 domain containing 2	453						cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)	Rab GTPase binding (GO:0017137)			NS(1)|breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|lung(4)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32			Lung(28;0.000837)|LUSC - Lung squamous cell carcinoma(32;0.00109)|STAD - Stomach adenocarcinoma(86;0.194)			GAAGCCAGAAGTCCAGCCAGA	0.572																																					p.V453fs		.											.	RUSC2-91	0			c.1357delG						.						107.0	127.0	120.0					9																	35547875		2203	4300	6503	SO:0001589	frameshift_variant	9853	exon2			.	AB002373	CCDS35008.1	9p13.2	2003-12-02			ENSG00000198853	ENSG00000198853			23625	protein-coding gene	gene with protein product		611053				9205841	Standard	NM_001135999		Approved	KIAA0375	uc003zww.3	Q8N2Y8	OTTHUMG00000019861	ENST00000455600.1:c.1357delG	9.37:g.35547875delG	ENSP00000393922:p.Val453fs	Somatic	76	0		WXS	Illumina HiSeq	Phase_I	86	53	NM_014806	0	0	0	0	0	A2RU62|A7E2A9|O15080|Q5W134|Q641Q6|Q6P1W7	Frame_Shift_Del	DEL	ENST00000455600.1	37	CCDS35008.1																																																																																			.		0.572	RUSC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052309.1	XM_048462	
TLN1	7094	broad.mit.edu	37	9	35699091	35699097	+	Frame_Shift_Del	DEL	CAGCTCC	CAGCTCC	-	rs370191540		TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	CAGCTCC	CAGCTCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr9:35699091_35699097delCAGCTCC	ENST00000314888.9	-	52	7284_7290	c.6931_6937delGGAGCTG	c.(6931-6939)ggagctgcafs	p.GAA2311fs	TLN1_ENST00000540444.1_Frame_Shift_Del_p.GAA2199fs	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	2311	I/LWEQ. {ECO:0000255|PROSITE- ProRule:PRU00292}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			ATGGCGGCTGCAGCTCCCAGGAGCTCA	0.585																																					p.2311_2313del													.	TLN1-609	0			c.6931_6937del						.																																			SO:0001589	frameshift_variant	7094	exon52			CGGCTGCAGCTCC	AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.6931_6937delGGAGCTG	9.37:g.35699091_35699097delCAGCTCC	ENSP00000316029:p.Gly2311fs	Somatic	51	0		WXS	Illumina HiSeq	Phase_I	53	9	NM_006289	0	0	0	0	0	A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Frame_Shift_Del	DEL	ENST00000314888.9	37	CCDS35009.1																																																																																			.		0.585	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052353.2	NM_006289	
OFD1	8481	hgsc.bcm.edu;bcgsc.ca	37	X	13762547	13762547	+	Frame_Shift_Del	DEL	T	T	-			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chrX:13762547delT	ENST00000340096.6	+	6	753	c.426delT	c.(424-426)catfs	p.H142fs	OFD1_ENST00000380567.1_Frame_Shift_Del_p.H2fs|OFD1_ENST00000490265.1_3'UTR|OFD1_ENST00000398395.3_Frame_Shift_Del_p.H142fs|OFD1_ENST00000380550.3_Frame_Shift_Del_p.H142fs	NM_003611.2	NP_003602.1	O75665	OFD1_HUMAN	oral-facial-digital syndrome 1	142					axoneme assembly (GO:0035082)|cilium morphogenesis (GO:0060271)|embryonic body morphogenesis (GO:0010172)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of fibroblast growth factor receptor signaling pathway involved in neural plate anterior/posterior pattern formation (GO:2000314)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	alpha-tubulin binding (GO:0043014)|gamma-tubulin binding (GO:0043015)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	25						TTCTTATGCATTTTTTAAAAG	0.308																																					p.H142fs		.											.	OFD1-108	0			c.426delT						.						66.0	59.0	61.0					X																	13762547		2203	4299	6502	SO:0001589	frameshift_variant	8481	exon6			.	Y15164	CCDS14157.1	Xp22	2014-06-18			ENSG00000046651	ENSG00000046651			2567	protein-coding gene	gene with protein product		300170	"""retinitis pigmentosa 23 (X-linked recessive)"""	CXorf5, RP23		9722947, 9215688, 22619378	Standard	NM_003611		Approved	71-7A, JBTS10	uc004cvp.4	O75665	OTTHUMG00000021159	ENST00000340096.6:c.426delT	X.37:g.13762547delT	ENSP00000344314:p.His142fs	Somatic	225	0		WXS	Illumina HiSeq	Phase_I	290	96	NM_003611	0	0	0	0	0	B9ZVU5|O75666|Q4VAK4	Frame_Shift_Del	DEL	ENST00000340096.6	37	CCDS14157.1																																																																																			.		0.308	OFD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055808.1	NM_003611	
UBQLN2	29978	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	56592091	56592092	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	AA	AA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chrX:56592091_56592092delAA	ENST00000338222.5	+	1	2066_2067	c.1785_1786delAA	c.(1783-1788)ttaaacfs	p.N596fs		NM_013444.3	NP_038472.2	Q9UHD9	UBQL2_HUMAN	ubiquilin 2	596	UBA. {ECO:0000255|PROSITE- ProRule:PRU00212}.				cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|endometrium(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(1)	21						TGGGGTTCTTAAACCGTGAAGC	0.515																																					p.595_596del	Esophageal Squamous(104;218 1492 6022 10838 28884)	.											.	UBQLN2-131	0			c.1785_1786del						.																																			SO:0001589	frameshift_variant	29978	exon1			.	AF189009	CCDS14374.1	Xp11.21	2014-09-17			ENSG00000188021	ENSG00000188021		"""Ubiquilin family"""	12509	protein-coding gene	gene with protein product	"""NEDD4 binding protein 4"""	300264				10675567	Standard	NM_013444		Approved	Chap1, Dsk2, RIHFB2157, LIC-2, CHAP1/DSK2, PLIC-2, N4BP4, PLIC2	uc004dus.3	Q9UHD9	OTTHUMG00000021669	ENST00000338222.5:c.1785_1786delAA	X.37:g.56592091_56592092delAA	ENSP00000345195:p.Asn596fs	Somatic	106	0		WXS	Illumina HiSeq	Phase_I	167	146	NM_013444	0	0	0	0	0	O94798|Q5D027|Q9H3W6|Q9HAZ4	Frame_Shift_Del	DEL	ENST00000338222.5	37	CCDS14374.1																																																																																			.		0.515	UBQLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056891.1	NM_013444	
UPRT	139596	hgsc.bcm.edu;bcgsc.ca	37	X	74494317	74494318	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chrX:74494317_74494318delAG	ENST00000373383.4	+	1	395_396	c.228_229delAG	c.(226-231)tcagagfs	p.E77fs	UPRT_ENST00000531704.1_3'UTR|UPRT_ENST00000530743.1_5'Flank|UPRT_ENST00000373379.1_Frame_Shift_Del_p.E77fs	NM_145052.3	NP_659489.1	Q96BW1	UPP_HUMAN	uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae)	77					female pregnancy (GO:0007565)|lactation (GO:0007595)|response to insulin (GO:0032868)|UMP biosynthetic process (GO:0006222)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(7)|kidney(2)|large_intestine(4)|lung(4)	18						GCCTCAACTCAGAGGGCAACAG	0.639																																					p.76_77del		.											.	UPRT-130	0			c.228_229del						.																																			SO:0001589	frameshift_variant	139596	exon1			.	BC015116	CCDS14429.1	Xq13.3	2009-01-14			ENSG00000094841	ENSG00000094841			28334	protein-coding gene	gene with protein product		300656				12477932	Standard	NM_145052		Approved	DKFZp781E1243, MGC23937, FUR1, RP11-311P8.3	uc004ecb.2	Q96BW1	OTTHUMG00000021864	ENST00000373383.4:c.228_229delAG	X.37:g.74494319_74494320delAG	ENSP00000362481:p.Glu77fs	Somatic	82	0		WXS	Illumina HiSeq	Phase_I	146	23	NM_145052	0	0	0	0	0	Q5JRL1|Q5JRL3|Q68DN0|Q96MW2	Frame_Shift_Del	DEL	ENST00000373383.4	37	CCDS14429.1																																																																																			.		0.639	UPRT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057278.1	NM_145052	
STAT5A	6776	broad.mit.edu	37	17	40452261	40452262	+	Frame_Shift_Ins	INS	-	-	G			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr17:40452261_40452262insG	ENST00000345506.4	+	8	1437_1438	c.795_796insG	c.(796-798)gggfs	p.G266fs	STAT5A_ENST00000590949.1_Frame_Shift_Ins_p.G266fs|STAT5A_ENST00000588868.1_Frame_Shift_Ins_p.G266fs|STAT5A_ENST00000546010.2_Frame_Shift_Ins_p.G236fs|STAT5A_ENST00000452307.2_Frame_Shift_Ins_p.G266fs	NM_003152.3	NP_003143.2	P42229	STA5A_HUMAN	signal transducer and activator of transcription 5A	266					2-oxoglutarate metabolic process (GO:0006103)|allantoin metabolic process (GO:0000255)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|citrate metabolic process (GO:0006101)|creatine metabolic process (GO:0006600)|creatinine metabolic process (GO:0046449)|development of secondary female sexual characteristics (GO:0046543)|development of secondary male sexual characteristics (GO:0046544)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|fatty acid metabolic process (GO:0006631)|female pregnancy (GO:0007565)|isoleucine metabolic process (GO:0006549)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|lipid storage (GO:0019915)|luteinization (GO:0001553)|mammary gland epithelium development (GO:0061180)|natural killer cell differentiation (GO:0001779)|negative regulation of erythrocyte differentiation (GO:0045647)|negative regulation of mast cell apoptotic process (GO:0033026)|oxaloacetate metabolic process (GO:0006107)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch development (GO:0048541)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of mast cell differentiation (GO:0060376)|positive regulation of mast cell proliferation (GO:0070668)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prolactin signaling pathway (GO:0038161)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of cell adhesion (GO:0030155)|regulation of epithelial cell differentiation (GO:0030856)|regulation of multicellular organism growth (GO:0040014)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|succinate metabolic process (GO:0006105)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|taurine metabolic process (GO:0019530)|transcription, DNA-templated (GO:0006351)|valine metabolic process (GO:0006573)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	calcium ion binding (GO:0005509)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	14		all_cancers(22;1.56e-06)|all_epithelial(22;3.17e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.128)		CCGGGAACGGCGGGCCCCCCGA	0.688																																					p.G265fs													.	STAT5A-846	0			c.795_796insG						.			24,266		11,2,132						-4.4	0.9			1	96,1048		28,40,504	no	frameshift	STAT5A	NM_003152.3		39,42,636	A1A1,A1R,RR		8.3916,8.2759,8.3682				120,1314				SO:0001589	frameshift_variant	6776	exon8			GAACGGCGGGCCC	U43185	CCDS11424.1, CCDS74066.1, CCDS74067.1	17q11.2	2013-02-14			ENSG00000126561	ENSG00000126561		"""SH2 domain containing"""	11366	protein-coding gene	gene with protein product		601511		STAT5		7719937, 8631883	Standard	NM_003152		Approved	MGF	uc002hzj.2	P42229	OTTHUMG00000150725	ENST00000345506.4:c.798dupG	17.37:g.40452264_40452264dupG	ENSP00000341208:p.Gly266fs	Somatic	77	0		WXS	Illumina HiSeq	Phase_I	236	9	NM_003152	0	0	0	0	0	Q1KLZ6	Frame_Shift_Ins	INS	ENST00000345506.4	37	CCDS11424.1																																																																																			.		0.688	STAT5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319804.1	NM_003152	
HPS3	84343	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	148857880	148857881	+	Frame_Shift_Ins	INS	-	-	GT	rs541164156		TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr3:148857880_148857881insGT	ENST00000296051.2	+	2	447_448	c.307_308insGT	c.(307-309)cgtfs	p.R103fs	HPS3_ENST00000460120.1_Intron	NM_032383.3	NP_115759.2	Q969F9	HPS3_HUMAN	Hermansky-Pudlak syndrome 3	103					organelle organization (GO:0006996)|pigmentation (GO:0043473)	BLOC-2 complex (GO:0031084)		p.R103S(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	34			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			TGAAAACTCTCGTGTGTGTATC	0.426									Hermansky-Pudlak syndrome																												p.R103fs		.											.	HPS3-158	1	Substitution - Missense(1)	lung(1)	c.307_308insGT						.																																			SO:0001589	frameshift_variant	84343	exon2	Familial Cancer Database	HPS, HPS1-8	.	AY033141	CCDS3140.1	3q24	2014-06-18			ENSG00000163755	ENSG00000163755			15597	protein-coding gene	gene with protein product		606118				11455388	Standard	NM_032383		Approved	SUTAL	uc003ewu.1	Q969F9	OTTHUMG00000159548	ENST00000296051.2:c.314_315dupGT	3.37:g.148857887_148857888dupGT	ENSP00000296051:p.Arg103fs	Somatic	145	0		WXS	Illumina HiSeq	Phase_I	131	30	NM_032383	0	0	0	0	0	A8K6G6|Q8WTV6|Q96AP1|Q96MR3|Q9H608	Frame_Shift_Ins	INS	ENST00000296051.2	37	CCDS3140.1																																																																																			.		0.426	HPS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356151.1	NM_032383	
RFC1	5981	bcgsc.ca	37	4	39306550	39306551	+	Splice_Site	INS	-	-	AAAAAA			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr4:39306550_39306551insAAAAAA	ENST00000381897.1	-	15	2132		c.e15-2		RFC1_ENST00000349703.2_Splice_Site	NM_001204747.1|NM_002913.4	NP_001191676.1|NP_002904.3	P35251	RFC1_HUMAN	replication factor C (activator 1) 1, 145kDa						DNA repair (GO:0006281)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA-dependent DNA replication (GO:0006261)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|positive regulation of catalytic activity (GO:0043085)|positive regulation of transcription, DNA-templated (GO:0045893)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|telomere maintenance via telomerase (GO:0007004)|transcription, DNA-templated (GO:0006351)|transcription-coupled nucleotide-excision repair (GO:0006283)	cell junction (GO:0030054)|DNA replication factor C complex (GO:0005663)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA clamp loader activity (GO:0003689)|double-stranded DNA binding (GO:0003690)|enzyme activator activity (GO:0008047)|sequence-specific DNA binding (GO:0043565)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	16						TCCCAACTCCTAATCAAAATAT	0.426																																					.	Colon(109;59 1555 12203 17579 39824)|Esophageal Squamous(18;360 542 16186 28570 51157)												.	RFC1-230	0			c.1996-2->TTTTTT						.																																			SO:0001630	splice_region_variant	5981	exon16			AACTCCTAATCAA	L23320	CCDS3450.1, CCDS56329.1	4p14-p13	2010-04-21	2002-08-29		ENSG00000035928	ENSG00000035928		"""ATPases / AAA-type"""	9969	protein-coding gene	gene with protein product		102579	"""replication factor C (activator 1) 1 (145kD)"""			8114700	Standard	NM_002913		Approved	A1, PO-GA, RFC140, MHCBFB	uc003gty.2	P35251	OTTHUMG00000099363	ENST00000381897.1:c.1999-2->TTTTTT	4.37:g.39306550_39306551insAAAAAA		Somatic	53	0		WXS	Illumina HiSeq	Phase_1	33	6	NM_002913	0	0	0	0	0	A8K6E7|Q5XKF5|Q6PKU0|Q86V41|Q86V46	Splice_Site	INS	ENST00000381897.1	37	CCDS56329.1																																																																																			.		0.426	RFC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216808.1	NM_002913	Intron
TJP2	9414	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	71869284	71869285	+	Frame_Shift_Ins	INS	-	-	T			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr9:71869284_71869285insT	ENST00000377245.4	+	23	3775_3776	c.3567_3568insT	c.(3568-3570)ttafs	p.L1190fs	TJP2_ENST00000535702.1_Frame_Shift_Ins_p.L1157fs|TJP2_ENST00000453658.2_Frame_Shift_Ins_p.L1020fs|TJP2_ENST00000348208.4_Frame_Shift_Ins_p.L1043fs|TJP2_ENST00000539225.1_Frame_Shift_Ins_p.L1221fs	NM_004817.3	NP_004808.2	Q9UDY2	ZO2_HUMAN	tight junction protein 2	1190	Interaction with SCRIB.				apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|hippo signaling (GO:0035329)|nucleotide phosphorylation (GO:0046939)|response to organic substance (GO:0010033)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	guanylate kinase activity (GO:0004385)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(5)|lung(9)|prostate(3)|skin(3)|soft_tissue(1)|upper_aerodigestive_tract(1)	35						GGGACACAGAATTATAGATGTC	0.579																																					p.E1220fs		.											.	TJP2-115	0			c.3660_3661insT						.																																			SO:0001589	frameshift_variant	9414	exon23			.	L27476	CCDS6627.1, CCDS6628.1, CCDS55314.1, CCDS55315.1, CCDS55316.1, CCDS55317.1	9q13-q21	2012-07-12	2012-07-12		ENSG00000119139	ENSG00000119139			11828	protein-coding gene	gene with protein product	"""Friedreich ataxia region gene X104 (tight junction protein ZO-2)"", ""zona occludens 2"""	607709	"""deafness, autosomal dominant 51"""	DFNA51		7951235, 20602916	Standard	NM_001170630		Approved	ZO-2, X104, ZO2	uc011lrv.2	Q9UDY2	OTTHUMG00000019978	ENST00000377245.4:c.3569dupT	9.37:g.71869286_71869286dupT	ENSP00000366453:p.Leu1190fs	Somatic	79	0		WXS	Illumina HiSeq	Phase_I	78	21	NM_001170416	0	0	0	0	0	A2A3H9|B7Z2R8|B7Z7T6|F5H301|F5H886|Q15883|Q5VXL0|Q5VXL1|Q8N756|Q8NI14|Q99839|Q9UDY0|Q9UDY1	Frame_Shift_Ins	INS	ENST00000377245.4	37	CCDS6627.1																																																																																			.		0.579	TJP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000052572.2	NM_201629	
RANBP2	5903	bcgsc.ca	37	2	109382102	109382103	+	Missense_Mutation	DNP	AC	AC	GT			TCGA-P4-A5EB-01A-11D-A28G-10	TCGA-P4-A5EB-11A-11D-A28G-10	AC	AC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e6cf6557-09fb-4516-af87-39037f809609	fa076b69-fed9-4164-af20-7592bff142fd	g.chr2:109382102_109382103AC>GT	ENST00000283195.6	+	20	5233_5234	c.5107_5108AC>GT	c.(5107-5109)ACa>GTa	p.T1703V		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	1703					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						TGCAGTTTCAACACCTGCCTCT	0.436																																					p.T1703V													.	RANBP2-675	0			c.C5108T						.																																			SO:0001583	missense	5903	exon20			TTTCAACACCTGC	D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	Exception_encountered	2.37:g.109382102_109382103delinsGT	ENSP00000283195:p.Thr1703Val	Somatic	732	6		WXS	Illumina HiSeq	Phase_1	944	350	NM_006267	0	0	0	0	0	Q13074|Q15280|Q53TE2|Q59FH7	Missense_Mutation	DNP	ENST00000283195.6	37	CCDS2079.1																																																																																			.		0.436	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1	NM_006267	
