#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PLA2G2D	26279	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	20440719	20440719	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr1:20440719C>T	ENST00000375105.3	-	4	384	c.326G>A	c.(325-327)tGt>tAt	p.C109Y		NM_012400.2	NP_036532.1	Q9UNK4	PA2GD_HUMAN	phospholipase A2, group IID	109					glycerophospholipid biosynthetic process (GO:0046474)|inflammatory response (GO:0006954)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|phospholipase A2 activity (GO:0004623)			endometrium(1)|lung(2)	3		Colorectal(325;0.000147)|Renal(390;0.000469)|Lung NSC(340;0.00412)|all_lung(284;0.00419)|Breast(348;0.00526)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|COAD - Colon adenocarcinoma(152;1.15e-05)|BRCA - Breast invasive adenocarcinoma(304;8.01e-05)|Kidney(64;0.000175)|GBM - Glioblastoma multiforme(114;0.000798)|KIRC - Kidney renal clear cell carcinoma(64;0.00261)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		GTCACAGGCACACAGCTGCTG	0.597										Multiple Myeloma(11;0.12)																											p.C109Y	Melanoma(60;742 1548 31762 39240)	.											.	PLA2G2D-90	0			c.G326A						.						63.0	60.0	61.0					1																	20440719		2203	4300	6503	SO:0001583	missense	26279	exon4			CAGGCACACAGCT	AF112982	CCDS203.1, CCDS72721.1	1p36.12	2008-09-19			ENSG00000117215	ENSG00000117215	3.1.1.4		9033	protein-coding gene	gene with protein product		605630				10455175	Standard	NM_012400		Approved	sPLA2S	uc001bcz.4	Q9UNK4	OTTHUMG00000002701	ENST00000375105.3:c.326G>A	1.37:g.20440719C>T	ENSP00000364246:p.Cys109Tyr	Somatic	76	0		WXS	Illumina HiSeq	Phase_I	61	15	NM_012400	0	0	2	2	0	A8K2Z1|B1AEL9|Q9UK01	Missense_Mutation	SNP	ENST00000375105.3	37	CCDS203.1	.	.	.	.	.	.	.	.	.	.	C	19.68	3.873650	0.72180	.	.	ENSG00000117215	ENST00000375105	D	0.86097	-2.07	5.2	5.2	0.72013	Phospholipase A2 (3);	0.000000	0.53938	D	0.000050	D	0.94443	0.8212	H	0.95365	3.66	0.47949	D	0.999553	D	0.89917	1.0	D	0.97110	1.0	D	0.95704	0.8752	10	0.87932	D	0	-24.7657	14.2445	0.65978	0.0:1.0:0.0:0.0	.	109	Q9UNK4	PA2GD_HUMAN	Y	109	ENSP00000364246:C109Y	ENSP00000364246:C109Y	C	-	2	0	PLA2G2D	20313306	0.996000	0.38824	0.998000	0.56505	0.910000	0.53928	4.132000	0.57977	2.443000	0.82685	0.462000	0.41574	TGT	.		0.597	PLA2G2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007683.1		
AGL	178	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	100327977	100327977	+	Nonsense_Mutation	SNP	C	C	G			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr1:100327977C>G	ENST00000294724.4	+	4	936	c.458C>G	c.(457-459)tCa>tGa	p.S153*	AGL_ENST00000370161.2_Nonsense_Mutation_p.S137*|AGL_ENST00000361302.3_Nonsense_Mutation_p.S137*|AGL_ENST00000370163.3_Nonsense_Mutation_p.S153*|AGL_ENST00000361915.3_Nonsense_Mutation_p.S153*|AGL_ENST00000370165.3_Nonsense_Mutation_p.S153*|AGL_ENST00000361522.4_Nonsense_Mutation_p.S136*	NM_000028.2	NP_000019.2	P35573	GDE_HUMAN	amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase	153					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|inclusion body (GO:0016234)|isoamylase complex (GO:0043033)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)	4-alpha-glucanotransferase activity (GO:0004134)|amylo-alpha-1,6-glucosidase activity (GO:0004135)|glycogen debranching enzyme activity (GO:0004133)|polysaccharide binding (GO:0030247)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(9)|lung(35)|ovary(1)|prostate(4)|skin(3)|urinary_tract(1)	69		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)		GCAAAAGAATCAGGTAATGTC	0.338																																					p.S153X		.											.	AGL-92	0			c.C458G						.						159.0	150.0	153.0					1																	100327977		2203	4300	6503	SO:0001587	stop_gained	178	exon4			AAGAATCAGGTAA	BC078663	CCDS759.1, CCDS760.1, CCDS761.1	1p21	2010-04-27	2010-04-27		ENSG00000162688	ENSG00000162688	2.4.1.25, 3.2.1.33		321	protein-coding gene	gene with protein product	"""glycogen debranching enzyme"", ""glycogen storage disease type III"""	610860	"""amylo-1, 6-glucosidase, 4-alpha-glucanotransferase"""			1505983	Standard	NM_000028		Approved		uc001dsi.1	P35573	OTTHUMG00000010803	ENST00000294724.4:c.458C>G	1.37:g.100327977C>G	ENSP00000294724:p.Ser153*	Somatic	111	0		WXS	Illumina HiSeq	Phase_I	102	23	NM_000644	0	0	0	0	0	A6NCX7|A6NEK2|D3DT51|P78354|P78544|Q59H92|Q6AZ90|Q9UF08	Nonsense_Mutation	SNP	ENST00000294724.4	37	CCDS759.1	.	.	.	.	.	.	.	.	.	.	C	39	7.619744	0.98393	.	.	ENSG00000162688	ENST00000361915;ENST00000370165;ENST00000370163;ENST00000294724;ENST00000361302;ENST00000370161;ENST00000361522	.	.	.	5.53	5.53	0.82687	.	0.435109	0.23914	N	0.043307	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	.	19.4571	0.94897	0.0:1.0:0.0:0.0	.	.	.	.	X	153;153;153;153;137;137;136	.	ENSP00000294724:S153X	S	+	2	0	AGL	100100565	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	7.764000	0.85297	2.599000	0.87857	0.655000	0.94253	TCA	.		0.338	AGL-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029778.1	NM_000028	
RPRD2	23248	hgsc.bcm.edu	37	1	150415711	150415711	+	Silent	SNP	T	T	C			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr1:150415711T>C	ENST00000369068.4	+	5	523	c.519T>C	c.(517-519)tcT>tcC	p.S173S	RPRD2_ENST00000401000.4_Silent_p.S147S|RPRD2_ENST00000492220.1_3'UTR|RPRD2_ENST00000539519.1_Silent_p.S147S	NM_015203.3	NP_056018.2	Q5VT52	RPRD2_HUMAN	regulation of nuclear pre-mRNA domain containing 2	173						DNA-directed RNA polymerase II, holoenzyme (GO:0016591)				central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(20)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						CAACAGCATCTACAAATCCAA	0.308																																					p.S173S		.											.	RPRD2-23	0			c.T519C						.						77.0	67.0	70.0					1																	150415711		1804	4072	5876	SO:0001819	synonymous_variant	23248	exon5			AGCATCTACAAAT	BX641025	CCDS44216.1, CCDS72907.1	1q21.2	2012-02-09	2008-08-15	2008-07-28	ENSG00000163125	ENSG00000163125			29039	protein-coding gene	gene with protein product		614695	"""KIAA0460"""	KIAA0460		22231121	Standard	XM_005245033		Approved	FLJ32145, HSPC099	uc009wlr.3	Q5VT52	OTTHUMG00000012808	ENST00000369068.4:c.519T>C	1.37:g.150415711T>C		Somatic	8	0		WXS	Illumina HiSeq	Phase_I	9	2	NM_015203	0	0	2	2	0	A8K6N8|B3KPT1|B4E2Q6|O75048|Q5VT51|Q5VT53|Q6MZL4|Q86XD2|Q9P0D7	Silent	SNP	ENST00000369068.4	37	CCDS44216.1																																																																																			.		0.308	RPRD2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000035844.1	NM_015203	
NTRK1	4914	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	156843561	156843561	+	Silent	SNP	C	C	T			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr1:156843561C>T	ENST00000524377.1	+	8	1028	c.987C>T	c.(985-987)ttC>ttT	p.F329F	NTRK1_ENST00000392302.2_Silent_p.F299F|NTRK1_ENST00000368196.3_Silent_p.F329F|NTRK1_ENST00000358660.3_Silent_p.F329F	NM_002529.3	NP_002520.2	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1	329	Ig-like C2-type 2.				activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|axon guidance (GO:0007411)|axonogenesis involved in innervation (GO:0060385)|B cell differentiation (GO:0030183)|cellular response to nerve growth factor stimulus (GO:1990090)|cellular response to nicotine (GO:0071316)|circadian rhythm (GO:0007623)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|developmental programmed cell death (GO:0010623)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory nerve development (GO:0021553)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of angiogenesis (GO:0045766)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of programmed cell death (GO:0043068)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|response to activity (GO:0014823)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to ethanol (GO:0045471)|response to hydrostatic pressure (GO:0051599)|response to nutrient levels (GO:0031667)|response to radiation (GO:0009314)|Sertoli cell development (GO:0060009)|small GTPase mediated signal transduction (GO:0007264)|sympathetic nervous system development (GO:0048485)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	axon (GO:0030424)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome (GO:0005769)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|nerve growth factor binding (GO:0048406)|nerve growth factor receptor activity (GO:0010465)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(35)|ovary(8)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	74	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Amitriptyline(DB00321)|Imatinib(DB00619)|Regorafenib(DB08896)	GCTTCATCTTCACTGAGTTCC	0.617			T	"""TPM3, TPR, TFG"""	papillary thyroid					TSP Lung(10;0.080)																											p.F329F		.		Dom	yes		1	1q21-q22	4914	"""neurotrophic tyrosine kinase, receptor, type 1"""		E	.	NTRK1-1393	0			c.C987T						.						44.0	36.0	39.0					1																	156843561		2203	4299	6502	SO:0001819	synonymous_variant	4914	exon8			CATCTTCACTGAG	Y09028	CCDS1161.1, CCDS30890.1, CCDS30891.1	1q21-q22	2014-09-17			ENSG00000198400	ENSG00000198400	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8031	protein-coding gene	gene with protein product	"""high affinity nerve growth factor receptor"""	191315				2869410	Standard	NM_001007792		Approved	TRK, TRKA, MTC	uc001fqh.1	P04629	OTTHUMG00000041304	ENST00000524377.1:c.987C>T	1.37:g.156843561C>T		Somatic	41	0		WXS	Illumina HiSeq	Phase_I	25	8	NM_001012331	0	0	0	0	0	B2R6T5|B7ZM34|P08119|Q15655|Q15656|Q5D056|Q5VZS2|Q7Z5C3|Q9UIU7	Silent	SNP	ENST00000524377.1	37	CCDS1161.1																																																																																			.		0.617	NTRK1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392279.1	NM_002529	
GORAB	92344	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	170501324	170501324	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr1:170501324C>T	ENST00000367763.3	+	1	55	c.35C>T	c.(34-36)gCg>gTg	p.A12V	GORAB_ENST00000367762.1_Missense_Mutation_p.A12V|RP11-576I22.2_ENST00000421020.1_RNA|RP11-576I22.2_ENST00000456083.1_RNA	NM_152281.2	NP_689494.2	Q5T7V8	GORAB_HUMAN	golgin, RAB6-interacting	12						cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)				endometrium(2)|large_intestine(3)|liver(2)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	17						GTCGCGGCTGCGAGATTTGGG	0.622																																					p.A12V		.											.	GORAB-90	0			c.C35T						.						51.0	62.0	58.0					1																	170501324		2203	4300	6503	SO:0001583	missense	92344	exon1			CGGCTGCGAGATT	AK021814	CCDS1289.1, CCDS53428.1	1q24.2	2009-02-13	2009-02-13	2009-02-13	ENSG00000120370	ENSG00000120370			25676	protein-coding gene	gene with protein product	"""gerodermia osteodysplastica"""	607983	"""SCY1-like 1 binding protein 1"""	SCYL1BP1		12783284, 15781263, 18997784	Standard	NM_152281		Approved	FLJ11752, NTKL-BP1, GO	uc001gha.2	Q5T7V8	OTTHUMG00000035228	ENST00000367763.3:c.35C>T	1.37:g.170501324C>T	ENSP00000356737:p.Ala12Val	Somatic	113	0		WXS	Illumina HiSeq	Phase_I	95	16	NM_152281	0	0	0	1	1	Q49A22|Q6P1P9|Q9HAE6|Q9Y350	Missense_Mutation	SNP	ENST00000367763.3	37	CCDS1289.1	.	.	.	.	.	.	.	.	.	.	C	12.10	1.836253	0.32421	.	.	ENSG00000120370	ENST00000367763;ENST00000367762	T;T	0.79247	-0.28;-1.25	5.24	-10.5	0.00291	.	3.953700	0.00937	N	0.002796	T	0.28167	0.0695	N	0.08118	0	0.09310	N	1	B;B	0.17268	0.021;0.021	B;B	0.14023	0.005;0.01	T	0.36986	-0.9725	10	0.37606	T	0.19	.	7.2128	0.25943	0.1379:0.6439:0.1383:0.0799	.	12;12	Q5T7V8-2;Q5T7V8	.;GORAB_HUMAN	V	12	ENSP00000356737:A12V;ENSP00000356736:A12V	ENSP00000356736:A12V	A	+	2	0	GORAB	168767948	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-4.322000	0.00253	-3.663000	0.00124	-1.000000	0.02509	GCG	.		0.622	GORAB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085226.1	NM_152281	
RGS21	431704	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	192321246	192321246	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr1:192321246C>A	ENST00000417209.2	+	4	332	c.158C>A	c.(157-159)gCc>gAc	p.A53D		NM_001039152.3	NP_001034241.1	Q2M5E4	RGS21_HUMAN	regulator of G-protein signaling 21	53	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			NS(1)|endometrium(3)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	15						TTCTGGCTTGCCTGTGAAGAC	0.328																																					p.A53D		.											.	RGS21-92	0			c.C158A						.						68.0	66.0	66.0					1																	192321246		1836	4106	5942	SO:0001583	missense	431704	exon4			GGCTTGCCTGTGA	AY643711	CCDS41448.1	1q31.2	2013-09-24	2007-08-14		ENSG00000253148	ENSG00000253148		"""Regulators of G-protein signaling"""	26839	protein-coding gene	gene with protein product		612407	"""regulator of G-protein signalling 21"""			15066150	Standard	NM_001039152		Approved		uc001gsh.3	Q2M5E4	OTTHUMG00000035594	ENST00000417209.2:c.158C>A	1.37:g.192321246C>A	ENSP00000428343:p.Ala53Asp	Somatic	57	0		WXS	Illumina HiSeq	Phase_I	51	11	NM_001039152	0	0	0	0	0		Missense_Mutation	SNP	ENST00000417209.2	37	CCDS41448.1	.	.	.	.	.	.	.	.	.	.	C	32	5.159165	0.94686	.	.	ENSG00000253148	ENST00000417209	T	0.02015	4.5	5.77	5.77	0.91146	Regulator of G protein signalling (4);Regulator of G protein signalling superfamily (1);	0.000000	0.33691	U	0.004656	T	0.14313	0.0346	M	0.77486	2.375	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.00016	-1.2383	10	0.87932	D	0	.	18.5418	0.91031	0.0:1.0:0.0:0.0	.	53	Q2M5E4	RGS21_HUMAN	D	53	ENSP00000428343:A53D	ENSP00000428343:A53D	A	+	2	0	RGS21	190587869	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.747000	0.85070	2.733000	0.93635	0.557000	0.71058	GCC	.		0.328	RGS21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086387.2		
CDC73	79577	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	193099338	193099338	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr1:193099338G>A	ENST00000367435.3	+	3	456	c.272G>A	c.(271-273)cGa>cAa	p.R91Q		NM_024529.4	NP_078805.3	Q6P1J9	CDC73_HUMAN	cell division cycle 73	91			R -> P (found in a patient with isolated hyperparathyroidism and parathyroid adenomas). {ECO:0000269|PubMed:17639062}.		cell cycle (GO:0007049)|cellular response to lipopolysaccharide (GO:0071222)|endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|mRNA polyadenylation (GO:0006378)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|protein destabilization (GO:0031648)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|nucleus (GO:0005634)	RNA polymerase II core binding (GO:0000993)	p.R91Q(1)		breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(14)|ovary(1)|pancreas(1)|parathyroid(51)|skin(1)|upper_aerodigestive_tract(1)	87						AGACCTGATCGAAAAGATCTA	0.294																																					p.R91Q		.											.	CDC73-1009	1	Substitution - Missense(1)	large_intestine(1)	c.G272A	GRCh37	CM072926	CDC73	M		.						140.0	144.0	143.0					1																	193099338		2203	4300	6503	SO:0001583	missense	79577	exon3			CTGATCGAAAAGA	AF312865	CCDS1382.1	1q25	2014-09-17	2013-01-17	2005-07-20	ENSG00000134371	ENSG00000134371			16783	protein-coding gene	gene with protein product	"""Paf1/RNA polymerase II complex component"""	607393	"""chromosome 1 open reading frame 28"", ""hyperparathyroidism 2 (with jaw tumor)"", ""cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)"", ""hyperparathyroidism 1"""	C1orf28, HRPT2, HRPT1		11318611, 15632063, 18755853	Standard	NM_024529		Approved	parafibromin, FIHP	uc001gtb.3	Q6P1J9	OTTHUMG00000035676	ENST00000367435.3:c.272G>A	1.37:g.193099338G>A	ENSP00000356405:p.Arg91Gln	Somatic	68	0		WXS	Illumina HiSeq	Phase_I	61	7	NM_024529	0	0	22	26	4	A6NLZ8|B2RBR2|Q6PK51|Q96A07|Q9H245|Q9H5L7	Missense_Mutation	SNP	ENST00000367435.3	37	CCDS1382.1	.	.	.	.	.	.	.	.	.	.	G	34	5.351125	0.95830	.	.	ENSG00000134371	ENST00000367435;ENST00000445394	D	0.91407	-2.84	5.62	4.71	0.59529	.	0.000000	0.85682	D	0.000000	D	0.95648	0.8585	M	0.87682	2.9	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96226	0.9164	10	0.87932	D	0	-10.3544	14.535	0.67953	0.0704:0.0:0.9296:0.0	.	91	Q6P1J9	CDC73_HUMAN	Q	91	ENSP00000356405:R91Q	ENSP00000356405:R91Q	R	+	2	0	CDC73	191365961	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	9.743000	0.98849	1.377000	0.46286	0.561000	0.74099	CGA	.		0.294	CDC73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086696.2	NM_024529	
LBR	3930	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	225599084	225599084	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr1:225599084A>T	ENST00000338179.2	-	9	1268	c.1143T>A	c.(1141-1143)ttT>ttA	p.F381L	LBR_ENST00000272163.4_Missense_Mutation_p.F381L|AC092811.1_ENST00000366845.2_5'Flank	NM_194442.2	NP_919424.1	Q14739	LBR_HUMAN	lamin B receptor	381					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|integral component of nuclear inner membrane (GO:0005639)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|lamin binding (GO:0005521)|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor (GO:0016628)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22	Breast(184;0.165)			GBM - Glioblastoma multiforme(131;0.117)		ATTTGAGATCAAAAGTACCAA	0.373																																					p.F381L		.											.	LBR-228	0			c.T1143A						.						122.0	130.0	127.0					1																	225599084		2203	4300	6503	SO:0001583	missense	3930	exon9			GAGATCAAAAGTA	L25931	CCDS1545.1	1q42.1	2013-01-23			ENSG00000143815	ENSG00000143815		"""Tudor domain containing"""	6518	protein-coding gene	gene with protein product	"""tudor domain containing 18"""	600024				8157663, 9878250	Standard	NM_194442		Approved	DHCR14B, TDRD18	uc001hoy.3	Q14739	OTTHUMG00000037520	ENST00000338179.2:c.1143T>A	1.37:g.225599084A>T	ENSP00000339883:p.Phe381Leu	Somatic	147	0		WXS	Illumina HiSeq	Phase_I	153	28	NM_194442	0	1	45	74	28	B2R5P3|Q14740|Q53GU7|Q59FE6	Missense_Mutation	SNP	ENST00000338179.2	37	CCDS1545.1	.	.	.	.	.	.	.	.	.	.	A	16.15	3.040696	0.55003	.	.	ENSG00000143815	ENST00000272163;ENST00000338179;ENST00000424022	D;D;D	0.96885	-4.16;-4.16;-4.16	6.16	2.64	0.31445	.	0.045876	0.85682	D	0.000000	D	0.93135	0.7814	L	0.33710	1.025	0.48288	D	0.99962	P	0.39782	0.688	P	0.46685	0.524	D	0.87185	0.2230	10	0.13853	T	0.58	-33.8453	9.3222	0.37971	0.796:0.0:0.204:0.0	.	381	Q14739	LBR_HUMAN	L	381;381;12	ENSP00000272163:F381L;ENSP00000339883:F381L;ENSP00000397817:F12L	ENSP00000272163:F381L	F	-	3	2	LBR	223665707	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.577000	0.53885	0.212000	0.20703	0.528000	0.53228	TTT	.		0.373	LBR-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091398.1	NM_002296	
ITGB1	3688	hgsc.bcm.edu	37	10	33212557	33212557	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr10:33212557G>C	ENST00000396033.2	-	7	1033	c.898C>G	c.(898-900)Caa>Gaa	p.Q300E	ITGB1_ENST00000302278.3_Missense_Mutation_p.Q300E|ITGB1_ENST00000374956.4_Missense_Mutation_p.Q300E|ITGB1_ENST00000423113.1_Missense_Mutation_p.Q300E|ITGB1_ENST00000484088.1_5'Flank	NM_133376.2	NP_596867.1	P05556	ITB1_HUMAN	integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)	300	VWFA.				axon extension (GO:0048675)|axon guidance (GO:0007411)|B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cardiac muscle cell differentiation (GO:0055007)|cell fate specification (GO:0001708)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cellular calcium ion homeostasis (GO:0006874)|cellular defense response (GO:0006968)|cellular response to ionizing radiation (GO:0071479)|cellular response to mechanical stimulus (GO:0071260)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|formation of radial glial scaffolds (GO:0021943)|G1/S transition of mitotic cell cycle (GO:0000082)|germ cell migration (GO:0008354)|heterotypic cell-cell adhesion (GO:0034113)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|maternal process involved in female pregnancy (GO:0060135)|mesodermal cell differentiation (GO:0048333)|negative regulation of anoikis (GO:2000811)|negative regulation of cell projection organization (GO:0031345)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of endocytosis (GO:0045807)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|protein transport within lipid bilayer (GO:0032594)|regulation of cell cycle (GO:0051726)|regulation of collagen catabolic process (GO:0010710)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of immune response (GO:0050776)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to gonadotropin (GO:0034698)|response to transforming growth factor beta (GO:0071559)|sarcomere organization (GO:0045214)|tight junction assembly (GO:0070830)|tissue homeostasis (GO:0001894)|viral process (GO:0016032)	acrosomal vesicle (GO:0001669)|basement membrane (GO:0005604)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integrin alpha1-beta1 complex (GO:0034665)|integrin alpha10-beta1 complex (GO:0034680)|integrin alpha11-beta1 complex (GO:0034681)|integrin alpha2-beta1 complex (GO:0034666)|integrin alpha3-beta1 complex (GO:0034667)|integrin alpha7-beta1 complex (GO:0034677)|integrin alpha8-beta1 complex (GO:0034678)|integrin alpha9-beta1 complex (GO:0034679)|integrin complex (GO:0008305)|intercalated disc (GO:0014704)|invadopodium membrane (GO:0071438)|membrane (GO:0016020)|membrane raft (GO:0045121)|myelin sheath abaxonal region (GO:0035748)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|cell adhesion molecule binding (GO:0050839)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)|peptide binding (GO:0042277)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|virus receptor activity (GO:0001618)			autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Ovarian(717;1.34e-05)|Breast(68;0.0634)			Antithymocyte globulin(DB00098)	AGGTGACATTGTCCATCATTT	0.398																																					p.Q300E		.											.	ITGB1-1084	0			c.C898G						.						86.0	74.0	78.0					10																	33212557		2203	4300	6503	SO:0001583	missense	3688	exon7			GACATTGTCCATC	BC020057	CCDS7174.1	10p11.2	2010-10-13			ENSG00000150093	ENSG00000150093		"""CD molecules"", ""Integrins"""	6153	protein-coding gene	gene with protein product		135630		FNRB, MSK12, MDF2		2524991	Standard	NM_033668		Approved	CD29, GPIIA	uc001iwt.4	P05556	OTTHUMG00000017928	ENST00000396033.2:c.898C>G	10.37:g.33212557G>C	ENSP00000379350:p.Gln300Glu	Somatic	46	0		WXS	Illumina HiSeq	Phase_I	36	2	NM_002211	0	0	136	136	0	A8K6N2|D3DRX9|D3DRY3|D3DRY4|D3DRY5|P78466|P78467|Q13089|Q13090|Q13091|Q13212|Q14622|Q14647|Q29RW2|Q7Z3V1|Q8WUM6	Missense_Mutation	SNP	ENST00000396033.2	37	CCDS7174.1	.	.	.	.	.	.	.	.	.	.	G	12.93	2.086740	0.36855	.	.	ENSG00000150093	ENST00000396033;ENST00000423113;ENST00000302278;ENST00000374956	D;D;D;D	0.92397	-3.03;-3.03;-3.03;-3.03	5.57	5.57	0.84162	Integrin beta subunit, N-terminal (2);von Willebrand factor, type A (1);	0.244954	0.42548	D	0.000686	D	0.82490	0.5048	N	0.08118	0	0.23727	N	0.997003	B;B;B;B;B	0.25312	0.0;0.0;0.0;0.123;0.001	B;B;B;B;B	0.26969	0.001;0.001;0.001;0.075;0.001	T	0.67185	-0.5734	10	0.15952	T	0.53	.	13.5534	0.61745	0.0:0.0:0.7397:0.2603	.	300;300;300;300;300	P05556-2;P05556;P05556-5;P05556-3;P05556-4	.;ITB1_HUMAN;.;.;.	E	300	ENSP00000379350:Q300E;ENSP00000388694:Q300E;ENSP00000303351:Q300E;ENSP00000364094:Q300E	ENSP00000303351:Q300E	Q	-	1	0	ITGB1	33252563	0.937000	0.31787	0.968000	0.41197	0.781000	0.44180	3.946000	0.56644	2.641000	0.89580	0.655000	0.94253	CAA	.		0.398	ITGB1-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000047496.1	NM_002211	
EXOC6	54536	hgsc.bcm.edu	37	10	94700514	94700514	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr10:94700514G>C	ENST00000260762.6	+	13	1257	c.1243G>C	c.(1243-1245)Gac>Cac	p.D415H	EXOC6_ENST00000371547.4_Missense_Mutation_p.D431H|EXOC6_ENST00000371552.4_Missense_Mutation_p.D410H|EXOC6_ENST00000443748.2_Missense_Mutation_p.D312H	NM_019053.4	NP_061926.3	Q8TAG9	EXOC6_HUMAN	exocyst complex component 6	415					cellular protein metabolic process (GO:0044267)|erythrocyte differentiation (GO:0030218)|membrane organization (GO:0061024)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	exocyst (GO:0000145)|plasma membrane (GO:0005886)				cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	26		Colorectal(252;0.123)				CCGACTTTTTGACCTTTTATT	0.303																																					p.D415H		.											.	EXOC6-91	0			c.G1243C						.						79.0	80.0	80.0					10																	94700514		2203	4299	6502	SO:0001583	missense	54536	exon13			CTTTTTGACCTTT	BC028395	CCDS7424.2, CCDS31247.1	10q23.33	2013-01-22	2006-11-07	2006-11-07	ENSG00000138190	ENSG00000138190			23196	protein-coding gene	gene with protein product		609672	"""SEC15-like 1 (S. cerevisiae)"""	SEC15L1		8889548	Standard	NM_001013848		Approved	SEC15L, FLJ1125, DKFZp761I2124, MGC33397, Sec15p, EXOC6A	uc001kig.3	Q8TAG9	OTTHUMG00000018767	ENST00000260762.6:c.1243G>C	10.37:g.94700514G>C	ENSP00000260762:p.Asp415His	Somatic	53	0		WXS	Illumina HiSeq	Phase_I	48	3	NM_019053	0	0	6	6	0	E9PHI3|Q5VXH8|Q9NZ24	Missense_Mutation	SNP	ENST00000260762.6	37	CCDS7424.2	.	.	.	.	.	.	.	.	.	.	G	27.0	4.795381	0.90453	.	.	ENSG00000138190	ENST00000371547;ENST00000371552;ENST00000443748;ENST00000260762	T;T;T;T	0.31769	1.48;1.48;1.48;1.48	6.07	6.07	0.98685	.	0.101356	0.64402	D	0.000001	T	0.63379	0.2506	M	0.85542	2.76	0.80722	D	1	D;D;D;D;D	0.89917	0.994;1.0;0.994;0.994;0.994	P;D;P;P;P	0.72075	0.873;0.976;0.873;0.873;0.873	T	0.66052	-0.6019	10	0.87932	D	0	-12.8758	20.6593	0.99626	0.0:0.0:1.0:0.0	.	431;312;407;415;410	F2Z2Q3;E7EW84;B4DEZ1;Q8TAG9;E9PHI3	.;.;.;EXOC6_HUMAN;.	H	431;410;312;415	ENSP00000360602:D431H;ENSP00000360607:D410H;ENSP00000396206:D312H;ENSP00000260762:D415H	ENSP00000260762:D415H	D	+	1	0	EXOC6	94690494	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.837000	0.99465	2.885000	0.99019	0.655000	0.94253	GAC	.		0.303	EXOC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049410.2	NM_019053	
OR10Q1	219960	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	57996225	57996225	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr11:57996225C>T	ENST00000316770.2	-	1	165	c.123G>A	c.(121-123)atG>atA	p.M41I		NM_001004471.2	NP_001004471.1	Q8NGQ4	O10Q1_HUMAN	olfactory receptor, family 10, subfamily Q, member 1	41						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)	35		Breast(21;0.0589)				CACAGAGGATCATCAAGTAGA	0.527																																					p.M41I		.											.	OR10Q1-70	0			c.G123A						.						114.0	122.0	119.0					11																	57996225		2200	4294	6494	SO:0001583	missense	219960	exon1			GAGGATCATCAAG	AB065735	CCDS31547.1	11q12.1	2012-08-09			ENSG00000180475	ENSG00000180475		"""GPCR / Class A : Olfactory receptors"""	15134	protein-coding gene	gene with protein product							Standard	NM_001004471		Approved		uc010rkd.2	Q8NGQ4	OTTHUMG00000167542	ENST00000316770.2:c.123G>A	11.37:g.57996225C>T	ENSP00000314324:p.Met41Ile	Somatic	129	0		WXS	Illumina HiSeq	Phase_I	106	28	NM_001004471	0	0	0	0	0	Q6IFG4	Missense_Mutation	SNP	ENST00000316770.2	37	CCDS31547.1	.	.	.	.	.	.	.	.	.	.	C	8.116	0.779975	0.16120	.	.	ENSG00000180475	ENST00000316770	T	0.00392	7.58	5.28	2.25	0.28309	.	0.123417	0.36555	N	0.002525	T	0.00178	0.0005	N	0.13168	0.305	0.09310	N	1	B	0.34181	0.44	B	0.30646	0.118	T	0.31558	-0.9939	10	0.10377	T	0.69	.	11.4267	0.50015	0.136:0.3334:0.5306:0.0	.	41	Q8NGQ4	O10Q1_HUMAN	I	41	ENSP00000314324:M41I	ENSP00000314324:M41I	M	-	3	0	OR10Q1	57752801	0.000000	0.05858	0.013000	0.15412	0.626000	0.37791	-0.168000	0.09925	0.305000	0.22832	0.650000	0.86243	ATG	.		0.527	OR10Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394706.1	NM_001004471	
PDGFD	80310	hgsc.bcm.edu	37	11	103797648	103797648	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr11:103797648A>T	ENST00000393158.2	-	6	1158	c.979T>A	c.(979-981)Tat>Aat	p.Y327N	PDGFD_ENST00000302251.5_Missense_Mutation_p.Y321N			Q9GZP0	PDGFD_HUMAN	platelet derived growth factor D	327					cellular response to amino acid stimulus (GO:0071230)|multicellular organismal development (GO:0007275)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell division (GO:0051781)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)				biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(8)|prostate(3)|upper_aerodigestive_tract(1)	23		Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Melanoma(852;0.0563)|all_neural(303;0.165)		BRCA - Breast invasive adenocarcinoma(274;0.00136)|Epithelial(105;0.111)		ACCTCATGATACTTTTTCACG	0.458																																					p.Y327N		.											.	PDGFD-723	0			c.T979A						.						84.0	68.0	73.0					11																	103797648		2202	4299	6501	SO:0001583	missense	80310	exon6			CATGATACTTTTT	AF113216	CCDS8326.1, CCDS41703.1	11q22.3	2008-02-05			ENSG00000170962	ENSG00000170962			30620	protein-coding gene	gene with protein product	"""spinal cord derived growth factor B"""	609673				11162582, 11980634	Standard	NM_033135		Approved	SCDGF-B, MSTP036, IEGF	uc001phq.3	Q9GZP0	OTTHUMG00000165953	ENST00000393158.2:c.979T>A	11.37:g.103797648A>T	ENSP00000376865:p.Tyr327Asn	Somatic	36	0		WXS	Illumina HiSeq	Phase_I	17	2	NM_025208	0	0	0	0	0	A8K9T6|Q9BWV5	Missense_Mutation	SNP	ENST00000393158.2	37	CCDS41703.1	.	.	.	.	.	.	.	.	.	.	A	23.2	4.393299	0.83011	.	.	ENSG00000170962	ENST00000393158;ENST00000302251	T;T	0.29142	1.58;1.58	5.88	5.88	0.94601	Platelet-derived growth factor (PDGF) (3);	0.201547	0.45361	D	0.000370	T	0.50871	0.1641	M	0.66939	2.045	0.46113	D	0.998875	D;D	0.57257	0.979;0.974	P;P	0.58331	0.837;0.748	T	0.53528	-0.8426	10	0.87932	D	0	-24.9983	16.2879	0.82732	1.0:0.0:0.0:0.0	.	327;321	Q9GZP0;Q9GZP0-2	PDGFD_HUMAN;.	N	327;321	ENSP00000376865:Y327N;ENSP00000302193:Y321N	ENSP00000302193:Y321N	Y	-	1	0	PDGFD	103302858	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	7.025000	0.76449	2.242000	0.73789	0.533000	0.62120	TAT	.		0.458	PDGFD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387231.2	NM_025208	
PFDN5	5204	hgsc.bcm.edu	37	12	53689653	53689653	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr12:53689653C>G	ENST00000551018.1	+	2	380	c.103C>G	c.(103-105)Cag>Gag	p.Q35E	PFDN5_ENST00000334478.4_Missense_Mutation_p.Q35E|PFDN5_ENST00000351500.3_Intron|PFDN5_ENST00000550846.1_Intron|RP11-680A11.5_ENST00000550263.1_RNA	NM_002624.3	NP_002615.2	Q99471	PFD5_HUMAN	prefoldin subunit 5	35					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription, DNA-templated (GO:0045892)|protein folding (GO:0006457)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|prefoldin complex (GO:0016272)	transcription corepressor activity (GO:0003714)			kidney(1)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(1)	8						GTCCATTGCTCAGCTCAAAGT	0.572																																					p.Q35E		.											.	PFDN5-227	0			c.C103G						.						103.0	86.0	92.0					12																	53689653		2203	4300	6503	SO:0001583	missense	5204	exon2			ATTGCTCAGCTCA	D89667	CCDS8853.1, CCDS8854.1	12q13.13	2008-05-14	2006-02-24						8869	protein-coding gene	gene with protein product		604899	"""prefoldin 5"""			9630229, 9792694	Standard	NM_002624		Approved	PFD5, MM-1	uc001scl.3	Q99471	OTTHUMG00000169675	ENST00000551018.1:c.103C>G	12.37:g.53689653C>G	ENSP00000447942:p.Gln35Glu	Somatic	63	0		WXS	Illumina HiSeq	Phase_I	47	3	NM_002624	0	0	571	571	0	A8K9A8|Q54AA8|Q9C083|Q9C084	Missense_Mutation	SNP	ENST00000551018.1	37	CCDS8853.1	.	.	.	.	.	.	.	.	.	.	C	33	5.198192	0.94997	.	.	ENSG00000123349	ENST00000551018;ENST00000334478	T;T	0.42513	0.97;0.97	5.73	5.73	0.89815	Prefoldin (1);Prefoldin subunit (1);	0.000000	0.85682	D	0.000000	T	0.57858	0.2082	M	0.72576	2.205	0.80722	D	1	P	0.48162	0.906	P	0.52343	0.696	T	0.59273	-0.7485	10	0.66056	D	0.02	.	17.7778	0.88515	0.0:1.0:0.0:0.0	.	35	Q99471	PFD5_HUMAN	E	35	ENSP00000447942:Q35E;ENSP00000334188:Q35E	ENSP00000243040:Q35E	Q	+	1	0	PFDN5	51975920	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.970000	0.76099	2.882000	0.98803	0.655000	0.94253	CAG	.		0.572	PFDN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405368.2		
ZNF385A	25946	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	54764720	54764720	+	Silent	SNP	T	T	C			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr12:54764720T>C	ENST00000338010.5	-	6	878	c.825A>G	c.(823-825)caA>caG	p.Q275Q	ZNF385A_ENST00000551109.1_Silent_p.Q255Q|ZNF385A_ENST00000551771.1_Silent_p.Q174Q|RP11-753H16.3_ENST00000550474.1_RNA|RP11-753H16.5_ENST00000552785.1_RNA|ZNF385A_ENST00000552382.1_5'UTR|ZNF385A_ENST00000352268.6_Silent_p.Q194Q|ZNF385A_ENST00000394313.2_Silent_p.Q255Q|ZNF385A_ENST00000546970.1_Silent_p.Q255Q	NM_001130967.1	NP_001124439.1	Q96PM9	Z385A_HUMAN	zinc finger protein 385A	275	Necessary for binding to ITPR1, CEBPA and p53/TP53 mRNAs. {ECO:0000250}.				apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|hemostasis (GO:0007599)|learning or memory (GO:0007611)|locomotory behavior (GO:0007626)|megakaryocyte development (GO:0035855)|mRNA localization resulting in posttranscriptional regulation of gene expression (GO:0010609)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)|positive regulation of DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:1902164)|positive regulation of fat cell differentiation (GO:0045600)|regulation of cytoplasmic translation (GO:2000765)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA 3'-UTR binding (GO:0003730)|p53 binding (GO:0002039)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)|urinary_tract(1)	15						CCTGTTTCAGTTGGACCTCCG	0.597											OREG0021894	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q275Q		.											.	ZNF385A-23	0			c.A825G						.						89.0	96.0	94.0					12																	54764720		2203	4300	6503	SO:0001819	synonymous_variant	25946	exon6			TTTCAGTTGGACC	AF304052	CCDS8879.1, CCDS44910.1, CCDS44911.1	12q13.13	2012-10-05	2007-12-06	2007-12-06		ENSG00000161642			17521	protein-coding gene	gene with protein product		609124	"""zinc finger protein 385"""	ZNF385			Standard	XM_005268785		Approved	DKFZp586G1122, Hzf, ZFP385	uc001sfy.3	Q96PM9	OTTHUMG00000169840	ENST00000338010.5:c.825A>G	12.37:g.54764720T>C		Somatic	217	0	1002	WXS	Illumina HiSeq	Phase_I	122	34	NM_001130967	0	0	1	2	1	B2RDN5|B4DKH2|F1T0F1|J3KNS3|Q5VH53|Q9H7R6|Q9UFU3	Silent	SNP	ENST00000338010.5	37	CCDS44911.1																																																																																			.		0.597	ZNF385A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406162.1	NM_015481	
PHLDA1	22822	hgsc.bcm.edu	37	12	76424937	76424937	+	Silent	SNP	T	T	C	rs111754051|rs398020175|rs71716769|rs57875368|rs76176478	byFrequency	TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr12:76424937T>C	ENST00000266671.5	-	1	2775	c.585A>G	c.(583-585)caA>caG	p.Q195Q	RP11-290L1.3_ENST00000552367.1_RNA|RP11-290L1.2_ENST00000547721.1_RNA|PHLDA1_ENST00000602540.1_Silent_p.Q54Q			Q8WV24	PHLA1_HUMAN	pleckstrin homology-like domain, family A, member 1	195	PH.|Poly-Gln.				apoptotic process (GO:0006915)|FasL biosynthetic process (GO:0045210)|forebrain neuron differentiation (GO:0021879)|positive regulation of apoptotic process (GO:0043065)	cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	14		Colorectal(145;0.09)				gctgctgctgttgctgctgct	0.652																																					p.Q195Q		.											.	PHLDA1-90	0			c.A585G						.																																			SO:0001819	synonymous_variant	22822	exon1			CTGCTGTTGCTGC	Z50194	CCDS31861.1	12q15	2008-08-05				ENSG00000139289			8933	protein-coding gene	gene with protein product	"""proline-histidine rich protein"""	605335				12384558, 15037619	Standard	NM_007350		Approved	TDAG51, DT1P1B11, PHRIP	uc001sxu.3	Q8WV24		ENST00000266671.5:c.585A>G	12.37:g.76424937T>C		Somatic	51	1		WXS	Illumina HiSeq	Phase_I	33	3	NM_007350	1	6	91	8204	8106	A1A4G9|Q15184|Q2TAN2|Q9NZ17	Silent	SNP	ENST00000266671.5	37	CCDS31861.1																																																																																			.		0.652	PHLDA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405846.2	NM_007350	
C12orf74	338809	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	93100691	93100691	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr12:93100691C>G	ENST00000397833.3	+	2	735	c.284C>G	c.(283-285)tCt>tGt	p.S95C	C12orf74_ENST00000544406.2_Missense_Mutation_p.S95C	NM_001037671.3|NM_001178097.2	NP_001032760.1|NP_001171568.1	Q32Q52	CL074_HUMAN	chromosome 12 open reading frame 74	95										kidney(1)|large_intestine(2)|lung(4)|prostate(1)|urinary_tract(2)	10						CCAAAGGATTCTTCACACTTG	0.582																																					p.S95C		.											.	C12orf74-90	0			c.C284G						.						55.0	59.0	58.0					12																	93100691		1914	4126	6040	SO:0001583	missense	338809	exon2			AGGATTCTTCACA	BC043363	CCDS41819.1, CCDS53818.1	12q22	2012-08-16			ENSG00000214215	ENSG00000214215			27887	protein-coding gene	gene with protein product						12477932	Standard	NM_001037671		Approved		uc001tch.2	Q32Q52	OTTHUMG00000170105	ENST00000397833.3:c.284C>G	12.37:g.93100691C>G	ENSP00000380933:p.Ser95Cys	Somatic	138	0		WXS	Illumina HiSeq	Phase_I	87	23	NM_001037671	0	0	0	0	0	F5H4P0	Missense_Mutation	SNP	ENST00000397833.3	37	CCDS41819.1	.	.	.	.	.	.	.	.	.	.	C	11.05	1.525193	0.27299	.	.	ENSG00000214215	ENST00000397833;ENST00000544406	.	.	.	4.98	0.507	0.16967	.	.	.	.	.	T	0.24314	0.0589	N	0.24115	0.695	0.09310	N	1	B;B	0.20261	0.043;0.043	B;B	0.21546	0.035;0.035	T	0.20940	-1.0260	8	0.37606	T	0.19	.	3.0572	0.06188	0.175:0.401:0.327:0.097	.	95;95	F5H4P0;Q32Q52	.;CL074_HUMAN	C	95	.	ENSP00000380933:S95C	S	+	2	0	C12orf74	91624822	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.457000	0.06745	0.212000	0.20703	0.462000	0.41574	TCT	.		0.582	C12orf74-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407285.1	NM_001037671	
HS3ST6	64711	hgsc.bcm.edu	37	16	1962102	1962102	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr16:1962102T>C	ENST00000293937.3	-	2	517	c.518A>G	c.(517-519)gAc>gGc	p.D173G	HS3ST6_ENST00000443547.1_Missense_Mutation_p.D142G|HS3ST6_ENST00000454677.2_Missense_Mutation_p.D190G			Q96QI5	HS3S6_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 6	173					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)			endometrium(2)|lung(2)	4						CAGCTTCGTGTCCGGGGACAT	0.682																																					p.D142G		.											.	.	0			c.A425G						.						20.0	23.0	22.0					16																	1962102		2196	4299	6495	SO:0001583	missense	64711	exon2			TTCGTGTCCGGGG			16p13.3	2008-10-30	2003-06-11	2003-06-13	ENSG00000162040	ENSG00000162040		"""Sulfotransferases, membrane-bound"""	14178	protein-coding gene	gene with protein product			"""heparan sulfate (glucosamine) 3-O-sulfotransferase 5"""	HS3ST5		11157797	Standard	NM_001009606		Approved		uc002cnf.3	Q96QI5	OTTHUMG00000047860	ENST00000293937.3:c.518A>G	16.37:g.1962102T>C	ENSP00000293937:p.Asp173Gly	Somatic	41	0		WXS	Illumina HiSeq	Phase_I	18	3	NM_001009606	0	0	2	2	0	Q96RX7	Missense_Mutation	SNP	ENST00000293937.3	37		.	.	.	.	.	.	.	.	.	.	t	9.096	1.002873	0.19121	.	.	ENSG00000162040	ENST00000293937;ENST00000443547;ENST00000454677	T;T	0.57595	0.39;0.39	4.83	2.5	0.30297	Sulfotransferase domain (1);	0.401910	0.29126	N	0.013071	T	0.43033	0.1229	L	0.42632	1.34	0.31735	N	0.636552	B	0.02656	0.0	B	0.10450	0.005	T	0.44128	-0.9348	10	0.42905	T	0.14	.	10.9406	0.47270	0.0:0.0:0.3168:0.6832	.	173	Q96QI5	HS3S6_HUMAN	G	173;142;212	ENSP00000293937:D173G;ENSP00000390354:D142G	ENSP00000293937:D173G	D	-	2	0	HS3ST6	1902103	1.000000	0.71417	0.850000	0.33497	0.970000	0.65996	2.195000	0.42677	0.207000	0.20607	0.409000	0.27619	GAC	.		0.682	HS3ST6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001009606	
KCNJ12	3768	broad.mit.edu;bcgsc.ca	37	17	21319100	21319100	+	Missense_Mutation	SNP	G	G	A	rs534524767	byFrequency	TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr17:21319100G>A	ENST00000583088.1	+	3	1341	c.446G>A	c.(445-447)cGc>cAc	p.R149H	KCNJ12_ENST00000331718.5_Missense_Mutation_p.R149H	NM_021012.4	NP_066292.2	Q14500	KCJ12_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 12	149					muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart contraction (GO:0008016)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			NS(1)|breast(4)|endometrium(4)|kidney(1)|large_intestine(5)|lung(39)|ovary(5)|skin(8)|stomach(3)	70				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)|Yohimbine(DB01392)	TACGGGCTGCGCTGTGTGACG	0.642										Prostate(3;0.18)			.|||	5	0.000998403	0.0	0.0	5008	,	,		35116	0.0		0.0	False		,,,				2504	0.0051				p.R149H													.	.	0			c.G446A						.						55.0	53.0	54.0					17																	21319100		2203	4300	6503	SO:0001583	missense	100134444	exon3			GGCTGCGCTGTGT	L36069	CCDS11219.1	17p11.1	2011-07-05	2004-01-13		ENSG00000184185	ENSG00000184185		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6258	protein-coding gene	gene with protein product		602323	"""potassium inwardly-rectifying channel, subfamily J, inhibitor 1"""	KCNJN1		7859381, 12417321, 16382105	Standard	NM_021012		Approved	Kir2.2, Kir2.2v, IRK2, hIRK1	uc021tss.1	Q14500	OTTHUMG00000132039	ENST00000583088.1:c.446G>A	17.37:g.21319100G>A	ENSP00000463778:p.Arg149His	Somatic	94	0		WXS	Illumina HiSeq	Phase_I	68	5	NM_001194958	0	0	0	0	0	O43401|Q15756|Q8NG63	Missense_Mutation	SNP	ENST00000583088.1	37	CCDS11219.1	.	.	.	.	.	.	.	.	.	.	G	29.4	4.998856	0.93227	.	.	ENSG00000184185	ENST00000331718	D	0.97016	-4.21	5.32	5.32	0.75619	Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);	0.000000	0.85682	D	0.000000	D	0.98735	0.9575	H	0.94808	3.585	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99663	1.0994	10	0.87932	D	0	.	18.9979	0.92821	0.0:0.0:1.0:0.0	.	149	Q14500	IRK12_HUMAN	H	149	ENSP00000328150:R149H	ENSP00000328150:R149H	R	+	2	0	KCNJ12	21259693	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.690000	0.98676	2.496000	0.84212	0.655000	0.94253	CGC	.		0.642	KCNJ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255060.2	NM_021012	
SUZ12	23512	hgsc.bcm.edu	37	17	30323881	30323881	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr17:30323881A>G	ENST00000322652.5	+	15	2088	c.1859A>G	c.(1858-1860)cAt>cGt	p.H620R	SUZ12_ENST00000580398.1_Missense_Mutation_p.H597R	NM_015355.2	NP_056170.2	Q15022	SUZ12_HUMAN	SUZ12 polycomb repressive complex 2 subunit	620	VEFS-box.				histone ubiquitination (GO:0016574)|negative regulation of cell differentiation (GO:0045596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|histone methyltransferase activity (GO:0042054)|metal ion binding (GO:0046872)|methylated histone binding (GO:0035064)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)		SSH2/SUZ12(2)|JAZF1/SUZ12(133)	breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|lung(5)|skin(1)	21		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.041)|Ovarian(249;0.182)|Breast(31;0.231)				TGGAATCTCCATGTCATGAAG	0.308			T	JAZF1	endometrial stromal tumours																																p.H620R		.		Dom	yes		17	17q11.2	23512	suppressor of zeste 12 homolog (Drosophila)		M	.	SUZ12-658	0			c.A1859G						.						49.0	51.0	50.0					17																	30323881		2202	4295	6497	SO:0001583	missense	23512	exon15			ATCTCCATGTCAT	D63881	CCDS11270.1	17q21	2013-06-05	2013-06-05		ENSG00000178691	ENSG00000178691		"""Zinc fingers, C2H2-type"""	17101	protein-coding gene	gene with protein product		606245	"""suppressor of zeste 12 homolog (Drosophila)"""			8590280, 11371647, 18784248	Standard	NM_015355		Approved	JJAZ1, KIAA0160, CHET9	uc002hgs.2	Q15022	OTTHUMG00000132813	ENST00000322652.5:c.1859A>G	17.37:g.30323881A>G	ENSP00000316578:p.His620Arg	Somatic	37	0		WXS	Illumina HiSeq	Phase_I	37	3	NM_015355	0	0	16	16	0	Q96BD9	Missense_Mutation	SNP	ENST00000322652.5	37	CCDS11270.1	.	.	.	.	.	.	.	.	.	.	a	14.14	2.447028	0.43429	.	.	ENSG00000178691	ENST00000322652	T	0.54071	0.59	5.67	5.67	0.87782	Polycomb protein, VEFS-Box (1);	0.105878	0.64402	D	0.000002	T	0.72637	0.3485	M	0.76574	2.34	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.80764	0.994;0.994	T	0.76124	-0.3074	10	0.72032	D	0.01	-1.1555	15.9473	0.79803	1.0:0.0:0.0:0.0	.	620;620	A8K1U9;Q15022	.;SUZ12_HUMAN	R	620	ENSP00000316578:H620R	ENSP00000316578:H620R	H	+	2	0	SUZ12	27347994	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.942000	0.92970	2.164000	0.68074	0.456000	0.33151	CAT	.		0.308	SUZ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256260.2	NM_015355	
COASY	80347	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	40717244	40717244	+	Splice_Site	SNP	G	G	T			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr17:40717244G>T	ENST00000393818.2	+	6	1758		c.e6-1		COASY_ENST00000449624.1_Splice_Site|MLX_ENST00000346833.4_5'Flank|MLX_ENST00000435881.2_5'Flank|MLX_ENST00000246912.4_5'Flank|COASY_ENST00000420359.1_Splice_Site|COASY_ENST00000421097.2_Splice_Site|COASY_ENST00000590958.1_Splice_Site	NM_025233.6	NP_079509.5	Q13057	COASY_HUMAN	CoA synthase						cell death (GO:0008219)|coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|dephospho-CoA kinase activity (GO:0004140)|pantetheine-phosphate adenylyltransferase activity (GO:0004595)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)	21		all_cancers(22;1.06e-05)|Breast(137;0.000153)|all_epithelial(22;0.000344)		BRCA - Breast invasive adenocarcinoma(366;0.13)		CCCCTCCCCAGAAGCAGCTGA	0.562																																					.		.											.	COASY-115	0			c.1303-1G>T						.						135.0	138.0	137.0					17																	40717244		2203	4300	6503	SO:0001630	splice_region_variant	80347	exon7			TCCCCAGAAGCAG	AF453478	CCDS11429.1, CCDS45685.1	17q12-q21	2010-04-30	2010-04-30			ENSG00000068120	2.7.7.3		29932	protein-coding gene	gene with protein product		609855	"""Coenzyme A synthase"""			11923312, 11980892	Standard	NM_025233		Approved	DPCK, NBP, CoASY, PPAT	uc010cyj.4	Q13057		ENST00000393818.2:c.1303-1G>T	17.37:g.40717244G>T		Somatic	307	0		WXS	Illumina HiSeq	Phase_I	219	45	NM_001042529	0	0	0	2	2	B2RA78|B4DLU0|Q6GS23|Q8NBM7|Q8NEW1|Q8WXD4|Q9NRM3	Splice_Site	SNP	ENST00000393818.2	37	CCDS11429.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.197183	0.79015	.	.	ENSG00000068120	ENST00000421097;ENST00000449624;ENST00000420359;ENST00000393818	.	.	.	5.56	5.56	0.83823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.7387	0.85454	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	COASY	37970770	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	8.174000	0.89682	2.649000	0.89929	0.556000	0.70494	.	.		0.562	COASY-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450409.1	NM_025233	Intron
AOC2	314	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	40997487	40997487	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr17:40997487G>C	ENST00000253799.3	+	1	871	c.844G>C	c.(844-846)Gtg>Ctg	p.V282L	AOC2_ENST00000452774.2_Missense_Mutation_p.V282L	NM_009590.2	NP_033720.2	O75106	AOC2_HUMAN	amine oxidase, copper containing 2 (retina-specific)	282					amine metabolic process (GO:0009308)|catecholamine metabolic process (GO:0006584)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	aliphatic-amine oxidase activity (GO:0052595)|aminoacetone:oxygen oxidoreductase(deaminating) activity (GO:0052594)|copper ion binding (GO:0005507)|electron carrier activity (GO:0009055)|phenethylamine:oxygen oxidoreductase (deaminating) activity (GO:0052596)|primary amine oxidase activity (GO:0008131)|quinone binding (GO:0048038)|tryptamine:oxygen oxidoreductase (deaminating) activity (GO:0052593)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(14)|ovary(4)|skin(2)	30		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)		CCGGTTGGAAGTGGTTAGAGT	0.572																																					p.V282L		.											.	AOC2-92	0			c.G844C						.						85.0	85.0	85.0					17																	40997487		2203	4300	6503	SO:0001583	missense	314	exon1			TTGGAAGTGGTTA	AF081363	CCDS11443.1, CCDS45690.1	17q21	2012-07-13				ENSG00000131480	1.4.3.21		549	protein-coding gene	gene with protein product		602268				9119395, 9722954	Standard	NM_001158		Approved	RAO, DAO2	uc002ibu.3	O75106		ENST00000253799.3:c.844G>C	17.37:g.40997487G>C	ENSP00000253799:p.Val282Leu	Somatic	116	0		WXS	Illumina HiSeq	Phase_I	102	23	NM_009590	0	0	0	0	0	A5PKW2|O00120|O75105|Q4TTW5|Q9UNY0	Missense_Mutation	SNP	ENST00000253799.3	37	CCDS11443.1	.	.	.	.	.	.	.	.	.	.	G	12.32	1.902404	0.33628	.	.	ENSG00000131480	ENST00000253799;ENST00000452774	T;T	0.22945	1.93;1.93	5.75	5.75	0.90469	Copper amine oxidase, N2/N3-terminal (1);Copper amine oxidase, N-terminal (1);	0.267133	0.37219	N	0.002188	T	0.18087	0.0434	N	0.08118	0	0.19945	N	0.99994	P;P	0.50617	0.533;0.937	B;P	0.49561	0.069;0.615	T	0.16424	-1.0403	10	0.10902	T	0.67	-33.3282	14.1397	0.65311	0.0717:0.0:0.9283:0.0	.	282;282	O75106;O75106-2	AOC2_HUMAN;.	L	282	ENSP00000253799:V282L;ENSP00000406134:V282L	ENSP00000253799:V282L	V	+	1	0	AOC2	38251013	0.986000	0.35501	0.707000	0.30419	0.755000	0.42902	2.284000	0.43478	2.720000	0.93068	0.561000	0.74099	GTG	.		0.572	AOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452442.1	NM_009590, NM_001158	
MAPT	4137	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	44101444	44101444	+	Silent	SNP	C	C	G			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr17:44101444C>G	ENST00000571987.1	+	13	2184	c.2184C>G	c.(2182-2184)gtC>gtG	p.V728V	MAPT_ENST00000262410.5_Silent_p.V728V|MAPT_ENST00000347967.5_Silent_p.V286V|MAPT_ENST00000334239.8_Silent_p.V322V|MAPT_ENST00000351559.5_Silent_p.V411V|MAPT_ENST00000431008.3_Silent_p.V380V|MAPT_ENST00000344290.5_Silent_p.V746V|MAPT_ENST00000574436.1_Silent_p.V411V|MAPT_ENST00000446361.3_Silent_p.V353V|MAPT_ENST00000535772.1_Silent_p.V380V|MAPT_ENST00000576518.1_Silent_p.V311V|MAPT_ENST00000415613.2_Silent_p.V746V|MAPT_ENST00000420682.2_Silent_p.V382V|MAPT_ENST00000340799.5_Silent_p.V382V			P10636	TAU_HUMAN	microtubule-associated protein tau	728					adult walking behavior (GO:0007628)|apoptotic process (GO:0006915)|axon cargo transport (GO:0008088)|axon extension (GO:0048675)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|generation of neurons (GO:0048699)|microtubule cytoskeleton organization (GO:0000226)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of microtubule polymerization (GO:0031116)|regulation of autophagy (GO:0010506)|regulation of microtubule polymerization (GO:0031113)|regulation of microtubule-based movement (GO:0060632)	axon (GO:0030424)|axoneme (GO:0005930)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|growth cone (GO:0030426)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nuclear periphery (GO:0034399)|plasma membrane (GO:0005886)|tubulin complex (GO:0045298)	apolipoprotein binding (GO:0034185)|enzyme binding (GO:0019899)|lipoprotein particle binding (GO:0071813)|microtubule binding (GO:0008017)|SH3 domain binding (GO:0017124)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	38		Melanoma(429;0.216)			Docetaxel(DB01248)|Paclitaxel(DB01229)	TCAGCAATGTCTCCTCCACCG	0.622																																					p.V746V		.											.	MAPT-91	0			c.C2238G						.						124.0	105.0	112.0					17																	44101444		2203	4300	6503	SO:0001819	synonymous_variant	4137	exon15			CAATGTCTCCTCC	J03778	CCDS11499.1, CCDS11500.1, CCDS11501.1, CCDS11502.1, CCDS45715.1, CCDS45716.1, CCDS56033.1	17q21	2014-09-17			ENSG00000186868	ENSG00000186868			6893	protein-coding gene	gene with protein product	"""G protein beta1/gamma2 subunit-interacting factor 1"", ""microtubule-associated protein tau, isoform 4"", ""protein phosphatase 1, regulatory subunit 103"""	157140		DDPAC, MAPTL		7936241, 3131773	Standard	NM_001123067		Approved	MTBT1, tau, PPND, FTDP-17, TAU, MSTD, MTBT2, FLJ31424, MGC138549, PPP1R103	uc010dau.3	P10636	OTTHUMG00000168833	ENST00000571987.1:c.2184C>G	17.37:g.44101444C>G		Somatic	186	0		WXS	Illumina HiSeq	Phase_I	155	10	NM_001123066	0	0	0	0	0	P18518|Q14799|Q15549|Q15550|Q15551|Q1RMF6|Q53YB1|Q5CZI7|Q5XWF0|Q6QT54|Q9UDJ3|Q9UMH0|Q9UQ96	Silent	SNP	ENST00000571987.1	37	CCDS11501.1																																																																																			.		0.622	MAPT-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000440133.1	NM_016835	
TYMS	7298	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	662242	662242	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr18:662242A>G	ENST00000323274.10	+	3	515	c.376A>G	c.(376-378)Aga>Gga	p.R126G	TYMS_ENST00000323224.7_Missense_Mutation_p.R126G|TYMS_ENST00000323250.5_Intron	NM_001071.2	NP_001062.1	P04818	TYSY_HUMAN	thymidylate synthetase	126					aging (GO:0007568)|cartilage development (GO:0051216)|circadian rhythm (GO:0007623)|deoxyribonucleoside monophosphate biosynthetic process (GO:0009157)|developmental growth (GO:0048589)|dTMP biosynthetic process (GO:0006231)|dTTP biosynthetic process (GO:0006235)|dUMP metabolic process (GO:0046078)|G1/S transition of mitotic cell cycle (GO:0000082)|immortalization of host cell by virus (GO:0019088)|intestinal epithelial cell maturation (GO:0060574)|mitotic cell cycle (GO:0000278)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|organ regeneration (GO:0031100)|polysaccharide metabolic process (GO:0005976)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside biosynthetic process (GO:0046134)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|response to organophosphorus (GO:0046683)|response to progesterone (GO:0032570)|response to toxic substance (GO:0009636)|response to vitamin A (GO:0033189)|small molecule metabolic process (GO:0044281)|tetrahydrofolate metabolic process (GO:0046653)|uracil metabolic process (GO:0019860)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cofactor binding (GO:0048037)|drug binding (GO:0008144)|folic acid binding (GO:0005542)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|thymidylate synthase activity (GO:0004799)			endometrium(1)|large_intestine(3)|lung(2)|urinary_tract(2)	8					Capecitabine(DB01101)|Floxuridine(DB00322)|Fluorouracil(DB00544)|Gemcitabine(DB00441)|Leucovorin(DB00650)|Methotrexate(DB00563)|Pemetrexed(DB00642)|Pralatrexate(DB06813)|Raltitrexed(DB00293)|Trifluridine(DB00432)|Trimethoprim(DB00440)	ATTCTCCACCAGAGAAGAAGG	0.498																																					p.R126G		.											.	TYMS-227	0			c.A376G						.						249.0	271.0	264.0					18																	662242		2203	4300	6503	SO:0001583	missense	7298	exon3			TCCACCAGAGAAG	X02308	CCDS11821.1	18p11.31-p11.21	2014-09-17			ENSG00000176890	ENSG00000176890	2.1.1.45		12441	protein-coding gene	gene with protein product		188350		TS			Standard	NM_001071		Approved	Tsase, TMS, HsT422	uc010dka.1	P04818	OTTHUMG00000131473	ENST00000323274.10:c.376A>G	18.37:g.662242A>G	ENSP00000315644:p.Arg126Gly	Somatic	528	1		WXS	Illumina HiSeq	Phase_I	416	65	NM_001071	0	0	45	56	11	Q8WYK3|Q8WYK4	Missense_Mutation	SNP	ENST00000323274.10	37	CCDS11821.1	.	.	.	.	.	.	.	.	.	.	A	12.29	1.893809	0.33442	.	.	ENSG00000176890	ENST00000323274;ENST00000323224	.	.	.	5.7	2.02	0.26589	Thymidylate synthase/dCMP hydroxymethylase domain (2);	0.000000	0.85682	D	0.000000	D	0.84334	0.5449	H	0.94222	3.51	0.80722	D	1	B;B	0.32051	0.325;0.354	B;P	0.46629	0.198;0.522	D	0.85170	0.0997	9	0.87932	D	0	-23.4672	14.3261	0.66521	0.5015:0.4985:0.0:0.0	.	126;126	Q8WYK3;P04818	.;TYSY_HUMAN	G	126	.	ENSP00000314727:R126G	R	+	1	2	TYMS	652242	0.843000	0.29541	0.251000	0.24312	0.407000	0.30961	1.774000	0.38573	0.089000	0.17243	0.460000	0.39030	AGA	.		0.498	TYMS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254316.1	NM_001071	
NDC80	10403	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	2616466	2616466	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr18:2616466G>C	ENST00000261597.4	+	17	2004	c.1822G>C	c.(1822-1824)Gat>Cat	p.D608H		NM_006101.2	NP_006092.1	O14777	NDC80_HUMAN	NDC80 kinetochore complex component	608	Interaction with NEK2 and ZWINT.|Interaction with the C-terminus of CDCA1 and the SPBC24-SPBC25 subcomplex.				attachment of spindle microtubules to kinetochore (GO:0008608)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)	chromosome, centromeric region (GO:0000775)|condensed chromosome kinetochore (GO:0000777)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)				NS(1)|biliary_tract(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(2)|urinary_tract(2)	22						TGCTAAAGTTGATAGAGAATA	0.269																																					p.D608H		.											.	NDC80-91	0			c.G1822C						.						44.0	47.0	46.0					18																	2616466		2200	4284	6484	SO:0001583	missense	10403	exon17			AAAGTTGATAGAG	AF017790	CCDS11827.1	18p11.31	2013-01-17	2013-01-17	2007-03-02	ENSG00000080986	ENSG00000080986			16909	protein-coding gene	gene with protein product		607272	"""highly expressed in cancer, rich in leucine heptad repeats (yeast)"", ""kinetochore associated 2"", ""NDC80 kinetochore complex component homolog (S. cerevisiae)"""	KNTC2		9315664, 12351790	Standard	NM_006101		Approved	HEC, HEC1, hsNDC80, TID3	uc002kli.3	O14777	OTTHUMG00000131483	ENST00000261597.4:c.1822G>C	18.37:g.2616466G>C	ENSP00000261597:p.Asp608His	Somatic	58	0		WXS	Illumina HiSeq	Phase_I	60	17	NM_006101	0	0	35	35	0	Q6PJX2	Missense_Mutation	SNP	ENST00000261597.4	37	CCDS11827.1	.	.	.	.	.	.	.	.	.	.	G	8.778	0.927542	0.18056	.	.	ENSG00000080986	ENST00000261597	T	0.51325	0.71	5.32	3.48	0.39840	.	0.281499	0.39834	N	0.001252	T	0.43942	0.1270	M	0.62723	1.935	0.38915	D	0.957602	P	0.39216	0.664	B	0.38655	0.278	T	0.42498	-0.9448	10	0.46703	T	0.11	-22.92	9.4287	0.38597	0.0766:0.0:0.7799:0.1435	.	608	O14777	NDC80_HUMAN	H	608	ENSP00000261597:D608H	ENSP00000261597:D608H	D	+	1	0	NDC80	2606466	0.973000	0.33851	0.655000	0.29622	0.368000	0.29767	1.715000	0.37971	0.699000	0.31761	-0.266000	0.10368	GAT	.		0.269	NDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254327.1	NM_006101	
NDC80	10403	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	2616517	2616517	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr18:2616517G>C	ENST00000261597.4	+	17	2055	c.1873G>C	c.(1873-1875)Gag>Cag	p.E625Q		NM_006101.2	NP_006092.1	O14777	NDC80_HUMAN	NDC80 kinetochore complex component	625	Interaction with the C-terminus of CDCA1 and the SPBC24-SPBC25 subcomplex.				attachment of spindle microtubules to kinetochore (GO:0008608)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)	chromosome, centromeric region (GO:0000775)|condensed chromosome kinetochore (GO:0000777)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)				NS(1)|biliary_tract(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(2)|urinary_tract(2)	22						AAATATTAAAGAGATTAGAGA	0.299																																					p.E625Q		.											.	NDC80-91	0			c.G1873C						.						40.0	43.0	42.0					18																	2616517		2199	4282	6481	SO:0001583	missense	10403	exon17			ATTAAAGAGATTA	AF017790	CCDS11827.1	18p11.31	2013-01-17	2013-01-17	2007-03-02	ENSG00000080986	ENSG00000080986			16909	protein-coding gene	gene with protein product		607272	"""highly expressed in cancer, rich in leucine heptad repeats (yeast)"", ""kinetochore associated 2"", ""NDC80 kinetochore complex component homolog (S. cerevisiae)"""	KNTC2		9315664, 12351790	Standard	NM_006101		Approved	HEC, HEC1, hsNDC80, TID3	uc002kli.3	O14777	OTTHUMG00000131483	ENST00000261597.4:c.1873G>C	18.37:g.2616517G>C	ENSP00000261597:p.Glu625Gln	Somatic	38	0		WXS	Illumina HiSeq	Phase_I	37	10	NM_006101	0	0	32	43	11	Q6PJX2	Missense_Mutation	SNP	ENST00000261597.4	37	CCDS11827.1	.	.	.	.	.	.	.	.	.	.	G	7.891	0.732376	0.15507	.	.	ENSG00000080986	ENST00000261597	T	0.49432	0.78	5.47	4.59	0.56863	.	0.333418	0.34245	N	0.004123	T	0.34948	0.0915	L	0.47716	1.5	0.28039	N	0.933831	P	0.39216	0.664	B	0.34242	0.178	T	0.18871	-1.0323	10	0.15066	T	0.55	-4.8199	10.1561	0.42823	0.0768:0.137:0.7862:0.0	.	625	O14777	NDC80_HUMAN	Q	625	ENSP00000261597:E625Q	ENSP00000261597:E625Q	E	+	1	0	NDC80	2606517	1.000000	0.71417	0.991000	0.47740	0.167000	0.22549	2.210000	0.42816	1.407000	0.46875	0.555000	0.69702	GAG	.		0.299	NDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254327.1	NM_006101	
SEMA6B	10501	hgsc.bcm.edu	37	19	4544313	4544313	+	Missense_Mutation	SNP	T	T	C	rs564925636		TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr19:4544313T>C	ENST00000586582.1	-	17	2277	c.1967A>G	c.(1966-1968)gAg>gGg	p.E656G	RN7SL121P_ENST00000584223.1_RNA|SEMA6B_ENST00000586965.1_Intron|SEMA6B_ENST00000301293.3_Missense_Mutation_p.E656G	NM_032108.3	NP_115484.2	Q9H3T3	SEM6B_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6B	656					cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(1)|central_nervous_system(2)|large_intestine(4)|lung(11)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)		cgccctgcgctcgcccAGGCG	0.796													T|||	1	0.000199681	0.0	0.0	5008	,	,		4939	0.0		0.001	False		,,,				2504	0.0				p.E656G		.											.	SEMA6B-91	0			c.A1967G						.																																			SO:0001583	missense	10501	exon17			CTGCGCTCGCCCA	AB022433	CCDS12131.1	19p13.3	2008-07-22				ENSG00000167680		"""Semaphorins"""	10739	protein-coding gene	gene with protein product	"""Sema VIb"", ""semaphorin Z"", ""semaphorin VIB"""	608873		SEMAN		9361278	Standard	NM_032108		Approved	semaZ, SEMA-VIB, SEM-SEMA-Y	uc010dud.2	Q9H3T3		ENST00000586582.1:c.1967A>G	19.37:g.4544313T>C	ENSP00000467290:p.Glu656Gly	Somatic	4	1		WXS	Illumina HiSeq	Phase_I	2	2	NM_032108	0	0	0	0	0	A5PKU4|F6IB19|Q9NRK9	Missense_Mutation	SNP	ENST00000586582.1	37	CCDS12131.1	.	.	.	.	.	.	.	.	.	.	.	6.330	0.429030	0.11987	.	.	ENSG00000167680	ENST00000301293;ENST00000301292	T	0.18657	2.2	3.38	3.38	0.38709	.	1.330970	0.05416	N	0.543405	T	0.28863	0.0716	N	0.12182	0.205	0.34419	D	0.697296	D	0.71674	0.998	D	0.70227	0.968	T	0.25676	-1.0125	10	0.87932	D	0	.	8.1934	0.31381	0.0:0.0:0.0:1.0	.	656	Q9H3T3	SEM6B_HUMAN	G	656	ENSP00000301293:E656G	ENSP00000301292:E656G	E	-	2	0	SEMA6B	4495313	0.982000	0.34865	0.987000	0.45799	0.244000	0.25665	0.903000	0.28475	1.166000	0.42689	0.397000	0.26171	GAG	.		0.796	SEMA6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458656.2	NM_032108	
FBXW9	84261	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	12800616	12800616	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr19:12800616G>A	ENST00000380339.3	-	7	1231	c.1195C>T	c.(1195-1197)Cac>Tac	p.H399Y	CTD-2659N19.2_ENST00000585742.1_RNA|FBXW9_ENST00000587955.1_Missense_Mutation_p.H389Y|FBXW9_ENST00000544494.1_Missense_Mutation_p.H107Y|CTD-2192J16.26_ENST00000593554.1_lincRNA|FBXW9_ENST00000393261.3_Missense_Mutation_p.H369Y			Q5XUX1	FBXW9_HUMAN	F-box and WD repeat domain containing 9	399					SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)					cervix(1)|lung(4)|ovary(1)|prostate(1)	7						GCGAAGACGTGCAGCAGGCCC	0.647																																					p.H369Y		.											.	FBXW9-227	0			c.C1105T						.						63.0	62.0	62.0					19																	12800616		2203	4300	6503	SO:0001583	missense	84261	exon7			AGACGTGCAGCAG	BC004290	CCDS12278.2	19p13.2	2013-01-09	2007-02-08		ENSG00000132004	ENSG00000132004		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	28136	protein-coding gene	gene with protein product		609074	"""F-box and WD-40 domain protein 9"""			12477932	Standard	NM_032301		Approved	MGC10870, Fbw9	uc002mum.1	Q5XUX1	OTTHUMG00000150152	ENST00000380339.3:c.1195C>T	19.37:g.12800616G>A	ENSP00000369696:p.His399Tyr	Somatic	180	0		WXS	Illumina HiSeq	Phase_I	98	22	NM_032301	0	0	11	24	13	B3KVP7|Q9BT89	Missense_Mutation	SNP	ENST00000380339.3	37		.	.	.	.	.	.	.	.	.	.	G	11.70	1.716443	0.30413	.	.	ENSG00000132004	ENST00000544494;ENST00000393261;ENST00000380339	T;T;T	0.75367	-0.93;-0.93;-0.93	4.62	3.5	0.40072	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.191473	0.45361	N	0.000365	T	0.48390	0.1497	N	0.11106	0.095	0.42212	D	0.991813	B;B;B	0.28880	0.226;0.011;0.002	B;B;B	0.22386	0.039;0.023;0.006	T	0.51356	-0.8716	10	0.51188	T	0.08	-14.7405	3.666	0.08255	0.3848:0.0:0.6152:0.0	.	389;399;369	Q5XUX1-2;Q5XUX1;Q5XUX1-3	.;FBXW9_HUMAN;.	Y	107;369;399	ENSP00000442714:H107Y;ENSP00000376945:H369Y;ENSP00000369696:H399Y	ENSP00000369696:H399Y	H	-	1	0	FBXW9	12661616	1.000000	0.71417	1.000000	0.80357	0.522000	0.34438	3.310000	0.51911	2.129000	0.65627	0.484000	0.47621	CAC	.		0.647	FBXW9-201	KNOWN	basic	protein_coding	protein_coding		NM_032301	
KLHL26	55295	broad.mit.edu	37	19	18778682	18778682	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr19:18778682G>A	ENST00000300976.4	+	3	565	c.475G>A	c.(475-477)Gcc>Acc	p.A159T	KLHL26_ENST00000599006.1_Intron|KLHL26_ENST00000596843.1_3'UTR	NM_018316.1	NP_060786.1	Q53HC5	KLH26_HUMAN	kelch-like family member 26	159										breast(1)|central_nervous_system(1)|kidney(1)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17						CCTGAAGGCGGCCATGAGCGT	0.647																																					p.A159T													.	KLHL26-91	0			c.G475A						.						83.0	66.0	72.0					19																	18778682		2203	4299	6502	SO:0001583	missense	55295	exon3			AAGGCGGCCATGA		CCDS12384.1	19p13.11	2013-10-15	2013-02-22		ENSG00000167487	ENSG00000167487		"""Kelch-like"", ""BTB/POZ domain containing"""	25623	protein-coding gene	gene with protein product			"""kelch-like 26 (Drosophila)"""				Standard	XM_006722785		Approved		uc002njz.1	Q53HC5	OTTHUMG00000183114	ENST00000300976.4:c.475G>A	19.37:g.18778682G>A	ENSP00000300976:p.Ala159Thr	Somatic	82	0		WXS	Illumina HiSeq	Phase_I	48	3	NM_018316	0	0	9	9	0	Q8TAP0|Q9NUX3	Missense_Mutation	SNP	ENST00000300976.4	37	CCDS12384.1	.	.	.	.	.	.	.	.	.	.	G	19.26	3.793922	0.70452	.	.	ENSG00000167487	ENST00000300976	T	0.75260	-0.92	5.04	5.04	0.67666	BTB/POZ-like (1);BTB/POZ fold (1);	0.000000	0.85682	D	0.000000	T	0.66665	0.2812	N	0.25485	0.75	0.80722	D	1	P	0.41188	0.741	B	0.42462	0.388	T	0.65331	-0.6194	9	.	.	.	.	17.3648	0.87360	0.0:0.0:1.0:0.0	.	159	Q53HC5	KLH26_HUMAN	T	159	ENSP00000300976:A159T	.	A	+	1	0	KLHL26	18639682	1.000000	0.71417	0.961000	0.40146	0.650000	0.38633	9.323000	0.96364	2.341000	0.79615	0.591000	0.81541	GCC	.		0.647	KLHL26-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465145.1	NM_018316	
CCDC85A	114800	broad.mit.edu	37	2	56420491	56420491	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr2:56420491G>A	ENST00000407595.2	+	2	1658	c.1156G>A	c.(1156-1158)Gga>Aga	p.G386R	RP11-482H16.1_ENST00000607540.1_RNA	NM_001080433.1	NP_001073902.1	Q96PX6	CC85A_HUMAN	coiled-coil domain containing 85A	386										breast(6)|cervix(2)|endometrium(5)|kidney(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)	38			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			AGGCAGCGGCGGAGGCAGCAG	0.627																																					p.G386R													.	CCDC85A-73	0			c.G1156A						.						24.0	30.0	28.0					2																	56420491		2195	4299	6494	SO:0001583	missense	114800	exon2			AGCGGCGGAGGCA	AB067499	CCDS46290.1	2p16.1	2006-03-29			ENSG00000055813	ENSG00000055813			29400	protein-coding gene	gene with protein product						11572484	Standard	NM_001080433		Approved	KIAA1912	uc002rzn.3	Q96PX6	OTTHUMG00000152033	ENST00000407595.2:c.1156G>A	2.37:g.56420491G>A	ENSP00000384040:p.Gly386Arg	Somatic	16	0		WXS	Illumina HiSeq	Phase_I	13	3	NM_001080433	0	0	0	0	0		Missense_Mutation	SNP	ENST00000407595.2	37	CCDS46290.1	.	.	.	.	.	.	.	.	.	.	G	12.10	1.836447	0.32421	.	.	ENSG00000055813	ENST00000407595	.	.	.	5.02	3.23	0.37069	.	0.151903	0.64402	D	0.000013	T	0.42921	0.1224	L	0.47716	1.5	0.54753	D	0.999988	D	0.56035	0.974	B	0.42798	0.398	T	0.21552	-1.0242	9	0.15952	T	0.53	-16.1309	11.2343	0.48931	0.1496:0.0:0.8504:0.0	.	386	Q96PX6	CC85A_HUMAN	R	386	.	ENSP00000384040:G386R	G	+	1	0	CCDC85A	56273995	0.077000	0.21312	0.094000	0.20943	0.180000	0.23129	0.649000	0.24843	0.531000	0.28639	0.484000	0.47621	GGA	.		0.627	CCDC85A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324993.1		
TMEM150A	129303	ucsc.edu	37	2	85828227	85828227	+	Silent	SNP	G	G	T			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr2:85828227G>T	ENST00000409668.1	-	3	584	c.117C>A	c.(115-117)tcC>tcA	p.S39S	TMEM150A_ENST00000306353.3_Missense_Mutation_p.P9H|TMEM150A_ENST00000334462.5_Silent_p.S39S			Q86TG1	T150A_HUMAN	transmembrane protein 150A	39					catabolic process (GO:0009056)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(2)|lung(1)|skin(1)	7						ACTCGTTGTAGGACCTGGCAG	0.627																																					p.S39S													.	TMEM150A-90	0			c.C117A						.						47.0	40.0	42.0					2																	85828227		2203	4300	6503	SO:0001819	synonymous_variant	129303	exon4			GTTGTAGGACCTG	AK098152	CCDS33233.1	2p11.2	2009-06-12	2009-06-12	2009-06-12	ENSG00000168890	ENSG00000168890			24677	protein-coding gene	gene with protein product			"""transmembrane protein 150"""	TMEM150		10858565	Standard	NM_001031738		Approved	TM6P1, FLJ90024	uc002spy.2	Q86TG1	OTTHUMG00000130168	ENST00000409668.1:c.117C>A	2.37:g.85828227G>T		Somatic	54	0		WXS	Illumina HiSeq		36	4	NM_001031738	0	0	1	1	0	A8K764|B7WPQ9|D6W5L2|Q8N2R6	Silent	SNP	ENST00000409668.1	37	CCDS33233.1	.	.	.	.	.	.	.	.	.	.	G	16.54	3.151229	0.57151	.	.	ENSG00000168890	ENST00000306353;ENST00000425160	T	0.50001	0.76	5.06	4.19	0.49359	.	.	.	.	.	T	0.39306	0.1073	.	.	.	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.30001	-0.9993	8	0.87932	D	0	-8.475	9.5166	0.39109	0.0975:0.0:0.9025:0.0	.	9	Q86TG1-2	.	H	9	ENSP00000302715:P9H	ENSP00000302715:P9H	P	-	2	0	TMEM150A	85681738	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	0.690000	0.25451	1.122000	0.41944	0.655000	0.94253	CCT	.		0.627	TMEM150A-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329474.1	NM_153342	
SIRPG	55423	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	1615980	1615980	+	Silent	SNP	C	C	A	rs147655438		TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr20:1615980C>A	ENST00000303415.3	-	4	1078	c.1014G>T	c.(1012-1014)gcG>gcT	p.A338A	RP11-77C3.3_ENST00000456177.1_RNA|SIRPG_ENST00000381583.2_Intron|RP11-77C3.3_ENST00000437384.1_RNA|SIRPG_ENST00000381580.1_Silent_p.A305A|SIRPG_ENST00000344103.4_Intron|SIRPG_ENST00000216927.4_Intron	NM_018556.3	NP_061026.2	Q9P1W8	SIRPG_HUMAN	signal-regulatory protein gamma	338	Ig-like C1-type 2.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell activation (GO:0050870)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|stomach(1)	27						GTTTGCTGACCGCCAGCTGCC	0.502																																					p.A338A		.											.	SIRPG-23	0			c.G1014T						.						116.0	94.0	101.0					20																	1615980		2203	4300	6503	SO:0001819	synonymous_variant	55423	exon4			GCTGACCGCCAGC	AB042624	CCDS13020.2, CCDS13021.2, CCDS33434.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000089012	ENSG00000089012		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	15757	protein-coding gene	gene with protein product		605466	"""signal-regulatory protein beta 2"""	SIRPB2		11185750, 16339511	Standard	XM_005260749		Approved	bA77C3.1, SIRP-B2, SIRPgamma, CD172g	uc002wfm.1	Q9P1W8	OTTHUMG00000031680	ENST00000303415.3:c.1014G>T	20.37:g.1615980C>A		Somatic	131	0		WXS	Illumina HiSeq	Phase_I	90	24	NM_018556	0	0	2	2	0	B1AKP6|Q5D051|Q5JV25|Q5MKL4|Q8WWA5|Q9NQK8	Silent	SNP	ENST00000303415.3	37	CCDS13020.2																																																																																			C|1.000;T|0.000		0.502	SIRPG-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077566.2	NM_018556	
HELZ2	85441	broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	62203482	62203482	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr20:62203482G>A	ENST00000467148.1	-	1	326	c.257C>T	c.(256-258)tCc>tTc	p.S86F	HELZ2_ENST00000479540.1_5'UTR	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	86					cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										CTCGAACTTGGAGAGTCCCGG	0.627																																					p.S86F													.	.	0			c.C257T						.						25.0	26.0	25.0					20																	62203482		2185	4295	6480	SO:0001583	missense	85441	exon2			AACTTGGAGAGTC	AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.257C>T	20.37:g.62203482G>A	ENSP00000417401:p.Ser86Phe	Somatic	31	0		WXS	Illumina HiSeq	Phase_I	19	4	NM_001037335	0	0	4	4	0	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Missense_Mutation	SNP	ENST00000467148.1	37	CCDS33508.1	.	.	.	.	.	.	.	.	.	.	G	9.215	1.031799	0.19590	.	.	ENSG00000130589	ENST00000467148	T	0.02944	4.1	4.12	1.89	0.25635	.	1.072950	0.07266	N	0.868321	T	0.10337	0.0253	M	0.63428	1.95	0.09310	N	1	D;B	0.71674	0.998;0.407	D;B	0.65443	0.935;0.054	T	0.27739	-1.0065	10	0.66056	D	0.02	-28.6382	5.3566	0.16065	0.0925:0.2127:0.5726:0.1222	.	86;86	Q4VXQ0;Q9BYK8	.;PR285_HUMAN	F	86	ENSP00000417401:S86F	ENSP00000417401:S86F	S	-	2	0	RP4-697K14.7	61673926	0.002000	0.14202	0.140000	0.22221	0.123000	0.20343	0.808000	0.27154	0.728000	0.32382	-0.152000	0.13540	TCC	.		0.627	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354127.1	NM_001037335	
ZNF512B	57473	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	20	62642850	62642850	+	Intron	SNP	G	G	C			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr20:62642850G>C	ENST00000450537.1	-	1	56				ZNF512B_ENST00000217130.3_Intron|PRPF6_ENST00000535781.1_Missense_Mutation_p.W506C			Q96KM6	Z512B_HUMAN	zinc finger protein 512B						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					GTGAGCAGTGGATCCAGGTGG	0.602																																					p.W506C		.											.	PRPF6-70	0			c.G1518C						.						44.0	38.0	40.0					20																	62642850		2203	4300	6503	SO:0001627	intron_variant	24148	exon11			GCAGTGGATCCAG	AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.4+37207C>G	20.37:g.62642850G>C		Somatic	47	0		WXS	Illumina HiSeq	Phase_I	24	3	NM_012469	0	0	0	0	0	Q08AK9|Q9ULM4	Missense_Mutation	SNP	ENST00000450537.1	37	CCDS13548.1	.	.	.	.	.	.	.	.	.	.	G	19.67	3.870612	0.72065	.	.	ENSG00000101161	ENST00000266079;ENST00000535781	T;T	0.50277	0.75;0.75	5.13	4.18	0.49190	.	0.000000	0.85682	D	0.000000	T	0.78194	0.4245	H	0.97131	3.945	0.80722	D	1	D;D	0.89917	1.0;0.988	D;P	0.83275	0.996;0.886	D	0.85224	0.1028	10	0.87932	D	0	.	13.52	0.61561	0.0755:0.0:0.9245:0.0	.	506;506	O94906-2;O94906	.;PRP6_HUMAN	C	506	ENSP00000266079:W506C;ENSP00000446216:W506C	ENSP00000266079:W506C	W	+	3	0	PRPF6	62113294	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	9.220000	0.95180	1.154000	0.42482	0.609000	0.83330	TGG	.		0.602	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080246.1	NM_020713	
FTCD	10841	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	47571511	47571511	+	Silent	SNP	G	G	T			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr21:47571511G>T	ENST00000291670.5	-	5	640	c.597C>A	c.(595-597)atC>atA	p.I199I	FTCD_ENST00000397748.1_Silent_p.I199I|FTCD_ENST00000397743.1_Silent_p.I199I|FTCD_ENST00000359679.2_Silent_p.I199I|FTCD_ENST00000498355.2_5'UTR|FTCD-AS1_ENST00000446649.1_RNA|FTCD_ENST00000355384.2_Silent_p.I199I|FTCD_ENST00000397746.3_Silent_p.I199I	NM_006657.2	NP_006648.1	O95954	FTCD_HUMAN	formimidoyltransferase cyclodeaminase	199	Formiminotransferase C-subdomain. {ECO:0000250}.				cellular nitrogen compound metabolic process (GO:0034641)|cytoskeleton organization (GO:0007010)|folic acid-containing compound metabolic process (GO:0006760)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	folic acid binding (GO:0005542)|formimidoyltetrahydrofolate cyclodeaminase activity (GO:0030412)|glutamate formimidoyltransferase activity (GO:0030409)			endometrium(1)|large_intestine(2)|lung(9)|pancreas(1)|prostate(3)|skin(3)	19	Breast(49;0.214)			Colorectal(79;0.235)	Tetrahydrofolic acid(DB00116)	GGTTGAGCGCGATGCGGTGGG	0.647																																					p.I199I		.											.	FTCD-92	0			c.C597A						.						67.0	71.0	69.0					21																	47571511		2203	4300	6503	SO:0001819	synonymous_variant	10841	exon5			GAGCGCGATGCGG	U91541	CCDS13731.1	21q22.3	2013-06-10	2013-06-10		ENSG00000160282	ENSG00000160282	2.1.2.5, 4.3.1.4		3974	protein-coding gene	gene with protein product		606806	"""formiminotransferase cyclodeaminase"""			10029623, 10773664	Standard	NM_006657		Approved		uc002zif.3	O95954	OTTHUMG00000090488	ENST00000291670.5:c.597C>A	21.37:g.47571511G>T		Somatic	157	0		WXS	Illumina HiSeq	Phase_I	97	27	NM_206965	0	0	0	0	0	B9EGD0|Q86V03|Q9HCT4|Q9HCT5|Q9HCT6|Q9UHJ2	Silent	SNP	ENST00000291670.5	37	CCDS13731.1																																																																																			.		0.647	FTCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206962.1	NM_006657	
DGCR2	9993	broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	19028613	19028613	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr22:19028613C>T	ENST00000263196.7	-	9	1601	c.1354G>A	c.(1354-1356)Gag>Aag	p.E452K	DGCR2_ENST00000537045.1_Missense_Mutation_p.E411K|DGCR2_ENST00000545799.1_3'UTR	NM_001184781.1|NM_005137.2	NP_001171710.1|NP_005128.1	P98153	IDD_HUMAN	DiGeorge syndrome critical region gene 2	452					cell adhesion (GO:0007155)|cognition (GO:0050890)|organ morphogenesis (GO:0009887)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(1)	18	Colorectal(54;0.0993)					ATGGAGGCCTCGTAGGGCGGC	0.632																																					p.E452K													.	DGCR2-90	0			c.G1354A						.						68.0	59.0	62.0					22																	19028613		2203	4300	6503	SO:0001583	missense	9993	exon9			AGGCCTCGTAGGG	D79985	CCDS33598.1, CCDS54496.1	22q11.21	2008-06-12			ENSG00000070413	ENSG00000070413			2845	protein-coding gene	gene with protein product	"""integral membrane protein DGCR2"""	600594				7655455, 8630060	Standard	NM_005137		Approved	KIAA0163, LAN, IDD, DGS-C, SEZ-12	uc002zoq.1	P98153	OTTHUMG00000150141	ENST00000263196.7:c.1354G>A	22.37:g.19028613C>T	ENSP00000263196:p.Glu452Lys	Somatic	64	0		WXS	Illumina HiSeq	Phase_I	46	7	NM_005137	0	0	26	39	13	A6NIB5|A8K6K5|B5TY34|B7Z935	Missense_Mutation	SNP	ENST00000263196.7	37	CCDS33598.1	.	.	.	.	.	.	.	.	.	.	C	34	5.312202	0.95655	.	.	ENSG00000070413	ENST00000537045;ENST00000263196	T;D	0.97994	0.46;-4.65	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	D	0.98620	0.9538	M	0.69823	2.125	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.994	D	0.99449	1.0940	10	0.72032	D	0.01	.	20.0384	0.97572	0.0:1.0:0.0:0.0	.	408;452	B7Z3T5;P98153	.;IDD_HUMAN	K	411;452	ENSP00000440062:E411K;ENSP00000263196:E452K	ENSP00000263196:E452K	E	-	1	0	DGCR2	17408613	1.000000	0.71417	0.999000	0.59377	0.449000	0.32228	7.722000	0.84778	2.837000	0.97791	0.655000	0.94253	GAG	.		0.632	DGCR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316504.1	NM_005137	
DLEC1	9940	hgsc.bcm.edu	37	3	38149133	38149133	+	Missense_Mutation	SNP	G	G	A	rs141938666	byFrequency	TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr3:38149133G>A	ENST00000308059.6	+	20	2944	c.2923G>A	c.(2923-2925)Gtg>Atg	p.V975M	DLEC1_ENST00000452631.2_Missense_Mutation_p.V975M|DLEC1_ENST00000346219.3_Missense_Mutation_p.V975M					deleted in lung and esophageal cancer 1											NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(3)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	51				KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)		GAGCAGCCAGGTGGAGGTTAG	0.507													G|||	9	0.00179712	0.0	0.0	5008	,	,		18744	0.0089		0.0	False		,,,				2504	0.0				p.V975M		.											.	DLEC1-161	0			c.G2923A						.						80.0	81.0	81.0					3																	38149133		1959	4147	6106	SO:0001583	missense	9940	exon20			AGCCAGGTGGAGG	AB020522	CCDS2672.2	3p21.3	2014-07-31			ENSG00000008226	ENSG00000008226			2899	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 81"""	604050				10213508	Standard	XM_005265630		Approved	DLC1, CFAP81	uc003chp.1	Q9Y238	OTTHUMG00000131085	ENST00000308059.6:c.2923G>A	3.37:g.38149133G>A	ENSP00000308597:p.Val975Met	Somatic	46	0		WXS	Illumina HiSeq	Phase_I	39	10	NM_007337	0	0	0	0	0		Missense_Mutation	SNP	ENST00000308059.6	37	CCDS2672.2	6	0.0027472527472527475	0	0.0	0	0.0	6	0.01048951048951049	0	0.0	G	13.63	2.294945	0.40594	.	.	ENSG00000008226	ENST00000308059;ENST00000346219;ENST00000452631	T;T;T	0.07800	3.16;3.16;3.39	5.05	-0.716	0.11212	.	0.181665	0.37136	N	0.002225	T	0.08758	0.0217	L	0.51422	1.61	0.21950	N	0.999458	P;B;D;P	0.54964	0.935;0.205;0.969;0.935	B;B;P;B	0.52066	0.424;0.078;0.689;0.424	T	0.08249	-1.0731	10	0.56958	D	0.05	-8.7464	10.246	0.43341	0.0:0.5584:0.2143:0.2274	.	975;975;975;975	F8W6T4;B7ZW06;Q9Y238-3;Q9Y238	.;.;.;DLEC1_HUMAN	M	975	ENSP00000308597:V975M;ENSP00000315914:V975M;ENSP00000410427:V975M	ENSP00000308597:V975M	V	+	1	0	DLEC1	38124137	0.092000	0.21681	0.469000	0.27204	0.960000	0.62799	0.026000	0.13599	-0.125000	0.11703	0.561000	0.74099	GTG	G|0.997;A|0.003		0.507	DLEC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253745.3	NM_007337	
HYAL1	3373	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	50340364	50340364	+	Missense_Mutation	SNP	G	G	C	rs370239620		TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr3:50340364G>C	ENST00000266031.4	-	1	639	c.24C>G	c.(22-24)atC>atG	p.I8M	HYAL1_ENST00000447605.2_Intron|HYAL1_ENST00000395144.2_Missense_Mutation_p.I8M|HYAL1_ENST00000395143.2_Missense_Mutation_p.I8M|HYAL1_ENST00000457214.2_Intron|HYAL1_ENST00000320295.8_Missense_Mutation_p.I8M			Q12794	HYAL1_HUMAN	hyaluronoglucosaminidase 1	8					carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to interleukin-1 (GO:0071347)|cellular response to pH (GO:0071467)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to UV-B (GO:0071493)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal joint morphogenesis (GO:0060272)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|inflammatory response (GO:0006954)|negative regulation of cell growth (GO:0030308)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of growth (GO:0045927)|positive regulation of hyaluranon cable assembly (GO:1900106)|response to antibiotic (GO:0046677)|response to reactive oxygen species (GO:0000302)|response to virus (GO:0009615)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|hyaluranon cable (GO:0036117)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	hyaluronan synthase activity (GO:0050501)|hyalurononglucosaminidase activity (GO:0004415)|transcription factor binding (GO:0008134)			cervix(1)|endometrium(2)|large_intestine(1)|lung(6)|prostate(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		AGAGGGCGCAGATGGGAAGCA	0.607																																					p.I8M		.											.	HYAL1-278	0			c.C24G						.						35.0	38.0	37.0					3																	50340364		2203	4300	6503	SO:0001583	missense	3373	exon2			GGCGCAGATGGGA	U90094	CCDS2816.1, CCDS2817.1, CCDS46832.1, CCDS46833.1	3p21.31	2014-07-17			ENSG00000114378	ENSG00000114378	3.2.1.35		5320	protein-coding gene	gene with protein product		607071				9223416, 9409739	Standard	NM_153281		Approved	LUCA1, HYAL-1, FUS2, NAT6	uc003czp.4	Q12794	OTTHUMG00000156941	ENST00000266031.4:c.24C>G	3.37:g.50340364G>C	ENSP00000266031:p.Ile8Met	Somatic	60	0		WXS	Illumina HiSeq	Phase_I	46	6	NM_033159	0	0	3	3	0	Q6FH23|Q6PIZ6|Q7KYU2|Q7LE34|Q8NFK5|Q8NFK6|Q8NFK7|Q8NFK8|Q8NFK9|Q93013|Q9UKD5|Q9UNI8	Missense_Mutation	SNP	ENST00000266031.4	37	CCDS2816.1	.	.	.	.	.	.	.	.	.	.	G	15.26	2.780578	0.49891	.	.	ENSG00000114378	ENST00000395144;ENST00000266031;ENST00000320295;ENST00000395143;ENST00000418723;ENST00000452672	T;T;T;T;T;T	0.48522	2.16;2.16;2.16;1.83;0.81;0.81	5.3	1.26	0.21427	.	3.721710	0.00447	N	0.000080	T	0.49236	0.1545	L	0.50333	1.59	0.24266	N	0.99527	P;P;P	0.37636	0.603;0.603;0.468	B;B;B	0.42386	0.386;0.295;0.293	T	0.34179	-0.9839	10	0.46703	T	0.11	-3.0796	6.6937	0.23187	0.2193:0.0:0.6565:0.1242	.	8;8;8	Q12794-7;Q12794-2;Q12794	.;.;HYAL1_HUMAN	M	8	ENSP00000378576:I8M;ENSP00000266031:I8M;ENSP00000346068:I8M;ENSP00000378575:I8M;ENSP00000394526:I8M;ENSP00000391666:I8M	ENSP00000266031:I8M	I	-	3	3	HYAL1	50315368	0.761000	0.28439	0.005000	0.12908	0.266000	0.26442	1.468000	0.35332	0.324000	0.23333	0.655000	0.94253	ATC	.		0.607	HYAL1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346703.1		
SERPINI2	5276	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	167170764	167170764	+	Silent	SNP	G	G	A	rs140665807	byFrequency	TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr3:167170764G>A	ENST00000476257.1	-	7	1222	c.924C>T	c.(922-924)acC>acT	p.T308T	SERPINI2_ENST00000471111.1_Silent_p.T308T|SERPINI2_ENST00000264677.4_Silent_p.T308T|SERPINI2_ENST00000461846.1_Silent_p.T308T			O75830	SPI2_HUMAN	serpin peptidase inhibitor, clade I (pancpin), member 2	308					cellular component movement (GO:0006928)|negative regulation of endopeptidase activity (GO:0010951)|regulation of cell adhesion (GO:0030155)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(20)|prostate(1)|skin(5)|urinary_tract(1)	41						TAAATATCTCGGTTATGTTCA	0.279													G|||	3	0.000599042	0.0015	0.0	5008	,	,		16433	0.0		0.001	False		,,,				2504	0.0				p.T318T		.											.	SERPINI2-228	0			c.C954T						.	G		4,4402	8.1+/-20.4	0,4,2199	65.0	63.0	64.0		924	-7.4	0.8	3	dbSNP_134	64	1,8595	1.2+/-3.3	0,1,4297	yes	coding-synonymous	SERPINI2	NM_006217.3		0,5,6496	AA,AG,GG		0.0116,0.0908,0.0385		308/406	167170764	5,12997	2203	4298	6501	SO:0001819	synonymous_variant	5276	exon7			TATCTCGGTTATG	AB006423	CCDS3200.1, CCDS75047.1	3q26.1	2014-02-18	2005-08-18		ENSG00000114204	ENSG00000114204		"""Serine (or cysteine) peptidase inhibitors"""	8945	protein-coding gene	gene with protein product		605587	"""serine (or cysteine) proteinase inhibitor, clade I (neuroserpin), member 2"", ""serine (or cysteine) proteinase inhibitor, clade I (pancpin), member 2"""	PI14		9624529, 24172014	Standard	NM_006217		Approved	PANCPIN, TSA2004, MEPI, pancpin	uc003fes.2	O75830	OTTHUMG00000158231	ENST00000476257.1:c.924C>T	3.37:g.167170764G>A		Somatic	37	0		WXS	Illumina HiSeq	Phase_I	48	17	NM_001012303	0	0	0	0	0		Silent	SNP	ENST00000476257.1	37	CCDS3200.1																																																																																			G|1.000;A|0.000		0.279	SERPINI2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350450.1	NM_006217	
DCK	1633	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	71892401	71892401	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr4:71892401C>A	ENST00000286648.5	+	6	1082	c.685C>A	c.(685-687)Caa>Aaa	p.Q229K	DCK_ENST00000504952.1_Missense_Mutation_p.Q229K|DCK_ENST00000504730.1_Nonsense_Mutation_p.S190*	NM_000788.2	NP_000779.1	P27707	DCK_HUMAN	deoxycytidine kinase	229					deoxyribonucleoside monophosphate biosynthetic process (GO:0009157)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide biosynthetic process (GO:0009165)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside salvage (GO:0043097)|pyrimidine nucleotide metabolic process (GO:0006220)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|deoxycytidine kinase activity (GO:0004137)|drug binding (GO:0008144)|nucleoside kinase activity (GO:0019206)|protein homodimerization activity (GO:0042803)			endometrium(2)|large_intestine(3)|lung(3)|ovary(1)	9			Lung(101;0.235)		Cladribine(DB00242)|Clofarabine(DB00631)|Cytarabine(DB00987)|Decitabine(DB01262)|Emtricitabine(DB00879)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Lamivudine(DB00709)|Nelarabine(DB01280)|Pemetrexed(DB00642)|Zalcitabine(DB00943)	CGATTATCTTCAAGAGGTGCC	0.284																																					p.Q229K		.											.	DCK-116	0			c.C685A						.						43.0	45.0	44.0					4																	71892401		2202	4288	6490	SO:0001583	missense	1633	exon6			TATCTTCAAGAGG	M60527	CCDS3548.1	4q13.3-q21.1	2008-02-05			ENSG00000156136	ENSG00000156136	2.7.1.74		2704	protein-coding gene	gene with protein product		125450				8406512	Standard	NM_000788		Approved		uc003hfx.3	P27707	OTTHUMG00000129908	ENST00000286648.5:c.685C>A	4.37:g.71892401C>A	ENSP00000286648:p.Gln229Lys	Somatic	70	0		WXS	Illumina HiSeq	Phase_I	39	13	NM_000788	0	0	16	23	7	B2R8V6|Q5TZY7|Q6FI11	Missense_Mutation	SNP	ENST00000286648.5	37	CCDS3548.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.0|27.0	4.787431|4.787431	0.90367|0.90367	.|.	.|.	ENSG00000156136|ENSG00000156136	ENST00000286648;ENST00000504952|ENST00000504730	D;D|.	0.97870|.	-4.58;-4.58|.	5.78|5.78	4.92|4.92	0.64577|0.64577	.|.	0.274194|.	0.41194|.	D|.	0.000924|.	T|.	0.49864|.	0.1582|.	N|N	0.16233|0.16233	0.39|0.39	0.45272|0.45272	D|D	0.998276|0.998276	B|.	0.09022|.	0.002|.	B|.	0.09377|.	0.004|.	T|.	0.44483|.	-0.9325|.	10|.	0.05351|.	T|.	0.99|.	.|.	16.6255|16.6255	0.84969|0.84969	0.0:0.8699:0.1301:0.0|0.0:0.8699:0.1301:0.0	.|.	229|.	P27707|.	DCK_HUMAN|.	K|X	229|190	ENSP00000286648:Q229K;ENSP00000421508:Q229K|.	ENSP00000286648:Q229K|.	Q|S	+|+	1|2	0|0	DCK|DCK	72111265|72111265	0.983000|0.983000	0.35010|0.35010	0.987000|0.987000	0.45799|0.45799	0.467000|0.467000	0.32768|0.32768	3.040000|3.040000	0.49799|0.49799	1.391000|1.391000	0.46566|0.46566	0.591000|0.591000	0.81541|0.81541	CAA|TCA	.		0.284	DCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252159.2		
PDE5A	8654	hgsc.bcm.edu	37	4	120486567	120486567	+	Splice_Site	SNP	T	T	C			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr4:120486567T>C	ENST00000354960.3	-	5	1223		c.e5-2		PDE5A_ENST00000394439.1_Splice_Site|PDE5A_ENST00000264805.5_Splice_Site	NM_001083.3	NP_001074.2	O76074	PDE5A_HUMAN	phosphodiesterase 5A, cGMP-specific						blood coagulation (GO:0007596)|cGMP catabolic process (GO:0046069)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of oocyte development (GO:0060282)|relaxation of cardiac muscle (GO:0055119)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)			breast(4)|endometrium(2)|kidney(3)|large_intestine(8)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	27					Avanafil(DB06237)|Caffeine(DB00201)|Dipyridamole(DB00975)|Pentoxifylline(DB00806)|Sildenafil(DB00203)|Tadalafil(DB00820)|Theophylline(DB00277)|Udenafil(DB06267)|Vardenafil(DB00862)	AGCAAAGTCCTAAAAAACAGA	0.353																																					.		.											.	PDE5A-90	0			c.778-2A>G						.						77.0	69.0	72.0					4																	120486567		2203	4299	6502	SO:0001630	splice_region_variant	8654	exon6			AAGTCCTAAAAAA	D89094	CCDS3713.1, CCDS34055.1	4q27	2008-05-15			ENSG00000138735	ENSG00000138735	3.1.4.17	"""Phosphodiesterases"""	8784	protein-coding gene	gene with protein product		603310				9714779, 9642111	Standard	NM_033437		Approved		uc003idh.3	O76074	OTTHUMG00000132971	ENST00000354960.3:c.904-2A>G	4.37:g.120486567T>C		Somatic	61	0		WXS	Illumina HiSeq	Phase_I	29	2	NM_033430	0	0	0	0	0	A0AV69|A8K2C4|O75026|O75887|Q86UI0|Q86V66|Q9Y6Z6	Splice_Site	SNP	ENST00000354960.3	37	CCDS3713.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.083965	0.76642	.	.	ENSG00000138735	ENST00000354960;ENST00000394439;ENST00000264805	.	.	.	5.56	5.56	0.83823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.68	0.77360	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	PDE5A	120706015	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	7.346000	0.79347	2.241000	0.73720	0.482000	0.46254	.	.		0.353	PDE5A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256529.1	NM_001083	Intron
FAT4	79633	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	126371574	126371574	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr4:126371574G>A	ENST00000394329.3	+	9	9416	c.9403G>A	c.(9403-9405)Ggc>Agc	p.G3135S	FAT4_ENST00000335110.5_Missense_Mutation_p.G1433S	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	3135	Cadherin 30. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						AAATGAAGAAGGCATTTTTGC	0.388																																					p.G3135S		.											.	FAT4-108	0			c.G9403A						.						67.0	68.0	68.0					4																	126371574		2203	4300	6503	SO:0001583	missense	79633	exon9			GAAGAAGGCATTT	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.9403G>A	4.37:g.126371574G>A	ENSP00000377862:p.Gly3135Ser	Somatic	89	0		WXS	Illumina HiSeq	Phase_I	37	15	NM_024582	0	0	0	0	0	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	G	14.20	2.464553	0.43736	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.61859	0.07;0.07	5.63	4.79	0.61399	Cadherin (4);Cadherin-like (1);	0.000000	0.35067	U	0.003472	T	0.60650	0.2285	N	0.25647	0.755	0.80722	D	1	P;D;D	0.89917	0.839;1.0;1.0	B;D;D	0.97110	0.287;0.997;1.0	T	0.54951	-0.8216	10	0.08599	T	0.76	.	14.512	0.67794	0.0698:0.0:0.9302:0.0	.	1433;3135;3135	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	S	3135;1433	ENSP00000377862:G3135S;ENSP00000335169:G1433S	ENSP00000335169:G1433S	G	+	1	0	FAT4	126591024	1.000000	0.71417	0.835000	0.33067	0.669000	0.39330	7.835000	0.86780	1.389000	0.46526	0.655000	0.94253	GGC	.		0.388	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
PCDHA6	56142	broad.mit.edu;bcgsc.ca	37	5	140209735	140209735	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr5:140209735G>A	ENST00000529310.1	+	1	2173	c.2059G>A	c.(2059-2061)Gcg>Acg	p.A687T	PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000530339.1_Intron	NM_018909.2|NM_031848.2|NM_031849.1	NP_061732.1|NP_114036.1|NP_114037.1	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6	687					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(42)|prostate(8)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	89			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGTGGGCGCCGCGGGCCCAGA	0.672																																					p.A687T													.	PCDHA6-92	0			c.G2059A						.						40.0	46.0	44.0					5																	140209735		2197	4279	6476	SO:0001583	missense	56142	exon1			GGCGCCGCGGGCC	AF152484	CCDS47281.1, CCDS47282.1	5q31	2010-11-26			ENSG00000081842	ENSG00000081842		"""Cadherins / Protocadherins : Clustered"""	8672	other	complex locus constituent	"""KIAA0345-like 8"""	606312		CNRS2		10380929, 10662547	Standard	NM_018909		Approved	CNR2, CRNR2, PCDH-ALPHA6		Q9UN73	OTTHUMG00000163353	ENST00000529310.1:c.2059G>A	5.37:g.140209735G>A	ENSP00000433378:p.Ala687Thr	Somatic	142	0		WXS	Illumina HiSeq	Phase_I	83	6	NM_018909	0	0	0	0	0	O75283|Q9NRT8	Missense_Mutation	SNP	ENST00000529310.1	37	CCDS47281.1	.	.	.	.	.	.	.	.	.	.	G	4.857	0.159299	0.09236	.	.	ENSG00000081842	ENST00000529310	T	0.51574	0.7	3.98	-1.4	0.08968	.	0.873151	0.09225	N	0.831374	T	0.26484	0.0647	N	0.25890	0.77	0.09310	N	0.999999	B;B	0.10296	0.001;0.003	B;B	0.06405	0.002;0.002	T	0.18840	-1.0324	10	0.26408	T	0.33	.	0.96	0.01393	0.3808:0.1123:0.279:0.2279	.	687;687	Q9UN73-3;Q9UN73	.;PCDA6_HUMAN	T	687	ENSP00000433378:A687T	ENSP00000433378:A687T	A	+	1	0	PCDHA6	140189919	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.411000	0.01040	-0.449000	0.07117	-0.683000	0.03753	GCG	.		0.672	PCDHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372829.3	NM_018909	
HIST1H4C	8364	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	26104205	26104205	+	Silent	SNP	C	C	G	rs139978722	byFrequency	TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr6:26104205C>G	ENST00000377803.2	+	1	102	c.30C>G	c.(28-30)ggC>ggG	p.G10G		NM_003542.3	NP_003533.1	P62805	H4_HUMAN	histone cluster 1, H4c	10					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(1)	7						GCGGAAAAGGCTTGGGGAAGG	0.532																																					p.G10G		.											.	HIST1H4C-68	0			c.C30G						.						57.0	58.0	58.0					6																	26104205		2203	4300	6503	SO:0001819	synonymous_variant	8364	exon1			AAAAGGCTTGGGG	X60486	CCDS4583.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000197061	ENSG00000197061		"""Histones / Replication-dependent"""	4787	protein-coding gene	gene with protein product		602827	"""H4 histone family, member G"", ""histone 1, H4c"""	H4FG		9119399, 12408966	Standard	NM_003542		Approved	H4/g, dJ221C16.1	uc003ngi.3	P62805	OTTHUMG00000014429	ENST00000377803.2:c.30C>G	6.37:g.26104205C>G		Somatic	115	0		WXS	Illumina HiSeq	Phase_I	88	21	NM_003542	0	0	1	1	0	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Silent	SNP	ENST00000377803.2	37	CCDS4583.1																																																																																			C|0.999;T|0.001		0.532	HIST1H4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040092.2	NM_003542	
ZKSCAN8	7745	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	28116192	28116192	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr6:28116192G>A	ENST00000330236.6	+	2	191	c.7G>A	c.(7-9)Gaa>Aaa	p.E3K	ZKSCAN8_ENST00000457389.2_Missense_Mutation_p.E3K	NM_001278119.1|NM_001278121.1|NM_001278122.1|NM_006298.2	NP_001265048.1|NP_001265050.1|NP_001265051.1|NP_006289.2	Q15776	ZKSC8_HUMAN	zinc finger with KRAB and SCAN domains 8	3					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										TCTAATGGCTGAAGAATCAAG	0.473																																					p.E3K		.											.	.	0			c.G7A						.						50.0	48.0	49.0					6																	28116192		2203	4300	6503	SO:0001583	missense	7745	exon2			ATGGCTGAAGAAT		CCDS4645.1	6p21	2013-01-09	2013-01-09	2013-01-09	ENSG00000198315	ENSG00000198315		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12983	protein-coding gene	gene with protein product		602240	"""zinc finger protein 192"""	ZNF192			Standard	NM_001278119		Approved	LD5-1, ZSCAN40	uc003nkn.2	Q15776	OTTHUMG00000014510	ENST00000330236.6:c.7G>A	6.37:g.28116192G>A	ENSP00000332750:p.Glu3Lys	Somatic	67	0		WXS	Illumina HiSeq	Phase_I	35	12	NM_006298	0	0	1	2	1	A1L3D4|B4DYF1|Q4VAR1|Q4VAR2|Q4VAR3|Q9H4T1	Missense_Mutation	SNP	ENST00000330236.6	37	CCDS4645.1	.	.	.	.	.	.	.	.	.	.	G	14.70	2.614734	0.46631	.	.	ENSG00000198315	ENST00000330236;ENST00000457389;ENST00000536028	T;T;T	0.05580	3.42;3.42;3.99	5.2	-0.593	0.11667	.	1.155400	0.06424	N	0.722860	T	0.01189	0.0039	N	0.19112	0.55	0.22827	N	0.998682	B	0.02656	0.0	B	0.01281	0.0	T	0.48592	-0.9022	10	0.42905	T	0.14	.	3.6279	0.08120	0.2558:0.0:0.4473:0.2969	.	3	Q15776	ZN192_HUMAN	K	3	ENSP00000332750:E3K;ENSP00000402948:E3K;ENSP00000439117:E3K	ENSP00000332750:E3K	E	+	1	0	ZNF192	28224171	0.141000	0.22595	0.921000	0.36526	0.930000	0.56654	0.165000	0.16564	-0.225000	0.09913	0.563000	0.77884	GAA	.		0.473	ZKSCAN8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040178.2		
CFB	629	bcgsc.ca	37	6	31919751	31919751	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr6:31919751C>G	ENST00000425368.2	+	18	2752	c.2239C>G	c.(2239-2241)Caa>Gaa	p.Q747E	CFB_ENST00000477310.1_Missense_Mutation_p.Q1098E|CFB_ENST00000456570.1_Missense_Mutation_p.Q1249E|CFB_ENST00000556679.1_Missense_Mutation_p.Q1249E	NM_001710.5	NP_001701.2	P00751	CFAB_HUMAN	complement factor B	747	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	complement binding (GO:0001848)|serine-type endopeptidase activity (GO:0004252)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(10)|pancreas(1)|skin(1)|urinary_tract(1)	21						CAACCTCTTTCAAGTGCTGCC	0.502																																					p.Q747E													.	CFB-91	0			c.C2239G						.						268.0	291.0	283.0					6																	31919751		1510	2709	4219	SO:0001583	missense	629	exon18			CTCTTTCAAGTGC	L15702	CCDS4729.1	6p21.33	2014-09-17	2006-02-10	2006-02-10	ENSG00000243649	ENSG00000243649	3.4.21.47	"""Complement system"""	1037	protein-coding gene	gene with protein product		138470	"""B-factor, properdin"""	BFD, BF			Standard	NM_001710		Approved	H2-Bf	uc011dor.2	P00751	OTTHUMG00000031198	ENST00000425368.2:c.2239C>G	6.37:g.31919751C>G	ENSP00000416561:p.Gln747Glu	Somatic	419	0		WXS	Illumina HiSeq	Phase_1	319	7	NM_001710	0	0	19	19	0	B0QZQ6|O15006|Q29944|Q53F89|Q5JP67|Q5ST50|Q96HX6|Q9BTF5|Q9BX92	Missense_Mutation	SNP	ENST00000425368.2	37	CCDS4729.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.65|13.65	2.299415|2.299415	0.40694|0.40694	.|.	.|.	ENSG00000243649|ENSG00000243649;ENSG00000243649;ENSG00000244255;ENSG00000244255	ENST00000483004|ENST00000556679;ENST00000425368;ENST00000456570;ENST00000477310	T|T;T;T;T	0.28666|0.28666	1.6|1.6;1.6;1.6;1.6	5.54|5.54	4.67|4.67	0.58626|0.58626	.|Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (2);	.|0.361824	.|0.24091	.|N	.|0.041637	T|T	0.06142|0.06142	0.0159|0.0159	N|N	0.04335|0.04335	-0.225|-0.225	0.34044|0.34044	D|D	0.655353|0.655353	.|B;B	.|0.30741	.|0.293;0.062	.|B;B	.|0.27076	.|0.076;0.017	T|T	0.09335|0.09335	-1.0679|-1.0679	7|10	0.72032|0.66056	D|D	0.01|0.02	-2.5092|-2.5092	8.9919|8.9919	0.36028|0.36028	0.1615:0.6642:0.1742:0.0|0.1615:0.6642:0.1742:0.0	.|.	.|1249;747	.|B4E1Z4;P00751	.|.;CFAB_HUMAN	L|E	287|1249;747;1249;1098	ENSP00000419887:F287L|ENSP00000451848:Q1249E;ENSP00000416561:Q747E;ENSP00000410815:Q1249E;ENSP00000418996:Q1098E	ENSP00000419887:F287L|ENSP00000416561:Q747E	F|Q	+|+	3|1	2|0	CFB|CFB;XXbac-BPG116M5.17	32027730|32027730	0.962000|0.962000	0.33011|0.33011	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	0.751000|0.751000	0.26348|0.26348	1.563000|1.563000	0.49615|0.49615	0.655000|0.655000	0.94253|0.94253	TTC|CAA	.		0.502	CFB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076395.3	NM_001710	
TFEB	7942	ucsc.edu	37	6	41658862	41658862	+	Silent	SNP	G	G	A			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr6:41658862G>A	ENST00000230323.4	-	3	391	c.90C>T	c.(88-90)gtC>gtT	p.V30V	TFEB_ENST00000420312.1_Silent_p.V30V|TFEB_ENST00000373033.1_Silent_p.V30V|TFEB_ENST00000358871.2_Silent_p.V44V|TFEB_ENST00000403298.4_Silent_p.V30V|TFEB_ENST00000394283.1_Silent_p.V30V	NM_001271945.1|NM_007162.2	NP_001258874.1|NP_009093.1	P19484	TFEB_HUMAN	transcription factor EB	30	Gln-rich.				autophagy (GO:0006914)|embryonic placenta development (GO:0001892)|humoral immune response (GO:0006959)|lysosome organization (GO:0007040)|positive regulation of autophagy (GO:0010508)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)	11	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;7.61e-05)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00507)			TGTAATGCATGACAGCCTGTT	0.657			T	ALPHA	renal (childhood epithelioid)						OREG0004069	type=REGULATORY REGION|Gene=TFEB|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.V44V				Dom	yes		6	6p21	7942	transcription factor EB		"""E,M"""	.	TFEB-659	0			c.C132T						.						18.0	15.0	16.0					6																	41658862		2195	4291	6486	SO:0001819	synonymous_variant	7942	exon2			ATGCATGACAGCC	M33782	CCDS4858.1, CCDS64424.1, CCDS64425.1	6p21	2013-05-21			ENSG00000112561	ENSG00000112561		"""Basic helix-loop-helix proteins"""	11753	protein-coding gene	gene with protein product		600744				2115126	Standard	NM_007162		Approved	TCFEB, bHLHe35	uc003oqu.2	P19484	OTTHUMG00000014684	ENST00000230323.4:c.90C>T	6.37:g.41658862G>A		Somatic	16	0	902	WXS	Illumina HiSeq		11	2	NM_001167827	0	0	8	8	0	Q709B3|Q7Z6P9|Q9BRJ5|Q9UJD8	Silent	SNP	ENST00000230323.4	37	CCDS4858.1																																																																																			.		0.657	TFEB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040522.3		
CRISP3	10321	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	49696475	49696475	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr6:49696475C>T	ENST00000393666.1	-	7	712	c.706G>A	c.(706-708)Gcc>Acc	p.A236T	CRISP3_ENST00000423399.2_Missense_Mutation_p.A146T|CRISP3_ENST00000371159.4_Missense_Mutation_p.A267T|CRISP3_ENST00000263045.4_Missense_Mutation_p.A249T|CRISP3_ENST00000433368.2_Missense_Mutation_p.A259T			P54108	CRIS3_HUMAN	cysteine-rich secretory protein 3	236	ShKT. {ECO:0000255|PROSITE- ProRule:PRU01005}.				defense response (GO:0006952)|innate immune response (GO:0045087)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|specific granule (GO:0042581)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(14)|skin(6)|upper_aerodigestive_tract(1)	27	Lung NSC(77;0.0161)		KIRC - Kidney renal clear cell carcinoma(2;0.106)|Kidney(12;0.156)			TTGCAGGAGGCCTTGCAACTG	0.403																																					p.A259T		.											.	CRISP3-92	0			c.G775A						.						188.0	169.0	175.0					6																	49696475		2203	4300	6503	SO:0001583	missense	10321	exon8			AGGAGGCCTTGCA	X94323	CCDS4929.1, CCDS4929.2, CCDS55019.1	6p12.3	2008-02-05			ENSG00000096006	ENSG00000096006			16904	protein-coding gene	gene with protein product						8665901, 12223513	Standard	NM_006061		Approved	SGP28, CRISP-3, CRS3, dJ442L6.3, Aeg2	uc003ozs.3	P54108	OTTHUMG00000014823	ENST00000393666.1:c.706G>A	6.37:g.49696475C>T	ENSP00000377274:p.Ala236Thr	Somatic	150	0		WXS	Illumina HiSeq	Phase_I	120	38	NM_001190986	0	0	17	41	24	A8K9S1|B2R8I8|Q15512|Q3MJ82|Q53FA9|Q5JW83|Q9H108	Missense_Mutation	SNP	ENST00000393666.1	37		.	.	.	.	.	.	.	.	.	.	C	17.52	3.410104	0.62399	.	.	ENSG00000096006	ENST00000263045;ENST00000433368;ENST00000393666;ENST00000423399;ENST00000371159	T;T;T;T;T	0.16073	2.88;2.87;2.9;2.37;2.87	4.55	4.55	0.56014	Cysteine-rich secretory protein (1);	0.089556	0.44285	U	0.000474	T	0.21921	0.0528	M	0.83483	2.645	0.30644	N	0.756123	D	0.60575	0.988	P	0.50590	0.645	T	0.06180	-1.0841	10	0.72032	D	0.01	.	13.1387	0.59423	0.0:1.0:0.0:0.0	.	236	P54108	CRIS3_HUMAN	T	249;259;236;146;267	ENSP00000263045:A249T;ENSP00000389026:A259T;ENSP00000377274:A236T;ENSP00000410469:A146T;ENSP00000360201:A267T	ENSP00000263045:A249T	A	-	1	0	CRISP3	49804434	0.287000	0.24315	0.827000	0.32855	0.121000	0.20230	1.129000	0.31381	2.236000	0.73375	0.609000	0.83330	GCC	.		0.403	CRISP3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_006061	
COL9A1	1297	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	70990561	70990561	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr6:70990561G>A	ENST00000357250.6	-	10	1087	c.929C>T	c.(928-930)cCg>cTg	p.P310L	COL9A1_ENST00000370499.4_Missense_Mutation_p.P67L|COL9A1_ENST00000320755.7_Missense_Mutation_p.P67L|COL9A1_ENST00000370496.3_Missense_Mutation_p.P310L|COL9A1_ENST00000489611.1_5'Flank	NM_001851.4	NP_001842.3	P20849	CO9A1_HUMAN	collagen, type IX, alpha 1	310	Collagen-like 1.|Triple-helical region (COL3).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|organ morphogenesis (GO:0009887)|tissue homeostasis (GO:0001894)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(44)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)	80						TGGCTTTCCCGGTTCACCTGC	0.627																																					p.P310L		.											.	COL9A1-94	0			c.C929T						.						18.0	19.0	19.0					6																	70990561		2203	4300	6503	SO:0001583	missense	1297	exon10			TTTCCCGGTTCAC		CCDS4971.1, CCDS47447.1	6q13	2013-05-07			ENSG00000112280	ENSG00000112280		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2217	protein-coding gene	gene with protein product		120210				1429648	Standard	NM_001851		Approved		uc003pfg.4	P20849	OTTHUMG00000014988	ENST00000357250.6:c.929C>T	6.37:g.70990561G>A	ENSP00000349790:p.Pro310Leu	Somatic	33	0		WXS	Illumina HiSeq	Phase_I	28	9	NM_001851	0	0	0	0	0	Q13699|Q13700|Q5TF52|Q6P467|Q96BM8|Q99225|Q9H151|Q9H152|Q9Y6P2|Q9Y6P3	Missense_Mutation	SNP	ENST00000357250.6	37	CCDS4971.1	.	.	.	.	.	.	.	.	.	.	G	10.65	1.410959	0.25465	.	.	ENSG00000112280	ENST00000357250;ENST00000320755;ENST00000370499;ENST00000370496	D;D;D;D	0.94000	-3.33;-3.33;-3.33;-3.28	5.6	4.72	0.59763	.	0.325795	0.37012	N	0.002296	D	0.90435	0.7005	M	0.84846	2.72	0.46981	D	0.999279	P;P	0.44429	0.835;0.516	B;B	0.38327	0.271;0.135	D	0.89481	0.3750	10	0.30854	T	0.27	.	15.4859	0.75569	0.0:0.139:0.861:0.0	.	310;67	P20849;P20849-2	CO9A1_HUMAN;.	L	310;67;67;310	ENSP00000349790:P310L;ENSP00000315252:P67L;ENSP00000359530:P67L;ENSP00000359527:P310L	ENSP00000315252:P67L	P	-	2	0	COL9A1	71047282	0.999000	0.42202	0.747000	0.31113	0.002000	0.02628	4.673000	0.61604	1.347000	0.45714	0.563000	0.77884	CCG	.		0.627	COL9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041131.2		
IMPG1	3617	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	76660465	76660465	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr6:76660465G>C	ENST00000369950.3	-	13	1827	c.1638C>G	c.(1636-1638)ttC>ttG	p.F546L	IMPG1_ENST00000369963.3_3'UTR	NM_001282368.1|NM_001563.2	NP_001269297.1|NP_001554.2			interphotoreceptor matrix proteoglycan 1											breast(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(8)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	63		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				TATCCTCCAAGAAATGATCTG	0.483																																					p.F546L	Pancreas(37;839 1141 2599 26037)	.											.	IMPG1-93	0			c.C1638G						.						93.0	79.0	84.0					6																	76660465		2203	4300	6503	SO:0001583	missense	3617	exon13			CTCCAAGAAATGA	AF017776	CCDS4985.1, CCDS75483.1	6q14.2-q15	2008-02-05	2004-05-25		ENSG00000112706	ENSG00000112706			6055	protein-coding gene	gene with protein product		602870	"""sialoprotein associated with cones and rods"""	SPACR			Standard	NM_001282368		Approved	IPM150, GP147	uc003pik.1	Q17R60	OTTHUMG00000015063	ENST00000369950.3:c.1638C>G	6.37:g.76660465G>C	ENSP00000358966:p.Phe546Leu	Somatic	87	0		WXS	Illumina HiSeq	Phase_I	63	15	NM_001563	0	0	0	0	0		Missense_Mutation	SNP	ENST00000369950.3	37	CCDS4985.1	.	.	.	.	.	.	.	.	.	.	G	9.188	1.025421	0.19512	.	.	ENSG00000112706	ENST00000369950	T	0.19532	2.14	5.67	0.817	0.18773	.	0.942898	0.08930	N	0.873167	T	0.08223	0.0205	M	0.73598	2.24	0.09310	N	1	B	0.26258	0.145	B	0.20955	0.032	T	0.42292	-0.9460	10	0.15066	T	0.55	.	8.972	0.35912	0.39:0.0:0.61:0.0	.	546	Q17R60	IMPG1_HUMAN	L	546	ENSP00000358966:F546L	ENSP00000358966:F546L	F	-	3	2	IMPG1	76717185	0.000000	0.05858	0.026000	0.17262	0.005000	0.04900	-0.651000	0.05372	0.055000	0.16094	-0.142000	0.14014	TTC	.		0.483	IMPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041288.1	NM_001563	
IMPG1	3617	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	76660529	76660529	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr6:76660529G>A	ENST00000369950.3	-	13	1763	c.1574C>T	c.(1573-1575)tCt>tTt	p.S525F	IMPG1_ENST00000369963.3_3'UTR	NM_001282368.1|NM_001563.2	NP_001269297.1|NP_001554.2			interphotoreceptor matrix proteoglycan 1											breast(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(8)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	63		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				AGGAGTGTCAGACAGATCCAT	0.488																																					p.S525F	Pancreas(37;839 1141 2599 26037)	.											.	IMPG1-93	0			c.C1574T						.						97.0	80.0	86.0					6																	76660529		2203	4300	6503	SO:0001583	missense	3617	exon13			GTGTCAGACAGAT	AF017776	CCDS4985.1, CCDS75483.1	6q14.2-q15	2008-02-05	2004-05-25		ENSG00000112706	ENSG00000112706			6055	protein-coding gene	gene with protein product		602870	"""sialoprotein associated with cones and rods"""	SPACR			Standard	NM_001282368		Approved	IPM150, GP147	uc003pik.1	Q17R60	OTTHUMG00000015063	ENST00000369950.3:c.1574C>T	6.37:g.76660529G>A	ENSP00000358966:p.Ser525Phe	Somatic	54	0		WXS	Illumina HiSeq	Phase_I	40	9	NM_001563	0	0	0	0	0		Missense_Mutation	SNP	ENST00000369950.3	37	CCDS4985.1	.	.	.	.	.	.	.	.	.	.	G	13.33	2.206277	0.39003	.	.	ENSG00000112706	ENST00000369950	T	0.21031	2.03	4.94	2.19	0.27852	.	1.695600	0.02971	N	0.144359	T	0.07954	0.0199	L	0.38175	1.15	0.09310	N	0.999999	P	0.46706	0.883	B	0.44044	0.439	T	0.13361	-1.0512	10	0.39692	T	0.17	.	4.5254	0.11980	0.435:0.0:0.4185:0.1465	.	525	Q17R60	IMPG1_HUMAN	F	525	ENSP00000358966:S525F	ENSP00000358966:S525F	S	-	2	0	IMPG1	76717249	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.632000	0.24583	0.339000	0.23719	0.650000	0.86243	TCT	.		0.488	IMPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041288.1	NM_001563	
IMPG1	3617	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	76660533	76660533	+	Silent	SNP	G	G	A			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr6:76660533G>A	ENST00000369950.3	-	13	1759	c.1570C>T	c.(1570-1572)Ctg>Ttg	p.L524L	IMPG1_ENST00000369963.3_3'UTR	NM_001282368.1|NM_001563.2	NP_001269297.1|NP_001554.2			interphotoreceptor matrix proteoglycan 1											breast(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(8)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	63		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				GTGTCAGACAGATCCATTTCA	0.493																																					p.L524L	Pancreas(37;839 1141 2599 26037)	.											.	IMPG1-93	0			c.C1570T						.						99.0	82.0	88.0					6																	76660533		2203	4300	6503	SO:0001819	synonymous_variant	3617	exon13			CAGACAGATCCAT	AF017776	CCDS4985.1, CCDS75483.1	6q14.2-q15	2008-02-05	2004-05-25		ENSG00000112706	ENSG00000112706			6055	protein-coding gene	gene with protein product		602870	"""sialoprotein associated with cones and rods"""	SPACR			Standard	NM_001282368		Approved	IPM150, GP147	uc003pik.1	Q17R60	OTTHUMG00000015063	ENST00000369950.3:c.1570C>T	6.37:g.76660533G>A		Somatic	52	0		WXS	Illumina HiSeq	Phase_I	39	10	NM_001563	0	0	0	0	0		Silent	SNP	ENST00000369950.3	37	CCDS4985.1																																																																																			.		0.493	IMPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041288.1	NM_001563	
IMPG1	3617	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	76660636	76660636	+	Silent	SNP	G	G	A			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr6:76660636G>A	ENST00000369950.3	-	13	1656	c.1467C>T	c.(1465-1467)atC>atT	p.I489I	IMPG1_ENST00000369963.3_3'UTR	NM_001282368.1|NM_001563.2	NP_001269297.1|NP_001554.2			interphotoreceptor matrix proteoglycan 1											breast(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(8)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	63		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				CCAGTTGGCTGATTGCAGAAT	0.498																																					p.I489I	Pancreas(37;839 1141 2599 26037)	.											.	IMPG1-93	0			c.C1467T						.						159.0	151.0	153.0					6																	76660636		2203	4300	6503	SO:0001819	synonymous_variant	3617	exon13			TTGGCTGATTGCA	AF017776	CCDS4985.1, CCDS75483.1	6q14.2-q15	2008-02-05	2004-05-25		ENSG00000112706	ENSG00000112706			6055	protein-coding gene	gene with protein product		602870	"""sialoprotein associated with cones and rods"""	SPACR			Standard	NM_001282368		Approved	IPM150, GP147	uc003pik.1	Q17R60	OTTHUMG00000015063	ENST00000369950.3:c.1467C>T	6.37:g.76660636G>A		Somatic	104	0		WXS	Illumina HiSeq	Phase_I	78	20	NM_001563	0	0	0	0	0		Silent	SNP	ENST00000369950.3	37	CCDS4985.1																																																																																			.		0.498	IMPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041288.1	NM_001563	
LAMA4	3910	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	112454683	112454683	+	Silent	SNP	G	G	C			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr6:112454683G>C	ENST00000230538.7	-	27	3961	c.3564C>G	c.(3562-3564)ctC>ctG	p.L1188L	LAMA4_ENST00000522006.1_Silent_p.L1181L|LAMA4_ENST00000389463.4_Silent_p.L1181L|LAMA4_ENST00000424408.2_Silent_p.L1181L	NM_001105206.2	NP_001098676.2	Q16363	LAMA4_HUMAN	laminin, alpha 4	1188	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				blood vessel development (GO:0001568)|brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(42)|ovary(4)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(8)	100		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		GGTGTGCTCTGAGGGCCCTGG	0.438																																					p.L1188L		.											.	LAMA4-140	0			c.C3564G						.						101.0	96.0	97.0					6																	112454683		2203	4300	6503	SO:0001819	synonymous_variant	3910	exon27			TGCTCTGAGGGCC		CCDS34514.1, CCDS43491.1, CCDS43492.1	6q21	2014-09-17			ENSG00000112769	ENSG00000112769		"""Laminins"""	6484	protein-coding gene	gene with protein product		600133				7959779	Standard	NM_001105206		Approved	LAMA3	uc003pvu.3	Q16363	OTTHUMG00000015386	ENST00000230538.7:c.3564C>G	6.37:g.112454683G>C		Somatic	154	0		WXS	Illumina HiSeq	Phase_I	119	29	NM_001105206	0	0	0	0	0	Q14731|Q14735|Q15335|Q4LE44|Q5SZG8|Q9BTB8|Q9UE18|Q9UJN9	Silent	SNP	ENST00000230538.7	37	CCDS43491.1																																																																																			.		0.438	LAMA4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041876.2	NM_001105206	
MSRA	4482	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	9912062	9912062	+	Silent	SNP	C	C	T			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr8:9912062C>T	ENST00000317173.4	+	1	285	c.36C>T	c.(34-36)ctC>ctT	p.L12L	MSRA_ENST00000441698.2_Silent_p.L12L|RP11-1E4.1_ENST00000562143.1_RNA|MSRA_ENST00000518255.1_Silent_p.L12L	NM_012331.3	NP_036463.1	Q9UJ68	MSRA_HUMAN	methionine sulfoxide reductase A	12				Missing (in Ref. 6; AAG09689). {ECO:0000305}.	cellular protein modification process (GO:0006464)|methionine metabolic process (GO:0006555)|protein repair (GO:0030091)|response to oxidative stress (GO:0006979)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	peptide-methionine (S)-S-oxide reductase activity (GO:0008113)			central_nervous_system(1)|endometrium(2)|kidney(1)|lung(4)	8		Myeloproliferative disorder(644;0.178)			L-Methionine(DB00134)	GCCAGCTCCTCCTCCTCCACA	0.716																																					p.L12L	NSCLC(88;1378 1469 30580 49103 52286)	.											.	MSRA-90	0			c.C36T						.						36.0	35.0	36.0					8																	9912062		2203	4300	6503	SO:0001819	synonymous_variant	4482	exon1			GCTCCTCCTCCTC	BC054033	CCDS5975.1, CCDS47798.1, CCDS47799.1, CCDS56522.1	8p23.1	2009-07-10			ENSG00000175806	ENSG00000175806	1.8.4.11		7377	protein-coding gene	gene with protein product		601250				10452521	Standard	NM_012331		Approved		uc003wsx.3	Q9UJ68	OTTHUMG00000090517	ENST00000317173.4:c.36C>T	8.37:g.9912062C>T		Somatic	67	0		WXS	Illumina HiSeq	Phase_I	43	16	NM_012331	0	0	8	8	0	E9PAS8|Q52TC4|Q549N4|Q66MI7	Silent	SNP	ENST00000317173.4	37	CCDS5975.1																																																																																			.		0.716	MSRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207005.1	NM_012331	
MSRA	4482	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	9912103	9912103	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr8:9912103C>T	ENST00000317173.4	+	1	326	c.77C>T	c.(76-78)tCg>tTg	p.S26L	MSRA_ENST00000441698.2_Missense_Mutation_p.S26L|RP11-1E4.1_ENST00000562143.1_RNA|MSRA_ENST00000518255.1_Missense_Mutation_p.S26L	NM_012331.3	NP_036463.1	Q9UJ68	MSRA_HUMAN	methionine sulfoxide reductase A	26					cellular protein modification process (GO:0006464)|methionine metabolic process (GO:0006555)|protein repair (GO:0030091)|response to oxidative stress (GO:0006979)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	peptide-methionine (S)-S-oxide reductase activity (GO:0008113)			central_nervous_system(1)|endometrium(2)|kidney(1)|lung(4)	8		Myeloproliferative disorder(644;0.178)			L-Methionine(DB00134)	ATGGGCAACTCGGCCTCGAAC	0.697																																					p.S26L	NSCLC(88;1378 1469 30580 49103 52286)	.											.	MSRA-90	0			c.C77T						.						38.0	37.0	37.0					8																	9912103		2203	4300	6503	SO:0001583	missense	4482	exon1			GCAACTCGGCCTC	BC054033	CCDS5975.1, CCDS47798.1, CCDS47799.1, CCDS56522.1	8p23.1	2009-07-10			ENSG00000175806	ENSG00000175806	1.8.4.11		7377	protein-coding gene	gene with protein product		601250				10452521	Standard	NM_012331		Approved		uc003wsx.3	Q9UJ68	OTTHUMG00000090517	ENST00000317173.4:c.77C>T	8.37:g.9912103C>T	ENSP00000313921:p.Ser26Leu	Somatic	69	0		WXS	Illumina HiSeq	Phase_I	51	15	NM_012331	0	0	9	10	1	E9PAS8|Q52TC4|Q549N4|Q66MI7	Missense_Mutation	SNP	ENST00000317173.4	37	CCDS5975.1	.	.	.	.	.	.	.	.	.	.	C	11.38	1.622922	0.28889	.	.	ENSG00000175806	ENST00000317173;ENST00000441698;ENST00000518255	.	.	.	4.84	3.94	0.45596	.	0.300238	0.32015	N	0.006711	T	0.34629	0.0904	L	0.42245	1.32	0.34862	D	0.74275	D;B	0.53885	0.963;0.249	B;B	0.37601	0.254;0.036	T	0.50039	-0.8874	8	.	.	.	0.3672	10.6214	0.45483	0.1922:0.8078:0.0:0.0	.	26;26	Q9UJ68-4;Q9UJ68	.;MSRA_HUMAN	L	26	.	.	S	+	2	0	MSRA	9949513	0.147000	0.22687	0.178000	0.23040	0.019000	0.09904	1.820000	0.39032	1.113000	0.41760	0.313000	0.20887	TCG	.		0.697	MSRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207005.1	NM_012331	
FAM74A7	100996582	broad.mit.edu;ucsc.edu	37	9	40716117	40716117	+	lincRNA	SNP	G	G	C			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr9:40716117G>C	ENST00000432614.1	-	0	0				FAM74A3_ENST00000604146.1_lincRNA																							CTGTCTGCAAGAAGACGTGCA	0.527																																					.													.	FAM74A3-23	0			.						.						99.0	92.0	94.0					9																	40716117		2201	4296	6497			728495	.			CTGCAAGAAGACG																													9.37:g.40716117G>C		Somatic	87	0		WXS	Illumina HiSeq	Phase_I	52	6	.	0	0	0	0	0		RNA	SNP	ENST00000432614.1	37																																																																																				.		0.527	RP11-395E19.5-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000143688.1		
ZNF189	7743	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	104170234	104170234	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr9:104170234G>C	ENST00000339664.2	+	3	313	c.184G>C	c.(184-186)Gag>Cag	p.E62Q	ZNF189_ENST00000259395.4_Missense_Mutation_p.E20Q|ZNF189_ENST00000374861.3_Missense_Mutation_p.E48Q	NM_001278240.1	NP_001265169.1	O75820	ZN189_HUMAN	zinc finger protein 189	62	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(10)|ovary(2)|prostate(3)|skin(2)|urinary_tract(1)	26		Acute lymphoblastic leukemia(62;0.0559)				AGATAAGGATGAGGAGCCAAC	0.368																																					p.E62Q		.											.	ZNF189-229	0			c.G184C						.						58.0	60.0	60.0					9																	104170234		2202	4300	6502	SO:0001583	missense	7743	exon3			AAGGATGAGGAGC	AF025770	CCDS6754.1, CCDS6755.1, CCDS65096.1, CCDS75867.1	9q22-q31	2013-01-08			ENSG00000136870	ENSG00000136870		"""Zinc fingers, C2H2-type"", ""-"""	12980	protein-coding gene	gene with protein product		603132				9653648	Standard	NM_003452		Approved		uc004bbh.2	O75820	OTTHUMG00000020383	ENST00000339664.2:c.184G>C	9.37:g.104170234G>C	ENSP00000342019:p.Glu62Gln	Somatic	29	0		WXS	Illumina HiSeq	Phase_I	17	5	NM_003452	0	0	2	3	1	O75802|Q5T7D7|Q5T7D8|Q5T7D9|Q9UBL4|Q9UPE9|Q9UPF0|Q9UPF1	Missense_Mutation	SNP	ENST00000339664.2	37	CCDS6754.1	.	.	.	.	.	.	.	.	.	.	G	5.540	0.284544	0.10513	.	.	ENSG00000136870	ENST00000374861;ENST00000339664;ENST00000259395	T;T;T	0.05580	5.66;5.66;3.42	4.79	4.79	0.61399	Krueppel-associated box (3);	0.000000	0.49916	D	0.000140	T	0.03220	0.0094	N	0.16201	0.385	0.34306	D	0.684889	B;B;B	0.33073	0.396;0.396;0.006	B;B;B	0.26864	0.074;0.074;0.011	T	0.43261	-0.9402	10	0.14252	T	0.57	.	9.2106	0.37316	0.0942:0.0:0.9058:0.0	.	47;48;62	B7ZLK9;Q5T7D8;O75820	.;.;ZN189_HUMAN	Q	48;62;20	ENSP00000363995:E48Q;ENSP00000342019:E62Q;ENSP00000259395:E20Q	ENSP00000259395:E20Q	E	+	1	0	ZNF189	103210055	0.191000	0.23288	1.000000	0.80357	0.895000	0.52256	0.622000	0.24433	2.941000	0.99782	0.655000	0.94253	GAG	.		0.368	ZNF189-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053447.1	NM_003452	
KIAA0368	23392	hgsc.bcm.edu	37	9	114148697	114148697	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr9:114148697T>C	ENST00000338205.5	-	31	3706	c.3487A>G	c.(3487-3489)Aag>Gag	p.K1163E	KIAA0368_ENST00000374378.3_5'UTR|KIAA0368_ENST00000259335.4_Missense_Mutation_p.K1341E			Q5VYK3	ECM29_HUMAN	KIAA0368	1169					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	centrosome (GO:0005813)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|late endosome (GO:0005770)|membrane (GO:0016020)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|proteasome complex (GO:0000502)				NS(2)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(23)|prostate(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	65						GTAAGGTTCTTAACCAAATCT	0.284																																					p.K1341E		.											.	KIAA0368-68	0			c.A4021G						.						53.0	50.0	51.0					9																	114148697		1805	4075	5880	SO:0001583	missense	23392	exon33			GGTTCTTAACCAA	AK025689	CCDS48006.1	9q32	2012-11-29	2006-11-23	2006-11-23	ENSG00000136813	ENSG00000136813			29020	protein-coding gene	gene with protein product	"""ECM29 homolog (S. cerevisiae)"""					9205841, 15496406, 20682791	Standard	NM_001080398		Approved	FLJ22036, ECM29	uc004bfe.1	Q5VYK3	OTTHUMG00000020489	ENST00000338205.5:c.3487A>G	9.37:g.114148697T>C	ENSP00000339889:p.Lys1163Glu	Somatic	41	0		WXS	Illumina HiSeq	Phase_I	23	2	NM_001080398	0	0	13	13	0	O15074|Q8WU82	Missense_Mutation	SNP	ENST00000338205.5	37		.	.	.	.	.	.	.	.	.	.	T	7.860	0.725839	0.15439	.	.	ENSG00000136813	ENST00000338205;ENST00000259335;ENST00000543827	T	0.65732	-0.17	6.02	6.02	0.97574	.	0.222920	0.47093	D	0.000258	T	0.47544	0.1451	N	0.20401	0.57	0.80722	D	1	B	0.06786	0.001	B	0.12156	0.007	T	0.42396	-0.9454	10	0.13108	T	0.6	.	16.5494	0.84464	0.0:0.0:0.0:1.0	.	638	B3KXF2	.	E	1163;1341;638	ENSP00000259335:K1341E	ENSP00000259335:K1341E	K	-	1	0	KIAA0368	113188518	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.127000	0.50484	2.299000	0.77371	0.528000	0.53228	AAG	.		0.284	KIAA0368-001	NOVEL	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000053637.2	NM_014686	
CXorf21	80231	bcgsc.ca	37	X	30578342	30578342	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chrX:30578342G>T	ENST00000378962.3	-	3	453	c.131C>A	c.(130-132)tCc>tAc	p.S44Y		NM_025159.2	NP_079435.1	Q9HAI6	CX021_HUMAN	chromosome X open reading frame 21	44										kidney(1)|large_intestine(3)|lung(13)|ovary(1)|stomach(1)|urinary_tract(1)	20						ATCCACAGAGGAATAGGAAAG	0.453																																					p.S44Y													.	CXorf21-131	0			c.C131A						.						148.0	128.0	135.0					X																	30578342		2202	4300	6502	SO:0001583	missense	80231	exon3			ACAGAGGAATAGG	BC020611	CCDS14224.1	Xp21.3	2006-04-12			ENSG00000120280	ENSG00000120280			25667	protein-coding gene	gene with protein product						12477932	Standard	NM_025159		Approved	FLJ11577	uc004dcg.2	Q9HAI6	OTTHUMG00000021325	ENST00000378962.3:c.131C>A	X.37:g.30578342G>T	ENSP00000368245:p.Ser44Tyr	Somatic	282	0		WXS	Illumina HiSeq	Phase_1	210	8	NM_025159	0	0	0	0	0		Missense_Mutation	SNP	ENST00000378962.3	37	CCDS14224.1	.	.	.	.	.	.	.	.	.	.	G	15.63	2.891588	0.52014	.	.	ENSG00000120280	ENST00000378962	.	.	.	5.25	4.38	0.52667	.	0.090773	0.47852	D	0.000207	T	0.62660	0.2446	L	0.56769	1.78	0.35472	D	0.797434	D	0.60575	0.988	P	0.59761	0.863	T	0.72792	-0.4186	9	0.66056	D	0.02	-3.4973	10.5321	0.44983	0.0:0.1493:0.7064:0.1444	.	44	Q9HAI6	CX021_HUMAN	Y	44	.	ENSP00000368245:S44Y	S	-	2	0	CXorf21	30488263	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	3.164000	0.50770	1.179000	0.42884	0.544000	0.68410	TCC	.		0.453	CXorf21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056164.1	NM_025159	
MSN	4478	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	64936758	64936758	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chrX:64936758G>C	ENST00000360270.5	+	2	263	c.91G>C	c.(91-93)Gac>Cac	p.D31H		NM_002444.2	NP_002435.1	P26038	MOES_HUMAN	moesin	31	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cellular component movement (GO:0006928)|establishment of endothelial barrier (GO:0061028)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|membrane to membrane docking (GO:0022614)|positive regulation of gene expression (GO:0010628)|regulation of lymphocyte migration (GO:2000401)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|uropod (GO:0001931)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|double-stranded RNA binding (GO:0003725)|protein kinase binding (GO:0019901)|receptor binding (GO:0005102)|structural constituent of cytoskeleton (GO:0005200)		MSN/ALK(6)	breast(4)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	43						GCAGCTATTTGACCAGGTAAG	0.507			T	ALK	ALCL																																p.D31H		.		Dom	yes		X	Xq11.2-q12	4478	moesin		L	.	MSN-1086	0			c.G91C						.						132.0	99.0	111.0					X																	64936758		2203	4300	6503	SO:0001583	missense	4478	exon2			CTATTTGACCAGG	M69066	CCDS14382.1	Xq11.1	2010-10-20			ENSG00000147065	ENSG00000147065			7373	protein-coding gene	gene with protein product		309845				1924289, 7628534	Standard	XM_005262269		Approved		uc004dwf.3	P26038	OTTHUMG00000021723	ENST00000360270.5:c.91G>C	X.37:g.64936758G>C	ENSP00000353408:p.Asp31His	Somatic	105	0		WXS	Illumina HiSeq	Phase_I	77	13	NM_002444	0	0	0	0	0		Missense_Mutation	SNP	ENST00000360270.5	37	CCDS14382.1	.	.	.	.	.	.	.	.	.	.	g	17.67	3.446489	0.63178	.	.	ENSG00000147065	ENST00000360270	T	0.80304	-1.36	5.73	5.73	0.89815	FERM, N-terminal (1);Band 4.1 domain (1);FERM domain (1);	0.000000	0.85682	D	0.000000	D	0.90892	0.7138	H	0.98155	4.16	0.80722	D	1	P	0.43542	0.81	P	0.47891	0.56	D	0.93688	0.7004	10	0.87932	D	0	.	16.1334	0.81461	0.0:0.0:1.0:0.0	.	31	P26038	MOES_HUMAN	H	31	ENSP00000353408:D31H	ENSP00000353408:D31H	D	+	1	0	MSN	64853483	1.000000	0.71417	1.000000	0.80357	0.803000	0.45373	8.899000	0.92544	2.412000	0.81896	0.597000	0.82753	GAC	.		0.507	MSN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056981.1	NM_002444	
OGT	8473	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	70782731	70782731	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chrX:70782731C>T	ENST00000373719.3	+	16	2229	c.2012C>T	c.(2011-2013)gCg>gTg	p.A671V	OGT_ENST00000373701.3_Missense_Mutation_p.A661V	NM_181672.2|NM_181673.2	NP_858058.1|NP_858059.1	O15294	OGT1_HUMAN	O-linked N-acetylglucosamine (GlcNAc) transferase	671					apoptotic process (GO:0006915)|cellular response to retinoic acid (GO:0071300)|chromatin organization (GO:0006325)|circadian regulation of gene expression (GO:0032922)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of protein ubiquitination (GO:0031397)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of catalytic activity (GO:0043085)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of histone H3-K27 methylation (GO:0061087)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glycolytic process (GO:0006110)|regulation of insulin receptor signaling pathway (GO:0046626)|regulation of Rac protein signal transduction (GO:0035020)|response to insulin (GO:0032868)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone acetyltransferase complex (GO:0000123)|microtubule organizing center (GO:0005815)|mitochondrion (GO:0005739)|MLL5-L complex (GO:0070688)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	acetylglucosaminyltransferase activity (GO:0008375)|enzyme activator activity (GO:0008047)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein N-acetylglucosaminyltransferase activity (GO:0016262)|protein O-GlcNAc transferase activity (GO:0097363)			breast(6)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|liver(3)|lung(9)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Renal(35;0.156)					ACGAGTGGTGCGCTTTTCATG	0.393																																					p.A671V		.											.	OGT-113	0			c.C2012T						.						129.0	115.0	120.0					X																	70782731		2203	4300	6503	SO:0001583	missense	8473	exon16			GTGGTGCGCTTTT	U77413	CCDS14414.1, CCDS35502.1	Xq13	2013-07-24	2012-05-04		ENSG00000147162	ENSG00000147162	2.4.1.255	"""Tetratricopeptide (TTC) repeat domain containing"""	8127	protein-coding gene	gene with protein product	"""UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase"""	300255	"""O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase)"""			9083068	Standard	NM_181672		Approved	O-GLCNAC, HRNT1, MGC22921, FLJ23071	uc004eaa.2	O15294	OTTHUMG00000033316	ENST00000373719.3:c.2012C>T	X.37:g.70782731C>T	ENSP00000362824:p.Ala671Val	Somatic	123	0		WXS	Illumina HiSeq	Phase_I	132	31	NM_181672	0	1	12	13	0	Q7Z3K0|Q8WWM8|Q96CC1|Q9UG57	Missense_Mutation	SNP	ENST00000373719.3	37	CCDS14414.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.612830	0.87258	.	.	ENSG00000147162	ENST00000373719;ENST00000373701	T;T	0.18338	2.22;2.22	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.42063	0.1186	M	0.74258	2.255	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.78314	0.991;0.99;0.989	T	0.15435	-1.0437	10	0.23302	T	0.38	.	17.876	0.88825	0.0:1.0:0.0:0.0	.	545;661;671	Q548W1;O15294-3;O15294	.;.;OGT1_HUMAN	V	671;661	ENSP00000362824:A671V;ENSP00000362805:A661V	ENSP00000362805:A661V	A	+	2	0	OGT	70699456	1.000000	0.71417	0.922000	0.36590	0.793000	0.44817	7.626000	0.83164	2.410000	0.81850	0.594000	0.82650	GCG	.		0.393	OGT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000081829.3	NM_003605, NM_181672	
STAG2	10735	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	123197834	123197834	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chrX:123197834C>A	ENST00000371160.1	+	20	2248	c.1958C>A	c.(1957-1959)tCa>tAa	p.S653*	STAG2_ENST00000371157.3_Nonsense_Mutation_p.S653*|STAG2_ENST00000469481.1_Intron|STAG2_ENST00000218089.9_Nonsense_Mutation_p.S653*|STAG2_ENST00000371144.3_Nonsense_Mutation_p.S653*|STAG2_ENST00000371145.3_Nonsense_Mutation_p.S653*|STAG2_ENST00000354548.5_Nonsense_Mutation_p.S584*	NM_001282418.1	NP_001269347.1	Q8N3U4	STAG2_HUMAN	stromal antigen 2	653					meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of DNA endoreduplication (GO:0032876)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	actin cytoskeleton (GO:0015629)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(9)|lung(21)|ovary(5)|prostate(2)|skin(5)|urinary_tract(4)	78						GTAGATATTTCAAGAAGTCAA	0.333																																					p.S653X		.											.	STAG2-134	0			c.C1958A						.						64.0	56.0	59.0					X																	123197834		2203	4300	6503	SO:0001587	stop_gained	10735	exon20			ATATTTCAAGAAG	Z75331	CCDS14607.1, CCDS43990.1	Xq25	2014-09-17			ENSG00000101972	ENSG00000101972			11355	protein-coding gene	gene with protein product		300826				9305759	Standard	NM_001042750		Approved	SA-2, SCC3B	uc004eua.3	Q8N3U4	OTTHUMG00000022725	ENST00000371160.1:c.1958C>A	X.37:g.123197834C>A	ENSP00000360202:p.Ser653*	Somatic	55	0		WXS	Illumina HiSeq	Phase_I	61	15	NM_001042749	0	0	4	4	0	B1AMT5|D3DTF5|O00540|Q5JTI6|Q68DE9|Q9H1N8	Nonsense_Mutation	SNP	ENST00000371160.1	37	CCDS14607.1	.	.	.	.	.	.	.	.	.	.	C	40	8.002701	0.98605	.	.	ENSG00000101972	ENST00000218089;ENST00000354548;ENST00000371160;ENST00000371157;ENST00000371145;ENST00000371144	.	.	.	5.28	5.28	0.74379	.	0.124104	0.53938	D	0.000049	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	-19.1078	18.0751	0.89424	0.0:1.0:0.0:0.0	.	.	.	.	X	653;584;653;653;653;653	.	ENSP00000218089:S653X	S	+	2	0	STAG2	123025515	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.759000	0.85235	2.203000	0.70933	0.600000	0.82982	TCA	.		0.333	STAG2-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000156159.2	NM_006603	
LYPD3	27076	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	43967294	43967300	+	Frame_Shift_Del	DEL	GTTGCCG	GTTGCCG	-			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	GTTGCCG	GTTGCCG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr19:43967294_43967300delGTTGCCG	ENST00000244333.3	-	4	610_616	c.522_528delCGGCAAC	c.(520-528)gacggcaacfs	p.DGN174fs		NM_014400.2	NP_055215.2	O95274	LYPD3_HUMAN	LY6/PLAUR domain containing 3	174	UPAR/Ly6 2.				cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)	anchored component of plasma membrane (GO:0046658)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|pancreas(1)|upper_aerodigestive_tract(2)	11		Prostate(69;0.0153)				TCAAGGTGACGTTGCCGTCGAAGCAGC	0.647																																					p.174_176del		.											.	LYPD3-91	0			c.522_528del						.																																			SO:0001589	frameshift_variant	27076	exon4			.	AF082889	CCDS12620.1	19q13.31	2008-02-05				ENSG00000124466			24880	protein-coding gene	gene with protein product		609484				11179665, 11245483	Standard	NM_014400		Approved	C4.4A	uc002owl.1	O95274		ENST00000244333.3:c.522_528delCGGCAAC	19.37:g.43967294_43967300delGTTGCCG	ENSP00000244333:p.Asp174fs	Somatic	171	0		WXS	Illumina HiSeq	Phase_I	98	20	NM_014400	0	0	0	0	0	Q9UJ74	Frame_Shift_Del	DEL	ENST00000244333.3	37	CCDS12620.1																																																																																			.		0.647	LYPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463177.1	NM_014400	
TSC1	7248	broad.mit.edu;bcgsc.ca	37	9	135796822	135796826	+	Splice_Site	DEL	GGCTA	GGCTA	-	rs118203425|rs118203423		TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	GGCTA	GGCTA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr9:135796822_135796826delGGCTA	ENST00000298552.3	-	8	885_886	c.664_665delTAGCC	c.(664-666)tag>g	p.*222fs	TSC1_ENST00000403810.1_Splice_Site_p.*222fs|TSC1_ENST00000475903.1_5'Flank|TSC1_ENST00000440111.2_Splice_Site_p.*222fs|TSC1_ENST00000545250.1_Splice_Site_p.*171fs	NM_000368.4|NM_001162426.1|NM_001162427.1	NP_000359.1|NP_001155898.1|NP_001155899.1	Q92574	TSC1_HUMAN	tuberous sclerosis 1	222					activation of Rho GTPase activity (GO:0032862)|cardiac muscle cell differentiation (GO:0055007)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|cerebral cortex development (GO:0021987)|hippocampus development (GO:0021766)|insulin receptor signaling pathway (GO:0008286)|kidney development (GO:0001822)|myelination (GO:0042552)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of TOR signaling (GO:0032007)|negative regulation of translation (GO:0017148)|neural tube closure (GO:0001843)|positive regulation of focal adhesion assembly (GO:0051894)|potassium ion transport (GO:0006813)|protein heterooligomerization (GO:0051291)|protein stabilization (GO:0050821)|regulation of cell cycle (GO:0051726)|regulation of cell-matrix adhesion (GO:0001952)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of protein kinase activity (GO:0045859)|regulation of stress fiber assembly (GO:0051492)|regulation of translation (GO:0006417)|response to insulin (GO:0032868)|rRNA export from nucleus (GO:0006407)|synapse organization (GO:0050808)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|lamellipodium (GO:0030027)|membrane (GO:0016020)|protein complex (GO:0043234)|TSC1-TSC2 complex (GO:0033596)	chaperone binding (GO:0051087)|GTPase regulator activity (GO:0030695)|protein N-terminus binding (GO:0047485)	p.?(1)		NS(1)|bone(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(9)|lung(20)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	65				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)		CTCCATCATTGGCTAGAAGAGTTGG	0.376			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																												p.222_222del			yes	Rec		Tuberous sclerosis 1	9	9q34	7248	tuberous sclerosis 1 gene		"""E, O"""	.	TSC1-1906	1	Unknown(1)	bone(1)	c.664_665del						.																																			SO:0001630	splice_region_variant	7248	exon8	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	ATCATTGGCTAGA	AF013168	CCDS6956.1, CCDS55350.1	9q34	2014-09-17			ENSG00000165699	ENSG00000165699			12362	protein-coding gene	gene with protein product		605284		TSC		9242607, 10806479	Standard	NM_000368		Approved	KIAA0243, LAM, hamartin	uc004cca.2	Q92574	OTTHUMG00000020844	ENST00000298552.3:c.664-1TAGCC>-	9.37:g.135796822_135796826delGGCTA		Somatic	68	0		WXS	Illumina HiSeq	Phase_I	31	8	NM_000368	0	0	0	0	0	B7Z897|Q5VVN5	Frame_Shift_Del	DEL	ENST00000298552.3	37	CCDS6956.1																																																																																			.		0.376	TSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054799.1		Frame_Shift_Del
RAB11FIP1	80223	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	37730588	37730589	+	Frame_Shift_Ins	INS	-	-	G			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr8:37730588_37730589insG	ENST00000330843.4	-	4	1743_1744	c.1731_1732insC	c.(1729-1734)ccctctfs	p.S578fs	RAB11FIP1_ENST00000522727.1_Intron|RAB11FIP1_ENST00000524118.1_Intron|RAB11FIP1_ENST00000523182.1_5'UTR|RAB11FIP1_ENST00000287263.4_Intron	NM_001002814.2	NP_001002814.2	Q6WKZ4	RFIP1_HUMAN	RAB11 family interacting protein 1 (class I)	578	Ser-rich.				protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(4)|endometrium(3)|large_intestine(6)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	49		Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;3.62e-11)			CCCAATTCAGAGGGGACAGATG	0.559																																					p.S578fs		.											.	RAB11FIP1-92	0			c.1732_1733insC						.																																			SO:0001589	frameshift_variant	80223	exon4			.	AK092296	CCDS34881.1, CCDS34882.1	8p11.22	2005-10-04			ENSG00000156675	ENSG00000156675			30265	protein-coding gene	gene with protein product		608737				11786538, 11495908	Standard	NM_001002814		Approved	RCP, FLJ22622, FLJ22524, Rab11-FIP1	uc003xkm.2	Q6WKZ4	OTTHUMG00000164026	ENST00000330843.4:c.1732dupC	8.37:g.37730592_37730592dupG	ENSP00000331342:p.Ser578fs	Somatic	115	0		WXS	Illumina HiSeq	Phase_I	77	26	NM_001002814	0	0	0	0	0	J3KNP0|Q307T1|Q6AZK4|Q6WKZ2|Q6WKZ6|Q86YV4|Q8TDL1|Q9H642	Frame_Shift_Ins	INS	ENST00000330843.4	37	CCDS34882.1																																																																																			.		0.559	RAB11FIP1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376816.1	NM_025151	
SNRPE	6635	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	203832834	203832835	+	Missense_Mutation	DNP	GG	GG	AA			TCGA-A4-7287-01A-11D-2136-08	TCGA-A4-7287-10A-01D-2136-08	GG	GG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	11ea8c34-5b98-4a26-9312-6d92ea3eb990	93eabf7d-e975-4f03-a638-5bc360235ff1	g.chr1:203832834_203832835GG>AA	ENST00000414487.2	+	3	170_171	c.125_126GG>AA	c.(124-126)cGG>cAA	p.R42Q	SNRPE_ENST00000367208.1_Missense_Mutation_p.R2Q|SNRPE_ENST00000483099.1_3'UTR	NM_003094.2	NP_003085.1	P62304	RUXE_HUMAN	small nuclear ribonucleoprotein polypeptide E	42					gene expression (GO:0010467)|hair cycle (GO:0042633)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)|spliceosomal snRNP assembly (GO:0000387)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|methylosome (GO:0034709)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pICln-Sm protein complex (GO:0034715)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN-Sm protein complex (GO:0034719)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)|U12-type spliceosomal complex (GO:0005689)|U4 snRNP (GO:0005687)|U7 snRNP (GO:0005683)	RNA binding (GO:0003723)			breast(1)|large_intestine(2)|lung(1)|skin(1)	5	all_cancers(21;0.103)		BRCA - Breast invasive adenocarcinoma(75;0.109)			GTGAATATGCGGATAGAAGGCT	0.426																																					p.R42Q	Ovarian(83;324 1318 17952 32395 39614)	.											.	SNRPE	0			c.G126A						.																																			SO:0001583	missense	6635	exon3			TATGCGGATAGAA	M37716	CCDS30979.1	1q32	2011-10-11			ENSG00000182004	ENSG00000182004			11161	protein-coding gene	gene with protein product		128260				1835977, 2143747	Standard	NM_003094		Approved	Sm-E	uc001hai.3	P62304	OTTHUMG00000035985	Exception_encountered	1.37:g.203832834_203832835delinsAA	ENSP00000400591:p.Arg42Gln	Somatic	239.0	1.0		WXS	Illumina HiSeq	Phase_I	247.0	87.0		0	0	0	0	0	B2R5B9|P08578|Q15498|Q5BKT2	Missense_Mutation	DNP	ENST00000414487.2	37	CCDS30979.1																																																																																			.		0.426	SNRPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087703.1	NM_003094	
