#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SKI	6497	hgsc.bcm.edu	37	1	2160390	2160390	+	Missense_Mutation	SNP	C	C	G	rs28384811	byFrequency	TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr1:2160390C>G	ENST00000378536.4	+	1	257	c.185C>G	c.(184-186)gCg>gGg	p.A62G		NM_003036.3	NP_003027.1	P12755	SKI_HUMAN	SKI proto-oncogene	62					anterior/posterior axis specification (GO:0009948)|BMP signaling pathway (GO:0030509)|bone morphogenesis (GO:0060349)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell motility (GO:0048870)|cell proliferation (GO:0008283)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|gene expression (GO:0010467)|lens morphogenesis in camera-type eye (GO:0002089)|myelination in peripheral nervous system (GO:0022011)|myotube differentiation (GO:0014902)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neural tube closure (GO:0001843)|nose morphogenesis (GO:0043585)|olfactory bulb development (GO:0021772)|palate development (GO:0060021)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|protein homotrimerization (GO:0070207)|regulation of apoptotic process (GO:0042981)|retina development in camera-type eye (GO:0060041)|skeletal muscle fiber development (GO:0048741)|SMAD protein signal transduction (GO:0060395)|somatic stem cell maintenance (GO:0035019)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase inhibitor activity (GO:0046811)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|repressing transcription factor binding (GO:0070491)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(2)|lung(5)|prostate(1)|stomach(1)	10	all_cancers(77;0.000139)|all_epithelial(69;4.45e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)			Epithelial(90;2.14e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.72e-29)|GBM - Glioblastoma multiforme(42;2.45e-08)|Colorectal(212;5.33e-05)|COAD - Colon adenocarcinoma(227;0.000228)|Kidney(185;0.00268)|BRCA - Breast invasive adenocarcinoma(365;0.00471)|STAD - Stomach adenocarcinoma(132;0.0147)|KIRC - Kidney renal clear cell carcinoma(229;0.0385)|Lung(427;0.207)		gcggtgccggcgccggTGCCC	0.776													C|||	229	0.0457268	0.0234	0.0576	5008	,	,		4535	0.0079		0.0706	False		,,,				2504	0.0808				p.A62G	Ovarian(177;144 1678 13697 20086 27838 40755)	.											.	SKI-838	0			c.C185G						.						1.0	1.0	1.0					1																	2160390		788	1840	2628	SO:0001583	missense	6497	exon1			TGCCGGCGCCGGT	X15218	CCDS39.1	1p36.33	2014-06-25	2014-06-25		ENSG00000157933	ENSG00000157933		"""SKI transcriptional corepressors"""	10896	protein-coding gene	gene with protein product		164780	"""v-ski avian sarcoma viral oncogene homolog"""			2762147	Standard	NM_003036		Approved		uc001aja.4	P12755	OTTHUMG00000001407	ENST00000378536.4:c.185C>G	1.37:g.2160390C>G	ENSP00000367797:p.Ala62Gly	Somatic	1	1		WXS	Illumina HiSeq	Phase_I	5	4	NM_003036	0	0	0	0	0	Q5SYT7	Missense_Mutation	SNP	ENST00000378536.4	37	CCDS39.1	102	0.046703296703296704	20	0.04065040650406504	28	0.07734806629834254	3	0.005244755244755245	51	0.06728232189973615	C	9.688	1.151208	0.21371	.	.	ENSG00000157933	ENST00000378536	D	0.95821	-3.82	2.3	2.3	0.28687	.	.	.	.	.	T	0.47857	0.1468	N	0.08118	0	0.45733	P	0.001363000000000003	D	0.57899	0.981	P	0.58520	0.84	T	0.76271	-0.3020	8	0.20519	T	0.43	-11.9718	7.7374	0.28823	0.0:1.0:0.0:0.0	rs28384811	62	P12755	SKI_HUMAN	G	62	ENSP00000367797:A62G	ENSP00000367797:A62G	A	+	2	0	SKI	2150250	0.994000	0.37717	0.998000	0.56505	0.971000	0.66376	0.878000	0.28126	1.104000	0.41587	0.185000	0.17295	GCG	C|0.953;G|0.047		0.776	SKI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004070.1	NM_003036	
BAI2	576	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	32207416	32207416	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr1:32207416C>A	ENST00000373658.3	-	9	1911	c.1570G>T	c.(1570-1572)Gag>Tag	p.E524*	BAI2_ENST00000398556.3_Nonsense_Mutation_p.E472*|BAI2_ENST00000398547.1_Nonsense_Mutation_p.E457*|BAI2_ENST00000398538.1_Nonsense_Mutation_p.E512*|BAI2_ENST00000440175.2_Nonsense_Mutation_p.E166*|BAI2_ENST00000398542.1_Nonsense_Mutation_p.E457*|BAI2_ENST00000527361.1_Nonsense_Mutation_p.E524*|BAI2_ENST00000257070.4_Nonsense_Mutation_p.E524*|BAI2_ENST00000373655.2_Nonsense_Mutation_p.E524*	NM_001703.2	NP_001694.2	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	524	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(2)|endometrium(1)|large_intestine(7)|liver(2)|lung(24)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	55		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		CACCTCTTCTCACTACAAGGC	0.652																																					p.E524X		.											.	BAI2-526	0			c.G1570T						.						95.0	100.0	98.0					1																	32207416		2203	4299	6502	SO:0001587	stop_gained	576	exon9			TCTTCTCACTACA	AB005298	CCDS72746.1, CCDS72747.1	1p35	2014-08-08			ENSG00000121753	ENSG00000121753		"""-"", ""GPCR / Class B : Orphans"""	944	protein-coding gene	gene with protein product		602683				9533023	Standard	XM_006710783		Approved		uc001btn.3	O60241	OTTHUMG00000003885	ENST00000373658.3:c.1570G>T	1.37:g.32207416C>A	ENSP00000362762:p.Glu524*	Somatic	109	0		WXS	Illumina HiSeq	Phase_I	110	17	NM_001703	0	0	0	0	0	B9EGK9|Q5T6K0|Q8NGW8|Q96GZ9	Nonsense_Mutation	SNP	ENST00000373658.3	37	CCDS346.2	.	.	.	.	.	.	.	.	.	.	C	36	5.737223	0.96865	.	.	ENSG00000121753	ENST00000398556;ENST00000398547;ENST00000373658;ENST00000373655;ENST00000398542;ENST00000257070;ENST00000527361;ENST00000440175;ENST00000398538;ENST00000420125;ENST00000533175	.	.	.	4.95	4.95	0.65309	.	0.000000	0.39985	N	0.001213	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	.	17.3262	0.87248	0.0:1.0:0.0:0.0	.	.	.	.	X	472;457;524;524;457;524;524;166;512;462;503	.	ENSP00000257070:E524X	E	-	1	0	BAI2	31980003	1.000000	0.71417	0.998000	0.56505	0.979000	0.70002	5.765000	0.68834	2.457000	0.83068	0.561000	0.74099	GAG	.		0.652	BAI2-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000381838.1	NM_001703	
BAI2	576	broad.mit.edu	37	1	32221746	32221746	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr1:32221746G>C	ENST00000373658.3	-	4	1033	c.692C>G	c.(691-693)gCc>gGc	p.A231G	BAI2_ENST00000398556.3_Missense_Mutation_p.A234G|MIR4254_ENST00000581063.1_RNA|BAI2_ENST00000398547.1_Missense_Mutation_p.A219G|BAI2_ENST00000398538.1_Missense_Mutation_p.A219G|BAI2_ENST00000398542.1_Missense_Mutation_p.A219G|BAI2_ENST00000527361.1_Missense_Mutation_p.A231G|BAI2_ENST00000257070.4_Missense_Mutation_p.A231G|BAI2_ENST00000373655.2_Missense_Mutation_p.A231G	NM_001703.2	NP_001694.2	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	231					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.A231G(2)		breast(5)|central_nervous_system(2)|endometrium(1)|large_intestine(7)|liver(2)|lung(24)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	55		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		GGTGGAGCCGGCCCCCGCCTC	0.711																																					p.A231G													.	BAI2-526	2	Substitution - Missense(2)	lung(2)	c.C692G						.						25.0	33.0	30.0					1																	32221746		2201	4297	6498	SO:0001583	missense	576	exon4			GAGCCGGCCCCCG	AB005298	CCDS72746.1, CCDS72747.1	1p35	2014-08-08			ENSG00000121753	ENSG00000121753		"""-"", ""GPCR / Class B : Orphans"""	944	protein-coding gene	gene with protein product		602683				9533023	Standard	XM_006710783		Approved		uc001btn.3	O60241	OTTHUMG00000003885	ENST00000373658.3:c.692C>G	1.37:g.32221746G>C	ENSP00000362762:p.Ala231Gly	Somatic	62	15		WXS	Illumina HiSeq	Phase_I	58	17	NM_001703	0	0	2	2	0	B9EGK9|Q5T6K0|Q8NGW8|Q96GZ9	Missense_Mutation	SNP	ENST00000373658.3	37	CCDS346.2	.	.	.	.	.	.	.	.	.	.	G	2.541	-0.306384	0.05458	.	.	ENSG00000121753	ENST00000398556;ENST00000398547;ENST00000373658;ENST00000373655;ENST00000398542;ENST00000257070;ENST00000527361;ENST00000398538;ENST00000420125;ENST00000533175	T;T;T;T;T;T;T;T;T;T	0.45276	1.59;1.79;0.95;0.95;1.96;0.9;0.9;0.98;1.58;1.43	5.08	4.17	0.49024	.	0.353687	0.20794	N	0.085578	T	0.20901	0.0503	N	0.08118	0	0.43122	D	0.994846	B;B;B;B;B;B	0.30281	0.0;0.275;0.054;0.001;0.026;0.015	B;B;B;B;B;B	0.26614	0.0;0.071;0.047;0.001;0.034;0.015	T	0.07443	-1.0772	10	0.25751	T	0.34	.	9.8209	0.40883	0.0967:0.0:0.9033:0.0	.	219;231;219;219;231;231	A2A3C3;O60241-4;O60241-3;A2A3C1;O60241-2;O60241	.;.;.;.;.;BAI2_HUMAN	G	234;219;231;231;219;231;231;219;224;265	ENSP00000381564:A234G;ENSP00000381555:A219G;ENSP00000362762:A231G;ENSP00000362759:A231G;ENSP00000381550:A219G;ENSP00000257070:A231G;ENSP00000435397:A231G;ENSP00000381548:A219G;ENSP00000410921:A224G;ENSP00000437219:A265G	ENSP00000257070:A231G	A	-	2	0	BAI2	31994333	0.014000	0.17966	0.066000	0.19879	0.322000	0.28314	1.196000	0.32198	1.283000	0.44513	0.462000	0.41574	GCC	G|1.000;A|0.000		0.711	BAI2-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000381838.1	NM_001703	
TOE1	114034	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	45808095	45808095	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr1:45808095C>G	ENST00000372090.5	+	6	1115	c.532C>G	c.(532-534)Ctg>Gtg	p.L178V	MUTYH_ENST00000372110.3_5'Flank|MUTYH_ENST00000529984.1_5'Flank|MUTYH_ENST00000528013.2_5'Flank|MUTYH_ENST00000355498.2_5'Flank|MUTYH_ENST00000450313.1_5'Flank|MUTYH_ENST00000488731.2_5'Flank|MUTYH_ENST00000531105.1_5'Flank|MUTYH_ENST00000372098.3_5'Flank|TOE1_ENST00000539779.1_Missense_Mutation_p.L98V|MUTYH_ENST00000354383.6_5'Flank|MUTYH_ENST00000528332.2_5'Flank|MUTYH_ENST00000372104.1_5'Flank|MUTYH_ENST00000448481.1_5'Flank|MUTYH_ENST00000456914.2_5'Flank|MUTYH_ENST00000372100.5_5'Flank|MUTYH_ENST00000372115.3_5'Flank|TOE1_ENST00000495703.1_3'UTR|TESK2_ENST00000486676.1_5'Flank	NM_025077.3	NP_079353.3	Q96GM8	TOE1_HUMAN	target of EGR1, member 1 (nuclear)	178						nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	11	Acute lymphoblastic leukemia(166;0.155)					GACCCTATTCCTGGAGCTAAT	0.552																																					p.L178V		.											.	TOE1-90	0			c.C532G						.						97.0	100.0	99.0					1																	45808095		2203	4300	6503	SO:0001583	missense	114034	exon6			CTATTCCTGGAGC		CCDS521.1	1p33	2011-02-03			ENSG00000132773	ENSG00000132773			15954	protein-coding gene	gene with protein product		613931				12562764	Standard	NM_025077		Approved		uc009vxq.3	Q96GM8	OTTHUMG00000007678	ENST00000372090.5:c.532C>G	1.37:g.45808095C>G	ENSP00000361162:p.Leu178Val	Somatic	168	0		WXS	Illumina HiSeq	Phase_I	168	29	NM_025077	0	0	9	11	2	B4DEM6|Q6IA35|Q8IWN5|Q9H846	Missense_Mutation	SNP	ENST00000372090.5	37	CCDS521.1	.	.	.	.	.	.	.	.	.	.	C	9.622	1.133977	0.21123	.	.	ENSG00000132773	ENST00000372090;ENST00000539779	T;T	0.23552	1.9;1.9	5.79	4.88	0.63580	Ribonuclease H-like (1);	0.129811	0.53938	D	0.000050	T	0.24661	0.0598	L	0.36672	1.1	0.41103	D	0.985687	B;P;P	0.40398	0.164;0.716;0.716	B;B;B	0.42245	0.077;0.381;0.194	T	0.02358	-1.1171	10	0.27785	T	0.31	-8.8608	14.7036	0.69171	0.0:0.9309:0.0:0.0691	.	184;98;178	B4DP23;B4DEM6;Q96GM8	.;.;TOE1_HUMAN	V	178;98	ENSP00000361162:L178V;ENSP00000438900:L98V	ENSP00000361162:L178V	L	+	1	2	TOE1	45580682	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	2.049000	0.41288	1.455000	0.47813	0.655000	0.94253	CTG	.		0.552	TOE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020517.1	NM_025077	
CCDC17	149483	broad.mit.edu	37	1	46086774	46086774	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr1:46086774G>T	ENST00000528266.1	-	11	1547	c.1400C>A	c.(1399-1401)tCa>tAa	p.S467*	CCDC17_ENST00000343901.2_Nonsense_Mutation_p.S435*|CCDC17_ENST00000445048.2_Intron|CCDC17_ENST00000421127.2_Nonsense_Mutation_p.S458*|CCDC17_ENST00000464739.1_5'UTR			Q96LX7	CCD17_HUMAN	coiled-coil domain containing 17	467										kidney(1)|large_intestine(1)|lung(1)|ovary(2)	5	Acute lymphoblastic leukemia(166;0.155)					TACTGATGATGAGGGTGGTAG	0.522																																					p.S467X													.	CCDC17-23	0			c.C1400A						.						34.0	35.0	35.0					1																	46086774		2203	4300	6503	SO:0001587	stop_gained	149483	exon11			GATGATGAGGGTG		CCDS44131.1, CCDS44131.2, CCDS53314.1	1p34.1	2014-02-12			ENSG00000159588	ENSG00000159588			26574	protein-coding gene	gene with protein product							Standard	NM_001190182		Approved	FLJ33084	uc010olt.2	Q96LX7	OTTHUMG00000007822	ENST00000528266.1:c.1400C>A	1.37:g.46086774G>T	ENSP00000432172:p.Ser467*	Somatic	38	0		WXS	Illumina HiSeq	Phase_I	38	5	NM_001114938	0	0	0	0	0	A1A4Y7|B4DNX7|B4E1Q5|C9J8L2|Q0P683|Q5T629	Nonsense_Mutation	SNP	ENST00000528266.1	37	CCDS44131.2	.	.	.	.	.	.	.	.	.	.	G	31	5.058885	0.93846	.	.	ENSG00000159588	ENST00000421127;ENST00000343901;ENST00000528266	.	.	.	5.19	5.19	0.71726	.	0.178624	0.39407	N	0.001373	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.5395	17.638	0.88128	0.0:0.0:1.0:0.0	.	.	.	.	X	458;435;467	.	ENSP00000341451:S435X	S	-	2	0	CCDC17	45859361	1.000000	0.71417	1.000000	0.80357	0.673000	0.39480	6.283000	0.72646	2.686000	0.91538	0.591000	0.81541	TCA	.		0.522	CCDC17-008	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386833.1	NM_152500	
LPHN2	23266	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	82456455	82456455	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr1:82456455C>G	ENST00000370728.1	+	25	4651	c.4006C>G	c.(4006-4008)Ctg>Gtg	p.L1336V	LPHN2_ENST00000394879.1_Missense_Mutation_p.L1338V|LPHN2_ENST00000370721.1_Missense_Mutation_p.L1261V|LPHN2_ENST00000370725.1_Missense_Mutation_p.L1351V|LPHN2_ENST00000335786.5_Missense_Mutation_p.L1293V|LPHN2_ENST00000469377.2_3'UTR|LPHN2_ENST00000370723.1_Missense_Mutation_p.L1338V|LPHN2_ENST00000319517.6_Missense_Mutation_p.L1280V|LPHN2_ENST00000370730.1_Missense_Mutation_p.L1293V|LPHN2_ENST00000370717.2_Missense_Mutation_p.L1351V|LPHN2_ENST00000359929.3_Missense_Mutation_p.L1280V|LPHN2_ENST00000370727.1_Missense_Mutation_p.L1308V|LPHN2_ENST00000271029.4_Missense_Mutation_p.L1308V|LPHN2_ENST00000370713.1_3'UTR|LPHN2_ENST00000370715.1_3'UTR			O95490	LPHN2_HUMAN	latrophilin 2	1336					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(37)|ovary(3)|pancreas(1)|prostate(3)|skin(22)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	119				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		TCACTCCCTTCTGTACCAACC	0.527																																					p.L1280V		.											.	LPHN2-525	0			c.C3838G						.						84.0	87.0	86.0					1																	82456455		2203	4300	6503	SO:0001583	missense	23266	exon20			TCCCTTCTGTACC	AJ131581	CCDS689.1, CCDS72811.1	1p31.1	2014-08-08	2003-03-17	2003-05-02	ENSG00000117114	ENSG00000117114		"""-"", ""GPCR / Class B : Orphans"""	18582	protein-coding gene	gene with protein product		607018	"""latrophilin 1"""	LPHH1		10760572	Standard	XR_248786		Approved	KIAA0786, LEC1	uc001diu.3	O95490	OTTHUMG00000009844	ENST00000370728.1:c.4006C>G	1.37:g.82456455C>G	ENSP00000359763:p.Leu1336Val	Somatic	142	0		WXS	Illumina HiSeq	Phase_I	165	44	NM_012302	0	0	34	73	39	A5XEI2|B1ALT8|B1ALT9|B1ALU0|B1ALU2|B1ALU4|B1ALU5|B1ALU6|O94882|Q5VX76|Q9UKY5|Q9UKY6	Missense_Mutation	SNP	ENST00000370728.1	37		.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	13.57|13.57|13.57	2.275917|2.275917|2.275917	0.40294|0.40294|0.40294	.|.|.	.|.|.	ENSG00000117114|ENSG00000117114|ENSG00000117114	ENST00000449420|ENST00000370721;ENST00000370728;ENST00000370730;ENST00000370727;ENST00000370725;ENST00000370723;ENST00000359929;ENST00000319517;ENST00000370717;ENST00000394879;ENST00000271029;ENST00000335786|ENST00000402328	.|T;T;T;T;T;T;T;T;T;T;T;T|.	.|0.72835|.	.|-0.52;-0.53;-0.69;-0.63;-0.47;-0.43;-0.63;-0.63;-0.47;-0.43;-0.63;-0.69|.	5.67|5.67|5.67	5.67|5.67|5.67	0.87782|0.87782|0.87782	.|.|.	.|0.000000|.	.|0.64402|.	.|D|.	.|0.000011|.	T|T|T	0.68375|0.68375|0.68375	0.2994|0.2994|0.2994	M|M|M	0.62723|0.62723|0.62723	1.935|1.935|1.935	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|P;D|.	.|0.69078|.	.|0.663;0.997|.	.|B;D|.	.|0.76071|.	.|0.395;0.987|.	T|T|T	0.64841|0.64841|0.64841	-0.6312|-0.6312|-0.6312	5|10|5	.|0.59425|.	.|D|.	.|0.04|.	.|.|.	19.773|19.773|19.773	0.96379|0.96379|0.96379	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.|.	.|1280;260|.	.|O95490-2;B3KVU1|.	.|.;.|.	L|V|C	1227|1261;1336;1293;1308;1351;1338;1280;1280;1351;1338;1308;1293|347	.|ENSP00000359756:L1261V;ENSP00000359763:L1336V;ENSP00000359765:L1293V;ENSP00000359762:L1308V;ENSP00000359760:L1351V;ENSP00000359758:L1338V;ENSP00000353006:L1280V;ENSP00000322270:L1280V;ENSP00000359752:L1351V;ENSP00000378344:L1338V;ENSP00000271029:L1308V;ENSP00000337306:L1293V|.	.|ENSP00000271029:L1308V|.	F|L|S	+|+|+	3|1|2	2|2|0	LPHN2|LPHN2|LPHN2	82229043|82229043|82229043	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.988000|0.988000|0.988000	0.76386|0.76386|0.76386	5.773000|5.773000|5.773000	0.68898|0.68898|0.68898	2.677000|2.677000|2.677000	0.91161|0.91161|0.91161	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	TTC|CTG|TCT	.		0.527	LPHN2-007	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000027188.1	NM_012302	
CIART	148523	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	150259000	150259000	+	Silent	SNP	T	T	A			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr1:150259000T>A	ENST00000290363.5	+	5	1241	c.792T>A	c.(790-792)acT>acA	p.T264T	C1orf51_ENST00000369094.1_Silent_p.T176T|C1orf51_ENST00000369095.1_Silent_p.T264T	NM_144697.2	NP_653298.1	Q8N365	CIART_HUMAN		264					circadian regulation of gene expression (GO:0032922)|locomotor rhythm (GO:0045475)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|E-box binding (GO:0070888)			endometrium(3)|large_intestine(2)|lung(3)|urinary_tract(2)	10	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			TCCACACCACTCCAATTTGCA	0.522																																					p.T264T		.											.	C1orf51-90	0			c.T792A						.						243.0	190.0	208.0					1																	150259000		2203	4300	6503	SO:0001819	synonymous_variant	148523	exon5			CACCACTCCAATT																												ENST00000290363.5:c.792T>A	1.37:g.150259000T>A		Somatic	161	0		WXS	Illumina HiSeq	Phase_I	183	35	NM_144697	0	0	15	20	5	B2RD43|D3DV01|Q8N795|Q96MG6	Silent	SNP	ENST00000290363.5	37	CCDS949.1																																																																																			.		0.522	C1orf51-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035058.1		
CRTC2	200186	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	153924520	153924520	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr1:153924520C>A	ENST00000368633.1	-	10	1098	c.971G>T	c.(970-972)gGc>gTc	p.G324V	CRTC2_ENST00000368630.3_Intron|CRTC2_ENST00000476883.1_5'Flank	NM_181715.2	NP_859066.1	Q53ET0	CRTC2_HUMAN	CREB regulated transcription coactivator 2	324				MGL -> HGP (in Ref. 1; AAQ98857). {ECO:0000305}.	gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|histone H3-K9 acetylation (GO:0043970)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	cAMP response element binding protein binding (GO:0008140)			NS(1)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)	27	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			TGGGCCCAGGCCCATGCCCCT	0.607																																					p.G324V		.											.	CRTC2-228	0			c.G971T						.						58.0	57.0	57.0					1																	153924520		2203	4300	6503	SO:0001583	missense	200186	exon10			CCCAGGCCCATGC	AY360172	CCDS30875.1	1q21.3	2008-02-05			ENSG00000160741	ENSG00000160741			27301	protein-coding gene	gene with protein product		608972				14506290, 14536081	Standard	NM_181715		Approved	TORC2	uc021pab.1	Q53ET0	OTTHUMG00000037156	ENST00000368633.1:c.971G>T	1.37:g.153924520C>A	ENSP00000357622:p.Gly324Val	Somatic	95	0		WXS	Illumina HiSeq	Phase_I	108	14	NM_181715	0	0	15	25	10	Q6UUV8|Q7Z3X7|Q8N332	Missense_Mutation	SNP	ENST00000368633.1	37	CCDS30875.1	.	.	.	.	.	.	.	.	.	.	c	6.593	0.477845	0.12521	.	.	ENSG00000160741	ENST00000368633	T	0.12774	2.65	4.84	3.92	0.45320	.	0.625789	0.15810	N	0.243526	T	0.05502	0.0145	L	0.36672	1.1	0.48830	D	0.999715	B	0.23249	0.082	B	0.21708	0.036	T	0.09185	-1.0686	10	0.66056	D	0.02	-3.8662	11.1372	0.48381	0.0:0.813:0.187:0.0	.	324	Q53ET0	CRTC2_HUMAN	V	324	ENSP00000357622:G324V	ENSP00000357622:G324V	G	-	2	0	CRTC2	152191144	0.420000	0.25457	0.997000	0.53966	0.095000	0.18619	0.767000	0.26575	1.028000	0.39785	0.450000	0.29827	GGC	.		0.607	CRTC2-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090272.3	NM_181715	
C1orf111	284680	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	162344114	162344114	+	Silent	SNP	T	T	C			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr1:162344114T>C	ENST00000367935.5	-	3	589	c.510A>G	c.(508-510)ctA>ctG	p.L170L	RP11-565P22.6_ENST00000431696.1_Intron	NM_182581.3	NP_872387.2	Q5T0L3	CA111_HUMAN	chromosome 1 open reading frame 111	170										central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)	11	all_hematologic(112;0.15)		BRCA - Breast invasive adenocarcinoma(70;0.0938)			TGGAAGCCATTAGGATGTCCT	0.567																																					p.L170L		.											.	C1orf111-69	0			c.A510G						.						204.0	196.0	198.0					1																	162344114		2203	4300	6503	SO:0001819	synonymous_variant	284680	exon3			AGCCATTAGGATG	BC032957	CCDS1238.1	1q23.3	2008-02-05			ENSG00000171722	ENSG00000171722			27648	protein-coding gene	gene with protein product						12477932	Standard	NM_182581		Approved		uc001gbx.2	Q5T0L3	OTTHUMG00000031375	ENST00000367935.5:c.510A>G	1.37:g.162344114T>C		Somatic	339	1		WXS	Illumina HiSeq	Phase_I	317	53	NM_182581	0	0	0	0	0	Q6X961|Q8NEC3	Silent	SNP	ENST00000367935.5	37	CCDS1238.1																																																																																			.		0.567	C1orf111-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076791.2	NM_182581	
IVNS1ABP	10625	hgsc.bcm.edu	37	1	185278246	185278246	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr1:185278246A>G	ENST00000367498.3	-	4	792	c.170T>C	c.(169-171)tTa>tCa	p.L57S	IVNS1ABP_ENST00000392007.3_5'UTR|IVNS1ABP_ENST00000367497.1_Missense_Mutation_p.L57S|IVNS1ABP_ENST00000459929.1_5'UTR	NM_006469.4	NP_006460.2	Q9Y6Y0	NS1BP_HUMAN	influenza virus NS1A binding protein	57	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|response to virus (GO:0009615)|RNA splicing (GO:0008380)|transcription from RNA polymerase III promoter (GO:0006383)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|spliceosomal complex (GO:0005681)|transcription factor complex (GO:0005667)				breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|ovary(4)|prostate(2)	29						GATTTCAAATAAATAGGGACT	0.348																																					p.L57S		.											.	IVNS1ABP-94	0			c.T170C						.						40.0	41.0	40.0					1																	185278246		2203	4300	6503	SO:0001583	missense	10625	exon4			TCAAATAAATAGG	AB020657	CCDS1368.1	1q25.1-q31.1	2013-01-30			ENSG00000116679	ENSG00000116679		"""Kelch-like"", ""BTB/POZ domain containing"""	16951	protein-coding gene	gene with protein product	"""kelch-like family member 39"""	609209				9696811, 10048485	Standard	NM_006469		Approved	NS1-BP, HSPC068, NS-1, KIAA0850, ND1, KLHL39	uc001grl.3	Q9Y6Y0	OTTHUMG00000035384	ENST00000367498.3:c.170T>C	1.37:g.185278246A>G	ENSP00000356468:p.Leu57Ser	Somatic	37	0		WXS	Illumina HiSeq	Phase_I	34	2	NM_006469	0	0	45	45	0	A8K8R6|Q1G4T6|Q1G4T7|Q5TF75|Q6NW38|Q7LCG2|Q9NZX0|Q9Y480	Missense_Mutation	SNP	ENST00000367498.3	37	CCDS1368.1	.	.	.	.	.	.	.	.	.	.	A	25.3	4.621805	0.87460	.	.	ENSG00000116679	ENST00000367498;ENST00000367497	T;T	0.73152	-0.72;1.8	5.67	5.67	0.87782	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	D	0.87430	0.6175	M	0.92026	3.265	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90273	0.4309	10	0.87932	D	0	.	15.916	0.79517	1.0:0.0:0.0:0.0	.	57	Q9Y6Y0	NS1BP_HUMAN	S	57	ENSP00000356468:L57S;ENSP00000356467:L57S	ENSP00000356467:L57S	L	-	2	0	IVNS1ABP	183544869	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.210000	0.95106	2.164000	0.68074	0.482000	0.46254	TTA	.		0.348	IVNS1ABP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085774.1	NM_006469	
BRINP3	339479	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	190067269	190067269	+	Nonsense_Mutation	SNP	A	A	T			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr1:190067269A>T	ENST00000367462.3	-	8	2411	c.2180T>A	c.(2179-2181)tTg>tAg	p.L727*	BRINP3_ENST00000534846.1_Nonsense_Mutation_p.L625*	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	727					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)											ATGACGAAGCAAGCAAGAGAA	0.463																																					p.L727X		.											.	FAM5C-228	0			c.T2180A						.						115.0	111.0	112.0					1																	190067269		2203	4300	6503	SO:0001587	stop_gained	339479	exon8			CGAAGCAAGCAAG	AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.2180T>A	1.37:g.190067269A>T	ENSP00000356432:p.Leu727*	Somatic	146	0		WXS	Illumina HiSeq	Phase_I	129	14	NM_199051	0	0	0	0	0	B3KVP1|B7Z260|O95726|Q2M330	Nonsense_Mutation	SNP	ENST00000367462.3	37	CCDS1373.1	.	.	.	.	.	.	.	.	.	.	A	37	6.250241	0.97412	.	.	ENSG00000162670	ENST00000367462;ENST00000534846	.	.	.	5.72	4.6	0.57074	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.7499	0.40470	0.9186:0.0:0.0814:0.0	.	.	.	.	X	727;625	.	ENSP00000356432:L727X	L	-	2	0	FAM5C	188333892	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.237000	0.95368	1.005000	0.39183	0.528000	0.53228	TTG	.		0.463	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086278.1	NM_199051	
PTPRC	5788	hgsc.bcm.edu;broad.mit.edu	37	1	198704382	198704382	+	Splice_Site	SNP	G	G	A			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr1:198704382G>A	ENST00000367376.2	+	23	2568		c.e23+1		PTPRC_ENST00000352140.3_Splice_Site|PTPRC_ENST00000594404.1_Splice_Site|PTPRC_ENST00000442510.2_Splice_Site|PTPRC_ENST00000348564.6_Splice_Site	NM_002838.4	NP_002829.3	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C						axon guidance (GO:0007411)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|bone marrow development (GO:0048539)|cell cycle phase transition (GO:0044770)|cell surface receptor signaling pathway (GO:0007166)|defense response to virus (GO:0051607)|dephosphorylation (GO:0016311)|hematopoietic progenitor cell differentiation (GO:0002244)|immunoglobulin biosynthetic process (GO:0002378)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of antigen receptor-mediated signaling pathway (GO:0050857)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of T cell proliferation (GO:0042102)|protein dephosphorylation (GO:0006470)|regulation of cell cycle (GO:0051726)|release of sequestered calcium ion into cytosol (GO:0051209)|stem cell development (GO:0048864)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(7)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(22)|lung(41)|ovary(4)|pancreas(2)|prostate(1)|skin(13)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	111						CATTGTAAATGTGAGTTTGCT	0.274																																					.		.											.	PTPRC-295	0			c.1920+1G>A						.						69.0	64.0	66.0					1																	198704382		2203	4299	6502	SO:0001630	splice_region_variant	5788	exon20			GTAAATGTGAGTT	Y00062	CCDS1397.1, CCDS1398.1, CCDS44291.1, CCDS1397.2, CCDS1398.2, CCDS44291.2	1q31-q32	2014-09-17			ENSG00000081237	ENSG00000081237		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9666	protein-coding gene	gene with protein product		151460		CD45		2169617	Standard	NM_001267798		Approved	LCA, T200, GP180	uc001gur.2	P08575	OTTHUMG00000035702	ENST00000367376.2:c.2397+1G>A	1.37:g.198704382G>A		Somatic	37	0		WXS	Illumina HiSeq	Phase_I	35	4	NM_080921	0	0	0	0	0	A8K7W6|Q16614|Q9H0Y6	Splice_Site	SNP	ENST00000367376.2	37		.	.	.	.	.	.	.	.	.	.	G	12.65	2.000478	0.35320	.	.	ENSG00000081237	ENST00000367376;ENST00000352140;ENST00000535566;ENST00000442510;ENST00000348564	.	.	.	5.1	5.1	0.69264	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.8748	0.92331	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PTPRC	196971005	1.000000	0.71417	0.950000	0.38849	0.039000	0.13416	9.366000	0.97143	2.523000	0.85059	0.655000	0.94253	.	.		0.274	PTPRC-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding			Intron
URB2	9816	broad.mit.edu	37	1	229771589	229771589	+	Missense_Mutation	SNP	G	G	A	rs139241970		TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr1:229771589G>A	ENST00000258243.2	+	4	1365	c.1229G>A	c.(1228-1230)cGc>cAc	p.R410H		NM_014777.2	NP_055592.2	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog (S. cerevisiae)	410						aggresome (GO:0016235)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(6)	73						GCCTGGTTCCGCTGTCTGAAG	0.527																																					p.R410H													.	URB2-174	0			c.G1229A						.	G	HIS/ARG	0,4406		0,0,2203	64.0	67.0	66.0		1229	5.5	1.0	1	dbSNP_134	66	1,8599	1.2+/-3.3	0,1,4299	no	missense	URB2	NM_014777.2	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	410/1525	229771589	1,13005	2203	4300	6503	SO:0001583	missense	9816	exon4			GGTTCCGCTGTCT	D50923	CCDS31052.1	1q42.13	2009-11-06	2008-10-01	2008-10-01	ENSG00000135763	ENSG00000135763			28967	protein-coding gene	gene with protein product	"""nucleolar preribosomal-associated protein 1"""		"""KIAA0133"""	KIAA0133		8590280	Standard	NM_014777		Approved	NPA2, NET10	uc001hts.1	Q14146	OTTHUMG00000039464	ENST00000258243.2:c.1229G>A	1.37:g.229771589G>A	ENSP00000258243:p.Arg410His	Somatic	100	0		WXS	Illumina HiSeq	Phase_I	98	4	NM_014777	0	0	2	2	0	Q5VYC9	Missense_Mutation	SNP	ENST00000258243.2	37	CCDS31052.1	.	.	.	.	.	.	.	.	.	.	G	18.47	3.630889	0.67015	0.0	1.16E-4	ENSG00000135763	ENST00000258243	T	0.35236	1.32	5.5	5.5	0.81552	.	0.050790	0.85682	D	0.000000	T	0.55049	0.1896	M	0.68952	2.095	0.58432	D	0.999999	D	0.76494	0.999	P	0.56788	0.806	T	0.51309	-0.8722	9	.	.	.	-23.8334	19.7863	0.96440	0.0:0.0:1.0:0.0	.	410	Q14146	URB2_HUMAN	H	410	ENSP00000258243:R410H	.	R	+	2	0	URB2	227838212	1.000000	0.71417	1.000000	0.80357	0.436000	0.31835	7.325000	0.79124	2.765000	0.95021	0.650000	0.86243	CGC	G|1.000;A|0.000		0.527	URB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095232.1	NM_014777	
HTRA1	5654	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	124273843	124273843	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr10:124273843A>T	ENST00000368984.3	+	9	1539	c.1411A>T	c.(1411-1413)Atc>Ttc	p.I471F		NM_002775.4	NP_002766.1	Q92743	HTRA1_HUMAN	HtrA serine peptidase 1	471					negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(1)|kidney(1)|large_intestine(8)|lung(7)	17		all_neural(114;0.0765)|Lung NSC(174;0.133)|all_lung(145;0.163)|Breast(234;0.238)				AGATATCATGATCACAGTGAT	0.507																																					p.I471F		.											.	HTRA1-90	0			c.A1411T						.						155.0	138.0	144.0					10																	124273843		2203	4300	6503	SO:0001583	missense	5654	exon9			ATCATGATCACAG	AF097709	CCDS7630.1	10q26.3	2014-01-28	2005-08-18	2005-08-18	ENSG00000166033	ENSG00000166033		"""Serine peptidases / Serine peptidases"""	9476	protein-coding gene	gene with protein product		602194	"""protease, serine, 11 (IGF binding)"""	PRSS11		8977104	Standard	NM_002775		Approved	HtrA, IGFBP5-protease, ARMD7	uc001lgj.2	Q92743	OTTHUMG00000019186	ENST00000368984.3:c.1411A>T	10.37:g.124273843A>T	ENSP00000357980:p.Ile471Phe	Somatic	100	0		WXS	Illumina HiSeq	Phase_I	99	20	NM_002775	0	0	161	238	77	D3DRE4|Q9UNS5	Missense_Mutation	SNP	ENST00000368984.3	37	CCDS7630.1	.	.	.	.	.	.	.	.	.	.	A	1.382	-0.583027	0.03827	.	.	ENSG00000166033	ENST00000368984;ENST00000435263;ENST00000420892	D;D	0.82893	-1.66;-1.66	5.48	1.75	0.24633	PDZ/DHR/GLGF (1);	0.119403	0.56097	D	0.000029	T	0.67636	0.2914	L	0.31371	0.925	0.51767	D	0.999938	B	0.06786	0.001	B	0.06405	0.002	T	0.51601	-0.8685	10	0.28530	T	0.3	-8.1432	3.9311	0.09285	0.4669:0.3415:0.0687:0.1228	.	471	Q92743	HTRA1_HUMAN	F	471;438;212	ENSP00000357980:I471F;ENSP00000412676:I212F	ENSP00000357980:I471F	I	+	1	0	HTRA1	124263833	0.991000	0.36638	0.304000	0.25085	0.093000	0.18481	0.396000	0.20867	0.043000	0.15746	-0.313000	0.08912	ATC	.		0.507	HTRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128327.1	NM_002775	
FAR1	84188	hgsc.bcm.edu	37	11	13743391	13743391	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr11:13743391C>G	ENST00000354817.3	+	10	1386	c.1242C>G	c.(1240-1242)aaC>aaG	p.N414K	FAR1_ENST00000532502.1_Missense_Mutation_p.N38K	NM_032228.5	NP_115604.1	Q8WVX9	FACR1_HUMAN	fatty acyl CoA reductase 1	414					cellular lipid metabolic process (GO:0044255)|ether lipid biosynthetic process (GO:0008611)|glycerophospholipid biosynthetic process (GO:0046474)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)|small molecule metabolic process (GO:0044281)|wax biosynthetic process (GO:0010025)	integral component of membrane (GO:0016021)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	fatty-acyl-CoA reductase (alcohol-forming) activity (GO:0080019)|long-chain-fatty-acyl-CoA reductase activity (GO:0050062)			breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	13						ATCAACTAAACCCTGAAGATA	0.303																																					p.N414K		.											.	FAR1-92	0			c.C1242G						.						68.0	67.0	68.0					11																	13743391		2200	4291	6491	SO:0001583	missense	84188	exon10			ACTAAACCCTGAA	AK026381	CCDS7813.1	11p15.2	2011-09-14	2008-06-06	2008-06-06	ENSG00000197601	ENSG00000197601	1.2.1.-	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	26222	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 10E, member 1"""		"""male sterility domain containing 2"""	MLSTD2		15220348, 15220349, 19027726	Standard	NM_032228		Approved	FLJ22728, SDR10E1	uc001mld.3	Q8WVX9	OTTHUMG00000165743	ENST00000354817.3:c.1242C>G	11.37:g.13743391C>G	ENSP00000346874:p.Asn414Lys	Somatic	41	0		WXS	Illumina HiSeq	Phase_I	36	2	NM_032228	0	0	11	11	0	D3DQW8|Q5CZA3	Missense_Mutation	SNP	ENST00000354817.3	37	CCDS7813.1	.	.	.	.	.	.	.	.	.	.	C	13.76	2.333187	0.41297	.	.	ENSG00000197601	ENST00000354817;ENST00000532502	T	0.22539	1.95	5.5	1.55	0.23275	.	0.086625	0.85682	D	0.000000	T	0.19005	0.0456	L	0.43923	1.385	0.32231	N	0.573949	B	0.26318	0.146	B	0.32928	0.155	T	0.14337	-1.0476	10	0.66056	D	0.02	-7.2202	9.0175	0.36179	0.0:0.5608:0.0:0.4392	.	414	Q8WVX9	FACR1_HUMAN	K	414;38	ENSP00000346874:N414K	ENSP00000346874:N414K	N	+	3	2	FAR1	13699967	0.983000	0.35010	0.998000	0.56505	0.984000	0.73092	0.318000	0.19504	0.098000	0.17522	0.650000	0.86243	AAC	.		0.303	FAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385990.2	NM_032228	
PHB2	11331	ucsc.edu;bcgsc.ca	37	12	7076752	7076752	+	Intron	SNP	C	C	T			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr12:7076752C>T	ENST00000535923.1	-	6	993				SCARNA12_ENST00000459155.1_RNA|U47924.29_ENST00000606539.1_RNA|PHB2_ENST00000544134.1_5'Flank|PHB2_ENST00000440277.1_Intron|PHB2_ENST00000399433.2_Intron|PHB2_ENST00000542912.1_Intron|PHB2_ENST00000546111.1_Intron	NM_001144831.1	NP_001138303.1			prohibitin 2											ovary(2)|pancreas(1)	3						TCGCATTCGCCTTAGTCTCAT	0.552																																					.													.	.	0			.						.						68.0	66.0	67.0					12																	7076752		876	1991	2867	SO:0001627	intron_variant	677777	.			ATTCGCCTTAGTC	AF126021	CCDS53741.1, CCDS58207.1	12p13	2013-03-11			ENSG00000215021	ENSG00000215021			30306	protein-coding gene	gene with protein product		610704				11302691, 9259555	Standard	NM_001144831		Approved	REA, BCAP37, Bap37, p22	uc021quf.1	Q99623	OTTHUMG00000168519	ENST00000535923.1:c.711+86G>A	12.37:g.7076752C>T		Somatic	87	0		WXS	Illumina HiSeq		87	15	.	0	0	0	0	0		RNA	SNP	ENST00000535923.1	37	CCDS53741.1																																																																																			.		0.552	PHB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400040.3	NM_007273	
CNTN1	1272	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	41327590	41327590	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr12:41327590A>C	ENST00000551295.2	+	9	1012	c.895A>C	c.(895-897)Aat>Cat	p.N299H	CNTN1_ENST00000547849.1_Missense_Mutation_p.N299H|CNTN1_ENST00000360099.3_Missense_Mutation_p.N299H|CNTN1_ENST00000348761.2_Missense_Mutation_p.N288H|CNTN1_ENST00000547702.1_Missense_Mutation_p.N299H|CNTN1_ENST00000347616.1_Missense_Mutation_p.N299H	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	299	Ig-like C2-type 3.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				TAAGATCTTCAATATTCAGCT	0.408																																					p.N299H		.											.	CNTN1-1149	0			c.A895C						.						85.0	87.0	87.0					12																	41327590		2203	4299	6502	SO:0001583	missense	1272	exon9			ATCTTCAATATTC	Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.895A>C	12.37:g.41327590A>C	ENSP00000447006:p.Asn299His	Somatic	84	0		WXS	Illumina HiSeq	Phase_I	76	14	NM_001256063	0	0	1	1	0	A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Missense_Mutation	SNP	ENST00000551295.2	37	CCDS8737.1	.	.	.	.	.	.	.	.	.	.	A	22.5	4.293171	0.80914	.	.	ENSG00000018236	ENST00000547702;ENST00000551295;ENST00000547849;ENST00000347616;ENST00000360099;ENST00000348761	T;T;T;T;T;T	0.34472	1.36;1.36;1.36;1.36;1.36;1.36	5.24	5.24	0.73138	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.55033	0.1895	L	0.56124	1.755	0.54753	D	0.999986	D;D;D	0.89917	1.0;0.997;0.998	D;D;D	0.75484	0.986;0.968;0.981	T	0.54309	-0.8313	10	0.46703	T	0.11	.	15.4433	0.75204	1.0:0.0:0.0:0.0	.	299;288;299	Q12860-3;Q12860-2;Q12860	.;.;CNTN1_HUMAN	H	299;299;299;299;299;288	ENSP00000448004:N299H;ENSP00000447006:N299H;ENSP00000448653:N299H;ENSP00000325660:N299H;ENSP00000353213:N299H;ENSP00000261160:N288H	ENSP00000325660:N299H	N	+	1	0	CNTN1	39613857	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.730000	0.91510	2.130000	0.65690	0.528000	0.53228	AAT	.		0.408	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403692.2	NM_001843	
PDZRN4	29951	hgsc.bcm.edu	37	12	41582619	41582619	+	Missense_Mutation	SNP	G	G	A	rs74955204	byFrequency	TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr12:41582619G>A	ENST00000402685.2	+	1	370	c.362G>A	c.(361-363)gGg>gAg	p.G121E		NM_001164595.1	NP_001158067.1	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing ring finger 4	121	Gly-rich.						ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	77	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				TGCGCTTCGGGGCTGGGCGGT	0.821													G|||	168	0.0335463	0.0008	0.0461	5008	,	,		2271	0.0635		0.0239	False		,,,				2504	0.0481				p.G121E		.											.	PDZRN4-296	0			c.G362A						.						2.0	1.0	1.0					12																	41582619		600	1482	2082	SO:0001583	missense	29951	exon1			CTTCGGGGCTGGG	AK094690	CCDS8739.1, CCDS53777.1	12q12	2008-08-14	2008-08-14			ENSG00000165966		"""RING-type (C3HC4) zinc fingers"""	30552	protein-coding gene	gene with protein product	"""similar to semaF cytoplasmic domain associated protein 3"""	609730				11230166, 15010864	Standard	NM_013377		Approved	DKFZp434B0417, LNX4, FLJ33777, IMAGE5767589	uc010skn.2	Q6ZMN7		ENST00000402685.2:c.362G>A	12.37:g.41582619G>A	ENSP00000384197:p.Gly121Glu	Somatic	1	1		WXS	Illumina HiSeq	Phase_I	9	4	NM_001164595	0	0	0	0	0	Q52LY3|Q52LY4|Q6N052|Q8IUU1|Q9NTP7	Missense_Mutation	SNP	ENST00000402685.2	37	CCDS53777.1	109	0.04990842490842491	10	0.02032520325203252	12	0.03314917127071823	65	0.11363636363636363	22	0.029023746701846966	G	5.875	0.345515	0.11126	.	.	ENSG00000165966	ENST00000402685	T	0.71461	-0.57	1.11	-0.936	0.10419	.	.	.	.	.	T	0.02848	0.0085	L	0.47190	1.495	0.80722	D	1	.	.	.	.	.	.	T	0.12785	-1.0534	7	0.48119	T	0.1	.	6.1922	0.20530	0.3279:0.0:0.6721:0.0	.	.	.	.	E	121	ENSP00000384197:G121E	ENSP00000384197:G121E	G	+	2	0	PDZRN4	39868886	0.991000	0.36638	0.010000	0.14722	0.064000	0.16182	0.261000	0.18442	-0.372000	0.07992	-0.350000	0.07774	GGG	G|0.950;A|0.050		0.821	PDZRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403701.1	NM_013377	
PLEKHA8P1	51054	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	45567881	45567881	+	RNA	SNP	G	G	T			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr12:45567881G>T	ENST00000256692.5	-	0	804					NR_037144.1		O95397	PKHA9_HUMAN	pleckstrin homology domain containing, family A member 8 pseudogene 1							cytoplasm (GO:0005737)	glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)			breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(10)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						TTATGAATTGGTATAATAGGA	0.413																																					.													.	PLEKHA8P1-226	0			.						.						133.0	123.0	127.0					12																	45567881		2203	4300	6503			51054	.			GAATTGGTATAAT	AF103731		12q12	2010-11-24	2010-11-24	2010-11-24	ENSG00000134297	ENSG00000134297			30222	pseudogene	pseudogene	"""putative glycolipid transfer protein"""		"""pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 9"""	PLEKHA9		12477932	Standard	NR_037144		Approved	FLJ14156	uc001rom.2	O95397			12.37:g.45567881G>T		Somatic	107	0		WXS	Illumina HiSeq	Phase_I	90	21	.	0	0	3	4	1		RNA	SNP	ENST00000256692.5	37																																																																																				.		0.413	PLEKHA8P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000404814.1	NR_037144	
KRT77	374454	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	53097170	53097170	+	Silent	SNP	G	G	T	rs375217197		TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr12:53097170G>T	ENST00000341809.3	-	1	77	c.49C>A	c.(49-51)Cgg>Agg	p.R17R	KRT77_ENST00000537195.1_5'UTR	NM_175078.2	NP_778253.2	Q7Z794	K2C1B_HUMAN	keratin 77	17	Head.					cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(2)|endometrium(2)|large_intestine(3)|lung(11)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25						CTATAAACCCGCCTGCTCATT	0.542																																					p.R17R		.											.	KRT77-187	0			c.C49A						.						64.0	70.0	68.0					12																	53097170		2203	4300	6503	SO:0001819	synonymous_variant	374454	exon1			AAACCCGCCTGCT	BK000975	CCDS8837.1	12q13.13	2013-06-25	2006-07-17	2006-07-17	ENSG00000189182	ENSG00000189182		"""-"", ""Intermediate filaments type II, keratins (basic)"""	20411	protein-coding gene	gene with protein product		611158	"""keratin 1B"""	KRT1B		11683385, 16831889	Standard	NM_175078		Approved		uc001saw.3	Q7Z794	OTTHUMG00000169450	ENST00000341809.3:c.49C>A	12.37:g.53097170G>T		Somatic	78	0		WXS	Illumina HiSeq	Phase_I	70	19	NM_175078	0	0	0	0	0	Q7RTS8	Silent	SNP	ENST00000341809.3	37	CCDS8837.1																																																																																			.		0.542	KRT77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404111.1	NM_175078	
STAT6	6778	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	57499083	57499083	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr12:57499083C>A	ENST00000300134.3	-	9	1177	c.852G>T	c.(850-852)aaG>aaT	p.K284N	STAT6_ENST00000537215.2_Missense_Mutation_p.K174N|STAT6_ENST00000543873.2_Missense_Mutation_p.K284N|STAT6_ENST00000454075.3_Missense_Mutation_p.K284N|STAT6_ENST00000556155.1_Missense_Mutation_p.K284N|STAT6_ENST00000538913.2_Missense_Mutation_p.K174N	NM_001178078.1|NM_003153.4	NP_001171549.1|NP_003144.3	P42226	STAT6_HUMAN	signal transducer and activator of transcription 6, interleukin-4 induced	284					cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|mammary gland epithelial cell proliferation (GO:0033598)|mammary gland morphogenesis (GO:0060443)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of isotype switching to IgE isotypes (GO:0048295)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|T-helper 1 cell lineage commitment (GO:0002296)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane raft (GO:0045121)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein phosphatase binding (GO:0019903)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(2)|lung(8)|ovary(4)|skin(1)	28						TGGTCTGAGTCTTCAGTACCT	0.632																																					p.K284N		.											.	STAT6-849	0			c.G852T						.						38.0	43.0	41.0					12																	57499083		2203	4299	6502	SO:0001583	missense	6778	exon9			CTGAGTCTTCAGT	BC005823, BQ028928	CCDS8931.1, CCDS53804.1	12q13	2013-02-14				ENSG00000166888		"""SH2 domain containing"""	11368	protein-coding gene	gene with protein product		601512				9605853, 8085155	Standard	NM_003153		Approved	D12S1644, IL-4-STAT	uc001sna.3	P42226		ENST00000300134.3:c.852G>T	12.37:g.57499083C>A	ENSP00000300134:p.Lys284Asn	Somatic	99	1		WXS	Illumina HiSeq	Phase_I	105	18	NM_001178079	0	0	59	91	32	A8K316|B7ZA27|F5GXI9|Q5FBW5|Q71UP4	Missense_Mutation	SNP	ENST00000300134.3	37	CCDS8931.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.943506	0.73672	.	.	ENSG00000166888	ENST00000300134;ENST00000535201;ENST00000538913;ENST00000543873;ENST00000556155;ENST00000537215;ENST00000454075;ENST00000542721;ENST00000542516	D;D;D;D;D;D	0.93307	-3.2;-3.2;-3.2;-3.2;-3.2;-3.2	4.64	3.76	0.43208	STAT transcription factor, DNA-binding, subdomain (1);STAT transcription factor, DNA-binding (1);p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.96488	0.8854	M	0.87328	2.875	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.96356	0.9262	10	0.87932	D	0	-24.3606	10.4551	0.44546	0.0:0.9051:0.0:0.0949	.	284;284	A8K4S9;P42226	.;STAT6_HUMAN	N	284;174;174;284;284;174;284;174;284	ENSP00000300134:K284N;ENSP00000445409:K174N;ENSP00000438451:K284N;ENSP00000451742:K284N;ENSP00000444530:K174N;ENSP00000401486:K284N	ENSP00000300134:K284N	K	-	3	2	STAT6	55785350	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.775000	0.47702	1.178000	0.42870	0.561000	0.74099	AAG	.		0.632	STAT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412248.3	NM_003153	
GCN1L1	10985	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	120599294	120599294	+	Splice_Site	SNP	C	C	T			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr12:120599294C>T	ENST00000300648.6	-	22	2448	c.2436G>A	c.(2434-2436)gaG>gaA	p.E812E		NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	812					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)			NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GTGTACTCACCTCCTTCAGCT	0.512																																					p.E812E		.											.	GCN1L1-94	0			c.G2436A						.						166.0	169.0	168.0					12																	120599294		2172	4262	6434	SO:0001630	splice_region_variant	10985	exon22			ACTCACCTCCTTC	U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.2436+1G>A	12.37:g.120599294C>T		Somatic	120	0		WXS	Illumina HiSeq	Phase_I	119	10	NM_006836	0	0	0	0	0	A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Silent	SNP	ENST00000300648.6	37	CCDS41847.1																																																																																			.		0.512	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403592.1		Silent
MYO16	23026	hgsc.bcm.edu	37	13	109793009	109793009	+	Silent	SNP	C	C	T	rs141423536	byFrequency	TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr13:109793009C>T	ENST00000357550.2	+	31	4424	c.4383C>T	c.(4381-4383)caC>caT	p.H1461H	MYO16_ENST00000356711.2_Silent_p.H1461H	NM_001198950.1	NP_001185879.1			myosin XVI											NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			CCCTGCTCCACCGCGCGCCGG	0.761													C|||	89	0.0177716	0.0023	0.0317	5008	,	,		6208	0.0		0.0527	False		,,,				2504	0.0112				p.H1483H		.											.	MYO16-142	0			c.C4449T						.						1.0	2.0	2.0					13																	109793009		1243	2621	3864	SO:0001819	synonymous_variant	23026	exon32			GCTCCACCGCGCG		CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.4383C>T	13.37:g.109793009C>T		Somatic	3	1		WXS	Illumina HiSeq	Phase_I	6	4	NM_001198950	0	0	0	0	0		Silent	SNP	ENST00000357550.2	37	CCDS32008.1																																																																																			C|0.974;T|0.026		0.761	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045746.1	NM_015011	
NFKBIA	4792	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	35871629	35871629	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr14:35871629A>T	ENST00000216797.5	-	5	978	c.877T>A	c.(877-879)Tca>Aca	p.S293T	NFKBIA_ENST00000557389.1_Missense_Mutation_p.S203T|NFKBIA_ENST00000557140.1_Missense_Mutation_p.S250T|NFKBIA_ENST00000557100.1_5'Flank	NM_020529.2	NP_065390.1	P25963	IKBA_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha	293					apoptotic process (GO:0006915)|cellular response to cold (GO:0070417)|cytoplasmic sequestering of NF-kappaB (GO:0007253)|cytoplasmic sequestering of transcription factor (GO:0042994)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of DNA binding (GO:0043392)|negative regulation of lipid storage (GO:0010888)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of Notch signaling pathway (GO:0045746)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070427)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|protein import into nucleus, translocation (GO:0000060)|regulation of cell proliferation (GO:0042127)|regulation of NF-kappaB import into nucleus (GO:0042345)|response to exogenous dsRNA (GO:0043330)|response to muramyl dipeptide (GO:0032495)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|I-kappaB/NF-kappaB complex (GO:0033256)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|nuclear localization sequence binding (GO:0008139)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			breast(3)|endometrium(1)|large_intestine(2)|liver(1)	7	Breast(36;0.0484)|Hepatocellular(127;0.158)		Lung(238;9.25e-06)|LUAD - Lung adenocarcinoma(48;1.53e-05)|Epithelial(34;0.00314)|all cancers(34;0.00891)	GBM - Glioblastoma multiforme(112;0.0222)	Acetylsalicylic acid(DB00945)	GTGAACTCTGACTCTGTGTCA	0.562																																					p.S293T		.											.	NFKBIA-721	0			c.T877A						.						88.0	94.0	92.0					14																	35871629		2203	4300	6503	SO:0001583	missense	4792	exon5			ACTCTGACTCTGT		CCDS9656.1	14q13	2014-09-17			ENSG00000100906	ENSG00000100906		"""Ankyrin repeat domain containing"""	7797	protein-coding gene	gene with protein product		164008		NFKBI		1829648	Standard	NM_020529		Approved	IKBA, MAD-3, IkappaBalpha	uc001wtf.4	P25963	OTTHUMG00000140220	ENST00000216797.5:c.877T>A	14.37:g.35871629A>T	ENSP00000216797:p.Ser293Thr	Somatic	144	0		WXS	Illumina HiSeq	Phase_I	145	24	NM_020529	0	0	87	130	43	B2R8L6	Missense_Mutation	SNP	ENST00000216797.5	37	CCDS9656.1	.	.	.	.	.	.	.	.	.	.	A	15.19	2.759198	0.49468	.	.	ENSG00000100906	ENST00000216797;ENST00000557140;ENST00000557389	T;T;T	0.46063	0.88;0.89;1.06	5.9	4.73	0.59995	Ankyrin repeat-containing domain (1);	.	.	.	.	T	0.28400	0.0702	L	0.29908	0.895	0.34457	D	0.701352	B;B	0.32467	0.372;0.145	B;B	0.30316	0.114;0.034	T	0.36915	-0.9728	9	0.35671	T	0.21	0.4354	7.8624	0.29517	0.7845:0.1395:0.0759:0.0	.	250;293	G3V3I4;P25963	.;IKBA_HUMAN	T	293;250;203	ENSP00000216797:S293T;ENSP00000451257:S250T;ENSP00000450514:S203T	ENSP00000216797:S293T	S	-	1	0	NFKBIA	34941380	1.000000	0.71417	0.820000	0.32676	0.916000	0.54674	3.478000	0.53158	1.015000	0.39444	0.533000	0.62120	TCA	.		0.562	NFKBIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276683.1	NM_020529	
SLC39A9	55334	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	69866098	69866098	+	Silent	SNP	C	C	T			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr14:69866098C>T	ENST00000336643.5	+	1	690	c.12C>T	c.(10-12)ttC>ttT	p.F4F	ERH_ENST00000216520.6_5'Flank|SLC39A9_ENST00000555245.1_Intron|SLC39A9_ENST00000031146.4_Silent_p.F4F|ERH_ENST00000555373.1_5'Flank|SLC39A9_ENST00000557046.1_Silent_p.F4F|ERH_ENST00000557016.1_5'Flank|SLC39A9_ENST00000556605.1_Silent_p.F4F	NM_018375.4	NP_060845.2	Q9NUM3	S39A9_HUMAN	solute carrier family 39, member 9	4					zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)	metal ion transmembrane transporter activity (GO:0046873)	p.F4F(1)		breast(1)|endometrium(2)|large_intestine(4)|lung(4)|prostate(1)|skin(1)|stomach(1)	14				all cancers(60;0.00299)|BRCA - Breast invasive adenocarcinoma(234;0.0145)|OV - Ovarian serous cystadenocarcinoma(108;0.0373)		TGGATGATTTCATCTCCATTA	0.438																																					p.F4F		.											.	SLC39A9-90	1	Substitution - coding silent(1)	endometrium(1)	c.C12T						.						224.0	200.0	208.0					14																	69866098		2203	4300	6503	SO:0001819	synonymous_variant	55334	exon1			TGATTTCATCTCC		CCDS9795.1, CCDS58327.1, CCDS58328.1	14q24.1	2013-07-17	2013-07-17			ENSG00000029364		"""Solute carriers"""	20182	protein-coding gene	gene with protein product							Standard	NM_018375		Approved	FLJ11274	uc001xle.3	Q9NUM3		ENST00000336643.5:c.12C>T	14.37:g.69866098C>T		Somatic	39	0		WXS	Illumina HiSeq	Phase_I	47	13	NM_001252150	0	0	20	35	15	G3V5J8|Q53HN3|Q5MJQ0|Q6P2Q1|Q86WY2	Silent	SNP	ENST00000336643.5	37	CCDS9795.1																																																																																			.		0.438	SLC39A9-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412446.1	NM_018375	
ATP10A	57194	broad.mit.edu	37	15	25953155	25953155	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr15:25953155G>A	ENST00000356865.6	-	12	2654	c.2543C>T	c.(2542-2544)gCc>gTc	p.A848V		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	848					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		CAGGCGAATGGCAGACTGGAA	0.537																																					p.A848V													.	ATP10A-139	0			c.C2543T						.						78.0	69.0	72.0					15																	25953155		2203	4300	6503	SO:0001583	missense	57194	exon12			CGAATGGCAGACT	AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.2543C>T	15.37:g.25953155G>A	ENSP00000349325:p.Ala848Val	Somatic	66	0		WXS	Illumina HiSeq	Phase_I	50	3	NM_024490	0	0	2	2	0	Q4G0S9|Q969I4	Missense_Mutation	SNP	ENST00000356865.6	37	CCDS32178.1	.	.	.	.	.	.	.	.	.	.	G	29.5	5.007574	0.93287	.	.	ENSG00000206190	ENST00000356865	T	0.12147	2.71	4.68	4.68	0.58851	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.85682	D	0.000000	T	0.33990	0.0882	M	0.62723	1.935	0.58432	D	0.999999	D	0.67145	0.996	D	0.72338	0.977	T	0.03130	-1.1069	10	0.25751	T	0.34	-32.1911	17.9745	0.89123	0.0:0.0:1.0:0.0	.	848	O60312	AT10A_HUMAN	V	848	ENSP00000349325:A848V	ENSP00000349325:A848V	A	-	2	0	ATP10A	23504248	1.000000	0.71417	0.504000	0.27639	0.994000	0.84299	9.090000	0.94144	2.311000	0.77944	0.655000	0.94253	GCC	.		0.537	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414830.1	NM_024490	
SLC28A2	9153	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	45561728	45561728	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr15:45561728A>C	ENST00000347644.3	+	14	1626	c.1561A>C	c.(1561-1563)Att>Ctt	p.I521L	CTD-2651B20.3_ENST00000561404.1_RNA|CTD-2651B20.3_ENST00000560344.1_RNA	NM_004212.3	NP_004203.2	O43868	S28A2_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 2	521					nucleobase-containing compound metabolic process (GO:0006139)|purine nucleoside transmembrane transport (GO:0015860)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|nucleoside:sodium symporter activity (GO:0005415)|purine nucleoside transmembrane transporter activity (GO:0015211)			NS(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(4)|skin(1)	26		all_cancers(109;8.53e-07)|all_epithelial(112;1.39e-05)|Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;3.77e-16)|GBM - Glioblastoma multiforme(94;2.71e-06)	Mercaptopurine(DB01033)	GAAACAGTGGATTTCTGTAAG	0.433																																					p.I521L	NSCLC(92;493 1501 26361 28917 47116)	.											.	SLC28A2-94	0			c.A1561C						.						96.0	90.0	92.0					15																	45561728		2198	4298	6496	SO:0001583	missense	9153	exon14			CAGTGGATTTCTG	U84392	CCDS10121.1	15q15	2013-07-17	2013-07-17		ENSG00000137860	ENSG00000137860		"""Solute carriers"""	11002	protein-coding gene	gene with protein product		606208	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 2"""			9435697	Standard	NM_004212		Approved	CNT2, SPNT1, HCNT2, HsT17153	uc001zva.2	O43868	OTTHUMG00000131426	ENST00000347644.3:c.1561A>C	15.37:g.45561728A>C	ENSP00000315006:p.Ile521Leu	Somatic	38	0		WXS	Illumina HiSeq	Phase_I	37	6	NM_004212	0	0	0	0	0	A8K7F9|O43239|Q52LZ0	Missense_Mutation	SNP	ENST00000347644.3	37	CCDS10121.1	.	.	.	.	.	.	.	.	.	.	A	17.79	3.475336	0.63737	.	.	ENSG00000137860	ENST00000347644	T	0.04454	3.62	6.17	3.87	0.44632	Na dependent nucleoside transporter, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.05318	0.0141	N	0.20445	0.575	0.58432	D	0.999999	P	0.39551	0.678	P	0.46339	0.513	T	0.50381	-0.8835	10	0.48119	T	0.1	-12.9596	7.5865	0.27995	0.7845:0.1422:0.0733:0.0	.	521	O43868	S28A2_HUMAN	L	521	ENSP00000315006:I521L	ENSP00000315006:I521L	I	+	1	0	SLC28A2	43349020	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.369000	0.52365	0.559000	0.29153	0.533000	0.62120	ATT	.		0.433	SLC28A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254219.2	NM_004212	
MTFMT	123263	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	65295424	65295424	+	Silent	SNP	A	A	C			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr15:65295424A>C	ENST00000220058.4	-	9	1159	c.1146T>G	c.(1144-1146)gtT>gtG	p.V382V		NM_139242.3	NP_640335.2	Q96DP5	FMT_HUMAN	mitochondrial methionyl-tRNA formyltransferase	382						mitochondrion (GO:0005739)	methionyl-tRNA formyltransferase activity (GO:0004479)			endometrium(1)|large_intestine(3)|lung(3)|ovary(3)	10					Tetrahydrofolic acid(DB00116)	GTTGCATAGCAACAGTTTTTT	0.348																																					p.V382V		.											.	MTFMT-24	0			c.T1146G						.						111.0	98.0	102.0					15																	65295424		1825	4084	5909	SO:0001819	synonymous_variant	123263	exon9			CATAGCAACAGTT	AK055688	CCDS45280.1	15q22.31	2006-11-29		2005-08-09		ENSG00000103707			29666	protein-coding gene	gene with protein product		611766				9614118	Standard	NM_139242		Approved	FMT1	uc002aof.4	Q96DP5		ENST00000220058.4:c.1146T>G	15.37:g.65295424A>C		Somatic	38	0		WXS	Illumina HiSeq	Phase_I	56	9	NM_139242	0	0	9	14	5	B7Z734	Silent	SNP	ENST00000220058.4	37	CCDS45280.1																																																																																			.		0.348	MTFMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418155.1	NM_139242	
C15orf27	123591	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	76484312	76484312	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr15:76484312G>A	ENST00000388942.3	+	9	1048	c.772G>A	c.(772-774)Gag>Aag	p.E258K		NM_152335.2	NP_689548.2	Q2M3C6	CO027_HUMAN	chromosome 15 open reading frame 27	258					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|membrane depolarization during action potential (GO:0086010)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	voltage-gated calcium channel activity (GO:0005245)			endometrium(1)|large_intestine(1)|lung(10)|pancreas(1)	13						TCCGCAGTTTGAGATCCGGCA	0.741																																					p.E258K		.											.	C15orf27-90	0			c.G772A						.						8.0	10.0	9.0					15																	76484312		2045	4020	6065	SO:0001583	missense	123591	exon9			CAGTTTGAGATCC	AK095509	CCDS10289.2	15q23-q24.1	2012-09-27			ENSG00000169758	ENSG00000169758			26763	protein-coding gene	gene with protein product						14702039, 22020278	Standard	NM_152335		Approved	FLJ38190	uc002bbq.3	Q2M3C6	OTTHUMG00000142918	ENST00000388942.3:c.772G>A	15.37:g.76484312G>A	ENSP00000373594:p.Glu258Lys	Somatic	43	0		WXS	Illumina HiSeq	Phase_I	49	9	NM_152335	0	0	0	0	0	Q8N993|Q96LL5	Missense_Mutation	SNP	ENST00000388942.3	37	CCDS10289.2	.	.	.	.	.	.	.	.	.	.	G	19.39	3.818369	0.71028	.	.	ENSG00000169758	ENST00000388942	T	0.47869	0.83	4.58	4.58	0.56647	.	0.123666	0.56097	D	0.000027	T	0.67392	0.2888	M	0.73962	2.25	0.58432	D	0.999999	D;D	0.71674	0.998;0.996	D;D	0.80764	0.994;0.99	T	0.70590	-0.4830	10	0.52906	T	0.07	-5.2743	14.5154	0.67816	0.0:0.0:1.0:0.0	.	222;258	Q2M3C6-2;Q2M3C6	.;CO027_HUMAN	K	258	ENSP00000373594:E258K	ENSP00000373594:E258K	E	+	1	0	C15orf27	74271367	1.000000	0.71417	1.000000	0.80357	0.669000	0.39330	8.737000	0.91562	2.097000	0.63578	0.491000	0.48974	GAG	.		0.741	C15orf27-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000286637.2	NM_152335	
ANPEP	290	broad.mit.edu	37	15	90349269	90349269	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr15:90349269G>C	ENST00000300060.6	-	2	859	c.546C>G	c.(544-546)ttC>ttG	p.F182L		NM_001150.2	NP_001141.2	P15144	AMPN_HUMAN	alanyl (membrane) aminopeptidase	182	Metalloprotease.				angiogenesis (GO:0001525)|angiotensin maturation (GO:0002003)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|viral process (GO:0016032)	endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|receptor activity (GO:0004872)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	57	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)|Icatibant(DB06196)	ACTCCCCCTCGAACTCGCTGT	0.607																																					p.F182L	NSCLC(30;827 977 2459 19669 26125)												.	ANPEP-94	0			c.C546G						.						91.0	86.0	87.0					15																	90349269		2200	4299	6499	SO:0001583	missense	290	exon2			CCCCTCGAACTCG	M22324	CCDS10356.1	15q25-q26	2008-07-31	2008-07-31		ENSG00000166825	ENSG00000166825	3.4.11.2	"""CD molecules"""	500	protein-coding gene	gene with protein product	"""aminopeptidase N"", ""aminopeptidase M"", ""microsomal aminopeptidase"""	151530		CD13, PEPN		2428842, 1977688	Standard	NM_001150		Approved	LAP1, gp150, p150	uc002bop.4	P15144	OTTHUMG00000149814	ENST00000300060.6:c.546C>G	15.37:g.90349269G>C	ENSP00000300060:p.Phe182Leu	Somatic	130	0		WXS	Illumina HiSeq	Phase_I	153	5	NM_001150	0	0	439	465	25	Q16728|Q6GT90|Q8IUK3|Q8IVH3|Q9UCE0	Missense_Mutation	SNP	ENST00000300060.6	37	CCDS10356.1	.	.	.	.	.	.	.	.	.	.	G	12.48	1.949569	0.34377	.	.	ENSG00000166825	ENST00000300060	T	0.03441	3.93	4.8	0.924	0.19418	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.26011	0.0634	H	0.98333	4.205	0.29499	N	0.855041	D	0.89917	1.0	D	0.97110	1.0	T	0.19418	-1.0306	10	0.87932	D	0	.	7.4046	0.26983	0.6447:0.0:0.3553:0.0	.	182	P15144	AMPN_HUMAN	L	182	ENSP00000300060:F182L	ENSP00000300060:F182L	F	-	3	2	ANPEP	88150273	0.003000	0.15002	0.035000	0.18076	0.018000	0.09664	0.045000	0.14013	0.310000	0.22990	0.563000	0.77884	TTC	.		0.607	ANPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313425.1		
CIITA	4261	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	10992818	10992818	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr16:10992818T>C	ENST00000324288.8	+	5	528	c.395T>C	c.(394-396)aTg>aCg	p.M132T	CIITA_ENST00000381835.5_Missense_Mutation_p.M132T|CIITA_ENST00000537380.1_3'UTR	NM_000246.3	NP_000237	P33076	C2TA_HUMAN	class II, major histocompatibility complex, transactivator	132	Asp/Glu-rich (acidic).|Required for acetyltransferase activity.				aging (GO:0007568)|cellular response to electrical stimulus (GO:0071257)|cellular response to exogenous dsRNA (GO:0071360)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to antibiotic (GO:0046677)|response to interferon-gamma (GO:0034341)|transcription, DNA-templated (GO:0006351)	cell surface (GO:0009986)|nucleoplasm (GO:0005654)|PML body (GO:0016605)	activating transcription factor binding (GO:0033613)|ATP binding (GO:0005524)|GTP binding (GO:0005525)|kinase activity (GO:0016301)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transferase activity, transferring acyl groups (GO:0016746)			central_nervous_system(1)|large_intestine(7)|ovary(1)|skin(1)|stomach(2)	12						GGTGAGAGTATGGAGATGCCA	0.483			T	"""FLJ27352, CD274, CD273, RALGDS, RUNDC2A, C16orf75, BCL6"""	"""PMBL, Hodgkin Lymphona, """																																p.M132T		.		Dom	yes		16	16p13	4261	"""class II, major histocompatibility complex, transactivator"""		L	.	CIITA-226	0			c.T395C						.						183.0	172.0	176.0					16																	10992818		2197	4300	6497	SO:0001583	missense	4261	exon5			AGAGTATGGAGAT	U18259	CCDS10544.1, CCDS66943.1, CCDS73826.1	16p13	2014-09-17	2005-08-12	2005-08-12	ENSG00000179583	ENSG00000179583		"""Nucleotide-binding domain and leucine rich repeat containing"""	7067	protein-coding gene	gene with protein product	"""NLR family, acid domain containing"", ""nucleotide-binding oligomerization domain, leucine rich repeat and acid domain containing"""	600005	"""MHC class II transactivator"""	MHC2TA		8402893	Standard	NM_000246		Approved	C2TA, NLRA	uc002dai.4	P33076	OTTHUMG00000129753	ENST00000324288.8:c.395T>C	16.37:g.10992818T>C	ENSP00000316328:p.Met132Thr	Somatic	141	0		WXS	Illumina HiSeq	Phase_I	137	15	NM_000246	0	0	11	11	0	A0N0N9|D3DUG0|E9PFE0|Q29675|Q8SNB8|Q96KL4	Missense_Mutation	SNP	ENST00000324288.8	37	CCDS10544.1	.	.	.	.	.	.	.	.	.	.	T	5.450	0.268042	0.10349	.	.	ENSG00000179583	ENST00000324288;ENST00000381835;ENST00000388910;ENST00000537380	T;T	0.70749	-0.51;1.78	3.81	2.68	0.31781	.	1.431470	0.05038	N	0.475874	T	0.52224	0.1721	N	0.14661	0.345	0.09310	N	1	B;B;B;B;B;B	0.30824	0.296;0.01;0.017;0.017;0.052;0.109	B;B;B;B;B;B	0.28849	0.095;0.005;0.014;0.014;0.047;0.021	T	0.44283	-0.9338	10	0.30078	T	0.28	.	5.0256	0.14383	0.0:0.1558:0.0:0.8442	.	132;132;132;132;133;132	F5H2J4;E9PFE0;A0N0N9;P33076;F2Z2G8;Q96KL4	.;.;.;C2TA_HUMAN;.;.	T	132;132;133;132	ENSP00000316328:M132T;ENSP00000371257:M132T	ENSP00000316328:M132T	M	+	2	0	CIITA	10900319	0.615000	0.27026	0.024000	0.17045	0.006000	0.05464	1.060000	0.30530	0.628000	0.30357	0.455000	0.32223	ATG	.		0.483	CIITA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251966.2	NM_000246	
ABCC11	85320	hgsc.bcm.edu;broad.mit.edu	37	16	48230229	48230229	+	Missense_Mutation	SNP	G	G	A	rs531997909		TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr16:48230229G>A	ENST00000394747.1	-	17	2667	c.2318C>T	c.(2317-2319)cCg>cTg	p.P773L	ABCC11_ENST00000394748.1_Missense_Mutation_p.P773L|ABCC11_ENST00000356608.2_Missense_Mutation_p.P773L|ABCC11_ENST00000353782.5_Missense_Mutation_p.P773L|ABCC11_ENST00000537808.1_Missense_Mutation_p.R741W	NM_033151.3	NP_149163.2	Q96J66	ABCCB_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 11	773					organic anion transport (GO:0015711)|purine nucleotide transport (GO:0015865)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)|purine nucleotide transmembrane transporter activity (GO:0015216)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(3)|prostate(2)|skin(5)|urinary_tract(2)	83		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)			Conjugated Estrogens(DB00286)|Folic Acid(DB00158)|Indomethacin(DB00328)|Methotrexate(DB00563)|Probenecid(DB01032)	CTGATGCTCCGGCACTGGGTC	0.542													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17131	0.0		0.0	False		,,,				2504	0.0				p.P773L		.											.	ABCC11-95	0			c.C2318T						.						92.0	67.0	75.0					16																	48230229		2201	4300	6501	SO:0001583	missense	85320	exon17			TGCTCCGGCACTG	AF367202	CCDS10732.1, CCDS10733.1	16q12	2012-03-14			ENSG00000121270	ENSG00000121270		"""ATP binding cassette transporters / subfamily C"""	14639	protein-coding gene	gene with protein product		607040				11483364, 11435397	Standard	NM_033151		Approved	MRP8	uc002efg.1	Q96J66	OTTHUMG00000133146	ENST00000394747.1:c.2318C>T	16.37:g.48230229G>A	ENSP00000378230:p.Pro773Leu	Somatic	39	0		WXS	Illumina HiSeq	Phase_I	52	3	NM_033151	0	0	0	0	0	Q8TDJ0|Q96JA6|Q9BX80	Missense_Mutation	SNP	ENST00000394747.1	37	CCDS10732.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.096|8.096	0.775519|0.775519	0.16051|0.16051	.|.	.|.	ENSG00000121270|ENSG00000121270	ENST00000353782;ENST00000356608;ENST00000394748;ENST00000394747|ENST00000537808	T;T;T;T|D	0.59083|0.93189	0.29;0.29;0.29;0.29|-3.18	5.24|5.24	-0.454|-0.454	0.12197|0.12197	.|.	1.019920|.	0.07799|.	N|.	0.956214|.	T|T	0.79947|0.79947	0.4534|0.4534	N|N	0.02539|0.02539	-0.55|-0.55	0.09310|0.09310	N|N	1|1	B;B|.	0.06786|.	0.001;0.0|.	B;B|.	0.04013|.	0.0;0.001|.	T|T	0.71692|0.71692	-0.4516|-0.4516	10|7	0.26408|0.72032	T|D	0.33|0.01	-0.0042|-0.0042	4.1543|4.1543	0.10252|0.10252	0.6596:0.0:0.2017:0.1387|0.6596:0.0:0.2017:0.1387	.|.	773;773|.	Q96J66-2;Q96J66|.	.;ABCCB_HUMAN|.	L|W	773|741	ENSP00000311326:P773L;ENSP00000349017:P773L;ENSP00000378231:P773L;ENSP00000378230:P773L|ENSP00000438530:R741W	ENSP00000311326:P773L|ENSP00000438530:R741W	P|R	-|-	2|1	0|2	ABCC11|ABCC11	46787730|46787730	0.000000|0.000000	0.05858|0.05858	0.003000|0.003000	0.11579|0.11579	0.054000|0.054000	0.15201|0.15201	-0.353000|-0.353000	0.07691|0.07691	-0.308000|-0.308000	0.08792|0.08792	-0.794000|-0.794000	0.03295|0.03295	CCG|CGG	.		0.542	ABCC11-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000429984.1	NM_032583	
IST1	9798	hgsc.bcm.edu;ucsc.edu	37	16	71956520	71956520	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr16:71956520G>T	ENST00000378799.6	+	7	1052	c.696G>T	c.(694-696)atG>atT	p.M232I	RP11-498D10.5_ENST00000567146.1_RNA|IST1_ENST00000538850.1_Missense_Mutation_p.M84I|IST1_ENST00000606369.1_Missense_Mutation_p.M84I|IST1_ENST00000544564.1_Missense_Mutation_p.M232I|IST1_ENST00000538565.1_3'UTR|IST1_ENST00000329908.8_Missense_Mutation_p.M232I|IST1_ENST00000378798.5_Missense_Mutation_p.M232I|IST1_ENST00000541571.2_Missense_Mutation_p.M232I|IST1_ENST00000535424.1_Missense_Mutation_p.M245I			P53990	IST1_HUMAN	increased sodium tolerance 1 homolog (yeast)	230	Interaction with VPS37B.|Interaction with VTA1.				abscission (GO:0009838)|cell division (GO:0051301)|cytokinesis (GO:0000910)|establishment of protein localization (GO:0045184)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of proteolysis (GO:0045862)|protein localization (GO:0008104)|viral capsid secondary envelopment (GO:0046745)|viral release from host cell (GO:0019076)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|Flemming body (GO:0090543)|midbody (GO:0030496)	MIT domain binding (GO:0090541)|protein complex binding (GO:0032403)|protein domain specific binding (GO:0019904)										caatgcccatgcccatgccca	0.493																																					p.M245I		.											.	.	0			c.G735T						.						109.0	82.0	91.0					16																	71956520		2198	4300	6498	SO:0001583	missense	9798	exon8			GCCCATGCCCATG	BC004359	CCDS10905.1, CCDS59271.1, CCDS59272.1, CCDS59273.1, CCDS59274.1	16q22.2	2011-08-18	2011-08-18	2011-08-18	ENSG00000182149	ENSG00000182149			28977	protein-coding gene	gene with protein product			"""KIAA0174"""	KIAA0174		8724849, 19129480	Standard	NM_001270975		Approved		uc002fbm.2	P53990	OTTHUMG00000137597	ENST00000378799.6:c.696G>T	16.37:g.71956520G>T	ENSP00000368076:p.Met232Ile	Somatic	49	0		WXS	Illumina HiSeq	Phase_I	84	13	NM_001270976	0	0	13	53	40	A8KAH5|J3QLU7|Q3SYM4|Q9BQ81|Q9BWN2	Missense_Mutation	SNP	ENST00000378799.6	37	CCDS59272.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.18|12.18	1.860092|1.860092	0.32884|0.32884	.|.	.|.	ENSG00000182149|ENSG00000182149	ENST00000541848|ENST00000535424;ENST00000378799;ENST00000538963;ENST00000329908;ENST00000538850;ENST00000378798;ENST00000456820	.|.	.|.	.|.	5.54|5.54	5.54|5.54	0.83059|0.83059	.|.	.|0.104309	.|0.85682	.|N	.|0.000000	T|T	0.41880|0.41880	0.1178|0.1178	N|N	0.22421|0.22421	0.69|0.69	0.43342|0.43342	D|D	0.995393|0.995393	.|B;B;B	.|0.26400	.|0.005;0.148;0.008	.|B;B;B	.|0.20955	.|0.013;0.032;0.01	T|T	0.27468|0.27468	-1.0073|-1.0073	5|9	.|0.23302	.|T	.|0.38	-12.5172|-12.5172	13.4407|13.4407	0.61112|0.61112	0.0:0.0:0.8434:0.1566|0.0:0.0:0.8434:0.1566	.|.	.|232;232;245	.|P53990-2;P53990-3;A8KAH5	.|.;.;.	F|I	119|245;232;221;232;84;232;170	.|.	.|ENSP00000330408:M232I	C|M	+|+	2|3	0|0	KIAA0174|KIAA0174	70514021|70514021	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.960000|0.960000	0.62799|0.62799	6.357000|6.357000	0.73051|0.73051	2.611000|2.611000	0.88343|0.88343	0.655000|0.655000	0.94253|0.94253	TGC|ATG	.		0.493	IST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269005.2	NM_014761	
GAN	8139	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	81411103	81411103	+	Missense_Mutation	SNP	C	C	T	rs368372086		TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr16:81411103C>T	ENST00000568107.2	+	11	1858	c.1696C>T	c.(1696-1698)Cgc>Tgc	p.R566C		NM_022041.3	NP_071324.1	Q9H2C0	GAN_HUMAN	gigaxonin	566					cell death (GO:0008219)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)	25		Colorectal(91;0.153)				ATCCGACCTTCGCCGTACAGG	0.493																																					p.R566C	GBM(106;1239 1507 7582 9741 33976)	.											.	GAN-92	0			c.C1696T						.	C	CYS/ARG	1,4401	2.1+/-5.4	0,1,2200	237.0	206.0	216.0		1696	5.6	0.9	16		216	0,8600		0,0,4300	no	missense	GAN	NM_022041.3	180	0,1,6500	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	566/598	81411103	1,13001	2201	4300	6501	SO:0001583	missense	8139	exon11			GACCTTCGCCGTA	AF291673	CCDS10935.1	16q24.1	2014-09-17	2008-08-01		ENSG00000261609	ENSG00000261609		"""Kelch-like"", ""BTB/POZ domain containing"""	4137	protein-coding gene	gene with protein product	"""kelch-like family member 16"""	605379	"""giant axonal neuropathy (gigaxonin)"""			9450783, 11062483	Standard	NM_022041		Approved	GAN1, KLHL16	uc002fgo.3	Q9H2C0	OTTHUMG00000137627	ENST00000568107.2:c.1696C>T	16.37:g.81411103C>T	ENSP00000476795:p.Arg566Cys	Somatic	261	0		WXS	Illumina HiSeq	Phase_I	359	54	NM_022041	0	0	2	2	0		Missense_Mutation	SNP	ENST00000568107.2	37	CCDS10935.1	.	.	.	.	.	.	.	.	.	.	C	17.99	3.524137	0.64747	2.27E-4	0.0	ENSG00000127688	ENST00000248272	T	0.76448	-1.02	5.58	5.58	0.84498	.	0.183579	0.47852	D	0.000209	T	0.70064	0.3181	N	0.14661	0.345	0.80722	D	1	D	0.69078	0.997	P	0.47470	0.548	T	0.70103	-0.4964	10	0.29301	T	0.29	.	19.5747	0.95438	0.0:1.0:0.0:0.0	.	566	Q9H2C0	GAN_HUMAN	C	566	ENSP00000248272:R566C	ENSP00000248272:R566C	R	+	1	0	GAN	79968604	1.000000	0.71417	0.950000	0.38849	0.726000	0.41606	4.573000	0.60893	2.631000	0.89168	0.467000	0.42956	CGC	.		0.493	GAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269050.3		
HSDL1	83693	hgsc.bcm.edu;broad.mit.edu	37	16	84158328	84158328	+	Silent	SNP	A	A	C			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr16:84158328A>C	ENST00000219439.4	-	6	1076	c.900T>G	c.(898-900)ctT>ctG	p.L300L	HSDL1_ENST00000434463.3_Silent_p.L245L|HSDL1_ENST00000565275.1_5'Flank	NM_001146051.1|NM_031463.4	NP_001139523.1|NP_113651.4	Q3SXM5	HSDL1_HUMAN	hydroxysteroid dehydrogenase like 1	300						mitochondrion (GO:0005739)	oxidoreductase activity (GO:0016491)			endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7						ACTGTGCAAAAAGAAACTAAA	0.433																																					p.L300L		.											.	HSDL1-90	0			c.T900G						.						78.0	71.0	73.0					16																	84158328		2200	4300	6500	SO:0001819	synonymous_variant	83693	exon6			TGCAAAAAGAAAC	AF237684	CCDS10942.1, CCDS54046.1	16q24	2011-09-20			ENSG00000103160	ENSG00000103160		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	16475	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 12C, member 3"""					12153137, 19027726	Standard	NM_031463		Approved	SDR12C3	uc002fhk.2	Q3SXM5	OTTHUMG00000137635	ENST00000219439.4:c.900T>G	16.37:g.84158328A>C		Somatic	57	0		WXS	Illumina HiSeq	Phase_I	63	11	NM_031463	0	0	1	1	0	B4DSL2|D3DUL4|Q3SXM4|Q8NC98|Q9BY22	Silent	SNP	ENST00000219439.4	37	CCDS10942.1																																																																																			.		0.433	HSDL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269076.3	NM_031463	
NLE1	54475	broad.mit.edu	37	17	33464163	33464163	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr17:33464163G>A	ENST00000442241.4	-	7	724	c.685C>T	c.(685-687)Cgg>Tgg	p.R229W	NLE1_ENST00000586869.1_5'UTR|NLE1_ENST00000593176.1_5'UTR|NLE1_ENST00000360831.5_Missense_Mutation_p.R187W	NM_001014445.1|NM_018096.3	NP_001014445.1|NP_060566.2	Q9NVX2	NLE1_HUMAN	notchless homolog 1 (Drosophila)	229					hematopoietic stem cell homeostasis (GO:0061484)|inner cell mass cell differentiation (GO:0001826)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:2001268)|negative regulation of mitotic cell cycle (GO:0045930)|Notch signaling pathway (GO:0007219)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|ribosomal large subunit biogenesis (GO:0042273)	nucleolus (GO:0005730)|nucleus (GO:0005634)				NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)	22		Ovarian(249;0.17)				TCCCAGATCCGCACACTGCCA	0.617																																					p.R229W													.	NLE1-290	0			c.C685T						.						62.0	54.0	57.0					17																	33464163		2203	4300	6503	SO:0001583	missense	54475	exon7			AGATCCGCACACT		CCDS11291.1, CCDS45647.1	17q12	2013-01-10		2005-08-09	ENSG00000073536	ENSG00000073536		"""WD repeat domain containing"""	19889	protein-coding gene	gene with protein product	"""Notchless gene homolog, (Drosophila)"""						Standard	XM_005257989		Approved	FLJ10458	uc002hiy.1	Q9NVX2	OTTHUMG00000132928	ENST00000442241.4:c.685C>T	17.37:g.33464163G>A	ENSP00000413572:p.Arg229Trp	Somatic	63	0		WXS	Illumina HiSeq	Phase_I	57	3	NM_018096	0	0	9	9	0	O60868|Q59GJ8|Q9BU54	Missense_Mutation	SNP	ENST00000442241.4	37	CCDS11291.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.848474	0.91277	.	.	ENSG00000073536	ENST00000442241;ENST00000537697	T	0.28454	1.61	4.51	4.51	0.55191	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.56891	0.2016	M	0.80847	2.515	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.63637	-0.6592	10	0.87932	D	0	-25.4301	14.7766	0.69736	0.0:0.0:1.0:0.0	.	229	Q9NVX2	NLE1_HUMAN	W	229;205	ENSP00000413572:R229W	ENSP00000413572:R229W	R	-	1	2	NLE1	30488276	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.047000	0.76599	2.358000	0.79984	0.591000	0.81541	CGG	.		0.617	NLE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256441.2	NM_018096	
KRT9	3857	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	39726126	39726126	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr17:39726126C>A	ENST00000246662.4	-	3	932	c.867G>T	c.(865-867)aaG>aaT	p.K289N	KRT9_ENST00000588431.1_Missense_Mutation_p.K56N	NM_000226.3	NP_000217.2	P35527	K1C9_HUMAN	keratin 9	289	Coil 1B.|Rod.				epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)	p.K289N(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		Breast(137;0.000307)				TATGATTCTTCTTGAGGGCCA	0.537																																					p.K289N		.											.	KRT9-92	1	Substitution - Missense(1)	lung(1)	c.G867T						.						100.0	101.0	101.0					17																	39726126		2200	4295	6495	SO:0001583	missense	3857	exon3			ATTCTTCTTGAGG		CCDS32654.1	17q21.2	2013-06-20	2008-08-01		ENSG00000171403	ENSG00000171403		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6447	protein-coding gene	gene with protein product	"""cytokeratin 9"", ""type I cytoskeletal 9"", ""epidermolytic palmoplantar keratoderma"""	607606				7512862, 16831889	Standard	NM_000226		Approved	EPPK, K9, CK-9	uc002hxe.4	P35527	OTTHUMG00000133599	ENST00000246662.4:c.867G>T	17.37:g.39726126C>A	ENSP00000246662:p.Lys289Asn	Somatic	264	0		WXS	Illumina HiSeq	Phase_I	277	60	NM_000226	0	0	0	0	0	O00109|Q0IJ47|Q14665	Missense_Mutation	SNP	ENST00000246662.4	37	CCDS32654.1	.	.	.	.	.	.	.	.	.	.	C	15.92	2.974370	0.53720	.	.	ENSG00000171403	ENST00000246662	D	0.93547	-3.24	4.86	2.84	0.33178	Filament (1);	0.249082	0.20923	N	0.083245	D	0.95940	0.8678	M	0.86805	2.84	0.29942	N	0.821017	D	0.58268	0.982	P	0.59825	0.864	D	0.92785	0.6243	10	0.87932	D	0	.	11.0067	0.47637	0.0:0.8453:0.0:0.1547	.	289	P35527	K1C9_HUMAN	N	289	ENSP00000246662:K289N	ENSP00000246662:K289N	K	-	3	2	KRT9	36979652	1.000000	0.71417	0.925000	0.36789	0.365000	0.29674	1.620000	0.36976	0.452000	0.26830	0.491000	0.48974	AAG	.		0.537	KRT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257707.1	NM_000226	
CDC27	996	hgsc.bcm.edu	37	17	45234298	45234298	+	Missense_Mutation	SNP	G	G	A	rs62077263		TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr17:45234298G>A	ENST00000066544.3	-	7	916	c.823C>T	c.(823-825)Ctt>Ttt	p.L275F	CDC27_ENST00000531206.1_Missense_Mutation_p.L275F|CDC27_ENST00000527547.1_Missense_Mutation_p.L275F|CDC27_ENST00000528748.1_5'Flank|CDC27_ENST00000446365.2_Missense_Mutation_p.L214F	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	275					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						AATGGACTAAGAGCTGCTGGT	0.358																																					p.L275F		.											.	CDC27-291	0			c.C823T						.						60.0	64.0	63.0					17																	45234298		2201	4292	6493	SO:0001583	missense	996	exon7			GACTAAGAGCTGC	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.823C>T	17.37:g.45234298G>A	ENSP00000066544:p.Leu275Phe	Somatic	59	0		WXS	Illumina HiSeq	Phase_I	55	3	NM_001114091	0	0	10	10	0	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	G	17.87	3.493833	0.64186	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547;ENST00000526866	T;T;T;T;T	0.68479	-0.33;-0.33;-0.06;-0.33;0.69	5.64	5.64	0.86602	.	0.000000	0.64402	D	0.000001	T	0.69878	0.3160	L	0.29908	0.895	0.80722	D	1	P;P;D;D	0.69078	0.553;0.782;0.997;0.995	B;B;D;P	0.65773	0.141;0.438;0.938;0.795	T	0.62501	-0.6841	10	0.11182	T	0.66	-15.1393	17.2083	0.86924	0.0:0.0:1.0:0.0	.	214;275;275;275	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	F	275;275;214;275;275	ENSP00000066544:L275F;ENSP00000434614:L275F;ENSP00000392802:L214F;ENSP00000437339:L275F;ENSP00000432105:L275F	ENSP00000066544:L275F	L	-	1	0	CDC27	42589297	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.871000	0.63042	2.665000	0.90641	0.460000	0.39030	CTT	G|0.333;C|0.667		0.358	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
PPM1D	8493	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	58740446	58740446	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr17:58740446G>T	ENST00000305921.3	+	6	1583	c.1351G>T	c.(1351-1353)Gag>Tag	p.E451*	RNU6-623P_ENST00000363143.1_RNA	NM_003620.3	NP_003611.1	O15297	PPM1D_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1D	451					G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of cell proliferation (GO:0008285)|peptidyl-threonine dephosphorylation (GO:0035970)|protein dephosphorylation (GO:0006470)|response to bacterium (GO:0009617)|response to radiation (GO:0009314)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	15	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;6.75e-12)|all cancers(12;1.96e-10)			GAATTTTTTAGAGGTTTCAGC	0.443											OREG0031485	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																									p.E451X		.											.	PPM1D-227	0			c.G1351T						.						100.0	99.0	100.0					17																	58740446		2203	4300	6503	SO:0001587	stop_gained	8493	exon6			TTTTTAGAGGTTT	U78305	CCDS11625.1	17q23.3	2014-09-17	2010-03-05		ENSG00000170836	ENSG00000170836		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9277	protein-coding gene	gene with protein product	"""wild-type p53-induced phosphatase 1"", ""protein phosphatase 2C, delta isoform"""	605100	"""protein phosphatase 1D magnesium-dependent, delta isoform"""			9177166	Standard	NM_003620		Approved	Wip1, PP2C-DELTA	uc002iyt.2	O15297		ENST00000305921.3:c.1351G>T	17.37:g.58740446G>T	ENSP00000306682:p.Glu451*	Somatic	101	0	1033	WXS	Illumina HiSeq	Phase_I	142	42	NM_003620	0	0	11	46	35	Q53XP4|Q6P991|Q8IVR6	Nonsense_Mutation	SNP	ENST00000305921.3	37	CCDS11625.1	.	.	.	.	.	.	.	.	.	.	G	39	7.470853	0.98306	.	.	ENSG00000170836	ENST00000305921	.	.	.	6.08	6.08	0.98989	.	0.064947	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07325	T	0.83	-21.5774	13.8168	0.63297	0.0695:0.0:0.9305:0.0	.	.	.	.	X	451	.	ENSP00000306682:E451X	E	+	1	0	PPM1D	56095228	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	5.119000	0.64679	2.894000	0.99253	0.591000	0.81541	GAG	.		0.443	PPM1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449474.1	NM_003620	
ABCA8	10351	hgsc.bcm.edu;bcgsc.ca	37	17	66928478	66928478	+	Missense_Mutation	SNP	T	T	C	rs149928780	byFrequency	TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr17:66928478T>C	ENST00000269080.2	-	6	885	c.748A>G	c.(748-750)Agg>Ggg	p.R250G	ABCA8_ENST00000430352.2_Missense_Mutation_p.R250G|ABCA8_ENST00000586539.1_Missense_Mutation_p.R250G	NM_007168.2	NP_009099.1	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 8	250					transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(3)|central_nervous_system(2)|endometrium(9)|kidney(5)|large_intestine(19)|liver(1)|lung(30)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|urinary_tract(4)	83	Breast(10;4.56e-13)					GCCTTCATCCTTTTCCTCTCT	0.393													T|||	2	0.000399361	0.0015	0.0	5008	,	,		20503	0.0		0.0	False		,,,				2504	0.0				p.R250G		.											.	ABCA8-93	0			c.A748G						.	T	GLY/ARG	1,4405	2.1+/-5.4	0,1,2202	89.0	82.0	84.0		748	1.2	0.0	17	dbSNP_134	84	0,8600		0,0,4300	no	missense	ABCA8	NM_007168.2	125	0,1,6502	CC,CT,TT		0.0,0.0227,0.0077	benign	250/1582	66928478	1,13005	2203	4300	6503	SO:0001583	missense	10351	exon6			TCATCCTTTTCCT	AB020629	CCDS11680.1, CCDS74138.1, CCDS74139.1	17q24	2012-03-14			ENSG00000141338	ENSG00000141338		"""ATP binding cassette transporters / subfamily A"""	38	protein-coding gene	gene with protein product		612505					Standard	XM_005256938		Approved	KIAA0822	uc002jhp.3	O94911		ENST00000269080.2:c.748A>G	17.37:g.66928478T>C	ENSP00000269080:p.Arg250Gly	Somatic	47	0		WXS	Illumina HiSeq	Phase_I	76	5	NM_007168	0	0	1	1	0	A1L3U3|C9JQE6|Q86WW0	Missense_Mutation	SNP	ENST00000269080.2	37	CCDS11680.1	.	.	.	.	.	.	.	.	.	.	T	7.800	0.713528	0.15306	2.27E-4	0.0	ENSG00000141338	ENST00000269080;ENST00000430352;ENST00000541225;ENST00000428549	D;D	0.84070	-1.8;-1.8	4.86	1.22	0.21188	.	0.865701	0.09871	N	0.744923	T	0.76550	0.4003	L	0.55481	1.735	0.09310	N	1	B;B;B;B;B	0.27951	0.195;0.157;0.044;0.109;0.034	B;B;B;B;B	0.29524	0.089;0.103;0.038;0.098;0.044	T	0.65253	-0.6213	10	0.56958	D	0.05	.	3.7768	0.08663	0.3317:0.0923:0.0:0.576	.	189;250;250;250;250	F5H6Z4;A1L3U3;B4DJ11;C9JQE6;O94911	.;.;.;.;ABCA8_HUMAN	G	250;250;189;250	ENSP00000269080:R250G;ENSP00000402814:R250G	ENSP00000269080:R250G	R	-	1	2	ABCA8	64440073	0.000000	0.05858	0.002000	0.10522	0.197000	0.23852	0.098000	0.15189	0.065000	0.16485	0.460000	0.39030	AGG	T|1.000;C|0.000		0.393	ABCA8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450172.1	NM_007168	
ABCA5	23461	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	67304486	67304486	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr17:67304486C>G	ENST00000392676.3	-	5	557	c.493G>C	c.(493-495)Gct>Cct	p.A165P	ABCA5_ENST00000588877.1_Missense_Mutation_p.A165P|ABCA5_ENST00000392677.2_Missense_Mutation_p.A165P			Q8WWZ7	ABCA5_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 5	165					cholesterol efflux (GO:0033344)|high-density lipoprotein particle remodeling (GO:0034375)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|reverse cholesterol transport (GO:0043691)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(18)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	54	Breast(10;3.72e-11)				Tacrolimus(DB00864)	TACTGAGCAGCCTCACATGAT	0.378																																					p.A165P		.											.	ABCA5-93	0			c.G493C						.						98.0	103.0	101.0					17																	67304486		2203	4300	6503	SO:0001583	missense	23461	exon4			GAGCAGCCTCACA	U66672	CCDS11685.1	17q24.3	2012-03-14			ENSG00000154265	ENSG00000154265		"""ATP binding cassette transporters / subfamily A"""	35	protein-coding gene	gene with protein product		612503				8894702	Standard	NM_172232		Approved	EST90625	uc002jig.2	Q8WWZ7		ENST00000392676.3:c.493G>C	17.37:g.67304486C>G	ENSP00000376443:p.Ala165Pro	Somatic	170	0		WXS	Illumina HiSeq	Phase_I	174	23	NM_018672	0	0	0	1	1	Q8IVJ2|Q96LJ1|Q96MS4|Q96PZ9|Q9NY14	Missense_Mutation	SNP	ENST00000392676.3	37	CCDS11685.1	.	.	.	.	.	.	.	.	.	.	C	15.02	2.710325	0.48517	.	.	ENSG00000154265	ENST00000392677;ENST00000392676	T;T	0.39229	1.09;1.09	4.96	4.96	0.65561	.	0.108387	0.40908	D	0.000993	T	0.54727	0.1876	L	0.47190	1.495	0.49483	D	0.999799	D;D	0.63880	0.984;0.993	P;D	0.67725	0.877;0.953	T	0.51276	-0.8726	9	.	.	.	.	13.9115	0.63869	0.1528:0.8472:0.0:0.0	.	165;165	Q8WWZ7-2;Q8WWZ7	.;ABCA5_HUMAN	P	165	ENSP00000376444:A165P;ENSP00000376443:A165P	.	A	-	1	0	ABCA5	64816081	0.993000	0.37304	0.999000	0.59377	0.987000	0.75469	2.955000	0.49121	2.293000	0.77203	0.585000	0.79938	GCT	.		0.378	ABCA5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450654.1	NM_018672	
CCDC57	284001	hgsc.bcm.edu	37	17	80115741	80115741	+	Silent	SNP	C	C	T	rs367918124	byFrequency	TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr17:80115741C>T	ENST00000389641.4	-	14	2160	c.2124G>A	c.(2122-2124)gaG>gaA	p.E708E	CCDC57_ENST00000392343.3_Silent_p.E708E|CCDC57_ENST00000327026.3_5'UTR|RP11-1376P16.1_ENST00000582774.1_RNA|CCDC57_ENST00000392347.1_Silent_p.E708E			Q2TAC2	CCD57_HUMAN	coiled-coil domain containing 57	708										endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	16	Breast(20;0.00285)|all_neural(118;0.0878)|all_lung(278;0.0949)|Lung NSC(278;0.128)|Ovarian(332;0.227)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0253)			GCTTCCGCAGCTCCAAAACCT	0.657													C|||	5	0.000998403	0.0038	0.0	5008	,	,		17781	0.0		0.0	False		,,,				2504	0.0				p.E708E		.											.	CCDC57-24	0			c.G2124A						.	C		8,3916		0,8,1954	24.0	27.0	26.0		2124	2.2	0.6	17		26	0,8292		0,0,4146	no	coding-synonymous	CCDC57	NM_198082.2		0,8,6100	TT,TC,CC		0.0,0.2039,0.0655		708/916	80115741	8,12208	1962	4146	6108	SO:0001819	synonymous_variant	284001	exon14			CCGCAGCTCCAAA	BC040264		17q25.3	2006-03-08			ENSG00000176155	ENSG00000176155			27564	protein-coding gene	gene with protein product						12477932	Standard	XM_006722279		Approved	FLJ00130, FLJ23754	uc002kdx.1	Q2TAC2	OTTHUMG00000140396	ENST00000389641.4:c.2124G>A	17.37:g.80115741C>T		Somatic	7	1		WXS	Illumina HiSeq	Phase_I	18	6	NM_198082	0	0	0	4	4	A6NP51|A8MQC7|Q8IWG2|Q8TER3	Silent	SNP	ENST00000389641.4	37		.	.	.	.	.	.	.	.	.	.	C	5.340	0.247999	0.10130	0.002039	0.0	ENSG00000176155	ENST00000419322	.	.	.	3.19	2.15	0.27550	.	.	.	.	.	T	0.43366	0.1244	.	.	.	0.33073	D	0.535584	.	.	.	.	.	.	T	0.51973	-0.8637	4	.	.	.	-15.9417	8.1007	0.30854	0.0:0.7494:0.2506:0.0	.	.	.	.	T	54	.	.	A	-	1	0	CCDC57	77709030	0.989000	0.36119	0.584000	0.28653	0.660000	0.38997	0.614000	0.24314	0.612000	0.30071	0.462000	0.41574	GCT	.		0.657	CCDC57-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000277182.3	NM_198082	
PTPRS	5802	broad.mit.edu;bcgsc.ca	37	19	5231542	5231542	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr19:5231542T>A	ENST00000587303.1	-	13	2033	c.1934A>T	c.(1933-1935)gAa>gTa	p.E645V	PTPRS_ENST00000262963.6_Missense_Mutation_p.E641V|PTPRS_ENST00000372412.4_Missense_Mutation_p.E646V|PTPRS_ENST00000588552.1_Intron|PTPRS_ENST00000357368.4_Missense_Mutation_p.E645V|PTPRS_ENST00000588012.1_Missense_Mutation_p.E632V|PTPRS_ENST00000592099.1_Intron|PTPRS_ENST00000348075.2_Missense_Mutation_p.E632V|PTPRS_ENST00000353284.2_Intron			Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type, S	645	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|corpus callosum development (GO:0022038)|extracellular matrix organization (GO:0030198)|hippocampus development (GO:0021766)|peptidyl-tyrosine dephosphorylation (GO:0035335)|spinal cord development (GO:0021510)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(9)|ovary(4)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)	61				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)	Alendronate(DB00630)|Etidronic acid(DB01077)	GTTGTGCGTTTCCGGCGGCGG	0.662																																					p.E645V													.	PTPRS-357	0			c.A1934T						.						23.0	21.0	21.0					19																	5231542		2202	4297	6499	SO:0001583	missense	5802	exon14			TGCGTTTCCGGCG	U35234	CCDS12139.1, CCDS12140.1, CCDS45930.1, CCDS74265.1	19p13.3	2013-02-11				ENSG00000105426		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9681	protein-coding gene	gene with protein product		601576				8954782, 8524829	Standard	NM_002850		Approved		uc002mbv.3	Q13332		ENST00000587303.1:c.1934A>T	19.37:g.5231542T>A	ENSP00000467537:p.Glu645Val	Somatic	38	0		WXS	Illumina HiSeq	Phase_I	33	7	NM_002850	0	0	4	6	2	O75255|O75870|Q15718|Q16341|Q2M3R7	Missense_Mutation	SNP	ENST00000587303.1	37	CCDS45930.1	.	.	.	.	.	.	.	.	.	.	t	19.75	3.884856	0.72410	.	.	ENSG00000105426	ENST00000372412;ENST00000357368;ENST00000355005;ENST00000356037;ENST00000262963;ENST00000348075	T;T;T;T	0.54279	0.58;0.58;0.58;0.58	3.88	3.88	0.44766	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.085998	0.44902	U	0.000401	T	0.62708	0.2450	M	0.81239	2.535	0.80722	D	1	P;P	0.46457	0.878;0.481	P;B	0.48873	0.593;0.41	T	0.70252	-0.4923	10	0.72032	D	0.01	.	12.8515	0.57860	0.0:0.0:0.0:1.0	.	632;645	Q13332-6;Q13332	.;PTPRS_HUMAN	V	646;645;645;645;641;632	ENSP00000361489:E646V;ENSP00000349932:E645V;ENSP00000262963:E641V;ENSP00000269907:E632V	ENSP00000262963:E641V	E	-	2	0	PTPRS	5182542	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	5.631000	0.67812	1.618000	0.50286	0.449000	0.29647	GAA	.		0.662	PTPRS-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450762.2		
ZNF681	148213	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	23926507	23926507	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr19:23926507C>G	ENST00000402377.3	-	4	1986	c.1845G>C	c.(1843-1845)gaG>gaC	p.E615D	ZNF681_ENST00000395385.3_Missense_Mutation_p.E546D	NM_138286.2	NP_612143.2	Q96N22	ZN681_HUMAN	zinc finger protein 681	615					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(3)	21		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				TGTAGAGTTTCTCACCAGTAT	0.333																																					p.E615D		.											.	.	0			c.G1845C						.						60.0	61.0	61.0					19																	23926507		2202	4300	6502	SO:0001583	missense	148213	exon4			GAGTTTCTCACCA	AK056088	CCDS12414.2	19p12	2013-01-08			ENSG00000196172	ENSG00000196172		"""Zinc fingers, C2H2-type"", ""-"""	26457	protein-coding gene	gene with protein product	"""hypothetical protein FLJ31526"""						Standard	NM_138286		Approved	FLJ31526	uc002nrk.4	Q96N22	OTTHUMG00000150831	ENST00000402377.3:c.1845G>C	19.37:g.23926507C>G	ENSP00000384000:p.Glu615Asp	Somatic	16	0		WXS	Illumina HiSeq	Phase_I	27	4	NM_138286	0	0	8	8	0	B3KVF7	Missense_Mutation	SNP	ENST00000402377.3	37	CCDS12414.2	.	.	.	.	.	.	.	.	.	.	.	8.238	0.806253	0.16467	.	.	ENSG00000196172	ENST00000402377;ENST00000395385	T;T	0.34472	1.36;1.36	1.44	1.44	0.22558	Zinc finger, C2H2 (1);	.	.	.	.	T	0.31327	0.0793	L	0.49350	1.555	0.25356	N	0.988829	B	0.18013	0.025	B	0.17979	0.02	T	0.31447	-0.9943	9	0.62326	D	0.03	.	8.329	0.32175	0.0:1.0:0.0:0.0	.	615	Q96N22	ZN681_HUMAN	D	615;546	ENSP00000384000:E615D;ENSP00000378783:E546D	ENSP00000378783:E546D	E	-	3	2	ZNF681	23718347	0.416000	0.25424	0.017000	0.16124	0.114000	0.19823	0.067000	0.14510	0.754000	0.32968	0.205000	0.17691	GAG	.		0.333	ZNF681-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320248.2	NM_138286	
SUPT5H	6829	hgsc.bcm.edu	37	19	39960028	39960028	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr19:39960028A>G	ENST00000599117.1	+	17	1731	c.1364A>G	c.(1363-1365)gAg>gGg	p.E455G	SUPT5H_ENST00000598725.1_Missense_Mutation_p.E455G|SUPT5H_ENST00000432763.2_Missense_Mutation_p.E455G|SUPT5H_ENST00000359191.6_Missense_Mutation_p.E451G|SUPT5H_ENST00000402194.2_Missense_Mutation_p.E451G			O00267	SPT5H_HUMAN	suppressor of Ty 5 homolog (S. cerevisiae)	455					7-methylguanosine mRNA capping (GO:0006370)|cell cycle (GO:0007049)|chromatin remodeling (GO:0006338)|DNA-templated transcription, elongation (GO:0006354)|gene expression (GO:0010467)|negative regulation of DNA-templated transcription, elongation (GO:0032785)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of macroautophagy (GO:0016239)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|response to organic substance (GO:0010033)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	DSIF complex (GO:0032044)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)			breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(13)|lung(12)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	51	all_cancers(60;6.69e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;1.57e-06)|Ovarian(47;0.159)		Epithelial(26;3.9e-26)|all cancers(26;1.35e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			CCCAAGCATGAGGACCTCAAG	0.592																																					p.E455G		.											.	SUPT5H-94	0			c.A1364G						.						85.0	67.0	73.0					19																	39960028		2203	4300	6503	SO:0001583	missense	6829	exon15			AGCATGAGGACCT	U56402	CCDS12536.1, CCDS46072.1	19q13	2008-07-22	2001-11-28			ENSG00000196235			11469	protein-coding gene	gene with protein product		602102	"""suppressor of Ty (S.cerevisiae) 5 homolog"""			8975720	Standard	NM_003169		Approved	SPT5H, SPT5, FLJ34157	uc002olp.4	O00267		ENST00000599117.1:c.1364A>G	19.37:g.39960028A>G	ENSP00000470252:p.Glu455Gly	Somatic	55	0		WXS	Illumina HiSeq	Phase_I	54	3	NM_003169	0	0	0	0	0	O43279|Q59G52|Q99639	Missense_Mutation	SNP	ENST00000599117.1	37	CCDS12536.1	.	.	.	.	.	.	.	.	.	.	A	26.2	4.711198	0.89112	.	.	ENSG00000196235	ENST00000432763;ENST00000402194;ENST00000378524;ENST00000359191	.	.	.	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.69637	0.3133	L	0.49455	1.56	0.80722	D	1	D;D;D	0.71674	0.996;0.998;0.993	D;D;D	0.71184	0.919;0.972;0.909	T	0.68565	-0.5375	8	.	.	.	-20.9067	14.8931	0.70623	1.0:0.0:0.0:0.0	.	247;451;455	B4DJK4;O00267-2;O00267	.;.;SPT5H_HUMAN	G	455;451;433;455	.	.	E	+	2	0	SUPT5H	44651868	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	9.040000	0.93783	2.169000	0.68431	0.528000	0.53228	GAG	.		0.592	SUPT5H-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464918.1	NM_003169	
POU2F2	5452	hgsc.bcm.edu	37	19	42599440	42599440	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr19:42599440T>C	ENST00000526816.2	-	11	1144	c.1129A>G	c.(1129-1131)Atg>Gtg	p.M377V	POU2F2_ENST00000560398.1_Missense_Mutation_p.M383V|POU2F2_ENST00000533720.1_Missense_Mutation_p.M361V|POU2F2_ENST00000529952.1_Missense_Mutation_p.M377V|POU2F2_ENST00000389341.5_Missense_Mutation_p.M361V|POU2F2_ENST00000560558.1_Missense_Mutation_p.M322V|POU2F2_ENST00000342301.4_Missense_Mutation_p.M377V|POU2F2_ENST00000529067.1_Missense_Mutation_p.M361V			P09086	PO2F2_HUMAN	POU class 2 homeobox 2	377					cell maturation (GO:0048469)|humoral immune response (GO:0006959)|immunoglobulin secretion involved in immune response (GO:0002380)|mature B cell differentiation (GO:0002335)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(5)|lung(4)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Prostate(69;0.059)			Dolutegravir(DB08930)	CTTGGTACCATATGGGGGCTG	0.647																																					p.M377V		.											.	POU2F2-227	0			c.A1129G						.						16.0	19.0	18.0					19																	42599440		2201	4300	6501	SO:0001583	missense	5452	exon11			GTACCATATGGGG		CCDS33035.1, CCDS56094.1, CCDS56095.1, CCDS58665.1	19q13.2	2011-06-20	2007-07-13					"""Homeoboxes / POU class"""	9213	protein-coding gene	gene with protein product		164176	"""POU domain class 2, transcription factor 2"""	OTF2			Standard	NM_001207026		Approved	OCT2	uc002osp.3	P09086		ENST00000526816.2:c.1129A>G	19.37:g.42599440T>C	ENSP00000431603:p.Met377Val	Somatic	20	0		WXS	Illumina HiSeq	Phase_I	33	2	NM_001207025	0	0	0	0	0	Q16648|Q7M4M8|Q9BRS4	Missense_Mutation	SNP	ENST00000526816.2	37	CCDS56095.1	.	.	.	.	.	.	.	.	.	.	T	10.89	1.479093	0.26511	.	.	ENSG00000028277	ENST00000389341;ENST00000342301;ENST00000292077;ENST00000533720;ENST00000526816;ENST00000529067;ENST00000529952	D;D;D;T;D	0.81908	-1.5;-1.54;-1.55;-1.32;-1.5	3.46	2.42	0.29668	.	1.165660	0.06364	N	0.712317	T	0.75591	0.3870	L	0.32530	0.975	0.34537	D	0.709819	B;B;B	0.28082	0.2;0.0;0.024	B;B;B	0.32022	0.139;0.001;0.061	T	0.73375	-0.4002	10	0.87932	D	0	.	4.4556	0.11642	0.1173:0.0:0.4065:0.4761	.	361;377;361	P09086-4;P09086;P09086-3	.;PO2F2_HUMAN;.	V	361;377;377;361;376;361;377	ENSP00000373992:M361V;ENSP00000339369:M377V;ENSP00000437221:M361V;ENSP00000437224:M361V;ENSP00000436988:M377V	ENSP00000292077:M377V	M	-	1	0	POU2F2	47291280	1.000000	0.71417	0.978000	0.43139	0.978000	0.69477	1.793000	0.38764	0.954000	0.37851	0.533000	0.62120	ATG	.		0.647	POU2F2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387329.3		
TAF1B	9014	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	10016047	10016047	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr2:10016047G>C	ENST00000263663.5	+	7	795	c.607G>C	c.(607-609)Gag>Cag	p.E203Q	TAF1B_ENST00000396242.3_Intron	NM_005680.2	NP_005671	Q53T94	TAF1B_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa	203	N-terminal cyclin fold.				gene expression (GO:0010467)|RNA polymerase I transcriptional preinitiation complex assembly at the promoter for the nuclear large rRNA transcript (GO:0001189)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RNA polymerase I core factor complex (GO:0070860)	metal ion binding (GO:0046872)|RNA polymerase I CORE element sequence-specific DNA binding (GO:0001164)|RNA polymerase I CORE element sequence-specific DNA binding transcription factor recruiting transcription factor activity (GO:0001187)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TBP-class protein binding (GO:0017025)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	14	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					ACAACGAAAGGAGAAGGGAAT	0.408																																					p.E203Q		.											.	TAF1B-92	0			c.G607C						.						223.0	193.0	203.0					2																	10016047		2203	4300	6503	SO:0001583	missense	9014	exon7			CGAAAGGAGAAGG	L39061	CCDS33143.1	2p25	2008-06-02	2002-08-29		ENSG00000115750	ENSG00000115750			11533	protein-coding gene	gene with protein product		604904	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kD"""			7801123	Standard	NM_005680		Approved	TAFI63, SL1, RAF1B, RAFI63	uc002qzz.3	Q53T94	OTTHUMG00000151673	ENST00000263663.5:c.607G>C	2.37:g.10016047G>C	ENSP00000263663:p.Glu203Gln	Somatic	210	0		WXS	Illumina HiSeq	Phase_I	200	40	NM_005680	0	0	19	36	17	B4DI42|F8WD72|Q15574|Q8WVC3	Missense_Mutation	SNP	ENST00000263663.5	37	CCDS33143.1	.	.	.	.	.	.	.	.	.	.	G	9.995	1.231767	0.22626	.	.	ENSG00000115750	ENST00000263663	T	0.01902	4.57	5.82	4.0	0.46444	.	0.254066	0.44285	D	0.000476	T	0.02807	0.0084	L	0.41236	1.265	0.80722	D	1	B;P	0.52316	0.172;0.952	B;P	0.46659	0.025;0.523	T	0.60419	-0.7267	9	.	.	.	-14.0229	5.6394	0.17554	0.1472:0.178:0.6747:0.0	.	203;203	Q53T94;Q53T94-2	TAF1B_HUMAN;.	Q	203	ENSP00000263663:E203Q	.	E	+	1	0	TAF1B	9933498	1.000000	0.71417	0.994000	0.49952	0.941000	0.58515	1.150000	0.31639	1.442000	0.47568	0.655000	0.94253	GAG	.		0.408	TAF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323426.2	NM_005680	
CAD	790	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	27460276	27460276	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr2:27460276G>A	ENST00000403525.1	+	27	4381	c.4237G>A	c.(4237-4239)Gaa>Aaa	p.E1413K	CAD_ENST00000264705.4_Missense_Mutation_p.E1476K			O76075	DFFB_HUMAN	carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase	0					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			NS(1)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(40)|ovary(6)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	92	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCACCTGCGGGAACCAGGTGG	0.552																																					p.E1476K		.											.	CAD-295	0			c.G4426A						.						87.0	84.0	85.0					2																	27460276		2203	4300	6503	SO:0001583	missense	790	exon28			CTGCGGGAACCAG	D78586	CCDS1742.1	2p22-p21	2012-10-02			ENSG00000084774	ENSG00000084774	2.1.3.2, 3.5.2.-		1424	protein-coding gene	gene with protein product		114010				8619816, 2565865	Standard	NM_004341		Approved		uc002rji.3	P27708	OTTHUMG00000097070	ENST00000403525.1:c.4237G>A	2.37:g.27460276G>A	ENSP00000384510:p.Glu1413Lys	Somatic	119	0		WXS	Illumina HiSeq	Phase_I	120	20	NM_004341	0	0	11	19	8	O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Missense_Mutation	SNP	ENST00000403525.1	37		.	.	.	.	.	.	.	.	.	.	G	28.5	4.927886	0.92389	.	.	ENSG00000084774	ENST00000264705;ENST00000403525	T;T	0.46063	0.88;0.88	4.91	4.01	0.46588	Dihydroorotase, conserved site (1);Amidohydrolase 1 (1);	0.167071	0.52532	D	0.000062	T	0.73249	0.3563	H	0.98111	4.15	0.80722	D	1	P;D	0.65815	0.941;0.995	P;P	0.62885	0.66;0.908	T	0.80306	-0.1438	10	0.33141	T	0.24	-0.4186	13.2019	0.59774	0.0:0.0:0.8392:0.1608	.	1413;1476	F8VPD4;P27708	.;PYR1_HUMAN	K	1476;1413	ENSP00000264705:E1476K;ENSP00000384510:E1413K	ENSP00000264705:E1476K	E	+	1	0	CAD	27313780	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.360000	0.97119	1.030000	0.39839	0.561000	0.74099	GAA	.		0.552	CAD-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000324970.1		
TSGA10	80705	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	99720473	99720473	+	Nonsense_Mutation	SNP	C	C	A	rs545440386	byFrequency	TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr2:99720473C>A	ENST00000393483.3	-	10	1412	c.568G>T	c.(568-570)Gaa>Taa	p.E190*	TSGA10_ENST00000355053.4_Nonsense_Mutation_p.E190*|TSGA10_ENST00000478090.1_5'UTR|TSGA10_ENST00000539964.1_Nonsense_Mutation_p.E190*|TSGA10_ENST00000410001.1_Nonsense_Mutation_p.E190*|TSGA10_ENST00000542655.1_Nonsense_Mutation_p.E190*	NM_025244.2	NP_079520.1	Q9BZW7	TSG10_HUMAN	testis specific, 10	190					cell projection assembly (GO:0030031)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|membrane (GO:0016020)|motile cilium (GO:0031514)|neuron projection (GO:0043005)|nucleus (GO:0005634)				NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	34						AGTTCACTTTCGGTATCCATT	0.348																																					p.E190X		.											.	TSGA10-91	0			c.G568T						.						240.0	212.0	222.0					2																	99720473		2202	4299	6501	SO:0001587	stop_gained	80705	exon9			CACTTTCGGTATC	AF254756	CCDS2037.1	2q11.2	2009-08-06			ENSG00000135951	ENSG00000135951			14927	protein-coding gene	gene with protein product	"""cancer/testis antigen 79"""	607166				11179690	Standard	NM_025244		Approved	CEP4L, CT79	uc002szi.4	Q9BZW7	OTTHUMG00000130637	ENST00000393483.3:c.568G>T	2.37:g.99720473C>A	ENSP00000377123:p.Glu190*	Somatic	86	0		WXS	Illumina HiSeq	Phase_I	113	12	NM_182911	0	0	1	2	1	B7Z925|D3DVH7|Q8NEP0|Q9BWX0	Nonsense_Mutation	SNP	ENST00000393483.3	37	CCDS2037.1	.	.	.	.	.	.	.	.	.	.	C	42	9.602630	0.99217	.	.	ENSG00000135951	ENST00000393483;ENST00000410001;ENST00000355053;ENST00000539964;ENST00000409564;ENST00000393482;ENST00000542655	.	.	.	5.36	5.36	0.76844	.	0.000000	0.64402	D	0.000017	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	-16.4617	16.7002	0.85348	0.0:1.0:0.0:0.0	.	.	.	.	X	190	.	ENSP00000347161:E190X	E	-	1	0	TSGA10	99086905	0.986000	0.35501	0.969000	0.41365	0.988000	0.76386	2.774000	0.47694	2.801000	0.96364	0.650000	0.86243	GAA	.		0.348	TSGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253125.1	NM_182911	
DARS	1615	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	136736937	136736937	+	Splice_Site	SNP	C	C	A			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr2:136736937C>A	ENST00000264161.4	-	3	340		c.e3-1		DARS_ENST00000463008.1_Splice_Site|DARS_ENST00000537273.1_Splice_Site	NM_001349.2	NP_001340.2	P14868	SYDC_HUMAN	aspartyl-tRNA synthetase						aspartyl-tRNA aminoacylation (GO:0006422)|gene expression (GO:0010467)|protein complex assembly (GO:0006461)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	aminoacylase activity (GO:0004046)|aspartate-tRNA ligase activity (GO:0004815)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|urinary_tract(2)	15				BRCA - Breast invasive adenocarcinoma(221;0.168)	L-Aspartic Acid(DB00128)	AAAACTCGATCTGTAATAACA	0.318																																					.		.											.	DARS-91	0			c.125-1G>T						.						105.0	108.0	107.0					2																	136736937		2203	4300	6503	SO:0001630	splice_region_variant	1615	exon4			CTCGATCTGTAAT	J05032	CCDS2180.1	2q21.3	2011-07-01			ENSG00000115866	ENSG00000115866	6.1.1.12	"""Aminoacyl tRNA synthetases / Class II"""	2678	protein-coding gene	gene with protein product	"""aspartate tRNA ligase 1, cytoplasmic"""	603084				2674137	Standard	NM_001349		Approved		uc002tux.1	P14868	OTTHUMG00000131741	ENST00000264161.4:c.125-1G>T	2.37:g.136736937C>A		Somatic	93	0		WXS	Illumina HiSeq	Phase_I	124	25	NM_001349	0	0	0	0	0	A8K3J2|D3DP77|Q2TNI3|Q32Q69|Q53HV4|Q53YC5|Q68CR9|Q9BW52	Splice_Site	SNP	ENST00000264161.4	37	CCDS2180.1	.	.	.	.	.	.	.	.	.	.	C	11.16	1.558088	0.27827	.	.	ENSG00000115866	ENST00000264161;ENST00000441323;ENST00000456565;ENST00000449218	.	.	.	5.34	5.34	0.76211	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.3312	0.83015	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DARS	136453407	1.000000	0.71417	1.000000	0.80357	0.161000	0.22273	5.328000	0.65887	2.655000	0.90218	0.462000	0.41574	.	.		0.318	DARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254660.5	NM_001349	Intron
THSD7B	80731	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	138169186	138169186	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr2:138169186C>A	ENST00000409968.1	+	14	2881	c.2703C>A	c.(2701-2703)agC>agA	p.S901R	THSD7B_ENST00000272643.3_Missense_Mutation_p.S901R|THSD7B_ENST00000543459.1_Intron|THSD7B_ENST00000413152.2_Missense_Mutation_p.S870R			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	901	TSP type-1 11. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)				NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		CAGGGAAAAGCAGAAAGAAGG	0.353																																					.													.	THSD7B-75	0			.						.						120.0	111.0	114.0					2																	138169186		1860	4090	5950	SO:0001583	missense	80731	.			GAAAAGCAGAAAG			2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.2703C>A	2.37:g.138169186C>A	ENSP00000387145:p.Ser901Arg	Somatic	91	0		WXS	Illumina HiSeq	Phase_I	108	15	.	0	0	0	0	0		Missense_Mutation	SNP	ENST00000409968.1	37		.	.	.	.	.	.	.	.	.	.	C	18.21	3.573910	0.65765	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152	T;T;T	0.61040	0.14;0.14;0.14	5.84	4.96	0.65561	.	0.078462	0.85682	D	0.000000	T	0.72070	0.3415	M	0.72353	2.195	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.69540	-0.5118	10	0.13853	T	0.58	.	14.675	0.68972	0.0:0.9306:0.0:0.0694	.	901;870	Q9C0I4;C9JKN6	THS7B_HUMAN;.	R	901;901;870	ENSP00000387145:S901R;ENSP00000272643:S901R;ENSP00000413841:S870R	ENSP00000272643:S901R	S	+	3	2	THSD7B	137885656	1.000000	0.71417	1.000000	0.80357	0.816000	0.46133	2.127000	0.42035	1.467000	0.48044	0.557000	0.71058	AGC	.		0.353	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331769.2	XM_046570.9	
KIF5C	3800	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	149835496	149835496	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr2:149835496C>T	ENST00000435030.1	+	13	1722	c.1354C>T	c.(1354-1356)Cag>Tag	p.Q452*	KIF5C_ENST00000464066.1_3'UTR|KIF5C_ENST00000414838.2_Nonsense_Mutation_p.Q357*|KIF5C_ENST00000397413.1_Nonsense_Mutation_p.Q220*			O60282	KIF5C_HUMAN	kinesin family member 5C	452					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mRNA transport (GO:0051028)|organelle organization (GO:0006996)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(12)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36				BRCA - Breast invasive adenocarcinoma(221;0.108)		GATGTTGGATCAGGATGAGGT	0.353																																					p.Q452X		.											.	KIF5C-69	0			c.C1354T						.						78.0	78.0	78.0					2																	149835496		1852	4105	5957	SO:0001587	stop_gained	3800	exon13			TTGGATCAGGATG	AB011103	CCDS74586.1	2q23	2008-02-05			ENSG00000168280	ENSG00000168280		"""Kinesins"""	6325	protein-coding gene	gene with protein product		604593				7514426	Standard	NM_004522		Approved		uc010zbu.2	O60282	OTTHUMG00000153779	ENST00000435030.1:c.1354C>T	2.37:g.149835496C>T	ENSP00000393379:p.Gln452*	Somatic	44	0		WXS	Illumina HiSeq	Phase_I	61	17	NM_004522	0	0	0	0	0	O95079|Q2YDC5	Nonsense_Mutation	SNP	ENST00000435030.1	37		.	.	.	.	.	.	.	.	.	.	C	39	7.391751	0.98255	.	.	ENSG00000168280	ENST00000435030;ENST00000414838;ENST00000334436;ENST00000397413	.	.	.	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	.	19.9142	0.97043	0.0:1.0:0.0:0.0	.	.	.	.	X	452;357;355;220	.	ENSP00000334176:Q355X	Q	+	1	0	KIF5C	149543742	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.627000	0.83176	2.941000	0.99782	0.655000	0.94253	CAG	.		0.353	KIF5C-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000332562.3	NM_004522	
TTN	7273	bcgsc.ca	37	2	179449124	179449124	+	Silent	SNP	T	T	C			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr2:179449124T>C	ENST00000591111.1	-	261	60455	c.60231A>G	c.(60229-60231)gaA>gaG	p.E20077E	TTN-AS1_ENST00000590743.1_RNA|TTN_ENST00000460472.2_Silent_p.E12653E|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Silent_p.E12845E|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Silent_p.E21718E|TTN_ENST00000342992.6_Silent_p.E19150E|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Silent_p.E12778E			Q8WZ42	TITIN_HUMAN	titin	20077	Fibronectin type-III 45. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CACAAGGATATTCAGTTGACC	0.458																																					p.E21718E													.	TTN-636	0			c.A65154G						.						109.0	108.0	108.0					2																	179449124		1933	4142	6075	SO:0001819	synonymous_variant	7273	exon311			AGGATATTCAGTT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.60231A>G	2.37:g.179449124T>C		Somatic	113	0		WXS	Illumina HiSeq	Phase_1	143	5	NM_001267550	0	0	0	0	0	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37																																																																																				.		0.458	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
SESTD1	91404	bcgsc.ca	37	2	180041254	180041254	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr2:180041254T>G	ENST00000428443.3	-	4	492	c.176A>C	c.(175-177)aAg>aCg	p.K59T	SESTD1_ENST00000486468.1_5'UTR	NM_178123.4	NP_835224.3	Q86VW0	SESD1_HUMAN	SEC14 and spectrin domains 1	59	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.						phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			breast(2)|endometrium(4)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(3)	30			OV - Ovarian serous cystadenocarcinoma(117;0.0344)|Epithelial(96;0.0531)|all cancers(119;0.147)			TCCTCTAGCCTTACACTTCTC	0.338																																					p.K59T													.	SESTD1-228	0			c.A176C						.						135.0	115.0	122.0					2																	180041254		2203	4300	6503	SO:0001583	missense	91404	exon4			CTAGCCTTACACT	AK096232	CCDS33338.1	2q31.3	2014-01-28			ENSG00000187231	ENSG00000187231			18379	protein-coding gene	gene with protein product						12837271	Standard	NM_178123		Approved	DKFZp434O0515, Solo	uc002uni.4	Q86VW0	OTTHUMG00000154554	ENST00000428443.3:c.176A>C	2.37:g.180041254T>G	ENSP00000415332:p.Lys59Thr	Somatic	47	0		WXS	Illumina HiSeq	Phase_1	68	4	NM_178123	0	0	0	0	0	Q53R38|Q53SP3|Q5GM69|Q8N6M1|Q96LQ2	Missense_Mutation	SNP	ENST00000428443.3	37	CCDS33338.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.989102	0.74589	.	.	ENSG00000187231	ENST00000428443;ENST00000440010;ENST00000435047	T;T;T	0.66099	-0.19;-0.19;-0.19	5.6	5.6	0.85130	Cellular retinaldehyde-binding/triple function, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.65719	0.2718	N	0.17345	0.48	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.65598	-0.6129	9	.	.	.	-20.2904	15.7878	0.78322	0.0:0.0:0.0:1.0	.	59	Q86VW0	SESD1_HUMAN	T	59	ENSP00000415332:K59T;ENSP00000416164:K59T;ENSP00000410286:K59T	.	K	-	2	0	SESTD1	179749499	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	8.015000	0.88690	2.132000	0.65825	0.377000	0.23210	AAG	.		0.338	SESTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335916.2	NM_178123	
USP37	57695	hgsc.bcm.edu;bcgsc.ca	37	2	219328058	219328058	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr2:219328058A>G	ENST00000258399.3	-	22	2910	c.2498T>C	c.(2497-2499)cTc>cCc	p.L833P	USP37_ENST00000418019.1_Missense_Mutation_p.L833P|USP37_ENST00000415516.1_Missense_Mutation_p.L739P|USP37_ENST00000454775.1_Missense_Mutation_p.L833P	NM_020935.2	NP_065986	Q86T82	UBP37_HUMAN	ubiquitin specific peptidase 37	833	USP.				G1/S transition of mitotic cell cycle (GO:0000082)|mitotic nuclear division (GO:0007067)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|protein kinase binding (GO:0019901)|ubiquitin-specific protease activity (GO:0004843)			NS(2)|breast(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(1)|lung(7)|ovary(2)|prostate(3)|skin(5)|stomach(1)	35		Renal(207;0.0915)		Epithelial(149;1.08e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.00375)|Lung(261;0.00487)		AGCTCTTTTGAGGTCATCATC	0.318																																					p.L833P		.											.	USP37-661	0			c.T2498C						.						107.0	106.0	106.0					2																	219328058		2203	4300	6503	SO:0001583	missense	57695	exon22			CTTTTGAGGTCAT	AB046814	CCDS2418.1	2q35	2008-02-05	2005-08-08		ENSG00000135913	ENSG00000135913		"""Ubiquitin-specific peptidases"""	20063	protein-coding gene	gene with protein product			"""ubiquitin specific protease 37"""			12838346	Standard	NM_020935		Approved	KIAA1594	uc010fvs.1	Q86T82	OTTHUMG00000133113	ENST00000258399.3:c.2498T>C	2.37:g.219328058A>G	ENSP00000258399:p.Leu833Pro	Somatic	99	0		WXS	Illumina HiSeq	Phase_I	87	5	NM_020935	0	0	0	0	0	A2RUQ8|B7ZM38|B7ZM41|E9PHL3|Q2KHT2|Q53S10|Q7Z3A5|Q9HCH8	Missense_Mutation	SNP	ENST00000258399.3	37	CCDS2418.1	.	.	.	.	.	.	.	.	.	.	A	16.55	3.154173	0.57259	.	.	ENSG00000135913	ENST00000258399;ENST00000454775;ENST00000415516;ENST00000418019	T;T;T;T	0.55588	0.55;0.55;0.51;0.55	4.77	4.77	0.60923	Ubiquitin interacting motif (3);Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.127314	0.53938	D	0.000041	T	0.65678	0.2714	L	0.59436	1.845	0.80722	D	1	D;D	0.62365	0.989;0.991	P;P	0.61658	0.892;0.881	T	0.68401	-0.5418	10	0.56958	D	0.05	-2.9498	14.7551	0.69557	1.0:0.0:0.0:0.0	.	739;833	Q86T82-2;Q86T82	.;UBP37_HUMAN	P	833;833;739;833	ENSP00000258399:L833P;ENSP00000393662:L833P;ENSP00000400902:L739P;ENSP00000396585:L833P	ENSP00000258399:L833P	L	-	2	0	USP37	219036302	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.305000	0.89960	2.127000	0.65507	0.477000	0.44152	CTC	.		0.318	USP37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256779.3	NM_020935	
PTPRN	5798	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	220161767	220161767	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr2:220161767A>C	ENST00000295718.2	-	15	2416	c.2176T>G	c.(2176-2178)Tgt>Ggt	p.C726G	PTPRN_ENST00000423636.2_Missense_Mutation_p.C636G|AC114803.3_ENST00000417355.1_RNA|PTPRN_ENST00000409251.3_Missense_Mutation_p.C697G|MIR153-1_ENST00000384914.1_RNA|PTPRN_ENST00000497977.1_5'Flank	NM_002846.3	NP_002837.1	Q16849	PTPRN_HUMAN	protein tyrosine phosphatase, receptor type, N	726	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cytokine-mediated signaling pathway (GO:0019221)|peptidyl-tyrosine dephosphorylation (GO:0035335)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to insulin (GO:0032868)|response to reactive oxygen species (GO:0000302)	integral component of plasma membrane (GO:0005887)	spectrin binding (GO:0030507)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(3)|prostate(4)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Renal(207;0.0474)		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)		GCGGTGGCACAGGTGTTTGGC	0.637																																					p.C726G		.											.	PTPRN-229	0			c.T2176G						.						95.0	99.0	98.0					2																	220161767		2203	4300	6503	SO:0001583	missense	5798	exon15			TGGCACAGGTGTT		CCDS2440.1, CCDS56167.1, CCDS56168.1	2q35-q36.1	2011-06-09			ENSG00000054356	ENSG00000054356		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9676	protein-coding gene	gene with protein product		601773				8024693	Standard	NM_001199763		Approved	IA-2	uc002vkz.3	Q16849	OTTHUMG00000133129	ENST00000295718.2:c.2176T>G	2.37:g.220161767A>C	ENSP00000295718:p.Cys726Gly	Somatic	80	0		WXS	Illumina HiSeq	Phase_I	75	21	NM_002846	0	0	0	0	0	B4DK12|F5GZS3|Q08319|Q53QD6|Q6NSL1	Missense_Mutation	SNP	ENST00000295718.2	37	CCDS2440.1	.	.	.	.	.	.	.	.	.	.	A	12.22	1.872163	0.33069	.	.	ENSG00000054356	ENST00000409251;ENST00000295718;ENST00000539342;ENST00000537666	T;T;T	0.14516	2.5;2.5;2.5	4.31	4.31	0.51392	Protein-tyrosine phosphatase, receptor/non-receptor type (2);	0.250911	0.35179	N	0.003398	T	0.24044	0.0582	M	0.67397	2.05	0.39123	D	0.961697	D;B	0.60160	0.987;0.081	P;B	0.51385	0.668;0.078	T	0.06409	-1.0828	10	0.33940	T	0.23	.	13.3146	0.60399	1.0:0.0:0.0:0.0	.	697;726	Q6NSL1;Q16849	.;PTPRN_HUMAN	G	697;726;697;636	ENSP00000386638:C697G;ENSP00000295718:C726G;ENSP00000444244:C636G	ENSP00000295718:C726G	C	-	1	0	PTPRN	219870011	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.355000	0.52262	1.806000	0.52798	0.379000	0.24179	TGT	.		0.637	PTPRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256819.2		
COL6A3	1293	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	238275884	238275884	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr2:238275884T>C	ENST00000295550.4	-	11	5398	c.4946A>G	c.(4945-4947)aAc>aGc	p.N1649S	COL6A3_ENST00000347401.3_Missense_Mutation_p.N1448S|COL6A3_ENST00000472056.1_Missense_Mutation_p.N1042S|COL6A3_ENST00000353578.4_Missense_Mutation_p.N1443S|COL6A3_ENST00000409809.1_Missense_Mutation_p.N1443S|COL6A3_ENST00000346358.4_Missense_Mutation_p.N1449S	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	1649	Nonhelical region.|VWFA 9. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		CCTCCTGAAGTTGATGGAACC	0.438																																					p.N1649S		.											.	COL6A3-526	0			c.A4946G						.						73.0	64.0	67.0					2																	238275884		2203	4300	6503	SO:0001583	missense	1293	exon11			CTGAAGTTGATGG	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.4946A>G	2.37:g.238275884T>C	ENSP00000295550:p.Asn1649Ser	Somatic	60	0		WXS	Illumina HiSeq	Phase_I	52	9	NM_004369	0	0	10	10	0	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	CCDS33412.1	.	.	.	.	.	.	.	.	.	.	T	13.60	2.285417	0.40394	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	T;T;T;T;T;T	0.72505	-0.66;-0.66;-0.66;-0.66;-0.66;-0.66	5.5	5.5	0.81552	von Willebrand factor, type A (3);	0.000000	0.64402	D	0.000018	T	0.65217	0.2670	N	0.05031	-0.125	0.46654	D	0.999143	D;D;D	0.76494	0.999;0.999;0.998	D;D;D	0.87578	0.998;0.998;0.953	T	0.62469	-0.6848	10	0.02654	T	1	.	15.5966	0.76587	0.0:0.0:0.0:1.0	.	1042;1443;1649	E9PFQ6;P12111-2;P12111	.;.;CO6A3_HUMAN	S	1649;1448;1443;1042;1443;1449	ENSP00000295550:N1649S;ENSP00000315609:N1448S;ENSP00000315873:N1443S;ENSP00000418285:N1042S;ENSP00000386844:N1443S;ENSP00000295546:N1449S	ENSP00000295550:N1649S	N	-	2	0	COL6A3	237940623	1.000000	0.71417	0.994000	0.49952	0.786000	0.44442	4.105000	0.57797	2.080000	0.62538	0.533000	0.62120	AAC	.		0.438	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
SLC23A2	9962	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	4855238	4855238	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr20:4855238A>T	ENST00000379333.1	-	10	1321	c.929T>A	c.(928-930)cTg>cAg	p.L310Q	SLC23A2_ENST00000424750.2_Missense_Mutation_p.L196Q|SLC23A2_ENST00000338244.1_Missense_Mutation_p.L310Q|SLC23A2_ENST00000468355.1_5'UTR	NM_203327.1	NP_976072.1	Q9UGH3	S23A2_HUMAN	solute carrier family 23 (ascorbic acid transporter), member 2	310					L-ascorbic acid metabolic process (GO:0019852)|L-ascorbic acid transport (GO:0015882)|molecular hydrogen transport (GO:0015993)|nucleobase transport (GO:0015851)|nucleobase-containing compound metabolic process (GO:0006139)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|transepithelial L-ascorbic acid transport (GO:0070904)|vitamin metabolic process (GO:0006766)|vitamin transmembrane transport (GO:0035461)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-ascorbate:sodium symporter activity (GO:0008520)|L-ascorbic acid transporter activity (GO:0015229)|nucleobase transmembrane transporter activity (GO:0015205)|sodium-dependent L-ascorbate transmembrane transporter activity (GO:0070890)|sodium-dependent multivitamin transmembrane transporter activity (GO:0008523)			endometrium(1)|kidney(3)|large_intestine(9)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						CATTTTGAACAGCTGTAACTT	0.383																																					p.L310Q		.											.	SLC23A2-92	0			c.T929A						.						195.0	187.0	190.0					20																	4855238		2203	4300	6503	SO:0001583	missense	9962	exon10			TTGAACAGCTGTA	AF058319	CCDS13085.1	20p13	2013-07-18	2013-07-18	2003-03-21	ENSG00000089057	ENSG00000089057		"""Solute carriers"""	10973	protein-coding gene	gene with protein product		603791	"""solute carrier family 23 (nucleobase transporters), member 1"""	SLC23A1		9804989, 10331392	Standard	NM_005116		Approved	SVCT2, KIAA0238, YSPL2	uc002wlh.1	Q9UGH3	OTTHUMG00000031793	ENST00000379333.1:c.929T>A	20.37:g.4855238A>T	ENSP00000368637:p.Leu310Gln	Somatic	213	0		WXS	Illumina HiSeq	Phase_I	181	28	NM_203327	0	0	6	7	1	B4DJZ1|Q8WWR4|Q92512|Q96D54|Q9UNU1|Q9UP85	Missense_Mutation	SNP	ENST00000379333.1	37	CCDS13085.1	.	.	.	.	.	.	.	.	.	.	A	12.02	1.811425	0.32053	.	.	ENSG00000089057	ENST00000379333;ENST00000338244;ENST00000424750	T;T;T	0.21543	2.0;2.0;2.0	5.44	5.44	0.79542	.	0.062992	0.64402	D	0.000005	T	0.40694	0.1127	M	0.62088	1.915	0.58432	D	0.999999	D;D;D	0.59767	0.986;0.976;0.976	P;P;P	0.60789	0.876;0.879;0.879	T	0.28996	-1.0026	10	0.87932	D	0	-14.7288	14.3204	0.66482	1.0:0.0:0.0:0.0	.	196;310;310	B4DJZ1;A0MSJ5;Q9UGH3	.;.;S23A2_HUMAN	Q	310;310;196	ENSP00000368637:L310Q;ENSP00000344322:L310Q;ENSP00000406601:L196Q	ENSP00000344322:L310Q	L	-	2	0	SLC23A2	4803238	1.000000	0.71417	0.998000	0.56505	0.004000	0.04260	9.339000	0.96797	2.063000	0.61619	0.533000	0.62120	CTG	.		0.383	SLC23A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077832.1		
ATP9A	10079	hgsc.bcm.edu	37	20	50221537	50221537	+	Silent	SNP	C	C	G	rs376310810		TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr20:50221537C>G	ENST00000338821.5	-	27	3090	c.2826G>C	c.(2824-2826)gcG>gcC	p.A942A	ATP9A_ENST00000402822.1_Silent_p.A821A|ATP9A_ENST00000311637.5_Silent_p.A806A	NM_006045.1	NP_006036.1	O75110	ATP9A_HUMAN	ATPase, class II, type 9A	942					phospholipid translocation (GO:0045332)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(10)|lung(18)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						ACAGCAGCAGCGCCCCGTACA	0.602																																					p.A942A		.											.	ATP9A-94	0			c.G2826C						.						89.0	62.0	71.0					20																	50221537		2203	4300	6503	SO:0001819	synonymous_variant	10079	exon27			CAGCAGCGCCCCG	AB014511	CCDS33489.1	20q13.2	2010-04-20	2007-09-19		ENSG00000054793	ENSG00000054793		"""ATPases / P-type"""	13540	protein-coding gene	gene with protein product		609126	"""ATPase, Class II, type 9A"""			9734811, 11015572	Standard	NM_006045		Approved	KIAA0611, ATPIIA	uc002xwg.1	O75110	OTTHUMG00000032751	ENST00000338821.5:c.2826G>C	20.37:g.50221537C>G		Somatic	34	0		WXS	Illumina HiSeq	Phase_I	30	2	NM_006045	0	0	10	10	0	E1P5Y3|E1P5Y4|Q5TFW5|Q5TFW6|Q5TFW9|Q6ZMF3|Q9NQK6|Q9NQK7	Silent	SNP	ENST00000338821.5	37	CCDS33489.1																																																																																			.		0.602	ATP9A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106494.1	NM_006045	
ATP9A	10079	hgsc.bcm.edu	37	20	50224072	50224072	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr20:50224072A>G	ENST00000338821.5	-	26	3061	c.2797T>C	c.(2797-2799)Tat>Cat	p.Y933H	ATP9A_ENST00000402822.1_Missense_Mutation_p.Y812H|ATP9A_ENST00000311637.5_Missense_Mutation_p.Y797H	NM_006045.1	NP_006036.1	O75110	ATP9A_HUMAN	ATPase, class II, type 9A	933					phospholipid translocation (GO:0045332)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(10)|lung(18)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						TTACCTTGATAGATGCTAATC	0.483																																					p.Y933H		.											.	ATP9A-94	0			c.T2797C						.						87.0	66.0	73.0					20																	50224072		2203	4300	6503	SO:0001583	missense	10079	exon26			CTTGATAGATGCT	AB014511	CCDS33489.1	20q13.2	2010-04-20	2007-09-19		ENSG00000054793	ENSG00000054793		"""ATPases / P-type"""	13540	protein-coding gene	gene with protein product		609126	"""ATPase, Class II, type 9A"""			9734811, 11015572	Standard	NM_006045		Approved	KIAA0611, ATPIIA	uc002xwg.1	O75110	OTTHUMG00000032751	ENST00000338821.5:c.2797T>C	20.37:g.50224072A>G	ENSP00000342481:p.Tyr933His	Somatic	39	0		WXS	Illumina HiSeq	Phase_I	40	2	NM_006045	0	0	0	0	0	E1P5Y3|E1P5Y4|Q5TFW5|Q5TFW6|Q5TFW9|Q6ZMF3|Q9NQK6|Q9NQK7	Missense_Mutation	SNP	ENST00000338821.5	37	CCDS33489.1	.	.	.	.	.	.	.	.	.	.	A	24.4	4.524609	0.85600	.	.	ENSG00000054793	ENST00000311637;ENST00000338821;ENST00000402822	T;T;T	0.74947	-0.89;-0.89;-0.89	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	D	0.88629	0.6488	M	0.91663	3.23	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.75484	0.986;0.986	D	0.91299	0.5065	10	0.87932	D	0	-15.2899	14.9169	0.70805	1.0:0.0:0.0:0.0	.	812;933	O75110-2;O75110	.;ATP9A_HUMAN	H	797;933;812	ENSP00000309086:Y797H;ENSP00000342481:Y933H;ENSP00000385875:Y812H	ENSP00000309086:Y797H	Y	-	1	0	ATP9A	49657479	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.754000	0.91642	1.927000	0.55829	0.528000	0.53228	TAT	.		0.483	ATP9A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106494.1	NM_006045	
LAMA5	3911	broad.mit.edu	37	20	60901783	60901783	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr20:60901783C>T	ENST00000252999.3	-	40	5314	c.5248G>A	c.(5248-5250)Gca>Aca	p.A1750T		NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	1750	Laminin IV type A. {ECO:0000255|PROSITE- ProRule:PRU00458}.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)	p.A1750T(1)		breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			GTGGGGTATGCCGGCTCCAGG	0.667																																					p.A1750T													.	LAMA5-93	1	Substitution - Missense(1)	prostate(1)	c.G5248A						.						107.0	73.0	84.0					20																	60901783		2203	4300	6503	SO:0001583	missense	3911	exon40			GGTATGCCGGCTC	AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.5248G>A	20.37:g.60901783C>T	ENSP00000252999:p.Ala1750Thr	Somatic	63	0		WXS	Illumina HiSeq	Phase_I	76	4	NM_005560	0	0	20	20	0	Q8TDF8|Q8WZA7|Q9H1P1	Missense_Mutation	SNP	ENST00000252999.3	37	CCDS33502.1	.	.	.	.	.	.	.	.	.	.	C	2.500	-0.315407	0.05422	.	.	ENSG00000130702	ENST00000252999	T	0.36878	1.23	5.12	2.89	0.33648	Laminin B type IV (2);Laminin B, subgroup (1);	0.706498	0.13757	N	0.364841	T	0.19046	0.0457	N	0.16656	0.425	0.09310	N	1	B	0.30146	0.27	B	0.28916	0.096	T	0.18967	-1.0320	10	0.15952	T	0.53	.	6.807	0.23782	0.3534:0.5042:0.0:0.1424	.	1750	O15230	LAMA5_HUMAN	T	1750	ENSP00000252999:A1750T	ENSP00000252999:A1750T	A	-	1	0	LAMA5	60335178	0.000000	0.05858	0.002000	0.10522	0.039000	0.13416	0.042000	0.13949	1.118000	0.41863	0.555000	0.69702	GCA	.		0.667	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080014.2	NM_005560	
ITSN1	6453	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	35239577	35239577	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr21:35239577C>A	ENST00000381318.3	+	33	4403	c.4115C>A	c.(4114-4116)tCt>tAt	p.S1372Y	ITSN1_ENST00000399367.3_Missense_Mutation_p.S1367Y|AP000304.12_ENST00000429238.1_Intron|ITSN1_ENST00000437442.2_Missense_Mutation_p.S1367Y|ITSN1_ENST00000381285.4_Missense_Mutation_p.S1372Y|ITSN1_ENST00000399326.3_3'UTR	NM_003024.2	NP_003015.2	Q15811	ITSN1_HUMAN	intersectin 1 (SH3 domain protein)	1372	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|guanyl-nucleotide exchange factor activity (GO:0005085)|kinase activator activity (GO:0019209)|proline-rich region binding (GO:0070064)|protein complex scaffold (GO:0032947)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(26)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	67						ATGCCACTCTCTAGTTTTATA	0.393																																					p.S1372Y		.											.	ITSN1-94	0			c.C4115A						.						151.0	144.0	146.0					21																	35239577		2203	4300	6503	SO:0001583	missense	6453	exon33			CACTCTCTAGTTT	AF064244	CCDS33545.1, CCDS33546.1	21q22.1-q22.2	2013-01-10			ENSG00000205726	ENSG00000205726		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"""	6183	protein-coding gene	gene with protein product	"""SH3 domain protein-1A"", ""human intersectin-SH3 domain-containing protein SH3P17"", ""Src homology 3 domain-containing protein"", ""intersectin 1 short form variant, 11"", ""intersectin 1 short form variant 3"", ""intersectin short variant 12"""	602442		SH3D1A, ITSN		9799604, 9813051	Standard	NM_003024		Approved	SH3P17, MGC134948, MGC134949	uc002yta.1	Q15811	OTTHUMG00000065284	ENST00000381318.3:c.4115C>A	21.37:g.35239577C>A	ENSP00000370719:p.Ser1372Tyr	Somatic	119	1		WXS	Illumina HiSeq	Phase_I	102	21	NM_003024	0	0	2	2	0	A7Y322|A8CTX8|A8CTY3|A8CTY7|A8D7D0|A8DCP3|B4DTM2|E7ERJ1|E9PE44|E9PG01|E9PHV2|O95216|Q0PW94|Q0PW95|Q0PW97|Q14BD3|Q1ED40|Q20BK3|Q9UET5|Q9UK60|Q9UNK1|Q9UNK2|Q9UQ92	Missense_Mutation	SNP	ENST00000381318.3	37	CCDS33545.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.756394	0.89843	.	.	ENSG00000205726	ENST00000381318;ENST00000381285;ENST00000381288;ENST00000399367;ENST00000437442	T;T;T;T	0.64085	-0.08;-0.08;-0.08;-0.08	5.51	5.51	0.81932	Guanine-nucleotide dissociation stimulator, CDC24, conserved site (1);Dbl homology (DH) domain (5);	0.000000	0.85682	D	0.000000	T	0.78654	0.4317	M	0.64630	1.985	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.983	T	0.79598	-0.1737	10	0.87932	D	0	.	19.7837	0.96428	0.0:1.0:0.0:0.0	.	1367;1367;1372	A8CTY3;A8CTX8;Q15811	.;.;ITSN1_HUMAN	Y	1372;1372;1301;1367;1367	ENSP00000370719:S1372Y;ENSP00000370685:S1372Y;ENSP00000382301:S1367Y;ENSP00000387377:S1367Y	ENSP00000370685:S1372Y	S	+	2	0	ITSN1	34161447	1.000000	0.71417	0.994000	0.49952	0.995000	0.86356	7.396000	0.79891	2.738000	0.93877	0.655000	0.94253	TCT	.		0.393	ITSN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000140070.4	NM_003024	
MYO18B	84700	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	26423002	26423002	+	Silent	SNP	C	C	G			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr22:26423002C>G	ENST00000407587.2	+	43	7234	c.7065C>G	c.(7063-7065)ctC>ctG	p.L2355L	MYO18B_ENST00000335473.7_Silent_p.L2354L|MYO18B_ENST00000536101.1_Silent_p.L2354L			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	2354						cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						GCGAGTCCCTCTTAGAATCCA	0.572																																					p.L2354L		.											.	MYO18B-142	0			c.C7062G						.						86.0	94.0	91.0					22																	26423002		1936	4137	6073	SO:0001819	synonymous_variant	84700	exon43			GTCCCTCTTAGAA	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.7065C>G	22.37:g.26423002C>G		Somatic	185	0		WXS	Illumina HiSeq	Phase_I	200	48	NM_032608	0	0	0	0	0	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Silent	SNP	ENST00000407587.2	37		.	.	.	.	.	.	.	.	.	.	C	3.671	-0.067510	0.07273	.	.	ENSG00000133454	ENST00000543971	.	.	.	4.89	-0.276	0.12902	.	.	.	.	.	T	0.40222	0.1108	.	.	.	0.31595	N	0.653425	.	.	.	.	.	.	T	0.47100	-0.9143	4	.	.	.	.	8.3531	0.32314	0.0:0.4167:0.4883:0.095	.	.	.	.	C	304	.	.	S	+	2	0	MYO18B	24753002	0.045000	0.20229	0.019000	0.16419	0.647000	0.38526	-0.357000	0.07651	-0.215000	0.10063	0.462000	0.41574	TCT	.		0.572	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608	
PKDREJ	10343	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	46653660	46653660	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr22:46653660T>G	ENST00000253255.5	-	1	5559	c.5560A>C	c.(5560-5562)Aat>Cat	p.N1854H		NM_006071.1	NP_006062.1	Q9NTG1	PKDRE_HUMAN	polycystin (PKD) family receptor for egg jelly	1854					acrosome reaction (GO:0007340)|calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|neuropeptide signaling pathway (GO:0007218)|regulation of acrosome reaction (GO:0060046)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)			NS(2)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(4)|kidney(5)|large_intestine(21)|lung(16)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	73		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)		GTAAATCCATTGGTACTCTCA	0.383																																					p.N1854H		.											.	PKDREJ-156	0			c.A5560C						.						133.0	136.0	135.0					22																	46653660		2203	4300	6503	SO:0001583	missense	10343	exon1			ATCCATTGGTACT	AF116458	CCDS14073.1	22q13.31	2013-07-31	2013-07-31		ENSG00000130943	ENSG00000130943			9015	protein-coding gene	gene with protein product		604670	"""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly, sea urchin homolog)-like"", ""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly homolog, sea urchin)-like"", ""polycystic kidney disease (polycystin) and REJ homolog (sperm receptor for egg jelly homolog, sea urchin)"""			9949214, 10591208	Standard	NM_006071		Approved		uc003bhh.3	Q9NTG1	OTTHUMG00000150493	ENST00000253255.5:c.5560A>C	22.37:g.46653660T>G	ENSP00000253255:p.Asn1854His	Somatic	134	0		WXS	Illumina HiSeq	Phase_I	137	34	NM_006071	0	0	0	0	0	B1AJY3|O95850	Missense_Mutation	SNP	ENST00000253255.5	37	CCDS14073.1	.	.	.	.	.	.	.	.	.	.	T	4.903	0.167837	0.09339	.	.	ENSG00000130943	ENST00000253255	T	0.70045	-0.45	4.51	-2.95	0.05564	Polycystin cation channel, PKD1/PKD2 (1);	1.774300	0.02687	N	0.110187	T	0.44371	0.1290	N	0.11560	0.145	0.09310	N	1	B	0.12013	0.005	B	0.15052	0.012	T	0.20940	-1.0260	10	0.30078	T	0.28	-0.4113	5.5709	0.17196	0.0:0.3289:0.2649:0.4062	.	1854	Q9NTG1	PKDRE_HUMAN	H	1854	ENSP00000253255:N1854H	ENSP00000253255:N1854H	N	-	1	0	PKDREJ	45032324	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	-0.516000	0.06282	-0.535000	0.06307	0.374000	0.22700	AAT	.		0.383	PKDREJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318466.1	NM_006071	
PPP6R2	9701	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	50878437	50878437	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr22:50878437G>T	ENST00000216061.5	+	22	2703	c.2333G>T	c.(2332-2334)aGc>aTc	p.S778I	PPP6R2_ENST00000395744.3_Missense_Mutation_p.S751I|PPP6R2_ENST00000395741.3_Missense_Mutation_p.S752I|PPP6R2_ENST00000359139.3_Missense_Mutation_p.S752I			O75170	PP6R2_HUMAN	protein phosphatase 6, regulatory subunit 2	778						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	22						ACAGAATGCAGCCATGCTGAG	0.642																																					p.S778I		.											.	PPP6R2-92	0			c.G2333T						.						42.0	42.0	42.0					22																	50878437		2203	4300	6503	SO:0001583	missense	9701	exon21			AATGCAGCCATGC	AB014585	CCDS33681.1, CCDS56235.1, CCDS56236.1, CCDS74881.1	22q13.33	2012-04-17	2010-06-28	2010-06-28	ENSG00000100239	ENSG00000100239		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	19253	protein-coding gene	gene with protein product		610877	"""KIAA0685"", ""SAPS domain family, member 2"""	KIAA0685, SAPS2		16769727	Standard	NM_014678		Approved	dJ579N16.1, SAP190	uc003blc.3	O75170	OTTHUMG00000150199	ENST00000216061.5:c.2333G>T	22.37:g.50878437G>T	ENSP00000216061:p.Ser778Ile	Somatic	86	0		WXS	Illumina HiSeq	Phase_I	69	13	NM_001242898	0	0	32	44	12	A6PVG3|B7Z7T3|Q5U5P3|Q7Z2L2|Q7Z5G5|Q7Z731|Q9UGB9	Missense_Mutation	SNP	ENST00000216061.5	37		.	.	.	.	.	.	.	.	.	.	G	16.34	3.095777	0.56075	.	.	ENSG00000100239	ENST00000359139;ENST00000395741;ENST00000395744;ENST00000216061	T;T;T;T	0.48201	0.82;0.82;0.82;0.82	4.84	2.68	0.31781	.	0.269718	0.36628	N	0.002493	T	0.63153	0.2487	M	0.70275	2.135	0.09310	N	1	D;D;D;D;D;D	0.71674	0.993;0.992;0.986;0.998;0.996;0.998	P;D;P;D;D;D	0.70716	0.877;0.917;0.828;0.956;0.917;0.97	T	0.55296	-0.8163	10	0.72032	D	0.01	-11.7634	10.2693	0.43473	0.0:0.1469:0.7006:0.1524	.	311;778;778;752;751;752	F2Z3M7;O75170-5;O75170;O75170-3;O75170-4;O75170-2	.;.;PP6R2_HUMAN;.;.;.	I	752;752;751;778	ENSP00000352051:S752I;ENSP00000379090:S752I;ENSP00000379093:S751I;ENSP00000216061:S778I	ENSP00000216061:S778I	S	+	2	0	PPP6R2	49225303	0.020000	0.18652	0.001000	0.08648	0.015000	0.08874	1.601000	0.36773	0.523000	0.28482	0.561000	0.74099	AGC	.		0.642	PPP6R2-004	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000316809.1	NM_014678	
SETD5	55209	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	9512542	9512542	+	Silent	SNP	T	T	C			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr3:9512542T>C	ENST00000406341.1	+	18	3314	c.3124T>C	c.(3124-3126)Ttg>Ctg	p.L1042L	SETD5_ENST00000302463.6_Silent_p.L944L|SETD5_ENST00000402466.1_Silent_p.L944L|SETD5_ENST00000407969.1_Silent_p.L1061L|SETD5_ENST00000402198.1_Silent_p.L1042L			Q9C0A6	SETD5_HUMAN	SET domain containing 5	1042										NS(2)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(3)|prostate(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.112)		TCGTGGATCCTTGTCACCTGG	0.478																																					p.L1042L		.											.	SETD5-70	0			c.T3124C						.						24.0	23.0	23.0					3																	9512542		1861	4094	5955	SO:0001819	synonymous_variant	55209	exon19			GGATCCTTGTCAC	BC020956	CCDS46741.1, CCDS74892.1	3p25.3	2011-12-13			ENSG00000168137	ENSG00000168137			25566	protein-coding gene	gene with protein product		615743				11214970	Standard	XM_005265299		Approved	FLJ10707	uc003brt.3	Q9C0A6	OTTHUMG00000150491	ENST00000406341.1:c.3124T>C	3.37:g.9512542T>C		Somatic	24	0		WXS	Illumina HiSeq	Phase_I	25	4	NM_001080517	0	0	4	7	3	Q6AI17|Q8WUB6|Q9H3X4|Q9H6V7|Q9H7S3|Q9NVI9	Silent	SNP	ENST00000406341.1	37	CCDS46741.1	.	.	.	.	.	.	.	.	.	.	T	8.531	0.871085	0.17322	.	.	ENSG00000168137	ENST00000399686;ENST00000421188	.	.	.	5.51	-0.229	0.13094	.	0.261170	0.47093	D	0.000242	T	0.54367	0.1854	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.45673	-0.9245	5	.	.	.	-3.3658	8.5026	0.33168	0.5133:0.3613:0.0:0.1253	.	.	.	.	P	709;372	.	.	L	+	2	0	SETD5	9487542	1.000000	0.71417	0.999000	0.59377	0.979000	0.70002	1.768000	0.38511	0.028000	0.15324	-0.649000	0.03915	CTT	.		0.478	SETD5-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318425.1	XM_371614	
CAPN7	23473	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	15262464	15262464	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr3:15262464C>T	ENST00000253693.2	+	5	867	c.614C>T	c.(613-615)aCa>aTa	p.T205I		NM_014296.2	NP_055111.1	Q9Y6W3	CAN7_HUMAN	calpain 7	205					positive regulation of epithelial cell migration (GO:0010634)|self proteolysis (GO:0097264)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|endopeptidase activity (GO:0004175)|MIT domain binding (GO:0090541)			breast(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(5)|ovary(1)|skin(2)	22						CAGAGATACACAGCAGAAGAA	0.363																																					p.T205I		.											.	CAPN7-91	0			c.C614T						.						59.0	59.0	59.0					3																	15262464		2203	4300	6503	SO:0001583	missense	23473	exon5			GATACACAGCAGA	AB028639	CCDS2624.1	3p24	2008-07-18			ENSG00000131375	ENSG00000131375			1484	protein-coding gene	gene with protein product	"""calpain like protease"", ""homolog of Aspergillus Nidulans PALB"""	606400				8163008, 10051333	Standard	NM_014296		Approved	PalBH	uc003bzn.3	Q9Y6W3	OTTHUMG00000129863	ENST00000253693.2:c.614C>T	3.37:g.15262464C>T	ENSP00000253693:p.Thr205Ile	Somatic	51	0		WXS	Illumina HiSeq	Phase_I	65	16	NM_014296	0	0	7	12	5		Missense_Mutation	SNP	ENST00000253693.2	37	CCDS2624.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.640356	0.87859	.	.	ENSG00000131375	ENST00000253693	T	0.43294	0.95	5.79	4.92	0.64577	.	0.109635	0.64402	D	0.000008	T	0.59959	0.2232	M	0.81802	2.56	0.58432	D	0.999998	D	0.62365	0.991	P	0.56823	0.807	T	0.65092	-0.6252	10	0.54805	T	0.06	-9.0239	12.9819	0.58568	0.0:0.9247:0.0:0.0753	.	205	Q9Y6W3	CAN7_HUMAN	I	205	ENSP00000253693:T205I	ENSP00000253693:T205I	T	+	2	0	CAPN7	15237468	1.000000	0.71417	0.555000	0.28281	0.997000	0.91878	7.223000	0.78033	1.465000	0.48006	0.555000	0.69702	ACA	.		0.363	CAPN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252105.2	NM_014296	
EXOSC7	23016	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	45048921	45048921	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr3:45048921C>T	ENST00000265564.7	+	7	673	c.625C>T	c.(625-627)Cgg>Tgg	p.R209W	CLEC3B_ENST00000490386.1_Intron|EXOSC7_ENST00000461361.1_3'UTR	NM_015004.3	NP_055819.2	Q15024	EXOS7_HUMAN	exosome component 7	209					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA catabolic process (GO:0006401)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|RNA binding (GO:0003723)			endometrium(3)|large_intestine(1)|lung(3)	7				BRCA - Breast invasive adenocarcinoma(193;0.00911)|KIRC - Kidney renal clear cell carcinoma(197;0.0509)|Kidney(197;0.064)		GATTGGCTATCGGCATGTGGT	0.612																																					p.R209W		.											.	EXOSC7-90	0			c.C625T						.						62.0	53.0	56.0					3																	45048921		2203	4300	6503	SO:0001583	missense	23016	exon7			GGCTATCGGCATG	BC012831	CCDS2725.1	3p21.32	2010-05-07			ENSG00000075914	ENSG00000075914	3.1.13.-		28112	protein-coding gene	gene with protein product		606488				11719186, 11812149	Standard	NR_023353		Approved	hRrp42p, Rrp42p, RRP42, EAP1, KIAA0116, p8	uc003coi.2	Q15024	OTTHUMG00000133095	ENST00000265564.7:c.625C>T	3.37:g.45048921C>T	ENSP00000265564:p.Arg209Trp	Somatic	57	0		WXS	Illumina HiSeq	Phase_I	31	10	NM_015004	0	0	0	0	0	Q96E72	Missense_Mutation	SNP	ENST00000265564.7	37	CCDS2725.1	.	.	.	.	.	.	.	.	.	.	C	19.72	3.879280	0.72294	.	.	ENSG00000075914	ENST00000265564	T	0.44482	0.92	5.77	4.82	0.62117	Exoribonuclease, phosphorolytic domain 2 (1);	0.000000	0.85682	D	0.000000	T	0.62974	0.2472	M	0.81802	2.56	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.66716	0.946;0.946	T	0.62525	-0.6836	10	0.38643	T	0.18	-14.1235	13.4903	0.61390	0.2342:0.7658:0.0:0.0	.	209;209	B2RDZ9;Q15024	.;EXOS7_HUMAN	W	209	ENSP00000265564:R209W	ENSP00000265564:R209W	R	+	1	2	EXOSC7	45023925	0.964000	0.33143	0.994000	0.49952	0.991000	0.79684	2.331000	0.43894	2.723000	0.93209	0.655000	0.94253	CGG	.		0.612	EXOSC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256754.2	NM_015004	
TREX1	11277	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	48508760	48508760	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr3:48508760A>T	ENST00000422277.2	+	1	1532	c.871A>T	c.(871-873)Aca>Tca	p.T291S	SHISA5_ENST00000465449.1_5'Flank|TREX1_ENST00000444177.1_Missense_Mutation_p.T226S|TREX1_ENST00000436480.2_Missense_Mutation_p.T236S|TREX1_ENST00000433541.1_Missense_Mutation_p.T97S|TREX1_ENST00000456089.1_Missense_Mutation_p.T97S|TREX1_ENST00000492235.1_3'UTR|TREX1_ENST00000296443.9_Missense_Mutation_p.T236S	NM_016381.4	NP_057465.1	Q9NSU2	TREX1_HUMAN	three prime repair exonuclease 1	291	Necessary for endoplasmic reticulum localization. {ECO:0000250}.				cell death (GO:0008219)|cellular response to interferon-beta (GO:0035458)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|innate immune response (GO:0045087)|mismatch repair (GO:0006298)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	endoplasmic reticulum membrane (GO:0005789)|nuclear envelope (GO:0005635)|nucleolus (GO:0005730)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|3'-5'-exodeoxyribonuclease activity (GO:0008296)|adenyl deoxyribonucleotide binding (GO:0032558)|double-stranded DNA binding (GO:0003690)|exodeoxyribonuclease III activity (GO:0008853)|metal ion binding (GO:0046872)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein homodimerization activity (GO:0042803)|single-stranded DNA binding (GO:0003697)			breast(1)|kidney(1)|large_intestine(1)|lung(3)|skin(3)	9				BRCA - Breast invasive adenocarcinoma(193;0.000286)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00605)		GTATGGGGTCACAGCCTCTGC	0.617																																					p.T291S		.											.	TREX1-227	0			c.A871T	GRCh37	CI075712	TREX1	I		.						97.0	83.0	88.0					3																	48508760		2203	4300	6503	SO:0001583	missense	11277	exon1			GGGGTCACAGCCT	AF151105	CCDS2769.1, CCDS59451.1	3p21.31	2014-09-17			ENSG00000213689	ENSG00000213689			12269	protein-coding gene	gene with protein product		606609	"""Aicardi-Goutieres syndrome 1"""	AGS1		10391904, 10393201, 16845398	Standard	NM_033629		Approved	DRN3	uc010hka.4	Q9NSU2	OTTHUMG00000156205	ENST00000422277.2:c.871A>T	3.37:g.48508760A>T	ENSP00000390478:p.Thr291Ser	Somatic	101	0		WXS	Illumina HiSeq	Phase_I	93	12	NM_016381	0	0	24	45	21	B2RCN9|Q8TEU2|Q9BPW1|Q9Y4X2	Missense_Mutation	SNP	ENST00000422277.2	37	CCDS43086.1	.	.	.	.	.	.	.	.	.	.	A	19.05	3.752702	0.69533	.	.	ENSG00000213689	ENST00000296443;ENST00000433541;ENST00000436480;ENST00000422277;ENST00000444177;ENST00000456089	T;T;T;T;T;T	0.47528	1.49;0.84;1.49;1.44;1.49;0.84	5.1	-6.21	0.02065	.	.	.	.	.	T	0.32010	0.0815	L	0.54323	1.7	0.09310	N	1	B	0.24426	0.103	B	0.19391	0.025	T	0.34304	-0.9834	9	0.10902	T	0.67	.	6.7824	0.23654	0.2855:0.3313:0.3832:0.0	.	291	Q9NSU2	TREX1_HUMAN	S	236;97;236;291;226;97	ENSP00000296443:T236S;ENSP00000412404:T97S;ENSP00000392569:T236S;ENSP00000390478:T291S;ENSP00000415972:T226S;ENSP00000411331:T97S	ENSP00000296443:T236S	T	+	1	0	TREX1	48483764	0.000000	0.05858	0.000000	0.03702	0.852000	0.48524	-0.417000	0.07088	-1.057000	0.03201	0.459000	0.35465	ACA	.		0.617	TREX1-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_016381	
VPS8	23355	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	184700420	184700420	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr3:184700420C>T	ENST00000437079.3	+	41	3658	c.3487C>T	c.(3487-3489)Cat>Tat	p.H1163Y	VPS8_ENST00000436792.2_Missense_Mutation_p.H1161Y|VPS8_ENST00000446204.2_Missense_Mutation_p.H1071Y|VPS8_ENST00000287546.4_Missense_Mutation_p.H1163Y	NM_001009921.2	NP_001009921.1	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog (S. cerevisiae)	1163							zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			AGCCATTCCTCATCTACACTC	0.393																																					p.H1163Y		.											.	VPS8-91	0			c.C3487T						.						81.0	71.0	75.0					3																	184700420		1894	4126	6020	SO:0001583	missense	23355	exon40			ATTCCTCATCTAC	AK056661	CCDS46972.1	3q27.2	2006-07-07	2006-07-07	2006-07-07	ENSG00000156931	ENSG00000156931			29122	protein-coding gene	gene with protein product			"""KIAA0804"""	KIAA0804		9872452	Standard	NM_001009921		Approved	FLJ32099	uc003fpb.1	Q8N3P4	OTTHUMG00000156707	ENST00000437079.3:c.3487C>T	3.37:g.184700420C>T	ENSP00000397879:p.His1163Tyr	Somatic	65	0		WXS	Illumina HiSeq	Phase_I	71	13	NM_001009921	0	0	3	11	8	A8K8Q8|B9EIQ1|C9JB61|O94896|Q63HP2|Q9BVP9|Q9H9B0	Missense_Mutation	SNP	ENST00000437079.3	37	CCDS46971.1	.	.	.	.	.	.	.	.	.	.	C	0.295	-0.977536	0.02197	.	.	ENSG00000156931	ENST00000287546;ENST00000437079;ENST00000436792;ENST00000446204	T;T;T;T	0.17854	2.25;2.25;2.25;2.25	6.05	6.05	0.98169	.	0.769709	0.13007	N	0.421217	T	0.17789	0.0427	L	0.38175	1.15	0.24222	N	0.995432	B;B;B	0.13145	0.0;0.007;0.0	B;B;B	0.19391	0.0;0.025;0.001	T	0.09684	-1.0663	10	0.62326	D	0.03	-11.998	13.6828	0.62496	0.0:0.8456:0.1544:0.0	.	1163;1071;1161	Q8N3P4;Q8N3P4-2;Q8N3P4-3	VPS8_HUMAN;.;.	Y	1163;1163;1161;1071	ENSP00000287546:H1163Y;ENSP00000397879:H1163Y;ENSP00000404704:H1161Y;ENSP00000405483:H1071Y	ENSP00000287546:H1163Y	H	+	1	0	VPS8	186183114	0.126000	0.22350	0.812000	0.32479	0.520000	0.34377	1.477000	0.35431	2.878000	0.98634	0.650000	0.86243	CAT	.		0.393	VPS8-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015303	
IDUA	3425	hgsc.bcm.edu	37	4	980971	980971	+	Missense_Mutation	SNP	T	T	G	rs10794537	byFrequency	TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr4:980971T>G	ENST00000247933.4	+	1	187	c.99T>G	c.(97-99)caT>caG	p.H33Q	IDUA_ENST00000453894.1_Missense_Mutation_p.H33Q|SLC26A1_ENST00000398520.2_Intron	NM_000203.3	NP_000194.2	P35475	IDUA_HUMAN	iduronidase, alpha-L-	33			H -> Q (in dbSNP:rs10794537). {ECO:0000269|PubMed:1362562, ECO:0000269|PubMed:1505961, ECO:0000269|PubMed:1946389, ECO:0000269|PubMed:21394825}.		carbohydrate metabolic process (GO:0005975)|cell morphogenesis (GO:0000902)|chemical homeostasis (GO:0048878)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate catabolic process (GO:0030209)|disaccharide metabolic process (GO:0005984)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|limb morphogenesis (GO:0035108)|lysosome organization (GO:0007040)|skeletal system morphogenesis (GO:0048705)|small molecule metabolic process (GO:0044281)	coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	L-iduronidase activity (GO:0003940)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			ACCTGGTGCATGTGGACGCGG	0.801													G|||	4467	0.891973	0.9826	0.8386	5008	,	,		8604	0.8472		0.8042	False		,,,				2504	0.9438				p.H33Q		.											.	IDUA-91	0			c.T99G						.						1.0	1.0	1.0					4																	980971		552	1375	1927	SO:0001583	missense	3425	exon1			GGTGCATGTGGAC	M74715	CCDS3343.1	4p16.3	2012-10-02			ENSG00000127415	ENSG00000127415	3.2.1.76		5391	protein-coding gene	gene with protein product		252800				1832239	Standard	NM_000203		Approved	MPS1	uc003gby.3	P35475	OTTHUMG00000088901	ENST00000247933.4:c.99T>G	4.37:g.980971T>G	ENSP00000247933:p.His33Gln	Somatic	1	1		WXS	Illumina HiSeq	Phase_I	3	3	NM_000203	0	0	0	5	5	B3KWK6	Missense_Mutation	SNP	ENST00000247933.4	37	CCDS3343.1	1801|1801	0.8246336996336996|0.8246336996336996	464|464	0.943089430894309|0.943089430894309	294|294	0.8121546961325967|0.8121546961325967	448|448	0.7832167832167832|0.7832167832167832	595|595	0.7849604221635884|0.7849604221635884	G|G	3.726|3.726	-0.056533|-0.056533	0.07362|0.07362	.|.	.|.	ENSG00000127415|ENSG00000127415	ENST00000504568|ENST00000247933;ENST00000453894;ENST00000502910	.|D;D;D	.|0.93247	.|-3.18;-3.19;-3.03	3.62|3.62	-0.897|-0.897	0.10553|0.10553	.|.	.|0.728933	.|0.12190	.|N	.|0.491278	T|T	0.00012|0.00012	0.0000|0.0000	N|N	0.08118|0.08118	0|0	0.80722|0.80722	P|P	0.0|0.0	.|B;B	.|0.02656	.|0.0;0.0	.|B;B	.|0.01281	.|0.0;0.0	T|T	0.36817|0.36817	-0.9732|-0.9732	4|9	.|0.10111	.|T	.|0.7	.|.	1.2904|1.2904	0.02059|0.02059	0.1461:0.2669:0.3485:0.2385|0.1461:0.2669:0.3485:0.2385	rs10794537|rs10794537	.|33;33	.|B3KWK6;P35475	.|.;IDUA_HUMAN	G|Q	33|33	.|ENSP00000247933:H33Q;ENSP00000396458:H33Q;ENSP00000422952:H33Q	.|ENSP00000247933:H33Q	C|H	+|+	1|3	0|2	IDUA|IDUA	970971|970971	0.000000|0.000000	0.05858|0.05858	0.992000|0.992000	0.48379|0.48379	0.012000|0.012000	0.07955|0.07955	-2.547000|-2.547000	0.00931|0.00931	-0.253000|-0.253000	0.09514|0.09514	-1.482000|-1.482000	0.00985|0.00985	TGT|CAT	T|0.175;G|0.825		0.801	IDUA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000201812.1	NM_000203	
ABCG2	9429	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	89042889	89042889	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr4:89042889A>C	ENST00000237612.3	-	6	1132	c.587T>G	c.(586-588)aTa>aGa	p.I196R	ABCG2_ENST00000515655.1_Missense_Mutation_p.I196R	NM_004827.2	NP_004818.2	Q9UNQ0	ABCG2_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 2 (Junior blood group)	196	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular iron ion homeostasis (GO:0006879)|drug export (GO:0046618)|drug transmembrane transport (GO:0006855)|embryonic process involved in female pregnancy (GO:0060136)|heme transport (GO:0015886)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|response to iron ion (GO:0010039)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|urate metabolic process (GO:0046415)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|heme transporter activity (GO:0015232)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)			breast(5)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(13)|lung(10)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	42		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;7.02e-05)	Afatinib(DB08916)|Apixaban(DB06605)|Buprenorphine(DB00921)|Cabazitaxel(DB06772)|Carboplatin(DB00958)|Cisplatin(DB00515)|Cladribine(DB00242)|Clofarabine(DB00631)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Diethylstilbestrol(DB00255)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Erlotinib(DB00530)|Estradiol(DB00783)|Estrone(DB00655)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gefitinib(DB00317)|Glyburide(DB01016)|Hesperetin(DB01094)|Hydrocortisone(DB00741)|Imatinib(DB00619)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Lansoprazole(DB00448)|Leflunomide(DB01097)|Methotrexate(DB00563)|Mitoxantrone(DB01204)|Mycophenolate mofetil(DB00688)|Nelfinavir(DB00220)|Nilotinib(DB04868)|Nitrofurantoin(DB00698)|Novobiocin(DB01051)|Omeprazole(DB00338)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Pitavastatin(DB08860)|Ponatinib(DB08901)|Pravastatin(DB00175)|Prazosin(DB00457)|Rabeprazole(DB01129)|Regorafenib(DB08896)|Rilpivirine(DB08864)|Riluzole(DB00740)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Sorafenib(DB00398)|Sulfasalazine(DB00795)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Teniposide(DB00444)|Teriflunomide(DB08880)|Testosterone(DB00624)|Topotecan(DB01030)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vincristine(DB00541)|Vismodegib(DB08828)|Zafirlukast(DB00549)|Zidovudine(DB00495)	CTCCATTCCTATACTAGTCCT	0.398																																					p.I196R		.											.	ABCG2-90	0			c.T587G						.						154.0	147.0	149.0					4																	89042889		2203	4300	6503	SO:0001583	missense	9429	exon6			ATTCCTATACTAG	AF103796	CCDS3628.1, CCDS58910.1	4q22.1	2014-08-27	2014-08-27		ENSG00000118777	ENSG00000118777		"""CD molecules"", ""ATP binding cassette transporters / subfamily G"""	74	protein-coding gene	gene with protein product		603756	"""ATP-binding cassette, sub-family G (WHITE), member 2"""			8894702, 9861027	Standard	NM_001257386		Approved	EST157481, MXR, BCRP, ABCP, CD338	uc003hrg.3	Q9UNQ0	OTTHUMG00000130601	ENST00000237612.3:c.587T>G	4.37:g.89042889A>C	ENSP00000237612:p.Ile196Arg	Somatic	70	0		WXS	Illumina HiSeq	Phase_I	75	13	NM_004827	0	0	4	4	0	A0A1W3|A8K1T5|O95374|Q4W5I3|Q53ZQ1|Q569L4|Q5YLG4|Q86V64|Q8IX16|Q96LD6|Q96TA8|Q9BY73|Q9NUS0	Missense_Mutation	SNP	ENST00000237612.3	37	CCDS3628.1	.	.	.	.	.	.	.	.	.	.	A	24.0	4.478150	0.84747	.	.	ENSG00000118777	ENST00000515655;ENST00000237612	D;D	0.96168	-3.93;-3.93	5.55	5.55	0.83447	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.85682	D	0.000000	D	0.98601	0.9532	H	0.97240	3.965	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.999	D	0.99755	1.1019	10	0.87932	D	0	-42.7755	15.3809	0.74654	1.0:0.0:0.0:0.0	.	196;196;196	Q9UNQ0-2;Q9UNQ0;Q4W5I3	.;ABCG2_HUMAN;.	R	196	ENSP00000426917:I196R;ENSP00000237612:I196R	ENSP00000237612:I196R	I	-	2	0	ABCG2	89261913	1.000000	0.71417	0.984000	0.44739	0.893000	0.52053	8.948000	0.93006	2.117000	0.64856	0.533000	0.62120	ATA	.		0.398	ABCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253051.1	NM_004827	
KIAA1109	84162	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	123156097	123156097	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr4:123156097G>T	ENST00000264501.4	+	27	3866	c.3493G>T	c.(3493-3495)Gag>Tag	p.E1165*	KIAA1109_ENST00000455637.1_Nonsense_Mutation_p.E1165*|KIAA1109_ENST00000495260.1_3'UTR|KIAA1109_ENST00000388738.3_Nonsense_Mutation_p.E1165*			Q2LD37	K1109_HUMAN	KIAA1109	1165					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						CACAAGTGCAGAGTCTGATAT	0.393																																					p.E1165X		.											.	KIAA1109-80	0			c.G3493T						.						109.0	106.0	107.0					4																	123156097		1863	4108	5971	SO:0001587	stop_gained	84162	exon25			AGTGCAGAGTCTG	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.3493G>T	4.37:g.123156097G>T	ENSP00000264501:p.Glu1165*	Somatic	102	0		WXS	Illumina HiSeq	Phase_I	107	25	NM_015312	0	0	4	5	1	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Nonsense_Mutation	SNP	ENST00000264501.4	37	CCDS43267.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	39|39	7.713265|7.713265	0.98447|0.98447	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000455637|ENST00000424425	.|.	.|.	.|.	5.14|5.14	5.14|5.14	0.70334|0.70334	.|.	0.138537|.	0.28067|.	U|.	0.016735|.	.|T	.|0.74612	.|0.3739	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.73956	.|-0.3819	.|3	0.14656|.	T|.	0.56|.	.|.	18.61|18.61	0.91281|0.91281	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|I	1165|996	.|.	ENSP00000264501:E1165X|.	E|R	+|+	1|2	0|0	KIAA1109|KIAA1109	123375547|123375547	1.000000|1.000000	0.71417|0.71417	0.987000|0.987000	0.45799|0.45799	0.981000|0.981000	0.71138|0.71138	9.147000|9.147000	0.94646|0.94646	2.391000|2.391000	0.81399|0.81399	0.563000|0.563000	0.77884|0.77884	GAG|AGA	.		0.393	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
FASTKD3	79072	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	7867621	7867621	+	Silent	SNP	A	A	G			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr5:7867621A>G	ENST00000264669.5	-	2	712	c.576T>C	c.(574-576)ccT>ccC	p.P192P	FASTKD3_ENST00000513658.1_Intron|MTRR_ENST00000264668.2_5'Flank|MTRR_ENST00000502509.1_Intron|MTRR_ENST00000341013.6_5'Flank|MTRR_ENST00000440940.2_5'Flank	NM_024091.3	NP_076996.2	Q14CZ7	FAKD3_HUMAN	FAST kinase domains 3	192					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(2)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						GGCTACTTTGAGGATCCACAT	0.443																																					p.P192P		.											.	FASTKD3-156	0			c.T576C						.						90.0	90.0	90.0					5																	7867621		2203	4300	6503	SO:0001819	synonymous_variant	79072	exon2			ACTTTGAGGATCC	AK026927	CCDS3873.1	5p15.31	2008-02-05			ENSG00000124279	ENSG00000124279			28758	protein-coding gene	gene with protein product						12477932	Standard	NM_024091		Approved	MGC5297, FLJ23274	uc003jeb.3	Q14CZ7	OTTHUMG00000131029	ENST00000264669.5:c.576T>C	5.37:g.7867621A>G		Somatic	130	0		WXS	Illumina HiSeq	Phase_I	180	23	NM_024091	0	0	13	18	5	Q9BVD3	Silent	SNP	ENST00000264669.5	37	CCDS3873.1																																																																																			.		0.443	FASTKD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253673.1	NM_024091	
ADAMTS6	11174	hgsc.bcm.edu	37	5	64537954	64537954	+	IGR	SNP	T	T	G			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr5:64537954T>G								ADAMTS6 (43362 upstream) : ADAMTS6 (55080 downstream)																							TTTCCAGTTATAATACTTTCC	0.358																																					p.Y637S		.											.	ADAMTS6-226	0			c.A1910C						.						97.0	101.0	100.0					5																	64537954		2203	4300	6503	SO:0001628	intergenic_variant	11174	exon15			CAGTTATAATACT																													5.37:g.64537954T>G		Somatic	67	0		WXS	Illumina HiSeq	Phase_I	79	4	NM_197941	0	0	0	0	0		Missense_Mutation	SNP		37		.	.	.	.	.	.	.	.	.	.	T	16.74	3.205533	0.58234	.	.	ENSG00000049192	ENST00000381055;ENST00000261306;ENST00000464680	T;T	0.06608	3.28;7.39	5.62	5.62	0.85841	.	0.054793	0.85682	D	0.000000	T	0.12305	0.0299	M	0.71871	2.18	0.80722	D	1	B;B	0.22346	0.068;0.008	B;B	0.24848	0.056;0.034	T	0.01349	-1.1378	10	0.72032	D	0.01	.	15.8202	0.78633	0.0:0.0:0.0:1.0	.	637;637	D6R9L6;Q9UKP5	.;ATS6_HUMAN	S	637;587;637	ENSP00000370443:Y637S;ENSP00000423551:Y637S	ENSP00000261306:Y587S	Y	-	2	0	ADAMTS6	64573710	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.581000	0.82535	2.139000	0.66308	0.460000	0.39030	TAT	.	0	0.358								
SPATA9	83890	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	94994451	94994451	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr5:94994451C>G	ENST00000274432.8	-	5	782	c.641G>C	c.(640-642)aGg>aCg	p.R214T	SPATA9_ENST00000477047.2_Intron|RFESD_ENST00000508206.1_Intron	NM_031952.3	NP_114158.2	Q9BWV2	SPAT9_HUMAN	spermatogenesis associated 9	214					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)				large_intestine(3)|lung(4)	7		all_cancers(142;1.28e-06)|all_epithelial(76;1.55e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.00473)|Colorectal(57;0.0846)|Breast(839;0.198)		all cancers(79;8.91e-16)		CGGCAATGACCTATAAGGTTT	0.403																																					p.R214T		.											.	SPATA9-90	0			c.G641C						.						102.0	98.0	99.0					5																	94994451		2203	4299	6502	SO:0001583	missense	83890	exon5			AATGACCTATAAG	AK093225	CCDS4076.1	5q15	2008-02-05			ENSG00000145757	ENSG00000145757			22988	protein-coding gene	gene with protein product		608039				12493713	Standard	NM_031952		Approved	NYD-SP16, FLJ35906	uc003klj.1	Q9BWV2	OTTHUMG00000121169	ENST00000274432.8:c.641G>C	5.37:g.94994451C>G	ENSP00000274432:p.Arg214Thr	Somatic	51	0		WXS	Illumina HiSeq	Phase_I	62	10	NM_031952	0	0	0	0	0	A8K8H3|Q4G122|Q86X33|Q8NA28	Missense_Mutation	SNP	ENST00000274432.8	37	CCDS4076.1	.	.	.	.	.	.	.	.	.	.	C	10.93	1.491277	0.26774	.	.	ENSG00000145757	ENST00000274432	T	0.31510	1.49	5.37	5.37	0.77165	.	0.173364	0.39985	N	0.001210	T	0.31857	0.0810	L	0.27053	0.805	0.80722	D	1	P	0.51351	0.944	P	0.49999	0.628	T	0.02214	-1.1194	10	0.54805	T	0.06	-9.9082	14.4904	0.67647	0.0:1.0:0.0:0.0	.	214	Q9BWV2	SPAT9_HUMAN	T	214	ENSP00000274432:R214T	ENSP00000274432:R214T	R	-	2	0	SPATA9	95020207	1.000000	0.71417	1.000000	0.80357	0.026000	0.11368	2.187000	0.42602	2.808000	0.96608	0.650000	0.86243	AGG	.		0.403	SPATA9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304036.1	NM_031952	
SLC36A2	153201	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	150701645	150701645	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr5:150701645A>T	ENST00000335244.4	-	9	1271	c.1142T>A	c.(1141-1143)cTg>cAg	p.L381Q	SLC36A2_ENST00000450886.1_Missense_Mutation_p.L105Q|SLC36A2_ENST00000521967.1_Missense_Mutation_p.L381Q	NM_181776.2	NP_861441.2	Q495M3	S36A2_HUMAN	solute carrier family 36 (proton/amino acid symporter), member 2	381					amino acid transport (GO:0006865)|ion transport (GO:0006811)|proline transmembrane transport (GO:0035524)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycine transmembrane transporter activity (GO:0015187)|hydrogen:amino acid symporter activity (GO:0005280)|L-alanine transmembrane transporter activity (GO:0015180)|L-proline transmembrane transporter activity (GO:0015193)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(14)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	33		Medulloblastoma(196;0.109)|all_hematologic(541;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Cycloserine(DB00260)	GGACAGATCCAGAGGCAGTGC	0.542																																					p.L381Q		.											.	SLC36A2-91	0			c.T1142A						.						138.0	127.0	131.0					5																	150701645		2203	4300	6503	SO:0001583	missense	153201	exon9			AGATCCAGAGGCA	AY162214	CCDS4315.1	5q33.1	2013-05-22			ENSG00000186335	ENSG00000186335		"""Solute carriers"""	18762	protein-coding gene	gene with protein product		608331				11959859	Standard	NM_181776		Approved	PAT2, tramdorin, TRAMD1	uc003lty.3	Q495M3	OTTHUMG00000130129	ENST00000335244.4:c.1142T>A	5.37:g.150701645A>T	ENSP00000334223:p.Leu381Gln	Somatic	130	0		WXS	Illumina HiSeq	Phase_I	147	31	NM_181776	0	0	0	1	1	Q495M4|Q495M6|Q6ZWK5|Q7Z6B5	Missense_Mutation	SNP	ENST00000335244.4	37	CCDS4315.1	.	.	.	.	.	.	.	.	.	.	A	13.87	2.366710	0.41902	.	.	ENSG00000186335	ENST00000335244;ENST00000450886;ENST00000521967	T;T;T	0.11495	4.19;4.19;2.77	4.76	2.4	0.29515	.	0.920881	0.09207	N	0.833849	T	0.18383	0.0441	L	0.57536	1.79	0.31863	N	0.620713	P;B	0.45531	0.86;0.132	P;B	0.50314	0.637;0.158	T	0.16897	-1.0387	10	0.28530	T	0.3	-0.0361	8.697	0.34303	0.8453:0.0:0.1547:0.0	.	381;381	E5RJJ5;Q495M3	.;S36A2_HUMAN	Q	381;105;381	ENSP00000334223:L381Q;ENSP00000399479:L105Q;ENSP00000430535:L381Q	ENSP00000334223:L381Q	L	-	2	0	SLC36A2	150681838	0.997000	0.39634	0.549000	0.28204	0.633000	0.38033	4.784000	0.62411	0.426000	0.26116	0.460000	0.39030	CTG	.		0.542	SLC36A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252437.1		
DOCK2	1794	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	169463529	169463529	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr5:169463529A>G	ENST00000256935.8	+	36	3715	c.3635A>G	c.(3634-3636)aAa>aGa	p.K1212R	DOCK2_ENST00000520908.1_Missense_Mutation_p.K704R|DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000540750.1_Missense_Mutation_p.K273R	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1212	DHR-2.|Interaction with CRKL.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AATTTCTACAAAGATAACAAC	0.423																																					p.K1212R		.											.	DOCK2-97	0			c.A3635G						.						135.0	132.0	133.0					5																	169463529		2203	4300	6503	SO:0001583	missense	1794	exon36			TCTACAAAGATAA	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.3635A>G	5.37:g.169463529A>G	ENSP00000256935:p.Lys1212Arg	Somatic	74	0		WXS	Illumina HiSeq	Phase_I	85	23	NM_004946	0	0	0	0	0	Q2M3I0|Q96AK7	Missense_Mutation	SNP	ENST00000256935.8	37	CCDS4371.1	.	.	.	.	.	.	.	.	.	.	A	19.91	3.914002	0.72983	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	T;T;T	0.55930	0.49;0.49;0.49	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.53174	0.1780	M	0.69463	2.115	0.41312	D	0.987117	P;P	0.46859	0.885;0.468	B;B	0.41299	0.353;0.074	T	0.57510	-0.7799	10	0.38643	T	0.18	.	15.5299	0.75952	1.0:0.0:0.0:0.0	.	704;1212	E7ERW7;Q92608	.;DOCK2_HUMAN	R	1212;704;273	ENSP00000256935:K1212R;ENSP00000429283:K704R;ENSP00000438827:K273R	ENSP00000256935:K1212R	K	+	2	0	DOCK2	169396107	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.358000	0.90090	2.147000	0.66899	0.533000	0.62120	AAA	.		0.423	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946	
NSD1	64324	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	176696648	176696648	+	Silent	SNP	C	C	T			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr5:176696648C>T	ENST00000439151.2	+	16	5394	c.5349C>T	c.(5347-5349)aaC>aaT	p.N1783N	NSD1_ENST00000347982.4_Silent_p.N1514N|NSD1_ENST00000361032.4_Silent_p.N1680N|NSD1_ENST00000354179.4_Silent_p.N1514N	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	1783	PWWP 2. {ECO:0000255|PROSITE- ProRule:PRU00162}.				gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		TTCCTTCCAACATTGATAAGA	0.488			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																											p.N1783N		.		Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	.	NSD1-188	0			c.C5349T	GRCh37	CD052485	NSD1	D		.						107.0	101.0	103.0					5																	176696648		2203	4300	6503	SO:0001819	synonymous_variant	64324	exon16	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	TTCCAACATTGAT	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.5349C>T	5.37:g.176696648C>T		Somatic	73	0		WXS	Illumina HiSeq	Phase_I	89	14	NM_022455	0	0	3	6	3	Q96PD8|Q96RN7	Silent	SNP	ENST00000439151.2	37	CCDS4412.1																																																																																			.		0.488	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253412.2	NM_172349	
FAM50B	26240	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	3850443	3850443	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr6:3850443C>T	ENST00000380274.1	+	1	824	c.398C>T	c.(397-399)gCg>gTg	p.A133V	FAM50B_ENST00000380272.3_Missense_Mutation_p.A133V			Q9Y247	FA50B_HUMAN	family with sequence similarity 50, member B	133						nucleus (GO:0005634)				cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|pancreas(1)|prostate(3)|urinary_tract(3)	17	Ovarian(93;0.0925)	all_hematologic(90;0.108)				CAGGCCGACGCGGCCGAGGCC	0.687																																					p.A133V													.	FAM50B-91	0			c.C398T						.						21.0	28.0	26.0					6																	3850443		2200	4297	6497	SO:0001583	missense	26240	exon2			CCGACGCGGCCGA	Y18504	CCDS4487.1	6p25.2	2008-05-15			ENSG00000145945	ENSG00000145945			18789	protein-coding gene	gene with protein product		614686				10534398	Standard	NM_012135		Approved	D6S2654E, X5L	uc003mvu.3	Q9Y247	OTTHUMG00000014147	ENST00000380274.1:c.398C>T	6.37:g.3850443C>T	ENSP00000369627:p.Ala133Val	Somatic	54	0		WXS	Illumina HiSeq	Phase_I	41	7	NM_012135	0	0	24	24	0	Q5T2L6	Missense_Mutation	SNP	ENST00000380274.1	37	CCDS4487.1	.	.	.	.	.	.	.	.	.	.	C	9.550	1.115671	0.20795	.	.	ENSG00000145945	ENST00000380274;ENST00000380272	.	.	.	3.79	-6.51	0.01878	.	2.245500	0.02440	N	0.084415	T	0.04907	0.0132	N	0.12746	0.255	0.09310	N	1	B	0.11235	0.004	B	0.13407	0.009	T	0.11299	-1.0593	9	0.31617	T	0.26	-0.103	1.0834	0.01647	0.2398:0.1759:0.124:0.4603	.	133	Q9Y247	FA50B_HUMAN	V	133	.	ENSP00000369625:A133V	A	+	2	0	FAM50B	3795442	0.000000	0.05858	0.000000	0.03702	0.485000	0.33311	-2.786000	0.00770	-1.203000	0.02652	0.485000	0.47835	GCG	.		0.687	FAM50B-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039693.1	NM_012135	
SLC35B3	51000	hgsc.bcm.edu	37	6	8413926	8413926	+	Silent	SNP	T	T	C			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr6:8413926T>C	ENST00000379660.4	-	11	1511	c.1062A>G	c.(1060-1062)gtA>gtG	p.V354V		NM_001142540.1|NM_001142541.1|NM_015948.3	NP_001136012.1|NP_001136013.1|NP_057032.2	Q9H1N7	S35B3_HUMAN	solute carrier family 35 (adenosine 3'-phospho 5'-phosphosulfate transporter), member B3	354					3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(1)|prostate(1)	15	Ovarian(93;0.0569)					AACCAGACCATACATACCTAA	0.249																																					p.V354V	Melanoma(83;700 1353 9357 11478 30548)	.											.	SLC35B3-90	0			c.A1062G						.						33.0	29.0	31.0					6																	8413926		2202	4294	6496	SO:0001819	synonymous_variant	51000	exon11			AGACCATACATAC	AF132953	CCDS4508.1	6p24.3	2013-07-17	2013-07-17	2003-09-10	ENSG00000124786	ENSG00000124786		"""Solute carriers"""	21601	protein-coding gene	gene with protein product	"""3' phosphoadenosine 5' phosphosulfate transporter 2"""	610845	"""chromosome 6 open reading frame 196"", ""solute carrier family 35, member B3"""	C6orf196		10810093	Standard	XM_005249156		Approved	CGI-19, dJ453H5.1, PAPST2	uc010joe.3	Q9H1N7	OTTHUMG00000014224	ENST00000379660.4:c.1062A>G	6.37:g.8413926T>C		Somatic	11	0		WXS	Illumina HiSeq	Phase_I	15	2	NM_001142540	0	0	0	0	0	A6NKX9|Q1XH11|Q6MZJ0|Q7Z662|Q9Y308	Silent	SNP	ENST00000379660.4	37	CCDS4508.1																																																																																			.		0.249	SLC35B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039802.1	NM_015948	
ATXN1	6310	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	6	16327407	16327407	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr6:16327407G>A	ENST00000244769.4	-	8	2071	c.1135C>T	c.(1135-1137)Cgg>Tgg	p.R379W	ATXN1_ENST00000436367.1_Missense_Mutation_p.R379W	NM_000332.3	NP_000323.2	P54253	ATX1_HUMAN	ataxin 1	379					adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|nuclear export (GO:0051168)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear inclusion body (GO:0042405)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|protein self-association (GO:0043621)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|lung(12)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)	44	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				ACAGAGGCCCGGACCCCCGAA	0.637																																					p.R379W		.											.	ATXN1-93	0			c.C1135T						.						116.0	131.0	126.0					6																	16327407		2203	4300	6503	SO:0001583	missense	6310	exon7			AGGCCCGGACCCC	X79204	CCDS34342.1	6p23	2014-09-17	2004-08-12	2004-08-13	ENSG00000124788	ENSG00000124788		"""Ataxins"""	10548	protein-coding gene	gene with protein product		601556	"""spinocerebellar ataxia 1 (olivopontocerebellar ataxia 1, autosomal dominant, ataxin 1)"""	SCA1		1582256	Standard	NM_000332		Approved	D6S504E, ATX1	uc010jpi.3	P54253	OTTHUMG00000014303	ENST00000244769.4:c.1135C>T	6.37:g.16327407G>A	ENSP00000244769:p.Arg379Trp	Somatic	244	2		WXS	Illumina HiSeq	Phase_I	239	56	NM_001128164	0	0	4	6	2	Q17S02|Q9UJG2|Q9Y4J1	Missense_Mutation	SNP	ENST00000244769.4	37	CCDS34342.1	.	.	.	.	.	.	.	.	.	.	G	16.70	3.196388	0.58126	.	.	ENSG00000124788	ENST00000244769;ENST00000450222;ENST00000436367	D;D	0.81908	-1.55;-1.55	4.76	4.76	0.60689	.	0.000000	0.85682	D	0.000000	D	0.84999	0.5597	L	0.36672	1.1	0.58432	D	0.999996	D	0.89917	1.0	D	0.79784	0.993	D	0.87603	0.2498	10	0.87932	D	0	-24.3006	17.7777	0.88514	0.0:0.0:1.0:0.0	.	379	P54253	ATX1_HUMAN	W	379	ENSP00000244769:R379W;ENSP00000416360:R379W	ENSP00000244769:R379W	R	-	1	2	ATXN1	16435386	1.000000	0.71417	0.999000	0.59377	0.646000	0.38490	3.159000	0.50731	2.184000	0.69523	0.561000	0.74099	CGG	.		0.637	ATXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039943.3	NM_000332	
CLPS	1208	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	35765001	35765001	+	Missense_Mutation	SNP	C	C	G	rs140966197	byFrequency	TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr6:35765001C>G	ENST00000259938.2	-	1	87	c.65G>C	c.(64-66)cGg>cCg	p.R22P		NM_001832.3	NP_001823.1	P04118	COL_HUMAN	colipase, pancreatic	22					lipid catabolic process (GO:0016042)|lipid digestion (GO:0044241)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	enzyme activator activity (GO:0008047)			large_intestine(2)|lung(2)|prostate(1)	5						AATGATCCCCCGGGGGCCAGG	0.587																																					p.R22P	Melanoma(167;2962 3494 37796)	.											.	CLPS-90	0			c.G65C						.						84.0	81.0	82.0					6																	35765001		2203	4300	6503	SO:0001583	missense	1208	exon1			ATCCCCCGGGGGC		CCDS4811.1, CCDS75437.1, CCDS75438.1	6p21.31	2012-02-06			ENSG00000137392	ENSG00000137392			2085	protein-coding gene	gene with protein product		120105				2045105	Standard	NM_001832		Approved		uc003ole.2	P04118	OTTHUMG00000014578	ENST00000259938.2:c.65G>C	6.37:g.35765001C>G	ENSP00000259938:p.Arg22Pro	Somatic	118	0		WXS	Illumina HiSeq	Phase_I	153	13	NM_001252598	0	0	0	0	0	Q5T9G7|Q5U809	Missense_Mutation	SNP	ENST00000259938.2	37	CCDS4811.1	.	.	.	.	.	.	.	.	.	.	C	9.579	1.123120	0.20959	.	.	ENSG00000137392	ENST00000259938;ENST00000541088	T	0.36878	1.23	4.74	4.74	0.60224	Colipase, N-terminal (1);	0.240709	0.29486	N	0.012016	T	0.52468	0.1736	M	0.73962	2.25	0.42641	D	0.993411	D;B	0.89917	1.0;0.22	D;B	0.85130	0.997;0.117	T	0.56763	-0.7925	10	0.66056	D	0.02	-16.1424	14.5722	0.68218	0.0:1.0:0.0:0.0	.	22;22	G3V1M8;P04118	.;COL_HUMAN	P	22	ENSP00000259938:R22P	ENSP00000259938:R22P	R	-	2	0	CLPS	35872979	0.958000	0.32768	0.993000	0.49108	0.025000	0.11179	3.128000	0.50492	2.462000	0.83206	0.655000	0.94253	CGG	C|0.999;T|0.001		0.587	CLPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040312.1	NM_001832	
GLTSCR1L	23506	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	42796705	42796705	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr6:42796705C>G	ENST00000314073.5	+	6	810	c.634C>G	c.(634-636)Caa>Gaa	p.Q212E	GLTSCR1L_ENST00000394168.1_Missense_Mutation_p.Q212E			Q6AI39	GSC1L_HUMAN	GLTSCR1-like	212								p.Q212*(1)									TGGTTCTGGTCAAATACAGTT	0.418																																					p.Q212E		.											.	.	1	Substitution - Nonsense(1)	lung(1)	c.C634G						.						149.0	143.0	145.0					6																	42796705		2203	4300	6503	SO:0001583	missense	23506	exon5			TCTGGTCAAATAC	AL833540	CCDS34451.1	6p21.1	2012-11-29	2012-11-29	2012-11-29	ENSG00000112624	ENSG00000112624			21111	protein-coding gene	gene with protein product			"""KIAA0240"""	KIAA0240			Standard	XM_005248972		Approved		uc003osp.1	Q6AI39	OTTHUMG00000014706	ENST00000314073.5:c.634C>G	6.37:g.42796705C>G	ENSP00000313933:p.Gln212Glu	Somatic	215	0		WXS	Illumina HiSeq	Phase_I	221	35	NM_015349	0	0	2	5	3	A1L3W2|Q5TFZ3|Q92514	Missense_Mutation	SNP	ENST00000314073.5	37	CCDS34451.1	.	.	.	.	.	.	.	.	.	.	C	17.94	3.510409	0.64522	.	.	ENSG00000112624	ENST00000394167;ENST00000536004;ENST00000314073;ENST00000394168	T;T	0.35973	1.28;1.28	5.49	5.49	0.81192	.	0.000000	0.64402	D	0.000005	T	0.50599	0.1625	M	0.61703	1.905	0.58432	D	0.999998	P;D;D	0.61697	0.954;0.99;0.99	D;P;P	0.67900	0.954;0.848;0.848	T	0.36768	-0.9734	10	0.40728	T	0.16	-10.2526	19.7507	0.96267	0.0:1.0:0.0:0.0	.	212;212;212	F5H616;Q6AI39;B7Z2G7	.;K0240_HUMAN;.	E	212	ENSP00000313933:Q212E;ENSP00000377723:Q212E	ENSP00000313933:Q212E	Q	+	1	0	KIAA0240	42904683	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.946000	0.75953	2.722000	0.93159	0.655000	0.94253	CAA	.		0.418	GLTSCR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040562.3	NM_015349	
MRPL2	51069	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	43023646	43023646	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr6:43023646A>C	ENST00000388752.3	-	5	1044	c.620T>G	c.(619-621)aTc>aGc	p.I207S	MRPL2_ENST00000230413.5_Missense_Mutation_p.I207S|CUL7_ENST00000535468.1_5'Flank|CUL7_ENST00000265348.3_5'Flank|MRPL2_ENST00000489623.1_Intron	NM_015950.3	NP_057034.2	Q5T653	RM02_HUMAN	mitochondrial ribosomal protein L2	207					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(2)	9		Ovarian(999;0.0014)	Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|all cancers(41;0.00708)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)	BRCA - Breast invasive adenocarcinoma(397;0.0026)		TGCAGCTCGGATATATTGGGC	0.567																																					p.I207S		.											.	MRPL2-90	0			c.T620G						.						44.0	39.0	40.0					6																	43023646		2203	4300	6503	SO:0001583	missense	51069	exon5			GCTCGGATATATT	AB051617	CCDS34454.1, CCDS75458.1	6p21.3	2012-09-13			ENSG00000112651	ENSG00000112651		"""Mitochondrial ribosomal proteins / large subunits"""	14056	protein-coding gene	gene with protein product		611822					Standard	XM_005249161		Approved	MRP-L14, RPML14, CGI-22	uc003ots.1	Q5T653	OTTHUMG00000014719	ENST00000388752.3:c.620T>G	6.37:g.43023646A>C	ENSP00000373404:p.Ile207Ser	Somatic	44	0		WXS	Illumina HiSeq	Phase_I	41	10	NM_015950	0	0	1	1	0	B2RC56|Q8WUL1|Q96Q56|Q9Y311	Missense_Mutation	SNP	ENST00000388752.3	37	CCDS34454.1	.	.	.	.	.	.	.	.	.	.	A	25.0	4.589723	0.86851	.	.	ENSG00000112651	ENST00000388752;ENST00000230413	T;T	0.44482	0.92;0.92	5.94	5.94	0.96194	Translation protein SH3-like (1);Translation protein SH3-like, subgroup (1);Ribosomal protein L2, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.47135	0.1429	L	0.49571	1.57	0.80722	D	1	D	0.63880	0.993	D	0.67382	0.951	T	0.37197	-0.9716	10	0.33141	T	0.24	-18.6054	14.9662	0.71196	1.0:0.0:0.0:0.0	.	207	Q5T653	RM02_HUMAN	S	207	ENSP00000373404:I207S;ENSP00000230413:I207S	ENSP00000230413:I207S	I	-	2	0	MRPL2	43131624	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.952000	0.93031	2.272000	0.75746	0.460000	0.39030	ATC	.		0.567	MRPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040577.2		
SENP6	26054	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	76412443	76412443	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr6:76412443G>A	ENST00000447266.2	+	19	2849	c.2371G>A	c.(2371-2373)Gct>Act	p.A791T	SENP6_ENST00000370010.2_Missense_Mutation_p.A784T|SENP6_ENST00000541192.1_Intron|SENP6_ENST00000370014.3_Missense_Mutation_p.A791T	NM_015571.2	NP_056386.2	Q9GZR1	SENP6_HUMAN	SUMO1/sentrin specific peptidase 6	791	Protease.				protein desumoylation (GO:0016926)|protein modification by small protein removal (GO:0070646)|protein sumoylation (GO:0016925)|regulation of kinetochore assembly (GO:0090234)|regulation of spindle assembly (GO:0090169)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	SUMO-specific protease activity (GO:0016929)			breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(12)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_hematologic(105;0.189)				CCATGAAAATGCTGTCATACA	0.383																																					p.A791T		.											.	SENP6-660	0			c.G2371A						.						59.0	55.0	56.0					6																	76412443		1832	4093	5925	SO:0001583	missense	26054	exon19			GAAAATGCTGTCA		CCDS43483.1, CCDS47454.1	6q13-q14.3	2008-02-05	2005-08-17		ENSG00000112701	ENSG00000112701			20944	protein-coding gene	gene with protein product		605003	"""SUMO1/sentrin specific protease 6"""				Standard	NM_015571		Approved	SUSP1, KIAA0797	uc003pid.4	Q9GZR1	OTTHUMG00000015060	ENST00000447266.2:c.2371G>A	6.37:g.76412443G>A	ENSP00000402527:p.Ala791Thr	Somatic	58	0		WXS	Illumina HiSeq	Phase_I	62	11	NM_015571	0	0	14	21	7	A6NNY9|O94891|Q5VUL3|Q5VUL4|Q8TBY4|Q9UJV5	Missense_Mutation	SNP	ENST00000447266.2	37	CCDS47454.1	.	.	.	.	.	.	.	.	.	.	G	11.12	1.545641	0.27652	.	.	ENSG00000112701	ENST00000370010;ENST00000370014;ENST00000447266	T;T;T	0.12255	2.7;2.7;2.7	5.74	3.51	0.40186	.	0.723156	0.13837	N	0.359285	T	0.02494	0.0076	L	0.33485	1.01	0.24879	N	0.992236	B;B	0.06786	0.001;0.001	B;B	0.11329	0.004;0.006	T	0.41698	-0.9494	10	0.25751	T	0.34	-0.6313	0.5061	0.00588	0.197:0.1755:0.2906:0.3369	.	784;791	Q9GZR1-2;Q9GZR1	.;SENP6_HUMAN	T	784;791;791	ENSP00000359027:A784T;ENSP00000359031:A791T;ENSP00000402527:A791T	ENSP00000359027:A784T	A	+	1	0	SENP6	76469163	0.954000	0.32549	0.998000	0.56505	0.939000	0.58152	0.671000	0.25172	1.214000	0.43395	0.579000	0.79373	GCT	.		0.383	SENP6-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041272.2	NM_015571	
SHPRH	257218	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	146234630	146234630	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr6:146234630C>G	ENST00000367505.2	-	24	4574	c.4310G>C	c.(4309-4311)cGa>cCa	p.R1437P	SHPRH_ENST00000367503.3_Missense_Mutation_p.R1441P|SHPRH_ENST00000275233.7_Missense_Mutation_p.R1437P|SHPRH_ENST00000438092.2_Missense_Mutation_p.R1441P			Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase, E3 ubiquitin protein ligase	1437					DNA repair (GO:0006281)|nucleosome assembly (GO:0006334)|protein polyubiquitination (GO:0000209)	nucleosome (GO:0000786)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(33)|ovary(3)|pancreas(2)|prostate(7)|skin(1)|urinary_tract(1)	79		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)		TCCTAGCTGTCGAGCACAGAT	0.308																																					p.R1441P		.											.	SHPRH-92	0			c.G4322C						.						123.0	123.0	123.0					6																	146234630		1803	4069	5872	SO:0001583	missense	257218	exon24			AGCTGTCGAGCAC	AB095943	CCDS43513.1, CCDS47496.1, CCDS43513.2	6q24.2	2012-02-23	2012-02-23		ENSG00000146414	ENSG00000146414		"""RING-type (C3HC4) zinc fingers"""	19336	protein-coding gene	gene with protein product		608048	"""SNF2 histone linker PHD RING helicase"""			12837266	Standard	NM_001042683		Approved	FLJ90837, KIAA2023, bA545I5.2	uc003qlf.3	Q149N8	OTTHUMG00000015750	ENST00000367505.2:c.4310G>C	6.37:g.146234630C>G	ENSP00000356475:p.Arg1437Pro	Somatic	80	0		WXS	Illumina HiSeq	Phase_I	95	18	NM_173082	0	0	0	0	0	Q149N9|Q5VV79|Q68DS5|Q7Z5J5|Q8IVE8|Q8IWQ9|Q8N1S8|Q8NBR7	Missense_Mutation	SNP	ENST00000367505.2	37	CCDS43513.2	.	.	.	.	.	.	.	.	.	.	C	23.4	4.415831	0.83449	.	.	ENSG00000146414	ENST00000367505;ENST00000367503;ENST00000438092;ENST00000275233	D;D;D;D	0.84730	-1.89;-1.89;-1.89;-1.89	5.52	4.65	0.58169	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);	0.088147	0.47455	D	0.000232	D	0.88514	0.6457	M	0.61703	1.905	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.89205	0.3560	10	0.51188	T	0.08	-9.0526	14.3892	0.66965	0.0:0.9287:0.0:0.0713	.	1437;1441	Q149N8;Q149N8-4	SHPRH_HUMAN;.	P	1437;1441;1441;1437	ENSP00000356475:R1437P;ENSP00000356473:R1441P;ENSP00000412797:R1441P;ENSP00000275233:R1437P	ENSP00000275233:R1437P	R	-	2	0	SHPRH	146276323	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	4.749000	0.62155	1.469000	0.48083	0.591000	0.81541	CGA	.		0.308	SHPRH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042571.2	NM_173082	
LPA	4018	broad.mit.edu;bcgsc.ca	37	6	161027563	161027563	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr6:161027563C>T	ENST00000316300.5	-	17	2775	c.2731G>A	c.(2731-2733)Gtc>Atc	p.V911I	LPA_ENST00000447678.1_Missense_Mutation_p.V911I			P08519	APOA_HUMAN	lipoprotein, Lp(a)	3419	Kringle 8. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	GGAGGCGCGACGGCAGTCCCT	0.547																																					p.V911I													.	LPA-74	0			c.G2731A						.						105.0	110.0	108.0					6																	161027563		2068	4257	6325	SO:0001583	missense	4018	exon18			GCGCGACGGCAGT	X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.2731G>A	6.37:g.161027563C>T	ENSP00000321334:p.Val911Ile	Somatic	207	0		WXS	Illumina HiSeq	Phase_I	194	8	NM_005577	0	0	0	0	0	Q5VTD7|Q9UD88	Missense_Mutation	SNP	ENST00000316300.5	37	CCDS43523.1	.	.	.	.	.	.	.	.	.	.	c	11.74	1.727367	0.30593	.	.	ENSG00000198670	ENST00000316300;ENST00000447678	T;T	0.62232	0.04;0.04	2.18	-2.62	0.06152	Kringle (1);Kringle-like fold (1);	.	.	.	.	T	0.21267	0.0512	L	0.38838	1.175	0.09310	N	1	P	0.50943	0.94	P	0.48089	0.566	T	0.26985	-1.0087	9	0.02654	T	1	.	0.3677	0.00374	0.2413:0.3112:0.2389:0.2086	.	3419	P08519	APOA_HUMAN	I	911	ENSP00000321334:V911I;ENSP00000395608:V911I	ENSP00000321334:V911I	V	-	1	0	LPA	160947553	0.000000	0.05858	0.000000	0.03702	0.108000	0.19459	-2.331000	0.01110	-0.260000	0.09418	0.184000	0.17185	GTC	.		0.547	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042957.1	NM_005577	
FAM188B	84182	hgsc.bcm.edu	37	7	30893077	30893077	+	Splice_Site	SNP	T	T	C			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr7:30893077T>C	ENST00000265299.6	+	12	1754		c.e12+2		AQP1_ENST00000509504.1_Splice_Site|AQP1_ENST00000434909.2_Splice_Site|INMT-FAM188B_ENST00000458257.1_Splice_Site	NM_032222.2	NP_115598.2	Q4G0A6	F188B_HUMAN	family with sequence similarity 188, member B											endometrium(1)|large_intestine(5)|lung(19)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						ATTCATCAGGTATGAAGCATG	0.483																																					.		.											.	FAM188B-90	0			c.1677+2T>C						.						107.0	105.0	106.0					7																	30893077		2030	4197	6227	SO:0001630	splice_region_variant	84182	exon12			ATCAGGTATGAAG	AK026027	CCDS43565.1	7p14.3	2010-08-17	2009-07-14	2009-07-14	ENSG00000106125	ENSG00000106125			21916	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 67"""	C7orf67			Standard	NM_032222		Approved	FLJ22374	uc003tbt.3	Q4G0A6	OTTHUMG00000152800	ENST00000265299.6:c.1677+2T>C	7.37:g.30893077T>C		Somatic	30	0		WXS	Illumina HiSeq	Phase_I	24	2	NM_032222	0	0	0	0	0	Q71AZ7|Q9H6D2	Splice_Site	SNP	ENST00000265299.6	37	CCDS43565.1	.	.	.	.	.	.	.	.	.	.	T	11.27	1.589907	0.28357	.	.	ENSG00000106125;ENSG00000250424	ENST00000265299;ENST00000509504	.	.	.	4.78	4.78	0.61160	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.8923	0.47002	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	RP5-877J2.1;FAM188B	30859602	1.000000	0.71417	0.993000	0.49108	0.349000	0.29174	4.176000	0.58269	2.148000	0.66965	0.459000	0.35465	.	.		0.483	FAM188B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327962.1	NM_032222	Intron
KIAA0895	23366	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	36396613	36396613	+	Silent	SNP	G	G	A			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr7:36396613G>A	ENST00000297063.6	-	3	815	c.765C>T	c.(763-765)ttC>ttT	p.F255F	KIAA0895_ENST00000338533.5_Silent_p.F242F|KIAA0895_ENST00000317020.6_Silent_p.F204F|KIAA0895_ENST00000415803.2_Silent_p.F242F|KIAA0895_ENST00000436884.1_Silent_p.F104F|KIAA0895_ENST00000453212.1_Intron|KIAA0895_ENST00000480192.1_Intron|KIAA0895_ENST00000440378.1_Silent_p.F204F	NM_001100425.1	NP_001093895.1	Q8NCT3	K0895_HUMAN	KIAA0895	255										breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	26						AGTCAGATTTGAAGAATCTCA	0.393																																					p.F255F		.											.	KIAA0895-90	0			c.C765T						.						103.0	95.0	97.0					7																	36396613		1840	4095	5935	SO:0001819	synonymous_variant	23366	exon3			AGATTTGAAGAAT	BC028678	CCDS43570.1, CCDS47573.1, CCDS56482.1, CCDS56483.1, CCDS56484.1, CCDS75583.1	7p14.2	2008-11-27			ENSG00000164542	ENSG00000164542			22206	protein-coding gene	gene with protein product							Standard	NM_015314		Approved		uc003tfd.2	Q8NCT3	OTTHUMG00000154939	ENST00000297063.6:c.765C>T	7.37:g.36396613G>A		Somatic	85	0		WXS	Illumina HiSeq	Phase_I	79	11	NM_001100425	0	0	2	2	0	B4DF35|B7ZLT4|B9EGB9|O94969|Q0VGC1|Q7Z4L2	Silent	SNP	ENST00000297063.6	37	CCDS43570.1																																																																																			.		0.393	KIAA0895-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000337717.1	NM_015314	
VPS41	27072	broad.mit.edu;bcgsc.ca	37	7	38783049	38783049	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr7:38783049T>A	ENST00000310301.4	-	24	2129	c.2075A>T	c.(2074-2076)gAt>gTt	p.D692V	VPS41_ENST00000395969.2_Missense_Mutation_p.D667V	NM_014396.3	NP_055211.2	P49754	VPS41_HUMAN	vacuolar protein sorting 41 homolog (S. cerevisiae)	692					Golgi vesicle transport (GO:0048193)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	cytosol (GO:0005829)|early endosome (GO:0005769)|Golgi-associated vesicle (GO:0005798)|HOPS complex (GO:0030897)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(5)|lung(17)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	44						CAGCTCTCCATCATCTTGCTC	0.398																																					p.D692V													.	VPS41-93	0			c.A2075T						.						156.0	144.0	148.0					7																	38783049		2203	4300	6503	SO:0001583	missense	27072	exon24			TCTCCATCATCTT	U87309	CCDS5457.1, CCDS5458.2	7p14.1-p13	2009-05-08	2006-12-19		ENSG00000006715	ENSG00000006715			12713	protein-coding gene	gene with protein product		605485	"""vacuolar protein sorting 41 (yeast homolog)"", ""vacuolar protein sorting 41 (yeast)"""			9159129	Standard	NM_080631		Approved	HVSP41	uc003tgy.3	P49754	OTTHUMG00000023629	ENST00000310301.4:c.2075A>T	7.37:g.38783049T>A	ENSP00000309457:p.Asp692Val	Somatic	113	0		WXS	Illumina HiSeq	Phase_I	105	6	NM_014396	0	0	40	45	5	E9PF36|Q86TP8|Q99851|Q99852	Missense_Mutation	SNP	ENST00000310301.4	37	CCDS5457.1	.	.	.	.	.	.	.	.	.	.	T	25.5	4.644627	0.87859	.	.	ENSG00000006715	ENST00000310301;ENST00000395969;ENST00000439468	T;T;T	0.24151	1.87;1.87;1.87	5.74	5.74	0.90152	Tetratricopeptide-like helical (1);	0.085770	0.85682	D	0.000000	T	0.59280	0.2182	M	0.91300	3.195	0.80722	D	1	D;D;D	0.61080	0.989;0.989;0.989	D;D;D	0.65573	0.936;0.936;0.936	T	0.69312	-0.5178	10	0.87932	D	0	-31.1895	16.3533	0.83225	0.0:0.0:0.0:1.0	.	692;667;692	B2RB94;E9PF36;P49754	.;.;VPS41_HUMAN	V	692;667;33	ENSP00000309457:D692V;ENSP00000379297:D667V;ENSP00000395410:D33V	ENSP00000309457:D692V	D	-	2	0	VPS41	38749574	1.000000	0.71417	0.962000	0.40283	0.959000	0.62525	8.040000	0.89188	2.330000	0.79161	0.528000	0.53228	GAT	.		0.398	VPS41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226986.3		
URGCP	55665	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	43918082	43918082	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr7:43918082A>C	ENST00000453200.1	-	6	1473	c.980T>G	c.(979-981)aTt>aGt	p.I327S	URGCP-MRPS24_ENST00000603700.1_Intron|URGCP_ENST00000223341.7_Missense_Mutation_p.I284S|URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000402306.3_Missense_Mutation_p.I318S|URGCP_ENST00000447717.3_Missense_Mutation_p.I284S|URGCP_ENST00000443736.1_Missense_Mutation_p.I284S|URGCP_ENST00000336086.6_Missense_Mutation_p.I284S			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	327					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						TTCTGGGAAAATGTCCAAGTC	0.512																																					p.I327S		.											.	URGCP-94	0			c.T980G						.						69.0	70.0	70.0					7																	43918082		1897	4129	6026	SO:0001583	missense	55665	exon6			GGGAAAATGTCCA		CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.980T>G	7.37:g.43918082A>C	ENSP00000396918:p.Ile327Ser	Somatic	76	0		WXS	Illumina HiSeq	Phase_I	109	24	NM_001077663	0	0	9	18	9	E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Missense_Mutation	SNP	ENST00000453200.1	37	CCDS47578.1	.	.	.	.	.	.	.	.	.	.	A	11.05	1.526247	0.27299	.	.	ENSG00000106608	ENST00000223341;ENST00000336086;ENST00000402306;ENST00000443736;ENST00000453200;ENST00000447717	T;T;T;T;T;T	0.09630	2.96;2.96;2.96;2.96;2.96;2.96	5.66	5.66	0.87406	.	0.567596	0.17461	N	0.173449	T	0.10981	0.0268	L	0.47716	1.5	0.09310	N	1	B;B	0.30973	0.302;0.302	B;B	0.29942	0.109;0.109	T	0.20207	-1.0282	10	0.49607	T	0.09	-6.1339	8.3974	0.32566	0.913:0.0:0.087:0.0	.	318;327	Q8TCY9-2;Q8TCY9	.;URGCP_HUMAN	S	284;284;318;284;327;284	ENSP00000223341:I284S;ENSP00000336872:I284S;ENSP00000384955:I318S;ENSP00000392136:I284S;ENSP00000396918:I327S;ENSP00000402803:I284S	ENSP00000223341:I284S	I	-	2	0	URGCP	43884607	0.050000	0.20438	0.044000	0.18714	0.845000	0.48019	3.327000	0.52045	2.158000	0.67659	0.482000	0.46254	ATT	.		0.512	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338995.1	NM_001077664	
ABCA13	154664	broad.mit.edu	37	7	48315672	48315672	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr7:48315672G>A	ENST00000435803.1	+	17	6433	c.6409G>A	c.(6409-6411)Gat>Aat	p.D2137N		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	2137					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TGCAAATGAGGATTACTCCAG	0.358																																					p.D2137N													.	ABCA13-521	0			c.G6409A						.						37.0	33.0	34.0					7																	48315672		1821	4077	5898	SO:0001583	missense	154664	exon17			AATGAGGATTACT	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.6409G>A	7.37:g.48315672G>A	ENSP00000411096:p.Asp2137Asn	Somatic	18	0		WXS	Illumina HiSeq	Phase_I	19	3	NM_152701	0	0	0	0	0	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	37	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	G	9.310	1.055426	0.19907	.	.	ENSG00000179869	ENST00000435803	T	0.16073	2.37	4.99	4.02	0.46733	.	0.540328	0.16662	N	0.204754	T	0.11836	0.0288	L	0.39633	1.23	0.22779	N	0.998743	B	0.14012	0.009	B	0.12837	0.008	T	0.25745	-1.0123	9	.	.	.	.	3.275	0.06896	0.4059:0.0:0.5941:0.0	.	2137	Q86UQ4	ABCAD_HUMAN	N	2137	ENSP00000411096:D2137N	.	D	+	1	0	ABCA13	48286218	0.424000	0.25490	0.002000	0.10522	0.442000	0.32017	2.187000	0.42602	1.133000	0.42147	0.484000	0.47621	GAT	.		0.358	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
LIMK1	3984	bcgsc.ca	37	7	73535525	73535525	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr7:73535525G>A	ENST00000336180.2	+	16	1889	c.1838G>A	c.(1837-1839)gGc>gAc	p.G613D	LIMK1_ENST00000538333.3_Missense_Mutation_p.G579D|LIMK1_ENST00000418310.1_Missense_Mutation_p.G643D	NM_002314.3	NP_002305.1	P53667	LIMK1_HUMAN	LIM domain kinase 1	613					actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|nervous system development (GO:0007399)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of axon extension (GO:0045773)|positive regulation of stress fiber assembly (GO:0051496)|protein phosphorylation (GO:0006468)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)	ATP binding (GO:0005524)|heat shock protein binding (GO:0031072)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	21		Lung NSC(55;0.137)			Dabrafenib(DB08912)	CACCTGGCCGGCCACCTGCCA	0.682																																					p.G613D													.	LIMK1-523	0			c.G1838A						.						35.0	35.0	35.0					7																	73535525		2203	4300	6503	SO:0001583	missense	3984	exon16			TGGCCGGCCACCT	D26309	CCDS5563.1, CCDS56491.1	7q11.23	2005-01-21			ENSG00000106683	ENSG00000106683			6613	protein-coding gene	gene with protein product		601329				8673124, 8812460	Standard	NM_002314		Approved	LIMK	uc003uaa.2	P53667	OTTHUMG00000023448	ENST00000336180.2:c.1838G>A	7.37:g.73535525G>A	ENSP00000336740:p.Gly613Asp	Somatic	71	0		WXS	Illumina HiSeq	Phase_1	67	6	NM_002314	1	0	22	23	0	B7Z6I8|D3DXF4|D3DXF5|O15283|Q15820|Q15821|Q75MU3|Q9Y5Q1	Missense_Mutation	SNP	ENST00000336180.2	37	CCDS5563.1	.	.	.	.	.	.	.	.	.	.	G	9.624	1.134668	0.21123	.	.	ENSG00000106683	ENST00000418310;ENST00000419043;ENST00000336180;ENST00000538333	T;T;T	0.61742	0.08;0.08;0.08	4.3	3.26	0.37387	Protein kinase-like domain (1);	0.454681	0.24124	N	0.041339	T	0.30823	0.0777	N	0.08118	0	0.39433	D	0.96711	B;B	0.19445	0.002;0.036	B;B	0.18871	0.014;0.023	T	0.14559	-1.0468	10	0.12103	T	0.63	-22.7694	8.7333	0.34512	0.0:0.0:0.6149:0.3851	.	579;613	B7Z6I8;P53667	.;LIMK1_HUMAN	D	643;613;613;579	ENSP00000409717:G643D;ENSP00000336740:G613D;ENSP00000444452:G579D	ENSP00000336740:G613D	G	+	2	0	LIMK1	73173461	1.000000	0.71417	0.996000	0.52242	0.909000	0.53808	3.499000	0.53310	2.157000	0.67596	0.456000	0.33151	GGC	.		0.682	LIMK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252335.2	NM_002314	
RELN	5649	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	103629656	103629656	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr7:103629656C>T	ENST00000428762.1	-	1	307	c.148G>A	c.(148-150)Ggg>Agg	p.G50R	RELN_ENST00000424685.2_Missense_Mutation_p.G50R|RELN_ENST00000343529.5_Missense_Mutation_p.G50R	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	50	Reelin. {ECO:0000255|PROSITE- ProRule:PRU00363}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		CCCTGCTCCCCATCCCCTTCC	0.642																																					p.G50R	NSCLC(146;835 1944 15585 22231 52158)	.											.	RELN-574	0			c.G148A						.						52.0	53.0	53.0					7																	103629656		2203	4300	6503	SO:0001583	missense	5649	exon1			GCTCCCCATCCCC		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.148G>A	7.37:g.103629656C>T	ENSP00000392423:p.Gly50Arg	Somatic	90	0		WXS	Illumina HiSeq	Phase_I	112	20	NM_173054	0	0	0	0	0	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	ENST00000428762.1	37	CCDS47680.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.301758	0.81136	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.21361	2.01;2.01;2.01	4.63	4.63	0.57726	Reeler domain (1);	0.000000	0.64402	U	0.000010	T	0.32645	0.0836	N	0.19112	0.55	0.58432	D	0.999997	D;D	0.89917	0.999;1.0	D;D	0.75484	0.976;0.986	T	0.19095	-1.0316	10	0.52906	T	0.07	.	17.6802	0.88240	0.0:1.0:0.0:0.0	.	50;50	P78509-2;P78509	.;RELN_HUMAN	R	50	ENSP00000392423:G50R;ENSP00000345694:G50R;ENSP00000388446:G50R	ENSP00000345694:G50R	G	-	1	0	RELN	103416892	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.718000	0.74713	2.386000	0.81285	0.563000	0.77884	GGG	.		0.642	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045	
CNOT4	4850	hgsc.bcm.edu;bcgsc.ca	37	7	135080545	135080545	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr7:135080545A>G	ENST00000315544.5	-	9	1249	c.970T>C	c.(970-972)Tcc>Ccc	p.S324P	CNOT4_ENST00000428680.2_Missense_Mutation_p.S321P|CNOT4_ENST00000356162.4_Missense_Mutation_p.S324P|CNOT4_ENST00000361528.4_Missense_Mutation_p.S321P|CNOT4_ENST00000541284.1_Missense_Mutation_p.S324P|CNOT4_ENST00000414802.1_Missense_Mutation_p.S324P|CNOT4_ENST00000451834.1_Missense_Mutation_p.S321P|CNOT4_ENST00000423368.2_Missense_Mutation_p.S324P	NM_001190848.1	NP_001177777.1	O95628	CNOT4_HUMAN	CCR4-NOT transcription complex, subunit 4	324					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|protein autoubiquitination (GO:0051865)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(1)	22						TCAAAAGGGGACCGTGCACTG	0.478																																					p.S324P	Ovarian(51;766 1130 5502 35047 50875)	.											.	CNOT4-90	0			c.T970C						.						165.0	162.0	163.0					7																	135080545		1957	4148	6105	SO:0001583	missense	4850	exon9			AAGGGGACCGTGC	AF180475	CCDS43650.1, CCDS47719.1, CCDS55164.1, CCDS55165.1, CCDS55166.1, CCDS55167.1	7q33	2013-09-19			ENSG00000080802	ENSG00000080802		"""RNA binding motif (RRM) containing"""	7880	protein-coding gene	gene with protein product		604911		NOT4		10637334	Standard	NM_013316		Approved	CLONE243, NOT4H	uc011kpy.2	O95628	OTTHUMG00000155568	ENST00000315544.5:c.970T>C	7.37:g.135080545A>G	ENSP00000326731:p.Ser324Pro	Somatic	57	1		WXS	Illumina HiSeq	Phase_I	58	4	NM_001190850	0	0	27	27	0	B7Z6I4|E7ET38|F8VQP3|O95339|O95627|Q8IYM7|Q8NCL0|Q9NPQ1|Q9NZN6	Missense_Mutation	SNP	ENST00000315544.5	37	CCDS55166.1	.	.	.	.	.	.	.	.	.	.	A	19.05	3.751375	0.69533	.	.	ENSG00000080802	ENST00000541284;ENST00000451834;ENST00000423368;ENST00000262563;ENST00000361528;ENST00000414802;ENST00000356162;ENST00000428680;ENST00000315544	T;T;T;T;T;T;T;T	0.62788	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.68915	0.3053	L	0.29908	0.895	0.80722	D	1	B;B;D;B;D;B	0.61080	0.024;0.089;0.989;0.022;0.981;0.009	B;B;P;B;D;B	0.68621	0.01;0.023;0.734;0.013;0.959;0.014	T	0.69331	-0.5173	10	0.44086	T	0.13	-13.0859	15.5751	0.76373	1.0:0.0:0.0:0.0	.	321;324;324;321;324;321	E7ET38;F8VQP3;O95628;O95628-2;O95628-4;O95628-8	.;.;CNOT4_HUMAN;.;.;.	P	324;321;324;324;321;324;324;321;324	ENSP00000445508:S324P;ENSP00000388491:S321P;ENSP00000406777:S324P;ENSP00000354673:S321P;ENSP00000416532:S324P;ENSP00000348485:S324P;ENSP00000399108:S321P;ENSP00000326731:S324P	ENSP00000262563:S324P	S	-	1	0	CNOT4	134731085	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.940000	0.92958	2.276000	0.75962	0.455000	0.32223	TCC	.		0.478	CNOT4-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_013316	
KIAA1549	57670	broad.mit.edu;ucsc.edu	37	7	138602635	138602635	+	Silent	SNP	C	C	T	rs570277151		TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr7:138602635C>T	ENST00000422774.1	-	2	1785	c.1737G>A	c.(1735-1737)ccG>ccA	p.P579P	KIAA1549_ENST00000242365.4_Silent_p.P529P|KIAA1549_ENST00000440172.1_Silent_p.P579P			Q9HCM3	K1549_HUMAN	KIAA1549	579	Ser-rich.					integral component of membrane (GO:0016021)			KIAA1549/BRAF(703)	large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(2)	7						CGGCAAGCGACGGTGTGTTTT	0.478			O	BRAF	pilocytic astrocytoma								C|||	1	0.000199681	0.0	0.0	5008	,	,		21163	0.001		0.0	False		,,,				2504	0.0				p.P579P	NSCLC(119;1534 1718 44213 46230 50068)			Dom	yes		7	7q34	57670	KIAA1549		O	.	KIAA1549-369	0			c.G1737A						.						65.0	67.0	66.0					7																	138602635		2005	4172	6177	SO:0001819	synonymous_variant	57670	exon2			AAGCGACGGTGTG		CCDS47723.1, CCDS47723.2, CCDS56513.1	7q34	2009-10-09			ENSG00000122778	ENSG00000122778			22219	protein-coding gene	gene with protein product		613344					Standard	NM_020910		Approved		uc011kql.2	Q9HCM3	OTTHUMG00000157214	ENST00000422774.1:c.1737G>A	7.37:g.138602635C>T		Somatic	11	0		WXS	Illumina HiSeq	Phase_I	17	4	NM_020910	0	0	12	15	3	B6HY55|B6HY56|B6HY58|B6HY60|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q5BJD6|Q8IY15|Q9H0M3	Silent	SNP	ENST00000422774.1	37	CCDS56513.1																																																																																			.		0.478	KIAA1549-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348092.1		
CHD7	55636	hgsc.bcm.edu	37	8	61761115	61761115	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr8:61761115A>C	ENST00000423902.2	+	24	5731	c.5252A>C	c.(5251-5253)gAa>gCa	p.E1751A	CHD7_ENST00000524602.1_Intron	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	1751					adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			CTAAGACAAGAAGTGATAGGA	0.493																																					p.E1751A		.											.	CHD7-141	0			c.A5252C						.						122.0	118.0	119.0					8																	61761115		1976	4186	6162	SO:0001583	missense	55636	exon24			GACAAGAAGTGAT	AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.5252A>C	8.37:g.61761115A>C	ENSP00000392028:p.Glu1751Ala	Somatic	40	0		WXS	Illumina HiSeq	Phase_I	37	2	NM_017780	0	0	5	5	0	D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Missense_Mutation	SNP	ENST00000423902.2	37	CCDS47865.1	.	.	.	.	.	.	.	.	.	.	A	17.29	3.353000	0.61293	.	.	ENSG00000171316	ENST00000307121;ENST00000423902	D	0.91180	-2.8	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	D	0.92694	0.7678	M	0.88241	2.94	0.80722	D	1	B	0.33826	0.427	B	0.37780	0.258	D	0.93440	0.6793	10	0.87932	D	0	-19.9182	15.2072	0.73190	1.0:0.0:0.0:0.0	.	1751	Q9P2D1	CHD7_HUMAN	A	1751	ENSP00000392028:E1751A	ENSP00000307304:E1751A	E	+	2	0	CHD7	61923669	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.339000	0.96797	2.059000	0.61396	0.528000	0.53228	GAA	.		0.493	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383468.2	XM_098762	
TRPA1	8989	hgsc.bcm.edu	37	8	72950286	72950286	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr8:72950286A>C	ENST00000262209.4	-	20	2524	c.2317T>G	c.(2317-2319)Tgt>Ggt	p.C773G	RP11-383H13.1_ENST00000524152.1_Intron|RP11-383H13.1_ENST00000537896.1_Intron|TRPA1_ENST00000519720.1_5'UTR|RP11-383H13.1_ENST00000457356.4_Intron	NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	773					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	AAAATCATACAAGTTTTTATT	0.264																																					p.C773G		.											.	TRPA1-230	0			c.T2317G						.						22.0	23.0	23.0					8																	72950286		2188	4261	6449	SO:0001583	missense	8989	exon20			TCATACAAGTTTT	Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.2317T>G	8.37:g.72950286A>C	ENSP00000262209:p.Cys773Gly	Somatic	13	0		WXS	Illumina HiSeq	Phase_I	26	2	NM_007332	0	0	0	0	0	A6NIN6	Missense_Mutation	SNP	ENST00000262209.4	37	CCDS34908.1	.	.	.	.	.	.	.	.	.	.	A	18.73	3.686665	0.68157	.	.	ENSG00000104321	ENST00000523582;ENST00000262209	T;T	0.79940	-1.32;-1.32	5.58	5.58	0.84498	.	0.042497	0.85682	D	0.000000	D	0.88187	0.6369	M	0.84433	2.695	0.58432	D	0.999993	D	0.55605	0.972	P	0.54590	0.756	D	0.90030	0.4134	10	0.66056	D	0.02	-16.7662	15.4216	0.75015	1.0:0.0:0.0:0.0	.	773	O75762	TRPA1_HUMAN	G	625;773	ENSP00000428151:C625G;ENSP00000262209:C773G	ENSP00000262209:C773G	C	-	1	0	TRPA1	73112840	1.000000	0.71417	0.994000	0.49952	0.924000	0.55760	6.764000	0.74960	2.120000	0.65058	0.533000	0.62120	TGT	.		0.264	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379079.2	NM_007332	
HAS2	3037	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	122641473	122641473	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr8:122641473A>T	ENST00000303924.4	-	2	645	c.108T>A	c.(106-108)ttT>ttA	p.F36L		NM_005328.2	NP_005319.1	Q92819	HYAS2_HUMAN	hyaluronan synthase 2	36					atrioventricular canal development (GO:0036302)|bone morphogenesis (GO:0060349)|cellular response to fluid shear stress (GO:0071498)|cellular response to interleukin-1 (GO:0071347)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|cellular response to tumor necrosis factor (GO:0071356)|endocardial cushion to mesenchymal transition (GO:0090500)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|hyaluronan biosynthetic process (GO:0030213)|kidney development (GO:0001822)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of monocyte aggregation (GO:1900625)|positive regulation of urine volume (GO:0035810)|renal water absorption (GO:0070295)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	hyaluronan synthase activity (GO:0050501)		HAS2/PLAG1(10)	breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(19)|ovary(5)|skin(1)	38	Lung NSC(37;3.12e-08)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)|all_neural(195;0.142)		STAD - Stomach adenocarcinoma(47;0.00503)			CCGTTTGGATAAACTGGTAGC	0.423																																					p.F36L		.											.	HAS2-236	0			c.T108A						.						88.0	85.0	86.0					8																	122641473		2203	4300	6503	SO:0001583	missense	3037	exon2			TTGGATAAACTGG	U54804	CCDS6335.1	8q24.12	2013-02-22			ENSG00000170961	ENSG00000170961	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4819	protein-coding gene	gene with protein product		601636				9169154	Standard	NM_005328		Approved		uc003yph.2	Q92819	OTTHUMG00000164953	ENST00000303924.4:c.108T>A	8.37:g.122641473A>T	ENSP00000306991:p.Phe36Leu	Somatic	95	0		WXS	Illumina HiSeq	Phase_I	90	16	NM_005328	0	0	1	1	0	Q32MM3	Missense_Mutation	SNP	ENST00000303924.4	37	CCDS6335.1	.	.	.	.	.	.	.	.	.	.	A	8.872	0.949410	0.18356	.	.	ENSG00000170961	ENST00000303924;ENST00000443194	T	0.37584	1.19	6.17	3.85	0.44370	.	0.042814	0.85682	D	0.000000	T	0.22166	0.0534	L	0.28192	0.835	0.53688	D	0.999978	B	0.09022	0.002	B	0.06405	0.002	T	0.05178	-1.0901	10	0.12430	T	0.62	-24.2374	9.8975	0.41327	0.809:0.0:0.191:0.0	.	36	Q92819	HAS2_HUMAN	L	36	ENSP00000306991:F36L	ENSP00000306991:F36L	F	-	3	2	HAS2	122710654	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	1.132000	0.31418	1.161000	0.42604	-0.250000	0.11733	TTT	.		0.423	HAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381150.2	NM_005328	
ZBTB43	23099	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	129595385	129595385	+	Silent	SNP	G	G	T	rs34266321		TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr9:129595385G>T	ENST00000373464.4	+	3	861	c.597G>T	c.(595-597)tcG>tcT	p.S199S	ZBTB43_ENST00000449886.1_Silent_p.S199S|ZBTB43_ENST00000373457.1_Silent_p.S199S	NM_014007.3	NP_054726.1	O43298	ZBT43_HUMAN	zinc finger and BTB domain containing 43	199					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14						CCAGCAACTCGTCCACAGAGC	0.587																																					p.S199S													.	ZBTB43-91	0			c.G597T						.						40.0	41.0	41.0					9																	129595385		2203	4300	6503	SO:0001819	synonymous_variant	23099	exon2			CAACTCGTCCACA	AF049907	CCDS6867.1	9q33.3	2013-01-09	2006-04-12	2006-04-12	ENSG00000169155	ENSG00000169155		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	17908	protein-coding gene	gene with protein product			"""zinc finger protein 297B"""	ZNF297B			Standard	NM_014007		Approved	KIAA0414, ZNF-X, FLJ22470, ZBTB22B	uc010mxf.3	O43298	OTTHUMG00000020693	ENST00000373464.4:c.597G>T	9.37:g.129595385G>T		Somatic	38	0		WXS	Illumina HiSeq	Phase_I	59	6	NM_001135776	0	0	3	8	5	Q5JU96	Silent	SNP	ENST00000373464.4	37	CCDS6867.1																																																																																			G|0.999;A|0.001		0.587	ZBTB43-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054124.1	NM_001135776	
COL5A1	1289	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	137734002	137734002	+	Splice_Site	SNP	G	G	C			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr9:137734002G>C	ENST00000371817.3	+	66	5784		c.e66-1			NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1						axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		CTCTTCCCCAGACCAAGAAAG	0.547																																					.		.											.	COL5A1-524	0			c.5371-1G>C						.						89.0	81.0	83.0					9																	137734002		2203	4300	6503	SO:0001630	splice_region_variant	1289	exon66			TCCCCAGACCAAG	D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.5371-1G>C	9.37:g.137734002G>C		Somatic	82	0		WXS	Illumina HiSeq	Phase_I	100	12	NM_000093	0	0	0	0	0	Q15094|Q5SUX4	Splice_Site	SNP	ENST00000371817.3	37	CCDS6982.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.985830	0.74589	.	.	ENSG00000130635	ENST00000371817;ENST00000355306	.	.	.	4.42	4.42	0.53409	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.3629	0.87356	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	COL5A1	136873823	1.000000	0.71417	0.075000	0.20258	0.907000	0.53573	9.541000	0.98083	2.174000	0.68829	0.563000	0.77884	.	.		0.547	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054954.2	NM_000093	Intron
MAGEB4	4115	hgsc.bcm.edu	37	X	30260477	30260477	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chrX:30260477G>C	ENST00000378982.2	+	1	421	c.225G>C	c.(223-225)atG>atC	p.M75I	MAGEB1_ENST00000397550.1_5'Flank|MAGEB1_ENST00000378981.3_5'Flank	NM_002367.3	NP_002358.1	O15481	MAGB4_HUMAN	melanoma antigen family B, 4	75										breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	27						CTGCAGCTATGTCATGCACTG	0.527																																					p.M75I		.											.	MAGEB4-131	0			c.G225C						.						55.0	47.0	50.0					X																	30260477		2202	4300	6502	SO:0001583	missense	4115	exon1			AGCTATGTCATGC		CCDS14221.1	Xp21.3	2009-03-17			ENSG00000120289	ENSG00000120289			6811	protein-coding gene	gene with protein product	"""melanoma-associated antigen B4"", ""cancer/testis antigen family 3, member 6"""	300153				9441743	Standard	NM_002367		Approved	MGC33144, CT3.6	uc004dcb.3	O15481	OTTHUMG00000021321	ENST00000378982.2:c.225G>C	X.37:g.30260477G>C	ENSP00000368266:p.Met75Ile	Somatic	25	0		WXS	Illumina HiSeq	Phase_I	21	2	NM_002367	0	0	0	0	0	B2R9G0|Q6FHH4|Q8IZ00	Missense_Mutation	SNP	ENST00000378982.2	37	CCDS14221.1	.	.	.	.	.	.	.	.	.	.	G	6.088	0.384441	0.11524	.	.	ENSG00000120289	ENST00000378982	T	0.03580	3.88	3.13	0.709	0.18150	Melanoma associated antigen, MAGE, N-terminal (1);	.	.	.	.	T	0.02455	0.0075	N	0.19112	0.55	0.09310	N	1	B	0.16802	0.019	B	0.20577	0.03	T	0.46665	-0.9175	9	0.36615	T	0.2	.	3.0253	0.06088	0.0:0.1527:0.2745:0.5729	.	75	O15481	MAGB4_HUMAN	I	75	ENSP00000368266:M75I	ENSP00000368266:M75I	M	+	3	0	MAGEB4	30170398	0.000000	0.05858	0.003000	0.11579	0.001000	0.01503	-0.052000	0.11865	0.045000	0.15804	-0.490000	0.04691	ATG	.		0.527	MAGEB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056159.1	NM_002367	
DACH2	117154	hgsc.bcm.edu	37	X	86087132	86087132	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chrX:86087132A>G	ENST00000373125.4	+	12	1774	c.1774A>G	c.(1774-1776)Atg>Gtg	p.M592V	DACH2_ENST00000510272.1_Missense_Mutation_p.M373V|DACH2_ENST00000373131.1_3'UTR|DACH2_ENST00000508860.1_Missense_Mutation_p.M425V	NM_053281.3	NP_444511.1	Q96NX9	DACH2_HUMAN	dachshund family transcription factor 2	592					development of primary female sexual characteristics (GO:0046545)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(14)|lung(28)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	71						CTGTTTAGAAATGGCACAACA	0.338																																					p.M592V		.											.	DACH2-136	0			c.A1774G						.						97.0	87.0	90.0					X																	86087132		2203	4300	6503	SO:0001583	missense	117154	exon12			TTAGAAATGGCAC	AF428101	CCDS14455.1, CCDS48140.1, CCDS55457.1	Xq21.3	2014-02-03	2014-02-03		ENSG00000126733	ENSG00000126733			16814	protein-coding gene	gene with protein product		300608	"""dachshund homolog 2 (Drosophila)"""				Standard	NM_053281		Approved		uc004eew.2	Q96NX9	OTTHUMG00000021944	ENST00000373125.4:c.1774A>G	X.37:g.86087132A>G	ENSP00000362217:p.Met592Val	Somatic	26	0		WXS	Illumina HiSeq	Phase_I	33	2	NM_053281	0	0	0	0	0	B1AJV3|B4DQG3|Q8NAY3|Q8ND17|Q96N55	Missense_Mutation	SNP	ENST00000373125.4	37	CCDS14455.1	.	.	.	.	.	.	.	.	.	.	A	9.414	1.081366	0.20309	.	.	ENSG00000126733	ENST00000344497;ENST00000373125;ENST00000508860;ENST00000510272;ENST00000400297	D	0.81996	-1.56	4.52	3.1	0.35709	.	0.202921	0.32952	N	0.005443	T	0.66665	0.2812	N	0.14661	0.345	0.23376	N	0.997808	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.54715	-0.8252	10	0.31617	T	0.26	.	9.0231	0.36213	0.8892:0.0:0.1108:0.0	.	458;592	Q1RMF5;Q96NX9	.;DACH2_HUMAN	V	592;592;425;373;425	ENSP00000362217:M592V	ENSP00000345134:M592V	M	+	1	0	DACH2	85973788	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.642000	0.54367	1.469000	0.48083	0.356000	0.21956	ATG	.		0.338	DACH2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359266.1	NM_053281	
ARHGEF6	9459	broad.mit.edu	37	X	135754263	135754263	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chrX:135754263G>C	ENST00000250617.6	-	20	3256	c.2051C>G	c.(2050-2052)tCc>tGc	p.S684C	ARHGEF6_ENST00000370620.1_Missense_Mutation_p.S530C|ARHGEF6_ENST00000370622.1_Missense_Mutation_p.S530C|ARHGEF6_ENST00000535227.1_Missense_Mutation_p.S557C	NM_004840.2	NP_004831.1	Q15052	ARHG6_HUMAN	Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6	684					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell junction assembly (GO:0034329)|JNK cascade (GO:0007254)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|intracellular (GO:0005622)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(1)|lung(14)|prostate(1)	38	Acute lymphoblastic leukemia(192;0.000127)					TTGTGGAATGGAATCTTTTCG	0.448																																					p.S684C													.	ARHGEF6-227	0			c.C2051G						.						188.0	163.0	172.0					X																	135754263		2203	4300	6503	SO:0001583	missense	9459	exon20			GGAATGGAATCTT	D13631	CCDS14660.1	Xq26	2013-01-10	2002-05-23		ENSG00000129675	ENSG00000129675		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	685	protein-coding gene	gene with protein product	"""Rac/Cdc42 guanine exchange factor (GEF) 6"", ""PAK-interacting exchange factor, alpha"", ""rho guanine nucleotide exchange factor 6"""	300267	"""mental retardation, X-linked 46"""	MRX46		7584048, 9659915	Standard	NM_004840		Approved	alphaPIX, Cool-2, KIAA0006, alpha-PIX, Cool2	uc004fab.3	Q15052	OTTHUMG00000022518	ENST00000250617.6:c.2051C>G	X.37:g.135754263G>C	ENSP00000250617:p.Ser684Cys	Somatic	94	0		WXS	Illumina HiSeq	Phase_I	94	4	NM_004840	0	0	13	13	0	A6NMW9|A8K6S7|B1AL37|Q15396|Q5JQ66|Q7Z3W1|Q86XH0	Missense_Mutation	SNP	ENST00000250617.6	37	CCDS14660.1	.	.	.	.	.	.	.	.	.	.	G	9.961	1.222904	0.22457	.	.	ENSG00000129675	ENST00000250617;ENST00000370620;ENST00000370622;ENST00000535736;ENST00000535227	T;T;T;T	0.55234	0.53;0.64;0.64;0.53	5.84	5.84	0.93424	.	0.047019	0.85682	D	0.000000	T	0.43299	0.1241	N	0.20401	0.57	0.39802	D	0.972583	B;B	0.15719	0.014;0.012	B;B	0.18561	0.022;0.013	T	0.29761	-1.0001	10	0.49607	T	0.09	.	19.1327	0.93414	0.0:0.0:1.0:0.0	.	557;684	B7Z3C7;Q15052	.;ARHG6_HUMAN	C	684;530;530;530;557	ENSP00000250617:S684C;ENSP00000359654:S530C;ENSP00000359656:S530C;ENSP00000439483:S557C	ENSP00000250617:S684C	S	-	2	0	ARHGEF6	135581929	1.000000	0.71417	0.964000	0.40570	0.111000	0.19643	5.043000	0.64208	2.469000	0.83416	0.600000	0.82982	TCC	.		0.448	ARHGEF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058511.2	NM_004840	
FMR1	2332	hgsc.bcm.edu;bcgsc.ca	37	X	147011651	147011651	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chrX:147011651T>A	ENST00000370475.4	+	7	646	c.518T>A	c.(517-519)aTc>aAc	p.I173N	FMR1_ENST00000370470.1_Missense_Mutation_p.I173N|FMR1_ENST00000370471.3_Missense_Mutation_p.I173N|FMR1_ENST00000439526.2_Missense_Mutation_p.I173N|FMR1_ENST00000440235.2_5'Flank|FMR1_ENST00000218200.8_Missense_Mutation_p.I173N|FMR1_ENST00000370477.1_Missense_Mutation_p.I173N|FMR1_ENST00000334557.6_Missense_Mutation_p.I173N	NM_002024.5	NP_002015.1	Q06787	FMR1_HUMAN	fragile X mental retardation 1	173					central nervous system development (GO:0007417)|mRNA transport (GO:0051028)|negative regulation of translational initiation (GO:0045947)	cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|membrane (GO:0016020)|mRNA cap binding complex (GO:0005845)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|synapse (GO:0045202)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(13)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	35	Acute lymphoblastic leukemia(192;6.56e-05)					ATTTAGTCCATCAATGAAGTC	0.353									Fragile X syndrome																												p.I173N		.											.	FMR1-133	0			c.T518A						.						116.0	99.0	105.0					X																	147011651		2203	4300	6503	SO:0001583	missense	2332	exon7	Familial Cancer Database	Martin-Bell syndrome, FRAXA syndrome	AGTCCATCAATGA	X69962	CCDS14682.1, CCDS55518.1, CCDS55519.1, CCDS76039.1	Xq27.3	2014-09-17			ENSG00000102081	ENSG00000102081			3775	protein-coding gene	gene with protein product		309550	"""premature ovarian failure 1"""	POF1, POF		1572655	Standard	NM_002024		Approved	FMRP, FRAXA, MGC87458	uc010nst.3	Q06787	OTTHUMG00000022606	ENST00000370475.4:c.518T>A	X.37:g.147011651T>A	ENSP00000359506:p.Ile173Asn	Somatic	69	0		WXS	Illumina HiSeq	Phase_I	47	4	NM_002024	0	0	0	0	0	A6NNH4|D3DWT0|D3DWT1|D3DWT2|G8JL90|Q16578|Q5PQZ6|Q99054	Missense_Mutation	SNP	ENST00000370475.4	37	CCDS14682.1	.	.	.	.	.	.	.	.	.	.	T	7.528	0.658159	0.14645	.	.	ENSG00000102081	ENST00000218200;ENST00000370471;ENST00000370477;ENST00000370475;ENST00000334557;ENST00000439526;ENST00000370470	T;T;T;T;T;T;T	0.56103	1.25;0.48;1.26;1.26;1.56;1.27;1.28	5.12	5.12	0.69794	.	0.053956	0.85682	D	0.000000	T	0.40119	0.1104	N	0.02011	-0.69	0.80722	D	1	B;P;B;D;D	0.62365	0.0;0.88;0.007;0.991;0.98	B;B;B;P;P	0.59889	0.001;0.296;0.008;0.865;0.805	T	0.45760	-0.9239	10	0.17832	T	0.49	-24.9991	13.3209	0.60432	0.0:0.0:0.0:1.0	.	173;173;89;173;173	Q8IXW7;Q06787;Q59GC1;Q06787-8;G3V0J0	.;FMR1_HUMAN;.;.;.	N	173	ENSP00000218200:I173N;ENSP00000359502:I173N;ENSP00000359508:I173N;ENSP00000359506:I173N;ENSP00000355115:I173N;ENSP00000395923:I173N;ENSP00000359501:I173N	ENSP00000218200:I173N	I	+	2	0	FMR1	146819343	1.000000	0.71417	0.999000	0.59377	0.830000	0.47004	6.149000	0.71795	1.808000	0.52836	0.430000	0.28490	ATC	.		0.353	FMR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058655.1	NM_002024	
PPRC1	23082	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	103898442	103898442	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr10:103898442delA	ENST00000278070.2	+	3	448	c.409delA	c.(409-411)aatfs	p.N137fs	PPRC1_ENST00000413464.2_Frame_Shift_Del_p.N137fs|PPRC1_ENST00000370012.1_5'Flank	NM_015062.3	NP_055877.3	Q5VV67	PPRC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator-related 1	137					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(10)|lung(19)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	56		Colorectal(252;0.122)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		GATCTTGGACAATGCAGATTC	0.532																																					p.N137fs		.											.	PPRC1-227	0			c.409delA						.						120.0	108.0	112.0					10																	103898442		2203	4300	6503	SO:0001589	frameshift_variant	23082	exon3			.	AF325193	CCDS7529.1, CCDS73186.1	10q24.32	2013-02-12	2006-10-17		ENSG00000148840	ENSG00000148840		"""RNA binding motif (RRM) containing"""	30025	protein-coding gene	gene with protein product			"""peroxisome proliferative activated receptor, gamma, coactivator-related 1"""			9628581, 11340167	Standard	XM_005269656		Approved	PRC, KIAA0595, MGC74642	uc001kum.3	Q5VV67	OTTHUMG00000018948	ENST00000278070.2:c.409delA	10.37:g.103898442delA	ENSP00000278070:p.Asn137fs	Somatic	87	0		WXS	Illumina HiSeq	Phase_I	90	15	NM_015062	0	0	0	0	0	Q5VV66|Q6P3U5|Q6P3W1|Q76N31|Q9BUJ3|Q9BZE5|Q9Y4E0	Frame_Shift_Del	DEL	ENST00000278070.2	37	CCDS7529.1																																																																																			.		0.532	PPRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050021.1	NM_015062	
ARAP1	116985	broad.mit.edu	37	11	72399555	72399555	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr11:72399555delT	ENST00000393609.3	-	31	4217	c.4015delA	c.(4015-4017)attfs	p.I1339fs	ARAP1_ENST00000426523.1_Frame_Shift_Del_p.I1083fs|ARAP1_ENST00000495878.1_5'UTR|ARAP1_ENST00000393605.3_Frame_Shift_Del_p.I1099fs|ARAP1_ENST00000359373.5_Frame_Shift_Del_p.I1328fs|ARAP1-AS1_ENST00000542022.1_RNA|ARAP1_ENST00000455638.2_Frame_Shift_Del_p.I1328fs|ARAP1_ENST00000334211.8_Frame_Shift_Del_p.I1094fs|ARAP1_ENST00000429686.1_Frame_Shift_Del_p.I1022fs	NM_001040118.2	NP_001035207.1	Q96P48	ARAP1_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1	1339	PH 4. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin filament reorganization involved in cell cycle (GO:0030037)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of receptor recycling (GO:0001921)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of cellular component movement (GO:0051270)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|large_intestine(10)|lung(8)|ovary(1)|skin(3)|urinary_tract(1)	27						AGACTCTTAATAGGCCACTCC	0.577																																					p.I1339fs	Ovarian(102;1198 1520 13195 17913 37529)												.	ARAP1-91	0			c.4015delA						.						74.0	61.0	65.0					11																	72399555		2200	4293	6493	SO:0001589	frameshift_variant	116985	exon31			TCTTAATAGGCCA	AF411983	CCDS8217.2, CCDS41687.1, CCDS44671.1	11q13.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000186635	ENSG00000186635		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16925	protein-coding gene	gene with protein product		606646	"""centaurin, delta 2"""	CENTD2			Standard	NM_001040118		Approved		uc001osu.3	Q96P48	OTTHUMG00000157102	ENST00000393609.3:c.4015delA	11.37:g.72399555delT	ENSP00000377233:p.Ile1339fs	Somatic	36	0		WXS	Illumina HiSeq	Phase_I	28	8	NM_001040118	0	0	0	0	0	A3KLL7|B2RTS2|O94879|Q4LDD5|Q59FI7|Q6PHS3|Q8WU51|Q96HP6|Q96L71	Frame_Shift_Del	DEL	ENST00000393609.3	37	CCDS41687.1																																																																																			.		0.577	ARAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347428.1	NM_001040118	
TECTA	7007	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	120980039	120980039	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr11:120980039delA	ENST00000392793.1	+	4	589	c.318delA	c.(316-318)ggafs	p.G106fs	TECTA_ENST00000264037.2_Frame_Shift_Del_p.G106fs			O75443	TECTA_HUMAN	tectorin alpha	106	NIDO. {ECO:0000255|PROSITE- ProRule:PRU00570}.				cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)			TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		TGCACAATGGAATTCGAGGCG	0.498																																					p.G106fs		.											.	TECTA-225	0			c.318delA						.						105.0	97.0	100.0					11																	120980039		2203	4299	6502	SO:0001589	frameshift_variant	7007	exon3			.	AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.318delA	11.37:g.120980039delA	ENSP00000376543:p.Gly106fs	Somatic	72	0		WXS	Illumina HiSeq	Phase_I	76	19	NM_005422	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000392793.1	37	CCDS8434.1																																																																																			.		0.498	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313850.1	NM_005422	
CACNA1G	8913	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	48692731	48692732	+	Frame_Shift_Del	DEL	GC	GC	-			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr17:48692731_48692732delGC	ENST00000359106.5	+	27	4769_4770	c.4769_4770delGC	c.(4768-4770)tgcfs	p.C1590fs	CACNA1G_ENST00000513689.2_Frame_Shift_Del_p.C1545fs|CACNA1G_ENST00000507336.1_Frame_Shift_Del_p.C1579fs|CACNA1G_ENST00000505165.1_Frame_Shift_Del_p.C1590fs|CACNA1G_ENST00000502264.1_Frame_Shift_Del_p.C1567fs|CACNA1G_ENST00000510115.1_Frame_Shift_Del_p.C1556fs|CACNA1G_ENST00000515765.1_Frame_Shift_Del_p.C1579fs|CACNA1G_ENST00000360761.4_Frame_Shift_Del_p.C1567fs|CACNA1G_ENST00000507896.1_Frame_Shift_Del_p.C1579fs|CACNA1G_ENST00000358244.5_Frame_Shift_Del_p.C1556fs|CACNA1G_ENST00000515165.1_Frame_Shift_Del_p.C1590fs|CACNA1G_ENST00000352832.5_Frame_Shift_Del_p.C1556fs|CACNA1G_ENST00000510366.1_Frame_Shift_Del_p.C1538fs|CACNA1G_ENST00000429973.2_Frame_Shift_Del_p.C1572fs|CACNA1G_ENST00000515411.1_Frame_Shift_Del_p.C1572fs|CACNA1G_ENST00000514717.1_Frame_Shift_Del_p.C1533fs|CACNA1G_ENST00000514181.1_Frame_Shift_Del_p.C1572fs|CACNA1G_ENST00000513964.1_Frame_Shift_Del_p.C1545fs|CACNA1G_ENST00000512389.1_Frame_Shift_Del_p.C1579fs|CACNA1G_ENST00000354983.4_Frame_Shift_Del_p.C1556fs|CACNA1G_ENST00000507510.2_Frame_Shift_Del_p.C1590fs|CACNA1G_ENST00000442258.2_Frame_Shift_Del_p.C1549fs|CACNA1G_ENST00000514079.1_Frame_Shift_Del_p.C1597fs|CACNA1G_ENST00000503485.1_Frame_Shift_Del_p.C1556fs|CACNA1G_ENST00000507609.1_Frame_Shift_Del_p.C1590fs	NM_018896.4	NP_061496.2	O43497	CAC1G_HUMAN	calcium channel, voltage-dependent, T type, alpha 1G subunit	1590					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|response to nickel cation (GO:0010045)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|scaffold protein binding (GO:0097110)			breast(5)|cervix(1)|endometrium(13)|kidney(5)|lung(23)	47	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	GAAGCCCAGTGCAAACCTTACT	0.629																																					p.1597_1597del		.											.	CACNA1G-67	0			c.4790_4791del						.																																			SO:0001589	frameshift_variant	8913	exon27			.	AC004590	CCDS45730.1, CCDS45731.1, CCDS45732.1, CCDS45733.1, CCDS45734.1, CCDS45735.1, CCDS45736.1, CCDS45737.1, CCDS54142.1, CCDS54143.1, CCDS54144.1, CCDS54145.1, CCDS54146.1, CCDS58565.1, CCDS58566.1, CCDS58567.1, CCDS58568.1, CCDS58569.1, CCDS58570.1, CCDS58571.1, CCDS58572.1, CCDS58573.1, CCDS58574.1, CCDS58575.1, CCDS58576.1	17q22	2012-03-07	2007-02-16		ENSG00000006283	ENSG00000006283		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1394	protein-coding gene	gene with protein product		604065				9495342, 16382099	Standard	NM_001256334		Approved	Cav3.1, NBR13	uc002irk.2	O43497	OTTHUMG00000162180	ENST00000359106.5:c.4769_4770delGC	17.37:g.48692731_48692732delGC	ENSP00000352011:p.Cys1590fs	Somatic	50	0		WXS	Illumina HiSeq	Phase_I	75	13	NM_001256325	0	0	0	0	0	D6RA64|E7EPR0|O43498|O94770|Q19QY8|Q19QY9|Q19QZ0|Q19QZ1|Q19QZ2|Q19QZ3|Q19QZ4|Q19QZ5|Q19QZ6|Q19QZ7|Q19QZ8|Q19QZ9|Q19R00|Q19R01|Q19R02|Q19R03|Q19R04|Q19R05|Q19R06|Q19R07|Q19R08|Q19R09|Q19R10|Q19R11|Q19R12|Q19R13|Q19R15|Q19R16|Q19R17|Q19R18|Q2TAC4|Q9NYU4|Q9NYU5|Q9NYU6|Q9NYU7|Q9NYU8|Q9NYU9|Q9NYV0|Q9NYV1|Q9UHN9|Q9UHP0|Q9ULU6|Q9UNG7|Q9Y5T2|Q9Y5T3	Frame_Shift_Del	DEL	ENST00000359106.5	37	CCDS45730.1																																																																																			.		0.629	CACNA1G-013	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367895.1	NM_018896	
TNRC6C	57690	broad.mit.edu	37	17	76046980	76046980	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr17:76046980delA	ENST00000588061.1	+	5	2564	c.1837delA	c.(1837-1839)aaafs	p.K614fs	TNRC6C_ENST00000541771.1_Frame_Shift_Del_p.K614fs|TNRC6C_ENST00000588847.1_Frame_Shift_Del_p.K614fs|TNRC6C_ENST00000335749.4_Frame_Shift_Del_p.K614fs|TNRC6C_ENST00000301624.4_Frame_Shift_Del_p.K614fs|TNRC6C_ENST00000544502.1_Frame_Shift_Del_p.K614fs			Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C	614	Sufficient for interaction with argonaute family proteins.				embryonic hemopoiesis (GO:0035162)|endoderm formation (GO:0001706)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of gene silencing by miRNA (GO:0060964)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			GGGGGATGGGAAAAAAAATGG	0.522																																					p.K613fs													.	TNRC6C-24	0			c.1837delA						.		,	8,3764		1,6,1879	77.0	78.0	78.0		,	-0.2	0.8	17	dbSNP_130	79	42,7894		10,22,3936	no	frameshift,frameshift	TNRC6C	NM_018996.3,NM_001142640.1	,	11,28,5815	A1A1,A1R,RR		0.5292,0.2121,0.4271	,	,	76046980	50,11658	1966	4142	6108	SO:0001589	frameshift_variant	57690	exon4			GATGGGAAAAAAA	AL834429	CCDS45798.1, CCDS45799.1	17q25.3	2012-10-04			ENSG00000078687	ENSG00000078687		"""Trinucleotide (CAG) repeat containing"""	29318	protein-coding gene	gene with protein product		610741					Standard	NM_018996		Approved	KIAA1582, FLJ20015	uc002juf.2	Q9HCJ0	OTTHUMG00000132642	ENST00000588061.1:c.1837delA	17.37:g.76046980delA	ENSP00000468647:p.Lys614fs	Somatic	110	0		WXS	Illumina HiSeq	Phase_I	169	5	NM_018996	0	0	0	0	0	G3XAB8|Q86UE5|Q8N3D8|Q96MU9	Frame_Shift_Del	DEL	ENST00000588061.1	37	CCDS45798.1																																																																																			.		0.522	TNRC6C-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000395947.1	NM_018996	
GAA	2548	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	78085893	78085894	+	Frame_Shift_Del	DEL	CC	CC	-			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	CC	CC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr17:78085893_78085894delCC	ENST00000302262.3	+	12	1967_1968	c.1748_1749delCC	c.(1747-1749)tccfs	p.S583fs	GAA_ENST00000390015.3_Frame_Shift_Del_p.S583fs	NM_000152.3	NP_000143.2	P10253	LYAG_HUMAN	glucosidase, alpha; acid	583					cardiac muscle contraction (GO:0060048)|diaphragm contraction (GO:0002086)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|heart morphogenesis (GO:0003007)|locomotory behavior (GO:0007626)|lysosome organization (GO:0007040)|maltose metabolic process (GO:0000023)|muscle cell cellular homeostasis (GO:0046716)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|regulation of the force of heart contraction (GO:0002026)|sucrose metabolic process (GO:0005985)|tissue development (GO:0009888)|vacuolar sequestering (GO:0043181)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|maltose alpha-glucosidase activity (GO:0032450)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|lung(6)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	21	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)		Acarbose(DB00284)|Miglitol(DB00491)	GCCATCGCCTCCCACAGGTGAG	0.649																																					p.583_583del		.											.	GAA-91	0			c.1748_1749del	GRCh37	CM082761	GAA	M		.																																			SO:0001589	frameshift_variant	2548	exon13			.		CCDS32760.1	17q25.2-q25.3	2014-09-17	2008-08-01				3.2.1.20		4065	protein-coding gene	gene with protein product	"""Pompe disease"", ""glycogen storage disease type II"""	606800					Standard	NM_000152		Approved		uc002jxq.3	P10253		ENST00000302262.3:c.1748_1749delCC	17.37:g.78085893_78085894delCC	ENSP00000305692:p.Ser583fs	Somatic	108	0		WXS	Illumina HiSeq	Phase_I	107	20	NM_001079803	0	0	0	0	0	Q09GN4|Q14351|Q16302|Q8IWE7	Frame_Shift_Del	DEL	ENST00000302262.3	37	CCDS32760.1																																																																																			.		0.649	GAA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437441.1		
LCT	3938	broad.mit.edu;bcgsc.ca	37	2	136566494	136566494	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr2:136566494delT	ENST00000264162.2	-	8	3433	c.3423delA	c.(3421-3423)gaafs	p.E1141fs	Y_RNA_ENST00000363794.1_RNA	NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	1141	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	GGTCAGCGGCTTCCACATCTC	0.552																																					p.E1141fs													.	LCT-101	0			c.3423delA						.						71.0	75.0	74.0					2																	136566494		2203	4300	6503	SO:0001589	frameshift_variant	3938	exon8			AGCGGCTTCCACA	X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.3423delA	2.37:g.136566494delT	ENSP00000264162:p.Glu1141fs	Somatic	127	0		WXS	Illumina HiSeq	Phase_I	156	21	NM_002299	0	0	0	0	0	Q4ZG58	Frame_Shift_Del	DEL	ENST00000264162.2	37	CCDS2178.1																																																																																			.		0.552	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254657.1	NM_002299	
PCDH18	54510	broad.mit.edu;bcgsc.ca	37	4	138452043	138452043	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr4:138452043delA	ENST00000344876.4	-	1	1586	c.1200delT	c.(1198-1200)catfs	p.H400fs	PCDH18_ENST00000510305.1_Intron|PCDH18_ENST00000507846.1_Frame_Shift_Del_p.H180fs|PCDH18_ENST00000511115.1_Intron|PCDH18_ENST00000412923.2_Frame_Shift_Del_p.H400fs	NM_019035.3	NP_061908.1	Q9HCL0	PCD18_HUMAN	protocadherin 18	400	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(27)|lung(21)|ovary(2)|pancreas(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86	all_hematologic(180;0.24)					GACCATGTCCATGAAGCTTAC	0.348																																					p.H400fs													.	PCDH18-185	0			c.1200delT						.						100.0	106.0	104.0					4																	138452043		2203	4300	6503	SO:0001589	frameshift_variant	54510	exon1			ATGTCCATGAAGC	AL137471	CCDS34064.1, CCDS75193.1	4q28.3	2010-01-26			ENSG00000189184	ENSG00000189184		"""Cadherins / Protocadherins : Non-clustered"""	14268	protein-coding gene	gene with protein product		608287				10835267, 11549318	Standard	XM_005263070		Approved	KIAA1562, PCDH68L	uc003ihe.4	Q9HCL0	OTTHUMG00000161348	ENST00000344876.4:c.1200delT	4.37:g.138452043delA	ENSP00000355082:p.His400fs	Somatic	79	0		WXS	Illumina HiSeq	Phase_I	87	13	NM_019035	0	0	0	0	0	A8K7K3|B7ZKT1|Q52LS2	Frame_Shift_Del	DEL	ENST00000344876.4	37	CCDS34064.1																																																																																			.		0.348	PCDH18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364614.1	NM_019035	
SEC24A	10802	broad.mit.edu;bcgsc.ca	37	5	133997149	133997160	+	In_Frame_Del	DEL	CTCACAAACAAA	CTCACAAACAAA	-			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	CTCACAAACAAA	CTCACAAACAAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr5:133997149_133997160delCTCACAAACAAA	ENST00000398844.2	+	2	726_737	c.438_449delCTCACAAACAAA	c.(436-450)gcctcacaaacaaac>gcc	p.SQTN147del	SEC24A_ENST00000322887.4_In_Frame_Del_p.SQTN147del	NM_021982.2	NP_068817.1	O95486	SC24A_HUMAN	SEC24 family member A	147	Pro-rich.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of protein secretion (GO:0050714)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045714)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	36			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CATCCACAGCCTCACAAACAAACCATTGTCCT	0.415																																					p.146_150del													.	SEC24A-68	0			c.438_449del						.																																			SO:0001651	inframe_deletion	10802	exon2			CACAGCCTCACAA	AJ131244	CCDS43363.1, CCDS58967.1	5q31.1	2013-10-21	2013-10-21		ENSG00000113615	ENSG00000113615			10703	protein-coding gene	gene with protein product		607183	"""SEC24 (S. cerevisiae) related gene family, member A"", ""SEC24 family, member A (S. cerevisiae)"""			10075675, 10329445	Standard	NM_021982		Approved		uc003kzs.3	O95486	OTTHUMG00000163064	ENST00000398844.2:c.438_449delCTCACAAACAAA	5.37:g.133997149_133997160delCTCACAAACAAA	ENSP00000381823:p.Ser147_Asn150del	Somatic	106	0		WXS	Illumina HiSeq	Phase_I	101	12	NM_001252231	0	0	0	0	0	A8MVW3|Q8WUV2|Q96GP7	In_Frame_Del	DEL	ENST00000398844.2	37	CCDS43363.1																																																																																			.		0.415	SEC24A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371563.1		
STAG3L2	442582	broad.mit.edu	37	7	74300557	74300564	+	RNA	DEL	AGAGCTCC	AGAGCTCC	-	rs367732188		TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	AGAGCTCC	AGAGCTCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr7:74300557_74300564delAGAGCTCC	ENST00000423186.1	-	0	573_580							P0CL84	ST3L2_HUMAN	stromal antigen 3-like 2 (pseudogene)							nucleus (GO:0005634)		p.E82fs*32(2)		breast(1)|central_nervous_system(1)|large_intestine(1)|lung(1)|pancreas(1)	5						CGGCCAGTGAAGAGCTCCAGGCGTGCGG	0.572																																					.													.	.	2	Deletion - Frameshift(2)	large_intestine(1)|central_nervous_system(1)	.						.			96,356		38,20,168							0.0			1	208,1036		88,32,502	no	frameshift	STAG3L2	NM_001025202.2		126,52,670	A1A1,A1R,RR		16.7203,21.2389,17.9245				304,1392						442582	.			CAGTGAAGAGCTC			7q11.23	2013-06-26	2013-06-26			ENSG00000277072			33886	pseudogene	pseudogene			"""stromal antigen 3-like 2"""				Standard	NR_040584		Approved	MGC131759, STAG3L2P	uc011kfj.2	P0CL84	OTTHUMG00000156216		7.37:g.74300557_74300564delAGAGCTCC		Somatic	183	0		WXS	Illumina HiSeq	Phase_I	229	3	.	0	0	0	0	0	A6NMT8|A8K0A1|Q32NE4|Q6NXR2|Q7L5M5|Q7Z5K6	RNA	DEL	ENST00000423186.1	37																																																																																				.		0.572	STAG3L2-002	KNOWN	basic	retained_intron	pseudogene	OTTHUMT00000343523.2	NM_001025202	
POLB	5423	broad.mit.edu;bcgsc.ca	37	8	42213041	42213041	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr8:42213041delA	ENST00000265421.4	+	7	548	c.378delA	c.(376-378)agafs	p.R126fs	POLB_ENST00000538005.1_5'UTR	NM_002690.2	NP_002681.1	P06746	DPOLB_HUMAN	polymerase (DNA directed), beta	126					base-excision repair (GO:0006284)|base-excision repair, gap-filling (GO:0006287)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|DNA-dependent DNA replication (GO:0006261)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|neuron apoptotic process (GO:0051402)|pyrimidine dimer repair (GO:0006290)|response to ethanol (GO:0045471)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|enzyme binding (GO:0019899)|lyase activity (GO:0016829)|metal ion binding (GO:0046872)|microtubule binding (GO:0008017)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|liver(1)|lung(5)|ovary(1)	16	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;2.58e-12)|Lung NSC(13;4.24e-11)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.1)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;3.18e-11)|Lung(22;0.00467)|OV - Ovarian serous cystadenocarcinoma(14;0.00523)|LUSC - Lung squamous cell carcinoma(45;0.024)		Cytarabine(DB00987)	CAGATCTCAGAAAAAATGAAG	0.303								DNA polymerases (catalytic subunits)																													p.R126fs													.	POLB-1084	0			c.378delA						.						65.0	69.0	67.0					8																	42213041		2203	4298	6501	SO:0001589	frameshift_variant	5423	exon7			TCTCAGAAAAAAT		CCDS6129.1	8p12-p11	2012-10-02			ENSG00000070501	ENSG00000070501	2.7.7.7	"""DNA polymerases"""	9174	protein-coding gene	gene with protein product		174760					Standard	NM_002690		Approved		uc003xoz.2	P06746	OTTHUMG00000164093	ENST00000265421.4:c.378delA	8.37:g.42213041delA	ENSP00000265421:p.Arg126fs	Somatic	86	0		WXS	Illumina HiSeq	Phase_I	81	9	NM_002690	0	0	0	0	0	B2RC78|Q3KP48|Q6FI34	Frame_Shift_Del	DEL	ENST00000265421.4	37	CCDS6129.1																																																																																			.		0.303	POLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377242.1	NM_002690	
SMC1A	8243	broad.mit.edu;bcgsc.ca	37	X	53442034	53442036	+	In_Frame_Del	DEL	ATC	ATC	-			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	ATC	ATC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chrX:53442034_53442036delATC	ENST00000322213.4	-	2	319_321	c.192_194delGAT	c.(190-195)ctgatc>ctc	p.I65del	SMC1A_ENST00000375340.6_In_Frame_Del_p.I65del	NM_006306.2	NP_006297.2	Q14683	SMC1A_HUMAN	structural maintenance of chromosomes 1A	65					DNA repair (GO:0006281)|gene expression (GO:0010467)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic sister chromatid cohesion (GO:0007064)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of DNA endoreduplication (GO:0032876)|response to radiation (GO:0009314)|RNA splicing (GO:0008380)|signal transduction in response to DNA damage (GO:0042770)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin core heterodimer (GO:0008280)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|meiotic cohesin complex (GO:0030893)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(8)|ovary(5)|upper_aerodigestive_tract(2)	49						AGCTCCATGGATCAGGTCCCGCA	0.552																																					p.64_65del													.	SMC1A-232	0			c.192_194del						.																																			SO:0001651	inframe_deletion	8243	exon2			CCATGGATCAGGT	S78271	CCDS14352.1, CCDS75985.1	Xp11.22-p11.21	2014-09-17	2006-07-06	2006-07-06	ENSG00000072501	ENSG00000072501		"""Structural maintenance of chromosomes proteins"""	11111	protein-coding gene	gene with protein product		300040	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 1 (yeast)"""	SMC1L1		7757074	Standard	NM_006306		Approved	DXS423E, KIAA0178, SB1.8, Smcb	uc004dsg.3	Q14683	OTTHUMG00000021614	ENST00000322213.4:c.192_194delGAT	X.37:g.53442034_53442036delATC	ENSP00000323421:p.Ile65del	Somatic	28	0		WXS	Illumina HiSeq	Phase_I	27	8	NM_006306	0	0	0	0	0	O14995|Q16351|Q2M228	In_Frame_Del	DEL	ENST00000322213.4	37	CCDS14352.1																																																																																			.		0.552	SMC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056756.2	NM_006306	
ABCA13	154664	broad.mit.edu;bcgsc.ca	37	7	48317816	48317817	+	Frame_Shift_Ins	INS	-	-	T			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr7:48317816_48317817insT	ENST00000435803.1	+	18	7049_7050	c.7025_7026insT	c.(7024-7029)agttcafs	p.S2343fs		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	2343					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						CTAATGAAAAGTTCATTTATAT	0.307																																					p.S2342fs													.	ABCA13-521	0			c.7025_7026insT						.																																			SO:0001589	frameshift_variant	154664	exon18			TGAAAAGTTCATT	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.7027dupT	7.37:g.48317818_48317818dupT	ENSP00000411096:p.Ser2343fs	Somatic	27	0		WXS	Illumina HiSeq	Phase_I	22	8	NM_152701	0	0	0	0	0	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Frame_Shift_Ins	INS	ENST00000435803.1	37	CCDS47584.1																																																																																			.		0.307	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
PTCHD1	139411	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	23411958	23411959	+	Frame_Shift_Ins	INS	-	-	G			TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chrX:23411958_23411959insG	ENST00000379361.4	+	3	3183_3184	c.2323_2324insG	c.(2323-2325)tttfs	p.F775fs		NM_173495.2	NP_775766.2	Q96NR3	PTHD1_HUMAN	patched domain containing 1	775					cognition (GO:0050890)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(4)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(4)|skin(2)|urinary_tract(2)	42						GTTATCCACATTTGTTCTGGGC	0.371																																					p.F775fs		.											.	PTCHD1-135	0			c.2323_2324insG						.																																			SO:0001589	frameshift_variant	139411	exon3			.	AK054858	CCDS35215.2	Xp22.13	2008-02-05			ENSG00000165186	ENSG00000165186			26392	protein-coding gene	gene with protein product		300828					Standard	NM_173495		Approved	FLJ30296	uc004dal.4	Q96NR3	OTTHUMG00000021251	Exception_encountered	X.37:g.23411958_23411959insG	ENSP00000368666:p.Phe775fs	Somatic	55	0		WXS	Illumina HiSeq	Phase_I	44	19	NM_173495	0	0	0	0	0	B4DQH0|Q0IJ60|Q6P6B8	Frame_Shift_Ins	INS	ENST00000379361.4	37	CCDS35215.2																																																																																			.		0.371	PTCHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056047.2	NM_173495	
BFSP1	631	hgsc.bcm.edu	37	20	17511868	17511869	+	Missense_Mutation	DNP	GC	GC	AA	rs549462369|rs561046384	byFrequency	TCGA-A4-7585-01A-11D-2136-08	TCGA-A4-7585-11A-01D-2136-08	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	62550e91-8d87-4feb-a763-bedc2e84cebe	2e2066d9-8dd8-4483-8bd9-67b26cbedc59	g.chr20:17511868_17511869GC>AA	ENST00000377873.3	-	1	145_146	c.106_107GC>TT	c.(106-108)GCt>TTt	p.A36F	BFSP1_ENST00000473415.1_Intron|BFSP1_ENST00000544874.1_Intron|BFSP1_ENST00000536626.1_Intron|BFSP1_ENST00000377868.2_Intron	NM_001195.3	NP_001186.1	Q12934	BFSP1_HUMAN	beaded filament structural protein 1, filensin	36	Head.				cell maturation (GO:0048469)|lens fiber cell development (GO:0070307)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)|structural constituent of eye lens (GO:0005212)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(7)|prostate(2)|skin(1)|stomach(1)	18						CGTTGCCCCAGCCCAGCCCTCG	0.782																																					p.A36F		.											.	BFSP1	0			c.G106T						.																																			SO:0001583	missense	631	exon1			CCCCAGCCCAGCC	Y16717	CCDS13126.1, CCDS54448.1, CCDS63229.1	20p12.1	2014-06-05			ENSG00000125864	ENSG00000125864		"""Intermediate filaments type VI, eye lens intermediate filaments"""	1040	protein-coding gene	gene with protein product		603307				9787085	Standard	NM_001161705		Approved	CP94, CP115, LIFL-H, filensin	uc002wpo.3	Q12934	OTTHUMG00000031940	ENST00000377873.3:c.106_107delinsAA	20.37:g.17511868_17511869delinsAA	ENSP00000367104:p.Ala36Phe	Somatic	3.0	1.0		WXS	Illumina HiSeq	Phase_I	9.0	8.0		0	0	0	0	0	F5H0G1|O43595|O76034|O95676|Q8IVZ6|Q9HBX4	Missense_Mutation	DNP	ENST00000377873.3	37	CCDS13126.1																																																																																			.		0.782	BFSP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078119.6	NM_001195	
