#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TAS1R2	80834	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	19181066	19181066	+	Missense_Mutation	SNP	C	C	T	rs201197024		TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr1:19181066C>T	ENST00000375371.3	-	3	919	c.898G>A	c.(898-900)Gcc>Acc	p.A300T	RP13-279N23.2_ENST00000494072.3_3'UTR	NM_152232.2	NP_689418.2	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2	300					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|sensory perception of sweet taste (GO:0050916)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(10)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(3)|stomach(1)	45		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	GACTCGGAGGCGATCCACACG	0.647													C|||	1	0.000199681	0.0	0.0014	5008	,	,		19322	0.0		0.0	False		,,,				2504	0.0				p.A300T		.											.	TAS1R2-93	0			c.G898A						.						56.0	54.0	55.0					1																	19181066		2203	4300	6503	SO:0001583	missense	80834	exon3			CGGAGGCGATCCA		CCDS187.1	1p36.13	2012-08-22	2003-03-07		ENSG00000179002	ENSG00000179002		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14905	protein-coding gene	gene with protein product		606226	"""G protein-coupled receptor 71"""	GPR71			Standard	NM_152232		Approved	T1R2, TR2	uc001bba.1	Q8TE23	OTTHUMG00000002442	ENST00000375371.3:c.898G>A	1.37:g.19181066C>T	ENSP00000364520:p.Ala300Thr	Somatic	84	0		WXS	Illumina HiSeq	Phase_I	64	21	NM_152232	0	0	0	0	0	Q5TZ19	Missense_Mutation	SNP	ENST00000375371.3	37	CCDS187.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	23.7	4.444658	0.83993	.	.	ENSG00000179002	ENST00000375371	D	0.84730	-1.89	4.89	4.89	0.63831	Extracellular ligand-binding receptor (1);	0.000000	0.46145	D	0.000306	D	0.92756	0.7697	M	0.87971	2.92	0.42114	D	0.991391	D	0.89917	1.0	D	0.80764	0.994	D	0.92892	0.6332	10	0.44086	T	0.13	.	15.5821	0.76452	0.0:1.0:0.0:0.0	.	300	Q8TE23	TS1R2_HUMAN	T	300	ENSP00000364520:A300T	ENSP00000364520:A300T	A	-	1	0	TAS1R2	19053653	1.000000	0.71417	1.000000	0.80357	0.419000	0.31324	5.789000	0.69029	2.550000	0.86006	0.561000	0.74099	GCC	C|1.000;T|0.000		0.647	TAS1R2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000006953.1		
SLC35D1	23169	hgsc.bcm.edu	37	1	67515474	67515474	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr1:67515474A>G	ENST00000235345.5	-	6	609	c.524T>C	c.(523-525)gTa>gCa	p.V175A	SLC35D1_ENST00000506472.2_Missense_Mutation_p.V96A	NM_015139.2	NP_055954.1	Q9NTN3	S35D1_HUMAN	solute carrier family 35 (UDP-GlcA/UDP-GalNAc transporter), member D1	175					carbohydrate transport (GO:0008643)|cellular glucuronidation (GO:0052695)|chondroitin sulfate biosynthetic process (GO:0030206)|embryonic skeletal system development (GO:0048706)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|UDP-glucuronate biosynthetic process (GO:0006065)|UDP-glucuronic acid transport (GO:0015787)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	UDP-glucuronic acid transmembrane transporter activity (GO:0005461)			endometrium(2)|kidney(1)|large_intestine(3)|lung(4)	10						CCTGGCAGCTACAAAGGCTCC	0.289																																					p.V175A		.											.	SLC35D1-90	0			c.T524C						.						61.0	63.0	62.0					1																	67515474		2203	4299	6502	SO:0001583	missense	23169	exon6			GCAGCTACAAAGG	AB044343	CCDS636.1	1p32-p31	2013-07-17	2013-07-17		ENSG00000116704	ENSG00000116704		"""Solute carriers"""	20800	protein-coding gene	gene with protein product		610804	"""solute carrier family 35 (UDP-glucuronic acid/UDP-N-acetylgalactosamine dual transporter), member D1"""			11322953	Standard	NM_015139		Approved	UGTREL7, KIAA0260	uc001ddk.2	Q9NTN3	OTTHUMG00000009360	ENST00000235345.5:c.524T>C	1.37:g.67515474A>G	ENSP00000235345:p.Val175Ala	Somatic	46	0		WXS	Illumina HiSeq	Phase_I	30	2	NM_015139	0	0	0	0	0	A8K185|B7Z3X2|Q52LU5|Q92548	Missense_Mutation	SNP	ENST00000235345.5	37	CCDS636.1	.	.	.	.	.	.	.	.	.	.	A	25.3	4.621853	0.87460	.	.	ENSG00000116704	ENST00000235345;ENST00000506472	T;T	0.66280	-0.2;0.25	5.29	5.29	0.74685	.	0.158134	0.56097	D	0.000027	T	0.69178	0.3082	M	0.86651	2.83	0.49483	D	0.999798	P;P	0.50156	0.932;0.806	P;P	0.53185	0.676;0.72	T	0.75445	-0.3315	10	0.54805	T	0.06	-7.0229	12.7442	0.57270	1.0:0.0:0.0:0.0	.	96;175	B7Z3X2;Q9NTN3	.;S35D1_HUMAN	A	175;96	ENSP00000235345:V175A;ENSP00000445189:V96A	ENSP00000235345:V175A	V	-	2	0	SLC35D1	67288062	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.193000	0.89719	2.000000	0.58554	0.533000	0.62120	GTA	.		0.289	SLC35D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025948.1	NM_015139	
ZNF644	84146	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	91406116	91406116	+	Silent	SNP	G	G	A			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr1:91406116G>A	ENST00000370440.1	-	3	1012	c.795C>T	c.(793-795)ttC>ttT	p.F265F	ZNF644_ENST00000467231.1_Intron|ZNF644_ENST00000347275.5_Intron|ZNF644_ENST00000337393.5_Silent_p.F265F|ZNF644_ENST00000361321.5_Intron			Q9H582	ZN644_HUMAN	zinc finger protein 644	265					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(2)|large_intestine(10)|lung(21)|ovary(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	47		all_lung(203;0.00206)|Lung NSC(277;0.0519)|Lung SC(238;0.101)		all cancers(265;0.00102)|Epithelial(280;0.00766)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		GAAATTGAATGAACTCTTTTT	0.353																																					p.F265F		.											.	ZNF644-155	0			c.C795T						.						106.0	105.0	105.0					1																	91406116		2202	4300	6502	SO:0001819	synonymous_variant	84146	exon3			TTGAATGAACTCT	AB033047	CCDS731.1, CCDS732.1	1p22.2	2008-02-05			ENSG00000122482	ENSG00000122482			29222	protein-coding gene	gene with protein product		614159				10574462	Standard	NM_032186		Approved	KIAA1221, BM-005, MGC60165, MGC70410	uc001dnw.3	Q9H582	OTTHUMG00000010078	ENST00000370440.1:c.795C>T	1.37:g.91406116G>A		Somatic	102	0		WXS	Illumina HiSeq	Phase_I	144	57	NM_201269	0	0	8	15	7	A2RU71|Q2TAM0|Q5TCC0|Q6BEP7|Q6P446|Q6PI06|Q7LG67|Q9ULJ9	Silent	SNP	ENST00000370440.1	37	CCDS731.1																																																																																			.		0.353	ZNF644-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027846.2	NM_032186	
KCND3	3752	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	112524716	112524716	+	Silent	SNP	C	C	T	rs35131566	byFrequency	TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr1:112524716C>T	ENST00000315987.2	-	2	1112	c.633G>A	c.(631-633)ccG>ccA	p.P211P	KCND3_ENST00000369697.1_Silent_p.P211P|KCND3_ENST00000302127.4_Silent_p.P211P	NM_004980.4	NP_004971.2	Q9UK17	KCND3_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 3	211					cell death (GO:0008219)|membrane repolarization (GO:0086009)|potassium ion export (GO:0071435)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	49		all_cancers(81;8.52e-06)|all_epithelial(167;5.65e-06)|all_lung(203;2.72e-05)|Lung NSC(69;4.56e-05)		all cancers(265;0.056)|Lung(183;0.0576)|Colorectal(144;0.1)|Epithelial(280;0.104)|COAD - Colon adenocarcinoma(174;0.222)|LUSC - Lung squamous cell carcinoma(189;0.231)	Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	CCTTGCTGCCCGGGACCGTGC	0.647																																					p.P211P		.											.	KCND3-155	0			c.G633A						.						27.0	28.0	28.0					1																	112524716		2203	4300	6503	SO:0001819	synonymous_variant	3752	exon2			GCTGCCCGGGACC	AF048713	CCDS843.1, CCDS844.1	1p13.2	2014-09-17			ENSG00000171385	ENSG00000171385		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6239	protein-coding gene	gene with protein product		605411	"""spinocerebellar ataxia 22"", ""spinocerebellar ataxia 19"""	SCA22, SCA19		10942109, 16382104, 23280837	Standard	NM_172198		Approved	Kv4.3, KSHIVB	uc001ebu.1	Q9UK17	OTTHUMG00000011989	ENST00000315987.2:c.633G>A	1.37:g.112524716C>T		Somatic	60	0		WXS	Illumina HiSeq	Phase_I	34	13	NM_004980	0	0	3	10	7	O60576|O60577|Q14D71|Q5T0M0|Q9UH85|Q9UH86|Q9UK16	Silent	SNP	ENST00000315987.2	37	CCDS843.1																																																																																			C|0.999;A|0.001		0.647	KCND3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000033144.1	NM_172198	
YY1AP1	55249	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	155638446	155638446	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr1:155638446A>T	ENST00000295566.4	-	9	1012	c.989T>A	c.(988-990)aTg>aAg	p.M330K	YY1AP1_ENST00000355499.4_Missense_Mutation_p.M284K|YY1AP1_ENST00000311573.5_Missense_Mutation_p.M253K|YY1AP1_ENST00000347088.5_Missense_Mutation_p.M284K|YY1AP1_ENST00000404643.1_Missense_Mutation_p.M264K|YY1AP1_ENST00000535662.1_Missense_Mutation_p.M130K|YY1AP1_ENST00000476093.1_5'Flank|YY1AP1_ENST00000407221.1_Missense_Mutation_p.M253K|YY1AP1_ENST00000361831.5_Missense_Mutation_p.M273K|YY1AP1_ENST00000368339.5_Missense_Mutation_p.M422K|MSTO1_ENST00000538143.1_Intron|MSTO1_ENST00000452804.2_Intron|YY1AP1_ENST00000368340.5_Missense_Mutation_p.M402K|YY1AP1_ENST00000405763.3_Missense_Mutation_p.M422K|YY1AP1_ENST00000359205.5_Missense_Mutation_p.M273K|YY1AP1_ENST00000368330.2_Missense_Mutation_p.M284K	NM_001198906.1|NM_139118.2	NP_001185835.1|NP_620829.1	Q9H869	YYAP1_HUMAN	YY1 associated protein 1	330					regulation of cell cycle (GO:0051726)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(7)|ovary(2)|skin(2)|urinary_tract(2)	31	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)					AGCTCTGTTCATGTTGAGGTT	0.433																																					p.M422K		.											.	YY1AP1-93	0			c.T1265A						.						307.0	257.0	274.0					1																	155638446		2203	4300	6503	SO:0001583	missense	55249	exon8			CTGTTCATGTTGA	BC008766	CCDS1115.1, CCDS1116.1, CCDS55643.1, CCDS55644.1, CCDS55645.1	1q22	2009-05-07			ENSG00000163374	ENSG00000163374			30935	protein-coding gene	gene with protein product		607860				11710830	Standard	NM_139119		Approved	YY1AP, HCCA2, YAP		Q9H869	OTTHUMG00000035437	ENST00000295566.4:c.989T>A	1.37:g.155638446A>T	ENSP00000295566:p.Met330Lys	Somatic	197	0		WXS	Illumina HiSeq	Phase_I	149	46	NM_001198903	0	0	36	60	24	B0QZ54|B4DMP2|B4E0I0|D3DV96|D3DV98|H7BY62|Q5VYZ1|Q5VYZ4|Q5VYZ7|Q7L4C3|Q7L5E2|Q8IXA6|Q8TEW5|Q8TF04|Q96HB6|Q9BQ64|Q9NV84	Missense_Mutation	SNP	ENST00000295566.4	37	CCDS1115.1	.	.	.	.	.	.	.	.	.	.	A	14.05	2.419504	0.42918	.	.	ENSG00000163374	ENST00000359205;ENST00000355499;ENST00000311573;ENST00000347088;ENST00000361831;ENST00000368340;ENST00000295566;ENST00000368330;ENST00000407221;ENST00000404643;ENST00000368339;ENST00000535662;ENST00000405763	T;T;T;T;T;T;T;T;T;T;T;T	0.24151	1.9;1.9;1.92;1.9;1.9;1.9;1.91;1.9;1.92;1.93;1.87;1.93	3.4	-0.935	0.10423	.	0.476592	0.21278	N	0.077194	T	0.07999	0.0200	L	0.53249	1.67	0.80722	D	1	B;B;B;B;B;P;B	0.40211	0.12;0.103;0.169;0.297;0.034;0.707;0.088	B;B;B;B;B;B;B	0.36845	0.098;0.025;0.079;0.175;0.017;0.234;0.046	T	0.14671	-1.0464	10	0.32370	T	0.25	.	4.6279	0.12488	0.6197:0.0:0.0911:0.2892	.	350;422;264;422;330;284;402	B4DQQ0;B4DMP2;Q9H869-4;B0QZ55;Q9H869;Q9H869-2;Q5VYZ1	.;.;.;.;YYAP1_HUMAN;.;.	K	273;284;253;284;273;402;330;284;253;264;422;130;422	ENSP00000352134:M273K;ENSP00000347686:M284K;ENSP00000311138:M253K;ENSP00000316079:M284K;ENSP00000355298:M273K;ENSP00000357324:M402K;ENSP00000295566:M330K;ENSP00000357314:M284K;ENSP00000385791:M253K;ENSP00000385390:M264K;ENSP00000357323:M422K;ENSP00000437926:M130K	ENSP00000295566:M330K	M	-	2	0	YY1AP1	153905070	0.275000	0.24201	0.971000	0.41717	0.982000	0.71751	0.942000	0.29017	0.038000	0.15604	0.379000	0.24179	ATG	.		0.433	YY1AP1-043	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000086027.1	NM_139118	
PVRL4	81607	hgsc.bcm.edu;bcgsc.ca	37	1	161049405	161049405	+	Silent	SNP	C	C	T			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr1:161049405C>T	ENST00000368012.3	-	2	716	c.414G>A	c.(412-414)caG>caA	p.Q138Q		NM_030916.2	NP_112178.2	Q96NY8	PVRL4_HUMAN	poliovirus receptor-related 4	138	Ig-like V-type 1.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|viral process (GO:0016032)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|urinary_tract(1)	20	all_cancers(52;8.9e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			GCAGCCGCGCCTGGAAGCTGC	0.677																																					p.Q138Q	NSCLC(76;1160 1387 14476 16172 29359)	.											.	PVRL4-92	0			c.G414A						.						9.0	11.0	10.0					1																	161049405		2016	4029	6045	SO:0001819	synonymous_variant	81607	exon2			CCGCGCCTGGAAG	AF426163	CCDS1216.1	1q22-q23.2	2013-01-14			ENSG00000143217	ENSG00000143217		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	19688	protein-coding gene	gene with protein product		609607				11544254	Standard	NM_030916		Approved	nectin-4, PRR4, LNIR	uc001fxo.2	Q96NY8	OTTHUMG00000031475	ENST00000368012.3:c.414G>A	1.37:g.161049405C>T		Somatic	44	0		WXS	Illumina HiSeq	Phase_I	23	10	NM_030916	0	0	0	0	0	B4DQW3|Q96K15	Silent	SNP	ENST00000368012.3	37	CCDS1216.1																																																																																			.		0.677	PVRL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077074.1	NM_030916	
CUBN	8029	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	17127627	17127627	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr10:17127627T>G	ENST00000377833.4	-	16	2144	c.2079A>C	c.(2077-2079)caA>caC	p.Q693H		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	693	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TATGGAAGCCTTGGTCACTAA	0.463																																					p.Q693H		.											.	CUBN-166	0			c.A2079C						.						117.0	123.0	121.0					10																	17127627		2203	4300	6503	SO:0001583	missense	8029	exon16			GAAGCCTTGGTCA	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.2079A>C	10.37:g.17127627T>G	ENSP00000367064:p.Gln693His	Somatic	227	1		WXS	Illumina HiSeq	Phase_I	180	69	NM_001081	0	0	2	2	0	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	37	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	T	16.08	3.021025	0.54576	.	.	ENSG00000107611	ENST00000377833	T	0.18502	2.21	5.73	-4.07	0.03975	CUB (5);	0.772213	0.10776	N	0.635427	T	0.15739	0.0379	L	0.45137	1.4	0.80722	D	1	P	0.48998	0.918	P	0.51355	0.667	T	0.50346	-0.8839	10	0.56958	D	0.05	.	0.6265	0.00787	0.2025:0.1691:0.2075:0.4209	.	693	O60494	CUBN_HUMAN	H	693	ENSP00000367064:Q693H	ENSP00000367064:Q693H	Q	-	3	2	CUBN	17167633	0.006000	0.16342	0.025000	0.17156	0.768000	0.43524	-0.278000	0.08490	-0.484000	0.06763	0.533000	0.62120	CAA	.		0.463	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
ARID5B	84159	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	63852307	63852307	+	Silent	SNP	C	C	A			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr10:63852307C>A	ENST00000279873.7	+	10	3495	c.3085C>A	c.(3085-3087)Cgg>Agg	p.R1029R	ARID5B_ENST00000309334.5_Silent_p.R786R	NM_032199.2	NP_115575.1	Q14865	ARI5B_HUMAN	AT rich interactive domain 5B (MRF1-like)	1029					adipose tissue development (GO:0060612)|adrenal gland development (GO:0030325)|cell development (GO:0048468)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|fat pad development (GO:0060613)|female gonad development (GO:0008585)|fibroblast migration (GO:0010761)|kidney development (GO:0001822)|liver development (GO:0001889)|male gonad development (GO:0008584)|multicellular organism growth (GO:0035264)|muscle organ morphogenesis (GO:0048644)|negative regulation of transcription, DNA-templated (GO:0045892)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|post-embryonic development (GO:0009791)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription regulatory region DNA binding (GO:0044212)	p.R1029W(1)		NS(1)|breast(2)|endometrium(13)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	Prostate(12;0.016)|all_hematologic(501;0.215)					GAAAAAGGCCCGGGCAGTGTC	0.597																																					p.R1029R		.											.	ARID5B-94	1	Substitution - Missense(1)	large_intestine(1)	c.C3085A						.						62.0	70.0	67.0					10																	63852307		2203	4300	6503	SO:0001819	synonymous_variant	84159	exon10			AAGGCCCGGGCAG	M73837	CCDS31208.1, CCDS58082.1	10q11.22	2013-02-07			ENSG00000150347	ENSG00000150347		"""-"""	17362	protein-coding gene	gene with protein product		608538				11483573, 11478881	Standard	NM_032199		Approved	FLJ21150, MRF2	uc001jlt.2	Q14865	OTTHUMG00000018298	ENST00000279873.7:c.3085C>A	10.37:g.63852307C>A		Somatic	184	0		WXS	Illumina HiSeq	Phase_I	131	44	NM_032199	0	0	11	27	16	B4DLB3|Q05DG6|Q32Q59|Q5VST4|Q6NZ42|Q7Z3M4|Q8N421|Q9H786	Silent	SNP	ENST00000279873.7	37	CCDS31208.1																																																																																			.		0.597	ARID5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048233.1	XM_084482	
PTPRJ	5795	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	48181586	48181586	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr11:48181586T>A	ENST00000418331.2	+	22	3895	c.3543T>A	c.(3541-3543)gaT>gaA	p.D1181E		NM_002843.3	NP_002834.3	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J	1181	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				contact inhibition (GO:0060242)|heart development (GO:0007507)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of vascular permeability (GO:0043116)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of cell adhesion (GO:0045785)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion (GO:0030155)|vasculogenesis (GO:0001570)	cell projection (GO:0042995)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|mitogen-activated protein kinase binding (GO:0051019)|phosphatase activity (GO:0016791)|platelet-derived growth factor receptor binding (GO:0005161)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|endometrium(7)|kidney(7)|large_intestine(5)|lung(15)|ovary(1)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						CCATCAGAGATTTCACAGTGA	0.393																																					p.D1181E		.											.	PTPRJ-541	0			c.T3543A						.						109.0	99.0	102.0					11																	48181586		2201	4298	6499	SO:0001583	missense	5795	exon22			CAGAGATTTCACA	U10886	CCDS7945.1, CCDS44596.1	11p11.2	2013-02-11			ENSG00000149177	ENSG00000149177		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9673	protein-coding gene	gene with protein product		600925				7937872, 7994032	Standard	NM_001098503		Approved	DEP1, HPTPeta, CD148	uc001ngp.4	Q12913	OTTHUMG00000166573	ENST00000418331.2:c.3543T>A	11.37:g.48181586T>A	ENSP00000400010:p.Asp1181Glu	Somatic	160	0		WXS	Illumina HiSeq	Phase_I	145	56	NM_002843	0	0	32	69	37	Q15255|Q6P4H4|Q8NHM2|Q9UDA9	Missense_Mutation	SNP	ENST00000418331.2	37	CCDS7945.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.277957	0.80692	.	.	ENSG00000149177	ENST00000418331	D	0.82526	-1.62	5.53	4.46	0.54185	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	.	.	.	.	T	0.59542	0.2201	N	0.02658	-0.545	0.80722	D	1	P	0.41131	0.739	B	0.44133	0.442	T	0.59537	-0.7436	9	0.07813	T	0.8	.	4.5662	0.12187	0.0:0.3223:0.0:0.6777	.	1181	Q12913	PTPRJ_HUMAN	E	1181	ENSP00000400010:D1181E	ENSP00000400010:D1181E	D	+	3	2	PTPRJ	48138162	0.990000	0.36364	1.000000	0.80357	0.994000	0.84299	0.202000	0.17295	1.076000	0.40961	0.529000	0.55759	GAT	.		0.393	PTPRJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390525.1		
CAPN1	823	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	64974118	64974118	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr11:64974118T>G	ENST00000527323.1	+	12	1778	c.1538T>G	c.(1537-1539)tTc>tGc	p.F513C	CAPN1_ENST00000524773.1_Missense_Mutation_p.F513C|CAPN1_ENST00000279247.6_Missense_Mutation_p.F513C|CAPN1_ENST00000533820.1_Missense_Mutation_p.F513C|CAPN1_ENST00000533129.1_Missense_Mutation_p.F513C			P07384	CAN1_HUMAN	calpain 1, (mu/I) large subunit	513	Domain III.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell proliferation (GO:0008284)|proteolysis (GO:0006508)|receptor catabolic process (GO:0032801)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			breast(2)|endometrium(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)	13		Lung NSC(402;0.094)|Melanoma(852;0.16)		Lung(977;0.00168)|LUSC - Lung squamous cell carcinoma(976;0.00813)		GTGCTGCGCTTCTTCTCAGAG	0.652																																					p.F513C		.											.	CAPN1-91	0			c.T1538G						.						30.0	34.0	33.0					11																	64974118		2089	4209	6298	SO:0001583	missense	823	exon13			TGCGCTTCTTCTC	X04366	CCDS44644.1	11q13	2013-01-10			ENSG00000014216	ENSG00000014216	3.4.22.52	"""EF-hand domain containing"""	1476	protein-coding gene	gene with protein product		114220				3017764, 2209092	Standard	NM_005186		Approved	muCANP, muCL, CANP, CANPL1	uc009yqd.2	P07384	OTTHUMG00000165614	ENST00000527323.1:c.1538T>G	11.37:g.64974118T>G	ENSP00000431984:p.Phe513Cys	Somatic	57	0		WXS	Illumina HiSeq	Phase_I	53	12	NM_001198869	0	0	366	714	348	Q2TTR0|Q6DHV4	Missense_Mutation	SNP	ENST00000527323.1	37	CCDS44644.1	.	.	.	.	.	.	.	.	.	.	T	22.0	4.227125	0.79576	.	.	ENSG00000014216	ENST00000533820;ENST00000533129;ENST00000524773;ENST00000279247;ENST00000259755;ENST00000527323	D;D;D;D;D	0.87103	-2.21;-2.21;-2.21;-2.21;-2.21	5.06	5.06	0.68205	Peptidase C2, calpain, large subunit, domain III (2);Peptidase C2, calpain, domain III (1);	0.209169	0.43416	D	0.000576	D	0.88171	0.6365	L	0.33753	1.03	0.46774	D	0.999196	P	0.48350	0.909	P	0.59115	0.852	D	0.89382	0.3682	10	0.87932	D	0	.	12.7595	0.57356	0.0:0.0:0.0:1.0	.	513	P07384	CAN1_HUMAN	C	513;513;513;513;459;513	ENSP00000435272:F513C;ENSP00000431686:F513C;ENSP00000434176:F513C;ENSP00000279247:F513C;ENSP00000431984:F513C	ENSP00000259755:F459C	F	+	2	0	CAPN1	64730694	1.000000	0.71417	1.000000	0.80357	0.669000	0.39330	7.950000	0.87804	1.897000	0.54924	0.379000	0.24179	TTC	.		0.652	CAPN1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385325.1		
MALAT1	378938	ucsc.edu;bcgsc.ca	37	11	65271872	65271872	+	lincRNA	SNP	T	T	C			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr11:65271872T>C	ENST00000534336.1	+	0	6640					NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		ACTGTTCTGATCCCGCTGCTA	0.393																																					.													.	.	0			.						.						47.0	45.0	45.0					11																	65271872		874	1988	2862			378938	.			TTCTGATCCCGCT	AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65271872T>C		Somatic	52	0		WXS	Illumina HiSeq		49	19	.	0	0	10	23	13		RNA	SNP	ENST00000534336.1	37																																																																																				.		0.393	MALAT1-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000389143.1	NR_002819	
RNF26	79102	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	119206410	119206410	+	Missense_Mutation	SNP	G	G	A	rs200033048		TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr11:119206410G>A	ENST00000311413.4	+	1	1174	c.578G>A	c.(577-579)aGc>aAc	p.S193N	RP11-334E6.10_ENST00000501918.2_RNA	NM_032015.4	NP_114404.1	Q9BY78	RNF26_HUMAN	ring finger protein 26	193						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(1)|lung(7)|ovary(1)|prostate(1)	12		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.8e-05)		CACATTTCCAGCAGTGCTGTG	0.622																																					p.S193N		.											.	RNF26-227	0			c.G578A						.	G	ASN/SER	0,4398		0,0,2199	115.0	95.0	102.0		578	5.1	1.0	11		102	1,8589	1.2+/-3.3	0,1,4294	no	missense	RNF26	NM_032015.3	46	0,1,6493	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	193/434	119206410	1,12987	2199	4295	6494	SO:0001583	missense	79102	exon1			TTTCCAGCAGTGC	AB055622	CCDS8419.1	11q23	2008-07-21				ENSG00000173456		"""RING-type (C3HC4) zinc fingers"""	14646	protein-coding gene	gene with protein product	"""ring finger protein with leucine zipper"""	606130				11352657	Standard	NM_032015		Approved	MGC2642	uc001pwh.3	Q9BY78		ENST00000311413.4:c.578G>A	11.37:g.119206410G>A	ENSP00000312439:p.Ser193Asn	Somatic	72	0		WXS	Illumina HiSeq	Phase_I	69	28	NM_032015	0	0	20	36	16	Q542Y8	Missense_Mutation	SNP	ENST00000311413.4	37	CCDS8419.1	.	.	.	.	.	.	.	.	.	.	G	16.69	3.192453	0.58017	0.0	1.16E-4	ENSG00000173456	ENST00000311413	T	0.79653	-1.29	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.73613	0.3609	L	0.32530	0.975	0.47659	D	0.999484	D	0.53312	0.959	P	0.46940	0.532	T	0.71024	-0.4712	10	0.26408	T	0.33	-16.3913	11.0828	0.48070	0.0844:0.0:0.9156:0.0	.	193	Q9BY78	RNF26_HUMAN	N	193	ENSP00000312439:S193N	ENSP00000312439:S193N	S	+	2	0	RNF26	118711620	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.210000	0.65214	2.393000	0.81446	0.561000	0.74099	AGC	G|0.999;A|0.001		0.622	RNF26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388220.1	NM_032015	
H2AFJ	55766	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	14927594	14927594	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr12:14927594C>G	ENST00000544848.1	+	1	325	c.190C>G	c.(190-192)Ctg>Gtg	p.L64V		NM_177925.2	NP_808760.1	Q9BTM1	H2AJ_HUMAN	H2A histone family, member J	64						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|central_nervous_system(1)|kidney(1)|ovary(1)|skin(1)	5						GGCGGAGATCCTGGAGCTGGC	0.632																																					p.L64V		.											.	H2AFJ-69	0			c.C190G						.						49.0	56.0	54.0					12																	14927594		2203	4300	6503	SO:0001583	missense	55766	exon1			GAGATCCTGGAGC	AK001765	CCDS31752.1	12p12.3	2012-09-11			ENSG00000246705	ENSG00000246705		"""Histones / Replication-independent"""	14456	protein-coding gene	gene with protein product							Standard	NM_177925		Approved	FLJ10903, MGC921	uc009zia.3	Q9BTM1	OTTHUMG00000168736	ENST00000544848.1:c.190C>G	12.37:g.14927594C>G	ENSP00000438553:p.Leu64Val	Somatic	139	0		WXS	Illumina HiSeq	Phase_I	105	36	NM_177925	0	0	97	173	76	Q9NV63	Missense_Mutation	SNP	ENST00000544848.1	37	CCDS31752.1	.	.	.	.	.	.	.	.	.	.	C	13.94	2.387309	0.42308	.	.	ENSG00000246705	ENST00000544848;ENST00000228929	T;T	0.72282	-0.64;-0.64	4.67	3.78	0.43462	Histone-fold (2);Histone core (1);Histone H2A (2);	.	.	.	.	T	0.81489	0.4833	H	0.97158	3.95	0.45139	D	0.998151	B	0.22800	0.075	B	0.30251	0.113	D	0.84014	0.0350	9	0.87932	D	0	.	13.3675	0.60694	0.0:0.8405:0.1594:0.0	.	64	Q9BTM1	H2AJ_HUMAN	V	64	ENSP00000438553:L64V;ENSP00000228929:L64V	ENSP00000228929:L64V	L	+	1	2	H2AFJ	14818861	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.833000	0.55790	1.571000	0.49722	-0.156000	0.13503	CTG	.		0.632	H2AFJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400845.1	NM_177925	
MRPS35	60488	hgsc.bcm.edu	37	12	27877051	27877051	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr12:27877051G>C	ENST00000081029.3	+	5	525	c.454G>C	c.(454-456)Gac>Cac	p.D152H	MRPS35_ENST00000538315.1_Missense_Mutation_p.D152H	NM_021821.3	NP_068593.2	Q9Y2Q9	RT28_HUMAN	mitochondrial ribosomal protein S35	0						mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|lung(2)|urinary_tract(1)	6	Lung SC(9;0.0873)					AATTGAAATTGACAGCACTGA	0.363																																					p.D152H		.											.	MRPS35-90	0			c.G454C						.						83.0	77.0	79.0					12																	27877051		2203	4300	6503	SO:0001583	missense	60488	exon5			GAAATTGACAGCA	AF182422	CCDS8714.1, CCDS53769.1	12p11	2012-09-13			ENSG00000061794	ENSG00000061794		"""Mitochondrial ribosomal proteins / small subunits"""	16635	protein-coding gene	gene with protein product		611995				11279123	Standard	NM_021821		Approved	MRPS28, MDS023	uc001rih.3	P82673	OTTHUMG00000169215	ENST00000081029.3:c.454G>C	12.37:g.27877051G>C	ENSP00000081029:p.Asp152His	Somatic	70	0		WXS	Illumina HiSeq	Phase_I	38	2	NM_001190864	0	0	70	70	0	B2RDZ7|Q96Q21	Missense_Mutation	SNP	ENST00000081029.3	37	CCDS8714.1	.	.	.	.	.	.	.	.	.	.	G	13.47	2.246246	0.39697	.	.	ENSG00000061794	ENST00000081029;ENST00000321446;ENST00000538315	T;T	0.44881	0.94;0.91	5.73	4.83	0.62350	Ribosomal protein S24/S35, mitochondrial, conserved domain (1);	0.315846	0.38272	N	0.001760	T	0.38612	0.1047	N	0.25647	0.755	0.35298	D	0.78274	P;P	0.50710	0.938;0.915	P;P	0.51355	0.537;0.667	T	0.51576	-0.8688	10	0.46703	T	0.11	-28.0696	9.2958	0.37815	0.076:0.1453:0.7788:0.0	.	152;152	P82673-2;P82673	.;RT35_HUMAN	H	152	ENSP00000081029:D152H;ENSP00000445390:D152H	ENSP00000081029:D152H	D	+	1	0	MRPS35	27768318	1.000000	0.71417	0.997000	0.53966	0.984000	0.73092	3.238000	0.51352	1.411000	0.46957	0.655000	0.94253	GAC	.		0.363	MRPS35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402897.1	NM_021821	
CPM	1368	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	69326479	69326479	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr12:69326479T>A	ENST00000551568.1	-	2	199	c.139A>T	c.(139-141)Agt>Tgt	p.S47C	CPM_ENST00000546373.1_Missense_Mutation_p.S47C|CPM_ENST00000338356.3_Missense_Mutation_p.S47C	NM_001005502.2|NM_198320.3	NP_001005502.1|NP_938079.1	P14384	CBPM_HUMAN	carboxypeptidase M	47					anatomical structure morphogenesis (GO:0009653)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(6)|prostate(2)	9	all_epithelial(5;1.09e-35)|Lung NSC(4;1.47e-33)|all_lung(4;1.02e-31)|Breast(13;1.59e-06)		all cancers(2;2.69e-50)|GBM - Glioblastoma multiforme(2;7.34e-41)|BRCA - Breast invasive adenocarcinoma(5;5.38e-10)|Lung(24;4.61e-05)|LUAD - Lung adenocarcinoma(15;0.000376)|STAD - Stomach adenocarcinoma(21;0.00372)|Kidney(9;0.143)			TTCCCAATACTGTGTAAGTGA	0.473																																					p.S47C		.											.	CPM-650	0			c.A139T						.						117.0	109.0	112.0					12																	69326479		2203	4300	6503	SO:0001583	missense	1368	exon2			CAATACTGTGTAA	AF368463	CCDS8987.1	12q15	2012-02-10			ENSG00000135678	ENSG00000135678	3.4.17.12		2311	protein-coding gene	gene with protein product	"""renal carboxypeptidase"", ""urinary carboxypeptidase B"""	114860				8586455	Standard	NM_001874		Approved		uc001suq.3	P14384	OTTHUMG00000169300	ENST00000551568.1:c.139A>T	12.37:g.69326479T>A	ENSP00000448517:p.Ser47Cys	Somatic	108	0		WXS	Illumina HiSeq	Phase_I	104	53	NM_001005502	0	0	45	85	40	B2R800|Q9H2K9	Missense_Mutation	SNP	ENST00000551568.1	37	CCDS8987.1	.	.	.	.	.	.	.	.	.	.	T	15.94	2.981836	0.53827	.	.	ENSG00000135678	ENST00000551568;ENST00000338356;ENST00000546373;ENST00000548954;ENST00000548262;ENST00000549781	T;T;T;T;T;T	0.12984	2.63;2.63;2.63;2.63;2.63;3.2	4.24	4.24	0.50183	Peptidase M14, carboxypeptidase A (2);	0.000000	0.85682	D	0.000000	T	0.29850	0.0746	H	0.94183	3.505	0.58432	D	0.999997	B	0.28324	0.207	B	0.34418	0.182	T	0.18650	-1.0330	9	.	.	.	-17.8592	11.2744	0.49157	0.0:0.0:0.0:1.0	.	47	P14384	CBPM_HUMAN	C	47	ENSP00000448517:S47C;ENSP00000339157:S47C;ENSP00000447255:S47C;ENSP00000446799:S47C;ENSP00000449911:S47C;ENSP00000448078:S47C	.	S	-	1	0	CPM	67612746	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.980000	0.49321	1.899000	0.54978	0.460000	0.39030	AGT	.		0.473	CPM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403355.1	NM_198320	
DUSP6	1848	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	89744677	89744677	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr12:89744677A>G	ENST00000279488.7	-	2	1757	c.526T>C	c.(526-528)Tct>Cct	p.S176P	DUSP6_ENST00000308385.6_Intron|DUSP6_ENST00000547291.1_Missense_Mutation_p.S51P|DUSP6_ENST00000547140.1_5'UTR	NM_001946.2	NP_001937.2	Q16828	DUS6_HUMAN	dual specificity phosphatase 6	176					cell differentiation (GO:0030154)|dorsal/ventral pattern formation (GO:0009953)|inactivation of MAPK activity (GO:0000188)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of apoptotic process (GO:0043065)|regulation of endodermal cell fate specification (GO:0042663)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of heart growth (GO:0060420)|response to drug (GO:0042493)|response to nitrosative stress (GO:0051409)|response to organic cyclic compound (GO:0014070)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)			large_intestine(5)|lung(8)|skin(2)|urinary_tract(1)	16						TCCGAGGAAGAGTCAGAGCTG	0.607																																					p.S176P	Colon(132;3456 5224)	.											.	DUSP6-846	0			c.T526C						.						53.0	48.0	50.0					12																	89744677		2203	4300	6503	SO:0001583	missense	1848	exon2			AGGAAGAGTCAGA	BC037236	CCDS9033.1, CCDS9034.1	12q22-q23	2011-06-09				ENSG00000139318		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3072	protein-coding gene	gene with protein product		602748				8626780, 9205128	Standard	NM_001946		Approved	MKP-3, PYST1	uc001tay.3	Q16828		ENST00000279488.7:c.526T>C	12.37:g.89744677A>G	ENSP00000279488:p.Ser176Pro	Somatic	72	0		WXS	Illumina HiSeq	Phase_I	63	28	NM_001946	0	0	98	156	58	O75109|Q53Y75|Q9BSH6	Missense_Mutation	SNP	ENST00000279488.7	37	CCDS9033.1	.	.	.	.	.	.	.	.	.	.	A	17.70	3.455071	0.63290	.	.	ENSG00000139318	ENST00000279488;ENST00000547291	T;T	0.03035	4.28;4.07	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.05090	0.0136	L	0.44542	1.39	0.80722	D	1	B	0.10296	0.003	B	0.06405	0.002	T	0.43940	-0.9360	10	0.22706	T	0.39	.	16.0353	0.80625	1.0:0.0:0.0:0.0	.	176	Q16828	DUS6_HUMAN	P	176;51	ENSP00000279488:S176P;ENSP00000449838:S51P	ENSP00000279488:S176P	S	-	1	0	DUSP6	88268808	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	4.624000	0.61254	2.178000	0.69098	0.533000	0.62120	TCT	.		0.607	DUSP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406534.2	NM_001946, NM_022652	
PRPF39	55015	hgsc.bcm.edu	37	14	45579918	45579918	+	Silent	SNP	A	A	G			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr14:45579918A>G	ENST00000355765.6	+	10	1640	c.1470A>G	c.(1468-1470)gaA>gaG	p.E490E	SNORD127_ENST00000458892.1_RNA	NM_017922.3	NP_060392.3	Q86UA1	PRP39_HUMAN	pre-mRNA processing factor 39	490					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)				breast(2)|endometrium(2)|kidney(4)|lung(3)|ovary(1)	12						CAAATAATGAATCTTCATTTT	0.373																																					p.E490E		.											.	PRPF39-70	0			c.A1470G						.						31.0	27.0	29.0					14																	45579918		2200	4294	6494	SO:0001819	synonymous_variant	55015	exon10			TAATGAATCTTCA	AK000673	CCDS9682.2	14q21.1	2013-10-03	2013-10-03		ENSG00000185246	ENSG00000185246			20314	protein-coding gene	gene with protein product		614907	"""PRP39 pre-mRNA processing factor 39 homolog (yeast)"", ""PRP39 pre-mRNA processing factor 39 homolog (S. cerevisiae)"""				Standard	NM_017922		Approved	FLJ20666, FLJ11128	uc001wvz.4	Q86UA1	OTTHUMG00000140265	ENST00000355765.6:c.1470A>G	14.37:g.45579918A>G		Somatic	10	1		WXS	Illumina HiSeq	Phase_I	11	6	NM_017922	0	0	14	31	17	Q08AL1|Q08AL2|Q9NUU5	Silent	SNP	ENST00000355765.6	37	CCDS9682.2																																																																																			.		0.373	PRPF39-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319683.2		
ABCD4	5826	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	74756774	74756774	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr14:74756774G>T	ENST00000356924.4	-	13	1518	c.1375C>A	c.(1375-1377)Ctg>Atg	p.L459M	AC005519.4_ENST00000554532.2_RNA|ABCD4_ENST00000557554.1_5'Flank|ABCD4_ENST00000298816.7_Missense_Mutation_p.L355M	NM_005050.3	NP_005041.1	O14678	ABCD4_HUMAN	ATP-binding cassette, sub-family D (ALD), member 4	459	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cobalamin metabolic process (GO:0009235)|transmembrane transport (GO:0055085)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			cervix(2)|endometrium(3)|kidney(3)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	27				BRCA - Breast invasive adenocarcinoma(234;0.00153)		TTTTGTGGCAGGAATAGCACC	0.592											OREG0022800	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L459M		.											.	ABCD4-292	0			c.C1375A						.						80.0	82.0	82.0					14																	74756774		2203	4300	6503	SO:0001583	missense	5826	exon13			GTGGCAGGAATAG	AF009746	CCDS9828.1	14q24	2012-03-14			ENSG00000119688	ENSG00000119688		"""ATP binding cassette transporters / subfamily D"""	68	protein-coding gene	gene with protein product		603214		PXMP1L		9266848, 9302272	Standard	NR_003256		Approved	PMP69, P70R, EST352188	uc001xpr.2	O14678	OTTHUMG00000171207	ENST00000356924.4:c.1375C>A	14.37:g.74756774G>T	ENSP00000349396:p.Leu459Met	Somatic	147	0	1155	WXS	Illumina HiSeq	Phase_I	105	36	NM_005050	0	0	13	28	15	A8K5L7|Q6IAQ0|Q96E75	Missense_Mutation	SNP	ENST00000356924.4	37	CCDS9828.1	.	.	.	.	.	.	.	.	.	.	G	19.52	3.843870	0.71488	.	.	ENSG00000119688	ENST00000356924;ENST00000298816	D;D	0.95035	-2.78;-3.59	5.76	4.87	0.63330	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.64402	D	0.000001	D	0.96367	0.8815	M	0.66560	2.04	0.58432	D	0.999996	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.996;0.998;0.998	D	0.96434	0.9321	10	0.72032	D	0.01	.	11.9671	0.53042	0.1395:0.0:0.8605:0.0	.	355;459;459	F8W7M4;A8K5L7;O14678	.;.;ABCD4_HUMAN	M	459;355	ENSP00000349396:L459M;ENSP00000298816:L355M	ENSP00000298816:L355M	L	-	1	2	ABCD4	73826527	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	4.539000	0.60657	1.443000	0.47586	0.462000	0.41574	CTG	.		0.592	ABCD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314382.1	NM_005050	
GABRG3	2567	hgsc.bcm.edu	37	15	27271931	27271931	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr15:27271931A>G	ENST00000333743.6	+	3	487	c.233A>G	c.(232-234)tAt>tGt	p.Y78C	GABRG3_ENST00000555083.1_Missense_Mutation_p.Y78C	NM_033223.4	NP_150092.2	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 3	78					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(23)|skin(1)|upper_aerodigestive_tract(4)	42		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GTTGACATTTATGTTAACAGC	0.393																																					p.Y78C	NSCLC(114;800 1656 7410 37729 45293)	.											.	.	0			c.A233G						.						118.0	111.0	113.0					15																	27271931		1947	4162	6109	SO:0001583	missense	2567	exon3			ACATTTATGTTAA		CCDS45195.1, CCDS59251.1	15q12	2012-06-22			ENSG00000182256	ENSG00000182256		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4088	protein-coding gene	gene with protein product	"""GABA(G) receptor, gamma 3"""	600233				7601451	Standard	NM_033223		Approved		uc001zbg.2	Q99928	OTTHUMG00000044462	ENST00000333743.6:c.233A>G	15.37:g.27271931A>G	ENSP00000331912:p.Tyr78Cys	Somatic	47	0		WXS	Illumina HiSeq	Phase_I	37	2	NM_001270873	0	0	2	2	0	G3V594|Q9HD46|Q9NYT2	Missense_Mutation	SNP	ENST00000333743.6	37	CCDS45195.1	.	.	.	.	.	.	.	.	.	.	A	18.63	3.665142	0.67700	.	.	ENSG00000182256	ENST00000333743;ENST00000555083	T;T	0.78924	-1.22;-1.22	5.96	5.96	0.96718	Neurotransmitter-gated ion-channel ligand-binding (3);	0.261625	0.32533	N	0.005964	D	0.88897	0.6562	M	0.88105	2.93	0.45330	D	0.998323	D;D	0.71674	0.996;0.998	D;D	0.68621	0.95;0.959	D	0.90706	0.4624	10	0.87932	D	0	.	12.8256	0.57718	1.0:0.0:0.0:0.0	.	78;78	Q99928;G3V594	GBRG3_HUMAN;.	C	78	ENSP00000331912:Y78C;ENSP00000452244:Y78C	ENSP00000331912:Y78C	Y	+	2	0	GABRG3	24854677	1.000000	0.71417	1.000000	0.80357	0.664000	0.39144	4.829000	0.62737	2.270000	0.75569	0.533000	0.62120	TAT	.		0.393	GABRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103584.2		
FSIP1	161835	hgsc.bcm.edu	37	15	40034075	40034075	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr15:40034075A>G	ENST00000350221.3	-	6	795	c.586T>C	c.(586-588)Ttt>Ctt	p.F196L	FSIP1_ENST00000559692.1_5'UTR	NM_152597.4	NP_689810.3	Q8NA03	FSIP1_HUMAN	fibrous sheath interacting protein 1	196										NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(4)|ovary(2)|skin(4)|stomach(2)|urinary_tract(1)	23		all_cancers(109;2.66e-19)|all_epithelial(112;2.66e-16)|Lung NSC(122;1.5e-11)|all_lung(180;4.03e-10)|Melanoma(134;0.0575)|Ovarian(310;0.0827)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;8.22e-06)|BRCA - Breast invasive adenocarcinoma(123;0.142)		ACTGAGGAAAAGGTGTCTTCC	0.308																																					p.F196L		.											.	FSIP1-517	0			c.T586C						.						80.0	79.0	80.0					15																	40034075		2203	4298	6501	SO:0001583	missense	161835	exon6			AGGAAAAGGTGTC	BC045191	CCDS10050.1	15q14	2012-11-19			ENSG00000150667	ENSG00000150667			21674	protein-coding gene	gene with protein product		615795				14702039	Standard	NM_152597		Approved	FLJ35989	uc001zki.3	Q8NA03	OTTHUMG00000172456	ENST00000350221.3:c.586T>C	15.37:g.40034075A>G	ENSP00000280236:p.Phe196Leu	Somatic	49	0		WXS	Illumina HiSeq	Phase_I	24	2	NM_152597	0	0	2	2	0	Q6X2C8|Q86Y89	Missense_Mutation	SNP	ENST00000350221.3	37	CCDS10050.1	.	.	.	.	.	.	.	.	.	.	A	12.32	1.903946	0.33628	.	.	ENSG00000150667	ENST00000350221	T	0.24908	1.83	5.44	0.0699	0.14376	.	0.379516	0.22348	N	0.061248	T	0.14313	0.0346	L	0.31664	0.95	0.09310	N	1	B	0.13594	0.008	B	0.13407	0.009	T	0.22977	-1.0201	9	.	.	.	-2.6282	6.4892	0.22105	0.414:0.494:0.0919:0.0	.	196	Q8NA03	FSIP1_HUMAN	L	196	ENSP00000280236:F196L	.	F	-	1	0	FSIP1	37821367	0.499000	0.26083	0.008000	0.14137	0.003000	0.03518	1.386000	0.34419	0.037000	0.15575	-0.313000	0.08912	TTT	.		0.308	FSIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252118.2	NM_152597	
PPIB	5479	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	64454355	64454355	+	Splice_Site	SNP	T	T	C			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr15:64454355T>C	ENST00000300026.3	-	2	354		c.e2-2		PPIB_ENST00000558492.1_Intron	NM_000942.4	NP_000933.1	P23284	PPIB_HUMAN	peptidylprolyl isomerase B (cyclophilin B)						bone development (GO:0060348)|chaperone-mediated protein folding (GO:0061077)|extracellular matrix organization (GO:0030198)|positive regulation of multicellular organism growth (GO:0040018)|protein peptidyl-prolyl isomerization (GO:0000413)|protein stabilization (GO:0050821)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|macromolecular complex (GO:0032991)|membrane (GO:0016020)|nucleus (GO:0005634)	peptide binding (GO:0042277)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|unfolded protein binding (GO:0051082)			kidney(2)|large_intestine(2)|lung(6)	10					L-Proline(DB00172)	AAAATACACCTGAGGAAAGAG	0.463																																					.	GBM(105;399 1481 32889 33051 36637)	.											.	PPIB-90	0			c.136-2A>G						.						132.0	141.0	138.0					15																	64454355		2203	4300	6503	SO:0001630	splice_region_variant	5479	exon3			TACACCTGAGGAA		CCDS10191.1	15q21-q22	2014-09-17			ENSG00000166794	ENSG00000166794	5.2.1.8		9255	protein-coding gene	gene with protein product		123841				2000394, 20089953	Standard	NM_000942		Approved	CYPB, OI9	uc002and.3	P23284	OTTHUMG00000133018	ENST00000300026.3:c.136-2A>G	15.37:g.64454355T>C		Somatic	220	0		WXS	Illumina HiSeq	Phase_I	187	80	NM_000942	0	0	0	2	2	A8K534|Q6IBH5|Q9BVK5	Splice_Site	SNP	ENST00000300026.3	37	CCDS10191.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.086591	0.76642	.	.	ENSG00000166794	ENST00000300026	.	.	.	5.57	5.57	0.84162	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3959	0.74794	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	PPIB	62241408	1.000000	0.71417	0.976000	0.42696	0.823000	0.46562	7.490000	0.81461	2.121000	0.65114	0.374000	0.22700	.	.		0.463	PPIB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256604.1		Intron
ULK3	25989	hgsc.bcm.edu	37	15	75132966	75132966	+	Silent	SNP	T	T	C			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr15:75132966T>C	ENST00000440863.2	-	5	577	c.486A>G	c.(484-486)caA>caG	p.Q162Q	ULK3_ENST00000569437.1_Silent_p.Q162Q|ULK3_ENST00000568667.1_Silent_p.Q173Q	NM_001099436.1	NP_001092906	Q6PHR2	ULK3_HUMAN	unc-51 like kinase 3	162	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				autophagic vacuole assembly (GO:0000045)|autophagy (GO:0006914)|cellular senescence (GO:0090398)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of smoothened signaling pathway (GO:0045880)|protein autophosphorylation (GO:0046777)|regulation of autophagy (GO:0010506)	ATG1/UKL1 signaling complex (GO:0034273)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|pre-autophagosomal structure (GO:0000407)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)	2						GGGACATGTGTTGTGCGAAAC	0.612																																					p.Q162Q		.											.	ULK3-290	0			c.A486G						.						29.0	32.0	31.0					15																	75132966		2095	4222	6317	SO:0001819	synonymous_variant	25989	exon5			CATGTGTTGTGCG	BC048289		15q24.1	2013-07-02	2013-07-02			ENSG00000140474			19703	protein-coding gene	gene with protein product		613472	"""unc-51-like kinase 3 (C. elegans)"""				Standard	XM_005254289		Approved	DKFZP434C131, FLJ90566	uc010bkf.1	Q6PHR2		ENST00000440863.2:c.486A>G	15.37:g.75132966T>C		Somatic	80	0		WXS	Illumina HiSeq	Phase_I	37	3	NM_001099436	0	0	30	30	0	B2RXK3|B4DRQ7|D3DW68|Q9NPN5|Q9UFS4	Silent	SNP	ENST00000440863.2	37	CCDS45305.1																																																																																			.		0.612	ULK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000421734.4	NM_015518	
GPR97	222487	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	57719830	57719830	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr16:57719830C>T	ENST00000333493.4	+	11	1693	c.1532C>T	c.(1531-1533)tCc>tTc	p.S511F	RP11-405F3.4_ENST00000563062.1_RNA|GPR97_ENST00000450388.3_Missense_Mutation_p.S391F|GPR97_ENST00000327655.6_Missense_Mutation_p.S301F	NM_170776.4	NP_740746.4	Q86Y34	GPR97_HUMAN	G protein-coupled receptor 97	511					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						CTTTTCAACTCCTTGCAAGGT	0.597																																					p.S511F		.											.	GPR97-91	0			c.C1532T						.						88.0	82.0	84.0					16																	57719830		2198	4300	6498	SO:0001583	missense	222487	exon11			TCAACTCCTTGCA	AY140959	CCDS10786.1	16q13	2014-08-08			ENSG00000182885	ENSG00000182885		"""-"", ""GPCR / Class B : Orphans"""	13728	protein-coding gene	gene with protein product						12435584, 222487	Standard	NM_170776		Approved	Pb99, PGR26	uc002emh.3	Q86Y34	OTTHUMG00000133458	ENST00000333493.4:c.1532C>T	16.37:g.57719830C>T	ENSP00000332900:p.Ser511Phe	Somatic	187	0		WXS	Illumina HiSeq	Phase_I	120	52	NM_170776	0	0	0	0	0	Q6ZMF4|Q86SL9|Q8IZF1	Missense_Mutation	SNP	ENST00000333493.4	37	CCDS10786.1	.	.	.	.	.	.	.	.	.	.	C	19.05	3.752027	0.69533	.	.	ENSG00000182885	ENST00000333493;ENST00000327655;ENST00000450388	T;T;T	0.56611	0.45;0.45;0.45	5.62	5.62	0.85841	GPCR, family 2-like (1);	0.000000	0.56097	D	0.000025	T	0.80737	0.4680	M	0.93939	3.475	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85478	0.1177	10	0.87932	D	0	.	18.6332	0.91368	0.0:1.0:0.0:0.0	.	511	Q86Y34	GPR97_HUMAN	F	511;301;391	ENSP00000332900:S511F;ENSP00000331199:S301F;ENSP00000404803:S391F	ENSP00000331199:S301F	S	+	2	0	GPR97	56277331	1.000000	0.71417	0.998000	0.56505	0.375000	0.29983	4.512000	0.60469	2.647000	0.89833	0.655000	0.94253	TCC	.		0.597	GPR97-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257333.2	NM_170776	
KIFC3	3801	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	57806198	57806198	+	Silent	SNP	T	T	C			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr16:57806198T>C	ENST00000379655.4	-	4	575	c.318A>G	c.(316-318)gtA>gtG	p.V106V	KIFC3_ENST00000540079.2_Silent_p.V4V|KIFC3_ENST00000421376.2_5'UTR|KIFC3_ENST00000445690.2_Silent_p.V106V|KIFC3_ENST00000566975.1_5'UTR|KIFC3_ENST00000543930.1_5'UTR|KIFC3_ENST00000562903.1_5'UTR|KIFC3_ENST00000465878.2_5'UTR|KIFC3_ENST00000539578.1_Silent_p.V48V|KIFC3_ENST00000541240.1_Silent_p.V128V	NM_005550.3	NP_005541.3	Q9BVG8	KIFC3_HUMAN	kinesin family member C3	106					ATP catabolic process (GO:0006200)|epithelial cell-cell adhesion (GO:0090136)|Golgi organization (GO:0007030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|visual perception (GO:0007601)|zonula adherens maintenance (GO:0045218)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|zonula adherens (GO:0005915)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(2)|central_nervous_system(3)|endometrium(4)|large_intestine(3)|lung(6)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23		all_neural(199;0.224)				TCAGGTGTTCTACCTGTGGGC	0.617																																					p.V106V		.											.	KIFC3-91	0			c.A318G						.						117.0	92.0	101.0					16																	57806198		2198	4300	6498	SO:0001819	synonymous_variant	3801	exon4			GTGTTCTACCTGT	BC001211	CCDS10789.2, CCDS45493.1, CCDS45494.1	16q13-q21	2008-02-05			ENSG00000140859	ENSG00000140859		"""Kinesins"""	6326	protein-coding gene	gene with protein product		604535				9782090	Standard	NM_001130099		Approved		uc002emp.3	Q9BVG8	OTTHUMG00000133455	ENST00000379655.4:c.318A>G	16.37:g.57806198T>C		Somatic	99	0		WXS	Illumina HiSeq	Phase_I	79	31	NM_001130100	0	0	0	1	1	A8K6S2|B7Z484|O75299|Q49A29|Q49AQ0|Q59G19|Q8IUT3|Q96HW6	Silent	SNP	ENST00000379655.4	37	CCDS10789.2																																																																																			.		0.617	KIFC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257329.2	NM_005550	
GSE1	23199	hgsc.bcm.edu	37	16	85706125	85706125	+	Silent	SNP	C	C	T			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr16:85706125C>T	ENST00000253458.7	+	16	3810	c.3634C>T	c.(3634-3636)Ctg>Ttg	p.L1212L	GSE1_ENST00000393243.1_Silent_p.L1139L|GSE1_ENST00000471070.1_3'UTR|GSE1_ENST00000405402.2_Silent_p.L1108L	NM_014615.2	NP_055430.1	Q14687	GSE1_HUMAN	Gse1 coiled-coil protein	1212																	TAGGGGCTACCTGAAGGGATA	0.453																																					p.L1212L		.											.	.	0			c.C3634T						.						59.0	48.0	51.0					16																	85706125		2198	4300	6498	SO:0001819	synonymous_variant	23199	exon16			GGCTACCTGAAGG	D80004	CCDS10952.1, CCDS45539.1, CCDS62007.1	16q24.1	2012-12-07	2012-12-07	2012-10-02	ENSG00000131149	ENSG00000131149			28979	protein-coding gene	gene with protein product	"""genetic suppressor element 1"""		"""KIAA0182"", ""Gse1 coiled-coil protein homolog (mouse)"""	KIAA0182		8724849, 8786132	Standard	NM_014615		Approved		uc002fix.4	Q14687	OTTHUMG00000137650	ENST00000253458.7:c.3634C>T	16.37:g.85706125C>T		Somatic	62	0		WXS	Illumina HiSeq	Phase_I	40	2	NM_014615	1	0	45	46	0	D3DUM4|Q8IY61|Q96GA4|Q9BW09	Silent	SNP	ENST00000253458.7	37	CCDS10952.1																																																																																			.		0.453	GSE1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325527.1	NM_014615	
MYO1C	4641	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	1370772	1370772	+	Splice_Site	SNP	A	A	C			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr17:1370772A>C	ENST00000575158.1	-	30	3137		c.e30+1		MYO1C_ENST00000438665.2_Splice_Site|MYO1C_ENST00000361007.2_Splice_Site|MYO1C_ENST00000359786.5_Splice_Site|MYO1C_ENST00000545534.2_Splice_Site			Q12965	MYO1E_HUMAN	myosin IC						actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|endocytosis (GO:0006897)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|glomerular visceral epithelial cell development (GO:0072015)|in utero embryonic development (GO:0001701)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic hemopoiesis (GO:0035166)|vasculogenesis (GO:0001570)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|phosphatidylinositol binding (GO:0035091)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|liver(2)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	17				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		CCCGCGCCTCACCTGCCCTGG	0.677																																					.		.											.	MYO1C-90	0			c.2960+2T>G						.						64.0	58.0	60.0					17																	1370772		2203	4299	6502	SO:0001630	splice_region_variant	4641	exon31			CGCCTCACCTGCC	X98507	CCDS11003.1, CCDS42226.1, CCDS45562.1	17p13.3	2011-09-27			ENSG00000197879	ENSG00000197879		"""Myosins / Myosin superfamily : Class I"""	7597	protein-coding gene	gene with protein product		606538				9119401	Standard	NM_001080779		Approved	myr2	uc002fsp.3	O00159	OTTHUMG00000090323	ENST00000575158.1:c.2960+1T>G	17.37:g.1370772A>C		Somatic	81	0		WXS	Illumina HiSeq	Phase_I	82	36	NM_033375	0	0	0	10	10	Q14778	Splice_Site	SNP	ENST00000575158.1	37	CCDS11003.1	.	.	.	.	.	.	.	.	.	.	a	23.7	4.448047	0.84101	.	.	ENSG00000197879	ENST00000359786;ENST00000438665;ENST00000535856;ENST00000361007;ENST00000545534	.	.	.	5.31	5.31	0.75309	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.5923	0.68373	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MYO1C	1317522	1.000000	0.71417	0.994000	0.49952	0.936000	0.57629	9.119000	0.94362	2.231000	0.72958	0.456000	0.33151	.	.		0.677	MYO1C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438694.2		Intron
LUC7L3	51747	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	48818486	48818486	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr17:48818486T>C	ENST00000505658.1	+	4	419	c.230T>C	c.(229-231)aTg>aCg	p.M77T	LUC7L3_ENST00000393227.2_Missense_Mutation_p.M77T|LUC7L3_ENST00000544170.1_Start_Codon_SNP_p.M1T|LUC7L3_ENST00000240304.1_Missense_Mutation_p.M77T			O95232	LC7L3_HUMAN	LUC7-like 3 (S. cerevisiae)	77					mRNA splice site selection (GO:0006376)|RNA splicing (GO:0008380)	focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|U1 snRNP (GO:0005685)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)	12						TCTCGTTTCATGAAAGTTGGC	0.383																																					p.M77T		.											.	LUC7L3-90	0			c.T230C						.						180.0	182.0	181.0					17																	48818486		2203	4300	6503	SO:0001583	missense	51747	exon4			GTTTCATGAAAGT		CCDS11573.1	17q21.33	2010-02-17			ENSG00000108848	ENSG00000108848			24309	protein-coding gene	gene with protein product	"""cisplatin resistance associated overexpressed protein"", ""CRE-associated protein"""	609434				10631324, 12565863	Standard	NM_016424		Approved	LUC7A, CROP, OA48-18, CREAP-1, FLJ11063, CRA, hLuc7A	uc002iss.3	O95232	OTTHUMG00000162257	ENST00000505658.1:c.230T>C	17.37:g.48818486T>C	ENSP00000425092:p.Met77Thr	Somatic	306	0		WXS	Illumina HiSeq	Phase_I	310	87	NM_006107	0	0	67	94	27	B3KN54|D3DTY1|Q6PHR9|Q9NUY0|Q9P2S7	Missense_Mutation	SNP	ENST00000505658.1	37	CCDS11573.1	.	.	.	.	.	.	.	.	.	.	T	20.9	4.064693	0.76187	.	.	ENSG00000108848	ENST00000505658;ENST00000393227;ENST00000240304;ENST00000542316;ENST00000505619;ENST00000544170;ENST00000510984	T;T;T;T;T	0.47528	1.31;1.31;1.31;1.03;0.84	5.95	4.83	0.62350	.	0.071512	0.85682	D	0.000000	T	0.39036	0.1063	L	0.31065	0.9	0.80722	D	1	D;B;B	0.53885	0.963;0.369;0.369	P;B;B	0.47786	0.557;0.171;0.237	T	0.11275	-1.0594	10	0.09338	T	0.73	-10.5258	13.4049	0.60906	0.0:0.0:0.1306:0.8694	.	1;77;77	B4DJ96;O95232;A8K3C5	.;LC7L3_HUMAN;.	T	77;77;77;77;126;1;1	ENSP00000425092:M77T;ENSP00000376919:M77T;ENSP00000240304:M77T;ENSP00000420933:M126T;ENSP00000444253:M1T	ENSP00000240304:M77T	M	+	2	0	LUC7L3	46173485	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.043000	0.64208	2.272000	0.75746	0.460000	0.39030	ATG	.		0.383	LUC7L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368205.2	NM_016424	
CLTC	1213	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	57724783	57724783	+	Missense_Mutation	SNP	A	A	T			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr17:57724783A>T	ENST00000269122.3	+	3	549	c.275A>T	c.(274-276)aAc>aTc	p.N92I	CLTC_ENST00000579456.1_Missense_Mutation_p.N92I|CLTC_ENST00000393043.1_Missense_Mutation_p.N92I	NM_004859.3	NP_004850.1	Q00610	CLH1_HUMAN	clathrin, heavy chain (Hc)	92	Globular terminal domain.|WD40-like repeat 2.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|mitotic nuclear division (GO:0007067)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|negative regulation of protein localization to plasma membrane (GO:1903077)|osteoblast differentiation (GO:0001649)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|transferrin transport (GO:0033572)	clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin complex (GO:0071439)|clathrin-coated endocytic vesicle membrane (GO:0030669)|clathrin-coated vesicle (GO:0030136)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	clathrin light chain binding (GO:0032051)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|structural molecule activity (GO:0005198)		CLTC/ALK(44)|CLTC/TFE3(2)	breast(2)|large_intestine(6)|ovary(1)	9	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					CAGATTTTTAACATTGAAATG	0.318			T	"""ALK, TFE3"""	"""ALCL, renal """																																p.N92I		.		Dom	yes		17	17q11-qter	1213	"""clathrin, heavy polypeptide (Hc)"""		L	.	CLTC-835	0			c.A275T						.						73.0	71.0	72.0					17																	57724783		2203	4300	6503	SO:0001583	missense	1213	exon3			TTTTTAACATTGA	X55878	CCDS32696.1, CCDS74115.1	17q23.1	2013-09-19	2006-09-29		ENSG00000141367	ENSG00000141367			2092	protein-coding gene	gene with protein product		118955	"""clathrin, heavy polypeptide (Hc)"", ""clathrin, heavy chain"", ""clathrin, heavy polypeptide-like 2"""	CLTCL2		1765375, 7584026	Standard	NM_004859		Approved	Hc	uc002ixq.1	Q00610	OTTHUMG00000134279	ENST00000269122.3:c.275A>T	17.37:g.57724783A>T	ENSP00000269122:p.Asn92Ile	Somatic	87	0		WXS	Illumina HiSeq	Phase_I	91	28	NM_004859	0	0	212	297	85	D3DU00|Q6N0A0|Q86TF2	Missense_Mutation	SNP	ENST00000269122.3	37	CCDS32696.1	.	.	.	.	.	.	.	.	.	.	A	22.1	4.244879	0.79912	.	.	ENSG00000141367	ENST00000269122;ENST00000393043	T;T	0.27256	1.68;1.68	5.79	5.79	0.91817	Clathrin, heavy chain, propeller, N-terminal (1);Clathrin, heavy chain, linker/propeller domain (1);	0.043886	0.85682	D	0.000000	T	0.63390	0.2507	H	0.94222	3.51	0.31520	N	0.662492	D;D	0.76494	0.994;0.999	D;D	0.79784	0.993;0.993	T	0.77419	-0.2595	10	0.87932	D	0	.	16.1376	0.81497	1.0:0.0:0.0:0.0	.	92;92	Q00610;Q00610-2	CLH1_HUMAN;.	I	92	ENSP00000269122:N92I;ENSP00000376763:N92I	ENSP00000269122:N92I	N	+	2	0	CLTC	55079565	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.339000	0.96797	2.212000	0.71576	0.533000	0.62120	AAC	.		0.318	CLTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258859.1	NM_004859	
BAHCC1	57597	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	79425869	79425869	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr17:79425869G>T	ENST00000307745.7	+	24	5479	c.5479G>T	c.(5479-5481)Gaa>Taa	p.E1827*	RP11-1055B8.8_ENST00000572590.1_RNA																							CCGCCTGCTGGAAAGCTTCGC	0.662																																					.													.	BAHCC1-23	0			.						.						17.0	22.0	20.0					17																	79425869		2091	4207	6298	SO:0001587	stop_gained	57597	.			CTGCTGGAAAGCT																												ENST00000307745.7:c.5479G>T	17.37:g.79425869G>T	ENSP00000303486:p.Glu1827*	Somatic	38	0		WXS	Illumina HiSeq	Phase_I	38	9	.	0	0	4	6	2		Nonsense_Mutation	SNP	ENST00000307745.7	37		.	.	.	.	.	.	.	.	.	.	G	44	10.877947	0.99482	.	.	ENSG00000171282	ENST00000307745	.	.	.	3.69	3.69	0.42338	.	0.124501	0.34200	U	0.004171	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	10.7766	0.46353	0.0:0.194:0.806:0.0	.	.	.	.	X	1827	.	ENSP00000303486:E1827X	E	+	1	0	AC110285.1	77040464	1.000000	0.71417	1.000000	0.80357	0.744000	0.42396	2.589000	0.46145	1.765000	0.52091	0.455000	0.32223	GAA	.		0.662	RP11-1055B8.7-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			
SUGP1	57794	hgsc.bcm.edu	37	19	19387814	19387814	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr19:19387814T>C	ENST00000247001.5	-	13	2200	c.1853A>G	c.(1852-1854)gAg>gGg	p.E618G		NM_172231.3	NP_757386.2	Q8IWZ8	SUGP1_HUMAN	SURP and G patch domain containing 1	618					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	nucleoplasm (GO:0005654)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(7)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(2)	22						CGCCTCATACTCGTCGTCCTC	0.637																																					p.E618G		.											.	SUGP1-91	0			c.A1853G						.						39.0	39.0	39.0					19																	19387814		2203	4300	6503	SO:0001583	missense	57794	exon13			TCATACTCGTCGT	AF521128	CCDS12399.1	19p13	2013-01-28	2010-08-10	2010-08-10		ENSG00000105705		"""G patch domain containing"""	18643	protein-coding gene	gene with protein product		607992	"""splicing factor 4"""	SF4		12594045	Standard	NM_172231		Approved	F23858, DKFZp434E2216, RBP	uc002nmh.3	Q8IWZ8		ENST00000247001.5:c.1853A>G	19.37:g.19387814T>C	ENSP00000247001:p.Glu618Gly	Somatic	52	0		WXS	Illumina HiSeq	Phase_I	36	2	NM_172231	0	0	34	34	0	O60378|Q6P3X9|Q8TCQ4|Q8WWT4|Q8WWT5|Q9NTG3	Missense_Mutation	SNP	ENST00000247001.5	37	CCDS12399.1	.	.	.	.	.	.	.	.	.	.	T	16.86	3.240159	0.58995	.	.	ENSG00000105705	ENST00000247001	T	0.28454	1.61	4.65	4.65	0.58169	.	0.000000	0.85682	D	0.000000	T	0.51092	0.1654	M	0.63843	1.955	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.53194	-0.8473	10	0.59425	D	0.04	.	12.9089	0.58169	0.0:0.0:0.0:1.0	.	618	Q8IWZ8	SUGP1_HUMAN	G	618	ENSP00000247001:E618G	ENSP00000247001:E618G	E	-	2	0	SUGP1	19248814	1.000000	0.71417	0.832000	0.32986	0.032000	0.12392	7.875000	0.87205	1.735000	0.51646	0.260000	0.18958	GAG	.		0.637	SUGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460128.4	NM_021164	
TBCB	1155	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	36606528	36606528	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr19:36606528C>G	ENST00000221855.3	+	1	641	c.66C>G	c.(64-66)ttC>ttG	p.F22L	TBCB_ENST00000586868.1_5'Flank|TBCB_ENST00000392178.4_3'UTR|POLR2I_ENST00000221859.4_5'Flank|TBCB_ENST00000589996.1_Missense_Mutation_p.F22L|TBCB_ENST00000585746.1_5'Flank	NM_001281.2	NP_001272.2	Q99426	TBCB_HUMAN	tubulin folding cofactor B	22					'de novo' posttranslational protein folding (GO:0051084)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|nervous system development (GO:0007399)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)				large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	5	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			TCAACACCTTCCGCTCCGAGA	0.667																																					p.F22L		.											.	TBCB-90	0			c.C66G						.						35.0	25.0	28.0					19																	36606528		2202	4298	6500	SO:0001583	missense	1155	exon1			CACCTTCCGCTCC	AF013488	CCDS12488.1, CCDS74344.1	19q13.11-q13.12	2008-02-05	2006-11-22	2006-11-22	ENSG00000105254	ENSG00000105254			1989	protein-coding gene	gene with protein product		601303	"""cytoskeleton-associated protein 1"", ""cytoskeleton associated protein 1"""	CKAP1		8978778	Standard	NM_001281		Approved	CG22, CKAPI	uc002odg.1	Q99426	OTTHUMG00000048143	ENST00000221855.3:c.66C>G	19.37:g.36606528C>G	ENSP00000221855:p.Phe22Leu	Somatic	43	0		WXS	Illumina HiSeq	Phase_I	28	10	NM_001281	0	0	102	181	79	O00111|O00674|O14728|Q6FGY5	Missense_Mutation	SNP	ENST00000221855.3	37	CCDS12488.1	.	.	.	.	.	.	.	.	.	.	C	17.44	3.391016	0.62066	.	.	ENSG00000105254	ENST00000221855;ENST00000392178	D	0.91068	-2.78	5.33	1.7	0.24286	.	0.000000	0.85682	D	0.000000	D	0.86916	0.6048	M	0.65498	2.005	0.80722	D	1	B	0.15473	0.013	B	0.20955	0.032	T	0.77035	-0.2737	10	0.28530	T	0.3	-21.5313	8.0558	0.30604	0.0:0.7565:0.0:0.2435	.	22	Q99426	TBCB_HUMAN	L	22	ENSP00000221855:F22L	ENSP00000221855:F22L	F	+	3	2	TBCB	41298368	1.000000	0.71417	0.999000	0.59377	0.866000	0.49608	1.041000	0.30291	0.088000	0.17205	0.484000	0.47621	TTC	.		0.667	TBCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000156291.2	NM_001281	
CIC	23152	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	42795453	42795453	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr19:42795453G>A	ENST00000575354.2	+	10	2573	c.2533G>A	c.(2533-2535)Gcc>Acc	p.A845T	CIC_ENST00000572681.2_Missense_Mutation_p.A1754T|CIC_ENST00000160740.3_Missense_Mutation_p.A845T	NM_015125.3	NP_055940.3	Q96RK0	CIC_HUMAN	capicua transcriptional repressor	845	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|breast(5)|central_nervous_system(32)|endometrium(10)|kidney(2)|large_intestine(7)|lung(9)|ovary(7)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	82		Prostate(69;0.00682)				CCCAGCACCAGCCCCTGGGAC	0.677			"""Mis, F, S"""		oligodendroglioma																																p.A845T		.		Rec	yes		19	19q13.2	23152	capicua homolog		O	.	CIC-591	0			c.G2533A						.						16.0	17.0	17.0					19																	42795453		2165	4211	6376	SO:0001583	missense	23152	exon10			GCACCAGCCCCTG	AB002304	CCDS12601.1	19q13.2	2013-03-15	2013-03-15		ENSG00000079432	ENSG00000079432			14214	protein-coding gene	gene with protein product		612082	"""capicua (Drosophila) homolog"", ""capicua homolog (Drosophila)"""			12393275, 15981098	Standard	NM_015125		Approved	KIAA0306	uc002otf.1	Q96RK0		ENST00000575354.2:c.2533G>A	19.37:g.42795453G>A	ENSP00000458663:p.Ala845Thr	Somatic	64	0		WXS	Illumina HiSeq	Phase_I	45	19	NM_015125	0	0	31	52	21	Q7LGI1|Q9UEG5|Q9Y6T1	Missense_Mutation	SNP	ENST00000575354.2	37	CCDS12601.1	.	.	.	.	.	.	.	.	.	.	G	14.48	2.547541	0.45383	.	.	ENSG00000079432	ENST00000160740	.	.	.	4.44	1.07	0.20283	.	.	.	.	.	T	0.20901	0.0503	N	0.08118	0	0.30059	N	0.811071	B	0.11235	0.004	B	0.04013	0.001	T	0.17319	-1.0373	8	0.87932	D	0	-7.4144	5.5731	0.17208	0.1937:0.1695:0.6368:0.0	.	845	Q96RK0	CIC_HUMAN	T	845	.	ENSP00000160740:A845T	A	+	1	0	CIC	47487293	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.094000	0.41719	0.553000	0.29044	0.561000	0.74099	GCC	.		0.677	CIC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000438532.2		
MYH14	79784	broad.mit.edu;ucsc.edu	37	19	50783389	50783389	+	Silent	SNP	C	C	T			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr19:50783389C>T	ENST00000596571.1	+	28	4005	c.4005C>T	c.(4003-4005)caC>caT	p.H1335H	MYH14_ENST00000376970.2_Silent_p.H1368H|MYH14_ENST00000601313.1_Silent_p.H1376H|MYH14_ENST00000598205.1_Silent_p.H1343H|MYH14_ENST00000440075.2_Silent_p.H1376H|MYH14_ENST00000262269.8_Silent_p.H1376H|MYH14_ENST00000425460.1_Silent_p.H1343H			Q7Z406	MYH14_HUMAN	myosin, heavy chain 14, non-muscle	1335					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|mitochondrion morphogenesis (GO:0070584)|neuronal action potential (GO:0019228)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue development (GO:0007519)|vocalization behavior (GO:0071625)	actomyosin (GO:0042641)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|stress fiber (GO:0001725)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	46		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		CCCAGCTGCACGATGCCCAGG	0.607																																					p.H1376H													.	MYH14-23	0			c.C4128T						.						55.0	63.0	60.0					19																	50783389		2188	4285	6473	SO:0001819	synonymous_variant	79784	exon31			GCTGCACGATGCC	AY165122	CCDS46151.1, CCDS54295.1, CCDS59411.1	19q13.33	2011-09-27	2009-11-19			ENSG00000105357		"""Myosins / Myosin superfamily : Class II"""	23212	protein-coding gene	gene with protein product		608568	"""myosin, heavy polypeptide 14"", ""myosin, heavy chain 14"""	DFNA4		12909352, 15015131, 17940200	Standard	NM_024729		Approved	FLJ13881, KIAA2034, MHC16, MYH17	uc010enu.1	Q7Z406		ENST00000596571.1:c.4005C>T	19.37:g.50783389C>T		Somatic	11	0		WXS	Illumina HiSeq	Phase_I	9	3	NM_001145809	0	0	0	0	0	B0I1S2|C3TTN4|Q5CZ75|Q6XYE4|Q76B62|Q8WV23|Q96I22|Q9BT27|Q9BW35|Q9H882	Silent	SNP	ENST00000596571.1	37	CCDS59411.1																																																																																			.		0.607	MYH14-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464710.2	NM_024729	
APOB	338	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	21251317	21251317	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr2:21251317G>A	ENST00000233242.1	-	13	1838	c.1711C>T	c.(1711-1713)Cag>Tag	p.Q571*	APOB_ENST00000399256.4_Nonsense_Mutation_p.Q571*	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	571	Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.				artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATATCTGCCTGTGAAGGACTC	0.438																																					p.Q571X		.											.	APOB-175	0			c.C1711T						.						131.0	133.0	132.0					2																	21251317		2203	4300	6503	SO:0001587	stop_gained	338	exon13			CTGCCTGTGAAGG	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.1711C>T	2.37:g.21251317G>A	ENSP00000233242:p.Gln571*	Somatic	179	0		WXS	Illumina HiSeq	Phase_I	144	55	NM_000384	0	0	0	0	0	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Nonsense_Mutation	SNP	ENST00000233242.1	37	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	G	37	6.513092	0.97629	.	.	ENSG00000084674	ENST00000233242;ENST00000535079;ENST00000399256	.	.	.	5.69	3.47	0.39725	.	0.330090	0.28688	N	0.014472	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	.	5.0861	0.14682	0.0975:0.133:0.632:0.1375	.	.	.	.	X	571	.	ENSP00000233242:Q571X	Q	-	1	0	APOB	21104822	0.134000	0.22483	0.496000	0.27539	0.194000	0.23727	0.571000	0.23669	0.602000	0.29896	0.655000	0.94253	CAG	.		0.438	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
ITGA6	3655	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	173352903	173352903	+	Missense_Mutation	SNP	C	C	A			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr2:173352903C>A	ENST00000264106.6	+	20	2772	c.2569C>A	c.(2569-2571)Caa>Aaa	p.Q857K	ITGA6_ENST00000343713.4_Missense_Mutation_p.Q813K|ITGA6_ENST00000375221.2_Missense_Mutation_p.Q857K|ITGA6_ENST00000409532.1_Missense_Mutation_p.Q699K|ITGA6_ENST00000409080.1_Missense_Mutation_p.Q818K|ITGA6_ENST00000264107.7_Missense_Mutation_p.Q818K|AC093818.1_ENST00000442417.1_RNA			P23229	ITA6_HUMAN	integrin, alpha 6	857					amelogenesis (GO:0097186)|blood coagulation (GO:0007596)|brown fat cell differentiation (GO:0050873)|cell adhesion mediated by integrin (GO:0033627)|cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|cellular response to extracellular stimulus (GO:0031668)|cellular response to organic cyclic compound (GO:0071407)|digestive tract development (GO:0048565)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|nail development (GO:0035878)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|renal system development (GO:0072001)|single organismal cell-cell adhesion (GO:0016337)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|external side of plasma membrane (GO:0009897)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integrin alpha6-beta4 complex (GO:0034676)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	44			OV - Ovarian serous cystadenocarcinoma(117;0.0979)			TGTTGGCGAGCAAGCTATGAA	0.368																																					p.Q818K		.											.	ITGA6-227	0			c.C2452A						.						152.0	153.0	153.0					2																	173352903		2203	4300	6503	SO:0001583	missense	3655	exon19			GGCGAGCAAGCTA		CCDS2249.1, CCDS46451.1	2q31.1	2010-09-20			ENSG00000091409	ENSG00000091409		"""CD molecules"", ""Integrins"""	6142	protein-coding gene	gene with protein product		147556					Standard	NM_001079818		Approved	CD49f	uc002uhp.1	P23229	OTTHUMG00000132277	ENST00000264106.6:c.2569C>A	2.37:g.173352903C>A	ENSP00000264106:p.Gln857Lys	Somatic	159	0		WXS	Illumina HiSeq	Phase_I	115	46	NM_000210	0	0	65	143	78	B2RMU9|B4DG69|B4DKB8|C4AM96|G5E9H1|Q08443|Q0MRC7|Q14646|Q16508|Q53RX7|Q59HB7|Q86VL6|Q9UCT1|Q9UN03	Missense_Mutation	SNP	ENST00000264106.6	37		.	.	.	.	.	.	.	.	.	.	C	14.43	2.532122	0.45073	.	.	ENSG00000091409	ENST00000409532;ENST00000264107;ENST00000264106;ENST00000375221;ENST00000343713;ENST00000409080;ENST00000442250;ENST00000458358;ENST00000416789	T;T;T;T;T;T;T;T;T	0.46819	0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86	5.76	3.78	0.43462	.	0.192038	0.56097	D	0.000033	T	0.33904	0.0879	N	0.22421	0.69	0.31631	N	0.648993	B;B;B;B	0.16802	0.007;0.008;0.019;0.019	B;B;B;B	0.19666	0.015;0.026;0.026;0.016	T	0.36065	-0.9763	10	0.42905	T	0.14	.	12.9758	0.58537	0.3451:0.6549:0.0:0.0	.	813;857;818;818	P23229-4;P23229-9;G5E9H1;P23229-2	.;.;.;.	K	699;818;857;857;813;818;857;813;43	ENSP00000386614:Q699K;ENSP00000264107:Q818K;ENSP00000264106:Q857K;ENSP00000364369:Q857K;ENSP00000341078:Q813K;ENSP00000386896:Q818K;ENSP00000406694:Q857K;ENSP00000394169:Q813K;ENSP00000388435:Q43K	ENSP00000264106:Q857K	Q	+	1	0	ITGA6	173061149	1.000000	0.71417	1.000000	0.80357	0.803000	0.45373	4.932000	0.63476	2.725000	0.93324	0.585000	0.79938	CAA	.		0.368	ITGA6-201	KNOWN	basic	protein_coding	protein_coding			
TUBB1	81027	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	57597910	57597910	+	Missense_Mutation	SNP	T	T	C	rs374942824		TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr20:57597910T>C	ENST00000217133.1	+	2	337	c.68T>C	c.(67-69)aTg>aCg	p.M23T		NM_030773.3	NP_110400.1	Q9H4B7	TBB1_HUMAN	tubulin, beta 1 class VI	23					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)|protein polymerization (GO:0051258)|spindle assembly (GO:0051225)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(2)|skin(2)	16	all_lung(29;0.00711)		Colorectal(105;0.109)		Cabazitaxel(DB06772)|Colchicine(DB01394)|Docetaxel(DB01248)|Paclitaxel(DB01229)|Vindesine(DB00309)	TTCTGGGAGATGATTGGTGAG	0.547																																					p.M23T		.											.	TUBB1-227	0			c.T68C						.	T	THR/MET	1,4405	2.1+/-5.4	0,1,2202	67.0	63.0	65.0		68	4.4	1.0	20		65	0,8600		0,0,4300	no	missense	TUBB1	NM_030773.3	81	0,1,6502	CC,CT,TT		0.0,0.0227,0.0077	benign	23/452	57597910	1,13005	2203	4300	6503	SO:0001583	missense	81027	exon2			GGGAGATGATTGG	AJ292757	CCDS13475.1	20q13.32	2014-09-17	2011-10-10		ENSG00000101162	ENSG00000101162		"""Tubulins"""	16257	protein-coding gene	gene with protein product	"""class VI beta-tubulin"""	612901	"""tubulin, beta 1"""				Standard	NM_030773		Approved	dJ543J19.4	uc002yak.3	Q9H4B7	OTTHUMG00000032860	ENST00000217133.1:c.68T>C	20.37:g.57597910T>C	ENSP00000217133:p.Met23Thr	Somatic	82	0		WXS	Illumina HiSeq	Phase_I	88	51	NM_030773	0	0	0	0	0		Missense_Mutation	SNP	ENST00000217133.1	37	CCDS13475.1	.	.	.	.	.	.	.	.	.	.	T	12.98	2.099754	0.37048	2.27E-4	0.0	ENSG00000101162	ENST00000217133	T	0.68903	-0.36	4.36	4.36	0.52297	Tubulin/FtsZ, GTPase domain (3);	0.121035	0.56097	D	0.000037	T	0.31888	0.0811	N	0.00277	-1.72	0.37932	D	0.932041	B	0.02656	0.0	B	0.04013	0.001	T	0.41413	-0.9510	10	0.87932	D	0	.	13.0037	0.58692	0.0:0.0:0.0:1.0	.	23	Q9H4B7	TBB1_HUMAN	T	23	ENSP00000217133:M23T	ENSP00000217133:M23T	M	+	2	0	TUBB1	57031305	1.000000	0.71417	0.989000	0.46669	0.464000	0.32679	7.967000	0.87967	1.727000	0.51537	0.528000	0.53228	ATG	.		0.547	TUBB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079903.1	NM_030773	
RIPK4	54101	broad.mit.edu	37	21	43166867	43166867	+	Silent	SNP	G	G	C			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr21:43166867G>C	ENST00000352483.2	-	5	802	c.738C>G	c.(736-738)ccC>ccG	p.P246P	RIPK4_ENST00000542057.1_Silent_p.P183P|RIPK4_ENST00000332512.3_Silent_p.P246P|RIPK4_ENST00000544709.1_Silent_p.P183P			P57078	RIPK4_HUMAN	receptor-interacting serine-threonine kinase 4	246	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				morphogenesis of an epithelium (GO:0002009)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						CTCTGCACACGGGCGGCAGCT	0.657																																					p.P246P													.	RIPK4-947	0			c.C738G						.						62.0	62.0	62.0					21																	43166867		2203	4300	6503	SO:0001819	synonymous_variant	54101	exon5			GCACACGGGCGGC	AJ278016	CCDS13675.1	21q22.3	2013-01-10	2004-07-06	2004-07-06	ENSG00000183421	ENSG00000183421		"""Ankyrin repeat domain containing"""	496	protein-coding gene	gene with protein product	"""protein kinase C-associated kinase"", ""PKC-delta-interacting protein kinase"""	605706	"""ankyrin repeat domain 3"""	ANKRD3		10830953	Standard	NM_020639		Approved	DIK, ANKK2, RIP4, PKK	uc002yzn.1	P57078	OTTHUMG00000086770	ENST00000352483.2:c.738C>G	21.37:g.43166867G>C		Somatic	232	0		WXS	Illumina HiSeq	Phase_I	135	4	NM_020639	0	0	58	60	2	Q96KH0	Silent	SNP	ENST00000352483.2	37																																																																																				.		0.657	RIPK4-201	KNOWN	basic	protein_coding	protein_coding		NM_020639	
SLC37A1	54020	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	43963563	43963563	+	Missense_Mutation	SNP	G	G	A			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr21:43963563G>A	ENST00000352133.2	+	8	1563	c.581G>A	c.(580-582)gGg>gAg	p.G194E	SLC37A1_ENST00000398341.3_Missense_Mutation_p.G194E			P57057	GLPT_HUMAN	solute carrier family 37 (glucose-6-phosphate transporter), member 1	194					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	transporter activity (GO:0005215)			breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|liver(2)|lung(3)	15						TTGATTATGGGGGTCTGGAAC	0.572																																					p.G194E		.											.	SLC37A1-90	0			c.G581A						.						165.0	155.0	158.0					21																	43963563		2203	4300	6503	SO:0001583	missense	54020	exon9			TTATGGGGGTCTG	AJ269529	CCDS13689.1	21q22.3	2013-07-17	2013-07-17		ENSG00000160190	ENSG00000160190		"""Solute carriers"""	11024	protein-coding gene	gene with protein product		608094	"""solute carrier family 37 (glycerol-3-phosphate transporter), member 1"""			11112347	Standard	NM_018964		Approved		uc002zbi.3	P57057	OTTHUMG00000086803	ENST00000352133.2:c.581G>A	21.37:g.43963563G>A	ENSP00000344648:p.Gly194Glu	Somatic	320	0		WXS	Illumina HiSeq	Phase_I	243	75	NM_018964	0	0	10	19	9	D3DSJ7|Q9HAQ1	Missense_Mutation	SNP	ENST00000352133.2	37	CCDS13689.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.732737	0.89482	.	.	ENSG00000160190	ENST00000398341;ENST00000352133	T;T	0.66099	-0.19;-0.19	4.99	4.99	0.66335	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.177957	0.49916	D	0.000125	D	0.85292	0.5663	H	0.94542	3.55	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89875	0.4026	10	0.87932	D	0	-14.7963	18.3114	0.90201	0.0:0.0:1.0:0.0	.	194	P57057	GLPT_HUMAN	E	194	ENSP00000381383:G194E;ENSP00000344648:G194E	ENSP00000344648:G194E	G	+	2	0	SLC37A1	42836632	1.000000	0.71417	0.995000	0.50966	0.986000	0.74619	9.423000	0.97461	2.324000	0.78689	0.650000	0.86243	GGG	.		0.572	SLC37A1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195377.1		
KLHL40	131377	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	42727131	42727131	+	Silent	SNP	G	G	A			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr3:42727131G>A	ENST00000287777.4	+	1	121	c.21G>A	c.(19-21)caG>caA	p.Q7Q		NM_152393.2	NP_689606.2	Q2TBA0	KLH40_HUMAN	kelch-like family member 40	7					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)											GCTTGGAGCAGGCGGAGGAGC	0.647																																					p.Q7Q		.											.	.	0			c.G21A						.						29.0	23.0	25.0					3																	42727131		2198	4298	6496	SO:0001819	synonymous_variant	131377	exon1			GGAGCAGGCGGAG	AK056577	CCDS2703.1	3p21.33	2013-07-30	2013-02-22	2013-01-08	ENSG00000157119	ENSG00000157119		"""Kelch-like"", ""BTB/POZ domain containing"""	30372	protein-coding gene	gene with protein product	"""sarcosynapsin"", ""nemaline myopathy type 8"""	615340	"""kelch repeat and BTB (POZ) domain containing 5"", ""kelch-like 40 (Drosophila)"""	KBTBD5		23746549	Standard	NM_152393		Approved	SRYP, NEM8	uc003clv.1	Q2TBA0	OTTHUMG00000133045	ENST00000287777.4:c.21G>A	3.37:g.42727131G>A		Somatic	22	0		WXS	Illumina HiSeq	Phase_I	16	8	NM_152393	0	0	0	0	0	Q86SI1|Q96MR2	Silent	SNP	ENST00000287777.4	37	CCDS2703.1																																																																																			.		0.647	KLHL40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256651.1	NM_152393	
HTR3D	200909	ucsc.edu	37	3	183756414	183756414	+	Splice_Site	SNP	T	T	A			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr3:183756414T>A	ENST00000382489.3	+	7	1135		c.e7+2		HTR3D_ENST00000428798.2_Splice_Site|HTR3D_ENST00000334128.2_Splice_Site|HTR3D_ENST00000453435.1_Splice_Site	NM_001163646.1	NP_001157118.1	Q70Z44	5HT3D_HUMAN	5-hydroxytryptamine (serotonin) receptor 3D, ionotropic						ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	extracellular ligand-gated ion channel activity (GO:0005230)			large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(2)	10	all_cancers(143;2.33e-10)|Ovarian(172;0.0303)		Epithelial(37;6.23e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Ergoloid mesylate(DB01049)	ACCTGCCCGGTGAGGGAAGTC	0.632																																					.													.	HTR3D-90	0			c.610+2T>A						.						20.0	24.0	23.0					3																	183756414		2199	4298	6497	SO:0001630	splice_region_variant	200909	exon5			GCCCGGTGAGGGA	AY159812	CCDS3249.1, CCDS46966.1, CCDS54685.1	3q27	2012-05-22	2012-02-03		ENSG00000186090	ENSG00000186090		"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	24004	protein-coding gene	gene with protein product		610122	"""5-hydroxytryptamine (serotonin) receptor 3 family member D"""			12801637	Standard	NM_001145143		Approved		uc011bqv.2	Q70Z44	OTTHUMG00000156858	ENST00000382489.3:c.1135+2T>A	3.37:g.183756414T>A		Somatic	22	0		WXS	Illumina HiSeq		23	4	NM_182537	0	0	0	0	0	C9J2I6|J3QT78|Q495N5|Q495N6|Q7Z6B3	Splice_Site	SNP	ENST00000382489.3	37	CCDS54685.1	.	.	.	.	.	.	.	.	.	.	T	13.17	2.156539	0.38119	.	.	ENSG00000186090	ENST00000334128;ENST00000428798;ENST00000382489;ENST00000453435	.	.	.	3.77	3.77	0.43336	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.0732	0.36504	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	HTR3D	185239108	0.592000	0.26832	0.793000	0.32043	0.128000	0.20619	2.138000	0.42140	1.706000	0.51276	0.379000	0.24179	.	.		0.632	HTR3D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346289.1	NM_182537	Intron
HERC5	51191	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	89410409	89410409	+	Silent	SNP	C	C	G	rs141289100	byFrequency	TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr4:89410409C>G	ENST00000264350.3	+	16	2208	c.2055C>G	c.(2053-2055)gtC>gtG	p.V685V	HERC5_ENST00000508159.1_Silent_p.V323V	NM_016323.3	NP_057407.2	Q9UII4	HERC5_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 5	685					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|ISG15-protein conjugation (GO:0032020)|negative regulation of type I interferon production (GO:0032480)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of defense response to virus (GO:0050688)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ISG15 ligase activity (GO:0042296)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|liver(2)|lung(17)|ovary(4)|prostate(1)|skin(4)	53		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000209)		ATCTAACAGTCAGAAGGAATC	0.383																																					p.V685V	Esophageal Squamous(39;887 1012 34045 50514)	.											.	HERC5-664	0			c.C2055G						.						177.0	183.0	181.0					4																	89410409		2203	4300	6503	SO:0001819	synonymous_variant	51191	exon16			AACAGTCAGAAGG	AB027289	CCDS3630.1	4q22.1-q23	2012-02-23	2012-02-23		ENSG00000138646	ENSG00000138646			24368	protein-coding gene	gene with protein product		608242	"""hect domain and RLD 5"""			10581175	Standard	NM_016323		Approved	CEB1	uc003hrt.4	Q9UII4	OTTHUMG00000130953	ENST00000264350.3:c.2055C>G	4.37:g.89410409C>G		Somatic	259	0		WXS	Illumina HiSeq	Phase_I	220	98	NM_016323	0	0	3	14	11	B2RTQ1|Q69G20	Silent	SNP	ENST00000264350.3	37	CCDS3630.1																																																																																			C|1.000;T|0.000		0.383	HERC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253554.2	NM_016323	
FAT4	79633	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	126411930	126411930	+	Silent	SNP	C	C	A			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr4:126411930C>A	ENST00000394329.3	+	17	13966	c.13953C>A	c.(13951-13953)atC>atA	p.I4651I	FAT4_ENST00000335110.5_Silent_p.I2892I	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	4651					branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						AATTTTCAATCCAGAGGCACA	0.502																																					p.I4651I		.											.	FAT4-108	0			c.C13953A						.						75.0	70.0	72.0					4																	126411930		2203	4300	6503	SO:0001819	synonymous_variant	79633	exon17			TTCAATCCAGAGG	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.13953C>A	4.37:g.126411930C>A		Somatic	85	0		WXS	Illumina HiSeq	Phase_I	73	32	NM_024582	0	0	9	18	9	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Silent	SNP	ENST00000394329.3	37	CCDS3732.3																																																																																			.		0.502	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
NSUN2	54888	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	6620336	6620336	+	Missense_Mutation	SNP	C	C	T			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr5:6620336C>T	ENST00000264670.6	-	7	1009	c.698G>A	c.(697-699)aGc>aAc	p.S233N	NSUN2_ENST00000506139.1_Missense_Mutation_p.S198N|NSUN2_ENST00000505264.1_5'UTR|NSUN2_ENST00000539938.1_5'UTR	NM_017755.5	NP_060225.4	Q08J23	NSUN2_HUMAN	NOP2/Sun RNA methyltransferase family, member 2	233					mitotic nuclear division (GO:0007067)|tRNA methylation (GO:0030488)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|tRNA (cytosine-5-)-methyltransferase activity (GO:0016428)|tRNA binding (GO:0000049)			breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(23)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	41						GATGCAGGGGCTGCTCAGCCT	0.502																																					p.S233N		.											.	NSUN2-91	0			c.G698A						.						99.0	99.0	99.0					5																	6620336		2203	4300	6503	SO:0001583	missense	54888	exon7			CAGGGGCTGCTCA	AK000310	CCDS3869.1, CCDS54832.1	5p15.32	2014-01-31	2012-06-12		ENSG00000037474	ENSG00000037474		"""NOP2/Sun domain containing"""	25994	protein-coding gene	gene with protein product	"""tRNA methyltransferase 4 homolog (S. cerevisiae)"", ""Myc-induced SUN-domain-containing protein"""	610916	"""NOL1/NOP2/Sun domain family, member 2"", ""NOP2/Sun domain family, member 2"", ""mental retardation, non-syndromic, autosomal recessive, 5"""	MRT5		17071714, 22541559	Standard	NM_017755		Approved	FLJ20303, TRM4, Misu	uc003jdu.3	Q08J23	OTTHUMG00000090455	ENST00000264670.6:c.698G>A	5.37:g.6620336C>T	ENSP00000264670:p.Ser233Asn	Somatic	151	0		WXS	Illumina HiSeq	Phase_I	144	9	NM_017755	0	0	26	26	0	A8K529|B2RNR4|B3KP09|B4DQW2|G3V1R4|Q9BVN4|Q9H858|Q9NXD9	Missense_Mutation	SNP	ENST00000264670.6	37	CCDS3869.1	.	.	.	.	.	.	.	.	.	.	C	36	5.656410	0.96724	.	.	ENSG00000037474	ENST00000264670;ENST00000506139	T;T	0.41065	1.01;1.04	6.02	6.02	0.97574	.	0.070917	0.85682	D	0.000000	T	0.67813	0.2933	M	0.76170	2.325	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.66571	-0.5890	10	0.56958	D	0.05	-41.3851	20.5407	0.99260	0.0:1.0:0.0:0.0	.	198;233	B4DQW2;Q08J23	.;NSUN2_HUMAN	N	233;198	ENSP00000264670:S233N;ENSP00000420957:S198N	ENSP00000264670:S233N	S	-	2	0	NSUN2	6673336	1.000000	0.71417	0.994000	0.49952	0.961000	0.63080	7.366000	0.79548	2.865000	0.98341	0.655000	0.94253	AGC	.		0.502	NSUN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206902.1	NM_017755	
FCHO2	115548	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	72378596	72378596	+	Missense_Mutation	SNP	A	A	C			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr5:72378596A>C	ENST00000430046.2	+	24	2305	c.2189A>C	c.(2188-2190)gAa>gCa	p.E730A	FCHO2_ENST00000512348.1_Missense_Mutation_p.E697A|FCHO2_ENST00000341845.6_Missense_Mutation_p.E730A	NM_001146032.1|NM_138782.2	NP_001139504.1|NP_620137.2	Q0JRZ9	FCHO2_HUMAN	FCH domain only 2	730	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.|Mediates interaction with DAB2, EPS15, EPS15R and ITSN1.				clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)|membrane invagination (GO:0010324)|protein localization to plasma membrane (GO:0072659)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|prostate(1)	17		Lung NSC(167;0.0465)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;4.6e-53)		AGGAATGCAGAACAAATGAAA	0.308																																					p.E730A		.											.	FCHO2-23	0			c.A2189C						.						67.0	66.0	66.0					5																	72378596		1810	4076	5886	SO:0001583	missense	115548	exon24			ATGCAGAACAAAT	AL831971	CCDS47230.1, CCDS54868.1	5q13.2	2005-08-15			ENSG00000157107	ENSG00000157107			25180	protein-coding gene	gene with protein product		613438				15254787	Standard	NM_138782		Approved		uc003kcl.3	Q0JRZ9	OTTHUMG00000162413	ENST00000430046.2:c.2189A>C	5.37:g.72378596A>C	ENSP00000393776:p.Glu730Ala	Somatic	25	0		WXS	Illumina HiSeq	Phase_I	14	9	NM_138782	0	0	0	0	0	A8K6W7|B2RNQ9|B4DHK0|E9PG79|Q0JTJ3|Q96CF5	Missense_Mutation	SNP	ENST00000430046.2	37	CCDS47230.1	.	.	.	.	.	.	.	.	.	.	A	17.13	3.309909	0.60414	.	.	ENSG00000157107	ENST00000430046;ENST00000341845;ENST00000512348	T;T;T	0.54071	0.59;0.59;0.59	5.31	5.31	0.75309	Muniscin C-terminal mu homology domain (1);	0.172570	0.49305	D	0.000142	T	0.49081	0.1536	L	0.52364	1.645	0.58432	D	0.999996	B;B	0.10296	0.003;0.003	B;B	0.21151	0.01;0.033	T	0.43572	-0.9383	10	0.40728	T	0.16	-23.3471	14.6045	0.68466	1.0:0.0:0.0:0.0	.	697;730	E9PG79;Q0JRZ9	.;FCHO2_HUMAN	A	730;730;697	ENSP00000393776:E730A;ENSP00000344034:E730A;ENSP00000427296:E697A	ENSP00000344034:E730A	E	+	2	0	FCHO2	72414352	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.460000	0.90369	2.231000	0.72958	0.533000	0.62120	GAA	.		0.308	FCHO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000368795.3	XM_291142	
AP3B1	8546	hgsc.bcm.edu	37	5	77406161	77406161	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr5:77406161T>C	ENST00000255194.6	-	20	2442	c.2267A>G	c.(2266-2268)gAg>gGg	p.E756G	AP3B1_ENST00000519295.1_Missense_Mutation_p.E707G	NM_001271769.1	NP_001258698.1	O00203	AP3B1_HUMAN	adaptor-related protein complex 3, beta 1 subunit	756	Glu/Ser-rich.				anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|blood coagulation (GO:0007596)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein targeting to lysosome (GO:0006622)	AP-3 adaptor complex (GO:0030123)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	GTP-dependent protein binding (GO:0030742)|protein phosphatase binding (GO:0019903)			breast(5)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(12)|lung(12)|prostate(1)|skin(2)|urinary_tract(1)	39		all_lung(232;0.000397)|Lung NSC(167;0.00106)|Ovarian(174;0.0105)|Prostate(461;0.215)		OV - Ovarian serous cystadenocarcinoma(54;8.23e-47)|Epithelial(54;2.74e-41)|all cancers(79;4.8e-36)		ATTTTCCTTCTCCCCATCTTC	0.294									Hermansky-Pudlak syndrome																												p.E756G		.											.	AP3B1-90	0			c.A2267G						.						48.0	46.0	46.0					5																	77406161		2199	4296	6495	SO:0001583	missense	8546	exon20	Familial Cancer Database	HPS, HPS1-8	TCCTTCTCCCCAT	U81504	CCDS4041.1, CCDS64186.1	5q14.1	2014-09-17			ENSG00000132842	ENSG00000132842			566	protein-coding gene	gene with protein product		603401				9182526, 9151686	Standard	NM_003664		Approved	ADTB3A, HPS2	uc003kfj.4	O00203	OTTHUMG00000106919	ENST00000255194.6:c.2267A>G	5.37:g.77406161T>C	ENSP00000255194:p.Glu756Gly	Somatic	30	0		WXS	Illumina HiSeq	Phase_I	20	2	NM_003664	0	1	23	24	0	E5RJ68|O00580|Q7Z393|Q9HD66	Missense_Mutation	SNP	ENST00000255194.6	37	CCDS4041.1	.	.	.	.	.	.	.	.	.	.	T	11.80	1.746589	0.30955	.	.	ENSG00000132842	ENST00000255194;ENST00000519295;ENST00000535760	T;T	0.64803	-0.12;-0.12	5.68	4.52	0.55395	.	1.179390	0.05769	N	0.606283	T	0.48995	0.1531	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34725	-0.9817	10	0.22706	T	0.39	-1.7341	8.3059	0.32042	0.0:0.1581:0.0:0.8419	.	756	O00203	AP3B1_HUMAN	G	756;707;756	ENSP00000255194:E756G;ENSP00000430597:E707G	ENSP00000255194:E756G	E	-	2	0	AP3B1	77441917	0.060000	0.20803	0.105000	0.21289	0.972000	0.66771	2.151000	0.42263	0.978000	0.38470	0.533000	0.62120	GAG	.		0.294	AP3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000225548.2		
SLC12A2	6558	hgsc.bcm.edu	37	5	127419881	127419881	+	Missense_Mutation	SNP	A	A	C	rs557916029		TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr5:127419881A>C	ENST00000262461.2	+	1	424	c.235A>C	c.(235-237)Agc>Cgc	p.S79R	SLC12A2_ENST00000343225.4_Missense_Mutation_p.S79R|CTC-228N24.3_ENST00000501702.2_lincRNA	NM_001046.2	NP_001037.1	P55011	S12A2_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 2	79					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|branching involved in mammary gland duct morphogenesis (GO:0060444)|chloride transmembrane transport (GO:1902476)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|gamma-aminobutyric acid signaling pathway (GO:0007214)|hyperosmotic response (GO:0006972)|ion transport (GO:0006811)|mammary duct terminal end bud growth (GO:0060763)|multicellular organism growth (GO:0035264)|positive regulation of cell volume (GO:0045795)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transepithelial ammonium transport (GO:0070634)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ammonium transmembrane transporter activity (GO:0008519)|sodium:potassium:chloride symporter activity (GO:0008511)			breast(3)|endometrium(5)|kidney(5)|large_intestine(12)|lung(16)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		all_cancers(142;0.0972)|Prostate(80;0.151)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.0433)|OV - Ovarian serous cystadenocarcinoma(64;0.0978)	Bumetanide(DB00887)|Potassium Chloride(DB00761)|Quinethazone(DB01325)	CCCGAGCCAGAGCCGTTTCCA	0.816													A|||	1	0.000199681	0.0	0.0	5008	,	,		6545	0.0		0.001	False		,,,				2504	0.0				p.S79R		.											.	SLC12A2-94	0			c.A235C						.						1.0	2.0	1.0					5																	127419881		861	2057	2918	SO:0001583	missense	6558	exon1			AGCCAGAGCCGTT		CCDS4144.1, CCDS58965.1	5q23.3	2014-06-13	2013-07-18		ENSG00000064651	ENSG00000064651		"""Solute carriers"""	10911	protein-coding gene	gene with protein product	"""bumetanide-sensitive sodium-(potassium)-chloride cotransporter 1"", ""basolateral Na-K-Cl symporter"", ""protein phosphatase 1, regulatory subunit 141"""	600840				7629105	Standard	NM_001256461		Approved	NKCC1, BSC, BSC2, PPP1R141	uc003kus.3	P55011	OTTHUMG00000128983	ENST00000262461.2:c.235A>C	5.37:g.127419881A>C	ENSP00000262461:p.Ser79Arg	Somatic	8	0		WXS	Illumina HiSeq	Phase_I	7	5	NM_001046	0	0	0	0	0	Q8N713|Q8WWH7	Missense_Mutation	SNP	ENST00000262461.2	37	CCDS4144.1	.	.	.	.	.	.	.	.	.	.	A	23.9	4.467578	0.84533	.	.	ENSG00000064651	ENST00000262461;ENST00000343225	D;D	0.86865	-2.16;-2.18	4.11	2.95	0.34219	.	0.128217	0.50627	D	0.000110	D	0.89280	0.6670	L	0.47190	1.495	0.58432	D	0.99999	D;D	0.76494	0.999;0.998	D;D	0.80764	0.994;0.986	D	0.88787	0.3275	10	0.72032	D	0.01	.	8.7601	0.34669	0.9077:0.0:0.0923:0.0	.	79;79	P55011-3;P55011	.;S12A2_HUMAN	R	79	ENSP00000262461:S79R;ENSP00000340878:S79R	ENSP00000262461:S79R	S	+	1	0	SLC12A2	127447780	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	4.501000	0.60393	1.474000	0.48178	0.260000	0.18958	AGC	.		0.816	SLC12A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250972.1	NM_001046	
HSPA4	3308	hgsc.bcm.edu	37	5	132425377	132425377	+	Silent	SNP	T	T	C			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr5:132425377T>C	ENST00000304858.2	+	11	1657	c.1368T>C	c.(1366-1368)gaT>gaC	p.D456D		NM_002154.3	NP_002145.3	P34932	HSP74_HUMAN	heat shock 70kDa protein 4	456					chaperone-mediated protein complex assembly (GO:0051131)|protein import into mitochondrial outer membrane (GO:0045040)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(10)|stomach(1)	32			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CCTATCCAGATCCTGCTATAG	0.383																																					p.D456D	Colon(114;1299 1588 6063 12302 48757)	.											.	HSPA4-226	0			c.T1368C						.						38.0	35.0	36.0					5																	132425377		2203	4300	6503	SO:0001819	synonymous_variant	3308	exon11			TCCAGATCCTGCT	AB023420	CCDS4166.1	5q31.1	2011-09-07	2002-08-29		ENSG00000170606	ENSG00000170606		"""Heat shock proteins / HSP70"""	5237	protein-coding gene	gene with protein product	"""hsp70 RY"""	601113	"""heat shock 70kD protein 4"""			8335910	Standard	NM_002154		Approved	HS24/P52, HSPH2	uc003kyj.3	P34932	OTTHUMG00000129012	ENST00000304858.2:c.1368T>C	5.37:g.132425377T>C		Somatic	20	0		WXS	Illumina HiSeq	Phase_I	22	2	NM_002154	0	0	0	0	0	O95756|Q2TAL4|Q9BUK9	Silent	SNP	ENST00000304858.2	37	CCDS4166.1	.	.	.	.	.	.	.	.	.	.	T	9.025	0.985947	0.18889	.	.	ENSG00000170606	ENST00000537974	.	.	.	5.63	1.94	0.25998	.	.	.	.	.	T	0.52256	0.1723	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.31280	-0.9949	5	0.21540	T	0.41	-23.0249	9.6052	0.39630	0.0:0.3421:0.0:0.6579	.	.	.	.	P	456	.	ENSP00000445221:S456P	S	+	1	0	HSPA4	132453276	0.748000	0.28294	1.000000	0.80357	0.977000	0.68977	-0.148000	0.10219	0.161000	0.19458	0.482000	0.46254	TCC	.		0.383	HSPA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251011.1	NM_002154, NM_198431	
CAMK2A	815	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	149644564	149644564	+	Missense_Mutation	SNP	C	C	G			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr5:149644564C>G	ENST00000348628.6	-	3	837	c.172G>C	c.(172-174)Gag>Cag	p.E58Q	CAMK2A_ENST00000398376.3_Missense_Mutation_p.E58Q	NM_015981.3|NM_171825.2	NP_057065.2|NP_741960.1	Q9UQM7	KCC2A_HUMAN	calcium/calmodulin-dependent protein kinase II alpha	58	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				calcium ion transport (GO:0006816)|cytokine-mediated signaling pathway (GO:0019221)|G1/S transition of mitotic cell cycle (GO:0000082)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of neurotransmitter secretion (GO:0046928)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|kinase activity (GO:0016301)|protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|skin(1)|stomach(1)	15		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GCTTCACGCTCCAGCTTCTGA	0.607																																					p.E58Q		.											.	CAMK2A-333	0			c.G172C						.						44.0	49.0	47.0					5																	149644564		2002	4186	6188	SO:0001583	missense	815	exon3			CACGCTCCAGCTT	AB023185	CCDS43386.1, CCDS43387.1	5q32	2013-09-20	2008-10-30		ENSG00000070808	ENSG00000070808	2.7.11.17		1460	protein-coding gene	gene with protein product	"""CaM-kinase II alpha chain"", ""calcium/calmodulin-dependent protein kinase II alpha-B subunit"", ""CaM kinase II alpha subunit"", ""CaMK-II alpha subunit"", ""calcium/calmodulin-dependent protein kinase type II alpha chain"""	114078	"""calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha"""	CAMKA		10231032, 3475713	Standard	NM_015981		Approved	KIAA0968, CaMKIINalpha	uc003lrt.2	Q9UQM7	OTTHUMG00000134281	ENST00000348628.6:c.172G>C	5.37:g.149644564C>G	ENSP00000261793:p.Glu58Gln	Somatic	98	0		WXS	Illumina HiSeq	Phase_I	68	20	NM_171825	0	0	0	0	0	Q9UL21|Q9Y2H4|Q9Y352	Missense_Mutation	SNP	ENST00000348628.6	37	CCDS43386.1	.	.	.	.	.	.	.	.	.	.	c	17.93	3.509651	0.64522	.	.	ENSG00000070808	ENST00000348628;ENST00000398376;ENST00000510347	T;T;T	0.24538	1.85;1.85;1.85	4.6	4.6	0.57074	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.067804	0.64402	U	0.000020	T	0.28863	0.0716	N	0.21448	0.665	0.58432	D	0.999997	B;B	0.29552	0.248;0.248	B;P	0.45099	0.307;0.469	T	0.27905	-1.0060	10	0.87932	D	0	.	13.2562	0.60081	0.0:1.0:0.0:0.0	.	58;58	Q9UQM7;A8K161	KCC2A_HUMAN;.	Q	58	ENSP00000261793:E58Q;ENSP00000381412:E58Q;ENSP00000426607:E58Q	ENSP00000261793:E58Q	E	-	1	0	CAMK2A	149624757	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	6.110000	0.71535	2.281000	0.76405	0.306000	0.20318	GAG	.		0.607	CAMK2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258869.2	NM_015981	
KIF13A	63971	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	17796913	17796913	+	Missense_Mutation	SNP	T	T	G			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr6:17796913T>G	ENST00000259711.6	-	23	3034	c.2929A>C	c.(2929-2931)Aca>Cca	p.T977P	KIF13A_ENST00000378814.5_Missense_Mutation_p.T977P|KIF13A_ENST00000378826.2_Missense_Mutation_p.T977P|KIF13A_ENST00000378843.2_Missense_Mutation_p.T977P|KIF13A_ENST00000378816.5_Missense_Mutation_p.T977P	NM_022113.5	NP_071396.4	Q9H1H9	KI13A_HUMAN	kinesin family member 13A	977					ATP catabolic process (GO:0006200)|cargo loading into vesicle (GO:0035459)|cytokinesis (GO:0000910)|endosome to lysosome transport (GO:0008333)|Golgi to plasma membrane protein transport (GO:0043001)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)	centrosome (GO:0005813)|endosome membrane (GO:0010008)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|midbody (GO:0030496)|trans-Golgi network membrane (GO:0032588)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	64	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			TCATGCAGTGTTCTTGTCTTA	0.507																																					p.T977P		.											.	KIF13A-137	0			c.A2929C						.						149.0	142.0	144.0					6																	17796913		1924	4131	6055	SO:0001583	missense	63971	exon23			GCAGTGTTCTTGT	AJ291578	CCDS47380.1, CCDS47381.1, CCDS54967.1, CCDS54968.1, CCDS58998.1	6p23	2008-10-21			ENSG00000137177	ENSG00000137177		"""Kinesins"""	14566	protein-coding gene	gene with protein product		605433				11106728	Standard	NM_022113		Approved	bA500C11.2	uc003ncg.4	Q9H1H9	OTTHUMG00000014313	ENST00000259711.6:c.2929A>C	6.37:g.17796913T>G	ENSP00000259711:p.Thr977Pro	Somatic	248	0		WXS	Illumina HiSeq	Phase_I	175	75	NM_001105567	0	0	16	24	8	A0JP21|A0JP22|F2Z382|Q5THQ2|Q5THQ3|Q9H193|Q9H194|Q9H1H8	Missense_Mutation	SNP	ENST00000259711.6	37	CCDS47381.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	24.3|24.3	4.513415|4.513415	0.85389|0.85389	.|.	.|.	ENSG00000137177|ENSG00000137177	ENST00000358380|ENST00000378814;ENST00000259711;ENST00000378826;ENST00000378843;ENST00000378816;ENST00000506044	.|T;T;T;T;T	.|0.72505	.|-0.62;-0.66;-0.62;-0.63;-0.62	5.05|5.05	5.05|5.05	0.67936|0.67936	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.75939|0.75939	0.3918|0.3918	L|L	0.55481|0.55481	1.735|1.735	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.76494	.|0.997;0.999;0.994;0.999	.|D;D;D;D	.|0.71184	.|0.947;0.962;0.922;0.972	T|T	0.79892|0.79892	-0.1611|-0.1611	5|10	.|0.87932	.|D	.|0	.|.	15.0983|15.0983	0.72253|0.72253	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|977;977;977;977	.|Q9H1H9-4;Q9H1H9-2;Q9H1H9;Q9H1H9-3	.|.;.;KI13A_HUMAN;.	D|P	370|977;977;977;977;977;37	.|ENSP00000368091:T977P;ENSP00000259711:T977P;ENSP00000368103:T977P;ENSP00000368120:T977P;ENSP00000368093:T977P	.|ENSP00000259711:T977P	E|T	-|-	3|1	2|0	KIF13A|KIF13A	17904892|17904892	1.000000|1.000000	0.71417|0.71417	0.959000|0.959000	0.39883|0.39883	0.984000|0.984000	0.73092|0.73092	5.938000|5.938000	0.70170|0.70170	2.019000|2.019000	0.59389|0.59389	0.460000|0.460000	0.39030|0.39030	GAA|ACA	.		0.507	KIF13A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039954.4		
DST	667	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	56463337	56463337	+	Silent	SNP	T	T	C			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr6:56463337T>C	ENST00000361203.3	-	42	11239	c.11232A>G	c.(11230-11232)gcA>gcG	p.A3744A	DST_ENST00000312431.6_Silent_p.A3744A|DST_ENST00000370788.2_Silent_p.A1658A|DST_ENST00000421834.2_Silent_p.A1658A|DST_ENST00000370769.4_Silent_p.A3746A|DST_ENST00000370754.5_Silent_p.A3924A|DST_ENST00000244364.6_Silent_p.A1332A|DST_ENST00000446842.2_Silent_p.A3420A			Q03001	DYST_HUMAN	dystonin	3744					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TAGACTGTTCTGCTTTTAAAT	0.353																																					p.A1332A		.											.	DST-523	0			c.A3996G						.						159.0	143.0	148.0					6																	56463337		1845	4078	5923	SO:0001819	synonymous_variant	667	exon27			CTGTTCTGCTTTT	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.11232A>G	6.37:g.56463337T>C		Somatic	28	0		WXS	Illumina HiSeq	Phase_I	34	13	NM_015548	0	0	12	23	11	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Silent	SNP	ENST00000361203.3	37																																																																																				.		0.353	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
MPC1	51660	hgsc.bcm.edu	37	6	166778932	166778932	+	Silent	SNP	T	T	C			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr6:166778932T>C	ENST00000360961.6	-	5	436	c.315A>G	c.(313-315)aaA>aaG	p.K105K	MPC1_ENST00000341756.6_Silent_p.K105K|MPC1_ENST00000487218.1_5'UTR	NM_001270879.1|NM_016098.3	NP_001257808.1|NP_057182.1	Q9Y5U8	MPC1_HUMAN	mitochondrial pyruvate carrier 1	105					cellular metabolic process (GO:0044237)|mitochondrial pyruvate transport (GO:0006850)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	pyruvate transmembrane transporter activity (GO:0050833)										CAGATGCCGTTTTAGTCATCC	0.393																																					p.K62K		.											.	.	0			c.A186G						.						94.0	80.0	85.0					6																	166778932		2202	4300	6502	SO:0001819	synonymous_variant	51660	exon5			TGCCGTTTTAGTC	AF125101	CCDS5293.1, CCDS75547.1	6q27	2012-08-01	2012-07-30	2012-07-30	ENSG00000060762	ENSG00000060762			21606	protein-coding gene	gene with protein product		614738	"""brain protein 44-like"""	BRP44L		22628558	Standard	NM_016098		Approved	dJ68L15.3, CGI-129	uc031sra.1	Q9Y5U8	OTTHUMG00000015999	ENST00000360961.6:c.315A>G	6.37:g.166778932T>C		Somatic	37	0		WXS	Illumina HiSeq	Phase_I	24	2	NM_001270879	0	0	1	1	0	B2R5I7|Q5TI66|Q9HB67|Q9UQN4	Silent	SNP	ENST00000360961.6	37	CCDS5293.1																																																																																			.		0.393	MPC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043052.1	NM_016098	
TYW1	55253	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	66514966	66514966	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr7:66514966G>T	ENST00000359626.5	+	8	1179	c.1015G>T	c.(1015-1017)Ggt>Tgt	p.G339C		NM_018264.2	NP_060734.2	Q9NV66	TYW1_HUMAN	tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)	339					tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|lyase activity (GO:0016829)|oxidoreductase activity (GO:0016491)			breast(1)|endometrium(8)|kidney(10)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(3)|stomach(2)|urinary_tract(2)	46		Lung NSC(55;0.0846)|all_lung(88;0.183)				AGAGAAGTCTGGTTTGTTCAG	0.383																																					p.G339C		.											.	TYW1-91	0			c.G1015T						.						45.0	47.0	47.0					7																	66514966		2203	4298	6501	SO:0001583	missense	55253	exon8			AAGTCTGGTTTGT	AK001762	CCDS5538.1	7q11.21	2007-11-29	2007-11-29	2007-11-29	ENSG00000198874	ENSG00000198874			25598	protein-coding gene	gene with protein product	"""tRNA-yW synthesizing protein 1 homolog A (S. cerevisiae)"""	611243	"""radical S-adenosyl methionine and flavodoxin domains 1"""	RSAFD1		16162496, 17150819	Standard	NM_018264		Approved	FLJ10900, MGC23001, MGC60291, YPL207W, TYW1A	uc003tvn.4	Q9NV66	OTTHUMG00000129723	ENST00000359626.5:c.1015G>T	7.37:g.66514966G>T	ENSP00000352645:p.Gly339Cys	Somatic	70	0		WXS	Illumina HiSeq	Phase_I	92	18	NM_018264	0	0	42	55	13	Q6PJG8|Q75MG8|Q75MN3|Q86V12|Q8IVS7|Q9H9C4	Missense_Mutation	SNP	ENST00000359626.5	37	CCDS5538.1	.	.	.	.	.	.	.	.	.	.	G	6.950	0.545036	0.13312	.	.	ENSG00000198874	ENST00000359626	T	0.17854	2.25	3.59	-7.17	0.01511	.	1.038170	0.07760	U	0.949947	T	0.14700	0.0355	L	0.39898	1.24	0.09310	N	1	P	0.39376	0.67	B	0.42112	0.376	T	0.31336	-0.9947	10	0.72032	D	0.01	.	9.461	0.38785	0.2223:0.1477:0.6299:0.0	.	339	Q9NV66	TYW1_HUMAN	C	339	ENSP00000352645:G339C	ENSP00000352645:G339C	G	+	1	0	TYW1	66152401	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-2.640000	0.00865	-1.521000	0.01771	-1.012000	0.02466	GGT	.		0.383	TYW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251932.2	NM_018264	
MET	4233	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	116423433	116423433	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr7:116423433T>A	ENST00000318493.6	+	19	3949	c.3762T>A	c.(3760-3762)agT>agA	p.S1254R	MET_ENST00000539704.1_Missense_Mutation_p.S106R|MET_ENST00000397752.3_Missense_Mutation_p.S1236R			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			AATACTATAGTGTACACAACA	0.383			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																												p.S1254R		.		Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	met proto-oncogene (hepatocyte growth factor receptor)		E	.	MET-5874	0			c.T3762A						.						99.0	95.0	96.0					7																	116423433		1861	4097	5958	SO:0001583	missense	4233	exon19	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	CTATAGTGTACAC	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.3762T>A	7.37:g.116423433T>A	ENSP00000317272:p.Ser1254Arg	Somatic	74	0		WXS	Illumina HiSeq	Phase_I	105	62	NM_001127500	0	0	132	445	313	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	ENST00000318493.6	37	CCDS47689.1	.	.	.	.	.	.	.	.	.	.	T	13.28	2.189759	0.38707	.	.	ENSG00000105976	ENST00000397752;ENST00000318493;ENST00000539704	T;T;T	0.34072	1.38;1.38;1.38	5.46	-2.57	0.06248	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.30696	0.0773	N	0.03304	-0.355	0.54753	D	0.999982	P;D	0.89917	0.924;1.0	P;D	0.85130	0.574;0.997	T	0.26326	-1.0106	10	0.87932	D	0	.	11.8823	0.52581	0.0:0.4505:0.0:0.5495	.	1254;1236	P08581-2;P08581	.;MET_HUMAN	R	1236;1254;106	ENSP00000380860:S1236R;ENSP00000317272:S1254R;ENSP00000445020:S106R	ENSP00000317272:S1254R	S	+	3	2	MET	116210669	0.936000	0.31750	0.978000	0.43139	0.978000	0.69477	0.045000	0.14013	-0.366000	0.08064	0.460000	0.39030	AGT	.		0.383	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059620.3		
SPAM1	6677	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	7	123599995	123599995	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr7:123599995T>A	ENST00000439500.1	+	6	2115	c.1502T>A	c.(1501-1503)cTt>cAt	p.L501H	SPAM1_ENST00000223028.7_Missense_Mutation_p.L501H|SPAM1_ENST00000402183.2_Missense_Mutation_p.L501H|SPAM1_ENST00000460182.1_Missense_Mutation_p.L501H|SPAM1_ENST00000340011.5_Intron	NM_001174045.1|NM_001174046.1	NP_001167516.1|NP_001167517.1	P38567	HYALP_HUMAN	sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)	501					binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	hyalurononglucosaminidase activity (GO:0004415)			breast(1)|cervix(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(23)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						ATTTTGTTTCTTATCATTTCT	0.353																																					p.L501H		.											.	SPAM1-94	0			c.T1502A						.						87.0	83.0	84.0					7																	123599995		2203	4300	6503	SO:0001583	missense	6677	exon5			TGTTTCTTATCAT	L13781	CCDS5790.1, CCDS5791.1	7q31	2008-05-02			ENSG00000106304	ENSG00000106304			11217	protein-coding gene	gene with protein product		600930				8282124, 8575780	Standard	NM_153189		Approved	HYAL5, PH-20, SPAG15	uc003vle.3	P38567	OTTHUMG00000157284	ENST00000439500.1:c.1502T>A	7.37:g.123599995T>A	ENSP00000402123:p.Leu501His	Somatic	50	0		WXS	Illumina HiSeq	Phase_I	97	54	NM_153189	0	0	0	0	0	Q8TC30	Missense_Mutation	SNP	ENST00000439500.1	37	CCDS5791.1	.	.	.	.	.	.	.	.	.	.	T	9.524	1.109145	0.20714	.	.	ENSG00000106304	ENST00000402183;ENST00000460182;ENST00000439500;ENST00000223028	T;T;T;T	0.16743	2.32;2.32;2.32;2.32	2.06	2.06	0.26882	.	.	.	.	.	T	0.05960	0.0155	N	0.08118	0	0.09310	N	1	P	0.49862	0.929	B	0.30316	0.114	T	0.22836	-1.0205	9	0.72032	D	0.01	.	6.1126	0.20110	0.0:0.0:0.0:1.0	.	501	P38567	HYALP_HUMAN	H	501	ENSP00000386028:L501H;ENSP00000417934:L501H;ENSP00000402123:L501H;ENSP00000223028:L501H	ENSP00000223028:L501H	L	+	2	0	SPAM1	123387231	0.016000	0.18221	0.004000	0.12327	0.009000	0.06853	2.479000	0.45197	1.210000	0.43336	0.528000	0.53228	CTT	.		0.353	SPAM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000348309.1		
SHH	6469	hgsc.bcm.edu	37	7	155595634	155595634	+	Missense_Mutation	SNP	T	T	C			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr7:155595634T>C	ENST00000297261.2	-	3	1499	c.1349A>G	c.(1348-1350)gAg>gGg	p.E450G		NM_000193.2	NP_000184.1	Q15465	SHH_HUMAN	sonic hedgehog	450					androgen metabolic process (GO:0008209)|apoptotic signaling pathway (GO:0097190)|artery development (GO:0060840)|axon guidance (GO:0007411)|Bergmann glial cell differentiation (GO:0060020)|blood coagulation (GO:0007596)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|branching morphogenesis of an epithelial tube (GO:0048754)|bud outgrowth involved in lung branching (GO:0060447)|camera-type eye development (GO:0043010)|canonical Wnt signaling pathway (GO:0060070)|CD4-positive or CD8-positive, alpha-beta T cell lineage commitment (GO:0043369)|cell development (GO:0048468)|cell fate specification (GO:0001708)|cell-cell signaling (GO:0007267)|cellular response to lithium ion (GO:0071285)|central nervous system development (GO:0007417)|cerebellar granule cell precursor proliferation (GO:0021930)|determination of left/right asymmetry in lateral mesoderm (GO:0003140)|dorsal/ventral neural tube patterning (GO:0021904)|dorsal/ventral pattern formation (GO:0009953)|ectoderm development (GO:0007398)|embryo development (GO:0009790)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic skeletal system development (GO:0048706)|endocytosis (GO:0006897)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|epithelial-mesenchymal signaling involved in prostate gland development (GO:0060738)|establishment of cell polarity (GO:0030010)|forebrain development (GO:0030900)|formation of anatomical boundary (GO:0048859)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|hindbrain development (GO:0030902)|hindgut morphogenesis (GO:0007442)|inner ear development (GO:0048839)|intein-mediated protein splicing (GO:0016539)|intermediate filament organization (GO:0045109)|left lung development (GO:0060459)|limb bud formation (GO:0060174)|lung development (GO:0030324)|lung epithelium development (GO:0060428)|lung lobe morphogenesis (GO:0060463)|lung-associated mesenchyme development (GO:0060484)|lymphoid progenitor cell differentiation (GO:0002320)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal smoothened signaling pathway involved in prostate gland development (GO:0060783)|metanephric mesenchymal cell proliferation involved in metanephros development (GO:0072136)|metanephros development (GO:0001656)|midbrain development (GO:0030901)|multicellular structure septum development (GO:0080125)|myoblast differentiation (GO:0045445)|myotube differentiation (GO:0014902)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell differentiation (GO:0045596)|negative regulation of cell migration (GO:0030336)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of kidney smooth muscle cell differentiation (GO:2000357)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of ureter smooth muscle cell differentiation (GO:2000062)|negative thymic T cell selection (GO:0045060)|neural crest cell migration (GO:0001755)|neuroblast proliferation (GO:0007405)|neuron fate commitment (GO:0048663)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte development (GO:0014003)|organ formation (GO:0048645)|osteoblast development (GO:0002076)|palate development (GO:0060021)|pancreas development (GO:0031016)|pattern specification process (GO:0007389)|patterning of blood vessels (GO:0001569)|polarity specification of anterior/posterior axis (GO:0009949)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of hh target transcription factor activity (GO:0007228)|positive regulation of immature T cell proliferation in thymus (GO:0033092)|positive regulation of kidney smooth muscle cell differentiation (GO:2000358)|positive regulation of mesenchymal cell proliferation involved in ureter development (GO:2000729)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of sclerotome development (GO:0061189)|positive regulation of skeletal muscle cell proliferation (GO:0014858)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of striated muscle cell differentiation (GO:0051155)|positive regulation of T cell differentiation in thymus (GO:0033089)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureter smooth muscle cell differentiation (GO:2000063)|positive regulation of Wnt signaling pathway (GO:0030177)|positive thymic T cell selection (GO:0045059)|primary prostatic bud elongation (GO:0060516)|prostate epithelial cord elongation (GO:0060523)|prostate gland development (GO:0030850)|protein localization to nucleus (GO:0034504)|regulation of cell proliferation (GO:0042127)|regulation of mesenchymal cell proliferation involved in prostate gland development (GO:0060782)|regulation of nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900175)|regulation of odontogenesis (GO:0042481)|regulation of prostatic bud formation (GO:0060685)|regulation of protein localization to nucleus (GO:1900180)|regulation of proteolysis (GO:0030162)|renal system development (GO:0072001)|right lung development (GO:0060458)|salivary gland cavitation (GO:0060662)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|somite development (GO:0061053)|spinal cord dorsal/ventral patterning (GO:0021513)|spinal cord motor neuron differentiation (GO:0021522)|stem cell development (GO:0048864)|striated muscle tissue development (GO:0014706)|T cell differentiation in thymus (GO:0033077)|telencephalon regionalization (GO:0021978)|thalamus development (GO:0021794)|thymus development (GO:0048538)|thyroid gland development (GO:0030878)|trachea morphogenesis (GO:0060439)|vasculogenesis (GO:0001570)|ventral midline development (GO:0007418)	cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|laminin-1 binding (GO:0043237)|morphogen activity (GO:0016015)|patched binding (GO:0005113)|peptidase activity (GO:0008233)|zinc ion binding (GO:0008270)			central_nervous_system(3)|kidney(1)|large_intestine(1)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	14	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00882)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GTGCAGGGCCTCGCTGTCCAG	0.731																																					p.E450G		.											.	SHH-1134	0			c.A1349G						.						9.0	10.0	10.0					7																	155595634		1638	3497	5135	SO:0001583	missense	6469	exon3			AGGGCCTCGCTGT		CCDS5942.1	7q36	2010-06-25	2010-06-25		ENSG00000164690	ENSG00000164690			10848	protein-coding gene	gene with protein product		600725	"""sonic hedgehog (Drosophila) homolog"", ""sonic hedgehog homolog (Drosophila)"""	HPE3, HLP3		7590746	Standard	NM_000193		Approved	HHG1, SMMCI, TPT, TPTPS, MCOPCB5	uc003wmk.1	Q15465	OTTHUMG00000151349	ENST00000297261.2:c.1349A>G	7.37:g.155595634T>C	ENSP00000297261:p.Glu450Gly	Somatic	43	0		WXS	Illumina HiSeq	Phase_I	38	2	NM_000193	0	0	24	24	0	A4D247|Q75MC9	Missense_Mutation	SNP	ENST00000297261.2	37	CCDS5942.1	.	.	.	.	.	.	.	.	.	.	T	9.939	1.216860	0.22373	.	.	ENSG00000164690	ENST00000297261	D	0.99801	-6.81	3.89	2.71	0.32032	.	0.294987	0.32028	N	0.006695	D	0.98298	0.9436	L	0.32530	0.975	0.30779	N	0.742184	B;B	0.27498	0.039;0.18	B;B	0.19946	0.024;0.027	D	0.99969	1.1953	10	0.23302	T	0.38	.	9.1642	0.37041	0.0:0.0:0.1838:0.8162	.	450;453	Q15465;D9ZGF9	SHH_HUMAN;.	G	450	ENSP00000297261:E450G	ENSP00000297261:E450G	E	-	2	0	SHH	155288395	1.000000	0.71417	0.976000	0.42696	0.983000	0.72400	4.427000	0.59888	0.537000	0.28751	0.459000	0.35465	GAG	.		0.731	SHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322327.1	NM_000193	
PKHD1L1	93035	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	110420393	110420393	+	Silent	SNP	G	G	C			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr8:110420393G>C	ENST00000378402.5	+	18	2033	c.1929G>C	c.(1927-1929)ggG>ggC	p.G643G		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	643					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			ATTGGGATGGGATCGCTTCTA	0.428										HNSCC(38;0.096)																											p.G643G		.											.	PKHD1L1-145	0			c.G1929C						.						121.0	121.0	121.0					8																	110420393		1946	4145	6091	SO:0001819	synonymous_variant	93035	exon18			GGATGGGATCGCT	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.1929G>C	8.37:g.110420393G>C		Somatic	60	0		WXS	Illumina HiSeq	Phase_I	58	12	NM_177531	0	0	0	0	0	Q567P2|Q9UF27	Silent	SNP	ENST00000378402.5	37	CCDS47911.1																																																																																			.		0.428	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531	
VPS28	51160	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	145651588	145651588	+	Missense_Mutation	SNP	G	G	T			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr8:145651588G>T	ENST00000526054.1	-	2	78	c.41C>A	c.(40-42)cCt>cAt	p.P14H	VPS28_ENST00000526734.1_5'UTR|VPS28_ENST00000377348.2_Missense_Mutation_p.P14H|VPS28_ENST00000529182.1_Missense_Mutation_p.P14H|VPS28_ENST00000292510.4_Missense_Mutation_p.P14H			Q9UK41	VPS28_HUMAN	vacuolar protein sorting 28 homolog (S. cerevisiae)	14	VPS28 N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00645}.				endosomal transport (GO:0016197)|intracellular transport of virus (GO:0075733)|membrane organization (GO:0061024)|negative regulation of protein ubiquitination (GO:0031397)|protein transport (GO:0015031)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|endosome membrane (GO:0010008)|ESCRT I complex (GO:0000813)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				kidney(1)|large_intestine(1)|lung(4)|prostate(1)	7	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			CTTGTTCCCAGGGGCTGCAAG	0.632																																					p.P14H		.											.	VPS28-90	0			c.C41A						.						20.0	19.0	20.0					8																	145651588		2194	4296	6490	SO:0001583	missense	51160	exon3			TTCCCAGGGGCTG	AF316887	CCDS6425.1, CCDS34967.1	8q24.3	2014-08-12	2006-04-04		ENSG00000160948	ENSG00000160948			18178	protein-coding gene	gene with protein product		611952	"""vacuolar protein sorting 28 (yeast)"""				Standard	NM_183057		Approved		uc003zct.1	Q9UK41	OTTHUMG00000165209	ENST00000526054.1:c.41C>A	8.37:g.145651588G>T	ENSP00000434064:p.Pro14His	Somatic	27	0		WXS	Illumina HiSeq	Phase_I	13	8	NM_016208	0	0	2	2	0	Q86VK0	Missense_Mutation	SNP	ENST00000526054.1	37	CCDS6425.1	.	.	.	.	.	.	.	.	.	.	g	19.57	3.851936	0.71719	.	.	ENSG00000160948	ENST00000529182;ENST00000526054;ENST00000292510;ENST00000377348;ENST00000533806;ENST00000531032;ENST00000530790	.	.	.	5.09	5.09	0.68999	Vacuolar protein sorting-associated, VPS28, N-terminal (1);	0.051939	0.85682	D	0.000000	T	0.52948	0.1766	N	0.08118	0	0.51482	D	0.999924	D;D	0.76494	0.999;0.986	D;P	0.66979	0.948;0.575	T	0.63120	-0.6708	9	0.62326	D	0.03	.	16.3554	0.83234	0.0:0.0:1.0:0.0	.	14;14	Q9UK41-2;Q9UK41	.;VPS28_HUMAN	H	14	.	ENSP00000292510:P14H	P	-	2	0	VPS28	145622396	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.858000	0.69532	2.515000	0.84797	0.650000	0.86243	CCT	.		0.632	VPS28-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382694.1		
CNTLN	54875	hgsc.bcm.edu	37	9	17394561	17394561	+	Silent	SNP	T	T	C	rs551838719		TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr9:17394561T>C	ENST00000380647.3	+	15	2193	c.2109T>C	c.(2107-2109)tcT>tcC	p.S703S	CNTLN_ENST00000425824.1_Silent_p.S703S|CNTLN_ENST00000262360.5_Silent_p.S703S			Q9NXG0	CNTLN_HUMAN	centlein, centrosomal protein	703					centriole-centriole cohesion (GO:0010457)|protein localization to organelle (GO:0033365)	centriole (GO:0005814)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)|protein binding, bridging (GO:0030674)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(6)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53				GBM - Glioblastoma multiforme(50;6.14e-10)		GGCTGAAATCTTTTGAGAAAA	0.294													T|||	0	0.0	0.0	0.0	5008	,	,		16095	0.0		0.0	False		,,,				2504	0.0				p.S703S		.											.	CNTLN-91	0			c.T2109C						.						24.0	22.0	23.0					9																	17394561		1782	4045	5827	SO:0001819	synonymous_variant	54875	exon15			GAAATCTTTTGAG	AK000283	CCDS43789.1, CCDS47953.1	9p22.2-p22.1	2008-11-11	2008-02-08	2008-02-08	ENSG00000044459	ENSG00000044459			23432	protein-coding gene	gene with protein product		611870	"""chromosome 9 open reading frame 101"", ""chromosome 9 open reading frame 39"""	C9orf101, C9orf39		18086554	Standard	XM_005251492		Approved	FLJ20276, bA340N12.1, OTTHUMG00000019597	uc003zmy.3	Q9NXG0	OTTHUMG00000019599	ENST00000380647.3:c.2109T>C	9.37:g.17394561T>C		Somatic	19	0		WXS	Illumina HiSeq	Phase_I	27	2	NM_017738	0	0	8	8	0	A5Z2X6|Q5VYJ0|Q8N1G9|Q9HAJ5	Silent	SNP	ENST00000380647.3	37	CCDS43789.1																																																																																			.		0.294	CNTLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051793.3	NM_017738	
FOCAD	54914	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	20990148	20990148	+	Missense_Mutation	SNP	T	T	A			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr9:20990148T>A	ENST00000380249.1	+	44	5395	c.5031T>A	c.(5029-5031)ttT>ttA	p.F1677L	FOCAD_ENST00000338382.6_Missense_Mutation_p.F1677L|FOCAD_ENST00000605086.1_Missense_Mutation_p.F1113L	NM_017794.3	NP_060264.3	Q5VW36	FOCAD_HUMAN	focadhesin	1677						focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)											TGCTGATATTTGCAACCGCAG	0.488																																					p.F1677L		.											.	.	0			c.T5031A						.						89.0	79.0	82.0					9																	20990148		2203	4300	6503	SO:0001583	missense	54914	exon44			GATATTTGCAACC	AB058700	CCDS34993.1	9p21	2012-03-23	2012-03-23	2012-03-23	ENSG00000188352	ENSG00000188352			23377	protein-coding gene	gene with protein product		614606	"""KIAA1797"""	KIAA1797		22427331	Standard	XM_006716794		Approved	FLJ20375	uc003zog.1	Q5VW36	OTTHUMG00000066930	ENST00000380249.1:c.5031T>A	9.37:g.20990148T>A	ENSP00000369599:p.Phe1677Leu	Somatic	93	0		WXS	Illumina HiSeq	Phase_I	89	39	NM_017794	0	0	4	23	19	D3DRJ9|Q6ZME1|Q8IZG0|Q96JM8|Q96MS9|Q9BVF3|Q9NX87	Missense_Mutation	SNP	ENST00000380249.1	37	CCDS34993.1	.	.	.	.	.	.	.	.	.	.	T	16.08	3.022456	0.54683	.	.	ENSG00000188352	ENST00000380249;ENST00000338382	T;T	0.22945	1.93;1.93	6.06	3.75	0.43078	.	0.052794	0.85682	D	0.000000	T	0.27489	0.0675	L	0.57536	1.79	0.54753	D	0.999988	P	0.42296	0.775	B	0.42738	0.396	T	0.01574	-1.1321	10	0.33141	T	0.24	-19.4576	10.2953	0.43620	0.0:0.1318:0.0:0.8682	.	1677	Q5VW36	K1797_HUMAN	L	1677	ENSP00000369599:F1677L;ENSP00000344307:F1677L	ENSP00000344307:F1677L	F	+	3	2	KIAA1797	20980148	1.000000	0.71417	0.998000	0.56505	0.834000	0.47266	1.862000	0.39448	0.543000	0.28864	0.533000	0.62120	TTT	.		0.488	FOCAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143442.1	NM_017794	
SMC5	23137	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	72913102	72913102	+	Missense_Mutation	SNP	G	G	C			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr9:72913102G>C	ENST00000361138.5	+	9	1332	c.1274G>C	c.(1273-1275)cGa>cCa	p.R425P		NM_015110.3	NP_055925.2	Q8IY18	SMC5_HUMAN	structural maintenance of chromosomes 5	425					cellular senescence (GO:0090398)|double-strand break repair via homologous recombination (GO:0000724)|mitotic nuclear division (GO:0007067)|positive regulation of maintenance of mitotic sister chromatid cohesion (GO:0034184)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|telomere maintenance via recombination (GO:0000722)	cell junction (GO:0030054)|chromosome, telomeric region (GO:0000781)|nucleus (GO:0005634)|PML body (GO:0016605)|Smc5-Smc6 complex (GO:0030915)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(9)|ovary(2)|prostate(1)|skin(4)	35						ATTGATAAGCGAAGAGAGAGG	0.358																																					p.R425P		.											.	SMC5-229	0			c.G1274C						.						90.0	86.0	87.0					9																	72913102		2203	4300	6503	SO:0001583	missense	23137	exon9			ATAAGCGAAGAGA	AB011166	CCDS6632.1	9q21.11	2008-02-05	2006-07-06	2006-07-06	ENSG00000198887	ENSG00000198887		"""Structural maintenance of chromosomes proteins"""	20465	protein-coding gene	gene with protein product		609386	"""SMC5 structural maintenance of chromosomes 5-like 1 (yeast)"""	SMC5L1		9628581	Standard	NM_015110		Approved	KIAA0594	uc004ahr.2	Q8IY18	OTTHUMG00000019992	ENST00000361138.5:c.1274G>C	9.37:g.72913102G>C	ENSP00000354957:p.Arg425Pro	Somatic	81	0		WXS	Illumina HiSeq	Phase_I	89	31	NM_015110	0	0	18	31	13	A6NM81|O60335|Q05D92|Q5VZ60|Q96SB9	Missense_Mutation	SNP	ENST00000361138.5	37	CCDS6632.1	.	.	.	.	.	.	.	.	.	.	G	14.40	2.524798	0.44969	.	.	ENSG00000198887	ENST00000361138	T	0.19669	2.13	5.72	-2.63	0.06133	RecF/RecN/SMC (1);	0.559219	0.18103	N	0.151640	T	0.17109	0.0411	L	0.46157	1.445	0.09310	N	1	P	0.48694	0.914	P	0.48840	0.592	T	0.11446	-1.0587	10	0.32370	T	0.25	-0.2642	2.2335	0.04002	0.3745:0.0877:0.3454:0.1924	.	425	Q8IY18	SMC5_HUMAN	P	425	ENSP00000354957:R425P	ENSP00000354957:R425P	R	+	2	0	SMC5	72102922	0.591000	0.26824	0.162000	0.22713	0.993000	0.82548	0.529000	0.23019	-0.132000	0.11557	0.591000	0.81541	CGA	.		0.358	SMC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052603.1	NM_015110	
VPS13A	23230	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	79981712	79981712	+	Missense_Mutation	SNP	A	A	C	rs566242673		TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr9:79981712A>C	ENST00000360280.3	+	61	8655	c.8395A>C	c.(8395-8397)Att>Ctt	p.I2799L	VPS13A_ENST00000376636.3_Missense_Mutation_p.I2760L|VPS13A_ENST00000376634.4_Missense_Mutation_p.I2799L|VPS13A_ENST00000357409.5_Missense_Mutation_p.I2799L	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	2799					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						TGGAGGACTGATTCCAGTTCA	0.313																																					p.I2799L		.											.	VPS13A-161	0			c.A8395C						.						66.0	69.0	68.0					9																	79981712		2203	4299	6502	SO:0001583	missense	23230	exon61			GGACTGATTCCAG	AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.8395A>C	9.37:g.79981712A>C	ENSP00000353422:p.Ile2799Leu	Somatic	39	0		WXS	Illumina HiSeq	Phase_I	42	20	NM_001018038	0	0	9	17	8	Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Missense_Mutation	SNP	ENST00000360280.3	37	CCDS6655.1	.	.	.	.	.	.	.	.	.	.	A	14.18	2.457324	0.43634	.	.	ENSG00000197969	ENST00000376634;ENST00000376636;ENST00000360280;ENST00000357409	T;T;T;T	0.78003	-1.14;-1.14;-1.14;-1.14	5.56	0.396	0.16309	.	0.303860	0.34178	N	0.004187	T	0.64757	0.2627	L	0.54323	1.7	0.80722	D	1	B;B;B;B	0.14438	0.001;0.002;0.01;0.004	B;B;B;B	0.15870	0.007;0.006;0.014;0.014	T	0.47005	-0.9150	9	.	.	.	.	3.193	0.06624	0.643:0.1183:0.1256:0.1131	.	2760;2799;2799;2799	Q96RL7-3;Q96RL7;Q96RL7-2;Q96RL7-4	.;VP13A_HUMAN;.;.	L	2799;2760;2799;2799	ENSP00000365821:I2799L;ENSP00000365823:I2760L;ENSP00000353422:I2799L;ENSP00000349985:I2799L	.	I	+	1	0	VPS13A	79171532	1.000000	0.71417	0.083000	0.20561	0.958000	0.62258	3.532000	0.53553	-0.167000	0.10871	-0.376000	0.06991	ATT	.		0.313	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052753.2	NM_015186	
PDCL	5082	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	125582792	125582792	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr9:125582792G>A	ENST00000259467.4	-	4	643	c.478C>T	c.(478-480)Cag>Tag	p.Q160*		NM_005388.4	NP_005379.3	Q13371	PHLP_HUMAN	phosducin-like	160					heterotrimeric G-protein complex assembly (GO:1902605)|intracellular signal transduction (GO:0035556)|negative regulation of protein refolding (GO:0061084)|protein folding (GO:0006457)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|visual perception (GO:0007601)	cytoplasm (GO:0005737)	receptor signaling protein activity (GO:0005057)			endometrium(1)|large_intestine(2)|lung(5)|skin(1)|stomach(1)	10						TCAAAAACCTGCTTGAATTGG	0.443																																					p.Q160X		.											.	PDCL-90	0			c.C478T						.						104.0	102.0	102.0					9																	125582792		2203	4300	6503	SO:0001587	stop_gained	5082	exon4			AAACCTGCTTGAA	AF083325	CCDS6845.1	9q12-q13	2008-07-21			ENSG00000136940	ENSG00000136940			8770	protein-coding gene	gene with protein product		604421				10095058	Standard	NM_005388		Approved	PhLP, DKFZp564M1863	uc004bmz.2	Q13371	OTTHUMG00000020624	ENST00000259467.4:c.478C>T	9.37:g.125582792G>A	ENSP00000259467:p.Gln160*	Somatic	232	0		WXS	Illumina HiSeq	Phase_I	162	56	NM_005388	0	0	20	29	9	Q4VXB6|Q96AF1|Q9UEW7|Q9UFL0|Q9UNX1|Q9UNX2	Nonsense_Mutation	SNP	ENST00000259467.4	37	CCDS6845.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.440900	0.83993	.	.	ENSG00000136940	ENST00000259467	.	.	.	5.58	4.67	0.58626	.	0.160604	0.56097	D	0.000026	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.79	12.8162	0.57667	0.0:0.0:0.7031:0.2969	.	.	.	.	X	160	.	ENSP00000259467:Q160X	Q	-	1	0	PDCL	124622613	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.527000	0.45615	1.349000	0.45751	0.655000	0.94253	CAG	.		0.443	PDCL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053956.1	NM_005388	
SLC2A8	29988	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	130167105	130167105	+	Missense_Mutation	SNP	A	A	G			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr9:130167105A>G	ENST00000373371.3	+	8	1074	c.985A>G	c.(985-987)Atg>Gtg	p.M329V	SLC2A8_ENST00000485806.1_3'UTR|SLC2A8_ENST00000373360.3_Missense_Mutation_p.M329V|SLC2A8_ENST00000373352.1_Missense_Mutation_p.M66V	NM_001271712.1|NM_014580.3	NP_001258641.1|NP_055395.2	Q9NY64	GTR8_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 8	329					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|insulin receptor signaling pathway (GO:0008286)|male meiosis I (GO:0007141)|response to hypoxia (GO:0001666)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	glucose binding (GO:0005536)|glucose transmembrane transporter activity (GO:0005355)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)	11						AGGTGTGGTCATGGTGTTCAG	0.697																																					p.M329V		.											.	SLC2A8-92	0			c.A985G						.						50.0	45.0	47.0					9																	130167105		2203	4297	6500	SO:0001583	missense	29988	exon8			GTGGTCATGGTGT	AJ245937	CCDS6870.1, CCDS65138.1, CCDS75903.1	9q33.3	2013-05-22	2008-09-02		ENSG00000136856	ENSG00000136856		"""Solute carriers"""	13812	protein-coding gene	gene with protein product		605245	"""solute carrier family 2 (facilitated glucose transporter) member 8"""			10671487, 10821868	Standard	NM_014580		Approved	GLUTX1, GLUT8	uc004bqu.4	Q9NY64	OTTHUMG00000020702	ENST00000373371.3:c.985A>G	9.37:g.130167105A>G	ENSP00000362469:p.Met329Val	Somatic	98	0		WXS	Illumina HiSeq	Phase_I	64	14	NM_014580	0	0	0	1	1	Q8WUZ9|Q9NSC4	Missense_Mutation	SNP	ENST00000373371.3	37	CCDS6870.1	.	.	.	.	.	.	.	.	.	.	A	16.44	3.122981	0.56613	.	.	ENSG00000136856	ENST00000373371;ENST00000451404;ENST00000373352;ENST00000373360;ENST00000439597;ENST00000423934;ENST00000373350;ENST00000430147	T;T;T;T;T;T;T	0.78003	-1.14;-1.14;-1.14;-1.14;-1.14;-1.14;-1.14	5.16	5.16	0.70880	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.071263	0.85682	D	0.000000	D	0.86585	0.5968	M	0.71036	2.16	0.80722	D	1	D;D	0.69078	0.997;0.994	D;D	0.80764	0.994;0.992	D	0.87560	0.2471	10	0.56958	D	0.05	.	14.2805	0.66208	1.0:0.0:0.0:0.0	.	329;329	Q5VVV9;Q9NY64	.;GTR8_HUMAN	V	329;166;66;329;168;194;194;168	ENSP00000362469:M329V;ENSP00000392434:M166V;ENSP00000362450:M66V;ENSP00000362458:M329V;ENSP00000404893:M168V;ENSP00000389070:M194V;ENSP00000391213:M168V	ENSP00000362448:M194V	M	+	1	0	SLC2A8	129206926	1.000000	0.71417	1.000000	0.80357	0.120000	0.20174	6.771000	0.74996	2.073000	0.62155	0.533000	0.62120	ATG	.		0.697	SLC2A8-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054177.1	NM_014580	
KLHL34	257240	hgsc.bcm.edu	37	X	21675434	21675434	+	Missense_Mutation	SNP	A	A	G	rs145604187		TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chrX:21675434A>G	ENST00000379499.2	-	1	1014	c.473T>C	c.(472-474)tTg>tCg	p.L158S		NM_153270.1	NP_695002.1	Q8N239	KLH34_HUMAN	kelch-like family member 34	158	BACK.					extracellular space (GO:0005615)				cervix(1)|endometrium(7)|kidney(1)|large_intestine(3)|lung(11)|ovary(2)|urinary_tract(1)	26						CAGCTCCTGCAAGTGGCTCAC	0.711													A|||	13	0.00344371	0.0008	0.0086	3775	,	,		10108	0.0		0.006	False		,,,				2504	0.0				p.L158S		.											.	KLHL34-131	0			c.T473C						.	A	SER/LEU	3,3293		0,2,1,1438,415	3.0	4.0	3.0		473	4.3	0.8	X	dbSNP_134	3	41,5735		0,28,13,2144,1419	yes	missense	KLHL34	NM_153270.1	145	0,30,14,3582,1834	GG,GA,G,AA,A		0.7098,0.091,0.485	possibly-damaging	158/645	21675434	44,9028	1856	3604	5460	SO:0001583	missense	257240	exon1			TCCTGCAAGTGGC	AK092279	CCDS14199.1	Xp22.12	2013-02-22	2013-02-22		ENSG00000185915	ENSG00000185915		"""Kelch-like"", ""BTB/POZ domain containing"""	26634	protein-coding gene	gene with protein product			"""kelch-like 34 (Drosophila)"""				Standard	NM_153270		Approved	FLJ34960, RP11-450P7.3	uc004czz.1	Q8N239	OTTHUMG00000021234	ENST00000379499.2:c.473T>C	X.37:g.21675434A>G	ENSP00000368813:p.Leu158Ser	Somatic	3	1		WXS	Illumina HiSeq	Phase_I	8	5	NM_153270	0	0	1	1	0		Missense_Mutation	SNP	ENST00000379499.2	37	CCDS14199.1	6	0.003616636528028933	0	0.0	1	0.0027624309392265192	0	0.0	4	0.005277044854881266	A	13.64	2.297650	0.40694	9.1E-4	0.007098	ENSG00000185915	ENST00000379499	T	0.70282	-0.47	4.35	4.35	0.52113	BTB/Kelch-associated (2);	0.155107	0.43579	D	0.000545	T	0.63640	0.2528	L	0.56769	1.78	0.24527	P	0.99413997	P	0.47191	0.891	P	0.45829	0.494	T	0.79685	-0.1700	9	0.87932	D	0	.	12.8899	0.58066	1.0:0.0:0.0:0.0	.	158	Q8N239	KLH34_HUMAN	S	158	ENSP00000368813:L158S	ENSP00000368813:L158S	L	-	2	0	KLHL34	21585355	1.000000	0.71417	0.829000	0.32907	0.226000	0.24999	8.854000	0.92228	1.610000	0.50200	0.345000	0.21793	TTG	A|0.996;G|0.004		0.711	KLHL34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056022.1	NM_153270	
NEDD4	4734	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	56208931	56208934	+	Frame_Shift_Del	DEL	CATG	CATG	-	rs1912403	byFrequency	TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	CATG	CATG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr15:56208931_56208934delCATG	ENST00000508342.1	-	1	395_398	c.96_99delCATG	c.(94-99)cacatgfs	p.HM32fs	NEDD4_ENST00000338963.2_Frame_Shift_Del_p.HM32fs|NEDD4_ENST00000506154.1_Frame_Shift_Del_p.HM32fs|NEDD4_ENST00000435532.3_Intron	NM_001284338.1	NP_001271267.1	P46934	NEDD4_HUMAN	neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase	32					adaptive immune response (GO:0002250)|blood vessel morphogenesis (GO:0048514)|cellular response to UV (GO:0034644)|cytokine-mediated signaling pathway (GO:0019221)|development involved in symbiotic interaction (GO:0044111)|endocardial cushion development (GO:0003197)|glucocorticoid receptor signaling pathway (GO:0042921)|lysosomal transport (GO:0007041)|negative regulation of sodium ion transport (GO:0010766)|negative regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage (GO:0010768)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|neuromuscular junction development (GO:0007528)|neuron projection development (GO:0031175)|outflow tract morphogenesis (GO:0003151)|positive regulation of nucleocytoplasmic transport (GO:0046824)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein catabolic process (GO:0045732)|progesterone receptor signaling pathway (GO:0050847)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|protein targeting to lysosome (GO:0006622)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|receptor catabolic process (GO:0032801)|receptor internalization (GO:0031623)|regulation of dendrite morphogenesis (GO:0048814)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of synapse organization (GO:0050807)|response to calcium ion (GO:0051592)|T cell activation (GO:0042110)|transmission of virus (GO:0019089)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	apicolateral plasma membrane (GO:0016327)|cell cortex (GO:0005938)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	beta-2 adrenergic receptor binding (GO:0031698)|ligase activity (GO:0016874)|phosphoserine binding (GO:0050815)|phosphothreonine binding (GO:0050816)|proline-rich region binding (GO:0070064)|protein domain specific binding (GO:0019904)|RNA polymerase binding (GO:0070063)|sodium channel inhibitor activity (GO:0019871)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	43				all cancers(107;0.0299)|GBM - Glioblastoma multiforme(80;0.113)		TTTTGAAGCACATGTGAACATGGC	0.436																																					p.32_33del		.											.	NEDD4-723	0			c.96_99del						.																																			SO:0001589	frameshift_variant	4734	exon1			.	D42055	CCDS10156.1, CCDS45265.1, CCDS61643.1, CCDS61644.1	15q	2012-02-23	2012-02-23		ENSG00000069869	ENSG00000069869			7727	protein-coding gene	gene with protein product	"""receptor-potentiating factor 1"""	602278	"""neural precursor cell expressed, developmentally down-regulated 4"""			9073511, 8649367	Standard	XR_243101		Approved	KIAA0093, MGC176705, NEDD4-1, RPF1	uc002adi.3	P46934	OTTHUMG00000132015	ENST00000508342.1:c.96_99delCATG	15.37:g.56208931_56208934delCATG	ENSP00000424827:p.His32fs	Somatic	225	0		WXS	Illumina HiSeq	Phase_I	214	67	NM_198400	0	0	0	0	0	A1KY35|A6ND72|A7MD29|B4E2R7|B7ZM59|B7ZM60|B9EGN5|D6RF89	Frame_Shift_Del	DEL	ENST00000508342.1	37																																																																																				.		0.436	NEDD4-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000359817.1	NM_198400	
ZNF385B	151126	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	180310448	180310448	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr2:180310448delT	ENST00000410066.1	-	8	1527	c.924delA	c.(922-924)aaafs	p.K308fs	ZNF385B_ENST00000466398.1_5'UTR|ZNF385B_ENST00000409343.1_Frame_Shift_Del_p.K232fs|ZNF385B_ENST00000336917.5_Frame_Shift_Del_p.K206fs|ZNF385B_ENST00000409692.1_Frame_Shift_Del_p.K206fs	NM_152520.4	NP_689733.3	Q569K4	Z385B_HUMAN	zinc finger protein 385B	308	Interaction with p53/TP53.				intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|p53 binding (GO:0002039)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	26			Epithelial(96;0.174)|OV - Ovarian serous cystadenocarcinoma(117;0.201)			TGGTCTTGTGTTTAGATCCTA	0.388																																					p.K308fs	Colon(155;204 2491 32774 51842)	.											.	ZNF385B-23	0			c.924delA						.						103.0	95.0	98.0					2																	180310448		2203	4300	6503	SO:0001589	frameshift_variant	151126	exon8			.	AK057999	CCDS33339.1, CCDS46463.1, CCDS46464.1	2q31.3-q32.1	2012-10-05	2007-12-06	2007-12-06	ENSG00000144331	ENSG00000144331			26332	protein-coding gene	gene with protein product		612344	"""zinc finger protein 533"""	ZNF533		12477932	Standard	NM_152520		Approved	FLJ25270	uc002unn.4	Q569K4	OTTHUMG00000154559	ENST00000410066.1:c.924delA	2.37:g.180310448delT	ENSP00000386845:p.Lys308fs	Somatic	81	0		WXS	Illumina HiSeq	Phase_I	91	30	NM_152520	0	0	0	0	0	Q49A04|Q6ZMZ7|Q8IY01|Q8N8H2|Q96DK4	Frame_Shift_Del	DEL	ENST00000410066.1	37	CCDS33339.1																																																																																			.		0.388	ZNF385B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335972.1	NM_152520	
SON	6651	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	21	34927198	34927198	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr21:34927198delA	ENST00000356577.4	+	3	6136	c.5661delA	c.(5659-5661)tcafs	p.S1887fs	SON_ENST00000290239.6_Frame_Shift_Del_p.S1887fs|SON_ENST00000381679.4_Frame_Shift_Del_p.S1887fs|SON_ENST00000300278.4_Frame_Shift_Del_p.S1887fs|SON_ENST00000381692.2_Intron	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	1887					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						GATCTGTATCAAAAGAGAAGC	0.453																																					p.S1887fs		.											.	SON-97	0			c.5661delA						.						52.0	50.0	51.0					21																	34927198		2203	4300	6503	SO:0001589	frameshift_variant	6651	exon3			.	AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.5661delA	21.37:g.34927198delA	ENSP00000348984:p.Ser1887fs	Somatic	38	0		WXS	Illumina HiSeq	Phase_I	42	15	NM_032195	0	0	0	0	0	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Frame_Shift_Del	DEL	ENST00000356577.4	37	CCDS13629.1																																																																																			.		0.453	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140978.2	NM_138927	
TOP2B	7155	broad.mit.edu	37	3	25678710	25678710	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr3:25678710delT	ENST00000264331.4	-	6	634	c.635delA	c.(634-636)aagfs	p.K212fs	TOP2B_ENST00000435706.2_Frame_Shift_Del_p.K207fs	NM_001068.2	NP_001059.2	Q02880	TOP2B_HUMAN	topoisomerase (DNA) II beta 180kDa	212					ATP catabolic process (GO:0006200)|axonogenesis (GO:0007409)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|forebrain development (GO:0030900)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|neuron migration (GO:0001764)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein kinase C binding (GO:0005080)			breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|skin(2)|stomach(1)	36					Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Etoposide(DB00773)	GCATACCTGCTTAAAACTGTG	0.333																																					p.K207fs													.	TOP2B-273	0			c.620delA						.						50.0	46.0	48.0					3																	25678710		1782	4022	5804	SO:0001589	frameshift_variant	7155	exon6			ACCTGCTTAAAAC	X68060	CCDS46776.1	3p24.2	2012-08-30	2002-08-29		ENSG00000077097	ENSG00000077097	5.99.1.3		11990	protein-coding gene	gene with protein product		126431	"""topoisomerase (DNA) II beta (180kD)"""			1309226, 1333583	Standard	NM_001068		Approved		uc003cdj.3	Q02880	OTTHUMG00000155596	ENST00000264331.4:c.635delA	3.37:g.25678710delT	ENSP00000264331:p.Lys212fs	Somatic	7	0		WXS	Illumina HiSeq	Phase_I	5	2	NM_001068	0	0	0	0	0	Q13600|Q9UMG8|Q9UQP8	Frame_Shift_Del	DEL	ENST00000264331.4	37																																																																																				.		0.333	TOP2B-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			
ZNF318	24149	broad.mit.edu	37	6	43323502	43323502	+	Frame_Shift_Del	DEL	T	T	-			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr6:43323502delT	ENST00000361428.2	-	4	1647	c.1570delA	c.(1570-1572)aggfs	p.R526fs	ZNF318_ENST00000318149.3_Frame_Shift_Del_p.R526fs	NM_014345.2	NP_055160.2	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	526					meiotic nuclear division (GO:0007126)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(21)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	61			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			CTACGTCGCCTTTTTTCCTGT	0.493																																					p.R524fs													.	ZNF318-157	0			c.1570delA						.						215.0	222.0	219.0					6																	43323502		2203	4300	6503	SO:0001589	frameshift_variant	24149	exon4			GTCGCCTTTTTTC	AF090114	CCDS4895.2	6p21.1	2013-09-19			ENSG00000171467	ENSG00000171467		"""Zinc fingers, C2H2-type"""	13578	protein-coding gene	gene with protein product						10873617	Standard	NM_014345		Approved	HRIHFB2436, ZFP318	uc003oux.3	Q5VUA4	OTTHUMG00000014732	ENST00000361428.2:c.1570delA	6.37:g.43323502delT	ENSP00000354964:p.Arg526fs	Somatic	517	0		WXS	Illumina HiSeq	Phase_I	438	7	NM_014345	0	0	0	0	0	O94796|Q4G0E4|Q8NEM6|Q9UNU8|Q9Y2W9	Frame_Shift_Del	DEL	ENST00000361428.2	37	CCDS4895.2																																																																																			.		0.493	ZNF318-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040601.2	NM_014345	
VPS37D	155382	broad.mit.edu	37	7	73083913	73083921	+	Splice_Site	DEL	GCGACTGGG	GCGACTGGG	-	rs199826922	byFrequency	TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	GCGACTGGG	GCGACTGGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr7:73083913_73083921delGCGACTGGG	ENST00000324941.4	+	2	437_444	c.303_310delGCGACTGGG	c.(301-312)cagcgactggga>caga	p.RLG102del	VPS37D_ENST00000451519.1_Intron	NM_001077621.1	NP_001071089.1			vacuolar protein sorting 37 homolog D (S. cerevisiae)											central_nervous_system(1)|ovary(1)	2		Lung NSC(55;0.0908)|all_lung(88;0.198)				ACAAGCTGCAGCGACTGGGTGAGGGCACG	0.675																																					p.101_104del													.	VPS37D-68	0			c.303_310del						.																																			SO:0001630	splice_region_variant	155382	exon2			GCTGCAGCGACTG	AY081952	CCDS43596.1	7q11.23	2007-07-27	2006-04-04	2005-08-18	ENSG00000176428	ENSG00000176428			18287	protein-coding gene	gene with protein product		610039	"""Williams Beuren syndrome chromosome region 24"", ""vacuolar protein sorting 37D (yeast)"""	WBSCR24		15218037	Standard	NM_001077621		Approved	MGC35352	uc003tyr.3	Q86XT2	OTTHUMG00000157227	ENST00000324941.4:c.310+1GCGACTGGG>-	7.37:g.73083913_73083921delGCGACTGGG		Somatic	14	0		WXS	Illumina HiSeq	Phase_I	8	3	NM_001077621	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000324941.4	37	CCDS43596.1																																																																																			.		0.675	VPS37D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348064.1	NM_152560	In_Frame_Del
GPR174	84636	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	78427128	78427128	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chrX:78427128delG	ENST00000276077.1	+	1	660	c.624delG	c.(622-624)acgfs	p.T208fs		NM_032553.1	NP_115942.1	Q9BXC1	GP174_HUMAN	G protein-coupled receptor 174	208						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(19)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	38						CCTGGAAGACGGTTTTATCAC	0.438										HNSCC(63;0.18)																											p.T208fs		.											.	GPR174-130	0			c.624delG						.						97.0	93.0	94.0					X																	78427128		2203	4300	6503	SO:0001589	frameshift_variant	84636	exon1			.	AF345567	CCDS14443.1	Xq13.3	2012-08-21			ENSG00000147138	ENSG00000147138		"""GPCR / Class A : Orphans"""	30245	protein-coding gene	gene with protein product		300903					Standard	NM_032553		Approved	FKSG79	uc004edg.1	Q9BXC1	OTTHUMG00000021898	ENST00000276077.1:c.624delG	X.37:g.78427128delG	ENSP00000276077:p.Thr208fs	Somatic	101	0		WXS	Illumina HiSeq	Phase_I	151	60	NM_032553	0	0	0	0	0	Q2M3F7	Frame_Shift_Del	DEL	ENST00000276077.1	37	CCDS14443.1																																																																																			.		0.438	GPR174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057327.1	NM_032553	
CORO1A	11151	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	30198546	30198547	+	Splice_Site	INS	-	-	GA			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr16:30198546_30198547insGA	ENST00000219150.5	+	5	941		c.e5+2		RP11-455F5.5_ENST00000566144.1_RNA|CORO1A_ENST00000565497.1_Splice_Site|RP11-455F5.5_ENST00000568506.1_RNA|CORO1A_ENST00000570045.1_Splice_Site|RP11-455F5.5_ENST00000567153.1_RNA	NM_001193333.2|NM_007074.3	NP_001180262.1|NP_009005.1	P31146	COR1A_HUMAN	coronin, actin binding protein, 1A						actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|calcium ion transport (GO:0006816)|cell-substrate adhesion (GO:0031589)|cellular component movement (GO:0006928)|cellular response to interleukin-4 (GO:0071353)|homeostasis of number of cells within a tissue (GO:0048873)|innate immune response (GO:0045087)|leukocyte chemotaxis (GO:0030595)|negative regulation of actin nucleation (GO:0051126)|phagocytosis (GO:0006909)|phagolysosome assembly (GO:0001845)|positive chemotaxis (GO:0050918)|positive regulation of cell migration (GO:0030335)|positive regulation of T cell proliferation (GO:0042102)|regulation of actin filament polymerization (GO:0030833)|regulation of cell shape (GO:0008360)|T cell homeostasis (GO:0043029)|uropod organization (GO:0032796)	actin filament (GO:0005884)|cell-cell junction (GO:0005911)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|lamellipodium (GO:0030027)|membrane (GO:0016020)|phagocytic cup (GO:0001891)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	actin filament binding (GO:0051015)|cytoskeletal protein binding (GO:0008092)|phosphatidylinositol 3-kinase binding (GO:0043548)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	9						GTCGTAGCTGTGAGTCGCCATC	0.589																																					.		.											.	CORO1A-226	0			c.636+2->GA						.																																			SO:0001630	splice_region_variant	11151	exon5			.	X89109	CCDS10673.1	16p11.2	2014-09-17	2001-11-28		ENSG00000102879	ENSG00000102879		"""Coronins"", ""WD repeat domain containing"""	2252	protein-coding gene	gene with protein product	"""Clabp TACO"""	605000	"""coronin, actin-binding protein, 1A"""			9778037	Standard	NM_007074		Approved	HCORO1, p57, coronin-1	uc002dww.3	P31146	OTTHUMG00000132148	ENST00000219150.5:c.636+2->GA	16.37:g.30198547_30198548dupGA		Somatic	102	0		WXS	Illumina HiSeq	Phase_I	74	21	NM_007074	0	0	0	0	0	B2RBL1|Q2YD73	Splice_Site	INS	ENST00000219150.5	37	CCDS10673.1																																																																																			.		0.589	CORO1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255195.2	NM_007074	Intron
OBSL1	23363	broad.mit.edu	37	2	220435527	220435528	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr2:220435527_220435528insC	ENST00000404537.1	-	1	483_484	c.427_428insG	c.(427-429)gcgfs	p.A143fs	OBSL1_ENST00000491370.1_Intron|OBSL1_ENST00000373873.4_Frame_Shift_Ins_p.A143fs|OBSL1_ENST00000289656.3_Intron|OBSL1_ENST00000603926.1_Frame_Shift_Ins_p.A143fs|OBSL1_ENST00000373876.1_Frame_Shift_Ins_p.A143fs|INHA_ENST00000243786.2_5'Flank|INHA_ENST00000489456.1_Intron|OBSL1_ENST00000265318.4_Frame_Shift_Ins_p.A143fs	NM_015311.2	NP_056126.1	O75147	OBSL1_HUMAN	obscurin-like 1	143	Ig-like 2.				cardiac myofibril assembly (GO:0055003)|cytoskeleton organization (GO:0007010)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|positive regulation of dendrite morphogenesis (GO:0050775)|protein localization to Golgi apparatus (GO:0034067)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|M band (GO:0031430)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)						Renal(207;0.0376)		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)		CACCACCTCCGCCCCCCGCAGC	0.748																																					p.A143fs													.	OBSL1-71	0			c.428_429insG						.																																			SO:0001589	frameshift_variant	23363	exon1			ACCTCCGCCCCCC	BC007201	CCDS46520.1, CCDS54433.1, CCDS63134.1	2q35	2013-01-29			ENSG00000124006	ENSG00000124006		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29092	protein-coding gene	gene with protein product		610991				9734811	Standard	NM_015311		Approved	KIAA0657	uc010fwk.3	O75147	OTTHUMG00000059157	ENST00000404537.1:c.428dupG	2.37:g.220435533_220435533dupC	ENSP00000385636:p.Ala143fs	Somatic	15	0		WXS	Illumina HiSeq	Phase_I	6	2	NM_001173431	0	0	0	0	0	A4KVA4|A4KVA5|Q96IW3|S4R3M6	Frame_Shift_Ins	INS	ENST00000404537.1	37	CCDS46520.1																																																																																			.		0.748	OBSL1-014	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322012.1		
NEK10	152110	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	27297798	27297799	+	Missense_Mutation	DNP	GA	GA	AT			TCGA-A4-7734-01A-11D-2136-08	TCGA-A4-7734-10A-01D-2136-08	GA	GA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	397b1104-cfd3-4d68-9e37-7ce13f64d5ea	9436630f-ab20-427a-9f0d-a8c636844aa8	g.chr3:27297798_27297799GA>AT	ENST00000429845.2	-	24	2440_2441	c.2078_2079TC>AT	c.(2077-2079)aTC>aAT	p.I693N	NEK10_ENST00000357467.2_Missense_Mutation_p.I90N|NEK10_ENST00000341435.5_Missense_Mutation_p.I693N			Q6ZWH5	NEK10_HUMAN	NIMA-related kinase 10	693	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein autophosphorylation (GO:0031954)|protein phosphorylation (GO:0006468)|regulation of cell cycle G2/M phase transition (GO:1902749)|regulation of ERK1 and ERK2 cascade (GO:0070372)	protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						AAGAATACAGGATTGTTCCAAC	0.342																																					p.I693N													.	NEK10-695	0			c.T2078A						.																																			SO:0001583	missense	152110	exon24			TACAGGATTGTTC	AK123061, AK057247	CCDS46781.1	3p24.1	2012-11-15	2012-11-15		ENSG00000163491	ENSG00000163491			18592	protein-coding gene	gene with protein product			"""NIMA (never in mitosis gene a)- related kinase 10"""			15289607	Standard	NM_199347		Approved	FLJ32685	uc003cdt.2	Q6ZWH5	OTTHUMG00000130571	ENST00000429845.2:c.2078_2079delinsAT	3.37:g.27297798_27297799delinsAT	ENSP00000395849:p.Ile693Asn	Somatic	33	0		WXS	Illumina HiSeq	Phase_I	25	8	NM_199347	0	0	0	0	0	A8MWG1|B9ZVR0|Q45VJ4|Q6ZR11|Q7Z671|Q86XB1|Q96MB3	Missense_Mutation	DNP	ENST00000429845.2	37																																																																																				.		0.342	NEK10-016	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000438156.1	NM_152534	
