#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CCDC27	148870	hgsc.bcm.edu	37	1	3679839	3679839	+	Silent	SNP	A	A	G			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr1:3679839A>G	ENST00000294600.2	+	7	1206	c.1122A>G	c.(1120-1122)gaA>gaG	p.E374E		NM_152492.2	NP_689705.2	Q2M243	CCD27_HUMAN	coiled-coil domain containing 27	374	Glu-rich.									breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(2)|lung(17)|prostate(1)|skin(2)|urinary_tract(2)	36	all_cancers(77;0.0385)|Ovarian(185;0.0634)|Lung NSC(156;0.21)|all_lung(157;0.218)	all_epithelial(116;5.52e-17)|all_lung(118;1.04e-06)|Lung NSC(185;0.000214)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Lung SC(97;0.0367)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)		Epithelial(90;1.11e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.35e-22)|GBM - Glioblastoma multiforme(42;3.46e-16)|Colorectal(212;1.17e-05)|COAD - Colon adenocarcinoma(227;5.76e-05)|Kidney(185;0.00036)|BRCA - Breast invasive adenocarcinoma(365;0.000696)|KIRC - Kidney renal clear cell carcinoma(229;0.00558)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.203)		aggaggaggaagaggaggaag	0.647																																					p.E374E		.											.	CCDC27-91	0			c.A1122G						.						71.0	73.0	72.0					1																	3679839		2200	4299	6499	SO:0001819	synonymous_variant	148870	exon7			GGAGGAAGAGGAG		CCDS50.1	1p36.32	2008-02-05			ENSG00000162592	ENSG00000162592			26546	protein-coding gene	gene with protein product							Standard	NM_152492		Approved	FLJ32825	uc001akv.2	Q2M243	OTTHUMG00000003504	ENST00000294600.2:c.1122A>G	1.37:g.3679839A>G		Somatic	19	0		WXS	Illumina HiSeq	Phase_I	36	2	NM_152492	0	0	0	0	0	Q5TBV3|Q96M50	Silent	SNP	ENST00000294600.2	37	CCDS50.1																																																																																			.		0.647	CCDC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009740.1	NM_152492	
KIF1B	23095	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	10342493	10342493	+	Missense_Mutation	SNP	T	T	A			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr1:10342493T>A	ENST00000377086.1	+	15	1538	c.1336T>A	c.(1336-1338)Tgc>Agc	p.C446S	KIF1B_ENST00000263934.6_Missense_Mutation_p.C400S|KIF1B_ENST00000377083.1_Missense_Mutation_p.C400S|KIF1B_ENST00000377081.1_Missense_Mutation_p.C446S|KIF1B_ENST00000377093.4_Missense_Mutation_p.C400S			O60333	KIF1B_HUMAN	kinesin family member 1B	446					anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		CCCATCTTCCTGCTCACTCAG	0.483																																					p.C400S		.											.	KIF1B-93	0			c.T1198A						.						145.0	132.0	137.0					1																	10342493		2203	4300	6503	SO:0001583	missense	23095	exon13			TCTTCCTGCTCAC	AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.1336T>A	1.37:g.10342493T>A	ENSP00000366290:p.Cys446Ser	Somatic	183	1		WXS	Illumina HiSeq	Phase_I	144	24	NM_183416	0	0	0	0	0	A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Missense_Mutation	SNP	ENST00000377086.1	37		.	.	.	.	.	.	.	.	.	.	T	9.981	1.228167	0.22542	.	.	ENSG00000054523	ENST00000355249;ENST00000263934;ENST00000377093;ENST00000377086;ENST00000377083;ENST00000377081	T;T;T;T;T	0.71698	-0.41;-0.59;-0.44;-0.59;-0.44	5.38	5.38	0.77491	.	0.219298	0.48286	D	0.000184	T	0.42381	0.1200	N	0.01576	-0.805	0.50039	D	0.999845	B;B;B;B;B;B;B	0.19200	0.0;0.001;0.0;0.0;0.0;0.034;0.007	B;B;B;B;B;B;B	0.17098	0.001;0.0;0.001;0.001;0.0;0.017;0.004	T	0.47471	-0.9115	10	0.07990	T	0.79	.	15.7585	0.78058	0.0:0.0:0.0:1.0	.	432;406;446;420;446;400;400	Q4R9M9;Q4R9M7;Q4VXC4;Q4R9M8;O60333;O60333-2;O60333-3	.;.;.;.;KIF1B_HUMAN;.;.	S	446;400;400;446;400;446	ENSP00000263934:C400S;ENSP00000366297:C400S;ENSP00000366290:C446S;ENSP00000366287:C400S;ENSP00000366284:C446S	ENSP00000263934:C400S	C	+	1	0	KIF1B	10265080	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.373000	0.59537	2.191000	0.70037	0.529000	0.55759	TGC	.		0.483	KIF1B-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000005102.1		
SCMH1	22955	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	41503104	41503104	+	Silent	SNP	G	G	A			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr1:41503104G>A	ENST00000326197.7	-	12	1877	c.1578C>T	c.(1576-1578)caC>caT	p.H526H	SCMH1_ENST00000402904.2_Silent_p.H526H|SCMH1_ENST00000361191.5_Silent_p.H465H|SCMH1_ENST00000372596.1_Silent_p.H465H|SCMH1_ENST00000337495.5_Silent_p.H536H|SCMH1_ENST00000456518.2_Silent_p.H368H|SCMH1_ENST00000397171.2_Silent_p.H465H|SCMH1_ENST00000361705.3_Silent_p.H479H|SCMH1_ENST00000397174.2_Silent_p.H506H|SCMH1_ENST00000472037.1_5'UTR|SCMH1_ENST00000372595.1_Silent_p.H465H|SCMH1_ENST00000372597.1_Silent_p.H479H					sex comb on midleg homolog 1 (Drosophila)											breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(2)|pancreas(2)|upper_aerodigestive_tract(1)	15	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)|Breast(333;0.162)	Myeloproliferative disorder(586;0.0393)				GCAAGGGCCGGTGCCTTTGGG	0.587																																					p.H536H		.											.	SCMH1-90	0			c.C1608T						.						200.0	179.0	186.0					1																	41503104		2203	4300	6503	SO:0001819	synonymous_variant	22955	exon13			GGGCCGGTGCCTT	AF149045	CCDS461.1, CCDS30688.1, CCDS53301.1, CCDS53302.1, CCDS53303.1, CCDS53304.1	1p34	2013-01-10			ENSG00000010803	ENSG00000010803		"""Sterile alpha motif (SAM) domain containing"""	19003	protein-coding gene	gene with protein product						10524249	Standard	NM_012236		Approved	Scml3	uc001cgs.3	Q96GD3	OTTHUMG00000005720	ENST00000326197.7:c.1578C>T	1.37:g.41503104G>A		Somatic	225	0		WXS	Illumina HiSeq	Phase_I	181	24	NM_001172219	0	0	37	64	27		Silent	SNP	ENST00000326197.7	37	CCDS30688.1																																																																																			.		0.587	SCMH1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015656.1		
INADL	10207	hgsc.bcm.edu	37	1	62516665	62516665	+	Missense_Mutation	SNP	A	A	G	rs375573695		TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr1:62516665A>G	ENST00000371158.2	+	31	4174	c.4060A>G	c.(4060-4062)Agt>Ggt	p.S1354G	INADL_ENST00000545929.1_Missense_Mutation_p.S27G|INADL_ENST00000316485.6_Missense_Mutation_p.S1354G|INADL_ENST00000543708.1_Missense_Mutation_p.S138G	NM_176877.2	NP_795352	Q8NI35	INADL_HUMAN	InaD-like (Drosophila)	1354					cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|intracellular signal transduction (GO:0035556)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(8)|liver(1)|lung(51)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)	103						ACCTATTAGTAGTGAGGAAGA	0.403																																					p.S1354G		.											.	INADL-94	0			c.A4060G						.	A	GLY/SER	3,4403	6.2+/-15.9	0,3,2200	135.0	129.0	131.0		4060	-0.1	0.4	1		131	0,8600		0,0,4300	no	missense	INADL	NM_176877.2	56	0,3,6500	GG,GA,AA		0.0,0.0681,0.0231	benign	1354/1802	62516665	3,13003	2203	4300	6503	SO:0001583	missense	10207	exon31			ATTAGTAGTGAGG	AB044807	CCDS617.2	1p31	2008-02-05			ENSG00000132849	ENSG00000132849			28881	protein-coding gene	gene with protein product		603199				9280290, 11374908	Standard	NM_176877		Approved	Cipp, PATJ	uc001dab.3	Q8NI35	OTTHUMG00000008560	ENST00000371158.2:c.4060A>G	1.37:g.62516665A>G	ENSP00000360200:p.Ser1354Gly	Somatic	90	0		WXS	Illumina HiSeq	Phase_I	39	2	NM_176877	0	0	13	13	0	O15249|O43742|O60833|Q5VUA5|Q5VUA6|Q5VUA7|Q5VUA8|Q5VUA9|Q5VUB0|Q8WU78|Q9H3N9	Missense_Mutation	SNP	ENST00000371158.2	37	CCDS617.2	.	.	.	.	.	.	.	.	.	.	A	7.721	0.697127	0.15106	6.81E-4	0.0	ENSG00000132849	ENST00000371158;ENST00000316485;ENST00000371156;ENST00000395513;ENST00000307297;ENST00000543708;ENST00000545929	T;T;T;T;T	0.34072	2.71;2.57;3.22;2.18;1.38	4.98	-0.0485	0.13838	.	0.641692	0.16310	N	0.220030	T	0.19446	0.0467	N	0.21282	0.65	0.19300	N	0.999977	B;B;B;B;B;B	0.10296	0.0;0.0;0.003;0.001;0.001;0.002	B;B;B;B;B;B	0.13407	0.0;0.001;0.006;0.003;0.002;0.009	T	0.13737	-1.0498	10	0.51188	T	0.08	.	3.256	0.06832	0.5452:0.0:0.2839:0.1709	.	27;138;813;1354;1354;1354	F5GY89;B4DE90;Q8NI35-5;F8W8T2;Q8NI35;Q8NI35-4	.;.;.;.;INADL_HUMAN;.	G	1354;1354;1354;1354;138;138;27	ENSP00000360200:S1354G;ENSP00000326199:S1354G;ENSP00000307496:S138G;ENSP00000445790:S138G;ENSP00000440094:S27G	ENSP00000307496:S138G	S	+	1	0	INADL	62289253	0.580000	0.26733	0.423000	0.26634	0.253000	0.25986	0.192000	0.17096	-0.097000	0.12307	0.533000	0.62120	AGT	.		0.403	INADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023639.2	NM_170605	
PTGFR	5737	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	78959187	78959187	+	Silent	SNP	G	G	A			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr1:78959187G>A	ENST00000370757.3	+	2	996	c.759G>A	c.(757-759)gcG>gcA	p.A253A	PTGFR_ENST00000370758.1_Silent_p.A253A|PTGFR_ENST00000370756.3_Silent_p.A253A	NM_000959.3	NP_000950.1	P43088	PF2R_HUMAN	prostaglandin F receptor (FP)	253					calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of apoptotic process (GO:0043066)|parturition (GO:0007567)|response to lipopolysaccharide (GO:0032496)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	prostaglandin F receptor activity (GO:0004958)	p.A253A(2)		breast(6)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	33				Colorectal(170;0.248)	Bimatoprost(DB00905)|Dinoprost Tromethamine(DB01160)|Latanoprost(DB00654)|Tafluprost(DB08819)|Travoprost(DB00287)	AGCTCCTGGCGATAATGTGTG	0.393																																					p.A253A		.											.	PTGFR-527	2	Substitution - coding silent(2)	skin(2)	c.G759A						.						52.0	49.0	50.0					1																	78959187		2203	4300	6503	SO:0001819	synonymous_variant	5737	exon2			CCTGGCGATAATG	AF004021	CCDS686.1, CCDS30759.1	1p31.1	2012-08-08			ENSG00000122420	ENSG00000122420		"""GPCR / Class A : Prostanoid receptors"""	9600	protein-coding gene	gene with protein product		600563				8300593, 7759114	Standard	XM_006710781		Approved	FP	uc001din.3	P43088	OTTHUMG00000009644	ENST00000370757.3:c.759G>A	1.37:g.78959187G>A		Somatic	153	0		WXS	Illumina HiSeq	Phase_I	127	17	NM_000959	0	0	0	0	0	A8K9Y0|Q2KHP3|Q6RYQ6|Q9P1X4	Silent	SNP	ENST00000370757.3	37	CCDS686.1																																																																																			.		0.393	PTGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026582.1	NM_000959	
AGL	178	broad.mit.edu	37	1	100346330	100346330	+	Missense_Mutation	SNP	T	T	A			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr1:100346330T>A	ENST00000294724.4	+	14	2356	c.1878T>A	c.(1876-1878)caT>caA	p.H626Q	AGL_ENST00000370163.3_Missense_Mutation_p.H626Q|AGL_ENST00000370165.3_Missense_Mutation_p.H626Q|AGL_ENST00000370161.2_Missense_Mutation_p.H610Q|AGL_ENST00000361915.3_Missense_Mutation_p.H626Q|AGL_ENST00000361522.4_Missense_Mutation_p.H609Q|AGL_ENST00000361302.3_Missense_Mutation_p.H610Q	NM_000028.2	NP_000019.2	P35573	GDE_HUMAN	amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase	626					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|inclusion body (GO:0016234)|isoamylase complex (GO:0043033)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)	4-alpha-glucanotransferase activity (GO:0004134)|amylo-alpha-1,6-glucosidase activity (GO:0004135)|glycogen debranching enzyme activity (GO:0004133)|polysaccharide binding (GO:0030247)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(9)|lung(35)|ovary(1)|prostate(4)|skin(3)|urinary_tract(1)	69		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)		ATATTACGCATGATAATGAGT	0.388																																					p.H626Q													.	AGL-92	0			c.T1878A						.						321.0	284.0	296.0					1																	100346330		2203	4300	6503	SO:0001583	missense	178	exon14			TACGCATGATAAT	BC078663	CCDS759.1, CCDS760.1, CCDS761.1	1p21	2010-04-27	2010-04-27		ENSG00000162688	ENSG00000162688	2.4.1.25, 3.2.1.33		321	protein-coding gene	gene with protein product	"""glycogen debranching enzyme"", ""glycogen storage disease type III"""	610860	"""amylo-1, 6-glucosidase, 4-alpha-glucanotransferase"""			1505983	Standard	NM_000028		Approved		uc001dsi.1	P35573	OTTHUMG00000010803	ENST00000294724.4:c.1878T>A	1.37:g.100346330T>A	ENSP00000294724:p.His626Gln	Somatic	377	0		WXS	Illumina HiSeq	Phase_I	68	4	NM_000644	0	0	1	1	0	A6NCX7|A6NEK2|D3DT51|P78354|P78544|Q59H92|Q6AZ90|Q9UF08	Missense_Mutation	SNP	ENST00000294724.4	37	CCDS759.1	.	.	.	.	.	.	.	.	.	.	T	17.28	3.348979	0.61183	.	.	ENSG00000162688	ENST00000361915;ENST00000370165;ENST00000370163;ENST00000294724;ENST00000361302;ENST00000370161;ENST00000361522	D;D;D;D;D;D;D	0.94417	-3.42;-3.42;-3.42;-3.42;-3.42;-3.42;-3.42	6.08	-0.561	0.11785	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	D	0.96074	0.8721	M	0.89353	3.025	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.95040	0.8177	10	0.87932	D	0	.	10.1565	0.42825	0.0:0.3802:0.0:0.6198	.	609;610;626	P35573-2;P35573-3;P35573	.;.;GDE_HUMAN	Q	626;626;626;626;610;610;609	ENSP00000355106:H626Q;ENSP00000359184:H626Q;ENSP00000359182:H626Q;ENSP00000294724:H626Q;ENSP00000354971:H610Q;ENSP00000359180:H610Q;ENSP00000354635:H609Q	ENSP00000294724:H626Q	H	+	3	2	AGL	100118918	1.000000	0.71417	0.992000	0.48379	0.734000	0.41952	0.657000	0.24963	-0.333000	0.08476	0.482000	0.46254	CAT	.		0.388	AGL-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029778.1	NM_000028	
LRIG2	9860	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	113657326	113657326	+	Silent	SNP	C	C	A			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr1:113657326C>A	ENST00000361127.5	+	15	2556	c.2358C>A	c.(2356-2358)tcC>tcA	p.S786S	LRIG2_ENST00000492207.1_3'UTR	NM_014813.1	NP_055628.1	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like domains 2	786					innervation (GO:0060384)|regulation of platelet-derived growth factor receptor signaling pathway (GO:0010640)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(10)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	31	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		TCATTTCATCCCCCAATTGTG	0.468																																					p.S786S		.											.	LRIG2-229	0			c.C2358A						.						203.0	166.0	179.0					1																	113657326		2203	4300	6503	SO:0001819	synonymous_variant	9860	exon15			TTCATCCCCCAAT	AB018349	CCDS30808.1	1p13.1	2013-01-11			ENSG00000198799	ENSG00000198799		"""Immunoglobulin superfamily / I-set domain containing"""	20889	protein-coding gene	gene with protein product		608869					Standard	XM_005271369		Approved	KIAA0806	uc001edf.1	O94898	OTTHUMG00000012133	ENST00000361127.5:c.2358C>A	1.37:g.113657326C>A		Somatic	298	1		WXS	Illumina HiSeq	Phase_I	111	15	NM_014813	0	0	2	3	1	Q9NSN2	Silent	SNP	ENST00000361127.5	37	CCDS30808.1																																																																																			.		0.468	LRIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033549.2	NM_014813	
PEX19	5824	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	160253370	160253370	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr1:160253370C>T	ENST00000368072.5	-	2	151	c.130G>A	c.(130-132)Gcc>Acc	p.A44T	PEX19_ENST00000532508.1_5'UTR|DCAF8_ENST00000556710.1_Intron|PEX19_ENST00000440949.3_5'UTR|DCAF8_ENST00000608310.1_Intron	NM_001193644.1|NM_002857.3	NP_001180573.1|NP_002848.1	P40855	PEX19_HUMAN	peroxisomal biogenesis factor 19	44	Docking to the peroxisome membrane and binding to PEX3.|Necessary for PEX19 function on peroxisome biogenesis.				chaperone-mediated protein folding (GO:0061077)|chaperone-mediated protein transport (GO:0072321)|establishment of protein localization to peroxisome (GO:0072663)|negative regulation of lipid binding (GO:1900131)|peroxisome fission (GO:0016559)|peroxisome membrane biogenesis (GO:0016557)|peroxisome organization (GO:0007031)|protein import into peroxisome membrane (GO:0045046)|protein stabilization (GO:0050821)|protein targeting to peroxisome (GO:0006625)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)	ATPase binding (GO:0051117)|peroxisome membrane class-1 targeting sequence binding (GO:0036105)|protein N-terminus binding (GO:0047485)			cervix(1)|endometrium(2)|large_intestine(2)|lung(4)|prostate(2)	11	all_cancers(52;1.27e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GCATCAGGGGCCGTGGTGGTA	0.562																																					p.A44T		.											.	PEX19-90	0			c.G130A						.						65.0	67.0	66.0					1																	160253370		2203	4300	6503	SO:0001583	missense	5824	exon2			CAGGGGCCGTGGT	Y09048	CCDS1201.1	1q22	2008-07-18	2004-03-17	2004-03-19	ENSG00000162735	ENSG00000162735			9713	protein-coding gene	gene with protein product	"""housekeeping gene, 33kD"""	600279	"""peroxisomal farnesylated protein"""	PXF		9339377, 10051604	Standard	NM_002857		Approved	HK33, D1S2223E, PMP1, PMPI, PXMP1		P40855	OTTHUMG00000033112	ENST00000368072.5:c.130G>A	1.37:g.160253370C>T	ENSP00000357051:p.Ala44Thr	Somatic	186	0		WXS	Illumina HiSeq	Phase_I	200	27	NM_002857	0	0	30	70	40	D3DVE7|Q5QNY4|Q8NI97	Missense_Mutation	SNP	ENST00000368072.5	37	CCDS1201.1	.	.	.	.	.	.	.	.	.	.	C	17.55	3.417114	0.62511	.	.	ENSG00000162735	ENST00000368072;ENST00000429425;ENST00000392220	.	.	.	4.61	0.66	0.17868	.	0.463549	0.23343	N	0.049217	T	0.12263	0.0298	N	0.19112	0.55	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.11792	-1.0573	9	0.13853	T	0.58	-0.5735	5.3692	0.16131	0.0:0.5415:0.1411:0.3175	.	44	P40855	PEX19_HUMAN	T	44;24;24	.	ENSP00000357051:A44T	A	-	1	0	PEX19	158519994	0.994000	0.37717	0.887000	0.34795	0.892000	0.51952	3.040000	0.49799	-0.022000	0.13986	-0.217000	0.12591	GCC	.		0.562	PEX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080642.2	NM_002857	
TMEM183A	92703	hgsc.bcm.edu	37	1	202976622	202976622	+	Missense_Mutation	SNP	G	G	T	rs199910238	byFrequency	TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr1:202976622G>T	ENST00000367242.3	+	1	109	c.29G>T	c.(28-30)aGg>aTg	p.R10M		NM_001079809.1|NM_138391.4	NP_001073277.1|NP_612400.3	Q8IXX5	T183A_HUMAN	transmembrane protein 183A	10			R -> M (in dbSNP:rs11558253). {ECO:0000269|PubMed:15489334}.			integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(1)|skin(3)	7			BRCA - Breast invasive adenocarcinoma(75;0.18)			CCGCTAGGCAGGCCTCGCCCC	0.766													G|||	27	0.00539137	0.0	0.013	5008	,	,		9878	0.001		0.0119	False		,,,				2504	0.0051				p.R10M		.											.	.	0			c.G29T						.						2.0	3.0	3.0					1																	202976622		1501	3310	4811	SO:0001583	missense	653659	exon1			TAGGCAGGCCTCG	BC013073	CCDS1432.1	1q31.1	2008-09-09	2006-12-18	2006-12-18	ENSG00000163444	ENSG00000163444			20173	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 37"""	C1orf37			Standard	NM_138391		Approved		uc001gyu.1	Q8IXX5	OTTHUMG00000042051	ENST00000367242.3:c.29G>T	1.37:g.202976622G>T	ENSP00000356211:p.Arg10Met	Somatic	3	0		WXS	Illumina HiSeq	Phase_I	12	6	NM_001079809	0	0	3	14	11	A8K5W1|Q6NW15|Q96E06	Missense_Mutation	SNP	ENST00000367242.3	37	CCDS1432.1	13	0.005952380952380952	0	0.0	5	0.013812154696132596	1	0.0017482517482517483	7	0.009234828496042216	G	15.26	2.779836	0.49891	.	.	ENSG00000163444	ENST00000367242	T	0.25414	1.8	4.82	3.91	0.45181	.	0.359030	0.24774	N	0.035707	T	0.13628	0.0330	N	0.22421	0.69	0.32624	N	0.522917	B;B;B;B	0.31351	0.32;0.32;0.284;0.284	B;B;B;B	0.34931	0.192;0.192;0.173;0.173	T	0.19224	-1.0312	10	0.49607	T	0.09	-1.6885	11.1122	0.48239	0.0865:0.0:0.9135:0.0	.	10;10;10;10	A8K5W1;Q8IXX5-2;Q1AE95;Q8IXX5	.;.;T183B_HUMAN;T183A_HUMAN	M	10	ENSP00000356211:R10M	ENSP00000356211:R10M	R	+	2	0	TMEM183A	201243245	0.084000	0.21492	0.950000	0.38849	0.370000	0.29829	0.669000	0.25142	1.253000	0.44018	0.557000	0.71058	AGG	.		0.766	TMEM183A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000100129.1	NM_138391	
ESRRG	2104	hgsc.bcm.edu	37	1	216680501	216680501	+	Missense_Mutation	SNP	T	T	G			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr1:216680501T>G	ENST00000408911.3	-	7	1310	c.1157A>C	c.(1156-1158)gAa>gCa	p.E386A	ESRRG_ENST00000463665.1_Missense_Mutation_p.E324A|ESRRG_ENST00000366937.1_Missense_Mutation_p.E398A|ESRRG_ENST00000487276.1_Missense_Mutation_p.E363A|ESRRG_ENST00000361395.2_Missense_Mutation_p.E363A|ESRRG_ENST00000359162.2_Missense_Mutation_p.E363A|ESRRG_ENST00000493748.1_Missense_Mutation_p.E363A|ESRRG_ENST00000361525.3_Missense_Mutation_p.E363A|ESRRG_ENST00000366938.2_Missense_Mutation_p.E363A|ESRRG_ENST00000391890.3_Missense_Mutation_p.E370A|ESRRG_ENST00000360012.3_Missense_Mutation_p.E363A|ESRRG_ENST00000366940.2_Missense_Mutation_p.E363A|ESRRG_ENST00000493603.1_Missense_Mutation_p.E363A	NM_001438.3	NP_001429.2	P62508	ERR3_HUMAN	estrogen-related receptor gamma	386					gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	AF-2 domain binding (GO:0050682)|retinoic acid receptor activity (GO:0003708)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(1)|large_intestine(8)|liver(1)|lung(29)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)	CTGAACGGCTTCAACATCTTC	0.413																																					p.E398A		.											.	ESRRG-187	0			c.A1193C						.						91.0	84.0	86.0					1																	216680501		2203	4300	6503	SO:0001583	missense	2104	exon8			ACGGCTTCAACAT	AF058291	CCDS1517.1, CCDS41468.1, CCDS58060.1, CCDS58061.1	1q41	2014-02-18			ENSG00000196482	ENSG00000196482		"""Nuclear hormone receptors"""	3474	protein-coding gene	gene with protein product		602969				9676434, 10072763	Standard	NM_001243505		Approved	NR3B3	uc001hkw.2	P62508	OTTHUMG00000037025	ENST00000408911.3:c.1157A>C	1.37:g.216680501T>G	ENSP00000386171:p.Glu386Ala	Somatic	244	0		WXS	Illumina HiSeq	Phase_I	41	3	NM_001243518	0	0	0	0	0	A8K4I0|A8K6I2|B3KY84|E9PGB7|F8W8J3|O75454|O96021|Q68DA0|Q6P274|Q6PK28|Q6TS38|Q9R1F3|Q9UNJ4	Missense_Mutation	SNP	ENST00000408911.3	37	CCDS41468.1	.	.	.	.	.	.	.	.	.	.	T	12.38	1.919936	0.33908	.	.	ENSG00000196482	ENST00000361525;ENST00000366940;ENST00000366937;ENST00000408911;ENST00000359162;ENST00000361395;ENST00000366938;ENST00000360012;ENST00000493603;ENST00000391890;ENST00000463665;ENST00000487276;ENST00000354407;ENST00000493748	D;D;D;D;D;D;D;D;D;D;D;D;D	0.98822	-5.16;-5.16;-5.16;-5.16;-5.16;-5.16;-5.16;-5.16;-5.16;-5.16;-4.08;-5.16;-5.16	5.61	5.61	0.85477	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.092649	0.64402	D	0.000001	D	0.97692	0.9243	M	0.61703	1.905	0.80722	D	1	B;B;B	0.27192	0.038;0.171;0.133	B;B;B	0.34536	0.185;0.097;0.102	D	0.97404	0.9998	10	0.32370	T	0.25	.	15.8204	0.78638	0.0:0.0:0.0:1.0	.	324;398;386	E9PGB7;F8W8J3;P62508	.;.;ERR3_HUMAN	A	363;363;398;386;363;363;363;363;363;370;324;363;363;363	ENSP00000355225:E363A;ENSP00000355907:E363A;ENSP00000355904:E398A;ENSP00000386171:E386A;ENSP00000352077:E363A;ENSP00000354584:E363A;ENSP00000355905:E363A;ENSP00000353108:E363A;ENSP00000419594:E363A;ENSP00000375761:E370A;ENSP00000418629:E324A;ENSP00000419155:E363A;ENSP00000417374:E363A	ENSP00000346386:E363A	E	-	2	0	ESRRG	214747124	1.000000	0.71417	0.089000	0.20774	0.629000	0.37895	8.040000	0.89188	2.146000	0.66826	0.459000	0.35465	GAA	.		0.413	ESRRG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000089882.2	NM_206595	
RYR2	6262	broad.mit.edu	37	1	237713899	237713899	+	Missense_Mutation	SNP	G	G	A			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr1:237713899G>A	ENST00000366574.2	+	27	3439	c.3122G>A	c.(3121-3123)cGa>cAa	p.R1041Q	RYR2_ENST00000360064.6_Missense_Mutation_p.R1039Q|RYR2_ENST00000542537.1_Missense_Mutation_p.R1025Q	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1041	4 X approximate repeats.|B30.2/SPRY 2. {ECO:0000255|PROSITE- ProRule:PRU00548}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CTGGATGACCGAACCAAGAAA	0.522																																					p.R1041Q													.	RYR2-158	0			c.G3122A						.						115.0	108.0	110.0					1																	237713899		1931	4146	6077	SO:0001583	missense	6262	exon27			ATGACCGAACCAA	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.3122G>A	1.37:g.237713899G>A	ENSP00000355533:p.Arg1041Gln	Somatic	15	0		WXS	Illumina HiSeq	Phase_I	18	3	NM_001035	0	0	0	0	0	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.521739	0.85600	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.91068	-2.78;-2.78;-2.78	5.14	5.14	0.70334	B30.2/SPRY domain (1);Ryanodine receptor Ryr (1);	0.000000	0.47852	U	0.000212	D	0.86481	0.5943	L	0.39566	1.225	0.80722	D	1	D	0.55605	0.972	B	0.43508	0.422	D	0.86298	0.1678	10	0.42905	T	0.14	.	12.0182	0.53326	0.0792:0.0:0.9208:0.0	.	1041	Q92736	RYR2_HUMAN	Q	1041;1039;1025	ENSP00000355533:R1041Q;ENSP00000353174:R1039Q;ENSP00000443798:R1025Q	ENSP00000353174:R1039Q	R	+	2	0	RYR2	235780522	1.000000	0.71417	0.993000	0.49108	0.998000	0.95712	7.929000	0.87595	2.393000	0.81446	0.563000	0.77884	CGA	.		0.522	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
EPC1	80314	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	10	32560793	32560793	+	Silent	SNP	A	A	G			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr10:32560793A>G	ENST00000263062.8	-	14	2396	c.2127T>C	c.(2125-2127)caT>caC	p.H709H	RP11-166N17.1_ENST00000415731.2_RNA|EPC1_ENST00000375110.2_Silent_p.H636H|EPC1_ENST00000319778.6_Silent_p.H686H	NM_025209.2	NP_079485.1	Q9H2F5	EPC1_HUMAN	enhancer of polycomb homolog 1 (Drosophila)	709					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Piccolo NuA4 histone acetyltransferase complex (GO:0032777)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(5)|urinary_tract(1)	24		Prostate(175;0.0199)				ATGGACTTGTATGTACAAGTG	0.413																																					p.H709H		.											.	EPC1-93	0			c.T2127C						.						113.0	113.0	113.0					10																	32560793		2203	4300	6503	SO:0001819	synonymous_variant	80314	exon14			ACTTGTATGTACA	AF277374	CCDS7172.1, CCDS60511.1, CCDS73083.1	10p11	2005-12-12			ENSG00000120616	ENSG00000120616			19876	protein-coding gene	gene with protein product		610999				10976108	Standard	NM_025209		Approved	Epl1	uc001iwg.2	Q9H2F5	OTTHUMG00000017925	ENST00000263062.8:c.2127T>C	10.37:g.32560793A>G		Somatic	179	1		WXS	Illumina HiSeq	Phase_I	53	5	NM_025209	0	0	18	25	7	B4DSC3|D3DRX7|Q5VW54|Q5VW56|Q5VW58|Q8NAQ4|Q8NE21|Q96LF4|Q96RR6|Q9H7T7	Silent	SNP	ENST00000263062.8	37	CCDS7172.1																																																																																			.		0.413	EPC1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047484.1		
CUEDC2	79004	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	104184514	104184514	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr10:104184514C>T	ENST00000369937.4	-	3	255	c.110G>A	c.(109-111)gGg>gAg	p.G37E	CUEDC2_ENST00000465409.1_5'Flank	NM_024040.2	NP_076945.2	Q9H467	CUED2_HUMAN	CUE domain containing 2	37						cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)				autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(1)|stomach(1)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.122)		Epithelial(162;9.17e-09)|all cancers(201;2.16e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		CTCCAGGACCCCAAGCACATA	0.592																																					p.G37E		.											.	CUEDC2-90	0			c.G110A						.						45.0	49.0	48.0					10																	104184514		1955	4136	6091	SO:0001583	missense	79004	exon3			AGGACCCCAAGCA	BC000262	CCDS41566.1	10q24.32	2008-10-23	2004-03-04	2004-03-05	ENSG00000107874	ENSG00000107874			28352	protein-coding gene	gene with protein product		614142	"""chromosome 10 open reading frame 66"""	C10orf66		12477932	Standard	NM_024040		Approved	MGC2491	uc001kvn.2	Q9H467	OTTHUMG00000018958	ENST00000369937.4:c.110G>A	10.37:g.104184514C>T	ENSP00000358953:p.Gly37Glu	Somatic	106	0		WXS	Illumina HiSeq	Phase_I	216	30	NM_024040	0	0	68	118	50	D3DR88|Q9BWG8	Missense_Mutation	SNP	ENST00000369937.4	37	CCDS41566.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.419316	0.83559	.	.	ENSG00000107874	ENST00000369937	D	0.85088	-1.94	5.36	5.36	0.76844	.	0.051192	0.85682	D	0.000000	D	0.89061	0.6608	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90111	0.4192	10	0.87932	D	0	-28.8879	18.4607	0.90737	0.0:1.0:0.0:0.0	.	37	Q9H467	CUED2_HUMAN	E	37	ENSP00000358953:G37E	ENSP00000358953:G37E	G	-	2	0	CUEDC2	104174504	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.245000	0.78237	2.688000	0.91661	0.561000	0.74099	GGG	.		0.592	CUEDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050060.1	NM_024040	
SORCS3	22986	hgsc.bcm.edu	37	10	107022222	107022222	+	Missense_Mutation	SNP	G	G	C			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr10:107022222G>C	ENST00000369701.3	+	26	3804	c.3577G>C	c.(3577-3579)Gac>Cac	p.D1193H		NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	1193					learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		GGAGCTGCTGGACAAAGAGCT	0.542																																					p.D1193H	NSCLC(116;1497 1690 7108 13108 14106)	.											.	SORCS3-99	0			c.G3577C						.						69.0	55.0	60.0					10																	107022222		2203	4300	6503	SO:0001583	missense	22986	exon26			CTGCTGGACAAAG	AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.3577G>C	10.37:g.107022222G>C	ENSP00000358715:p.Asp1193His	Somatic	122	0		WXS	Illumina HiSeq	Phase_I	27	2	NM_014978	0	0	10	10	0	Q5VXF9|Q9NQJ2	Missense_Mutation	SNP	ENST00000369701.3	37	CCDS7558.1	.	.	.	.	.	.	.	.	.	.	G	28.2	4.902493	0.92035	.	.	ENSG00000156395	ENST00000369701	T	0.19394	2.15	5.84	5.84	0.93424	.	0.105330	0.64402	D	0.000004	T	0.34106	0.0886	N	0.24115	0.695	0.58432	D	0.999998	D	0.76494	0.999	D	0.70935	0.971	T	0.02512	-1.1148	9	.	.	.	.	20.1579	0.98126	0.0:0.0:1.0:0.0	.	1193	Q9UPU3	SORC3_HUMAN	H	1193	ENSP00000358715:D1193H	.	D	+	1	0	SORCS3	107012212	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.476000	0.97823	2.767000	0.95098	0.555000	0.69702	GAC	.		0.542	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050221.1	NM_014978	
HTRA1	5654	broad.mit.edu	37	10	124273765	124273765	+	Missense_Mutation	SNP	G	G	A	rs371279115		TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr10:124273765G>A	ENST00000368984.3	+	9	1461	c.1333G>A	c.(1333-1335)Gcc>Acc	p.A445T		NM_002775.4	NP_002766.1	Q92743	HTRA1_HUMAN	HtrA serine peptidase 1	445	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(1)|kidney(1)|large_intestine(8)|lung(7)	17		all_neural(114;0.0765)|Lung NSC(174;0.133)|all_lung(145;0.163)|Breast(234;0.238)				CGTGGTCTCCGCCAATGATGT	0.468													g|||	1	0.000199681	0.0008	0.0	5008	,	,		21134	0.0		0.0	False		,,,				2504	0.0				p.A445T													.	HTRA1-90	0			c.G1333A						.	G	THR/ALA	1,4405	2.1+/-5.4	0,1,2202	283.0	250.0	262.0		1333	5.4	1.0	10		262	0,8600		0,0,4300	no	missense	HTRA1	NM_002775.4	58	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	445/481	124273765	1,13005	2203	4300	6503	SO:0001583	missense	5654	exon9			GTCTCCGCCAATG	AF097709	CCDS7630.1	10q26.3	2014-01-28	2005-08-18	2005-08-18	ENSG00000166033	ENSG00000166033		"""Serine peptidases / Serine peptidases"""	9476	protein-coding gene	gene with protein product		602194	"""protease, serine, 11 (IGF binding)"""	PRSS11		8977104	Standard	NM_002775		Approved	HtrA, IGFBP5-protease, ARMD7	uc001lgj.2	Q92743	OTTHUMG00000019186	ENST00000368984.3:c.1333G>A	10.37:g.124273765G>A	ENSP00000357980:p.Ala445Thr	Somatic	319	0		WXS	Illumina HiSeq	Phase_I	397	10	NM_002775	0	0	216	216	0	D3DRE4|Q9UNS5	Missense_Mutation	SNP	ENST00000368984.3	37	CCDS7630.1	.	.	.	.	.	.	.	.	.	.	G	12.49	1.953604	0.34471	2.27E-4	0.0	ENSG00000166033	ENST00000368984;ENST00000435263;ENST00000420892	T;T	0.27104	1.69;1.69	5.38	5.38	0.77491	PDZ/DHR/GLGF (4);	0.173330	0.50627	D	0.000107	T	0.17152	0.0412	N	0.26042	0.785	0.58432	D	0.999999	B	0.23990	0.095	B	0.22152	0.038	T	0.07790	-1.0754	10	0.13108	T	0.6	-11.7132	12.4957	0.55927	0.076:0.0:0.924:0.0	.	445	Q92743	HTRA1_HUMAN	T	445;412;186	ENSP00000357980:A445T;ENSP00000412676:A186T	ENSP00000357980:A445T	A	+	1	0	HTRA1	124263755	1.000000	0.71417	0.960000	0.40013	0.714000	0.41099	7.493000	0.81493	2.515000	0.84797	0.655000	0.94253	GCC	.		0.468	HTRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128327.1	NM_002775	
MUC2	4583	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	1104253	1104253	+	Missense_Mutation	SNP	G	G	A			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr11:1104253G>A	ENST00000441003.2	+	49	8471	c.8444G>A	c.(8443-8445)gGg>gAg	p.G2815E		NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	5177					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	AGGCATCTGGGGAGCGGGTGA	0.692																																					p.G2811E		.											.	MUC2-90	0			c.G8432A						.						27.0	31.0	30.0					11																	1104253		1848	4082	5930	SO:0001583	missense	4583	exon50			ATCTGGGGAGCGG	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.8444G>A	11.37:g.1104253G>A	ENSP00000415183:p.Gly2815Glu	Somatic	36	0		WXS	Illumina HiSeq	Phase_I	111	17	NM_002457	0	0	0	0	0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	G	6.142	0.394436	0.11638	.	.	ENSG00000198788	ENST00000441003	T	0.14516	2.5	2.52	0.508	0.16972	.	.	.	.	.	T	0.10594	0.0259	L	0.44542	1.39	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.33471	-0.9867	9	0.87932	D	0	.	3.1167	0.06377	0.153:0.0:0.5868:0.2602	.	2815	E7EUV1	.	E	2815	ENSP00000415183:G2815E	ENSP00000415183:G2815E	G	+	2	0	MUC2	1094253	0.029000	0.19370	0.000000	0.03702	0.009000	0.06853	2.405000	0.44548	0.131000	0.18576	0.491000	0.48974	GGG	.		0.692	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MRGPRX3	117195	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	18159638	18159638	+	Missense_Mutation	SNP	G	G	A			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr11:18159638G>A	ENST00000396275.2	+	3	1250	c.889G>A	c.(889-891)Gac>Aac	p.D297N		NM_054031.3	NP_473372.3	Q96LB0	MRGX3_HUMAN	MAS-related GPR, member X3	297						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27						GGCTCTGCAGGACACGCCTGA	0.557																																					p.D297N		.											.	MRGPRX3-92	0			c.G889A						.						45.0	48.0	47.0					11																	18159638		2200	4292	6492	SO:0001583	missense	117195	exon3			CTGCAGGACACGC		CCDS7830.1	11p15.1	2013-10-10			ENSG00000179826	ENSG00000179826		"""GPCR / Class A : Orphans"""	17980	protein-coding gene	gene with protein product		607229				11551509	Standard	NM_054031		Approved	MRGX3	uc001mnu.3	Q96LB0	OTTHUMG00000166435	ENST00000396275.2:c.889G>A	11.37:g.18159638G>A	ENSP00000379571:p.Asp297Asn	Somatic	132	0		WXS	Illumina HiSeq	Phase_I	168	10	NM_054031	0	0	0	0	0	B0M0L1|Q8TDE0|Q8TDE1	Missense_Mutation	SNP	ENST00000396275.2	37	CCDS7830.1	.	.	.	.	.	.	.	.	.	.	G	17.59	3.428032	0.62844	.	.	ENSG00000179826	ENST00000396275	T	0.25912	1.77	1.3	1.3	0.21679	.	0.429218	0.22048	N	0.065351	T	0.47469	0.1447	M	0.84433	2.695	0.24902	N	0.9921	D	0.89917	1.0	D	0.76575	0.988	T	0.18461	-1.0336	10	0.87932	D	0	.	5.9358	0.19165	0.0:0.0:1.0:0.0	.	297	Q96LB0	MRGX3_HUMAN	N	297	ENSP00000379571:D297N	ENSP00000379571:D297N	D	+	1	0	MRGPRX3	18116214	0.485000	0.25972	0.781000	0.31783	0.068000	0.16541	1.158000	0.31737	1.011000	0.39340	0.195000	0.17529	GAC	.		0.557	MRGPRX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389767.1	NM_054031	
SNX15	29907	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	64802325	64802325	+	Missense_Mutation	SNP	T	T	G			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr11:64802325T>G	ENST00000377244.3	+	4	393	c.263T>G	c.(262-264)tTt>tGt	p.F88C	RP11-399J13.3_ENST00000301886.3_3'UTR|SNX15_ENST00000352068.5_Missense_Mutation_p.F88C	NM_013306.4|NM_147777.3	NP_037438.2|NP_680086.2	Q9NRS6	SNX15_HUMAN	sorting nexin 15	88	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				intracellular protein transport (GO:0006886)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)	phosphatidylinositol binding (GO:0035091)			endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	14						GTAGGCCGGTTTGAAGCCTCA	0.622																																					p.F88C	Esophageal Squamous(56;269 1304 3324 8253)	.											.	SNX15-227	0			c.T263G						.						55.0	54.0	54.0					11																	64802325		2201	4297	6498	SO:0001583	missense	29907	exon4			GCCGGTTTGAAGC	AF175267	CCDS8089.1, CCDS8090.1	11q12	2008-05-22			ENSG00000110025	ENSG00000110025		"""Sorting nexins"""	14978	protein-coding gene	gene with protein product		605964				11208079	Standard	NM_013306		Approved			Q9NRS6	OTTHUMG00000037387	ENST00000377244.3:c.263T>G	11.37:g.64802325T>G	ENSP00000366452:p.Phe88Cys	Somatic	123	0		WXS	Illumina HiSeq	Phase_I	237	27	NM_147777	0	0	0	0	0	E5KQS6|Q9NRS5	Missense_Mutation	SNP	ENST00000377244.3	37	CCDS8089.1	.	.	.	.	.	.	.	.	.	.	T	9.953	1.220623	0.22457	.	.	ENSG00000110025	ENST00000377244;ENST00000534637;ENST00000524831;ENST00000352068	T;T;T;T	0.38722	1.12;1.12;1.12;1.12	5.24	5.24	0.73138	Phox homologous domain (5);	0.000000	0.85682	D	0.000000	T	0.72922	0.3521	M	0.94142	3.5	0.80722	D	1	B;B;D	0.89917	0.002;0.032;1.0	B;B;D	0.91635	0.004;0.031;0.999	T	0.81028	-0.1118	10	0.87932	D	0	-11.7965	13.084	0.59129	0.0:0.0:0.0:1.0	.	88;88;88	E5KQS5;E5KQS6;Q9NRS6	.;.;SNX15_HUMAN	C	88;84;76;88	ENSP00000366452:F88C;ENSP00000437277:F84C;ENSP00000431690:F76C;ENSP00000316410:F88C	ENSP00000316410:F88C	F	+	2	0	SNX15	64558901	1.000000	0.71417	0.793000	0.32043	0.045000	0.14185	7.364000	0.79526	1.991000	0.58162	0.374000	0.22700	TTT	.		0.622	SNX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091004.3		
FOLH1B	219595	broad.mit.edu	37	11	89413808	89413808	+	RNA	SNP	A	A	G			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr11:89413808A>G	ENST00000532352.1	+	0	1293							Q9HBA9	FOH1B_HUMAN	folate hydrolase 1B							cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)	p.P160P(3)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(26)|ovary(4)|skin(4)|urinary_tract(2)	48						ATTGTACACCACTGATGTACA	0.294																																					p.P160P													.	FOLH1B-519	3	Substitution - coding silent(3)	lung(2)|kidney(1)	c.A480G						.						43.0	43.0	43.0					11																	89413808		2201	4293	6494			219595	exon8			TACACCACTGATG	AF261715		11q14.3	2014-03-18			ENSG00000134612	ENSG00000134612			13636	protein-coding gene	gene with protein product	"""prostate specific membrane antigen like protein"", ""Cell growth-inhibiting gene 26 protein"", ""glutamate carboxypeptidase III"""	609020	"""folate hydrolase 2"""	FOLH2, FOLHP		9838072, 14716746	Standard	NM_153696		Approved	PSMAL, GCPIII	uc001pda.3	Q9HBA9	OTTHUMG00000167376		11.37:g.89413808A>G		Somatic	82	1		WXS	Illumina HiSeq	Phase_I	26	6	NM_153696	0	0	0	14	14		Silent	SNP	ENST00000532352.1	37																																																																																				.		0.294	FOLH1B-004	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000395421.1	NM_153696	
BIRC3	330	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	102206814	102206814	+	Missense_Mutation	SNP	T	T	G			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr11:102206814T>G	ENST00000263464.3	+	7	4192	c.1442T>G	c.(1441-1443)gTt>gGt	p.V481G	BIRC3_ENST00000532808.1_Missense_Mutation_p.V481G	NM_001165.4	NP_001156.1	Q13489	BIRC3_HUMAN	baculoviral IAP repeat containing 3	481	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				apoptotic process (GO:0006915)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of necroptotic process (GO:0060546)|negative regulation of phosphorylation (GO:0042326)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein ubiquitination (GO:0031398)|protein heterooligomerization (GO:0051291)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cysteine-type endopeptidase activity (GO:2000116)|regulation of inflammatory response (GO:0050727)|regulation of innate immune response (GO:0045088)|regulation of necroptotic process (GO:0060544)|regulation of nucleotide-binding oligomerization domain containing signaling pathway (GO:0070424)|regulation of RIG-I signaling pathway (GO:0039535)|regulation of toll-like receptor signaling pathway (GO:0034121)|spermatogenesis (GO:0007283)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane raft (GO:0045121)|nucleus (GO:0005634)|protein complex (GO:0043234)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(7)|lung(5)|ovary(3)|skin(1)	21	all_cancers(8;0.00044)|all_epithelial(12;0.00348)|Lung NSC(15;0.227)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0093)	Lung(13;0.109)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0146)		GAACATGATGTTATTAAACAG	0.353			T	MALT1	MALT																																p.V481G		.		Dom	yes		11	11q22-q23	330	baculoviral IAP repeat-containing 3		L	.	BIRC3-662	0			c.T1442G						.						104.0	107.0	106.0					11																	102206814		2203	4298	6501	SO:0001583	missense	330	exon7			ATGATGTTATTAA	L49432	CCDS8315.1	11q22	2011-01-25	2011-01-25			ENSG00000023445		"""Baculoviral IAP repeat containing"", ""RING-type (C3HC4) zinc fingers"""	591	protein-coding gene	gene with protein product	"""apoptosis inhibitor 2"", ""TNFR2-TRAF signaling complex protein"", ""mammalian IAP homolog C"", ""inhibitor of apoptosis protein 1"""	601721	"""baculoviral IAP repeat-containing 3"""	API2		8552191, 8548810	Standard	NM_001165		Approved	cIAP2, hiap-1, MIHC, RNF49, MALT2, c-IAP2	uc001pgx.3	Q13489		ENST00000263464.3:c.1442T>G	11.37:g.102206814T>G	ENSP00000263464:p.Val481Gly	Somatic	243	0		WXS	Illumina HiSeq	Phase_I	63	12	NM_001165	0	0	308	621	313	Q16628|Q9HC27|Q9UP46	Missense_Mutation	SNP	ENST00000263464.3	37	CCDS8315.1	.	.	.	.	.	.	.	.	.	.	T	9.986	1.229473	0.22542	.	.	ENSG00000023445	ENST00000263464;ENST00000532808;ENST00000532609	T;T	0.19532	2.14;2.14	4.98	1.35	0.21983	DEATH-like (2);Caspase Recruitment (3);	0.559991	0.21816	N	0.068695	T	0.16981	0.0408	L	0.58669	1.825	0.31062	N	0.71399	B	0.10296	0.003	B	0.15484	0.013	T	0.12915	-1.0529	10	0.27785	T	0.31	.	4.8847	0.13697	0.0:0.231:0.1477:0.6212	.	481	Q13489	BIRC3_HUMAN	G	481;481;249	ENSP00000263464:V481G;ENSP00000432907:V481G	ENSP00000263464:V481G	V	+	2	0	BIRC3	101712024	0.052000	0.20516	0.281000	0.24762	0.902000	0.53008	0.187000	0.16998	0.130000	0.18549	-0.316000	0.08728	GTT	.		0.353	BIRC3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394159.1	NM_001165	
CASP1	834	broad.mit.edu;ucsc.edu	37	11	104903803	104903803	+	Missense_Mutation	SNP	A	A	T			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr11:104903803A>T	ENST00000533400.1	-	3	360	c.325T>A	c.(325-327)Tct>Act	p.S109T	CASP1_ENST00000415981.2_Intron|CASP1_ENST00000393136.4_Intron|CASP1_ENST00000534497.1_Intron|CASP1_ENST00000527979.1_Intron|CASP1_ENST00000526568.1_Intron|CASP1_ENST00000525825.1_Intron|CASP1_ENST00000598974.1_Missense_Mutation_p.S109T|CASP1_ENST00000593315.1_Intron|CASP1_ENST00000446369.1_Intron|CASP1_ENST00000353247.5_Intron|CASP1_ENST00000531166.1_Intron|CASP1_ENST00000436863.3_Missense_Mutation_p.S109T|CASP1_ENST00000528974.1_Missense_Mutation_p.S70T|CASP1_ENST00000594519.1_Intron	NM_001257118.1	NP_001244047.1	P29466	CASP1_HUMAN	caspase 1, apoptosis-related cysteine peptidase	109					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic substance (GO:0071310)|execution phase of apoptosis (GO:0097194)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|membrane hyperpolarization (GO:0060081)|mitochondrial depolarization (GO:0051882)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-1 alpha secretion (GO:0050717)|positive regulation of interleukin-1 beta secretion (GO:0050718)|programmed necrotic cell death (GO:0097300)|proteolysis (GO:0006508)|pyroptosis (GO:0070269)|regulation of inflammatory response (GO:0050727)|response to ATP (GO:0033198)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	AIM2 inflammasome complex (GO:0097169)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|IPAF inflammasome complex (GO:0072557)|NLRP1 inflammasome complex (GO:0072558)|NLRP3 inflammasome complex (GO:0072559)	cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|cysteine-type endopeptidase activity (GO:0004197)|endopeptidase activity (GO:0004175)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)	5		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000525)|Epithelial(105;0.0128)|all cancers(92;0.0482)	Minocycline(DB01017)	GGAAAGGAAGAAAGTACTCCT	0.358																																					p.S109T	NSCLC(41;1246 1743 4934)												.	CASP1-661	0			c.T325A						.						89.0	93.0	92.0					11																	104903803		2202	4299	6501	SO:0001583	missense	834	exon3			AGGAAGAAAGTAC	U13697	CCDS8329.1, CCDS8330.1, CCDS8331.1, CCDS8332.1, CCDS53704.1	11q23	2012-02-29	2012-02-29		ENSG00000137752	ENSG00000137752		"""Caspases"""	1499	protein-coding gene	gene with protein product	"""caspase-1"", ""interleukin 1, beta, convertase"""	147678	"""caspase 1, apoptosis-related cysteine protease (interleukin 1, beta, convertase)"", ""caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase)"""	IL1BC		1373520, 9250871	Standard	NM_033292		Approved	ICE	uc001pim.5	P29466	OTTHUMG00000048072	ENST00000533400.1:c.325T>A	11.37:g.104903803A>T	ENSP00000433138:p.Ser109Thr	Somatic	117	0		WXS	Illumina HiSeq	Phase_I	20	3	NM_001257118	0	0	0	0	0	B5MDZ1|Q53EY6|Q6DMQ1|Q6GSS3|Q6PI75|Q9UCN3	Missense_Mutation	SNP	ENST00000533400.1	37	CCDS8330.1	.	.	.	.	.	.	.	.	.	.	.	1.034	-0.681045	0.03353	.	.	ENSG00000137752	ENST00000533400;ENST00000436863;ENST00000528974	T;T;T	0.02579	4.97;4.97;4.24	3.03	-1.43	0.08884	.	4.281240	0.00654	U	0.000568	T	0.02193	0.0068	L	0.29908	0.895	0.09310	N	1	B;B;B	0.32160	0.255;0.358;0.121	B;B;B	0.25987	0.049;0.065;0.047	T	0.41070	-0.9529	10	0.15066	T	0.55	.	2.6498	0.04995	0.3929:0.0:0.3944:0.2126	.	109;70;109	B4DKN4;B4DVD8;P29466	.;.;CASP1_HUMAN	T	109;109;70	ENSP00000433138:S109T;ENSP00000410076:S109T;ENSP00000434259:S70T	ENSP00000410076:S109T	S	-	1	0	CASP1	104409013	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.732000	0.04904	-0.249000	0.09569	-0.321000	0.08615	TCT	.		0.358	CASP1-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388116.1	NM_033292	
OR8G5	219865	hgsc.bcm.edu	37	11	124135727	124135727	+	Silent	SNP	C	C	T			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr11:124135727C>T	ENST00000524943.2	+	1	1005	c.1005C>T	c.(1003-1005)gcC>gcT	p.A335A	OR8G1_ENST00000341493.2_RNA	NM_001005198.1	NP_001005198.1	Q8NG78	OR8G5_HUMAN	olfactory receptor, family 8, subfamily G, member 5	335						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)						Breast(109;0.0157)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0523)		TCCACGTTGCCCTGAAGAAAA	0.403																																					p.A335A	Ovarian(169;523 1969 8640 31295 51256)	.											.	.	0			c.C1005T						.						54.0	52.0	53.0					11																	124135727		2018	4203	6221	SO:0001819	synonymous_variant	219865	exon1			CGTTGCCCTGAAG	BK004516	CCDS66256.1	11q24.1	2014-04-17		2004-03-10	ENSG00000255298	ENSG00000255298		"""GPCR / Class A : Olfactory receptors"""	19622	protein-coding gene	gene with protein product				OR8G5P, OR8G6			Standard	NM_001005198		Approved			Q8NG78	OTTHUMG00000186059	ENST00000524943.2:c.1005C>T	11.37:g.124135727C>T		Somatic	87	0		WXS	Illumina HiSeq	Phase_I	46	11	NM_001005198	0	0	0	0	0	B2RND3|Q6IEU6	Silent	SNP	ENST00000524943.2	37																																																																																				.		0.403	OR8G5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000387283.2	NM_001005198	
PKNOX2	63876	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	125280693	125280693	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr11:125280693C>T	ENST00000298282.9	+	9	1008	c.737C>T	c.(736-738)cCg>cTg	p.P246L	PKNOX2_ENST00000542175.1_Missense_Mutation_p.P182L|PKNOX2_ENST00000530517.1_3'UTR	NM_022062.2	NP_071345.2	Q96KN3	PKNX2_HUMAN	PBX/knotted 1 homeobox 2	246					regulation of transcription from RNA polymerase II promoter (GO:0006357)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(14)|ovary(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	29		Breast(109;0.00234)|all_lung(97;0.0191)|Lung NSC(97;0.0196)|Medulloblastoma(222;0.0447)|all_neural(223;0.116)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.117)		TTATACCAACCGGTTACCATG	0.577																																					p.P246L		.											.	PKNOX2-93	0			c.C737T						.						94.0	91.0	92.0					11																	125280693		1947	4142	6089	SO:0001583	missense	63876	exon9			ACCAACCGGTTAC	AK023136	CCDS41730.1	11q24.2	2014-09-04			ENSG00000165495	ENSG00000165495		"""Homeoboxes / TALE class"""	16714	protein-coding gene	gene with protein product		613066				11549286	Standard	NM_022062		Approved		uc001qbu.3	Q96KN3	OTTHUMG00000165884	ENST00000298282.9:c.737C>T	11.37:g.125280693C>T	ENSP00000298282:p.Pro246Leu	Somatic	110	0		WXS	Illumina HiSeq	Phase_I	137	27	NM_022062	0	0	0	0	0	B7Z5I5|F5GZ15|Q63HL6|Q86XD1	Missense_Mutation	SNP	ENST00000298282.9	37	CCDS41730.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.066060	0.76187	.	.	ENSG00000165495	ENST00000530517;ENST00000531116;ENST00000298282;ENST00000542175;ENST00000535518	D;D;D;D	0.88277	-2.36;-2.36;-2.36;-2.25	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	D	0.93324	0.7872	L	0.54323	1.7	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.995	D	0.93357	0.6723	10	0.59425	D	0.04	-12.9127	19.0405	0.92997	0.0:1.0:0.0:0.0	.	182;246	F5GZ15;Q96KN3	.;PKNX2_HUMAN	L	217;217;246;182;234	ENSP00000434732:P217L;ENSP00000433971:P217L;ENSP00000298282:P246L;ENSP00000441470:P182L	ENSP00000298282:P246L	P	+	2	0	PKNOX2	124785903	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.191000	0.77763	2.586000	0.87340	0.655000	0.94253	CCG	.		0.577	PKNOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386866.3		
SNX19	399979	ucsc.edu	37	11	130785010	130785010	+	Silent	SNP	T	T	G			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr11:130785010T>G	ENST00000265909.4	-	1	1394	c.825A>C	c.(823-825)gcA>gcC	p.A275A	SNX19_ENST00000528555.1_Intron|SNX19_ENST00000530356.1_Intron|SNX19_ENST00000533214.1_Silent_p.A275A|SNX19_ENST00000533318.1_Intron|SNX19_ENST00000539184.1_Intron	NM_014758.2	NP_055573	Q92543	SNX19_HUMAN	sorting nexin 19	275					protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(8)|ovary(3)|prostate(1)|skin(6)|urinary_tract(1)	35	all_hematologic(175;0.0597)	Lung NSC(97;0.000272)|all_lung(97;0.000608)|Breast(109;0.000962)|all_neural(223;0.0298)|Medulloblastoma(222;0.0425)		OV - Ovarian serous cystadenocarcinoma(99;0.0195)|Lung(977;0.233)		CTGGGCAGGGTGCTGGATCTC	0.547																																					p.A275A													.	SNX19-229	0			c.A825C						.						70.0	77.0	74.0					11																	130785010		2201	4297	6498	SO:0001819	synonymous_variant	399979	exon1			GCAGGGTGCTGGA	D87443	CCDS31721.1, CCDS73416.1	11q25	2010-04-20			ENSG00000120451	ENSG00000120451		"""Sorting nexins"""	21532	protein-coding gene	gene with protein product							Standard	NM_014758		Approved	KIAA0254, CHET8	uc001qgk.4	Q92543	OTTHUMG00000165663	ENST00000265909.4:c.825A>C	11.37:g.130785010T>G		Somatic	193	21		WXS	Illumina HiSeq		287	18	NM_014758	0	0	9	10	1	E9PKB9|Q8IV55	Silent	SNP	ENST00000265909.4	37	CCDS31721.1																																																																																			.		0.547	SNX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385649.1	NM_014758	
WNK1	65125	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	978188	978188	+	Intron	SNP	T	T	A			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr12:978188T>A	ENST00000315939.6	+	9	2782				WNK1_ENST00000340908.4_Intron|WNK1_ENST00000574564.1_Missense_Mutation_p.F398Y|WNK1_ENST00000530271.2_Missense_Mutation_p.F1184Y|WNK1_ENST00000535572.1_Intron|WNK1_ENST00000537687.1_Missense_Mutation_p.F1099Y	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1						intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)			breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			TCCCCACTTTTCTTCTGTTTC	0.493																																					p.F1184Y	Colon(19;451 567 6672 12618 28860)	.											.	WNK1-916	0			c.T3551A						.						323.0	310.0	314.0					12																	978188		1914	4143	6057	SO:0001627	intron_variant	65125	exon10			CACTTTTCTTCTG	AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.2140-2243T>A	12.37:g.978188T>A		Somatic	735	1		WXS	Illumina HiSeq	Phase_I	315	51	NM_213655	0	0	1	3	2	A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	Missense_Mutation	SNP	ENST00000315939.6	37	CCDS8506.1	.	.	.	.	.	.	.	.	.	.	T	14.12	2.440816	0.43326	.	.	ENSG00000060237	ENST00000537687;ENST00000530271	T;T	0.16743	2.32;2.32	5.85	5.85	0.93711	.	.	.	.	.	T	0.23133	0.0559	.	.	.	0.80722	D	1	P	0.46656	0.882	B	0.44278	0.445	T	0.00842	-1.1544	8	0.52906	T	0.07	.	14.8154	0.70031	0.0:0.0:0.0:1.0	.	1184	F5H2M7	.	Y	1099;1184	ENSP00000444465:F1099Y;ENSP00000433548:F1184Y	ENSP00000433548:F1184Y	F	+	2	0	WNK1	848449	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.421000	0.52742	2.233000	0.73108	0.455000	0.32223	TTC	.		0.493	WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206683.1	NM_018979	
CD27	939	hgsc.bcm.edu;broad.mit.edu	37	12	6554287	6554287	+	Missense_Mutation	SNP	T	T	A			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr12:6554287T>A	ENST00000266557.3	+	1	255	c.26T>A	c.(25-27)cTg>cAg	p.L9Q	CD27-AS1_ENST00000399492.2_RNA|CD27-AS1_ENST00000545339.1_RNA	NM_001242.4	NP_001233	P26842	CD27_HUMAN	CD27 molecule	9					cell surface receptor signaling pathway (GO:0007166)|extrinsic apoptotic signaling pathway (GO:0097191)|immunoglobulin mediated immune response (GO:0016064)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of T cell apoptotic process (GO:0070233)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of JNK cascade (GO:0046330)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|response to ethanol (GO:0045471)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|transmembrane signaling receptor activity (GO:0004888)			kidney(1)|large_intestine(5)|lung(1)|urinary_tract(3)	10						CCCTGGTGGCTGTGCGTTCTG	0.642																																					p.L9Q		.											.	CD27-659	0			c.T26A						.						18.0	24.0	22.0					12																	6554287		2202	4299	6501	SO:0001583	missense	939	exon1			GGTGGCTGTGCGT	M63928	CCDS8545.1	12p13	2014-09-17	2006-10-27	2006-10-27	ENSG00000139193	ENSG00000139193		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11922	protein-coding gene	gene with protein product		186711	"""tumor necrosis factor receptor superfamily, member 7"""	TNFRSF7		2442250, 8530100	Standard	NM_001242		Approved	S152, Tp55	uc001qod.3	P26842	OTTHUMG00000168316	ENST00000266557.3:c.26T>A	12.37:g.6554287T>A	ENSP00000266557:p.Leu9Gln	Somatic	25	0		WXS	Illumina HiSeq	Phase_I	41	6	NM_001242	0	0	140	140	0	B2RDZ0	Missense_Mutation	SNP	ENST00000266557.3	37	CCDS8545.1	.	.	.	.	.	.	.	.	.	.	T	17.78	3.473069	0.63737	.	.	ENSG00000139193	ENST00000266557	D	0.95788	-3.81	4.91	4.91	0.64330	.	0.254840	0.25922	N	0.027424	D	0.95726	0.8610	L	0.36672	1.1	0.41219	D	0.986497	D	0.89917	1.0	D	0.85130	0.997	D	0.95798	0.8830	10	0.72032	D	0.01	-12.3828	10.8657	0.46853	0.0:0.0:0.0:1.0	.	9	P26842	CD27_HUMAN	Q	9	ENSP00000266557:L9Q	ENSP00000266557:L9Q	L	+	2	0	CD27	6424548	1.000000	0.71417	1.000000	0.80357	0.604000	0.37047	3.432000	0.52824	2.064000	0.61679	0.455000	0.32223	CTG	.		0.642	CD27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399258.1		
SOX5	6660	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	24102509	24102509	+	Missense_Mutation	SNP	C	C	G			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr12:24102509C>G	ENST00000451604.2	-	1	128	c.27G>C	c.(25-27)caG>caC	p.Q9H	SOX5_ENST00000545921.1_Intron|SOX5_ENST00000441133.2_Missense_Mutation_p.Q9H|SOX5_ENST00000541847.1_Intron|SOX5_ENST00000536850.1_5'UTR|SOX5_ENST00000309359.1_5'UTR|SOX5_ENST00000381381.2_5'UTR|SOX5_ENST00000537393.1_Missense_Mutation_p.Q9H			P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5	9					cartilage development (GO:0051216)|cell fate commitment (GO:0045165)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system neuron differentiation (GO:0021953)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|oligodendrocyte differentiation (GO:0048709)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of timing of neuron differentiation (GO:0060164)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear transcription factor complex (GO:0044798)	sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(25)|ovary(5)|skin(2)|upper_aerodigestive_tract(3)	57						TTTCAAACTCCTGAGGTAAAT	0.433																																					p.Q9H		.											.	SOX5-655	0			c.G27C						.						112.0	102.0	106.0					12																	24102509		2203	4300	6503	SO:0001583	missense	6660	exon1			AAACTCCTGAGGT	AB081589	CCDS8699.1, CCDS41761.1, CCDS44844.1, CCDS58216.1, CCDS58217.1	12p12.1	2010-04-20			ENSG00000134532	ENSG00000134532		"""SRY (sex determining region Y)-boxes"""	11201	protein-coding gene	gene with protein product		604975				8812465	Standard	NM_006940		Approved	L-SOX5, MGC35153	uc001rfw.3	P35711	OTTHUMG00000169026	ENST00000451604.2:c.27G>C	12.37:g.24102509C>G	ENSP00000398273:p.Gln9His	Somatic	140	0		WXS	Illumina HiSeq	Phase_I	98	17	NM_006940	0	0	0	0	0	B7Z8V0|F5H5B0|Q86UK8|Q8J017|Q8J018|Q8J019|Q8J020|Q8N1D9|Q8N7E0|Q8TEA4	Missense_Mutation	SNP	ENST00000451604.2	37	CCDS8699.1	.	.	.	.	.	.	.	.	.	.	c	15.91	2.971147	0.53614	.	.	ENSG00000134532	ENST00000451604;ENST00000537393;ENST00000441133	D;D	0.97378	-4.34;-4.36	5.28	5.28	0.74379	.	0.154071	0.45126	D	0.000386	D	0.96222	0.8768	L	0.54323	1.7	0.80722	D	1	P;P	0.44309	0.832;0.826	P;B	0.44990	0.466;0.276	D	0.96291	0.9214	10	0.52906	T	0.07	.	17.0691	0.86568	0.0:1.0:0.0:0.0	.	9;9	G3V0H1;P35711	.;SOX5_HUMAN	H	9	ENSP00000398273:Q9H;ENSP00000439832:Q9H	ENSP00000393240:Q9H	Q	-	3	2	SOX5	23993776	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.509000	0.73725	2.631000	0.89168	0.645000	0.84053	CAG	.		0.433	SOX5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402006.2	NM_006940	
DDX11	1663	hgsc.bcm.edu	37	12	31242981	31242981	+	Silent	SNP	C	C	A	rs3892690		TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr12:31242981C>A	ENST00000407793.2	+	9	1293	c.1042C>A	c.(1042-1044)Cgg>Agg	p.R348R	DDX11_ENST00000545668.1_Silent_p.R348R|DDX11_ENST00000228264.6_Silent_p.R322R|DDX11_ENST00000251758.5_3'UTR|DDX11_ENST00000350437.4_Silent_p.R348R|DDX11_ENST00000542838.1_Silent_p.R348R	NM_030653.3|NM_152438.1	NP_085911.2|NP_689651.1	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11	348	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(11)|large_intestine(5)|lung(23)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	57	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					GAAGGAGGCCCGGGCCTGTCC	0.647										Multiple Myeloma(12;0.14)																											p.R348R		.											.	DDX11-229	0			c.C1042A						.						1.0	2.0	2.0					12																	31242981		1322	2876	4198	SO:0001819	synonymous_variant	1663	exon9			GAGGCCCGGGCCT	U75969	CCDS8721.1, CCDS41767.1, CCDS44856.1, CCDS58224.1	12p11.21	2012-02-23	2012-02-23		ENSG00000013573	ENSG00000013573		"""DEAD-boxes"""	2736	protein-coding gene	gene with protein product	"""CHL1-like helicase homolog (S. cerevisiae)"""	601150	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (S.cerevisiae CHL1-like helicase)"", ""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11"""				Standard	NM_030653		Approved	CHLR1, KRG2, CHL1, ChlR1, WABS	uc001rjv.2	Q96FC9	OTTHUMG00000168435	ENST00000407793.2:c.1042C>A	12.37:g.31242981C>A		Somatic	21	1		WXS	Illumina HiSeq	Phase_I	48	10	NM_030653	0	0	5	7	2	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Silent	SNP	ENST00000407793.2	37	CCDS44856.1																																																																																			C|1.000;|0.000		0.647	DDX11-202	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000399728.1	NM_030653	
SRGAP1	57522	hgsc.bcm.edu;broad.mit.edu	37	12	64377805	64377805	+	Missense_Mutation	SNP	T	T	A			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr12:64377805T>A	ENST00000355086.3	+	2	670	c.146T>A	c.(145-147)cTg>cAg	p.L49Q	SRGAP1_ENST00000543397.1_Missense_Mutation_p.L9Q|SRGAP1_ENST00000357825.3_Missense_Mutation_p.L49Q	NM_020762.2	NP_065813.1	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	49	F-BAR domain.|FCH. {ECO:0000255|PROSITE- ProRule:PRU00083}.				axon guidance (GO:0007411)|cell migration (GO:0016477)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)			breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	65			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		CTCCAGGATCTGCAAGATTTC	0.428																																					p.L49Q		.											.	SRGAP1-653	0			c.T146A						.						110.0	114.0	113.0					12																	64377805		2203	4300	6503	SO:0001583	missense	57522	exon2			AGGATCTGCAAGA	AB037725	CCDS8967.1	12q13.13	2011-07-04			ENSG00000196935	ENSG00000196935		"""Rho GTPase activating proteins"""	17382	protein-coding gene	gene with protein product		606523				11672528	Standard	NM_020762		Approved	KIAA1304, ARHGAP13	uc010ssp.1	Q7Z6B7	OTTHUMG00000168750	ENST00000355086.3:c.146T>A	12.37:g.64377805T>A	ENSP00000347198:p.Leu49Gln	Somatic	207	0		WXS	Illumina HiSeq	Phase_I	86	12	NM_020762	0	0	0	0	0	Q9H8A3|Q9P2P2	Missense_Mutation	SNP	ENST00000355086.3	37	CCDS8967.1	.	.	.	.	.	.	.	.	.	.	T	26.0	4.690212	0.88735	.	.	ENSG00000196935	ENST00000355086;ENST00000357825;ENST00000543397	T;T;T	0.56611	0.45;0.45;1.94	5.1	5.1	0.69264	Fps/Fes/Fer/CIP4 homology (3);	0.000000	0.28600	U	0.014776	T	0.74261	0.3693	M	0.83603	2.65	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.87578	0.998;0.987;0.987	T	0.77648	-0.2509	9	.	.	.	.	15.199	0.73120	0.0:0.0:0.0:1.0	.	49;9;49	Q7Z6B7;G5EA48;Q7Z6B7-2	SRGP1_HUMAN;.;.	Q	49;49;9	ENSP00000347198:L49Q;ENSP00000350480:L49Q;ENSP00000437948:L9Q	.	L	+	2	0	SRGAP1	62664072	1.000000	0.71417	0.997000	0.53966	0.933000	0.57130	7.975000	0.88055	2.060000	0.61445	0.477000	0.44152	CTG	.		0.428	SRGAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400896.1		
SLC35E3	55508	hgsc.bcm.edu	37	12	69140471	69140471	+	Missense_Mutation	SNP	T	T	C			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr12:69140471T>C	ENST00000398004.2	+	1	586	c.314T>C	c.(313-315)cTg>cCg	p.L105P		NM_018656.2	NP_061126.2	Q7Z769	S35E3_HUMAN	solute carrier family 35, member E3	105						integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	12	Breast(13;2.31e-06)|Renal(347;0.0684)		Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00372)			ACCTATCAGCTGGCCAAGGCC	0.562																																					p.L105P		.											.	SLC35E3-514	0			c.T314C						.						126.0	135.0	132.0					12																	69140471		1995	4175	6170	SO:0001583	missense	55508	exon1			ATCAGCTGGCCAA	AF148713, AY358943	CCDS41808.1	12q15	2014-09-04			ENSG00000175782	ENSG00000175782		"""Solute carriers"""	20864	protein-coding gene	gene with protein product						12975309	Standard	XM_005269006		Approved	BLOV1	uc001suh.3	Q7Z769	OTTHUMG00000169282	ENST00000398004.2:c.314T>C	12.37:g.69140471T>C	ENSP00000381089:p.Leu105Pro	Somatic	249	2		WXS	Illumina HiSeq	Phase_I	505	36	NM_018656	0	0	5	10	5	A8K0T0|Q0P5Y5|Q9P0V1	Missense_Mutation	SNP	ENST00000398004.2	37	CCDS41808.1	.	.	.	.	.	.	.	.	.	.	T	25.9	4.685593	0.88639	.	.	ENSG00000175782	ENST00000398004	T	0.56941	0.43	4.98	4.98	0.66077	.	0.000000	0.64402	D	0.000001	T	0.72558	0.3475	M	0.82056	2.57	0.80722	D	1	D	0.89917	1.0	D	0.70935	0.971	T	0.75929	-0.3144	9	.	.	.	-9.0953	14.9804	0.71306	0.0:0.0:0.0:1.0	.	105	Q7Z769	S35E3_HUMAN	P	105	ENSP00000381089:L105P	.	L	+	2	0	SLC35E3	67426738	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.534000	0.82004	1.996000	0.58369	0.482000	0.46254	CTG	.		0.562	SLC35E3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403241.1	NM_018656	
MYBPC1	4604	broad.mit.edu	37	12	102046970	102046970	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr12:102046970G>T	ENST00000550270.1	+	16	1636	c.1636G>T	c.(1636-1638)Gag>Tag	p.E546*	MYBPC1_ENST00000549145.1_Nonsense_Mutation_p.E559*|MYBPC1_ENST00000547509.1_Nonsense_Mutation_p.E532*|MYBPC1_ENST00000541119.1_Nonsense_Mutation_p.E534*|RP11-755O11.2_ENST00000547027.1_RNA|MYBPC1_ENST00000452455.2_Nonsense_Mutation_p.E546*|RP11-755O11.2_ENST00000552081.1_RNA|MYBPC1_ENST00000551300.1_Nonsense_Mutation_p.E447*|MYBPC1_ENST00000441232.1_Nonsense_Mutation_p.E546*|MYBPC1_ENST00000545503.2_Nonsense_Mutation_p.E546*|MYBPC1_ENST00000360610.2_Nonsense_Mutation_p.E546*|MYBPC1_ENST00000361685.2_Nonsense_Mutation_p.E571*|MYBPC1_ENST00000536007.1_Nonsense_Mutation_p.E527*|MYBPC1_ENST00000547405.1_Nonsense_Mutation_p.E520*|MYBPC1_ENST00000550501.1_Intron|MYBPC1_ENST00000361466.2_Nonsense_Mutation_p.E571*|MYBPC1_ENST00000553190.1_Nonsense_Mutation_p.E546*|MYBPC1_ENST00000392934.3_Nonsense_Mutation_p.E533*			Q00872	MYPC1_HUMAN	myosin binding protein C, slow type	546	Ig-like C2-type 5.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myofibril (GO:0030016)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	57						GCTTCGTCTTGAGATCCCCAT	0.458																																					p.E571X													.	MYBPC1-94	0			c.G1711T						.						145.0	139.0	141.0					12																	102046970		2203	4300	6503	SO:0001587	stop_gained	4604	exon18			CGTCTTGAGATCC		CCDS9083.1, CCDS9084.1, CCDS9085.1, CCDS55877.1, CCDS58268.1, CCDS58269.1, CCDS58270.1, CCDS58271.1, CCDS58272.1, CCDS58273.1	12q23.2	2013-02-11	2001-11-28		ENSG00000196091	ENSG00000196091		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7549	protein-coding gene	gene with protein product		160794	"""myosin-binding protein C, slow-type"""			8375400, 16918501	Standard	NM_002465		Approved		uc010svs.2	Q00872	OTTHUMG00000170274	ENST00000550270.1:c.1636G>T	12.37:g.102046970G>T	ENSP00000449702:p.Glu546*	Somatic	98	0		WXS	Illumina HiSeq	Phase_I	34	3	NM_206819	0	0	0	0	0	B4DKR5|B7Z8G8|B7ZL02|B7ZL09|B7ZL10|E7ESM5|E7EWS6|G3XAE8|Q15497|Q17RR7|Q569K7|Q86T48|Q86TC8|Q8N3L2	Nonsense_Mutation	SNP	ENST00000550270.1	37	CCDS9085.1	.	.	.	.	.	.	.	.	.	.	G	40	8.002340	0.98605	.	.	ENSG00000196091	ENST00000547405;ENST00000452455;ENST00000441232;ENST00000360610;ENST00000392934;ENST00000547509;ENST00000361685;ENST00000549145;ENST00000553190;ENST00000540770;ENST00000545503;ENST00000536007;ENST00000541119;ENST00000361466;ENST00000551300;ENST00000550270	.	.	.	5.71	5.71	0.89125	.	0.000000	0.52532	D	0.000074	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.8505	0.96738	0.0:0.0:1.0:0.0	.	.	.	.	X	520;546;546;546;533;532;571;559;546;571;546;527;534;571;447;546	.	ENSP00000353822:E546X	E	+	1	0	MYBPC1	100571101	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.476000	0.97823	2.688000	0.91661	0.655000	0.94253	GAG	.		0.458	MYBPC1-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000408806.1		
NID2	22795	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	52485956	52485956	+	Missense_Mutation	SNP	A	A	C			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr14:52485956A>C	ENST00000216286.5	-	14	2850	c.2851T>G	c.(2851-2853)Tat>Gat	p.Y951D	NID2_ENST00000541773.1_Missense_Mutation_p.Y850D	NM_007361.3	NP_031387.3	Q14112	NID2_HUMAN	nidogen 2 (osteonidogen)	951	Thyroglobulin type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00500}.				basement membrane organization (GO:0071711)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)			NS(1)|breast(5)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(40)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	87	Breast(41;0.0639)|all_epithelial(31;0.123)					GGGTAGGCATACTGGGCCTGG	0.577																																					p.Y951D		.											.	NID2-158	0			c.T2851G						.						52.0	46.0	48.0					14																	52485956		2203	4300	6503	SO:0001583	missense	22795	exon14			AGGCATACTGGGC	AB009799	CCDS9706.1	14q22.1	2008-05-14			ENSG00000087303	ENSG00000087303			13389	protein-coding gene	gene with protein product		605399				9733643	Standard	NM_007361		Approved		uc001wzo.3	Q14112	OTTHUMG00000140298	ENST00000216286.5:c.2851T>G	14.37:g.52485956A>C	ENSP00000216286:p.Tyr951Asp	Somatic	74	0		WXS	Illumina HiSeq	Phase_I	103	27	NM_007361	0	0	0	0	0	A8K6I7|B4DU19|O43710	Missense_Mutation	SNP	ENST00000216286.5	37	CCDS9706.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	9.654|9.654	1.142329|1.142329	0.21205|0.21205	.|.	.|.	ENSG00000087303|ENSG00000087303	ENST00000556572|ENST00000216286;ENST00000316204;ENST00000541773;ENST00000395707	.|T;T	.|0.61742	.|0.08;0.08	5.32|5.32	0.0082|0.0082	0.14073|0.14073	.|Thyroglobulin type-1 (4);	.|1.030560	.|0.07634	.|N	.|0.929216	T|T	0.40473|0.40473	0.1118|0.1118	N|N	0.24115|0.24115	0.695|0.695	0.09310|0.09310	N|N	1|1	.|B;B;B;B	.|0.27997	.|0.0;0.021;0.197;0.117	.|B;B;B;B	.|0.29862	.|0.002;0.023;0.108;0.009	T|T	0.30387|0.30387	-0.9980|-0.9980	5|10	.|0.33940	.|T	.|0.23	.|.	5.3979|5.3979	0.16278|0.16278	0.0652:0.2279:0.4723:0.2346|0.0652:0.2279:0.4723:0.2346	.|.	.|545;850;953;951	.|E7EPP3;Q14112-2;Q5CZI2;Q14112	.|.;.;.;NID2_HUMAN	G|D	219|951;545;850;953	.|ENSP00000216286:Y951D;ENSP00000443730:Y850D	.|ENSP00000216286:Y951D	V|Y	-|-	2|1	0|0	NID2|NID2	51555706|51555706	0.419000|0.419000	0.25449|0.25449	0.019000|0.019000	0.16419|0.16419	0.026000|0.026000	0.11368|0.11368	1.277000|1.277000	0.33167|0.33167	-0.092000|-0.092000	0.12417|0.12417	-0.242000|-0.242000	0.12053|0.12053	GTA|TAT	.		0.577	NID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276888.1		
KNSTRN	90417	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	40685795	40685795	+	Missense_Mutation	SNP	G	G	T			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr15:40685795G>T	ENST00000249776.8	+	9	1063	c.948G>T	c.(946-948)atG>atT	p.M316I	KNSTRN_ENST00000416151.2_3'UTR|KNSTRN_ENST00000608100.1_Missense_Mutation_p.M238I|KNSTRN_ENST00000448395.2_3'UTR	NM_033286.3	NP_150628.3			kinetochore-localized astrin/SPAG5 binding protein																		TATTAGAAATGTAAGAAGaag	0.423																																					p.M316I		.											.	.	0			c.G948T						.						83.0	76.0	78.0					15																	40685795		1885	4111	5996	SO:0001583	missense	90417	exon9			AGAAATGTAAGAA	AK027408	CCDS42021.1, CCDS45226.1, CCDS45227.1	15q15.1	2013-01-17	2012-12-04	2012-12-04	ENSG00000128944	ENSG00000128944			30767	protein-coding gene	gene with protein product	"""small kinetochore-associated protein"", ""kinetochore-localized astrin-binding protein"", ""TRAF4 associated factor 1"""	614718	"""chromosome 15 open reading frame 23"""	C15orf23		12477932	Standard	NM_033286		Approved	FLJ14502, SKAP, kinastrin, TRAF4AF1	uc001zll.3	Q9Y448	OTTHUMG00000172454	ENST00000249776.8:c.948G>T	15.37:g.40685795G>T	ENSP00000249776:p.Met316Ile	Somatic	97	0		WXS	Illumina HiSeq	Phase_I	90	18	NM_033286	0	0	15	16	1		Missense_Mutation	SNP	ENST00000249776.8	37	CCDS42021.1	.	.	.	.	.	.	.	.	.	.	G	12.89	2.074155	0.36566	.	.	ENSG00000128944	ENST00000249776	T	0.27720	1.65	5.02	3.02	0.34903	.	0.171826	0.41938	D	0.000798	T	0.16128	0.0388	N	0.14661	0.345	0.80722	D	1	B	0.11235	0.004	B	0.11329	0.006	T	0.06267	-1.0836	10	0.62326	D	0.03	-5.1946	5.8118	0.18469	0.0965:0.0:0.7133:0.1903	.	316	Q9Y448	T4AF1_HUMAN	I	316	ENSP00000249776:M316I	ENSP00000249776:M316I	M	+	3	0	C15orf23	38473087	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	1.826000	0.39092	1.491000	0.48482	0.650000	0.86243	ATG	.		0.423	KNSTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418636.1	NM_001142761	
RAB27A	5873	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	55516128	55516128	+	Silent	SNP	T	T	A			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr15:55516128T>A	ENST00000396307.2	-	5	677	c.426A>T	c.(424-426)gtA>gtT	p.V142V	RAB27A_ENST00000569493.1_Silent_p.V142V|RAB27A_ENST00000336787.1_Silent_p.V142V|RAB27A_ENST00000564609.1_Silent_p.V142V	NM_004580.4	NP_004571.2	P51159	RB27A_HUMAN	RAB27A, member RAS oncogene family	142					antigen processing and presentation (GO:0019882)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|cytotoxic T cell degranulation (GO:0043316)|exocytosis (GO:0006887)|exosomal secretion (GO:1990182)|melanocyte differentiation (GO:0030318)|melanosome transport (GO:0032402)|multivesicular body organization (GO:0036257)|multivesicular body sorting pathway (GO:0071985)|natural killer cell degranulation (GO:0043320)|positive regulation of exocytosis (GO:0045921)|positive regulation of gene expression (GO:0010628)|protein targeting (GO:0006605)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle transport (GO:0048489)	apical plasma membrane (GO:0016324)|dendrite (GO:0030425)|exocytic vesicle (GO:0070382)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|lysosome (GO:0005764)|melanosome (GO:0042470)|multivesicular body membrane (GO:0032585)|photoreceptor outer segment (GO:0001750)|secretory granule membrane (GO:0030667)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|large_intestine(2)|liver(1)|lung(3)|ovary(1)|skin(1)	9				all cancers(107;0.0273)|GBM - Glioblastoma multiforme(80;0.0993)		CCTCTTTCACTACTCTCTGGT	0.398																																					p.V142V		.											.	RAB27A-228	0			c.A426T						.						167.0	168.0	167.0					15																	55516128		2193	4292	6485	SO:0001819	synonymous_variant	5873	exon6			TTTCACTACTCTC	U38654	CCDS10153.1	15q15-q21.1	2014-09-17			ENSG00000069974	ENSG00000069974		"""RAB, member RAS oncogene"""	9766	protein-coding gene	gene with protein product		603868				7592656	Standard	NM_183235		Approved	RAB27, RAM, GS2, HsT18676	uc002acq.3	P51159	OTTHUMG00000131959	ENST00000396307.2:c.426A>T	15.37:g.55516128T>A		Somatic	447	0		WXS	Illumina HiSeq	Phase_I	91	12	NM_183235	0	0	55	58	3	O00195|Q6FI40|Q9UIR9|Q9Y5U3	Silent	SNP	ENST00000396307.2	37	CCDS10153.1																																																																																			.		0.398	RAB27A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254918.1	NM_004580, NM_183236	
PIGQ	9091	broad.mit.edu	37	16	624651	624651	+	Missense_Mutation	SNP	T	T	G			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr16:624651T>G	ENST00000026218.5	+	2	665	c.577T>G	c.(577-579)Tcg>Gcg	p.S193A	PIGQ_ENST00000321878.5_Missense_Mutation_p.S193A|PIGQ_ENST00000470411.2_Missense_Mutation_p.S193A|PIGQ_ENST00000409527.2_Missense_Mutation_p.S193A	NM_148920.2	NP_683721.1	Q9BRB3	PIGQ_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class Q	193					C-terminal protein lipidation (GO:0006501)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex (GO:0000506)|integral component of membrane (GO:0016021)	phosphatidylinositol N-acetylglucosaminyltransferase activity (GO:0017176)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	13		Hepatocellular(780;0.00335)				CCACTGGCAGTCGGAGGGCGT	0.682																																					p.S193A													.	PIGQ-226	0			c.T577G						.						10.0	12.0	11.0					16																	624651		2131	4203	6334	SO:0001583	missense	9091	exon2			TGGCAGTCGGAGG	AB003723	CCDS10411.1, CCDS10412.1	16p13.3	2013-03-28	2006-06-28		ENSG00000007541	ENSG00000007541		"""Phosphatidylinositol glycan anchor biosynthesis"""	14135	protein-coding gene	gene with protein product		605754	"""phosphatidylinositol glycan, class Q"""			9463366, 9729469	Standard	NM_004204		Approved	hGPI1, GPI1	uc002cho.3	Q9BRB3	OTTHUMG00000168047	ENST00000026218.5:c.577T>G	16.37:g.624651T>G	ENSP00000026218:p.Ser193Ala	Somatic	32	4		WXS	Illumina HiSeq	Phase_I	42	10	NM_148920	0	0	22	22	0	A2IDE1|D3DU52|O14927|Q96G00|Q96S22|Q9UJH4	Missense_Mutation	SNP	ENST00000026218.5	37	CCDS10411.1	.	.	.	.	.	.	.	.	.	.	T	16.74	3.206870	0.58343	.	.	ENSG00000007541	ENST00000409527;ENST00000409439;ENST00000422307;ENST00000321878;ENST00000026218;ENST00000470411	T;T;T;T;T;T	0.54479	0.63;0.61;0.62;0.63;1.84;0.57	5.45	5.45	0.79879	.	0.066299	0.64402	D	0.000008	T	0.67116	0.2859	M	0.66939	2.045	0.52501	D	0.999951	D;P;D;D	0.65815	0.984;0.956;0.981;0.995	P;P;P;P	0.61132	0.635;0.676;0.681;0.884	T	0.67998	-0.5525	9	.	.	.	-11.7834	14.6869	0.69055	0.0:0.0:0.0:1.0	.	207;193;193;193	E7ERP4;Q9BRB3;Q9BRB3-2;Q9BRB3-3	.;PIGQ_HUMAN;.;.	A	193	ENSP00000386760:S193A;ENSP00000386554:S193A;ENSP00000413753:S193A;ENSP00000326674:S193A;ENSP00000026218:S193A;ENSP00000439650:S193A	.	S	+	1	0	PIGQ	564652	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.958000	0.63660	2.077000	0.62373	0.459000	0.35465	TCG	.		0.682	PIGQ-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000239270.2	NM_004204	
ZNF598	90850	hgsc.bcm.edu	37	16	2059674	2059674	+	Missense_Mutation	SNP	T	T	C	rs71384660		TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr16:2059674T>C	ENST00000431526.1	-	2	88	c.74A>G	c.(73-75)gAa>gGa	p.E25G	ZNF598_ENST00000562103.1_5'UTR|ZNF598_ENST00000563630.1_5'UTR	NM_178167.2	NP_835461.2	Q86UK7	ZN598_HUMAN	zinc finger protein 598	25							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|lung(7)|skin(1)|urinary_tract(1)	16						GCTCCCGCCTTCCCGCTCAGG	0.766													C|||	5008	1.0	1.0	1.0	5008	,	,		5162	1.0		1.0	False		,,,				2504	1.0				p.E25G		.											.	ZNF598-432	0			c.A74G						.						1.0	2.0	2.0					16																	2059674		1089	2314	3403	SO:0001583	missense	90850	exon2			CCGCCTTCCCGCT	BC029270		16p13.3	2008-05-02				ENSG00000167962		"""Zinc fingers, C2H2-type"""	28079	protein-coding gene	gene with protein product							Standard	NM_178167		Approved	FLJ00086	uc002cof.2	Q86UK7		ENST00000431526.1:c.74A>G	16.37:g.2059674T>C	ENSP00000411409:p.Glu25Gly	Somatic	0	0		WXS	Illumina HiSeq	Phase_I	4	4	NM_178167	0	0	0	0	0	Q8IW49|Q8N3D9|Q96FG3|Q9H7J3	Missense_Mutation	SNP	ENST00000431526.1	37		2168	0.9926739926739927	487	0.9898373983739838	361	0.9972375690607734	568	0.993006993006993	752	0.9920844327176781	N	1.560	-0.537056	0.04082	.	.	ENSG00000167962	ENST00000431526	T	0.77098	-1.07	3.3	3.3	0.37823	.	0.415485	0.23105	N	0.051871	T	0.00012	0.0000	.	.	.	0.48696	P	3.1000000000003247E-4	.	.	.	.	.	.	T	0.34650	-0.9820	6	0.22706	T	0.39	-7.8624	8.393	0.32540	0.0:0.8796:0.0:0.1204	.	.	.	.	G	25	ENSP00000411409:E25G	ENSP00000411409:E25G	E	-	2	0	ZNF598	1999675	1.000000	0.71417	1.000000	0.80357	0.107000	0.19398	0.911000	0.28584	0.691000	0.31592	-0.642000	0.03964	GAA	T|0.007;C|0.993		0.766	ZNF598-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_178167	
RNPS1	10921	broad.mit.edu	37	16	2313224	2313224	+	Missense_Mutation	SNP	T	T	G			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr16:2313224T>G	ENST00000565678.1	-	4	837	c.292A>C	c.(292-294)Agc>Cgc	p.S98R	RNPS1_ENST00000561718.1_5'UTR|RNPS1_ENST00000566458.1_Missense_Mutation_p.S75R|RNPS1_ENST00000566397.1_5'UTR|RNPS1_ENST00000569598.2_Intron|RNPS1_ENST00000397086.2_Missense_Mutation_p.S98R|RNPS1_ENST00000568631.1_Missense_Mutation_p.S98R|RNPS1_ENST00000567147.1_Missense_Mutation_p.S75R|RNPS1_ENST00000301730.8_Missense_Mutation_p.S98R|RNPS1_ENST00000320225.5_Missense_Mutation_p.S98R			Q15287	RNPS1_HUMAN	RNA binding protein S1, serine-rich domain	98	Necessary for interaction with SRP54, nuclear localization and exon-skipping.|Necessary for interaction with the cleaved p110 isoform of CDC2L1.|Necessary for interactions with UPF2 and UPF3B and UPF2-dependent NMD.|Ser-rich.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of apoptotic process (GO:0043065)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(1)|large_intestine(1)|lung(4)|ovary(2)|urinary_tract(1)	9						gaggaagagctggagccactg	0.617																																					p.S98R													.	RNPS1-91	0			c.A292C						.						32.0	28.0	29.0					16																	2313224		2198	4300	6498	SO:0001583	missense	10921	exon4			AAGAGCTGGAGCC	AF015608	CCDS10465.1, CCDS66907.1, CCDS73811.1	16p13.3	2013-02-12	2001-11-28		ENSG00000205937	ENSG00000205937		"""RNA binding motif (RRM) containing"""	10080	protein-coding gene	gene with protein product		606447	"""RNA-binding protein S1, serine-rich domain"""			9580558, 8543184	Standard	XM_005255048		Approved		uc002cpu.3	Q15287	OTTHUMG00000128828	ENST00000565678.1:c.292A>C	16.37:g.2313224T>G	ENSP00000457723:p.Ser98Arg	Somatic	25	5		WXS	Illumina HiSeq	Phase_I	81	13	NM_006711	0	0	140	157	17	A8K1P0|B4DDU8|B4DZU7|B7ZA17|O75308|Q32P25|Q8WY42|Q9NYG3	Missense_Mutation	SNP	ENST00000565678.1	37	CCDS10465.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.015897	0.75161	.	.	ENSG00000205937	ENST00000320225;ENST00000397086;ENST00000301730	T;T;T	0.06933	3.24;3.24;3.24	6.06	6.06	0.98353	.	0.688144	0.15090	N	0.281144	T	0.23965	0.0580	L	0.59436	1.845	0.80722	D	1	D;D	0.64830	0.994;0.99	D;D	0.71870	0.975;0.944	T	0.01202	-1.1420	10	0.20046	T	0.44	-3.5075	14.5591	0.68123	0.0:0.0:0.0:1.0	.	75;98	Q15287-2;Q15287	.;RNPS1_HUMAN	R	98	ENSP00000315859:S98R;ENSP00000380275:S98R;ENSP00000301730:S98R	ENSP00000301730:S98R	S	-	1	0	RNPS1	2253225	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.380000	0.79704	2.319000	0.78375	0.523000	0.50628	AGC	.		0.617	RNPS1-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435415.1	NM_080594	
TMC7	79905	hgsc.bcm.edu;broad.mit.edu	37	16	19073098	19073098	+	Splice_Site	SNP	A	A	T			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr16:19073098A>T	ENST00000304381.5	+	16	2236		c.e16-1		RP11-626G11.5_ENST00000567047.1_RNA|RP11-626G11.5_ENST00000576433.1_RNA|RP11-626G11.5_ENST00000568971.1_RNA|RP11-626G11.5_ENST00000571934.1_RNA|TMC7_ENST00000421369.3_Splice_Site	NM_024847.3	NP_079123.3	Q7Z402	TMC7_HUMAN	transmembrane channel-like 7						ion transport (GO:0006811)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	28						ATTATTTTTTAGGAAAGTCGT	0.403																																					.		.											.	TMC7-93	0			c.2107-2A>T						.						87.0	80.0	82.0					16																	19073098		2197	4300	6497	SO:0001630	splice_region_variant	79905	exon16			TTTTTTAGGAAAG	AY263165	CCDS10573.1, CCDS53992.1, CCDS73837.1	16p13.11	2008-02-05			ENSG00000170537	ENSG00000170537			23000	protein-coding gene	gene with protein product						12812529, 12906855	Standard	XM_005255597		Approved	FLJ21240	uc002dfq.3	Q7Z402	OTTHUMG00000131456	ENST00000304381.5:c.2107-1A>T	16.37:g.19073098A>T		Somatic	83	0		WXS	Illumina HiSeq	Phase_I	90	13	NM_024847	0	0	0	0	0	E7ERB6|Q5H9Q8|Q7Z5M4|Q86WX0|Q9H766	Splice_Site	SNP	ENST00000304381.5	37	CCDS10573.1	.	.	.	.	.	.	.	.	.	.	A	14.61	2.586609	0.46110	.	.	ENSG00000170537	ENST00000304381;ENST00000421369	.	.	.	5.03	5.03	0.67393	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.2868	0.60247	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TMC7	18980599	1.000000	0.71417	0.916000	0.36221	0.545000	0.35147	6.318000	0.72866	2.012000	0.59069	0.533000	0.62120	.	.		0.403	TMC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254276.3	NM_024847	Intron
DNAH3	55567	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	21080893	21080893	+	Missense_Mutation	SNP	C	C	T	rs577456196		TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr16:21080893C>T	ENST00000261383.3	-	23	3223	c.3224G>A	c.(3223-3225)cGc>cAc	p.R1075H	DNAH3_ENST00000415178.1_Missense_Mutation_p.R1075H	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	1075	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)	p.R1075P(2)		NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		GTCTTGTATGCGAATTAGCTT	0.453													C|||	1	0.000199681	0.0	0.0	5008	,	,		19175	0.001		0.0	False		,,,				2504	0.0				p.R1075H		.											.	DNAH3-167	2	Substitution - Missense(2)	lung(2)	c.G3224A						.						173.0	130.0	144.0					16																	21080893		2201	4300	6501	SO:0001583	missense	55567	exon23			TGTATGCGAATTA	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.3224G>A	16.37:g.21080893C>T	ENSP00000261383:p.Arg1075His	Somatic	176	0		WXS	Illumina HiSeq	Phase_I	96	14	NM_017539	0	0	0	0	0	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	37	CCDS10594.1	.	.	.	.	.	.	.	.	.	.	C	10.65	1.410395	0.25465	.	.	ENSG00000158486	ENST00000261383;ENST00000415178	T;T	0.61859	0.07;0.07	5.4	4.22	0.49857	Dynein heavy chain, domain-2 (1);	0.726956	0.12981	N	0.423277	T	0.44519	0.1297	L	0.28192	0.835	0.09310	N	1	D	0.65815	0.995	P	0.49332	0.607	T	0.36625	-0.9740	10	0.26408	T	0.33	.	2.0715	0.03614	0.3159:0.4174:0.1475:0.1193	.	1075	Q8TD57	DYH3_HUMAN	H	1075	ENSP00000261383:R1075H;ENSP00000394245:R1075H	ENSP00000261383:R1075H	R	-	2	0	DNAH3	20988394	0.001000	0.12720	0.952000	0.39060	0.634000	0.38068	0.318000	0.19504	2.696000	0.92011	0.655000	0.94253	CGC	.		0.453	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539	
TMEM107	84314	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	8079579	8079579	+	Missense_Mutation	SNP	G	G	T			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr17:8079579G>T	ENST00000437139.2	-	1	113	c.26C>A	c.(25-27)cCc>cAc	p.P9H	TMEM107_ENST00000532998.1_Missense_Mutation_p.P9H|RP11-599B13.7_ENST00000581248.1_lincRNA|TMEM107_ENST00000431792.2_Missense_Mutation_p.P9H|TMEM107_ENST00000533070.1_Missense_Mutation_p.P9H|SNORD118_ENST00000363593.1_RNA|TMEM107_ENST00000316425.5_Missense_Mutation_p.P9H|TMEM107_ENST00000449985.2_Missense_Mutation_p.P9H	NM_183065.2	NP_898888.1	Q6UX40	TM107_HUMAN	transmembrane protein 107	9					cilium assembly (GO:0042384)|embryonic digit morphogenesis (GO:0042733)|neural tube patterning (GO:0021532)	integral component of membrane (GO:0016021)				large_intestine(1)|lung(4)|ovary(1)	6						GAAGCGAGAGGGCACAAGCCC	0.632																																					p.P9H		.											.	TMEM107-90	0			c.C26A						.						58.0	48.0	51.0					17																	8079579		2203	4300	6503	SO:0001583	missense	84314	exon1			CGAGAGGGCACAA	AF311338	CCDS11132.1, CCDS45607.1	17p13.1	2005-12-19				ENSG00000179029			28128	protein-coding gene	gene with protein product						12477932	Standard	NM_032354		Approved	MGC10744	uc002gkh.4	Q6UX40		ENST00000437139.2:c.26C>A	17.37:g.8079579G>T	ENSP00000402732:p.Pro9His	Somatic	84	0		WXS	Illumina HiSeq	Phase_I	159	21	NM_183065	0	0	25	41	16	A0PJV7|Q6NSE3|Q6ZRX9|Q96T82	Missense_Mutation	SNP	ENST00000437139.2	37	CCDS45607.1	.	.	.	.	.	.	.	.	.	.	G	17.61	3.431906	0.62844	.	.	ENSG00000179029	ENST00000449985;ENST00000532998;ENST00000437139;ENST00000533070;ENST00000316425;ENST00000431792;ENST00000415860	.	.	.	5.6	4.63	0.57726	.	0.000000	0.85682	D	0.000000	T	0.77465	0.4134	M	0.79475	2.455	0.49915	D	0.999835	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.982	T	0.79948	-0.1588	9	0.87932	D	0	-37.9001	10.8172	0.46583	0.0877:0.0:0.9123:0.0	.	9;9;9;9	B3KNL7;Q6UX40-3;Q6UX40-4;Q6UX40	.;.;.;TM107_HUMAN	H	9	.	ENSP00000314116:P9H	P	-	2	0	TMEM107	8020304	1.000000	0.71417	1.000000	0.80357	0.028000	0.11728	8.301000	0.89951	1.511000	0.48818	-0.158000	0.13435	CCC	.		0.632	TMEM107-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388844.1	NM_032354	
TBC1D29	26083	hgsc.bcm.edu	37	17	28887148	28887148	+	Missense_Mutation	SNP	T	T	A	rs200596738		TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr17:28887148T>A	ENST00000580161.1	+	3	2523	c.26T>A	c.(25-27)cTa>cAa	p.L9Q	TBC1D29_ENST00000579181.1_Missense_Mutation_p.L9Q|TBC1D29_ENST00000584297.1_Missense_Mutation_p.L9Q|RP11-218M11.6_ENST00000582125.1_RNA			Q9UFV1	TBC29_HUMAN	TBC1 domain family, member 29	9	Rab-GAP TBC; truncated. {ECO:0000255|PROSITE-ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)	p.L9Q(1)		breast(1)|kidney(1)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	9		Myeloproliferative disorder(56;0.0255)				AAGGAAGGTCTATGCACACAG	0.607																																					p.L9Q		.											.	TBC1D29-22	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)	c.T26A						.						51.0	46.0	48.0					17																	28887148		2203	4300	6503	SO:0001583	missense	26083	exon2			AAGGTCTATGCAC	BC096718	CCDS32606.1	17q11.2	2014-09-04			ENSG00000266733	ENSG00000266733			24509	protein-coding gene	gene with protein product						12618308	Standard	XM_006721805		Approved	DKFZP434O047	uc002hfh.3	Q9UFV1	OTTHUMG00000178857	ENST00000580161.1:c.26T>A	17.37:g.28887148T>A	ENSP00000462799:p.Leu9Gln	Somatic	43	2		WXS	Illumina HiSeq	Phase_I	95	5	NM_015594	0	0	0	0	0		Missense_Mutation	SNP	ENST00000580161.1	37	CCDS32606.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	.	10.28	1.307657	0.23821	.	.	ENSG00000197689	ENST00000329040;ENST00000378698	.	.	.	0.15	0.15	0.14883	Rab-GAP/TBC domain (2);	.	.	.	.	T	0.54498	0.1862	M	0.62723	1.935	0.09310	N	1	D	0.62365	0.991	D	0.68039	0.955	T	0.41752	-0.9491	7	0.87932	D	0	.	.	.	.	.	9	Q9UFV1	TBC29_HUMAN	Q	9	.	ENSP00000330052:L9Q	L	+	2	0	TBC1D29	25911274	0.000000	0.05858	0.025000	0.17156	0.025000	0.11179	-0.060000	0.11712	0.168000	0.19655	0.166000	0.16787	CTA	T|1.000;A|0.000		0.607	TBC1D29-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443632.1	NM_015594	
ASIC2	40	hgsc.bcm.edu	37	17	31618997	31618997	+	Intron	SNP	C	C	A	rs112647385	byFrequency	TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr17:31618997C>A	ENST00000359872.6	-	2	1317				ASIC2_ENST00000448983.1_5'Flank|ASIC2_ENST00000225823.2_Missense_Mutation_p.R46L	NM_001094.4	NP_001085.2	Q16515	ASIC2_HUMAN	acid-sensing (proton-gated) ion channel 2						central nervous system development (GO:0007417)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|ion transmembrane transport (GO:0034220)|monovalent inorganic cation transport (GO:0015672)|negative regulation of apoptotic process (GO:0043066)|peripheral nervous system development (GO:0007422)|phototransduction (GO:0007602)|positive regulation of synapse assembly (GO:0051965)|protein localization to synapse (GO:0035418)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of membrane potential (GO:0042391)|regulation of systemic arterial blood pressure by aortic arch baroreceptor feedback (GO:0003026)|regulation of vasoconstriction (GO:0019229)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|sensory perception of sound (GO:0007605)|sensory perception of sour taste (GO:0050915)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ion gated channel activity (GO:0022839)|ligand-gated sodium channel activity (GO:0015280)|voltage-gated sodium channel activity (GO:0005248)									Amiloride(DB00594)	CTGCAGCGCCCGCTCGCCGCC	0.806													C|||	1091	0.217851	0.112	0.1902	5008	,	,		5226	0.3194		0.2664	False		,,,				2504	0.226				p.R46L		.											.	.	0			c.G137T						.						1.0	2.0	2.0					17																	31618997		903	2226	3129	SO:0001627	intron_variant	40	exon1			AGCGCCCGCTCGC	AL834182	CCDS11276.1, CCDS42296.1	17q11.2-q12	2012-02-23	2012-02-22	2012-02-22	ENSG00000108684	ENSG00000108684		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	99	protein-coding gene	gene with protein product	"""degenerin"""	601784	"""amiloride-sensitive cation channel 1, neuronal"""	ACCN, ACCN1		8921408	Standard	NM_183377		Approved	ASIC2a, BNC1, BNaC1, hBNaC1, MDEG	uc002hhu.3	Q16515	OTTHUMG00000132885	ENST00000359872.6:c.556-179912G>T	17.37:g.31618997C>A		Somatic	2	1		WXS	Illumina HiSeq	Phase_I	7	7	NM_183377	0	0	0	0	0	E9PBX2|Q13553|Q6DJU1|Q8N3E2	Missense_Mutation	SNP	ENST00000359872.6	37	CCDS42296.1	567	0.25961538461538464	84	0.17073170731707318	81	0.22375690607734808	197	0.34440559440559443	205	0.2704485488126649	C	13.69	2.313571	0.40996	.	.	ENSG00000108684	ENST00000225823	T	0.65178	-0.14	4.45	-0.0635	0.13776	.	1.386070	0.04769	N	0.427624	T	0.00012	0.0000	N	0.08118	0	0.58432	P	5.000000000032756E-6	B	0.17038	0.02	B	0.10450	0.005	T	0.17715	-1.0360	9	0.29301	T	0.29	-24.8125	4.0823	0.09932	0.0:0.3667:0.3479:0.2854	.	46	E9PBX2	.	L	46	ENSP00000225823:R46L	ENSP00000225823:R46L	R	-	2	0	ACCN1	28643110	0.458000	0.25760	0.926000	0.36857	0.865000	0.49528	1.119000	0.31258	0.274000	0.22072	0.306000	0.20318	CGG	C|0.740;A|0.260		0.806	ASIC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447552.1	NM_183377, NM_001094	
PSMC3IP	29893	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	40726133	40726133	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr17:40726133G>T	ENST00000393795.3	-	4	429	c.321C>A	c.(319-321)tgC>tgA	p.C107*	PSMC3IP_ENST00000587209.1_Nonsense_Mutation_p.C44*|PSMC3IP_ENST00000590760.1_Intron|PSMC3IP_ENST00000253789.5_Nonsense_Mutation_p.C107*	NM_001256015.1|NM_001256016.1|NM_016556.3	NP_001242944.1|NP_001242945.1|NP_057640.1	Q9P2W1	HOP2_HUMAN	PSMC3 interacting protein	107					DNA recombination (GO:0006310)|meiotic nuclear division (GO:0007126)|regulation of RNA biosynthetic process (GO:2001141)	nucleus (GO:0005634)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)			endometrium(2)|large_intestine(1)|lung(1)|skin(1)|upper_aerodigestive_tract(2)	7		all_cancers(22;0.00426)|Breast(137;0.00116)|all_epithelial(22;0.0395)		BRCA - Breast invasive adenocarcinoma(366;0.13)		CCATGTAGCGGCAGCTCTGCT	0.512																																					p.C107X													.	PSMC3IP-92	0			c.C321A						.						57.0	45.0	49.0					17																	40726133		2203	4300	6503	SO:0001587	stop_gained	29893	exon4			GTAGCGGCAGCTC	AB030304, NM_013290, BC008792	CCDS11431.1, CCDS45688.1, CCDS59289.1	17q21.2	2012-04-10				ENSG00000131470		"""Proteasome (prosome, macropain) subunits"""	17928	protein-coding gene	gene with protein product	"""TBP-1 interacting protein"""	608665				7490091, 10806355, 11739747	Standard	NM_016556		Approved	TBPIP, GT198, HUMGT198A	uc002iai.3	Q9P2W1		ENST00000393795.3:c.321C>A	17.37:g.40726133G>T	ENSP00000377384:p.Cys107*	Somatic	79	0		WXS	Illumina HiSeq	Phase_I	64	15	NM_016556	0	0	3	5	2	C5ILB7|Q14458|Q8WXG2|Q96HA2	Nonsense_Mutation	SNP	ENST00000393795.3	37	CCDS45688.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.354575	0.82243	.	.	ENSG00000131470	ENST00000393795;ENST00000253789	.	.	.	5.73	2.53	0.30540	.	0.092706	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	-20.0948	9.5122	0.39085	0.297:0.0:0.703:0.0	.	.	.	.	X	107	.	ENSP00000253789:C107X	C	-	3	2	PSMC3IP	37979659	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.337000	0.52120	0.288000	0.22398	0.563000	0.77884	TGC	.		0.512	PSMC3IP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450427.1	NM_013290	
TMEM106A	113277	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	41365849	41365849	+	Silent	SNP	C	C	T			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr17:41365849C>T	ENST00000331615.3	+	4	451	c.214C>T	c.(214-216)Ctg>Ttg	p.L72L	TMEM106A_ENST00000592564.1_3'UTR|TMEM106A_ENST00000541594.1_Silent_p.L24L|TMEM106A_ENST00000588659.1_Silent_p.L72L|TMEM106A_ENST00000536052.1_Silent_p.L72L	NM_145041.1	NP_659478.1	Q96A25	T106A_HUMAN	transmembrane protein 106A	72						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|endometrium(2)|large_intestine(1)|lung(6)|prostate(1)	11		Breast(137;0.0164)		BRCA - Breast invasive adenocarcinoma(366;0.0917)		CTCTCTAGAGCTGGAGAAGCA	0.552																																					p.L72L		.											.	.	0			c.C214T						.						97.0	74.0	82.0					17																	41365849		2203	4296	6499	SO:0001819	synonymous_variant	113277	exon4			CTAGAGCTGGAGA	AK056132	CCDS11462.1, CCDS74073.1	17q21.31	2012-01-23			ENSG00000184988	ENSG00000184988			28288	protein-coding gene	gene with protein product							Standard	XM_006721658		Approved	MGC20235	uc002idn.1	Q96A25		ENST00000331615.3:c.214C>T	17.37:g.41365849C>T		Somatic	108	0		WXS	Illumina HiSeq	Phase_I	165	17	NM_145041	0	0	0	0	0	A8K2X2|B7Z698	Silent	SNP	ENST00000331615.3	37	CCDS11462.1																																																																																			.		0.552	TMEM106A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453470.2	NM_145041	
CDC27	996	hgsc.bcm.edu	37	17	45247409	45247409	+	Splice_Site	SNP	C	C	T	rs78111769		TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr17:45247409C>T	ENST00000066544.3	-	4	345		c.e4-1		CDC27_ENST00000531206.1_Splice_Site|RP5-867C24.5_ENST00000572193.1_RNA|CDC27_ENST00000446365.2_Splice_Site|CDC27_ENST00000527547.1_Splice_Site|CDC27_ENST00000528748.1_Splice_Site	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						TTCTGCAAGCCTTTAAAATAC	0.318																																					.		.											.	CDC27-291	0			c.252-1G>A						.						51.0	59.0	56.0					17																	45247409		2203	4296	6499	SO:0001630	splice_region_variant	996	exon5			GCAAGCCTTTAAA	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.252-1G>A	17.37:g.45247409C>T		Somatic	177	2		WXS	Illumina HiSeq	Phase_I	71	6	NM_001256	0	0	0	0	0	G3V1C4|Q16349|Q96F35	Splice_Site	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.116295	0.77323	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000533415;ENST00000446365;ENST00000527547;ENST00000526866	.	.	.	5.35	5.35	0.76521	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.9253	0.86174	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CDC27	42602408	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	7.687000	0.84139	2.663000	0.90544	0.655000	0.94253	.	.		0.318	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		Intron
TRAPPC8	22878	hgsc.bcm.edu	37	18	29444612	29444612	+	Missense_Mutation	SNP	G	G	C			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr18:29444612G>C	ENST00000283351.4	-	19	3058	c.2723C>G	c.(2722-2724)aCa>aGa	p.T908R	TRAPPC8_ENST00000582539.1_Missense_Mutation_p.T854R	NM_014939.3	NP_055754	Q9Y2L5	TPPC8_HUMAN	trafficking protein particle complex 8	908					vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(7)|liver(2)|lung(13)|ovary(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						CATTTCTTCTGTGATTATGGG	0.328																																					p.T908R		.											.	TRAPPC8-159	0			c.C2723G						.						117.0	112.0	114.0					18																	29444612		2203	4300	6503	SO:0001583	missense	22878	exon19			TCTTCTGTGATTA	AB023229	CCDS11901.1	18q12.1	2011-10-10	2010-06-29	2010-06-29	ENSG00000153339	ENSG00000153339		"""Trafficking protein particle complex"""	29169	protein-coding gene	gene with protein product	"""general sporulation gene 1 homolog (S. cerevisiae)"""	614136	"""KIAA1012"""	KIAA1012		10231032, 11230166	Standard	NM_014939		Approved	HsT2706, TRS85, GSG1	uc002kxc.4	Q9Y2L5	OTTHUMG00000132267	ENST00000283351.4:c.2723C>G	18.37:g.29444612G>C	ENSP00000283351:p.Thr908Arg	Somatic	187	0		WXS	Illumina HiSeq	Phase_I	26	2	NM_014939	0	0	15	15	0	A0JP15|B3KME5|Q9H0L2	Missense_Mutation	SNP	ENST00000283351.4	37	CCDS11901.1	.	.	.	.	.	.	.	.	.	.	G	13.08	2.129354	0.37630	.	.	ENSG00000153339	ENST00000283351	T	0.09911	2.93	5.91	4.12	0.48240	.	0.093959	0.64402	D	0.000001	T	0.14917	0.0360	M	0.76328	2.33	0.80722	D	1	P	0.47910	0.902	B	0.41813	0.367	T	0.12319	-1.0552	10	0.20519	T	0.43	.	13.0419	0.58904	0.1324:0.0:0.8676:0.0	.	908	Q9Y2L5	TPPC8_HUMAN	R	908	ENSP00000283351:T908R	ENSP00000283351:T908R	T	-	2	0	TRAPPC8	27698610	1.000000	0.71417	0.989000	0.46669	0.994000	0.84299	6.119000	0.71590	1.513000	0.48852	0.555000	0.69702	ACA	.		0.328	TRAPPC8-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255355.1	NM_014939	
ME2	4200	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	18	48442562	48442562	+	Missense_Mutation	SNP	C	C	G			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr18:48442562C>G	ENST00000321341.5	+	5	689	c.417C>G	c.(415-417)gaC>gaG	p.D139E	ME2_ENST00000382927.3_Missense_Mutation_p.D139E	NM_002396.4	NP_002387.1	P23368	MAOM_HUMAN	malic enzyme 2, NAD(+)-dependent, mitochondrial	139					malate metabolic process (GO:0006108)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|malate dehydrogenase (decarboxylating) (NAD+) activity (GO:0004471)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|oxaloacetate decarboxylase activity (GO:0008948)			breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(11)|upper_aerodigestive_tract(3)	23		Colorectal(6;0.0273)|all_epithelial(6;0.118)		Colorectal(21;0.0313)|READ - Rectum adenocarcinoma(32;0.105)|STAD - Stomach adenocarcinoma(97;0.184)		CGATCTCAGACAGAGGTCATG	0.333																																					p.D139E		.											.	ME2-90	0			c.C417G						.						186.0	177.0	180.0					18																	48442562		2203	4300	6503	SO:0001583	missense	4200	exon5			CTCAGACAGAGGT	M55905	CCDS11948.1, CCDS54187.1	18q21	2012-10-02			ENSG00000082212	ENSG00000082212	1.1.1.40		6984	protein-coding gene	gene with protein product		154270				1993674	Standard	NM_002396		Approved		uc002ley.3	P23368	OTTHUMG00000132694	ENST00000321341.5:c.417C>G	18.37:g.48442562C>G	ENSP00000321070:p.Asp139Glu	Somatic	234	0		WXS	Illumina HiSeq	Phase_I	38	4	NM_001168335	0	0	10	20	10	B2R8J2|Q9BWL6|Q9BYG1|Q9H4B2	Missense_Mutation	SNP	ENST00000321341.5	37	CCDS11948.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.129308	0.77549	.	.	ENSG00000082212	ENST00000321341;ENST00000382927	T;T	0.45668	0.89;0.89	5.8	5.8	0.92144	Malic enzyme, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.63698	0.2533	M	0.77712	2.385	0.58432	D	0.999994	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.61950	-0.6957	10	0.36615	T	0.2	-22.0057	12.879	0.58006	0.0:0.9218:0.0:0.0782	.	139;139	Q9BWL6;P23368	.;MAOM_HUMAN	E	139	ENSP00000321070:D139E;ENSP00000372384:D139E	ENSP00000321070:D139E	D	+	3	2	ME2	46696560	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.392000	0.52537	2.741000	0.93983	0.650000	0.86243	GAC	.		0.333	ME2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255991.1	NM_002396	
ACSBG2	81616	hgsc.bcm.edu;broad.mit.edu	37	19	6177251	6177251	+	Missense_Mutation	SNP	T	T	G			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr19:6177251T>G	ENST00000586696.1	+	8	1026	c.750T>G	c.(748-750)atT>atG	p.I250M	ACSBG2_ENST00000252669.5_Missense_Mutation_p.I250M|ACSBG2_ENST00000588485.1_Missense_Mutation_p.I63M|ACSBG2_ENST00000591741.1_3'UTR|ACSBG2_ENST00000588304.1_Missense_Mutation_p.I200M|ACSBG2_ENST00000591403.1_Missense_Mutation_p.I250M			Q5FVE4	ACBG2_HUMAN	acyl-CoA synthetase bubblegum family member 2	250					cell differentiation (GO:0030154)|fatty acid metabolic process (GO:0006631)|long-chain fatty acid metabolic process (GO:0001676)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)	acyl-CoA hydrolase activity (GO:0047617)|ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)	p.I250M(3)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(3)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TCACGTGGATTGCAGGAGCAG	0.433																																					p.I250M		.											.	ACSBG2-23	3	Substitution - Missense(3)	endometrium(2)|kidney(1)	c.T750G						.						97.0	69.0	78.0					19																	6177251		2203	4300	6503	SO:0001583	missense	81616	exon8			GTGGATTGCAGGA		CCDS12159.1, CCDS74269.1	19p13.3	2012-10-02			ENSG00000130377	ENSG00000130377		"""Acyl-CoA synthetase family"""	24174	protein-coding gene	gene with protein product	"""bubblegum related protein"""	614363				11230166	Standard	XM_005259653		Approved	BGR, PRTD-NY3, DKFZp434K1635	uc002meh.1	Q5FVE4	OTTHUMG00000180754	ENST00000586696.1:c.750T>G	19.37:g.6177251T>G	ENSP00000465589:p.Ile250Met	Somatic	82	0		WXS	Illumina HiSeq	Phase_I	36	6	NM_030924	0	0	0	0	0	B3KSF2|Q6UWJ3|Q7Z5A0|Q8WW03|Q96M36|Q9BYZ3|Q9H0C4	Missense_Mutation	SNP	ENST00000586696.1	37	CCDS12159.1	.	.	.	.	.	.	.	.	.	.	T	8.593	0.885063	0.17540	.	.	ENSG00000130377	ENST00000252669	T	0.10477	2.87	4.48	-8.78	0.00824	AMP-dependent synthetase/ligase (1);	1.500690	0.04439	N	0.370611	T	0.03564	0.0102	N	0.03154	-0.405	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.16722	0.016;0.007	T	0.41124	-0.9526	10	0.49607	T	0.09	-6.8573	2.6506	0.04998	0.499:0.0951:0.1226:0.2833	.	250;250	B4DYU1;Q5FVE4	.;ACBG2_HUMAN	M	250	ENSP00000252669:I250M	ENSP00000252669:I250M	I	+	3	3	ACSBG2	6128251	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-3.884000	0.00342	-1.157000	0.02815	-0.778000	0.03378	ATT	.		0.433	ACSBG2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452898.1	NM_030924	
MUC16	94025	broad.mit.edu	37	19	9067237	9067237	+	Missense_Mutation	SNP	T	T	G	rs201826382		TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr19:9067237T>G	ENST00000397910.4	-	3	20412	c.20209A>C	c.(20209-20211)Act>Cct	p.T6737P		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	6739	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CCTGTTCGAGTGATGATGGTC	0.507																																					p.T6737P													.	MUC16-566	0			c.A20209C						.						277.0	272.0	274.0					19																	9067237		2188	4278	6466	SO:0001583	missense	94025	exon3			TTCGAGTGATGAT	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.20209A>C	19.37:g.9067237T>G	ENSP00000381008:p.Thr6737Pro	Somatic	427	1		WXS	Illumina HiSeq	Phase_I	73	3	NM_024690	0	0	0	0	0	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	t	5.549	0.286102	0.10513	.	.	ENSG00000181143	ENST00000397910	T	0.02579	4.24	2.52	2.52	0.30459	.	.	.	.	.	T	0.02533	0.0077	N	0.12182	0.205	.	.	.	D	0.62365	0.991	P	0.47102	0.537	T	0.41448	-0.9508	8	0.87932	D	0	.	6.9393	0.24484	0.0:0.0:0.0:1.0	.	6737	B5ME49	.	P	6737	ENSP00000381008:T6737P	ENSP00000381008:T6737P	T	-	1	0	MUC16	8928237	0.000000	0.05858	0.006000	0.13384	0.009000	0.06853	-0.127000	0.10547	1.395000	0.46643	0.317000	0.21355	ACT	T|0.999;G|0.001		0.507	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
APLP1	333	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	36362560	36362560	+	Nonsense_Mutation	SNP	T	T	A			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr19:36362560T>A	ENST00000221891.4	+	5	776	c.584T>A	c.(583-585)tTa>tAa	p.L195*	NPHS1_ENST00000591817.1_5'Flank|APLP1_ENST00000537454.2_Nonsense_Mutation_p.L156*|APLP1_ENST00000586861.1_Nonsense_Mutation_p.L189*	NM_001024807.1|NM_005166.3	NP_001019978.1|NP_005157.1	P51693	APLP1_HUMAN	amyloid beta (A4) precursor-like protein 1	195					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular response to norepinephrine stimulus (GO:0071874)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|mRNA polyadenylation (GO:0006378)|negative regulation of cAMP biosynthetic process (GO:0030818)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|regulation of translation (GO:0006417)	basement membrane (GO:0005604)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	alpha-2A adrenergic receptor binding (GO:0031694)|alpha-2B adrenergic receptor binding (GO:0031695)|alpha-2C adrenergic receptor binding (GO:0031696)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|transition metal ion binding (GO:0046914)			breast(4)|endometrium(2)|kidney(2)|large_intestine(12)|liver(1)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	33	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GGCATGCTCTTACCCTGTGGC	0.642																																					p.L195X		.											.	APLP1-92	0			c.T584A						.						111.0	105.0	107.0					19																	36362560		2203	4300	6503	SO:0001587	stop_gained	333	exon5			TGCTCTTACCCTG	U48437	CCDS32997.1	19q	2008-07-15							597	protein-coding gene	gene with protein product	"""amyloid-like protein 1"", ""amyloid precursor-like protein 1"""	104775				8432545	Standard	NM_001024807		Approved	APLP	uc002ocf.3	P51693		ENST00000221891.4:c.584T>A	19.37:g.36362560T>A	ENSP00000221891:p.Leu195*	Somatic	155	0		WXS	Illumina HiSeq	Phase_I	345	57	NM_005166	0	0	0	0	0	O00113|Q96A92	Nonsense_Mutation	SNP	ENST00000221891.4	37	CCDS32997.1	.	.	.	.	.	.	.	.	.	.	T	36	5.888940	0.97068	.	.	ENSG00000105290	ENST00000537454;ENST00000221891	.	.	.	4.41	4.41	0.53225	.	0.000000	0.33515	N	0.004832	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.3771	11.5688	0.50822	0.0:0.0:0.0:1.0	.	.	.	.	X	156;195	.	ENSP00000221891:L195X	L	+	2	0	APLP1	41054400	1.000000	0.71417	1.000000	0.80357	0.713000	0.41058	7.189000	0.77747	1.630000	0.50440	0.379000	0.24179	TTA	.		0.642	APLP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452564.1	NM_001024807	
WDR62	284403	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	36582178	36582178	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr19:36582178C>T	ENST00000270301.7	+	17	2111	c.2111C>T	c.(2110-2112)tCg>tTg	p.S704L	WDR62_ENST00000401500.2_Missense_Mutation_p.S704L			O43379	WDR62_HUMAN	WD repeat domain 62	704					cerebral cortex development (GO:0021987)|neurogenesis (GO:0022008)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle pole (GO:0000922)				cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(15)|prostate(4)|stomach(2)|urinary_tract(3)	43	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			GACTTTTACTCGGGCGAGTGC	0.582																																					p.S704L		.											.	WDR62-90	0			c.C2111T						.						105.0	84.0	91.0					19																	36582178		2203	4300	6503	SO:0001583	missense	284403	exon17			TTTACTCGGGCGA	BX647726	CCDS33001.1, CCDS46059.1	19q13.12	2013-01-09	2005-05-09	2005-05-09	ENSG00000075702	ENSG00000075702		"""WD repeat domain containing"""	24502	protein-coding gene	gene with protein product		613583	"""chromosome 19 open reading frame 14"", ""microcephaly, primary autosomal recessive 2"""	C19orf14, MCPH2		19910486, 20729831, 20890278, 21496009	Standard	NM_001083961		Approved	DKFZP434J046, FLJ33298	uc002odd.2	O43379	OTTHUMG00000048139	ENST00000270301.7:c.2111C>T	19.37:g.36582178C>T	ENSP00000270301:p.Ser704Leu	Somatic	92	1		WXS	Illumina HiSeq	Phase_I	161	25	NM_173636	0	0	0	0	0	Q63HP9|Q659D7|Q8NBF7|Q96AD9	Missense_Mutation	SNP	ENST00000270301.7	37	CCDS33001.1	.	.	.	.	.	.	.	.	.	.	C	35	5.548778	0.96488	.	.	ENSG00000075702	ENST00000401500;ENST00000270301	T;T	0.59906	0.87;0.23	5.35	5.35	0.76521	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.149243	0.46145	D	0.000308	T	0.80193	0.4578	M	0.90814	3.15	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.71414	0.964;0.973	D	0.83964	0.0323	10	0.87932	D	0	-12.0401	16.6023	0.84819	0.0:1.0:0.0:0.0	.	704;704	O43379-4;O43379	.;WDR62_HUMAN	L	704	ENSP00000384792:S704L;ENSP00000270301:S704L	ENSP00000270301:S704L	S	+	2	0	WDR62	41274018	1.000000	0.71417	0.968000	0.41197	0.999000	0.98932	7.278000	0.78587	2.780000	0.95670	0.655000	0.94253	TCG	.		0.582	WDR62-006	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000457436.1	NM_015671	
ZNF585B	92285	hgsc.bcm.edu;broad.mit.edu	37	19	37678072	37678072	+	Missense_Mutation	SNP	T	T	A			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr19:37678072T>A	ENST00000532828.2	-	5	618	c.367A>T	c.(367-369)Att>Ttt	p.I123F	ZNF585B_ENST00000312908.5_5'Flank|ZNF585B_ENST00000531805.1_Missense_Mutation_p.I68F|CTC-454I21.3_ENST00000585860.2_Intron|ZNF585B_ENST00000527838.1_Missense_Mutation_p.I123F	NM_152279.3	NP_689492.3	Q52M93	Z585B_HUMAN	zinc finger protein 585B	123					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|endometrium(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CCAGAATAAATTTTTTGATCT	0.373																																					p.I123F	Melanoma(93;882 1454 18863 28917 48427)	.											.	ZNF585B-91	0			c.A367T						.						59.0	64.0	62.0					19																	37678072		2202	4299	6501	SO:0001583	missense	92285	exon5			AATAAATTTTTTG	AK027834	CCDS12500.1	19q13.13	2013-01-08				ENSG00000245680		"""Zinc fingers, C2H2-type"", ""-"""	30948	protein-coding gene	gene with protein product						12477932	Standard	NM_152279		Approved	FLJ14928, SZFP41	uc002ofq.3	Q52M93		ENST00000532828.2:c.367A>T	19.37:g.37678072T>A	ENSP00000433773:p.Ile123Phe	Somatic	174	0		WXS	Illumina HiSeq	Phase_I	88	9	NM_152279	0	0	3	3	0	Q8IZD3|Q96JW6	Missense_Mutation	SNP	ENST00000532828.2	37	CCDS12500.1	.	.	.	.	.	.	.	.	.	.	T	4.132	0.022795	0.08006	.	.	ENSG00000245680	ENST00000531805;ENST00000532828;ENST00000527838	T;T;T	0.08634	3.07;3.15;6.5	2.32	2.32	0.28847	.	0.230506	0.22120	U	0.064354	T	0.10551	0.0258	M	0.65498	2.005	0.80722	D	1	B	0.22909	0.077	B	0.20184	0.028	T	0.06427	-1.0827	10	0.72032	D	0.01	.	9.2461	0.37527	0.0:0.0:0.0:1.0	.	123	Q52M93	Z585B_HUMAN	F	68;123;123	ENSP00000436774:I68F;ENSP00000433773:I123F;ENSP00000435268:I123F	ENSP00000435268:I123F	I	-	1	0	ZNF585B	42369912	0.614000	0.27017	0.755000	0.31263	0.021000	0.10359	0.914000	0.28624	1.052000	0.40392	0.374000	0.22700	ATT	.		0.373	ZNF585B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388272.2	NM_152279	
ZNF320	162967	broad.mit.edu	37	19	53385207	53385207	+	Silent	SNP	A	A	G			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr19:53385207A>G	ENST00000595635.1	-	8	673	c.172T>C	c.(172-174)Ttg>Ctg	p.L58L	ZNF320_ENST00000597909.1_Intron|ZNF320_ENST00000600930.1_Intron|ZNF320_ENST00000391781.2_Silent_p.L58L	NM_207333.2	NP_997216.2	A2RRD8	ZN320_HUMAN	zinc finger protein 320	58	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|kidney(4)|large_intestine(5)|liver(1)|lung(10)|urinary_tract(1)	24				GBM - Glioblastoma multiforme(134;0.0534)		GTTGATGACAATGTATTCATC	0.358																																					p.L58L													.	ZNF320-91	0			c.T172C						.						138.0	136.0	137.0					19																	53385207		2203	4298	6501	SO:0001819	synonymous_variant	162967	exon4			ATGACAATGTATT	AF086262	CCDS33095.1	19q13.41	2014-09-04			ENSG00000182986	ENSG00000182986		"""Zinc fingers, C2H2-type"", ""-"""	13842	protein-coding gene	gene with protein product		606427				11536051	Standard	XM_006723059		Approved	ZFPL, DKFZp686G16228	uc002qag.3	A2RRD8	OTTHUMG00000182797	ENST00000595635.1:c.172T>C	19.37:g.53385207A>G		Somatic	310	0		WXS	Illumina HiSeq	Phase_I	187	5	NM_207333	0	0	16	16	0	Q8NDR6	Silent	SNP	ENST00000595635.1	37	CCDS33095.1																																																																																			.		0.358	ZNF320-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463771.1	NM_207333	
WDR35	57539	broad.mit.edu	37	2	20175308	20175308	+	Missense_Mutation	SNP	T	T	A			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr2:20175308T>A	ENST00000345530.3	-	6	668	c.553A>T	c.(553-555)Aat>Tat	p.N185Y	WDR35_ENST00000416055.2_5'UTR|WDR35_ENST00000281405.4_Missense_Mutation_p.N185Y	NM_001006657.1	NP_001006658.1	Q9P2L0	WDR35_HUMAN	WD repeat domain 35	185					cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)				breast(1)|endometrium(5)|kidney(8)|large_intestine(8)|lung(16)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTTCCTTGATTATCGTAAATG	0.318																																					p.N185Y													.	WDR35-91	0			c.A553T						.						92.0	82.0	85.0					2																	20175308		2203	4300	6503	SO:0001583	missense	57539	exon6			CTTGATTATCGTA	AB037757	CCDS1695.1, CCDS33152.1	2p24.3	2014-02-21			ENSG00000118965	ENSG00000118965		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	29250	protein-coding gene	gene with protein product		613602				10718198	Standard	NM_001006657		Approved	MGC33196, KIAA1336, IFT121, IFTA1	uc002rdi.3	Q9P2L0	OTTHUMG00000090737	ENST00000345530.3:c.553A>T	2.37:g.20175308T>A	ENSP00000314444:p.Asn185Tyr	Somatic	50	0		WXS	Illumina HiSeq	Phase_I	24	4	NM_020779	0	0	0	0	0	B3KVI5|Q4ZG01|Q8NE11	Missense_Mutation	SNP	ENST00000345530.3	37	CCDS33152.1	.	.	.	.	.	.	.	.	.	.	T	19.60	3.858472	0.71834	.	.	ENSG00000118965	ENST00000345530;ENST00000281405	T;T	0.32023	1.47;1.47	5.24	5.24	0.73138	WD40/YVTN repeat-like-containing domain (1);	0.248299	0.46442	D	0.000290	T	0.50497	0.1619	M	0.75264	2.295	0.80722	D	1	P;B	0.46706	0.883;0.209	P;B	0.55785	0.784;0.322	T	0.53613	-0.8414	10	0.59425	D	0.04	-26.4985	14.6366	0.68694	0.0:0.0:0.0:1.0	.	185;185	Q9P2L0-2;Q9P2L0	.;WDR35_HUMAN	Y	185	ENSP00000314444:N185Y;ENSP00000281405:N185Y	ENSP00000281405:N185Y	N	-	1	0	WDR35	20038789	1.000000	0.71417	1.000000	0.80357	0.758000	0.43043	7.966000	0.87956	2.119000	0.64992	0.533000	0.62120	AAT	.		0.318	WDR35-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000207472.2	NM_020779	
PUM2	23369	hgsc.bcm.edu	37	2	20511256	20511256	+	Splice_Site	SNP	T	T	C			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr2:20511256T>C	ENST00000361078.2	-	4	539	c.517A>G	c.(517-519)Aat>Gat	p.N173D	PUM2_ENST00000319801.5_Splice_Site_p.N173D|PUM2_ENST00000420234.1_Intron|PUM2_ENST00000338086.5_Splice_Site_p.N173D|PUM2_ENST00000403432.1_Splice_Site_p.N173D|PUM2_ENST00000536417.1_Splice_Site_p.N117D			Q8TB72	PUM2_HUMAN	pumilio RNA-binding family member 2	173	Interaction with SNAPIN.				regulation of translation (GO:0006417)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nuclear membrane (GO:0031965)|perinuclear region of cytoplasm (GO:0048471)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(7)|lung(13)|ovary(2)|prostate(4)|urinary_tract(3)	42	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AAATCTTACTTAAAATCTTTG	0.323																																					p.N173D		.											.	PUM2-91	0			c.A517G						.						85.0	85.0	85.0					2																	20511256		2203	4300	6503	SO:0001630	splice_region_variant	23369	exon4			CTTACTTAAAATC	AF315591	CCDS1698.1, CCDS74486.1, CCDS74487.1	2p22-p21	2013-09-02	2013-09-02		ENSG00000055917	ENSG00000055917			14958	protein-coding gene	gene with protein product		607205	"""pumilio (Drosphila) homolog 2"", ""pumilio homolog 2 (Drosophila)"""			9039502, 12459267, 12511597	Standard	XM_005262607		Approved	PUMH2, KIAA0235	uc002rds.1	Q8TB72	OTTHUMG00000122098	ENST00000361078.2:c.518+1A>G	2.37:g.20511256T>C		Somatic	121	0		WXS	Illumina HiSeq	Phase_I	24	2	NM_015317	0	0	0	0	0	B3KSL0|B4E2B6|D6W527|O00234|Q53TV7|Q8WY43|Q9HAN2	Missense_Mutation	SNP	ENST00000361078.2	37		.	.	.	.	.	.	.	.	.	.	T	18.22	3.576580	0.65878	.	.	ENSG00000055917	ENST00000338086;ENST00000361078;ENST00000319801;ENST00000440577;ENST00000403432;ENST00000536417;ENST00000442400	T;T;T;T;T;T	0.23552	1.9;2.17;2.17;2.1;1.9;1.97	5.84	5.84	0.93424	.	0.039993	0.85682	D	0.000000	T	0.32585	0.0834	M	0.65975	2.015	0.80722	D	1	B;B;P	0.35139	0.397;0.231;0.486	B;B;B	0.35607	0.206;0.037;0.149	T	0.10590	-1.0623	10	0.59425	D	0.04	-11.1657	16.2055	0.82126	0.0:0.0:0.0:1.0	.	117;173;173	B4E2B6;B7ZL34;Q8TB72-3	.;.;.	D	173;173;173;64;173;117;173	ENSP00000338173:N173D;ENSP00000354370:N173D;ENSP00000326746:N173D;ENSP00000409905:N64D;ENSP00000385992:N173D;ENSP00000440093:N117D	ENSP00000326746:N173D	N	-	1	0	PUM2	20374737	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.929000	0.63455	2.220000	0.72140	0.533000	0.62120	AAT	.		0.323	PUM2-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015317	Missense_Mutation
GDF7	151449	hgsc.bcm.edu	37	2	20870531	20870531	+	Silent	SNP	G	G	A	rs192407174	byFrequency	TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr2:20870531G>A	ENST00000272224.3	+	2	1275	c.699G>A	c.(697-699)ttG>ttA	p.L233L		NM_182828.2	NP_878248.2	Q7Z4P5	GDF7_HUMAN	growth differentiation factor 7	233					activin receptor signaling pathway (GO:0032924)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|branching morphogenesis of an epithelial tube (GO:0048754)|cell fate commitment (GO:0045165)|epithelial cell differentiation (GO:0030855)|forebrain morphogenesis (GO:0048853)|gland morphogenesis (GO:0022612)|growth (GO:0040007)|midbrain development (GO:0030901)|morphogenesis of an epithelial fold (GO:0060571)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of tendon cell differentiation (GO:2001051)|positive regulation of transcription, DNA-templated (GO:0045893)|reproductive structure development (GO:0048608)|roof plate formation (GO:0021509)|spinal cord association neuron differentiation (GO:0021527)	extracellular space (GO:0005615)				breast(1)|cervix(1)|endometrium(2)|lung(1)|prostate(1)|skin(1)	7	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCTGCCTCTTGCTGCGCGCAG	0.761													G|||	13	0.00259585	0.0015	0.0014	5008	,	,		9539	0.0		0.006	False		,,,				2504	0.0041				p.L233L		.											.	GDF7-226	0			c.G699A						.						2.0	2.0	2.0					2																	20870531		1206	2627	3833	SO:0001819	synonymous_variant	151449	exon2			CCTCTTGCTGCGC	AF522369	CCDS1701.1	2p24.1	2008-05-22			ENSG00000143869	ENSG00000143869			4222	protein-coding gene	gene with protein product		604651				10022976, 9808626	Standard	NM_182828		Approved	BMP12	uc002rdz.1	Q7Z4P5	OTTHUMG00000090781	ENST00000272224.3:c.699G>A	2.37:g.20870531G>A		Somatic	6	2		WXS	Illumina HiSeq	Phase_I	14	13	NM_182828	0	0	0	0	0		Silent	SNP	ENST00000272224.3	37	CCDS1701.1																																																																																			G|0.989;A|0.011		0.761	GDF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207563.2	NM_182828	
Unknown	0	hgsc.bcm.edu	37	2	98128421	98128421	+	IGR	SNP	T	T	C	rs200637231		TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr2:98128421T>C								AC159540.1 (37372 upstream) : ANKRD36B (35606 downstream)																							GTTTTGGTTTTTTATTGTGTC	0.368																																					p.K967R		.											.	.	0			c.A2900G						.						1.0	1.0	1.0					2																	98128421		294	676	970	SO:0001628	intergenic_variant	57730	exon39			TGGTTTTTTATTG																													2.37:g.98128421T>C		Somatic	143	2		WXS	Illumina HiSeq	Phase_I	26	4	NM_025190	0	0	5	5	0		Missense_Mutation	SNP		37																																																																																				T|0.250;C|0.750	0	0.368								
SCN3A	6328	hgsc.bcm.edu	37	2	165947167	165947167	+	Silent	SNP	G	G	C			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr2:165947167G>C	ENST00000360093.3	-	28	5987	c.5496C>G	c.(5494-5496)gtC>gtG	p.V1832V	SCN3A_ENST00000465043.1_5'Flank|AC013463.2_ENST00000431341.1_RNA|SCN3A_ENST00000283254.7_Silent_p.V1832V|SCN3A_ENST00000409101.3_Silent_p.V1783V|SCN3A_ENST00000540861.1_Silent_p.V315V	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	1832					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CAATAAGCTGGACTTTGTTGG	0.463																																					p.V1832V		.											.	SCN3A-141	0			c.C5496G						.						102.0	105.0	104.0					2																	165947167		2203	4300	6503	SO:0001819	synonymous_variant	6328	exon28			AAGCTGGACTTTG	AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.5496C>G	2.37:g.165947167G>C		Somatic	238	0		WXS	Illumina HiSeq	Phase_I	39	2	NM_006922	0	0	0	0	0	Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Silent	SNP	ENST00000360093.3	37																																																																																				.		0.463	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_006922	
LRP2	4036	broad.mit.edu;ucsc.edu	37	2	170029726	170029726	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr2:170029726C>T	ENST00000263816.3	-	57	11308	c.11023G>A	c.(11023-11025)Gcc>Acc	p.A3675T		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	3675					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	CAGAGATGGGCAGAGCTCACT	0.468																																					p.A3675T													.	LRP2-175	0			c.G11023A						.						83.0	81.0	82.0					2																	170029726		2203	4300	6503	SO:0001583	missense	4036	exon57			GATGGGCAGAGCT		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.11023G>A	2.37:g.170029726C>T	ENSP00000263816:p.Ala3675Thr	Somatic	77	0		WXS	Illumina HiSeq	Phase_I	69	6	NM_004525	0	0	0	1	1	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	C	11.86	1.765698	0.31228	.	.	ENSG00000081479	ENST00000263816;ENST00000536293	D	0.89810	-2.57	5.61	3.79	0.43588	.	0.161611	0.53938	D	0.000050	T	0.80444	0.4624	L	0.28115	0.83	0.80722	D	1	P	0.40578	0.722	B	0.36719	0.231	T	0.74945	-0.3491	10	0.14656	T	0.56	.	14.6412	0.68726	0.3478:0.6522:0.0:0.0	.	3675	P98164	LRP2_HUMAN	T	3675;370	ENSP00000263816:A3675T	ENSP00000263816:A3675T	A	-	1	0	LRP2	169737972	1.000000	0.71417	0.092000	0.20876	0.755000	0.42902	2.239000	0.43079	0.703000	0.31848	0.655000	0.94253	GCC	.		0.468	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
SPHKAP	80309	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	228882137	228882137	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr2:228882137C>T	ENST00000392056.3	-	7	3479	c.3433G>A	c.(3433-3435)Gag>Aag	p.E1145K	SPHKAP_ENST00000344657.5_Missense_Mutation_p.E1145K	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	1145						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		AGCAGTAACTCAAATCCTCTC	0.527																																					p.E1145K		.											.	SPHKAP-167	0			c.G3433A						.						65.0	54.0	58.0					2																	228882137		2203	4300	6503	SO:0001583	missense	80309	exon7			GTAACTCAAATCC		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.3433G>A	2.37:g.228882137C>T	ENSP00000375909:p.Glu1145Lys	Somatic	121	0		WXS	Illumina HiSeq	Phase_I	157	25	NM_030623	0	0	0	0	0	Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	ENST00000392056.3	37	CCDS46537.1	.	.	.	.	.	.	.	.	.	.	C	30	5.054264	0.93793	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.62498	0.02;0.02	5.57	5.57	0.84162	.	0.089852	0.85682	D	0.000000	T	0.65842	0.2730	N	0.19112	0.55	0.58432	D	0.999995	P;D;D	0.65815	0.952;0.995;0.99	P;P;P	0.59487	0.601;0.82;0.858	T	0.69793	-0.5049	10	0.72032	D	0.01	.	18.8971	0.92427	0.0:1.0:0.0:0.0	.	176;1145;1145	B3KR30;Q2M3C7;Q2M3C7-2	.;SPKAP_HUMAN;.	K	1145	ENSP00000375909:E1145K;ENSP00000339886:E1145K	ENSP00000339886:E1145K	E	-	1	0	SPHKAP	228590381	1.000000	0.71417	0.983000	0.44433	0.989000	0.77384	7.152000	0.77419	2.785000	0.95823	0.655000	0.94253	GAG	.		0.527	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1	NM_030623	
KIZ-AS1	101929591	broad.mit.edu;ucsc.edu	37	20	21143713	21143713	+	RNA	SNP	C	C	T			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr20:21143713C>T	ENST00000591761.1	-	0	5051				PLK1S1_ENST00000457464.1_RNA|RP5-872K7.7_ENST00000425746.2_RNA																							GAAAGAGTTGCCCTATCCACT	0.433																																					.													.	.	0			.						.						90.0	91.0	91.0					20																	21143713		1897	4110	6007			55857	.			GAGTTGCCCTATC																													20.37:g.21143713C>T		Somatic	124	0		WXS	Illumina HiSeq	Phase_I	33	5	.	0	0	8	8	0		Missense_Mutation	SNP	ENST00000591761.1	37																																																																																				.		0.433	RP4-777D9.2-002	KNOWN	basic	antisense	antisense	OTTHUMT00000078258.2		
XRN2	22803	hgsc.bcm.edu	37	20	21367553	21367553	+	Missense_Mutation	SNP	C	C	G			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr20:21367553C>G	ENST00000377191.3	+	29	2791	c.2696C>G	c.(2695-2697)aCc>aGc	p.T899S	XRN2_ENST00000539513.1_Missense_Mutation_p.T845S|XRN2_ENST00000430571.2_Missense_Mutation_p.T823S	NM_012255.3	NP_036387.2	Q9H0D6	XRN2_HUMAN	5'-3' exoribonuclease 2	899					cell growth (GO:0016049)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA-templated transcription, termination (GO:0006353)|mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA catabolic process (GO:0006401)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|RNA processing (GO:0006396)|spermatogenesis (GO:0007283)	aggresome (GO:0016235)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|5'-3' exoribonuclease activity (GO:0004534)|nuclease activity (GO:0004518)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(6)|large_intestine(10)|lung(12)|ovary(1)|skin(5)	39						ATGCTGCAAACCCAGAATGCA	0.527																																					p.T899S		.											.	XRN2-515	0			c.C2696G						.						113.0	107.0	109.0					20																	21367553		2203	4300	6503	SO:0001583	missense	22803	exon29			TGCAAACCCAGAA	AF064257	CCDS13144.1	20p11.2-p11.1	2011-09-12			ENSG00000088930	ENSG00000088930	3.1.13.-		12836	protein-coding gene	gene with protein product		608851				10409438	Standard	NM_012255		Approved		uc002wsf.1	Q9H0D6	OTTHUMG00000032025	ENST00000377191.3:c.2696C>G	20.37:g.21367553C>G	ENSP00000366396:p.Thr899Ser	Somatic	180	1		WXS	Illumina HiSeq	Phase_I	35	2	NM_012255	0	0	161	161	0	Q3L8N4|Q6KGZ9|Q9BQL1|Q9NTW0|Q9NXS6|Q9UL53	Missense_Mutation	SNP	ENST00000377191.3	37	CCDS13144.1	.	.	.	.	.	.	.	.	.	.	C	5.701	0.313921	0.10789	.	.	ENSG00000088930	ENST00000377191;ENST00000430571;ENST00000539513	T;T;T	0.28666	1.6;1.6;1.6	6.17	1.63	0.23807	.	0.640269	0.17029	N	0.189797	T	0.10680	0.0261	N	0.03608	-0.345	0.19775	N	0.999951	B	0.02656	0.0	B	0.01281	0.0	T	0.36286	-0.9754	10	0.02654	T	1	0.091	9.5329	0.39205	0.5479:0.3867:0.0:0.0655	.	899	Q9H0D6	XRN2_HUMAN	S	899;823;845	ENSP00000366396:T899S;ENSP00000413548:T823S;ENSP00000441113:T845S	ENSP00000366396:T899S	T	+	2	0	XRN2	21315553	0.997000	0.39634	0.664000	0.29753	0.803000	0.45373	0.669000	0.25142	0.039000	0.15632	0.655000	0.94253	ACC	.		0.527	XRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078273.2	NM_012255	
MYH7B	57644	broad.mit.edu;bcgsc.ca	37	20	33577862	33577862	+	Silent	SNP	C	C	T			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr20:33577862C>T	ENST00000262873.7	+	19	2031	c.1939C>T	c.(1939-1941)Ctg>Ttg	p.L647L	MIR499A_ENST00000384903.1_RNA	NM_020884.3	NP_065935.2	A7E2Y1	MYH7B_HUMAN	myosin, heavy chain 7B, cardiac muscle, beta	605	Myosin motor.					membrane (GO:0016020)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(5)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(19)|ovary(5)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	54			BRCA - Breast invasive adenocarcinoma(18;0.00691)			CAAGGATCCCCTGAATGAGAC	0.572																																					p.L647L													.	MYH7B-136	0			c.C1939T						.						75.0	83.0	81.0					20																	33577862		2128	4269	6397	SO:0001819	synonymous_variant	57644	exon21			GATCCCCTGAATG	AB040945	CCDS42869.1	20q11	2011-09-27	2006-09-29		ENSG00000078814	ENSG00000078814		"""Myosins / Myosin superfamily : Class II"""	15906	protein-coding gene	gene with protein product		609928	"""myosin, heavy polypeptide 7B, cardiac muscle, beta"""			11919279, 15014174	Standard	XM_006723839		Approved	KIAA1512, dJ756N5.1, MYH14, MHC14	uc002xbi.2	A7E2Y1	OTTHUMG00000032320	ENST00000262873.7:c.1939C>T	20.37:g.33577862C>T		Somatic	193	0		WXS	Illumina HiSeq	Phase_I	405	11	NM_020884	0	0	1	1	0	Q5JVW7|Q6NT44|Q6NT57|Q6WG75|Q96I57|Q9NWE2|Q9P216	Silent	SNP	ENST00000262873.7	37	CCDS42869.1																																																																																			.		0.572	MYH7B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000078833.2	NM_020884	
CSE1L	1434	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	47675025	47675025	+	Missense_Mutation	SNP	C	C	A			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr20:47675025C>A	ENST00000262982.2	+	2	148	c.25C>A	c.(25-27)Caa>Aaa	p.Q9K	CSE1L_ENST00000542325.1_5'UTR|CSE1L_ENST00000396192.3_Missense_Mutation_p.Q9K	NM_001256135.1|NM_001316.3	NP_001243064.1|NP_001307.2	P55060	XPO2_HUMAN	CSE1 chromosome segregation 1-like (yeast)	9					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	importin-alpha export receptor activity (GO:0008262)			breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(11)|ovary(1)|prostate(3)|skin(2)|urinary_tract(2)	35			BRCA - Breast invasive adenocarcinoma(12;0.000491)|Colorectal(8;0.198)			TGCAAATCTGCAAACACTAAC	0.333																																					p.Q9K		.											.	CSE1L-290	0			c.C25A						.						100.0	109.0	106.0					20																	47675025		2203	4300	6503	SO:0001583	missense	1434	exon2			AATCTGCAAACAC	U33286	CCDS13412.1, CCDS58773.1	20q13	2013-05-01	2001-11-28		ENSG00000124207	ENSG00000124207		"""Exportins"""	2431	protein-coding gene	gene with protein product	"""cellular apoptosis susceptibility"""	601342	"""chromosome segregation 1 (yeast homolog)-like"""			8963895, 7479798	Standard	NM_001316		Approved	CAS, XPO2, CSE1	uc002xty.4	P55060	OTTHUMG00000033046	ENST00000262982.2:c.25C>A	20.37:g.47675025C>A	ENSP00000262982:p.Gln9Lys	Somatic	173	0		WXS	Illumina HiSeq	Phase_I	234	24	NM_001256135	0	0	1	1	0	A3RLL6|B2R5T4|E1P5Y0|F8W904|O75432|Q32M40|Q9H5B7|Q9NTS0|Q9UP98|Q9UP99|Q9UPA0	Missense_Mutation	SNP	ENST00000262982.2	37	CCDS13412.1	.	.	.	.	.	.	.	.	.	.	C	14.53	2.561981	0.45590	.	.	ENSG00000124207	ENST00000262982;ENST00000396192	T;T	0.68624	-0.34;-0.34	5.3	4.36	0.52297	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.58004	0.2092	L	0.59436	1.845	0.80722	D	1	B;P	0.36990	0.24;0.577	B;B	0.33042	0.157;0.13	T	0.55431	-0.8142	10	0.10902	T	0.67	-1.2095	14.1142	0.65142	0.0:0.927:0.0:0.073	.	9;9	F8W904;P55060	.;XPO2_HUMAN	K	9	ENSP00000262982:Q9K;ENSP00000379495:Q9K	ENSP00000262982:Q9K	Q	+	1	0	CSE1L	47108432	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	7.272000	0.78516	1.222000	0.43521	0.591000	0.81541	CAA	.		0.333	CSE1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080345.2	NM_001316	
DSCAM	1826	broad.mit.edu;bcgsc.ca	37	21	41447083	41447083	+	Missense_Mutation	SNP	T	T	C			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr21:41447083T>C	ENST00000400454.1	-	27	5246	c.4769A>G	c.(4768-4770)aAc>aGc	p.N1590S		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	1590					cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				GAGCCCCTCGTTGGTCGTCAG	0.547																																					p.N1590S	Melanoma(134;970 1778 1785 21664 32388)												.	DSCAM-101	0			c.A4769G						.						124.0	128.0	127.0					21																	41447083		2066	4204	6270	SO:0001583	missense	1826	exon27			CCCTCGTTGGTCG	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.4769A>G	21.37:g.41447083T>C	ENSP00000383303:p.Asn1590Ser	Somatic	122	0		WXS	Illumina HiSeq	Phase_I	186	6	NM_001271534	0	0	0	0	0	O60468	Missense_Mutation	SNP	ENST00000400454.1	37	CCDS42929.1	.	.	.	.	.	.	.	.	.	.	T	13.14	2.148505	0.37923	.	.	ENSG00000171587	ENST00000400454;ENST00000404019	T;T	0.57752	0.38;0.49	5.69	5.69	0.88448	.	0.113799	0.64402	D	0.000010	T	0.36744	0.0978	N	0.14661	0.345	0.34194	D	0.672378	B	0.10296	0.003	B	0.08055	0.003	T	0.42361	-0.9456	10	0.22109	T	0.4	.	15.9467	0.79799	0.0:0.0:0.0:1.0	.	1590	O60469	DSCAM_HUMAN	S	1590;1342	ENSP00000383303:N1590S;ENSP00000385342:N1342S	ENSP00000383303:N1590S	N	-	2	0	DSCAM	40368953	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.657000	0.67996	2.169000	0.68431	0.533000	0.62120	AAC	.		0.547	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389	
OXSM	54995	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	25832524	25832524	+	Missense_Mutation	SNP	C	C	A			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr3:25832524C>A	ENST00000280701.3	+	2	112	c.13C>A	c.(13-15)Ctg>Atg	p.L5M	NGLY1_ENST00000417874.2_5'Flank|OXSM_ENST00000420173.2_Missense_Mutation_p.L5M|OXSM_ENST00000449808.1_3'UTR	NM_017897.2	NP_060367.1	Q9NWU1	OXSM_HUMAN	3-oxoacyl-ACP synthase, mitochondrial	5					acyl-CoA metabolic process (GO:0006637)|medium-chain fatty acid biosynthetic process (GO:0051792)|short-chain fatty acid biosynthetic process (GO:0051790)	mitochondrion (GO:0005739)	3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	25						GTCCAACTGCCTGCAAAATTT	0.368																																					p.L5M		.											.	OXSM-132	0			c.C13A						.						83.0	88.0	86.0					3																	25832524		2203	4300	6503	SO:0001583	missense	54995	exon2			AACTGCCTGCAAA	BC008202	CCDS2643.1, CCDS46780.1	3p24.2	2010-03-19			ENSG00000151093	ENSG00000151093	2.3.1.41		26063	protein-coding gene	gene with protein product	"""beta-ketoacyl synthase"""	610324				12477932	Standard	NM_017897		Approved	KS, FLJ20604, FASN2D	uc003cdn.3	Q9NWU1	OTTHUMG00000130477	ENST00000280701.3:c.13C>A	3.37:g.25832524C>A	ENSP00000280701:p.Leu5Met	Somatic	278	0		WXS	Illumina HiSeq	Phase_I	196	36	NM_017897	0	0	3	11	8		Missense_Mutation	SNP	ENST00000280701.3	37	CCDS2643.1	.	.	.	.	.	.	.	.	.	.	C	7.760	0.705106	0.15172	.	.	ENSG00000151093	ENST00000452098;ENST00000280701;ENST00000420173;ENST00000428266	.	.	.	4.84	3.7	0.42460	.	1.003210	0.08029	N	0.993289	T	0.24774	0.0601	N	0.08118	0	0.24531	N	0.994111	P;P	0.47677	0.899;0.838	P;B	0.51355	0.667;0.372	T	0.14117	-1.0484	9	0.52906	T	0.07	-10.4228	5.7793	0.18297	0.0:0.0885:0.1686:0.7429	.	5;5	Q9NWU1-2;Q9NWU1	.;OXSM_HUMAN	M	5	.	ENSP00000280701:L5M	L	+	1	2	OXSM	25807528	0.036000	0.19791	0.572000	0.28498	0.418000	0.31294	0.834000	0.27518	0.992000	0.38840	-0.367000	0.07326	CTG	.		0.368	OXSM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252876.2	NM_017897	
ZKSCAN7	55888	broad.mit.edu	37	3	44612491	44612491	+	Missense_Mutation	SNP	C	C	T	rs373307729		TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr3:44612491C>T	ENST00000273320.3	+	6	2318	c.1889C>T	c.(1888-1890)aCg>aTg	p.T630M	ZKSCAN7_ENST00000431636.1_Intron|ZKSCAN7_ENST00000426540.1_Missense_Mutation_p.T630M|RP11-944L7.4_ENST00000457331.1_RNA|RP11-944L7.5_ENST00000419137.1_Intron|ZKSCAN7_ENST00000341840.3_Intron	NM_018651.2	NP_061121.2	Q9P0L1	ZKSC7_HUMAN	zinc finger with KRAB and SCAN domains 7	630					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T630M(1)									AGACTTCACACGGGTGAAAAG	0.408																																					p.T630M													.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1889T						.	C	MET/THR,	1,4405		0,1,2202	66.0	70.0	69.0		1889,	4.2	0.9	3		69	0,8600		0,0,4300	no	missense,intron	ZNF167	NM_018651.2,NM_025169.1	81,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,	630/755,	44612491	1,13005	2203	4300	6503	SO:0001583	missense	55888	exon6			TTCACACGGGTGA	L32164, AY280798	CCDS2714.1, CCDS2715.1, CCDS74924.1	3p21.32	2013-01-09	2013-01-09	2013-01-09	ENSG00000196345	ENSG00000196345		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12955	protein-coding gene	gene with protein product			"""zinc finger protein 64"", ""zinc finger protein 448"", ""zinc finger protein 167"""	ZNF64, ZNF448, ZNF167		7814019, 1505991	Standard	XM_005265323		Approved	FLJ12738, ZSCAN39	uc003cnj.3	Q9P0L1	OTTHUMG00000133094	ENST00000273320.3:c.1889C>T	3.37:g.44612491C>T	ENSP00000273320:p.Thr630Met	Somatic	157	0		WXS	Illumina HiSeq	Phase_I	46	3	NM_018651	0	0	1	1	0	A0PJV3|A8K5H0|Q6WL09|Q96FQ2	Missense_Mutation	SNP	ENST00000273320.3	37	CCDS2715.1	.	.	.	.	.	.	.	.	.	.	.	19.67	3.870147	0.72065	2.27E-4	0.0	ENSG00000196345	ENST00000426540;ENST00000273320;ENST00000315777	T;T	0.26373	1.74;1.74	4.2	4.2	0.49525	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.241708	0.21541	N	0.072899	T	0.52933	0.1765	M	0.80183	2.485	0.80722	D	1	D	0.89917	1.0	D	0.72338	0.977	T	0.60831	-0.7185	10	0.87932	D	0	-6.8142	15.5027	0.75713	0.0:1.0:0.0:0.0	.	630	Q9P0L1	ZN167_HUMAN	M	630;630;68	ENSP00000395524:T630M;ENSP00000273320:T630M	ENSP00000273320:T630M	T	+	2	0	ZNF167	44587495	0.125000	0.22332	0.913000	0.36048	0.946000	0.59487	1.167000	0.31847	2.179000	0.69175	0.655000	0.94253	ACG	.		0.408	ZKSCAN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256752.4	NM_018651	
SPATA12	353324	hgsc.bcm.edu	37	3	57108279	57108279	+	Missense_Mutation	SNP	T	T	C			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr3:57108279T>C	ENST00000334325.1	+	2	1232	c.557T>C	c.(556-558)aTa>aCa	p.I186T	ARHGEF3_ENST00000338458.4_Intron	NM_181727.1	NP_859078.1	Q7Z6I5	SPT12_HUMAN	spermatogenesis associated 12	186										large_intestine(2)|lung(1)	3				KIRC - Kidney renal clear cell carcinoma(284;0.0111)|Kidney(284;0.0129)		AACACACACATACACACACAT	0.507																																					p.I186T		.											.	SPATA12-90	0			c.T557C						.						99.0	100.0	100.0					3																	57108279		2183	4253	6436	SO:0001583	missense	353324	exon2			CACACATACACAC	AY221117	CCDS2879.1	3p21.2	2012-09-19			ENSG00000186451	ENSG00000186451			23221	protein-coding gene	gene with protein product		609869				22981541, 17251597	Standard	NM_181727		Approved		uc003dij.1	Q7Z6I5	OTTHUMG00000158862	ENST00000334325.1:c.557T>C	3.37:g.57108279T>C	ENSP00000335392:p.Ile186Thr	Somatic	253	1		WXS	Illumina HiSeq	Phase_I	117	8	NM_181727	0	0	0	0	0	A0AVA8|B2RMW1	Missense_Mutation	SNP	ENST00000334325.1	37	CCDS2879.1	.	.	.	.	.	.	.	.	.	.	T	0.666	-0.803844	0.02819	.	.	ENSG00000186451	ENST00000334325	.	.	.	2.03	-2.63	0.06133	.	.	.	.	.	T	0.15349	0.0370	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.17319	-1.0373	8	0.87932	D	0	.	2.9297	0.05795	0.2105:0.2753:0.0:0.5142	.	186	Q7Z6I5	SPT12_HUMAN	T	186	.	ENSP00000335392:I186T	I	+	2	0	SPATA12	57083319	0.001000	0.12720	0.000000	0.03702	0.085000	0.17905	-0.127000	0.10547	-0.825000	0.04290	-1.417000	0.01113	ATA	.		0.507	SPATA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352457.2	NM_181727	
PROS1	5627	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	93624723	93624723	+	Missense_Mutation	SNP	C	C	G			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr3:93624723C>G	ENST00000394236.3	-	6	822	c.506G>C	c.(505-507)gGa>gCa	p.G169A	PROS1_ENST00000407433.1_Missense_Mutation_p.G38A	NM_000313.3	NP_000304.2	P07225	PROS_HUMAN	protein S (alpha)	169	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|negative regulation of endopeptidase activity (GO:0010951)|peptidyl-glutamic acid carboxylation (GO:0017187)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|Golgi membrane (GO:0000139)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|endopeptidase inhibitor activity (GO:0004866)			endometrium(3)|kidney(5)|large_intestine(8)|lung(26)|ovary(1)|skin(2)|urinary_tract(1)	46					Drotrecogin alfa(DB00055)|Menadione(DB00170)|Sodium Tetradecyl Sulfate(DB00464)	ACTGCAACCTCCATTTATATT	0.299																																					p.G169A		.											.	PROS1-153	0			c.G506C						.						77.0	79.0	78.0					3																	93624723		2199	4296	6495	SO:0001583	missense	5627	exon6			CAACCTCCATTTA		CCDS2923.1	3q11.1	2013-06-03			ENSG00000184500	ENSG00000184500			9456	protein-coding gene	gene with protein product		176880		PROS		214811, 1833851	Standard	NM_000313		Approved		uc003drb.4	P07225	OTTHUMG00000150354	ENST00000394236.3:c.506G>C	3.37:g.93624723C>G	ENSP00000377783:p.Gly169Ala	Somatic	268	0		WXS	Illumina HiSeq	Phase_I	287	47	NM_000313	0	0	6	14	8	A8KAC9|D3DN28|Q15518|Q7Z715|Q9UCZ8	Missense_Mutation	SNP	ENST00000394236.3	37	CCDS2923.1	.	.	.	.	.	.	.	.	.	.	C	17.74	3.464378	0.63513	.	.	ENSG00000184500	ENST00000394236;ENST00000407433;ENST00000348974;ENST00000472684	D;D;D;D	0.98329	-4.87;-4.87;-4.87;-1.67	4.44	4.44	0.53790	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.125904	0.53938	D	0.000053	D	0.96334	0.8804	M	0.67397	2.05	0.40346	D	0.979083	P	0.46064	0.872	B	0.35655	0.207	D	0.96712	0.9526	10	0.62326	D	0.03	.	13.0646	0.59025	0.0:0.8385:0.1615:0.0	.	169	P07225	PROS_HUMAN	A	169;38;201;38	ENSP00000377783:G169A;ENSP00000385794:G38A;ENSP00000330021:G201A;ENSP00000419616:G38A	ENSP00000330021:G201A	G	-	2	0	PROS1	95107413	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	2.172000	0.42463	2.314000	0.78098	0.484000	0.47621	GGA	.		0.299	PROS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317762.1	NM_000313	
FBXO40	51725	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	121341915	121341915	+	Missense_Mutation	SNP	C	C	T			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr3:121341915C>T	ENST00000338040.4	+	3	2053	c.1639C>T	c.(1639-1641)Ccg>Tcg	p.P547S		NM_016298.3	NP_057382.2	Q9UH90	FBX40_HUMAN	F-box protein 40	547					muscle cell differentiation (GO:0042692)	cytoplasm (GO:0005737)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(11)|lung(19)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	46				GBM - Glioblastoma multiforme(114;0.189)		TGCCATTAAGCCGGAGGTTGC	0.493																																					p.P547S		.											.	FBXO40-273	0			c.C1639T						.						56.0	57.0	57.0					3																	121341915		2203	4300	6503	SO:0001583	missense	51725	exon3			ATTAAGCCGGAGG	AF204674	CCDS33835.1	3q21.1	2004-08-24			ENSG00000163833	ENSG00000163833		"""F-boxes /  ""other"""""	29816	protein-coding gene	gene with protein product		609107				10574462	Standard	NM_016298		Approved	KIAA1195, Fbx40	uc003eeg.2	Q9UH90	OTTHUMG00000159410	ENST00000338040.4:c.1639C>T	3.37:g.121341915C>T	ENSP00000337510:p.Pro547Ser	Somatic	132	1		WXS	Illumina HiSeq	Phase_I	133	24	NM_016298	0	0	0	0	0	B2RAX7|Q32M70|Q9ULM5	Missense_Mutation	SNP	ENST00000338040.4	37	CCDS33835.1	.	.	.	.	.	.	.	.	.	.	C	17.79	3.475767	0.63737	.	.	ENSG00000163833	ENST00000338040	T	0.33865	1.39	5.96	5.1	0.69264	.	0.000000	0.85682	D	0.000000	T	0.60573	0.2279	M	0.77313	2.365	0.58432	D	0.999998	D	0.89917	1.0	D	0.91635	0.999	T	0.65685	-0.6108	10	0.87932	D	0	-6.694	12.9482	0.58384	0.0:0.9222:0.0:0.0778	.	547	Q9UH90	FBX40_HUMAN	S	547	ENSP00000337510:P547S	ENSP00000337510:P547S	P	+	1	0	FBXO40	122824605	1.000000	0.71417	0.997000	0.53966	0.957000	0.61999	7.818000	0.86416	1.541000	0.49316	-0.142000	0.14014	CCG	.		0.493	FBXO40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355158.1	NM_016298	
INTU	27152	hgsc.bcm.edu	37	4	128608920	128608920	+	Silent	SNP	T	T	C			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr4:128608920T>C	ENST00000335251.6	+	8	1450	c.1347T>C	c.(1345-1347)caT>caC	p.H449H		NM_015693.3	NP_056508.2	Q9ULD6	INTU_HUMAN	inturned planar cell polarity protein	449					cilium assembly (GO:0042384)|hair follicle morphogenesis (GO:0031069)|keratinocyte differentiation (GO:0030216)|limb development (GO:0060173)|negative regulation of cell division (GO:0051782)|negative regulation of keratinocyte proliferation (GO:0010839)|nervous system development (GO:0007399)|positive regulation of smoothened signaling pathway (GO:0045880)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord dorsal/ventral patterning (GO:0021513)	cytoplasm (GO:0005737)				breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	43						CGAAACTGCATTCCAGCGCCA	0.473																																					p.H449H		.											.	INTU-91	0			c.T1347C						.						131.0	124.0	126.0					4																	128608920		2203	4300	6503	SO:0001819	synonymous_variant	27152	exon8			ACTGCATTCCAGC	BC051698	CCDS34061.1	4q28.2	2013-03-05	2013-03-05	2006-10-24	ENSG00000164066	ENSG00000164066			29239	protein-coding gene	gene with protein product		610621	"""PDZ domain containing 6"", ""inturned planar cell polarity effector homolog (Drosophila)"""	PDZK6, PDZD6		10574462, 21761479	Standard	NM_015693		Approved	KIAA1284	uc003ifk.2	Q9ULD6	OTTHUMG00000161202	ENST00000335251.6:c.1347T>C	4.37:g.128608920T>C		Somatic	188	2		WXS	Illumina HiSeq	Phase_I	35	2	NM_015693	0	0	2	2	0	A1L4N5|D6RAE6|D6RBT4|Q4W5I8|Q86V55	Silent	SNP	ENST00000335251.6	37	CCDS34061.1																																																																																			.		0.473	INTU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364147.2	XM_371707	
ITGA1	3672	hgsc.bcm.edu	37	5	52223476	52223476	+	Missense_Mutation	SNP	C	C	G			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr5:52223476C>G	ENST00000282588.6	+	20	3134	c.2676C>G	c.(2674-2676)ttC>ttG	p.F892L		NM_181501.1	NP_852478.1	P56199	ITA1_HUMAN	integrin, alpha 1	892					activation of MAPK activity (GO:0000187)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular extravasation (GO:0045123)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neutrophil chemotaxis (GO:0030593)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|vasodilation (GO:0042311)	acrosomal vesicle (GO:0001669)|basal part of cell (GO:0045178)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha1-beta1 complex (GO:0034665)|integrin complex (GO:0008305)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)|protein phosphatase binding (GO:0019903)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(19)|ovary(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Lung NSC(810;5.05e-05)|Breast(144;0.0851)				GATATCCCTTCCTGAGAAGAG	0.343																																					p.F892L		.											.	ITGA1-228	0			c.C2676G						.						127.0	123.0	124.0					5																	52223476		2203	4300	6503	SO:0001583	missense	3672	exon20			TCCCTTCCTGAGA	X68742	CCDS3955.1	5q11.1	2010-03-23			ENSG00000213949	ENSG00000213949		"""CD molecules"", ""Integrins"""	6134	protein-coding gene	gene with protein product		192968				8428973, 11937138	Standard	NM_181501		Approved	VLA1, CD49a	uc003jou.3	P56199	OTTHUMG00000131163	ENST00000282588.6:c.2676C>G	5.37:g.52223476C>G	ENSP00000282588:p.Phe892Leu	Somatic	233	0		WXS	Illumina HiSeq	Phase_I	40	2	NM_181501	0	0	7	7	0	B2RNU0	Missense_Mutation	SNP	ENST00000282588.6	37	CCDS3955.1	.	.	.	.	.	.	.	.	.	.	C	15.68	2.905631	0.52333	.	.	ENSG00000213949	ENST00000282588	T	0.44083	0.93	5.52	1.77	0.24775	Integrin alpha-2 (1);	0.048823	0.85682	D	0.000000	T	0.43055	0.1230	L	0.42245	1.32	0.53005	D	0.99996	P	0.46859	0.885	P	0.52031	0.688	T	0.23368	-1.0190	10	0.62326	D	0.03	.	8.4809	0.33043	0.0:0.6851:0.0:0.3149	.	892	P56199	ITA1_HUMAN	L	892	ENSP00000282588:F892L	ENSP00000282588:F892L	F	+	3	2	ITGA1	52259233	1.000000	0.71417	0.989000	0.46669	0.712000	0.41017	0.952000	0.29149	0.105000	0.17753	-0.157000	0.13467	TTC	.		0.343	ITGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253855.3	NM_181501	
GPBP1	65056	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	56542173	56542173	+	Silent	SNP	T	T	A	rs371740495		TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr5:56542173T>A	ENST00000506184.2	+	7	1630	c.525T>A	c.(523-525)atT>atA	p.I175I	GPBP1_ENST00000264779.6_Silent_p.I182I|GPBP1_ENST00000454432.2_Silent_p.I195I|GPBP1_ENST00000538707.1_Silent_p.I182I|GPBP1_ENST00000424459.3_Silent_p.I195I|GPBP1_ENST00000511209.1_Silent_p.I182I|GPBP1_ENST00000514387.2_Silent_p.I4I			Q86WP2	GPBP1_HUMAN	GC-rich promoter binding protein 1	175					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	19		Lung NSC(810;0.000861)|Prostate(74;0.0305)|Breast(144;0.222)		OV - Ovarian serous cystadenocarcinoma(10;7.64e-39)		TGCTGGTCATTAAGAAAGGTA	0.383																																					p.I182I		.											.	GPBP1-135	0			c.T546A						.						84.0	86.0	85.0					5																	56542173		2203	4300	6503	SO:0001819	synonymous_variant	65056	exon6			GGTCATTAAGAAA		CCDS34162.1, CCDS47211.1, CCDS47212.1, CCDS47212.2, CCDS56368.1	5q11.2	2008-02-05				ENSG00000062194			29520	protein-coding gene	gene with protein product		608412				12842993	Standard	NM_022913		Approved	DKFZp761C169, vasculin	uc003jrk.4	Q86WP2		ENST00000506184.2:c.525T>A	5.37:g.56542173T>A		Somatic	124	0		WXS	Illumina HiSeq	Phase_I	68	10	NM_001127236	0	0	28	47	19	A6NKW3|Q6NSH6|Q9H0D4|Q9H785|Q9NSN4	Silent	SNP	ENST00000506184.2	37	CCDS34162.1																																																																																			.		0.383	GPBP1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000374496.1	NM_022913	
MAST4	375449	hgsc.bcm.edu	37	5	66432458	66432458	+	Silent	SNP	C	C	G			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr5:66432458C>G	ENST00000403625.2	+	19	2755	c.2460C>G	c.(2458-2460)ctC>ctG	p.L820L	MAST4_ENST00000405643.1_Silent_p.L641L|MAST4_ENST00000403666.1_Silent_p.L631L|MAST4_ENST00000404260.3_Silent_p.L823L|MAST4_ENST00000261569.7_Silent_p.L626L	NM_001164664.1	NP_001158136.1	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase family member 4	823	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|kidney(2)|lung(6)|ovary(2)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		TTACCTTACTCCTCAGGCAGA	0.443																																					p.L820L		.											.	MAST4-647	0			c.C2460G						.						51.0	51.0	51.0					5																	66432458		1871	4104	5975	SO:0001819	synonymous_variant	375449	exon19			CTTACTCCTCAGG	AY830839	CCDS47224.1, CCDS47225.1, CCDS54861.1, CCDS75254.1	5q12.3	2007-06-20			ENSG00000069020	ENSG00000069020			19037	protein-coding gene	gene with protein product						9205841	Standard	NM_198828		Approved	KIAA0303	uc021xzk.1	O15021	OTTHUMG00000152471	ENST00000403625.2:c.2460C>G	5.37:g.66432458C>G		Somatic	29	0		WXS	Illumina HiSeq	Phase_I	9	2	NM_001164664	0	0	1	1	0	A6NL49|B5ME48|Q05EE6|Q6ZN07|Q8N4X4|Q96LY3	Silent	SNP	ENST00000403625.2	37	CCDS54861.1																																																																																			.		0.443	MAST4-001	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326324.2		
PCDHA4	56144	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	140188710	140188710	+	Silent	SNP	C	C	T			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr5:140188710C>T	ENST00000530339.1	+	1	1938	c.1938C>T	c.(1936-1938)cgC>cgT	p.R646R	PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Silent_p.R646R|PCDHA4_ENST00000356878.4_Silent_p.R646R	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	646	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCGCCACCGCCTACTGGTAC	0.682																																					p.R646R		.											.	PCDHA4-96	0			c.C1938T						.						74.0	76.0	75.0					5																	140188710		2203	4300	6503	SO:0001819	synonymous_variant	56144	exon1			CCACCGCCTACTG	AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		ENST00000530339.1:c.1938C>T	5.37:g.140188710C>T		Somatic	156	0		WXS	Illumina HiSeq	Phase_I	345	50	NM_031500	0	0	0	0	0	O75285|Q2M253	Silent	SNP	ENST00000530339.1	37	CCDS54916.1																																																																																			.		0.682	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372864.2	NM_018907	
PBX2	5089	broad.mit.edu	37	6	32156280	32156280	+	Splice_Site	SNP	G	G	T	rs568374645	byFrequency	TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr6:32156280G>T	ENST00000375050.4	-	3	567	c.297C>A	c.(295-297)ggC>ggA	p.G99G	XXbac-BPG300A18.13_ENST00000559458.1_RNA	NM_002586.4	NP_002577.2	P40425	PBX2_HUMAN	pre-B-cell leukemia homeobox 2	99					embryonic limb morphogenesis (GO:0030326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.G99G(1)		endometrium(1)|kidney(1)|lung(9)|ovary(1)|prostate(2)	14						GAATGCTGAGGCCTAGCATGC	0.612													G|||	24	0.00479233	0.0045	0.0029	5008	,	,		16536	0.002		0.006	False		,,,				2504	0.0082				p.G99G													.	PBX2-91	1	Substitution - coding silent(1)	prostate(1)	c.C297A						.						20.0	22.0	21.0					6																	32156280		2203	4298	6501	SO:0001630	splice_region_variant	5089	exon3			GCTGAGGCCTAGC		CCDS4748.1	6p21.32	2011-06-20	2007-01-30		ENSG00000204304	ENSG00000204304		"""Homeoboxes / TALE class"""	8633	protein-coding gene	gene with protein product		176311	"""pre-B-cell leukemia transcription factor 2"""			7835890	Standard	NM_002586		Approved	G17, HOX12, PBX2MHC	uc003oav.1	P40425	OTTHUMG00000031116	ENST00000375050.4:c.296-1C>A	6.37:g.32156280G>T		Somatic	68	1		WXS	Illumina HiSeq	Phase_I	125	11	NM_002586	0	1	5	6	0	A2BFJ2	Silent	SNP	ENST00000375050.4	37	CCDS4748.1																																																																																			.		0.612	PBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076194.4		Silent
HLA-DQB1	3119	hgsc.bcm.edu	37	6	32632659	32632659	+	Missense_Mutation	SNP	C	C	G			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr6:32632659C>G	ENST00000399084.1	-	3	473	c.295G>C	c.(295-297)Gtc>Ctc	p.V99L	HLA-DQB1_ENST00000399079.3_Missense_Mutation_p.V99L|HLA-DQB1_ENST00000399082.3_Intron|HLA-DQB1_ENST00000374943.4_Missense_Mutation_p.V99L|XXbac-BPG254F23.6_ENST00000443574.1_RNA|HLA-DQB1_ENST00000434651.2_Missense_Mutation_p.V99L			P01920	DQB1_HUMAN	major histocompatibility complex, class II, DQ beta 1	99	Beta-1.		V -> D (in allele DQB1*03:13).|V -> I (in allele DQB1*02:01, allele DQB1*02:02, allele DQB1*02:03, allele DQB1*02:04, allele DQB1*02:05, allele DQB1*03:06, allele DQB1*03:25, allele DQB1*04:01, allele DQB1*04:02, allele DQB1*04:03, allele DQB1*05:04, allele DQB1*06:01 and allele DQB1*06:35).		antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|immune response (GO:0006955)|immunoglobulin production involved in immunoglobulin mediated immune response (GO:0002381)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)|peptide antigen binding (GO:0042605)			breast(1)|large_intestine(1)|lung(1)|pancreas(1)	4					"""""""Insulin(DB00071)"""	CCCTCCAGGACTTCCTTCTGG	0.672									T-cell Lymphoma, (Cutaneous) , Familial Clustering of;Sjgren syndrome;Melanoma, Familial Clustering of;ACTH-independent macronodular adrenal hyperplasia																												p.V99L	Esophageal Squamous(151;720 1825 15000 40336 43415)	.											.	HLA-DQB1-22	0			c.G295C						.						40.0	42.0	41.0					6																	32632659		2031	4137	6168	SO:0001583	missense	3119	exon2	Familial Cancer Database	incl.: Mycosis Fungoides, Sezary syndrome, Adult T-cell Lymphoma;Sjogren syndrome; ;AIMAH, Cushing disease, Adrenal, Familial	CCAGGACTTCCTT		CCDS43451.1, CCDS59006.1	6p21.3	2013-01-11			ENSG00000179344	ENSG00000179344		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4944	protein-coding gene	gene with protein product		604305		HLA-DQB			Standard	NM_001243962		Approved	IDDM1, CELIAC1	uc031snw.1	P01920	OTTHUMG00000031124	ENST00000399084.1:c.295G>C	6.37:g.32632659C>G	ENSP00000382034:p.Val99Leu	Somatic	28	0		WXS	Illumina HiSeq	Phase_I	37	3	NM_002123	0	0	0	0	0	A1KR27|A2RPH3|A4Q9R4|A4USG2|A4USG5|A6N8I7|A9YQA0|B0S7Y7|B1A0K6|B1GXI3|B3VLT3|B5BLN7|B7VU69|C0MQ34|C0MQ35|C8ZL52|C8ZLJ8|C8ZLJ9|C9DRQ3|O19708|O19713|O19724|O62861|O78046|O78221|O78223|O98034|O98201|P01917|P01918|P01919|P03992|P05537|P79482|P79526|P79544|P79551|Q08GC8|Q09035|Q0E4V9|Q1M312|Q29731|Q29877|Q29884|Q29915|Q29966|Q2P9N3|Q2QK85|Q30061|Q30075|Q30076|Q30080|Q30081|Q30082|Q30083|Q30084|Q30089|Q30095|Q31633|Q38I47|Q45UE3|Q4QZB5|Q53I44|Q564J6|Q5G841|Q5ISH1|Q5ISH3|Q5W1E1|Q5Y7G8|Q643R4|Q6B9X1|Q70VH8|Q7YP69|Q8HWH0|Q8MH58|Q8SNB4|Q8SND1|Q8SP70|Q8WMA3|Q9BD17|Q9MYH2|Q9TPA9|Q9XRY6|Q9XRY7|Q9XRZ2	Missense_Mutation	SNP	ENST00000399084.1	37	CCDS43451.1	52	0.023809523809523808	13	0.026422764227642278	10	0.027624309392265192	4	0.006993006993006993	25	0.032981530343007916	.	0.017	-1.499816	0.01001	.	.	ENSG00000179344	ENST00000399079;ENST00000374943;ENST00000434651;ENST00000399084;ENST00000447884	T;T;T;T	0.00279	8.33;8.33;8.33;8.33	3.78	-7.56	0.01322	.	1.342600	0.05692	U	0.592472	T	0.00012	0.0000	N	0.05199	-0.095	0.09310	N	1	B;B;B;B;B	0.30439	0.279;0.0;0.0;0.0;0.0	B;B;B;B;B	0.20184	0.028;0.0;0.0;0.0;0.0	T	0.41378	-0.9512	10	0.08381	T	0.77	.	0.0463	0.00010	0.2748:0.1963:0.2237:0.3053	.	109;99;64;99;99	Q59F80;A2AAZ0;A2VCT9;Q5Y7D6;Q5Y7A9	.;.;.;.;.	L	99;99;99;99;35	ENSP00000382029:V99L;ENSP00000364080:V99L;ENSP00000407332:V99L;ENSP00000382034:V99L	ENSP00000364080:V99L	V	-	1	0	HLA-DQB1	32740637	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-13.071000	0.00001	-5.402000	0.00015	-2.321000	0.00252	GTC	C|0.951;G|0.020		0.672	HLA-DQB1-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276127.1	NM_002123	
LAMA2	3908	broad.mit.edu	37	6	129670492	129670492	+	Missense_Mutation	SNP	G	G	A			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr6:129670492G>A	ENST00000421865.2	+	31	4535	c.4486G>A	c.(4486-4488)Gct>Act	p.A1496T		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	1496	Laminin EGF-like 16. {ECO:0000255|PROSITE-ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		CCGCTGCACGGCTTGTCCACG	0.428																																					p.A1496T													.	LAMA2-162	0			c.G4486A						.						119.0	113.0	115.0					6																	129670492		2203	4300	6503	SO:0001583	missense	3908	exon31			TGCACGGCTTGTC	Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.4486G>A	6.37:g.129670492G>A	ENSP00000400365:p.Ala1496Thr	Somatic	189	0		WXS	Illumina HiSeq	Phase_I	27	4	NM_000426	0	0	0	0	0	Q14736|Q5VUM2|Q93022	Missense_Mutation	SNP	ENST00000421865.2	37	CCDS5138.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.491014	0.84962	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865	T	0.63255	-0.03	5.98	5.98	0.97165	EGF-like, laminin (4);	0.057949	0.64402	D	0.000001	T	0.78635	0.4314	M	0.81239	2.535	0.80722	D	1	D;D	0.89917	1.0;0.992	D;D	0.91635	0.999;0.993	T	0.76424	-0.2964	10	0.45353	T	0.12	.	20.452	0.99131	0.0:0.0:1.0:0.0	.	1496;1496	A6NF00;P24043	.;LAMA2_HUMAN	T	1496	ENSP00000400365:A1496T	ENSP00000346769:A1496T	A	+	1	0	LAMA2	129712185	1.000000	0.71417	0.108000	0.21378	0.295000	0.27426	4.093000	0.57714	2.838000	0.97847	0.591000	0.81541	GCT	.		0.428	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042180.1		
STXBP5	134957	broad.mit.edu	37	6	147637421	147637421	+	Silent	SNP	G	G	A			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr6:147637421G>A	ENST00000321680.6	+	16	1680	c.1680G>A	c.(1678-1680)gaG>gaA	p.E560E	STXBP5_ENST00000367481.3_Silent_p.E560E|STXBP5_ENST00000367480.3_Silent_p.E560E|STXBP5_ENST00000179882.6_Silent_p.E231E	NM_001127715.2	NP_001121187.1	Q5T5C0	STXB5_HUMAN	syntaxin binding protein 5 (tomosyn)	560					exocytosis (GO:0006887)|negative regulation of exocytosis (GO:0045920)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|synapse (GO:0045202)	syntaxin-1 binding (GO:0017075)			breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(21)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	42		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)		CGGAGGGTGAGCAGCCACCAC	0.458																																					p.E560E													.	STXBP5-90	0			c.G1680A						.						87.0	87.0	87.0					6																	147637421		2203	4300	6503	SO:0001819	synonymous_variant	134957	exon16			GGGTGAGCAGCCA	AK055484	CCDS5211.1, CCDS47499.1	6q24.3	2013-01-10			ENSG00000164506	ENSG00000164506		"""WD repeat domain containing"""	19665	protein-coding gene	gene with protein product		604586				9620695, 14767561	Standard	NM_139244		Approved	tomosyn, LLGL3	uc010khz.2	Q5T5C0	OTTHUMG00000015766	ENST00000321680.6:c.1680G>A	6.37:g.147637421G>A		Somatic	96	1		WXS	Illumina HiSeq	Phase_I	23	3	NM_139244	0	0	2	3	1	Q14DF3|Q5T5C1|Q5T5C2|Q8NBG8|Q96NG9	Silent	SNP	ENST00000321680.6	37	CCDS47499.1																																																																																			.		0.458	STXBP5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042606.1		
NOD1	10392	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	30472766	30472766	+	Missense_Mutation	SNP	A	A	G			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr7:30472766A>G	ENST00000222823.4	-	12	3176	c.2651T>C	c.(2650-2652)gTg>gCg	p.V884A		NM_006092.2	NP_006083.1	Q9Y239	NOD1_HUMAN	nucleotide-binding oligomerization domain containing 1	884					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPK activity (GO:0000187)|apoptotic process (GO:0006915)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-8 biosynthetic process (GO:0042228)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of tumor necrosis factor production (GO:0032760)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|identical protein binding (GO:0042802)|peptidoglycan binding (GO:0042834)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|skin(2)	39						ACTCTCTGCCACTTCATCGTT	0.393																																					p.V884A		.											.	NOD1-229	0			c.T2651C						.						133.0	117.0	123.0					7																	30472766		2203	4300	6503	SO:0001583	missense	10392	exon12			TCTGCCACTTCAT	AF126484	CCDS5427.1	7p15-p14	2006-12-08	2006-12-08	2006-12-08	ENSG00000106100	ENSG00000106100		"""Nucleotide-binding domain and leucine rich repeat containing"""	16390	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 1"", ""NLR family, CARD domain containing 1"""	605980	"""caspase recruitment domain family, member 4"""	CARD4		10224040, 10329646	Standard	NM_006092		Approved	NLRC1, CLR7.1	uc003tav.3	Q9Y239	OTTHUMG00000023923	ENST00000222823.4:c.2651T>C	7.37:g.30472766A>G	ENSP00000222823:p.Val884Ala	Somatic	125	0		WXS	Illumina HiSeq	Phase_I	44	8	NM_006092	0	0	23	25	2	B4DTU3|Q549U4|Q8IWF5	Missense_Mutation	SNP	ENST00000222823.4	37	CCDS5427.1	.	.	.	.	.	.	.	.	.	.	A	3.545	-0.092917	0.07053	.	.	ENSG00000106100	ENST00000222823	T	0.51574	0.7	5.74	0.404	0.16355	.	0.399974	0.28544	N	0.014963	T	0.14013	0.0339	N	0.00815	-1.16	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.09885	-1.0654	10	0.12103	T	0.63	.	8.3537	0.32318	0.5662:0.0:0.4338:0.0	.	884	Q9Y239	NOD1_HUMAN	A	884	ENSP00000222823:V884A	ENSP00000222823:V884A	V	-	2	0	NOD1	30439291	0.488000	0.25996	0.983000	0.44433	0.937000	0.57800	0.908000	0.28545	0.117000	0.18138	0.460000	0.39030	GTG	.		0.393	NOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250443.2		
HERPUD2	64224	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	35674964	35674964	+	Missense_Mutation	SNP	G	G	T			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr7:35674964G>T	ENST00000396081.1	-	6	1526	c.722C>A	c.(721-723)cCa>cAa	p.P241Q	HERPUD2_ENST00000311350.3_Missense_Mutation_p.P241Q|HERPUD2_ENST00000426180.1_5'UTR	NM_022373.4	NP_071768.3	Q9BSE4	HERP2_HUMAN	HERPUD family member 2	241					response to unfolded protein (GO:0006986)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)				kidney(3)|large_intestine(5)|lung(6)|ovary(3)|prostate(1)	18						GTTTGGAGCTGGTGGGGGTTC	0.473																																					p.P241Q		.											.	HERPUD2-93	0			c.C722A						.						155.0	158.0	157.0					7																	35674964		2203	4300	6503	SO:0001583	missense	64224	exon7			GGAGCTGGTGGGG	BC020264	CCDS5446.1	7p14.2	2006-03-20	2006-03-20		ENSG00000122557	ENSG00000122557			21915	protein-coding gene	gene with protein product	"""homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 2"""						Standard	NM_022373		Approved	FLJ22313	uc003tes.4	Q9BSE4	OTTHUMG00000128687	ENST00000396081.1:c.722C>A	7.37:g.35674964G>T	ENSP00000379390:p.Pro241Gln	Somatic	358	1		WXS	Illumina HiSeq	Phase_I	120	17	NM_022373	0	0	44	55	11	A4D1Y8|Q9H6F9	Missense_Mutation	SNP	ENST00000396081.1	37	CCDS5446.1	.	.	.	.	.	.	.	.	.	.	G	14.74	2.624185	0.46840	.	.	ENSG00000122557	ENST00000396081;ENST00000311350;ENST00000438224	T;T;T	0.32272	1.9;1.9;1.46	5.96	5.96	0.96718	.	0.264276	0.43579	D	0.000544	T	0.26774	0.0655	L	0.47190	1.495	0.44295	D	0.997168	B	0.16396	0.017	B	0.12837	0.008	T	0.06588	-1.0818	10	0.10636	T	0.68	-12.3571	14.5539	0.68086	0.0693:0.0:0.9307:0.0	.	241	Q9BSE4	HERP2_HUMAN	Q	241;241;177	ENSP00000379390:P241Q;ENSP00000310729:P241Q;ENSP00000415475:P177Q	ENSP00000310729:P241Q	P	-	2	0	HERPUD2	35641489	1.000000	0.71417	0.998000	0.56505	0.979000	0.70002	4.904000	0.63279	2.832000	0.97577	0.655000	0.94253	CCA	.		0.473	HERPUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250584.1	NM_022373	
NAPEPLD	222236	broad.mit.edu	37	7	102769017	102769017	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr7:102769017C>T	ENST00000417955.1	-	2	361	c.207G>A	c.(205-207)tgG>tgA	p.W69*	NAPEPLD_ENST00000465647.1_Nonsense_Mutation_p.W69*|NAPEPLD_ENST00000427257.1_Nonsense_Mutation_p.W69*|NAPEPLD_ENST00000455523.2_Nonsense_Mutation_p.W142*|NAPEPLD_ENST00000341533.4_Nonsense_Mutation_p.W69*			Q6IQ20	NAPEP_HUMAN	N-acyl phosphatidylethanolamine phospholipase D	69					phospholipid catabolic process (GO:0009395)	extracellular vesicular exosome (GO:0070062)|photoreceptor outer segment membrane (GO:0042622)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17						TCCATGTTGGCCACGGATTCA	0.403																																					p.W69X													.	NAPEPLD-227	0			c.G207A						.						127.0	116.0	119.0					7																	102769017		2203	4300	6503	SO:0001587	stop_gained	222236	exon2			TGTTGGCCACGGA	BC037350, AY357337	CCDS5729.1	7q22.1	2014-03-14			ENSG00000161048	ENSG00000161048	3.1.4.54		21683	protein-coding gene	gene with protein product	"""chromosome 7 open reading frame 18, N-acyl-phosphatidylethanolamine-hydrolyzing phospholipase D"""	612334				14634025, 15820312, 18067139	Standard	NM_198990		Approved	FMP30, C7orf18, NAPE-PLD	uc003vbd.2	Q6IQ20	OTTHUMG00000157204	ENST00000417955.1:c.207G>A	7.37:g.102769017C>T	ENSP00000407112:p.Trp69*	Somatic	196	0		WXS	Illumina HiSeq	Phase_I	63	4	NM_001122838	0	0	3	3	0	Q5CZ87|Q769K1	Nonsense_Mutation	SNP	ENST00000417955.1	37	CCDS5729.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.673876	0.88445	.	.	ENSG00000161048	ENST00000341533;ENST00000417955;ENST00000465647;ENST00000427257;ENST00000455523;ENST00000418294	.	.	.	6.16	6.16	0.99307	.	0.101764	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	-13.6216	20.8598	0.99761	0.0:1.0:0.0:0.0	.	.	.	.	X	69;69;69;69;142;69	.	ENSP00000340093:W69X	W	-	3	0	NAPEPLD	102556253	1.000000	0.71417	1.000000	0.80357	0.786000	0.44442	7.150000	0.77403	2.937000	0.99478	0.650000	0.86243	TGG	.		0.403	NAPEPLD-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347904.1	NM_198990	
SSPO	23145	hgsc.bcm.edu	37	7	149487608	149487608	+	RNA	SNP	T	T	G	rs1635798	byFrequency	TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr7:149487608T>G	ENST00000378016.2	+	0	4921							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GACGCCTGCGTTGAGGCTCCC	0.776													G|||	1320	0.263578	0.6959	0.1095	5008	,	,		8211	0.1171		0.0885	False		,,,				2504	0.1196				.		.											.	.	0			c.4921+1T>G						.						1.0	1.0	1.0					7																	149487608		434	1167	1601			23145	exon32			CCTGCGTTGAGGC	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149487608T>G		Somatic	0	0		WXS	Illumina HiSeq	Phase_I	2	2	NM_198455	0	0	0	0	0	Q76B61	Splice_Site	SNP	ENST00000378016.2	37																																																																																				T|0.784;G|0.216		0.776	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript			
GAS1	2619	hgsc.bcm.edu	37	9	89560846	89560846	+	Silent	SNP	C	C	G			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr9:89560846C>G	ENST00000298743.7	-	1	1258	c.849G>C	c.(847-849)ccG>ccC	p.P283P	RP11-276H19.1_ENST00000415801.1_lincRNA	NM_002048.2	NP_002039.2	P54826	GAS1_HUMAN	growth arrest-specific 1	283					axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|cell cycle arrest (GO:0007050)|cell fate commitment (GO:0045165)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cerebellum morphogenesis (GO:0021587)|developmental growth (GO:0048589)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digit morphogenesis (GO:0042733)|eye morphogenesis (GO:0048592)|middle ear morphogenesis (GO:0042474)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein processing (GO:0010955)|negative regulation of smoothened signaling pathway (GO:0045879)|odontogenesis (GO:0042476)|outer ear morphogenesis (GO:0042473)|palate development (GO:0060021)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smoothened signaling pathway (GO:0045880)|programmed cell death (GO:0012501)|regulation of apoptotic process (GO:0042981)|regulation of ER to Golgi vesicle-mediated transport (GO:0060628)|regulation of smoothened signaling pathway (GO:0008589)	anchored component of plasma membrane (GO:0046658)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				kidney(1)|lung(2)|skin(1)	4						CGTCGTCCAGCGGCTGCTCAC	0.756																																					p.P283P		.											.	GAS1-226	0			c.G849C						.						4.0	6.0	5.0					9																	89560846		1831	3830	5661	SO:0001819	synonymous_variant	2619	exon1			GTCCAGCGGCTGC		CCDS6674.1	9q21.3-q22	2008-07-21			ENSG00000180447	ENSG00000180447			4165	protein-coding gene	gene with protein product	"""Growth arrest-specific gene-1"""	139185				8307588	Standard	NM_002048		Approved		uc004aox.4	P54826	OTTHUMG00000020141	ENST00000298743.7:c.849G>C	9.37:g.89560846C>G		Somatic	5	0		WXS	Illumina HiSeq	Phase_I	29	2	NM_002048	0	0	0	0	0	B9EGM4|Q6B086	Silent	SNP	ENST00000298743.7	37	CCDS6674.1																																																																																			.		0.756	GAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052928.1	NM_002048	
OR1L4	254973	hgsc.bcm.edu	37	9	125486286	125486286	+	Silent	SNP	T	T	C			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr9:125486286T>C	ENST00000259466.1	+	1	18	c.18T>C	c.(16-18)taT>taC	p.Y6Y		NM_001005235.1	NP_001005235.1	Q8NGR5	OR1L4_HUMAN	olfactory receptor, family 1, subfamily L, member 4	6						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|large_intestine(3)|lung(13)|prostate(1)|skin(1)	20						CAAAGAATTATAGCAGCAGCA	0.488																																					p.Y6Y		.											.	OR1L4-68	0			c.T18C						.						151.0	146.0	148.0					9																	125486286		2203	4300	6503	SO:0001819	synonymous_variant	254973	exon1			GAATTATAGCAGC		CCDS35129.1	9q33.2	2013-09-20			ENSG00000136939	ENSG00000136939		"""GPCR / Class A : Olfactory receptors"""	8216	protein-coding gene	gene with protein product				OR1L5			Standard	NM_001005235		Approved	OR9-E	uc004bmu.1	Q8NGR5	OTTHUMG00000020620	ENST00000259466.1:c.18T>C	9.37:g.125486286T>C		Somatic	248	2		WXS	Illumina HiSeq	Phase_I	40	4	NM_001005235	0	0	0	0	0	Q6IFN0|Q96R81	Silent	SNP	ENST00000259466.1	37	CCDS35129.1																																																																																			.		0.488	OR1L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053951.1		
RLIM	51132	hgsc.bcm.edu	37	X	73811841	73811841	+	Missense_Mutation	SNP	T	T	C			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chrX:73811841T>C	ENST00000332687.6	-	4	1527	c.1309A>G	c.(1309-1311)Atg>Gtg	p.M437V	RLIM_ENST00000349225.2_Missense_Mutation_p.M437V	NM_016120.3	NP_057204.2	Q9NVW2	RNF12_HUMAN	ring finger protein, LIM domain interacting	437	Ser-rich.				negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|random inactivation of X chromosome (GO:0060816)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	ligase activity (GO:0016874)|transcription corepressor activity (GO:0003714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GCCCTTTCCATATTTCGATTT	0.468																																					p.M437V	Esophageal Squamous(169;1899 1923 14997 18818 32118)	.											.	RLIM-228	0			c.A1309G						.						80.0	81.0	81.0					X																	73811841		2203	4300	6503	SO:0001583	missense	51132	exon5			TTTCCATATTTCG	AF155109	CCDS14427.1	Xq13-q21	2013-01-09	2009-02-17	2009-02-17	ENSG00000131263	ENSG00000131263		"""RING-type (C3HC4) zinc fingers"""	13429	protein-coding gene	gene with protein product	"""ring zinc finger protein NY-REN-43antigen"", ""LIM domain interacting ring finger protein"""	300379	"""ring finger protein 12"""	RNF12		10508479	Standard	NM_016120		Approved	NY-REN-43, MGC15161	uc004ebw.3	Q9NVW2	OTTHUMG00000021859	ENST00000332687.6:c.1309A>G	X.37:g.73811841T>C	ENSP00000328059:p.Met437Val	Somatic	133	0		WXS	Illumina HiSeq	Phase_I	28	2	NM_183353	0	0	11	11	0	B2RBQ1|D3DTE0|Q96D38|Q9Y598	Missense_Mutation	SNP	ENST00000332687.6	37	CCDS14427.1	.	.	.	.	.	.	.	.	.	.	T	0.001	-3.045444	0.00039	.	.	ENSG00000131263	ENST00000332687;ENST00000349225	T;T	0.07114	3.22;3.22	5.5	-5.67	0.02444	.	0.968910	0.08563	N	0.927213	T	0.02342	0.0072	N	0.02539	-0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47249	-0.9132	10	0.17369	T	0.5	5.075	5.2448	0.15490	0.1268:0.5334:0.1263:0.2135	.	437	Q9NVW2	RNF12_HUMAN	V	437	ENSP00000328059:M437V;ENSP00000253571:M437V	ENSP00000328059:M437V	M	-	1	0	RLIM	73728566	0.000000	0.05858	0.023000	0.16930	0.160000	0.22226	-0.063000	0.11655	-0.764000	0.04651	0.486000	0.48141	ATG	.		0.468	RLIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057268.1	NM_016120	
COL4A6	1288	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	107433650	107433650	+	Missense_Mutation	SNP	T	T	G			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chrX:107433650T>G	ENST00000372216.4	-	20	1501	c.1401A>C	c.(1399-1401)aaA>aaC	p.K467N	COL4A6_ENST00000538570.1_Missense_Mutation_p.K466N|COL4A6_ENST00000545689.1_Missense_Mutation_p.K466N|COL4A6_ENST00000334504.7_Missense_Mutation_p.K466N|COL4A6_ENST00000394872.2_Missense_Mutation_p.K467N	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	467	Triple-helical region.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						CTAGGTTTCCTTTTGGACCTT	0.443									Alport syndrome with Diffuse Leiomyomatosis																												p.K467N	Melanoma(87;1895 1945 2589 7165)	.											.	COL4A6-199	0			c.A1401C						.						130.0	118.0	122.0					X																	107433650		2203	4300	6503	SO:0001583	missense	1288	exon20	Familial Cancer Database		GTTTCCTTTTGGA	U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.1401A>C	X.37:g.107433650T>G	ENSP00000361290:p.Lys467Asn	Somatic	179	0		WXS	Illumina HiSeq	Phase_I	99	38	NM_001847	0	0	0	0	0	Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Missense_Mutation	SNP	ENST00000372216.4	37	CCDS14541.1	.	.	.	.	.	.	.	.	.	.	T	12.36	1.915515	0.33815	.	.	ENSG00000197565	ENST00000372216;ENST00000334504;ENST00000394872;ENST00000541389;ENST00000545689;ENST00000538570	D;D;D;D;D	0.94232	-3.38;-3.38;-3.38;-3.25;-3.38	5.3	2.74	0.32292	.	0.000000	0.45361	D	0.000370	D	0.92506	0.7620	L	0.52206	1.635	0.33503	D	0.590155	D;D;D;D	0.61697	0.982;0.982;0.983;0.99	P;P;P;P	0.59487	0.764;0.764;0.725;0.858	D	0.91531	0.5242	10	0.59425	D	0.04	.	2.7178	0.05192	0.1932:0.2036:0.0:0.6032	.	466;466;467;466	F5H851;F5H3Q5;Q14031;Q14031-2	.;.;CO4A6_HUMAN;.	N	467;466;467;466;466;466	ENSP00000361290:K467N;ENSP00000334733:K466N;ENSP00000378340:K467N;ENSP00000443707:K466N;ENSP00000445236:K466N	ENSP00000334733:K466N	K	-	3	2	COL4A6	107320306	0.993000	0.37304	0.998000	0.56505	0.987000	0.75469	0.944000	0.29043	0.886000	0.36113	0.486000	0.48141	AAA	.		0.443	COL4A6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057875.2		
FLNA	2316	ucsc.edu	37	X	153588776	153588776	+	Silent	SNP	G	G	A	rs372874251		TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chrX:153588776G>A	ENST00000369850.3	-	22	3623	c.3387C>T	c.(3385-3387)acC>acT	p.T1129T	FLNA_ENST00000344736.4_Silent_p.T1129T|FLNA_ENST00000360319.4_Silent_p.T1129T|FLNA_ENST00000422373.1_Silent_p.T1129T|FLNA_ENST00000369856.3_5'Flank	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	1129					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CCCCGGGCTCGGTGGGCACGT	0.622											OREG0003593	type=REGULATORY REGION|Gene=FLNA|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.T1129T													.	FLNA-599	0			c.C3387T						.		,	1,3732		0,1,1580,571	70.0	81.0	77.0		3387,3387	-9.8	0.5	X		77	0,6620		0,0,2402,1816	no	coding-synonymous,coding-synonymous	FLNA	NM_001110556.1,NM_001456.3	,	0,1,3982,2387	AA,AG,GG,G		0.0,0.0268,0.0097	,	1129/2648,1129/2640	153588776	1,10352	2152	4218	6370	SO:0001819	synonymous_variant	2316	exon22			GGGCTCGGTGGGC	X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.3387C>T	X.37:g.153588776G>A		Somatic	68	0	1756	WXS	Illumina HiSeq		175	1	NM_001456	0	0	6	7	1	E9KL45|Q5HY53|Q5HY55|Q8NF52	Silent	SNP	ENST00000369850.3	37	CCDS48194.1																																																																																			.		0.622	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058942.3		
FCGR2A	2212	broad.mit.edu	37	1	161475799	161475804	+	Splice_Site	DEL	TGAGTA	TGAGTA	-	rs573668650		TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	TGAGTA	TGAGTA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr1:161475799_161475804delTGAGTA	ENST00000271450.6	+	2	144		c.e2+2		FCGR2A_ENST00000367972.4_Splice_Site	NM_001136219.1|NM_021642.3	NP_001129691.1|NP_067674.2	P12318	FCG2A_HUMAN	Fc fragment of IgG, low affinity IIa, receptor (CD32)						Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(2)|endometrium(2)|large_intestine(2)|lung(11)|ovary(1)	19	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	GTCAAGCTGGTGAGTATGCCCTTTGC	0.471																																					.													.	FCGR2A-91	0			.						.																																			SO:0001630	splice_region_variant	2212	.			AGCTGGTGAGTAT	J03619	CCDS30922.1, CCDS44264.1	1q23	2013-01-11	2005-02-02		ENSG00000143226	ENSG00000143226		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3616	protein-coding gene	gene with protein product	"""Immunoglobulin G Fc receptor II"""	146790	"""Fc fragment of IgG, low affinity IIa, receptor for (CD32)"""	FCG2, FCGR2A1, FCGR2		2139735	Standard	NM_021642		Approved	CD32, CD32A, IGFR2, CDw32	uc001gan.3	P12318	OTTHUMG00000034469	ENST00000271450.6:c.106+2TGAGTA>-	1.37:g.161475799_161475804delTGAGTA		Somatic	761	0		WXS	Illumina HiSeq	Phase_I	1172	0	.	0	0	0	0	0	Q8WUN1|Q8WW64	Splice_Site	DEL	ENST00000271450.6	37	CCDS44264.1																																																																																			.		0.471	FCGR2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000083318.3	NM_021642	Intron
PITRM1	10531	broad.mit.edu;bcgsc.ca	37	10	3199645	3199645	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr10:3199645delA	ENST00000224949.4	-	12	1363	c.1329delT	c.(1327-1329)tttfs	p.F443fs	PITRM1-AS1_ENST00000598280.1_RNA|PITRM1_ENST00000451104.2_Frame_Shift_Del_p.F411fs|PITRM1_ENST00000380994.1_5'UTR|PITRM1_ENST00000380989.2_Frame_Shift_Del_p.F443fs|PITRM1-AS1_ENST00000601046.1_RNA			Q5JRX3	PREP_HUMAN	pitrilysin metallopeptidase 1	443					positive regulation of catalytic activity (GO:0043085)|proteolysis (GO:0006508)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	enzyme activator activity (GO:0008047)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|urinary_tract(3)	33						GCATCAGCCCAAAGCTGGTAG	0.318																																					p.F443fs													.	PITRM1-91	0			c.1329delT						.						112.0	106.0	108.0					10																	3199645		1840	4105	5945	SO:0001589	frameshift_variant	10531	exon12			CAGCCCAAAGCTG	AB029027	CCDS55699.1, CCDS55700.1, CCDS59208.1	10p15.2	2008-07-30	2005-08-17		ENSG00000107959	ENSG00000107959			17663	protein-coding gene	gene with protein product	"""PreP peptidasome"""		"""pitrilysin metalloproteinase 1"""			1036083, 10470851, 16849325	Standard	NM_014889		Approved	MP1, KIAA1104, hMP1, PreP	uc009xhv.2	Q5JRX3	OTTHUMG00000017557	ENST00000224949.4:c.1329delT	10.37:g.3199645delA	ENSP00000224949:p.Phe443fs	Somatic	53	0		WXS	Illumina HiSeq	Phase_I	34	8	NM_014889	0	0	0	0	0	B3KMJ6|B4E0J8|C9JSL2|E7ES23|O95204|Q2M2G6|Q4VBR1|Q5JRW7|Q7L5Z7|Q9BSI6|Q9BVJ5|Q9UPP8	Frame_Shift_Del	DEL	ENST00000224949.4	37	CCDS59208.1																																																																																			.		0.318	PITRM1-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000046469.2		
TCF7L2	6934	broad.mit.edu	37	10	114925317	114925317	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr10:114925317delA	ENST00000355995.4	+	15	1953	c.1446delA	c.(1444-1446)agafs	p.R482fs	TCF7L2_ENST00000543371.1_Frame_Shift_Del_p.R465fs|TCF7L2_ENST00000355717.4_Frame_Shift_Del_p.E465fs|TCF7L2_ENST00000466338.1_3'UTR|TCF7L2_ENST00000352065.5_3'UTR|TCF7L2_ENST00000538897.1_Frame_Shift_Del_p.E458fs|TCF7L2_ENST00000369386.1_3'UTR|TCF7L2_ENST00000369397.4_Frame_Shift_Del_p.R459fs|TCF7L2_ENST00000545257.1_Frame_Shift_Del_p.R482fs|TCF7L2_ENST00000369389.1_Frame_Shift_Del_p.E152fs|TCF7L2_ENST00000542695.1_Frame_Shift_Del_p.R198fs|TCF7L2_ENST00000536810.1_Frame_Shift_Del_p.R465fs			Q9NQB0	TF7L2_HUMAN	transcription factor 7-like 2 (T-cell specific, HMG-box)	482	Promoter-specific activation domain.				blood vessel development (GO:0001568)|bone mineralization (GO:0030282)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|catenin import into nucleus (GO:0035411)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cellular response to starvation (GO:0009267)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic genitalia morphogenesis (GO:0030538)|embryonic hindgut morphogenesis (GO:0048619)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|generation of neurons (GO:0048699)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycogen metabolic process (GO:0005977)|insulin metabolic process (GO:1901142)|maintenance of DNA repeat elements (GO:0043570)|multicellular organism growth (GO:0035264)|myoblast fate commitment (GO:0048625)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of organ growth (GO:0046621)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neural tube development (GO:0021915)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte development (GO:0014003)|pancreas development (GO:0031016)|pituitary gland development (GO:0021983)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of insulin secretion (GO:0032024)|positive regulation of protein binding (GO:0032092)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|post-embryonic development (GO:0009791)|regulation of hormone metabolic process (GO:0032350)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of myelination (GO:0031641)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of skeletal muscle tissue development (GO:0048641)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|secretory granule localization (GO:0032252)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	beta-catenin-TCF7L2 complex (GO:0070369)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|gamma-catenin binding (GO:0045295)|nuclear hormone receptor binding (GO:0035257)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)		VTI1A/TCF7L2(8)	central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(24)|liver(2)|lung(8)|ovary(1)|skin(1)	41		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)		TTTCTAGGAGAAAAAAAAAGT	0.522			T	VTI1A	colorectal																																p.R465fs				Dom	yes		10	10q25.3	6934	transcription factor 7-like 2		E	.	TCF7L2-586	0			c.1395delA						.						94.0	102.0	99.0					10																	114925317		2203	4300	6503	SO:0001589	frameshift_variant	6934	exon14			TAGGAGAAAAAAA	X62871	CCDS7576.1, CCDS53578.1, CCDS55729.1, CCDS73196.1, CCDS73197.1, CCDS73198.1	10q25.3	2006-11-24			ENSG00000148737	ENSG00000148737			11641	protein-coding gene	gene with protein product		602228		TCF4		1741298	Standard	NM_001146283		Approved	TCF-4	uc001lae.4	Q9NQB0	OTTHUMG00000019070	ENST00000355995.4:c.1446delA	10.37:g.114925317delA	ENSP00000348274:p.Arg482fs	Somatic	277	0		WXS	Illumina HiSeq	Phase_I	547	7	NM_001146274	0	0	0	0	0	B4DRJ8|B9X074|C6ZRJ8|C6ZRK0|E2GH14|E2GH19|E2GH20|E2GH24|E2GH25|E9PFH9|F8W742|F8W7T5|O00185|Q9NQB1|Q9NQB2|Q9NQB3|Q9NQB4|Q9NQB5|Q9NQB6|Q9NQB7|Q9ULC2	Frame_Shift_Del	DEL	ENST00000355995.4	37																																																																																				.		0.522	TCF7L2-203	KNOWN	basic	protein_coding	protein_coding		NM_030756	
PHB	5245	broad.mit.edu	37	17	47486482	47486483	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	CT	CT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr17:47486482_47486483delCT	ENST00000300408.3	-	5	503_504	c.431_432delAG	c.(430-432)gagfs	p.E144fs	RP11-81K2.1_ENST00000576461.1_Intron|PHB_ENST00000511832.1_Intron|PHB_ENST00000508009.1_5'UTR	NM_001281496.1|NM_001281715.1|NM_002634.2	NP_001268425.1|NP_001268644.1|NP_002625.1	P35232	PHB_HUMAN	prohibitin	144					cellular response to interleukin-6 (GO:0071354)|DNA replication (GO:0006260)|histone deacetylation (GO:0016575)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast differentiation (GO:0001649)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone receptor signaling pathway (GO:0050847)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|transcription regulatory region DNA binding (GO:0044212)			endometrium(4)|large_intestine(2)|lung(4)	10	all_cancers(4;2.62e-14)|Breast(4;4.21e-29)|all_epithelial(4;6.9e-18)		Epithelial(5;8.1e-06)|all cancers(6;7.71e-05)			TGGAGACCAGCTCTCTCTGGGT	0.554																																					p.144_144del													.	PHB-90	0			c.431_432del						.																																			SO:0001589	frameshift_variant	5245	exon5			GACCAGCTCTCTC		CCDS11548.1, CCDS62244.1	17q21	2010-11-25			ENSG00000167085	ENSG00000167085			8912	protein-coding gene	gene with protein product		176705				10376528, 8244394	Standard	NM_001281496		Approved	PHB1	uc002iox.1	P35232	OTTHUMG00000134271	ENST00000300408.3:c.431_432delAG	17.37:g.47486488_47486489delCT	ENSP00000300408:p.Glu144fs	Somatic	76	0		WXS	Illumina HiSeq	Phase_I	139	17	NM_002634	0	0	0	0	0	B4DY47|Q4VBQ0	Frame_Shift_Del	DEL	ENST00000300408.3	37	CCDS11548.1																																																																																			.		0.554	PHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258826.1	NM_002634	
SLC25A42	284439	broad.mit.edu	37	19	19221630	19221630	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr19:19221630delT	ENST00000318596.7	+	8	1053	c.902delT	c.(901-903)atcfs	p.I301fs		NM_178526.4	NP_848621.2	Q86VD7	S2542_HUMAN	solute carrier family 25, member 42	301					ADP transport (GO:0015866)|AMP transport (GO:0080121)|ATP transport (GO:0015867)|coenzyme A transmembrane transport (GO:0035349)|metabolic process (GO:0008152)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	adenosine-diphosphatase activity (GO:0043262)|ADP transmembrane transporter activity (GO:0015217)|AMP transmembrane transporter activity (GO:0080122)|ATP transmembrane transporter activity (GO:0005347)|coenzyme A transmembrane transporter activity (GO:0015228)			cervix(1)|large_intestine(2)|lung(3)	6			OV - Ovarian serous cystadenocarcinoma(5;5.4e-06)|Epithelial(12;0.000497)			GCCGTGGGCATCAGCTTCACC	0.657																																					p.I301fs													.	SLC25A42-90	0			c.902delT						.						68.0	52.0	57.0					19																	19221630		2203	4300	6503	SO:0001589	frameshift_variant	284439	exon8			TGGGCATCAGCTT		CCDS32966.1	19p13.11	2013-05-22			ENSG00000181035	ENSG00000181035		"""Solute carriers"""	28380	protein-coding gene	gene with protein product		610823				16949250, 19429682	Standard	NM_178526		Approved	MGC26694	uc002nlf.3	Q86VD7		ENST00000318596.7:c.902delT	19.37:g.19221630delT	ENSP00000326693:p.Ile301fs	Somatic	106	0		WXS	Illumina HiSeq	Phase_I	192	24	NM_178526	0	0	0	0	0	D2T2J5|O14553|O43378	Frame_Shift_Del	DEL	ENST00000318596.7	37	CCDS32966.1																																																																																			.		0.657	SLC25A42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465931.1	NM_178526	
TRIOBP	11078	broad.mit.edu	37	22	38129406	38129406	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr22:38129406delC	ENST00000406386.3	+	8	4304	c.4049delC	c.(4048-4050)gccfs	p.A1350fs		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	1350					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					TCCAGCCCTGCCCCCAGCAGG	0.697																																					p.A1350fs													.	TRIOBP-136	0			c.4049delC						.						8.0	13.0	11.0					22																	38129406		1882	3870	5752	SO:0001589	frameshift_variant	11078	exon8			GCCCTGCCCCCAG	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.4049delC	22.37:g.38129406delC	ENSP00000384312:p.Ala1350fs	Somatic	2	0		WXS	Illumina HiSeq	Phase_I	7	2	NM_001039141	0	0	0	0	0	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Frame_Shift_Del	DEL	ENST00000406386.3	37	CCDS43015.1																																																																																			.		0.697	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2		
LAMB2	3913	broad.mit.edu	37	3	49167097	49167098	+	Frame_Shift_Del	DEL	GG	GG	-			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	GG	GG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr3:49167097_49167098delGG	ENST00000418109.1	-	12	1621_1622	c.1457_1458delCC	c.(1456-1458)cccfs	p.P486fs	LAMB2_ENST00000305544.4_Frame_Shift_Del_p.P486fs	NM_002292.3	NP_002283.3	P55268	LAMB2_HUMAN	laminin, beta 2 (laminin S)	486	Laminin EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00460}.				astrocyte development (GO:0014002)|axon extension involved in regeneration (GO:0048677)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|metanephric glomerular basement membrane development (GO:0072274)|metanephric glomerular visceral epithelial cell development (GO:0072249)|neuromuscular junction development (GO:0007528)|retina development in camera-type eye (GO:0060041)|Schwann cell development (GO:0014044)|visual perception (GO:0007601)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-11 complex (GO:0043260)|laminin-3 complex (GO:0005608)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(15)|kidney(3)|large_intestine(6)|lung(21)|ovary(4)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		ATCCACTGTTGGGGTCACAAGG	0.559																																					p.486_486del													.	LAMB2-93	0			c.1457_1458del						.																																			SO:0001589	frameshift_variant	3913	exon11			ACTGTTGGGGTCA		CCDS2789.1	3p21.3-p21.2	2013-03-01			ENSG00000172037	ENSG00000172037		"""Laminins"""	6487	protein-coding gene	gene with protein product	"""laminin S"""	150325		LAMS		2922051, 10393422	Standard	NM_002292		Approved		uc003cwe.3	P55268	OTTHUMG00000156807	ENST00000418109.1:c.1457_1458delCC	3.37:g.49167099_49167100delGG	ENSP00000388325:p.Pro486fs	Somatic	94	0		WXS	Illumina HiSeq	Phase_I	125	0	NM_002292	0	0	0	0	0	Q16321	Frame_Shift_Del	DEL	ENST00000418109.1	37	CCDS2789.1																																																																																			.		0.559	LAMB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345939.1	NM_002292	
BAP1	8314	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	52437889	52437889	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr3:52437889delC	ENST00000460680.1	-	13	1743	c.1272delG	c.(1270-1272)gggfs	p.G424fs	BAP1_ENST00000296288.5_Frame_Shift_Del_p.G406fs	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.K425fs*4(1)		NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		CCCCTGGCTTCCCTGTTCCCT	0.557			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															p.G424fs	GBM(101;493 1458 7992 21037 25532)	.		Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	.	BAP1-1032	1	Deletion - Frameshift(1)	kidney(1)	c.1272delG						.						85.0	89.0	88.0					3																	52437889		2203	4300	6503	SO:0001589	frameshift_variant	8314	exon13			.	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.1272delG	3.37:g.52437889delC	ENSP00000417132:p.Gly424fs	Somatic	158	0		WXS	Illumina HiSeq	Phase_I	333	62	NM_004656	0	0	0	0	0	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Frame_Shift_Del	DEL	ENST00000460680.1	37	CCDS2853.1																																																																																			.		0.557	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1		
ZXDC	79364	broad.mit.edu	37	3	126178522	126178522	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr3:126178522delT	ENST00000389709.3	-	7	2239	c.2186delA	c.(2185-2187)aagfs	p.K729fs		NM_025112.4	NP_079388.3	Q2QGD7	ZXDC_HUMAN	ZXD family zinc finger C	729					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|LRR domain binding (GO:0030275)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|ovary(1)	17				GBM - Glioblastoma multiforme(114;0.155)		TCCTCTCTGCTTTTTTTCCTT	0.522																																					p.K729fs													.	ZXDC-91	0			c.2186delA						.						288.0	315.0	306.0					3																	126178522		2005	4167	6172	SO:0001589	frameshift_variant	79364	exon7			CTCTGCTTTTTTT	AK023923	CCDS43145.1, CCDS43146.1	3q21.3	2014-02-12			ENSG00000070476	ENSG00000070476		"""Zinc fingers, C2H2-type"""	28160	protein-coding gene	gene with protein product		615746				8619474, 9110174	Standard	XM_005247757		Approved	MGC11349, FLJ13861	uc003eiv.3	Q2QGD7	OTTHUMG00000162754	ENST00000389709.3:c.2186delA	3.37:g.126178522delT	ENSP00000374359:p.Lys729fs	Somatic	825	0		WXS	Illumina HiSeq	Phase_I	858	7	NM_025112	0	0	0	0	0	C5J0H9|Q6DKI8|Q7L3L1|Q8NAU2	Frame_Shift_Del	DEL	ENST00000389709.3	37	CCDS43145.1																																																																																			.		0.522	ZXDC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000370327.2	NM_025112	
CCAR2	57805	broad.mit.edu;bcgsc.ca	37	8	22474942	22474942	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr8:22474942delG	ENST00000308511.4	+	15	2104	c.1855delG	c.(1855-1857)gggfs	p.G619fs	CCAR2_ENST00000389279.3_Frame_Shift_Del_p.G619fs|RP11-582J16.5_ENST00000521025.1_RNA|CCAR2_ENST00000520861.1_Frame_Shift_Del_p.G294fs			Q8N163	CCAR2_HUMAN	cell cycle and apoptosis regulator 2	619					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mRNA processing (GO:0006397)|negative regulation of catalytic activity (GO:0043086)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage checkpoint (GO:2000003)|regulation of circadian rhythm (GO:0042752)|regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of protein stability (GO:0031647)|response to UV (GO:0009411)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|DBIRD complex (GO:0044609)|mitochondrial matrix (GO:0005759)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core binding (GO:0000993)										GAAGGAGGATGGGCTTTTGCC	0.502																																					p.G619fs													.	KIAA1967-92	0			c.1855delG						.						101.0	113.0	109.0					8																	22474942		2203	4300	6503	SO:0001589	frameshift_variant	57805	exon15			GAGGATGGGCTTT	AL834351	CCDS34863.1	8p22	2013-08-22	2013-08-22	2013-08-22		ENSG00000158941			23360	protein-coding gene	gene with protein product	"""deleted in breast cancer"""	607359	"""KIAA1967"""	KIAA1967		12370419	Standard	NM_021174		Approved	DBC-1, DBC1, NET35	uc003xci.3	Q8N163		ENST00000308511.4:c.1855delG	8.37:g.22474942delG	ENSP00000310670:p.Gly619fs	Somatic	322	0		WXS	Illumina HiSeq	Phase_I	669	97	NM_021174	0	0	0	0	0	A6NL03|B2RB79|D3DSR6|Q6P0Q9|Q8N3G7|Q8N8M1|Q8TF34|Q9H9Q9|Q9HD12|Q9NT55	Frame_Shift_Del	DEL	ENST00000308511.4	37	CCDS34863.1																																																																																			.		0.502	CCAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375865.1	NM_021174	
GDPD5	81544	broad.mit.edu	37	11	75146590	75146591	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr11:75146590_75146591insG	ENST00000336898.3	-	17	2616_2617	c.1779_1780insC	c.(1777-1782)ggcagcfs	p.S594fs	GDPD5_ENST00000376282.3_Frame_Shift_Ins_p.S475fs|GDPD5_ENST00000443276.2_3'UTR|GDPD5_ENST00000526177.1_Frame_Shift_Ins_p.S456fs|GDPD5_ENST00000533784.1_Frame_Shift_Ins_p.S475fs|GDPD5_ENST00000533805.1_Frame_Shift_Ins_p.S349fs|GDPD5_ENST00000529721.1_Frame_Shift_Ins_p.S594fs	NM_030792.6	NP_110419.5	Q8WTR4	GDPD5_HUMAN	glycerophosphodiester phosphodiesterase domain containing 5	594					cerebral cortex neuron differentiation (GO:0021895)|glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)|negative regulation of Notch signaling pathway (GO:0045746)|neuron projection development (GO:0031175)|positive regulation of neuron differentiation (GO:0045666)|regulation of timing of cell differentiation (GO:0048505)|spinal cord motor neuron differentiation (GO:0021522)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	glycerophosphodiester phosphodiesterase activity (GO:0008889)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(3)|skin(2)	20						TTGGTGTGGCTGCCACCCCCTC	0.579																																					p.S594fs													.	GDPD5-91	0			c.1780_1781insC						.																																			SO:0001589	frameshift_variant	81544	exon17			TGTGGCTGCCACC	AF318377	CCDS8238.1	11q13.4-q13.5	2011-01-25				ENSG00000158555			28804	protein-coding gene	gene with protein product		609632				18667693, 17275818	Standard	NM_030792		Approved	PP1665, GDE2	uc001owp.4	Q8WTR4		ENST00000336898.3:c.1780dupC	11.37:g.75146591_75146591dupG	ENSP00000337972:p.Ser594fs	Somatic	109	0		WXS	Illumina HiSeq	Phase_I	234	4	NM_030792	0	0	0	0	0	Q49AQ5|Q6UX76|Q7Z4S0|Q8N781|Q8NCB7|Q8TB77	Frame_Shift_Ins	INS	ENST00000336898.3	37	CCDS8238.1																																																																																			.		0.579	GDPD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384409.1	NM_030792	
CLIP1	6249	broad.mit.edu	37	12	122812690	122812691	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr12:122812690_122812691insT	ENST00000540338.1	-	16	3093_3094	c.3052_3053insA	c.(3052-3054)agcfs	p.S1018fs	CLIP1_ENST00000545889.1_Frame_Shift_Ins_p.S593fs|CLIP1_ENST00000361654.4_Frame_Shift_Ins_p.S896fs|CLIP1_ENST00000537178.1_Frame_Shift_Ins_p.S972fs|CLIP1_ENST00000302528.7_Frame_Shift_Ins_p.S1007fs|CLIP1_ENST00000358808.2_Frame_Shift_Ins_p.S1007fs			P30622	CLIP1_HUMAN	CAP-GLY domain containing linker protein 1	1018					microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|positive regulation of microtubule polymerization (GO:0031116)|transport (GO:0006810)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|intermediate filament (GO:0005882)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	metal ion binding (GO:0046872)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|nucleic acid binding (GO:0003676)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|endometrium(4)|kidney(5)|large_intestine(16)|liver(1)|lung(21)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		CTGGTTGTGGCTTGTTTCCATT	0.505																																					p.S1018fs													.	CLIP1-155	0			c.3053_3054insA						.																																			SO:0001589	frameshift_variant	6249	exon17			TTGTGGCTTGTTT		CCDS9232.1, CCDS9233.1, CCDS58285.1	12q24.3	2013-01-17	2007-01-05	2007-01-05	ENSG00000130779	ENSG00000130779			10461	protein-coding gene	gene with protein product	"""restin"""	179838	"""restin (Reed-Steinberg cell-expressed intermediate filament-associated protein)"""	RSN		8222754	Standard	NM_001247997		Approved	CYLN1, CLIP170, CLIP, CLIP-170	uc001ucg.2	P30622	OTTHUMG00000168922	ENST00000540338.1:c.3053dupA	12.37:g.122812692_122812692dupT	ENSP00000439093:p.Ser1018fs	Somatic	267	0		WXS	Illumina HiSeq	Phase_I	396	6	NM_001247997	0	0	0	0	0	A0AVD3|Q17RS4|Q29RG0	Frame_Shift_Ins	INS	ENST00000540338.1	37	CCDS58285.1																																																																																			.		0.505	CLIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000401625.1	NM_002956	
PEX13	5194	broad.mit.edu	37	2	61275734	61275735	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr2:61275734_61275735insG	ENST00000295030.5	+	4	1079_1080	c.1041_1042insG	c.(1042-1044)gttfs	p.V348fs		NM_002618.3	NP_002609.1	Q92968	PEX13_HUMAN	peroxisomal biogenesis factor 13	348					cerebral cortex cell migration (GO:0021795)|fatty acid alpha-oxidation (GO:0001561)|locomotory behavior (GO:0007626)|microtubule-based peroxisome localization (GO:0060152)|neuron migration (GO:0001764)|protein import into peroxisome matrix, docking (GO:0016560)|suckling behavior (GO:0001967)	integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)				endometrium(2)|large_intestine(2)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10			LUSC - Lung squamous cell carcinoma(5;2.05e-06)|Lung(5;3.13e-05)|Epithelial(17;0.114)			AATCAAGTAAAGTTTCCAAGCA	0.411																																					p.K347fs													.	PEX13-91	0			c.1041_1042insG						.																																			SO:0001589	frameshift_variant	5194	exon4			AAGTAAAGTTTCC	U71374	CCDS1866.1	2p16.1	2008-08-26	2008-08-26		ENSG00000162928	ENSG00000162928			8855	protein-coding gene	gene with protein product		601789	"""peroxisome biogenesis factor 13"""			9878256	Standard	NM_002618		Approved		uc002sau.4	Q92968	OTTHUMG00000129422	ENST00000295030.5:c.1042dupG	2.37:g.61275735_61275735dupG	ENSP00000295030:p.Val348fs	Somatic	126	0		WXS	Illumina HiSeq	Phase_I	79	8	NM_002618	0	0	0	0	0	B2RCS1	Frame_Shift_Ins	INS	ENST00000295030.5	37	CCDS1866.1																																																																																			.		0.411	PEX13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251581.3	NM_002618	
VHL	7428	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	10188203	10188204	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr3:10188203_10188204insT	ENST00000256474.2	+	2	1186_1187	c.346_347insT	c.(346-348)cttfs	p.L116fs	VHL_ENST00000345392.2_Intron|VHL_ENST00000477538.1_3'UTR	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	116	Involved in binding to CCT complex.		L -> V (in VHLD). {ECO:0000269|PubMed:8730290}.		cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.?(3)|p.L116fs*43(3)|p.W117fs*14(2)|p.L116V(1)|p.H115fs*15(1)|p.L116fs*16(1)|p.W117fs*42(1)|p.H115fs*41(1)|p.H115fs*42(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		GATAGGTCACCTTTGGCTCTTC	0.53		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																												p.L116fs		.	yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	.	VHL-6694	14	Deletion - Frameshift(9)|Unknown(3)|Substitution - Missense(1)|Insertion - Frameshift(1)	kidney(14)	c.346_347insT	GRCh37	CM961424	VHL	M		.																																			SO:0001589	frameshift_variant	7428	exon2	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	.	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.349dupT	3.37:g.10188206_10188206dupT	ENSP00000256474:p.Leu116fs	Somatic	308	0		WXS	Illumina HiSeq	Phase_I	443	81	NM_000551	0	0	0	0	0	B2RE45|Q13599|Q6PDA9	Frame_Shift_Ins	INS	ENST00000256474.2	37	CCDS2597.1																																																																																			.		0.530	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1	NM_000551	
METTL17	64745	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	21464718	21464719	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	GG	GG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr14:21464718_21464719GG>TT	ENST00000339374.6	+	13	1346_1347	c.1113_1114GG>TT	c.(1111-1116)atGGtg>atTTtg	p.371_372MV>IL	SLC39A2_ENST00000298681.4_5'Flank|SLC39A2_ENST00000554422.1_5'Flank|RP11-84C10.4_ENST00000557335.1_RNA|METTL17_ENST00000382985.4_Missense_Mutation_p.371_372MV>IL|METTL17_ENST00000556670.2_Missense_Mutation_p.371_372MV>IL	NM_001029991.1|NM_022734.2	NP_001025162.1|NP_073571.1	Q9H7H0	MET17_HUMAN	methyltransferase like 17	371					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	copper ion binding (GO:0005507)|methyltransferase activity (GO:0008168)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|skin(2)	20						AGTTCTCTATGGTGATCCTTGC	0.465																																					p.MV371IL		.											.	METTL17	0			c.G1114T						.																																			SO:0001583	missense	64745	exon13			TCTATGGTGATCC	AK024512	CCDS9562.1, CCDS41913.1	14q11.2	2011-03-03	2011-03-02	2011-03-02	ENSG00000165792	ENSG00000165792			19280	protein-coding gene	gene with protein product			"""methyltransferase 11 domain containing 1"""	METT11D1		11278769	Standard	XM_006720235		Approved	FLJ20859	uc001vyn.3	Q9H7H0	OTTHUMG00000029610	Exception_encountered	14.37:g.21464718_21464719delinsTT	ENSP00000343041:p.M371_V372delinsIL	Somatic	171.0	0.0		WXS	Illumina HiSeq	Phase_I	164.0	25.0		0	0	0	0	0	Q9BSH1|Q9BZH2|Q9BZH3	Missense_Mutation	DNP	ENST00000339374.6	37	CCDS9562.1																																																																																			.		0.465	METTL17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073804.4	NM_022734	
ZNF512B	57473	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	62598869	62598870	+	Missense_Mutation	DNP	CG	CG	AA			TCGA-AL-3473-01A-01D-1252-08	TCGA-AL-3473-10A-01D-1252-08	CG	CG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	23f15c01-fc74-46bf-8ba5-afc140084aa1	0e794ded-be71-4cd3-932d-121f1b81ecf2	g.chr20:62598869_62598870CG>AA	ENST00000450537.1	-	3	188_189	c.128_129CG>TT	c.(127-129)cCG>cTT	p.P43L	ZNF512B_ENST00000217130.3_Missense_Mutation_p.P43L|ZNF512B_ENST00000369888.1_Missense_Mutation_p.P43L			Q96KM6	Z512B_HUMAN	zinc finger protein 512B	43					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					CACGGACCACCGGCATCCCTGC	0.639																																					p.P43L		.											.	ZNF512B	0			c.C128T						.																																			SO:0001583	missense	57473	exon3			ACCACCGGCATCC	AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.128_129delinsAA	20.37:g.62598869_62598870delinsAA	ENSP00000393795:p.Pro43Leu	Somatic	198.0	0.0		WXS	Illumina HiSeq	Phase_I	417.0	69.0		0	0	0	0	0	Q08AK9|Q9ULM4	Missense_Mutation	DNP	ENST00000450537.1	37	CCDS13548.1																																																																																			.		0.639	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080246.1	NM_020713	
