#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
GABRD	2563	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	1960690	1960690	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr1:1960690G>A	ENST00000378585.4	+	7	915	c.832G>A	c.(832-834)Gcc>Acc	p.A278T		NM_000815.4	NP_000806.2	O14764	GBRD_HUMAN	gamma-aminobutyric acid (GABA) A receptor, delta	278					signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			central_nervous_system(2)|endometrium(3)|kidney(2)|lung(8)|ovary(2)|prostate(1)|skin(2)	20	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;2.7e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.19e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.17e-24)|GBM - Glioblastoma multiforme(42;9.56e-08)|Colorectal(212;4.12e-05)|COAD - Colon adenocarcinoma(227;0.000194)|Kidney(185;0.00231)|BRCA - Breast invasive adenocarcinoma(365;0.00441)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0344)|Lung(427;0.2)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GGCGGTGCCCGCCAGGGTGTC	0.682																																					p.A278T		.											.	GABRD-92	0			c.G832A						.						37.0	32.0	34.0					1																	1960690		2180	4269	6449	SO:0001583	missense	2563	exon7			GTGCCCGCCAGGG	BC033801	CCDS36.1	1p36.3	2012-06-22			ENSG00000187730	ENSG00000187730		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4084	protein-coding gene	gene with protein product	"""GABA(A) receptor, delta"""	137163				2176788, 10965146	Standard	NM_000815		Approved		uc001aip.2	O14764	OTTHUMG00000041064	ENST00000378585.4:c.832G>A	1.37:g.1960690G>A	ENSP00000367848:p.Ala278Thr	Somatic	74	0		WXS	Illumina HiSeq	Phase_I	56	9	NM_000815	0	0	2	2	0	Q8N4N9	Missense_Mutation	SNP	ENST00000378585.4	37	CCDS36.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.624127	0.87560	.	.	ENSG00000187730	ENST00000378585	D	0.86164	-2.08	4.23	4.23	0.50019	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.95198	0.8443	H	0.94771	3.58	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.96541	0.9400	10	0.87932	D	0	-18.1939	16.1634	0.81734	0.0:0.0:1.0:0.0	.	278	O14764	GBRD_HUMAN	T	278	ENSP00000367848:A278T	ENSP00000367848:A278T	A	+	1	0	GABRD	1950550	1.000000	0.71417	0.998000	0.56505	0.588000	0.36517	9.302000	0.96175	2.367000	0.80283	0.655000	0.94253	GCC	.		0.682	GABRD-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098493.1	NM_000815	
ARID1A	8289	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	27100918	27100918	+	Silent	SNP	T	T	C			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr1:27100918T>C	ENST00000324856.7	+	18	4571	c.4200T>C	c.(4198-4200)ccT>ccC	p.P1400P	ARID1A_ENST00000540690.1_Intron|ARID1A_ENST00000374152.2_Silent_p.P1017P|ARID1A_ENST00000457599.2_Intron	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1400	Gln-rich.				androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		AGGGGCAGCCTCAGCAGCAGC	0.602			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.P1400P				Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	ARID1A-584	0			c.T4200C						.						43.0	42.0	42.0					1																	27100918		2203	4298	6501	SO:0001819	synonymous_variant	8289	exon18			GCAGCCTCAGCAG	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.4200T>C	1.37:g.27100918T>C		Somatic	198	1		WXS	Illumina HiSeq	Phase_I	136	33	NM_006015	0	0	1	1	0	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Silent	SNP	ENST00000324856.7	37	CCDS285.1	.	.	.	.	.	.	.	.	.	.	T	6.383	0.438690	0.12104	.	.	ENSG00000117713	ENST00000430799	.	.	.	5.84	-2.21	0.06973	.	.	.	.	.	T	0.42517	0.1206	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.34875	-0.9811	4	.	.	.	-2.6103	3.654	0.08214	0.1906:0.2999:0.399:0.1105	.	.	.	.	P	297	.	.	S	+	1	0	ARID1A	26973505	0.996000	0.38824	0.991000	0.47740	0.939000	0.58152	0.430000	0.21428	-0.039000	0.13602	-0.313000	0.08912	TCA	.		0.602	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
NUDC	10726	broad.mit.edu	37	1	27268248	27268248	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr1:27268248A>G	ENST00000321265.5	+	4	491	c.368A>G	c.(367-369)aAg>aGg	p.K123R		NM_006600.3	NP_006591.1	Q9Y266	NUDC_HUMAN	nudC nuclear distribution protein	123					cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|nucleoplasm (GO:0005654)				cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|ovary(1)	8				UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;6.1e-51)|OV - Ovarian serous cystadenocarcinoma(117;2.87e-29)|Colorectal(126;5.74e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000281)|STAD - Stomach adenocarcinoma(196;0.000604)|KIRC - Kidney renal clear cell carcinoma(1967;0.000739)|READ - Rectum adenocarcinoma(331;0.0421)		CCCCAGAAAAAGGATGCAGAG	0.597																																					p.K123R													.	NUDC-91	0			c.A368G						.						63.0	59.0	60.0					1																	27268248		2203	4300	6503	SO:0001583	missense	10726	exon4			AGAAAAAGGATGC		CCDS292.1	1p35-p34	2013-08-06	2013-08-06		ENSG00000090273	ENSG00000090273			8045	protein-coding gene	gene with protein product		610325	"""nuclear distribution gene C homolog (A. nidulans)"", ""nuclear distribution C homolog (A. nidulans)"""				Standard	NM_006600		Approved	NudC	uc001bng.2	Q9Y266	OTTHUMG00000004226	ENST00000321265.5:c.368A>G	1.37:g.27268248A>G	ENSP00000319664:p.Lys123Arg	Somatic	243	0		WXS	Illumina HiSeq	Phase_I	162	4	NM_006600	0	0	0	0	0	Q5QP31|Q5QP35|Q9H0N2|Q9Y2B6	Missense_Mutation	SNP	ENST00000321265.5	37	CCDS292.1	.	.	.	.	.	.	.	.	.	.	A	13.60	2.286148	0.40394	.	.	ENSG00000090273	ENST00000435827;ENST00000321265;ENST00000452707	D	0.81908	-1.55	4.37	3.23	0.37069	.	0.090778	0.85682	D	0.000000	D	0.87414	0.6171	M	0.86502	2.82	0.43110	D	0.994819	D;B	0.58268	0.982;0.092	P;B	0.54664	0.758;0.086	D	0.85550	0.1221	10	0.40728	T	0.16	.	7.0842	0.25247	0.8125:0.0:0.1875:0.0	.	74;123	Q9H2R7;Q9Y266	.;NUDC_HUMAN	R	127;123;74	ENSP00000319664:K123R	ENSP00000319664:K123R	K	+	2	0	NUDC	27140835	1.000000	0.71417	1.000000	0.80357	0.810000	0.45777	3.248000	0.51430	0.847000	0.35167	0.533000	0.62120	AAG	.		0.597	NUDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012172.2		
FGR	2268	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	27943445	27943445	+	Missense_Mutation	SNP	T	T	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr1:27943445T>A	ENST00000374005.3	-	7	893	c.605A>T	c.(604-606)aAa>aTa	p.K202I	FGR_ENST00000399173.1_Missense_Mutation_p.K202I|FGR_ENST00000545953.1_Missense_Mutation_p.K136I|FGR_ENST00000374004.1_Missense_Mutation_p.K202I	NM_005248.2	NP_005239.1	P09769	FGR_HUMAN	FGR proto-oncogene, Src family tyrosine kinase	202	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				blood coagulation (GO:0007596)|defense response to Gram-positive bacterium (GO:0050830)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response-regulating cell surface receptor signaling pathway (GO:0002768)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell shape (GO:0008360)|regulation of innate immune response (GO:0045088)|regulation of phagocytosis (GO:0050764)|regulation of protein kinase activity (GO:0045859)|response to virus (GO:0009615)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|Fc-gamma receptor I complex binding (GO:0034988)|immunoglobulin receptor binding (GO:0034987)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphotyrosine binding (GO:0001784)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|skin(4)	16		all_lung(284;2.05e-05)|Colorectal(325;3.46e-05)|Lung NSC(340;3.67e-05)|Renal(390;0.00121)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.25e-24)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00244)|KIRC - Kidney renal clear cell carcinoma(1967;0.0027)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		CATGTCCAGTTTGCGGATCTT	0.562																																					p.K202I		.											.	FGR-547	0			c.A605T						.						172.0	152.0	159.0					1																	27943445		2203	4300	6503	SO:0001583	missense	2268	exon7			TCCAGTTTGCGGA	BC064382	CCDS305.1	1p36.2-p36.1	2014-06-25	2014-06-25		ENSG00000000938	ENSG00000000938		"""SH2 domain containing"""	3697	protein-coding gene	gene with protein product		164940	"""Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog"", ""v-fgr feline Gardner-Rasheed sarcoma viral oncogene homolog"", ""feline Gardner-Rasheed sarcoma viral oncogene homolog"""	SRC2		3922831	Standard	NM_001042729		Approved	c-fgr, p55c-fgr	uc001bom.3	P09769	OTTHUMG00000003516	ENST00000374005.3:c.605A>T	1.37:g.27943445T>A	ENSP00000363117:p.Lys202Ile	Somatic	199	0		WXS	Illumina HiSeq	Phase_I	139	29	NM_001042729	0	0	21	21	0	D3DPL7|Q9UIQ3	Missense_Mutation	SNP	ENST00000374005.3	37	CCDS305.1	.	.	.	.	.	.	.	.	.	.	T	16.35	3.098543	0.56183	.	.	ENSG00000000938	ENST00000374005;ENST00000545953;ENST00000399173;ENST00000374004;ENST00000374003;ENST00000457296	D;D;D;D;D;D	0.89415	-2.51;-2.51;-2.51;-2.51;-2.51;-2.51	4.38	4.38	0.52667	SH2 motif (5);	0.000000	0.56097	D	0.000024	D	0.90662	0.7071	M	0.81497	2.545	0.32422	N	0.549198	B	0.22080	0.064	B	0.36289	0.221	D	0.92358	0.5895	10	0.62326	D	0.03	.	13.1133	0.59285	0.0:0.0:0.0:1.0	.	202	P09769	FGR_HUMAN	I	202;136;202;202;202;202	ENSP00000363117:K202I;ENSP00000445302:K136I;ENSP00000382126:K202I;ENSP00000363116:K202I;ENSP00000363115:K202I;ENSP00000407670:K202I	ENSP00000363115:K202I	K	-	2	0	FGR	27816032	1.000000	0.71417	0.927000	0.36925	0.561000	0.35649	8.040000	0.89188	1.903000	0.55091	0.402000	0.26972	AAA	.		0.562	FGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009772.1	NM_005248	
MRPS15	64960	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	36921882	36921882	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr1:36921882A>G	ENST00000373116.5	-	7	703	c.542T>C	c.(541-543)aTa>aCa	p.I181T	MRPS15_ENST00000488606.1_5'UTR	NM_031280.3	NP_112570.2	P82914	RT15_HUMAN	mitochondrial ribosomal protein S15	181					translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)|nuclear membrane (GO:0031965)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)	14		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CCCCCAGCATATCTTCTCAAA	0.498																																					p.I181T		.											.	MRPS15-91	0			c.T542C						.						93.0	87.0	89.0					1																	36921882		2203	4300	6503	SO:0001583	missense	64960	exon7			CAGCATATCTTCT	AB049946	CCDS411.1	1p34.3	2012-09-13			ENSG00000116898	ENSG00000116898		"""Mitochondrial ribosomal proteins / small subunits"""	14504	protein-coding gene	gene with protein product		611979					Standard	NM_031280		Approved	FLJ11564	uc001cas.2	P82914	OTTHUMG00000008042	ENST00000373116.5:c.542T>C	1.37:g.36921882A>G	ENSP00000362208:p.Ile181Thr	Somatic	67	0		WXS	Illumina HiSeq	Phase_I	72	22	NM_031280	0	0	109	189	80	B2RD82|Q9H2K1	Missense_Mutation	SNP	ENST00000373116.5	37	CCDS411.1	.	.	.	.	.	.	.	.	.	.	A	0.013	-1.615508	0.00828	.	.	ENSG00000116898	ENST00000373116	.	.	.	6.17	-2.05	0.07321	S15/NS1, RNA-binding (2);	0.501132	0.23960	N	0.042864	T	0.19846	0.0477	N	0.14661	0.345	0.09310	N	0.999999	B	0.09022	0.002	B	0.09377	0.004	T	0.29971	-0.9994	9	0.07813	T	0.8	-14.528	12.7078	0.57070	0.5586:0.0:0.4414:0.0	.	181	P82914	RT15_HUMAN	T	181	.	ENSP00000362208:I181T	I	-	2	0	MRPS15	36694469	0.606000	0.26949	0.007000	0.13788	0.015000	0.08874	1.243000	0.32767	-0.243000	0.09653	-0.899000	0.02877	ATA	.		0.498	MRPS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022052.2	NM_031280	
BCAR3	8412	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	94033045	94033045	+	Missense_Mutation	SNP	G	G	C			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr1:94033045G>C	ENST00000370244.1	-	13	2378	c.2090C>G	c.(2089-2091)tCc>tGc	p.S697C	BCAR3_ENST00000539242.1_Missense_Mutation_p.S373C|BCAR3_ENST00000370247.3_Missense_Mutation_p.S606C|BCAR3_ENST00000260502.6_Missense_Mutation_p.S697C|BCAR3_ENST00000370243.1_Missense_Mutation_p.S697C	NM_001261408.1	NP_001248337.1	O75815	BCAR3_HUMAN	breast cancer anti-estrogen resistance 3	697	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				lens morphogenesis in camera-type eye (GO:0002089)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|response to drug (GO:0042493)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)		guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(1)	25		all_lung(203;0.00145)|Lung NSC(277;0.00662)		all cancers(265;0.0126)|GBM - Glioblastoma multiforme(16;0.0467)|Epithelial(280;0.166)		AACACATGTGGACTCTGAAGA	0.463																																					p.S697C		.											.	BCAR3-228	0			c.C2090G						.						103.0	107.0	105.0					1																	94033045		2203	4300	6503	SO:0001583	missense	8412	exon11			CATGTGGACTCTG	U92715	CCDS745.1, CCDS58010.1	1p22.1	2013-02-14			ENSG00000137936	ENSG00000137936		"""SH2 domain containing"""	973	protein-coding gene	gene with protein product		604704				9582273	Standard	NM_001261408		Approved	NSP2, SH2D3B	uc001dpz.4	O75815	OTTHUMG00000010301	ENST00000370244.1:c.2090C>G	1.37:g.94033045G>C	ENSP00000359264:p.Ser697Cys	Somatic	99	0		WXS	Illumina HiSeq	Phase_I	63	14	NM_001261409	0	0	0	0	0	D3DT43|Q5TEW3|Q6UW40|Q9BR50	Missense_Mutation	SNP	ENST00000370244.1	37	CCDS745.1	.	.	.	.	.	.	.	.	.	.	G	17.79	3.475298	0.63737	.	.	ENSG00000137936	ENST00000370247;ENST00000260502;ENST00000370244;ENST00000370243;ENST00000539242	T;T;T;T;T	0.34667	1.35;1.35;1.35;1.35;1.35	5.85	4.92	0.64577	Guanine-nucleotide dissociation stimulator CDC25 (3);Ras guanine nucleotide exchange factor, domain (1);	0.709965	0.14950	N	0.288969	T	0.26521	0.0648	L	0.53249	1.67	0.09310	N	1	P;P	0.52692	0.955;0.955	P;P	0.52598	0.703;0.703	T	0.12400	-1.0549	10	0.38643	T	0.18	-19.933	7.5531	0.27808	0.1189:0.0:0.7329:0.1482	.	697;606	O75815;Q5TEW3	BCAR3_HUMAN;.	C	606;697;697;697;373	ENSP00000359267:S606C;ENSP00000260502:S697C;ENSP00000359264:S697C;ENSP00000359263:S697C;ENSP00000441343:S373C	ENSP00000260502:S697C	S	-	2	0	BCAR3	93805633	1.000000	0.71417	0.201000	0.23476	0.452000	0.32318	3.862000	0.56009	1.434000	0.47414	0.655000	0.94253	TCC	.		0.463	BCAR3-003	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028420.1		
DRAM2	128338	broad.mit.edu	37	1	111667502	111667502	+	Splice_Site	SNP	G	G	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr1:111667502G>T	ENST00000286692.4	-	5	818	c.201C>A	c.(199-201)tgC>tgA	p.C67*	DRAM2_ENST00000484310.1_5'UTR|DRAM2_ENST00000539140.1_Splice_Site_p.C67*			Q6UX65	DRAM2_HUMAN	DNA-damage regulated autophagy modulator 2	67					apoptotic process (GO:0006915)|regulation of autophagy (GO:0010506)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|microtubule cytoskeleton (GO:0015630)				endometrium(1)|large_intestine(5)|lung(3)	9						TGGTAGCAATGCCTGGGAAAA	0.358																																					p.C67X													.	DRAM2-90	0			c.C201A						.						64.0	60.0	61.0					1																	111667502		2203	4300	6503	SO:0001630	splice_region_variant	128338	exon5			AGCAATGCCTGGG	AY336747	CCDS30801.1	1p13.3	2010-07-08	2009-06-12	2009-06-12	ENSG00000156171	ENSG00000156171			28769	protein-coding gene	gene with protein product		613360	"""transmembrane protein 77"""	TMEM77		12975309	Standard	NM_178454		Approved	MGC54289, PRO180, WWFQ154, RP5-1180E21.1	uc001ead.4	Q6UX65	OTTHUMG00000011911	ENST00000286692.4:c.200-1C>A	1.37:g.111667502G>T		Somatic	76	0		WXS	Illumina HiSeq	Phase_I	63	4	NM_178454	0	0	0	0	0	B3SUG9|Q4VWF6|Q86VD3|Q8NBQ4	Nonsense_Mutation	SNP	ENST00000286692.4	37	CCDS30801.1	.	.	.	.	.	.	.	.	.	.	G	32	5.181425	0.94885	.	.	ENSG00000156171	ENST00000286692;ENST00000539140	.	.	.	6.17	-0.548	0.11833	.	0.205806	0.49916	D	0.000140	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	.	4.0975	0.09998	0.4393:0.0:0.4001:0.1606	.	.	.	.	X	67	.	ENSP00000286692:C67X	C	-	3	2	DRAM2	111469025	0.001000	0.12720	0.740000	0.30986	0.933000	0.57130	-0.417000	0.07088	0.197000	0.20387	-0.140000	0.14226	TGC	.		0.358	DRAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032930.3	NM_178454	Nonsense_Mutation
FLG	2312	broad.mit.edu	37	1	152276113	152276113	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr1:152276113G>T	ENST00000368799.1	-	3	11284	c.11249C>A	c.(11248-11250)gCg>gAg	p.A3750E	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3750	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTCTTGGGACGCTGAGTGCCT	0.602									Ichthyosis																												p.A3750E													.	FLG-106	0			c.C11249A						.						288.0	285.0	286.0					1																	152276113		2203	4297	6500	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	TGGGACGCTGAGT	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.11249C>A	1.37:g.152276113G>T	ENSP00000357789:p.Ala3750Glu	Somatic	140	0		WXS	Illumina HiSeq	Phase_I	140	4	NM_002016	0	0	0	0	0	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	G	6.071	0.381482	0.11524	.	.	ENSG00000143631	ENST00000368799	T	0.01804	4.63	3.25	-6.5	0.01884	.	.	.	.	.	T	0.01029	0.0034	M	0.70595	2.14	0.09310	N	1	D	0.71674	0.998	D	0.67900	0.954	T	0.49360	-0.8948	9	0.07325	T	0.83	.	1.64	0.02750	0.1646:0.2649:0.4071:0.1633	.	3750	P20930	FILA_HUMAN	E	3750	ENSP00000357789:A3750E	ENSP00000357789:A3750E	A	-	2	0	FLG	150542737	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-4.206000	0.00274	-4.070000	0.00076	-1.430000	0.01095	GCG	.		0.602	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
GON4L	54856	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	155734744	155734744	+	Intron	SNP	A	A	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr1:155734744A>G	ENST00000368331.1	-	21	4522				GON4L_ENST00000437809.1_Intron|GON4L_ENST00000361040.5_Missense_Mutation_p.M1507T|GON4L_ENST00000471341.1_5'UTR|GON4L_ENST00000271883.5_Intron	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)						regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					TAAGTGATACATATTACTGAG	0.398																																					p.M1507T		.											.	GON4L-93	0			c.T4520C						.						84.0	76.0	78.0					1																	155734744		2203	4300	6503	SO:0001627	intron_variant	54856	exon21			TGATACATATTAC	AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.4473+46T>C	1.37:g.155734744A>G		Somatic	299	0		WXS	Illumina HiSeq	Phase_I	303	86	NM_032292	0	0	6	9	3	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Missense_Mutation	SNP	ENST00000368331.1	37		.	.	.	.	.	.	.	.	.	.	A	10.67	1.416623	0.25552	.	.	ENSG00000116580	ENST00000361040	T	0.11277	2.79	4.47	-0.731	0.11151	.	.	.	.	.	T	0.01489	0.0048	N	0.08118	0	0.09310	N	1	B	0.13594	0.008	B	0.11329	0.006	T	0.46693	-0.9173	9	0.87932	D	0	.	4.9844	0.14182	0.5165:0.3159:0.1676:0.0	.	1507	Q3T8J9-2	.	T	1507	ENSP00000354322:M1507T	ENSP00000354322:M1507T	M	-	2	0	GON4L	154001368	0.000000	0.05858	0.000000	0.03702	0.121000	0.20230	-0.744000	0.04839	-0.308000	0.08792	0.378000	0.23410	ATG	.		0.398	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_032292	
GORAB	92344	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	170508438	170508438	+	Missense_Mutation	SNP	A	A	C			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr1:170508438A>C	ENST00000367763.3	+	2	244	c.224A>C	c.(223-225)aAa>aCa	p.K75T	GORAB_ENST00000367762.1_Missense_Mutation_p.K75T|GORAB_ENST00000465717.1_3'UTR	NM_152281.2	NP_689494.2	Q5T7V8	GORAB_HUMAN	golgin, RAB6-interacting	75						cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)				endometrium(2)|large_intestine(3)|liver(2)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	17						CAAAGCCAAAAACTTGGGCTT	0.443																																					p.K75T		.											.	GORAB-90	0			c.A224C						.						107.0	102.0	104.0					1																	170508438		2203	4300	6503	SO:0001583	missense	92344	exon2			GCCAAAAACTTGG	AK021814	CCDS1289.1, CCDS53428.1	1q24.2	2009-02-13	2009-02-13	2009-02-13	ENSG00000120370	ENSG00000120370			25676	protein-coding gene	gene with protein product	"""gerodermia osteodysplastica"""	607983	"""SCY1-like 1 binding protein 1"""	SCYL1BP1		12783284, 15781263, 18997784	Standard	NM_152281		Approved	FLJ11752, NTKL-BP1, GO	uc001gha.2	Q5T7V8	OTTHUMG00000035228	ENST00000367763.3:c.224A>C	1.37:g.170508438A>C	ENSP00000356737:p.Lys75Thr	Somatic	164	0		WXS	Illumina HiSeq	Phase_I	149	39	NM_152281	0	0	0	1	1	Q49A22|Q6P1P9|Q9HAE6|Q9Y350	Missense_Mutation	SNP	ENST00000367763.3	37	CCDS1289.1	.	.	.	.	.	.	.	.	.	.	A	16.66	3.186138	0.57909	.	.	ENSG00000120370	ENST00000367763;ENST00000367762	T;T	0.63580	-0.05;-0.05	5.49	4.37	0.52481	.	0.297450	0.41194	D	0.000932	T	0.62307	0.2417	M	0.70275	2.135	0.32365	N	0.556672	D	0.71674	0.998	D	0.66351	0.943	T	0.66268	-0.5966	10	0.56958	D	0.05	-12.6953	6.2817	0.21011	0.7838:0.0:0.0755:0.1408	.	75	Q5T7V8	GORAB_HUMAN	T	75	ENSP00000356737:K75T;ENSP00000356736:K75T	ENSP00000356736:K75T	K	+	2	0	GORAB	168775062	1.000000	0.71417	1.000000	0.80357	0.654000	0.38779	2.106000	0.41835	0.919000	0.36945	0.528000	0.53228	AAA	.		0.443	GORAB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085226.1	NM_152281	
TEDDM1	127670	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	182369011	182369011	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr1:182369011A>G	ENST00000367565.1	-	1	740	c.610T>C	c.(610-612)Tgg>Cgg	p.W204R		NM_172000.3	NP_741997.3	Q5T9Z0	TEDM1_HUMAN	transmembrane epididymal protein 1	204						integral component of membrane (GO:0016021)				haematopoietic_and_lymphoid_tissue(1)|lung(4)|ovary(2)	7						ATCACATGCCAGCAGAAGAAG	0.488																																					p.W204R													.	TEDDM1-92	0			c.T610C						.						96.0	87.0	90.0					1																	182369011		2203	4300	6503	SO:0001583	missense	127670	exon1			CATGCCAGCAGAA	AJ515384	CCDS30953.1	1q25.3	2009-09-17		2005-08-09	ENSG00000203730	ENSG00000203730			30233	protein-coding gene	gene with protein product	"""putative membrane protein HE9"", ""transmembrane protein 45C"", ""epididymal protein 9"""						Standard	NM_172000		Approved	HE9, Epdd1, TMEM45C, EDDM9	uc001gpe.3	Q5T9Z0	OTTHUMG00000037398	ENST00000367565.1:c.610T>C	1.37:g.182369011A>G	ENSP00000356536:p.Trp204Arg	Somatic	132	1		WXS	Illumina HiSeq	Phase_I	114	29	NM_172000	0	0	0	0	0	Q8IVJ0	Missense_Mutation	SNP	ENST00000367565.1	37	CCDS30953.1	.	.	.	.	.	.	.	.	.	.	A	17.12	3.307925	0.60305	.	.	ENSG00000203730	ENST00000367565	T	0.53857	0.6	4.82	3.7	0.42460	.	0.000000	0.64402	D	0.000014	T	0.72252	0.3437	M	0.86864	2.845	0.33542	D	0.595044	D	0.89917	1.0	D	0.97110	1.0	T	0.80144	-0.1505	10	0.87932	D	0	-25.2564	8.2528	0.31737	0.9058:0.0:0.0942:0.0	.	204	Q5T9Z0	TEDM1_HUMAN	R	204	ENSP00000356536:W204R	ENSP00000356536:W204R	W	-	1	0	TEDDM1	180635634	1.000000	0.71417	0.999000	0.59377	0.944000	0.59088	2.946000	0.49050	0.880000	0.35969	0.460000	0.39030	TGG	.		0.488	TEDDM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091029.1	NM_172000	
EIF2D	1939	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	206767112	206767112	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr1:206767112C>T	ENST00000271764.2	-	14	1748	c.1540G>A	c.(1540-1542)Ggt>Agt	p.G514S	EIF2D_ENST00000367114.3_Missense_Mutation_p.G390S|EIF2D_ENST00000472709.2_Intron	NM_006893.2	NP_008824.2	P41214	EIF2D_HUMAN	eukaryotic translation initiation factor 2D	514	SUI1. {ECO:0000255|PROSITE- ProRule:PRU00200}.				formation of translation preinitiation complex (GO:0001731)|intracellular protein transport (GO:0006886)|IRES-dependent translational initiation (GO:0002192)|ribosome disassembly (GO:0032790)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	receptor activity (GO:0004872)|translation initiation factor activity (GO:0003743)			autonomic_ganglia(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	23						GGGTCCAGACCATAGGCCTCC	0.622																																					p.G514S		.											.	EIF2D-92	0			c.G1540A						.						59.0	53.0	55.0					1																	206767112		2203	4300	6503	SO:0001583	missense	1939	exon14			CCAGACCATAGGC	BC001585	CCDS1465.1, CCDS55680.1	1q32.1	2014-05-06	2011-01-19	2011-01-19	ENSG00000143486	ENSG00000143486			6583	protein-coding gene	gene with protein product		613709				20566627	Standard	NM_001201478		Approved	LGTN	uc001heh.2	P41214	OTTHUMG00000184619	ENST00000271764.2:c.1540G>A	1.37:g.206767112C>T	ENSP00000271764:p.Gly514Ser	Somatic	45	0		WXS	Illumina HiSeq	Phase_I	37	8	NM_006893	0	0	82	122	40	Q5SY40|Q8IXV3|Q96DG3|Q96TG7|Q9NR27|Q9NSN0|Q9NV18|Q9NZ21	Missense_Mutation	SNP	ENST00000271764.2	37	CCDS1465.1	.	.	.	.	.	.	.	.	.	.	C	35	5.545011	0.96488	.	.	ENSG00000143486	ENST00000367114;ENST00000271764	T;T	0.31510	1.49;1.49	5.68	5.68	0.88126	Translation initiation factor SUI1 (3);	0.000000	0.85682	D	0.000000	T	0.55273	0.1910	M	0.72479	2.2	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.97110	1.0;0.976	T	0.44050	-0.9353	10	0.21540	T	0.41	-19.8057	18.7742	0.91904	0.0:1.0:0.0:0.0	.	390;514	P41214-2;P41214	.;EIF2D_HUMAN	S	390;514	ENSP00000356081:G390S;ENSP00000271764:G514S	ENSP00000271764:G514S	G	-	1	0	EIF2D	204833735	1.000000	0.71417	0.991000	0.47740	0.995000	0.86356	7.586000	0.82596	2.676000	0.91093	0.563000	0.77884	GGT	.		0.622	EIF2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088475.1	NM_006893	
PLXNA2	5362	broad.mit.edu	37	1	208257763	208257763	+	Missense_Mutation	SNP	G	G	A	rs374437126		TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr1:208257763G>A	ENST00000367033.3	-	10	3017	c.2260C>T	c.(2260-2262)Cgc>Tgc	p.R754C		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	754					axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		CTGTTGAAGCGCAGAGCGGGG	0.622																																					p.R754C													.	PLXNA2-92	0			c.C2260T						.	G	CYS/ARG	0,4406		0,0,2203	64.0	70.0	68.0		2260	5.7	1.0	1		68	1,8599	1.2+/-3.3	0,1,4299	no	missense	PLXNA2	NM_025179.3	180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	754/1895	208257763	1,13005	2203	4300	6503	SO:0001583	missense	5362	exon10			TGAAGCGCAGAGC	X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.2260C>T	1.37:g.208257763G>A	ENSP00000356000:p.Arg754Cys	Somatic	112	0		WXS	Illumina HiSeq	Phase_I	66	3	NM_025179	0	0	0	0	0	A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Missense_Mutation	SNP	ENST00000367033.3	37	CCDS31013.1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.856472	0.91355	0.0	1.16E-4	ENSG00000076356	ENST00000367033	T	0.01025	5.43	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.08044	0.0201	M	0.90425	3.115	0.80722	D	1	D	0.89917	1.0	D	0.65443	0.935	T	0.01087	-1.1456	10	0.56958	D	0.05	.	19.8253	0.96616	0.0:0.0:1.0:0.0	.	754	O75051	PLXA2_HUMAN	C	754	ENSP00000356000:R754C	ENSP00000356000:R754C	R	-	1	0	PLXNA2	206324386	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	7.527000	0.81931	2.676000	0.91093	0.650000	0.86243	CGC	.		0.622	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088932.6	NM_025179	
TP53BP2	7159	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	223983631	223983631	+	Missense_Mutation	SNP	C	C	A	rs376978247		TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr1:223983631C>A	ENST00000343537.7	-	13	2901	c.2610G>T	c.(2608-2610)gaG>gaT	p.E870D	TP53BP2_ENST00000391879.2_Missense_Mutation_p.E103D|TP53BP2_ENST00000391878.2_Missense_Mutation_p.E741D|TP53BP2_ENST00000498843.1_5'UTR	NM_001031685.2	NP_001026855.2	Q13625	ASPP2_HUMAN	tumor protein p53 binding protein 2	864	Pro-rich.				cell cycle (GO:0007049)|central nervous system development (GO:0007417)|embryo development ending in birth or egg hatching (GO:0009792)|heart development (GO:0007507)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)|positive regulation of signal transduction (GO:0009967)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(131;0.0958)		GAGGGTACTCCTCCAGGTACA	0.572																																					p.E870D		.											.	TP53BP2-229	0			c.G2610T						.						104.0	105.0	105.0					1																	223983631		2203	4300	6503	SO:0001583	missense	7159	exon13			GTACTCCTCCAGG	U09582	CCDS1538.1, CCDS44319.1	1q41	2014-06-24	2014-06-24		ENSG00000143514	ENSG00000143514		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	12000	protein-coding gene	gene with protein product		602143	"""tumor protein p53-binding protein, 2"""			8668206, 8016121	Standard	NM_005426		Approved	PPP1R13A, ASPP2, 53BP2	uc010pvb.2	Q13625	OTTHUMG00000037379	ENST00000343537.7:c.2610G>T	1.37:g.223983631C>A	ENSP00000341957:p.Glu870Asp	Somatic	81	0		WXS	Illumina HiSeq	Phase_I	72	19	NM_001031685	0	0	3	8	5	B4DG66|Q12892|Q86X75|Q96KQ3	Missense_Mutation	SNP	ENST00000343537.7	37	CCDS44319.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.85|16.85	3.235801|3.235801	0.58886|0.58886	.|.	.|.	ENSG00000143514|ENSG00000143514	ENST00000391878;ENST00000343537;ENST00000391879|ENST00000494100	T;T;T|.	0.54279|.	0.68;0.85;0.58|.	5.55|5.55	3.32|3.32	0.38043|0.38043	Src homology-3 domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.60702|.	0.2289|.	L|L	0.60455|0.60455	1.87|1.87	0.80722|0.80722	D|D	1|1	D;D|.	0.69078|.	0.997;0.997|.	D;D|.	0.72625|.	0.978;0.978|.	T|.	0.54938|.	-0.8218|.	10|.	0.34782|.	T|.	0.22|.	.|.	9.5862|9.5862	0.39517|0.39517	0.0:0.7192:0.0:0.2808|0.0:0.7192:0.0:0.2808	.|.	870;864|.	B4DG66;Q13625|.	.;ASPP2_HUMAN|.	D|X	741;870;103|204	ENSP00000375750:E741D;ENSP00000341957:E870D;ENSP00000375751:E103D|.	ENSP00000341957:E870D|.	E|G	-|-	3|1	2|0	TP53BP2|TP53BP2	222050254|222050254	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.740000|0.740000	0.42216|0.42216	1.205000|1.205000	0.32308|0.32308	0.441000|0.441000	0.26529|0.26529	0.563000|0.563000	0.77884|0.77884	GAG|GGA	.		0.572	TP53BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090985.3	NM_001031685, NM_005426	
ALOX5	240	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	45936826	45936826	+	Missense_Mutation	SNP	T	T	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr10:45936826T>A	ENST00000374391.2	+	9	1273	c.1220T>A	c.(1219-1221)aTc>aAc	p.I407N	ALOX5_ENST00000542434.1_Missense_Mutation_p.I407N	NM_000698.3|NM_001256153.1	NP_000689.1|NP_001243082.1	P09917	LOX5_HUMAN	arachidonate 5-lipoxygenase	407	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				arachidonic acid metabolic process (GO:0019369)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|leukotriene production involved in inflammatory response (GO:0002540)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular space (GO:0005615)|nuclear envelope (GO:0005635)|nuclear envelope lumen (GO:0005641)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)	arachidonate 5-lipoxygenase activity (GO:0004051)|iron ion binding (GO:0005506)			breast(1)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|pancreas(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Lung SC(717;0.0257)			Aminosalicylic Acid(DB00233)|Balsalazide(DB01014)|Diclofenac(DB00586)|Diethylcarbamazine(DB00711)|Masoprocol(DB00179)|Meclofenamic acid(DB00939)|Mesalazine(DB00244)|Minocycline(DB01017)|Montelukast(DB00471)|Sulfasalazine(DB00795)|Vitamin E(DB00163)|Zileuton(DB00744)	ACCATTGCAATCAACACCAAG	0.627																																					p.I407N		.											.	ALOX5-228	0			c.T1220A						.						180.0	169.0	173.0					10																	45936826		2203	4300	6503	SO:0001583	missense	240	exon9			TTGCAATCAACAC	J03571	CCDS7212.1, CCDS58078.1	10q11.2	2008-03-18			ENSG00000012779	ENSG00000012779	1.13.11.34	"""Arachidonate lipoxygenases"""	435	protein-coding gene	gene with protein product		152390				2565035	Standard	NM_001256153		Approved	5-LOX	uc001jce.4	P09917	OTTHUMG00000018081	ENST00000374391.2:c.1220T>A	10.37:g.45936826T>A	ENSP00000363512:p.Ile407Asn	Somatic	94	0		WXS	Illumina HiSeq	Phase_I	67	24	NM_000698	0	0	37	45	8	B7ZLS0|E5FPY5|E5FPY7|E5FPY8|Q5JQ14	Missense_Mutation	SNP	ENST00000374391.2	37	CCDS7212.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.185478	0.78677	.	.	ENSG00000012779	ENST00000542434;ENST00000374391	D;D	0.94000	-3.33;-3.33	5.45	5.45	0.79879	Lipoxygenase, C-terminal (3);	0.047406	0.85682	D	0.000000	D	0.97399	0.9149	M	0.93197	3.39	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.989;0.995	D	0.98292	1.0514	10	0.87932	D	0	-34.9933	13.4602	0.61223	0.0:0.0:0.0:1.0	.	407;407;407	B7ZLS0;E5FPY8;P09917	.;.;LOX5_HUMAN	N	407	ENSP00000437634:I407N;ENSP00000363512:I407N	ENSP00000363512:I407N	I	+	2	0	ALOX5	45256832	1.000000	0.71417	1.000000	0.80357	0.638000	0.38207	7.996000	0.88334	2.054000	0.61138	0.533000	0.62120	ATC	.		0.627	ALOX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047780.1		
NCOA4	8031	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	51585173	51585173	+	Silent	SNP	G	G	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr10:51585173G>A	ENST00000443446.1	+	8	1501	c.1272G>A	c.(1270-1272)aaG>aaA	p.K424K	NCOA4_ENST00000374087.4_Silent_p.K424K|NCOA4_ENST00000374082.1_Silent_p.K424K|NCOA4_ENST00000438493.1_Silent_p.K440K|NCOA4_ENST00000414907.2_Silent_p.K258K|NCOA4_ENST00000452682.1_Silent_p.K440K|NCOA4_ENST00000430396.2_Silent_p.K324K|NCOA4_ENST00000344348.6_Silent_p.K424K	NM_001145262.1	NP_001138734.1	Q13772	NCOA4_HUMAN	nuclear receptor coactivator 4	424					androgen receptor signaling pathway (GO:0030521)|male gonad development (GO:0008584)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|transcription coactivator activity (GO:0003713)			NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|skin(1)	5						ATTGTGAGAAGGAGGCTCTGT	0.478			T	RET	papillary thyroid																																p.K440K		.		Dom	yes		10	10q11.2	8031	nuclear receptor coactivator 4 - PTC3 (ELE1)		E	.	NCOA4-1042	0			c.G1320A						.						70.0	75.0	73.0					10																	51585173		2203	4300	6503	SO:0001819	synonymous_variant	8031	exon9			TGAGAAGGAGGCT	L49399	CCDS73092.1, CCDS73093.1, CCDS73094.1	10q11.2	2014-04-10			ENSG00000138293	ENSG00000266412			7671	protein-coding gene	gene with protein product	"""RET-activating gene ELE1"""	601984				8290261, 8643607, 24695223	Standard	NM_001145260		Approved	ARA70, RFG, ELE1, PTC3, DKFZp762E1112	uc009xon.3	Q13772	OTTHUMG00000188314	ENST00000443446.1:c.1272G>A	10.37:g.51585173G>A		Somatic	175	0		WXS	Illumina HiSeq	Phase_I	151	47	NM_001145261	0	0	7	8	1	A8K8W5|B4E260|E9PAV7|J3KQN8|Q14239	Silent	SNP	ENST00000443446.1	37	CCDS7237.1																																																																																			.		0.478	NCOA4-204	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048052.1	NM_005437	
NUDT13	25961	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	74879906	74879906	+	Missense_Mutation	SNP	A	A	C			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr10:74879906A>C	ENST00000357321.4	+	3	332	c.214A>C	c.(214-216)Agc>Cgc	p.S72R	NUDT13_ENST00000349051.5_Missense_Mutation_p.S72R|NUDT13_ENST00000488223.1_3'UTR|NUDT13_ENST00000372997.3_Missense_Mutation_p.S72R|NUDT13_ENST00000544879.1_5'UTR|NUDT13_ENST00000537969.1_5'UTR	NM_001283016.1|NM_015901.4	NP_001269945.1|NP_056985.3			nudix (nucleoside diphosphate linked moiety X)-type motif 13											large_intestine(2)|lung(5)	7	Prostate(51;0.0119)					CCCCCGGCACAGCCTGTTAGG	0.498																																					p.S72R		.											.	NUDT13-90	0			c.A214C						.						55.0	56.0	56.0					10																	74879906		2203	4300	6503	SO:0001583	missense	25961	exon3			CGGCACAGCCTGT	AL050114	CCDS31220.1, CCDS60551.1, CCDS60552.1, CCDS60553.1, CCDS73148.1	10q22.3	2014-04-24			ENSG00000166321	ENSG00000166321		"""Nudix motif containing"""	18827	protein-coding gene	gene with protein product		609233				15164054	Standard	NM_001283019		Approved	DKFZp586P2219	uc001jtj.3	Q86X67	OTTHUMG00000018453	ENST00000357321.4:c.214A>C	10.37:g.74879906A>C	ENSP00000349874:p.Ser72Arg	Somatic	78	0		WXS	Illumina HiSeq	Phase_I	52	17	NM_015901	0	0	0	0	0		Missense_Mutation	SNP	ENST00000357321.4	37	CCDS31220.1	.	.	.	.	.	.	.	.	.	.	A	12.27	1.887191	0.33348	.	.	ENSG00000166321	ENST00000357321;ENST00000349051;ENST00000372997	T;T;T	0.32515	1.45;1.45;1.45	5.63	5.63	0.86233	NADH pyrophosphatase-like, N-terminal (1);	0.319618	0.40302	N	0.001140	T	0.25419	0.0618	L	0.38531	1.155	0.80722	D	1	B;B;B	0.33755	0.424;0.045;0.079	B;B;B	0.29942	0.109;0.102;0.092	T	0.03453	-1.1035	10	0.35671	T	0.21	.	15.0175	0.71597	1.0:0.0:0.0:0.0	.	72;72;72	Q86X67-2;Q5SQM6;Q86X67	.;.;NUD13_HUMAN	R	72	ENSP00000349874:S72R;ENSP00000335326:S72R;ENSP00000362088:S72R	ENSP00000335326:S72R	S	+	1	0	NUDT13	74549912	0.996000	0.38824	0.776000	0.31678	0.176000	0.22953	3.633000	0.54295	2.148000	0.66965	0.533000	0.62120	AGC	.		0.498	NUDT13-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048614.1	NM_015901	
ZMIZ1	57178	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	80968102	80968102	+	Missense_Mutation	SNP	A	A	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr10:80968102A>T	ENST00000334512.5	+	6	642	c.70A>T	c.(70-72)Aat>Tat	p.N24Y		NM_020338.3	NP_065071.1	Q9ULJ6	ZMIZ1_HUMAN	zinc finger, MIZ-type containing 1	24					artery morphogenesis (GO:0048844)|cell aging (GO:0007569)|developmental growth (GO:0048589)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)|vitellogenesis (GO:0007296)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(2)|prostate(3)|skin(1)	30	all_cancers(46;0.0292)|Breast(12;8.52e-05)|all_epithelial(25;0.000854)|Prostate(51;0.00985)		Epithelial(14;0.00256)|all cancers(16;0.00726)|Colorectal(32;0.229)			GCACTTACAGAATCCTGCCAA	0.622																																					p.N24Y		.											.	ZMIZ1-292	0			c.A70T						.						68.0	56.0	60.0					10																	80968102		2203	4300	6503	SO:0001583	missense	57178	exon6			TTACAGAATCCTG	AB033050	CCDS7357.1	10q22.3	2012-11-30	2006-10-24	2006-10-24	ENSG00000108175	ENSG00000108175		"""Zinc fingers, MIZ-type"""	16493	protein-coding gene	gene with protein product		607159	"""retinoic acid induced 17"""	RAI17		15626329	Standard	NM_020338		Approved	RP11-519K18.1, KIAA1224, FLJ13541, hZIMP10, Zimp10, MIZ	uc001kaf.2	Q9ULJ6	OTTHUMG00000018560	ENST00000334512.5:c.70A>T	10.37:g.80968102A>T	ENSP00000334474:p.Asn24Tyr	Somatic	70	0		WXS	Illumina HiSeq	Phase_I	63	16	NM_020338	0	0	0	0	0	Q5JSH9|Q7Z7E6	Missense_Mutation	SNP	ENST00000334512.5	37	CCDS7357.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.022073	0.75275	.	.	ENSG00000108175	ENST00000334512;ENST00000394592	T	0.34667	1.35	5.23	4.1	0.47936	.	.	.	.	.	T	0.52645	0.1747	L	0.60455	1.87	0.80722	D	1	D;D	0.65815	0.995;0.993	D;P	0.72982	0.979;0.885	T	0.52793	-0.8528	9	0.87932	D	0	-6.037	9.9202	0.41459	0.9182:0.0:0.0818:0.0	.	24;24	Q9ULJ6;A0JLS3	ZMIZ1_HUMAN;.	Y	24	ENSP00000334474:N24Y	ENSP00000334474:N24Y	N	+	1	0	ZMIZ1	80638108	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	8.717000	0.91425	0.846000	0.35142	0.379000	0.24179	AAT	.		0.622	ZMIZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048944.2	NM_020338	
SORCS1	114815	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	108371744	108371744	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr10:108371744G>T	ENST00000263054.6	-	22	2965	c.2958C>A	c.(2956-2958)aaC>aaA	p.N986K	SORCS1_ENST00000369698.1_Missense_Mutation_p.N521K|SORCS1_ENST00000344440.6_Missense_Mutation_p.N986K|SORCS1_ENST00000478809.2_5'UTR	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	986					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		AGTCATCCAGGTTTGGAGAAA	0.463																																					p.N986K		.											.	SORCS1-153	0			c.C2958A						.						113.0	103.0	106.0					10																	108371744		2203	4300	6503	SO:0001583	missense	114815	exon22			ATCCAGGTTTGGA	AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.2958C>A	10.37:g.108371744G>T	ENSP00000263054:p.Asn986Lys	Somatic	161	0		WXS	Illumina HiSeq	Phase_I	158	44	NM_001206572	0	0	0	0	0	A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	ENST00000263054.6	37	CCDS7559.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.41|19.41	3.822407|3.822407	0.71028|0.71028	.|.	.|.	ENSG00000108018|ENSG00000108018	ENST00000369698;ENST00000263054;ENST00000344440|ENST00000452214	T;T;T|.	0.24908|.	1.83;2.4;2.4|.	5.4|5.4	4.49|4.49	0.54785|0.54785	.|.	0.048600|.	0.85682|.	D|.	0.000000|.	T|T	0.73869|0.73869	0.3642|0.3642	M|M	0.80183|0.80183	2.485|2.485	0.44359|0.44359	D|D	0.997259|0.997259	D;D;D;D;D|.	0.58620|.	0.972;0.983;0.983;0.972;0.983|.	P;P;P;P;P|.	0.62298|.	0.797;0.9;0.9;0.797;0.9|.	T|T	0.75391|0.75391	-0.3334|-0.3334	9|5	.|.	.|.	.|.	-33.8428|-33.8428	11.7072|11.7072	0.51603|0.51603	0.1432:0.0:0.8568:0.0|0.1432:0.0:0.8568:0.0	.|.	986;986;986;986;986|.	A8K182;Q8WY21-4;Q8WY21-3;Q8WY21;Q8WY21-2|.	.;.;.;SORC1_HUMAN;.|.	K|N	521;986;986|1	ENSP00000358712:N521K;ENSP00000263054:N986K;ENSP00000345964:N986K|.	.|.	N|T	-|-	3|2	2|0	SORCS1|SORCS1	108361734|108361734	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	1.681000|1.681000	0.37618|0.37618	1.406000|1.406000	0.46857|0.46857	0.650000|0.650000	0.86243|0.86243	AAC|ACC	.		0.463	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050232.4	NM_052918	
OR5P2	120065	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	11	7818420	7818420	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr11:7818420G>T	ENST00000329434.2	-	1	100	c.70C>A	c.(70-72)Cca>Aca	p.P24T	RP11-35J10.5_ENST00000527565.1_lincRNA	NM_153444.1	NP_703145.1	Q8WZ92	OR5P2_HUMAN	olfactory receptor, family 5, subfamily P, member 2	24						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)	22				Epithelial(150;8.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CGAAGGATTGGATCATCTGTT	0.428																																					p.P24T		.											.	OR5P2-496	0			c.C70A						.						63.0	73.0	70.0					11																	7818420		2103	4292	6395	SO:0001583	missense	120065	exon1			GGATTGGATCATC	AF173006	CCDS7782.1	11p15.4	2012-08-09			ENSG00000183303	ENSG00000183303		"""GPCR / Class A : Olfactory receptors"""	14783	protein-coding gene	gene with protein product							Standard	NM_153444		Approved	JCG3	uc001mfp.1	Q8WZ92	OTTHUMG00000165668	ENST00000329434.2:c.70C>A	11.37:g.7818420G>T	ENSP00000331823:p.Pro24Thr	Somatic	67	0		WXS	Illumina HiSeq	Phase_I	61	15	NM_153444	0	0	0	0	0	Q3MIS8	Missense_Mutation	SNP	ENST00000329434.2	37	CCDS7782.1	.	.	.	.	.	.	.	.	.	.	G	11.68	1.710700	0.30322	.	.	ENSG00000183303	ENST00000329434	T	0.20200	2.09	5.5	4.59	0.56863	.	0.193570	0.37304	N	0.002145	T	0.32315	0.0825	M	0.74258	2.255	0.37509	D	0.917076	P	0.40376	0.715	P	0.45343	0.477	T	0.35101	-0.9802	10	0.52906	T	0.07	-10.9491	12.0929	0.53737	0.0821:0.0:0.9179:0.0	.	24	Q8WZ92	OR5P2_HUMAN	T	24	ENSP00000331823:P24T	ENSP00000331823:P24T	P	-	1	0	OR5P2	7774996	0.000000	0.05858	0.034000	0.17996	0.330000	0.28571	0.798000	0.27014	1.569000	0.49696	0.555000	0.69702	CCA	.		0.428	OR5P2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385696.1	NM_153444	
LGR4	55366	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	27402259	27402259	+	Splice_Site	SNP	C	C	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr11:27402259C>G	ENST00000379214.4	-	9	1274		c.e9-1		LGR4_ENST00000389858.4_Splice_Site	NM_018490.2	NP_060960.2	Q9BXB1	LGR4_HUMAN	leucine-rich repeat containing G protein-coupled receptor 4						bone mineralization (GO:0030282)|bone remodeling (GO:0046849)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cell differentiation involved in metanephros development (GO:0072202)|epithelial cell proliferation (GO:0050673)|innate immune response (GO:0045087)|male genitalia development (GO:0030539)|metanephric glomerulus development (GO:0072224)|metanephric nephron tubule morphogenesis (GO:0072282)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast differentiation (GO:0001649)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|endometrium(3)|kidney(2)|large_intestine(11)|lung(10)|ovary(1)	32						ATACAAATGTCTGTGAAAATA	0.299																																					.		.											.	LGR4-91	0			c.831-1G>C						.						49.0	52.0	51.0					11																	27402259		2201	4289	6490	SO:0001630	splice_region_variant	55366	exon10			AAATGTCTGTGAA	AF257182	CCDS31449.1	11p14-p13	2012-08-21	2011-01-25	2004-11-12	ENSG00000205213	ENSG00000205213		"""GPCR / Class A : Orphans"""	13299	protein-coding gene	gene with protein product		606666	"""G protein-coupled receptor 48"", ""leucine-rich repeat-containing G protein-coupled receptor 4"""	GPR48		10894923	Standard	NM_018490		Approved		uc001mrj.4	Q9BXB1	OTTHUMG00000133508	ENST00000379214.4:c.831-1G>C	11.37:g.27402259C>G		Somatic	232	0		WXS	Illumina HiSeq	Phase_I	223	73	NM_018490	0	0	0	0	0	A6NCH3|G5E9B3|Q8N537|Q9NYD1	Splice_Site	SNP	ENST00000379214.4	37	CCDS31449.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.067334	0.76301	.	.	ENSG00000205213	ENST00000379214;ENST00000389858	.	.	.	5.51	5.51	0.81932	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7788	0.96409	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	LGR4	27358835	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.487000	0.81328	2.749000	0.94314	0.460000	0.39030	.	.		0.299	LGR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257467.1	NM_018490	Intron
PLCB3	5331	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	64034708	64034708	+	Nonsense_Mutation	SNP	C	C	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr11:64034708C>T	ENST00000540288.1	+	30	3569	c.3466C>T	c.(3466-3468)Cag>Tag	p.Q1156*	PLCB3_ENST00000325234.5_Nonsense_Mutation_p.Q1089*|PLCB3_ENST00000279230.6_Nonsense_Mutation_p.Q1156*	NM_000932.2	NP_000923.1	Q01970	PLCB3_HUMAN	phospholipase C, beta 3 (phosphatidylinositol-specific)	1156					inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|regulation of systemic arterial blood pressure (GO:0003073)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|urinary_tract(1)	33						TGGGCAGCAGCAGGTCCTGCA	0.672																																					p.Q1156X		.											.	PLCB3-228	0			c.C3466T						.						19.0	18.0	18.0					11																	64034708		1955	3784	5739	SO:0001587	stop_gained	5331	exon30			CAGCAGCAGGTCC	Z26649	CCDS8064.1, CCDS53654.1	11q13	2008-03-18			ENSG00000149782	ENSG00000149782	3.1.4.11		9056	protein-coding gene	gene with protein product		600230				7849701	Standard	NM_000932		Approved		uc009ypg.2	Q01970	OTTHUMG00000167816	ENST00000540288.1:c.3466C>T	11.37:g.64034708C>T	ENSP00000443631:p.Gln1156*	Somatic	138	0		WXS	Illumina HiSeq	Phase_I	101	30	NM_000932	0	0	31	39	8	A5PKZ6|G5E960|Q8N1A4	Nonsense_Mutation	SNP	ENST00000540288.1	37	CCDS8064.1	.	.	.	.	.	.	.	.	.	.	C	39	7.682014	0.98431	.	.	ENSG00000149782	ENST00000279230;ENST00000540288;ENST00000325234	.	.	.	4.42	4.42	0.53409	.	0.339854	0.29830	N	0.011090	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.18276	T	0.48	.	11.0366	0.47804	0.0:0.6842:0.3158:0.0	.	.	.	.	X	1156;1156;1089	.	ENSP00000279230:Q1156X	Q	+	1	0	PLCB3	63791284	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.151000	0.58105	2.297000	0.77311	0.561000	0.74099	CAG	.		0.672	PLCB3-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396405.1		
NRXN2	9379	broad.mit.edu	37	11	64453314	64453314	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr11:64453314C>T	ENST00000377551.1	-	5	1167	c.956G>A	c.(955-957)cGc>cAc	p.R319H	NRXN2_ENST00000409571.1_Missense_Mutation_p.R319H|NRXN2_ENST00000377559.3_Missense_Mutation_p.R295H|NRXN2_ENST00000265459.6_Missense_Mutation_p.R319H			Q9P2S2	NRX2A_HUMAN	neurexin 2	319	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|gephyrin clustering (GO:0097116)|neuroligin clustering (GO:0097118)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	calcium channel regulator activity (GO:0005246)|cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|neuroligin family protein binding (GO:0097109)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	71						TTGCAGGGTGCGGAAGGCCAG	0.562																																					p.R319H													.	NRXN2-232	0			c.G956A						.						358.0	285.0	310.0					11																	64453314		2201	4297	6498	SO:0001583	missense	9379	exon6			AGGGTGCGGAAGG		CCDS8077.1, CCDS31597.1, CCDS8078.1	11q13	2008-07-18			ENSG00000110076	ENSG00000110076			8009	protein-coding gene	gene with protein product	"""neurexin II"""	600566				1621094	Standard	NM_015080		Approved		uc021qkw.1	P58401	OTTHUMG00000045214	ENST00000377551.1:c.956G>A	11.37:g.64453314C>T	ENSP00000366774:p.Arg319His	Somatic	205	0		WXS	Illumina HiSeq	Phase_I	191	5	NM_015080	0	0	0	0	0	A7E2C1|Q9Y2D6	Missense_Mutation	SNP	ENST00000377551.1	37	CCDS8077.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.1|23.1	4.374819|4.374819	0.82573|0.82573	.|.	.|.	ENSG00000110076|ENSG00000110076	ENST00000417749|ENST00000377551;ENST00000377559;ENST00000265459;ENST00000345863;ENST00000409571;ENST00000442300	.|D;D;D;D;D	.|0.84370	.|-1.84;-1.79;-1.84;-1.84;-1.84	4.17|4.17	4.17|4.17	0.49024|0.49024	.|Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	.|0.000000	.|0.44097	.|U	.|0.000496	D|D	0.91637|0.91637	0.7357|0.7357	M|M	0.79475|0.79475	2.455|2.455	0.58432|0.58432	D|D	0.99999|0.99999	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.76575	.|0.988;0.973	D|D	0.92845|0.92845	0.6292|0.6292	5|10	.|0.87932	.|D	.|0	.|.	14.3646|14.3646	0.66799|0.66799	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|295;319	.|Q9P2S2-2;Q9P2S2	.|.;NRX2A_HUMAN	T|H	80|319;295;319;295;319;90	.|ENSP00000366774:R319H;ENSP00000366782:R295H;ENSP00000265459:R319H;ENSP00000386416:R319H;ENSP00000388971:R90H	.|ENSP00000265459:R319H	A|R	-|-	1|2	0|0	NRXN2|NRXN2	64209890|64209890	0.969000|0.969000	0.33509|0.33509	1.000000|1.000000	0.80357|0.80357	0.979000|0.979000	0.70002|0.70002	1.776000|1.776000	0.38594|0.38594	2.062000|2.062000	0.61559|0.61559	0.467000|0.467000	0.42956|0.42956	GCA|CGC	.		0.562	NRXN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104967.3	NM_015080	
NAALADL1	10004	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	64813975	64813975	+	Silent	SNP	G	G	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr11:64813975G>A	ENST00000358658.3	-	14	1650	c.1623C>T	c.(1621-1623)taC>taT	p.Y541Y	NAALADL1_ENST00000528884.1_Intron|NAALADL1_ENST00000355721.3_Silent_p.Y500Y|NAALADL1_ENST00000340252.4_Silent_p.Y592Y|NAALADL1_ENST00000339885.2_Missense_Mutation_p.T511I|NAALADL1_ENST00000356632.3_Silent_p.Y506Y|NAALADL1_ENST00000355369.2_Intron|NAALADL1_ENST00000526799.1_5'UTR	NM_005468.2	NP_005459.2	Q9UQQ1	NALDL_HUMAN	N-acetylated alpha-linked acidic dipeptidase-like 1	541	NAALADase.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	29						GGTAGGTGGGGTAGATCCTGG	0.552																																					p.Y541Y		.											.	NAALADL1-90	0			c.C1623T						.						130.0	109.0	116.0					11																	64813975		2201	4297	6498	SO:0001819	synonymous_variant	10004	exon14			GGTGGGGTAGATC	AF010141	CCDS31604.1	11q12	2011-08-16			ENSG00000168060	ENSG00000168060			23536	protein-coding gene	gene with protein product	"""ileal peptidase I100"""	602640				10085079	Standard	NM_005468		Approved		uc001ocn.3	Q9UQQ1	OTTHUMG00000165595	ENST00000358658.3:c.1623C>T	11.37:g.64813975G>A		Somatic	184	0		WXS	Illumina HiSeq	Phase_I	138	31	NM_005468	0	0	0	0	0	C9J8A1|C9J964|C9JL35|C9JSN0|O43176	Silent	SNP	ENST00000358658.3	37	CCDS31604.1	.	.	.	.	.	.	.	.	.	.	G	18.25	3.583064	0.65992	.	.	ENSG00000168060	ENST00000339885	T	0.48522	0.81	5.53	4.63	0.57726	.	.	.	.	.	T	0.49609	0.1567	.	.	.	0.26194	N	0.979542	.	.	.	.	.	.	T	0.48317	-0.9046	6	0.87932	D	0	-29.7051	8.5374	0.33371	0.1733:0.0:0.8267:0.0	.	.	.	.	I	511	ENSP00000340111:T511I	ENSP00000340111:T511I	T	-	2	0	NAALADL1	64570551	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.241000	0.51376	1.370000	0.46153	0.561000	0.74099	ACC	.		0.552	NAALADL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385162.1	NM_005468	
FAM86C1	55199	broad.mit.edu	37	11	71507083	71507083	+	Silent	SNP	G	G	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr11:71507083G>A	ENST00000359244.4	+	4	305	c.282G>A	c.(280-282)aaG>aaA	p.K94K	FAM86C1_ENST00000426628.2_Silent_p.K87K|FAM86C1_ENST00000346333.6_Silent_p.K60K	NM_018172.2	NP_060642.2	Q9NVL1	FA86C_HUMAN	family with sequence similarity 86, member C1	94										lung(1)	1						TTGCCCAGAAGCCATCGTGTC	0.612																																					p.K94K													.	FAM86C1-90	0			c.G282A						.						44.0	48.0	46.0					11																	71507083		2199	4288	6487	SO:0001819	synonymous_variant	55199	exon4			CCAGAAGCCATCG	AK130709	CCDS8202.1, CCDS41686.1, CCDS44664.1	11q13.4	2011-07-07	2011-07-07	2011-07-07	ENSG00000158483	ENSG00000158483			25561	protein-coding gene	gene with protein product			"""family with sequence similarity 86, member C"""	FAM86C		12477932	Standard	NM_152563		Approved	FLJ10661, FLJ27199	uc001oqv.4	Q9NVL1	OTTHUMG00000160552	ENST00000359244.4:c.282G>A	11.37:g.71507083G>A		Somatic	91	1		WXS	Illumina HiSeq	Phase_I	61	3	NM_018172	0	0	38	40	2	Q8N5D3	Silent	SNP	ENST00000359244.4	37	CCDS41686.1																																																																																			.		0.612	FAM86C1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000361120.1	NM_152563	
CLPB	81570	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	72145214	72145214	+	Missense_Mutation	SNP	T	T	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr11:72145214T>A	ENST00000294053.3	-	1	478	c.305A>T	c.(304-306)gAc>gTc	p.D102V	CLPB_ENST00000437826.2_Silent_p.G21G|CLPB_ENST00000340729.5_Missense_Mutation_p.D102V|CLPB_ENST00000542555.1_5'Flank|CLPB_ENST00000445069.2_Intron|CLPB_ENST00000538039.1_Missense_Mutation_p.D102V|CLPB_ENST00000543042.1_5'UTR	NM_001258394.1|NM_030813.4	NP_001245323.1|NP_110440.1	Q9H078	CLPB_HUMAN	ClpB caseinolytic peptidase B homolog (E. coli)	102					cellular response to heat (GO:0034605)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)			endometrium(3)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	19						GTTCCAGCTGTCCTGTCCTGG	0.662											OREG0021194	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D102V		.											.	CLPB-91	0			c.A305T						.						45.0	49.0	47.0					11																	72145214		2200	4292	6492	SO:0001583	missense	81570	exon1			CAGCTGTCCTGTC	BC006404	CCDS8215.1, CCDS58152.1, CCDS58153.1, CCDS58154.1	11q13.4	2013-01-10			ENSG00000162129	ENSG00000162129		"""Ankyrin repeat domain containing"""	30664	protein-coding gene	gene with protein product	"""suppressor of potassium transport defect 3"""					11230166, 7835694	Standard	NM_030813		Approved	HSP78, SKD3, FLJ13152	uc010rqy.3	Q9H078	OTTHUMG00000167902	ENST00000294053.3:c.305A>T	11.37:g.72145214T>A	ENSP00000294053:p.Asp102Val	Somatic	96	0	1135	WXS	Illumina HiSeq	Phase_I	69	15	NM_001258392	0	0	3	3	0	B4DXJ7|B4DXP7|E7EWN6|F8W7P6|Q8ND11|Q9H8Y0	Missense_Mutation	SNP	ENST00000294053.3	37	CCDS8215.1	.	.	.	.	.	.	.	.	.	.	T	15.88	2.964448	0.53507	.	.	ENSG00000162129	ENST00000294053;ENST00000538039;ENST00000340729	T;T;T	0.69175	1.9;1.08;-0.38	5.04	2.43	0.29744	.	0.289184	0.26286	N	0.025253	T	0.45856	0.1363	N	0.14661	0.345	0.80722	D	1	P;B;P	0.37955	0.514;0.437;0.612	B;B;B	0.38880	0.284;0.189;0.203	T	0.43637	-0.9379	10	0.72032	D	0.01	-12.7372	5.6906	0.17827	0.1674:0.0:0.1731:0.6594	.	102;102;102	F8W7P6;Q9H078-2;Q9H078	.;.;CLPB_HUMAN	V	102	ENSP00000294053:D102V;ENSP00000441518:D102V;ENSP00000340385:D102V	ENSP00000294053:D102V	D	-	2	0	CLPB	71822862	1.000000	0.71417	1.000000	0.80357	0.867000	0.49689	1.637000	0.37155	0.808000	0.34231	0.533000	0.62120	GAC	.		0.662	CLPB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000396889.1	NM_030813	
FZD4	8322	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	86663362	86663362	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr11:86663362T>C	ENST00000531380.1	-	2	741	c.436A>G	c.(436-438)Agc>Ggc	p.S146G	PRSS23_ENST00000533902.2_3'UTR	NM_012193.3	NP_036325.2	Q9ULV1	FZD4_HUMAN	frizzled class receptor 4	146	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|cerebellum vasculature morphogenesis (GO:0061301)|extracellular matrix-cell signaling (GO:0035426)|locomotion involved in locomotory behavior (GO:0031987)|negative regulation of cell-substrate adhesion (GO:0010812)|neuron differentiation (GO:0030182)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone secretion (GO:0042701)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal blood vessel morphogenesis (GO:0061304)|sensory perception of sound (GO:0007605)|substrate adhesion-dependent cell spreading (GO:0034446)|vasculogenesis (GO:0001570)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	cell projection (GO:0042995)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine binding (GO:0019955)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|kidney(1)|large_intestine(3)|lung(9)|prostate(6)|skin(1)	21		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				GGGAATTTGCTGCAGTTCAGA	0.557																																					p.S146G		.											.	FZD4-1145	0			c.A436G						.						91.0	94.0	93.0					11																	86663362		2201	4299	6500	SO:0001583	missense	8322	exon2			ATTTGCTGCAGTT	AB032417	CCDS8279.1	11q14-q21	2014-01-29	2014-01-29			ENSG00000174804		"""GPCR / Class F : Frizzled receptors"", ""CD molecules"""	4042	protein-coding gene	gene with protein product		604579	"""frizzled (Drosophila) homolog 4"", ""exudative vitreoretinopathy 1"", ""frizzled homolog 4 (Drosophila)"", ""frizzled 4, seven transmembrane spanning receptor"", ""frizzled family receptor 4"""	EVR1		10544037, 15024691	Standard	NM_012193		Approved	CD344	uc001pce.3	Q9ULV1		ENST00000531380.1:c.436A>G	11.37:g.86663362T>C	ENSP00000434034:p.Ser146Gly	Somatic	146	0		WXS	Illumina HiSeq	Phase_I	101	20	NM_012193	0	0	3	3	0	A8K9Q3|Q14C97|Q6S9E4	Missense_Mutation	SNP	ENST00000531380.1	37	CCDS8279.1	.	.	.	.	.	.	.	.	.	.	T	15.71	2.915066	0.52546	.	.	ENSG00000174804	ENST00000531380	T	0.80393	-1.37	5.82	5.82	0.92795	Frizzled domain (5);	0.000000	0.85682	D	0.000000	D	0.82426	0.5034	M	0.77712	2.385	0.58432	D	0.999999	B	0.25441	0.126	B	0.32289	0.143	T	0.79037	-0.1967	9	.	.	.	.	16.1832	0.81925	0.0:0.0:0.0:1.0	.	146	Q9ULV1	FZD4_HUMAN	G	146	ENSP00000434034:S146G	.	S	-	1	0	FZD4	86341010	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.221000	0.58574	2.228000	0.72767	0.533000	0.62120	AGC	.		0.557	FZD4-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393818.2	NM_012193	
FAT3	120114	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	11	92531377	92531377	+	Missense_Mutation	SNP	G	G	A	rs150673105	byFrequency	TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr11:92531377G>A	ENST00000298047.6	+	9	5215	c.5198G>A	c.(5197-5199)cGc>cAc	p.R1733H	FAT3_ENST00000409404.2_Missense_Mutation_p.R1733H|FAT3_ENST00000525166.1_Missense_Mutation_p.R1583H			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	1733	Cadherin 15. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				GATTATGAGCGCACATCCTCT	0.408										TCGA Ovarian(4;0.039)			g|||	19	0.00379393	0.0144	0.0	5008	,	,		21525	0.0		0.0	False		,,,				2504	0.0				p.R1733H		.											.	FAT3-73	0			c.G5198A						.	A	HIS/ARG	33,3907		0,33,1937	90.0	87.0	88.0		5198	-3.0	0.0	11	dbSNP_134	88	1,8327		0,1,4163	yes	missense	FAT3	NM_001008781.2	29	0,34,6100	AA,AG,GG		0.012,0.8376,0.2771	benign	1733/4558	92531377	34,12234	1970	4164	6134	SO:0001583	missense	120114	exon9			ATGAGCGCACATC	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.5198G>A	11.37:g.92531377G>A	ENSP00000298047:p.Arg1733His	Somatic	104	0		WXS	Illumina HiSeq	Phase_I	109	16	NM_001008781	0	0	0	0	0	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37		11	0.005036630036630037	11	0.022357723577235773	0	0.0	0	0.0	0	0.0	g	10.46	1.355966	0.24598	0.008376	1.2E-4	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.51574	0.7;0.7;0.7	5.93	-2.98	0.05513	.	.	.	.	.	T	0.17916	0.0430	L	0.33710	1.025	0.46279	D	0.998966	B	0.12013	0.005	B	0.04013	0.001	T	0.02352	-1.1172	9	0.39692	T	0.17	.	10.5459	0.45060	0.6862:0.0:0.2094:0.1044	.	1733	Q8TDW7-3	.	H	1733;1733;1583	ENSP00000298047:R1733H;ENSP00000387040:R1733H;ENSP00000432586:R1583H	ENSP00000298047:R1733H	R	+	2	0	FAT3	92171025	0.003000	0.15002	0.005000	0.12908	0.890000	0.51754	0.054000	0.14205	-0.910000	0.03847	-0.930000	0.02707	CGC	G|0.995;A|0.005		0.408	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
DYNC2H1	79659	broad.mit.edu	37	11	103022865	103022865	+	Splice_Site	SNP	A	A	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr11:103022865A>T	ENST00000375735.2	+	21	3091	c.2947A>T	c.(2947-2949)Att>Ttt	p.I983F	DYNC2H1_ENST00000398093.3_Splice_Site_p.I983F|DYNC2H1_ENST00000334267.7_Intron	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	983	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		TAACCTTTAGATTTTGCCCTT	0.269																																					p.I983F													.	DYNC2H1-68	0			c.A2947T						.						35.0	33.0	34.0					11																	103022865		1785	4053	5838	SO:0001630	splice_region_variant	79659	exon21			CTTTAGATTTTGC	AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.2947-1A>T	11.37:g.103022865A>T		Somatic	88	7		WXS	Illumina HiSeq	Phase_I	92	12	NM_001377	0	0	0	0	0	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	ENST00000375735.2	37	CCDS53701.1	.	.	.	.	.	.	.	.	.	.	A	15.03	2.712951	0.48517	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	T;T	0.30981	1.51;1.51	6.05	6.05	0.98169	.	0.322034	0.24488	U	0.038086	T	0.34861	0.0912	M	0.72118	2.19	0.58432	D	0.999999	B;B	0.20368	0.026;0.044	B;B	0.26416	0.021;0.069	T	0.11842	-1.0571	9	.	.	.	.	11.6037	0.51020	0.9313:0.0:0.0687:0.0	.	983;983	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	F	983	ENSP00000364887:I983F;ENSP00000381167:I983F	.	I	+	1	0	DYNC2H1	102528075	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.242000	0.51384	2.323000	0.78572	0.519000	0.50382	ATT	.		0.269	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	XM_370652	Missense_Mutation
DYNC2H1	79659	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	103091430	103091430	+	Missense_Mutation	SNP	C	C	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr11:103091430C>G	ENST00000375735.2	+	57	9169	c.9025C>G	c.(9025-9027)Cca>Gca	p.P3009A	DYNC2H1_ENST00000398093.3_Missense_Mutation_p.P3009A|DYNC2H1_ENST00000334267.7_Intron	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	3009	Stalk. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		ACTACGCATGCCACCTGATGT	0.368																																					p.P3009A													.	DYNC2H1-68	0			c.C9025G						.						96.0	94.0	95.0					11																	103091430		1880	4118	5998	SO:0001583	missense	79659	exon57			CGCATGCCACCTG	AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.9025C>G	11.37:g.103091430C>G	ENSP00000364887:p.Pro3009Ala	Somatic	119	1		WXS	Illumina HiSeq	Phase_I	106	14	NM_001377	0	0	0	0	0	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	ENST00000375735.2	37	CCDS53701.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.814794	0.90790	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	D;D	0.81579	-1.51;-1.51	6.17	6.17	0.99709	Dynein heavy chain, coiled coil stalk (1);	0.113491	0.64402	D	0.000009	D	0.91713	0.7380	M	0.86573	2.825	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.77557	0.99;0.976	D	0.91585	0.5282	10	0.72032	D	0.01	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	3009;3009	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	A	3009	ENSP00000364887:P3009A;ENSP00000381167:P3009A	ENSP00000364887:P3009A	P	+	1	0	DYNC2H1	102596640	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.794000	0.85869	2.941000	0.99782	0.655000	0.94253	CCA	.		0.368	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	XM_370652	
SLC35F2	54733	broad.mit.edu	37	11	107682461	107682461	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr11:107682461G>T	ENST00000525815.1	-	3	766	c.346C>A	c.(346-348)Cta>Ata	p.L116I	SLC35F2_ENST00000429869.1_Missense_Mutation_p.L116I|SLC35F2_ENST00000375682.4_Missense_Mutation_p.L69I|SLC35F2_ENST00000265836.7_5'UTR|SLC35F2_ENST00000525071.1_Missense_Mutation_p.L116I	NM_017515.4	NP_059985.2	Q8IXU6	S35F2_HUMAN	solute carrier family 35, member F2	116					transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		all_cancers(61;9.46e-06)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;0.000111)|all_hematologic(158;0.000315)|all_epithelial(67;0.00197)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)|Epithelial(105;0.000105)|all cancers(92;0.00217)		ACATCTGCTAGTCCCAGCAGG	0.423																																					p.L116I													.	SLC35F2-90	0			c.C346A						.						219.0	203.0	208.0					11																	107682461		1884	4113	5997	SO:0001583	missense	54733	exon3			CTGCTAGTCCCAG		CCDS41709.1	11q22.3	2013-05-22			ENSG00000110660	ENSG00000110660		"""Solute carriers"""	23615	protein-coding gene	gene with protein product						9119394	Standard	NM_017515		Approved	FLJ13018	uc001pjq.3	Q8IXU6	OTTHUMG00000166366	ENST00000525815.1:c.346C>A	11.37:g.107682461G>T	ENSP00000436785:p.Leu116Ile	Somatic	146	0		WXS	Illumina HiSeq	Phase_I	101	3	NM_017515	0	0	3	3	0	Q14963|Q5JPA8|Q6ZRQ3|Q9H947	Missense_Mutation	SNP	ENST00000525815.1	37	CCDS41709.1	.	.	.	.	.	.	.	.	.	.	G	8.640	0.895759	0.17686	.	.	ENSG00000110660	ENST00000525815;ENST00000525071;ENST00000375682;ENST00000429869	T;T;T;T	0.71461	-0.57;-0.57;-0.57;-0.57	5.42	0.28	0.15682	.	0.161185	0.43260	D	0.000597	T	0.50990	0.1648	N	0.25094	0.71	0.58432	D	0.999999	B;B	0.28713	0.22;0.22	B;B	0.35114	0.196;0.163	T	0.12967	-1.0527	10	0.19147	T	0.46	.	5.5271	0.16964	0.4192:0.0:0.4572:0.1236	.	116;116	E9PJD1;Q8IXU6	.;S35F2_HUMAN	I	116;116;69;116	ENSP00000436785:L116I;ENSP00000434307:L116I;ENSP00000364834:L69I;ENSP00000393571:L116I	ENSP00000364834:L69I	L	-	1	2	SLC35F2	107187671	0.031000	0.19500	0.068000	0.19968	0.782000	0.44232	0.234000	0.17930	0.030000	0.15379	-0.266000	0.10368	CTA	.		0.423	SLC35F2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389417.1	NM_017515	
BACE1	23621	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	117186300	117186300	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr11:117186300G>A	ENST00000313005.6	-	1	672	c.212C>T	c.(211-213)tCg>tTg	p.S71L	AP000892.4_ENST00000504906.1_RNA|BACE1_ENST00000428381.2_Missense_Mutation_p.S71L|BACE1_ENST00000514464.1_5'UTR|BACE1_ENST00000528053.1_Missense_Mutation_p.S71L|BACE1_ENST00000445823.2_Missense_Mutation_p.S71L|BACE1_ENST00000513780.1_Missense_Mutation_p.S71L	NM_012104.4|NM_138971.3|NM_138972.3|NM_138973.3	NP_036236|NP_620427.1|NP_620428.1|NP_620429.1	P56817	BACE1_HUMAN	beta-site APP-cleaving enzyme 1	71					beta-amyloid metabolic process (GO:0050435)|membrane protein ectodomain proteolysis (GO:0006509)|proteolysis (GO:0006508)	axon (GO:0030424)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	aspartic-type endopeptidase activity (GO:0004190)|beta-amyloid binding (GO:0001540)|beta-aspartyl-peptidase activity (GO:0008798)|enzyme binding (GO:0019899)			breast(2)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)	19	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000563)|all cancers(92;0.0032)		GCCCTGCCCCGACTTGCCCCT	0.697																																					p.S71L													.	BACE1-91	0			c.C212T						.						50.0	47.0	48.0					11																	117186300		2201	4296	6497	SO:0001583	missense	23621	exon1			TGCCCCGACTTGC	AF190725	CCDS8383.1, CCDS44739.1, CCDS44740.1, CCDS44741.1, CCDS55787.1, CCDS55786.1	11q23-q24	2011-07-27	2004-04-02	2004-04-02	ENSG00000186318	ENSG00000186318			933	protein-coding gene	gene with protein product		604252	"""beta-site APP-cleaving enzyme"""	BACE		10531052	Standard	NM_012104		Approved		uc001pqz.3	P56817	OTTHUMG00000160636	ENST00000313005.6:c.212C>T	11.37:g.117186300G>A	ENSP00000318585:p.Ser71Leu	Somatic	152	1		WXS	Illumina HiSeq	Phase_I	127	48	NM_138972	0	0	0	0	0	A0M8W7|B0YIU9|E9PE65|H7BXJ9|Q9BYB9|Q9BYC0|Q9BYC1|Q9UJT5|Q9ULS1	Missense_Mutation	SNP	ENST00000313005.6	37	CCDS8383.1	.	.	.	.	.	.	.	.	.	.	G	31	5.094932	0.94197	.	.	ENSG00000186318	ENST00000313005;ENST00000528053;ENST00000428381;ENST00000513780;ENST00000445823	T;T;T;T;T	0.39406	1.08;1.08;1.08;1.08;1.08	4.99	4.99	0.66335	Peptidase aspartic (1);	0.000000	0.85682	D	0.000000	T	0.53206	0.1782	L	0.59436	1.845	0.80722	D	1	D;D;P;D;D	0.76494	0.999;0.998;0.878;0.993;0.995	P;D;B;P;P	0.64506	0.788;0.926;0.355;0.862;0.661	T	0.51395	-0.8711	10	0.02654	T	1	.	15.7488	0.77967	0.0:0.0:1.0:0.0	.	71;71;71;71;71	Q76KP0;P56817;P56817-3;P56817-4;P56817-2	.;BACE1_HUMAN;.;.;.	L	71	ENSP00000318585:S71L;ENSP00000431848:S71L;ENSP00000402228:S71L;ENSP00000424536:S71L;ENSP00000403685:S71L	ENSP00000318585:S71L	S	-	2	0	BACE1	116691510	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.645000	0.91049	2.302000	0.77476	0.655000	0.94253	TCG	.		0.697	BACE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361505.1		
ADAMTS15	170689	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	130319535	130319535	+	Missense_Mutation	SNP	C	C	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr11:130319535C>G	ENST00000299164.2	+	1	667	c.667C>G	c.(667-669)Ctg>Gtg	p.L223V		NM_139055.2	NP_620686.1	Q8TE58	ATS15_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 15	223	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(16)|pancreas(1)|prostate(1)|skin(8)|urinary_tract(1)	36	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0631)|Lung(977;0.215)		CGTGGAGACGCTGGTGGTCGC	0.667											OREG0021518	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L223V													.	ADAMTS15-291	0			c.C667G						.						35.0	31.0	32.0					11																	130319535		2195	4294	6489	SO:0001583	missense	170689	exon1			GAGACGCTGGTGG	AJ315733	CCDS8488.1	11q25	2008-02-01	2005-08-19		ENSG00000166106	ENSG00000166106		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	16305	protein-coding gene	gene with protein product		607509	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 15"""			11867212	Standard	NM_139055		Approved		uc010scd.2	Q8TE58	OTTHUMG00000165657	ENST00000299164.2:c.667C>G	11.37:g.130319535C>G	ENSP00000299164:p.Leu223Val	Somatic	123	2	1579	WXS	Illumina HiSeq	Phase_I	99	11	NM_139055	0	0	0	0	0	Q32MI6	Missense_Mutation	SNP	ENST00000299164.2	37	CCDS8488.1	.	.	.	.	.	.	.	.	.	.	C	18.53	3.642991	0.67244	.	.	ENSG00000166106	ENST00000299164	D	0.87412	-2.25	5.21	3.35	0.38373	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	.	.	.	.	D	0.90428	0.7003	L	0.55743	1.74	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.89457	0.3734	9	0.66056	D	0.02	.	10.0356	0.42127	0.0:0.7626:0.0:0.2374	.	223	Q8TE58	ATS15_HUMAN	V	223	ENSP00000299164:L223V	ENSP00000299164:L223V	L	+	1	2	ADAMTS15	129824745	0.947000	0.32204	0.802000	0.32245	0.991000	0.79684	2.100000	0.41777	0.701000	0.31803	-0.137000	0.14449	CTG	.		0.667	ADAMTS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385638.1	NM_139055	
GUCY2C	2984	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	14839143	14839143	+	Missense_Mutation	SNP	C	C	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr12:14839143C>G	ENST00000261170.3	-	3	483	c.347G>C	c.(346-348)gGc>gCc	p.G116A	RP11-174G6.1_ENST00000501178.2_RNA	NM_004963.3	NP_004954.2	P25092	GUC2C_HUMAN	guanylate cyclase 2C (heat stable enterotoxin receptor)	116					intracellular signal transduction (GO:0035556)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of cell proliferation (GO:0042127)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|toxic substance binding (GO:0015643)			breast(3)|endometrium(7)|kidney(3)|large_intestine(9)|lung(17)|ovary(4)|skin(7)|urinary_tract(1)	51					Linaclotide(DB08890)	GAGGACACAGCCCATCCGTTG	0.428																																					p.G116A													.	GUCY2C-338	0			c.G347C						.						104.0	87.0	93.0					12																	14839143		2203	4300	6503	SO:0001583	missense	2984	exon3			ACACAGCCCATCC		CCDS8664.1	12p12	2008-08-18			ENSG00000070019	ENSG00000070019			4688	protein-coding gene	gene with protein product		601330		GUC2C		8661067	Standard	NM_004963		Approved	STAR	uc001rcd.3	P25092	OTTHUMG00000168732	ENST00000261170.3:c.347G>C	12.37:g.14839143C>G	ENSP00000261170:p.Gly116Ala	Somatic	85	1		WXS	Illumina HiSeq	Phase_I	73	27	NM_004963	0	0	0	0	0	B2RMY6	Missense_Mutation	SNP	ENST00000261170.3	37	CCDS8664.1	.	.	.	.	.	.	.	.	.	.	C	19.58	3.855051	0.71719	.	.	ENSG00000070019	ENST00000261170	D	0.82255	-1.59	5.92	5.92	0.95590	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.88811	0.6538	M	0.74881	2.28	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.84414	0.0567	10	0.02654	T	1	.	15.8215	0.78648	0.0:1.0:0.0:0.0	.	116	P25092	GUC2C_HUMAN	A	116	ENSP00000261170:G116A	ENSP00000261170:G116A	G	-	2	0	GUCY2C	14730410	1.000000	0.71417	1.000000	0.80357	0.566000	0.35808	5.512000	0.67030	2.804000	0.96469	0.655000	0.94253	GGC	.		0.428	GUCY2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400835.1		
FAM186B	84070	broad.mit.edu	37	12	49994268	49994268	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr12:49994268T>C	ENST00000257894.2	-	4	1316	c.1155A>G	c.(1153-1155)atA>atG	p.I385M	PRPF40B_ENST00000508736.1_3'UTR|FAM186B_ENST00000551047.1_Intron|FAM186B_ENST00000544141.1_Missense_Mutation_p.I295M	NM_032130.2	NP_115506.1	Q8IYM0	F186B_HUMAN	family with sequence similarity 186, member B	385						protein complex (GO:0043234)				breast(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						GCCCTGCAGCTATAGCACCAC	0.567																																					p.I385M													.	FAM186B-91	0			c.A1155G						.						86.0	68.0	74.0					12																	49994268		2203	4300	6503	SO:0001583	missense	84070	exon4			TGCAGCTATAGCA	AL136748	CCDS8788.1	12q13.12	2008-09-17	2008-09-17	2008-09-17	ENSG00000135436	ENSG00000135436			25296	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 25"""	C12orf25		11230166	Standard	NM_032130		Approved	DKFZP434J0113	uc001ruo.3	Q8IYM0	OTTHUMG00000167427	ENST00000257894.2:c.1155A>G	12.37:g.49994268T>C	ENSP00000257894:p.Ile385Met	Somatic	69	0		WXS	Illumina HiSeq	Phase_I	73	4	NM_032130	0	0	0	0	0	B4DZ15|Q8TCP7|Q9H0L3	Missense_Mutation	SNP	ENST00000257894.2	37	CCDS8788.1	.	.	.	.	.	.	.	.	.	.	T	10.17	1.276364	0.23307	.	.	ENSG00000135436	ENST00000544141;ENST00000257894	T;T	0.11821	2.74;2.94	5.11	-4.84	0.03151	.	1.605610	0.03763	N	0.258518	T	0.04452	0.0122	N	0.02011	-0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.38001	-0.9681	9	.	.	.	5.1651	6.7462	0.23462	0.268:0.55:0.0:0.1821	.	295;385	B4DZ15;Q8IYM0	.;F186B_HUMAN	M	295;385	ENSP00000438569:I295M;ENSP00000257894:I385M	.	I	-	3	3	FAM186B	48280535	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-1.673000	0.01951	-0.796000	0.04456	0.533000	0.62120	ATA	.		0.567	FAM186B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394583.2	NM_032130	
LRIG3	121227	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	59268266	59268266	+	Missense_Mutation	SNP	T	T	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr12:59268266T>G	ENST00000320743.3	-	17	3071	c.2785A>C	c.(2785-2787)Atg>Ctg	p.M929L	LRIG3_ENST00000379141.4_Missense_Mutation_p.M869L	NM_153377.4	NP_700356.2	Q6UXM1	LRIG3_HUMAN	leucine-rich repeats and immunoglobulin-like domains 3	929					otolith morphogenesis (GO:0032474)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)			LRIG3/ROS1(2)	breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(12)|liver(1)|lung(14)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48			GBM - Glioblastoma multiforme(1;1.17e-18)			TTCAAATACATAGGGCCTGTG	0.428			T	ROS1	NSCLC																																p.M929L		.		Dom	yes		12	12q14.1	121227	leucine-rich repeats and immunoglobulin-like domains 3		E	.	LRIG3-229	0			c.A2785C						.						148.0	135.0	139.0					12																	59268266		2203	4300	6503	SO:0001583	missense	121227	exon17			AATACATAGGGCC	AY505340	CCDS8960.1, CCDS44933.1	12q13.2	2013-01-11				ENSG00000139263		"""Immunoglobulin superfamily / I-set domain containing"""	30991	protein-coding gene	gene with protein product		608870					Standard	NM_153377		Approved	FLJ90440, KIAA3016	uc001sqr.4	Q6UXM1	OTTHUMG00000169940	ENST00000320743.3:c.2785A>C	12.37:g.59268266T>G	ENSP00000326759:p.Met929Leu	Somatic	146	0		WXS	Illumina HiSeq	Phase_I	130	48	NM_153377	0	0	21	25	4	Q6UXL7|Q8NC72	Missense_Mutation	SNP	ENST00000320743.3	37	CCDS8960.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	4.815|4.815	0.151595|0.151595	0.09185|0.09185	.|.	.|.	ENSG00000139263|ENSG00000139263	ENST00000379141;ENST00000320743|ENST00000550825	T;T|.	0.54479|.	0.62;0.57|.	6.03|6.03	5.14|5.14	0.70334|0.70334	.|.	0.517740|.	0.14462|.	N|.	0.318092|.	T|T	0.19366|0.19366	0.0465|0.0465	N|N	0.12182|0.12182	0.205|0.205	0.18873|0.18873	N|N	0.999984|0.999984	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.01281|.	0.0;0.0|.	T|T	0.16453|0.16453	-1.0402|-1.0402	9|5	.|.	.|.	.|.	.|.	4.6325|4.6325	0.12509|0.12509	0.2843:0.5306:0.0:0.1851|0.2843:0.5306:0.0:0.1851	.|.	869;929|.	Q6UXM1-2;Q6UXM1|.	.;LRIG3_HUMAN|.	L|S	869;929|30	ENSP00000368436:M869L;ENSP00000326759:M929L|.	.|.	M|Y	-|-	1|2	0|0	LRIG3|LRIG3	57554533|57554533	0.449000|0.449000	0.25689|0.25689	0.998000|0.998000	0.56505|0.56505	0.018000|0.018000	0.09664|0.09664	0.724000|0.724000	0.25954|0.25954	1.568000|1.568000	0.49683|0.49683	-0.132000|-0.132000	0.14878|0.14878	ATG|TAT	.		0.428	LRIG3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406623.1	NM_153377	
GPN3	51184	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	110902939	110902939	+	Silent	SNP	T	T	C			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr12:110902939T>C	ENST00000228827.3	-	2	191	c.129A>G	c.(127-129)gcA>gcG	p.A43A	GPN3_ENST00000552180.1_5'UTR|GPN3_ENST00000537466.2_Silent_p.A53A|GPN3_ENST00000543199.1_Silent_p.A82A	NM_016301.3	NP_057385.3			GPN-loop GTPase 3											endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|urinary_tract(1)	8						TGAAGTGTTCTGCTGCTGGAT	0.547																																					p.A82A		.											.	GPN3-90	0			c.A246G						.						190.0	151.0	164.0					12																	110902939		2203	4300	6503	SO:0001819	synonymous_variant	51184	exon2			GTGTTCTGCTGCT	BC008416	CCDS9147.1, CCDS53830.1, CCDS53831.1	12q24.11	2012-12-18	2008-04-30	2008-04-30	ENSG00000111231	ENSG00000111231		"""GPN-loop GTPases"""	30186	protein-coding gene	gene with protein product			"""ATP binding domain 1 family, member C"""	ATPBD1C		12975309	Standard	NM_016301		Approved	MGC14560	uc021rdu.1	Q9UHW5	OTTHUMG00000169524	ENST00000228827.3:c.129A>G	12.37:g.110902939T>C		Somatic	111	0		WXS	Illumina HiSeq	Phase_I	106	18	NM_001164372	0	0	13	18	5		Silent	SNP	ENST00000228827.3	37	CCDS9147.1																																																																																			.		0.547	GPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404607.1	NM_016301	
BRCA2	675	broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	32912897	32912897	+	Missense_Mutation	SNP	G	G	T	rs397507331		TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr13:32912897G>T	ENST00000380152.3	+	11	4638	c.4405G>T	c.(4405-4407)Gac>Tac	p.D1469Y	BRCA2_ENST00000544455.1_Missense_Mutation_p.D1469Y			P51587	BRCA2_HUMAN	breast cancer 2, early onset	1469	Interaction with POLH.|Required for stimulation of POLH DNA polymerization activity.				brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		ATTACATTCTGACATAAGAAA	0.303			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											p.D1469Y	Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)		yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	.	BRCA2-3153	0			c.G4405T						.						53.0	62.0	59.0					13																	32912897		2201	4294	6495	SO:0001583	missense	675	exon11	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	CATTCTGACATAA	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.4405G>T	13.37:g.32912897G>T	ENSP00000369497:p.Asp1469Tyr	Somatic	351	1		WXS	Illumina HiSeq	Phase_I	324	90	NM_000059	0	0	0	0	0	O00183|O15008|Q13879|Q5TBJ7	Missense_Mutation	SNP	ENST00000380152.3	37	CCDS9344.1	.	.	.	.	.	.	.	.	.	.	G	13.72	2.321955	0.41096	.	.	ENSG00000139618	ENST00000380152;ENST00000544455	T;T	0.00691	5.84;5.84	5.95	3.25	0.37280	.	1.061550	0.07241	N	0.864150	T	0.00998	0.0033	N	0.22421	0.69	0.09310	N	1	P	0.51653	0.947	P	0.44561	0.453	T	0.58451	-0.7634	10	0.72032	D	0.01	.	9.2592	0.37601	0.2723:0.0:0.7277:0.0	.	1469	P51587	BRCA2_HUMAN	Y	1469	ENSP00000369497:D1469Y;ENSP00000439902:D1469Y	ENSP00000369497:D1469Y	D	+	1	0	BRCA2	31810897	0.000000	0.05858	0.761000	0.31378	0.872000	0.50106	0.402000	0.20965	1.512000	0.48834	0.563000	0.77884	GAC	.		0.303	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046000.2	NM_000059	
KLF5	688	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	73636276	73636276	+	Missense_Mutation	SNP	C	C	T	rs200707995	byFrequency	TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr13:73636276C>T	ENST00000377687.4	+	2	1075	c.539C>T	c.(538-540)cCg>cTg	p.P180L	KLF5_ENST00000539231.1_Missense_Mutation_p.P89L|KLF5_ENST00000477333.1_3'UTR	NM_001730.3	NP_001721.2	Q13887	KLF5_HUMAN	Kruppel-like factor 5 (intestinal)	180					angiogenesis (GO:0001525)|cellular response to organic cyclic compound (GO:0071407)|cellular response to peptide (GO:1901653)|intestinal epithelial cell development (GO:0060576)|microvillus assembly (GO:0030033)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of microvillus assembly (GO:0032534)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Prostate(6;0.00187)|Breast(118;0.0735)		GBM - Glioblastoma multiforme(99;0.0011)		GCCCCTCCTCCGGCCCCGACC	0.522													C|||	2	0.000399361	0.0	0.0	5008	,	,		18258	0.001		0.0	False		,,,				2504	0.001				p.P180L		.											.	KLF5-155	0			c.C539T						.						70.0	71.0	71.0					13																	73636276		2203	4300	6503	SO:0001583	missense	688	exon2			CTCCTCCGGCCCC	D14520	CCDS9448.1, CCDS66562.1	13q21.3	2013-01-08			ENSG00000102554	ENSG00000102554		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	6349	protein-coding gene	gene with protein product		602903		BTEB2		8479902, 9973612	Standard	NM_001730		Approved	IKLF, CKLF	uc001vje.3	Q13887	OTTHUMG00000017074	ENST00000377687.4:c.539C>T	13.37:g.73636276C>T	ENSP00000366915:p.Pro180Leu	Somatic	128	0		WXS	Illumina HiSeq	Phase_I	75	17	NM_001730	0	0	1	3	2	L0R3U5|L0R4T9|Q9UHP8	Missense_Mutation	SNP	ENST00000377687.4	37	CCDS9448.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	18.09	3.546448	0.65198	.	.	ENSG00000102554	ENST00000539231;ENST00000377687;ENST00000545883	T;T	0.07021	3.42;3.23	5.94	5.94	0.96194	.	0.132092	0.51477	D	0.000090	T	0.10337	0.0253	L	0.48642	1.525	0.80722	D	1	P	0.47545	0.897	B	0.35073	0.195	T	0.02232	-1.1191	10	0.72032	D	0.01	.	20.3591	0.98849	0.0:1.0:0.0:0.0	.	180	Q13887	KLF5_HUMAN	L	89;180;160	ENSP00000440407:P89L;ENSP00000366915:P180L	ENSP00000366915:P180L	P	+	2	0	KLF5	72534277	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.687000	0.37680	2.816000	0.96949	0.561000	0.74099	CCG	C|0.999;T|0.000		0.522	KLF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045263.1		
FAM155A	728215	hgsc.bcm.edu	37	13	108518698	108518698	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr13:108518698G>T	ENST00000375915.2	-	1	385	c.247C>A	c.(247-249)Cag>Aag	p.Q83K		NM_001080396.2	NP_001073865.1	B1AL88	F155A_HUMAN	family with sequence similarity 155, member A	83	Poly-Gln.					integral component of membrane (GO:0016021)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33						tgctgctgctgctgctgctgc	0.706																																					p.Q83K		.											.	FAM155A-23	0			c.C247A						.						16.0	22.0	20.0					13																	108518698		1929	3762	5691	SO:0001583	missense	728215	exon1			GCTGCTGCTGCTG	L10374	CCDS32006.1	13q33.3	2008-04-15			ENSG00000204442	ENSG00000204442			33877	protein-coding gene	gene with protein product							Standard	NM_001080396		Approved		uc001vql.3	B1AL88	OTTHUMG00000017326	ENST00000375915.2:c.247C>A	13.37:g.108518698G>T	ENSP00000365080:p.Gln83Lys	Somatic	16	0		WXS	Illumina HiSeq	Phase_I	28	5	NM_001080396	0	0	0	0	0	B2RUV1|B7Z334	Missense_Mutation	SNP	ENST00000375915.2	37	CCDS32006.1	.	.	.	.	.	.	.	.	.	.	G	10.92	1.487166	0.26686	.	.	ENSG00000204442	ENST00000375915	T	0.62364	0.03	4.45	4.45	0.53987	Armadillo-like helical (1);	0.715687	0.11618	N	0.546038	T	0.55146	0.1902	L	0.43923	1.385	0.25117	N	0.990675	B	0.13594	0.008	B	0.13407	0.009	T	0.45308	-0.9270	10	0.36615	T	0.2	.	12.5709	0.56337	0.0:0.0:1.0:0.0	.	83	B1AL88	F155A_HUMAN	K	83	ENSP00000365080:Q83K	ENSP00000365080:Q83K	Q	-	1	0	FAM155A	107316699	1.000000	0.71417	0.893000	0.35052	0.674000	0.39518	4.577000	0.60922	2.027000	0.59764	0.561000	0.74099	CAG	.		0.706	FAM155A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045736.2	NM_001080396	
ACOT1	641371	broad.mit.edu	37	14	74004293	74004293	+	Silent	SNP	C	C	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr14:74004293C>T	ENST00000311148.4	+	1	476	c.168C>T	c.(166-168)acC>acT	p.T56T	HEATR4_ENST00000560393.1_Intron|ACOT1_ENST00000557556.1_Silent_p.T56T|HEATR4_ENST00000334988.2_Intron|HEATR4_ENST00000553558.1_Intron	NM_001037161.1	NP_001032238.1	Q86TX2	ACOT1_HUMAN	acyl-CoA thioesterase 1	56					acyl-CoA metabolic process (GO:0006637)|long-chain fatty acid metabolic process (GO:0001676)|very long-chain fatty acid metabolic process (GO:0000038)	cytosol (GO:0005829)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|palmitoyl-CoA hydrolase activity (GO:0016290)			endometrium(1)|large_intestine(1)|lung(2)	4				OV - Ovarian serous cystadenocarcinoma(108;1.37e-45)|BRCA - Breast invasive adenocarcinoma(234;0.0033)		GCGCCGACACCCTTGGCGAGC	0.746																																					p.T56T													.	ACOT1-44	0			c.C168T						.																																			SO:0001819	synonymous_variant	641371	exon1			CGACACCCTTGGC	DQ082754	CCDS32117.1	14q24.3	2013-09-20			ENSG00000184227	ENSG00000184227		"""Acyl CoA thioesterases"""	33128	protein-coding gene	gene with protein product		614313				16103133, 16940157	Standard	NM_001037161		Approved	ACH2, CTE-1, LACH2		Q86TX2	OTTHUMG00000171607	ENST00000311148.4:c.168C>T	14.37:g.74004293C>T		Somatic	8	0		WXS	Illumina HiSeq	Phase_I	52	9	NM_001037161	0	0	0	0	0	A1L173|Q3I5F9	Silent	SNP	ENST00000311148.4	37	CCDS32117.1																																																																																			C|0.029;T|0.971		0.746	ACOT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414432.1	NM_001037161	
THBS1	7057	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	39877738	39877738	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr15:39877738A>G	ENST00000260356.5	+	7	1259	c.1094A>G	c.(1093-1095)gAt>gGt	p.D365G		NM_003246.2	NP_003237.2	P07996	TSP1_HUMAN	thrombospondin 1	365	VWFC. {ECO:0000255|PROSITE- ProRule:PRU00220}.				activation of MAPK activity (GO:0000187)|behavioral response to pain (GO:0048266)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heat (GO:0034605)|cellular response to tumor necrosis factor (GO:0071356)|chronic inflammatory response (GO:0002544)|endocardial cushion development (GO:0003197)|engulfment of apoptotic cell (GO:0043652)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|immune response (GO:0006955)|negative regulation of angiogenesis (GO:0016525)|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II (GO:0002581)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cGMP-mediated signaling (GO:0010754)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell antigen processing and presentation (GO:0002605)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|negative regulation of plasminogen activation (GO:0010757)|outflow tract morphogenesis (GO:0003151)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of macrophage activation (GO:0043032)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of transforming growth factor beta1 production (GO:0032914)|positive regulation of translation (GO:0045727)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to magnesium ion (GO:0032026)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to testosterone (GO:0033574)|response to unfolded protein (GO:0006986)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|sarcoplasmic reticulum (GO:0016529)|secretory granule (GO:0030141)	calcium ion binding (GO:0005509)|collagen V binding (GO:0070052)|fibrinogen binding (GO:0070051)|fibroblast growth factor binding (GO:0017134)|fibronectin binding (GO:0001968)|glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|low-density lipoprotein particle binding (GO:0030169)|phosphatidylserine binding (GO:0001786)|proteoglycan binding (GO:0043394)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(5)|large_intestine(15)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	53		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)		ACAGTTCCTGATGGAGAATGC	0.507																																					p.D365G		.											.	THBS1-653	0			c.A1094G						.						218.0	152.0	174.0					15																	39877738		2200	4297	6497	SO:0001583	missense	7057	exon7			TTCCTGATGGAGA		CCDS32194.1	15q15	2009-04-08			ENSG00000137801	ENSG00000137801			11785	protein-coding gene	gene with protein product	"""thrombospondin-1p180"""	188060				2341158, 2335352	Standard	NM_003246		Approved	TSP1, THBS, TSP, THBS-1, TSP-1	uc001zkh.3	P07996	OTTHUMG00000133665	ENST00000260356.5:c.1094A>G	15.37:g.39877738A>G	ENSP00000260356:p.Asp365Gly	Somatic	35	0		WXS	Illumina HiSeq	Phase_I	34	7	NM_003246	0	0	2	3	1	A8K6H4|B4E3J7|B9EGH6|Q15667|Q59E99	Missense_Mutation	SNP	ENST00000260356.5	37	CCDS32194.1	.	.	.	.	.	.	.	.	.	.	A	31	5.103828	0.94245	.	.	ENSG00000137801	ENST00000260356	T	0.65364	-0.15	5.86	5.86	0.93980	von Willebrand factor, type C (4);	0.000000	0.34676	N	0.003775	T	0.77751	0.4177	M	0.69463	2.115	0.58432	D	0.999998	D	0.76494	0.999	D	0.85130	0.997	T	0.79640	-0.1719	10	0.66056	D	0.02	-17.1145	15.4256	0.75048	1.0:0.0:0.0:0.0	.	365	P07996	TSP1_HUMAN	G	365	ENSP00000260356:D365G	ENSP00000260356:D365G	D	+	2	0	THBS1	37665030	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	9.339000	0.96797	2.237000	0.73441	0.533000	0.62120	GAT	.		0.507	THBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257831.2	NM_003246	
SPINT1	6692	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	41136856	41136856	+	Missense_Mutation	SNP	C	C	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr15:41136856C>A	ENST00000344051.4	+	2	338	c.104C>A	c.(103-105)gCc>gAc	p.A35D	RP11-532F12.5_ENST00000568419.1_RNA|RP11-532F12.5_ENST00000568525.1_RNA|SPINT1_ENST00000431806.1_Missense_Mutation_p.A35D|RP11-532F12.5_ENST00000564302.1_RNA|SPINT1_ENST00000562057.1_Missense_Mutation_p.A35D|RP11-532F12.5_ENST00000565315.1_RNA			O43278	SPIT1_HUMAN	serine peptidase inhibitor, Kunitz type 1	35					branching involved in labyrinthine layer morphogenesis (GO:0060670)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)|placenta blood vessel development (GO:0060674)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	serine-type endopeptidase inhibitor activity (GO:0004867)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	16		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;2.91e-05)|COAD - Colon adenocarcinoma(120;0.153)|BRCA - Breast invasive adenocarcinoma(123;0.166)		GGCACCCAGGCCGGGCCACCG	0.761																																					p.A35D		.											.	SPINT1-91	0			c.C104A						.						6.0	8.0	8.0					15																	41136856		2067	4058	6125	SO:0001583	missense	6692	exon2			CCCAGGCCGGGCC		CCDS10067.1, CCDS45231.1	15q13.3	2008-02-05	2005-08-17		ENSG00000166145	ENSG00000166145			11246	protein-coding gene	gene with protein product		605123	"""serine protease inhibitor, Kunitz type 1"""				Standard	XM_006720657		Approved	HAI, MANSC2	uc001zna.3	O43278	OTTHUMG00000130068	ENST00000344051.4:c.104C>A	15.37:g.41136856C>A	ENSP00000342098:p.Ala35Asp	Somatic	15	0		WXS	Illumina HiSeq	Phase_I	77	23	NM_181642	0	0	0	0	0	Q7Z7D2	Missense_Mutation	SNP	ENST00000344051.4	37	CCDS10067.1	.	.	.	.	.	.	.	.	.	.	C	18.06	3.538187	0.65085	.	.	ENSG00000166145	ENST00000344051;ENST00000431806	D;D	0.95656	-3.76;-3.77	5.02	3.07	0.35406	.	0.452065	0.24688	N	0.036402	D	0.89591	0.6759	N	0.08118	0	0.09310	N	1	P;P;P	0.48162	0.906;0.9;0.906	B;P;P	0.49999	0.425;0.628;0.521	T	0.82341	-0.0505	10	0.29301	T	0.29	-21.5589	6.2982	0.21097	0.0:0.7099:0.1902:0.1	.	35;35;35	B2RBU9;O43278-2;O43278	.;.;SPIT1_HUMAN	D	35	ENSP00000342098:A35D;ENSP00000409935:A35D	ENSP00000342098:A35D	A	+	2	0	SPINT1	38924148	0.876000	0.30132	0.328000	0.25416	0.002000	0.02628	3.594000	0.54008	1.206000	0.43276	0.563000	0.77884	GCC	.		0.761	SPINT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252359.2	NM_003710	
LRRC57	255252	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	42837381	42837381	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr15:42837381C>T	ENST00000323443.2	-	4	939	c.572G>A	c.(571-573)aGc>aAc	p.S191N	LRRC57_ENST00000563454.1_Missense_Mutation_p.S191N|LRRC57_ENST00000397130.3_Missense_Mutation_p.S191N			Q8N9N7	LRC57_HUMAN	leucine rich repeat containing 57	191						extracellular vesicular exosome (GO:0070062)				breast(1)|kidney(1)|lung(5)|prostate(1)	8		all_cancers(109;1.99e-12)|all_epithelial(112;5.11e-11)|Lung NSC(122;4.53e-07)|all_lung(180;1.64e-06)|Melanoma(134;0.0262)		GBM - Glioblastoma multiforme(94;6.87e-07)		GGGAAGCATGCTGAGCTCAAG	0.423																																					p.S191N		.											.	LRRC57-90	0			c.G572A						.						99.0	94.0	96.0					15																	42837381		2203	4299	6502	SO:0001583	missense	255252	exon5			AGCATGCTGAGCT	AK094891	CCDS10089.1	15q15.1	2006-02-13			ENSG00000180979	ENSG00000180979			26719	protein-coding gene	gene with protein product							Standard	NM_153260		Approved	FLJ36812	uc001zqc.3	Q8N9N7	OTTHUMG00000130679	ENST00000323443.2:c.572G>A	15.37:g.42837381C>T	ENSP00000326817:p.Ser191Asn	Somatic	85	0		WXS	Illumina HiSeq	Phase_I	74	26	NM_153260	0	0	5	6	1	Q7Z2Z6|Q8N1T6	Missense_Mutation	SNP	ENST00000323443.2	37	CCDS10089.1	.	.	.	.	.	.	.	.	.	.	C	16.88	3.243740	0.58995	.	.	ENSG00000180979	ENST00000323443;ENST00000397130	T;T	0.46451	0.87;0.87	5.36	4.43	0.53597	.	0.131595	0.64402	D	0.000001	T	0.32763	0.0840	L	0.33339	1.005	0.54753	D	0.999984	B	0.11235	0.004	B	0.09377	0.004	T	0.08126	-1.0737	10	0.34782	T	0.22	.	14.3053	0.66380	0.0:0.9273:0.0:0.0727	.	191	Q8N9N7	LRC57_HUMAN	N	191	ENSP00000326817:S191N;ENSP00000380319:S191N	ENSP00000326817:S191N	S	-	2	0	LRRC57	40624673	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.969000	0.49232	2.520000	0.84964	0.557000	0.71058	AGC	.		0.423	LRRC57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253174.1	NM_153260	
SHC4	399694	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	49148178	49148178	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr15:49148178G>T	ENST00000332408.4	-	8	1642	c.1214C>A	c.(1213-1215)cCc>cAc	p.P405H	SHC4_ENST00000396535.3_Missense_Mutation_p.P162H|SHC4_ENST00000537958.1_Missense_Mutation_p.P119H	NM_203349.3	NP_976224.3	Q6S5L8	SHC4_HUMAN	SHC (Src homology 2 domain containing) family, member 4	405	CH1.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of cell proliferation (GO:0008284)|regulation of gene expression (GO:0010468)|stem cell differentiation (GO:0048863)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(2)|large_intestine(8)|lung(11)|ovary(3)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	29		all_lung(180;0.00466)		all cancers(107;9.4e-08)|GBM - Glioblastoma multiforme(94;5.94e-07)		ACACTGTATGGGGCAGTAAGC	0.408																																					p.P405H		.											.	SHC4-95	0			c.C1214A						.						140.0	128.0	132.0					15																	49148178		2197	4294	6491	SO:0001583	missense	399694	exon8			TGTATGGGGCAGT	AY358250	CCDS10130.1	15q21.1-q21.2	2013-02-14			ENSG00000185634	ENSG00000185634		"""SH2 domain containing"""	16743	protein-coding gene	gene with protein product	"""rai-like protein"""						Standard	NM_203349		Approved	RaLP	uc001zxb.1	Q6S5L8	OTTHUMG00000131513	ENST00000332408.4:c.1214C>A	15.37:g.49148178G>T	ENSP00000329668:p.Pro405His	Somatic	145	0		WXS	Illumina HiSeq	Phase_I	117	28	NM_203349	0	0	0	0	0	Q6UXQ3|Q8IYW3	Missense_Mutation	SNP	ENST00000332408.4	37	CCDS10130.1	.	.	.	.	.	.	.	.	.	.	G	17.07	3.293981	0.60086	.	.	ENSG00000185634	ENST00000332408;ENST00000396535;ENST00000537958	T;T;T	0.31769	3.48;1.48;1.5	5.03	5.03	0.67393	.	0.200639	0.36134	N	0.002762	T	0.44435	0.1293	L	0.43923	1.385	0.46521	D	0.999085	P;D	0.69078	0.575;0.997	B;P	0.60886	0.211;0.88	T	0.31194	-0.9952	10	0.59425	D	0.04	-10.6953	15.38	0.74648	0.0:0.0:1.0:0.0	.	162;405	Q6S5L8-2;Q6S5L8	.;SHC4_HUMAN	H	405;162;119	ENSP00000329668:P405H;ENSP00000379786:P162H;ENSP00000443300:P119H	ENSP00000329668:P405H	P	-	2	0	SHC4	46935470	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.871000	0.69628	2.612000	0.88384	0.655000	0.94253	CCC	.		0.408	SHC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254371.1	NM_203349	
FBXL22	283807	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	63889797	63889797	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr15:63889797C>T	ENST00000360587.2	+	1	246	c.206C>T	c.(205-207)cCg>cTg	p.P69L	USP3-AS1_ENST00000559861.1_RNA|USP3-AS1_ENST00000559737.1_RNA|FBXL22_ENST00000539570.3_Missense_Mutation_p.P63L|USP3-AS1_ENST00000560962.1_RNA|USP3-AS1_ENST00000560622.1_RNA|USP3-AS1_ENST00000558831.1_RNA|FBXL22_ENST00000534939.1_Missense_Mutation_p.P69L|USP3-AS1_ENST00000561191.1_RNA|USP3-AS1_ENST00000561256.1_RNA	NM_203373.2	NP_976307.2	Q6P050	FXL22_HUMAN	F-box and leucine-rich repeat protein 22	69					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				lung(4)	4						CTCCTGGGCCCGGCACTCCGC	0.617																																					p.P69L		.											.	FBXL22-90	0			c.C206T						.						47.0	38.0	41.0					15																	63889797		2203	4300	6503	SO:0001583	missense	283807	exon1			TGGGCCCGGCACT	BC065833	CCDS10187.1, CCDS10187.2	15q22.1	2012-04-05			ENSG00000197361	ENSG00000197361		"""F-boxes / Leucine-rich repeats"""	27537	protein-coding gene	gene with protein product		609088				12477932	Standard	NM_203373		Approved	Fbl22, FLJ39626	uc002amn.4	Q6P050	OTTHUMG00000132905	ENST00000360587.2:c.206C>T	15.37:g.63889797C>T	ENSP00000353794:p.Pro69Leu	Somatic	58	0		WXS	Illumina HiSeq	Phase_I	25	6	NM_203373	0	0	0	0	0		Missense_Mutation	SNP	ENST00000360587.2	37	CCDS10187.2	.	.	.	.	.	.	.	.	.	.	C	27.1	4.799631	0.90538	.	.	ENSG00000197361	ENST00000360587;ENST00000539570	T;T	0.38722	1.12;1.12	5.72	5.72	0.89469	.	0.183522	0.48767	D	0.000162	T	0.58352	0.2116	L	0.48642	1.525	0.58432	D	0.999999	D	0.76494	0.999	D	0.63957	0.92	T	0.58940	-0.7547	10	0.87932	D	0	-2.5763	18.8613	0.92273	0.0:1.0:0.0:0.0	.	63	Q6P050	FXL22_HUMAN	L	69;63	ENSP00000353794:P69L;ENSP00000442112:P63L	ENSP00000353794:P69L	P	+	2	0	FBXL22	61676850	1.000000	0.71417	0.959000	0.39883	0.594000	0.36715	7.583000	0.82559	2.699000	0.92147	0.563000	0.77884	CCG	.		0.617	FBXL22-001	KNOWN	downstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256412.4	NM_203373	
LARP6	55323	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	71128826	71128826	+	Silent	SNP	T	T	C			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr15:71128826T>C	ENST00000299213.8	-	2	289	c.219A>G	c.(217-219)ggA>ggG	p.G73G		NM_018357.2	NP_060827.2	Q9BRS8	LARP6_HUMAN	La ribonucleoprotein domain family, member 6	73					regulation of translation (GO:0006417)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	19						CGTTCTCACCTCCACTTGCAG	0.522																																					p.G73G		.											.	LARP6-90	0			c.A219G						.						70.0	72.0	71.0					15																	71128826		2199	4297	6496	SO:0001819	synonymous_variant	55323	exon2			CTCACCTCCACTT	BC009446	CCDS10236.1, CCDS32281.1	15q23	2012-11-19			ENSG00000166173	ENSG00000166173		"""La ribonucleoprotein domain containing"""	24012	protein-coding gene	gene with protein product		611300				12477932	Standard	NM_018357		Approved	acheron, FLJ11196	uc002ass.3	Q9BRS8	OTTHUMG00000172179	ENST00000299213.8:c.219A>G	15.37:g.71128826T>C		Somatic	81	0		WXS	Illumina HiSeq	Phase_I	70	24	NM_018357	0	0	2	4	2	Q5XKE4|Q8N3N2|Q9NUR0	Silent	SNP	ENST00000299213.8	37	CCDS32281.1																																																																																			.		0.522	LARP6-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417197.2	NM_018357	
NTRK3	4916	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	88680721	88680721	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr15:88680721T>C	ENST00000360948.2	-	6	697	c.536A>G	c.(535-537)gAg>gGg	p.E179G	NTRK3_ENST00000540489.2_Missense_Mutation_p.E179G|NTRK3_ENST00000317501.3_Missense_Mutation_p.E179G|NTRK3_ENST00000355254.2_Missense_Mutation_p.E179G|NTRK3_ENST00000357724.2_Missense_Mutation_p.E179G|NTRK3_ENST00000557856.1_Missense_Mutation_p.E179G|NTRK3_ENST00000394480.2_Missense_Mutation_p.E179G|NTRK3_ENST00000542733.2_Missense_Mutation_p.E81G|NTRK3_ENST00000558676.1_Missense_Mutation_p.E179G	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	179	LRRCT.				activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			GAGCTTGGCCTCCCCCTGCTC	0.567			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																											p.E179G		.		Dom	yes		15	15q25	4916	"""neurotrophic tyrosine kinase, receptor, type 3"""		"""E, M"""	.	NTRK3-3538	0			c.A536G						.						124.0	94.0	104.0					15																	88680721		2201	4299	6500	SO:0001583	missense	4916	exon7			TTGGCCTCCCCCT	U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.536A>G	15.37:g.88680721T>C	ENSP00000354207:p.Glu179Gly	Somatic	56	0		WXS	Illumina HiSeq	Phase_I	41	4	NM_001243101	0	0	0	0	0	B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Missense_Mutation	SNP	ENST00000360948.2	37	CCDS32322.1	.	.	.	.	.	.	.	.	.	.	T	16.79	3.219821	0.58560	.	.	ENSG00000140538	ENST00000394480;ENST00000360948;ENST00000357724;ENST00000355254;ENST00000542733;ENST00000540489;ENST00000317501	D;D;D;D;D;D;D	0.89875	-2.58;-2.58;-2.58;-2.58;-2.58;-2.58;-2.58	5.71	5.71	0.89125	Cysteine-rich flanking region, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.92331	0.7567	L	0.51422	1.61	0.58432	D	0.999993	D;D;P;D;D;P	0.76494	0.999;0.999;0.47;0.999;0.998;0.47	D;D;B;D;D;B	0.81914	0.995;0.986;0.244;0.995;0.993;0.244	D	0.91792	0.5444	10	0.40728	T	0.16	.	15.1854	0.72996	0.0:0.0:0.0:1.0	.	81;179;179;179;179;179	B7Z7U4;E9PG56;B7Z4C5;Q96CY4;Q16288-3;Q16288	.;.;.;.;.;NTRK3_HUMAN	G	179;179;179;179;81;179;179	ENSP00000377990:E179G;ENSP00000354207:E179G;ENSP00000350356:E179G;ENSP00000347397:E179G;ENSP00000437773:E81G;ENSP00000444673:E179G;ENSP00000318328:E179G	ENSP00000318328:E179G	E	-	2	0	NTRK3	86481725	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.723000	0.68492	2.171000	0.68590	0.528000	0.53228	GAG	.		0.567	NTRK3-204	KNOWN	basic|CCDS	protein_coding	protein_coding			
PARN	5073	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	14678281	14678281	+	Splice_Site	SNP	T	T	C			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr16:14678281T>C	ENST00000437198.2	-	16	1147		c.e16-2		PARN_ENST00000539279.1_Splice_Site|PARN_ENST00000420015.2_Splice_Site|PARN_ENST00000341484.7_Splice_Site	NM_001134477.2|NM_002582.3	NP_001127949.1|NP_002573.1	O95453	PARN_HUMAN	poly(A)-specific ribonuclease						female gamete generation (GO:0007292)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|RNA metabolic process (GO:0016070)|RNA modification (GO:0009451)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|mRNA 3'-UTR binding (GO:0003730)|nuclease activity (GO:0004518)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly(A)-specific ribonuclease activity (GO:0004535)|protein kinase binding (GO:0019901)			cervix(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|urinary_tract(1)	21						AATGATATCCTGCAAACCACG	0.383																																					.		.											.	PARN-24	0			c.868-2A>G						.						52.0	50.0	51.0					16																	14678281		1825	4081	5906	SO:0001630	splice_region_variant	5073	exon16			ATATCCTGCAAAC	AJ005698	CCDS45419.1, CCDS45420.1, CCDS58425.1	16p13	2014-08-08	2011-07-07		ENSG00000140694	ENSG00000140694	3.1.13.4		8609	protein-coding gene	gene with protein product	"""deadenylation nuclease"""	604212	"""poly(A)-specific ribonuclease (deadenylation nuclease)"""			10640832	Standard	NM_002582		Approved	DAN	uc010uzd.2	O95453	OTTHUMG00000173199	ENST00000437198.2:c.1006-2A>G	16.37:g.14678281T>C		Somatic	95	0		WXS	Illumina HiSeq	Phase_I	60	22	NM_001242992	0	0	0	0	0	B2RCB3|B4DDG8|B4DWR4|B4E1H6	Splice_Site	SNP	ENST00000437198.2	37	CCDS45419.1	.	.	.	.	.	.	.	.	.	.	T	19.70	3.876641	0.72180	.	.	ENSG00000140694	ENST00000437198;ENST00000341484;ENST00000420015;ENST00000539279	.	.	.	5.75	5.75	0.90469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9377	0.70970	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	PARN	14585782	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	6.627000	0.74258	2.198000	0.70561	0.456000	0.33151	.	.		0.383	PARN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422383.1	NM_002582	Intron
ACSM2A	123876	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	20489950	20489950	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr16:20489950G>A	ENST00000573854.1	+	10	1346	c.1232G>A	c.(1231-1233)gGc>gAc	p.G411D	ACSM2A_ENST00000575690.1_Missense_Mutation_p.G411D|ACSM2A_ENST00000536134.1_Missense_Mutation_p.G183D|ACSM2A_ENST00000417235.2_Missense_Mutation_p.G332D|ACSM2A_ENST00000219054.6_Missense_Mutation_p.G411D|ACSM2A_ENST00000575558.1_3'UTR|ACSM2A_ENST00000396104.2_Missense_Mutation_p.G411D	NM_001010845.2	NP_001010845	Q08AH3	ACS2A_HUMAN	acyl-CoA synthetase medium-chain family member 2A	411					fatty acid metabolic process (GO:0006631)|glucose homeostasis (GO:0042593)|medium-chain fatty-acyl-CoA metabolic process (GO:0036112)|triglyceride homeostasis (GO:0070328)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(34)|ovary(1)|skin(6)|stomach(1)	51						GGAGACATTGGCATCAGGGTC	0.527																																					p.G411D		.											.	ACSM2A-91	0			c.G1232A						.						103.0	87.0	92.0					16																	20489950		2203	4297	6500	SO:0001583	missense	123876	exon11			ACATTGGCATCAG	AK091878, AK096039	CCDS32401.1	16p12.3	2014-08-08	2007-06-20	2007-06-20	ENSG00000183747	ENSG00000183747		"""Acyl-CoA synthetase family"""	32017	protein-coding gene	gene with protein product		614358	"""acyl-CoA synthetase medium-chain family member 2"""	ACSM2			Standard	NM_001010845		Approved	A-923A4.1, MGC150530	uc010bwe.3	Q08AH3	OTTHUMG00000177401	ENST00000573854.1:c.1232G>A	16.37:g.20489950G>A	ENSP00000459451:p.Gly411Asp	Somatic	89	0		WXS	Illumina HiSeq	Phase_I	67	24	NM_001010845	0	0	764	836	72	B3KTT9|O75202	Missense_Mutation	SNP	ENST00000573854.1	37	CCDS32401.1	.	.	.	.	.	.	.	.	.	.	G	9.906	1.208165	0.22205	.	.	ENSG00000183747	ENST00000417235;ENST00000219054;ENST00000536134;ENST00000396104	T;T;T;T	0.40476	1.03;1.03;1.03;1.03	3.33	0.71	0.18157	AMP-dependent synthetase/ligase (1);	0.312022	0.23048	N	0.052540	T	0.57975	0.2090	M	0.68952	2.095	0.20638	N	0.99987	D;D	0.76494	0.999;0.999	D;D	0.74674	0.977;0.984	T	0.52313	-0.8592	10	0.87932	D	0	-4.1522	11.8873	0.52610	0.0:0.6828:0.3172:0.0	.	332;411	B7Z8R0;Q08AH3	.;ACS2A_HUMAN	D	332;411;183;411	ENSP00000392169:G332D;ENSP00000219054:G411D;ENSP00000445082:G183D;ENSP00000379411:G411D	ENSP00000219054:G411D	G	+	2	0	ACSM2A	20397451	0.419000	0.25449	0.008000	0.14137	0.141000	0.21300	0.682000	0.25335	0.408000	0.25621	0.289000	0.19496	GGC	.		0.527	ACSM2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436764.1	NM_001010845	
TNRC6A	27327	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	24801321	24801321	+	Missense_Mutation	SNP	C	C	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr16:24801321C>G	ENST00000395799.3	+	6	1487	c.1358C>G	c.(1357-1359)cCa>cGa	p.P453R	TNRC6A_ENST00000315183.7_Missense_Mutation_p.P453R	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	453	Interaction with argonaute family proteins.|Sufficient for interaction with AGO1, AGO3 and AGO4.|Sufficient for interaction with AGO2.				cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.P453Q(1)		breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		ATGACTGGACCAAATAACACT	0.438																																					p.P453R		.											.	TNRC6A-92	1	Substitution - Missense(1)	lung(1)	c.C1358G						.						58.0	56.0	57.0					16																	24801321		2197	4300	6497	SO:0001583	missense	27327	exon6			CTGGACCAAATAA	U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.1358C>G	16.37:g.24801321C>G	ENSP00000379144:p.Pro453Arg	Somatic	106	0		WXS	Illumina HiSeq	Phase_I	102	25	NM_014494	0	0	0	0	0	C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	Missense_Mutation	SNP	ENST00000395799.3	37	CCDS10624.2	.	.	.	.	.	.	.	.	.	.	C	16.88	3.243926	0.58995	.	.	ENSG00000090905	ENST00000315183;ENST00000395799	T;T	0.44881	0.91;1.02	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.67069	0.2854	M	0.69823	2.125	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.989;0.999;0.998	T	0.67138	-0.5746	10	0.72032	D	0.01	-7.5051	20.3594	0.98849	0.0:1.0:0.0:0.0	.	200;453;453	Q8NDV7-2;Q8NDV7-6;Q8NDV7	.;.;TNR6A_HUMAN	R	453	ENSP00000326900:P453R;ENSP00000379144:P453R	ENSP00000326900:P453R	P	+	2	0	TNRC6A	24708822	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.247000	0.78257	2.816000	0.96949	0.563000	0.77884	CCA	.		0.438	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214081.1	NM_020847	
ATP2A1	487	bcgsc.ca	37	16	28914659	28914659	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr16:28914659C>T	ENST00000357084.3	+	21	3145	c.2878C>T	c.(2878-2880)Cgg>Tgg	p.R960W	ATP2A1_ENST00000395503.4_Missense_Mutation_p.R960W|ATP2A1_ENST00000536376.1_Missense_Mutation_p.R835W	NM_173201.3	NP_775293.1	O14983	AT2A1_HUMAN	ATPase, Ca++ transporting, cardiac muscle, fast twitch 1	960					apoptotic mitochondrial changes (GO:0008637)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|ion transmembrane transport (GO:0034220)|maintenance of mitochondrion location (GO:0051659)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|negative regulation of striated muscle contraction (GO:0045988)|positive regulation of endoplasmic reticulum calcium ion concentration (GO:0032470)|positive regulation of fast-twitch skeletal muscle fiber contraction (GO:0031448)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|regulation of striated muscle contraction (GO:0006942)|relaxation of skeletal muscle (GO:0090076)|response to endoplasmic reticulum stress (GO:0034976)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|H zone (GO:0031673)|I band (GO:0031674)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-transporting ATPase activity (GO:0005388)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	38						CTTCAAGCTCCGGGCCCTGGA	0.617																																					p.R960W													.	ATP2A1-93	0			c.C2878T						.						99.0	88.0	92.0					16																	28914659		2197	4300	6497	SO:0001583	missense	487	exon21			AAGCTCCGGGCCC		CCDS10643.1, CCDS42139.1, CCDS66997.1	16p12.1	2012-10-22			ENSG00000196296	ENSG00000196296	3.6.3.8	"""ATPases / P-type"""	811	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 1"", ""calcium pump 1"""	108730		ATP2A			Standard	NM_004320		Approved	SERCA1	uc002dro.1	O14983	OTTHUMG00000131760	ENST00000357084.3:c.2878C>T	16.37:g.28914659C>T	ENSP00000349595:p.Arg960Trp	Somatic	86	0		WXS	Illumina HiSeq	Phase_1	70	4	NM_004320	0	0	3	3	0	A8K5J9|B3KY17|O14984	Missense_Mutation	SNP	ENST00000357084.3	37	CCDS10643.1	.	.	.	.	.	.	.	.	.	.	C	17.78	3.473627	0.63737	.	.	ENSG00000196296	ENST00000357084;ENST00000395503;ENST00000536376	D;D;D	0.96073	-3.9;-3.9;-2.38	5.62	-0.253	0.12996	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);	0.750250	0.12288	N	0.482260	D	0.93216	0.7839	L	0.29908	0.895	0.09310	N	1	P;P;P	0.41546	0.754;0.6;0.545	P;B;P	0.52957	0.714;0.195;0.54	D	0.86482	0.1792	10	0.87932	D	0	.	5.6958	0.17855	0.579:0.2428:0.1065:0.0717	.	835;960;960	B3KY17;O14983;O14983-2	.;AT2A1_HUMAN;.	W	960;960;835	ENSP00000349595:R960W;ENSP00000378879:R960W;ENSP00000443101:R835W	ENSP00000349595:R960W	R	+	1	2	ATP2A1	28822160	0.106000	0.21978	0.306000	0.25113	0.895000	0.52256	3.849000	0.55910	0.264000	0.21851	0.561000	0.74099	CGG	.		0.617	ATP2A1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254686.2	NM_004320	
ZNF764	92595	broad.mit.edu	37	16	30569338	30569338	+	Silent	SNP	G	G	T	rs112425159		TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr16:30569338G>T	ENST00000252797.2	-	1	246	c.166C>A	c.(166-168)Cgg>Agg	p.R56R	AC002310.13_ENST00000568114.1_Silent_p.R56R|ZNF764_ENST00000395091.2_Silent_p.R56R	NM_001172679.1|NM_033410.3	NP_001166150.1|NP_219363.2	Q96H86	ZN764_HUMAN	zinc finger protein 764	56	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	7						TAGGTCTCCCGCATCACGTCC	0.731																																					p.R56R													.	ZNF764-91	0			c.C166A						.						22.0	24.0	23.0					16																	30569338		2195	4298	6493	SO:0001819	synonymous_variant	92595	exon1			TCTCCCGCATCAC	BC008821	CCDS10683.1, CCDS54001.1	16p11.2	2013-01-08			ENSG00000169951	ENSG00000169951		"""Zinc fingers, C2H2-type"", ""-"""	28200	protein-coding gene	gene with protein product						12477932	Standard	NM_033410		Approved	MGC13138	uc002dyq.3	Q96H86	OTTHUMG00000132406	ENST00000252797.2:c.166C>A	16.37:g.30569338G>T		Somatic	95	0		WXS	Illumina HiSeq	Phase_I	144	5	NM_001172679	0	0	0	0	0	A8MZF4|B3KSN2|H9KV99|Q9BWS1	Silent	SNP	ENST00000252797.2	37	CCDS10683.1																																																																																			G|0.500;T|0.500		0.731	ZNF764-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255541.1	NM_033410	
PYDC1	260434	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	31228204	31228204	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr16:31228204A>G	ENST00000302964.3	-	1	476	c.146T>C	c.(145-147)aTc>aCc	p.I49T	PYDC1_ENST00000568383.1_5'Flank|TRIM72_ENST00000322122.3_Intron	NM_152901.2	NP_690865.1	Q8WXC3	PYDC1_HUMAN	PYD (pyrin domain) containing 1	49	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.				innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of interleukin-1 beta secretion (GO:0050718)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytosol (GO:0005829)|IkappaB kinase complex (GO:0008385)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(2)|lung(1)	5						GAGGTCCACGATATCTAGCTG	0.652																																					p.I49T		.											.	PYDC1-68	0			c.T146C						.						68.0	61.0	63.0					16																	31228204		2197	4300	6497	SO:0001583	missense	260434	exon1			TCCACGATATCTA		CCDS10710.1	16p11.2	2008-02-05	2005-12-02		ENSG00000169900	ENSG00000169900			30261	protein-coding gene	gene with protein product		615700	"""pyrin domain containing 1"""			11786556, 16905547	Standard	NM_152901		Approved	ASC2, POP1	uc002ebo.3	Q8WXC3	OTTHUMG00000132407	ENST00000302964.3:c.146T>C	16.37:g.31228204A>G	ENSP00000304336:p.Ile49Thr	Somatic	172	0		WXS	Illumina HiSeq	Phase_I	98	23	NM_152901	0	0	0	0	0	B2R8L4|Q8NFP8	Missense_Mutation	SNP	ENST00000302964.3	37	CCDS10710.1	.	.	.	.	.	.	.	.	.	.	A	10.48	1.362629	0.24684	.	.	ENSG00000169900	ENST00000302964	T	0.45276	0.9	4.3	0.865	0.19074	Pyrin (2);DEATH-like (2);	2.187950	0.03117	U	0.163273	T	0.29355	0.0731	.	.	.	0.09310	N	1	P	0.42296	0.775	B	0.40864	0.342	T	0.18209	-1.0344	9	0.18710	T	0.47	.	5.5097	0.16874	0.124:0.4356:0.4404:0.0	.	49	Q8WXC3	PYDC1_HUMAN	T	49	ENSP00000304336:I49T	ENSP00000304336:I49T	I	-	2	0	PYDC1	31135705	0.000000	0.05858	0.000000	0.03702	0.091000	0.18340	-0.903000	0.04084	0.401000	0.25424	-0.415000	0.06103	ATC	.		0.652	PYDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255543.2	NM_152901	
N4BP1	9683	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	48576974	48576974	+	Silent	SNP	G	G	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr16:48576974G>A	ENST00000262384.3	-	7	2768	c.2532C>T	c.(2530-2532)ccC>ccT	p.P844P	N4BP1_ENST00000565423.1_5'UTR	NM_153029.3	NP_694574.3	O75113	N4BP1_HUMAN	NEDD4 binding protein 1	844					cellular response to UV (GO:0034644)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of protein ubiquitination (GO:0031397)	nucleolus (GO:0005730)|PML body (GO:0016605)				breast(3)|kidney(2)|lung(11)|urinary_tract(1)	17		all_cancers(37;0.179)|all_lung(18;0.11)				GAGCTGGCATGGGCAGGTTCT	0.577																																					p.P844P		.											.	N4BP1-22	0			c.C2532T						.						53.0	52.0	53.0					16																	48576974		1974	4170	6144	SO:0001819	synonymous_variant	9683	exon7			TGGCATGGGCAGG	AK026937	CCDS45479.1	16q12.1	2008-01-18				ENSG00000102921			29850	protein-coding gene	gene with protein product						9734811, 11717310	Standard	NM_153029		Approved		uc002efp.3	O75113		ENST00000262384.3:c.2532C>T	16.37:g.48576974G>A		Somatic	76	0		WXS	Illumina HiSeq	Phase_I	68	9	NM_153029	0	0	24	25	1	A7MD49|Q2YDX1	Silent	SNP	ENST00000262384.3	37	CCDS45479.1																																																																																			.		0.577	N4BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000429920.1	NM_014664	
ADCY7	113	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	50338447	50338447	+	Silent	SNP	C	C	T	rs144290211		TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr16:50338447C>T	ENST00000394697.2	+	11	1885	c.1545C>T	c.(1543-1545)aaC>aaT	p.N515N	ADCY7_ENST00000566433.2_Silent_p.N515N|ADCY7_ENST00000537579.1_Intron|ADCY7_ENST00000254235.3_Silent_p.N515N|ADCY7_ENST00000538642.1_Silent_p.N515N			P51828	ADCY7_HUMAN	adenylate cyclase 7	515					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to ethanol (GO:0071361)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|maternal process involved in female pregnancy (GO:0060135)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cAMP biosynthetic process (GO:0030819)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(5)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	35		all_cancers(37;0.0127)		GBM - Glioblastoma multiforme(240;0.195)		ACGTCCCCAACGGGCGGAGGC	0.652													C|||	1	0.000199681	0.0	0.0	5008	,	,		18295	0.0		0.0	False		,,,				2504	0.001				p.N515N													.	ADCY7-91	0			c.C1545T						.	C		3,4393	6.2+/-15.9	0,3,2195	43.0	46.0	45.0		1545	-10.0	0.0	16	dbSNP_134	45	0,8600		0,0,4300	no	coding-synonymous	ADCY7	NM_001114.3		0,3,6495	TT,TC,CC		0.0,0.0682,0.0231		515/1081	50338447	3,12993	2198	4300	6498	SO:0001819	synonymous_variant	113	exon10			CCCCAACGGGCGG	D25538	CCDS10741.1, CCDS73882.1	16q12.1	2013-02-04			ENSG00000121281	ENSG00000121281	4.6.1.1	"""Adenylate cyclases"""	238	protein-coding gene	gene with protein product		600385				7860067	Standard	NM_001286057		Approved	KIAA0037, AC7	uc002egd.1	P51828	OTTHUMG00000133172	ENST00000394697.2:c.1545C>T	16.37:g.50338447C>T		Somatic	107	2		WXS	Illumina HiSeq	Phase_I	112	26	NM_001114	0	0	4	5	1	A0AVA6	Silent	SNP	ENST00000394697.2	37	CCDS10741.1																																																																																			C|1.000;T|0.000		0.652	ADCY7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256877.3		
BCAR1	9564	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	75276534	75276534	+	Missense_Mutation	SNP	G	G	C	rs373232015		TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr16:75276534G>C	ENST00000162330.5	-	2	593	c.467C>G	c.(466-468)cCg>cGg	p.P156R	BCAR1_ENST00000420641.3_Missense_Mutation_p.P174R|BCAR1_ENST00000546196.1_Missense_Mutation_p.P127R|BCAR1_ENST00000393422.2_Missense_Mutation_p.P174R|BCAR1_ENST00000393420.6_Missense_Mutation_p.P156R|BCAR1_ENST00000542031.2_Missense_Mutation_p.P154R|BCAR1_ENST00000538440.2_Missense_Mutation_p.P156R|BCAR1_ENST00000418647.3_Missense_Mutation_p.P202R|BCAR1_ENST00000535626.2_Intron	NM_001170717.1|NM_014567.3	NP_001164188.1|NP_055382.2	P56945	BCAR1_HUMAN	breast cancer anti-estrogen resistance 1	156	Substrate for kinases. {ECO:0000250}.				actin filament organization (GO:0007015)|antigen receptor-mediated signaling pathway (GO:0050851)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell division (GO:0051301)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|epidermal growth factor receptor signaling pathway (GO:0007173)|G-protein coupled receptor signaling pathway (GO:0007186)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell migration (GO:0030335)|positive regulation of endothelial cell migration (GO:0010595)|regulation of apoptotic process (GO:0042981)|regulation of cell growth (GO:0001558)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(2)|central_nervous_system(5)|endometrium(1)|kidney(6)|large_intestine(1)|liver(1)|lung(13)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)	35				BRCA - Breast invasive adenocarcinoma(221;0.169)		GCTGGGAAACGGGTGATGGGG	0.642																																					p.P202R													.	BCAR1-1145	0			c.C605G						.						100.0	99.0	99.0					16																	75276534		2198	4300	6498	SO:0001583	missense	9564	exon3			GGAAACGGGTGAT	AJ242987	CCDS10915.1, CCDS54037.1, CCDS54038.1, CCDS54039.1, CCDS54040.1, CCDS54041.1, CCDS54042.1, CCDS54043.1	16q22-q23	2011-04-13			ENSG00000050820	ENSG00000050820		"""Cas scaffolding proteins"""	971	protein-coding gene	gene with protein product	"""Crk-associated substrate"", ""Cas scaffolding protein family member 1"""	602941				8413311, 10639512	Standard	NM_001170714		Approved	P130Cas, Crkas, CAS, CASS1	uc010vnb.2	P56945	OTTHUMG00000137604	ENST00000162330.5:c.467C>G	16.37:g.75276534G>C	ENSP00000162330:p.Pro156Arg	Somatic	126	1		WXS	Illumina HiSeq	Phase_I	94	25	NM_001170714	0	0	5	8	3	B3KWD7|B4DEV4|B4DGB5|B4DIW5|B7Z7X7|E9PCL5|E9PCV2|F5GXA2|F5GXV6|F5H7Z0|F8WA69|Q6QEF7	Missense_Mutation	SNP	ENST00000162330.5	37	CCDS10915.1	.	.	.	.	.	.	.	.	.	.	G	5.268	0.234849	0.09969	.	.	ENSG00000050820	ENST00000162330;ENST00000393422;ENST00000420641;ENST00000538440;ENST00000418647;ENST00000393420;ENST00000542031;ENST00000546196	T;T;T;T;T;T;T;T	0.57595	0.39;0.39;0.39;0.39;0.39;0.39;0.39;0.39	5.02	2.76	0.32466	.	1.250770	0.05591	N	0.574609	T	0.50735	0.1633	L	0.34521	1.04	0.09310	N	0.999999	B;P;P;B;B;P;B	0.46512	0.2;0.589;0.879;0.355;0.411;0.879;0.242	B;B;P;B;B;P;B	0.44518	0.09;0.174;0.452;0.186;0.229;0.452;0.052	T	0.50890	-0.8774	10	0.51188	T	0.08	-15.5833	13.9777	0.64284	0.0:0.0:0.687:0.313	.	174;202;154;156;174;156;156	B4DIW5;E9PCL5;F5GXA2;F8WA69;E9PCV2;F5H7Z0;P56945	.;.;.;.;.;.;BCAR1_HUMAN	R	156;174;174;156;202;156;154;127	ENSP00000162330:P156R;ENSP00000377074:P174R;ENSP00000392708:P174R;ENSP00000443841:P156R;ENSP00000391669:P202R;ENSP00000377072:P156R;ENSP00000440415:P154R;ENSP00000442161:P127R	ENSP00000162330:P156R	P	-	2	0	BCAR1	73834035	0.257000	0.24022	0.676000	0.29932	0.095000	0.18619	1.683000	0.37638	0.641000	0.30601	-0.824000	0.03097	CCG	.		0.642	BCAR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000269017.1	NM_014567	
HS3ST3A1	9955	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	13504436	13504436	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr17:13504436G>T	ENST00000284110.1	-	1	808	c.11C>A	c.(10-12)cCg>cAg	p.P4Q		NM_006042.1	NP_006033.1	Q9Y663	HS3SA_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 3A1	4					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 3 activity (GO:0033872)|sulfotransferase activity (GO:0008146)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_lung(20;0.114)		UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		GGCCGGGCCCGGAGGGGCCAT	0.711																																					p.P4Q		.											.	HS3ST3A1-515	0			c.C11A						.						21.0	21.0	21.0					17																	13504436		2176	4264	6440	SO:0001583	missense	9955	exon1			GGGCCCGGAGGGG	AF105376	CCDS11165.1	17p12	2007-04-02			ENSG00000153976	ENSG00000153976	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5196	protein-coding gene	gene with protein product		604057				9988767	Standard	NM_006042		Approved	3OST3A1, 30ST3A1	uc002gob.1	Q9Y663	OTTHUMG00000058768	ENST00000284110.1:c.11C>A	17.37:g.13504436G>T	ENSP00000284110:p.Pro4Gln	Somatic	66	0		WXS	Illumina HiSeq	Phase_I	67	15	NM_006042	0	0	0	0	0	A8K7N2	Missense_Mutation	SNP	ENST00000284110.1	37	CCDS11165.1	.	.	.	.	.	.	.	.	.	.	G	11.91	1.778371	0.31502	.	.	ENSG00000153976	ENST00000284110	T	0.50548	0.74	2.79	-0.456	0.12190	.	0.327925	0.15205	U	0.274780	T	0.30854	0.0778	N	0.24115	0.695	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.05632	-1.0873	10	0.66056	D	0.02	.	9.3973	0.38410	0.3961:0.0:0.6039:0.0	.	4	Q9Y663	HS3SA_HUMAN	Q	4	ENSP00000284110:P4Q	ENSP00000284110:P4Q	P	-	2	0	HS3ST3A1	13445161	0.000000	0.05858	0.792000	0.32020	0.729000	0.41735	-0.271000	0.08572	-0.327000	0.08551	-1.119000	0.02030	CCG	.		0.711	HS3ST3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129952.1	NM_006042	
NF1	4763	broad.mit.edu	37	17	29533389	29533389	+	Splice_Site	SNP	G	G	A	rs201604273		TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr17:29533389G>A	ENST00000358273.4	+	12	1775	c.1392G>A	c.(1390-1392)ccG>ccA	p.P464P	NF1_ENST00000431387.4_Splice_Site_p.P464P|NF1_ENST00000356175.3_Splice_Site_p.P464P	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	464					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(6)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		GAATGGCACCGGTAAGATAAA	0.383			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			G|||	1	0.000199681	0.0	0.0	5008	,	,		18347	0.001		0.0	False		,,,				2504	0.0				p.P464P			yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	.	NF1-3353	14	Whole gene deletion(8)|Unknown(6)	soft_tissue(7)|autonomic_ganglia(3)|central_nervous_system(3)|lung(1)	c.G1392A						.	G	,,	1,4405	2.1+/-5.4	0,1,2202	147.0	135.0	139.0		1392,1392,1392	2.7	1.0	17		139	0,8600		0,0,4300	no	coding-synonymous-near-splice,coding-synonymous-near-splice,coding-synonymous-near-splice	NF1	NM_000267.3,NM_001042492.2,NM_001128147.2	,,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,,	464/2819,464/2840,464/594	29533389	1,13005	2203	4300	6503	SO:0001630	splice_region_variant	4763	exon12	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	GGCACCGGTAAGA		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.1392+1G>A	17.37:g.29533389G>A		Somatic	171	1		WXS	Illumina HiSeq	Phase_I	134	4	NM_001128147	0	0	0	0	0	O00662|Q14284|Q14930|Q14931|Q9UMK3	Silent	SNP	ENST00000358273.4	37	CCDS42292.1																																																																																			G|0.999;A|0.000		0.383	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267	Silent
ZNF830	91603	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	33288777	33288777	+	Silent	SNP	C	C	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr17:33288777C>A	ENST00000361952.3	+	1	229	c.192C>A	c.(190-192)ctC>ctA	p.L64L	CCT6B_ENST00000314144.5_5'Flank|CCT6B_ENST00000436961.3_5'Flank|CCT6B_ENST00000421975.3_5'Flank	NM_052857.3	NP_443089.3	Q96NB3	ZN830_HUMAN	zinc finger protein 830	64					blastocyst growth (GO:0001832)|mitotic nuclear division (GO:0007067)|nuclear cell cycle DNA replication (GO:0033260)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(2)|large_intestine(1)|liver(2)|lung(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		Ovarian(249;0.17)				AGAGCGAGCTCCTGTGGCAGA	0.582																																					p.L64L		.											.	ZNF830-89	0			c.C192A						.						93.0	90.0	91.0					17																	33288777		2203	4300	6503	SO:0001819	synonymous_variant	91603	exon1			CGAGCTCCTGTGG	AK055707	CCDS32618.1	17q12	2013-10-23	2008-03-25	2008-03-25	ENSG00000198783	ENSG00000198783			28291	protein-coding gene	gene with protein product	"""orphan maintenance of genome 1"""		"""coiled-coil domain containing 16"""	CCDC16		23066043	Standard	NM_052857		Approved	MGC20398, OMCG1	uc002hih.4	Q96NB3	OTTHUMG00000179771	ENST00000361952.3:c.192C>A	17.37:g.33288777C>A		Somatic	117	0		WXS	Illumina HiSeq	Phase_I	128	53	NM_052857	0	0	6	7	1	Q96F60|Q96GZ5|Q9BU38	Silent	SNP	ENST00000361952.3	37	CCDS32618.1																																																																																			.		0.582	ZNF830-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448018.1	NM_052857	
GGNBP2	79893	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	34934557	34934557	+	Silent	SNP	C	C	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr17:34934557C>T	ENST00000304718.4	+	7	1102	c.786C>T	c.(784-786)tgC>tgT	p.C262C		NM_024835.3	NP_079111.1	Q9H3C7	GGNB2_HUMAN	gametogenetin binding protein 2	262					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)		p.C262C(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)	38		Breast(25;0.00957)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		TACATGTTTGCTGTGAAACAG	0.463																																					p.C262C		.											.	GGNBP2-70	1	Substitution - coding silent(1)	lung(1)	c.C786T						.						216.0	194.0	201.0					17																	34934557		2203	4300	6503	SO:0001819	synonymous_variant	79893	exon7			TGTTTGCTGTGAA	AF126964	CCDS11314.1	17q21.1	2014-05-06	2007-08-20	2007-08-20	ENSG00000005955	ENSG00000278311			19357	protein-coding gene	gene with protein product		612275	"""zinc finger protein 403"""	ZNF403		11728448	Standard	NM_024835		Approved	ZFP403, LZK1, FLJ22561, FLJ21230, DIF-3, DIF3	uc002hnb.3	Q9H3C7	OTTHUMG00000188440	ENST00000304718.4:c.786C>T	17.37:g.34934557C>T		Somatic	131	0		WXS	Illumina HiSeq	Phase_I	108	24	NM_024835	0	0	6	6	0	B2RPK7|Q96T90|Q9GZR8|Q9H767	Silent	SNP	ENST00000304718.4	37	CCDS11314.1																																																																																			.		0.463	GGNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256684.2	NM_024835	
CNTNAP1	8506	broad.mit.edu	37	17	40849969	40849969	+	Splice_Site	SNP	G	G	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr17:40849969G>T	ENST00000264638.4	+	23	4079		c.e23+1		CTD-3193K9.3_ENST00000592440.1_RNA	NM_003632.2	NP_003623.1	P78357	CNTP1_HUMAN	contactin associated protein 1						axon cargo transport (GO:0008088)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytoskeleton organization (GO:0007010)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|neuron projection morphogenesis (GO:0048812)|neuronal action potential propagation (GO:0019227)|paranodal junction assembly (GO:0030913)|positive regulation of signal transduction (GO:0009967)|protein localization to paranode region of axon (GO:0002175)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|paranode region of axon (GO:0033270)|voltage-gated potassium channel complex (GO:0008076)	receptor activity (GO:0004872)|SH3 domain binding (GO:0017124)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|lung(15)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.143)		CTTTTAGGCTGTGAGTAGCAC	0.517																																					.													.	CNTNAP1-525	0			c.3862+1G>T						.						233.0	180.0	198.0					17																	40849969		2203	4300	6503	SO:0001630	splice_region_variant	8506	exon23			TAGGCTGTGAGTA	U87223	CCDS11436.1	17q21	2008-07-18				ENSG00000108797			8011	protein-coding gene	gene with protein product	"""neurexin 4"""	602346		NRXN4		9118959	Standard	NM_003632		Approved	p190, Caspr, CNTNAP	uc002iay.3	P78357		ENST00000264638.4:c.3862+1G>T	17.37:g.40849969G>T		Somatic	100	0		WXS	Illumina HiSeq	Phase_I	74	3	NM_003632	0	0	0	0	0		Splice_Site	SNP	ENST00000264638.4	37	CCDS11436.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.414119	0.83449	.	.	ENSG00000108797	ENST00000264638	.	.	.	5.74	5.74	0.90152	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.8389	0.85963	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CNTNAP1	38103495	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.784000	0.68990	2.716000	0.92895	0.650000	0.86243	.	.		0.517	CNTNAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452342.1	NM_003632	Intron
NBR1	4077	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	41343439	41343439	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr17:41343439T>C	ENST00000422280.1	+	10	1373	c.914T>C	c.(913-915)tTg>tCg	p.L305S	NBR1_ENST00000389312.4_Missense_Mutation_p.L305S|NBR1_ENST00000589872.1_Missense_Mutation_p.L305S|NBR1_ENST00000542611.1_Missense_Mutation_p.L284S|NBR1_ENST00000341165.6_Missense_Mutation_p.L305S|NBR1_ENST00000590996.1_Missense_Mutation_p.L305S	NM_031858.2	NP_114064.1	Q14596	NBR1_HUMAN	neighbor of BRCA1 gene 1	305					macroautophagy (GO:0016236)|negative regulation of osteoblast differentiation (GO:0045668)|protein oligomerization (GO:0051259)|regulation of bone mineralization (GO:0030500)|regulation of stress-activated MAPK cascade (GO:0032872)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|pre-autophagosomal structure (GO:0000407)	mitogen-activated protein kinase binding (GO:0051019)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(1)|kidney(4)|large_intestine(1)|lung(7)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	24		Breast(137;0.00086)		BRCA - Breast invasive adenocarcinoma(366;0.0934)		AAGCAAAGGTTGCGAGCTGAG	0.373																																					p.L305S													.	NBR1-130	0			c.T914C						.						46.0	46.0	46.0					17																	41343439		1855	4107	5962	SO:0001583	missense	4077	exon10			AAAGGTTGCGAGC	X76952	CCDS45694.1	17q21.31	2008-02-01	2005-02-15	2005-02-16		ENSG00000188554			6746	protein-coding gene	gene with protein product		166945	"""membrane component, chromosome 17, surface marker 2 (ovarian carcinoma antigen CA125)"""	M17S2		8069304	Standard	XM_006721903		Approved	CA125, KIAA0049, 1A1-3B	uc010whv.2	Q14596		ENST00000422280.1:c.914T>C	17.37:g.41343439T>C	ENSP00000411250:p.Leu305Ser	Somatic	383	1		WXS	Illumina HiSeq	Phase_I	324	83	NM_031862	0	0	6	9	3	Q13173|Q15026|Q5J7Q8|Q96GB6|Q9NRF7	Missense_Mutation	SNP	ENST00000422280.1	37	CCDS45694.1	.	.	.	.	.	.	.	.	.	.	T	24.1	4.489318	0.84962	.	.	ENSG00000188554	ENST00000422280;ENST00000542611;ENST00000341165;ENST00000389312;ENST00000389311	T;T;T;T	0.54479	1.18;0.57;1.18;1.18	5.37	5.37	0.77165	.	0.000000	0.64402	D	0.000001	T	0.59046	0.2165	N	0.24115	0.695	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.999;1.0;0.999	T	0.61540	-0.7042	10	0.48119	T	0.1	-5.3106	13.949	0.64104	0.0:0.0:0.0:1.0	.	305;284;305;305	A8K1U0;B7Z5R6;Q14596-2;Q14596	.;.;.;NBR1_HUMAN	S	305;284;305;305;305	ENSP00000411250:L305S;ENSP00000437545:L284S;ENSP00000343479:L305S;ENSP00000373963:L305S	ENSP00000343479:L305S	L	+	2	0	NBR1	38596965	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.175000	0.77632	2.044000	0.60594	0.533000	0.62120	TTG	.		0.373	NBR1-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453461.1	NM_005899	
RPRML	388394	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	45056083	45056083	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr17:45056083G>T	ENST00000322329.3	-	1	531	c.291C>A	c.(289-291)agC>agA	p.S97R	LRRC37A17P_ENST00000570478.1_RNA|RP11-156P1.2_ENST00000571841.1_Intron|GOSR2_ENST00000439730.2_Intron	NM_203400.4	NP_981945.1	Q8N4K4	RPRML_HUMAN	reprimo-like	97						integral component of membrane (GO:0016021)				lung(1)	1						AGTTGATCATGCTCTCGGACT	0.652																																					p.S97R		.											.	RPRML-68	0			c.C291A						.						34.0	32.0	33.0					17																	45056083		2201	4300	6501	SO:0001583	missense	388394	exon1			GATCATGCTCTCG	BC033942	CCDS11508.1	17q21.32	2006-09-26				ENSG00000179673			32422	protein-coding gene	gene with protein product							Standard	NM_203400		Approved	MGC43894	uc002ilb.3	Q8N4K4		ENST00000322329.3:c.291C>A	17.37:g.45056083G>T	ENSP00000318032:p.Ser97Arg	Somatic	106	0		WXS	Illumina HiSeq	Phase_I	102	28	NM_203400	0	0	1	1	0		Missense_Mutation	SNP	ENST00000322329.3	37	CCDS11508.1	.	.	.	.	.	.	.	.	.	.	G	17.66	3.444031	0.63067	.	.	ENSG00000179673	ENST00000322329	.	.	.	3.72	2.72	0.32119	.	0.000000	0.85682	D	0.000000	T	0.66655	0.2811	L	0.52573	1.65	0.58432	D	0.999997	D	0.76494	0.999	D	0.72075	0.976	T	0.65561	-0.6138	9	0.52906	T	0.07	-8.687	10.3405	0.43875	0.103:0.0:0.897:0.0	.	97	Q8N4K4	RPRML_HUMAN	R	97	.	ENSP00000318032:S97R	S	-	3	2	RPRML	42411082	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	2.546000	0.45778	0.727000	0.32360	0.313000	0.20887	AGC	.		0.652	RPRML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440919.1	NM_203400	
ABCA10	10349	broad.mit.edu	37	17	67189985	67189985	+	Silent	SNP	T	T	C			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr17:67189985T>C	ENST00000269081.4	-	14	2400	c.1491A>G	c.(1489-1491)aaA>aaG	p.K497K	ABCA10_ENST00000416101.2_Intron	NM_080282.3	NP_525021.3	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 10	497	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(34)|ovary(2)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	81	Breast(10;6.95e-12)					GCTGAATCCCTTTTATTTTAG	0.328																																					p.K497K													.	ABCA10-93	0			c.A1491G						.						142.0	142.0	142.0					17																	67189985		2203	4300	6503	SO:0001819	synonymous_variant	10349	exon14			AATCCCTTTTATT	AY247065	CCDS11684.1	17q24	2012-03-14			ENSG00000154263	ENSG00000154263		"""ATP binding cassette transporters / subfamily A"""	30	protein-coding gene	gene with protein product		612508				12821155, 11435397	Standard	NM_080282		Approved	EST698739	uc010dfa.1	Q8WWZ4	OTTHUMG00000164716	ENST00000269081.4:c.1491A>G	17.37:g.67189985T>C		Somatic	167	0		WXS	Illumina HiSeq	Phase_I	157	4	NM_080282	0	0	0	0	0	C9JZH2|C9K035|Q6PIQ6|Q7Z2I9|Q7Z7P7|Q86TD2	Silent	SNP	ENST00000269081.4	37	CCDS11684.1																																																																																			.		0.328	ABCA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379881.4	NM_080282	
FDXR	2232	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	72862364	72862364	+	Silent	SNP	G	G	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr17:72862364G>A	ENST00000293195.5	-	5	474	c.396C>T	c.(394-396)agC>agT	p.S132S	FDXR_ENST00000583917.1_Silent_p.S133S|FDXR_ENST00000413947.2_Silent_p.S163S|FDXR_ENST00000582944.1_Silent_p.S124S|FDXR_ENST00000420580.2_Silent_p.S92S|FDXR_ENST00000442102.2_Silent_p.S175S|FDXR_ENST00000455107.2_Silent_p.S88S|FDXR_ENST00000581530.1_Silent_p.S132S|FDXR_ENST00000544854.1_Silent_p.S80S|FDXR_ENST00000581969.1_5'UTR	NM_001258014.1|NM_004110.3|NM_024417.2	NP_001244943.1|NP_004101.2|NP_077728.2	P22570	ADRO_HUMAN	ferredoxin reductase	132					cholesterol metabolic process (GO:0008203)|generation of precursor metabolites and energy (GO:0006091)|NADPH oxidation (GO:0070995)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ferredoxin-NADP+ reductase activity (GO:0004324)|NADPH binding (GO:0070402)|NADPH-adrenodoxin reductase activity (GO:0015039)			central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(9)|prostate(1)|skin(1)	16	all_lung(278;0.172)|Lung NSC(278;0.207)				Flavin adenine dinucleotide(DB03147)	CTGCCCCGTAGCTCTGATGAA	0.657																																					p.S175S													.	FDXR-226	0			c.C525T						.						30.0	35.0	34.0					17																	72862364		2203	4300	6503	SO:0001819	synonymous_variant	2232	exon5			CCCGTAGCTCTGA	J03826	CCDS11707.1, CCDS58591.1, CCDS58592.1, CCDS58593.1, CCDS58594.1, CCDS58595.1, CCDS58596.1	17q25.1	2013-06-18			ENSG00000161513	ENSG00000161513	1.18.1.6		3642	protein-coding gene	gene with protein product	"""adrenodoxin-NADP(+) reductase"", ""adrenodoxin reductase"""	103270		ADXR		2969697	Standard	NM_001258014		Approved		uc010wrl.2	P22570	OTTHUMG00000179026	ENST00000293195.5:c.396C>T	17.37:g.72862364G>A		Somatic	103	1		WXS	Illumina HiSeq	Phase_I	74	12	NM_001258012	0	0	0	0	0	B4DDI7|B4DHX5|B4DQQ4|B4DX24|B7Z7G2|E7EQC1|Q13716|Q4PJI0|Q9BU12	Silent	SNP	ENST00000293195.5	37	CCDS58593.1																																																																																			.		0.657	FDXR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000444449.1	NM_004110	
FBF1	85302	broad.mit.edu	37	17	73916511	73916511	+	Splice_Site	SNP	C	C	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr17:73916511C>A	ENST00000586717.1	-	17	1906		c.e17-1		FBF1_ENST00000319129.5_Splice_Site|FBF1_ENST00000389570.4_Splice_Site			Q8TES7	FBF1_HUMAN	Fas (TNFRSF6) binding factor 1						apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				large_intestine(2)|ovary(1)|upper_aerodigestive_tract(1)	4						GGAGCAGGGGCTGGAGGAGAG	0.632																																					.													.	FBF1-205	0			c.1630-1G>T						.						19.0	23.0	22.0					17																	73916511		1975	4158	6133	SO:0001630	splice_region_variant	85302	exon18			CAGGGGCTGGAGG	AK074045	CCDS45779.1	17q25.3	2011-04-21			ENSG00000188878	ENSG00000188878			24674	protein-coding gene	gene with protein product	"""albatross"""					11347906	Standard	NM_001080542		Approved	FLJ00103, FBF-1, KIAA1863, ALB	uc002jqc.3	Q8TES7		ENST00000586717.1:c.1633-1G>T	17.37:g.73916511C>A		Somatic	130	0		WXS	Illumina HiSeq	Phase_I	103	3	NM_001080542	0	0	0	0	0	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Splice_Site	SNP	ENST00000586717.1	37		.	.	.	.	.	.	.	.	.	.	C	6.970	0.548988	0.13312	.	.	ENSG00000188878	ENST00000337792;ENST00000389570;ENST00000319129;ENST00000427433	.	.	.	5.22	5.22	0.72569	.	.	.	.	.	.	.	.	.	.	.	0.49051	D	0.999741	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.5633	0.50790	0.2254:0.7746:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	FBF1	71428106	0.990000	0.36364	0.155000	0.22561	0.037000	0.13140	4.709000	0.61867	2.445000	0.82738	0.655000	0.94253	.	.		0.632	FBF1-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000448945.2	NM_001080542	Intron
CEP192	55125	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	13055803	13055803	+	Missense_Mutation	SNP	A	A	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr18:13055803A>T	ENST00000325971.8	+	17	3019	c.1426A>T	c.(1426-1428)Acc>Tcc	p.T476S	CEP192_ENST00000430049.2_Missense_Mutation_p.T597S|CEP192_ENST00000506447.1_Missense_Mutation_p.T1072S			Q8TEP8	CE192_HUMAN	centrosomal protein 192kDa	476					centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(36)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						CGAGTTGAGTACCACAATTAT	0.368																																					p.T1072S		.											.	CEP192-27	0			c.A3214T						.						57.0	57.0	57.0					18																	13055803		2203	4300	6503	SO:0001583	missense	55125	exon19			TTGAGTACCACAA	AK074074	CCDS32792.1, CCDS32792.2	18p11.21	2014-02-20				ENSG00000101639		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25515	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 62"""					11230166, 14654843	Standard	NM_032142		Approved	KIAA1569, FLJ10352, PPP1R62	uc010xac.2	Q8TEP8		ENST00000325971.8:c.1426A>T	18.37:g.13055803A>T	ENSP00000317156:p.Thr476Ser	Somatic	67	0		WXS	Illumina HiSeq	Phase_I	42	14	NM_032142	0	0	0	0	0	A0A060A9S4|E9PF99|Q8WYT8|Q9H0F4|Q9NW27	Missense_Mutation	SNP	ENST00000325971.8	37		.	.	.	.	.	.	.	.	.	.	A	19.71	3.878317	0.72294	.	.	ENSG00000101639	ENST00000506447;ENST00000325971;ENST00000399863;ENST00000430049	T;T;T	0.21031	2.03;2.03;2.03	4.5	4.5	0.54988	.	0.111905	0.39687	N	0.001284	T	0.22704	0.0548	L	0.39397	1.21	0.42538	D	0.993064	B;B;P	0.43973	0.291;0.291;0.823	B;B;P	0.44477	0.214;0.214;0.451	T	0.02307	-1.1179	10	0.44086	T	0.13	-5.7927	14.1063	0.65091	1.0:0.0:0.0:0.0	.	597;1072;476	C9JT09;E9PF99;Q8TEP8	.;.;CE192_HUMAN	S	1072;476;476;597	ENSP00000427550:T1072S;ENSP00000317156:T476S;ENSP00000389190:T597S	ENSP00000317156:T476S	T	+	1	0	CEP192	13045803	1.000000	0.71417	0.998000	0.56505	0.797000	0.45037	6.760000	0.74939	1.790000	0.52503	0.460000	0.39030	ACC	.		0.368	CEP192-201	KNOWN	basic	protein_coding	protein_coding		NM_032142	
CABLES1	91768	broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	20814665	20814665	+	Silent	SNP	G	G	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr18:20814665G>A	ENST00000256925.7	+	5	1182	c.1182G>A	c.(1180-1182)ggG>ggA	p.G394G	CABLES1_ENST00000585061.1_Intron|CABLES1_ENST00000400473.2_Silent_p.G67G|CABLES1_ENST00000420687.2_Silent_p.G129G|TMEM241_ENST00000450466.2_Intron	NM_001100619.2	NP_001094089.1	Q8TDN4	CABL1_HUMAN	Cdk5 and Abl enzyme substrate 1	394	Interacts with CDK3. {ECO:0000250}.				blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cell division (GO:0051301)|nervous system development (GO:0007399)|regulation of cell cycle (GO:0051726)|regulation of cell division (GO:0051302)	cytosol (GO:0005829)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)			breast(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|stomach(1)	11	all_cancers(21;0.000102)|all_epithelial(16;2.48e-06)|Lung NSC(20;0.00696)|all_lung(20;0.0197)|Colorectal(14;0.0202)|Ovarian(20;0.127)					GTGCTGATGGGAAGGTAAGGC	0.562																																					p.G394G													.	CABLES1-522	0			c.G1182A						.						59.0	64.0	62.0					18																	20814665		2034	4195	6229	SO:0001819	synonymous_variant	91768	exon5			TGATGGGAAGGTA	BC037218	CCDS42417.1, CCDS42418.1, CCDS58615.1	18q11.2	2005-08-16				ENSG00000134508			25097	protein-coding gene	gene with protein product		609194				12477932	Standard	NM_138375		Approved	HsT2563, FLJ35924	uc002kuc.2	Q8TDN4		ENST00000256925.7:c.1182G>A	18.37:g.20814665G>A		Somatic	136	1		WXS	Illumina HiSeq	Phase_I	73	24	NM_001100619	0	0	0	0	0	B4DK60|Q8N3Y8|Q8NA22|Q9BTG1	Silent	SNP	ENST00000256925.7	37	CCDS42417.1																																																																																			.		0.562	CABLES1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445198.2	NM_138375	
PHLPP1	23239	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	60384475	60384475	+	Missense_Mutation	SNP	T	T	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr18:60384475T>A	ENST00000262719.5	+	1	1793	c.1559T>A	c.(1558-1560)cTc>cAc	p.L520H	PHLPP1_ENST00000400316.4_Missense_Mutation_p.L8H			O60346	PHLP1_HUMAN	PH domain and leucine rich repeat protein phosphatase 1	520					apoptotic process (GO:0006915)|entrainment of circadian clock (GO:0009649)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			endometrium(2)|kidney(2)|lung(13)	17						ATTGGCTGCCTCATCCGCTTC	0.537																																					p.L520H		.											.	.	0			c.T1559A						.						76.0	88.0	84.0					18																	60384475		2032	4181	6213	SO:0001583	missense	23239	exon1			GCTGCCTCATCCG	AB011178	CCDS45881.1, CCDS45881.2	18q21.32	2013-01-11	2009-05-26	2009-05-26	ENSG00000081913	ENSG00000081913		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	20610	protein-coding gene	gene with protein product		609396	"""pleckstrin homology domain containing, family E (with leucine rich repeats) member 1"", ""PH domain and leucine rich repeat protein phosphatase"""	PLEKHE1, PHLPP		10570941, 15808505	Standard	NM_194449		Approved	KIAA0606, SCOP	uc021ule.1	O60346	OTTHUMG00000150629	ENST00000262719.5:c.1559T>A	18.37:g.60384475T>A	ENSP00000262719:p.Leu520His	Somatic	80	0		WXS	Illumina HiSeq	Phase_I	46	16	NM_194449	0	0	0	0	0	A1A4F5|Q641Q7|Q6P4C4|Q6PJI6|Q86TN6|Q96FK2|Q9NUY1	Missense_Mutation	SNP	ENST00000262719.5	37	CCDS45881.2	.	.	.	.	.	.	.	.	.	.	T	21.9	4.221833	0.79464	.	.	ENSG00000081913	ENST00000400316;ENST00000262719	T;T	0.35605	1.52;1.3	3.91	3.91	0.45181	.	.	.	.	.	T	0.49932	0.1586	L	0.43923	1.385	0.45272	D	0.998273	D	0.89917	1.0	D	0.87578	0.998	T	0.51498	-0.8698	9	0.66056	D	0.02	-10.6803	11.9254	0.52817	0.0:0.0:0.0:1.0	.	520	O60346	PHLP1_HUMAN	H	8;520	ENSP00000383170:L8H;ENSP00000262719:L520H	ENSP00000262719:L520H	L	+	2	0	PHLPP1	58535455	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.650000	0.74368	1.653000	0.50694	0.454000	0.30748	CTC	.		0.537	PHLPP1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319249.2	NM_194449	
FSD1	79187	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	4306032	4306032	+	Silent	SNP	C	C	T	rs143212819	byFrequency	TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr19:4306032C>T	ENST00000221856.6	+	2	252	c.105C>T	c.(103-105)aaC>aaT	p.N35N	FSD1_ENST00000597590.1_Silent_p.N35N	NM_024333.2	NP_077309.1	Q9BTV5	FSD1_HUMAN	fibronectin type III and SPRY domain containing 1	35					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)				breast(2)|cervix(1)|endometrium(1)|large_intestine(4)|liver(1)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	21				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.034)|STAD - Stomach adenocarcinoma(1328;0.18)		TGCTGCTGAACGTGGAGGTGA	0.547													C|||	2	0.000399361	0.0	0.0014	5008	,	,		18860	0.0		0.001	False		,,,				2504	0.0				p.N35N		.											.	FSD1-91	0			c.C105T						.	C		0,4406		0,0,2203	107.0	112.0	110.0		105	-2.0	1.0	19	dbSNP_134	110	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	FSD1	NM_024333.2		0,2,6501	TT,TC,CC		0.0233,0.0,0.0154		35/497	4306032	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	79187	exon2			GCTGAACGTGGAG	AF316829	CCDS12127.1	19p13.3	2013-02-11	2005-03-01			ENSG00000105255		"""Fibronectin type III domain containing"""	13745	protein-coding gene	gene with protein product		609828	"""fibronectin type 3 and SPRY domain containing 1"""			11267680	Standard	NM_024333		Approved	MGC3213, MIR1	uc002lzy.2	Q9BTV5		ENST00000221856.6:c.105C>T	19.37:g.4306032C>T		Somatic	119	0		WXS	Illumina HiSeq	Phase_I	79	28	NM_024333	0	0	0	0	0	B2RDT0|Q9BXN0|Q9HAG4	Silent	SNP	ENST00000221856.6	37	CCDS12127.1																																																																																			C|1.000;T|0.000		0.547	FSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458091.1	NM_024333	
FEM1A	55527	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	4792820	4792820	+	Silent	SNP	C	C	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr19:4792820C>A	ENST00000269856.3	+	1	1093	c.954C>A	c.(952-954)gcC>gcA	p.A318A	AC005523.2_ENST00000601192.1_RNA|AC005523.3_ENST00000598782.1_lincRNA|AC005523.2_ENST00000596170.1_RNA	NM_018708.2	NP_061178.1	Q9BSK4	FEM1A_HUMAN	fem-1 homolog a (C. elegans)	318					negative regulation of inflammatory response (GO:0050728)|regulation of ubiquitin-protein transferase activity (GO:0051438)	cytoplasm (GO:0005737)	EP4 subtype prostaglandin E2 receptor binding (GO:0031867)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	17		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0139)		TGCTTGGGGCCCTTAAACACT	0.597																																					p.A318A		.											.	FEM1A-90	0			c.C954A						.						47.0	51.0	50.0					19																	4792820		2203	4299	6502	SO:0001819	synonymous_variant	55527	exon1			TGGGGCCCTTAAA	BC004988	CCDS12135.1	19p13.3	2013-01-10	2006-11-08		ENSG00000141965	ENSG00000141965		"""Ankyrin repeat domain containing"""	16934	protein-coding gene	gene with protein product		613538				11441184	Standard	NM_018708		Approved		uc002mbf.3	Q9BSK4		ENST00000269856.3:c.954C>A	19.37:g.4792820C>A		Somatic	159	0		WXS	Illumina HiSeq	Phase_I	108	32	NM_018708	0	0	1	2	1	B2RDI3|Q711P8|Q9NPN7|Q9NPW8	Silent	SNP	ENST00000269856.3	37	CCDS12135.1																																																																																			.		0.597	FEM1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459000.1		
ZNF558	148156	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	8922694	8922694	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr19:8922694A>G	ENST00000601372.1	-	10	1183	c.472T>C	c.(472-474)Ttt>Ctt	p.F158L	ZNF558_ENST00000301475.1_Missense_Mutation_p.F158L|ZNF558_ENST00000444186.2_Missense_Mutation_p.F87L			Q96NG5	ZN558_HUMAN	zinc finger protein 558	158					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(7)|prostate(1)|skin(1)	15						AAGACTTTAAAACACTGATTA	0.338																																					p.F158L		.											.	ZNF558-90	0			c.T472C						.						42.0	38.0	40.0					19																	8922694		2203	4300	6503	SO:0001583	missense	148156	exon6			CTTTAAAACACTG	AK055494	CCDS12208.1	19p13.2	2013-09-20			ENSG00000167785	ENSG00000167785		"""Zinc fingers, C2H2-type"", ""-"""	26422	protein-coding gene	gene with protein product							Standard	NM_144693		Approved	FLJ30932	uc002mkn.1	Q96NG5	OTTHUMG00000182196	ENST00000601372.1:c.472T>C	19.37:g.8922694A>G	ENSP00000471277:p.Phe158Leu	Somatic	84	0		WXS	Illumina HiSeq	Phase_I	72	9	NM_144693	0	0	0	0	0	A8K5F0|B7Z798	Missense_Mutation	SNP	ENST00000601372.1	37	CCDS12208.1	.	.	.	.	.	.	.	.	.	.	A	24.1	4.492197	0.84962	.	.	ENSG00000167785	ENST00000301475;ENST00000444186	T;T	0.07216	3.21;3.21	5.07	4.0	0.46444	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.44688	D	0.000434	T	0.04137	0.0115	N	0.12182	0.205	0.34332	D	0.687801	P	0.39250	0.665	B	0.30716	0.119	T	0.30208	-0.9986	10	0.72032	D	0.01	-19.1944	8.9778	0.35946	0.7058:0.2942:0.0:0.0	.	158	Q96NG5	ZN558_HUMAN	L	158;87	ENSP00000301475:F158L;ENSP00000410703:F87L	ENSP00000301475:F158L	F	-	1	0	ZNF558	8783694	0.975000	0.34042	0.999000	0.59377	0.988000	0.76386	1.844000	0.39269	2.128000	0.65567	0.482000	0.46254	TTT	.		0.338	ZNF558-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459955.2	NM_144693	
ZNF426	79088	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	9639297	9639297	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr19:9639297G>A	ENST00000535489.1	-	6	1760	c.1424C>T	c.(1423-1425)cCc>cTc	p.P475L	ZNF426_ENST00000593003.1_Missense_Mutation_p.P437L|ZNF426_ENST00000253115.2_Missense_Mutation_p.P475L			Q9BUY5	ZN426_HUMAN	zinc finger protein 426	475					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(3)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	20						ACACTCATAGGGTTTTTCTCC	0.428																																					p.P475L		.											.	ZNF426-91	0			c.C1424T						.						95.0	93.0	94.0					19																	9639297		2203	4300	6503	SO:0001583	missense	79088	exon8			TCATAGGGTTTTT	AK095759	CCDS12215.1, CCDS74279.1	19p13.2	2013-01-08				ENSG00000130818		"""Zinc fingers, C2H2-type"", ""-"""	20725	protein-coding gene	gene with protein product							Standard	NM_024106		Approved	MGC2663	uc002mlq.3	Q9BUY5		ENST00000535489.1:c.1424C>T	19.37:g.9639297G>A	ENSP00000439017:p.Pro475Leu	Somatic	147	0		WXS	Illumina HiSeq	Phase_I	114	29	NM_024106	0	0	0	0	0	B3KTL2	Missense_Mutation	SNP	ENST00000535489.1	37	CCDS12215.1	.	.	.	.	.	.	.	.	.	.	G	17.19	3.326242	0.60743	.	.	ENSG00000130818	ENST00000545189;ENST00000253115;ENST00000535489	T;T	0.17054	2.3;2.3	1.52	1.52	0.23074	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.36717	0.0977	M	0.74546	2.27	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77557	0.99;0.99	T	0.24012	-1.0172	9	0.72032	D	0.01	.	8.9649	0.35869	0.0:0.0:1.0:0.0	.	462;475	Q59EH4;Q9BUY5	.;ZN426_HUMAN	L	462;475;475	ENSP00000253115:P475L;ENSP00000439017:P475L	ENSP00000253115:P475L	P	-	2	0	ZNF426	9500297	0.426000	0.25506	0.005000	0.12908	0.100000	0.18952	1.495000	0.35627	1.133000	0.42147	0.563000	0.77884	CCC	.		0.428	ZNF426-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449905.1	NM_024106	
ICAM3	3385	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	10444569	10444569	+	Silent	SNP	T	T	A	rs369252388		TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr19:10444569T>A	ENST00000160262.5	-	7	1816	c.1608A>T	c.(1606-1608)acA>acT	p.T536T	RAVER1_ENST00000293677.6_5'Flank|ICAM3_ENST00000589261.1_Silent_p.T459T	NM_002162.3	NP_002153.2	P32942	ICAM3_HUMAN	intercellular adhesion molecule 3	536					extracellular matrix organization (GO:0030198)|regulation of immune response (GO:0050776)|single organismal cell-cell adhesion (GO:0016337)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|upper_aerodigestive_tract(2)	13			OV - Ovarian serous cystadenocarcinoma(20;6.13e-09)|Epithelial(33;9.69e-06)|all cancers(31;2.05e-05)			CCATTGCTTCTGTCGGCTGCA	0.567																																					p.T536T		.											.	ICAM3-131	0			c.A1608T						.	T		0,4406		0,0,2203	180.0	166.0	171.0		1608	-8.7	0.0	19		171	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ICAM3	NM_002162.3		0,1,6502	AA,AT,TT		0.0116,0.0,0.0077		536/548	10444569	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	3385	exon7			TGCTTCTGTCGGC		CCDS12235.1	19p13.3-p13.2	2013-01-11				ENSG00000076662		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5346	protein-coding gene	gene with protein product		146631				1448174	Standard	NM_002162		Approved	CDW50, ICAM-R, CD50	uc002mob.2	P32942		ENST00000160262.5:c.1608A>T	19.37:g.10444569T>A		Somatic	162	0		WXS	Illumina HiSeq	Phase_I	121	24	NM_002162	0	0	56	70	14	Q6PD68	Silent	SNP	ENST00000160262.5	37	CCDS12235.1																																																																																			.		0.567	ICAM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451234.1		
CYP4F3	4051	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	15752256	15752256	+	Missense_Mutation	SNP	C	C	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr19:15752256C>G	ENST00000221307.8	+	2	78	c.31C>G	c.(31-33)Ctt>Gtt	p.L11V	CYP4F3_ENST00000585846.1_Missense_Mutation_p.L11V|CYP4F3_ENST00000591058.1_Missense_Mutation_p.L11V|CYP4F3_ENST00000586182.2_Missense_Mutation_p.L11V	NM_000896.2	NP_000887.2	Q08477	CP4F3_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 3	11					arachidonic acid metabolic process (GO:0019369)|icosanoid metabolic process (GO:0006690)|leukotriene metabolic process (GO:0006691)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alpha-tocopherol omega-hydroxylase activity (GO:0052871)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)|monooxygenase activity (GO:0004497)			endometrium(3)|large_intestine(4)|lung(21)|ovary(3)|prostate(2)|stomach(1)	34						CTCGCTGGGCCTTTGGCCAAT	0.652																																					p.L11V		.											.	CYP4F3-93	0			c.C31G						.						56.0	56.0	56.0					19																	15752256		2203	4300	6503	SO:0001583	missense	4051	exon2			CTGGGCCTTTGGC	AB002454	CCDS12332.1, CCDS59362.1	19p13.12	2013-02-21	2003-01-14		ENSG00000186529	ENSG00000186529		"""Cytochrome P450s"""	2646	protein-coding gene	gene with protein product		601270	"""cytochrome P450, subfamily IVF, polypeptide 3 (leukotriene B4 omega hydroxylase)"""	LTB4H		8486631, 9539102	Standard	NM_000896		Approved	CYP4F	uc010xol.2	Q08477	OTTHUMG00000182374	ENST00000221307.8:c.31C>G	19.37:g.15752256C>G	ENSP00000221307:p.Leu11Val	Somatic	84	0		WXS	Illumina HiSeq	Phase_I	64	16	NM_001199209	0	0	0	0	0	B7Z8Z3|O60634|Q5U740	Missense_Mutation	SNP	ENST00000221307.8	37	CCDS12332.1	.	.	.	.	.	.	.	.	.	.	.	12.16	1.854157	0.32791	.	.	ENSG00000186529	ENST00000221307	D	0.93426	-3.22	3.73	2.65	0.31530	.	0.298234	0.22742	U	0.056184	D	0.92450	0.7603	M	0.73598	2.24	0.09310	N	1	P;P	0.38420	0.63;0.63	B;B	0.43082	0.317;0.407	D	0.85130	0.0974	10	0.42905	T	0.14	.	8.5276	0.33315	0.2301:0.7698:0.0:0.0	.	11;11	B7Z8Z3;Q08477	.;CP4F3_HUMAN	V	11	ENSP00000221307:L11V	ENSP00000221307:L11V	L	+	1	0	CYP4F3	15613256	0.000000	0.05858	0.002000	0.10522	0.028000	0.11728	-0.157000	0.10085	0.504000	0.28082	0.411000	0.27672	CTT	.		0.652	CYP4F3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460819.3	NM_000896	
CPAMD8	27151	broad.mit.edu	37	19	17056401	17056401	+	Silent	SNP	G	G	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr19:17056401G>T	ENST00000443236.1	-	22	2923	c.2892C>A	c.(2890-2892)gtC>gtA	p.V964V		NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	917						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						CCCCGATGGGGACCCTCCTGT	0.567																																					p.V964V													.	CPAMD8-141	0			c.C2892A						.						97.0	105.0	103.0					19																	17056401		2029	4159	6188	SO:0001819	synonymous_variant	27151	exon22			GATGGGGACCCTC	AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.2892C>A	19.37:g.17056401G>T		Somatic	104	0		WXS	Illumina HiSeq	Phase_I	63	3	NM_015692	0	0	0	0	0	Q8NC09|Q9ULD7	Silent	SNP	ENST00000443236.1	37	CCDS42519.1	.	.	.	.	.	.	.	.	.	.	G	4.981	0.182145	0.09495	.	.	ENSG00000160111	ENST00000443236	.	.	.	3.49	-0.451	0.12214	.	.	.	.	.	T	0.32645	0.0836	.	.	.	0.26785	N	0.969518	.	.	.	.	.	.	T	0.32534	-0.9903	4	.	.	.	.	8.8157	0.34993	0.3659:0.0:0.6341:0.0	.	.	.	.	Y	975	.	.	S	-	2	0	CPAMD8	16917401	1.000000	0.71417	0.005000	0.12908	0.047000	0.14425	1.514000	0.35834	0.057000	0.16193	0.591000	0.81541	TCC	.		0.567	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257531.2	NM_015692	
ZNF506	440515	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	19905760	19905760	+	Silent	SNP	G	G	C			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr19:19905760G>C	ENST00000540806.2	-	4	1024	c.936C>G	c.(934-936)ccC>ccG	p.P312P	ZNF506_ENST00000450683.2_Silent_p.P280P|CTC-559E9.4_ENST00000590274.1_lincRNA|CTC-559E9.6_ENST00000591884.1_RNA|ZNF506_ENST00000443905.2_Silent_p.P312P|CTC-559E9.6_ENST00000589657.1_RNA|ZNF506_ENST00000587461.1_Intron			Q5JVG8	ZN506_HUMAN	zinc finger protein 506	312					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|large_intestine(7)|lung(3)|skin(1)|stomach(1)	14						CACATTTGTAGGGTTTCTCTC	0.373																																					p.P312P		.											.	ZNF506-68	0			c.C936G						.						55.0	59.0	57.0					19																	19905760		2197	4300	6497	SO:0001819	synonymous_variant	440515	exon4			TTTGTAGGGTTTC	AK095575	CCDS42531.1, CCDS46027.1	19p13.11	2013-01-08				ENSG00000081665		"""Zinc fingers, C2H2-type"", ""-"""	23780	protein-coding gene	gene with protein product							Standard	NM_001099269		Approved	DKFZp761G1812	uc010eci.2	Q5JVG8		ENST00000540806.2:c.936C>G	19.37:g.19905760G>C		Somatic	36	0		WXS	Illumina HiSeq	Phase_I	39	10	NM_001099269	3	0	1	4	0	B3KTH6	Silent	SNP	ENST00000540806.2	37	CCDS42531.1																																																																																			.		0.373	ZNF506-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460794.1	XM_036218	
LTBP4	8425	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	41129532	41129532	+	Nonsense_Mutation	SNP	C	C	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr19:41129532C>T	ENST00000308370.7	+	29	3778	c.3778C>T	c.(3778-3780)Cga>Tga	p.R1260*	LTBP4_ENST00000204005.9_Nonsense_Mutation_p.R1223*|LTBP4_ENST00000602240.1_3'UTR|LTBP4_ENST00000545697.1_Nonsense_Mutation_p.R628*|LTBP4_ENST00000243562.9_3'UTR|LTBP4_ENST00000396819.3_Nonsense_Mutation_p.R1193*	NM_001042544.1	NP_001036009.1	Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding protein 4	1261	EGF-like 13; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|growth hormone secretion (GO:0030252)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|regulation of cell differentiation (GO:0045595)|regulation of cell growth (GO:0001558)|regulation of proteolysis (GO:0030162)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|integrin binding (GO:0005178)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			TCAGCTCTTCCGAGACCAGGT	0.587																																					.													.	LTBP4-93	0			.						.						78.0	81.0	80.0					19																	41129532		2099	4233	6332	SO:0001587	stop_gained	8425	.			CTCTTCCGAGACC	Y13622	CCDS74368.1, CCDS74369.1, CCDS74370.1	19q13.1-q13.2	2011-10-20				ENSG00000090006		"""Latent transforming growth factor, beta binding proteins"""	6717	protein-coding gene	gene with protein product		604710				9660815, 9271198	Standard	NM_003573		Approved	LTBP-4, LTBP-4L, FLJ46318, FLJ90018	uc002ooh.1	Q8N2S1		ENST00000308370.7:c.3778C>T	19.37:g.41129532C>T	ENSP00000311905:p.Arg1260*	Somatic	60	0		WXS	Illumina HiSeq	Phase_I	45	12	.	0	0	27	30	3	O00508|O75412|O75413	Nonsense_Mutation	SNP	ENST00000308370.7	37		.	.	.	.	.	.	.	.	.	.	C	42	9.163582	0.99085	.	.	ENSG00000090006	ENST00000204005;ENST00000545697;ENST00000308370;ENST00000396819;ENST00000318809	.	.	.	3.84	2.72	0.32119	.	0.966303	0.08373	U	0.955762	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12766	T	0.61	.	6.3251	0.21239	0.1718:0.4914:0.3368:0.0	.	.	.	.	X	1223;628;1260;1193;21	.	ENSP00000204005:R1223X	R	+	1	2	LTBP4	45821372	0.156000	0.22821	1.000000	0.80357	0.911000	0.54048	0.335000	0.19806	1.972000	0.57404	0.313000	0.20887	CGA	.		0.587	LTBP4-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_003573	
CYP2F1	1572	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	41627458	41627458	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr19:41627458C>T	ENST00000331105.2	+	5	652	c.580C>T	c.(580-582)Cgt>Tgt	p.R194C		NM_000774.3	NP_000765.2	P24903	CP2F1_HUMAN	cytochrome P450, family 2, subfamily F, polypeptide 1	194					naphthalene metabolic process (GO:0018931)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|trichloroethylene metabolic process (GO:0018979)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)|oxygen binding (GO:0019825)			central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|liver(2)|lung(11)|ovary(2)|skin(2)	29						TGATGATGAGCGTCTGCTCAC	0.562																																					p.R194C		.											.	CYP2F1-90	0			c.C580T						.						113.0	115.0	115.0					19																	41627458		2181	4299	6480	SO:0001583	missense	1572	exon5			GATGAGCGTCTGC	J02906	CCDS12572.1	19q13.1-q13.2	2008-02-05	2003-01-14		ENSG00000197446	ENSG00000197446		"""Cytochrome P450s"""	2632	protein-coding gene	gene with protein product		124070	"""cytochrome P450, subfamily IIF, polypeptide 1"""	CYP2F			Standard	NM_000774		Approved		uc002opu.1	P24903	OTTHUMG00000167412	ENST00000331105.2:c.580C>T	19.37:g.41627458C>T	ENSP00000333534:p.Arg194Cys	Somatic	69	0		WXS	Illumina HiSeq	Phase_I	43	13	NM_000774	0	0	1	1	0	A7KAU6|A7KAU7|A7KAU8|A7KAU9|A7KAV0|Q32MN5|Q8WWJ2	Missense_Mutation	SNP	ENST00000331105.2	37	CCDS12572.1	.	.	.	.	.	.	.	.	.	.	c	10.84	1.464169	0.26335	.	.	ENSG00000197446	ENST00000331105	T	0.69435	-0.4	2.87	2.87	0.33458	.	0.714608	0.13306	U	0.397870	T	0.79052	0.4381	M	0.79475	2.455	0.34749	D	0.731557	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.983	T	0.82147	-0.0601	10	0.72032	D	0.01	.	7.7914	0.29123	0.0:0.7393:0.2607:0.0	.	194;194	Q32MN5;P24903	.;CP2F1_HUMAN	C	194	ENSP00000333534:R194C	ENSP00000333534:R194C	R	+	1	0	CYP2F1	46319298	0.000000	0.05858	0.113000	0.21522	0.208000	0.24298	-0.348000	0.07740	1.461000	0.47929	0.064000	0.15345	CGT	.		0.562	CYP2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394527.2		
PSG9	5678	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	43772079	43772079	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr19:43772079C>T	ENST00000270077.3	-	2	383	c.287G>A	c.(286-288)aGt>aAt	p.S96N	PSG9_ENST00000418820.2_Missense_Mutation_p.S96N|PSG9_ENST00000443718.3_Missense_Mutation_p.S96N|PSG9_ENST00000291752.5_Missense_Mutation_p.S96N|PSG9_ENST00000593948.1_Missense_Mutation_p.S96N|PSG9_ENST00000244293.7_Missense_Mutation_p.S96N|PSG9_ENST00000596730.1_Missense_Mutation_p.S96N	NM_002784.3	NP_002775.3	Q00887	PSG9_HUMAN	pregnancy specific beta-1-glycoprotein 9	96	Ig-like V-type.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	41		Prostate(69;0.00682)				TTCTCTTCCACTGTATGCAGG	0.428																																					p.S96N		.											.	PSG9-92	0			c.G287A						.						250.0	239.0	243.0					19																	43772079		2203	4300	6503	SO:0001583	missense	5678	exon2			CTTCCACTGTATG	M34481	CCDS12618.1	19q13.2	2013-01-29			ENSG00000183668	ENSG00000183668		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9526	protein-coding gene	gene with protein product		176398		PSG11		7806221	Standard	XM_005259076		Approved	PSGII	uc002owd.4	Q00887	OTTHUMG00000182826	ENST00000270077.3:c.287G>A	19.37:g.43772079C>T	ENSP00000270077:p.Ser96Asn	Somatic	171	0		WXS	Illumina HiSeq	Phase_I	149	44	NM_002784	0	0	0	0	0	B2R869|Q15227|Q15236|Q15237|Q8WW78|Q9UQ73	Missense_Mutation	SNP	ENST00000270077.3	37	CCDS12618.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	10.79|10.79	1.448341|1.448341	0.26074|0.26074	.|.	.|.	ENSG00000183668|ENSG00000183668	ENST00000270077;ENST00000291752;ENST00000443718;ENST00000435220;ENST00000244293|ENST00000418820	T;T;T;T|.	0.69175|.	-0.38;-0.38;-0.38;-0.38|.	1.56|1.56	-1.3|-1.3	0.09259|0.09259	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);|.	.|.	.|.	.|.	.|.	T|T	0.65249|0.65249	0.2673|0.2673	M|M	0.93507|0.93507	3.425|3.425	0.09310|0.09310	N|N	1|1	P;P;D;P;B;B|.	0.53885|.	0.729;0.904;0.963;0.872;0.056;0.184|.	P;D;D;P;B;B|.	0.67231|.	0.826;0.921;0.95;0.686;0.272;0.393|.	T|T	0.59873|0.59873	-0.7372|-0.7372	9|5	0.54805|.	T|.	0.06|.	.|.	7.098|7.098	0.25321|0.25321	0.0:0.4456:0.5544:0.0|0.0:0.4456:0.5544:0.0	.|.	96;45;96;96;96;96|.	E7EW65;Q15225;Q15227;G3XAA7;Q6LEU7;Q00887|.	.;.;.;.;.;PSG9_HUMAN|.	N|M	96;96;96;57;96|83	ENSP00000270077:S96N;ENSP00000291752:S96N;ENSP00000396753:S96N;ENSP00000244293:S96N|.	ENSP00000244293:S96N|.	S|V	-|-	2|1	0|0	PSG9|PSG9	48463919|48463919	0.000000|0.000000	0.05858|0.05858	0.002000|0.002000	0.10522|0.10522	0.052000|0.052000	0.14988|0.14988	-0.107000|-0.107000	0.10873|0.10873	-0.216000|-0.216000	0.10048|0.10048	-0.876000|-0.876000	0.02978|0.02978	AGT|GTG	.		0.428	PSG9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323065.1	NM_002784	
CLASRP	11129	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	45561034	45561034	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr19:45561034G>A	ENST00000221455.3	+	7	589	c.491G>A	c.(490-492)gGt>gAt	p.G164D	CLASRP_ENST00000544944.2_Missense_Mutation_p.G164D|CLASRP_ENST00000391953.4_Missense_Mutation_p.G102D	NM_007056.2	NP_008987	Q8N2M8	CLASR_HUMAN	CLK4-associating serine/arginine rich protein	164					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|pancreas(2)|prostate(1)	16						GCTTCCATCGGTTATACCTAC	0.617																																					p.G164D													.	CLASRP-154	0			c.G491A						.						132.0	111.0	118.0					19																	45561034		2203	4300	6503	SO:0001583	missense	11129	exon7			CCATCGGTTATAC	AF042800	CCDS12652.2, CCDS62710.1	19q13.3	2010-09-21	2010-09-21	2010-09-21	ENSG00000104859	ENSG00000104859			17731	protein-coding gene	gene with protein product	"""Clk4 associating SR-related protein"""		"""splicing factor, arginine/serine-rich 16"""	SFRS16		12169693	Standard	NM_007056		Approved	SWAP2, CLASP	uc002pak.3	Q8N2M8	OTTHUMG00000150189	ENST00000221455.3:c.491G>A	19.37:g.45561034G>A	ENSP00000221455:p.Gly164Asp	Somatic	120	0		WXS	Illumina HiSeq	Phase_I	106	28	NM_007056	0	0	16	29	13	B4DDT8|F8WAG9|O96026|Q6UW71|Q96DX2	Missense_Mutation	SNP	ENST00000221455.3	37	CCDS12652.2	.	.	.	.	.	.	.	.	.	.	G	26.0	4.690578	0.88735	.	.	ENSG00000104859	ENST00000221455;ENST00000391952;ENST00000391953;ENST00000544944	T;T;T;T	0.34472	1.36;1.36;1.36;1.36	4.7	4.7	0.59300	Splicing factor, suppressor of white apricot (1);	0.000000	0.36932	U	0.002335	T	0.61274	0.2334	M	0.79123	2.44	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.997	T	0.66548	-0.5896	10	0.87932	D	0	-30.767	15.1769	0.72920	0.0:0.0:1.0:0.0	.	102;164;164	F8WAG9;F5H0Q6;Q8N2M8	.;.;CLASR_HUMAN	D	164;164;102;164	ENSP00000221455:G164D;ENSP00000375814:G164D;ENSP00000375815:G102D;ENSP00000438702:G164D	ENSP00000221455:G164D	G	+	2	0	CLASRP	50252874	1.000000	0.71417	0.996000	0.52242	0.916000	0.54674	9.208000	0.95075	2.434000	0.82447	0.563000	0.77884	GGT	.		0.617	CLASRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316749.1	NM_007056	
DMWD	1762	broad.mit.edu	37	19	46289396	46289396	+	Missense_Mutation	SNP	T	T	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr19:46289396T>G	ENST00000270223.6	-	3	1403	c.1358A>C	c.(1357-1359)cAc>cCc	p.H453P	DMWD_ENST00000601370.1_5'Flank|AC011530.4_ENST00000593999.1_5'Flank|DMWD_ENST00000377735.3_Missense_Mutation_p.H453P	NM_004943.1	NP_004934.1	Q09019	DMWD_HUMAN	dystrophia myotonica, WD repeat containing	453										central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	16		Ovarian(192;0.0308)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00604)|GBM - Glioblastoma multiforme(486;0.0807)|Epithelial(262;0.236)		CAGGGGGGGGTGCGGGTAGAG	0.711																																					p.H453P													.	DMWD-90	0			c.A1358C						.						5.0	6.0	6.0					19																	46289396		2081	4094	6175	SO:0001583	missense	1762	exon3			GGGGGGTGCGGGT	L19267	CCDS33054.1	19q13.32	2013-01-09	2007-02-20		ENSG00000185800	ENSG00000185800		"""WD repeat domain containing"""	2936	protein-coding gene	gene with protein product		609857	"""dystrophia myotonica-containing WD repeat motif"""			1302022	Standard	NM_004943		Approved	DMR-N9, gene59, D19S593E	uc021uwc.1	Q09019	OTTHUMG00000169044	ENST00000270223.6:c.1358A>C	19.37:g.46289396T>G	ENSP00000270223:p.His453Pro	Somatic	66	12		WXS	Illumina HiSeq	Phase_I	96	28	NM_004943	0	0	1	1	0		Missense_Mutation	SNP	ENST00000270223.6	37	CCDS33054.1	.	.	.	.	.	.	.	.	.	.	T	11.77	1.738941	0.30774	.	.	ENSG00000185800	ENST00000377735;ENST00000270223	T;T	0.58506	0.33;0.33	4.12	2.02	0.26589	.	0.136335	0.49916	D	0.000126	T	0.42944	0.1225	L	0.42245	1.32	0.40057	D	0.975844	B;B;B	0.09022	0.0;0.002;0.001	B;B;B	0.09377	0.001;0.004;0.002	T	0.30238	-0.9985	10	0.39692	T	0.17	-34.1134	5.3843	0.16211	0.0:0.1001:0.1807:0.7191	.	138;453;453	Q8WUW6;G5E9A7;Q09019	.;.;DMWD_HUMAN	P	453	ENSP00000366964:H453P;ENSP00000270223:H453P	ENSP00000270223:H453P	H	-	2	0	DMWD	50981236	1.000000	0.71417	0.824000	0.32777	0.083000	0.17756	0.976000	0.29462	0.745000	0.32763	-0.527000	0.04329	CAC	.		0.711	DMWD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402063.1	NM_004943	
ZNF836	162962	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	52660313	52660313	+	Missense_Mutation	SNP	A	A	T	rs186568049		TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr19:52660313A>T	ENST00000322146.8	-	5	1144	c.623T>A	c.(622-624)cTt>cAt	p.L208H	ZNF836_ENST00000597252.1_Missense_Mutation_p.L208H|CTC-471J1.8_ENST00000594362.1_RNA	NM_001102657.1	NP_001096127.1	Q6ZNA1	ZN836_HUMAN	zinc finger protein 836	208					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						TGTTTTCTCAAGTTGGGTGGG	0.373																																					p.L208H		.											.	ZNF836-46	0			c.T623A						.						66.0	64.0	65.0					19																	52660313		1911	4155	6066	SO:0001583	missense	162962	exon5			TTCTCAAGTTGGG	BC011784	CCDS46162.1	19q13.33	2013-01-08			ENSG00000196267	ENSG00000196267		"""Zinc fingers, C2H2-type"", ""-"""	34333	protein-coding gene	gene with protein product							Standard	NM_001102657		Approved	FLJ16287	uc010ydj.2	Q6ZNA1		ENST00000322146.8:c.623T>A	19.37:g.52660313A>T	ENSP00000325038:p.Leu208His	Somatic	180	0		WXS	Illumina HiSeq	Phase_I	177	48	NM_001102657	0	0	0	0	0		Missense_Mutation	SNP	ENST00000322146.8	37	CCDS46162.1	.	.	.	.	.	.	.	.	.	.	A	0.030	-1.337491	0.01287	.	.	ENSG00000196267	ENST00000322146;ENST00000396443	T	0.06371	3.31	1.8	-0.761	0.11038	.	.	.	.	.	T	0.02380	0.0073	N	0.08118	0	0.09310	N	1	P	0.50943	0.94	B	0.43783	0.431	T	0.13737	-1.0498	9	0.02654	T	1	.	2.5139	0.04663	0.2469:0.1649:0.0:0.5882	.	208	Q6ZNA1	ZN836_HUMAN	H	208;6	ENSP00000325038:L208H	ENSP00000325038:L208H	L	-	2	0	ZNF836	57352125	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	0.440000	0.21592	-0.496000	0.06650	-1.328000	0.01277	CTT	A|0.999;C|0.000		0.373	ZNF836-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462456.1	NM_001102657	
PTPRH	5794	broad.mit.edu	37	19	55697891	55697891	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr19:55697891G>A	ENST00000376350.3	-	15	2606	c.2584C>T	c.(2584-2586)Ccc>Tcc	p.P862S	PTPRH_ENST00000263434.5_Missense_Mutation_p.P684S	NM_002842.3	NP_002833.3	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H	862	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				apoptotic process (GO:0006915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(8)|lung(27)|ovary(2)|prostate(5)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	67		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		GGCTTCAGGGGCACCCGGGAC	0.587																																					p.P862S													.	PTPRH-138	0			c.C2584T						.						67.0	68.0	68.0					19																	55697891		2203	4300	6503	SO:0001583	missense	5794	exon15			TCAGGGGCACCCG		CCDS33110.1, CCDS54321.1	19q13.4	2013-02-11				ENSG00000080031		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9672	protein-coding gene	gene with protein product		602510				8294459	Standard	XM_006723312		Approved	SAP-1	uc002qjq.3	Q9HD43		ENST00000376350.3:c.2584C>T	19.37:g.55697891G>A	ENSP00000365528:p.Pro862Ser	Somatic	67	0		WXS	Illumina HiSeq	Phase_I	54	3	NM_002842	0	0	1	1	0	C9JCH2|Q15426|Q2NKN9|Q2NKP0	Missense_Mutation	SNP	ENST00000376350.3	37	CCDS33110.1	.	.	.	.	.	.	.	.	.	.	G	13.38	2.220909	0.39201	.	.	ENSG00000080031	ENST00000376350;ENST00000263434	D;D	0.83075	-1.68;-1.68	5.25	3.06	0.35304	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.416142	0.17903	N	0.158107	T	0.67896	0.2942	N	0.16790	0.44	0.27804	N	0.942366	B;B	0.28419	0.211;0.211	B;B	0.29862	0.062;0.108	T	0.59101	-0.7517	10	0.41790	T	0.15	.	5.8507	0.18691	0.1711:0.0:0.6776:0.1513	.	684;862	C9JCH2;Q9HD43	.;PTPRH_HUMAN	S	862;684	ENSP00000365528:P862S;ENSP00000263434:P684S	ENSP00000263434:P684S	P	-	1	0	PTPRH	60389703	0.250000	0.23951	0.985000	0.45067	0.951000	0.60555	0.209000	0.17435	0.677000	0.31305	-0.156000	0.13503	CCC	.		0.587	PTPRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452649.1		
ZIM2	23619	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	57286732	57286732	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr19:57286732C>T	ENST00000391708.3	-	12	1450	c.908G>A	c.(907-909)gGa>gAa	p.G303E	ZIM2_ENST00000221722.5_Missense_Mutation_p.G303E|ZIM2_ENST00000599935.1_Missense_Mutation_p.G303E|AC006115.3_ENST00000597946.1_RNA|AC006115.3_ENST00000595954.1_RNA|ZIM2_ENST00000593711.1_Missense_Mutation_p.G303E|ZIM2_ENST00000601070.1_Missense_Mutation_p.G303E|AC006115.3_ENST00000594400.1_RNA	NM_001146326.1|NM_001146327.1	NP_001139798.1|NP_001139799.1	Q9NZV7	ZIM2_HUMAN	zinc finger, imprinted 2	303					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(20)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0314)		GGGATCCTTTCCTAGAGGATC	0.453																																					p.G303E		.											.	ZIM2-28	0			c.G908A						.						119.0	114.0	116.0					19																	57286732		2203	4300	6503	SO:0001583	missense	23619	exon11			TCCTTTCCTAGAG	AF166122	CCDS33123.1	19q13.4	2012-10-31				ENSG00000269699		"""Zinc fingers, C2H2-type"""	12875	protein-coding gene	gene with protein product							Standard	NM_015363		Approved	ZNF656		Q9NZV7		ENST00000391708.3:c.908G>A	19.37:g.57286732C>T	ENSP00000375589:p.Gly303Glu	Somatic	112	0		WXS	Illumina HiSeq	Phase_I	88	21	NM_015363	0	0	0	0	0	Q2M3K1	Missense_Mutation	SNP	ENST00000391708.3	37	CCDS33123.1	.	.	.	.	.	.	.	.	.	.	C	15.06	2.720643	0.48728	.	.	ENSG00000198300	ENST00000391708;ENST00000221722	T;T	0.04317	3.65;3.65	3.89	0.45	0.16624	.	.	.	.	.	T	0.03220	0.0094	N	0.24115	0.695	.	.	.	B	0.21606	0.058	B	0.20184	0.028	T	0.37911	-0.9685	8	0.49607	T	0.09	.	2.8917	0.05678	0.3745:0.3962:0.0:0.2293	.	303	Q9NZV7	ZIM2_HUMAN	E	303	ENSP00000375589:G303E;ENSP00000221722:G303E	ENSP00000221722:G303E	G	-	2	0	ZIM2	61978544	0.000000	0.05858	0.131000	0.22000	0.731000	0.41821	-0.337000	0.07852	0.176000	0.19873	0.655000	0.94253	GGA	.		0.453	ZIM2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416094.2		
LPIN1	23175	broad.mit.edu	37	2	11925180	11925180	+	Silent	SNP	C	C	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr2:11925180C>T	ENST00000256720.2	+	9	1512	c.1419C>T	c.(1417-1419)agC>agT	p.S473S	LPIN1_ENST00000404113.2_5'Flank|LPIN1_ENST00000425416.2_Silent_p.S479S|LPIN1_ENST00000449576.2_Silent_p.S558S|LPIN1_ENST00000396099.1_Silent_p.S515S|LPIN1_ENST00000396097.1_Silent_p.S203S	NM_145693.2	NP_663731.1	Q14693	LPIN1_HUMAN	lipin 1	473					cellular lipid metabolic process (GO:0044255)|fatty acid catabolic process (GO:0009062)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)|triglyceride mobilization (GO:0006642)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(15)|liver(1)|lung(10)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	45	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.173)		GGGGCCTCAGCGACCACCGGG	0.697											OREG0014445	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S558S													.	LPIN1-156	0			c.C1674T						.						21.0	22.0	21.0					2																	11925180		2201	4296	6497	SO:0001819	synonymous_variant	23175	exon11			CCTCAGCGACCAC	D80010	CCDS1682.1, CCDS58699.1, CCDS58700.1, CCDS58701.1	2p25.1	2008-05-23			ENSG00000134324	ENSG00000134324			13345	protein-coding gene	gene with protein product		605518				11138012, 8724849, 16950137	Standard	NM_145693		Approved	KIAA0188	uc010yjm.3	Q14693	OTTHUMG00000119082	ENST00000256720.2:c.1419C>T	2.37:g.11925180C>T		Somatic	97	0	675	WXS	Illumina HiSeq	Phase_I	75	3	NM_001261428	0	0	0	0	0	A8MU38|B4DET9|B4DGS4|B4DGZ6|B5MC18|B7Z858|D6W506|E7ESE7|F5GY24|Q53T25	Silent	SNP	ENST00000256720.2	37	CCDS1682.1																																																																																			.		0.697	LPIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239296.3	NM_145693	
MYCN	4613	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	16082258	16082258	+	Silent	SNP	A	A	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr2:16082258A>G	ENST00000281043.3	+	2	369	c.72A>G	c.(70-72)ctA>ctG	p.L24L	MYCNOS_ENST00000419083.1_RNA|MYCNOS_ENST00000439180.1_RNA|MYCNOS_ENST00000420452.1_RNA|MYCNOS_ENST00000448719.1_RNA|MYCNOS_ENST00000453400.1_RNA	NM_005378.4	NP_005369.2	P04198	MYCN_HUMAN	v-myc avian myelocytomatosis viral oncogene neuroblastoma derived homolog	24					branching morphogenesis of an epithelial tube (GO:0048754)|cartilage condensation (GO:0001502)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|lung development (GO:0030324)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|positive regulation of cell death (GO:0010942)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromatin (GO:0000785)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	31	all_cancers(1;1.35e-08)|all_neural(1;2.92e-24)|Lung SC(1;3.26e-07)|Medulloblastoma(1;6.9e-06)|all_lung(1;1.26e-05)|Glioma(3;0.135)|Acute lymphoblastic leukemia(172;0.155)|all_epithelial(1;0.169)|all_hematologic(175;0.197)		GBM - Glioblastoma multiforme(3;0.000332)			TTGACTCGCTACAGCCCTGCT	0.642			A		neuroblastoma																																p.L24L		.		Dom	yes		2	2p24.1	4613	"""v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)"""		O	.	MYCN-1271	0			c.A72G						.						54.0	56.0	56.0					2																	16082258		2203	4300	6503	SO:0001819	synonymous_variant	4613	exon2			CTCGCTACAGCCC	BC002712	CCDS1687.1	2p24.3	2013-08-14	2013-07-09		ENSG00000134323	ENSG00000134323		"""Basic helix-loop-helix proteins"""	7559	protein-coding gene	gene with protein product		164840		NMYC			Standard	XM_006711886		Approved	bHLHe37, N-myc, MYCNOT	uc002rci.3	P04198	OTTHUMG00000039579	ENST00000281043.3:c.72A>G	2.37:g.16082258A>G		Somatic	264	0		WXS	Illumina HiSeq	Phase_I	216	58	NM_005378	0	0	0	0	0	Q53XS5|Q6LDT9	Silent	SNP	ENST00000281043.3	37	CCDS1687.1																																																																																			.		0.642	MYCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095469.2	NM_005378	
DPY30	84661	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	32264491	32264491	+	Splice_Site	SNP	T	T	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr2:32264491T>A	ENST00000342166.5	-	2	150	c.35A>T	c.(34-36)cAg>cTg	p.Q12L	DPY30_ENST00000295066.3_Splice_Site_p.Q12L			Q9C005	DPY30_HUMAN	dpy-30 homolog (C. elegans)	12					endosomal transport (GO:0016197)|histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)|trans-Golgi network (GO:0005802)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)			large_intestine(2)	2	Acute lymphoblastic leukemia(172;0.155)					TCCTGATACCTGCGTTTGTCC	0.567																																					p.Q12L		.											.	DPY30-68	0			c.A35T						.						104.0	103.0	103.0					2																	32264491		2203	4300	6503	SO:0001630	splice_region_variant	84661	exon2			GATACCTGCGTTT		CCDS1777.1	2p22.3	2013-09-09			ENSG00000162961	ENSG00000162961			24590	protein-coding gene	gene with protein product		612032				12477932	Standard	XM_006712117		Approved	Saf19, HDPY-30, Cps25	uc002roa.1	Q9C005	OTTHUMG00000128457	ENST00000342166.5:c.36+1A>T	2.37:g.32264491T>A		Somatic	117	0		WXS	Illumina HiSeq	Phase_I	103	29	NM_032574	0	0	0	0	0	D6W578	Missense_Mutation	SNP	ENST00000342166.5	37	CCDS1777.1	.	.	.	.	.	.	.	.	.	.	T	13.66	2.302365	0.40694	.	.	ENSG00000162961	ENST00000342166;ENST00000295066	.	.	.	5.92	3.54	0.40534	.	0.158879	0.56097	D	0.000023	T	0.44498	0.1296	.	.	.	0.41659	D	0.989174	B	0.14438	0.01	B	0.10450	0.005	T	0.45264	-0.9273	8	0.48119	T	0.1	-14.8864	9.1274	0.36824	0.0:0.0721:0.136:0.7919	.	12	Q9C005	DPY30_HUMAN	L	12	.	ENSP00000295066:Q12L	Q	-	2	0	DPY30	32117995	1.000000	0.71417	1.000000	0.80357	0.814000	0.46013	2.804000	0.47931	2.274000	0.75844	0.533000	0.62120	CAG	.		0.567	DPY30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250255.2	NM_032574	Missense_Mutation
EPAS1	2034	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	46607787	46607787	+	Missense_Mutation	SNP	C	C	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr2:46607787C>G	ENST00000263734.3	+	12	2486	c.1976C>G	c.(1975-1977)aCa>aGa	p.T659R		NM_001430.4	NP_001421.2	Q99814	EPAS1_HUMAN	endothelial PAS domain protein 1	659					angiogenesis (GO:0001525)|blood vessel remodeling (GO:0001974)|cell maturation (GO:0048469)|cellular response to hypoxia (GO:0071456)|embryonic placenta development (GO:0001892)|erythrocyte differentiation (GO:0030218)|lung development (GO:0030324)|mitochondrion organization (GO:0007005)|myoblast fate commitment (GO:0048625)|norepinephrine metabolic process (GO:0042415)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart rate (GO:0002027)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|surfactant homeostasis (GO:0043129)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|histone acetyltransferase binding (GO:0035035)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	LUSC - Lung squamous cell carcinoma(58;0.151)			GATCAGCGCACAGAGTTCTTG	0.592																																					p.T659R		.											.	EPAS1-227	0			c.C1976G						.						71.0	83.0	79.0					2																	46607787		2199	4290	6489	SO:0001583	missense	2034	exon12			AGCGCACAGAGTT	U81984	CCDS1825.1	2p21-p16	2013-05-21			ENSG00000116016	ENSG00000116016		"""Basic helix-loop-helix proteins"""	3374	protein-coding gene	gene with protein product	"""HIF-1 alpha-like factor"""	603349				9000051, 9079689, 18378852	Standard	NM_001430		Approved	MOP2, PASD2, HIF2A, HLF, bHLHe73	uc002ruv.3	Q99814	OTTHUMG00000128818	ENST00000263734.3:c.1976C>G	2.37:g.46607787C>G	ENSP00000263734:p.Thr659Arg	Somatic	90	0		WXS	Illumina HiSeq	Phase_I	76	17	NM_001430	0	0	5	6	1	Q86VA2|Q99630	Missense_Mutation	SNP	ENST00000263734.3	37	CCDS1825.1	.	.	.	.	.	.	.	.	.	.	C	9.602	1.128965	0.21041	.	.	ENSG00000116016	ENST00000263734	T	0.46451	0.87	4.89	3.08	0.35506	.	1.373260	0.04589	N	0.396496	T	0.30823	0.0777	N	0.22421	0.69	0.09310	N	1	B	0.23316	0.083	B	0.25405	0.06	T	0.26155	-1.0111	10	0.24483	T	0.36	.	6.4229	0.21754	0.1452:0.7017:0.0:0.1531	.	659	Q99814	EPAS1_HUMAN	R	659	ENSP00000263734:T659R	ENSP00000263734:T659R	T	+	2	0	EPAS1	46461291	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	1.108000	0.31123	0.480000	0.27534	-0.237000	0.12165	ACA	.		0.592	EPAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250752.2	NM_001430	
CNTNAP5	129684	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	125175092	125175092	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr2:125175092G>A	ENST00000431078.1	+	4	818	c.454G>A	c.(454-456)Gtt>Att	p.V152I		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	152	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		AGCCCGATTTGTTCGCTTTGT	0.498																																					p.V152I													.	CNTNAP5-524	0			c.G454A						.						96.0	100.0	99.0					2																	125175092		1990	4172	6162	SO:0001583	missense	129684	exon4			CGATTTGTTCGCT	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.454G>A	2.37:g.125175092G>A	ENSP00000399013:p.Val152Ile	Somatic	122	1		WXS	Illumina HiSeq	Phase_I	125	41	NM_130773	0	0	0	0	0	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	ENST00000431078.1	37	CCDS46401.1	.	.	.	.	.	.	.	.	.	.	G	15.92	2.974606	0.53720	.	.	ENSG00000155052	ENST00000431078	D	0.97642	-4.47	6.17	-6.25	0.02039	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.767069	0.11093	N	0.600490	D	0.90116	0.6912	N	0.16656	0.425	0.29732	N	0.837787	B	0.02656	0.0	B	0.10450	0.005	T	0.79266	-0.1874	10	0.20046	T	0.44	.	9.7379	0.40399	0.4913:0.3858:0.1229:0.0	.	152	Q8WYK1	CNTP5_HUMAN	I	152	ENSP00000399013:V152I	ENSP00000399013:V152I	V	+	1	0	CNTNAP5	124891562	0.005000	0.15991	0.001000	0.08648	0.952000	0.60782	0.076000	0.14712	-1.035000	0.03291	0.655000	0.94253	GTT	.		0.498	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3		
CCDC141	285025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	179843225	179843225	+	Nonsense_Mutation	SNP	C	C	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr2:179843225C>A	ENST00000409284.1	-	3	520	c.403G>T	c.(403-405)Gaa>Taa	p.E135*	CCDC141_ENST00000420890.2_Nonsense_Mutation_p.E135*			Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	135										NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(37)|ovary(8)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)	78			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			AAGGCATTTTCAAAAAATTCA	0.413																																					p.E135X		.											.	CCDC141-78	0			c.G403T						.																																			SO:0001587	stop_gained	285025	exon3			CATTTTCAAAAAA	AK096821		2q31.2	2013-01-14			ENSG00000163492	ENSG00000163492		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26821	protein-coding gene	gene with protein product	"""coiled-coil protein associated with myosin II and DISC1"""					20956536	Standard	NM_173648		Approved	FLJ39502, CAMDI	uc002une.2	Q6ZP82	OTTHUMG00000132578	ENST00000409284.1:c.403G>T	2.37:g.179843225C>A	ENSP00000386503:p.Glu135*	Somatic	127	0		WXS	Illumina HiSeq	Phase_I	100	16	NM_173648	0	0	0	0	0	H7C0P1|J3KNW6|Q8N8H3	Nonsense_Mutation	SNP	ENST00000409284.1	37		.	.	.	.	.	.	.	.	.	.	C	34	5.311347	0.95655	.	.	ENSG00000163492	ENST00000420890;ENST00000443758;ENST00000446116;ENST00000409284	.	.	.	6.16	4.33	0.51752	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.7277	0.46079	0.0:0.6819:0.2519:0.0662	.	.	.	.	X	135	.	.	E	-	1	0	CCDC141	179551470	1.000000	0.71417	1.000000	0.80357	0.819000	0.46315	2.308000	0.43690	1.581000	0.49865	0.650000	0.86243	GAA	.		0.413	CCDC141-003	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000335873.1	NM_173648	
HIBCH	26275	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	191069874	191069874	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr2:191069874T>C	ENST00000359678.5	-	14	1424	c.1130A>G	c.(1129-1131)aAg>aGg	p.K377R	HIBCH_ENST00000486981.1_5'UTR|HIBCH_ENST00000410045.1_Missense_Mutation_p.K154R|HIBCH_ENST00000392332.3_3'UTR	NM_014362.3|NM_198047.2	NP_055177.2|NP_932164.1	Q6NVY1	HIBCH_HUMAN	3-hydroxyisobutyryl-CoA hydrolase	377					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|valine catabolic process (GO:0006574)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)	3-hydroxyisobutyryl-CoA hydrolase activity (GO:0003860)			NS(1)|breast(2)|endometrium(1)|large_intestine(1)|lung(5)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	13			OV - Ovarian serous cystadenocarcinoma(117;0.000586)|Epithelial(96;0.0286)|all cancers(119;0.0814)			TCCCAAAGACTTAAAGTGATT	0.373																																					p.K377R													.	HIBCH-90	0			c.A1130G						.						85.0	80.0	82.0					2																	191069874		2202	4299	6501	SO:0001583	missense	26275	exon14			AAAGACTTAAAGT	U66669	CCDS2304.1, CCDS46475.1	2q32.3	2010-04-29	2010-04-29		ENSG00000198130	ENSG00000198130	3.1.2.4		4908	protein-coding gene	gene with protein product		610690	"""3-hydroxyisobutyryl-Coenzyme A hydrolase"""			8824301	Standard	NM_014362		Approved		uc002uru.3	Q6NVY1	OTTHUMG00000132673	ENST00000359678.5:c.1130A>G	2.37:g.191069874T>C	ENSP00000352706:p.Lys377Arg	Somatic	111	1		WXS	Illumina HiSeq	Phase_I	107	32	NM_014362	0	0	40	48	8	D3DPI4|Q53GA8|Q53GF2|Q53RF7|Q53TC6|Q92931|Q9BS94	Missense_Mutation	SNP	ENST00000359678.5	37	CCDS2304.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.26|12.26	1.885753|1.885753	0.33255|0.33255	.|.	.|.	ENSG00000198130|ENSG00000198130	ENST00000359678;ENST00000410045|ENST00000399855	T|.	0.57907|.	0.37|.	5.31|5.31	5.31|5.31	0.75309|0.75309	.|.	0.226670|.	0.45606|.	D|.	0.000353|.	T|T	0.44477|0.44477	0.1295|0.1295	N|N	0.25825|0.25825	0.765|0.765	0.37023|0.37023	D|D	0.896302|0.896302	B|.	0.12630|.	0.006|.	B|.	0.16289|.	0.015|.	T|T	0.48614|0.48614	-0.9020|-0.9020	10|5	0.15066|.	T|.	0.55|.	-2.683|-2.683	9.365|9.365	0.38219|0.38219	0.0:0.0:0.18:0.82|0.0:0.0:0.18:0.82	.|.	377|.	Q6NVY1|.	HIBCH_HUMAN|.	R|G	377;154|29	ENSP00000352706:K377R|.	ENSP00000352706:K377R|.	K|S	-|-	2|1	0|0	HIBCH|HIBCH	190778119|190778119	0.976000|0.976000	0.34144|0.34144	1.000000|1.000000	0.80357|0.80357	0.978000|0.978000	0.69477|0.69477	1.768000|1.768000	0.38511|0.38511	2.243000|2.243000	0.73865|0.73865	0.533000|0.533000	0.62120|0.62120	AAG|AGT	.		0.373	HIBCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255933.1		
NEU2	4759	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	233898967	233898967	+	Silent	SNP	C	C	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr2:233898967C>T	ENST00000233840.3	+	2	343	c.343C>T	c.(343-345)Ctg>Ttg	p.L115L		NM_005383.2	NP_005374.2	Q9Y3R4	NEUR2_HUMAN	sialidase 2 (cytosolic sialidase)	115					ganglioside catabolic process (GO:0006689)|glycosphingolipid metabolic process (GO:0006687)|oligosaccharide catabolic process (GO:0009313)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	exo-alpha-(2->3)-sialidase activity (GO:0052794)|exo-alpha-(2->6)-sialidase activity (GO:0052795)|exo-alpha-(2->8)-sialidase activity (GO:0052796)			endometrium(3)|large_intestine(2)|lung(10)|skin(2)|urinary_tract(1)	18		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0271)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0839)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000311)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)|GBM - Glioblastoma multiforme(43;0.0488)	Oseltamivir(DB00198)|Zanamivir(DB00558)	GCAACAGCAGCTGCAGACCAG	0.627																																					p.L115L		.											.	NEU2-90	0			c.C343T						.						89.0	72.0	78.0					2																	233898967		2203	4300	6503	SO:0001819	synonymous_variant	4759	exon2			CAGCAGCTGCAGA	Y16535	CCDS2501.1	2q37	2008-05-27			ENSG00000115488	ENSG00000115488			7759	protein-coding gene	gene with protein product	"""N-acetyl-alpha-neuraminidase 2"""	605528				10191093, 14613940	Standard	NM_005383		Approved	SIAL2	uc010zmn.2	Q9Y3R4	OTTHUMG00000133274	ENST00000233840.3:c.343C>T	2.37:g.233898967C>T		Somatic	111	0		WXS	Illumina HiSeq	Phase_I	64	14	NM_005383	0	0	0	0	0	Q3KNW4|Q6NTB4	Silent	SNP	ENST00000233840.3	37	CCDS2501.1																																																																																			.		0.627	NEU2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257053.2	NM_005383	
ATRN	8455	broad.mit.edu;bcgsc.ca	37	20	3452154	3452154	+	Missense_Mutation	SNP	G	G	C			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr20:3452154G>C	ENST00000262919.5	+	1	468	c.400G>C	c.(400-402)Ggc>Cgc	p.G134R	ATRN_ENST00000446916.2_Missense_Mutation_p.G134R	NM_139321.2	NP_647537.1	O75882	ATRN_HUMAN	attractin	134	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cerebellum development (GO:0021549)|inflammatory response (GO:0006954)|myelination (GO:0042552)|pigmentation (GO:0043473)|regulation of multicellular organism growth (GO:0040014)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			breast(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(22)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	59						GCACTGCGGGGGCCGCTTCAG	0.701																																					p.G134R													.	ATRN-154	0			c.G400C						.						3.0	4.0	4.0					20																	3452154		1855	3869	5724	SO:0001583	missense	8455	exon1			TGCGGGGGCCGCT	AF034957	CCDS13053.1, CCDS13054.1	20p13	2008-07-02			ENSG00000088812	ENSG00000088812			885	protein-coding gene	gene with protein product	"""mahogany protein"""	603130				9736737, 8596018	Standard	NM_139321		Approved	DPPT-L, MGCA	uc002wim.2	O75882	OTTHUMG00000031746	ENST00000262919.5:c.400G>C	20.37:g.3452154G>C	ENSP00000262919:p.Gly134Arg	Somatic	23	0		WXS	Illumina HiSeq	Phase_I	23	4	NM_139321	0	0	0	0	0	A8KAE5|O60295|O95414|Q3MIT3|Q5TDA2|Q5TDA4|Q5VYW3|Q9NTQ3|Q9NTQ4|Q9NU01|Q9NZ57|Q9NZ58|Q9UC75|Q9UDF5	Missense_Mutation	SNP	ENST00000262919.5	37	CCDS13053.1	.	.	.	.	.	.	.	.	.	.	G	35	5.490406	0.96339	.	.	ENSG00000088812	ENST00000262919;ENST00000446916;ENST00000340500	T;T	0.63913	-0.07;-0.07	5.32	5.32	0.75619	EGF-like, laminin (1);CUB (5);	0.113928	0.64402	N	0.000014	D	0.84374	0.5458	M	0.92833	3.35	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.975	D	0.88025	0.2771	10	0.87932	D	0	-14.9415	18.1397	0.89636	0.0:0.0:1.0:0.0	.	134;134	O75882;O75882-2	ATRN_HUMAN;.	R	134;134;60	ENSP00000262919:G134R;ENSP00000416587:G134R	ENSP00000262919:G134R	G	+	1	0	ATRN	3400154	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.035000	0.93752	2.632000	0.89209	0.555000	0.69702	GGC	.		0.701	ATRN-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077740.2	NM_139321	
SSTR4	6754	broad.mit.edu	37	20	23016957	23016957	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr20:23016957G>T	ENST00000255008.3	+	1	901	c.837G>T	c.(835-837)caG>caT	p.Q279H	RP4-753D10.3_ENST00000440921.1_RNA	NM_001052.2	NP_001043.2	P31391	SSR4_HUMAN	somatostatin receptor 4	279					arachidonic acid metabolic process (GO:0019369)|cell migration (GO:0016477)|cellular response to glucocorticoid stimulus (GO:0071385)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP metabolic process (GO:0030815)|negative regulation of cell proliferation (GO:0008285)|positive regulation of MAPK cascade (GO:0043410)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)	32	Colorectal(13;0.0518)|Lung NSC(19;0.0542)|all_lung(19;0.118)					ACGTGGTGCAGCTGCTGAACC	0.572																																					p.Q279H	Esophageal Squamous(15;850 1104 16640)												.	SSTR4-522	0			c.G837T						.						199.0	205.0	203.0					20																	23016957		2203	4300	6503	SO:0001583	missense	6754	exon1			GGTGCAGCTGCTG		CCDS42856.1	20p11.21	2014-07-11			ENSG00000132671	ENSG00000132671		"""GPCR / Class A : Somatostatin receptors"""	11333	protein-coding gene	gene with protein product		182454				8483934	Standard	NM_001052		Approved		uc002wsr.2	P31391	OTTHUMG00000032054	ENST00000255008.3:c.837G>T	20.37:g.23016957G>T	ENSP00000255008:p.Gln279His	Somatic	82	0		WXS	Illumina HiSeq	Phase_I	67	3	NM_001052	0	0	0	0	0	Q17RM1|Q17RM3|Q9UIY1	Missense_Mutation	SNP	ENST00000255008.3	37	CCDS42856.1	.	.	.	.	.	.	.	.	.	.	G	14.82	2.648929	0.47362	.	.	ENSG00000132671	ENST00000255008	T	0.37411	1.2	3.36	3.36	0.38483	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	U	0.000012	T	0.50480	0.1618	L	0.58810	1.83	0.44388	D	0.997296	D	0.76494	0.999	D	0.79108	0.992	T	0.51585	-0.8687	10	0.72032	D	0.01	.	7.6455	0.28318	0.1218:0.0:0.8782:0.0	.	279	P31391	SSR4_HUMAN	H	279	ENSP00000255008:Q279H	ENSP00000255008:Q279H	Q	+	3	2	SSTR4	22964957	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	1.821000	0.39041	1.694000	0.51137	0.655000	0.94253	CAG	.		0.572	SSTR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078308.1		
NCOA6	23054	broad.mit.edu	37	20	33345744	33345744	+	Silent	SNP	C	C	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr20:33345744C>T	ENST00000374796.2	-	8	3377	c.807G>A	c.(805-807)caG>caA	p.Q269Q	NCOA6_ENST00000359003.2_Silent_p.Q269Q			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	269	CREBBP-binding region.|Gln-rich.|NCOA1-binding region.|TBP/GTF2A-binding region.				brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)	p.Q269Q(15)		NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						gctgctgctgctgttgttgtt	0.537																																					p.Q269Q													.	NCOA6-292	15	Substitution - coding silent(15)	lung(5)|prostate(4)|endometrium(3)|central_nervous_system(1)|urinary_tract(1)|kidney(1)	c.G807A						.						64.0	52.0	56.0					20																	33345744		2203	4300	6503	SO:0001819	synonymous_variant	23054	exon7			CTGCTGCTGTTGT	AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.807G>A	20.37:g.33345744C>T		Somatic	62	1		WXS	Illumina HiSeq	Phase_I	38	3	NM_014071	0	0	0	0	0	A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Silent	SNP	ENST00000374796.2	37	CCDS13241.1																																																																																			.		0.537	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078811.2	NM_014071	
TIAM1	7074	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	32639267	32639267	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr21:32639267G>A	ENST00000286827.3	-	5	493	c.22C>T	c.(22-24)Cat>Tat	p.H8Y	TIAM1_ENST00000469412.1_Intron|TIAM1_ENST00000541036.1_Missense_Mutation_p.H8Y	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	8					apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						TGCTCTACATGTTGACTTTCT	0.527																																					p.H8Y		.											.	TIAM1-724	0			c.C22T						.						54.0	56.0	55.0					21																	32639267		2203	4300	6503	SO:0001583	missense	7074	exon5			CTACATGTTGACT		CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.22C>T	21.37:g.32639267G>A	ENSP00000286827:p.His8Tyr	Somatic	50	0		WXS	Illumina HiSeq	Phase_I	24	7	NM_003253	0	0	0	0	0	B7ZLR6|F5GZ53|Q17RT7	Missense_Mutation	SNP	ENST00000286827.3	37	CCDS13609.1	.	.	.	.	.	.	.	.	.	.	G	13.84	2.358038	0.41801	.	.	ENSG00000156299	ENST00000286827;ENST00000541036;ENST00000455508	T;T	0.39056	1.1;1.1	5.08	2.64	0.31445	.	0.211502	0.47852	D	0.000203	T	0.23611	0.0571	N	0.08118	0	0.21147	N	0.999772	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.22521	-1.0214	10	0.87932	D	0	.	11.7355	0.51763	0.0:0.0:0.3141:0.6859	.	8;8;8	F5GZ53;B7ZLR6;Q13009	.;.;TIAM1_HUMAN	Y	8	ENSP00000286827:H8Y;ENSP00000441570:H8Y	ENSP00000286827:H8Y	H	-	1	0	TIAM1	31561138	1.000000	0.71417	0.978000	0.43139	0.974000	0.67602	5.772000	0.68889	0.251000	0.21505	0.460000	0.39030	CAT	.		0.527	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192552.1	NM_003253	
HDAC11	79885	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	13525052	13525052	+	Silent	SNP	T	T	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr3:13525052T>G	ENST00000295757.3	+	3	423	c.240T>G	c.(238-240)ctT>ctG	p.L80L	HDAC11_ENST00000404040.1_Silent_p.L80L|HDAC11_ENST00000402259.1_Intron|HDAC11_ENST00000437379.2_Silent_p.L52L|HDAC11_ENST00000402271.1_Silent_p.L80L|HDAC11_ENST00000405025.1_Silent_p.L52L|HDAC11_ENST00000446613.2_Intron|HDAC11_ENST00000404548.1_Silent_p.L80L|HDAC11_ENST00000433119.1_Silent_p.L52L|HDAC11_ENST00000522202.1_Silent_p.L52L	NM_024827.3	NP_079103.2	Q96DB2	HDA11_HUMAN	histone deacetylase 11	80	Histone deacetylase.				chromatin modification (GO:0016568)|histone deacetylation (GO:0016575)|oligodendrocyte development (GO:0014003)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone deacetylase activity (GO:0004407)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|transcription factor binding (GO:0008134)			breast(1)|endometrium(2)|large_intestine(1)|lung(2)|ovary(4)|prostate(3)	13						GGCGCTATCTTAATGAGCTCA	0.647																																					p.L80L		.											.	HDAC11-228	0			c.T240G						.						63.0	72.0	69.0					3																	13525052		2203	4300	6503	SO:0001819	synonymous_variant	79885	exon3			CTATCTTAATGAG	AK025426	CCDS2615.1, CCDS46760.1	3p25.1	2008-07-18			ENSG00000163517	ENSG00000163517	3.5.1.98		19086	protein-coding gene	gene with protein product		607226				11948178	Standard	NM_001136041		Approved		uc003bxy.3	Q96DB2	OTTHUMG00000129800	ENST00000295757.3:c.240T>G	3.37:g.13525052T>G		Somatic	180	0		WXS	Illumina HiSeq	Phase_I	105	65	NM_024827	0	0	0	0	0	B4DDK1|Q9H6I7|Q9H6X3|Q9NTC9	Silent	SNP	ENST00000295757.3	37	CCDS2615.1																																																																																			.		0.647	HDAC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252028.5	NM_024827	
DAZL	1618	broad.mit.edu	37	3	16639640	16639640	+	Missense_Mutation	SNP	C	C	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr3:16639640C>G	ENST00000399444.2	-	3	489	c.196G>C	c.(196-198)Gtg>Ctg	p.V66L	DAZL_ENST00000250863.8_Missense_Mutation_p.V86L	NM_001351.3	NP_001342.2	Q92904	DAZL_HUMAN	deleted in azoospermia-like	66	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				female meiosis II (GO:0007147)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|oocyte maturation (GO:0001556)|positive regulation of meiosis (GO:0045836)|positive regulation of translational initiation (GO:0045948)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|polysome (GO:0005844)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|translation activator activity (GO:0008494)		RAF1/DAZL(2)	endometrium(1)|large_intestine(3)|lung(4)|prostate(3)	11						ACTTCTTTCACTGAACCATAT	0.333																																					p.V86L													.	DAZL-90	0			c.G256C						.						104.0	96.0	98.0					3																	16639640		1829	4090	5919	SO:0001583	missense	1618	exon3			CTTTCACTGAACC	BC027595	CCDS43059.1, CCDS54556.1	3p24	2013-02-12			ENSG00000092345	ENSG00000092345		"""RNA binding motif (RRM) containing"""	2685	protein-coding gene	gene with protein product		601486		DAZLA		8896558	Standard	NM_001351		Approved	DAZH, SPGYLA, MGC26406, DAZL1	uc003cbb.3	Q92904	OTTHUMG00000157050	ENST00000399444.2:c.196G>C	3.37:g.16639640C>G	ENSP00000382373:p.Val66Leu	Somatic	189	0		WXS	Illumina HiSeq	Phase_I	176	5	NM_001190811	0	0	0	0	0	O15396|Q5HYB4|Q92909	Missense_Mutation	SNP	ENST00000399444.2	37	CCDS43059.1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.920420	0.92249	.	.	ENSG00000092345	ENST00000250863;ENST00000399444;ENST00000454457	T;T;T	0.43294	0.95;0.95;0.95	5.55	5.55	0.83447	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.057203	0.64402	D	0.000001	T	0.66499	0.2795	M	0.69523	2.12	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.68792	-0.5315	10	0.87932	D	0	-7.8288	19.5113	0.95142	0.0:1.0:0.0:0.0	.	66;86	Q92904;Q5HYB4	DAZL_HUMAN;.	L	86;66;104	ENSP00000250863:V86L;ENSP00000382373:V66L;ENSP00000398109:V104L	ENSP00000250863:V86L	V	-	1	0	DAZL	16614644	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.641000	0.74324	2.612000	0.88384	0.591000	0.81541	GTG	.		0.333	DAZL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347261.2	NM_001351	
TRAK1	22906	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	42218379	42218379	+	Silent	SNP	G	G	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr3:42218379G>A	ENST00000327628.5	+	3	760	c.360G>A	c.(358-360)gaG>gaA	p.E120E	TRAK1_ENST00000449246.1_Silent_p.E46E|TRAK1_ENST00000396175.1_Silent_p.E62E|TRAK1_ENST00000341421.3_Silent_p.E62E|TRAK1_ENST00000487159.1_3'UTR	NM_001042646.2	NP_001036111.1	Q9UPV9	TRAK1_HUMAN	trafficking protein, kinesin binding 1	120	HAP1 N-terminal.				endosome to lysosome transport (GO:0008333)|protein O-linked glycosylation (GO:0006493)|protein targeting (GO:0006605)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	22						GGCTTCTTGAGGAGGTAAGTG	0.388																																					p.E120E	GBM(44;195 884 22595 31865 41850)	.											.	TRAK1-91	0			c.G360A						.						157.0	164.0	162.0					3																	42218379		2203	4300	6503	SO:0001819	synonymous_variant	22906	exon3			TCTTGAGGAGGTA		CCDS2695.1, CCDS43072.1, CCDS58826.1, CCDS74922.1	3p22.1	2012-03-05			ENSG00000182606	ENSG00000182606			29947	protein-coding gene	gene with protein product	"""OGT(O Glc NAc transferase) interacting protein 106 KDa"", ""O-linked N-acetylglucosamine transferase interacting protein 106"", ""milton homolog 1 (Drosophila)"""	608112				10470851, 12435728, 16380713, 20230862	Standard	NM_014965		Approved	OIP106, KIAA1042, MILT1	uc003cky.4	Q9UPV9	OTTHUMG00000131795	ENST00000327628.5:c.360G>A	3.37:g.42218379G>A		Somatic	126	0		WXS	Illumina HiSeq	Phase_I	82	39	NM_001265608	0	0	0	0	0	E9PDS2|J3KNT7|Q63HR0|Q659B5|Q96B69	Silent	SNP	ENST00000327628.5	37	CCDS43072.1																																																																																			.		0.388	TRAK1-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343413.1	NM_014965	
SNRK	54861	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	43388848	43388848	+	Missense_Mutation	SNP	A	A	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr3:43388848A>T	ENST00000296088.7	+	7	1401	c.1097A>T	c.(1096-1098)aAa>aTa	p.K366I	SNRK_ENST00000454177.1_Missense_Mutation_p.K366I|SNRK_ENST00000429705.2_Missense_Mutation_p.K366I|SNRK-AS1_ENST00000422681.1_RNA|RP11-188P20.3_ENST00000607513.1_RNA|SNRK_ENST00000437827.1_Missense_Mutation_p.K160I	NM_017719.4	NP_060189.3			SNF related kinase											breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(5)|prostate(1)|skin(2)|stomach(1)	27				KIRC - Kidney renal clear cell carcinoma(284;0.0636)|Kidney(284;0.0792)		TGGCCAACCAAAATTGATGTA	0.483																																					p.K366I		.											.	SNRK-815	0			c.A1097T						.						104.0	110.0	108.0					3																	43388848		1980	4155	6135	SO:0001583	missense	54861	exon7			CAACCAAAATTGA	D43636	CCDS43075.1	3p22.1	2005-08-09			ENSG00000163788	ENSG00000163788			30598	protein-coding gene	gene with protein product		612760				8654423, 7788527	Standard	NM_017719		Approved	FLJ20224, HSNFRK, KIAA0096	uc003cmt.4	Q9NRH2	OTTHUMG00000156491	ENST00000296088.7:c.1097A>T	3.37:g.43388848A>T	ENSP00000296088:p.Lys366Ile	Somatic	55	0		WXS	Illumina HiSeq	Phase_I	27	16	NM_017719	0	0	0	1	1		Missense_Mutation	SNP	ENST00000296088.7	37	CCDS43075.1	.	.	.	.	.	.	.	.	.	.	A	14.78	2.636679	0.47049	.	.	ENSG00000163788	ENST00000454177;ENST00000429705;ENST00000296088;ENST00000437827	T;T;T;T	0.66460	-0.21;-0.21;-0.21;2.71	5.07	3.91	0.45181	.	0.175030	0.49305	N	0.000150	T	0.48960	0.1529	N	0.19112	0.55	0.49687	D	0.999812	B	0.23735	0.09	B	0.21360	0.034	T	0.49244	-0.8960	10	0.42905	T	0.14	.	10.4529	0.44533	0.9229:0.0:0.0771:0.0	.	366	Q9NRH2	SNRK_HUMAN	I	366;366;366;160	ENSP00000401246:K366I;ENSP00000411375:K366I;ENSP00000296088:K366I;ENSP00000409516:K160I	ENSP00000296088:K366I	K	+	2	0	SNRK	43363852	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.731000	0.68554	2.049000	0.60858	0.533000	0.62120	AAA	.		0.483	SNRK-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344325.1	NM_017719	
NBEAL2	23218	broad.mit.edu	37	3	47030855	47030855	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr3:47030855C>T	ENST00000450053.3	+	5	636	c.457C>T	c.(457-459)Cgg>Tgg	p.R153W	NBEAL2_ENST00000383740.2_5'UTR|NBEAL2_ENST00000292309.5_Missense_Mutation_p.R153W	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	153					blood coagulation (GO:0007596)|megakaryocyte development (GO:0035855)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		CCAAACCTGGCGGCGCCAGCG	0.667																																					p.R153W													.	NBEAL2-69	0			c.C457T						.						22.0	25.0	24.0					3																	47030855		2003	4141	6144	SO:0001583	missense	23218	exon5			ACCTGGCGGCGCC	AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796		"""WD repeat domain containing"""	31928	protein-coding gene	gene with protein product		614169					Standard	NM_015175		Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	ENST00000450053.3:c.457C>T	3.37:g.47030855C>T	ENSP00000415034:p.Arg153Trp	Somatic	92	0		WXS	Illumina HiSeq	Phase_I	72	3	NM_015175	0	0	0	0	0	O60288|Q6P994|Q6UX91|Q8NAC9	Missense_Mutation	SNP	ENST00000450053.3	37	CCDS46817.1	.	.	.	.	.	.	.	.	.	.	C	18.54	3.646968	0.67358	.	.	ENSG00000160796	ENST00000292309;ENST00000450053;ENST00000296147	T;T	0.73789	-0.78;-0.72	3.92	1.78	0.24846	.	.	.	.	.	D	0.83303	0.5225	M	0.73962	2.25	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.964	D	0.83688	0.0175	9	0.87932	D	0	.	10.6426	0.45602	0.4823:0.5177:0.0:0.0	.	146;153	Q6ZNJ1-4;Q6ZNJ1	.;NBEL2_HUMAN	W	153;153;146	ENSP00000292309:R153W;ENSP00000415034:R153W	ENSP00000292309:R153W	R	+	1	2	NBEAL2	47005859	0.998000	0.40836	1.000000	0.80357	0.998000	0.95712	0.561000	0.23515	0.780000	0.33566	0.655000	0.94253	CGG	.		0.667	NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344363.3	XM_291064	
PBRM1	55193	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	52649430	52649430	+	Nonsense_Mutation	SNP	T	T	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr3:52649430T>A	ENST00000296302.7	-	15	1862	c.1861A>T	c.(1861-1863)Aaa>Taa	p.K621*	PBRM1_ENST00000337303.4_Nonsense_Mutation_p.K621*|PBRM1_ENST00000409767.1_Nonsense_Mutation_p.K636*|PBRM1_ENST00000410007.1_Nonsense_Mutation_p.K621*|PBRM1_ENST00000356770.4_Nonsense_Mutation_p.K589*|PBRM1_ENST00000409057.1_Nonsense_Mutation_p.K621*|PBRM1_ENST00000409114.3_Nonsense_Mutation_p.K636*|PBRM1_ENST00000394830.3_Nonsense_Mutation_p.K621*			Q86U86	PB1_HUMAN	polybromo 1	621			K -> E (found in a case of clear cell renal carcinoma; somatic mutation). {ECO:0000269|PubMed:21248752}.		chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TCTTTCCTTTTCTCCTTGAGT	0.363			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																p.K621X				Rec	yes		3	3p21	55193	polybromo 1		E	.	PBRM1-575	0			c.A1861T						.						116.0	105.0	109.0					3																	52649430		2203	4300	6503	SO:0001587	stop_gained	55193	exon16			TCCTTTTCTCCTT	BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.1861A>T	3.37:g.52649430T>A	ENSP00000296302:p.Lys621*	Somatic	83	0		WXS	Illumina HiSeq	Phase_I	63	35	NM_018313	0	0	0	0	0	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Nonsense_Mutation	SNP	ENST00000296302.7	37		.	.	.	.	.	.	.	.	.	.	T	41	8.750604	0.98939	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351;ENST00000446103	.	.	.	5.69	5.69	0.88448	.	0.044753	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-21.8447	15.944	0.79779	0.0:0.0:0.0:1.0	.	.	.	.	X	589;621;621;621;621;621;636;636;621;580	.	ENSP00000296302:K621X	K	-	1	0	PBRM1	52624470	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	8.040000	0.89188	2.170000	0.68504	0.379000	0.24179	AAA	.		0.363	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1	NM_018165	
DENND6A	201627	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	57616537	57616537	+	Missense_Mutation	SNP	T	T	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr3:57616537T>G	ENST00000311128.5	-	17	1492	c.1422A>C	c.(1420-1422)ttA>ttC	p.L474F	RP11-755B10.2_ENST00000470427.1_RNA	NM_152678.2	NP_689891.1	Q8IWF6	DEN6A_HUMAN	DENN/MADD domain containing 6A	474					positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of Rab GTPase activity (GO:0032851)	cytoplasm (GO:0005737)|recycling endosome (GO:0055037)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)										GAAACTGTCTTAATTGAGGTG	0.353																																					p.L474F													.	.	0			c.A1422C						.						73.0	73.0	73.0					3																	57616537		2203	4300	6503	SO:0001583	missense	201627	exon17			CTGTCTTAATTGA	AK074156	CCDS33773.1	3p14.3	2013-10-11	2012-10-03	2012-10-03	ENSG00000174839	ENSG00000174839		"""DENN/MADD domain containing"""	26635	protein-coding gene	gene with protein product			"""family with sequence similarity 116, member A"""	FAM116A		21330364	Standard	NM_152678		Approved	FLJ34969, AFI1A	uc003dja.3	Q8IWF6	OTTHUMG00000158639	ENST00000311128.5:c.1422A>C	3.37:g.57616537T>G	ENSP00000311401:p.Leu474Phe	Somatic	125	1		WXS	Illumina HiSeq	Phase_I	116	39	NM_152678	0	0	1	1	0	Q7Z5T4|Q8N235|Q8TEG8	Missense_Mutation	SNP	ENST00000311128.5	37	CCDS33773.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.83|18.83	3.706236|3.706236	0.68615|0.68615	.|.	.|.	ENSG00000174839|ENSG00000174839	ENST00000471531|ENST00000311128	.|.	.|.	.|.	5.94|5.94	3.59|3.59	0.41128|0.41128	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.65015|0.65015	0.2651|0.2651	M|M	0.83118|0.83118	2.625|2.625	0.51482|0.51482	D|D	0.999927|0.999927	.|D	.|0.58620	.|0.983	.|P	.|0.54924	.|0.764	T|T	0.65121|0.65121	-0.6245|-0.6245	5|9	.|0.44086	.|T	.|0.13	-27.6308|-27.6308	2.8604|2.8604	0.05585|0.05585	0.0:0.3025:0.248:0.4495|0.0:0.3025:0.248:0.4495	.|.	.|474	.|Q8IWF6	.|F116A_HUMAN	Q|F	46|474	.|.	.|ENSP00000311401:L474F	K|L	-|-	1|3	0|2	FAM116A|FAM116A	57591577|57591577	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.953000|0.953000	0.61014|0.61014	1.091000|1.091000	0.30915|0.30915	1.070000|1.070000	0.40811|0.40811	0.455000|0.455000	0.32223|0.32223	AAG|TTA	.		0.353	DENND6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351594.1	NM_152678	
SH3TC1	54436	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	8230146	8230146	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr4:8230146T>C	ENST00000245105.3	+	12	2792	c.2725T>C	c.(2725-2727)Ttc>Ctc	p.F909L	SH3TC1_ENST00000539824.1_Missense_Mutation_p.F833L	NM_018986.3	NP_061859	Q8TE82	S3TC1_HUMAN	SH3 domain and tetratricopeptide repeats 1	909										NS(1)|breast(3)|endometrium(4)|kidney(4)|large_intestine(6)|lung(10)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33						GCTGGCCAACTTCGGGGCCCT	0.706																																					p.F909L	NSCLC(145;2298 2623 35616 37297)	.											.	SH3TC1-154	0			c.T2725C						.						32.0	39.0	37.0					4																	8230146		2202	4298	6500	SO:0001583	missense	54436	exon12			GCCAACTTCGGGG	AK074093	CCDS3399.1	4p16.1	2013-01-11			ENSG00000125089	ENSG00000125089		"""Tetratricopeptide (TTC) repeat domain containing"""	26009	protein-coding gene	gene with protein product							Standard	NM_018986		Approved	FLJ20356	uc003gkv.4	Q8TE82	OTTHUMG00000160934	ENST00000245105.3:c.2725T>C	4.37:g.8230146T>C	ENSP00000245105:p.Phe909Leu	Somatic	73	0		WXS	Illumina HiSeq	Phase_I	82	24	NM_018986	0	0	7	10	3	Q4W5G5	Missense_Mutation	SNP	ENST00000245105.3	37	CCDS3399.1	.	.	.	.	.	.	.	.	.	.	T	3.669	-0.067891	0.07228	.	.	ENSG00000125089	ENST00000382516;ENST00000245105;ENST00000539824;ENST00000535265	T;T	0.56103	0.48;0.48	4.63	0.869	0.19096	Tetratricopeptide-like helical (1);	0.456640	0.23165	N	0.051183	T	0.31765	0.0807	L	0.29908	0.895	0.32645	N	0.520198	B	0.21225	0.053	B	0.25759	0.063	T	0.40327	-0.9569	10	0.02654	T	1	-12.4248	8.0727	0.30699	0.0:0.2424:0.0:0.7576	.	909	Q8TE82	S3TC1_HUMAN	L	647;909;833;738	ENSP00000245105:F909L;ENSP00000441045:F833L	ENSP00000245105:F909L	F	+	1	0	SH3TC1	8281046	1.000000	0.71417	0.984000	0.44739	0.251000	0.25915	1.897000	0.39799	0.167000	0.19631	0.459000	0.35465	TTC	.		0.706	SH3TC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206991.2	NM_018986	
NPFFR2	10886	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	73012854	73012854	+	Silent	SNP	C	C	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr4:73012854C>G	ENST00000308744.6	+	4	992	c.894C>G	c.(892-894)tcC>tcG	p.S298S	NPFFR2_ENST00000395999.1_Silent_p.S199S|NPFFR2_ENST00000506359.1_3'UTR|NPFFR2_ENST00000358749.3_Silent_p.S196S|NPFFR2_ENST00000344413.5_3'UTR	NM_004885.2	NP_004876.2	Q9Y5X5	NPFF2_HUMAN	neuropeptide FF receptor 2	298					detection of abiotic stimulus (GO:0009582)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of adenylate cyclase activity (GO:0045761)|regulation of cAMP-dependent protein kinase activity (GO:2000479)|regulation of MAPK cascade (GO:0043408)	actin cytoskeleton (GO:0015629)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(24)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43			Lung(101;0.0935)|LUSC - Lung squamous cell carcinoma(112;0.138)			GACTCAACTCCCAGAATAAAA	0.443																																					p.S298S		.											.	NPFFR2-92	0			c.C894G						.						121.0	117.0	119.0					4																	73012854		2203	4300	6503	SO:0001819	synonymous_variant	10886	exon4			CAACTCCCAGAAT	AF236083	CCDS3551.1, CCDS3552.1, CCDS47072.1	4q21	2012-08-10	2006-02-15	2006-02-15	ENSG00000056291	ENSG00000056291		"""GPCR / Class A :  Neuropeptide receptors : FF/AF"", ""GPCR / Class A : RF amide peptide receptors"""	4525	protein-coding gene	gene with protein product	"""neuropeptide FF 2"""	607449	"""G protein-coupled receptor 74"""	GPR74		10079187, 10851242	Standard	NM_001144756		Approved	NPFF2, NPGPR	uc003hgg.2	Q9Y5X5	OTTHUMG00000129918	ENST00000308744.6:c.894C>G	4.37:g.73012854C>G		Somatic	82	0		WXS	Illumina HiSeq	Phase_I	58	15	NM_004885	0	0	0	0	0	Q96RV1|Q9NR49	Silent	SNP	ENST00000308744.6	37	CCDS3551.1																																																																																			.		0.443	NPFFR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252170.2	NM_004885	
FAM13A	10144	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	89658657	89658657	+	Missense_Mutation	SNP	T	T	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr4:89658657T>A	ENST00000264344.5	-	21	2819	c.2612A>T	c.(2611-2613)gAg>gTg	p.E871V	FAM13A_ENST00000513837.1_Missense_Mutation_p.E517V|FAM13A_ENST00000503556.1_Missense_Mutation_p.E531V|FAM13A_ENST00000395002.2_Intron|FAM13A_ENST00000511976.1_Missense_Mutation_p.E457V|FAM13A_ENST00000508369.1_Missense_Mutation_p.E545V	NM_014883.3	NP_055698.2	O94988	FA13A_HUMAN	family with sequence similarity 13, member A	871					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	55						AGTTTCGCCCTCGATAATTGG	0.542																																					p.E871V		.											.	FAM13A-70	0			c.A2612T						.						103.0	100.0	101.0					4																	89658657		2203	4300	6503	SO:0001583	missense	10144	exon21			TCGCCCTCGATAA	AB020721	CCDS34029.1, CCDS43251.1, CCDS58911.1, CCDS58912.1, CCDS58913.1	4q22.1	2011-09-07	2009-01-20	2009-01-20	ENSG00000138640	ENSG00000138640		"""Rho GTPase activating proteins"""	19367	protein-coding gene	gene with protein product		613299	"""family with sequence similarity 13, member A1"""	FAM13A1			Standard	NM_014883		Approved	KIAA0914, ARHGAP48	uc003hse.2	O94988	OTTHUMG00000161006	ENST00000264344.5:c.2612A>T	4.37:g.89658657T>A	ENSP00000264344:p.Glu871Val	Somatic	115	0		WXS	Illumina HiSeq	Phase_I	85	24	NM_014883	0	0	2	3	1	B4DLC1|Q24JP0|Q5PR21|Q8NBA3	Missense_Mutation	SNP	ENST00000264344.5	37	CCDS34029.1	.	.	.	.	.	.	.	.	.	.	T	25.5	4.640552	0.87859	.	.	ENSG00000138640	ENST00000264344;ENST00000503556;ENST00000511976;ENST00000508369;ENST00000513837	T;T;T;T;T	0.51817	1.33;0.69;0.77;0.7;0.71	4.84	4.84	0.62591	.	0.109676	0.64402	D	0.000010	T	0.66636	0.2809	M	0.71036	2.16	0.80722	D	1	D;D;D;D;D	0.89917	0.999;1.0;1.0;0.999;0.999	D;D;D;D;D	0.71870	0.974;0.975;0.963;0.974;0.974	T	0.71377	-0.4611	10	0.87932	D	0	.	14.5853	0.68320	0.0:0.0:0.0:1.0	.	517;457;871;531;545	O94988-6;E9PGM7;O94988;O94988-5;O94988-1	.;.;FA13A_HUMAN;.;.	V	871;531;457;545;517	ENSP00000264344:E871V;ENSP00000427189:E531V;ENSP00000421914:E457V;ENSP00000421562:E545V;ENSP00000423252:E517V	ENSP00000264344:E871V	E	-	2	0	FAM13A	89877680	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.507000	0.81676	2.023000	0.59567	0.477000	0.44152	GAG	.		0.542	FAM13A-022	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363371.1		
KIAA0922	23240	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	154542029	154542029	+	Nonsense_Mutation	SNP	C	C	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr4:154542029C>A	ENST00000409663.3	+	27	3738	c.3686C>A	c.(3685-3687)tCa>tAa	p.S1229*	KIAA0922_ENST00000409959.3_Nonsense_Mutation_p.S1230*|KIAA0922_ENST00000440693.1_Nonsense_Mutation_p.S1146*	NM_015196.3	NP_056011.3	A2VDJ0	T131L_HUMAN	KIAA0922	1229						integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(16)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	63	all_hematologic(180;0.093)	Renal(120;0.118)				GCTCCAGTCTCAAGGTGCGTA	0.303																																					p.S1230X		.											.	KIAA0922-92	0			c.C3689A						.						94.0	112.0	106.0					4																	154542029		2203	4300	6503	SO:0001587	stop_gained	23240	exon27			CAGTCTCAAGGTG	AK096538	CCDS3783.2, CCDS47148.1	4q31.3	2008-02-05			ENSG00000121210	ENSG00000121210			29146	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_015196		Approved	DKFZp586H1322, TMEM131L	uc010ipp.3	A2VDJ0	OTTHUMG00000153244	ENST00000409663.3:c.3686C>A	4.37:g.154542029C>A	ENSP00000386574:p.Ser1229*	Somatic	671	0		WXS	Illumina HiSeq	Phase_I	651	188	NM_001131007	0	0	0	0	0	B3KRV3|Q7LGA7|Q86Y92|Q8WU56|Q9H065|Q9Y2D7	Nonsense_Mutation	SNP	ENST00000409663.3	37	CCDS3783.2	.	.	.	.	.	.	.	.	.	.	C	40	7.923983	0.98563	.	.	ENSG00000121210	ENST00000409663;ENST00000440693;ENST00000409959;ENST00000240487	.	.	.	5.5	3.61	0.41365	.	1.125250	0.06486	N	0.733676	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	0.0653	9.2055	0.37287	0.0:0.8085:0.0:0.1915	.	.	.	.	X	1229;1146;1230;1007	.	ENSP00000240487:S1007X	S	+	2	0	KIAA0922	154761479	0.021000	0.18746	0.003000	0.11579	0.003000	0.03518	1.282000	0.33226	0.532000	0.28657	0.563000	0.77884	TCA	.		0.303	KIAA0922-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330370.1	NM_015196	
PALLD	23022	broad.mit.edu	37	4	169432701	169432701	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr4:169432701G>T	ENST00000505667.1	+	2	219	c.46G>T	c.(46-48)Gac>Tac	p.D16Y	PALLD_ENST00000261509.6_Missense_Mutation_p.D16Y|PALLD_ENST00000333488.4_5'Flank|PALLD_ENST00000335742.7_5'UTR			Q8WX93	PALLD_HUMAN	palladin, cytoskeletal associated protein	16					cytoskeleton organization (GO:0007010)	actin filament (GO:0005884)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	muscle alpha-actinin binding (GO:0051371)			breast(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(18)|ovary(3)|prostate(3)|skin(4)	48		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)		CTCCCTCTCAGACATGCAGGA	0.512									Pancreatic Cancer, Familial Clustering of																												p.D16Y	Esophageal Squamous(109;1482 1532 18347 40239 51172)												.	PALLD-94	0			c.G46T						.						67.0	67.0	67.0					4																	169432701		2203	4300	6503	SO:0001583	missense	23022	exon2	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1	CTCTCAGACATGC	AB023209	CCDS34098.1, CCDS54818.1, CCDS54819.1, CCDS54820.1	4q32.3	2013-01-11			ENSG00000129116	ENSG00000129116		"""Immunoglobulin superfamily / I-set domain containing"""	17068	protein-coding gene	gene with protein product		608092				10231032, 10931874	Standard	NM_001166108		Approved	KIAA0992, SIH002, CGI-151	uc011cjx.2	Q8WX93	OTTHUMG00000161097	ENST00000505667.1:c.46G>T	4.37:g.169432701G>T	ENSP00000425556:p.Asp16Tyr	Somatic	110	0		WXS	Illumina HiSeq	Phase_I	88	3	NM_001166108	0	0	0	0	0	B3KTG2|B5MD56|B7ZMM5|Q7L3E0|Q7Z3W0|Q86WE8|Q8N1M2|Q9UGA0|Q9UQF5|Q9Y2J6|Q9Y3E9	Missense_Mutation	SNP	ENST00000505667.1	37	CCDS54818.1	.	.	.	.	.	.	.	.	.	.	G	12.61	1.988442	0.35036	.	.	ENSG00000129116	ENST00000261509;ENST00000505667;ENST00000511948	T;T	0.68479	-0.33;-0.07	5.56	5.56	0.83823	.	.	.	.	.	T	0.68265	0.2982	L	0.60455	1.87	0.80722	D	1	P;P	0.43169	0.8;0.8	B;B	0.41723	0.365;0.365	T	0.72821	-0.4177	9	0.72032	D	0.01	.	19.5035	0.95105	0.0:0.0:1.0:0.0	.	16;16	B7ZMM5;B2RTX2	.;.	Y	16	ENSP00000261509:D16Y;ENSP00000425556:D16Y	ENSP00000261509:D16Y	D	+	1	0	PALLD	169669276	1.000000	0.71417	0.244000	0.24202	0.032000	0.12392	6.761000	0.74945	2.616000	0.88540	0.655000	0.94253	GAC	.		0.512	PALLD-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000363762.1	NM_016081	
C6	729	broad.mit.edu	37	5	41176588	41176588	+	Missense_Mutation	SNP	A	A	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr5:41176588A>T	ENST00000263413.3	-	8	1421	c.1157T>A	c.(1156-1158)cTa>cAa	p.L386Q	C6_ENST00000337836.5_Missense_Mutation_p.L386Q|C6_ENST00000475349.1_5'UTR	NM_001115131.1	NP_001108603.2	P13671	CO6_HUMAN	complement component 6	386	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)				central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(7)|large_intestine(16)|liver(1)|lung(51)|ovary(3)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)	96		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				TGAGTTCTTTAGTTCCTCACT	0.393																																					p.L386Q													.	C6-95	0			c.T1157A						.						72.0	68.0	69.0					5																	41176588		2203	4300	6503	SO:0001583	missense	729	exon8			TTCTTTAGTTCCT	J05024	CCDS3936.1	5p13.1	2014-09-17			ENSG00000039537	ENSG00000039537		"""Complement system"""	1339	protein-coding gene	gene with protein product		217050					Standard	NM_001115131		Approved		uc003jmk.3	P13671	OTTHUMG00000094781	ENST00000263413.3:c.1157T>A	5.37:g.41176588A>T	ENSP00000263413:p.Leu386Gln	Somatic	147	1		WXS	Illumina HiSeq	Phase_I	181	4	NM_001115131	0	0	0	0	0		Missense_Mutation	SNP	ENST00000263413.3	37	CCDS3936.1	.	.	.	.	.	.	.	.	.	.	A	19.12	3.766774	0.69878	.	.	ENSG00000039537	ENST00000337836;ENST00000263413	D;D	0.85013	-1.93;-1.93	5.36	5.36	0.76844	Membrane attack complex component/perforin (MACPF) domain (3);	0.000000	0.64402	D	0.000001	D	0.93350	0.7880	M	0.89414	3.03	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.94523	0.7729	10	0.87932	D	0	-7.1975	15.5075	0.75753	1.0:0.0:0.0:0.0	.	386	P13671	CO6_HUMAN	Q	386	ENSP00000338861:L386Q;ENSP00000263413:L386Q	ENSP00000263413:L386Q	L	-	2	0	C6	41212345	1.000000	0.71417	0.407000	0.26434	0.621000	0.37620	8.172000	0.89677	2.250000	0.74265	0.482000	0.46254	CTA	.		0.393	C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211592.1		
C6	729	broad.mit.edu	37	5	41176594	41176594	+	Missense_Mutation	SNP	T	T	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr5:41176594T>G	ENST00000263413.3	-	8	1415	c.1151A>C	c.(1150-1152)gAg>gCg	p.E384A	C6_ENST00000337836.5_Missense_Mutation_p.E384A|C6_ENST00000475349.1_5'UTR	NM_001115131.1	NP_001108603.2	P13671	CO6_HUMAN	complement component 6	384	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)				central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(7)|large_intestine(16)|liver(1)|lung(51)|ovary(3)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)	96		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				CTTTAGTTCCTCACTGCTAAA	0.393																																					p.E384A													.	C6-95	0			c.A1151C						.						74.0	70.0	72.0					5																	41176594		2203	4300	6503	SO:0001583	missense	729	exon8			AGTTCCTCACTGC	J05024	CCDS3936.1	5p13.1	2014-09-17			ENSG00000039537	ENSG00000039537		"""Complement system"""	1339	protein-coding gene	gene with protein product		217050					Standard	NM_001115131		Approved		uc003jmk.3	P13671	OTTHUMG00000094781	ENST00000263413.3:c.1151A>C	5.37:g.41176594T>G	ENSP00000263413:p.Glu384Ala	Somatic	148	0		WXS	Illumina HiSeq	Phase_I	190	5	NM_001115131	0	0	3	3	0		Missense_Mutation	SNP	ENST00000263413.3	37	CCDS3936.1	.	.	.	.	.	.	.	.	.	.	T	18.01	3.527926	0.64860	.	.	ENSG00000039537	ENST00000337836;ENST00000263413	D;D	0.85629	-2.01;-2.01	5.36	5.36	0.76844	Membrane attack complex component/perforin (MACPF) domain (3);	0.103112	0.64402	D	0.000004	D	0.89853	0.6835	M	0.70275	2.135	0.58432	D	0.999998	D	0.59357	0.985	P	0.57679	0.825	D	0.89950	0.4079	10	0.46703	T	0.11	-18.8041	15.5075	0.75753	0.0:0.0:0.0:1.0	.	384	P13671	CO6_HUMAN	A	384	ENSP00000338861:E384A;ENSP00000263413:E384A	ENSP00000263413:E384A	E	-	2	0	C6	41212351	1.000000	0.71417	0.113000	0.21522	0.627000	0.37826	7.224000	0.78042	2.250000	0.74265	0.482000	0.46254	GAG	.		0.393	C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211592.1		
F2R	2149	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	76029290	76029290	+	Missense_Mutation	SNP	A	A	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr5:76029290A>G	ENST00000319211.4	+	2	1505	c.1240A>G	c.(1240-1242)Aac>Gac	p.N414D		NM_001992.3	NP_001983.2	P25116	PAR1_HUMAN	coagulation factor II (thrombin) receptor	414					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPKK activity (GO:0000186)|anatomical structure morphogenesis (GO:0009653)|blood coagulation (GO:0007596)|connective tissue replacement involved in inflammatory response wound healing (GO:0002248)|establishment of synaptic specificity at neuromuscular junction (GO:0007529)|G-protein coupled receptor signaling pathway (GO:0007186)|homeostasis of number of cells within a tissue (GO:0048873)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of renin secretion into blood stream (GO:1900134)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|platelet activation (GO:0030168)|platelet dense granule organization (GO:0060155)|positive regulation of blood coagulation (GO:0030194)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasoconstriction (GO:0045907)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of blood coagulation (GO:0030193)|regulation of interleukin-1 beta production (GO:0032651)|regulation of sensory perception of pain (GO:0051930)|release of sequestered calcium ion into cytosol (GO:0051209)|response to lipopolysaccharide (GO:0032496)|response to wounding (GO:0009611)|STAT protein import into nucleus (GO:0007262)|tyrosine phosphorylation of STAT protein (GO:0007260)	caveola (GO:0005901)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|platelet dense tubular network (GO:0031094)|postsynaptic membrane (GO:0045211)	G-protein alpha-subunit binding (GO:0001965)|G-protein beta-subunit binding (GO:0031681)|G-protein coupled receptor activity (GO:0004930)|receptor binding (GO:0005102)|thrombin receptor activity (GO:0015057)			NS(1)|breast(1)|endometrium(3)|kidney(1)|lung(7)|ovary(3)	16		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Prostate(461;0.00955)|Ovarian(174;0.0129)		all cancers(79;4.43e-43)	Streptokinase(DB00086)	CTGCTCTAGTAACCTGAATAA	0.388																																					p.N414D		.											.	F2R-93	0			c.A1240G						.						69.0	74.0	72.0					5																	76029290		2200	4300	6500	SO:0001583	missense	2149	exon2			TCTAGTAACCTGA	M62424	CCDS4032.1	5q13	2012-08-08			ENSG00000181104	ENSG00000181104		"""GPCR / Class A : Protease activated receptors"""	3537	protein-coding gene	gene with protein product		187930				8395910	Standard	NM_001992		Approved	TR, CF2R, PAR1, PAR-1	uc003ken.4	P25116	OTTHUMG00000131299	ENST00000319211.4:c.1240A>G	5.37:g.76029290A>G	ENSP00000321326:p.Asn414Asp	Somatic	143	0		WXS	Illumina HiSeq	Phase_I	121	21	NM_001992	0	0	0	0	0	Q53XV0|Q96RF7|Q9BUN4	Missense_Mutation	SNP	ENST00000319211.4	37	CCDS4032.1	.	.	.	.	.	.	.	.	.	.	A	14.69	2.610635	0.46527	.	.	ENSG00000181104	ENST00000319211	T	0.75938	-0.98	4.79	1.18	0.20946	.	0.606938	0.17367	N	0.176834	T	0.67477	0.2897	L	0.59436	1.845	0.29406	N	0.861551	P	0.35433	0.501	B	0.32864	0.154	T	0.59968	-0.7354	10	0.34782	T	0.22	-19.7943	13.2149	0.59854	0.7302:0.2698:0.0:0.0	.	414	P25116	PAR1_HUMAN	D	414	ENSP00000321326:N414D	ENSP00000321326:N414D	N	+	1	0	F2R	76065046	0.204000	0.23447	0.988000	0.46212	0.977000	0.68977	0.936000	0.28938	0.110000	0.17919	0.379000	0.24179	AAC	.		0.388	F2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254068.2		
MSH3	4437	hgsc.bcm.edu	37	5	79950715	79950715	+	Missense_Mutation	SNP	G	G	C	rs144776112|rs201874762		TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr5:79950715G>C	ENST00000265081.6	+	1	249	c.169G>C	c.(169-171)Gcc>Ccc	p.A57P	DHFR_ENST00000511032.1_5'Flank|DHFR_ENST00000513048.1_5'Flank|DHFR_ENST00000505337.1_5'Flank|DHFR_ENST00000439211.2_5'UTR|DHFR_ENST00000504396.1_5'Flank	NM_002439.4	NP_002430.3	P20585	MSH3_HUMAN	mutS homolog 3	57	Poly-Ala.		Missing. {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:8942985}.		ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|maintenance of DNA repeat elements (GO:0043570)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|heteroduplex DNA loop binding (GO:0000404)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		ggctgcagcggccgcagcggc	0.692								Mismatch excision repair (MMR)																													p.A57P	Melanoma(88;1010 1399 13793 26548 36275)	.											.	MSH3-661	0			c.G169C						.						7.0	7.0	7.0					5																	79950715		2089	4077	6166	SO:0001583	missense	4437	exon1			GCAGCGGCCGCAG	U61981	CCDS34195.1	5q11-q12	2013-09-12	2013-09-12		ENSG00000113318	ENSG00000113318			7326	protein-coding gene	gene with protein product	"""Divergent upstream protein"", ""Mismatch repair protein 1"""	600887	"""mutS (E. coli) homolog 3"", ""mutS homolog 3 (E. coli)"""				Standard	NM_002439		Approved	DUP, MRP1	uc003kgz.4	P20585	OTTHUMG00000162540	ENST00000265081.6:c.169G>C	5.37:g.79950715G>C	ENSP00000265081:p.Ala57Pro	Somatic	5	0		WXS	Illumina HiSeq	Phase_I	40	18	NM_002439	0	0	0	0	0	A1L480|A1L482|A6NMM6|Q6PJT5|Q86UQ6|Q92867	Missense_Mutation	SNP	ENST00000265081.6	37	CCDS34195.1	362	0.16575091575091574	115	0.23373983739837398	67	0.1850828729281768	32	0.055944055944055944	148	0.19525065963060687	-	0.222	-1.028222	0.02045	.	.	ENSG00000113318	ENST00000265081	D	0.87256	-2.23	.	.	.	.	.	.	.	.	T	0.00039	0.0001	N	0.03608	-0.345	0.80722	P	0.0	.	.	.	.	.	.	T	0.02983	-1.1086	3	.	.	.	.	.	.	.	.	57	P20585	MSH3_HUMAN	P	57	ENSP00000265081:A57P	.	A	+	1	0	MSH3	79986471	0.041000	0.20044	0.049000	0.19019	0.152000	0.21847	0.000000	0.12993	0.000000	0.14550	0.000000	0.15137	GCC	G|0.834;C|0.166		0.692	MSH3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369471.1	NM_002439	
MSH3	4437	hgsc.bcm.edu	37	5	79950718	79950718	+	Missense_Mutation	SNP	G	G	C	rs148550291		TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr5:79950718G>C	ENST00000265081.6	+	1	252	c.172G>C	c.(172-174)Gca>Cca	p.A58P	DHFR_ENST00000511032.1_5'Flank|DHFR_ENST00000513048.1_5'Flank|DHFR_ENST00000505337.1_5'Flank|DHFR_ENST00000439211.2_5'UTR|DHFR_ENST00000504396.1_5'Flank	NM_002439.4	NP_002430.3	P20585	MSH3_HUMAN	mutS homolog 3	58	Poly-Ala.		Missing. {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:8942985}.		ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|maintenance of DNA repeat elements (GO:0043570)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|heteroduplex DNA loop binding (GO:0000404)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		tgcagcggccgcagcggccgc	0.706								Mismatch excision repair (MMR)																													p.A58P	Melanoma(88;1010 1399 13793 26548 36275)	.											.	MSH3-661	0			c.G172C						.						6.0	7.0	6.0					5																	79950718		2077	4042	6119	SO:0001583	missense	4437	exon1			GCGGCCGCAGCGG	U61981	CCDS34195.1	5q11-q12	2013-09-12	2013-09-12		ENSG00000113318	ENSG00000113318			7326	protein-coding gene	gene with protein product	"""Divergent upstream protein"", ""Mismatch repair protein 1"""	600887	"""mutS (E. coli) homolog 3"", ""mutS homolog 3 (E. coli)"""				Standard	NM_002439		Approved	DUP, MRP1	uc003kgz.4	P20585	OTTHUMG00000162540	ENST00000265081.6:c.172G>C	5.37:g.79950718G>C	ENSP00000265081:p.Ala58Pro	Somatic	5	0		WXS	Illumina HiSeq	Phase_I	38	8	NM_002439	0	0	0	0	0	A1L480|A1L482|A6NMM6|Q6PJT5|Q86UQ6|Q92867	Missense_Mutation	SNP	ENST00000265081.6	37	CCDS34195.1	355	0.16254578754578755	114	0.23170731707317074	67	0.1850828729281768	27	0.0472027972027972	147	0.19393139841688653	-	7.967	0.748328	0.15710	.	.	ENSG00000113318	ENST00000265081	D	0.87256	-2.23	.	.	.	.	.	.	.	.	T	0.00073	0.0002	N	0.19112	0.55	0.09310	N	1	B	0.22983	0.078	B	0.11329	0.006	T	0.00891	-1.1525	6	.	.	.	.	.	.	.	.	58	P20585	MSH3_HUMAN	P	58	ENSP00000265081:A58P	.	A	+	1	0	MSH3	79986474	0.036000	0.19791	0.017000	0.16124	0.213000	0.24496	0.000000	0.12993	-0.982000	0.03515	0.000000	0.15137	GCA	G|0.837;C|0.162		0.706	MSH3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369471.1	NM_002439	
TMEM173	340061	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	138855862	138855862	+	Missense_Mutation	SNP	C	C	T	rs117897081	byFrequency	TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr5:138855862C>T	ENST00000330794.4	-	8	1457	c.1124G>A	c.(1123-1125)cGc>cAc	p.R375H	TMEM173_ENST00000511850.1_5'Flank	NM_198282.2	NP_938023.1	Q86WV6	STING_HUMAN	transmembrane protein 173	375	C-terminal tail (CTT).				activation of innate immune response (GO:0002218)|apoptotic process (GO:0006915)|cellular response to exogenous dsRNA (GO:0071360)|cellular response to interferon-beta (GO:0035458)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|interferon-beta production (GO:0032608)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of protein binding (GO:0032092)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytoplasmic vesicle membrane (GO:0030659)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	cyclic-di-GMP binding (GO:0035438)|cyclic-GMP-AMP binding (GO:0061507)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|transcription factor binding (GO:0008134)			endometrium(1)|kidney(1)|lung(6)|upper_aerodigestive_tract(1)	9			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			GAAATCCGTGCGGAGAGGGAG	0.597																																					p.R375H		.											.	TMEM173-69	0			c.G1124A						.						44.0	44.0	44.0					5																	138855862		2203	4300	6503	SO:0001583	missense	340061	exon8			TCCGTGCGGAGAG		CCDS4215.1	5q31.2	2009-11-06			ENSG00000184584	ENSG00000184584			27962	protein-coding gene	gene with protein product		612374				12477932	Standard	XM_005268445		Approved	FLJ38577, NET23	uc003lep.3	Q86WV6	OTTHUMG00000129239	ENST00000330794.4:c.1124G>A	5.37:g.138855862C>T	ENSP00000331288:p.Arg375His	Somatic	105	0		WXS	Illumina HiSeq	Phase_I	90	38	NM_198282	0	0	59	75	16	A8K3P6|B6EB35|D6RBX0|D6RE01|D6RID9	Missense_Mutation	SNP	ENST00000330794.4	37	CCDS4215.1	.	.	.	.	.	.	.	.	.	.	C	13.97	2.395533	0.42512	.	.	ENSG00000184584	ENST00000330794	T	0.30448	1.53	5.36	3.48	0.39840	.	0.070055	0.53938	N	0.000050	T	0.36744	0.0978	M	0.70595	2.14	0.35562	D	0.804743	D	0.60160	0.987	P	0.50537	0.643	T	0.49532	-0.8930	10	0.42905	T	0.14	-17.9707	5.749	0.18136	0.1568:0.6785:0.0:0.1647	.	375	Q86WV6	TM173_HUMAN	H	375	ENSP00000331288:R375H	ENSP00000331288:R375H	R	-	2	0	TMEM173	138836046	0.671000	0.27521	0.933000	0.37362	0.148000	0.21650	0.972000	0.29409	1.268000	0.44264	-0.369000	0.07265	CGC	C|0.995;A|0.005		0.597	TMEM173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251338.1	NM_198282	
UNC5A	90249	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	176305475	176305475	+	Splice_Site	SNP	G	G	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr5:176305475G>A	ENST00000329542.4	+	13	2293		c.e13-1		UNC5A_ENST00000261961.3_Splice_Site	NM_133369.2	NP_588610.2	Q6ZN44	UNC5A_HUMAN	unc-5 homolog A (C. elegans)						anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.?(1)		endometrium(4)|kidney(3)|large_intestine(2)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	34	all_cancers(89;0.000119)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ATCCCCATCAGGAGATCCCCT	0.612																																					.		.											.	UNC5A-91	1	Unknown(1)	kidney(1)	c.2020-1G>A						.						89.0	83.0	85.0					5																	176305475		2203	4300	6503	SO:0001630	splice_region_variant	90249	exon13			CCATCAGGAGATC	AB075856	CCDS34299.1	5q35.3	2013-01-11	2001-11-28		ENSG00000113763	ENSG00000113763		"""Immunoglobulin superfamily / I-set domain containing"""	12567	protein-coding gene	gene with protein product		607869	"""unc5 (C.elegans homolog) a"""				Standard	XM_006714927		Approved	KIAA1976, UNC5H1	uc003mey.3	Q6ZN44	OTTHUMG00000163225	ENST00000329542.4:c.2020-1G>A	5.37:g.176305475G>A		Somatic	115	0		WXS	Illumina HiSeq	Phase_I	110	24	NM_133369	0	0	0	0	0	B2RXE6|Q8TF26|Q96GP4	Splice_Site	SNP	ENST00000329542.4	37	CCDS34299.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.275028	0.80580	.	.	ENSG00000113763	ENST00000329542;ENST00000261961	.	.	.	5.6	5.6	0.85130	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.176	0.89761	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	UNC5A	176238081	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	9.860000	0.99555	2.641000	0.89580	0.491000	0.48974	.	.		0.612	UNC5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372166.1	XM_030300	Intron
UIMC1	51720	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	176395662	176395662	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr5:176395662C>T	ENST00000377227.4	-	6	1226	c.1094G>A	c.(1093-1095)aGg>aAg	p.R365K	UIMC1_ENST00000377219.2_Missense_Mutation_p.R365K|UIMC1_ENST00000511320.1_Missense_Mutation_p.R365K|UIMC1_ENST00000506128.1_Intron|UIMC1_ENST00000503273.1_5'UTR			Q96RL1	UIMC1_HUMAN	ubiquitin interaction motif containing 1	365	AIR.				double-strand break repair (GO:0006302)|G2 DNA damage checkpoint (GO:0031572)|histone H2A K63-linked deubiquitination (GO:0070537)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of DNA repair (GO:0045739)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)	BRCA1-A complex (GO:0070531)|nucleus (GO:0005634)	histone binding (GO:0042393)|K63-linked polyubiquitin binding (GO:0070530)			NS(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(5)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	21	all_cancers(89;7.96e-05)|Renal(175;0.000269)|Lung NSC(126;0.00476)|all_lung(126;0.00806)	Medulloblastoma(196;0.0145)|all_neural(177;0.0325)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GTCAGATGCCCTAGACTCCTG	0.433																																					p.R365K													.	UIMC1-208	0			c.G1094A						.						169.0	160.0	163.0					5																	176395662		2203	4300	6503	SO:0001583	missense	51720	exon6			GATGCCCTAGACT	AF349313	CCDS4408.1	5q35.2	2008-02-05			ENSG00000087206	ENSG00000087206			30298	protein-coding gene	gene with protein product	"""receptor associated protein 80"""	609433				12080054	Standard	NM_001199297		Approved	RAP80	uc021yin.1	Q96RL1	OTTHUMG00000130852	ENST00000377227.4:c.1094G>A	5.37:g.176395662C>T	ENSP00000366434:p.Arg365Lys	Somatic	90	1		WXS	Illumina HiSeq	Phase_I	121	28	NM_016290	0	0	0	4	4	A8MSA1|B3KMZ1|B4E3N2|Q5XKQ1|Q7Z3W7|Q8N5B9|Q9BZR1|Q9BZR5|Q9UHX7	Missense_Mutation	SNP	ENST00000377227.4	37	CCDS4408.1	.	.	.	.	.	.	.	.	.	.	C	11.99	1.803874	0.31869	.	.	ENSG00000087206	ENST00000377227;ENST00000377219;ENST00000511320;ENST00000377220	T;T;T	0.26373	1.74;1.74;1.74	5.74	4.84	0.62591	.	0.370207	0.27600	N	0.018642	T	0.18215	0.0437	L	0.44542	1.39	0.30376	N	0.782434	P;P	0.41848	0.763;0.718	B;B	0.39027	0.288;0.215	T	0.06127	-1.0844	10	0.20519	T	0.43	.	5.9781	0.19391	0.1849:0.7:0.0:0.1152	.	365;287	Q96RL1;Q96RL1-3	UIMC1_HUMAN;.	K	365;365;365;287	ENSP00000366434:R365K;ENSP00000366425:R365K;ENSP00000421926:R365K	ENSP00000366425:R365K	R	-	2	0	UIMC1	176328268	0.999000	0.42202	1.000000	0.80357	0.998000	0.95712	1.690000	0.37711	2.716000	0.92895	0.555000	0.69702	AGG	.		0.433	UIMC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253422.1	NM_016290	
SQSTM1	8878	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	179250983	179250983	+	Missense_Mutation	SNP	A	A	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr5:179250983A>T	ENST00000389805.4	+	3	605	c.427A>T	c.(427-429)Agc>Tgc	p.S143C	SQSTM1_ENST00000360718.5_Missense_Mutation_p.S59C|SQSTM1_ENST00000402874.3_Missense_Mutation_p.S59C|SQSTM1_ENST00000510187.1_Missense_Mutation_p.S143C|SQSTM1_ENST00000376929.3_Missense_Mutation_p.S59C	NM_003900.4	NP_003891.1	Q13501	SQSTM_HUMAN	sequestosome 1	143	Interaction with GABRR3. {ECO:0000250}.				apoptotic signaling pathway (GO:0097190)|autophagy (GO:0006914)|cell differentiation (GO:0030154)|endosomal transport (GO:0016197)|immune system process (GO:0002376)|intracellular signal transduction (GO:0035556)|macroautophagy (GO:0016236)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of macroautophagy (GO:0016239)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein heterooligomerization (GO:0051291)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of Ras protein signal transduction (GO:0046578)|response to stress (GO:0006950)|ubiquitin-dependent protein catabolic process (GO:0006511)	aggresome (GO:0016235)|autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)|lysosome (GO:0005764)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|pre-autophagosomal structure (GO:0000407)	identical protein binding (GO:0042802)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|receptor tyrosine kinase binding (GO:0030971)|SH2 domain binding (GO:0042169)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)		SQSTM1/ALK(2)	NS(1)|breast(1)|endometrium(1)|large_intestine(2)|liver(2)|lung(5)|ovary(1)	13	all_cancers(89;0.000205)|all_epithelial(37;7.15e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0395)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CTACAAGTGCAGCGTCTGCCC	0.642																																					p.S143C													.	SQSTM1-92	0			c.A427T						.						81.0	75.0	77.0					5																	179250983		2203	4300	6503	SO:0001583	missense	8878	exon3			AAGTGCAGCGTCT	U46751	CCDS34317.1, CCDS47355.1	5q35	2008-02-05	2004-04-15		ENSG00000161011	ENSG00000161011			11280	protein-coding gene	gene with protein product		601530	"""Paget disease of bone 3"", ""oxidative stress induced like"""	PDB3, OSIL		8650207, 8551575	Standard	NM_003900		Approved	p62, p60, p62B, A170	uc003mkw.4	Q13501	OTTHUMG00000150643	ENST00000389805.4:c.427A>T	5.37:g.179250983A>T	ENSP00000374455:p.Ser143Cys	Somatic	115	1		WXS	Illumina HiSeq	Phase_I	97	44	NM_003900	0	0	214	428	214	A6NFN7|B2R661|B3KUW5|Q13446|Q9BUV7|Q9BVS6|Q9UEU1	Missense_Mutation	SNP	ENST00000389805.4	37	CCDS34317.1	.	.	.	.	.	.	.	.	.	.	A	16.32	3.090186	0.55968	.	.	ENSG00000161011	ENST00000376929;ENST00000514093;ENST00000422245;ENST00000389805;ENST00000504627;ENST00000402874;ENST00000510187;ENST00000360718	D;D;D;D;D;D;D;D	0.91464	-2.85;-2.85;-2.85;-2.85;-2.85;-2.85;-2.85;-2.85	5.59	5.59	0.84812	Zinc finger, ZZ-type (4);	0.262605	0.44285	D	0.000467	D	0.93174	0.7826	L	0.58583	1.82	0.34038	D	0.654646	P;D	0.76494	0.498;0.999	B;D	0.66716	0.216;0.946	D	0.95449	0.8532	10	0.51188	T	0.08	-16.2832	11.7311	0.51737	0.8528:0.1472:0.0:0.0	.	143;143	Q13501;E7EMC7	SQSTM_HUMAN;.	C	59;59;59;143;166;59;143;59	ENSP00000366128:S59C;ENSP00000427308:S59C;ENSP00000394534:S59C;ENSP00000374455:S143C;ENSP00000425957:S166C;ENSP00000385553:S59C;ENSP00000424477:S143C;ENSP00000353944:S59C	ENSP00000353944:S59C	S	+	1	0	SQSTM1	179183589	1.000000	0.71417	0.997000	0.53966	0.390000	0.30446	3.781000	0.55394	2.120000	0.65058	0.459000	0.35465	AGC	.		0.642	SQSTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319344.1		
DHX16	8449	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	30622528	30622528	+	Silent	SNP	C	C	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr6:30622528C>A	ENST00000376442.3	-	19	3147	c.2952G>T	c.(2950-2952)ctG>ctT	p.L984L	DHX16_ENST00000376437.5_Silent_p.L503L	NM_001164239.1|NM_003587.4	NP_001157711.1|NP_003578.2	O60231	DHX16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 16	984					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			kidney(2)|ovary(2)	4						CGTGGTAGAGCAGCCAGCGTG	0.542																																					p.L984L													.	DHX16-228	0			c.G2952T						.						142.0	115.0	125.0					6																	30622528		1511	2709	4220	SO:0001819	synonymous_variant	8449	exon19			GTAGAGCAGCCAG	AB001601	CCDS4685.1	6p21.3	2010-02-17	2003-06-13	2003-06-20	ENSG00000204560	ENSG00000204560		"""DEAH-boxes"""	2739	protein-coding gene	gene with protein product		603405	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 16"""	DDX16		9547260	Standard	NM_003587		Approved	DBP2, Prp2, PRPF2	uc003nqz.3	O60231	OTTHUMG00000031060	ENST00000376442.3:c.2952G>T	6.37:g.30622528C>A		Somatic	117	2		WXS	Illumina HiSeq	Phase_I	75	22	NM_003587	0	0	46	67	21	O60322|Q5JP45|Q969X7|Q96QC1	Silent	SNP	ENST00000376442.3	37	CCDS4685.1																																																																																			.		0.542	DHX16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076076.2	NM_003587	
TNFRSF21	27242	broad.mit.edu	37	6	47251781	47251781	+	Missense_Mutation	SNP	T	T	C			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr6:47251781T>C	ENST00000296861.2	-	3	1529	c.1136A>G	c.(1135-1137)aAg>aGg	p.K379R		NM_014452.3	NP_055267.1	O75509	TNR21_HUMAN	tumor necrosis factor receptor superfamily, member 21	379					adaptive immune response (GO:0002250)|apoptotic process (GO:0006915)|B cell apoptotic process (GO:0001783)|cellular lipid metabolic process (GO:0044255)|cellular response to tumor necrosis factor (GO:0071356)|humoral immune response (GO:0006959)|myelination (GO:0042552)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-13 secretion (GO:2000666)|negative regulation of interleukin-5 secretion (GO:2000663)|negative regulation of myelination (GO:0031642)|negative regulation of T cell proliferation (GO:0042130)|neuron apoptotic process (GO:0051402)|oligodendrocyte apoptotic process (GO:0097252)|regulation of oligodendrocyte differentiation (GO:0048713)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(7)|pancreas(1)|skin(2)	21			Lung(136;0.189)			CCGGGGCCCCTTTTTCAGAGT	0.512																																					p.K379R													.	TNFRSF21-227	0			c.A1136G						.						98.0	104.0	102.0					6																	47251781		2203	4300	6503	SO:0001583	missense	27242	exon3			GGCCCCTTTTTCA	AF068868	CCDS4921.1	6p21.1	2011-08-11			ENSG00000146072	ENSG00000146072		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	13469	protein-coding gene	gene with protein product	"""death receptor 6"""	605732				9714541	Standard	NM_014452		Approved	DR6, CD358	uc003oyv.3	O75509	OTTHUMG00000014796	ENST00000296861.2:c.1136A>G	6.37:g.47251781T>C	ENSP00000296861:p.Lys379Arg	Somatic	127	0		WXS	Illumina HiSeq	Phase_I	106	3	NM_014452	0	0	32	32	0	B2RDI9|Q0D2P5|Q96D86	Missense_Mutation	SNP	ENST00000296861.2	37	CCDS4921.1	.	.	.	.	.	.	.	.	.	.	T	28.9	4.960173	0.92791	.	.	ENSG00000146072	ENST00000296861;ENST00000419206	T	0.70631	-0.5	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.79753	0.4500	M	0.63843	1.955	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.82068	-0.0640	10	0.87932	D	0	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	379	O75509	TNR21_HUMAN	R	379;68	ENSP00000296861:K379R	ENSP00000296861:K379R	K	-	2	0	TNFRSF21	47359740	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.708000	0.68377	2.371000	0.80710	0.533000	0.62120	AAG	.		0.512	TNFRSF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040814.1	NM_014452	
COL19A1	1310	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	70646796	70646796	+	Silent	SNP	A	A	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr6:70646796A>G	ENST00000322773.4	+	8	969	c.867A>G	c.(865-867)ccA>ccG	p.P289P		NM_001858.4	NP_001849.2	Q14993	COJA1_HUMAN	collagen, type XIX, alpha 1	289					cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)|skeletal muscle tissue development (GO:0007519)|skeletal system development (GO:0001501)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(8)|lung(54)|ovary(3)|prostate(2)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	109						AGTGCATTCCAAACAAGGTAT	0.448																																					p.P289P		.											.	COL19A1-156	0			c.A867G						.						145.0	136.0	139.0					6																	70646796		2203	4300	6503	SO:0001819	synonymous_variant	1310	exon8			CATTCCAAACAAG		CCDS4970.1	6q12-q13	2013-01-16			ENSG00000082293	ENSG00000082293		"""Collagens"""	2196	protein-coding gene	gene with protein product		120165				7916703, 9143499	Standard	NM_001858		Approved		uc003pfc.1	Q14993	OTTHUMG00000014987	ENST00000322773.4:c.867A>G	6.37:g.70646796A>G		Somatic	122	0		WXS	Illumina HiSeq	Phase_I	102	28	NM_001858	0	0	0	0	0	Q00559|Q05850|Q12885|Q13676|Q14DH1|Q5JUF0|Q5T424|Q9H572|Q9NPZ2|Q9NQP2	Silent	SNP	ENST00000322773.4	37	CCDS4970.1																																																																																			.		0.448	COL19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041127.1		
IMPG1	3617	broad.mit.edu	37	6	76640750	76640750	+	Silent	SNP	G	G	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr6:76640750G>A	ENST00000369950.3	-	15	2352	c.2163C>T	c.(2161-2163)agC>agT	p.S721S	Y_RNA_ENST00000363170.1_RNA|IMPG1_ENST00000369963.3_3'UTR	NM_001282368.1|NM_001563.2	NP_001269297.1|NP_001554.2			interphotoreceptor matrix proteoglycan 1											breast(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(8)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	63		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				GACCGTCCAGGCTCCCCTGGC	0.587																																					p.S721S	Pancreas(37;839 1141 2599 26037)												.	IMPG1-93	0			c.C2163T						.						123.0	103.0	109.0					6																	76640750		2203	4300	6503	SO:0001819	synonymous_variant	3617	exon15			GTCCAGGCTCCCC	AF017776	CCDS4985.1, CCDS75483.1	6q14.2-q15	2008-02-05	2004-05-25		ENSG00000112706	ENSG00000112706			6055	protein-coding gene	gene with protein product		602870	"""sialoprotein associated with cones and rods"""	SPACR			Standard	NM_001282368		Approved	IPM150, GP147	uc003pik.1	Q17R60	OTTHUMG00000015063	ENST00000369950.3:c.2163C>T	6.37:g.76640750G>A		Somatic	138	1		WXS	Illumina HiSeq	Phase_I	107	3	NM_001563	0	0	0	0	0		Silent	SNP	ENST00000369950.3	37	CCDS4985.1																																																																																			.		0.587	IMPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041288.1	NM_001563	
AC005013.5	0	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	28996484	28996484	+	lincRNA	SNP	G	G	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr7:28996484G>A	ENST00000436594.1	+	0	0				TRIL_ENST00000322982.3_RNA																							GCAGGGCCGGGGGGTGGCGAC	0.662																																					.													.	.	0			.						.						24.0	31.0	29.0					7																	28996484		2096	4207	6303			9865	.			GGCCGGGGGGTGG																													7.37:g.28996484G>A		Somatic	39	0		WXS	Illumina HiSeq	Phase_I	61	17	.	0	0	0	0	0		Silent	SNP	ENST00000436594.1	37																																																																																				.		0.662	AC005013.5-001	KNOWN	basic|exp_conf	lincRNA	lincRNA	OTTHUMT00000327953.3		
ABCA13	154664	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	48319048	48319048	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr7:48319048G>A	ENST00000435803.1	+	18	8281	c.8257G>A	c.(8257-8259)Gat>Aat	p.D2753N		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	2753					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						CTTAAAGAAAGATAATTGGAA	0.323																																					p.D2753N													.	ABCA13-521	0			c.G8257A						.						37.0	36.0	36.0					7																	48319048		1804	4066	5870	SO:0001583	missense	154664	exon18			AAGAAAGATAATT	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.8257G>A	7.37:g.48319048G>A	ENSP00000411096:p.Asp2753Asn	Somatic	426	1		WXS	Illumina HiSeq	Phase_I	547	112	NM_152701	0	0	0	0	0	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	37	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	G	16.68	3.189644	0.57909	.	.	ENSG00000179869	ENST00000435803	T	0.60548	0.18	5.31	3.5	0.40072	.	0.419222	0.20293	N	0.095183	T	0.49304	0.1549	L	0.29908	0.895	0.18873	N	0.999989	P	0.51057	0.941	P	0.48815	0.591	T	0.41070	-0.9529	10	0.87932	D	0	.	7.1966	0.25855	0.196:0.0:0.804:0.0	.	2753	Q86UQ4	ABCAD_HUMAN	N	2753	ENSP00000411096:D2753N	ENSP00000411096:D2753N	D	+	1	0	ABCA13	48289594	0.000000	0.05858	0.006000	0.13384	0.047000	0.14425	0.381000	0.20619	1.251000	0.43983	0.655000	0.94253	GAT	.		0.323	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
POM121L12	285877	broad.mit.edu	37	7	53103618	53103618	+	Missense_Mutation	SNP	A	A	C			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr7:53103618A>C	ENST00000408890.4	+	1	270	c.254A>C	c.(253-255)gAc>gCc	p.D85A		NM_182595.3	NP_872401.3	Q8N7R1	P1L12_HUMAN	POM121 transmembrane nucleoporin-like 12	85										endometrium(5)|kidney(1)|large_intestine(5)|lung(44)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	61						CCCACCCAGGACCCCGCCAAG	0.711																																					p.D85A													.	.	0			c.A254C						.						13.0	17.0	16.0					7																	53103618		1875	4077	5952	SO:0001583	missense	285877	exon1			CCCAGGACCCCGC		CCDS43584.1	7p12.1	2012-03-13	2012-03-13		ENSG00000221900	ENSG00000221900			25369	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 12"""				Standard	NM_182595		Approved	DKFZp564N2472	uc003tpz.3	Q8N7R1	OTTHUMG00000155995	ENST00000408890.4:c.254A>C	7.37:g.53103618A>C	ENSP00000386133:p.Asp85Ala	Somatic	45	6		WXS	Illumina HiSeq	Phase_I	97	19	NM_182595	0	0	0	0	0	Q8NDI9	Missense_Mutation	SNP	ENST00000408890.4	37	CCDS43584.1	.	.	.	.	.	.	.	.	.	.	A	13.21	2.169558	0.38315	.	.	ENSG00000221900	ENST00000408890	T	0.24908	1.83	2.6	-1.55	0.08558	.	.	.	.	.	T	0.13200	0.0320	L	0.31926	0.97	0.09310	N	1	P	0.48694	0.914	B	0.37601	0.254	T	0.15954	-1.0419	9	0.40728	T	0.16	.	2.8435	0.05536	0.4096:0.26:0.3304:0.0	.	85	Q8N7R1	P1L12_HUMAN	A	85	ENSP00000386133:D85A	ENSP00000386133:D85A	D	+	2	0	POM121L12	53071112	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.256000	0.08757	-0.177000	0.10690	0.379000	0.24179	GAC	.		0.711	POM121L12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342656.1	NM_182595	
LIMK1	3984	broad.mit.edu;bcgsc.ca	37	7	73535230	73535230	+	Silent	SNP	G	G	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr7:73535230G>A	ENST00000336180.2	+	15	1683	c.1632G>A	c.(1630-1632)ggG>ggA	p.G544G	LIMK1_ENST00000418310.1_Silent_p.G574G|LIMK1_ENST00000538333.3_Silent_p.G510G	NM_002314.3	NP_002305.1	P53667	LIMK1_HUMAN	LIM domain kinase 1	544	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|nervous system development (GO:0007399)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of axon extension (GO:0045773)|positive regulation of stress fiber assembly (GO:0051496)|protein phosphorylation (GO:0006468)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)	ATP binding (GO:0005524)|heat shock protein binding (GO:0031072)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	21		Lung NSC(55;0.137)			Dabrafenib(DB08912)	AGATCATCGGGCGGGTGAACG	0.647																																					p.G544G													.	LIMK1-523	0			c.G1632A						.						86.0	82.0	84.0					7																	73535230		2203	4300	6503	SO:0001819	synonymous_variant	3984	exon15			CATCGGGCGGGTG	D26309	CCDS5563.1, CCDS56491.1	7q11.23	2005-01-21			ENSG00000106683	ENSG00000106683			6613	protein-coding gene	gene with protein product		601329				8673124, 8812460	Standard	NM_002314		Approved	LIMK	uc003uaa.2	P53667	OTTHUMG00000023448	ENST00000336180.2:c.1632G>A	7.37:g.73535230G>A		Somatic	135	0		WXS	Illumina HiSeq	Phase_I	126	6	NM_002314	0	0	0	0	0	B7Z6I8|D3DXF4|D3DXF5|O15283|Q15820|Q15821|Q75MU3|Q9Y5Q1	Silent	SNP	ENST00000336180.2	37	CCDS5563.1																																																																																			.		0.647	LIMK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252335.2	NM_002314	
LMTK2	22853	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	97833339	97833339	+	Missense_Mutation	SNP	T	T	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr7:97833339T>G	ENST00000297293.5	+	13	4617	c.4324T>G	c.(4324-4326)Tct>Gct	p.S1442A		NM_014916.3	NP_055731.2	Q8IWU2	LMTK2_HUMAN	lemur tyrosine kinase 2	1442					early endosome to late endosome transport (GO:0045022)|endocytic recycling (GO:0032456)|negative regulation of catalytic activity (GO:0043086)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor recycling (GO:0001881)|transferrin transport (GO:0033572)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|myosin VI binding (GO:0070853)|protein phosphatase inhibitor activity (GO:0004864)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|pancreas(2)|skin(2)|stomach(3)	59	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)					CTCCAAGCCTTCTCTCCAAAC	0.527																																					p.S1442A													.	LMTK2-1381	0			c.T4324G						.						95.0	106.0	102.0					7																	97833339		2203	4300	6503	SO:0001583	missense	22853	exon13			AAGCCTTCTCTCC	AB029002	CCDS5654.1	7q22.1	2014-06-12			ENSG00000164715	ENSG00000164715			17880	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 100"""	610989				15005709	Standard	NM_014916		Approved	KIAA1079, KPI2, KPI-2, cprk, LMR2, BREK, AATYK2, PPP1R100	uc003upd.2	Q8IWU2	OTTHUMG00000154256	ENST00000297293.5:c.4324T>G	7.37:g.97833339T>G	ENSP00000297293:p.Ser1442Ala	Somatic	101	1		WXS	Illumina HiSeq	Phase_I	91	39	NM_014916	0	0	1	5	4	A4D272|Q75MG7|Q9UPS3	Missense_Mutation	SNP	ENST00000297293.5	37	CCDS5654.1	.	.	.	.	.	.	.	.	.	.	T	10.31	1.314063	0.23908	.	.	ENSG00000164715	ENST00000297293	T	0.78364	-1.17	5.84	-3.32	0.04973	.	0.326711	0.37623	N	0.002020	T	0.54143	0.1840	L	0.28274	0.84	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.32079	-0.9920	10	0.22706	T	0.39	.	3.7573	0.08591	0.1088:0.1347:0.448:0.3085	.	1442	Q8IWU2	LMTK2_HUMAN	A	1442	ENSP00000297293:S1442A	ENSP00000297293:S1442A	S	+	1	0	LMTK2	97671275	0.000000	0.05858	0.001000	0.08648	0.635000	0.38103	-0.076000	0.11412	-0.835000	0.04234	0.460000	0.39030	TCT	.		0.527	LMTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334560.1	NM_014916	
SRRT	51593	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	100485704	100485704	+	Missense_Mutation	SNP	C	C	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr7:100485704C>A	ENST00000347433.4	+	18	2526	c.2368C>A	c.(2368-2370)Cag>Aag	p.Q790K	SRRT_ENST00000457580.2_Missense_Mutation_p.Q786K|SRRT_ENST00000388793.4_Missense_Mutation_p.Q789K|SRRT_ENST00000432932.1_Missense_Mutation_p.Q785K			Q9BXP5	SRRT_HUMAN	serrate, RNA effector molecule	790	Pro-rich.				cell proliferation (GO:0008283)|neuronal stem cell maintenance (GO:0097150)|primary miRNA processing (GO:0031053)|regulation of transcription, DNA-templated (GO:0006355)|response to arsenic-containing substance (GO:0046685)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(5)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40						CTACCCACACCAGACTCCCCA	0.612																																					p.Q790K		.											.	SRRT-92	0			c.C2368A						.						52.0	56.0	55.0					7																	100485704		2203	4300	6503	SO:0001583	missense	51593	exon18			CCACACCAGACTC		CCDS34709.1, CCDS47665.1, CCDS47666.1, CCDS47667.1	7q21	2014-04-14	2014-04-14		ENSG00000087087	ENSG00000087087			24101	protein-coding gene	gene with protein product	"""arsenite resistance protein"""	614469	"""serrate RNA effector molecule homolog (Arabidopsis)"""			11239002, 11230166	Standard	NM_015908		Approved	Asr2, serrate, ARS2	uc003uwy.2	Q9BXP5	OTTHUMG00000157031	ENST00000347433.4:c.2368C>A	7.37:g.100485704C>A	ENSP00000314491:p.Gln790Lys	Somatic	157	0		WXS	Illumina HiSeq	Phase_I	148	69	NM_015908	0	0	57	101	44	A4D2E5|A4D2E6|A6NK22|B4DJL4|B4DZA6|O95808|Q32MI4|Q6NT74|Q8TDQ5|Q9BWP6|Q9BXP4|Q9Y4S4	Missense_Mutation	SNP	ENST00000347433.4	37	CCDS34709.1	.	.	.	.	.	.	.	.	.	.	C	16.78	3.217920	0.58560	.	.	ENSG00000087087	ENST00000457580;ENST00000388793;ENST00000342198;ENST00000432932;ENST00000347433;ENST00000448764;ENST00000445337	.	.	.	4.91	4.91	0.64330	Arsenite-resistance protein 2 (1);	0.000000	0.85682	D	0.000000	T	0.50446	0.1616	N	0.08118	0	0.51767	D	0.999935	B;P;P;D	0.53885	0.206;0.954;0.954;0.963	B;D;D;D	0.71414	0.058;0.954;0.954;0.973	T	0.46789	-0.9166	9	0.15952	T	0.53	.	15.6172	0.76775	0.0:1.0:0.0:0.0	.	789;785;786;790	Q9BXP5-3;Q9BXP5-4;Q9BXP5-2;Q9BXP5	.;.;.;SRRT_HUMAN	K	786;789;155;785;790;420;67	.	ENSP00000344670:Q155K	Q	+	1	0	SRRT	100323640	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.964000	0.63701	2.545000	0.85829	0.484000	0.47621	CAG	.		0.612	SRRT-004	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347168.1	NM_015908	
DLD	1738	bcgsc.ca	37	7	107556128	107556128	+	Nonsense_Mutation	SNP	A	A	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr7:107556128A>T	ENST00000205402.5	+	9	1143	c.862A>T	c.(862-864)Aaa>Taa	p.K288*	DLD_ENST00000440410.1_Nonsense_Mutation_p.K265*|DLD_ENST00000537148.1_Nonsense_Mutation_p.K189*|DLD_ENST00000437604.2_Nonsense_Mutation_p.K240*	NM_000108.3	NP_000099.2	P09622	DLDH_HUMAN	dihydrolipoamide dehydrogenase	288					branched-chain amino acid catabolic process (GO:0009083)|cell redox homeostasis (GO:0045454)|cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|gastrulation (GO:0007369)|lysine catabolic process (GO:0006554)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|proteolysis (GO:0006508)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of membrane potential (GO:0042391)|small molecule metabolic process (GO:0044281)|sperm capacitation (GO:0048240)|tricarboxylic acid cycle (GO:0006099)	acrosomal matrix (GO:0043159)|cilium (GO:0005929)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	dihydrolipoyl dehydrogenase activity (GO:0004148)|flavin adenine dinucleotide binding (GO:0050660)			NS(1)|breast(1)|central_nervous_system(1)|kidney(5)|large_intestine(1)|lung(10)|prostate(1)	20					Flavin adenine dinucleotide(DB03147)	GTCAGATGGAAAAATTGATGT	0.313																																					p.K288X													.	DLD-226	0			c.A862T						.						52.0	54.0	54.0					7																	107556128		2203	4300	6503	SO:0001587	stop_gained	1738	exon9			GATGGAAAAATTG	AB209703	CCDS5749.1	7q31-q32	2006-05-22	2006-05-22		ENSG00000091140	ENSG00000091140	1.8.1.4		2898	protein-coding gene	gene with protein product	"""E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate complex, branched chain keto acid dehydrogenase complex"""	238331	"""dihydrolipoamide dehydrogenase (E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate complex, branched chain keto acid dehydrogenase complex)"""	LAD, GCSL			Standard	NM_000108		Approved	DLDH	uc003vet.3	P09622	OTTHUMG00000154813	ENST00000205402.5:c.862A>T	7.37:g.107556128A>T	ENSP00000205402:p.Lys288*	Somatic	124	0		WXS	Illumina HiSeq	Phase_1	125	14	NM_000108	0	0	0	0	0	B2R5X0|B4DHG0|B4DT69|Q14131|Q14167|Q59EV8|Q8WTS4	Nonsense_Mutation	SNP	ENST00000205402.5	37	CCDS5749.1	.	.	.	.	.	.	.	.	.	.	A	37	6.003156	0.97189	.	.	ENSG00000091140	ENST00000205402;ENST00000417551;ENST00000537148;ENST00000440410;ENST00000437604;ENST00000539590	.	.	.	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.0775	16.6512	0.85203	1.0:0.0:0.0:0.0	.	.	.	.	X	288;288;189;265;240;238	.	ENSP00000205402:K288X	K	+	1	0	DLD	107343364	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.359000	0.79477	2.333000	0.79357	0.482000	0.46254	AAA	.		0.313	DLD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337194.3	NM_000108	
CADPS2	93664	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	122081599	122081599	+	Silent	SNP	A	A	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr7:122081599A>G	ENST00000449022.2	-	16	2338	c.2319T>C	c.(2317-2319)ggT>ggC	p.G773G	CADPS2_ENST00000412584.2_Silent_p.G770G|CADPS2_ENST00000334010.7_Silent_p.G774G|RP5-1101C3.1_ENST00000592542.1_RNA|CADPS2_ENST00000313070.7_Silent_p.G770G	NM_017954.10	NP_060424.9	Q86UW7	CAPS2_HUMAN	Ca++-dependent secretion activator 2	773	Interaction with DRD2.				cellular response to starvation (GO:0009267)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasmic membrane-bounded vesicle (GO:0016023)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(2)	43						CTTTTAGAGCACCTTCAGGTC	0.313																																					p.G773G													.	CADPS2-94	0			c.T2319C						.						41.0	38.0	39.0					7																	122081599		1742	3890	5632	SO:0001819	synonymous_variant	93664	exon16			TAGAGCACCTTCA		CCDS47691.1, CCDS55158.1	7q31.32	2013-01-10	2008-08-28		ENSG00000081803	ENSG00000081803		"""Pleckstrin homology (PH) domain containing"""	16018	protein-coding gene	gene with protein product		609978	"""Ca++-dependent activator protein for secretion 2"""				Standard	NM_017954		Approved		uc010lkq.3	Q86UW7	OTTHUMG00000157093	ENST00000449022.2:c.2319T>C	7.37:g.122081599A>G		Somatic	337	2		WXS	Illumina HiSeq	Phase_I	427	82	NM_001167940	0	0	1	1	0	A4D0X3|B7ZM56|Q658Q2|Q7Z5T7|Q8IZW9|Q8N7M4|Q9H6P4|Q9HCI1|Q9NWK8	Silent	SNP	ENST00000449022.2	37	CCDS55158.1	.	.	.	.	.	.	.	.	.	.	A	9.548	1.115285	0.20795	.	.	ENSG00000081803	ENST00000397721	.	.	.	5.77	3.34	0.38264	.	.	.	.	.	T	0.61400	0.2344	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55761	-0.8090	4	.	.	.	-17.4989	10.8394	0.46706	0.5695:0.0:0.0:0.4305	.	.	.	.	R	419	.	.	C	-	1	0	CADPS2	121868835	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.814000	0.27239	0.425000	0.26087	-0.274000	0.10170	TGC	.		0.313	CADPS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347414.2	NM_017954	
TMEM176A	55365	broad.mit.edu;ucsc.edu	37	7	150501526	150501526	+	Missense_Mutation	SNP	G	G	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr7:150501526G>T	ENST00000484928.1	+	6	1213	c.632G>T	c.(631-633)tGg>tTg	p.W211L	TMEM176A_ENST00000461345.1_Missense_Mutation_p.W152L|TMEM176A_ENST00000004103.3_Missense_Mutation_p.W211L			Q96HP8	T176A_HUMAN	transmembrane protein 176A	211					negative regulation of dendritic cell differentiation (GO:2001199)	integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|lung(7)|ovary(2)|stomach(1)	12			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		ACCCCTCTGTGGCTGTACTGC	0.557																																					p.W211L													.	TMEM176A-92	0			c.G632T						.						145.0	133.0	137.0					7																	150501526		2203	4300	6503	SO:0001583	missense	55365	exon6			CTCTGTGGCTGTA	AF258340	CCDS5909.1	7q36.1	2006-09-04			ENSG00000002933	ENSG00000002933			24930	protein-coding gene	gene with protein product		610334				12097419, 8889548	Standard	NM_018487		Approved	HCA112	uc003whx.1	Q96HP8	OTTHUMG00000158114	ENST00000484928.1:c.632G>T	7.37:g.150501526G>T	ENSP00000417626:p.Trp211Leu	Somatic	73	1		WXS	Illumina HiSeq	Phase_I	83	14	NM_018487	1	0	1647	1652	4	D3DX00|Q9NYC7	Missense_Mutation	SNP	ENST00000484928.1	37	CCDS5909.1	.	.	.	.	.	.	.	.	.	.	G	2.416	-0.334160	0.05278	.	.	ENSG00000002933	ENST00000484928;ENST00000004103;ENST00000461345;ENST00000475536	T;T;T;T	0.01981	4.52;4.52;4.52;4.52	4.79	2.91	0.33838	.	1.300260	0.05601	N	0.576349	T	0.01976	0.0062	N	0.08118	0	0.09310	N	1	B	0.19445	0.036	B	0.19946	0.027	T	0.49476	-0.8936	10	0.41790	T	0.15	-19.4964	10.1706	0.42908	0.0:0.0:0.6371:0.3629	.	211	Q96HP8	T176A_HUMAN	L	211;211;152;163	ENSP00000417626:W211L;ENSP00000004103:W211L;ENSP00000420818:W152L;ENSP00000417834:W163L	ENSP00000004103:W211L	W	+	2	0	TMEM176A	150132459	0.009000	0.17119	0.376000	0.26042	0.857000	0.48899	0.314000	0.19432	0.503000	0.28060	0.655000	0.94253	TGG	.		0.557	TMEM176A-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350222.1	NM_018487	
CHPF2	54480	broad.mit.edu	37	7	150935559	150935559	+	Missense_Mutation	SNP	T	T	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr7:150935559T>G	ENST00000035307.2	+	4	3624	c.2111T>G	c.(2110-2112)gTg>gGg	p.V704G	MIR671_ENST00000390183.1_RNA|RP4-548D19.3_ENST00000607902.1_RNA|CHPF2_ENST00000495645.1_Missense_Mutation_p.V696G	NM_019015.1	NP_061888.1	Q9P2E5	CHPF2_HUMAN	chondroitin polymerizing factor 2	704					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			breast(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(4)|prostate(1)|skin(3)	17						GGGCTGGAGGTGATGGATGTT	0.647																																					p.V704G													.	CHPF2-91	0			c.T2111G						.						46.0	42.0	43.0					7																	150935559		2197	4298	6495	SO:0001583	missense	54480	exon4			TGGAGGTGATGGA	AB037823	CCDS34779.1, CCDS64803.1	7q36.1	2013-02-19			ENSG00000033100	ENSG00000033100	2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	29270	protein-coding gene	gene with protein product		608037				10718198, 12145278, 18316376	Standard	NM_019015		Approved	KIAA1402, ChSy-3, CSGlcA-T	uc003wjr.1	Q9P2E5	OTTHUMG00000157380	ENST00000035307.2:c.2111T>G	7.37:g.150935559T>G	ENSP00000035307:p.Val704Gly	Somatic	112	17		WXS	Illumina HiSeq	Phase_I	128	22	NM_019015	0	1	79	83	3	B2DBD8|Q6P2I4|Q6UXD2	Missense_Mutation	SNP	ENST00000035307.2	37	CCDS34779.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.946996	0.73672	.	.	ENSG00000033100	ENST00000495645;ENST00000035307	T;T	0.19105	2.17;2.17	4.81	4.81	0.61882	.	0.059849	0.64402	D	0.000002	T	0.39279	0.1072	L	0.50333	1.59	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.71184	0.972;0.917	T	0.18935	-1.0321	10	0.66056	D	0.02	-22.7599	13.7365	0.62821	0.0:0.0:0.0:1.0	.	704;696	Q9P2E5;G5E9W2	CHPF2_HUMAN;.	G	696;704	ENSP00000418914:V696G;ENSP00000035307:V704G	ENSP00000035307:V704G	V	+	2	0	CHPF2	150566492	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.956000	0.70315	2.018000	0.59344	0.533000	0.62120	GTG	.		0.647	CHPF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348648.2	NM_019015	
ANK1	286	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	41551436	41551436	+	Missense_Mutation	SNP	C	C	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr8:41551436C>T	ENST00000347528.4	-	29	3595	c.3512G>A	c.(3511-3513)cGc>cAc	p.R1171H	ANK1_ENST00000289734.7_Missense_Mutation_p.R1171H|ANK1_ENST00000379758.2_Missense_Mutation_p.R1171H|ANK1_ENST00000352337.4_Missense_Mutation_p.R1171H|ANK1_ENST00000396945.1_Missense_Mutation_p.R1171H|ANK1_ENST00000396942.1_Missense_Mutation_p.R1171H|ANK1_ENST00000265709.8_Missense_Mutation_p.R1212H	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	1171	ZU5 2. {ECO:0000255|PROSITE- ProRule:PRU00485}.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.R1171H(1)		breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			GCAAAGCAGGCGCAGGCTGGT	0.647																																					p.R1212H		.											.	ANK1-716	1	Substitution - Missense(1)	large_intestine(1)	c.G3635A						.						31.0	28.0	29.0					8																	41551436		2203	4300	6503	SO:0001583	missense	286	exon30			AGCAGGCGCAGGC	M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.3512G>A	8.37:g.41551436C>T	ENSP00000339620:p.Arg1171His	Somatic	176	0		WXS	Illumina HiSeq	Phase_I	161	37	NM_001142446	0	0	0	0	0	A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Missense_Mutation	SNP	ENST00000347528.4	37	CCDS6119.1	.	.	.	.	.	.	.	.	.	.	C	35	5.421819	0.96111	.	.	ENSG00000029534	ENST00000347528;ENST00000289734;ENST00000379758;ENST00000396945;ENST00000396942;ENST00000352337;ENST00000265709;ENST00000358820	T;T;T;T;T;T;T	0.73469	-0.72;-0.72;-0.69;-0.68;-0.69;-0.67;-0.75	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	D	0.87018	0.6073	M	0.80183	2.485	0.80722	D	1	D;D;D;P;D;D	0.89917	0.988;0.996;0.994;0.914;0.988;1.0	D;P;P;P;D;D	0.73708	0.91;0.821;0.677;0.498;0.91;0.981	D	0.88810	0.3291	10	0.87932	D	0	.	18.7318	0.91738	0.0:1.0:0.0:0.0	.	1212;1171;1171;1171;1171;487	P16157-21;P16157-4;P16157;P16157-5;P16157-3;B3KX39	.;.;ANK1_HUMAN;.;.;.	H	1171;1171;1171;1171;1171;1171;1212;1171	ENSP00000339620:R1171H;ENSP00000289734:R1171H;ENSP00000369082:R1171H;ENSP00000380149:R1171H;ENSP00000380147:R1171H;ENSP00000309131:R1171H;ENSP00000265709:R1212H	ENSP00000265709:R1212H	R	-	2	0	ANK1	41670593	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.794000	0.85869	2.493000	0.84123	0.313000	0.20887	CGC	.		0.647	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317297.1	NM_020475	
TRPA1	8989	bcgsc.ca	37	8	72964852	72964852	+	Missense_Mutation	SNP	G	G	T	rs147715599		TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr8:72964852G>T	ENST00000262209.4	-	14	2000	c.1793C>A	c.(1792-1794)aCg>aAg	p.T598K	RP11-383H13.1_ENST00000537896.1_3'UTR|RP11-383H13.1_ENST00000457356.4_3'UTR|RP11-383H13.1_ENST00000524152.1_3'UTR	NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	598					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	CCTGATGATCGTAAGAACAAC	0.448																																					p.T598K													.	TRPA1-230	0			c.C1793A						.						141.0	122.0	129.0					8																	72964852		2203	4300	6503	SO:0001583	missense	8989	exon14			ATGATCGTAAGAA	Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.1793C>A	8.37:g.72964852G>T	ENSP00000262209:p.Thr598Lys	Somatic	65	0		WXS	Illumina HiSeq	Phase_1	46	4	NM_007332	0	0	0	0	0	A6NIN6	Missense_Mutation	SNP	ENST00000262209.4	37	CCDS34908.1	.	.	.	.	.	.	.	.	.	.	G	12.24	1.877413	0.33162	.	.	ENSG00000104321	ENST00000523582;ENST00000262209	T;T	0.64438	-0.1;-0.1	4.98	2.19	0.27852	Ankyrin repeat-containing domain (3);	0.254047	0.47852	D	0.000208	T	0.56381	0.1981	M	0.64997	1.995	0.09310	N	1	P	0.45428	0.858	B	0.43225	0.412	T	0.47548	-0.9109	10	0.30078	T	0.28	-3.4347	8.5498	0.33444	0.3012:0.0:0.6988:0.0	.	598	O75762	TRPA1_HUMAN	K	450;598	ENSP00000428151:T450K;ENSP00000262209:T598K	ENSP00000262209:T598K	T	-	2	0	TRPA1	73127406	0.949000	0.32298	0.066000	0.19879	0.208000	0.24298	1.698000	0.37794	0.231000	0.21079	0.585000	0.79938	ACG	G|1.000;A|0.000		0.448	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379079.2	NM_007332	
RGS22	26166	broad.mit.edu	37	8	101054051	101054051	+	Silent	SNP	G	G	A	rs200708091		TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr8:101054051G>A	ENST00000360863.6	-	12	2111	c.1917C>T	c.(1915-1917)taC>taT	p.Y639Y	RGS22_ENST00000523437.1_Silent_p.Y627Y|RGS22_ENST00000523287.1_Silent_p.Y458Y	NM_015668.3	NP_056483.3	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	639					positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)		RGS22/SYCP1(2)	breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(33)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	68			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			CTGTATAAGCGTATCTTCTAT	0.358																																					p.Y639Y													.	RGS22-140	0			c.C1917T						.						117.0	106.0	110.0					8																	101054051		1834	4092	5926	SO:0001819	synonymous_variant	26166	exon12			ATAAGCGTATCTT	AY009106	CCDS43758.1, CCDS69521.1, CCDS75775.1	8q22.2	2014-01-21	2007-08-14		ENSG00000132554	ENSG00000132554		"""Regulators of G-protein signaling"""	24499	protein-coding gene	gene with protein product		615650	"""regulator of G-protein signalling 22"""				Standard	XM_005250856		Approved	DKFZP434I092, PRTD-NY2, CT145	uc003yjb.1	Q8NE09	OTTHUMG00000164802	ENST00000360863.6:c.1917C>T	8.37:g.101054051G>A		Somatic	82	0		WXS	Illumina HiSeq	Phase_I	75	3	NM_015668	0	0	0	0	0	A8K944|Q569L2|Q86Y71|Q9BYZ4|Q9UFN6	Silent	SNP	ENST00000360863.6	37	CCDS43758.1																																																																																			G|0.999;A|0.001		0.358	RGS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380365.1	NM_015668	
RFX3	5991	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	3271084	3271084	+	Missense_Mutation	SNP	C	C	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr9:3271084C>G	ENST00000382004.3	-	11	1432	c.1121G>C	c.(1120-1122)aGc>aCc	p.S374T	RFX3_ENST00000302303.1_Missense_Mutation_p.S374T|RFX3_ENST00000358730.2_Missense_Mutation_p.S374T	NM_001282116.1|NM_134428.1	NP_001269045.1|NP_602304.1	P48380	RFX3_HUMAN	regulatory factor X, 3 (influences HLA class II expression)	374					cell maturation (GO:0048469)|cilium assembly (GO:0042384)|cilium-dependent cell motility (GO:0060285)|endocrine pancreas development (GO:0031018)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type B pancreatic cell development (GO:2000078)|regulation of insulin secretion (GO:0050796)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|type B pancreatic cell maturation (GO:0072560)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(11)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	40				GBM - Glioblastoma multiforme(50;0.00124)|Lung(2;0.0337)		TTCTATCAGGCTAAATTGAAG	0.388																																					p.S374T		.											.	RFX3-93	0			c.G1121C						.						166.0	152.0	156.0					9																	3271084		2203	4300	6503	SO:0001583	missense	5991	exon11			ATCAGGCTAAATT	AI811824	CCDS6449.1, CCDS6450.1, CCDS75809.1	9p24.2	2008-02-05			ENSG00000080298	ENSG00000080298			9984	protein-coding gene	gene with protein product		601337				8289803	Standard	XM_005251534		Approved		uc003zhr.3	P48380	OTTHUMG00000019456	ENST00000382004.3:c.1121G>C	9.37:g.3271084C>G	ENSP00000371434:p.Ser374Thr	Somatic	111	0		WXS	Illumina HiSeq	Phase_I	122	35	NM_134428	0	0	0	0	0	A8K0H5|D3DRH8|D3DRH9|Q5JTL7|Q5JTL8|Q6NW13|Q8WTU4|Q95HL5|Q95HL6	Missense_Mutation	SNP	ENST00000382004.3	37	CCDS6449.1	.	.	.	.	.	.	.	.	.	.	c	5.417	0.262094	0.10239	.	.	ENSG00000080298	ENST00000382004;ENST00000358730;ENST00000302303	T;T;T	0.08102	3.13;3.13;3.13	5.76	4.85	0.62838	.	0.039316	0.85682	D	0.000000	T	0.03695	0.0105	N	0.04508	-0.205	0.48632	D	0.999686	B;B;B	0.09022	0.002;0.0;0.002	B;B;B	0.12156	0.007;0.007;0.004	T	0.43877	-0.9364	10	0.09338	T	0.73	-10.837	11.3803	0.49752	0.0:0.8614:0.0:0.1386	.	374;374;374	P48380-3;P48380-2;P48380	.;.;RFX3_HUMAN	T	374	ENSP00000371434:S374T;ENSP00000351574:S374T;ENSP00000303847:S374T	ENSP00000303847:S374T	S	-	2	0	RFX3	3261084	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.760000	0.55235	2.738000	0.93877	0.645000	0.84053	AGC	.		0.388	RFX3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051545.1	NM_002919	
RASEF	158158	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	85624582	85624582	+	Nonsense_Mutation	SNP	A	A	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr9:85624582A>T	ENST00000376447.3	-	6	1193	c.933T>A	c.(931-933)taT>taA	p.Y311*		NM_152573.2	NP_689786.2	Q8IZ41	RASEF_HUMAN	RAS and EF-hand domain containing	311					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)			NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(4)|liver(1)|lung(15)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	33						TCTGATCAGCATAATCACTTT	0.348																																					p.Y311X													.	RASEF-280	0			c.T933A						.						153.0	140.0	144.0					9																	85624582		2203	4300	6503	SO:0001587	stop_gained	158158	exon6			ATCAGCATAATCA	AK056176	CCDS6662.1	9q21.33	2014-05-09	2004-06-11	2004-06-16	ENSG00000165105	ENSG00000165105		"""EF-hand domain containing"", ""RAB, member RAS oncogene"""	26464	protein-coding gene	gene with protein product		611344	"""RAB45, member RAS oncogene family"""	RAB45		17448446	Standard	NM_152573		Approved	FLJ31614	uc004amo.2	Q8IZ41	OTTHUMG00000020100	ENST00000376447.3:c.933T>A	9.37:g.85624582A>T	ENSP00000365630:p.Tyr311*	Somatic	80	1		WXS	Illumina HiSeq	Phase_I	104	22	NM_152573	0	0	0	0	0	A6NC29|Q96N04	Nonsense_Mutation	SNP	ENST00000376447.3	37	CCDS6662.1	.	.	.	.	.	.	.	.	.	.	A	39	7.753455	0.98471	.	.	ENSG00000165105	ENST00000376447	.	.	.	5.92	3.56	0.40772	.	0.142934	0.49916	D	0.000121	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.379	0.44099	0.8654:0.0:0.1346:0.0	.	.	.	.	X	311	.	ENSP00000365630:Y311X	Y	-	3	2	RASEF	84814402	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.535000	0.36061	0.483000	0.27608	0.383000	0.25322	TAT	.		0.348	RASEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052825.1	NM_152573	
STXBP1	6812	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	130438137	130438137	+	Missense_Mutation	SNP	G	G	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr9:130438137G>A	ENST00000373299.1	+	14	1280	c.1165G>A	c.(1165-1167)Gcc>Acc	p.A389T	STXBP1_ENST00000373302.3_Missense_Mutation_p.A389T|STXBP1_ENST00000481942.1_3'UTR	NM_001032221.3	NP_001027392.1	P61764	STXB1_HUMAN	syntaxin binding protein 1	389					axon target recognition (GO:0007412)|energy reserve metabolic process (GO:0006112)|glutamate secretion (GO:0014047)|long term synaptic depression (GO:0060292)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter secretion (GO:0007269)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|protein stabilization (GO:0050821)|protein transport (GO:0015031)|regulation of insulin secretion (GO:0050796)|regulation of SNARE complex assembly (GO:0035542)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|regulation of synaptic vesicle priming (GO:0010807)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|synaptic vesicle maturation (GO:0016188)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|protein complex (GO:0043234)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|SNARE binding (GO:0000149)|syntaxin binding (GO:0019905)|syntaxin-1 binding (GO:0017075)			breast(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(7)|skin(2)	23						CCCTATGCGAGCCATCGTCCC	0.507																																					p.A389T		.											.	STXBP1-91	0			c.G1165A						.						157.0	112.0	127.0					9																	130438137		2203	4300	6503	SO:0001583	missense	6812	exon14			ATGCGAGCCATCG	AF004563	CCDS6874.1, CCDS35146.1	9q34.1	2008-07-21			ENSG00000136854	ENSG00000136854			11444	protein-coding gene	gene with protein product	"""syntaxin-binding protein 1"""	602926				9545644	Standard	NM_001032221		Approved	hUNC18, MUNC18-1, UNC18, rbSec1	uc004brk.2	P61764	OTTHUMG00000020713	ENST00000373299.1:c.1165G>A	9.37:g.130438137G>A	ENSP00000362396:p.Ala389Thr	Somatic	123	0		WXS	Illumina HiSeq	Phase_I	92	22	NM_001032221	0	0	7	8	1	B1AM97|Q28208|Q62759|Q64320|Q96TG8	Missense_Mutation	SNP	ENST00000373299.1	37	CCDS35146.1	.	.	.	.	.	.	.	.	.	.	G	14.01	2.406455	0.42715	.	.	ENSG00000136854	ENST00000535154;ENST00000373302;ENST00000541198;ENST00000373299	T;T	0.80033	-1.33;-1.33	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.62913	0.2467	N	0.04203	-0.255	0.58432	D	0.999998	B;B	0.14012	0.009;0.008	B;B	0.18263	0.021;0.012	T	0.59369	-0.7467	10	0.13108	T	0.6	-12.1555	17.491	0.87703	0.0:0.0:1.0:0.0	.	389;389	P61764;P61764-2	STXB1_HUMAN;.	T	343;389;221;389	ENSP00000362399:A389T;ENSP00000362396:A389T	ENSP00000362396:A389T	A	+	1	0	STXBP1	129477958	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.669000	0.68081	2.793000	0.96121	0.655000	0.94253	GCC	.		0.507	STXBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054229.1	NM_003165	
ENG	2022	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	130582297	130582297	+	Missense_Mutation	SNP	G	G	A	rs199764615		TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr9:130582297G>A	ENST00000373203.4	-	9	1554	c.1154C>T	c.(1153-1155)aCg>aTg	p.T385M	RP11-228B15.4_ENST00000439298.1_RNA|RP11-228B15.4_ENST00000425991.1_RNA|ENG_ENST00000480266.1_5'UTR|ENG_ENST00000344849.3_Missense_Mutation_p.T385M	NM_000118.2|NM_001114753.1|NM_001278138.1	NP_000109.1|NP_001108225.1|NP_001265067.1	P17813	EGLN_HUMAN	endoglin	385	Ser/Thr-rich.				artery morphogenesis (GO:0048844)|BMP signaling pathway (GO:0030509)|bone development (GO:0060348)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|cell migration involved in endocardial cushion formation (GO:0003273)|cell motility (GO:0048870)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|chronological cell aging (GO:0001300)|detection of hypoxia (GO:0070483)|extracellular matrix constituent secretion (GO:0070278)|extracellular matrix disassembly (GO:0022617)|heart looping (GO:0001947)|intracellular signal transduction (GO:0035556)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|patterning of blood vessels (GO:0001569)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of gene expression (GO:0010628)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of systemic arterial blood pressure (GO:0003084)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell adhesion (GO:0030155)|regulation of cell proliferation (GO:0042127)|regulation of phosphorylation (GO:0042325)|regulation of transcription, DNA-templated (GO:0006355)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to corticosteroid (GO:0031960)|response to hypoxia (GO:0001666)|response to statin (GO:0036273)|response to transforming growth factor beta (GO:0071559)|smooth muscle tissue development (GO:0048745)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)|wound healing (GO:0042060)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endothelial microparticle (GO:0072563)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	activin binding (GO:0048185)|galactose binding (GO:0005534)|glycosaminoglycan binding (GO:0005539)|protein homodimerization activity (GO:0042803)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor, cytoplasmic mediator activity (GO:0005072)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane signaling receptor activity (GO:0004888)|type I transforming growth factor beta receptor binding (GO:0034713)|type II transforming growth factor beta receptor binding (GO:0005114)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	17						GGTCAGGCCCGTGATGGTGCA	0.607									Juvenile Polyposis;Hereditary Hemorrhagic Telangiectasia				G|||	1	0.000199681	0.0	0.0	5008	,	,		18170	0.0		0.001	False		,,,				2504	0.0				p.T385M													.	ENG-90	0			c.C1154T						.						76.0	67.0	70.0					9																	130582297		2203	4300	6503	SO:0001583	missense	2022	exon9	Familial Cancer Database	incl.: Juvenile Polyposis of the Stomach;HHT, Rendu-Osler-Weber disease, incl.: Pulmonary arteriovenous malformations, hypertrophic osteoarthropathy and juvenile polyposis,	AGGCCCGTGATGG	AF035753	CCDS6880.1, CCDS48029.1, CCDS75906.1	9q34.11	2014-09-17	2008-09-04		ENSG00000106991	ENSG00000106991		"""CD molecules"""	3349	protein-coding gene	gene with protein product		131195	"""Osler-Rendu-Weber syndrome 1"""	ORW1, ORW		8404038, 10548503	Standard	NM_001278138		Approved	END, HHT1, CD105	uc031tfe.1	P17813	OTTHUMG00000020723	ENST00000373203.4:c.1154C>T	9.37:g.130582297G>A	ENSP00000362299:p.Thr385Met	Somatic	44	0		WXS	Illumina HiSeq	Phase_I	40	7	NM_001114753	0	0	57	58	1	Q14248|Q14926|Q5T9C0	Missense_Mutation	SNP	ENST00000373203.4	37	CCDS48029.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	2.178	-0.388283	0.04932	.	.	ENSG00000106991	ENST00000373203;ENST00000344849;ENST00000545345;ENST00000546301	D;D	0.82984	-1.67;-1.67	3.99	-7.97	0.01139	Zona pellucida sperm-binding protein (1);	2.913470	0.01331	N	0.011242	T	0.61123	0.2322	N	0.20685	0.6	0.09310	N	1	B;B	0.30511	0.282;0.282	B;B	0.21546	0.035;0.035	T	0.61008	-0.7149	10	0.13108	T	0.6	-8.77	0.8767	0.01226	0.364:0.2503:0.2057:0.1801	.	385;385	Q5T9B9;P17813	.;EGLN_HUMAN	M	385;385;385;203	ENSP00000362299:T385M;ENSP00000341917:T385M	ENSP00000341917:T385M	T	-	2	0	ENG	129622118	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-2.456000	0.01002	-3.548000	0.00143	-1.579000	0.00862	ACG	G|0.999;A|0.000		0.607	ENG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054313.1		
ASB6	140459	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	132400146	132400146	+	Nonsense_Mutation	SNP	T	T	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr9:132400146T>A	ENST00000277458.4	-	6	1354	c.1189A>T	c.(1189-1191)Aaa>Taa	p.K397*	RP11-483H20.4_ENST00000455074.1_RNA|ASB6_ENST00000277459.4_3'UTR|ASB6_ENST00000450050.2_Nonsense_Mutation_p.K318*	NM_017873.3	NP_060343.1	Q9NWX5	ASB6_HUMAN	ankyrin repeat and SOCS box containing 6	397	SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.				intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				NS(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|prostate(2)	15		Ovarian(14;0.00556)				GGCAGGGCTTTGACCTTCACA	0.607																																					p.K397X		.											.	ASB6-226	0			c.A1189T						.						66.0	63.0	64.0					9																	132400146		2203	4300	6503	SO:0001587	stop_gained	140459	exon6			GGGCTTTGACCTT		CCDS6924.1, CCDS6925.1, CCDS75919.1	9q34.13	2013-01-10	2011-01-25		ENSG00000148331	ENSG00000148331		"""Ankyrin repeat domain containing"""	17181	protein-coding gene	gene with protein product		615051	"""ankyrin repeat and SOCS box-containing 6"""				Standard	NM_017873		Approved		uc004byf.2	Q9NWX5	OTTHUMG00000020787	ENST00000277458.4:c.1189A>T	9.37:g.132400146T>A	ENSP00000277458:p.Lys397*	Somatic	47	0		WXS	Illumina HiSeq	Phase_I	29	9	NM_017873	0	0	13	27	14	Q5SZB7|Q9BV15	Nonsense_Mutation	SNP	ENST00000277458.4	37	CCDS6924.1	.	.	.	.	.	.	.	.	.	.	T	37	6.123362	0.97305	.	.	ENSG00000148331	ENST00000277458;ENST00000450050	.	.	.	4.95	0.937	0.19494	.	0.300887	0.39759	N	0.001264	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.0669	11.7516	0.51852	0.0:0.0:0.4323:0.5677	.	.	.	.	X	397;318	.	ENSP00000277458:K397X	K	-	1	0	ASB6	131439967	0.998000	0.40836	0.854000	0.33618	0.993000	0.82548	1.584000	0.36589	-0.003000	0.14444	0.379000	0.24179	AAA	.		0.607	ASB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054594.1	NM_017873	
ASMTL	8623	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	1540611	1540611	+	Missense_Mutation	SNP	G	G	C			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chrX:1540611G>C	ENST00000381317.3	-	9	1217	c.1185C>G	c.(1183-1185)atC>atG	p.I395M	ASMTL_ENST00000381333.4_Missense_Mutation_p.I379M|ASMTL_ENST00000534940.1_Missense_Mutation_p.I337M|ASMTL_ENST00000416733.2_Missense_Mutation_p.I319M	NM_004192.3	NP_004183.2	O95671	ASML_HUMAN	acetylserotonin O-methyltransferase-like	395	ASMT-like.					cytoplasm (GO:0005737)	O-methyltransferase activity (GO:0008171)			NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(9)|pancreas(1)|soft_tissue(1)	23		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TTCCCTCTCGGATGGCAAACT	0.537																																					p.I395M		.											.	ASMTL-62	0			c.C1185G						.						267.0	279.0	275.0					X																	1540611		2010	4172	6182	SO:0001583	missense	8623	exon9			CTCTCGGATGGCA	Y15521	CCDS43917.1, CCDS55362.1, CCDS55363.1	Xp22.3 and Yp11.3	2008-02-05			ENSG00000169093	ENSG00000169093		"""Pseudoautosomal regions / PAR1"""	751	protein-coding gene	gene with protein product		300162, 400011				9736779	Standard	NM_004192		Approved		uc004cpx.2	O95671	OTTHUMG00000021057	ENST00000381317.3:c.1185C>G	X.37:g.1540611G>C	ENSP00000370718:p.Ile395Met	Somatic	561	1		WXS	Illumina HiSeq	Phase_I	288	119	NM_004192	0	0	6	28	22	B4DX75|F5GXH4|J3JS33|Q5JQ53|Q8NBH5|Q96G02|Q9BUL6	Missense_Mutation	SNP	ENST00000381317.3	37	CCDS43917.1	.	.	.	.	.	.	.	.	.	.	g	11.19	1.566957	0.28003	.	.	ENSG00000169093	ENST00000416733;ENST00000534940;ENST00000381333;ENST00000381317	T;T;T;T	0.26223	1.75;1.75;1.75;1.75	1.58	-3.16	0.05217	O-methyltransferase, family 2 (1);	0.083070	0.47093	U	0.000252	T	0.24275	0.0588	L	0.38175	1.15	0.09310	N	1	D;D;D	0.60575	0.979;0.988;0.979	P;P;P	0.55713	0.782;0.666;0.582	T	0.14643	-1.0465	10	0.87932	D	0	.	5.5218	0.16938	0.2398:0.184:0.5763:0.0	.	319;379;395	E7ER97;O95671-2;O95671	.;.;ASML_HUMAN	M	319;337;379;395	ENSP00000410578:I319M;ENSP00000446410:I337M;ENSP00000370734:I379M;ENSP00000370718:I395M	ENSP00000370718:I395M	I	-	3	3	ASMTL	1500611	0.986000	0.35501	0.006000	0.13384	0.132000	0.20833	-0.099000	0.11007	-0.451000	0.07097	0.100000	0.15512	ATC	.		0.537	ASMTL-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055595.1	NM_004192	
ACOT9	23597	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	23723161	23723161	+	Silent	SNP	G	G	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chrX:23723161G>A	ENST00000336430.7	-	13	1160	c.1029C>T	c.(1027-1029)atC>atT	p.I343I	ACOT9_ENST00000379303.5_Silent_p.I352I|ACOT9_ENST00000379295.1_Silent_p.I283I	NM_001033583.2	NP_001028755.2	Q9Y305	ACOT9_HUMAN	acyl-CoA thioesterase 9	343					acyl-CoA metabolic process (GO:0006637)	mitochondrion (GO:0005739)	acetyl-CoA hydrolase activity (GO:0003986)|carboxylic ester hydrolase activity (GO:0052689)			breast(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(4)|pancreas(1)|skin(1)	15						TCTGAAACATGATGTCATCTA	0.403																																					p.I352I		.											.	ACOT9-133	0			c.C1056T						.						120.0	109.0	113.0					X																	23723161		2203	4300	6503	SO:0001819	synonymous_variant	23597	exon14			AAACATGATGTCA	AF132950	CCDS35216.1, CCDS43924.1	Xp22.11	2008-02-05			ENSG00000123130	ENSG00000123130		"""Acyl CoA thioesterases"""	17152	protein-coding gene	gene with protein product		300862				10383425, 10810093, 16103133, 16940157	Standard	XM_005274471		Approved	CGI-16, MT-ACT48, ACATE2	uc004dao.3	Q9Y305	OTTHUMG00000021257	ENST00000336430.7:c.1029C>T	X.37:g.23723161G>A		Somatic	166	0		WXS	Illumina HiSeq	Phase_I	161	100	NM_001037171	0	0	18	33	15	B3KNC9|B7ZM94	Silent	SNP	ENST00000336430.7	37	CCDS35216.1																																																																																			.		0.403	ACOT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056065.1	NM_012332	
AR	367	hgsc.bcm.edu	37	X	66765167	66765167	+	Missense_Mutation	SNP	A	A	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chrX:66765167A>T	ENST00000374690.3	+	1	703	c.179A>T	c.(178-180)cAg>cTg	p.Q60L	AR_ENST00000504326.1_Missense_Mutation_p.Q60L|AR_ENST00000396044.3_Missense_Mutation_p.Q60L|AR_ENST00000513847.1_3'UTR	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	60	Gln-rich.|Modulating.|Poly-Gln.				androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	CTgcagcagcagcagcagcag	0.677									Androgen Insensitivity Syndrome																												p.Q60L		.											.	AR-661	0			c.A179T	GRCh37	CI994028	AR	I		.						6.0	9.0	8.0					X																	66765167		1971	3901	5872	SO:0001583	missense	367	exon1	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	AGCAGCAGCAGCA	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.179A>T	X.37:g.66765167A>T	ENSP00000363822:p.Gln60Leu	Somatic	72	0		WXS	Illumina HiSeq	Phase_I	77	7	NM_000044	0	0	4	4	0	A2RUN2|B1AKD7|Q9UD95	Missense_Mutation	SNP	ENST00000374690.3	37	CCDS14387.1	.	.	.	.	.	.	.	.	.	.	a	11.27	1.588228	0.28357	.	.	ENSG00000169083	ENST00000374690;ENST00000504326;ENST00000396044;ENST00000538891	T;T;T	0.57436	0.4;0.4;0.4	.	.	.	.	1.241110	0.06210	N	0.684797	T	0.29288	0.0729	N	0.19112	0.55	0.09310	N	0.999999	P;P;.	0.36048	0.534;0.534;.	B;B;.	0.29862	0.08;0.108;.	T	0.11494	-1.0585	8	0.12103	T	0.63	.	.	.	.	.	60;60;58	E7EVX6;D3YPQ2;P10275	.;.;ANDR_HUMAN	L	60	ENSP00000363822:Q60L;ENSP00000421155:Q60L;ENSP00000379359:Q60L	ENSP00000363822:Q60L	Q	+	2	0	AR	66681892	0.997000	0.39634	0.860000	0.33809	0.513000	0.34164	1.220000	0.32491	0.000000	0.14550	0.000000	0.15137	CAG	.		0.677	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057007.1	NM_000044	
ZMAT1	84460	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	101152941	101152941	+	Silent	SNP	A	A	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chrX:101152941A>T	ENST00000372782.3	-	5	452	c.405T>A	c.(403-405)atT>atA	p.I135I	ZMAT1_ENST00000458570.1_5'UTR|ZMAT1_ENST00000540921.1_Silent_p.I135I	NM_001011657.3	NP_001011657	Q5H9K5	ZMAT1_HUMAN	zinc finger, matrin-type 1	135						nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	22						GAGACTGAGCAATAAGTGGAG	0.403																																					p.I135I		.											.	ZMAT1-131	0			c.T405A						.						157.0	124.0	135.0					X																	101152941		2203	4300	6503	SO:0001819	synonymous_variant	84460	exon5			CTGAGCAATAAGT	Z69304	CCDS35348.1	Xq21	2012-10-05	2010-09-15		ENSG00000166432	ENSG00000166432		"""Zinc fingers, matrin-type"""	29377	protein-coding gene	gene with protein product							Standard	NM_001011657		Approved	KIAA1789	uc011mrl.2	Q5H9K5	OTTHUMG00000022044	ENST00000372782.3:c.405T>A	X.37:g.101152941A>T		Somatic	86	0		WXS	Illumina HiSeq	Phase_I	76	36	NM_001011657	0	0	0	0	0	Q8NDS3|Q96JN6	Silent	SNP	ENST00000372782.3	37	CCDS35348.1																																																																																			.		0.403	ZMAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057598.1		
HTR2C	3358	ucsc.edu;bcgsc.ca	37	X	113997817	113997817	+	Intron	SNP	C	C	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chrX:113997817C>T	ENST00000276198.1	+	4	1077				MIR1911_ENST00000410783.1_RNA|HTR2C_ENST00000371950.3_Intron|HTR2C_ENST00000371951.1_Intron	NM_000868.2	NP_000859.1	P28335	5HT2C_HUMAN	5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled						behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|cGMP biosynthetic process (GO:0006182)|feeding behavior (GO:0007631)|locomotory behavior (GO:0007626)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|regulation of appetite (GO:0032098)|regulation of corticotropin-releasing hormone secretion (GO:0043397)|regulation of neurological system process (GO:0031644)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|Gq/11-coupled serotonin receptor activity (GO:0001587)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50					Agomelatine(DB06594)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Dexfenfluramine(DB01191)|Doxepin(DB01142)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Lorcaserin(DB04871)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pramipexole(DB00413)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	TCTCCGCTgacgctttgccat	0.552													C|||	1	0.000264901	0.0	0.0014	3775	,	,		14129	0.0		0.0	False		,,,				2504	0.0				.													.	.	0			.						.						108.0	84.0	91.0					X																	113997817		692	1591	2283	SO:0001627	intron_variant	100302222	.			CGCTGACGCTTTG		CCDS14564.1, CCDS59174.1	Xq23	2013-12-19	2012-02-03		ENSG00000147246	ENSG00000147246		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5295	protein-coding gene	gene with protein product		312861	"""5-hydroxytryptamine (serotonin) receptor 2C"""	HTR1C		7895773	Standard	NM_000868		Approved	5-HT2C, 5HTR2C	uc004epu.1	P28335	OTTHUMG00000022226	ENST00000276198.1:c.349+31801C>T	X.37:g.113997817C>T		Somatic	30	0		WXS	Illumina HiSeq		14	5	.	0	0	0	0	0	B1AMW4|Q5VUF8|Q9NP28	RNA	SNP	ENST00000276198.1	37	CCDS14564.1																																																																																			.		0.552	HTR2C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057962.1	NM_000868	
PNCK	139728	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	152937048	152937048	+	Missense_Mutation	SNP	G	G	C			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chrX:152937048G>C	ENST00000370150.1	-	6	672	c.494C>G	c.(493-495)gCt>gGt	p.A165G	PNCK_ENST00000370145.4_Missense_Mutation_p.A182G|PNCK_ENST00000447676.2_Missense_Mutation_p.A248G|PNCK_ENST00000340888.3_Missense_Mutation_p.A165G|PNCK_ENST00000370142.1_Missense_Mutation_p.A165G|PNCK_ENST00000393831.2_Missense_Mutation_p.A165G|PNCK_ENST00000475172.1_5'UTR			Q6P2M8	KCC1B_HUMAN	pregnancy up-regulated nonubiquitous CaM kinase	165	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			breast(2)|lung(3)|skin(1)	6	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CATGTTCCCAGCCTGGATTTT	0.602																																					p.A248G		.											.	PNCK-207	0			c.C743G						.						121.0	112.0	115.0					X																	152937048		2203	4300	6503	SO:0001583	missense	139728	exon6			TTCCCAGCCTGGA	BC033746	CCDS35503.2, CCDS48189.1	Xq28	2013-10-14	2013-10-14		ENSG00000130822	ENSG00000130822			13415	protein-coding gene	gene with protein product		300680	"""pregnancy upregulated non-ubiquitously expressed CaM kinase"", ""pregnancy up-regulated non-ubiquitously expressed CaM kinase"""			12477932	Standard	NM_001039582		Approved	MGC45419, CaMK1b	uc011myu.2	Q6P2M8	OTTHUMG00000024216	ENST00000370150.1:c.494C>G	X.37:g.152937048G>C	ENSP00000359169:p.Ala165Gly	Somatic	101	0		WXS	Illumina HiSeq	Phase_I	66	39	NM_001039582	0	0	0	1	1	B4DJR8|B4E1A6|B7WPG0|D3DWU7|Q8N4R0	Missense_Mutation	SNP	ENST00000370150.1	37		.	.	.	.	.	.	.	.	.	.	g	7.308	0.614372	0.14129	.	.	ENSG00000130822	ENST00000340888;ENST00000370150;ENST00000393831;ENST00000370142;ENST00000370145;ENST00000447676;ENST00000439087;ENST00000422811	T;T;T;T;T;T;T;T	0.65732	-0.17;-0.17;-0.17;-0.17;-0.17;-0.17;-0.17;-0.17	4.91	3.95	0.45737	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.215813	0.29579	N	0.011742	T	0.32734	0.0839	N	0.01789	-0.72	0.28784	N	0.899677	B;B;B;B	0.28350	0.001;0.208;0.026;0.026	B;B;B;B	0.22152	0.01;0.038;0.022;0.022	T	0.31586	-0.9938	10	0.49607	T	0.09	-9.2523	10.6054	0.45392	0.0:0.0:0.689:0.311	.	192;248;182;165	B4DJG4;Q6P2M8-5;B4E1A6;Q6P2M8	.;.;.;KCC1B_HUMAN	G	165;165;165;165;182;248;165;165	ENSP00000340586:A165G;ENSP00000359169:A165G;ENSP00000377417:A165G;ENSP00000359161:A165G;ENSP00000359164:A182G;ENSP00000405950:A248G;ENSP00000415770:A165G;ENSP00000391772:A165G	ENSP00000340586:A165G	A	-	2	0	PNCK	152590242	0.291000	0.24352	0.998000	0.56505	0.864000	0.49448	3.237000	0.51344	2.005000	0.58758	0.529000	0.55759	GCT	.		0.602	PNCK-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000061044.2	NM_198452	
PARP1	142	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	226555997	226555999	+	In_Frame_Del	DEL	GAG	GAG	-	rs369734863		TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	GAG	GAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr1:226555997_226555999delGAG	ENST00000366794.5	-	16	2321_2323	c.2178_2180delCTC	c.(2176-2181)gactct>gat	p.S727del	PARP1_ENST00000490921.1_5'UTR	NM_001618.3	NP_001609.2	P09874	PARP1_HUMAN	poly (ADP-ribose) polymerase 1	727	PARP alpha-helical. {ECO:0000255|PROSITE- ProRule:PRU00398}.				base-excision repair (GO:0006284)|cellular response to insulin stimulus (GO:0032869)|DNA damage response, detection of DNA damage (GO:0042769)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|gene expression (GO:0010467)|macrophage differentiation (GO:0030225)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|protein ADP-ribosylation (GO:0006471)|protein autoprocessing (GO:0016540)|protein poly-ADP-ribosylation (GO:0070212)|regulation of growth rate (GO:0040009)|signal transduction involved in regulation of gene expression (GO:0023019)|telomere maintenance (GO:0000723)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|NAD binding (GO:0051287)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|kidney(4)|large_intestine(8)|lung(15)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	44	Breast(184;0.133)			GBM - Glioblastoma multiforme(131;0.0531)		CAGGATCTGAGAGTCGCTGCTGC	0.562								Poly(ADP-ribose) polymerase (PARP) enzymes that bind to DNA																													p.726_727del		.											.	PARP1-727	0			c.2178_2180del						.																																			SO:0001651	inframe_deletion	142	exon16			.	BC037545	CCDS1554.1	1q41-q42	2010-02-16	2008-07-28	2004-08-26	ENSG00000143799	ENSG00000143799	2.4.2.30	"""Poly (ADP-ribose) polymerases"""	270	protein-coding gene	gene with protein product		173870	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)"", ""poly (ADP-ribose) polymerase family, member 1"""	PPOL, ADPRT		10964595	Standard	NM_001618		Approved	PARP	uc001hqd.4	P09874	OTTHUMG00000037556	ENST00000366794.5:c.2178_2180delCTC	1.37:g.226555997_226555999delGAG	ENSP00000355759:p.Ser727del	Somatic	76	0		WXS	Illumina HiSeq	Phase_I	66	17	NM_001618	0	0	0	0	0	B1ANJ4|Q8IUZ9	In_Frame_Del	DEL	ENST00000366794.5	37	CCDS1554.1																																																																																			.		0.562	PARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091519.1	NM_001618	
C12orf40	283461	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	40076521	40076521	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr12:40076521delA	ENST00000324616.5	+	8	949	c.795delA	c.(793-795)tcafs	p.S265fs	C12orf40_ENST00000405531.3_Frame_Shift_Del_p.S265fs|C12orf40_ENST00000398716.1_Frame_Shift_Del_p.S188fs	NM_001031748.2	NP_001026918.2	Q86WS4	CL040_HUMAN	chromosome 12 open reading frame 40	265										breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(14)|ovary(6)|prostate(1)|skin(2)	38						AAAAACACTCAATACAGCATA	0.353																																					p.S265fs		.											.	C12orf40-96	0			c.795delA						.						133.0	134.0	134.0					12																	40076521		1841	4086	5927	SO:0001589	frameshift_variant	283461	exon8			.	AK097445	CCDS41770.1	12q12	2008-08-04			ENSG00000180116	ENSG00000180116			26846	protein-coding gene	gene with protein product						12477932	Standard	XM_005268806		Approved	FLJ40126	uc001rmc.3	Q86WS4	OTTHUMG00000133567	ENST00000324616.5:c.795delA	12.37:g.40076521delA	ENSP00000317671:p.Ser265fs	Somatic	120	0		WXS	Illumina HiSeq	Phase_I	154	36	NM_001031748	0	0	0	0	0	B7WNU1|Q8IXY6|Q8N818|V9HW02	Frame_Shift_Del	DEL	ENST00000324616.5	37	CCDS41770.1																																																																																			.		0.353	C12orf40-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257664.2	NM_173599	
IGFBP6	3489	broad.mit.edu	37	12	53491528	53491530	+	In_Frame_Del	DEL	GCT	GCT	-			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	GCT	GCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr12:53491528_53491530delGCT	ENST00000301464.3	+	1	300_302	c.27_29delGCT	c.(25-30)ccgctg>ccg	p.L14del	IGFBP6_ENST00000548547.1_In_Frame_Del_p.L14del	NM_002178.2	NP_002169.1	P24592	IBP6_HUMAN	insulin-like growth factor binding protein 6	14					cellular protein metabolic process (GO:0044267)|negative regulation of cell proliferation (GO:0008285)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)				large_intestine(1)|lung(3)|ovary(1)|pancreas(1)	6						tgctgccaccgctgctgctgctg	0.719																																					p.9_10del	Esophageal Squamous(83;1656 1718 30141 34380)												.	IGFBP6-523	0			c.27_29del						.			9,3135		2,5,1565						0.2	0.2			5	39,6279		7,25,3127	no	coding	IGFBP6	NM_002178.2		9,30,4692	A1A1,A1R,RR		0.6173,0.2863,0.5073				48,9414				SO:0001651	inframe_deletion	3489	exon1			GCCACCGCTGCTG		CCDS8846.1	12q13	2008-07-28				ENSG00000167779			5475	protein-coding gene	gene with protein product		146735				1850258, 10087296	Standard	NM_002178		Approved		uc001sbu.1	P24592	OTTHUMG00000169773	ENST00000301464.3:c.27_29delGCT	12.37:g.53491537_53491539delGCT	ENSP00000301464:p.Leu14del	Somatic	67	0		WXS	Illumina HiSeq	Phase_I	102	7	NM_002178	0	0	0	0	0	Q14492	In_Frame_Del	DEL	ENST00000301464.3	37	CCDS8846.1																																																																																			.		0.719	IGFBP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405813.1		
RAI1	10743	broad.mit.edu	37	17	17699993	17699995	+	In_Frame_Del	DEL	GCA	GCA	-			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	GCA	GCA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr17:17699993_17699995delGCA	ENST00000353383.1	+	3	4200_4202	c.3731_3733delGCA	c.(3730-3735)cgcagc>cgc	p.S1249del	RAI1_ENST00000261641.6_In_Frame_Del_p.S1249del	NM_030665.3	NP_109590.3	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	1249	Poly-Ser.				circadian regulation of gene expression (GO:0032922)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer binding (GO:0035326)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(5)|urinary_tract(7)	48				READ - Rectum adenocarcinoma(1115;0.0276)		TTGCGGAGCCGCAGCAGCAGCAG	0.626																																					p.1244_1245del													.	RAI1-91	0			c.3731_3733del						.																																			SO:0001651	inframe_deletion	10743	exon3			GGAGCCGCAGCAG	AJ230819	CCDS11188.1	17p11.2	2011-02-08			ENSG00000108557	ENSG00000108557			9834	protein-coding gene	gene with protein product		607642	"""Smith-Magenis syndrome chromosome region"""	SMCR		10036180	Standard	NM_030665		Approved	DKFZP434A139, SMS, KIAA1820, MGC12824	uc002grm.3	Q7Z5J4	OTTHUMG00000059314	ENST00000353383.1:c.3731_3733delGCA	17.37:g.17700002_17700004delGCA	ENSP00000323074:p.Ser1249del	Somatic	61	0		WXS	Illumina HiSeq	Phase_I	64	7	NM_030665	0	0	0	0	0	Q8N3B4|Q8ND08|Q8WU64|Q96JK5|Q9H1C1|Q9H1C2|Q9UF69	In_Frame_Del	DEL	ENST00000353383.1	37	CCDS11188.1																																																																																			.		0.626	RAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131775.1	NM_030665	
RPS7	6201	bcgsc.ca	37	2	3624203	3624205	+	In_Frame_Del	DEL	GTC	GTC	-	rs61730448	byFrequency	TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	GTC	GTC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr2:3624203_3624205delGTC	ENST00000304921.5	+	4	438_440	c.274_276delGTC	c.(274-276)gtcdel	p.V93del	RPS7_ENST00000403564.1_In_Frame_Del_p.V93del|RPS7_ENST00000406376.1_In_Frame_Del_p.V93del|RPS7_ENST00000407445.3_In_Frame_Del_p.V93del	NM_001011.3	NP_001002.1	P62081	RS7_HUMAN	ribosomal protein S7	93					cellular protein metabolic process (GO:0044267)|cytoplasmic translation (GO:0002181)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosomal small subunit biogenesis (GO:0042274)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|ribosome (GO:0005840)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			endometrium(1)|lung(2)|urinary_tract(1)	4	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)			OV - Ovarian serous cystadenocarcinoma(76;0.0963)|Epithelial(75;0.208)		TGGGAAGCATGTCGTCTTTATCG	0.409																																					p.92_92del													.	RPS7-90	0			c.274_276del						.																																			SO:0001651	inframe_deletion	6201	exon4			AAGCATGTCGTCT		CCDS1648.1	2p25	2011-04-05			ENSG00000171863	ENSG00000171863		"""S ribosomal proteins"""	10440	protein-coding gene	gene with protein product		603658				8522193, 10625621	Standard	NM_001011		Approved	S7	uc002qxw.3	P62081	OTTHUMG00000090305	ENST00000304921.5:c.274_276delGTC	2.37:g.3624206_3624208delGTC	ENSP00000339095:p.Val93del	Somatic	520	3		WXS	Illumina HiSeq	Phase_1	412	99	NM_001011	0	0	0	0	0	P23821|P24818|Q57Z92|Q6IPH1	In_Frame_Del	DEL	ENST00000304921.5	37	CCDS1648.1																																																																																			.		0.409	RPS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206667.1	NM_001011	
ALS2	57679	broad.mit.edu	37	2	202572610	202572610	+	Frame_Shift_Del	DEL	G	G	-			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr2:202572610delG	ENST00000264276.6	-	28	4757	c.4385delC	c.(4384-4386)tctfs	p.S1462fs	ALS2_ENST00000457679.2_3'UTR	NM_020919.3	NP_065970.2	Q96Q42	ALS2_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)	1462					behavioral fear response (GO:0001662)|cell death (GO:0008219)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|locomotory behavior (GO:0007626)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Rab GTPase activity (GO:0032851)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rac protein signal transduction (GO:0035022)|positive regulation of Ran GTPase activity (GO:0032853)|protein localization (GO:0008104)|receptor recycling (GO:0001881)|regulation of endosome size (GO:0051036)|response to oxidative stress (GO:0006979)|synaptic transmission, glutamatergic (GO:0035249)|vesicle organization (GO:0016050)	centrosome (GO:0005813)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome (GO:0005769)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|ruffle (GO:0001726)|vesicle (GO:0031982)	protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activator activity (GO:0043539)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Ran guanyl-nucleotide exchange factor activity (GO:0005087)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(22)|ovary(1)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	72						TGGTGATTCAGATCGGGAATC	0.488																																					p.S1462fs													.	ALS2-275	0			c.4385delC						.						75.0	72.0	73.0					2																	202572610		1869	4110	5979	SO:0001589	frameshift_variant	57679	exon28			GATTCAGATCGGG	AB053305	CCDS42800.1, CCDS46492.1	2q33-q35	2014-09-17	2004-06-23		ENSG00000003393	ENSG00000003393		"""Rho guanine nucleotide exchange factors"""	443	protein-coding gene	gene with protein product	"""alsin"""	606352	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 6"""	ALS2CR6		11586298	Standard	NM_020919		Approved		uc002uyo.3	Q96Q42	OTTHUMG00000154507	ENST00000264276.6:c.4385delC	2.37:g.202572610delG	ENSP00000264276:p.Ser1462fs	Somatic	330	0		WXS	Illumina HiSeq	Phase_I	273	24	NM_020919	0	0	0	0	0	Q53TT1|Q53TV2|Q8N1E0|Q96PC4|Q96Q41|Q9H973|Q9HCK9	Frame_Shift_Del	DEL	ENST00000264276.6	37	CCDS42800.1																																																																																			.		0.488	ALS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335562.3	NM_020919	
ALS2	57679	broad.mit.edu;bcgsc.ca	37	2	202572613	202572623	+	Frame_Shift_Del	DEL	CGGGAATCTGA	CGGGAATCTGA	-	rs374047961		TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	CGGGAATCTGA	CGGGAATCTGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr2:202572613_202572623delCGGGAATCTGA	ENST00000264276.6	-	28	4744_4754	c.4372_4382delTCAGATTCCCG	c.(4372-4383)tcagattcccgafs	p.SDSR1458fs	ALS2_ENST00000457679.2_3'UTR	NM_020919.3	NP_065970.2	Q96Q42	ALS2_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)	1458					behavioral fear response (GO:0001662)|cell death (GO:0008219)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|locomotory behavior (GO:0007626)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Rab GTPase activity (GO:0032851)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rac protein signal transduction (GO:0035022)|positive regulation of Ran GTPase activity (GO:0032853)|protein localization (GO:0008104)|receptor recycling (GO:0001881)|regulation of endosome size (GO:0051036)|response to oxidative stress (GO:0006979)|synaptic transmission, glutamatergic (GO:0035249)|vesicle organization (GO:0016050)	centrosome (GO:0005813)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome (GO:0005769)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|ruffle (GO:0001726)|vesicle (GO:0031982)	protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activator activity (GO:0043539)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Ran guanyl-nucleotide exchange factor activity (GO:0005087)	p.R1461Q(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(22)|ovary(1)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	72						TGATTCAGATCGGGAATCTGACTTCCCAGTG	0.488																																					p.1458_1461del													.	ALS2-275	1	Substitution - Missense(1)	endometrium(1)	c.4372_4382del						.																																			SO:0001589	frameshift_variant	57679	exon28			TCAGATCGGGAAT	AB053305	CCDS42800.1, CCDS46492.1	2q33-q35	2014-09-17	2004-06-23		ENSG00000003393	ENSG00000003393		"""Rho guanine nucleotide exchange factors"""	443	protein-coding gene	gene with protein product	"""alsin"""	606352	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 6"""	ALS2CR6		11586298	Standard	NM_020919		Approved		uc002uyo.3	Q96Q42	OTTHUMG00000154507	ENST00000264276.6:c.4372_4382delTCAGATTCCCG	2.37:g.202572613_202572623delCGGGAATCTGA	ENSP00000264276:p.Ser1458fs	Somatic	333	0		WXS	Illumina HiSeq	Phase_I	253	22	NM_020919	0	0	0	0	0	Q53TT1|Q53TV2|Q8N1E0|Q96PC4|Q96Q41|Q9H973|Q9HCK9	Frame_Shift_Del	DEL	ENST00000264276.6	37	CCDS42800.1																																																																																			.		0.488	ALS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335562.3	NM_020919	
MTMR14	64419	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	9724894	9724896	+	In_Frame_Del	DEL	CCT	CCT	-			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	CCT	CCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr3:9724894_9724896delCCT	ENST00000296003.4	+	10	1052_1054	c.930_932delCCT	c.(928-933)tacctg>tag	p.310_311YL>*	MTMR14_ENST00000351233.5_In_Frame_Del_p.310_311YL>*|MTMR14_ENST00000420925.1_In_Frame_Del_p.64_65YL>*|MTMR14_ENST00000353332.5_In_Frame_Del_p.310_311YL>*	NM_001077525.2	NP_001070993.1	Q8NCE2	MTMRE_HUMAN	myotubularin related protein 14	310					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(3)|kidney(2)|lung(10)|skin(3)|upper_aerodigestive_tract(2)	21	Medulloblastoma(99;0.227)					CACAAAACTACCTGAAGCTGCTG	0.429																																					p.310_311del		.											.	MTMR14-91	0			c.930_932del						.																																			SO:0001651	inframe_deletion	64419	exon10			.	BC001674	CCDS43043.1, CCDS43044.1, CCDS43045.1	3p26	2011-06-09	2006-12-18	2006-12-18	ENSG00000163719	ENSG00000163719		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	26190	protein-coding gene	gene with protein product	"""egg-derived tyrosine phosphatase homolog (Drosophila)"""	611089	"""chromosome 3 open reading frame 29"""	C3orf29		15186772	Standard	NM_022485		Approved	FLJ22405, FLJ90311, hJumpy, hEDTP	uc003brz.3	Q8NCE2	OTTHUMG00000155111	ENST00000296003.4:c.930_932delCCT	3.37:g.9724894_9724896delCCT	ENSP00000296003:p.Tyr310_Leu311delins*	Somatic	289	0		WXS	Illumina HiSeq	Phase_I	141	71	NM_022485	0	0	0	0	0	Q0JTH5|Q0JU83|Q6PIZ4|Q6QE21|Q86VK9|Q8IYK1|Q8TCM7|Q9H6C0	In_Frame_Del	DEL	ENST00000296003.4	37	CCDS43043.1																																																																																			.		0.429	MTMR14-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338435.1	NM_022485	
MTMR14	64419	hgsc.bcm.edu	37	3	9724894	9724897	+	Frame_Shift_Del	DEL	CCTG	CCTG	-			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	CCTG	CCTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr3:9724894_9724897delCCTG	ENST00000296003.4	+	10	1052_1055	c.930_933delCCTG	c.(928-933)tacctgfs	p.YL310fs	MTMR14_ENST00000351233.5_Frame_Shift_Del_p.YL310fs|MTMR14_ENST00000420925.1_Frame_Shift_Del_p.YL64fs|MTMR14_ENST00000353332.5_Frame_Shift_Del_p.YL310fs	NM_001077525.2	NP_001070993.1	Q8NCE2	MTMRE_HUMAN	myotubularin related protein 14	310					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(3)|kidney(2)|lung(10)|skin(3)|upper_aerodigestive_tract(2)	21	Medulloblastoma(99;0.227)					CACAAAACTACCTGAAGCTGCTGC	0.426																																					p.310_311del		.											.	MTMR14-91	0			c.930_933del						.																																			SO:0001589	frameshift_variant	64419	exon10			.	BC001674	CCDS43043.1, CCDS43044.1, CCDS43045.1	3p26	2011-06-09	2006-12-18	2006-12-18	ENSG00000163719	ENSG00000163719		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	26190	protein-coding gene	gene with protein product	"""egg-derived tyrosine phosphatase homolog (Drosophila)"""	611089	"""chromosome 3 open reading frame 29"""	C3orf29		15186772	Standard	NM_022485		Approved	FLJ22405, FLJ90311, hJumpy, hEDTP	uc003brz.3	Q8NCE2	OTTHUMG00000155111	ENST00000296003.4:c.930_933delCCTG	3.37:g.9724894_9724897delCCTG	ENSP00000296003:p.Tyr310fs	Somatic	291	0		WXS	Illumina HiSeq	Phase_I	144	54	NM_022485	0	0	0	0	0	Q0JTH5|Q0JU83|Q6PIZ4|Q6QE21|Q86VK9|Q8IYK1|Q8TCM7|Q9H6C0	Frame_Shift_Del	DEL	ENST00000296003.4	37	CCDS43043.1																																																																																			.		0.426	MTMR14-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338435.1	NM_022485	
AFF4	27125	broad.mit.edu;bcgsc.ca	37	5	132224787	132224791	+	Frame_Shift_Del	DEL	GCTTT	GCTTT	-	rs370588988		TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	GCTTT	GCTTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr5:132224787_132224791delGCTTT	ENST00000265343.5	-	14	3091_3095	c.2712_2716delAAAGC	c.(2710-2718)acaaagcttfs	p.KL905fs		NM_014423.3	NP_055238.1	Q9UHB7	AFF4_HUMAN	AF4/FMR2 family, member 4	905					spermatid development (GO:0007286)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	sequence-specific DNA binding transcription factor activity (GO:0003700)		SEPT8/AFF4(2)	breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(7)|lung(11)|ovary(3)|pancreas(1)|prostate(3)|skin(2)	43		all_cancers(142;0.145)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TCAAAGACAAGCTTTGTTCTCCGAG	0.351																																					p.904_906del	Ovarian(126;889 1733 2942 10745 11605)												.	AFF4-229	0			c.2712_2716del						.																																			SO:0001589	frameshift_variant	27125	exon14			AGACAAGCTTTGT	AF197927	CCDS4164.1	5q31	2006-04-28			ENSG00000072364	ENSG00000072364			17869	protein-coding gene	gene with protein product	"""ALL1 fused gene from 5q31"""	604417				10588740	Standard	XM_005271963		Approved	AF5Q31, MCEF	uc003kyd.3	Q9UHB7	OTTHUMG00000059838	ENST00000265343.5:c.2712_2716delAAAGC	5.37:g.132224787_132224791delGCTTT	ENSP00000265343:p.Lys905fs	Somatic	425	0		WXS	Illumina HiSeq	Phase_I	460	24	NM_014423	0	0	0	0	0	B2RP19|B7WPD2|Q498B2|Q59FB3|Q6P592|Q8TDR1|Q9P0E4	Frame_Shift_Del	DEL	ENST00000265343.5	37	CCDS4164.1																																																																																			.		0.351	AFF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133049.1	NM_014423	
CDHR3	222256	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	105673047	105673047	+	Frame_Shift_Del	DEL	G	G	-			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr7:105673047delG	ENST00000317716.9	+	19	2642	c.2562delG	c.(2560-2562)ctgfs	p.L854fs	CDHR3_ENST00000343407.5_3'UTR|CDHR3_ENST00000542731.1_Frame_Shift_Del_p.L854fs|CDHR3_ENST00000478080.1_Frame_Shift_Del_p.L766fs	NM_152750.4	NP_689963.2	Q6ZTQ4	CDHR3_HUMAN	cadherin-related family member 3	854					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(15)|ovary(1)	23						ATGCTGGTCTGGGTTCCAGAA	0.552																																					p.L854fs		.											.	CDHR3-23	0			c.2562delG						.						68.0	76.0	73.0					7																	105673047		2097	4220	6317	SO:0001589	frameshift_variant	222256	exon19			.	AK126338	CCDS47684.1, CCDS75651.1	7q22.2	2011-07-01			ENSG00000128536	ENSG00000128536		"""Cadherins / Cadherin-related"""	26308	protein-coding gene	gene with protein product		615610					Standard	NM_152750		Approved	FLJ44366, FLJ23834, CDH28	uc003vdl.4	Q6ZTQ4	OTTHUMG00000157520	ENST00000317716.9:c.2562delG	7.37:g.105673047delG	ENSP00000325954:p.Leu854fs	Somatic	175	0		WXS	Illumina HiSeq	Phase_I	170	37	NM_152750	0	0	0	0	0	Q8TCI7	Frame_Shift_Del	DEL	ENST00000317716.9	37	CCDS47684.1																																																																																			.		0.552	CDHR3-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349025.2	NM_152750	
CBLL1	79872	broad.mit.edu	37	7	107393940	107393940	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr7:107393940delT	ENST00000440859.3	+	3	733	c.266delT	c.(265-267)cttfs	p.L89fs	CBLL1_ENST00000222597.2_Frame_Shift_Del_p.L88fs|CBLL1_ENST00000415884.2_Frame_Shift_Del_p.L89fs	NM_001284291.1|NM_024814.2	NP_001271220.1|NP_079090.2	Q75N03	HAKAI_HUMAN	Cbl proto-oncogene-like 1, E3 ubiquitin protein ligase	89					negative regulation of cell adhesion (GO:0007162)|positive regulation of cell migration (GO:0030335)|positive regulation of endocytosis (GO:0045807)|protein ubiquitination (GO:0016567)|single organismal cell-cell adhesion (GO:0016337)	ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(3)|skin(3)	21						CCTGGACACCTTTTTTGGGAC	0.284																																					p.L89fs													.	CBLL1-229	0			c.266delT						.						53.0	58.0	56.0					7																	107393940		2203	4300	6503	SO:0001589	frameshift_variant	79872	exon3			GACACCTTTTTTG	AK026762	CCDS5747.1, CCDS64754.1	7q22.3	2013-07-09	2013-07-09		ENSG00000105879	ENSG00000105879		"""RING-type (C3HC4) zinc fingers"""	21225	protein-coding gene	gene with protein product	"""Casitas B-lineage lymphoma-like"""	606872	"""Cas-Br-M (murine) ecotropic retroviral transforming sequence-like 1"""			11836526, 11944035	Standard	NM_001284291		Approved	HAKAI, FLJ23109, RNF188	uc003veq.3	Q75N03	OTTHUMG00000154809	ENST00000440859.3:c.266delT	7.37:g.107393940delT	ENSP00000401277:p.Leu89fs	Somatic	310	0		WXS	Illumina HiSeq	Phase_I	370	7	NM_024814	0	0	0	0	0	B7ZM03|Q8TAJ4|Q9H5S6	Frame_Shift_Del	DEL	ENST00000440859.3	37	CCDS5747.1																																																																																			.		0.284	CBLL1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337156.2	NM_024814	
DLD	1738	broad.mit.edu;bcgsc.ca	37	7	107556127	107556127	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr7:107556127delA	ENST00000205402.5	+	9	1142	c.861delA	c.(859-861)ggafs	p.G287fs	DLD_ENST00000440410.1_Frame_Shift_Del_p.G264fs|DLD_ENST00000537148.1_Frame_Shift_Del_p.G188fs|DLD_ENST00000437604.2_Frame_Shift_Del_p.G239fs	NM_000108.3	NP_000099.2	P09622	DLDH_HUMAN	dihydrolipoamide dehydrogenase	287					branched-chain amino acid catabolic process (GO:0009083)|cell redox homeostasis (GO:0045454)|cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|gastrulation (GO:0007369)|lysine catabolic process (GO:0006554)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|proteolysis (GO:0006508)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of membrane potential (GO:0042391)|small molecule metabolic process (GO:0044281)|sperm capacitation (GO:0048240)|tricarboxylic acid cycle (GO:0006099)	acrosomal matrix (GO:0043159)|cilium (GO:0005929)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	dihydrolipoyl dehydrogenase activity (GO:0004148)|flavin adenine dinucleotide binding (GO:0050660)			NS(1)|breast(1)|central_nervous_system(1)|kidney(5)|large_intestine(1)|lung(10)|prostate(1)	20					Flavin adenine dinucleotide(DB03147)	AGTCAGATGGAAAAATTGATG	0.308																																					p.G287fs													.	DLD-226	0			c.861delA						.						52.0	54.0	54.0					7																	107556127		2203	4300	6503	SO:0001589	frameshift_variant	1738	exon9			AGATGGAAAAATT	AB209703	CCDS5749.1	7q31-q32	2006-05-22	2006-05-22		ENSG00000091140	ENSG00000091140	1.8.1.4		2898	protein-coding gene	gene with protein product	"""E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate complex, branched chain keto acid dehydrogenase complex"""	238331	"""dihydrolipoamide dehydrogenase (E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate complex, branched chain keto acid dehydrogenase complex)"""	LAD, GCSL			Standard	NM_000108		Approved	DLDH	uc003vet.3	P09622	OTTHUMG00000154813	ENST00000205402.5:c.861delA	7.37:g.107556127delA	ENSP00000205402:p.Gly287fs	Somatic	130	0		WXS	Illumina HiSeq	Phase_I	126	14	NM_000108	0	0	0	0	0	B2R5X0|B4DHG0|B4DT69|Q14131|Q14167|Q59EV8|Q8WTS4	Frame_Shift_Del	DEL	ENST00000205402.5	37	CCDS5749.1																																																																																			.		0.308	DLD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337194.3	NM_000108	
SLC20A2	6575	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	42302170	42302170	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr8:42302170delT	ENST00000342228.3	-	6	1093	c.724delA	c.(724-726)atafs	p.I242fs	SLC20A2_ENST00000520262.1_Frame_Shift_Del_p.I242fs|SLC20A2_ENST00000520179.1_Frame_Shift_Del_p.I242fs	NM_006749.4	NP_006740.1	Q08357	S20A2_HUMAN	solute carrier family 20 (phosphate transporter), member 2	242					ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic phosphate transmembrane transporter activity (GO:0005315)|receptor activity (GO:0004872)|sodium:phosphate symporter activity (GO:0005436)|virus receptor activity (GO:0001618)			breast(1)|endometrium(6)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|stomach(1)	26	all_lung(13;8.33e-12)|Lung NSC(13;1.41e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;5.73e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00419)|Lung(22;0.0302)|LUSC - Lung squamous cell carcinoma(45;0.0869)			ATACCTGTTATTTTCCTCCGC	0.463																																					p.I242X		.											.	SLC20A2-92	0			c.724delA						.						137.0	120.0	126.0					8																	42302170		2203	4300	6503	SO:0001589	frameshift_variant	6575	exon6			.		CCDS6132.1	8p11.21	2013-05-22			ENSG00000168575	ENSG00000168575		"""Solute carriers"""	10947	protein-coding gene	gene with protein product		158378		MLVAR, GLVR2		7745689, 16790504	Standard	NM_001257180		Approved	PiT-2, Glvr-2	uc010lxm.4	Q08357	OTTHUMG00000164169	ENST00000342228.3:c.724delA	8.37:g.42302170delT	ENSP00000340465:p.Ile242fs	Somatic	124	0		WXS	Illumina HiSeq	Phase_I	126	42	NM_001257181	0	0	0	0	0		Nonsense_Mutation	DEL	ENST00000342228.3	37	CCDS6132.1																																																																																			.		0.463	SLC20A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377578.1		
SLC24A2	25769	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	19516367	19516367	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr9:19516367delA	ENST00000341998.2	-	10	1831	c.1770delT	c.(1768-1770)attfs	p.I590fs	SLC24A2_ENST00000286344.3_Frame_Shift_Del_p.I573fs	NM_001193288.2|NM_020344.3	NP_001180217.1|NP_065077.1	Q9UI40	NCKX2_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 2	590					cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)	cadmium ion binding (GO:0046870)|calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium, potassium:sodium antiporter activity (GO:0008273)|manganese ion binding (GO:0030145)|nickel cation binding (GO:0016151)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|symporter activity (GO:0015293)			endometrium(3)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33				GBM - Glioblastoma multiforme(1;1.67e-55)|Lung(42;0.0443)		GGAATCTGTGAATGACGGTGT	0.547																																					p.I590fs		.											.	SLC24A2-517	0			c.1770delT						.						47.0	44.0	45.0					9																	19516367		2203	4300	6503	SO:0001589	frameshift_variant	25769	exon10			.	AF097366	CCDS6493.1, CCDS55297.1	9p22.1	2013-05-22			ENSG00000155886	ENSG00000155886		"""Solute carriers"""	10976	protein-coding gene	gene with protein product		609838				10662833	Standard	NM_020344		Approved	NCKX2	uc003zoa.2	Q9UI40	OTTHUMG00000019646	ENST00000341998.2:c.1770delT	9.37:g.19516367delA	ENSP00000344801:p.Ile590fs	Somatic	97	0		WXS	Illumina HiSeq	Phase_I	86	29	NM_020344	0	0	0	0	0	B7ZLL8|Q9NTN5|Q9NZQ4	Frame_Shift_Del	DEL	ENST00000341998.2	37	CCDS6493.1																																																																																			.		0.547	SLC24A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051866.2	NM_020344	
PRDX6	9588	bcgsc.ca	37	1	173454533	173454534	+	Frame_Shift_Ins	INS	-	-	AAAAAAA			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr1:173454533_173454534insAAAAAAA	ENST00000340385.5	+	3	418_419	c.286_287insAAAAAAA	c.(286-288)gaafs	p.-96fs	PRDX6_ENST00000470017.1_3'UTR	NM_004905.2	NP_004896.1	P30041	PRDX6_HUMAN	peroxiredoxin 6						hydrogen peroxide catabolic process (GO:0042744)|phospholipid catabolic process (GO:0009395)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|membrane (GO:0016020)	antioxidant activity (GO:0016209)|glutathione peroxidase activity (GO:0004602)|peroxiredoxin activity (GO:0051920)|phospholipase A2 activity (GO:0004623)	p.E96*(1)		NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(5)|urinary_tract(1)	12						AGAGCCCACAGAAAAGTTACCT	0.441																																					p.E96fs													.	PRDX6-186	1	Substitution - Nonsense(1)	urinary_tract(1)	c.286_287insAAAAAAA						.																																			SO:0001589	frameshift_variant	9588	exon3			CCCACAGAAAAGT	D14662	CCDS1307.1	1q24.1	2008-02-05			ENSG00000117592	ENSG00000117592			16753	protein-coding gene	gene with protein product		602316				11233154	Standard	NM_004905		Approved	AOP2, KIAA0106, 1-Cys, NSGPx, PRX, aiPLA2, MGC46173, p29	uc001giy.1	P30041	OTTHUMG00000034804	Exception_encountered	1.37:g.173454533_173454534insAAAAAAA	ENSP00000342026:p.Glu96fs	Somatic	152	0		WXS	Illumina HiSeq	Phase_1	131	0	NM_004905	0	0	0	0	0	A8JZY7|P32077|Q5TAH4|Q5ZEZ8	Frame_Shift_Ins	INS	ENST00000340385.5	37	CCDS1307.1																																																																																			.		0.441	PRDX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084222.1	NM_004905	
PLCZ1	89869	hgsc.bcm.edu;bcgsc.ca	37	12	18876363	18876364	+	Frame_Shift_Ins	INS	-	-	T			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr12:18876363_18876364insT	ENST00000266505.7	-	4	511_512	c.248_249insA	c.(247-249)aacfs	p.N83fs	PLCZ1_ENST00000447925.2_Frame_Shift_Ins_p.N81fs|PLCZ1_ENST00000435379.1_Intron|PLCZ1_ENST00000539875.1_Intron|RP11-361I14.2_ENST00000536931.1_RNA					phospholipase C, zeta 1											NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	31	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)					GAATTTTCCGGTTTTCAGAATA	0.332																																					p.N83fs		.											.	PLCZ1-228	0			c.249_250insA						.																																			SO:0001589	frameshift_variant	89869	exon4			.	AY035866	CCDS8680.1	12p13.31	2013-01-10			ENSG00000139151	ENSG00000139151	3.1.4.11	"""EF-hand domain containing"""	19218	protein-coding gene	gene with protein product		608075				12117804	Standard	NM_033123		Approved	NYD-SP27, PLCzeta	uc021qvx.2	Q86YW0	OTTHUMG00000168937	ENST00000266505.7:c.249dupA	12.37:g.18876367_18876367dupT	ENSP00000266505:p.Asn83fs	Somatic	108	0		WXS	Illumina HiSeq	Phase_I	171	46	NM_033123	0	0	0	0	0		Frame_Shift_Ins	INS	ENST00000266505.7	37	CCDS8680.1																																																																																			.		0.332	PLCZ1-001	KNOWN	NAGNAG_splice_site|non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000401667.3	NM_033123	
MCF2L	23263	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	13	113719317	113719318	+	Frame_Shift_Ins	INS	-	-	G			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr13:113719317_113719318insG	ENST00000375608.3	+	8	822_823	c.764_765insG	c.(763-768)ctggctfs	p.A256fs	MCF2L_ENST00000397030.1_Frame_Shift_Ins_p.A259fs|MCF2L_ENST00000375601.3_Frame_Shift_Ins_p.A230fs|MCF2L_ENST00000535094.2_Frame_Shift_Ins_p.A226fs|MCF2L_ENST00000375597.4_Frame_Shift_Ins_p.A224fs|MCF2L_ENST00000375604.2_Frame_Shift_Ins_p.A283fs|MCF2L_ENST00000442652.2_Frame_Shift_Ins_p.A256fs|MCF2L_ENST00000423482.2_Frame_Shift_Ins_p.A224fs|MCF2L_ENST00000434480.2_Frame_Shift_Ins_p.A232fs|MCF2L_ENST00000421756.1_Frame_Shift_Ins_p.A230fs			O15068	MCF2L_HUMAN	MCF.2 cell line derived transforming sequence-like	256					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular space (GO:0005615)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			kidney(1)|large_intestine(5)|ovary(1)|stomach(1)	8	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0368)|all_epithelial(44;0.0396)|Lung NSC(25;0.129)|Breast(118;0.188)				GGGACCGAGCTGGCTGAAACAG	0.564																																					p.L225fs		.											.	MCF2L-228	0			c.674_675insG						.																																			SO:0001589	frameshift_variant	23263	exon7			.	AB002360	CCDS9527.2, CCDS45070.1, CCDS9527.3, CCDS45070.2	13q34	2013-01-10			ENSG00000126217	ENSG00000126217		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14576	protein-coding gene	gene with protein product		609499				9205841	Standard	NM_001112732		Approved	KIAA0362, DBS, OST, ARHGEF14	uc010tjr.2	O15068	OTTHUMG00000017377	ENST00000375608.3:c.766dupG	13.37:g.113719319_113719319dupG	ENSP00000364758:p.Ala256fs	Somatic	106	0		WXS	Illumina HiSeq	Phase_I	76	16	NM_001112732	0	0	0	0	0	A2A2X1|A2A2X2|A2A3G6|A2A3G8|B4DHD6|B4DIL6|E9PDN8|Q5JU56|Q5VXT1|Q6ZWD4|Q765G8|Q765G9|Q8N679	Frame_Shift_Ins	INS	ENST00000375608.3	37																																																																																				.		0.564	MCF2L-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045849.4		
HOXB4	3214	hgsc.bcm.edu;bcgsc.ca	37	17	46655633	46655634	+	In_Frame_Ins	INS	-	-	CTT			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr17:46655633_46655634insCTT	ENST00000332503.5	-	1	1839_1840	c.48_49insAAG	c.(46-51)aagttc>aagAAGttc	p.16_17insK	HOXB-AS3_ENST00000465846.2_RNA|HOXB3_ENST00000552000.2_Intron|HOXB3_ENST00000498678.1_Intron|HOXB3_ENST00000460160.1_Intron|HOXB3_ENST00000489475.1_Intron|HOXB3_ENST00000465120.3_Intron|MIR10A_ENST00000385043.1_RNA|HOXB3_ENST00000476342.1_Intron|HOXB3_ENST00000472863.1_Intron	NM_024015.4	NP_076920.1	P17483	HXB4_HUMAN	homeobox B4	16	Pro-rich (part of the transcriptional activation domain).				anterior/posterior pattern specification (GO:0009952)|bone marrow development (GO:0048539)|cell proliferation (GO:0008283)|definitive hemopoiesis (GO:0060216)|embryonic skeletal system morphogenesis (GO:0048704)|hematopoietic stem cell differentiation (GO:0060218)|morphogenesis of an epithelial sheet (GO:0002011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of stem cell differentiation (GO:2000738)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|somatic stem cell division (GO:0048103)|spleen development (GO:0048536)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|urinary_tract(2)	9						CATGGAGGGAACTTGGGGTCGA	0.5																																					p.F17delinsKF		.											.	HOXB4-515	0			c.49_50insAAG						.																																			SO:0001652	inframe_insertion	3214	exon1			.		CCDS11529.1	17q21.32	2011-06-20	2005-12-22		ENSG00000182742	ENSG00000182742		"""Homeoboxes / ANTP class : HOXL subclass"""	5115	protein-coding gene	gene with protein product		142965	"""homeo box B4"""	HOX2, HOX2F		1973146, 1358459	Standard	NM_024015		Approved		uc002inp.3	P17483	OTTHUMG00000159920	ENST00000332503.5:c.46_48dupAAG	17.37:g.46655634_46655636dupCTT	ENSP00000328928:p.Lys16_Lys16dup	Somatic	166	0		WXS	Illumina HiSeq	Phase_I	188	36	NM_024015	0	0	0	0	0	Q9NTA0	In_Frame_Ins	INS	ENST00000332503.5	37	CCDS11529.1																																																																																			.		0.500	HOXB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358259.2		
REV1	51455	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	100019396	100019397	+	Frame_Shift_Ins	INS	-	-	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr2:100019396_100019397insA	ENST00000258428.3	-	20	3567_3568	c.3339_3340insT	c.(3337-3342)attgatfs	p.D1114fs	REV1_ENST00000393445.3_Frame_Shift_Ins_p.D1113fs|REV1_ENST00000465835.1_5'Flank|RP11-527J8.1_ENST00000608144.1_RNA	NM_001037872.1|NM_016316.2	NP_001032961.1|NP_057400.1	Q9UBZ9	REV1_HUMAN	REV1, polymerase (DNA directed)	1114					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)|error-prone translesion synthesis (GO:0042276)|response to UV (GO:0009411)	nucleoplasm (GO:0005654)	damaged DNA binding (GO:0003684)|deoxycytidyl transferase activity (GO:0017125)|DNA-directed DNA polymerase activity (GO:0003887)|magnesium ion binding (GO:0000287)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(12)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						AGAAACCCATCAATTAACTTCT	0.421								Direct reversal of damage																													p.D1114_G1115delinsX		.											.	REV1-92	0			c.3340_3341insT						.																																			SO:0001589	frameshift_variant	51455	exon20			.	AF206019	CCDS2045.1, CCDS42722.1	2q11.1-q11.2	2012-05-18	2012-05-18	2006-11-07	ENSG00000135945	ENSG00000135945		"""DNA polymerases"""	14060	protein-coding gene	gene with protein product		606134	"""REV1 (yeast homolog)- like"", ""REV1-like (yeast)"", ""REV1 homolog (S. cerevisiae)"""	REV1L		10536157	Standard	XM_005263968		Approved		uc002tad.3	Q9UBZ9	OTTHUMG00000130636	ENST00000258428.3:c.3340dupT	2.37:g.100019398_100019398dupA	ENSP00000258428:p.Asp1114fs	Somatic	124	0		WXS	Illumina HiSeq	Phase_I	98	27	NM_016316	0	0	0	0	0	O95941|Q53SI7|Q9C0J4|Q9NUP2	Nonsense_Mutation	INS	ENST00000258428.3	37	CCDS2045.1																																																																																			.		0.421	REV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253123.2	NM_016316	
MTMR14	64419	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	9724897	9724898	+	Frame_Shift_Ins	INS	-	-	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr3:9724897_9724898insA	ENST00000296003.4	+	10	1055_1056	c.933_934insA	c.(934-936)aagfs	p.K312fs	MTMR14_ENST00000351233.5_Frame_Shift_Ins_p.K312fs|MTMR14_ENST00000420925.1_Frame_Shift_Ins_p.K66fs|MTMR14_ENST00000353332.5_Frame_Shift_Ins_p.K312fs	NM_001077525.2	NP_001070993.1	Q8NCE2	MTMRE_HUMAN	myotubularin related protein 14	312					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(3)|kidney(2)|lung(10)|skin(3)|upper_aerodigestive_tract(2)	21	Medulloblastoma(99;0.227)					AAAACTACCTGAAGCTGCTGCT	0.431																																					p.L311fs		.											.	MTMR14-91	0			c.933_934insA						.																																			SO:0001589	frameshift_variant	64419	exon10			.	BC001674	CCDS43043.1, CCDS43044.1, CCDS43045.1	3p26	2011-06-09	2006-12-18	2006-12-18	ENSG00000163719	ENSG00000163719		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	26190	protein-coding gene	gene with protein product	"""egg-derived tyrosine phosphatase homolog (Drosophila)"""	611089	"""chromosome 3 open reading frame 29"""	C3orf29		15186772	Standard	NM_022485		Approved	FLJ22405, FLJ90311, hJumpy, hEDTP	uc003brz.3	Q8NCE2	OTTHUMG00000155111	ENST00000296003.4:c.935dupA	3.37:g.9724899_9724899dupA	ENSP00000296003:p.Lys312fs	Somatic	291	0		WXS	Illumina HiSeq	Phase_I	143	67	NM_022485	0	0	0	0	0	Q0JTH5|Q0JU83|Q6PIZ4|Q6QE21|Q86VK9|Q8IYK1|Q8TCM7|Q9H6C0	Frame_Shift_Ins	INS	ENST00000296003.4	37	CCDS43043.1																																																																																			.		0.431	MTMR14-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338435.1	NM_022485	
SETD2	29072	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	47165390	47165391	+	Frame_Shift_Ins	INS	-	-	A			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr3:47165390_47165391insA	ENST00000409792.3	-	3	777_778	c.735_736insT	c.(733-738)attgtafs	p.V246fs		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	246	Pro-rich.				angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		GATTCTGGTACAATTATAATTG	0.381			"""N, F, S, Mis"""		clear cell renal carcinoma																																p.V246fs		.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	.	SETD2-1273	0			c.736_737insT						.																																			SO:0001589	frameshift_variant	29072	exon3			.	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.736dupT	3.37:g.47165392_47165392dupA	ENSP00000386759:p.Val246fs	Somatic	72	0		WXS	Illumina HiSeq	Phase_I	52	30	NM_014159	0	0	0	0	0	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Frame_Shift_Ins	INS	ENST00000409792.3	37	CCDS2749.2																																																																																			.		0.381	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
PIR	8544	broad.mit.edu;bcgsc.ca	37	X	15403223	15403224	+	In_Frame_Ins	INS	-	-	TCA			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chrX:15403223_15403224insTCA	ENST00000380421.3	-	10	1235_1236	c.775_776insTGA	c.(775-777)aac>aTGAac	p.258_259insM	PIR_ENST00000380420.5_In_Frame_Ins_p.258_259insM|FIGF_ENST00000297904.3_5'Flank	NM_001018109.2|NM_003662.3	NP_001018119.1|NP_003653.1	O00625	PIR_HUMAN	pirin (iron-binding nuclear protein)	258					monocyte differentiation (GO:0030224)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|quercetin 2,3-dioxygenase activity (GO:0008127)|transcription cofactor activity (GO:0003712)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	9	Hepatocellular(33;0.183)					TTCATTGGTGTTCATCACAAAT	0.376																																					p.N259delinsMN	Ovarian(180;1587 2015 10555 34192 51653)												.	PIR-131	0			c.776_777insTGA						.																																			SO:0001652	inframe_insertion	8544	exon10			TTGGTGTTCATCA	Y07868	CCDS14167.1	Xp22.31	2008-02-05			ENSG00000087842	ENSG00000087842			30048	protein-coding gene	gene with protein product		300931				9079676	Standard	NM_003662		Approved		uc004cwv.3	O00625	OTTHUMG00000021176	ENST00000380421.3:c.773_775dupTGA	X.37:g.15403227_15403229dupTCA	ENSP00000369786:p.Met258_Met258dup	Somatic	41	0		WXS	Illumina HiSeq	Phase_I	28	9	NM_001018109	0	0	0	0	0	Q5U0G0|Q6FHD2	In_Frame_Ins	INS	ENST00000380421.3	37	CCDS14167.1																																																																																			.		0.376	PIR-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055863.1	NM_003662	
OR5P2	120065	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	11	7818418	7818419	+	Missense_Mutation	DNP	TG	TG	AA			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	TG	TG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr11:7818418_7818419TG>AA	ENST00000329434.2	-	1	101_102	c.71_72CA>TT	c.(70-72)cCA>cTT	p.P24L	RP11-35J10.5_ENST00000527565.1_lincRNA	NM_153444.1	NP_703145.1	Q8WZ92	OR5P2_HUMAN	olfactory receptor, family 5, subfamily P, member 2	24						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)	22				Epithelial(150;8.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CTCGAAGGATTGGATCATCTGT	0.426																																					p.P24L		.											.	OR5P2-496	0			c.C71T						.																																			SO:0001583	missense	120065	exon1			AGGATTGGATCAT	AF173006	CCDS7782.1	11p15.4	2012-08-09			ENSG00000183303	ENSG00000183303		"""GPCR / Class A : Olfactory receptors"""	14783	protein-coding gene	gene with protein product							Standard	NM_153444		Approved	JCG3	uc001mfp.1	Q8WZ92	OTTHUMG00000165668	ENST00000329434.2:c.71_72delinsAA	11.37:g.7818418_7818419delinsAA	ENSP00000331823:p.Pro24Leu	Somatic	67.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	15.0	NM_153444	0	0	0	0	0	Q3MIS8	Missense_Mutation	DNP	ENST00000329434.2	37	CCDS7782.1																																																																																			.		0.426	OR5P2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385696.1	NM_153444	
KCNE3	10008	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	74168349	74168350	+	Missense_Mutation	DNP	TT	TT	AA			TCGA-B1-A656-01A-11D-A31X-10	TCGA-B1-A656-10A-01D-A31X-10	TT	TT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2ac9225b-09f2-40d9-8d53-3287fa4779b7	1b3cf7d6-8f3d-472a-958f-0e800ef04ce3	g.chr11:74168349_74168350TT>AA	ENST00000310128.4	-	3	678_679	c.259_260AA>TT	c.(259-261)AAg>TTg	p.K87L	RP11-702H23.4_ENST00000533008.1_RNA|KCNE3_ENST00000525550.1_Missense_Mutation_p.K87L|RP11-702H23.6_ENST00000530510.1_RNA	NM_005472.4	NP_005463.1	Q9Y6H6	KCNE3_HUMAN	potassium voltage-gated channel, Isk-related family, member 3	87					regulation of potassium ion transport (GO:0043266)	integral component of membrane (GO:0016021)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)			cervix(1)|large_intestine(1)|lung(1)|ovary(1)	4	Breast(11;2.86e-06)					GTCACTACGCTTGTCCACTTTG	0.495																																					p.K87L		.											.	KCNE3-69	0			c.A259T						.																																			SO:0001583	missense	10008	exon3			TACGCTTGTCCAC	AF076531	CCDS8232.1	11q13.4	2014-09-17				ENSG00000175538		"""Potassium channels"""	6243	protein-coding gene	gene with protein product		604433				10219239	Standard	NM_005472		Approved	MiRP2, HOKPP	uc001ovc.3	Q9Y6H6		ENST00000310128.4:c.259_260delinsAA	11.37:g.74168349_74168350delinsAA	ENSP00000310557:p.Lys87Leu	Somatic	120.0	0.0		WXS	Illumina HiSeq	Phase_I	87.0	19.0	NM_005472	0	0	0	0	0		Missense_Mutation	DNP	ENST00000310128.4	37	CCDS8232.1																																																																																			.		0.495	KCNE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385531.1	NM_005472	
