#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CCNL2	81669	hgsc.bcm.edu;broad.mit.edu	37	1	1334456	1334456	+	Silent	SNP	G	G	A	rs374243154		TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr1:1334456G>A	ENST00000400809.3	-	1	236	c.231C>T	c.(229-231)ctC>ctT	p.L77L	CCNL2_ENST00000408952.5_5'Flank|RP4-758J18.2_ENST00000576232.1_5'Flank|RP4-758J18.2_ENST00000444362.1_5'Flank|CCNL2_ENST00000408918.4_Silent_p.L77L|MRPL20_ENST00000493287.1_5'Flank|RP4-758J18.2_ENST00000448629.2_5'Flank	NM_030937.4	NP_112199.2	Q96S94	CCNL2_HUMAN	cyclin L2	77					regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(3)|ovary(2)|prostate(2)	13	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;2.03e-36)|OV - Ovarian serous cystadenocarcinoma(86;4.17e-22)|Colorectal(212;0.000159)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.0023)|BRCA - Breast invasive adenocarcinoma(365;0.00465)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0342)|Lung(427;0.146)		CCACCACGCGGAGGTCGGTCT	0.692																																					p.L77L		.											.	CCNL2-70	0			c.C231T						.	G	,	0,4404		0,0,2202	52.0	43.0	46.0		231,231	0.9	0.1	1		46	1,8599		0,1,4299	no	coding-synonymous,coding-synonymous	CCNL2	NM_001039577.3,NM_030937.4	,	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	,	77/227,77/521	1334456	1,13003	2202	4300	6502	SO:0001819	synonymous_variant	81669	exon1			CACGCGGAGGTCG	AF251294	CCDS30557.1, CCDS30558.1	1p36.33	2014-07-03			ENSG00000221978	ENSG00000221978			20570	protein-coding gene	gene with protein product	"""cyclin S"""	613482	"""cyclin M"""	CCNM		14725631	Standard	NM_030937		Approved	ania-6b, PCEE, SB138, HLA-ISO, CCNS	uc001afi.2	Q96S94	OTTHUMG00000002917	ENST00000400809.3:c.231C>T	1.37:g.1334456G>A		Somatic	46	0		WXS	Illumina HiSeq	Phase_I	47	16	NM_030937	0	0	28	63	35	A8K8A3|B1B152|Q5T2N5|Q5T2N6|Q6IQ12|Q7Z4Z8|Q8N3C9|Q8N3D5|Q8NHE3|Q8TEL0|Q96B00	Silent	SNP	ENST00000400809.3	37	CCDS30557.1																																																																																			.		0.692	CCNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008146.2	NM_030937	
CCNL2	81669	hgsc.bcm.edu;broad.mit.edu	37	1	1334592	1334592	+	Missense_Mutation	SNP	G	G	A			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr1:1334592G>A	ENST00000400809.3	-	1	100	c.95C>T	c.(94-96)tCg>tTg	p.S32L	CCNL2_ENST00000408952.5_5'Flank|RP4-758J18.2_ENST00000576232.1_5'Flank|RP4-758J18.2_ENST00000444362.1_5'Flank|CCNL2_ENST00000408918.4_Missense_Mutation_p.S32L|MRPL20_ENST00000493287.1_5'Flank|RP4-758J18.2_ENST00000448629.2_5'Flank	NM_030937.4	NP_112199.2	Q96S94	CCNL2_HUMAN	cyclin L2	32					regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(3)|ovary(2)|prostate(2)	13	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;2.03e-36)|OV - Ovarian serous cystadenocarcinoma(86;4.17e-22)|Colorectal(212;0.000159)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.0023)|BRCA - Breast invasive adenocarcinoma(365;0.00465)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0342)|Lung(427;0.146)		CACCCCCTGCGACCCTGAGGG	0.711																																					p.S32L		.											.	CCNL2-70	0			c.C95T						.						39.0	35.0	36.0					1																	1334592		2202	4300	6502	SO:0001583	missense	81669	exon1			CCCTGCGACCCTG	AF251294	CCDS30557.1, CCDS30558.1	1p36.33	2014-07-03			ENSG00000221978	ENSG00000221978			20570	protein-coding gene	gene with protein product	"""cyclin S"""	613482	"""cyclin M"""	CCNM		14725631	Standard	NM_030937		Approved	ania-6b, PCEE, SB138, HLA-ISO, CCNS	uc001afi.2	Q96S94	OTTHUMG00000002917	ENST00000400809.3:c.95C>T	1.37:g.1334592G>A	ENSP00000383611:p.Ser32Leu	Somatic	49	0		WXS	Illumina HiSeq	Phase_I	63	28	NM_030937	0	0	16	31	15	A8K8A3|B1B152|Q5T2N5|Q5T2N6|Q6IQ12|Q7Z4Z8|Q8N3C9|Q8N3D5|Q8NHE3|Q8TEL0|Q96B00	Missense_Mutation	SNP	ENST00000400809.3	37	CCDS30557.1	.	.	.	.	.	.	.	.	.	.	G	9.593	1.126618	0.20959	.	.	ENSG00000221978	ENST00000400809;ENST00000408918	T;T	0.45668	1.45;0.89	2.66	1.69	0.24217	.	0.620701	0.13809	N	0.361266	T	0.34571	0.0902	L	0.50333	1.59	0.45762	D	0.998651	B;B;B;B	0.25390	0.076;0.038;0.076;0.125	B;B;B;B	0.16722	0.012;0.016;0.007;0.016	T	0.18461	-1.0336	10	0.48119	T	0.1	.	9.3386	0.38065	0.0:0.2214:0.7786:0.0	.	32;32;32;32	F2Z3J5;C9J148;Q96S94;Q96S94-2	.;.;CCNL2_HUMAN;.	L	32	ENSP00000383611:S32L;ENSP00000386158:S32L	ENSP00000383611:S32L	S	-	2	0	CCNL2	1324455	0.139000	0.22563	0.041000	0.18516	0.007000	0.05969	3.167000	0.50793	0.644000	0.30656	0.591000	0.81541	TCG	.		0.711	CCNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008146.2	NM_030937	
PLEKHG5	57449	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	6528353	6528353	+	Missense_Mutation	SNP	C	C	T			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr1:6528353C>T	ENST00000400915.3	-	21	2777	c.2711G>A	c.(2710-2712)cGa>cAa	p.R904Q	TNFRSF25_ENST00000356876.3_5'Flank|PLEKHG5_ENST00000537245.1_Missense_Mutation_p.R927Q|PLEKHG5_ENST00000400913.1_Missense_Mutation_p.R848Q|PLEKHG5_ENST00000377728.3_Missense_Mutation_p.R848Q|TNFRSF25_ENST00000377782.3_5'Flank|PLEKHG5_ENST00000377740.3_Intron|PLEKHG5_ENST00000535355.1_Missense_Mutation_p.R917Q|PLEKHG5_ENST00000377732.1_Missense_Mutation_p.R885Q|PLEKHG5_ENST00000377737.2_Missense_Mutation_p.R848Q|PLEKHG5_ENST00000544978.1_Missense_Mutation_p.R848Q|TNFRSF25_ENST00000351959.5_5'Flank|PLEKHG5_ENST00000377748.1_Missense_Mutation_p.R925Q|TNFRSF25_ENST00000461703.2_5'Flank|PLEKHG5_ENST00000377725.1_Missense_Mutation_p.R848Q|TNFRSF25_ENST00000348333.3_5'Flank|PLEKHG5_ENST00000340850.5_Missense_Mutation_p.R848Q|TNFRSF25_ENST00000351748.3_5'Flank	NM_001042663.1	NP_001036128.1	O94827	PKHG5_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 5	904					apoptotic signaling pathway (GO:0097190)|endothelial cell chemotaxis (GO:0035767)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			liver(1)	1	Ovarian(185;0.02)|all_lung(157;0.154)	all_cancers(23;1.7e-35)|all_epithelial(116;2.78e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Colorectal(325;4.47e-05)|all_hematologic(16;0.00014)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0448)		Epithelial(90;5.51e-35)|GBM - Glioblastoma multiforme(13;3.57e-27)|Colorectal(212;6.23e-08)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000894)|BRCA - Breast invasive adenocarcinoma(365;0.00107)|STAD - Stomach adenocarcinoma(132;0.00159)|READ - Rectum adenocarcinoma(331;0.0419)		GGAAGGAACTCGTGGGGACTC	0.662																																					p.R927Q		.											.	PLEKHG5-652	0			c.G2780A						.						13.0	15.0	14.0					1																	6528353		2184	4290	6474	SO:0001583	missense	57449	exon21			GGAACTCGTGGGG	AK024676	CCDS79.1, CCDS41240.1, CCDS41241.1, CCDS57967.1, CCDS57968.1, CCDS57969.1	1p36.31	2014-09-17		2005-08-09	ENSG00000171680	ENSG00000171680		"""Pleckstrin homology (PH) domain containing"""	29105	protein-coding gene	gene with protein product	"""synectin-binding guanine exchange factor"""	611101				17564964	Standard	NM_001042663		Approved	KIAA0720, Syx, GEF720, Tech	uc010nzr.1	O94827	OTTHUMG00000000905	ENST00000400915.3:c.2711G>A	1.37:g.6528353C>T	ENSP00000383706:p.Arg904Gln	Somatic	25	0		WXS	Illumina HiSeq	Phase_I	18	8	NM_001265592	0	0	13	28	15	B3KU07|B7Z2M3|B7Z5X2|F5GZ21|F5H1I0|Q5SY17|Q5T8W5|Q5T8W9|Q6ZNM0|Q7Z436|Q86YD8|Q96BS1	Missense_Mutation	SNP	ENST00000400915.3	37	CCDS41241.1	.	.	.	.	.	.	.	.	.	.	C	0.669	-0.802826	0.02841	.	.	ENSG00000171680	ENST00000377748;ENST00000340850;ENST00000400913;ENST00000400915;ENST00000377732;ENST00000377728;ENST00000377725;ENST00000535355;ENST00000377737;ENST00000535966;ENST00000537245;ENST00000544978	T;T;T;T;T;T;T;T;T;T;T	0.64438	-0.1;-0.1;-0.1;-0.1;-0.1;-0.1;-0.1;-0.1;-0.1;-0.1;-0.1	4.88	-8.23	0.01033	.	0.885603	0.10069	N	0.719935	T	0.21921	0.0528	N	0.02539	-0.55	0.09310	N	1	B;B;B;B	0.13594	0.008;0.0;0.008;0.002	B;B;B;B	0.04013	0.001;0.0;0.001;0.0	T	0.25984	-1.0116	10	0.11182	T	0.66	-0.2459	2.6352	0.04956	0.1692:0.3187:0.354:0.158	.	917;848;925;904	F5GZ21;O94827-4;O94827-2;O94827	.;.;.;PKHG5_HUMAN	Q	925;848;848;904;885;848;848;917;848;754;927;848	ENSP00000366977:R925Q;ENSP00000344570:R848Q;ENSP00000383704:R848Q;ENSP00000383706:R904Q;ENSP00000366961:R885Q;ENSP00000366957:R848Q;ENSP00000366954:R848Q;ENSP00000441445:R917Q;ENSP00000366966:R848Q;ENSP00000439625:R927Q;ENSP00000437710:R848Q	ENSP00000344570:R848Q	R	-	2	0	PLEKHG5	6450940	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	-1.455000	0.02379	-1.208000	0.02634	-2.049000	0.00408	CGA	.		0.662	PLEKHG5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000002631.1	NM_020631	
PRAMEF1	65121	hgsc.bcm.edu;broad.mit.edu	37	1	12854436	12854436	+	Silent	SNP	G	G	C			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr1:12854436G>C	ENST00000332296.7	+	3	763	c.660G>C	c.(658-660)ctG>ctC	p.L220L	PRAMEF1_ENST00000400814.3_5'Flank	NM_023013.2	NP_075389.1	O95521	PRAM1_HUMAN	PRAME family member 1	220					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	35	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GGCCACGTCTGATAAGAAAGC	0.393																																					p.L220L		.											.	PRAMEF1-22	0			c.G660C						.						271.0	250.0	257.0					1																	12854436		2203	4300	6503	SO:0001819	synonymous_variant	65121	exon3			ACGTCTGATAAGA	AL049686	CCDS148.1	1p36.21	2013-01-17			ENSG00000116721	ENSG00000116721		"""-"""	28840	protein-coding gene	gene with protein product							Standard	NM_023013		Approved		uc001auj.2	O95521	OTTHUMG00000001928	ENST00000332296.7:c.660G>C	1.37:g.12854436G>C		Somatic	789	1		WXS	Illumina HiSeq	Phase_I	1313	504	NM_023013	0	0	0	0	0	Q9UQP2	Silent	SNP	ENST00000332296.7	37	CCDS148.1																																																																																			.		0.393	PRAMEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005458.1	NM_023013	
THRAP3	9967	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	36748232	36748232	+	Missense_Mutation	SNP	G	G	A	rs148045717		TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr1:36748232G>A	ENST00000354618.5	+	3	292	c.68G>A	c.(67-69)cGt>cAt	p.R23H	THRAP3_ENST00000469141.2_Missense_Mutation_p.R23H	NM_005119.3	NP_005110.2	Q9Y2W1	TR150_HUMAN	thyroid hormone receptor associated protein 3	23	Arg-rich.|Required for mRNA splicing activation.|Ser-rich.				androgen receptor signaling pathway (GO:0030521)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|mRNA processing (GO:0006397)|mRNA stabilization (GO:0048255)|nuclear-transcribed mRNA catabolic process (GO:0000956)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|phosphoprotein binding (GO:0051219)|poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(5)|stomach(1)	37		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				TCAAGATCTCGTTCTCGTTCA	0.453			T	USP6	aneurysmal bone cysts																																p.R23H	Pancreas(129;785 1795 20938 23278 32581)	.		Dom	yes		1	1p34.3	9967	thyroid hormone receptor associated protein 3 (TRAP150)		M	.	THRAP3-663	0			c.G68A						.	G	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	124.0	110.0	114.0		68	5.8	1.0	1	dbSNP_134	114	0,8600		0,0,4300	no	missense	THRAP3	NM_005119.3	29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	23/956	36748232	1,13005	2203	4300	6503	SO:0001583	missense	9967	exon3			GATCTCGTTCTCG	AF117756	CCDS405.1	1p34.3	2008-02-05			ENSG00000054118	ENSG00000054118			22964	protein-coding gene	gene with protein product		603809					Standard	NM_005119		Approved	TRAP150	uc001cae.4	Q9Y2W1	OTTHUMG00000007866	ENST00000354618.5:c.68G>A	1.37:g.36748232G>A	ENSP00000346634:p.Arg23His	Somatic	91	0		WXS	Illumina HiSeq	Phase_I	182	82	NM_005119	0	0	30	48	18	D3DPS5|Q5VTK6	Missense_Mutation	SNP	ENST00000354618.5	37	CCDS405.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.031760	0.93575	2.27E-4	0.0	ENSG00000054118	ENST00000354618;ENST00000469141;ENST00000478853	T;T	0.14766	2.48;2.48	5.76	5.76	0.90799	.	0.000000	0.64402	D	0.000001	T	0.36082	0.0954	L	0.55481	1.735	0.58432	D	0.999997	D	0.89917	1.0	D	0.85130	0.997	T	0.00986	-1.1490	10	0.72032	D	0.01	-8.0853	19.3309	0.94288	0.0:0.0:1.0:0.0	.	23	Q9Y2W1	TR150_HUMAN	H	23	ENSP00000346634:R23H;ENSP00000433825:R23H	ENSP00000346634:R23H	R	+	2	0	THRAP3	36520819	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.473000	0.60196	2.880000	0.98712	0.650000	0.86243	CGT	G|1.000;A|0.000		0.453	THRAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021688.2	NM_005119	
MACF1	23499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	39910503	39910503	+	Missense_Mutation	SNP	G	G	C			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr1:39910503G>C	ENST00000372915.3	+	79	19385	c.19298G>C	c.(19297-19299)aGa>aCa	p.R6433T	MACF1_ENST00000289893.4_Missense_Mutation_p.R4977T|MACF1_ENST00000539005.1_Missense_Mutation_p.R4345T|MACF1_ENST00000564288.1_Missense_Mutation_p.R6534T|MACF1_ENST00000361689.2_Missense_Mutation_p.R4475T|MACF1_ENST00000567887.1_Missense_Mutation_p.R6571T|MACF1_ENST00000317713.7_Missense_Mutation_p.R4475T|MACF1_ENST00000545844.1_Missense_Mutation_p.R4475T			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	6433					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			ATGGAAGAAAGAAAGGTACAG	0.418																																					p.R4475T		.											.	MACF1-165	0			c.G13424C						.						105.0	96.0	99.0					1																	39910503		2203	4300	6503	SO:0001583	missense	23499	exon77			AAGAAAGAAAGGT	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.19298G>C	1.37:g.39910503G>C	ENSP00000362006:p.Arg6433Thr	Somatic	83	0		WXS	Illumina HiSeq	Phase_I	109	49	NM_012090	0	0	0	0	0	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	34|34	5.305218|5.305218	0.95601|0.95601	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000372925|ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893	.|T;T;T;T;T;T	.|0.60920	.|0.15;0.15;0.15;0.15;0.15;0.15	6.16|6.16	6.16|6.16	0.99307|0.99307	.|.	.|0.000000	.|0.64402	.|D	.|0.000002	T|T	0.80824|0.80824	0.4697|0.4697	M|M	0.85299|0.85299	2.745|2.745	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.85130	.|0.997;0.997	T|T	0.81662|0.81662	-0.0831|-0.0831	5|10	.|0.87932	.|D	.|0	.|.	20.8598|20.8598	0.99761|0.99761	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|6433;4475	.|Q9UPN3;F8W8Q1	.|MACF1_HUMAN;.	N|T	3478|4475;6433;4475;4475;4345;4977	.|ENSP00000439537:R4475T;ENSP00000362006:R6433T;ENSP00000354573:R4475T;ENSP00000313438:R4475T;ENSP00000444364:R4345T;ENSP00000289893:R4977T	.|ENSP00000289893:R4977T	K|R	+|+	3|2	2|0	MACF1|MACF1	39683090|39683090	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	7.831000|7.831000	0.86748|0.86748	2.937000|2.937000	0.99478|0.99478	0.650000|0.650000	0.86243|0.86243	AAG|AGA	.		0.418	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044	
ST7L	54879	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	113126670	113126670	+	Silent	SNP	T	T	C			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr1:113126670T>C	ENST00000358039.4	-	7	1084	c.780A>G	c.(778-780)gcA>gcG	p.A260A	ST7L_ENST00000543570.1_Silent_p.A243A|ST7L_ENST00000343210.7_Silent_p.A260A|ST7L_ENST00000369666.1_Silent_p.A243A|ST7L_ENST00000490067.1_Silent_p.A243A|ST7L_ENST00000369669.1_Silent_p.A77A|ST7L_ENST00000538187.1_Silent_p.A204A|ST7L_ENST00000360743.4_Silent_p.A260A|ST7L_ENST00000463235.1_5'UTR|ST7L_ENST00000369668.2_Silent_p.A260A|ST7L_ENST00000544629.1_Silent_p.A195A	NM_017744.4|NM_138727.3	NP_060214.2|NP_620055.1	Q8TDW4	ST7L_HUMAN	suppression of tumorigenicity 7 like	260					negative regulation of cell growth (GO:0030308)	integral component of membrane (GO:0016021)				endometrium(1)|kidney(4)|large_intestine(3)|lung(1)|prostate(2)|stomach(1)|urinary_tract(3)	15	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTGCCTTGAGTGCCTGTTTAA	0.433																																					p.A260A		.											.	ST7L-90	0			c.A780G						.						168.0	148.0	155.0					1																	113126670		2203	4300	6503	SO:0001819	synonymous_variant	54879	exon7			CTTGAGTGCCTGT	AB081317	CCDS848.1, CCDS849.1, CCDS850.1, CCDS852.1	1p13.1	2008-06-06			ENSG00000007341	ENSG00000007341			18441	protein-coding gene	gene with protein product						12012006	Standard	NM_138729		Approved	FLJ20284, STLR, ST7R, FAM4B	uc001ecd.3	Q8TDW4	OTTHUMG00000011753	ENST00000358039.4:c.780A>G	1.37:g.113126670T>C		Somatic	144	1		WXS	Illumina HiSeq	Phase_I	223	105	NM_138728	0	0	0	0	0	A8K4S7|Q49AH6|Q5TEI4|Q5U5K6|Q6N067|Q7Z2Z0|Q7Z3C2|Q8N7P8|Q8TDW1|Q8TDW2|Q8TDW3|Q9NXF3	Silent	SNP	ENST00000358039.4	37	CCDS848.1	.	.	.	.	.	.	.	.	.	.	T	10.78	1.446176	0.25987	.	.	ENSG00000007341	ENST00000418497	.	.	.	5.66	-2.14	0.07123	.	.	.	.	.	T	0.24005	0.0581	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.31110	-0.9955	4	.	.	.	-15.1242	2.6912	0.05121	0.222:0.0684:0.286:0.4236	.	.	.	.	R	132	.	.	H	-	2	0	ST7L	112928193	0.441000	0.25626	0.997000	0.53966	0.998000	0.95712	-0.396000	0.07278	-0.182000	0.10602	0.460000	0.39030	CAC	.		0.433	ST7L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000032504.3		
ATP1A1	476	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	116931284	116931284	+	Missense_Mutation	SNP	G	G	A			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr1:116931284G>A	ENST00000295598.5	+	6	778	c.526G>A	c.(526-528)Gag>Aag	p.E176K	ATP1A1_ENST00000369496.4_Missense_Mutation_p.E145K|ATP1A1_ENST00000537345.1_Missense_Mutation_p.E176K	NM_000701.7	NP_000692.2	P05023	AT1A1_HUMAN	ATPase, Na+/K+ transporting, alpha 1 polypeptide	176					ATP biosynthetic process (GO:0006754)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|membrane hyperpolarization (GO:0060081)|membrane repolarization (GO:0086009)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of glucocorticoid biosynthetic process (GO:0031947)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart contraction (GO:0045823)|positive regulation of striated muscle contraction (GO:0045989)|potassium ion import (GO:0010107)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of sodium ion transport (GO:0002028)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|sodium:potassium-exchanging ATPase complex (GO:0005890)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|chaperone binding (GO:0051087)|phosphatase activity (GO:0016791)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(2)|breast(2)|cervix(3)|endometrium(2)|kidney(5)|large_intestine(9)|lung(17)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	47	Lung SC(450;0.225)	all_cancers(81;1.28e-06)|all_epithelial(167;3.48e-07)|all_lung(203;2.64e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0164)|LUSC - Lung squamous cell carcinoma(189;0.0548)|Colorectal(144;0.0825)|COAD - Colon adenocarcinoma(174;0.127)|all cancers(265;0.24)	Acetyldigitoxin(DB00511)|Almitrine(DB01430)|Aluminium(DB01370)|Bepridil(DB01244)|Bretylium(DB01158)|Ciclopirox(DB01188)|Deslanoside(DB01078)|Diazoxide(DB01119)|Digitoxin(DB01396)|Digoxin(DB00390)|Ethacrynic acid(DB00903)|Hydroflumethiazide(DB00774)|Ouabain(DB01092)|Trichlormethiazide(DB01021)	TCGAAATGGTGAGAAAATGAG	0.398																																					p.E176K		.											.	ATP1A1-91	0			c.G526A						.						99.0	104.0	102.0					1																	116931284		2203	4300	6503	SO:0001583	missense	476	exon6			AATGGTGAGAAAA	D00099	CCDS887.1, CCDS53351.1, CCDS53352.1	1p13	2012-10-22			ENSG00000163399	ENSG00000163399	3.6.3.9	"""ATPases / P-type"""	799	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-1"", ""sodium pump subunit alpha-1"", ""sodium-potassium ATPase catalytic subunit alpha-1"""	182310					Standard	NM_000701		Approved		uc001ege.3	P05023	OTTHUMG00000012109	ENST00000295598.5:c.526G>A	1.37:g.116931284G>A	ENSP00000295598:p.Glu176Lys	Somatic	175	0		WXS	Illumina HiSeq	Phase_I	251	98	NM_000701	0	0	59	101	42	B2RBR6|B7Z2T5|B7Z3U6|F5H3A1|Q16689|Q6LDM4|Q9UCN1|Q9UJ20|Q9UJ21	Missense_Mutation	SNP	ENST00000295598.5	37	CCDS887.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.528363	0.85706	.	.	ENSG00000163399	ENST00000295598;ENST00000537345;ENST00000339159;ENST00000369496	D;D;D	0.90069	-2.61;-2.61;-2.61	5.17	5.17	0.71159	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.048596	0.85682	D	0.000000	T	0.77671	0.4165	N	0.05351	-0.065	0.80722	D	1	B;B	0.25904	0.044;0.137	B;B	0.38803	0.124;0.282	T	0.75300	-0.3366	10	0.33940	T	0.23	.	18.8482	0.92215	0.0:0.0:1.0:0.0	.	176;176	F5H3A1;P05023	.;AT1A1_HUMAN	K	176;176;175;145	ENSP00000295598:E176K;ENSP00000445306:E176K;ENSP00000358508:E145K	ENSP00000295598:E176K	E	+	1	0	ATP1A1	116732807	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	9.657000	0.98554	2.676000	0.91093	0.655000	0.94253	GAG	.		0.398	ATP1A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000033481.5	NM_001160233	
NBPF14	25832	hgsc.bcm.edu	37	1	148025786	148025786	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr1:148025786G>A	ENST00000369219.1	-	1	62	c.46C>T	c.(46-48)Cag>Tag	p.Q16*				Q5TI25	NBPFE_HUMAN	neuroblastoma breakpoint family, member 14	16						cytoplasm (GO:0005737)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(23)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	42	all_hematologic(923;0.032)					TGCTTGAGCTGCTCTGCAAGC	0.527																																					p.Q16X		.											.	NBPF14-91	0			c.C46T						.						45.0	62.0	56.0					1																	148025786		988	2174	3162	SO:0001587	stop_gained	25832	exon1			TGAGCTGCTCTGC	AK092351		1q21.1	2013-01-17			ENSG00000122497			"""neuroblastoma breakpoint family"""	25232	protein-coding gene	gene with protein product		614003				8619474, 9110174, 16079250	Standard	NM_015383		Approved	DJ328E19.C1.1	uc021owp.2	Q5TI25	OTTHUMG00000013900	ENST00000369219.1:c.46C>T	1.37:g.148025786G>A	ENSP00000358221:p.Gln16*	Somatic	1065	0		WXS	Illumina HiSeq	Phase_I	1187	144	NM_015383	0	0	84	87	3	Q5TI23|Q8IX76|Q9UJI9	Nonsense_Mutation	SNP	ENST00000369219.1	37		.	.	.	.	.	.	.	.	.	.	g	10.94	1.492532	0.26774	.	.	ENSG00000122497	ENST00000369219	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.07990	T	0.79	.	.	.	.	.	.	.	.	X	16	.	ENSP00000358221:Q16X	Q	-	1	0	NBPF14	146492410	0.000000	0.05858	0.005000	0.12908	0.154000	0.21943	-1.767000	0.01795	-0.921000	0.03794	0.064000	0.15345	CAG	.		0.527	NBPF14-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_015383	
NBPF14	25832	hgsc.bcm.edu;broad.mit.edu	37	1	148025829	148025829	+	Start_Codon_SNP	SNP	C	C	T			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr1:148025829C>T	ENST00000369219.1	-	1	19	c.3G>A	c.(1-3)atG>atA	p.M1I				Q5TI25	NBPFE_HUMAN	neuroblastoma breakpoint family, member 14	1						cytoplasm (GO:0005737)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(23)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	42	all_hematologic(923;0.032)					CATTCCTCAGCATAGATTTTA	0.532																																					p.M1I		.											.	NBPF14-91	0			c.G3A						.						61.0	87.0	79.0					1																	148025829		1137	2451	3588	SO:0001582	initiator_codon_variant	25832	exon1			CCTCAGCATAGAT	AK092351		1q21.1	2013-01-17			ENSG00000122497			"""neuroblastoma breakpoint family"""	25232	protein-coding gene	gene with protein product		614003				8619474, 9110174, 16079250	Standard	NM_015383		Approved	DJ328E19.C1.1	uc021owp.2	Q5TI25	OTTHUMG00000013900	ENST00000369219.1:c.3G>A	1.37:g.148025829C>T	ENSP00000358221:p.Met1Ile	Somatic	879	1		WXS	Illumina HiSeq	Phase_I	1037	184	NM_015383	0	0	9	9	0	Q5TI23|Q8IX76|Q9UJI9	Missense_Mutation	SNP	ENST00000369219.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	2.376|2.376	-0.343189|-0.343189	0.05243|0.05243	.|.	.|.	ENSG00000122497|ENSG00000122497	ENST00000310701;ENST00000444640;ENST00000431121;ENST00000436356;ENST00000448574;ENST00000458135;ENST00000392972;ENST00000426874|ENST00000369219	.|T	.|0.04156	.|3.69	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.01222|0.01222	0.0040|0.0040	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|B;B	.|0.26744	.|0.021;0.158	.|B;B	.|0.20955	.|0.007;0.032	T|T	0.46428|0.46428	-0.9192|-0.9192	2|6	.|0.66056	.|D	.|0.02	.|.	.|.	.|.	.|.	.|.	.|1;266	.|Q5TI25;Q5VTG7	.|NBPFE_HUMAN;.	Y|I	7;12;12;12;12;12;12;12|1	.|ENSP00000358221:M1I	.|ENSP00000358221:M1I	C|M	-|-	2|3	0|0	NBPF14|NBPF14	146492453|146492453	0.020000|0.020000	0.18652|0.18652	0.017000|0.017000	0.16124|0.16124	0.147000|0.147000	0.21601|0.21601	0.633000|0.633000	0.24598|0.24598	0.429000|0.429000	0.26202|0.26202	0.064000|0.064000	0.15345|0.15345	TGC|ATG	.		0.532	NBPF14-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_015383	Missense_Mutation
SHE	126669	hgsc.bcm.edu	37	1	154474217	154474217	+	Missense_Mutation	SNP	C	C	T			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr1:154474217C>T	ENST00000304760.2	-	1	372	c.286G>A	c.(286-288)Gtc>Atc	p.V96I	TDRD10_ENST00000368482.4_5'Flank|TDRD10_ENST00000368480.3_5'Flank	NM_001010846.2	NP_001010846.1	Q5VZ18	SHE_HUMAN	Src homology 2 domain containing E	96										breast(4)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(2)|pancreas(1)	14	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			TTGGGGCCGACGCCGGCCCTG	0.731																																					p.V96I		.											.	SHE-95	0			c.G286A						.						4.0	5.0	4.0					1																	154474217		1898	3852	5750	SO:0001583	missense	126669	exon1			GGCCGACGCCGGC	AK074067	CCDS30877.1	1q21.3	2013-02-14			ENSG00000169291	ENSG00000169291		"""SH2 domain containing"""	27004	protein-coding gene	gene with protein product		610482				9315092	Standard	NM_001010846		Approved		uc001ffb.3	Q5VZ18	OTTHUMG00000036072	ENST00000304760.2:c.286G>A	1.37:g.154474217C>T	ENSP00000307369:p.Val96Ile	Somatic	27	0		WXS	Illumina HiSeq	Phase_I	21	8	NM_001010846	0	0	0	0	0	Q8TEQ5	Missense_Mutation	SNP	ENST00000304760.2	37	CCDS30877.1	.	.	.	.	.	.	.	.	.	.	C	12.74	2.028934	0.35797	.	.	ENSG00000169291	ENST00000304760	T	0.29655	1.56	4.34	3.41	0.39046	.	7739.210000	0.00166	N	0.000002	T	0.08891	0.0220	N	0.14661	0.345	0.09310	N	1	B	0.20988	0.05	B	0.08055	0.003	T	0.16217	-1.0410	10	0.51188	T	0.08	-10.482	10.0975	0.42484	0.0:0.7964:0.2036:0.0	.	96	Q5VZ18	SHE_HUMAN	I	96	ENSP00000307369:V96I	ENSP00000307369:V96I	V	-	1	0	SHE	152740841	0.000000	0.05858	0.001000	0.08648	0.756000	0.42949	-0.544000	0.06077	1.011000	0.39340	0.561000	0.74099	GTC	.		0.731	SHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087910.2	NM_001010846	
TDRD10	126668	hgsc.bcm.edu;broad.mit.edu	37	1	154493835	154493835	+	Silent	SNP	G	G	A			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr1:154493835G>A	ENST00000368480.3	+	6	334	c.249G>A	c.(247-249)gtG>gtA	p.V83V	TDRD10_ENST00000368482.4_Silent_p.V83V			Q5VZ19	TDR10_HUMAN	tudor domain containing 10	83	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			TGCAGAAAGTGACACTTGCAA	0.502																																					p.V83V		.											.	TDRD10-91	0			c.G249A						.						139.0	147.0	144.0					1																	154493835		2203	4300	6503	SO:0001819	synonymous_variant	126668	exon6			GAAAGTGACACTT	AL713777	CCDS30878.2, CCDS41406.1	1q21.3	2013-02-12			ENSG00000163239	ENSG00000163239		"""Tudor domain containing"", ""RNA binding motif (RRM) containing"""	25316	protein-coding gene	gene with protein product						12975309	Standard	NM_182499		Approved	DKFZp434M202	uc009wow.3	Q5VZ19	OTTHUMG00000037264	ENST00000368480.3:c.249G>A	1.37:g.154493835G>A		Somatic	311	0		WXS	Illumina HiSeq	Phase_I	368	35	NM_182499	0	0	1	1	0	A4FU09|B0QZ53|B4DXV4|Q3ZCP1|Q3ZCS7|Q5SXY7|Q6UXV2|Q8TCN3	Silent	SNP	ENST00000368480.3	37	CCDS41406.1																																																																																			.		0.502	TDRD10-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090700.2	NM_182499	
NDUFS2	4720	broad.mit.edu	37	1	161183707	161183707	+	Silent	SNP	C	C	A			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr1:161183707C>A	ENST00000367993.3	+	14	1798	c.1350C>A	c.(1348-1350)atC>atA	p.I450I	NDUFS2_ENST00000465923.1_3'UTR|FCER1G_ENST00000367992.3_5'Flank|NDUFS2_ENST00000392179.4_Silent_p.I450I|FCER1G_ENST00000289902.1_5'Flank	NM_004550.4	NP_004541.1	O75306	NDUS2_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 2, 49kDa (NADH-coenzyme Q reductase)	450					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|quinone binding (GO:0048038)			breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|prostate(1)|skin(1)	18	all_cancers(52;1.16e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Doxorubicin(DB00997)	TCGTTGCCATCATAGGTACGA	0.493																																					p.I450I													.	NDUFS2-91	0			c.C1350A						.						201.0	172.0	182.0					1																	161183707		2203	4300	6503	SO:0001819	synonymous_variant	4720	exon13			TGCCATCATAGGT	BC008868	CCDS1224.1, CCDS53404.1	1q23.3	2011-07-04	2002-08-29		ENSG00000158864	ENSG00000158864	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7708	protein-coding gene	gene with protein product	"""complex I 49kDa subunit"", ""NADH dehydrogenase [ubiquinone] iron-sulfur protein 2, mitochondrial"""	602985	"""NADH dehydrogenase (ubiquinone) Fe-S protein 2 (49kD) (NADH-coenzyme Q reductase)"""			1832859, 9585441	Standard	NM_004550		Approved	CI-49	uc001fyw.3	O75306	OTTHUMG00000034344	ENST00000367993.3:c.1350C>A	1.37:g.161183707C>A		Somatic	267	0		WXS	Illumina HiSeq	Phase_I	329	5	NM_001166159	0	0	21	21	0	D3DVG7|J3KPM7|Q5VTW0|Q969P3|Q9UEV3	Silent	SNP	ENST00000367993.3	37	CCDS1224.1																																																																																			.		0.493	NDUFS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000083015.1	NM_004550	
F5	2153	broad.mit.edu	37	1	169525999	169525999	+	Missense_Mutation	SNP	G	G	C			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr1:169525999G>C	ENST00000367797.3	-	6	1038	c.837C>G	c.(835-837)aaC>aaG	p.N279K	F5_ENST00000367796.3_Missense_Mutation_p.N279K|F5_ENST00000546081.1_Missense_Mutation_p.N142K	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	279	F5/8 type A 1.|Plastocyanin-like 2.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	CCTTATGATGGTTCTGCTCCA	0.517																																					p.N279K													.	F5-157	0			c.C837G						.						166.0	132.0	144.0					1																	169525999		2203	4300	6503	SO:0001583	missense	2153	exon6			ATGATGGTTCTGC	M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.837C>G	1.37:g.169525999G>C	ENSP00000356771:p.Asn279Lys	Somatic	105	0		WXS	Illumina HiSeq	Phase_I	120	4	NM_000130	0	0	1	1	0	A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Missense_Mutation	SNP	ENST00000367797.3	37	CCDS1281.1	.	.	.	.	.	.	.	.	.	.	G	16.32	3.091117	0.55968	.	.	ENSG00000198734	ENST00000367797;ENST00000367796;ENST00000546081	D;D;D	0.98777	-5.13;-5.13;-5.13	6.07	5.13	0.70059	Cupredoxin (2);	0.647124	0.17395	N	0.175782	D	0.91112	0.7202	L	0.37630	1.12	0.33636	D	0.606619	B	0.29988	0.264	B	0.26693	0.072	D	0.84453	0.0589	9	0.05436	T	0.98	-19.8836	7.2531	0.26160	0.1508:0.0:0.7031:0.1461	.	279	P12259	FA5_HUMAN	K	279;279;142	ENSP00000356771:N279K;ENSP00000356770:N279K;ENSP00000439664:N142K	ENSP00000356770:N279K	N	-	3	2	F5	167792623	0.990000	0.36364	0.964000	0.40570	0.993000	0.82548	0.914000	0.28624	1.516000	0.48900	0.650000	0.86243	AAC	.		0.517	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083712.1	NM_000130	
XPR1	9213	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	180849312	180849312	+	Missense_Mutation	SNP	G	G	C			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr1:180849312G>C	ENST00000367590.4	+	14	2107	c.1909G>C	c.(1909-1911)Gat>Cat	p.D637H	XPR1_ENST00000367589.3_Missense_Mutation_p.D572H	NM_004736.3	NP_004727.2	Q9UBH6	XPR1_HUMAN	xenotropic and polytropic retrovirus receptor 1	637	EXS. {ECO:0000255|PROSITE- ProRule:PRU00712}.				G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)|virus receptor activity (GO:0001618)			breast(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	35						CCTGAACGCAGATGATCAGAC	0.517																																					p.D637H		.											.	XPR1-90	0			c.G1909C						.						132.0	126.0	128.0					1																	180849312		2203	4300	6503	SO:0001583	missense	9213	exon14			AACGCAGATGATC	AF099082	CCDS1340.1, CCDS44284.1	1q25.1	2013-07-18	2010-04-23		ENSG00000143324	ENSG00000143324			12827	protein-coding gene	gene with protein product		605237	"""xenotropic and polytropic retrovirus receptor"""			9990033	Standard	NM_004736		Approved	SYG1, X3	uc001goi.3	Q9UBH6	OTTHUMG00000035116	ENST00000367590.4:c.1909G>C	1.37:g.180849312G>C	ENSP00000356562:p.Asp637His	Somatic	129	1		WXS	Illumina HiSeq	Phase_I	185	90	NM_004736	0	0	24	36	12	O95719|Q7L8K9|Q8IW20|Q9NT19|Q9UFB9	Missense_Mutation	SNP	ENST00000367590.4	37	CCDS1340.1	.	.	.	.	.	.	.	.	.	.	G	32	5.157082	0.94686	.	.	ENSG00000143324	ENST00000367590;ENST00000367589	T	0.48522	0.81	5.75	5.75	0.90469	EXS, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.70430	0.3223	M	0.82823	2.61	0.58432	D	0.999994	D;D	0.61080	0.989;0.982	P;P	0.60949	0.881;0.839	T	0.73206	-0.4056	10	0.59425	D	0.04	-16.0548	19.5298	0.95223	0.0:0.0:1.0:0.0	.	572;637	Q9UBH6-2;Q9UBH6	.;XPR1_HUMAN	H	637;572	ENSP00000356562:D637H	ENSP00000356561:D572H	D	+	1	0	XPR1	179115935	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.726000	0.98782	2.707000	0.92482	0.591000	0.81541	GAT	.		0.517	XPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084996.2	NM_004736	
LRRN2	10446	hgsc.bcm.edu;broad.mit.edu	37	1	204587907	204587907	+	Missense_Mutation	SNP	C	C	T	rs371946869		TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr1:204587907C>T	ENST00000367175.1	-	1	3426	c.1214G>A	c.(1213-1215)cGc>cAc	p.R405H	RP11-430C7.4_ENST00000453895.1_RNA|LRRN2_ENST00000496057.1_5'Flank|LRRN2_ENST00000367177.3_Missense_Mutation_p.R405H|LRRN2_ENST00000367176.3_Missense_Mutation_p.R405H			O75325	LRRN2_HUMAN	leucine rich repeat neuronal 2	405	LRRCT.				cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|liver(1)|lung(22)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	38	all_cancers(21;0.0519)|Breast(84;0.112)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)			GACCGGGAGGCGCTGGAGGTC	0.662													C|||	1	0.000199681	0.0	0.0	5008	,	,		16007	0.0		0.0	False		,,,				2504	0.001				p.R405H		.											.	LRRN2-514	0			c.G1214A						.	C	HIS/ARG,HIS/ARG	0,4406		0,0,2203	41.0	46.0	44.0		1214,1214	4.6	1.0	1		44	2,8598	1.2+/-3.3	0,2,4298	no	missense,missense	LRRN2	NM_006338.2,NM_201630.1	29,29	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign,benign	405/714,405/714	204587907	2,13004	2203	4300	6503	SO:0001583	missense	10446	exon3			GGGAGGCGCTGGA	AF030435	CCDS1448.1	1q32.1	2013-01-11	2007-01-31	2007-01-31	ENSG00000170382	ENSG00000170382		"""Immunoglobulin superfamily / I-set domain containing"""	16914	protein-coding gene	gene with protein product	"""leucine rich and ankyrin repeats 1"", ""fibronectin type III, immunoglobulin and leucine rich repeat domain 7"""	605492	"""leucine rich repeat neuronal 5"""	LRRN5		9662332	Standard	NM_006338		Approved	GAC1, LRANK1, FIGLER7	uc001hbf.1	O75325	OTTHUMG00000035989	ENST00000367175.1:c.1214G>A	1.37:g.204587907C>T	ENSP00000356143:p.Arg405His	Somatic	140	0		WXS	Illumina HiSeq	Phase_I	116	8	NM_006338	0	0	0	0	0	B2R624|Q5T0Y0|Q6UXM0|Q8N182	Missense_Mutation	SNP	ENST00000367175.1	37	CCDS1448.1	.	.	.	.	.	.	.	.	.	.	C	12.88	2.070520	0.36566	0.0	2.33E-4	ENSG00000170382	ENST00000367176;ENST00000367177;ENST00000367175	T;T;T	0.59502	0.26;0.26;0.26	5.69	4.59	0.56863	Cysteine-rich flanking region, C-terminal (1);	0.159801	0.29767	N	0.011250	T	0.36580	0.0972	N	0.08118	0	0.37294	D	0.90841	B	0.17465	0.022	B	0.09377	0.004	T	0.40059	-0.9583	10	0.66056	D	0.02	.	11.5883	0.50931	0.0:0.7898:0.1305:0.0797	.	405	O75325	LRRN2_HUMAN	H	405	ENSP00000356144:R405H;ENSP00000356145:R405H;ENSP00000356143:R405H	ENSP00000356143:R405H	R	-	2	0	LRRN2	202854530	0.939000	0.31865	1.000000	0.80357	0.940000	0.58332	1.848000	0.39309	2.684000	0.91462	0.557000	0.71058	CGC	.		0.662	LRRN2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089894.1	NM_006338	
SLC26A9	115019	hgsc.bcm.edu;ucsc.edu	37	1	205888030	205888030	+	Missense_Mutation	SNP	C	C	T			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr1:205888030C>T	ENST00000367135.3	-	19	2307	c.2194G>A	c.(2194-2196)Gac>Aac	p.D732N	SLC26A9_ENST00000340781.4_Missense_Mutation_p.D732N|SLC26A9_ENST00000367134.2_Missense_Mutation_p.D732N	NM_052934.3	NP_443166.1	Q7LBE3	S26A9_HUMAN	solute carrier family 26 (anion exchanger), member 9	732	STAS. {ECO:0000255|PROSITE- ProRule:PRU00198}.				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|positive regulation of gene expression (GO:0010628)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	anion:anion antiporter activity (GO:0015301)|ATPase binding (GO:0051117)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride channel activity (GO:0005254)|secondary active sulfate transmembrane transporter activity (GO:0008271)			NS(1)|breast(3)|endometrium(11)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|skin(7)|urinary_tract(5)	52	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0458)			AGGACTGCGTCATGTATGCTG	0.517											OREG0014164	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D732N		.											.	SLC26A9-92	0			c.G2194A						.						310.0	292.0	298.0					1																	205888030		2203	4300	6503	SO:0001583	missense	115019	exon19			CTGCGTCATGTAT	AF331525	CCDS30989.1, CCDS30990.1	1q32.1	2013-07-18	2013-07-18		ENSG00000174502	ENSG00000174502		"""Solute carriers"""	14469	protein-coding gene	gene with protein product	"""anion transporter/exchanger-9"""	608481	"""solute carrier family 26, member 9"""			11834742	Standard	NM_134325		Approved		uc001hdp.3	Q7LBE3	OTTHUMG00000036001	ENST00000367135.3:c.2194G>A	1.37:g.205888030C>T	ENSP00000356103:p.Asp732Asn	Somatic	502	2	2155	WXS	Illumina HiSeq	Phase_I	646	307	NM_134325	0	0	0	0	0	A7E2V6|B1AVM8|B1AVM9|B7ZKK2|Q96PK9|Q96RN0	Missense_Mutation	SNP	ENST00000367135.3	37	CCDS30990.1	.	.	.	.	.	.	.	.	.	.	C	17.83	3.484381	0.63962	.	.	ENSG00000174502	ENST00000340781;ENST00000367135;ENST00000367134	D;D;D	0.90069	-2.61;-2.61;-2.61	5.2	5.2	0.72013	Sulphate transporter/antisigma-factor antagonist STAS (3);	0.000000	0.85682	D	0.000000	D	0.95137	0.8424	M	0.84948	2.725	0.54753	D	0.999984	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.95535	0.8607	10	0.72032	D	0.01	.	18.7233	0.91704	0.0:1.0:0.0:0.0	.	732;732	Q7LBE3;B1AVM8	S26A9_HUMAN;.	N	732	ENSP00000341682:D732N;ENSP00000356103:D732N;ENSP00000356102:D732N	ENSP00000341682:D732N	D	-	1	0	SLC26A9	204154653	1.000000	0.71417	0.271000	0.24616	0.102000	0.19082	6.298000	0.72763	2.584000	0.87258	0.563000	0.77884	GAC	.		0.517	SLC26A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087742.1	NM_052934	
NEBL	10529	hgsc.bcm.edu;broad.mit.edu	37	10	21309109	21309109	+	Silent	SNP	G	G	A			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr10:21309109G>A	ENST00000417816.2	-	3	539	c.186C>T	c.(184-186)ttC>ttT	p.F62F	NEBL_ENST00000377159.4_Silent_p.F28F	NM_001173484.1|NM_213569.2	NP_001166955.1|NP_998734.1	O76041	NEBL_HUMAN	nebulette	107					cardiac muscle thin filament assembly (GO:0071691)	extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|cytoskeletal protein binding (GO:0008092)|filamin binding (GO:0031005)|structural constituent of muscle (GO:0008307)|tropomyosin binding (GO:0005523)			NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						CCACCGTGGTGAAGGACTGCT	0.413																																					p.F62F		.											.	NEBL-92	0			c.C186T						.						103.0	97.0	99.0					10																	21309109		2203	4300	6503	SO:0001819	synonymous_variant	10529	exon3			CGTGGTGAAGGAC	Y16241	CCDS7133.1, CCDS7134.1	10p12	2014-09-17			ENSG00000078114	ENSG00000078114			16932	protein-coding gene	gene with protein product		605491				9733644, 10470015	Standard	NM_213569		Approved		uc001iqi.3	O76041	OTTHUMG00000017788	ENST00000417816.2:c.186C>T	10.37:g.21309109G>A		Somatic	153	0		WXS	Illumina HiSeq	Phase_I	193	11	NM_001173484	0	0	6	6	0	B0YJ45|Q2TBD0|Q70I54|Q9UIC4	Silent	SNP	ENST00000417816.2	37	CCDS7133.1																																																																																			.		0.413	NEBL-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047112.1	NM_006393	
SGMS1	259230	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	10	52071078	52071078	+	Missense_Mutation	SNP	T	T	C			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr10:52071078T>C	ENST00000361781.2	-	9	1798	c.839A>G	c.(838-840)tAt>tGt	p.Y280C	SGMS1_ENST00000429490.1_Missense_Mutation_p.Y111C	NM_147156.3	NP_671512.1	Q86VZ5	SMS1_HUMAN	sphingomyelin synthase 1	286					apoptotic process (GO:0006915)|cell growth (GO:0016049)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingomyelin biosynthetic process (GO:0006686)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|Golgi trans cisterna (GO:0000138)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ceramide cholinephosphotransferase activity (GO:0047493)|kinase activity (GO:0016301)|sphingomyelin synthase activity (GO:0033188)			endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(4)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	16						GCTGTACAGATAGTCCCCACA	0.453																																					p.Y280C		.											.	SGMS1-227	0			c.A839G						.						141.0	105.0	117.0					10																	52071078		2203	4300	6503	SO:0001583	missense	259230	exon9			TACAGATAGTCCC	AY280959	CCDS7240.1	10q11.2	2013-01-10	2007-03-16	2007-03-16	ENSG00000198964	ENSG00000198964	2.7.8.27	"""Sterile alpha motif (SAM) domain containing"""	29799	protein-coding gene	gene with protein product		611573	"""transmembrane protein 23"""	TMEM23		11841947, 14976195	Standard	NM_147156		Approved	MOB, MGC17342, SMS1	uc001jje.3	Q86VZ5	OTTHUMG00000018231	ENST00000361781.2:c.839A>G	10.37:g.52071078T>C	ENSP00000354829:p.Tyr280Cys	Somatic	113	0		WXS	Illumina HiSeq	Phase_I	129	57	NM_147156	0	0	11	25	14	Q68U43|Q6EKK0|Q75SP1	Missense_Mutation	SNP	ENST00000361781.2	37	CCDS7240.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.171766	0.78452	.	.	ENSG00000198964	ENST00000412547;ENST00000361781;ENST00000429490	T	0.53206	0.63	5.87	4.68	0.58851	.	0.056539	0.64402	D	0.000001	T	0.65974	0.2743	M	0.73430	2.235	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.76575	0.968;0.988	T	0.69548	-0.5116	10	0.87932	D	0	-23.9233	11.1732	0.48584	0.1378:0.0:0.0:0.8622	.	111;286	B4DJU2;Q86VZ5	.;SMS1_HUMAN	C	80;280;111	ENSP00000354829:Y280C	ENSP00000354829:Y280C	Y	-	2	0	SGMS1	51741084	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.058000	0.64300	2.371000	0.80710	0.533000	0.62120	TAT	.		0.453	SGMS1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048074.2	NM_147156	
IDE	3416	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	10	94297234	94297234	+	Missense_Mutation	SNP	G	G	C			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr10:94297234G>C	ENST00000265986.6	-	2	228	c.172C>G	c.(172-174)Cct>Gct	p.P58A		NM_004969.3	NP_004960.2	P14735	IDE_HUMAN	insulin-degrading enzyme	58					beta-amyloid metabolic process (GO:0050435)|bradykinin catabolic process (GO:0010815)|determination of adult lifespan (GO:0008340)|hormone catabolic process (GO:0042447)|insulin catabolic process (GO:1901143)|insulin metabolic process (GO:1901142)|insulin receptor signaling pathway (GO:0008286)|negative regulation of proteolysis (GO:0045861)|positive regulation of protein oligomerization (GO:0032461)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein homotetramerization (GO:0051289)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|ubiquitin homeostasis (GO:0010992)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|beta-amyloid binding (GO:0001540)|beta-endorphin binding (GO:0031626)|glycoprotein binding (GO:0001948)|insulin binding (GO:0043559)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(10)|ovary(2)|urinary_tract(2)	33					"""""""Insulin(DB00071)|Bacitracin(DB00626)|Insulin Regular(DB00030)"""	TTGTCTTCAGGAGACTTGGTA	0.388																																					p.P58A		.											.	IDE-92	0			c.C172G						.						216.0	192.0	200.0					10																	94297234		2203	4300	6503	SO:0001583	missense	3416	exon2			CTTCAGGAGACTT	M21188	CCDS7421.1, CCDS53554.1	10q23-q25	2007-03-27			ENSG00000119912	ENSG00000119912			5381	protein-coding gene	gene with protein product	"""insulysin"""	146680				2293021	Standard	NM_004969		Approved		uc001kia.3	P14735	OTTHUMG00000018759	ENST00000265986.6:c.172C>G	10.37:g.94297234G>C	ENSP00000265986:p.Pro58Ala	Somatic	166	0		WXS	Illumina HiSeq	Phase_I	210	85	NM_004969	0	0	4	9	5	B2R721|B7ZAU2|D3DR35|Q5T5N2	Missense_Mutation	SNP	ENST00000265986.6	37	CCDS7421.1	.	.	.	.	.	.	.	.	.	.	G	10.72	1.430602	0.25726	.	.	ENSG00000119912	ENST00000265986;ENST00000436178	T;T	0.30448	1.53;1.53	5.58	5.58	0.84498	Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.056903	0.64402	D	0.000001	T	0.20659	0.0497	N	0.14661	0.345	0.80722	D	1	B	0.13145	0.007	B	0.14578	0.011	T	0.09228	-1.0684	10	0.10902	T	0.67	-4.7075	19.5704	0.95409	0.0:0.0:1.0:0.0	.	58	P14735	IDE_HUMAN	A	58;44	ENSP00000265986:P58A;ENSP00000408850:P44A	ENSP00000265986:P58A	P	-	1	0	IDE	94287214	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.325000	0.96381	2.624000	0.88883	0.655000	0.94253	CCT	.		0.388	IDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049393.1	NM_004969	
RIC8A	60626	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	11	209483	209483	+	Missense_Mutation	SNP	T	T	A			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr11:209483T>A	ENST00000526104.1	+	3	1553	c.209T>A	c.(208-210)gTc>gAc	p.V70D	RIC8A_ENST00000527696.1_Missense_Mutation_p.V64D|BET1L_ENST00000410108.1_5'Flank|BET1L_ENST00000486280.1_5'Flank|BET1L_ENST00000325147.9_5'Flank|RIC8A_ENST00000325207.5_Missense_Mutation_p.V70D|BET1L_ENST00000529614.2_5'Flank|BET1L_ENST00000332865.6_5'Flank|BET1L_ENST00000382762.3_5'Flank			Q9NPQ8	RIC8A_HUMAN	RIC8 guanine nucleotide exchange factor A	70					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|basement membrane organization (GO:0071711)|cell migration involved in gastrulation (GO:0042074)|cell-cell adhesion involved in gastrulation (GO:0070586)|in utero embryonic development (GO:0001701)|vasculature development (GO:0001944)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(3)|kidney(1)|large_intestine(3)|lung(3)|pancreas(1)|prostate(1)|skin(1)	13		all_cancers(49;9.23e-07)|all_epithelial(84;0.000315)|Breast(177;0.00122)|Ovarian(85;0.0202)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;4.45e-27)|Epithelial(43;2.94e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.86e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)		CTGCAGAGTGTCCGAATCCTG	0.642																																					p.V70D		.											.	RIC8A-514	0			c.T209A						.						83.0	79.0	80.0					11																	209483		2203	4300	6503	SO:0001583	missense	60626	exon3			AGAGTGTCCGAAT	AK022870	CCDS7690.1, CCDS65982.1	11p15.5	2013-08-05	2013-08-05		ENSG00000177963	ENSG00000177963			29550	protein-coding gene	gene with protein product		609146	"""resistance to inhibitors of cholinesterase 8 homolog A (C. elegans)"""			10985349, 11230166	Standard	XM_005253052		Approved	synembryn, synembryn-A	uc001lof.3	Q9NPQ8	OTTHUMG00000119069	ENST00000526104.1:c.209T>A	11.37:g.209483T>A	ENSP00000432008:p.Val70Asp	Somatic	142	0		WXS	Illumina HiSeq	Phase_I	107	23	NM_021932	0	0	50	54	4	Q0P508|Q2T9J1|Q7Z352|Q96EZ1|Q96SZ2|Q9H064|Q9H5H3|Q9H9E7	Missense_Mutation	SNP	ENST00000526104.1	37		.	.	.	.	.	.	.	.	.	.	T	31	5.086235	0.94100	.	.	ENSG00000177963	ENST00000526104;ENST00000325207;ENST00000531209;ENST00000528357;ENST00000530889;ENST00000527696	T;T;T;T	0.53423	0.7;0.7;0.62;0.7	4.32	4.32	0.51571	Armadillo-type fold (1);	0.242015	0.40302	N	0.001130	T	0.54983	0.1892	L	0.39898	1.24	0.53688	D	0.999973	D;P;P	0.58620	0.983;0.904;0.951	P;P;P	0.59761	0.807;0.863;0.784	T	0.59621	-0.7420	10	0.87932	D	0	-12.0203	13.3635	0.60669	0.0:0.0:0.0:1.0	.	64;70;70	Q9NPQ8-2;Q9NPQ8;Q9NPQ8-3	.;RIC8A_HUMAN;.	D	70;70;70;46;74;64	ENSP00000432008:V70D;ENSP00000325941:V70D;ENSP00000433968:V74D;ENSP00000434833:V64D	ENSP00000325941:V70D	V	+	2	0	RIC8A	199483	1.000000	0.71417	0.975000	0.42487	0.986000	0.74619	7.525000	0.81892	1.906000	0.55180	0.459000	0.35465	GTC	.		0.642	RIC8A-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000384761.1	NM_021932	
OR4S2	219431	broad.mit.edu	37	11	55418712	55418712	+	Silent	SNP	C	C	T			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr11:55418712C>T	ENST00000312422.2	+	1	333	c.333C>T	c.(331-333)ttC>ttT	p.F111F		NM_001004059.2	NP_001004059.2	Q8NH73	OR4S2_HUMAN	olfactory receptor, family 4, subfamily S, member 2	111						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(4)|lung(28)|ovary(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_epithelial(135;0.0748)				CTGAGATCTTCATCCTTACTG	0.403																																					p.F111F													.	OR4S2-71	0			c.C333T						.						213.0	178.0	190.0					11																	55418712		2183	4039	6222	SO:0001819	synonymous_variant	219431	exon1			GATCTTCATCCTT	BK004390	CCDS31505.1	11q11	2012-08-09	2002-11-13	2002-11-15	ENSG00000174982	ENSG00000174982		"""GPCR / Class A : Olfactory receptors"""	15183	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily S, member 2 pseudogene"""	OR4S2P			Standard	NM_001004059		Approved	OST725	uc001nhs.1	Q8NH73	OTTHUMG00000166799	ENST00000312422.2:c.333C>T	11.37:g.55418712C>T		Somatic	447	1		WXS	Illumina HiSeq	Phase_I	591	20	NM_001004059	0	0	0	0	0	Q6IF72	Silent	SNP	ENST00000312422.2	37	CCDS31505.1																																																																																			.		0.403	OR4S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391503.1	NM_001004059	
APLNR	187	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	11	57004337	57004337	+	Missense_Mutation	SNP	G	G	C			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr11:57004337G>C	ENST00000606794.1	-	1	338	c.142C>G	c.(142-144)Ctg>Gtg	p.L48V		NM_005161.4	NP_005152.1	P35414	APJ_HUMAN	apelin receptor	48					G-protein coupled receptor signaling pathway (GO:0007186)|gastrulation (GO:0007369)|heart development (GO:0007507)|regulation of body fluid levels (GO:0050878)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32						CAGAGCACCAGACCGTTGCCC	0.592																																					p.L48V		.											.	APLNR-573	0			c.C142G						.						75.0	72.0	73.0					11																	57004337		2201	4296	6497	SO:0001583	missense	187	exon1			GCACCAGACCGTT	U03642	CCDS7950.1	11q12.1	2012-08-08	2008-05-12	2008-05-12	ENSG00000134817	ENSG00000134817			339	protein-coding gene	gene with protein product	"""APJ (apelin) receptor"""	600052	"""angiotensin II receptor-like 1"""	AGTRL1		8294032, 14622440	Standard	NM_005161		Approved	FLJ90771, APJ, APJR	uc001njo.3	P35414	OTTHUMG00000167021	ENST00000606794.1:c.142C>G	11.37:g.57004337G>C	ENSP00000475344:p.Leu48Val	Somatic	181	0		WXS	Illumina HiSeq	Phase_I	149	70	NM_005161	0	0	2	2	0		Missense_Mutation	SNP	ENST00000606794.1	37	CCDS7950.1	.	.	.	.	.	.	.	.	.	.	G	12.76	2.034103	0.35893	.	.	ENSG00000134817	ENST00000257254;ENST00000444275	T	0.77098	-1.07	5.25	4.13	0.48395	GPCR, rhodopsin-like superfamily (1);	0.088434	0.47455	D	0.000235	T	0.71417	0.3337	L	0.35593	1.075	0.37382	D	0.912064	P	0.43231	0.801	P	0.45610	0.487	T	0.74506	-0.3643	10	0.36615	T	0.2	-13.9545	12.6969	0.57010	0.0931:0.0:0.9069:0.0	.	48	P35414	APJ_HUMAN	V	48;13	ENSP00000257254:L48V	ENSP00000257254:L48V	L	-	1	2	APLNR	56760913	0.027000	0.19231	1.000000	0.80357	0.995000	0.86356	0.324000	0.19610	2.460000	0.83146	0.561000	0.74099	CTG	.		0.592	APLNR-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000470575.1	NM_005161	
MS4A15	219995	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	11	60540926	60540926	+	Missense_Mutation	SNP	T	T	A			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr11:60540926T>A	ENST00000405633.3	+	5	546	c.467T>A	c.(466-468)aTt>aAt	p.I156N	MS4A15_ENST00000528170.1_Missense_Mutation_p.I115N|MS4A15_ENST00000337911.4_Missense_Mutation_p.I63N	NM_001098835.1	NP_001092305.1	Q8N5U1	M4A15_HUMAN	membrane-spanning 4-domains, subfamily A, member 15	156						integral component of membrane (GO:0016021)				breast(1)|large_intestine(2)|lung(3)	6						GGGACAGCCATTCTGCTCATG	0.572																																					p.I156N		.											.	MS4A15-69	0			c.T467A						.						101.0	82.0	89.0					11																	60540926		2203	4300	6503	SO:0001583	missense	219995	exon5			CAGCCATTCTGCT	AY584608	CCDS7991.1, CCDS44617.1, CCDS60802.1	11q12.2	2008-03-25							28573	protein-coding gene	gene with protein product							Standard	NM_001098835		Approved		uc009ynf.1	Q8N5U1		ENST00000405633.3:c.467T>A	11.37:g.60540926T>A	ENSP00000386022:p.Ile156Asn	Somatic	71	0		WXS	Illumina HiSeq	Phase_I	70	39	NM_001098835	0	0	0	0	0	A9UJY6|A9UJY7|F2Z2J5	Missense_Mutation	SNP	ENST00000405633.3	37	CCDS44617.1	.	.	.	.	.	.	.	.	.	.	T	21.5	4.159477	0.78226	.	.	ENSG00000166961	ENST00000528170;ENST00000337911;ENST00000405633	T;T;T	0.02763	4.17;4.17;4.17	4.73	4.73	0.59995	.	0.564419	0.18877	N	0.128670	T	0.12433	0.0302	M	0.82132	2.575	0.32907	D	0.514004	D;D	0.61080	0.98;0.989	P;P	0.60345	0.873;0.837	T	0.06006	-1.0851	10	0.87932	D	0	-4.8067	10.6302	0.45532	0.0:0.0:0.0:1.0	.	115;156	F2Z2J5;Q8N5U1	.;M4A15_HUMAN	N	115;63;156	ENSP00000434165:I115N;ENSP00000338692:I63N;ENSP00000386022:I156N	ENSP00000338692:I63N	I	+	2	0	MS4A15	60297502	0.968000	0.33430	0.979000	0.43373	0.987000	0.75469	2.143000	0.42187	1.772000	0.52199	0.454000	0.30748	ATT	.		0.572	MS4A15-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395618.1		
VWCE	220001	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	11	61026184	61026184	+	Missense_Mutation	SNP	G	G	A			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr11:61026184G>A	ENST00000335613.5	-	20	3217	c.2831C>T	c.(2830-2832)cCa>cTa	p.P944L	VWCE_ENST00000535710.1_Missense_Mutation_p.P409L	NM_152718.2	NP_689931.2	Q96DN2	VWCE_HUMAN	von Willebrand factor C and EGF domains	944						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37						AGCCCCCACTGGGGGCTGCTG	0.662																																					p.P944L		.											.	VWCE-91	0			c.C2831T						.						32.0	41.0	38.0					11																	61026184		2181	4260	6441	SO:0001583	missense	220001	exon20			CCCACTGGGGGCT	AK056571	CCDS8002.1	11q12.2	2006-08-04			ENSG00000167992	ENSG00000167992			26487	protein-coding gene	gene with protein product		611115				12869306	Standard	NM_152718		Approved	URG11, FLJ32009, VWC1	uc001nra.3	Q96DN2	OTTHUMG00000168208	ENST00000335613.5:c.2831C>T	11.37:g.61026184G>A	ENSP00000334186:p.Pro944Leu	Somatic	224	0		WXS	Illumina HiSeq	Phase_I	178	55	NM_152718	0	0	4	4	0	A5PKV0|Q7Z7L6|Q86WK8	Missense_Mutation	SNP	ENST00000335613.5	37	CCDS8002.1	.	.	.	.	.	.	.	.	.	.	G	7.159	0.585335	0.13749	.	.	ENSG00000167992	ENST00000335613;ENST00000535710	T;T	0.68025	-0.3;3.56	4.57	2.7	0.31948	.	1.078380	0.07367	N	0.885042	T	0.43545	0.1252	N	0.03115	-0.41	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.33007	-0.9885	10	0.48119	T	0.1	.	7.595	0.28044	0.2008:0.0:0.7992:0.0	.	944	Q96DN2	VWCE_HUMAN	L	944;409	ENSP00000334186:P944L;ENSP00000442570:P409L	ENSP00000334186:P944L	P	-	2	0	VWCE	60782760	0.002000	0.14202	0.000000	0.03702	0.000000	0.00434	1.128000	0.31369	0.478000	0.27488	-0.254000	0.11334	CCA	.		0.662	VWCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398811.1	NM_152718	
STARD10	10809	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	11	72470333	72470333	+	Missense_Mutation	SNP	C	C	G			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr11:72470333C>G	ENST00000334805.6	-	3	1220	c.301G>C	c.(301-303)Gag>Cag	p.E101Q	STARD10_ENST00000538536.1_Missense_Mutation_p.E55Q|STARD10_ENST00000545082.1_Missense_Mutation_p.E72Q|ARAP1_ENST00000359373.5_Intron|STARD10_ENST00000538437.1_5'UTR|STARD10_ENST00000543304.1_Missense_Mutation_p.E101Q	NM_006645.2	NP_006636.2	Q9Y365	PCTL_HUMAN	StAR-related lipid transfer (START) domain containing 10	101	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				bile acid secretion (GO:0032782)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)	cytosol (GO:0005829)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|microvillus (GO:0005902)	lipid binding (GO:0008289)			endometrium(4)|large_intestine(1)|lung(2)|prostate(1)	8			BRCA - Breast invasive adenocarcinoma(5;7.08e-07)			TCAAAAGTCTCAATGACGTTG	0.562																																					p.E101Q		.											.	STARD10-90	0			c.G301C						.						138.0	143.0	141.0					11																	72470333		2184	4279	6463	SO:0001583	missense	10809	exon3			AAGTCTCAATGAC	AF039696	CCDS41688.1	11q13	2011-09-12	2007-08-16	2003-02-07		ENSG00000214530		"""StAR-related lipid transfer (START) domain containing"""	10666	protein-coding gene	gene with protein product			"""serologically defined colon cancer antigen 28"", ""START domain containing 10"""	SDCCAG28		9610721	Standard	NM_006645		Approved	NY-CO-28, CGI-52, PCTP2	uc001otb.3	Q9Y365		ENST00000334805.6:c.301G>C	11.37:g.72470333C>G	ENSP00000335247:p.Glu101Gln	Somatic	128	0		WXS	Illumina HiSeq	Phase_I	127	64	NM_006645	0	0	38	68	30	O60532	Missense_Mutation	SNP	ENST00000334805.6	37	CCDS41688.1	.	.	.	.	.	.	.	.	.	.	C	36	5.751817	0.96890	.	.	ENSG00000214530	ENST00000537351;ENST00000543304;ENST00000334805;ENST00000538536;ENST00000545082;ENST00000544767;ENST00000537947;ENST00000536728;ENST00000542989;ENST00000546314;ENST00000539138;ENST00000535054	T;T;T;T;T;T;T;T;T;T;D;T	0.85088	1.36;1.36;1.36;1.36;1.36;1.36;1.36;1.36;1.36;1.36;-1.94;0.81	5.95	5.95	0.96441	Lipid-binding START (3);START-like domain (1);	0.062950	0.64402	U	0.000008	D	0.91126	0.7206	M	0.79805	2.47	0.58432	D	0.999995	P;P	0.52316	0.94;0.952	P;P	0.57720	0.591;0.826	D	0.88905	0.3355	10	0.28530	T	0.3	-28.7367	17.8792	0.88835	0.0:1.0:0.0:0.0	.	55;101	F5GY11;Q9Y365	.;PCTL_HUMAN	Q	8;101;101;55;72;32;101;32;101;101;72;55	ENSP00000445708:E8Q;ENSP00000438792:E101Q;ENSP00000335247:E101Q;ENSP00000440016:E55Q;ENSP00000443548:E72Q;ENSP00000438357:E32Q;ENSP00000445657:E101Q;ENSP00000442414:E32Q;ENSP00000443597:E101Q;ENSP00000445886:E101Q;ENSP00000441589:E72Q;ENSP00000440924:E55Q	ENSP00000335247:E101Q	E	-	1	0	STARD10	72147981	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.825000	0.97269	0.655000	0.94253	GAG	.		0.562	STARD10-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397254.1		
ARRB1	408	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	11	74985127	74985127	+	Missense_Mutation	SNP	G	G	C			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr11:74985127G>C	ENST00000420843.2	-	11	1002	c.905C>G	c.(904-906)tCt>tGt	p.S302C	ARRB1_ENST00000393505.4_Missense_Mutation_p.S302C|ARRB1_ENST00000360025.3_Missense_Mutation_p.S302C	NM_004041.4	NP_004032.2	P49407	ARRB1_HUMAN	arrestin, beta 1	302					activation of MAPK activity (GO:0000187)|apoptotic DNA fragmentation (GO:0006309)|blood coagulation (GO:0007596)|follicle-stimulating hormone signaling pathway (GO:0042699)|G-protein coupled receptor internalization (GO:0002031)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of GTPase activity (GO:0034260)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein ubiquitination (GO:0031397)|Notch signaling pathway (GO:0007219)|phototransduction (GO:0007602)|platelet activation (GO:0030168)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of GTPase activity (GO:0043547)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H4 acetylation (GO:0090240)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of receptor internalization (GO:0002092)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-Golgi vesicle-mediated transport (GO:0006892)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|stress fiber assembly (GO:0043149)|transcription from RNA polymerase II promoter (GO:0006366)	basolateral plasma membrane (GO:0016323)|chromatin (GO:0000785)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|pseudopodium (GO:0031143)	angiotensin receptor binding (GO:0031701)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|enzyme inhibitor activity (GO:0004857)|GTPase activator activity (GO:0005096)|insulin-like growth factor receptor binding (GO:0005159)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			breast(4)|large_intestine(2)|lung(4)|prostate(1)	11						CAGGGTGCTAGAGGCCAAGTT	0.602																																					p.S302C		.											.	ARRB1-567	0			c.C905G						.						263.0	213.0	230.0					11																	74985127		2200	4293	6493	SO:0001583	missense	408	exon11			GTGCTAGAGGCCA	BC003636	CCDS31640.1, CCDS44684.1	11q13	2008-12-11			ENSG00000137486	ENSG00000137486			711	protein-coding gene	gene with protein product	"""arrestin 2"""	107940		ARR1		8486659	Standard	NM_004041		Approved		uc001owe.2	P49407	OTTHUMG00000165444	ENST00000420843.2:c.905C>G	11.37:g.74985127G>C	ENSP00000409581:p.Ser302Cys	Somatic	382	0		WXS	Illumina HiSeq	Phase_I	366	162	NM_020251	0	0	0	0	0	B6V9G8|O75625|O75630|Q2PP20|Q9BTK8	Missense_Mutation	SNP	ENST00000420843.2	37	CCDS44684.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.125072	0.77436	.	.	ENSG00000137486	ENST00000420843;ENST00000393505;ENST00000360025	T;T;T	0.19250	2.16;2.16;2.16	4.51	4.51	0.55191	Immunoglobulin E-set (1);Arrestin, C-terminal (1);Arrestin-like, C-terminal (1);	0.000000	0.64402	D	0.000002	T	0.50633	0.1627	M	0.87827	2.91	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.71870	0.933;0.975	T	0.60712	-0.7209	10	0.72032	D	0.01	-10.6596	14.7321	0.69388	0.0:0.0:1.0:0.0	.	302;302	P49407-2;P49407	.;ARRB1_HUMAN	C	302	ENSP00000409581:S302C;ENSP00000377141:S302C;ENSP00000353124:S302C	ENSP00000353124:S302C	S	-	2	0	ARRB1	74662775	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	9.770000	0.98971	2.058000	0.61347	0.462000	0.41574	TCT	.		0.602	ARRB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384092.3	NM_004041	
RAPGEF3	10411	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	12	48142257	48142257	+	Missense_Mutation	SNP	G	G	A			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr12:48142257G>A	ENST00000449771.2	-	12	1311	c.1223C>T	c.(1222-1224)tCc>tTc	p.S408F	RAPGEF3_ENST00000171000.4_Missense_Mutation_p.S366F|RAPGEF3_ENST00000549151.1_Missense_Mutation_p.S366F|RAPGEF3_ENST00000389212.3_Missense_Mutation_p.S408F|RAPGEF3_ENST00000395358.3_Missense_Mutation_p.S408F|RAPGEF3_ENST00000405493.2_Missense_Mutation_p.S366F|RAPGEF3_ENST00000548919.1_Missense_Mutation_p.S366F			O95398	RPGF3_HUMAN	Rap guanine nucleotide exchange factor (GEF) 3	408	Interaction with PDE3B.|N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cAMP-mediated signaling (GO:0019933)|cell proliferation (GO:0008283)|cellular response to cAMP (GO:0071320)|energy reserve metabolic process (GO:0006112)|establishment of endothelial barrier (GO:0061028)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cAMP catabolic process (GO:0030822)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of stress fiber assembly (GO:0051496)|Rap protein signal transduction (GO:0032486)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cAMP-dependent protein kinase complex (GO:0005952)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase regulator activity (GO:0008603)|guanyl-nucleotide exchange factor activity (GO:0005085)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)			endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|pancreas(1)|prostate(1)|skin(7)	25	Lung SC(27;0.192)			GBM - Glioblastoma multiforme(48;0.0375)		ATGAGCACTGGAATCTGGTCC	0.547																																					p.S408F		.											.	RAPGEF3-660	0			c.C1223T						.						131.0	109.0	117.0					12																	48142257		2203	4300	6503	SO:0001583	missense	10411	exon12			GCACTGGAATCTG	AK092448	CCDS31784.1, CCDS41775.1	12q13.1	2006-04-12	2004-03-26		ENSG00000079337	ENSG00000079337			16629	protein-coding gene	gene with protein product	"""exchange protein directly activated by cAMP 1"""	606057	"""RAP guanine-nucleotide-exchange factor (GEF) 3"""			10777494, 9856955	Standard	NM_001098531		Approved	cAMP-GEFI, EPAC, bcm910	uc001rpz.4	O95398	OTTHUMG00000133667	ENST00000449771.2:c.1223C>T	12.37:g.48142257G>A	ENSP00000395708:p.Ser408Phe	Somatic	87	0		WXS	Illumina HiSeq	Phase_I	82	30	NM_001098531	0	0	2	4	2	A8K2G5|E7EQC8|O95634|Q8WVN0	Missense_Mutation	SNP	ENST00000449771.2	37	CCDS41775.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.512216	0.85389	.	.	ENSG00000079337	ENST00000405493;ENST00000449771;ENST00000541821;ENST00000549151;ENST00000171000;ENST00000389211;ENST00000389212;ENST00000397089;ENST00000548919;ENST00000395358	T;T;T;T;T;T;T	0.71579	-0.39;-0.4;-0.39;-0.39;-0.4;-0.58;-0.49	5.16	5.16	0.70880	Ras guanine nucleotide exchange factor, domain (1);Ras-like guanine nucleotide exchange factor, N-terminal (3);	0.662303	0.13744	N	0.365734	T	0.80210	0.4581	L	0.44542	1.39	0.58432	D	0.999999	D;D	0.89917	0.992;1.0	D;D	0.77557	0.937;0.99	T	0.79320	-0.1852	10	0.59425	D	0.04	.	16.511	0.84284	0.0:0.0:1.0:0.0	.	420;408	B7Z5J6;O95398	.;RPGF3_HUMAN	F	366;408;55;366;366;366;408;420;366;408	ENSP00000384521:S366F;ENSP00000395708:S408F;ENSP00000448619:S366F;ENSP00000171000:S366F;ENSP00000373864:S408F;ENSP00000448480:S366F;ENSP00000378764:S408F	ENSP00000171000:S366F	S	-	2	0	RAPGEF3	46428524	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.309000	0.78937	2.588000	0.87417	0.650000	0.86243	TCC	.		0.547	RAPGEF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257848.1	NM_006105	
KMT2D	8085	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	12	49425839	49425839	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr12:49425839G>A	ENST00000301067.7	-	39	12648	c.12649C>T	c.(12649-12651)Cag>Tag	p.Q4217*		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	4217	Gln-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										TGCTGCTGCTGAGGACTTAAG	0.622																																					p.Q4217X		.											.	MLL2-612	0			c.C12649T						.						29.0	33.0	32.0					12																	49425839		2083	4219	6302	SO:0001587	stop_gained	8085	exon39			GCTGCTGAGGACT	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.12649C>T	12.37:g.49425839G>A	ENSP00000301067:p.Gln4217*	Somatic	96	0		WXS	Illumina HiSeq	Phase_I	81	36	NM_003482	0	0	12	18	6	O14687	Nonsense_Mutation	SNP	ENST00000301067.7	37	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	G	53	20.787619	0.99934	.	.	ENSG00000167548	ENST00000301067	.	.	.	4.89	4.89	0.63831	.	0.000000	0.34531	N	0.003897	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.7009	0.88294	0.0:0.0:1.0:0.0	.	.	.	.	X	4217	.	ENSP00000301067:Q4217X	Q	-	1	0	MLL2	47712106	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	6.491000	0.73649	2.662000	0.90505	0.655000	0.94253	CAG	.		0.622	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
KMT2D	8085	hgsc.bcm.edu;broad.mit.edu	37	12	49426526	49426526	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr12:49426526G>A	ENST00000301067.7	-	39	11961	c.11962C>T	c.(11962-11964)Cag>Tag	p.Q3988*	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	3988	Gln-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.Q3718*(1)									TGTTGTTGCTGAGGAGACAGT	0.532																																					p.Q3988X		.											.	MLL2-612	1	Substitution - Nonsense(1)	haematopoietic_and_lymphoid_tissue(1)	c.C11962T						.						64.0	70.0	68.0					12																	49426526		2196	4296	6492	SO:0001587	stop_gained	8085	exon39			GTTGCTGAGGAGA	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.11962C>T	12.37:g.49426526G>A	ENSP00000301067:p.Gln3988*	Somatic	42	0		WXS	Illumina HiSeq	Phase_I	31	13	NM_003482	0	0	2	7	5	O14687	Nonsense_Mutation	SNP	ENST00000301067.7	37	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	G	50	17.079656	0.99878	.	.	ENSG00000167548	ENST00000301067	.	.	.	4.88	4.88	0.63580	.	0.000000	0.34652	N	0.003786	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.6695	0.88212	0.0:0.0:1.0:0.0	.	.	.	.	X	3988	.	ENSP00000301067:Q3988X	Q	-	1	0	MLL2	47712793	0.997000	0.39634	1.000000	0.80357	0.099000	0.18886	3.213000	0.51153	2.643000	0.89663	0.655000	0.94253	CAG	.		0.532	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
HSP90B1	7184	broad.mit.edu	37	12	104327895	104327895	+	Missense_Mutation	SNP	G	G	C			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr12:104327895G>C	ENST00000299767.5	+	5	755	c.573G>C	c.(571-573)ttG>ttC	p.L191F		NM_003299.2	NP_003290.1	P14625	ENPL_HUMAN	heat shock protein 90kDa beta (Grp94), member 1	191					actin rod assembly (GO:0031247)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cellular response to ATP (GO:0071318)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|protein folding (GO:0006457)|protein transport (GO:0015031)|regulation of phosphoprotein phosphatase activity (GO:0043666)|response to hypoxia (GO:0001666)|sequestering of calcium ion (GO:0051208)|toll-like receptor signaling pathway (GO:0002224)	cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|low-density lipoprotein particle receptor binding (GO:0050750)|protein phosphatase binding (GO:0019903)|RNA binding (GO:0003723)|virion binding (GO:0046790)			central_nervous_system(1)|kidney(5)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(4)	29					Rifabutin(DB00615)	CTTCTGAATTGATTGGCCAGT	0.428																																					p.L191F													.	HSP90B1-93	0			c.G573C						.						117.0	113.0	115.0					12																	104327895		2203	4300	6503	SO:0001583	missense	7184	exon5			TGAATTGATTGGC	AY040226	CCDS9094.1	12q24.2-q24.3	2011-09-02	2006-02-24	2006-02-24		ENSG00000166598		"""Heat shock proteins / HSPC"""	12028	protein-coding gene	gene with protein product		191175	"""tumor rejection antigen (gp96) 1"""	TRA1		16269234	Standard	NM_003299		Approved	GP96, GRP94	uc001tkb.2	P14625	OTTHUMG00000170118	ENST00000299767.5:c.573G>C	12.37:g.104327895G>C	ENSP00000299767:p.Leu191Phe	Somatic	201	0		WXS	Illumina HiSeq	Phase_I	261	6	NM_003299	0	0	284	290	6	Q96A97	Missense_Mutation	SNP	ENST00000299767.5	37	CCDS9094.1	.	.	.	.	.	.	.	.	.	.	G	18.47	3.631800	0.67015	.	.	ENSG00000166598	ENST00000299767;ENST00000537375	T	0.23147	1.92	5.92	5.01	0.66863	ATPase-like, ATP-binding domain (4);	0.000000	0.64402	D	0.000001	T	0.57021	0.2025	M	0.93808	3.46	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.983	T	0.63998	-0.6510	10	0.87932	D	0	.	7.1278	0.25482	0.1456:0.1887:0.6657:0.0	.	217;191	Q59FC6;P14625	.;ENPL_HUMAN	F	191	ENSP00000299767:L191F	ENSP00000299767:L191F	L	+	3	2	HSP90B1	102852025	1.000000	0.71417	0.990000	0.47175	0.996000	0.88848	2.147000	0.42226	1.416000	0.47057	0.650000	0.86243	TTG	.		0.428	HSP90B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407349.1	NM_003299	
INSM2	84684	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	14	36005048	36005048	+	Silent	SNP	C	C	T			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr14:36005048C>T	ENST00000307169.3	+	1	1801	c.1590C>T	c.(1588-1590)tgC>tgT	p.C530C		NM_032594.3	NP_115983.3	Q96T92	INSM2_HUMAN	insulinoma-associated 2	530					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(1)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	10	Breast(36;0.122)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(9;2.16e-07)|Lung(238;2.63e-07)|Epithelial(34;0.00145)|all cancers(34;0.00452)	GBM - Glioblastoma multiforme(112;0.0223)		GCAAGCACTGCCCGTCCACTT	0.627																																					p.C530C		.											.	INSM2-226	0			c.C1590T						.						31.0	34.0	33.0					14																	36005048		2200	4297	6497	SO:0001819	synonymous_variant	84684	exon1			GCACTGCCCGTCC	AF260323	CCDS9657.1	14q13.1	2013-01-08			ENSG00000168348	ENSG00000168348		"""Zinc fingers, C2H2-type"""	17539	protein-coding gene	gene with protein product	"""mlt 1"""	614027					Standard	NM_032594		Approved	IA-6	uc001wth.1	Q96T92	OTTHUMG00000140223	ENST00000307169.3:c.1590C>T	14.37:g.36005048C>T		Somatic	133	0		WXS	Illumina HiSeq	Phase_I	116	23	NM_032594	0	0	0	0	0	A1L432|J9Y024|Q8N8K7|Q96Q84	Silent	SNP	ENST00000307169.3	37	CCDS9657.1																																																																																			.		0.627	INSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276686.1		
MIA2	117153	hgsc.bcm.edu	37	14	39717145	39717145	+	Missense_Mutation	SNP	A	A	G			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr14:39717145A>G	ENST00000280082.3	+	4	1566	c.1367A>G	c.(1366-1368)tAt>tGt	p.Y456C	MIA2_ENST00000556784.1_Missense_Mutation_p.Y455C|RP11-407N17.3_ENST00000553728.1_Missense_Mutation_p.Y456C	NM_054024.3	NP_473365.3	Q96PC5	MIA2_HUMAN	melanoma inhibitory activity 2	456					cholesterol homeostasis (GO:0042632)|triglyceride homeostasis (GO:0070328)	endoplasmic reticulum exit site (GO:0070971)|extracellular region (GO:0005576)				NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	31	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0216)		ACTATACCATATTTGAAAAAG	0.313																																					p.Y456C		.											.	MIA2-154	0			c.A1367G						.						54.0	60.0	58.0					14																	39717145		2202	4298	6500	SO:0001583	missense	117153	exon4			TACCATATTTGAA	BC035981	CCDS9672.1	14q13.2	2007-05-01			ENSG00000150526	ENSG00000150526			18432	protein-coding gene	gene with protein product		608001				12586826	Standard	NM_054024		Approved	FLJ22404	uc001wux.3	Q96PC5	OTTHUMG00000028831	ENST00000280082.3:c.1367A>G	14.37:g.39717145A>G	ENSP00000280082:p.Tyr456Cys	Somatic	70	1		WXS	Illumina HiSeq	Phase_I	102	6	NM_054024	0	0	0	0	0	A1L4H0|Q9H6C1	Missense_Mutation	SNP	ENST00000280082.3	37	CCDS9672.1	.	.	.	.	.	.	.	.	.	.	A	13.26	2.185016	0.38609	.	.	ENSG00000150526;ENSG00000150526;ENSG00000258941	ENST00000280082;ENST00000556784;ENST00000553728	T;T;T	0.51325	0.71;0.73;3.13	5.49	5.49	0.81192	.	0.192329	0.25878	N	0.027707	T	0.63022	0.2476	M	0.71581	2.175	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.986;0.994	T	0.59343	-0.7472	9	.	.	.	-8.4686	6.8201	0.23852	0.7925:0.0:0.0729:0.1346	.	456;456	Q96PC5;Q96PC5-2	MIA2_HUMAN;.	C	456;455;456	ENSP00000280082:Y456C;ENSP00000451934:Y455C;ENSP00000452252:Y456C	.	Y	+	2	0	MIA2;RP11-407N17.3	38786896	0.979000	0.34478	0.736000	0.30914	0.664000	0.39144	1.014000	0.29950	2.103000	0.63969	0.529000	0.55759	TAT	.		0.313	MIA2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276768.3	NM_054024	
FKBP3	2287	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	14	45603575	45603575	+	Silent	SNP	G	G	A			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr14:45603575G>A	ENST00000216330.3	-	2	495	c.85C>T	c.(85-87)Ctg>Ttg	p.L29L	FKBP3_ENST00000396062.3_Silent_p.L29L|FANCM_ENST00000542564.2_5'Flank|FANCM_ENST00000556036.1_5'Flank|FANCM_ENST00000267430.5_5'Flank			Q00688	FKBP3_HUMAN	FK506 binding protein 3, 25kDa	29					chaperone-mediated protein folding (GO:0061077)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)			NS(1)|biliary_tract(1)|endometrium(1)|large_intestine(2)|lung(6)|skin(1)	12						TGTTCCTGCAGAAACTTGATA	0.652																																					p.L29L		.											.	FKBP3-226	0			c.C85T						.						85.0	76.0	79.0					14																	45603575		2203	4300	6503	SO:0001819	synonymous_variant	2287	exon1			CCTGCAGAAACTT	M96256	CCDS9683.1	14q21.2	2008-08-11	2002-08-29		ENSG00000100442	ENSG00000100442			3719	protein-coding gene	gene with protein product		186947	"""FK506-binding protein 3 (25kD)"""			1374240, 1532945	Standard	NM_002013		Approved	FKBP-25, PPIase	uc010tqf.2	Q00688	OTTHUMG00000140267	ENST00000216330.3:c.85C>T	14.37:g.45603575G>A		Somatic	215	0		WXS	Illumina HiSeq	Phase_I	161	59	NM_002013	0	0	13	20	7	B2R4Q9|Q14317	Silent	SNP	ENST00000216330.3	37	CCDS9683.1																																																																																			.		0.652	FKBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276796.1	NM_002013	
ZFP36L1	677	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	14	69256349	69256349	+	Silent	SNP	C	C	G			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr14:69256349C>G	ENST00000439696.2	-	2	1219	c.918G>C	c.(916-918)ctG>ctC	p.L306L	ZFP36L1_ENST00000336440.3_Silent_p.L306L|ZFP36L1_ENST00000555997.1_3'UTR	NM_001244701.1|NM_004926.3	NP_001231630.1|NP_004917.2	Q07352	TISB_HUMAN	ZFP36 ring finger protein-like 1	306					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|T cell differentiation in thymus (GO:0033077)|vasculogenesis (GO:0001570)	cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|kidney(1)|large_intestine(1)|liver(2)|lung(9)|ovary(1)|prostate(2)|urinary_tract(1)	21				all cancers(60;0.00203)|BRCA - Breast invasive adenocarcinoma(234;0.00205)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		TGGAGCTGCTCAGGTAGCCCT	0.597											OREG0022753	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L375L		.											.	ZFP36L1-91	0			c.G1125C						.						71.0	79.0	76.0					14																	69256349		2203	4300	6503	SO:0001819	synonymous_variant	677	exon3			GCTGCTCAGGTAG	X79066	CCDS9791.1	14q22-q24	2012-11-27	2012-11-27	2001-11-23		ENSG00000185650		"""RING-type (C3HC4) zinc fingers"""	1107	protein-coding gene	gene with protein product		601064	"""zinc finger protein, C3H type, 36-like 1"", ""zinc finger protein 36, C3H type-like 1"""	BRF1		8024689	Standard	NM_004926		Approved	RNF162B, Berg36, ERF1, TIS11B, cMG1	uc021rve.1	Q07352		ENST00000439696.2:c.918G>C	14.37:g.69256349C>G		Somatic	229	0	1113	WXS	Illumina HiSeq	Phase_I	196	81	NM_001244701	1	0	90	169	78	Q13851	Silent	SNP	ENST00000439696.2	37	CCDS9791.1																																																																																			.		0.597	ZFP36L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413227.1		
MLH3	27030	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	14	75514890	75514890	+	Missense_Mutation	SNP	G	G	C			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr14:75514890G>C	ENST00000556740.1	-	1	1504	c.1469C>G	c.(1468-1470)tCt>tGt	p.S490C	MLH3_ENST00000555671.1_5'Flank|MLH3_ENST00000355774.2_Missense_Mutation_p.S490C|MLH3_ENST00000238662.7_Missense_Mutation_p.S490C|MLH3_ENST00000380968.2_De_novo_Start_OutOfFrame|MLH3_ENST00000544985.1_5'Flank|MLH3_ENST00000556257.1_Missense_Mutation_p.S490C			Q9UHC1	MLH3_HUMAN	mutL homolog 3	490					ATP catabolic process (GO:0006200)|female meiosis I (GO:0007144)|male meiosis (GO:0007140)|mismatch repair (GO:0006298)|protein localization (GO:0008104)|reciprocal meiotic recombination (GO:0007131)|synaptonemal complex assembly (GO:0007130)	chiasma (GO:0005712)|male germ cell nucleus (GO:0001673)|mismatch repair complex (GO:0032300)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|centromeric DNA binding (GO:0019237)|chromatin binding (GO:0003682)|mismatched DNA binding (GO:0030983)|satellite DNA binding (GO:0003696)|single-stranded DNA binding (GO:0003697)	p.S490Y(2)		breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	44				BRCA - Breast invasive adenocarcinoma(234;0.00688)		TTCCAGGAAAGATTTTTTATG	0.378								Mismatch excision repair (MMR)																													p.S490C		.											.	MLH3-228	2	Substitution - Missense(2)	lung(2)	c.C1469G						.						90.0	97.0	95.0					14																	75514890		2203	4299	6502	SO:0001583	missense	27030	exon2			AGGAAAGATTTTT	AF195657	CCDS9837.1, CCDS32123.1	14q24.3	2014-09-17	2013-09-12			ENSG00000119684			7128	protein-coding gene	gene with protein product		604395	"""mutL (E. coli) homolog 3"", ""mutL homolog 3 (E. coli)"""			10615123	Standard	XR_245681		Approved		uc001xrd.1	Q9UHC1		ENST00000556740.1:c.1469C>G	14.37:g.75514890G>C	ENSP00000452316:p.Ser490Cys	Somatic	223	0		WXS	Illumina HiSeq	Phase_I	358	134	NM_014381	0	0	1	4	3	P49751|Q56DK9|Q9P292|Q9UHC0	Missense_Mutation	SNP	ENST00000556740.1	37	CCDS32123.1	.	.	.	.	.	.	.	.	.	.	G	6.646	0.487760	0.12641	.	.	ENSG00000119684	ENST00000355774;ENST00000238662;ENST00000556257;ENST00000556740	D;D;D;D	0.83506	-1.63;-1.67;-1.73;-1.63	5.34	-0.28	0.12886	.	1.749140	0.02828	N	0.126415	T	0.81786	0.4896	L	0.56769	1.78	0.09310	N	0.999996	P;P	0.48503	0.911;0.761	P;B	0.47162	0.54;0.24	T	0.65705	-0.6103	10	0.54805	T	0.06	0.3633	2.4863	0.04600	0.2139:0.342:0.3276:0.1165	.	490;490	Q9UHC1-2;Q9UHC1	.;MLH3_HUMAN	C	490	ENSP00000348020:S490C;ENSP00000238662:S490C;ENSP00000451540:S490C;ENSP00000452316:S490C	ENSP00000238662:S490C	S	-	2	0	MLH3	74584643	0.000000	0.05858	0.121000	0.21740	0.448000	0.32197	0.167000	0.16602	-0.075000	0.12798	-0.291000	0.09656	TCT	.		0.378	MLH3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415006.1	NM_014381	
PPP2R5C	5527	broad.mit.edu	37	14	102391505	102391505	+	Missense_Mutation	SNP	C	C	G			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr14:102391505C>G	ENST00000334743.5	+	14	1519	c.1471C>G	c.(1471-1473)Cct>Gct	p.P491A	PPP2R5C_ENST00000350249.3_Missense_Mutation_p.P452A|PPP2R5C_ENST00000328724.5_Missense_Mutation_p.P507A|PPP2R5C_ENST00000422945.2_Missense_Mutation_p.P522A	NM_002719.3	NP_002710.2	Q13362	2A5G_HUMAN	protein phosphatase 2, regulatory subunit B', gamma	491					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of cell proliferation (GO:0008285)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	chromosome, centromeric region (GO:0000775)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	20						GAAGGACCGTCCTCTTGCACG	0.552																																					p.P522A													.	PPP2R5C-659	0			c.C1564G						.						147.0	159.0	155.0					14																	102391505		2203	4300	6503	SO:0001583	missense	5527	exon16			GACCGTCCTCTTG	L42375	CCDS9964.1, CCDS9965.1, CCDS45163.1, CCDS53911.1, CCDS53912.1	14q32.31	2010-06-18	2010-04-14		ENSG00000078304	ENSG00000078304		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9311	protein-coding gene	gene with protein product		601645	"""protein phosphatase 2, regulatory subunit B (B56), gamma isoform"", ""protein phosphatase 2, regulatory subunit B', gamma isoform"""			7592815	Standard	NM_002719		Approved	B56G, PR61G	uc001ykk.3	Q13362		ENST00000334743.5:c.1471C>G	14.37:g.102391505C>G	ENSP00000333905:p.Pro491Ala	Somatic	343	0		WXS	Illumina HiSeq	Phase_I	427	7	NM_001161725	0	0	19	20	1	B4DYJ8|B5BUA5|F5GWP3|Q14391|Q15060|Q15174|Q6ZN33	Missense_Mutation	SNP	ENST00000334743.5	37	CCDS9964.1	.	.	.	.	.	.	.	.	.	.	C	12.74	2.028934	0.35797	.	.	ENSG00000078304	ENST00000422945;ENST00000328724;ENST00000557268;ENST00000350249;ENST00000334743	T;T;T;T;T	0.48522	0.96;0.82;0.96;0.81;0.96	6.17	2.25	0.28309	.	0.200176	0.53938	N	0.000050	T	0.50633	0.1627	M	0.74881	2.28	0.47441	D	0.999424	B;B;B;B	0.16396	0.002;0.0;0.0;0.017	B;B;B;B	0.12837	0.008;0.003;0.001;0.006	T	0.51411	-0.8709	10	0.36615	T	0.2	-2.3351	18.9747	0.92731	0.0:0.5569:0.4431:0.0	.	522;452;491;507	F5GWP3;Q13362-3;Q13362;Q6ZN33	.;.;2A5G_HUMAN;.	A	522;507;520;452;491	ENSP00000412324:P522A;ENSP00000329009:P507A;ENSP00000450931:P520A;ENSP00000262239:P452A;ENSP00000333905:P491A	ENSP00000329009:P507A	P	+	1	0	PPP2R5C	101461258	1.000000	0.71417	0.294000	0.24946	0.986000	0.74619	2.801000	0.47908	0.146000	0.19002	0.655000	0.94253	CCT	.		0.552	PPP2R5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414373.2	NM_002719	
SNHG14	104472715	broad.mit.edu;ucsc.edu	37	15	25296712	25296712	+	RNA	SNP	G	G	C			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr15:25296712G>C	ENST00000549804.2	+	0	98				SNHG14_ENST00000547292.1_RNA|SNORD116-2_ENST00000384274.1_RNA|RP11-701H24.10_ENST00000552781.1_RNA|SNORD116-1_ENST00000384335.1_RNA					small nucleolar RNA host gene 14 (non-protein coding)																		CATCGGAACTGAGGTCCAGCA	0.473																																					.													.	.	0			.						.						162.0	146.0	150.0					15																	25296712		876	1991	2867			100033413	.			GGAACTGAGGTCC			15q11.2	2014-01-17	2011-08-22	2011-08-22	ENSG00000224078	ENSG00000224078		"""Long non-coding RNAs"""	37462	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 214"""		"""UBE3A antisense RNA 1 (non-protein coding)"""	UBE3A-AS1		23771028	Standard			Approved	NCRNA00214, UBE3A-AS			OTTHUMG00000056661		15.37:g.25296712G>C		Somatic	124	0		WXS	Illumina HiSeq	Phase_I	190	88	.	0	0	0	0	0		RNA	SNP	ENST00000549804.2	37																																																																																				.		0.473	SNHG14-012	KNOWN	non_canonical_other|basic	antisense	processed_transcript	OTTHUMT00000408278.2		
GABRB3	2562	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	15	26793190	26793190	+	Nonsense_Mutation	SNP	G	G	C			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr15:26793190G>C	ENST00000311550.5	-	9	1283	c.1172C>G	c.(1171-1173)tCa>tGa	p.S391*	GABRB3_ENST00000400188.3_Nonsense_Mutation_p.S320*|GABRB3_ENST00000541819.2_Nonsense_Mutation_p.S447*|GABRB3_ENST00000299267.4_Nonsense_Mutation_p.S391*|GABRB3_ENST00000545868.1_Nonsense_Mutation_p.S306*	NM_000814.5|NM_001278631.1	NP_000805.1|NP_001265560.1	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 3	391					cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|cochlea development (GO:0090102)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|GABA-gated chloride ion channel activity (GO:0022851)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(41)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	68		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Fospropofol(DB06716)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ivermectin(DB00602)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Piperazine(DB00592)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GGATATTGCTGAATTCCTGGT	0.493																																					p.S391X		.											.	GABRB3-518	0			c.C1172G						.						123.0	114.0	117.0					15																	26793190		2203	4300	6503	SO:0001587	stop_gained	2562	exon9			ATTGCTGAATTCC		CCDS10018.1, CCDS10019.1, CCDS53920.1, CCDS53921.1	15q12	2012-06-22			ENSG00000166206	ENSG00000166206		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4083	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 3"""	137192					Standard	NM_000814		Approved		uc001zaz.3	P28472	OTTHUMG00000129231	ENST00000311550.5:c.1172C>G	15.37:g.26793190G>C	ENSP00000308725:p.Ser391*	Somatic	245	0		WXS	Illumina HiSeq	Phase_I	273	125	NM_021912	0	0	8	8	0	B7Z2W1|B7Z825|F5H3D2|H7BYV8|Q14352|Q96FM5	Nonsense_Mutation	SNP	ENST00000311550.5	37	CCDS10019.1	.	.	.	.	.	.	.	.	.	.	G	32	5.176507	0.94846	.	.	ENSG00000166206	ENST00000311550;ENST00000541819;ENST00000299267;ENST00000400188;ENST00000545868	.	.	.	5.82	4.9	0.64082	.	0.597023	0.16989	N	0.191371	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	.	13.4207	0.60996	0.0746:0.0:0.9254:0.0	.	.	.	.	X	391;447;391;320;306	.	ENSP00000299267:S391X	S	-	2	0	GABRB3	24344283	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.681000	0.61663	2.752000	0.94435	0.655000	0.94253	TCA	.		0.493	GABRB3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251352.2		
APBA2	321	broad.mit.edu	37	15	29368274	29368274	+	Nonsense_Mutation	SNP	C	C	A			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr15:29368274C>A	ENST00000558402.1	+	7	1648	c.1049C>A	c.(1048-1050)tCa>tAa	p.S350*	APBA2_ENST00000411764.1_Nonsense_Mutation_p.S350*|APBA2_ENST00000561069.1_Nonsense_Mutation_p.S350*|APBA2_ENST00000558259.1_Nonsense_Mutation_p.S350*|APBA2_ENST00000558330.1_Nonsense_Mutation_p.S350*			Q99767	APBA2_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 2	350					in utero embryonic development (GO:0001701)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein transport (GO:0015031)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)	beta-amyloid binding (GO:0001540)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|liver(2)|lung(33)|stomach(1)|urinary_tract(1)	59		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)		AAGGTGGCATCATTTCCAAGT	0.373																																					p.S350X													.	APBA2-90	0			c.C1049A						.						181.0	182.0	181.0					15																	29368274		2203	4300	6503	SO:0001587	stop_gained	321	exon5			TGGCATCATTTCC	AB014719	CCDS10022.1, CCDS45197.1	15q11-q12	2008-07-18	2008-07-18		ENSG00000034053	ENSG00000034053			579	protein-coding gene	gene with protein product		602712	"""X11-like"", ""amyloid beta (A4) precursor protein-binding, family A, member 2 (X11-like)"""	X11L, MINT2		8955346	Standard	NM_005503		Approved	D15S1518E, LIN-10, MGC:14091, HsT16821	uc001zck.3	Q99767	OTTHUMG00000129255	ENST00000558402.1:c.1049C>A	15.37:g.29368274C>A	ENSP00000453293:p.Ser350*	Somatic	311	0		WXS	Illumina HiSeq	Phase_I	423	8	NM_005503	0	0	0	0	0	E9PGI4|O60571|Q5XKC0	Nonsense_Mutation	SNP	ENST00000558402.1	37	CCDS10022.1	.	.	.	.	.	.	.	.	.	.	C	40	8.254019	0.98727	.	.	ENSG00000034053	ENST00000411764;ENST00000219865;ENST00000382938	.	.	.	4.85	4.85	0.62838	.	0.168736	0.39407	N	0.001363	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.4725	0.75449	0.0:1.0:0.0:0.0	.	.	.	.	X	350;350;54	.	ENSP00000219865:S350X	S	+	2	0	APBA2	27155566	0.995000	0.38212	0.736000	0.30914	0.984000	0.73092	5.880000	0.69698	2.243000	0.73865	0.655000	0.94253	TCA	.		0.373	APBA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251362.3	NM_005503	
DMXL2	23312	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	15	51857284	51857284	+	Splice_Site	SNP	C	C	A			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr15:51857284C>A	ENST00000251076.5	-	4	652		c.e4+1		DMXL2_ENST00000449909.3_Splice_Site|DMXL2_ENST00000543779.2_Splice_Site|DMXL2_ENST00000560421.1_Splice_Site	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2							cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		TTGCTAAATACCTTGAGGATC	0.294																																					.		.											.	DMXL2-99	0			c.364+1G>T						.						26.0	26.0	26.0					15																	51857284		2194	4290	6484	SO:0001630	splice_region_variant	23312	exon5			TAAATACCTTGAG	AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.364+1G>T	15.37:g.51857284C>A		Somatic	31	0		WXS	Illumina HiSeq	Phase_I	55	24	NM_015263	0	0	0	0	0	B2RTR3|B7ZMH3|F5GWF1|O94938	Splice_Site	SNP	ENST00000251076.5	37	CCDS10141.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.052647	0.75960	.	.	ENSG00000104093	ENST00000251076;ENST00000543779;ENST00000449909	.	.	.	4.9	4.9	0.64082	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.4422	0.90670	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DMXL2	49644576	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	6.430000	0.73391	2.419000	0.82065	0.655000	0.94253	.	.		0.294	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254671.2	NM_015263	Intron
NTN3	4917	broad.mit.edu	37	16	2522390	2522390	+	Missense_Mutation	SNP	G	G	C			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr16:2522390G>C	ENST00000293973.1	+	1	891	c.688G>C	c.(688-690)Gca>Cca	p.A230P	TBC1D24_ENST00000293970.5_5'Flank|TBC1D24_ENST00000567020.1_5'Flank	NM_006181.2	NP_006172.1	O00634	NET3_HUMAN	netrin 3	230	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axon guidance (GO:0007411)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)	Golgi apparatus (GO:0005794)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|central_nervous_system(2)|lung(3)|prostate(1)	7						GCCTAGCACGGCAGGTGACCC	0.667																																					p.A230P													.	NTN3-90	0			c.G688C						.						45.0	42.0	43.0					16																	2522390		2197	4295	6492	SO:0001583	missense	4917	exon1			AGCACGGCAGGTG	U86759	CCDS10469.1	16p13.3	2013-03-01	2008-10-29	2008-10-29	ENSG00000162068	ENSG00000162068		"""Netrins"""	8030	protein-coding gene	gene with protein product	"""Netrin-3"""	602349	"""netrin 2 (chicken)-like"", ""netrin 2-like (chicken)"""	NTN2L		9143507, 10366627	Standard	NM_006181		Approved		uc002cqj.3	O00634	OTTHUMG00000128867	ENST00000293973.1:c.688G>C	16.37:g.2522390G>C	ENSP00000293973:p.Ala230Pro	Somatic	120	0		WXS	Illumina HiSeq	Phase_I	91	3	NM_006181	0	0	0	0	0		Missense_Mutation	SNP	ENST00000293973.1	37	CCDS10469.1	.	.	.	.	.	.	.	.	.	.	G	5.453	0.268715	0.10349	.	.	ENSG00000162068	ENST00000293973	T	0.75367	-0.93	3.94	2.98	0.34508	Laminin, N-terminal (3);	0.832194	0.10240	N	0.698483	T	0.55737	0.1939	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.43032	-0.9416	10	0.33141	T	0.24	.	12.0483	0.53493	0.0:0.8149:0.1851:0.0	.	230	O00634	NET3_HUMAN	P	230	ENSP00000293973:A230P	ENSP00000293973:A230P	A	+	1	0	NTN3	2462391	0.000000	0.05858	0.001000	0.08648	0.014000	0.08584	0.200000	0.17257	0.876000	0.35872	0.305000	0.20034	GCA	.		0.667	NTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250812.1	NM_006181	
GGA2	23062	broad.mit.edu	37	16	23503028	23503028	+	Missense_Mutation	SNP	G	G	C			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr16:23503028G>C	ENST00000309859.4	-	5	527	c.445C>G	c.(445-447)Cga>Gga	p.R149G	GGA2_ENST00000567468.1_Missense_Mutation_p.R149G	NM_015044.4	NP_055859.1	Q9UJY4	GGA2_HUMAN	golgi-associated, gamma adaptin ear containing, ARF binding protein 2	149	VHS. {ECO:0000255|PROSITE- ProRule:PRU00218}.				intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)	p.R149*(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)	21				GBM - Glioblastoma multiforme(48;0.0386)		TAAGCGTCTCGAATCTTGATG	0.443																																					p.R149G													.	GGA2-91	1	Substitution - Nonsense(1)	large_intestine(1)	c.C445G						.						182.0	160.0	167.0					16																	23503028		2197	4300	6497	SO:0001583	missense	23062	exon5			CGTCTCGAATCTT	AF190863	CCDS10611.1	16p12	2010-02-12	2010-02-12		ENSG00000103365	ENSG00000103365			16064	protein-coding gene	gene with protein product		606005				10747088, 10749927	Standard	NM_015044		Approved	VEAR, KIAA1080	uc002dlq.3	Q9UJY4	OTTHUMG00000096957	ENST00000309859.4:c.445C>G	16.37:g.23503028G>C	ENSP00000311962:p.Arg149Gly	Somatic	289	0		WXS	Illumina HiSeq	Phase_I	407	9	NM_015044	0	0	46	47	1	D3DWF0|O14564|Q9NYN2|Q9UPS2	Missense_Mutation	SNP	ENST00000309859.4	37	CCDS10611.1	.	.	.	.	.	.	.	.	.	.	G	13.36	2.214586	0.39102	.	.	ENSG00000103365	ENST00000309859	T	0.22945	1.93	5.48	4.49	0.54785	VHS subgroup (1);ENTH/VHS (2);VHS (2);	0.141960	0.49305	D	0.000151	T	0.42630	0.1211	L	0.59436	1.845	0.37997	D	0.934095	D	0.71674	0.998	D	0.68039	0.955	T	0.34775	-0.9815	10	0.42905	T	0.14	-12.57	11.491	0.50381	0.0:0.0:0.689:0.311	.	149	Q9UJY4	GGA2_HUMAN	G	149	ENSP00000311962:R149G	ENSP00000311962:R149G	R	-	1	2	GGA2	23410529	0.999000	0.42202	1.000000	0.80357	0.802000	0.45316	1.149000	0.31626	2.568000	0.86640	0.643000	0.83706	CGA	.		0.443	GGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214019.1		
SEZ6L2	26470	broad.mit.edu	37	16	29884594	29884594	+	Missense_Mutation	SNP	A	A	G			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr16:29884594A>G	ENST00000308713.5	-	14	2982	c.2455T>C	c.(2455-2457)Tcc>Ccc	p.S819P	SEZ6L2_ENST00000537485.1_Missense_Mutation_p.S775P|SEZ6L2_ENST00000346932.5_Missense_Mutation_p.S705P|SEZ6L2_ENST00000350527.3_Missense_Mutation_p.S749P	NM_001114099.2|NM_201575.3	NP_001107571.1|NP_963869.2	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2	819	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GTCCACTGGGAGGGGTGGCCG	0.642																																					p.S819P													.	SEZ6L2-92	0			c.T2455C						.						45.0	48.0	47.0					16																	29884594		2197	4300	6497	SO:0001583	missense	26470	exon14			ACTGGGAGGGGTG	AY358404	CCDS10658.1, CCDS10659.1, CCDS45458.1, CCDS58447.1, CCDS73865.1	16p12.1	2008-02-05			ENSG00000174938	ENSG00000174938			30844	protein-coding gene	gene with protein product	"""type I transmembrane receptor (seizure related protein)"""					12975309	Standard	NM_012410		Approved	PSK-1, FLJ90517	uc010vec.2	Q6UXD5	OTTHUMG00000132112	ENST00000308713.5:c.2455T>C	16.37:g.29884594A>G	ENSP00000312550:p.Ser819Pro	Somatic	88	7		WXS	Illumina HiSeq	Phase_I	82	13	NM_001243332	0	0	4	4	0	B7Z1N0|F5H293|H7BXQ6|Q9BW82|Q9UJ45|Q9UJ46|Q9UJ47	Missense_Mutation	SNP	ENST00000308713.5	37	CCDS10659.1	.	.	.	.	.	.	.	.	.	.	A	22.0	4.229317	0.79688	.	.	ENSG00000174938	ENST00000350527;ENST00000308713;ENST00000346932;ENST00000537485	T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21	4.39	4.39	0.52855	Complement control module (2);Sushi/SCR/CCP (3);	0.220176	0.26244	N	0.025488	T	0.77356	0.4118	M	0.62088	1.915	0.80722	D	1	D;D;D;D;D;D	0.76494	0.999;0.986;0.971;0.983;0.986;0.983	D;P;P;P;P;P	0.75484	0.986;0.825;0.773;0.731;0.825;0.731	T	0.76170	-0.3057	10	0.35671	T	0.21	.	12.7207	0.57140	1.0:0.0:0.0:0.0	.	775;819;705;749;819;749	F5H293;B7Z5L4;Q9BW82;Q6UXD5-2;Q6UXD5;Q6UXD5-3	.;.;.;.;SE6L2_HUMAN;.	P	749;819;705;775	ENSP00000310206:S749P;ENSP00000312550:S819P;ENSP00000319215:S705P;ENSP00000439412:S775P	ENSP00000312550:S819P	S	-	1	0	SEZ6L2	29792095	1.000000	0.71417	0.989000	0.46669	0.984000	0.73092	6.921000	0.75805	1.831000	0.53308	0.533000	0.62120	TCC	.		0.642	SEZ6L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255154.2	NM_012410	
CX3CL1	6376	hgsc.bcm.edu;broad.mit.edu	37	16	57413597	57413597	+	Missense_Mutation	SNP	C	C	T			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr16:57413597C>T	ENST00000006053.6	+	2	233	c.122C>T	c.(121-123)tCa>tTa	p.S41L	CX3CL1_ENST00000564948.1_Intron|CX3CL1_ENST00000563383.1_Missense_Mutation_p.S47L|CX3CL1_ENST00000565912.1_Missense_Mutation_p.S3L	NM_002996.3	NP_002987.1	P78423	X3CL1_HUMAN	chemokine (C-X3-C motif) ligand 1	41	Chemokine.				angiogenesis involved in wound healing (GO:0060055)|cell adhesion (GO:0007155)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|immune response (GO:0006955)|leukocyte adhesive activation (GO:0050902)|leukocyte chemotaxis (GO:0030595)|lymphocyte chemotaxis (GO:0048247)|macrophage chemotaxis (GO:0048246)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|neutrophil chemotaxis (GO:0030593)|positive regulation of angiogenesis (GO:0045766)|positive regulation of calcium-independent cell-cell adhesion (GO:0051041)|positive regulation of inflammatory response (GO:0050729)|positive regulation of transforming growth factor beta1 production (GO:0032914)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	chemokine activity (GO:0008009)|receptor binding (GO:0005102)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)	5						AAGATGACATCAAAGATACCT	0.517																																					p.S41L		.											.	CX3CL1-226	0			c.C122T						.						180.0	130.0	147.0					16																	57413597		2198	4300	6498	SO:0001583	missense	6376	exon2			TGACATCAAAGAT	U84487	CCDS10779.1	16q13	2013-02-25	2002-08-22	2002-08-23	ENSG00000006210	ENSG00000006210		"""Endogenous ligands"""	10647	protein-coding gene	gene with protein product		601880	"""small inducible cytokine subfamily D (Cys-X3-Cys), member 1 (fractalkine, neurotactin)"""	SCYD1		9177350, 9024663	Standard	NM_002996		Approved	NTN, C3Xkine, ABCD-3, CXC3C, CXC3, fractalkine, neurotactin	uc002eli.3	P78423	OTTHUMG00000133469	ENST00000006053.6:c.122C>T	16.37:g.57413597C>T	ENSP00000006053:p.Ser41Leu	Somatic	108	0		WXS	Illumina HiSeq	Phase_I	109	6	NM_002996	0	0	9	9	0	O00672	Missense_Mutation	SNP	ENST00000006053.6	37	CCDS10779.1	.	.	.	.	.	.	.	.	.	.	C	10.24	1.296655	0.23650	.	.	ENSG00000006210	ENST00000006053	T	0.05199	3.48	3.0	0.929	0.19449	Chemokine interleukin-8-like domain (3);	2.900500	0.01491	N	0.017077	T	0.10551	0.0258	L	0.55103	1.725	0.09310	N	1	B	0.29862	0.259	B	0.35114	0.196	T	0.36744	-0.9735	10	0.87932	D	0	-27.7552	5.6639	0.17684	0.2253:0.5558:0.2189:0.0	.	41	P78423	X3CL1_HUMAN	L	41	ENSP00000006053:S41L	ENSP00000006053:S41L	S	+	2	0	CX3CL1	55971098	0.000000	0.05858	0.004000	0.12327	0.044000	0.14063	-1.476000	0.02333	0.302000	0.22762	0.460000	0.39030	TCA	.		0.517	CX3CL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257345.3	NM_002996	
WDR59	79726	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	16	74990405	74990405	+	Missense_Mutation	SNP	G	G	A			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr16:74990405G>A	ENST00000262144.6	-	3	338	c.208C>T	c.(208-210)Cat>Tat	p.H70Y	WDR59_ENST00000562331.1_5'UTR	NM_030581.3	NP_085058.3	Q6PJI9	WDR59_HUMAN	WD repeat domain 59	70										breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|ovary(1)|prostate(1)	27						AAGCTGTCATGAGGATTCCAC	0.468																																					p.H70Y		.											.	WDR59-92	0			c.C208T						.						106.0	94.0	98.0					16																	74990405		2198	4300	6498	SO:0001583	missense	79726	exon3			TGTCATGAGGATT	AB067510	CCDS32488.1	16q22.3	2013-01-09				ENSG00000103091		"""WD repeat domain containing"""	25706	protein-coding gene	gene with protein product						11572484	Standard	XM_005256146		Approved	FLJ12270	uc002fdh.1	Q6PJI9		ENST00000262144.6:c.208C>T	16.37:g.74990405G>A	ENSP00000262144:p.His70Tyr	Somatic	94	0		WXS	Illumina HiSeq	Phase_I	123	42	NM_030581	0	0	3	10	7	B3KRC3|Q71RE7|Q96PW5|Q9BSW6|Q9HA43	Missense_Mutation	SNP	ENST00000262144.6	37	CCDS32488.1	.	.	.	.	.	.	.	.	.	.	G	35	5.427353	0.96131	.	.	ENSG00000103091	ENST00000262144;ENST00000536050	T	0.70282	-0.47	6.17	6.17	0.99709	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.83119	0.5185	M	0.78049	2.395	0.80722	D	1	D;D	0.67145	0.996;0.993	D;D	0.75484	0.986;0.968	T	0.76072	-0.3093	10	0.06236	T	0.91	-22.0166	20.8794	0.99867	0.0:0.0:1.0:0.0	.	70;70	Q6PJI9-2;Q6PJI9	.;WDR59_HUMAN	Y	70;49	ENSP00000262144:H70Y	ENSP00000262144:H70Y	H	-	1	0	WDR59	73547906	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.410000	0.97335	2.941000	0.99782	0.655000	0.94253	CAT	.		0.468	WDR59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410601.3	NM_030581	
ZDHHC7	55625	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	16	85010706	85010706	+	Missense_Mutation	SNP	C	C	T			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr16:85010706C>T	ENST00000313732.4	-	7	1097	c.745G>A	c.(745-747)Gag>Aag	p.E249K	ZDHHC7_ENST00000564466.1_Missense_Mutation_p.E286K|ZDHHC7_ENST00000569488.1_5'Flank	NM_017740.2	NP_060210.2	Q9NXF8	ZDHC7_HUMAN	zinc finger, DHHC-type containing 7	249					peptidyl-L-cysteine S-palmitoylation (GO:0018230)|protein palmitoylation (GO:0018345)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			large_intestine(6)|lung(4)	10						CTTACCGTCTCGTCGTTGCAT	0.448																																					p.E286K		.											.	ZDHHC7-289	0			c.G856A						.						162.0	149.0	153.0					16																	85010706		2199	4300	6499	SO:0001583	missense	55625	exon8			CCGTCTCGTCGTT	AK000286	CCDS10950.1, CCDS45538.1	16q23.1	2010-02-09			ENSG00000153786	ENSG00000153786		"""Zinc fingers, DHHC-type"""	18459	protein-coding gene	gene with protein product	"""Sertoli cell gene with zinc finger domain-&#946;"""	614604					Standard	NM_017740		Approved	FLJ10792, ZNF370, FLJ20279, SERZ-B, SERZ1	uc002fiq.2	Q9NXF8	OTTHUMG00000137645	ENST00000313732.4:c.745G>A	16.37:g.85010706C>T	ENSP00000315604:p.Glu249Lys	Somatic	223	0		WXS	Illumina HiSeq	Phase_I	285	130	NM_001145548	0	0	0	1	1	D3DUM1|Q8WV42|Q9NVD8	Missense_Mutation	SNP	ENST00000313732.4	37	CCDS10950.1	.	.	.	.	.	.	.	.	.	.	C	36	5.726803	0.96847	.	.	ENSG00000153786	ENST00000313732;ENST00000344861	T;T	0.23552	1.9;1.9	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	T	0.47395	0.1443	L	0.57130	1.785	0.80722	D	1	P;D	0.71674	0.943;0.998	P;P	0.62184	0.674;0.899	T	0.26677	-1.0096	10	0.54805	T	0.06	-14.3722	19.2167	0.93781	0.0:1.0:0.0:0.0	.	286;249	Q9NXF8-2;Q9NXF8	.;ZDHC7_HUMAN	K	249;286	ENSP00000315604:E249K;ENSP00000341681:E286K	ENSP00000315604:E249K	E	-	1	0	ZDHHC7	83568207	1.000000	0.71417	0.981000	0.43875	0.844000	0.47949	7.666000	0.83877	2.784000	0.95788	0.655000	0.94253	GAG	.		0.448	ZDHHC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269087.1	NM_017740	
ITGAE	3682	hgsc.bcm.edu;broad.mit.edu	37	17	3659152	3659152	+	Missense_Mutation	SNP	A	A	T	rs376670383		TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr17:3659152A>T	ENST00000263087.4	-	11	1309	c.1211T>A	c.(1210-1212)aTt>aAt	p.I404N		NM_002208.4	NP_002199.3	P38570	ITAE_HUMAN	integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide)	404					cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	external side of plasma membrane (GO:0009897)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	41				UCEC - Uterine corpus endometrioid carcinoma (3;0.0813)		ACTGAAGCCAATCTGTGCCAG	0.592																																					p.I404N	NSCLC(182;635 2928 8995 38788)	.											.	ITGAE-161	0			c.T1211A						.						93.0	58.0	70.0					17																	3659152		2203	4300	6503	SO:0001583	missense	3682	exon11			AAGCCAATCTGTG	L25851	CCDS32531.1	17p13	2010-03-23				ENSG00000083457		"""CD molecules"", ""Integrins"""	6147	protein-coding gene	gene with protein product		604682				8119947	Standard	NM_002208		Approved	CD103, HUMINAE	uc002fwo.4	P38570		ENST00000263087.4:c.1211T>A	17.37:g.3659152A>T	ENSP00000263087:p.Ile404Asn	Somatic	8	0		WXS	Illumina HiSeq	Phase_I	15	8	NM_002208	0	0	0	0	0	Q17RS6|Q9NZU9	Missense_Mutation	SNP	ENST00000263087.4	37	CCDS32531.1	.	.	.	.	.	.	.	.	.	.	A	9.577	1.122528	0.20877	.	.	ENSG00000083457	ENST00000263087	T	0.58358	0.34	4.49	2.07	0.26955	.	.	.	.	.	T	0.41143	0.1146	L	0.51422	1.61	0.22571	N	0.998974	P	0.34462	0.454	B	0.29785	0.107	T	0.28744	-1.0034	9	0.51188	T	0.08	.	5.4982	0.16815	0.6409:0.0:0.3591:0.0	.	404	P38570	ITAE_HUMAN	N	404	ENSP00000263087:I404N	ENSP00000263087:I404N	I	-	2	0	ITGAE	3605901	0.002000	0.14202	0.605000	0.28930	0.320000	0.28249	0.698000	0.25571	0.284000	0.22305	0.421000	0.28195	ATT	.		0.592	ITGAE-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438169.1	NM_002208	
TP53	7157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	17	7579415	7579415	+	Nonsense_Mutation	SNP	C	C	T			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr17:7579415C>T	ENST00000269305.4	-	4	461	c.272G>A	c.(271-273)tGg>tAg	p.W91*	TP53_ENST00000359597.4_Nonsense_Mutation_p.W91*|TP53_ENST00000455263.2_Nonsense_Mutation_p.W91*|TP53_ENST00000413465.2_Nonsense_Mutation_p.W91*|TP53_ENST00000445888.2_Nonsense_Mutation_p.W91*|TP53_ENST00000420246.2_Nonsense_Mutation_p.W91*|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	91	Interaction with WWOX.		W -> C (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.W91*(7)|p.G59fs*23(3)|p.V73fs*9(1)|p.D48fs*55(1)|p.A88fs*52(1)|p.W91fs*13(1)|p.P87fs*54(1)|p.P13fs*18(1)|p.S33fs*23(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGACAGGGGCCAGGAGGGGGC	0.632		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.W91X	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	.	TP53-70225	25	Deletion - Frameshift(10)|Whole gene deletion(8)|Substitution - Nonsense(7)	lung(7)|upper_aerodigestive_tract(4)|bone(4)|central_nervous_system(3)|breast(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)|prostate(1)|liver(1)	c.G272A						.						44.0	50.0	48.0					17																	7579415		2202	4299	6501	SO:0001587	stop_gained	7157	exon4	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AGGGGCCAGGAGG	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.272G>A	17.37:g.7579415C>T	ENSP00000269305:p.Trp91*	Somatic	128	0		WXS	Illumina HiSeq	Phase_I	143	23	NM_000546	0	0	58	60	2	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	19.89	3.911071	0.72983	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000508793;ENST00000503591	.	.	.	4.08	4.08	0.47627	.	0.425160	0.22616	N	0.057766	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	-8.1711	14.5887	0.68347	0.0:1.0:0.0:0.0	.	.	.	.	X	91	.	ENSP00000269305:W91X	W	-	2	0	TP53	7520140	0.997000	0.39634	0.998000	0.56505	0.633000	0.38033	-0.143000	0.10296	2.561000	0.86390	0.561000	0.74099	TGG	.		0.632	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
MLLT6	4302	hgsc.bcm.edu	37	17	36881009	36881009	+	Missense_Mutation	SNP	C	C	A	rs150198262	byFrequency	TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr17:36881009C>A	ENST00000325718.7	+	19	3111	c.3020C>A	c.(3019-3021)gCg>gAg	p.A1007E		NM_005937.3	NP_005928	P55198	AF17_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6	1007					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(3)|lung(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8	Breast(7;4.43e-21)					CTGCTGTCTGCGGGTACCCCT	0.677			T	MLL	AL																																p.A1007E		.		Dom	yes		17	17q21	4302	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 (AF17)"""		L	.	MLLT6-659	0			c.C3020A						.						13.0	16.0	15.0					17																	36881009		2196	4297	6493	SO:0001583	missense	4302	exon19			TGTCTGCGGGTAC		CCDS11327.1	17q21	2014-04-10	2001-11-28		ENSG00000108292	ENSG00000275023		"""Zinc fingers, PHD-type"""	7138	protein-coding gene	gene with protein product	"""Myeloid/lymphoid or mixed-lineage leukemia, translocated to, 6"", ""trithorax homolog"""	600328	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 6"""			8058765	Standard	NM_005937		Approved	AF17, FLJ23480	uc002hqi.4	P55198	OTTHUMG00000188498	ENST00000325718.7:c.3020C>A	17.37:g.36881009C>A	ENSP00000316426:p.Ala1007Glu	Somatic	32	0		WXS	Illumina HiSeq	Phase_I	29	2	NM_005937	0	0	49	49	0	Q59F28|Q96IU3|Q9H5F6|Q9UF49	Missense_Mutation	SNP	ENST00000325718.7	37	CCDS11327.1	.	.	.	.	.	.	.	.	.	.	C	18.92	3.725015	0.68959	.	.	ENSG00000108292	ENST00000325718	T	0.46451	0.87	5.19	5.19	0.71726	.	0.696318	0.14064	N	0.343867	T	0.34890	0.0913	L	0.29908	0.895	0.36941	D	0.892365	B	0.27498	0.18	B	0.23275	0.045	T	0.36625	-0.9740	10	0.72032	D	0.01	.	15.9024	0.79392	0.0:1.0:0.0:0.0	.	1007	P55198	AF17_HUMAN	E	1007	ENSP00000316426:A1007E	ENSP00000316426:A1007E	A	+	2	0	MLLT6	34134535	0.994000	0.37717	0.541000	0.28102	0.960000	0.62799	5.959000	0.70339	2.860000	0.98153	0.655000	0.94253	GCG	C|0.999;T|0.001		0.677	MLLT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256799.1	NM_005937	
KRT13	3860	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	17	39659037	39659037	+	Missense_Mutation	SNP	T	T	A			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr17:39659037T>A	ENST00000246635.3	-	5	971	c.925A>T	c.(925-927)Acc>Tcc	p.T309S	KRT13_ENST00000336861.3_Missense_Mutation_p.T309S|KRT13_ENST00000587544.1_Missense_Mutation_p.T309S|KRT13_ENST00000587118.1_5'Flank|AC019349.5_ENST00000411759.1_RNA	NM_153490.2	NP_705694	P13646	K1C13_HUMAN	keratin 13	309	Coil 2.|Rod.				cellular response to retinoic acid (GO:0071300)|cytoskeleton organization (GO:0007010)|response to radiation (GO:0009314)|tongue morphogenesis (GO:0043587)	extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	33		Breast(137;0.000286)				GCAGTGTTGGTAGACACCTCC	0.577																																					p.T309S		.											.	KRT13-95	0			c.A925T						.						216.0	195.0	202.0					17																	39659037		2203	4300	6503	SO:0001583	missense	3860	exon5			TGTTGGTAGACAC		CCDS11396.1, CCDS11397.1	17q21.2	2013-06-20			ENSG00000171401	ENSG00000171401		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6415	protein-coding gene	gene with protein product	"""keratin, type I cytoskeletal 13"", ""cytokeratin 13"""	148065				16831889	Standard	NM_153490		Approved	K13, CK13, MGC3781, MGC161462	uc002hwu.1	P13646	OTTHUMG00000133434	ENST00000246635.3:c.925A>T	17.37:g.39659037T>A	ENSP00000246635:p.Thr309Ser	Somatic	456	0		WXS	Illumina HiSeq	Phase_I	447	195	NM_002274	0	0	15	39	24	Q53G54|Q6AZK5|Q8N240	Missense_Mutation	SNP	ENST00000246635.3	37	CCDS11396.1	.	.	.	.	.	.	.	.	.	.	T	0.668	-0.803036	0.02841	.	.	ENSG00000171401	ENST00000246635;ENST00000336861;ENST00000157775	T;T	0.76968	-1.06;-1.06	4.45	-3.03	0.05429	Filament (1);	0.306290	0.23211	N	0.050674	T	0.51058	0.1652	N	0.05124	-0.11	0.09310	N	1	B;B;B;B	0.15719	0.014;0.008;0.006;0.008	B;B;B;B	0.28305	0.053;0.088;0.03;0.088	T	0.47446	-0.9117	10	0.02654	T	1	.	12.9134	0.58192	0.301:0.0:0.0:0.699	.	297;309;309;309	P13646-2;A1A4E9;P13646-3;P13646	.;.;.;K1C13_HUMAN	S	309;309;297	ENSP00000246635:T309S;ENSP00000336604:T309S	ENSP00000157775:T297S	T	-	1	0	KRT13	36912563	0.000000	0.05858	0.056000	0.19401	0.751000	0.42716	-0.832000	0.04400	-0.336000	0.08438	0.391000	0.25812	ACC	.		0.577	KRT13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257297.1	NM_153490	
DBF4B	80174	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	17	42828063	42828063	+	Silent	SNP	C	C	T			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr17:42828063C>T	ENST00000315005.3	+	14	1428	c.1290C>T	c.(1288-1290)ctC>ctT	p.L430L	DBF4B_ENST00000393547.2_Intron	NM_145663.2	NP_663696.1	Q8NFT6	DBF4B_HUMAN	DBF4 zinc finger B	430					cell cycle (GO:0007049)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of protein kinase activity (GO:0045860)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(1)|lung(5)	7		Prostate(33;0.0322)				CCACAACCCTCCTGCCGGCCT	0.617																																					p.L430L		.											.	DBF4B-227	0			c.C1290T						.						56.0	52.0	53.0					17																	42828063		2203	4300	6503	SO:0001819	synonymous_variant	80174	exon14			AACCCTCCTGCCG	AF465820	CCDS11485.1, CCDS45706.1, CCDS45706.2	17q21.31	2014-02-17	2014-02-17		ENSG00000161692	ENSG00000161692		"""Zinc fingers, DBF-type"""	17883	protein-coding gene	gene with protein product	"""chiffon homolog B (Drosophila)"", ""zinc finger, DBF-type containing 1B"""	611661	"""DBF4 homolog B (S. cerevisiae)"""			15668232	Standard	NM_145663		Approved	FLJ13087, DRF1, ASKL1, chifb, ZDBF1B	uc002ihf.3	Q8NFT6	OTTHUMG00000165717	ENST00000315005.3:c.1290C>T	17.37:g.42828063C>T		Somatic	132	0		WXS	Illumina HiSeq	Phase_I	131	59	NM_145663	0	0	0	1	1	D3DX56|Q8TEX0|Q96B19|Q9H912	Silent	SNP	ENST00000315005.3	37	CCDS11485.1																																																																																			.		0.617	DBF4B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000385930.1	NM_025104	
EPN3	55040	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	17	48615544	48615544	+	Missense_Mutation	SNP	G	G	A			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr17:48615544G>A	ENST00000268933.3	+	3	1246	c.667G>A	c.(667-669)Gag>Aag	p.E223K	RP11-94C24.8_ENST00000513017.1_RNA|EPN3_ENST00000541226.1_Missense_Mutation_p.E167K|EPN3_ENST00000537145.1_Missense_Mutation_p.E278K	NM_017957.2	NP_060427.2	Q9H201	EPN3_HUMAN	epsin 3	223						clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	lipid binding (GO:0008289)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	14	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;2.88e-09)			CATGAGCCGTGAGGAGGCAGA	0.667																																					p.E223K		.											.	EPN3-91	0			c.G667A						.						47.0	38.0	41.0					17																	48615544		2203	4300	6503	SO:0001583	missense	55040	exon3			AGCCGTGAGGAGG	AF324241	CCDS11570.1	17q21.33	2008-07-18				ENSG00000049283			18235	protein-coding gene	gene with protein product		607264				10951261, 11359770	Standard	NM_017957		Approved	FLJ20778, MGC129899	uc002ira.4	Q9H201		ENST00000268933.3:c.667G>A	17.37:g.48615544G>A	ENSP00000268933:p.Glu223Lys	Somatic	63	0		WXS	Illumina HiSeq	Phase_I	43	29	NM_017957	0	0	3	7	4	A8K6J3|A8KAB2|Q9BVN6|Q9NWK2	Missense_Mutation	SNP	ENST00000268933.3	37	CCDS11570.1	.	.	.	.	.	.	.	.	.	.	G	28.5	4.925509	0.92319	.	.	ENSG00000049283	ENST00000268933;ENST00000442715;ENST00000537145;ENST00000541226;ENST00000411703	T;T;T	0.58060	2.08;1.24;0.36	4.54	4.54	0.55810	Ubiquitin interacting motif (3);	0.062476	0.64402	D	0.000007	T	0.73434	0.3586	M	0.79805	2.47	0.58432	D	0.999991	D;D;D	0.89917	1.0;1.0;0.998	D;D;D	0.87578	0.997;0.998;0.992	T	0.74408	-0.3675	10	0.35671	T	0.21	-20.981	17.345	0.87308	0.0:0.0:1.0:0.0	.	278;278;223	B4DK18;F6QWW5;Q9H201	.;.;EPN3_HUMAN	K	223;278;278;167;223	ENSP00000268933:E223K;ENSP00000439512:E278K;ENSP00000440540:E167K	ENSP00000268933:E223K	E	+	1	0	EPN3	45970543	1.000000	0.71417	0.861000	0.33841	0.595000	0.36748	9.783000	0.99037	2.247000	0.74100	0.456000	0.33151	GAG	.		0.667	EPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367573.1	NM_017957	
EPN3	55040	hgsc.bcm.edu;ucsc.edu	37	17	48616322	48616322	+	Missense_Mutation	SNP	G	G	C			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr17:48616322G>C	ENST00000268933.3	+	4	1338	c.759G>C	c.(757-759)gaG>gaC	p.E253D	RP11-94C24.8_ENST00000513017.1_RNA|EPN3_ENST00000541226.1_Intron|EPN3_ENST00000537145.1_Intron	NM_017957.2	NP_060427.2	Q9H201	EPN3_HUMAN	epsin 3	253						clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	lipid binding (GO:0008289)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	14	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;2.88e-09)			AGGAGCACGAGAAGGTAGTGG	0.687																																					p.E253D		.											.	EPN3-91	0			c.G759C						.						24.0	24.0	24.0					17																	48616322		2201	4299	6500	SO:0001583	missense	55040	exon4			GCACGAGAAGGTA	AF324241	CCDS11570.1	17q21.33	2008-07-18				ENSG00000049283			18235	protein-coding gene	gene with protein product		607264				10951261, 11359770	Standard	NM_017957		Approved	FLJ20778, MGC129899	uc002ira.4	Q9H201		ENST00000268933.3:c.759G>C	17.37:g.48616322G>C	ENSP00000268933:p.Glu253Asp	Somatic	48	0		WXS	Illumina HiSeq	Phase_I	24	11	NM_017957	0	0	2	2	0	A8K6J3|A8KAB2|Q9BVN6|Q9NWK2	Missense_Mutation	SNP	ENST00000268933.3	37	CCDS11570.1	.	.	.	.	.	.	.	.	.	.	G	13.33	2.204206	0.38905	.	.	ENSG00000049283	ENST00000268933;ENST00000411703	T	0.15256	2.44	4.5	3.51	0.40186	Ubiquitin interacting motif (2);	0.319926	0.29668	N	0.011504	T	0.12944	0.0314	L	0.42245	1.32	0.80722	D	1	B	0.12630	0.006	B	0.13407	0.009	T	0.07309	-1.0779	10	0.11794	T	0.64	.	9.5827	0.39497	0.0:0.1552:0.684:0.1609	.	253	Q9H201	EPN3_HUMAN	D	253	ENSP00000268933:E253D	ENSP00000268933:E253D	E	+	3	2	EPN3	45971321	1.000000	0.71417	0.999000	0.59377	0.801000	0.45260	4.211000	0.58507	1.001000	0.39076	0.313000	0.20887	GAG	.		0.687	EPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367573.1	NM_017957	
SPATA20	64847	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	17	48628090	48628090	+	Missense_Mutation	SNP	G	G	A			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr17:48628090G>A	ENST00000356488.4	+	10	1230	c.1147G>A	c.(1147-1149)Gaa>Aaa	p.E383K	SPATA20_ENST00000006658.6_Missense_Mutation_p.E399K|SPATA20_ENST00000511937.1_3'UTR|SPATA20_ENST00000393244.3_Missense_Mutation_p.E339K	NM_001258372.1	NP_001245301.1	Q8TB22	SPT20_HUMAN	spermatogenesis associated 20	383					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)	catalytic activity (GO:0003824)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;9.38e-09)			CTATAGCGCAGAAGATGCAGA	0.672											OREG0024568	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E399K		.											.	SPATA20-90	0			c.G1195A						.						47.0	58.0	54.0					17																	48628090		2203	4299	6502	SO:0001583	missense	64847	exon11			AGCGCAGAAGATG		CCDS11571.1, CCDS58563.1, CCDS58564.1	17q21.33	2011-03-17			ENSG00000006282	ENSG00000006282			26125	protein-coding gene	gene with protein product	"""hypothetical protein FLJ21347"""	613939				12477932	Standard	NM_022827		Approved	FLJ21347, SSP411, Tisp78	uc002ird.3	Q8TB22	OTTHUMG00000162162	ENST00000356488.4:c.1147G>A	17.37:g.48628090G>A	ENSP00000348878:p.Glu383Lys	Somatic	323	1	119	WXS	Illumina HiSeq	Phase_I	450	205	NM_022827	0	0	28	28	0	Q2TA99|Q2XUZ6|Q6P0P1|Q8WVW3|Q9H747	Missense_Mutation	SNP	ENST00000356488.4	37	CCDS58563.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.393663	0.83011	.	.	ENSG00000006282	ENST00000006658;ENST00000356488;ENST00000393244	T;T;T	0.30981	1.51;1.51;1.51	5.64	5.64	0.86602	Six-hairpin glycosidase (1);Six-hairpin glycosidase-like (1);	0.000000	0.85682	D	0.000000	T	0.68137	0.2968	H	0.95187	3.635	0.80722	D	1	D;D	0.76494	0.999;0.99	D;D	0.77557	0.99;0.964	T	0.77907	-0.2412	10	0.72032	D	0.01	-3.9451	16.6877	0.85314	0.0:0.1292:0.8708:0.0	.	383;399	Q8TB22;Q8TB22-2	SPT20_HUMAN;.	K	399;383;339	ENSP00000006658:E399K;ENSP00000348878:E383K;ENSP00000376935:E339K	ENSP00000006658:E399K	E	+	1	0	SPATA20	45983089	1.000000	0.71417	0.953000	0.39169	0.342000	0.28953	7.988000	0.88194	2.664000	0.90586	0.655000	0.94253	GAA	.		0.672	SPATA20-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367651.1	NM_022827	
SPATA20	64847	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	17	48628385	48628385	+	Silent	SNP	G	G	A			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr17:48628385G>A	ENST00000356488.4	+	11	1445	c.1362G>A	c.(1360-1362)caG>caA	p.Q454Q	SPATA20_ENST00000006658.6_Silent_p.Q470Q|SPATA20_ENST00000511937.1_3'UTR|SPATA20_ENST00000393244.3_Silent_p.Q410Q	NM_001258372.1	NP_001245301.1	Q8TB22	SPT20_HUMAN	spermatogenesis associated 20	454					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)	catalytic activity (GO:0003824)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;9.38e-09)			TGCAGGGCCAGAATGTGCTGA	0.637											OREG0024568	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q470Q		.											.	SPATA20-90	0			c.G1410A						.						37.0	42.0	40.0					17																	48628385		2203	4300	6503	SO:0001819	synonymous_variant	64847	exon12			GGGCCAGAATGTG		CCDS11571.1, CCDS58563.1, CCDS58564.1	17q21.33	2011-03-17			ENSG00000006282	ENSG00000006282			26125	protein-coding gene	gene with protein product	"""hypothetical protein FLJ21347"""	613939				12477932	Standard	NM_022827		Approved	FLJ21347, SSP411, Tisp78	uc002ird.3	Q8TB22	OTTHUMG00000162162	ENST00000356488.4:c.1362G>A	17.37:g.48628385G>A		Somatic	100	0	119	WXS	Illumina HiSeq	Phase_I	145	67	NM_022827	0	0	27	27	0	Q2TA99|Q2XUZ6|Q6P0P1|Q8WVW3|Q9H747	Silent	SNP	ENST00000356488.4	37	CCDS58563.1																																																																																			.		0.637	SPATA20-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367651.1	NM_022827	
TEX2	55852	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	17	62238165	62238165	+	Missense_Mutation	SNP	C	C	G			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr17:62238165C>G	ENST00000583097.1	-	8	2972	c.2800G>C	c.(2800-2802)Gaa>Caa	p.E934Q	TEX2_ENST00000258991.3_Missense_Mutation_p.E941Q|TEX2_ENST00000584379.1_Missense_Mutation_p.E934Q			Q8IWB9	TEX2_HUMAN	testis expressed 2	934					signal transduction (GO:0007165)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)				breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(8;1.33e-10)	READ - Rectum adenocarcinoma(1115;0.0689)		CCTTACCCTTCTTTGCCAATT	0.463																																					p.E941Q		.											.	TEX2-91	0			c.G2821C						.						176.0	187.0	183.0					17																	62238165		2203	4300	6503	SO:0001583	missense	55852	exon8			ACCCTTCTTTGCC	AB051525	CCDS11658.1, CCDS74131.1	17q23.3	2007-03-13	2007-03-13			ENSG00000136478			30884	protein-coding gene	gene with protein product	"""transmembrane protein 96"""		"""testis expressed sequence 2"""			11214970	Standard	XM_005257507		Approved	HT008, TMEM96, KIAA1738	uc002jee.3	Q8IWB9		ENST00000583097.1:c.2800G>C	17.37:g.62238165C>G	ENSP00000462665:p.Glu934Gln	Somatic	408	0		WXS	Illumina HiSeq	Phase_I	1011	701	NM_018469	0	0	0	0	0	Q6AHZ5|Q8N3L0|Q9C0C5	Missense_Mutation	SNP	ENST00000583097.1	37		.	.	.	.	.	.	.	.	.	.	C	16.25	3.069164	0.55539	.	.	ENSG00000136478	ENST00000258991	T	0.50548	0.74	5.84	5.84	0.93424	.	0.096119	0.64402	D	0.000001	T	0.67711	0.2922	M	0.68952	2.095	0.80722	D	1	D;D	0.69078	0.997;0.962	D;P	0.65010	0.931;0.756	T	0.66464	-0.5917	10	0.52906	T	0.07	.	20.1386	0.98045	0.0:1.0:0.0:0.0	.	941;934	Q8IWB9-2;Q8IWB9	.;TEX2_HUMAN	Q	941	ENSP00000258991:E941Q	ENSP00000258991:E941Q	E	-	1	0	TEX2	59591897	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.767000	0.95098	0.561000	0.74099	GAA	.		0.463	TEX2-003	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000443745.1	NM_018469	
CACNG4	27092	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	17	65026963	65026963	+	Missense_Mutation	SNP	T	T	C			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr17:65026963T>C	ENST00000262138.3	+	4	829	c.827T>C	c.(826-828)aTg>aCg	p.M276T	AC005544.1_ENST00000375684.1_5'Flank|RP11-74H8.1_ENST00000579138.1_RNA	NM_014405.3	NP_055220.1	Q9UBN1	CCG4_HUMAN	calcium channel, voltage-dependent, gamma subunit 4	276					membrane depolarization (GO:0051899)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(3)	19	all_cancers(12;9.86e-11)		BRCA - Breast invasive adenocarcinoma(6;1.35e-07)			GAGCTGTCCATGTACACGCTG	0.647																																					p.M276T		.											.	CACNG4-90	0			c.T827C						.						38.0	35.0	36.0					17																	65026963		2203	4300	6503	SO:0001583	missense	27092	exon4			TGTCCATGTACAC	AH008289	CCDS11667.1	17q24	2006-01-23				ENSG00000075461		"""Calcium channel subunits"""	1408	protein-coding gene	gene with protein product		606404				10613843	Standard	NM_014405		Approved	MGC11138, MGC24983	uc002jft.2	Q9UBN1		ENST00000262138.3:c.827T>C	17.37:g.65026963T>C	ENSP00000262138:p.Met276Thr	Somatic	102	1		WXS	Illumina HiSeq	Phase_I	163	33	NM_014405	0	0	2	2	0	B2RCK0	Missense_Mutation	SNP	ENST00000262138.3	37	CCDS11667.1	.	.	.	.	.	.	.	.	.	.	T	15.02	2.709441	0.48517	.	.	ENSG00000075461	ENST00000262138	T	0.57436	0.4	5.15	5.15	0.70609	.	0.039332	0.85682	D	0.000000	T	0.53562	0.1804	M	0.77313	2.365	0.80722	D	1	P	0.42827	0.791	B	0.35859	0.212	T	0.64483	-0.6397	10	0.87932	D	0	-22.375	15.0541	0.71897	0.0:0.0:0.0:1.0	.	276	Q9UBN1	CCG4_HUMAN	T	276	ENSP00000262138:M276T	ENSP00000262138:M276T	M	+	2	0	CACNG4	62457425	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.578000	0.82498	1.967000	0.57214	0.529000	0.55759	ATG	.		0.647	CACNG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447036.1	NM_014405	
SLC38A10	124565	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	17	79249777	79249777	+	Missense_Mutation	SNP	C	C	T			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr17:79249777C>T	ENST00000374759.3	-	8	1287	c.904G>A	c.(904-906)Gag>Aag	p.E302K	SLC38A10_ENST00000288439.5_Missense_Mutation_p.E302K|SLC38A10_ENST00000546352.1_5'UTR	NM_001037984.1	NP_001033073.1	Q9HBR0	S38AA_HUMAN	solute carrier family 38, member 10	302					amino acid transport (GO:0006865)|bone development (GO:0060348)|sodium ion transport (GO:0006814)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(2)|lung(7)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			ACCTGCTGCTCACACAGCAGC	0.597																																					p.E302K		.											.	SLC38A10-70	0			c.G904A						.						91.0	87.0	88.0					17																	79249777		2203	4300	6503	SO:0001583	missense	124565	exon8			GCTGCTCACACAG	BC014642	CCDS11780.1, CCDS42397.1	17q25.3	2013-05-22			ENSG00000157637	ENSG00000157637		"""Solute carriers"""	28237	protein-coding gene	gene with protein product							Standard	XM_005257019		Approved	MGC15523, PP1744	uc002jzz.1	Q9HBR0	OTTHUMG00000168049	ENST00000374759.3:c.904G>A	17.37:g.79249777C>T	ENSP00000363891:p.Glu302Lys	Somatic	249	0		WXS	Illumina HiSeq	Phase_I	361	77	NM_001037984	0	0	0	0	0	Q6ZRC5|Q8NA99|Q96C66	Missense_Mutation	SNP	ENST00000374759.3	37	CCDS42397.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.510735	0.85389	.	.	ENSG00000157637	ENST00000374759;ENST00000288439	T;T	0.02216	4.39;4.39	4.88	4.88	0.63580	.	0.239727	0.41396	D	0.000893	T	0.05456	0.0144	N	0.16567	0.415	0.58432	D	0.999998	B;D	0.89917	0.178;1.0	B;D	0.85130	0.054;0.997	T	0.65307	-0.6200	10	0.16420	T	0.52	-37.9351	17.6417	0.88138	0.0:1.0:0.0:0.0	.	302;302	Q9HBR0-2;Q9HBR0	.;S38AA_HUMAN	K	302	ENSP00000363891:E302K;ENSP00000288439:E302K	ENSP00000288439:E302K	E	-	1	0	SLC38A10	76864372	1.000000	0.71417	0.929000	0.37066	0.845000	0.48019	7.379000	0.79691	2.244000	0.73946	0.655000	0.94253	GAG	.		0.597	SLC38A10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397747.1	NM_138570	
DSC2	1824	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	18	28660162	28660162	+	Missense_Mutation	SNP	G	G	C			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr18:28660162G>C	ENST00000280904.6	-	10	1863	c.1420C>G	c.(1420-1422)Cca>Gca	p.P474A	DSC2_ENST00000251081.6_Missense_Mutation_p.P474A	NM_024422.3	NP_077740.1	Q02487	DSC2_HUMAN	desmocollin 2	474	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell-cardiac muscle cell adhesion (GO:0086042)|cell adhesion (GO:0007155)|cellular response to starvation (GO:0009267)|homophilic cell adhesion (GO:0007156)|regulation of heart rate by cardiac conduction (GO:0086091)|ventricular cardiac muscle cell action potential (GO:0086005)	cell-cell adherens junction (GO:0005913)|cytoplasmic vesicle (GO:0031410)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)	21			OV - Ovarian serous cystadenocarcinoma(10;0.0241)			GTCTGTATTGGAGGGTTACAC	0.443																																					p.P474A		.											.	DSC2-517	0			c.C1420G						.						195.0	167.0	177.0					18																	28660162		2203	4300	6503	SO:0001583	missense	1824	exon10			GTATTGGAGGGTT	X56807	CCDS11892.1, CCDS11893.1	18q12.1	2014-09-17			ENSG00000134755	ENSG00000134755		"""Cadherins / Major cadherins"""	3036	protein-coding gene	gene with protein product		125645		DSC3		7774948	Standard	NM_024422		Approved	CDHF2	uc002kwl.4	Q02487	OTTHUMG00000131981	ENST00000280904.6:c.1420C>G	18.37:g.28660162G>C	ENSP00000280904:p.Pro474Ala	Somatic	265	0		WXS	Illumina HiSeq	Phase_I	427	225	NM_024422	0	0	2	2	0		Missense_Mutation	SNP	ENST00000280904.6	37	CCDS11892.1	.	.	.	.	.	.	.	.	.	.	G	5.668	0.307878	0.10733	.	.	ENSG00000134755	ENST00000251081;ENST00000280904;ENST00000438199;ENST00000399347	T;T	0.60548	0.18;0.18	5.92	-2.13	0.07144	Cadherin (3);Cadherin-like (1);	2.202610	0.03087	N	0.159213	T	0.31199	0.0789	N	0.11673	0.155	0.09310	N	1	B;B	0.09022	0.001;0.002	B;B	0.15052	0.005;0.012	T	0.20672	-1.0268	10	0.06365	T	0.9	.	4.1607	0.10282	0.1425:0.4668:0.1934:0.1973	.	474;474	Q02487;Q02487-2	DSC2_HUMAN;.	A	474;474;240;487	ENSP00000251081:P474A;ENSP00000280904:P474A	ENSP00000251081:P474A	P	-	1	0	DSC2	26914160	0.000000	0.05858	0.000000	0.03702	0.251000	0.25915	-0.336000	0.07863	-0.382000	0.07870	-0.150000	0.13652	CCA	.		0.443	DSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254943.1	NM_004949	
MISP	126353	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	757669	757669	+	Silent	SNP	C	C	T			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr19:757669C>T	ENST00000215582.6	+	2	826	c.723C>T	c.(721-723)aaC>aaT	p.N241N		NM_173481.2	NP_775752.1	Q8IVT2	MISP_HUMAN	mitotic spindle positioning	241					mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)											ACCTGGCCAACGGGCACGTGG	0.672																																					p.N241N		.											.	C19orf21-91	0			c.C723T						.						24.0	27.0	26.0					19																	757669		2203	4300	6503	SO:0001819	synonymous_variant	126353	exon2			GGCCAACGGGCAC	BC052236	CCDS12042.1	19p13.3	2014-06-25	2013-05-03	2013-05-03	ENSG00000099812	ENSG00000099812			27000	protein-coding gene	gene with protein product	"""mitotic interactor and substrate of Plk1"""	615289	"""chromosome 19 open reading frame 21"""	C19orf21		23574715, 23509069, 24475924	Standard	NM_173481		Approved	DKFZp686H18209, Caprice		Q8IVT2	OTTHUMG00000181786	ENST00000215582.6:c.723C>T	19.37:g.757669C>T		Somatic	53	0		WXS	Illumina HiSeq	Phase_I	59	29	NM_173481	0	0	2	13	11		Silent	SNP	ENST00000215582.6	37	CCDS12042.1																																																																																			.		0.672	MISP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457600.2	NM_173481	
PIK3R2	5296	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	18279617	18279617	+	Silent	SNP	G	G	A			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr19:18279617G>A	ENST00000593731.1	+	15	2450	c.1890G>A	c.(1888-1890)acG>acA	p.T630T	PIK3R2_ENST00000222254.8_Silent_p.T630T			O00459	P85B_HUMAN	phosphoinositide-3-kinase, regulatory subunit 2 (beta)	630	SH2 2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)	phosphatidylinositol 3-kinase regulator activity (GO:0035014)|receptor tyrosine kinase binding (GO:0030971)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(3)|pancreas(1)|stomach(1)	24					Isoprenaline(DB01064)	TCAACCGCACGCAGGCAGAGG	0.657											OREG0025359	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T630T		.											.	PIK3R2-1311	0			c.G1890A						.						75.0	48.0	57.0					19																	18279617		2203	4300	6503	SO:0001819	synonymous_variant	5296	exon15			CCGCACGCAGGCA		CCDS12371.1	19p13.11	2013-03-28	2008-02-04		ENSG00000105647	ENSG00000105647		"""SH2 domain containing"""	8980	protein-coding gene	gene with protein product		603157				1314371	Standard	NM_005027		Approved	P85B, p85	uc002nia.2	O00459	OTTHUMG00000183383	ENST00000593731.1:c.1890G>A	19.37:g.18279617G>A		Somatic	65	0	724	WXS	Illumina HiSeq	Phase_I	48	21	NM_005027	0	0	19	40	21	Q5EAT5|Q9UPH9	Silent	SNP	ENST00000593731.1	37	CCDS12371.1																																																																																			.		0.657	PIK3R2-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	protein_coding	OTTHUMT00000466386.2	NM_005027	
PRR12	57479	hgsc.bcm.edu;broad.mit.edu	37	19	50099849	50099849	+	Missense_Mutation	SNP	G	G	A			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr19:50099849G>A	ENST00000418929.2	+	4	2269	c.2257G>A	c.(2257-2259)Gcc>Acc	p.A753T		NM_020719.1	NP_065770.1	Q9ULL5	PRR12_HUMAN	proline rich 12	0							DNA binding (GO:0003677)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|pancreas(1)|prostate(2)	11		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)		CGGGGCAGGCGCCAAGGAGCT	0.692																																					p.A753T		.											.	PRR12-70	0			c.G2257A						.						9.0	11.0	10.0					19																	50099849		1883	4040	5923	SO:0001583	missense	57479	exon4			GCAGGCGCCAAGG	AB033031	CCDS46143.1	19q13.33	2008-07-02	2006-02-06	2006-02-06		ENSG00000126464			29217	protein-coding gene	gene with protein product			"""KIAA1205"""	KIAA1205		10574462	Standard	NM_020719		Approved		uc002poo.4	Q9ULL5		ENST00000418929.2:c.2257G>A	19.37:g.50099849G>A	ENSP00000394510:p.Ala753Thr	Somatic	42	0		WXS	Illumina HiSeq	Phase_I	18	6	NM_020719	0	0	8	10	2	E9PB06|Q8N4J6	Missense_Mutation	SNP	ENST00000418929.2	37	CCDS46143.1	.	.	.	.	.	.	.	.	.	.	G	7.112	0.576277	0.13686	.	.	ENSG00000126464	ENST00000418929	.	.	.	3.56	3.56	0.40772	.	.	.	.	.	T	0.33177	0.0854	.	.	.	0.26879	N	0.967589	D	0.61080	0.989	P	0.48552	0.581	T	0.06516	-1.0822	7	0.23891	T	0.37	.	10.6184	0.45465	0.0:0.197:0.803:0.0	.	753	Q9ULL5-3	.	T	753	.	ENSP00000394510:A753T	A	+	1	0	PRR12	54791661	0.998000	0.40836	1.000000	0.80357	0.271000	0.26615	1.743000	0.38258	2.001000	0.58596	0.313000	0.20887	GCC	.		0.692	PRR12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465915.1	NM_020719	
ADCY3	109	broad.mit.edu	37	2	25057766	25057766	+	Missense_Mutation	SNP	G	G	A	rs142082596		TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr2:25057766G>A	ENST00000260600.5	-	9	2553	c.1702C>T	c.(1702-1704)Cgc>Tgc	p.R568C	ADCY3_ENST00000405392.1_Missense_Mutation_p.R201C|ADCY3_ENST00000450524.1_5'Flank	NM_004036.3	NP_004027.2	O60266	ADCY3_HUMAN	adenylate cyclase 3	568					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			NS(1)|breast(5)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|prostate(4)|skin(2)	44	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					TCCTGCAGGCGCAGCCTCCGG	0.652													G|||	1	0.000199681	0.0	0.0	5008	,	,		16963	0.0		0.001	False		,,,				2504	0.0				p.R568C													.	ADCY3-94	0			c.C1702T						.	G	CYS/ARG	0,4404		0,0,2202	29.0	29.0	29.0		1702	5.1	1.0	2	dbSNP_134	29	1,8599	1.2+/-3.3	0,1,4299	no	missense	ADCY3	NM_004036.3	180	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	benign	568/1145	25057766	1,13003	2202	4300	6502	SO:0001583	missense	109	exon9			GCAGGCGCAGCCT	AF033861	CCDS1715.1	2p23.3	2013-02-04			ENSG00000138031	ENSG00000138031	4.6.1.1	"""Adenylate cyclases"""	234	protein-coding gene	gene with protein product		600291				9920776	Standard	NM_004036		Approved	AC3	uc002rfs.4	O60266	OTTHUMG00000094765	ENST00000260600.5:c.1702C>T	2.37:g.25057766G>A	ENSP00000260600:p.Arg568Cys	Somatic	66	0		WXS	Illumina HiSeq	Phase_I	55	3	NM_004036	0	0	21	21	0	B3KT86|Q53T54|Q9UDB1	Missense_Mutation	SNP	ENST00000260600.5	37	CCDS1715.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	17.34	3.364062	0.61513	0.0	1.16E-4	ENSG00000138031	ENST00000260600;ENST00000405392;ENST00000415879	T;T	0.46819	0.86;0.86	5.05	5.05	0.67936	.	0.062472	0.64402	D	0.000003	T	0.40645	0.1125	N	0.24115	0.695	0.51012	D	0.9999	B;P;D	0.63046	0.002;0.844;0.992	B;B;P	0.46339	0.001;0.28;0.513	T	0.24512	-1.0158	10	0.33940	T	0.23	.	16.979	0.86322	0.0:0.0:1.0:0.0	.	568;568;201	B7ZLX9;O60266;B3KT86	.;ADCY3_HUMAN;.	C	568;201;543	ENSP00000260600:R568C;ENSP00000384484:R201C	ENSP00000260600:R568C	R	-	1	0	ADCY3	24911270	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.613000	0.67688	2.344000	0.79699	0.563000	0.77884	CGC	G|1.000;A|0.000		0.652	ADCY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211574.2		
ETAA1	54465	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	67631299	67631299	+	Silent	SNP	A	A	G			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr2:67631299A>G	ENST00000272342.5	+	5	1615	c.1485A>G	c.(1483-1485)caA>caG	p.Q495Q	ETAA1_ENST00000462772.1_Intron	NM_019002.3	NP_061875.2	Q9NY74	ETAA1_HUMAN	Ewing tumor-associated antigen 1	495						cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(9)|ovary(3)|prostate(1)|stomach(3)|urinary_tract(1)	33						ACGAAATTCAAAATTGTATAG	0.279																																					p.Q495Q		.											.	ETAA1-156	0			c.A1485G						.						20.0	22.0	22.0					2																	67631299		2126	4252	6378	SO:0001819	synonymous_variant	54465	exon5			AATTCAAAATTGT	AJ242682	CCDS1882.1	2p14	2014-02-12	2007-10-04		ENSG00000143971	ENSG00000143971			24648	protein-coding gene	gene with protein product		613196	"""Ewing's tumor-associated antigen 1"""			16003559	Standard	XM_005264374		Approved	ETAA16	uc002sdz.1	Q9NY74	OTTHUMG00000129545	ENST00000272342.5:c.1485A>G	2.37:g.67631299A>G		Somatic	51	0		WXS	Illumina HiSeq	Phase_I	89	44	NM_019002	0	0	5	5	0	Q05BT7|Q53SC4	Silent	SNP	ENST00000272342.5	37	CCDS1882.1																																																																																			.		0.279	ETAA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251735.1	NM_019002	
AFF3	3899	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	100623250	100623250	+	Silent	SNP	G	G	A	rs138844530		TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr2:100623250G>A	ENST00000409236.2	-	5	829	c.717C>T	c.(715-717)gaC>gaT	p.D239D	AFF3_ENST00000409579.1_Silent_p.D264D|AFF3_ENST00000356421.2_Silent_p.D264D|AFF3_ENST00000317233.4_Silent_p.D239D			P51826	AFF3_HUMAN	AF4/FMR2 family, member 3	239					embryonic hindlimb morphogenesis (GO:0035116)|regulation of transcription, DNA-templated (GO:0006355)|response to tumor necrosis factor (GO:0034612)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)			NS(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(9)|kidney(4)|large_intestine(20)|liver(1)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(3)	86						GATCTTGGCCGTCCATTGGCC	0.572													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18592	0.0		0.0	False		,,,				2504	0.0				p.D264D		.											.	AFF3-230	0			c.C792T						.	G	,	1,4405	2.1+/-5.4	0,1,2202	83.0	76.0	79.0		792,717	-7.5	0.9	2	dbSNP_134	79	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	AFF3	NM_001025108.1,NM_002285.2	,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,	264/1252,239/1227	100623250	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	3899	exon6			TTGGCCGTCCATT	U34360	CCDS33258.1, CCDS42723.1	2q11.2-q12	2008-02-05	2005-06-27	2005-06-27	ENSG00000144218	ENSG00000144218			6473	protein-coding gene	gene with protein product		601464	"""lymphoid nuclear protein related to AF4"""	LAF4		8662235, 8555498	Standard	XM_005263945		Approved	MLLT2-like	uc002taf.3	P51826	OTTHUMG00000153011	ENST00000409236.2:c.717C>T	2.37:g.100623250G>A		Somatic	100	1		WXS	Illumina HiSeq	Phase_I	102	43	NM_001025108	0	0	0	0	0	B7ZM46|B9EGL9|D3DVI6|Q53RD6|Q53S47|Q53SI6|Q53TB9|Q59F27|Q8IWJ5	Silent	SNP	ENST00000409236.2	37	CCDS42723.1																																																																																			G|1.000;A|0.000		0.572	AFF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328982.3	NM_002285	
SH3RF3	344558	broad.mit.edu	37	2	110065844	110065844	+	Missense_Mutation	SNP	G	G	A	rs369331698		TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr2:110065844G>A	ENST00000309415.6	+	8	2047	c.2047G>A	c.(2047-2049)Gca>Aca	p.A683T		NM_001099289.1	NP_001092759.1	Q8TEJ3	SH3R3_HUMAN	SH3 domain containing ring finger 3	683							zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(6)|liver(2)|lung(5)|ovary(2)	18						CGTCAGTGCCGCAAACCTCAA	0.622																																					p.A683T													.	SH3RF3-24	0			c.G2047A						.	G	THR/ALA	1,4173		0,1,2086	32.0	39.0	37.0		2047	4.0	0.8	2		37	0,8446		0,0,4223	no	missense	SH3RF3	NM_001099289.1	58	0,1,6309	AA,AG,GG		0.0,0.024,0.0079	possibly-damaging	683/883	110065844	1,12619	2087	4223	6310	SO:0001583	missense	344558	exon8			AGTGCCGCAAACC	AK074131	CCDS74557.1	2q13	2013-01-11	2008-05-14	2008-05-14	ENSG00000172985	ENSG00000172985		"""RING-type (C3HC4) zinc fingers"""	24699	protein-coding gene	gene with protein product			"""SH3 multiple domains 4"""	SH3MD4		16374509	Standard	XM_006712493		Approved	FLJ00204, POSH2	uc010ywt.1	Q8TEJ3	OTTHUMG00000153439	ENST00000309415.6:c.2047G>A	2.37:g.110065844G>A	ENSP00000309186:p.Ala683Thr	Somatic	36	0		WXS	Illumina HiSeq	Phase_I	42	3	NM_001099289	0	0	3	3	0	A0SDZ7|A8MPR1|Q8NDU1	Missense_Mutation	SNP	ENST00000309415.6	37		.	.	.	.	.	.	.	.	.	.	G	12.40	1.926213	0.34002	2.4E-4	0.0	ENSG00000172985	ENST00000418513;ENST00000309415	T;T	0.59906	0.23;2.07	4.9	4.03	0.46877	.	0.238285	0.41712	N	0.000823	T	0.46464	0.1394	.	.	.	0.38387	D	0.945298	P	0.35656	0.514	B	0.28139	0.086	T	0.53837	-0.8382	9	0.51188	T	0.08	-22.8632	13.0862	0.59142	0.0771:0.0:0.9229:0.0	.	683	Q8TEJ3	SH3R3_HUMAN	T	683	ENSP00000414997:A683T;ENSP00000309186:A683T	ENSP00000309186:A683T	A	+	1	0	SH3RF3	109432276	1.000000	0.71417	0.790000	0.31976	0.245000	0.25701	3.980000	0.56895	1.300000	0.44818	0.655000	0.94253	GCA	.		0.622	SH3RF3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001099289	
RGPD8	727851	broad.mit.edu	37	2	113127775	113127775	+	Missense_Mutation	SNP	G	G	C	rs370761877		TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr2:113127775G>C	ENST00000302558.3	-	23	5469	c.5278C>G	c.(5278-5280)Cct>Gct	p.P1760A	RGPD8_ENST00000409750.1_Missense_Mutation_p.P1620A	NM_001164463.1	NP_001157935.1	O14715	RGPD8_HUMAN	RANBP2-like and GRIP domain containing 8	1760				P -> A (in Ref. 3; CAI56757). {ECO:0000305}.	protein targeting to Golgi (GO:0000042)	nuclear pore (GO:0005643)	Ran GTPase binding (GO:0008536)	p.P1760A(12)		endometrium(4)|kidney(1)|lung(1)|prostate(3)|urinary_tract(1)	10						GAACGGGAAGGATTTTCTTCC	0.308																																					p.P1760A													.	.	12	Substitution - Missense(12)	prostate(6)|urinary_tract(2)|endometrium(2)|kidney(2)	c.C5278G						.						235.0	168.0	189.0					2																	113127775		686	1558	2244	SO:0001583	missense	727851	exon23			GGGAAGGATTTTC	AF012086	CCDS46394.1	2q13	2013-01-10	2005-12-20	2005-12-20	ENSG00000169629	ENSG00000169629		"""Tetratricopeptide (TTC) repeat domain containing"""	9849	protein-coding gene	gene with protein product		602752	"""RAN binding protein 2-like 1"""	RANBP2L1		9480752	Standard	NM_001164463		Approved	RanBP2alpha	uc002ths.2	O14715	OTTHUMG00000153289	ENST00000302558.3:c.5278C>G	2.37:g.113127775G>C	ENSP00000306637:p.Pro1760Ala	Somatic	51	1		WXS	Illumina HiSeq	Phase_I	69	3	NM_001164463	0	0	0	10	10	Q5CZA8	Missense_Mutation	SNP	ENST00000302558.3	37	CCDS46394.1	.	.	.	.	.	.	.	.	.	.	g	0.008	-1.892319	0.00522	.	.	ENSG00000169629	ENST00000302558;ENST00000409750	T;T	0.36520	1.25;1.25	0.719	0.719	0.18208	.	.	.	.	.	T	0.11239	0.0274	N	0.02011	-0.69	0.58432	D	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.18650	-1.0330	9	0.10902	T	0.67	-6.3628	6.3935	0.21599	0.0:0.6881:0.3119:0.0	.	1760	O14715	RGPD8_HUMAN	A	1760;1620	ENSP00000306637:P1760A;ENSP00000386511:P1620A	ENSP00000306637:P1760A	P	-	1	0	RGPD8	112844246	0.746000	0.28272	0.842000	0.33263	0.015000	0.08874	0.243000	0.18106	-0.105000	0.12132	-1.123000	0.02005	CCT	C|1.000;|0.000		0.308	RGPD8-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375951.1	XM_001722279	
POTEF	728378	hgsc.bcm.edu	37	2	130868165	130868165	+	Missense_Mutation	SNP	G	G	C			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr2:130868165G>C	ENST00000409914.2	-	7	1405	c.1006C>G	c.(1006-1008)Cta>Gta	p.L336V	RNU6-1049P_ENST00000516414.1_RNA|POTEF_ENST00000357462.5_Missense_Mutation_p.L336V|POTEF_ENST00000360967.5_Missense_Mutation_p.L336V|POTEF_ENST00000361163.4_Missense_Mutation_p.L346V|AC018804.3_ENST00000433507.1_RNA	NM_001099771.2	NP_001093241.1	A5A3E0	POTEF_HUMAN	POTE ankyrin domain family, member F	336					retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(28)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	53						TGTCCAGATAGATCTTGAGAA	0.368																																					p.L336V		.											.	POTEF-27	0			c.C1006G						.						14.0	14.0	14.0					2																	130868165		1694	3647	5341	SO:0001583	missense	728378	exon7			CAGATAGATCTTG	EF523384	CCDS46409.1	2q21.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000196604	ENSG00000196604		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33905	protein-coding gene	gene with protein product			"""ANKRD26-like family C, member 1B"""	A26C1B		17101985	Standard	NM_001099771		Approved	POTEACTIN, POTE2alpha	uc010fmh.2	A5A3E0	OTTHUMG00000153628	ENST00000409914.2:c.1006C>G	2.37:g.130868165G>C	ENSP00000386786:p.Leu336Val	Somatic	341	0		WXS	Illumina HiSeq	Phase_I	503	26	NM_001099771	0	0	3	3	0	A6NC34	Missense_Mutation	SNP	ENST00000409914.2	37	CCDS46409.1	.	.	.	.	.	.	.	.	.	.	.	1.850	-0.465204	0.04476	.	.	ENSG00000196604	ENST00000357462;ENST00000409914;ENST00000360967;ENST00000361163	T;T;T;T	0.64085	-0.08;-0.08;-0.08;0.63	0.887	-1.77	0.07982	Ankyrin repeat-containing domain (4);	3.437520	0.02566	U	0.097359	T	0.33294	0.0858	N	0.02539	-0.55	0.09310	N	1	B	0.16166	0.016	B	0.14578	0.011	T	0.10776	-1.0615	10	0.38643	T	0.18	.	2.5236	0.04686	0.0:0.4188:0.3215:0.2597	.	336	A5A3E0	POTEF_HUMAN	V	336;336;336;346	ENSP00000350052:L336V;ENSP00000386786:L336V;ENSP00000354232:L336V;ENSP00000355012:L346V	ENSP00000350052:L336V	L	-	1	2	POTEF	130584635	0.001000	0.12720	0.006000	0.13384	0.255000	0.26057	-2.256000	0.01181	-0.731000	0.04862	0.162000	0.16502	CTA	.		0.368	POTEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331889.2	NM_001099771	
POTEE	445582	hgsc.bcm.edu	37	2	131985905	131985905	+	Missense_Mutation	SNP	C	C	G			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr2:131985905C>G	ENST00000356920.5	+	5	1100	c.1006C>G	c.(1006-1008)Cta>Gta	p.L336V	PLEKHB2_ENST00000303908.3_Intron|RNU6-127P_ENST00000390897.1_RNA|POTEE_ENST00000358087.5_Missense_Mutation_p.L346V|PLEKHB2_ENST00000404460.1_Intron	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	336					retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)											TTCTCAAGATCTATCTGGACA	0.373																																					p.L336V		.											.	.	0			c.C1006G						.						2.0	3.0	2.0					2																	131985905		1105	2580	3685	SO:0001583	missense	445582	exon5			CAAGATCTATCTG	AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.1006C>G	2.37:g.131985905C>G	ENSP00000439189:p.Leu336Val	Somatic	393	0		WXS	Illumina HiSeq	Phase_I	646	33	NM_001083538	0	0	3	3	0	Q6S8J4|Q6S8J5|Q6S8J8	Missense_Mutation	SNP	ENST00000356920.5	37	CCDS46414.1	.	.	.	.	.	.	.	.	.	.	.	10.40	1.339185	0.24253	.	.	ENSG00000188219	ENST00000356920;ENST00000358087	T;T	0.64085	-0.08;0.63	0.887	-1.77	0.07982	Ankyrin repeat-containing domain (3);	3.437520	0.02566	U	0.097359	T	0.36441	0.0967	N	0.04132	-0.27	0.09310	N	1	B	0.16166	0.016	B	0.14578	0.011	T	0.11792	-1.0573	10	0.40728	T	0.16	.	2.5236	0.04686	0.2597:0.3215:0.4188:0.0	.	336	Q6S8J3	POTEE_HUMAN	V	336;346	ENSP00000439189:L336V;ENSP00000443049:L346V	ENSP00000439189:L336V	L	+	1	2	AC131180.1	131702375	0.000000	0.05858	0.006000	0.13384	0.317000	0.28152	-1.726000	0.01861	-0.731000	0.04862	0.162000	0.16502	CTA	.		0.373	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001083538	
NEB	4703	broad.mit.edu	37	2	152397247	152397247	+	Silent	SNP	C	C	T			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr2:152397247C>T	ENST00000172853.10	-	109	15795	c.15648G>A	c.(15646-15648)ttG>ttA	p.L5216L	NEB_ENST00000427231.2_Silent_p.L6917L|NEB_ENST00000603639.1_Silent_p.L6917L|NEB_ENST00000604864.1_Silent_p.L6917L|NEB_ENST00000397345.3_Silent_p.L6917L|NEB_ENST00000409198.1_Silent_p.L5216L			P20929	NEBU_HUMAN	nebulin	5216					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TAGCATGCTTCAAGGCTGTGG	0.433																																					p.L6917L													.	NEB-145	0			c.G20751A						.						155.0	151.0	152.0					2																	152397247		2037	4208	6245	SO:0001819	synonymous_variant	4703	exon137			ATGCTTCAAGGCT	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.15648G>A	2.37:g.152397247C>T		Somatic	139	1		WXS	Illumina HiSeq	Phase_I	186	10	NM_001271208	0	0	1	1	0	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Silent	SNP	ENST00000172853.10	37																																																																																				.		0.433	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
CCDC108	255101	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	219886640	219886640	+	Missense_Mutation	SNP	C	C	T			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr2:219886640C>T	ENST00000341552.5	-	18	3075	c.2992G>A	c.(2992-2994)Gag>Aag	p.E998K	CCDC108_ENST00000453220.1_Missense_Mutation_p.E998K|CCDC108_ENST00000441968.1_Missense_Mutation_p.E998K	NM_194302.2	NP_919278.2	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108	998						integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(1)|lung(34)|ovary(2)|pancreas(1)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AAGGCCAGCTCCTTTTCCTTT	0.597																																					p.E998K		.											.	CCDC108-94	0			c.G2992A						.						103.0	108.0	106.0					2																	219886640		2203	4300	6503	SO:0001583	missense	255101	exon18			CCAGCTCCTTTTC	NM_194302, AL833882, AK127189	CCDS2430.2, CCDS2431.2, CCDS63125.1, CCDS63126.1	2q35	2008-02-05			ENSG00000181378	ENSG00000181378			25325	protein-coding gene	gene with protein product		614270				12477932	Standard	NM_194302		Approved	DKFZp434O0527, MGC35338	uc002vjl.2	Q6ZU64	OTTHUMG00000133013	ENST00000341552.5:c.2992G>A	2.37:g.219886640C>T	ENSP00000340776:p.Glu998Lys	Somatic	279	0		WXS	Illumina HiSeq	Phase_I	159	90	NM_194302	0	0	0	0	0	A2BDD8|E9PCR1|E9PG25|E9PG72|Q6ZSR8|Q8N0T4|Q8NDJ3	Missense_Mutation	SNP	ENST00000341552.5	37	CCDS2430.2	.	.	.	.	.	.	.	.	.	.	C	9.157	1.017735	0.19355	.	.	ENSG00000181378	ENST00000341552;ENST00000441968;ENST00000453220	T;T;T	0.05199	3.48;3.48;3.48	4.89	3.11	0.35812	.	0.308243	0.23081	N	0.052148	T	0.08626	0.0214	M	0.67953	2.075	0.27209	N	0.959953	P	0.35656	0.514	B	0.37650	0.255	T	0.20107	-1.0285	10	0.12103	T	0.63	-17.3902	10.4801	0.44689	0.0:0.5718:0.3504:0.0778	.	998	Q6ZU64	CC108_HUMAN	K	998	ENSP00000340776:E998K;ENSP00000413377:E998K;ENSP00000409117:E998K	ENSP00000340776:E998K	E	-	1	0	CCDC108	219594884	0.378000	0.25114	0.953000	0.39169	0.255000	0.26057	0.327000	0.19663	0.289000	0.22422	-1.886000	0.00541	GAG	.		0.597	CCDC108-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256598.4	NM_194302	
TUBA4A	7277	broad.mit.edu	37	2	220115274	220115274	+	Missense_Mutation	SNP	C	C	T	rs368743618		TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr2:220115274C>T	ENST00000248437.4	-	4	1320	c.1147G>A	c.(1147-1149)Gcc>Acc	p.A383T	TUBA4A_ENST00000498660.1_5'Flank|TUBA4A_ENST00000392088.2_Missense_Mutation_p.A368T|TUBA4B_ENST00000490341.1_RNA	NM_006000.2	NP_005991.1	P68366	TBA4A_HUMAN	tubulin, alpha 4a	383					'de novo' posttranslational protein folding (GO:0051084)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	20		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000191)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	Cabazitaxel(DB06772)|Podofilox(DB01179)|Vincristine(DB00541)	TCGGCGATGGCGGTCGTGTTG	0.622																																					p.A383T													.	TUBA4A-93	0			c.G1147A						.	C	THR/ALA	1,4405	2.1+/-5.4	0,1,2202	86.0	72.0	77.0		1147	5.1	1.0	2		77	0,8600		0,0,4300	no	missense	TUBA4A	NM_006000.1	58	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	383/449	220115274	1,13005	2203	4300	6503	SO:0001583	missense	7277	exon4			CGATGGCGGTCGT	AK054731	CCDS2438.1, CCDS63131.1	2q36.1	2012-10-02	2007-02-12	2007-02-12	ENSG00000127824	ENSG00000127824		"""Tubulins"""	12407	protein-coding gene	gene with protein product		191110	"""tubulin, alpha 1 (testis specific)"", ""tubulin, alpha 1"""	TUBA1		3785200	Standard	NM_006000		Approved	FLJ30169, H2-ALPHA	uc002vkt.1	P68366	OTTHUMG00000133126	ENST00000248437.4:c.1147G>A	2.37:g.220115274C>T	ENSP00000248437:p.Ala383Thr	Somatic	139	0		WXS	Illumina HiSeq	Phase_I	81	4	NM_006000	0	0	9	9	0	A8MUB1|B3KNQ6|P05215	Missense_Mutation	SNP	ENST00000248437.4	37	CCDS2438.1	.	.	.	.	.	.	.	.	.	.	C	17.25	3.340976	0.60963	2.27E-4	0.0	ENSG00000127824	ENST00000248437;ENST00000392088	D;D	0.84298	-1.83;-1.83	5.05	5.05	0.67936	Tubulin/FtsZ, 2-layer sandwich domain (3);Tubulin/FtsZ, C-terminal (1);	0.000000	0.64402	D	0.000002	D	0.96093	0.8727	H	0.99705	4.715	0.80722	D	1	D	0.65815	0.995	D	0.65233	0.933	D	0.98196	1.0465	10	0.87932	D	0	.	18.5797	0.91166	0.0:1.0:0.0:0.0	.	383	P68366	TBA4A_HUMAN	T	383;368	ENSP00000248437:A383T;ENSP00000375938:A368T	ENSP00000248437:A383T	A	-	1	0	TUBA4A	219823518	1.000000	0.71417	0.989000	0.46669	0.796000	0.44982	7.622000	0.83099	2.608000	0.88229	0.650000	0.86243	GCC	.		0.622	TUBA4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256816.3	NM_006000	
OBSL1	23363	hgsc.bcm.edu;broad.mit.edu	37	2	220420911	220420911	+	Silent	SNP	G	G	A	rs200341414		TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr2:220420911G>A	ENST00000404537.1	-	14	4496	c.4440C>T	c.(4438-4440)gcC>gcT	p.A1480A	OBSL1_ENST00000603926.1_Silent_p.A1480A|OBSL1_ENST00000265317.5_Silent_p.A379A|RP11-256I23.2_ENST00000597192.1_RNA|OBSL1_ENST00000265318.4_Missense_Mutation_p.P1347L|OBSL1_ENST00000373876.1_Silent_p.A1388A	NM_015311.2	NP_056126.1	O75147	OBSL1_HUMAN	obscurin-like 1	1480	Ig-like 12.				cardiac myofibril assembly (GO:0055003)|cytoskeleton organization (GO:0007010)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|positive regulation of dendrite morphogenesis (GO:0050775)|protein localization to Golgi apparatus (GO:0034067)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|M band (GO:0031430)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)						Renal(207;0.0376)		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)		CCCAGCGCACGGCCCCCGCTG	0.657													G|||	1	0.000199681	0.0	0.0	5008	,	,		14964	0.0		0.001	False		,,,				2504	0.0				p.A1480A		.											.	OBSL1-71	0			c.C4440T						.	G	,	0,4222		0,0,2111	20.0	26.0	24.0		4440,4440	-5.8	0.9	2		24	1,8429		0,1,4214	no	coding-synonymous,coding-synonymous	OBSL1	NM_001173431.1,NM_015311.2	,	0,1,6325	AA,AG,GG		0.0119,0.0,0.0079	,	1480/1544,1480/1897	220420911	1,12651	2111	4215	6326	SO:0001819	synonymous_variant	23363	exon14			GCGCACGGCCCCC	BC007201	CCDS46520.1, CCDS54433.1, CCDS63134.1	2q35	2013-01-29			ENSG00000124006	ENSG00000124006		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29092	protein-coding gene	gene with protein product		610991				9734811	Standard	NM_015311		Approved	KIAA0657	uc010fwk.3	O75147	OTTHUMG00000059157	ENST00000404537.1:c.4440C>T	2.37:g.220420911G>A		Somatic	46	0		WXS	Illumina HiSeq	Phase_I	22	8	NM_001173431	0	0	1	1	0	A4KVA4|A4KVA5|Q96IW3|S4R3M6	Silent	SNP	ENST00000404537.1	37	CCDS46520.1	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	G	0.022	-1.408515	0.01155	0.0	1.19E-4	ENSG00000124006	ENST00000265318;ENST00000456147	T	0.56611	0.45	4.67	-5.8	0.02347	.	.	.	.	.	T	0.36524	0.0970	.	.	.	0.33297	D	0.564277	.	.	.	.	.	.	T	0.44952	-0.9294	6	0.23891	T	0.37	.	6.0534	0.19799	0.4558:0.0:0.2936:0.2506	.	.	.	.	L	1347;382	ENSP00000265318:P1347L	ENSP00000265318:P1347L	P	-	2	0	OBSL1	220129155	0.001000	0.12720	0.892000	0.35008	0.055000	0.15305	-1.760000	0.01806	-0.994000	0.03463	-1.174000	0.01732	CCG	G|0.999;A|0.001		0.657	OBSL1-014	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322012.1		
CPXM1	56265	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	20	2775058	2775058	+	Missense_Mutation	SNP	C	C	A			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr20:2775058C>A	ENST00000380605.2	-	14	2047	c.1983G>T	c.(1981-1983)tgG>tgT	p.W661C		NM_001184699.1|NM_019609.4	NP_001171628.1|NP_062555.1	Q96SM3	CPXM1_HUMAN	carboxypeptidase X (M14 family), member 1	661					cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(8)|lung(17)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43						TCAGCAGACGCCAATAATCCC	0.597																																					p.W661C		.											.	CPXM1-94	0			c.G1983T						.						56.0	55.0	55.0					20																	2775058		2203	4300	6503	SO:0001583	missense	56265	exon14			CAGACGCCAATAA	AL035460	CCDS13033.1	20p13	2012-02-10	2006-08-24	2006-08-24	ENSG00000088882	ENSG00000088882			15771	protein-coding gene	gene with protein product	"""carboxypeptidase-like protein X1"""	609555	"""carboxypeptidase X (M14 family)"""	CPXM		14702039	Standard	NM_019609		Approved	CPX-1, CPX1	uc002wgu.3	Q96SM3	OTTHUMG00000031706	ENST00000380605.2:c.1983G>T	20.37:g.2775058C>A	ENSP00000369979:p.Trp661Cys	Somatic	128	0		WXS	Illumina HiSeq	Phase_I	106	24	NM_019609	0	0	10	12	2	Q6P4G8|Q6UW65|Q9NUB5	Missense_Mutation	SNP	ENST00000380605.2	37	CCDS13033.1	.	.	.	.	.	.	.	.	.	.	c	21.1	4.099189	0.76983	.	.	ENSG00000088882	ENST00000380605;ENST00000421947	T	0.41758	0.99	5.12	5.12	0.69794	Peptidase M14, carboxypeptidase A (1);Carboxypeptidase-like, regulatory domain (1);Carboxypeptidase, regulatory domain (1);	0.000000	0.85682	D	0.000000	T	0.76399	0.3982	H	0.97103	3.94	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.84208	0.0454	10	0.87932	D	0	-16.2562	16.4323	0.83853	0.0:1.0:0.0:0.0	.	661	Q96SM3	CPXM1_HUMAN	C	661;357	ENSP00000369979:W661C	ENSP00000369979:W661C	W	-	3	0	CPXM1	2723058	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	7.560000	0.82277	2.821000	0.97095	0.651000	0.88453	TGG	.		0.597	CPXM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077643.2	NM_019609	
CTCFL	140690	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	20	56090811	56090811	+	Missense_Mutation	SNP	C	C	G			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr20:56090811C>G	ENST00000608263.1	-	5	1800	c.1139G>C	c.(1138-1140)aGa>aCa	p.R380T	CTCFL_ENST00000539382.1_Missense_Mutation_p.R175T|CTCFL_ENST00000432255.2_Intron|CTCFL_ENST00000609232.1_Missense_Mutation_p.R380T|CTCFL_ENST00000422869.2_Missense_Mutation_p.R380T|CTCFL_ENST00000608425.1_Missense_Mutation_p.R380T|CTCFL_ENST00000608903.1_Missense_Mutation_p.R118T|CTCFL_ENST00000502686.2_Missense_Mutation_p.R118T|CTCFL_ENST00000608440.1_Missense_Mutation_p.R380T|CTCFL_ENST00000371196.2_Missense_Mutation_p.R380T|CTCFL_ENST00000433949.3_Missense_Mutation_p.R175T|CTCFL_ENST00000429804.3_Missense_Mutation_p.R380T|CTCFL_ENST00000608858.1_5'UTR|CTCFL_ENST00000243914.3_Missense_Mutation_p.R380T|CTCFL_ENST00000423479.3_Missense_Mutation_p.R380T	NM_001269041.1	NP_001255970.1	Q8NI51	CTCFL_HUMAN	CCCTC-binding factor (zinc finger protein)-like	380					cell cycle (GO:0007049)|DNA methylation involved in gamete generation (GO:0043046)|histone methylation (GO:0016571)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of histone H3-K4 methylation (GO:0051569)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(28)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58	Lung NSC(12;0.00132)|all_lung(29;0.00433)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;3.95e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.09e-07)			GTAGGTATCTCTGCTGGCATA	0.483																																					p.R380T		.											.	CTCFL-292	0			c.G1139C						.						175.0	165.0	169.0					20																	56090811		2203	4300	6503	SO:0001583	missense	140690	exon5			GTATCTCTGCTGG		CCDS13459.1, CCDS58776.1, CCDS58777.1, CCDS58778.1, CCDS58779.1, CCDS58780.1, CCDS58781.1, CCDS58782.1, CCDS68161.1, CCDS68162.1, CCDS68163.1, CCDS68164.1	20q13.31	2013-01-08			ENSG00000124092	ENSG00000124092		"""Zinc fingers, C2H2-type"""	16234	protein-coding gene	gene with protein product	"""cancer/testis antigen 27"""	607022					Standard	NM_001269040		Approved	dJ579F20.2, BORIS, CT27	uc010giw.1	Q8NI51	OTTHUMG00000032829	ENST00000608263.1:c.1139G>C	20.37:g.56090811C>G	ENSP00000476783:p.Arg380Thr	Somatic	338	0		WXS	Illumina HiSeq	Phase_I	573	253	NM_001269044	0	0	0	0	0	A0S6W1|A1L4C6|A6XGL8|A6XGM2|A6XGM3|A6XGM8|A6XGN0|A6XGN1|A6XGN2|A6XGN3|A6XGN4|E7EQ27|E7EUE3|E9PBA9|Q5JUG4|Q9BZ30|Q9NQJ3	Missense_Mutation	SNP	ENST00000608263.1	37	CCDS13459.1	.	.	.	.	.	.	.	.	.	.	C	12.42	1.933464	0.34096	.	.	ENSG00000124092	ENST00000423479;ENST00000243914;ENST00000371196;ENST00000429804;ENST00000433949;ENST00000502686;ENST00000422109;ENST00000426658;ENST00000539382;ENST00000422869	T;T;T;T;T;T;T;T;T;T	0.27557	2.51;2.51;2.51;1.66;2.51;2.51;1.66;2.51;2.51;2.51	5.24	0.214	0.15249	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.465807	0.17788	N	0.161995	T	0.20700	0.0498	N	0.16016	0.355	0.35738	D	0.818477	B;P;B;P;P	0.43231	0.016;0.801;0.056;0.801;0.801	B;B;B;P;P	0.49012	0.038;0.412;0.088;0.598;0.598	T	0.18398	-1.0338	10	0.12103	T	0.63	-30.8232	9.21	0.37313	0.0:0.5082:0.0:0.4918	.	380;380;380;380;380	A6XGM9;A6XGM2;E7EUE3;A6XGL8;Q8NI51	.;.;.;.;CTCFL_HUMAN	T	380;380;380;380;380;118;380;380;175;380	ENSP00000415579:R380T;ENSP00000243914:R380T;ENSP00000360239:R380T;ENSP00000415329:R380T;ENSP00000392034:R380T;ENSP00000437999:R118T;ENSP00000413713:R380T;ENSP00000403369:R380T;ENSP00000439998:R175T;ENSP00000399061:R380T	ENSP00000243914:R380T	R	-	2	0	CTCFL	55524217	0.986000	0.35501	0.791000	0.31998	0.533000	0.34776	0.574000	0.23714	0.045000	0.15804	-0.312000	0.09012	AGA	.		0.483	CTCFL-019	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000472040.1	NM_080618	
ZBTB46	140685	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	20	62407208	62407208	+	Silent	SNP	G	G	A			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr20:62407208G>A	ENST00000245663.4	-	3	1195	c.1045C>T	c.(1045-1047)Ctg>Ttg	p.L349L	ZBTB46_ENST00000395104.1_Silent_p.L349L|ZBTB46_ENST00000302995.2_Silent_p.L349L	NM_025224.3	NP_079500.2	Q86UZ6	ZBT46_HUMAN	zinc finger and BTB domain containing 46	349					negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of monocyte differentiation (GO:0045656)|positive regulation of dendritic cell differentiation (GO:2001200)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(2)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	24	all_cancers(38;2.09e-12)|all_epithelial(29;3.8e-14)|Lung NSC(23;7.61e-10)|all_lung(23;2.64e-09)					GGAGGGCCCAGATAGCTGGCT	0.662																																					p.L349L		.											.	ZBTB46-154	0			c.C1045T						.						56.0	58.0	57.0					20																	62407208		2203	4300	6503	SO:0001819	synonymous_variant	140685	exon3			GGCCCAGATAGCT	AK131482	CCDS13538.1	20q13.33	2013-01-08	2006-09-19	2006-09-19	ENSG00000130584	ENSG00000130584		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	16094	protein-coding gene	gene with protein product	"""BTB-ZF protein expressed in effector lymphocytes"""	614639	"""BTB (POZ) domain containing 4"""	ZNF340, BTBD4			Standard	NM_025224		Approved	FLJ13502, RINZF, BZEL	uc002ygv.2	Q86UZ6	OTTHUMG00000033001	ENST00000245663.4:c.1045C>T	20.37:g.62407208G>A		Somatic	176	0		WXS	Illumina HiSeq	Phase_I	208	99	NM_025224	0	0	5	5	0	E1P5K9|Q5JWJ3|Q6GMV4|Q9BQK3|Q9H3Z8|Q9H3Z9	Silent	SNP	ENST00000245663.4	37	CCDS13538.1																																																																																			.		0.662	ZBTB46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080232.2	NM_025224	
SLC25A1	6576	broad.mit.edu	37	22	19164390	19164390	+	Silent	SNP	G	G	A			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr22:19164390G>A	ENST00000215882.5	-	6	756	c.600C>T	c.(598-600)ttC>ttT	p.F200F	SLC25A1_ENST00000451283.1_Silent_p.F97F|SLC25A1_ENST00000461267.1_5'UTR|CLTCL1_ENST00000442042.2_5'Flank	NM_005984.3	NP_005975.1	P53007	TXTP_HUMAN	solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1	200					carbohydrate metabolic process (GO:0005975)|cellular lipid metabolic process (GO:0044255)|citrate transport (GO:0015746)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	citrate transmembrane transporter activity (GO:0015137)			cervix(1)|lung(1)	2	Colorectal(54;0.0993)	all_lung(157;9.94e-09)		Lung(27;0.124)		AGGTCATGACGAAGAAGCGGA	0.642																																					p.F207F													.	SLC25A1-90	0			c.C621T						.						92.0	82.0	85.0					22																	19164390		2203	4300	6503	SO:0001819	synonymous_variant	6576	exon5			CATGACGAAGAAG	U25147	CCDS13758.1, CCDS74817.1	22q11	2013-05-22			ENSG00000100075	ENSG00000100075		"""Solute carriers"""	10979	protein-coding gene	gene with protein product		190315	"""solute carrier family 20 (mitochondrial citrate transporter), member 3"""	SLC20A3		8666394, 9254007	Standard	NM_001256534		Approved	CTP	uc002zoz.4	P53007	OTTHUMG00000150123	ENST00000215882.5:c.600C>T	22.37:g.19164390G>A		Somatic	147	0		WXS	Illumina HiSeq	Phase_I	154	6	NM_001256534	0	0	123	123	0	A8K8E8|Q9BSK6	Silent	SNP	ENST00000215882.5	37	CCDS13758.1																																																																																			.		0.642	SLC25A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316441.1	NM_005984	
PICK1	9463	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	22	38470965	38470965	+	Missense_Mutation	SNP	C	C	G			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr22:38470965C>G	ENST00000404072.3	+	13	1421	c.1074C>G	c.(1072-1074)ttC>ttG	p.F358L	PICK1_ENST00000356976.3_Missense_Mutation_p.F358L|RP5-1039K5.13_ENST00000445483.1_RNA	NM_001039583.1|NM_001039584.1	NP_001034672.1|NP_001034673.1	Q9NRD5	PICK1_HUMAN	protein interacting with PRKCA 1	358					ATP catabolic process (GO:0006200)|cellular response to decreased oxygen levels (GO:0036294)|cellular response to glucose starvation (GO:0042149)|dendritic spine maintenance (GO:0097062)|dendritic spine organization (GO:0097061)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|glial cell development (GO:0021782)|long term synaptic depression (GO:0060292)|monoamine transport (GO:0015844)|negative regulation of Arp2/3 complex-mediated actin nucleation (GO:0034316)|neuronal ion channel clustering (GO:0045161)|positive regulation of receptor internalization (GO:0002092)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)|protein targeting (GO:0006605)|receptor clustering (GO:0043113)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|endocytic vesicle membrane (GO:0030666)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	actin filament binding (GO:0051015)|Arp2/3 complex binding (GO:0071933)|ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein kinase C binding (GO:0005080)|receptor binding (GO:0005102)			cervix(1)|endometrium(3)|large_intestine(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	13	Melanoma(58;0.045)					CCGACGTCTTCCCCATCGAGG	0.607																																					p.F358L		.											.	PICK1-226	0			c.C1074G						.						106.0	74.0	85.0					22																	38470965		2203	4300	6503	SO:0001583	missense	9463	exon13			CGTCTTCCCCATC	AL049654	CCDS13965.1	22q13.1	2006-02-14	2006-02-14	2006-02-14	ENSG00000100151	ENSG00000100151			9394	protein-coding gene	gene with protein product		605926	"""protein kinase C, alpha binding protein"", ""protein interacting with PRKCA"""	PRKCABP		10340301, 10591208	Standard	XM_006724377		Approved	dJ1039K5, MGC15204	uc003aus.3	Q9NRD5	OTTHUMG00000151159	ENST00000404072.3:c.1074C>G	22.37:g.38470965C>G	ENSP00000385205:p.Phe358Leu	Somatic	83	0		WXS	Illumina HiSeq	Phase_I	66	25	NM_012407	0	0	22	30	8	B3KS52|O95906	Missense_Mutation	SNP	ENST00000404072.3	37	CCDS13965.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.273750	0.80580	.	.	ENSG00000100151	ENST00000404072;ENST00000356976	T;T	0.37411	1.2;1.2	4.33	3.21	0.36854	.	0.047493	0.85682	N	0.000000	T	0.55800	0.1943	M	0.81497	2.545	0.58432	D	0.999998	D	0.63880	0.993	D	0.68192	0.956	T	0.59726	-0.7400	10	0.72032	D	0.01	-17.1105	8.2306	0.31595	0.0:0.7398:0.162:0.0982	.	358	Q9NRD5	PICK1_HUMAN	L	358	ENSP00000385205:F358L;ENSP00000349465:F358L	ENSP00000349465:F358L	F	+	3	2	PICK1	36800911	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	2.142000	0.42177	2.124000	0.65301	0.561000	0.74099	TTC	.		0.607	PICK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321569.2	NM_012407	
MKL1	57591	hgsc.bcm.edu;broad.mit.edu	37	22	40814967	40814967	+	Missense_Mutation	SNP	G	G	A	rs199908950		TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr22:40814967G>A	ENST00000355630.3	-	12	2065	c.1475C>T	c.(1474-1476)tCg>tTg	p.S492L	MKL1_ENST00000402042.1_Missense_Mutation_p.S442L|MKL1_ENST00000396617.3_Missense_Mutation_p.S492L|MKL1_ENST00000407029.1_Missense_Mutation_p.S492L	NM_020831.3	NP_065882.1	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia (translocation) 1	492					negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription via serum response element binding (GO:0010735)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	actin binding (GO:0003779)|actin monomer binding (GO:0003785)|leucine zipper domain binding (GO:0043522)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(13)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	30						CTGCAGTGGCGAGGCCTGCAG	0.677			T	RBM15	acute megakaryocytic leukemia																																p.S492L		.		Dom	yes		22	22q13	57591	megakaryoblastic leukemia (translocation) 1		L	.	MKL1-948	0			c.C1475T						.						29.0	30.0	30.0					22																	40814967		2200	4299	6499	SO:0001583	missense	57591	exon12			AGTGGCGAGGCCT	AB037859	CCDS14003.1, CCDS74865.1, CCDS74866.1	22q13	2008-06-12			ENSG00000196588	ENSG00000196588			14334	protein-coding gene	gene with protein product	"""megakaryocytic acute leukemia"", ""myocardin-related transcription factor A"", ""basic, SAP and coiled-coil domain"""	606078				11431691, 12019265, 14970199	Standard	XM_005261692		Approved	KIAA1438, MAL, MRTF-A, BSAC	uc003ayw.1	Q969V6	OTTHUMG00000151146	ENST00000355630.3:c.1475C>T	22.37:g.40814967G>A	ENSP00000347847:p.Ser492Leu	Somatic	77	0		WXS	Illumina HiSeq	Phase_I	68	11	NM_020831	0	0	6	6	0	Q8TCL1|Q96SC5|Q96SC6|Q9P2B0	Missense_Mutation	SNP	ENST00000355630.3	37	CCDS14003.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.036393	0.75617	.	.	ENSG00000196588	ENST00000355630;ENST00000396617;ENST00000402042;ENST00000407029	T;T;T;T	0.69040	-0.29;-0.37;-0.36;-0.29	5.15	5.15	0.70609	.	0.061993	0.64402	D	0.000003	D	0.86163	0.5867	M	0.92367	3.3	0.52099	D	0.999946	B;D;D	0.76494	0.255;0.999;0.999	B;D;D	0.72625	0.024;0.978;0.978	D	0.88893	0.3347	10	0.62326	D	0.03	-16.568	18.819	0.92089	0.0:0.0:1.0:0.0	.	442;492;492	B0QY83;E7ER32;Q969V6	.;.;MKL1_HUMAN	L	492;492;442;492	ENSP00000347847:S492L;ENSP00000379861:S492L;ENSP00000385584:S442L;ENSP00000385835:S492L	ENSP00000347847:S492L	S	-	2	0	MKL1	39144913	1.000000	0.71417	0.515000	0.27774	0.937000	0.57800	6.783000	0.75078	2.676000	0.91093	0.591000	0.81541	TCG	G|0.999;A|0.001		0.677	MKL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321522.1	NM_020831	
PARVB	29780	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	22	44564537	44564537	+	Silent	SNP	C	C	T			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr22:44564537C>T	ENST00000338758.7	+	13	1137	c.1074C>T	c.(1072-1074)acC>acT	p.T358T	PARVB_ENST00000406477.3_Silent_p.T391T|PARVB_ENST00000404989.1_Silent_p.T321T	NM_013327.4	NP_037459.2	Q9HBI1	PARVB_HUMAN	parvin, beta	358	CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin cytoskeleton reorganization (GO:0031532)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell projection assembly (GO:0030031)|establishment or maintenance of cell polarity regulating cell shape (GO:0071963)|lamellipodium assembly (GO:0030032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(3)|large_intestine(7)|lung(8)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	25		Ovarian(80;0.0246)|all_neural(38;0.0423)				ACCTGTTCACCAAGTACAAGA	0.552																																					p.T391T		.											.	PARVB-226	0			c.C1173T						.						99.0	92.0	94.0					22																	44564537		2203	4300	6503	SO:0001819	synonymous_variant	29780	exon14			GTTCACCAAGTAC	AF151814	CCDS14056.1, CCDS46724.1, CCDS58808.1, CCDS74874.1	22q13.2-q13.33	2013-01-24			ENSG00000188677	ENSG00000188677		"""Parvins"""	14653	protein-coding gene	gene with protein product	"""affixin"""	608121				10810093, 11171322	Standard	NM_001003828		Approved	CGI-56	uc003ben.3	Q9HBI1	OTTHUMG00000150665	ENST00000338758.7:c.1074C>T	22.37:g.44564537C>T		Somatic	103	0		WXS	Illumina HiSeq	Phase_I	117	13	NM_001003828	0	0	8	8	0	B0QYM8|B0QYN1|B2R9X6|Q5TGJ5|Q86X93|Q96PN1|Q9NSP7|Q9UGT3|Q9Y368|Q9Y3L6|Q9Y3L7	Silent	SNP	ENST00000338758.7	37	CCDS14056.1																																																																																			.		0.552	PARVB-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319518.2	NM_001003828	
GTSE1	51512	broad.mit.edu	37	22	46712115	46712115	+	Missense_Mutation	SNP	C	C	T	rs542415397		TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr22:46712115C>T	ENST00000454366.1	+	7	1450	c.1238C>T	c.(1237-1239)cCc>cTc	p.P413L		NM_016426.6	NP_057510	Q9NYZ3	GTSE1_HUMAN	G-2 and S-phase expressed 1	394					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|microtubule-based process (GO:0007017)	cytoplasmic microtubule (GO:0005881)|membrane (GO:0016020)				NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	27		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00462)		CTCACGGCACCCCCCTCAGCA	0.627																																					p.P413L	GBM(153;542 1915 12487 29016 50495)												.	GTSE1-187	0			c.C1238T						.						28.0	34.0	32.0					22																	46712115		2203	4299	6502	SO:0001583	missense	51512	exon7			CGGCACCCCCCTC	AF223408	CCDS14074.2	22q13.2-q13.3	2008-06-10			ENSG00000075218	ENSG00000075218			13698	protein-coding gene	gene with protein product		607477				10974554, 10984615, 12750368	Standard	NM_016426		Approved	GTSE-1, B99	uc011aqy.2	Q9NYZ3	OTTHUMG00000150486	ENST00000454366.1:c.1238C>T	22.37:g.46712115C>T	ENSP00000415430:p.Pro413Leu	Somatic	137	0		WXS	Illumina HiSeq	Phase_I	133	5	NM_016426	0	0	7	7	0	B0QYM3|Q20WK2|Q53GX5|Q5R3I6|Q6DHX4|Q9BRE0|Q9UGZ9|Q9Y557	Missense_Mutation	SNP	ENST00000454366.1	37	CCDS14074.2	.	.	.	.	.	.	.	.	.	.	C	12.37	1.918468	0.33908	.	.	ENSG00000075218	ENST00000454366;ENST00000361934	T	0.07567	3.18	5.03	1.63	0.23807	.	0.747054	0.13230	N	0.403722	T	0.04363	0.0120	N	0.08118	0	0.09310	N	1	B;B	0.32101	0.053;0.356	B;B	0.34346	0.032;0.18	T	0.41502	-0.9505	10	0.44086	T	0.13	-7.8341	5.8869	0.18886	0.2662:0.5811:0.0:0.1527	.	394;373	Q9NYZ3;B4DZT6	GTSE1_HUMAN;.	L	413;373	ENSP00000415430:P413L	ENSP00000354634:P373L	P	+	2	0	GTSE1	45090779	0.001000	0.12720	0.014000	0.15608	0.004000	0.04260	0.808000	0.27154	0.211000	0.20683	0.650000	0.86243	CCC	.		0.627	GTSE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318360.2	NM_016426	
CELSR1	9620	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	22	46930992	46930992	+	Silent	SNP	G	G	A	rs529594359		TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr22:46930992G>A	ENST00000262738.3	-	1	2075	c.2076C>T	c.(2074-2076)taC>taT	p.Y692Y	CELSR1_ENST00000395964.1_Silent_p.Y692Y|CELSR1_ENST00000497509.1_5'Flank	NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	692	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		GACGAAGCTCGTAGGTGGGCT	0.642													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18477	0.0		0.0	False		,,,				2504	0.0				p.Y692Y		.											.	CELSR1-525	0			c.C2076T						.						44.0	28.0	34.0					22																	46930992		2201	4298	6499	SO:0001819	synonymous_variant	9620	exon1			AAGCTCGTAGGTG	AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.2076C>T	22.37:g.46930992G>A		Somatic	52	0		WXS	Illumina HiSeq	Phase_I	48	13	NM_014246	0	0	1	3	2	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Silent	SNP	ENST00000262738.3	37	CCDS14076.1	.	.	.	.	.	.	.	.	.	.	G	3.230	-0.157692	0.06544	.	.	ENSG00000075275	ENST00000454637	.	.	.	4.51	1.53	0.23141	.	.	.	.	.	T	0.55689	0.1936	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48479	-0.9032	4	.	.	.	.	8.3078	0.32053	0.4017:0.0:0.5983:0.0	.	.	.	.	M	67	.	.	T	-	2	0	CELSR1	45309656	0.873000	0.30073	0.986000	0.45419	0.599000	0.36880	-0.092000	0.11129	0.459000	0.27016	0.305000	0.20034	ACG	.		0.642	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318037.1	NM_014246	
LHFPL4	375323	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	9547649	9547649	+	Splice_Site	SNP	G	G	A			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr3:9547649G>A	ENST00000287585.6	-	3	929		c.e3+1			NM_198560.2	NP_940962.1	Q86UP9	LHPL3_HUMAN	lipoma HMGIC fusion partner-like 4							integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(3)|skin(1)	10	Medulloblastoma(99;0.227)					CAGCACACTCGCCTTTGTTCT	0.592																																					.		.											.	LHFPL4-71	0			c.643+2C>T						.						92.0	94.0	93.0					3																	9547649		2203	4300	6503	SO:0001630	splice_region_variant	375323	exon4			ACACTCGCCTTTG	AY278320	CCDS33691.1	3p25.3	2006-06-13			ENSG00000156959	ENSG00000156959			29568	protein-coding gene	gene with protein product		610240				15905332	Standard	NM_198560		Approved		uc003bry.3	Q7Z7J7	OTTHUMG00000155066	ENST00000287585.6:c.643+1C>T	3.37:g.9547649G>A		Somatic	372	2		WXS	Illumina HiSeq	Phase_I	390	176	NM_198560	0	0	0	0	0	A1L383|A4D0Q5	Splice_Site	SNP	ENST00000287585.6	37	CCDS33691.1	.	.	.	.	.	.	.	.	.	.	G	16.54	3.152833	0.57259	.	.	ENSG00000156959	ENST00000287585	.	.	.	5.49	1.02	0.19986	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.1995	0.25873	0.6562:0.0:0.3438:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	LHFPL4	9522649	1.000000	0.71417	0.999000	0.59377	0.952000	0.60782	3.006000	0.49529	0.261000	0.21753	0.655000	0.94253	.	.		0.592	LHFPL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338298.1	NM_198560	Intron
EFHB	151651	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	19925989	19925989	+	Silent	SNP	G	G	C			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr3:19925989G>C	ENST00000295824.9	-	11	2213	c.2052C>G	c.(2050-2052)ctC>ctG	p.L684L	EFHB_ENST00000344838.4_Silent_p.L554L	NM_144715.3	NP_653316.3	Q8N7U6	EFHB_HUMAN	EF-hand domain family, member B	684							calcium ion binding (GO:0005509)			breast(2)|endometrium(4)|kidney(1)|lung(17)|prostate(1)|urinary_tract(1)	26						GAAGTGTCCGGAGAGTCTTTT	0.393																																					p.L684L		.											.	EFHB-22	0			c.C2052G						.						126.0	130.0	128.0					3																	19925989		2203	4300	6503	SO:0001819	synonymous_variant	151651	exon11			TGTCCGGAGAGTC	AK122616	CCDS33715.2	3p24.3	2014-07-18			ENSG00000163576	ENSG00000163576		"""EF-hand domain containing"""	26330	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 21"""					12477932	Standard	NM_144715		Approved	FLJ25200, CFAP21	uc003cbl.4	Q8N7U6	OTTHUMG00000150505	ENST00000295824.9:c.2052C>G	3.37:g.19925989G>C		Somatic	129	0		WXS	Illumina HiSeq	Phase_I	190	85	NM_144715	0	0	0	0	0	A6ND25|A8MPR3|Q6ZWK9|Q8IV58|Q96LQ6	Silent	SNP	ENST00000295824.9	37	CCDS33715.2																																																																																			.		0.393	EFHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318673.2	NM_144715	
RAD54L2	23132	broad.mit.edu	37	3	51667682	51667682	+	Silent	SNP	C	C	T			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr3:51667682C>T	ENST00000409535.2	+	7	1040	c.915C>T	c.(913-915)caC>caT	p.H305H	RAD54L2_ENST00000296477.3_5'UTR	NM_015106.2	NP_055921.2	Q9Y4B4	ARIP4_HUMAN	RAD54-like 2 (S. cerevisiae)	305	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.					nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|transcription cofactor activity (GO:0003712)			NS(2)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|liver(2)|lung(9)|ovary(4)|skin(2)	31				BRCA - Breast invasive adenocarcinoma(193;0.000102)|Kidney(197;0.000758)|KIRC - Kidney renal clear cell carcinoma(197;0.000896)		TTCTGGCCCACAGCATGGGTC	0.527																																					p.H305H													.	RAD54L2-93	0			c.C915T						.						105.0	111.0	109.0					3																	51667682		2203	4300	6503	SO:0001819	synonymous_variant	23132	exon7			GGCCCACAGCATG	AB018352	CCDS33765.2	3p21.2	2006-01-17			ENSG00000164080	ENSG00000164080			29123	protein-coding gene	gene with protein product						9872452	Standard	NM_015106		Approved	KIAA0809, SRISNF2L	uc011bdt.2	Q9Y4B4	OTTHUMG00000152936	ENST00000409535.2:c.915C>T	3.37:g.51667682C>T		Somatic	182	0		WXS	Illumina HiSeq	Phase_I	219	6	NM_015106	0	0	5	5	0	Q8TB57|Q9BV54	Silent	SNP	ENST00000409535.2	37	CCDS33765.2	.	.	.	.	.	.	.	.	.	.	C	8.949	0.967608	0.18659	.	.	ENSG00000164080	ENST00000432863	.	.	.	5.55	2.41	0.29592	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-4.0289	8.2154	0.31507	0.0:0.593:0.0:0.407	.	.	.	.	X	134	.	.	Q	+	1	0	RAD54L2	51642722	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.322000	0.33689	0.152000	0.19188	0.655000	0.94253	CAG	.		0.527	RAD54L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328700.2	NM_015106	
PARP3	10039	broad.mit.edu	37	3	51979556	51979556	+	Missense_Mutation	SNP	G	G	C			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr3:51979556G>C	ENST00000417220.2	+	8	1395	c.907G>C	c.(907-909)Gag>Cag	p.E303Q	PARP3_ENST00000431474.1_Missense_Mutation_p.E303Q|PARP3_ENST00000398755.3_Missense_Mutation_p.E310Q			Q9Y6F1	PARP3_HUMAN	poly (ADP-ribose) polymerase family, member 3	303					DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|positive regulation of DNA ligation (GO:0051106)|protein ADP-ribosylation (GO:0006471)|protein localization to site of double-strand break (GO:1990166)|regulation of mitotic spindle organization (GO:0060236)|telomere maintenance (GO:0000723)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	catalytic activity (GO:0003824)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000541)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		GGCAGTCTCTGAGCAGGAGAA	0.622																																					p.E310Q													.	PARP3-660	0			c.G928C						.						42.0	48.0	46.0					3																	51979556		2085	4206	6291	SO:0001583	missense	10039	exon7			GTCTCTGAGCAGG	AF083068	CCDS43097.1, CCDS46839.1	3p22.2-p21.1	2010-07-14	2004-08-20	2004-08-26	ENSG00000041880	ENSG00000041880	2.4.2.30	"""Poly (ADP-ribose) polymerases"""	273	protein-coding gene	gene with protein product	"""poly(ADP-ribose) synthetase-3"", ""NAD+ ADP-ribosyltransferase 3"", ""poly(ADP-ribose) polymerase 3"""	607726	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 3"""	ADPRTL3		10329013	Standard	NM_001003931		Approved	ADPRT3, IRT1, hPARP-3, pADPRT-3	uc003dbz.3	Q9Y6F1	OTTHUMG00000156931	ENST00000417220.2:c.907G>C	3.37:g.51979556G>C	ENSP00000395951:p.Glu303Gln	Somatic	104	0		WXS	Illumina HiSeq	Phase_I	107	3	NM_001003931	0	0	14	14	0	Q8NER9|Q96CG2|Q9UG81	Missense_Mutation	SNP	ENST00000417220.2	37	CCDS43097.1	.	.	.	.	.	.	.	.	.	.	G	9.374	1.071180	0.20147	.	.	ENSG00000041880	ENST00000417220;ENST00000431474;ENST00000398755;ENST00000498510	T;T;T;T	0.11821	2.74;2.74;2.74;2.74	4.74	1.99	0.26369	Poly(ADP-ribose) polymerase, regulatory domain (3);	0.185088	0.47852	D	0.000218	T	0.13927	0.0337	L	0.61387	1.9	0.25613	N	0.986488	B;B	0.32010	0.312;0.351	B;B	0.33750	0.054;0.169	T	0.13629	-1.0502	10	0.49607	T	0.09	-17.5701	6.3533	0.21387	0.2469:0.172:0.5812:0.0	.	310;303	Q9Y6F1-2;Q9Y6F1	.;PARP3_HUMAN	Q	303;303;310;303	ENSP00000395951:E303Q;ENSP00000401511:E303Q;ENSP00000381740:E310Q;ENSP00000417625:E303Q	ENSP00000381740:E310Q	E	+	1	0	PARP3	51954596	0.545000	0.26449	0.005000	0.12908	0.385000	0.30292	1.575000	0.36493	0.241000	0.21283	0.561000	0.74099	GAG	.		0.622	PARP3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000348612.2	NM_005485.4	
FLNB	2317	broad.mit.edu	37	3	58089735	58089735	+	Silent	SNP	C	C	T	rs371251819		TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr3:58089735C>T	ENST00000295956.4	+	10	1698	c.1533C>T	c.(1531-1533)taC>taT	p.Y511Y	FLNB_ENST00000493452.1_Silent_p.Y342Y|FLNB_ENST00000358537.3_Silent_p.Y511Y|FLNB_ENST00000357272.4_Silent_p.Y511Y|FLNB_ENST00000429972.2_Silent_p.Y511Y|FLNB_ENST00000419752.2_Silent_p.Y342Y|FLNB_ENST00000348383.5_Silent_p.Y511Y|FLNB_ENST00000490882.1_Silent_p.Y511Y	NM_001457.3	NP_001448.2	O75369	FLNB_HUMAN	filamin B, beta	511					actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|cytoskeletal anchoring at plasma membrane (GO:0007016)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin binding (GO:0003779)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(13)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(23)|liver(2)|lung(38)|ovary(6)|prostate(3)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(5)	120				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		ATGGGGTCTACGCATTCGAGT	0.542																																					p.Y511Y													.	FLNB-593	0			c.C1533T						.	C	,,,	0,4406		0,0,2203	87.0	86.0	86.0		1533,1533,1533,1533	-5.2	0.4	3		86	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	FLNB	NM_001164317.1,NM_001164318.1,NM_001164319.1,NM_001457.3	,,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,,	511/2634,511/2592,511/2579,511/2603	58089735	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	2317	exon10			GGTCTACGCATTC	AF043045	CCDS2885.1, CCDS54599.1, CCDS54600.1, CCDS54601.1	3p14.3	2011-02-11	2009-07-23		ENSG00000136068	ENSG00000136068			3755	protein-coding gene	gene with protein product	"""actin binding protein 278"""	603381	"""filamin B, beta (actin binding protein 278)"", ""Larsen syndrome 1 (autosomal dominant)"""	FLN1L, LRS1		8327473, 10449914, 14991055, 16801345	Standard	NM_001457		Approved	TAP, TABP, ABP-278, FH1	uc010hne.2	O75369	OTTHUMG00000159158	ENST00000295956.4:c.1533C>T	3.37:g.58089735C>T		Somatic	188	0		WXS	Illumina HiSeq	Phase_I	173	4	NM_001457	0	0	10	10	0	B2ZZ83|B2ZZ84|B2ZZ85|C9JKE6|C9JMC4|Q13706|Q59EC2|Q60FE7|Q6MZJ1|Q8WXS9|Q8WXT0|Q8WXT1|Q8WXT2|Q8WXT3|Q9NRB5|Q9NT26|Q9UEV9	Silent	SNP	ENST00000295956.4	37	CCDS2885.1																																																																																			.		0.542	FLNB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353569.1	NM_001457	
GOLGB1	2804	broad.mit.edu	37	3	121386444	121386444	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr3:121386444G>A	ENST00000340645.5	-	20	9543	c.9418C>T	c.(9418-9420)Cag>Tag	p.Q3140*	GOLGB1_ENST00000393667.3_Nonsense_Mutation_p.Q3150*	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	3140					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		AGCTGCTGCTGAGCTTCAGAA	0.423																																					p.Q3150X													.	GOLGB1-161	0			c.C9448T						.						71.0	64.0	67.0					3																	121386444		2203	4300	6503	SO:0001587	stop_gained	2804	exon20			GCTGCTGAGCTTC	X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.9418C>T	3.37:g.121386444G>A	ENSP00000341848:p.Gln3140*	Somatic	91	0		WXS	Illumina HiSeq	Phase_I	136	5	NM_001256486	0	0	90	90	0	B2ZZ91|D3DN92|E7EP74|Q14398	Nonsense_Mutation	SNP	ENST00000340645.5	37	CCDS3004.1	.	.	.	.	.	.	.	.	.	.	G	51	17.699545	0.99891	.	.	ENSG00000173230	ENST00000340645;ENST00000393667	.	.	.	5.33	5.33	0.75918	.	0.107337	0.42053	D	0.000765	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18276	T	0.48	.	14.3897	0.66970	0.0:0.0:1.0:0.0	.	.	.	.	X	3140;3150	.	ENSP00000341848:Q3140X	Q	-	1	0	GOLGB1	122869134	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.018000	0.40991	2.775000	0.95449	0.650000	0.86243	CAG	.		0.423	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355159.1	NM_004487	
COL6A6	131873	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	130287049	130287049	+	Missense_Mutation	SNP	G	G	A			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr3:130287049G>A	ENST00000358511.6	+	5	2033	c.2002G>A	c.(2002-2004)Gac>Aac	p.D668N	COL6A6_ENST00000453409.2_Missense_Mutation_p.D668N	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	668	Nonhelical region.|VWFA 4. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.D668N(1)		NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						CCAGTTCAGCGACATCAATAA	0.423																																					p.D668N		.											.	COL6A6-76	1	Substitution - Missense(1)	large_intestine(1)	c.G2002A						.						178.0	173.0	175.0					3																	130287049		1922	4127	6049	SO:0001583	missense	131873	exon5			TTCAGCGACATCA	AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.2002G>A	3.37:g.130287049G>A	ENSP00000351310:p.Asp668Asn	Somatic	239	0		WXS	Illumina HiSeq	Phase_I	330	152	NM_001102608	0	0	0	0	0	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	ENST00000358511.6	37	CCDS46911.1	.	.	.	.	.	.	.	.	.	.	G	4.358	0.066002	0.08388	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	T;T	0.79749	-1.3;-1.3	5.53	-3.41	0.04839	von Willebrand factor, type A (3);	0.427722	0.21922	N	0.067159	T	0.71307	0.3324	L	0.50993	1.605	0.09310	N	1	B	0.18461	0.028	B	0.13407	0.009	T	0.58335	-0.7654	10	0.38643	T	0.18	.	13.4535	0.61184	0.0599:0.6662:0.1805:0.0934	.	668	A6NMZ7	CO6A6_HUMAN	N	668	ENSP00000351310:D668N;ENSP00000399236:D668N	ENSP00000351310:D668N	D	+	1	0	COL6A6	131769739	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-0.129000	0.10515	-0.601000	0.05783	0.655000	0.94253	GAC	.		0.423	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356705.5	NM_001102608	
DLG1	1739	broad.mit.edu	37	3	196771534	196771534	+	Missense_Mutation	SNP	G	G	C			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr3:196771534G>C	ENST00000419354.1	-	26	2961	c.2675C>G	c.(2674-2676)tCt>tGt	p.S892C	DLG1_ENST00000357674.4_Missense_Mutation_p.S881C|DLG1_ENST00000346964.2_Missense_Mutation_p.S914C|DLG1_ENST00000450955.1_Missense_Mutation_p.S881C|DLG1_ENST00000392382.2_Missense_Mutation_p.S859C|DLG1_ENST00000314062.3_Missense_Mutation_p.S841C|DLG1_ENST00000452595.1_Missense_Mutation_p.S776C|DLG1_ENST00000448528.2_Missense_Mutation_p.S892C|DLG1_ENST00000443183.1_Missense_Mutation_p.S788C|DLG1_ENST00000422288.1_Missense_Mutation_p.S841C			Q12959	DLG1_HUMAN	discs, large homolog 1 (Drosophila)	892					actin filament organization (GO:0007015)|activation of protein kinase activity (GO:0032147)|amyloid precursor protein metabolic process (GO:0042982)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|cortical actin cytoskeleton organization (GO:0030866)|dephosphorylation (GO:0016311)|embryonic skeletal system morphogenesis (GO:0048704)|endothelial cell proliferation (GO:0001935)|establishment or maintenance of cell polarity (GO:0007163)|hard palate development (GO:0060022)|immunological synapse formation (GO:0001771)|lens development in camera-type eye (GO:0002088)|membrane raft organization (GO:0031579)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell proliferation (GO:0042130)|nucleotide phosphorylation (GO:0046939)|peristalsis (GO:0030432)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell proliferation (GO:0008284)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of potassium ion transport (GO:0043268)|protein localization to plasma membrane (GO:0072659)|regulation of membrane potential (GO:0042391)|regulation of myelination (GO:0031641)|regulation of sodium ion transmembrane transport (GO:1902305)|reproductive structure development (GO:0048608)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|synaptic transmission (GO:0007268)|T cell activation (GO:0042110)|T cell cytokine production (GO:0002369)|tight junction assembly (GO:0070830)|viral process (GO:0016032)	basal lamina (GO:0005605)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell projection membrane (GO:0031253)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|immunological synapse (GO:0001772)|intercalated disc (GO:0014704)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|membrane raft (GO:0045121)|microtubule (GO:0005874)|MPP7-DLG1-LIN7 complex (GO:0097025)|myelin sheath abaxonal region (GO:0035748)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	cytoskeletal protein binding (GO:0008092)|guanylate kinase activity (GO:0004385)|ion channel binding (GO:0044325)|L27 domain binding (GO:0097016)|mitogen-activated protein kinase kinase binding (GO:0031434)|phosphatase binding (GO:0019902)|phosphoprotein phosphatase activity (GO:0004721)|potassium channel regulator activity (GO:0015459)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	26	all_cancers(143;6.22e-10)|Ovarian(172;0.0418)|Breast(254;0.0589)	Lung NSC(153;0.133)	Epithelial(36;3.23e-24)|all cancers(36;2.15e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0148)		GTAAGAACCAGATTGTTCTTC	0.378																																					p.S914C													.	DLG1-118	0			c.C2741G						.						158.0	151.0	153.0					3																	196771534		2203	4300	6503	SO:0001583	missense	1739	exon26			GAACCAGATTGTT	U13897	CCDS3327.1, CCDS43194.1, CCDS56300.1, CCDS56301.1, CCDS75072.1	3q29	2008-12-15	2001-11-28		ENSG00000075711	ENSG00000075711			2900	protein-coding gene	gene with protein product	"""discs large homolog 1"", ""presynaptic protein SAP97"", ""synapse-associated protein 97"""	601014	"""discs, large (Drosophila) homolog 1"""			7937897, 8825652	Standard	NM_004087		Approved	SAP97, SAP-97, hdlg, DLGH1, dJ1061C18.1.1	uc003fxn.4	Q12959	OTTHUMG00000047972	ENST00000419354.1:c.2675C>G	3.37:g.196771534G>C	ENSP00000407531:p.Ser892Cys	Somatic	144	0		WXS	Illumina HiSeq	Phase_I	245	7	NM_004087	0	0	41	43	2	A5YKK7|B4DGU1|B4DGZ8|B7ZMM0|B9EIQ5|D3DXB8|D3DXB9|E7EWL7|E9PG21|Q12958	Missense_Mutation	SNP	ENST00000419354.1	37	CCDS43194.1	.	.	.	.	.	.	.	.	.	.	G	18.54	3.645743	0.67358	.	.	ENSG00000075711	ENST00000346964;ENST00000359922;ENST00000357674;ENST00000381807;ENST00000314062;ENST00000419354;ENST00000452595;ENST00000422288;ENST00000448528;ENST00000443183;ENST00000392382;ENST00000450955	T;T;T;T;T;T;T;T;T;T	0.18338	2.22;2.22;2.22;2.22;2.22;2.22;2.22;2.22;2.22;2.22	5.26	5.26	0.73747	Guanylate kinase/L-type calcium channel (1);	0.000000	0.85682	D	0.000000	T	0.47021	0.1423	M	0.88906	2.99	0.80722	D	1	D;D;D;D;D	0.76494	0.984;0.973;0.984;0.981;0.999	P;P;P;P;D	0.63113	0.772;0.841;0.735;0.779;0.911	T	0.52200	-0.8607	10	0.41790	T	0.15	.	17.8536	0.88755	0.0:0.0:1.0:0.0	.	881;776;788;892;914	Q12959-4;E9PG21;E7EWL7;Q12959;Q12959-2	.;.;.;DLG1_HUMAN;.	C	914;905;881;879;841;892;776;841;892;788;859;881	ENSP00000345731:S914C;ENSP00000350303:S881C;ENSP00000321087:S841C;ENSP00000407531:S892C;ENSP00000398939:S776C;ENSP00000413238:S841C;ENSP00000391732:S892C;ENSP00000396658:S788C;ENSP00000376187:S859C;ENSP00000411278:S881C	ENSP00000321087:S841C	S	-	2	0	DLG1	198255931	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.476000	0.97823	2.469000	0.83416	0.655000	0.94253	TCT	.		0.378	DLG1-008	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000258170.2	NM_004087	
FGFR3	2261	hgsc.bcm.edu;broad.mit.edu	37	4	1803568	1803568	+	Missense_Mutation	SNP	C	C	G	rs121913483		TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr4:1803568C>G	ENST00000260795.2	+	6	848	c.746C>G	c.(745-747)tCc>tGc	p.S249C	FGFR3_ENST00000412135.2_Missense_Mutation_p.S249C|FGFR3_ENST00000440486.2_Missense_Mutation_p.S249C|FGFR3_ENST00000340107.4_Missense_Mutation_p.S249C|FGFR3_ENST00000352904.1_Missense_Mutation_p.S249C|FGFR3_ENST00000474521.1_3'UTR|FGFR3_ENST00000481110.2_Missense_Mutation_p.S249C			P22607	FGFR3_HUMAN	fibroblast growth factor receptor 3	249			S -> C (in KERSEB, bladder cancer, cervical cancer and TD1). {ECO:0000269|PubMed:10360402, ECO:0000269|PubMed:10471491, ECO:0000269|PubMed:15772091, ECO:0000269|PubMed:8589699, ECO:0000269|PubMed:8845844}.		alveolar secondary septum development (GO:0061144)|axonogenesis involved in innervation (GO:0060385)|bone maturation (GO:0070977)|bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|cell-cell signaling (GO:0007267)|central nervous system myelination (GO:0022010)|chondrocyte differentiation (GO:0002062)|chondrocyte proliferation (GO:0035988)|cochlea development (GO:0090102)|digestive tract morphogenesis (GO:0048546)|endochondral bone growth (GO:0003416)|endochondral ossification (GO:0001958)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell fate commitment (GO:0072148)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor apoptotic signaling pathway (GO:1902178)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inner ear receptor cell differentiation (GO:0060113)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade (GO:0007259)|lens fiber cell development (GO:0070307)|lens morphogenesis in camera-type eye (GO:0002089)|MAPK cascade (GO:0000165)|morphogenesis of an epithelium (GO:0002009)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of developmental growth (GO:0048640)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitosis (GO:0045839)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|substantia nigra development (GO:0021762)	cell surface (GO:0009986)|cytoplasmic side of plasma membrane (GO:0009898)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|protein tyrosine kinase activity (GO:0004713)	p.S249C(1204)|p.R248_S249del(1)		NS(1)|central_nervous_system(5)|cervix(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(40)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|pancreas(2)|prostate(9)|skin(339)|soft_tissue(4)|testis(2)|upper_aerodigestive_tract(58)|urinary_tract(2607)	3091		Breast(71;0.212)|all_epithelial(65;0.241)	all cancers(2;0.000145)|OV - Ovarian serous cystadenocarcinoma(23;0.0019)|Epithelial(3;0.00221)|GBM - Glioblastoma multiforme(2;0.234)		Palifermin(DB00039)|Pazopanib(DB06589)|Ponatinib(DB08901)	ACAGAGCGCTCCCCGCACCGG	0.736		1	"""Mis, T"""	"""IGH@, ETV6"""	"""bladder, MM, T-cell lymphoma"""		"""Hypochondroplasia, Thanatophoric dysplasia"""		Saethre-Chotzen syndrome;Muenke syndrome																												p.S249C		.		Dom	yes		4	4p16.3	2261	fibroblast growth factor receptor 3	yes	"""L, E"""	.	FGFR3-9542	1205	Substitution - Missense(1204)|Deletion - In frame(1)	urinary_tract(1168)|skin(27)|cervix(5)|lung(4)|upper_aerodigestive_tract(1)	c.C746G	GRCh37	CM950470	FGFR3	M	rs121913483	.						13.0	16.0	15.0					4																	1803568		2180	4267	6447	SO:0001583	missense	2261	exon7	Familial Cancer Database	Acrocephalosyndactyly type III;Muenke Nonsyndromic Coronal Craniosynostosis, FGFR3-related Craniosynostosis	AGCGCTCCCCGCA	M64347	CCDS3353.1, CCDS3354.1, CCDS54706.1	4p16.3	2013-01-11	2008-08-01		ENSG00000068078	ENSG00000068078		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3690	protein-coding gene	gene with protein product		134934	"""achondroplasia, thanatophoric dwarfism"""	ACH		1847508	Standard	NM_000142		Approved	CEK2, JTK4, CD333	uc003gdu.2	P22607	OTTHUMG00000121148	ENST00000260795.2:c.746C>G	4.37:g.1803568C>G	ENSP00000260795:p.Ser249Cys	Somatic	44	1		WXS	Illumina HiSeq	Phase_I	32	14	NM_001163213	0	0	3	9	6	D3DVP9|D3DVQ0|Q14308|Q16294|Q16608|Q59FL9	Missense_Mutation	SNP	ENST00000260795.2	37	CCDS3353.1	.	.	.	.	.	.	.	.	.	.	c	18.75	3.690127	0.68271	.	.	ENSG00000068078	ENST00000481110;ENST00000340107;ENST00000440486;ENST00000412135;ENST00000260795;ENST00000352904;ENST00000507588	D;T;T;T;T;T;T	0.82081	-1.57;-1.35;-1.33;-1.33;-1.33;-1.33;-1.32	3.94	3.94	0.45596	.	0.000000	0.85682	D	0.000000	D	0.92808	0.7713	M	0.92412	3.305	0.30597	A	0.239052	D;D;D;D;D;D	0.89917	0.998;0.997;1.0;1.0;1.0;1.0	P;D;D;D;D;D	0.80764	0.906;0.978;0.983;0.994;0.968;0.993	D	0.94822	0.7988	9	0.72032	D	0.01	.	16.2883	0.82736	0.0:1.0:0.0:0.0	.	212;249;249;249;249;249	Q8NI15;P22607-2;P22607-4;P22607-3;P22607;F8W9L4	.;.;.;.;FGFR3_HUMAN;.	C	249;249;249;249;249;249;69	ENSP00000420533:S249C;ENSP00000339824:S249C;ENSP00000414914:S249C;ENSP00000412903:S249C;ENSP00000260795:S249C;ENSP00000231803:S249C;ENSP00000427289:S69C	ENSP00000260795:S249C	S	+	2	0	FGFR3	1773366	1.000000	0.71417	1.000000	0.80357	0.445000	0.32107	7.424000	0.80242	1.903000	0.55091	0.436000	0.28706	TCC	.		0.736	FGFR3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000241632.2	NM_000142	
FGFR3	2261	broad.mit.edu	37	4	1803584	1803584	+	Silent	SNP	C	C	A			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr4:1803584C>A	ENST00000260795.2	+	6	864	c.762C>A	c.(760-762)atC>atA	p.I254I	FGFR3_ENST00000412135.2_Silent_p.I254I|FGFR3_ENST00000440486.2_Silent_p.I254I|FGFR3_ENST00000340107.4_Silent_p.I254I|FGFR3_ENST00000352904.1_Silent_p.I254I|FGFR3_ENST00000474521.1_3'UTR|FGFR3_ENST00000481110.2_Silent_p.I254I			P22607	FGFR3_HUMAN	fibroblast growth factor receptor 3	254	Ig-like C2-type 3.				alveolar secondary septum development (GO:0061144)|axonogenesis involved in innervation (GO:0060385)|bone maturation (GO:0070977)|bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|cell-cell signaling (GO:0007267)|central nervous system myelination (GO:0022010)|chondrocyte differentiation (GO:0002062)|chondrocyte proliferation (GO:0035988)|cochlea development (GO:0090102)|digestive tract morphogenesis (GO:0048546)|endochondral bone growth (GO:0003416)|endochondral ossification (GO:0001958)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell fate commitment (GO:0072148)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor apoptotic signaling pathway (GO:1902178)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inner ear receptor cell differentiation (GO:0060113)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade (GO:0007259)|lens fiber cell development (GO:0070307)|lens morphogenesis in camera-type eye (GO:0002089)|MAPK cascade (GO:0000165)|morphogenesis of an epithelium (GO:0002009)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of developmental growth (GO:0048640)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitosis (GO:0045839)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|substantia nigra development (GO:0021762)	cell surface (GO:0009986)|cytoplasmic side of plasma membrane (GO:0009898)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|protein tyrosine kinase activity (GO:0004713)			NS(1)|central_nervous_system(5)|cervix(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(40)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|pancreas(2)|prostate(9)|skin(339)|soft_tissue(4)|testis(2)|upper_aerodigestive_tract(58)|urinary_tract(2607)	3091		Breast(71;0.212)|all_epithelial(65;0.241)	all cancers(2;0.000145)|OV - Ovarian serous cystadenocarcinoma(23;0.0019)|Epithelial(3;0.00221)|GBM - Glioblastoma multiforme(2;0.234)		Palifermin(DB00039)|Pazopanib(DB06589)|Ponatinib(DB08901)	ACCGGCCCATCCTGCAGGCGG	0.731		1	"""Mis, T"""	"""IGH@, ETV6"""	"""bladder, MM, T-cell lymphoma"""		"""Hypochondroplasia, Thanatophoric dysplasia"""		Saethre-Chotzen syndrome;Muenke syndrome																												p.I254I				Dom	yes		4	4p16.3	2261	fibroblast growth factor receptor 3	yes	"""L, E"""	.	FGFR3-9542	0			c.C762A						.						15.0	18.0	17.0					4																	1803584		2167	4251	6418	SO:0001819	synonymous_variant	2261	exon7	Familial Cancer Database	Acrocephalosyndactyly type III;Muenke Nonsyndromic Coronal Craniosynostosis, FGFR3-related Craniosynostosis	GCCCATCCTGCAG	M64347	CCDS3353.1, CCDS3354.1, CCDS54706.1	4p16.3	2013-01-11	2008-08-01		ENSG00000068078	ENSG00000068078		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3690	protein-coding gene	gene with protein product		134934	"""achondroplasia, thanatophoric dwarfism"""	ACH		1847508	Standard	NM_000142		Approved	CEK2, JTK4, CD333	uc003gdu.2	P22607	OTTHUMG00000121148	ENST00000260795.2:c.762C>A	4.37:g.1803584C>A		Somatic	64	0		WXS	Illumina HiSeq	Phase_I	34	14	NM_001163213	0	0	114	262	148	D3DVP9|D3DVQ0|Q14308|Q16294|Q16608|Q59FL9	Silent	SNP	ENST00000260795.2	37	CCDS3353.1																																																																																			.		0.731	FGFR3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000241632.2	NM_000142	
FGFR3	2261	ucsc.edu	37	4	1803749	1803749	+	Silent	SNP	C	C	T			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr4:1803749C>T	ENST00000260795.2	+	6	1029	c.927C>T	c.(925-927)ctC>ctT	p.L309L	FGFR3_ENST00000412135.2_Silent_p.L309L|FGFR3_ENST00000440486.2_Silent_p.L309L|FGFR3_ENST00000340107.4_Silent_p.L309L|FGFR3_ENST00000352904.1_Silent_p.L309L|FGFR3_ENST00000474521.1_3'UTR|FGFR3_ENST00000481110.2_Silent_p.L309L			P22607	FGFR3_HUMAN	fibroblast growth factor receptor 3	309	Ig-like C2-type 3.				alveolar secondary septum development (GO:0061144)|axonogenesis involved in innervation (GO:0060385)|bone maturation (GO:0070977)|bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|cell-cell signaling (GO:0007267)|central nervous system myelination (GO:0022010)|chondrocyte differentiation (GO:0002062)|chondrocyte proliferation (GO:0035988)|cochlea development (GO:0090102)|digestive tract morphogenesis (GO:0048546)|endochondral bone growth (GO:0003416)|endochondral ossification (GO:0001958)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell fate commitment (GO:0072148)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor apoptotic signaling pathway (GO:1902178)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inner ear receptor cell differentiation (GO:0060113)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade (GO:0007259)|lens fiber cell development (GO:0070307)|lens morphogenesis in camera-type eye (GO:0002089)|MAPK cascade (GO:0000165)|morphogenesis of an epithelium (GO:0002009)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of developmental growth (GO:0048640)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitosis (GO:0045839)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|substantia nigra development (GO:0021762)	cell surface (GO:0009986)|cytoplasmic side of plasma membrane (GO:0009898)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|protein tyrosine kinase activity (GO:0004713)			NS(1)|central_nervous_system(5)|cervix(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(40)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|pancreas(2)|prostate(9)|skin(339)|soft_tissue(4)|testis(2)|upper_aerodigestive_tract(58)|urinary_tract(2607)	3091		Breast(71;0.212)|all_epithelial(65;0.241)	all cancers(2;0.000145)|OV - Ovarian serous cystadenocarcinoma(23;0.0019)|Epithelial(3;0.00221)|GBM - Glioblastoma multiforme(2;0.234)		Palifermin(DB00039)|Pazopanib(DB06589)|Ponatinib(DB08901)	TTACCGTGCTCAAGGTGGGCC	0.662		1	"""Mis, T"""	"""IGH@, ETV6"""	"""bladder, MM, T-cell lymphoma"""		"""Hypochondroplasia, Thanatophoric dysplasia"""		Saethre-Chotzen syndrome;Muenke syndrome																												p.L309L				Dom	yes		4	4p16.3	2261	fibroblast growth factor receptor 3	yes	"""L, E"""	.	FGFR3-9542	0			c.C927T						.						34.0	30.0	31.0					4																	1803749		2200	4298	6498	SO:0001819	synonymous_variant	2261	exon7	Familial Cancer Database	Acrocephalosyndactyly type III;Muenke Nonsyndromic Coronal Craniosynostosis, FGFR3-related Craniosynostosis	CGTGCTCAAGGTG	M64347	CCDS3353.1, CCDS3354.1, CCDS54706.1	4p16.3	2013-01-11	2008-08-01		ENSG00000068078	ENSG00000068078		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3690	protein-coding gene	gene with protein product		134934	"""achondroplasia, thanatophoric dwarfism"""	ACH		1847508	Standard	NM_000142		Approved	CEK2, JTK4, CD333	uc003gdu.2	P22607	OTTHUMG00000121148	ENST00000260795.2:c.927C>T	4.37:g.1803749C>T		Somatic	28	0		WXS	Illumina HiSeq		20	6	NM_001163213	0	0	22	60	38	D3DVP9|D3DVQ0|Q14308|Q16294|Q16608|Q59FL9	Silent	SNP	ENST00000260795.2	37	CCDS3353.1																																																																																			.		0.662	FGFR3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000241632.2	NM_000142	
UNC5C	8633	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	4	96127913	96127913	+	Missense_Mutation	SNP	G	G	T			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr4:96127913G>T	ENST00000453304.1	-	11	2116	c.1768C>A	c.(1768-1770)Cct>Act	p.P590T		NM_003728.3	NP_003719.3	O95185	UNC5C_HUMAN	unc-5 homolog C (C. elegans)	590	ZU5. {ECO:0000255|PROSITE- ProRule:PRU00485}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|brain development (GO:0007420)|positive regulation of apoptotic process (GO:0043065)|regulation of cell migration (GO:0030334)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)	p.P590T(1)		NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(14)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	55		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		CTCACCACAGGGGTCAAAAGT	0.537																																					p.P590T		.											.	UNC5C-94	1	Substitution - Missense(1)	lung(1)	c.C1768A						.						50.0	49.0	50.0					4																	96127913		2203	4300	6503	SO:0001583	missense	8633	exon11			CCACAGGGGTCAA	AF055634	CCDS3643.1	4q21-q23	2013-01-11	2001-11-28		ENSG00000182168	ENSG00000182168		"""Immunoglobulin superfamily / I-set domain containing"""	12569	protein-coding gene	gene with protein product		603610	"""unc5 (C.elegans homolog) c"""			9126742, 9782087	Standard	NM_003728		Approved		uc003hto.3	O95185	OTTHUMG00000130989	ENST00000453304.1:c.1768C>A	4.37:g.96127913G>T	ENSP00000406022:p.Pro590Thr	Somatic	87	0		WXS	Illumina HiSeq	Phase_I	106	20	NM_003728	0	0	1	1	0	Q8IUT0	Missense_Mutation	SNP	ENST00000453304.1	37	CCDS3643.1	.	.	.	.	.	.	.	.	.	.	G	17.77	3.471684	0.63737	.	.	ENSG00000182168	ENST00000453304;ENST00000331502;ENST00000513796	T;T	0.56103	0.48;0.48	5.28	5.28	0.74379	ZU5 (3);	0.000000	0.85682	D	0.000000	T	0.71804	0.3383	M	0.90977	3.165	0.80722	D	1	P;B	0.49559	0.925;0.055	P;B	0.49561	0.615;0.021	T	0.80127	-0.1512	10	0.87932	D	0	.	19.2637	0.93979	0.0:0.0:1.0:0.0	.	590;590	A8K385;O95185	.;UNC5C_HUMAN	T	590;549;609	ENSP00000406022:P590T;ENSP00000426924:P609T	ENSP00000328673:P549T	P	-	1	0	UNC5C	96346936	1.000000	0.71417	0.971000	0.41717	0.843000	0.47879	7.884000	0.87274	2.611000	0.88343	0.563000	0.77884	CCT	.		0.537	UNC5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253607.1	NM_003728	
EXOSC9	5393	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	4	122722582	122722582	+	Start_Codon_SNP	SNP	G	G	A			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr4:122722582G>A	ENST00000243498.5	+	1	111	c.3G>A	c.(1-3)atG>atA	p.M1I	EXOSC9_ENST00000512454.1_5'Flank|EXOSC9_ENST00000379663.3_Start_Codon_SNP_p.M1I|EXOSC9_ENST00000509980.1_3'UTR	NM_005033.2	NP_005024.2	Q06265	EXOS9_HUMAN	exosome component 9	1	ARE binding.				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|immune response (GO:0006955)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear polyadenylation-dependent rRNA catabolic process (GO:0071035)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|positive regulation of cell growth (GO:0030307)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|intermediate filament cytoskeleton (GO:0045111)|nuclear exosome (RNase complex) (GO:0000176)|nucleolus (GO:0005730)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|AU-rich element binding (GO:0017091)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(4)|urinary_tract(1)	16						CCAACACCATGAAGGAAACGC	0.607																																					p.M1I		.											.	EXOSC9-90	0			c.G3A						.						85.0	85.0	85.0					4																	122722582		2203	4300	6503	SO:0001582	initiator_codon_variant	5393	exon1			CACCATGAAGGAA	M58460	CCDS3722.2, CCDS34057.1	4q27	2010-05-07	2004-06-16	2004-06-18	ENSG00000123737	ENSG00000123737	3.1.13.-		9137	protein-coding gene	gene with protein product	"""polymyositis/scleroderma autoantigen 1 (75kD)"""	606180	"""polymyositis/scleroderma autoantigen 1, 75kDa"""	PMSCL1			Standard	XR_427545		Approved	PM/Scl-75, Rrp45p, RRP45, p5, p6	uc003idz.3	Q06265	OTTHUMG00000128783	ENST00000243498.5:c.3G>A	4.37:g.122722582G>A	ENSP00000243498:p.Met1Ile	Somatic	193	0		WXS	Illumina HiSeq	Phase_I	172	69	NM_001034194	0	0	2	6	4	Q12883|Q4W5P5|Q86Y41|Q86Y48	Missense_Mutation	SNP	ENST00000243498.5	37	CCDS3722.2	.	.	.	.	.	.	.	.	.	.	G	35	5.431299	0.96150	.	.	ENSG00000123737	ENST00000243498;ENST00000379663;ENST00000509800	T;T;T	0.41400	1.0;1.0;1.0	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.67961	0.2949	.	.	.	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.83275	0.996;0.977	T	0.70215	-0.4933	9	0.87932	D	0	.	18.9071	0.92467	0.0:0.0:1.0:0.0	.	1;1	Q06265;Q06265-2	EXOS9_HUMAN;.	I	1	ENSP00000243498:M1I;ENSP00000368984:M1I;ENSP00000422205:M1I	ENSP00000243498:M1I	M	+	3	0	EXOSC9	122942032	1.000000	0.71417	1.000000	0.80357	0.693000	0.40251	8.525000	0.90583	2.755000	0.94549	0.650000	0.86243	ATG	.		0.607	EXOSC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250708.2	NM_005033	Missense_Mutation
TRIML1	339976	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	4	189068521	189068521	+	Missense_Mutation	SNP	G	G	A			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr4:189068521G>A	ENST00000332517.3	+	6	1542	c.1402G>A	c.(1402-1404)Gtc>Atc	p.V468I	TRIML1_ENST00000507581.1_3'UTR	NM_178556.3	NP_848651.2	Q8N9V2	TRIML_HUMAN	tripartite motif family-like 1	468	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				multicellular organismal development (GO:0007275)|protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(3)|breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(30)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	60		all_cancers(14;1.33e-43)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)|all_hematologic(60;0.062)		OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|BRCA - Breast invasive adenocarcinoma(30;4.19e-06)|GBM - Glioblastoma multiforme(59;0.000232)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.156)		GAACAGCCACGTCTGAGGGGC	0.542																																					p.V468I	Melanoma(31;213 1036 16579 23968 32372)	.											.	TRIML1-156	0			c.G1402A						.						38.0	40.0	39.0					4																	189068521		2199	4297	6496	SO:0001583	missense	339976	exon6			AGCCACGTCTGAG	AK093499	CCDS3851.1	4q35.2	2013-01-09			ENSG00000184108	ENSG00000184108		"""RING-type (C3HC4) zinc fingers"""	26698	protein-coding gene	gene with protein product						12477932	Standard	NM_178556		Approved	FLJ36180, RNF209	uc003izm.1	Q8N9V2	OTTHUMG00000160237	ENST00000332517.3:c.1402G>A	4.37:g.189068521G>A	ENSP00000327738:p.Val468Ile	Somatic	127	1		WXS	Illumina HiSeq	Phase_I	133	67	NM_178556	0	0	0	0	0	Q96BE5	Missense_Mutation	SNP	ENST00000332517.3	37	CCDS3851.1	.	.	.	.	.	.	.	.	.	.	g	11.82	1.751945	0.31046	.	.	ENSG00000184108	ENST00000332517	T	0.61158	0.13	4.79	0.492	0.16872	B30.2/SPRY domain (1);	1.487680	0.04495	N	0.380167	T	0.31734	0.0806	N	0.08118	0	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	T	0.15150	-1.0447	10	0.13108	T	0.6	-2.5793	2.7703	0.05332	0.4061:0.0:0.3903:0.2036	.	468	Q8N9V2	TRIML_HUMAN	I	468	ENSP00000327738:V468I	ENSP00000327738:V468I	V	+	1	0	TRIML1	189305515	0.000000	0.05858	0.003000	0.11579	0.001000	0.01503	0.020000	0.13466	0.267000	0.21916	-0.142000	0.14014	GTC	.		0.542	TRIML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359813.1	NM_178556	
PCDHGA3	56112	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	5	140725009	140725009	+	Missense_Mutation	SNP	C	C	T			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr5:140725009C>T	ENST00000253812.6	+	1	1409	c.1409C>T	c.(1408-1410)tCc>tTc	p.S470F	PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3	470	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGAGGAGCCTCCATCTTCTCA	0.547																																					p.S470F		.											.	PCDHGA3-68	0			c.C1409T						.						116.0	132.0	127.0					5																	140725009		2135	4271	6406	SO:0001583	missense	56112	exon1			GAGCCTCCATCTT	AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.1409C>T	5.37:g.140725009C>T	ENSP00000253812:p.Ser470Phe	Somatic	231	0		WXS	Illumina HiSeq	Phase_I	308	143	NM_032011	0	0	0	0	0	Q9Y5D4	Missense_Mutation	SNP	ENST00000253812.6	37	CCDS47290.1	.	.	.	.	.	.	.	.	.	.	.	15.45	2.838553	0.51057	.	.	ENSG00000254245	ENST00000253812	T	0.02709	4.19	5.36	4.5	0.54988	Cadherin (3);Cadherin-like (1);	0.000000	0.33199	U	0.005170	T	0.09468	0.0233	M	0.64997	1.995	0.27060	N	0.963586	P;P	0.49358	0.734;0.923	P;P	0.56648	0.485;0.803	T	0.01566	-1.1323	10	0.72032	D	0.01	.	11.5922	0.50951	0.0:0.8506:0.0:0.1494	.	470;470	Q9Y5H0-2;Q9Y5H0	.;PCDG3_HUMAN	F	470	ENSP00000253812:S470F	ENSP00000253812:S470F	S	+	2	0	PCDHGA3	140705193	0.021000	0.18746	1.000000	0.80357	0.953000	0.61014	1.432000	0.34936	1.399000	0.46721	0.563000	0.77884	TCC	.		0.547	PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377017.1	NM_018916	
PCDHGA12	26025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	5	140811015	140811015	+	Missense_Mutation	SNP	T	T	C			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr5:140811015T>C	ENST00000252085.3	+	1	831	c.689T>C	c.(688-690)gTg>gCg	p.V230A	PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGB7_ENST00000398594.2_Intron	NM_003735.2|NM_032094.1	NP_003726.1|NP_115265.1	O60330	PCDGC_HUMAN	protocadherin gamma subfamily A, 12	230	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|cervix(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(23)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	58			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCATCCGCGTGATGGTTCTG	0.657																																					p.V230A		.											.	PCDHGA12-27	0			c.T689C						.						52.0	53.0	53.0					5																	140811015		2203	4300	6503	SO:0001583	missense	26025	exon1			TCCGCGTGATGGT	AF152506	CCDS4260.1, CCDS75346.1	5q31	2010-01-26	2002-05-23		ENSG00000253159	ENSG00000253159		"""Cadherins / Protocadherins : Clustered"""	8699	other	protocadherin	"""fibroblast cadherin FIB3"""	603059	"""cadherin 21"""	CDH21		10380929	Standard	NM_003735		Approved	KIAA0588, FIB3, PCDH-GAMMA-A12		O60330	OTTHUMG00000129611	ENST00000252085.3:c.689T>C	5.37:g.140811015T>C	ENSP00000252085:p.Val230Ala	Somatic	191	1		WXS	Illumina HiSeq	Phase_I	162	70	NM_032094	0	0	3	3	0	O15100|Q6UW70|Q9Y5D7	Missense_Mutation	SNP	ENST00000252085.3	37	CCDS4260.1	.	.	.	.	.	.	.	.	.	.	t	19.24	3.789729	0.70337	.	.	ENSG00000253159	ENST00000252085	T	0.72505	-0.66	4.89	4.89	0.63831	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	.	.	.	.	D	0.89378	0.6698	H	0.99404	4.55	0.21064	N	0.999791	P;P	0.50156	0.791;0.932	P;P	0.55508	0.668;0.777	D	0.84959	0.0876	9	0.87932	D	0	.	14.3394	0.66614	0.0:0.0:0.0:1.0	.	230;230	O60330-2;O60330	.;PCDGC_HUMAN	A	230	ENSP00000252085:V230A	ENSP00000252085:V230A	V	+	2	0	PCDHGA12	140791199	1.000000	0.71417	0.751000	0.31187	0.627000	0.37826	7.868000	0.87116	2.064000	0.61679	0.533000	0.62120	GTG	.		0.657	PCDHGA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251806.2	NM_003735	
CLINT1	9685	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	5	157240138	157240138	+	Missense_Mutation	SNP	C	C	G			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr5:157240138C>G	ENST00000411809.2	-	5	654	c.450G>C	c.(448-450)aaG>aaC	p.K150N	CLINT1_ENST00000523908.1_Missense_Mutation_p.K150N|CLINT1_ENST00000523094.1_Missense_Mutation_p.K132N|CLINT1_ENST00000296951.5_Missense_Mutation_p.K132N|CLINT1_ENST00000530742.1_Missense_Mutation_p.K132N	NM_014666.3	NP_055481.1	Q14677	EPN4_HUMAN	clathrin interactor 1	150					clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)	clathrin-coated vesicle (GO:0030136)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	clathrin binding (GO:0030276)|lipid binding (GO:0008289)			breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|urinary_tract(1)	21	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TCTTTGCTTTCTTTCGCTCTT	0.423																																					p.K150N	Colon(22;427 587 2170 6147 14291)	.											.	CLINT1-48	0			c.G450C						.						217.0	207.0	210.0					5																	157240138		1913	4128	6041	SO:0001583	missense	9685	exon5			TGCTTTCTTTCGC	AF434813	CCDS47330.1, CCDS56388.1, CCDS56389.1	5q33.3	2006-06-13			ENSG00000113282	ENSG00000113282			23186	protein-coding gene	gene with protein product		607265				12213833, 12429846	Standard	NM_014666		Approved	ENTH, KIAA0171, EPNR, CLINT	uc011ddv.2	Q14677	OTTHUMG00000163527	ENST00000411809.2:c.450G>C	5.37:g.157240138C>G	ENSP00000388340:p.Lys150Asn	Somatic	125	0		WXS	Illumina HiSeq	Phase_I	168	83	NM_014666	0	0	36	68	32	B7Z6F8|D3DQJ6|Q8NAF1|Q96E05	Missense_Mutation	SNP	ENST00000411809.2	37	CCDS47330.1	.	.	.	.	.	.	.	.	.	.	C	17.00	3.275997	0.59649	.	.	ENSG00000113282	ENST00000523094;ENST00000530742;ENST00000411809;ENST00000296951;ENST00000523908	T;T;T;T;T	0.54279	0.6;0.6;0.6;0.6;0.58	5.88	4.05	0.47172	ENTH/VHS (1);	0.085100	0.85682	D	0.000000	T	0.67608	0.2911	M	0.75884	2.315	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.80764	0.994;0.989	T	0.64689	-0.6348	10	0.33141	T	0.24	-15.7865	9.2432	0.37509	0.0:0.7587:0.0:0.2413	.	150;150	B7Z6F8;Q14677	.;EPN4_HUMAN	N	132;132;150;132;150	ENSP00000429345:K132N;ENSP00000433419:K132N;ENSP00000388340:K150N;ENSP00000296951:K132N;ENSP00000429824:K150N	ENSP00000296951:K132N	K	-	3	2	CLINT1	157172716	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.312000	0.33574	0.753000	0.32945	0.655000	0.94253	AAG	.		0.423	CLINT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000374001.1	NM_014666	
FLT4	2324	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	5	180048230	180048230	+	Silent	SNP	C	C	T			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr5:180048230C>T	ENST00000261937.6	-	14	2121	c.2043G>A	c.(2041-2043)acG>acA	p.T681T	FLT4_ENST00000393347.3_Silent_p.T681T|FLT4_ENST00000424276.2_5'UTR|FLT4_ENST00000502649.1_Silent_p.T681T	NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	681	Ig-like C2-type 7.				blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TCAAGTTCTGCGTGAGCCGAG	0.637																																					p.T681T	Colon(97;1075 1466 27033 27547 35871)	.											.	FLT4-1490	0			c.G2043A						.						26.0	30.0	29.0					5																	180048230		2201	4293	6494	SO:0001819	synonymous_variant	2324	exon14			GTTCTGCGTGAGC	X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.2043G>A	5.37:g.180048230C>T		Somatic	91	1		WXS	Illumina HiSeq	Phase_I	64	30	NM_182925	0	0	5	6	1	A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Silent	SNP	ENST00000261937.6	37	CCDS4457.1																																																																																			.		0.637	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253527.4		
OR14J1	442191	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	6	29274483	29274483	+	Missense_Mutation	SNP	C	C	T			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr6:29274483C>T	ENST00000377160.2	+	1	81	c.17C>T	c.(16-18)tCa>tTa	p.S6L		NM_030946.1	NP_112208.1	Q9UGF5	O14J1_HUMAN	olfactory receptor, family 14, subfamily J, member 1	6						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(3)|lung(8)|ovary(2)|upper_aerodigestive_tract(2)	17						AATTTGACTTCAATGAGTGGA	0.403																																					p.S6L		.											.	OR14J1-1	0			c.C17T						.						178.0	185.0	182.0					6																	29274483		1511	2709	4220	SO:0001583	missense	442191	exon1			TGACTTCAATGAG		CCDS34362.1	6p21.3	2012-08-09	2008-04-02	2008-04-02	ENSG00000204695	ENSG00000204695		"""GPCR / Class A : Olfactory receptors"""	13971	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily U, member 1"""	OR5U1			Standard	NM_030946		Approved	hs6M1-28	uc011dln.2	Q9UGF5	OTTHUMG00000031184	ENST00000377160.2:c.17C>T	6.37:g.29274483C>T	ENSP00000366365:p.Ser6Leu	Somatic	258	0		WXS	Illumina HiSeq	Phase_I	408	159	NM_030946	0	0	0	0	0	A2BEC2|B0V078|Q5ST27	Missense_Mutation	SNP	ENST00000377160.2	37	CCDS34362.1	.	.	.	.	.	.	.	.	.	.	C	7.344	0.621483	0.14193	.	.	ENSG00000204695	ENST00000377160	T	0.00522	6.84	4.73	1.88	0.25563	.	0.481890	0.15328	N	0.268184	T	0.00073	0.0002	N	0.05414	-0.055	0.09310	N	1	B	0.25441	0.126	B	0.24701	0.055	T	0.08911	-1.0699	10	0.27785	T	0.31	.	4.4271	0.11509	0.1483:0.4819:0.288:0.0819	.	6	Q9UGF5	O14J1_HUMAN	L	6	ENSP00000366365:S6L	ENSP00000366365:S6L	S	+	2	0	OR14J1	29382462	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-2.295000	0.01143	0.263000	0.21812	0.655000	0.94253	TCA	.		0.403	OR14J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076362.2		
BRD2	6046	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	6	32945959	32945959	+	Silent	SNP	C	C	G			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr6:32945959C>G	ENST00000374825.4	+	10	3336	c.1635C>G	c.(1633-1635)ccC>ccG	p.P545P	BRD2_ENST00000395287.1_Silent_p.P545P|BRD2_ENST00000395289.2_Silent_p.P545P|BRD2_ENST00000443797.2_Silent_p.P425P|BRD2_ENST00000449085.2_Silent_p.P498P|BRD2_ENST00000374831.4_Silent_p.P545P	NM_005104.3	NP_005095.1	P25440	BRD2_HUMAN	bromodomain containing 2	545	Arg/Lys-rich (highly basic).				chromatin modification (GO:0016568)|nucleosome assembly (GO:0006334)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|lysine-acetylated histone binding (GO:0070577)			central_nervous_system(3)|stomach(2)	5						TATCCAAGCCCAAGAGGAAAA	0.463																																					p.P545P		.											.	BRD2-398	0			c.C1635G						.						38.0	46.0	43.0					6																	32945959		1508	2708	4216	SO:0001819	synonymous_variant	6046	exon10			CAAGCCCAAGAGG	X96670	CCDS4762.1, CCDS56420.1, CCDS56421.1	6p21.3	2010-12-23	2002-01-14		ENSG00000204256	ENSG00000204256			1103	protein-coding gene	gene with protein product		601540	"""bromodomain-containing 2"""			1352711, 8781126	Standard	NM_005104		Approved	KIAA9001, RING3, D6S113E, NAT, FSRG1	uc021ywf.1	P25440	OTTHUMG00000031241	ENST00000374825.4:c.1635C>G	6.37:g.32945959C>G		Somatic	99	0		WXS	Illumina HiSeq	Phase_I	91	36	NM_005104	0	0	46	87	41	A2AAU0|B0S7P0|B1AZT1|O00699|O00700|Q15310|Q5STC9|Q63HQ9|Q658Y7|Q6P3U2|Q969U4	Silent	SNP	ENST00000374825.4	37	CCDS4762.1	.	.	.	.	.	.	.	.	.	.	C	10.41	1.342233	0.24339	.	.	ENSG00000204256	ENST00000449025	T	0.31247	1.5	5.35	-3.94	0.04130	.	0.000000	0.49916	D	0.000124	T	0.08403	0.0209	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.14924	-1.0455	7	0.18710	T	0.47	-14.208	4.8892	0.13719	0.4611:0.1625:0.0:0.3764	.	.	.	.	R	551	ENSP00000409613:P551R	ENSP00000409613:P551R	P	+	2	0	BRD2	33053937	0.103000	0.21917	0.943000	0.38184	0.899000	0.52679	-0.561000	0.05957	-0.702000	0.05056	-0.272000	0.10252	CCA	.		0.463	BRD2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076503.2		
BRD2	6046	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	6	32947799	32947799	+	Nonsense_Mutation	SNP	C	C	G			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr6:32947799C>G	ENST00000374825.4	+	11	3737	c.2036C>G	c.(2035-2037)tCa>tGa	p.S679*	BRD2_ENST00000395287.1_Nonsense_Mutation_p.S714*|BRD2_ENST00000395289.2_Nonsense_Mutation_p.S714*|BRD2_ENST00000443797.2_Nonsense_Mutation_p.S559*|BRD2_ENST00000449085.2_Nonsense_Mutation_p.S632*|BRD2_ENST00000374831.4_Nonsense_Mutation_p.S679*	NM_005104.3	NP_005095.1	P25440	BRD2_HUMAN	bromodomain containing 2	679	NET. {ECO:0000255|PROSITE- ProRule:PRU00857}.				chromatin modification (GO:0016568)|nucleosome assembly (GO:0006334)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|lysine-acetylated histone binding (GO:0070577)			central_nervous_system(3)|stomach(2)	5						TTACGTGATTCAAACCCAGAA	0.498																																					p.S714X		.											.	BRD2-398	0			c.C2141G						.						65.0	64.0	64.0					6																	32947799		1511	2709	4220	SO:0001587	stop_gained	6046	exon11			GTGATTCAAACCC	X96670	CCDS4762.1, CCDS56420.1, CCDS56421.1	6p21.3	2010-12-23	2002-01-14		ENSG00000204256	ENSG00000204256			1103	protein-coding gene	gene with protein product		601540	"""bromodomain-containing 2"""			1352711, 8781126	Standard	NM_005104		Approved	KIAA9001, RING3, D6S113E, NAT, FSRG1	uc021ywf.1	P25440	OTTHUMG00000031241	ENST00000374825.4:c.2036C>G	6.37:g.32947799C>G	ENSP00000363958:p.Ser679*	Somatic	72	0		WXS	Illumina HiSeq	Phase_I	105	44	NM_001199455	0	0	77	116	39	A2AAU0|B0S7P0|B1AZT1|O00699|O00700|Q15310|Q5STC9|Q63HQ9|Q658Y7|Q6P3U2|Q969U4	Nonsense_Mutation	SNP	ENST00000374825.4	37	CCDS4762.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	52|52	19.743137|19.743137	0.99923|0.99923	.|.	.|.	ENSG00000204256|ENSG00000204256	ENST00000449025|ENST00000374825;ENST00000374831;ENST00000395289;ENST00000443797;ENST00000395287;ENST00000449085	.|.	.|.	.|.	5.51|5.51	5.51|5.51	0.81932|0.81932	.|.	.|0.000000	.|0.41605	.|D	.|0.000858	T|.	0.70055|.	0.3180|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.70457|.	-0.4866|.	3|.	.|0.52906	.|T	.|0.07	-14.2571|-14.2571	16.9633|16.9633	0.86278|0.86278	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	E|X	685|679;679;714;559;714;632	.|.	.|ENSP00000363958:S679X	Q|S	+|+	1|2	0|0	BRD2|BRD2	33055777|33055777	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	7.637000|7.637000	0.83313|0.83313	2.873000|2.873000	0.98535|0.98535	0.643000|0.643000	0.83706|0.83706	CAA|TCA	.		0.498	BRD2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076503.2		
HECW1	23072	broad.mit.edu	37	7	43519234	43519234	+	Missense_Mutation	SNP	G	G	C	rs531623127		TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr7:43519234G>C	ENST00000395891.2	+	17	3730	c.3125G>C	c.(3124-3126)cGa>cCa	p.R1042P	HECW1_ENST00000453890.1_Missense_Mutation_p.R1008P	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	1042	WW 2. {ECO:0000255|PROSITE- ProRule:PRU00224}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						CACAACAGTCGAGCTACCACT	0.493																																					p.R1042P													.	HECW1-669	0			c.G3125C						.						160.0	151.0	154.0					7																	43519234		1940	4154	6094	SO:0001583	missense	23072	exon17			ACAGTCGAGCTAC	AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.3125G>C	7.37:g.43519234G>C	ENSP00000379228:p.Arg1042Pro	Somatic	234	0		WXS	Illumina HiSeq	Phase_I	283	8	NM_015052	0	0	0	0	0	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Missense_Mutation	SNP	ENST00000395891.2	37	CCDS5469.2	.	.	.	.	.	.	.	.	.	.	G	32	5.133939	0.94517	.	.	ENSG00000002746	ENST00000395891;ENST00000453890;ENST00000265522	D;D	0.85702	-2.02;-2.02	5.53	5.53	0.82687	WW/Rsp5/WWP (6);	0.056927	0.64402	D	0.000001	D	0.94265	0.8158	M	0.90922	3.16	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.77557	0.99;0.976	D	0.95065	0.8199	10	0.87932	D	0	.	19.4697	0.94958	0.0:0.0:1.0:0.0	.	1008;1042	B4DH42;Q76N89	.;HECW1_HUMAN	P	1042;1008;1042	ENSP00000379228:R1042P;ENSP00000407774:R1008P	ENSP00000265522:R1042P	R	+	2	0	HECW1	43485759	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.840000	0.99478	2.611000	0.88343	0.462000	0.41574	CGA	.		0.493	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250893.2	NM_015052	
CTTNBP2	83992	broad.mit.edu	37	7	117407188	117407188	+	Missense_Mutation	SNP	C	C	G			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr7:117407188C>G	ENST00000160373.3	-	9	2912	c.2821G>C	c.(2821-2823)Gaa>Caa	p.E941Q		NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	941					brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)				breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		TCTCTCCTTTCTGGCTCAAGC	0.433																																					p.E941Q													.	CTTNBP2-94	0			c.G2821C						.						173.0	145.0	154.0					7																	117407188		2203	4300	6503	SO:0001583	missense	83992	exon9			TCCTTTCTGGCTC		CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.2821G>C	7.37:g.117407188C>G	ENSP00000160373:p.Glu941Gln	Somatic	129	0		WXS	Illumina HiSeq	Phase_I	210	5	NM_033427	0	0	1	1	0	O43389|Q7LG11|Q9C0A5	Missense_Mutation	SNP	ENST00000160373.3	37	CCDS5774.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.3|20.3	3.970686|3.970686	0.74246|0.74246	.|.	.|.	ENSG00000077063|ENSG00000077063	ENST00000160373|ENST00000446636	T|.	0.53857|.	0.6|.	5.64|5.64	5.64|5.64	0.86602|0.86602	Ankyrin repeat-containing domain (2);|.	0.278035|.	0.44483|.	D|.	0.000453|.	T|T	0.67785|0.67785	0.2930|0.2930	L|L	0.40543|0.40543	1.245|1.245	0.46981|0.46981	D|D	0.999274|0.999274	D|.	0.58620|.	0.983|.	P|.	0.52386|.	0.697|.	T|T	0.61402|0.61402	-0.7070|-0.7070	10|5	0.54805|.	T|.	0.06|.	-10.6121|-10.6121	20.0666|20.0666	0.97706|0.97706	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	941|.	Q8WZ74|.	CTTB2_HUMAN|.	Q|T	941|428	ENSP00000160373:E941Q|.	ENSP00000160373:E941Q|.	E|R	-|-	1|2	0|0	CTTNBP2|CTTNBP2	117194424|117194424	1.000000|1.000000	0.71417|0.71417	0.294000|0.294000	0.24946|0.24946	0.588000|0.588000	0.36517|0.36517	5.568000|5.568000	0.67385|0.67385	2.826000|2.826000	0.97356|0.97356	0.561000|0.561000	0.74099|0.74099	GAA|AGA	.		0.433	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059201.4	NM_033427	
CHRM2	1129	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	7	136700056	136700056	+	Missense_Mutation	SNP	G	G	T			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr7:136700056G>T	ENST00000445907.2	+	3	972	c.444G>T	c.(442-444)tgG>tgT	p.W148C	CHRM2_ENST00000397608.3_Missense_Mutation_p.W148C|CHRM2_ENST00000402486.3_Missense_Mutation_p.W148C|CHRM2_ENST00000401861.1_Missense_Mutation_p.W148C|CHRM2_ENST00000453373.1_Missense_Mutation_p.W148C|CHRM2_ENST00000320658.5_Missense_Mutation_p.W148C|hsa-mir-490_ENST00000439694.1_RNA|hsa-mir-490_ENST00000592183.1_RNA|hsa-mir-490_ENST00000593789.1_RNA|hsa-mir-490_ENST00000597642.1_RNA|hsa-mir-490_ENST00000586239.1_RNA|hsa-mir-490_ENST00000598184.1_RNA|hsa-mir-490_ENST00000425981.2_RNA	NM_001006627.1|NM_001006629.1	NP_001006628.1|NP_001006630.1	P08172	ACM2_HUMAN	cholinergic receptor, muscarinic 2	148					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|nervous system development (GO:0007399)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|regulation of heart contraction (GO:0008016)|response to virus (GO:0009615)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled acetylcholine receptor activity (GO:0016907)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(13)|liver(1)|lung(29)|ovary(4)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	68					Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Bethanechol(DB01019)|Brompheniramine(DB00835)|Carbachol(DB00411)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cocaine(DB00907)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Dicyclomine(DB00804)|Dimetindene(DB08801)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxacurium chloride(DB01135)|Doxepin(DB01142)|Ethopropazine(DB00392)|Fesoterodine(DB06702)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Rocuronium(DB00728)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	CAGCTGCCTGGGTCCTCTCTT	0.488																																					p.W148C		.											.	CHRM2-94	0			c.G444T						.						66.0	68.0	68.0					7																	136700056		2203	4300	6503	SO:0001583	missense	1129	exon3			TGCCTGGGTCCTC		CCDS5843.1	7q35-q36	2014-09-17			ENSG00000181072	ENSG00000181072		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1951	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 2"""	118493					Standard	NM_000739		Approved		uc003vtl.1	P08172	OTTHUMG00000155658	ENST00000445907.2:c.444G>T	7.37:g.136700056G>T	ENSP00000399745:p.Trp148Cys	Somatic	120	0		WXS	Illumina HiSeq	Phase_I	145	26	NM_001006632	0	0	0	0	0	Q4VBK6|Q9P1X9	Missense_Mutation	SNP	ENST00000445907.2	37	CCDS5843.1	.	.	.	.	.	.	.	.	.	.	G	18.18	3.567740	0.65651	.	.	ENSG00000181072	ENST00000445907;ENST00000453373;ENST00000320658;ENST00000397608;ENST00000402486;ENST00000401861	D;D;D;D;D;D	0.88818	-2.43;-2.43;-2.43;-2.43;-2.43;-2.43	5.65	5.65	0.86999	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.97340	0.9130	H	0.99156	4.45	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98748	1.0719	10	0.87932	D	0	-1.0967	19.7244	0.96157	0.0:0.0:1.0:0.0	.	148	P08172	ACM2_HUMAN	C	148	ENSP00000399745:W148C;ENSP00000415386:W148C;ENSP00000319984:W148C;ENSP00000380733:W148C;ENSP00000384937:W148C;ENSP00000384401:W148C	ENSP00000319984:W148C	W	+	3	0	CHRM2	136350596	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.807000	0.99171	2.659000	0.90383	0.655000	0.94253	TGG	.		0.488	CHRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341010.1		
PRKAG2	51422	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	7	151372582	151372582	+	Missense_Mutation	SNP	C	C	G			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr7:151372582C>G	ENST00000287878.4	-	4	1112	c.608G>C	c.(607-609)aGg>aCg	p.R203T	PRKAG2_ENST00000461529.1_5'Flank|PRKAG2_ENST00000492843.1_Missense_Mutation_p.R79T|PRKAG2_ENST00000392801.2_Missense_Mutation_p.R159T|PRKAG2_ENST00000433631.2_Missense_Mutation_p.R79T	NM_016203.3	NP_057287.2	Q9UGJ0	AAKG2_HUMAN	protein kinase, AMP-activated, gamma 2 non-catalytic subunit	203					ATP biosynthetic process (GO:0006754)|carnitine shuttle (GO:0006853)|cell cycle arrest (GO:0007050)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|glycogen metabolic process (GO:0005977)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|membrane organization (GO:0061024)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase activity (GO:0045860)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of fatty acid metabolic process (GO:0019217)|regulation of fatty acid oxidation (GO:0046320)|regulation of glucose import (GO:0046324)|regulation of glycolytic process (GO:0006110)|small molecule metabolic process (GO:0044281)|sterol biosynthetic process (GO:0016126)	AMP-activated protein kinase complex (GO:0031588)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)	ADP binding (GO:0043531)|AMP binding (GO:0016208)|ATP binding (GO:0005524)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|phosphorylase kinase regulator activity (GO:0008607)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|upper_aerodigestive_tract(1)	26	all_neural(206;0.187)	all_hematologic(28;0.0605)	OV - Ovarian serous cystadenocarcinoma(82;0.00252)	UCEC - Uterine corpus endometrioid carcinoma (81;0.185)	Acetylsalicylic acid(DB00945)	CGGGCAGAACCTCTGCCCTGT	0.587																																					p.R203T		.											.	PRKAG2-658	0			c.G608C						.						82.0	75.0	77.0					7																	151372582		2203	4300	6503	SO:0001583	missense	51422	exon4			CAGAACCTCTGCC	AF087875	CCDS5928.1, CCDS43683.1, CCDS47752.1	7q35-q36	2014-09-17			ENSG00000106617	ENSG00000106617			9386	protein-coding gene	gene with protein product	"""AMPK gamma2"""	602743				8557660, 8621499	Standard	NM_024429		Approved	AAKG, AAKG2, H91620p, WPWS, CMH6	uc003wkk.3	Q9UGJ0	OTTHUMG00000157324	ENST00000287878.4:c.608G>C	7.37:g.151372582C>G	ENSP00000287878:p.Arg203Thr	Somatic	113	1		WXS	Illumina HiSeq	Phase_I	118	49	NM_016203	0	0	0	0	0	Q53Y07|Q6NUI0|Q75MP4|Q9NUZ9|Q9UDN8|Q9ULX8	Missense_Mutation	SNP	ENST00000287878.4	37	CCDS5928.1	.	.	.	.	.	.	.	.	.	.	C	16.96	3.264778	0.59431	.	.	ENSG00000106617	ENST00000287878;ENST00000492843;ENST00000433631;ENST00000392801	D;D;D;D	0.90385	-2.25;-2.66;-2.66;-2.63	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	D	0.94255	0.8155	L	0.60455	1.87	0.47245	D	0.999369	P;D;D	0.67145	0.704;0.996;0.976	B;D;P	0.77557	0.15;0.99;0.703	D	0.94164	0.7417	10	0.52906	T	0.07	.	18.022	0.89258	0.0:1.0:0.0:0.0	.	79;203;203	B7Z6X8;Q8NCK6;Q9UGJ0	.;.;AAKG2_HUMAN	T	203;79;79;159	ENSP00000287878:R203T;ENSP00000419577:R79T;ENSP00000406544:R79T;ENSP00000376549:R159T	ENSP00000287878:R203T	R	-	2	0	PRKAG2	151003515	1.000000	0.71417	0.998000	0.56505	0.073000	0.16967	5.317000	0.65822	2.489000	0.83994	0.456000	0.33151	AGG	.		0.587	PRKAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348440.2	NM_016203	
KMT2C	58508	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	7	151879016	151879016	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr7:151879016G>A	ENST00000262189.6	-	36	6147	c.5929C>T	c.(5929-5931)Caa>Taa	p.Q1977*	KMT2C_ENST00000355193.2_Nonsense_Mutation_p.Q1977*	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	1977	Pro-rich.				histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TTGGGAAATTGATCTGTCATC	0.458																																					p.Q1977X		.											.	MLL3-1398	0			c.C5929T						.						215.0	223.0	220.0					7																	151879016		2203	4300	6503	SO:0001587	stop_gained	58508	exon36			GAAATTGATCTGT	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.5929C>T	7.37:g.151879016G>A	ENSP00000262189:p.Gln1977*	Somatic	536	0		WXS	Illumina HiSeq	Phase_I	722	115	NM_170606	0	0	5	5	0	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Nonsense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	G	47	13.696566	0.99758	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	.	.	.	5.37	4.49	0.54785	.	0.000000	0.42420	U	0.000717	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.3796	0.44104	0.1499:0.0:0.8501:0.0	.	.	.	.	X	1977	.	ENSP00000262189:Q1977X	Q	-	1	0	MLL3	151509949	1.000000	0.71417	0.139000	0.22197	0.959000	0.62525	6.683000	0.74533	1.289000	0.44618	0.558000	0.71614	CAA	.		0.458	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
ERLIN2	11160	broad.mit.edu	37	8	37597912	37597912	+	Missense_Mutation	SNP	G	G	A			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr8:37597912G>A	ENST00000276461.5	+	3	204	c.137G>A	c.(136-138)gGc>gAc	p.G46D	ERLIN2_ENST00000518586.1_Missense_Mutation_p.G46D|ERLIN2_ENST00000335171.6_Missense_Mutation_p.G46D|RP11-863K10.7_ENST00000330539.1_5'Flank|ERLIN2_ENST00000523107.1_Missense_Mutation_p.G46D|ERLIN2_ENST00000523887.1_Missense_Mutation_p.G46D|ERLIN2_ENST00000519638.1_Missense_Mutation_p.G46D|ERLIN2_ENST00000397228.2_Missense_Mutation_p.G46D	NM_007175.6	NP_009106.1	O94905	ERLN2_HUMAN	ER lipid raft associated 2	46					cell death (GO:0008219)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|protein complex (GO:0043234)				NS(1)|large_intestine(1)|lung(5)	7		Lung NSC(58;0.174)	BRCA - Breast invasive adenocarcinoma(5;6.14e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			TCGACCAGCGGCCCTGGTTTC	0.537																																					p.G46D													.	ERLIN2-90	0			c.G137A						.						228.0	199.0	208.0					8																	37597912		2203	4300	6503	SO:0001583	missense	11160	exon3			CCAGCGGCCCTGG	AY358108	CCDS6095.1, CCDS34879.1	8p11.2	2012-11-23	2007-01-26	2007-01-26	ENSG00000147475	ENSG00000147475			1356	protein-coding gene	gene with protein product		611605	"""chromosome 8 open reading frame 2"", ""SPFH domain family, member 2"""	C8orf2, SPFH2, Erlin-2		10449903, 15897872, 16835267	Standard	NM_007175		Approved	NET32, SPG18	uc003xke.4	O94905	OTTHUMG00000164005	ENST00000276461.5:c.137G>A	8.37:g.37597912G>A	ENSP00000276461:p.Gly46Asp	Somatic	390	0		WXS	Illumina HiSeq	Phase_I	498	25	NM_001003791	0	0	22	22	0	A0JLQ1|A8K5S9|B4DM38|D3DSW0|Q6NW21|Q86VS6|Q86W49	Missense_Mutation	SNP	ENST00000276461.5	37	CCDS6095.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.263471	0.80358	.	.	ENSG00000147475	ENST00000397228;ENST00000523887;ENST00000276461;ENST00000518586;ENST00000335171;ENST00000521644;ENST00000519638	D;D;D;D;D;D;D	0.94457	-3.43;-3.43;-3.43;-3.43;-3.43;-3.43;-3.43	5.91	5.91	0.95273	.	0.088984	0.85682	D	0.000000	D	0.95204	0.8445	L	0.45137	1.4	0.80722	D	1	D;B;B	0.58620	0.983;0.257;0.009	P;B;B	0.57502	0.822;0.162;0.029	D	0.94048	0.7315	10	0.37606	T	0.19	-17.7147	19.29	0.94095	0.0:0.0:1.0:0.0	.	46;46;46	O94905;O94905-3;O94905-2	ERLN2_HUMAN;.;.	D	46	ENSP00000380405:G46D;ENSP00000429903:G46D;ENSP00000276461:G46D;ENSP00000427847:G46D;ENSP00000335220:G46D;ENSP00000429621:G46D;ENSP00000428112:G46D	ENSP00000276461:G46D	G	+	2	0	ERLIN2	37717070	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.379000	0.97198	2.799000	0.96334	0.650000	0.86243	GGC	.		0.537	ERLIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376712.2	NM_007175	
ST18	9705	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	8	53028901	53028901	+	Silent	SNP	C	C	T			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr8:53028901C>T	ENST00000276480.7	-	25	3620	c.2937G>A	c.(2935-2937)ctG>ctA	p.L979L		NM_014682.2	NP_055497.1	O60284	ST18_HUMAN	suppression of tumorigenicity 18, zinc finger	979					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(14)|lung(38)|ovary(4)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	85		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				CCAGCTCTTTCAGCAGACTTT	0.433																																					p.L979L		.											.	ST18-95	0			c.G2937A						.						232.0	167.0	189.0					8																	53028901		2203	4300	6503	SO:0001819	synonymous_variant	9705	exon25			CTCTTTCAGCAGA	AB011107	CCDS6149.1	8q11.23	2014-03-24	2014-03-24	2002-12-13	ENSG00000147488	ENSG00000147488		"""Zinc fingers, C2HC-type containing"""	18695	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 3"""		"""zinc finger protein 387"", ""suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)"""	ZNF387		15489893	Standard	NM_014682		Approved	KIAA0535, ZC2HC10, NZF3	uc003xra.2	O60284	OTTHUMG00000164233	ENST00000276480.7:c.2937G>A	8.37:g.53028901C>T		Somatic	139	0		WXS	Illumina HiSeq	Phase_I	175	69	NM_014682	0	0	0	0	0	Q17RY1	Silent	SNP	ENST00000276480.7	37	CCDS6149.1																																																																																			.		0.433	ST18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377867.1		
ST18	9705	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	8	53028912	53028912	+	Missense_Mutation	SNP	C	C	T			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr8:53028912C>T	ENST00000276480.7	-	25	3609	c.2926G>A	c.(2926-2928)Gaa>Aaa	p.E976K		NM_014682.2	NP_055497.1	O60284	ST18_HUMAN	suppression of tumorigenicity 18, zinc finger	976					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(14)|lung(38)|ovary(4)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	85		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				AGCAGACTTTCATTGTTCTGT	0.438																																					p.E976K		.											.	ST18-95	0			c.G2926A						.						238.0	170.0	193.0					8																	53028912		2203	4300	6503	SO:0001583	missense	9705	exon25			GACTTTCATTGTT	AB011107	CCDS6149.1	8q11.23	2014-03-24	2014-03-24	2002-12-13	ENSG00000147488	ENSG00000147488		"""Zinc fingers, C2HC-type containing"""	18695	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 3"""		"""zinc finger protein 387"", ""suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)"""	ZNF387		15489893	Standard	NM_014682		Approved	KIAA0535, ZC2HC10, NZF3	uc003xra.2	O60284	OTTHUMG00000164233	ENST00000276480.7:c.2926G>A	8.37:g.53028912C>T	ENSP00000276480:p.Glu976Lys	Somatic	124	1		WXS	Illumina HiSeq	Phase_I	160	60	NM_014682	0	0	0	0	0	Q17RY1	Missense_Mutation	SNP	ENST00000276480.7	37	CCDS6149.1	.	.	.	.	.	.	.	.	.	.	C	36	5.702512	0.96812	.	.	ENSG00000147488	ENST00000276480	T	0.49139	0.79	5.63	5.63	0.86233	.	0.048484	0.85682	D	0.000000	T	0.60779	0.2295	L	0.49778	1.585	0.80722	D	1	D	0.62365	0.991	P	0.57204	0.815	T	0.61063	-0.7138	10	0.59425	D	0.04	-24.3803	19.6718	0.95914	0.0:1.0:0.0:0.0	.	976	O60284	ST18_HUMAN	K	976	ENSP00000276480:E976K	ENSP00000276480:E976K	E	-	1	0	ST18	53191465	1.000000	0.71417	0.869000	0.34112	0.805000	0.45488	4.884000	0.63135	2.643000	0.89663	0.655000	0.94253	GAA	.		0.438	ST18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377867.1		
GRHL2	79977	broad.mit.edu	37	8	102631907	102631907	+	Missense_Mutation	SNP	C	C	G			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr8:102631907C>G	ENST00000251808.3	+	9	1577	c.1239C>G	c.(1237-1239)atC>atG	p.I413M	GRHL2_ENST00000395927.1_Missense_Mutation_p.I397M	NM_024915.3	NP_079191.2	Q6ISB3	GRHL2_HUMAN	grainyhead-like 2 (Drosophila)	413					brain development (GO:0007420)|camera-type eye development (GO:0043010)|cardiac ventricle morphogenesis (GO:0003208)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digit morphogenesis (GO:0042733)|face development (GO:0060324)|in utero embryonic development (GO:0001701)|lung lobe morphogenesis (GO:0060463)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28	all_cancers(14;4.39e-08)|all_epithelial(15;4.09e-10)|Lung NSC(17;7.11e-06)|all_lung(17;1.44e-05)		Epithelial(11;5.81e-09)|all cancers(13;3.81e-07)|OV - Ovarian serous cystadenocarcinoma(57;0.000213)			ATTGCCAGATCAAGGTCTTCT	0.338																																					p.I413M													.	GRHL2-93	0			c.C1239G						.						97.0	96.0	96.0					8																	102631907		2203	4300	6503	SO:0001583	missense	79977	exon9			CCAGATCAAGGTC	AK023844	CCDS34931.1	8q22.3	2008-02-05	2005-07-11	2005-07-11	ENSG00000083307	ENSG00000083307			2799	protein-coding gene	gene with protein product		608576	"""deafness, autosomal dominant 28"", ""transcription factor CP2-like 3"""	DFNA28, TFCP2L3		12393799	Standard	NM_024915		Approved	FLJ13782, BOM	uc010mbu.3	Q6ISB3	OTTHUMG00000149915	ENST00000251808.3:c.1239C>G	8.37:g.102631907C>G	ENSP00000251808:p.Ile413Met	Somatic	171	0		WXS	Illumina HiSeq	Phase_I	264	8	NM_024915	0	0	30	30	0	A1L303|Q6NT03|Q9H8B8	Missense_Mutation	SNP	ENST00000251808.3	37	CCDS34931.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.981703	0.74474	.	.	ENSG00000083307	ENST00000251808;ENST00000395927;ENST00000395928	T;T	0.24538	1.85;1.85	5.85	5.85	0.93711	CP2 transcription factor (1);	0.046113	0.85682	D	0.000000	T	0.52075	0.1712	M	0.72353	2.195	0.80722	D	1	D	0.61080	0.989	D	0.64877	0.93	T	0.49753	-0.8906	10	0.66056	D	0.02	-36.8225	20.1634	0.98142	0.0:1.0:0.0:0.0	.	413	Q6ISB3	GRHL2_HUMAN	M	413;397;413	ENSP00000251808:I413M;ENSP00000379260:I397M	ENSP00000251808:I413M	I	+	3	3	GRHL2	102701083	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.929000	0.63455	2.773000	0.95371	0.655000	0.94253	ATC	.		0.338	GRHL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313882.1	NM_024915	
VLDLR	7436	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	9	2651933	2651933	+	Missense_Mutation	SNP	G	G	A	rs183359461		TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr9:2651933G>A	ENST00000382100.3	+	17	2751	c.2395G>A	c.(2395-2397)Gca>Aca	p.A799T	VLDLR_ENST00000382099.2_Missense_Mutation_p.A771T	NM_003383.3	NP_003374.3	P98155	VLDLR_HUMAN	very low density lipoprotein receptor	799					cholesterol metabolic process (GO:0008203)|glycoprotein transport (GO:0034436)|lipid transport (GO:0006869)|memory (GO:0007613)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|positive regulation of dendrite development (GO:1900006)|positive regulation of protein kinase activity (GO:0045860)|receptor-mediated endocytosis (GO:0006898)|reelin-mediated signaling pathway (GO:0038026)|signal transduction (GO:0007165)|ventral spinal cord development (GO:0021517)|very-low-density lipoprotein particle clearance (GO:0034447)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|very-low-density lipoprotein particle (GO:0034361)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|glycoprotein binding (GO:0001948)|glycoprotein transporter activity (GO:0034437)|low-density lipoprotein receptor activity (GO:0005041)|reelin receptor activity (GO:0038025)|very-low-density lipoprotein particle binding (GO:0034189)|very-low-density lipoprotein particle receptor activity (GO:0030229)	p.A799T(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	24				GBM - Glioblastoma multiforme(50;0.0668)|Lung(218;0.123)		GACTTCTGCCGCATGGGCCAT	0.433																																					p.A799T		.											.	VLDLR-516	1	Substitution - Missense(1)	pancreas(1)	c.G2395A						.	G	THR/ALA,THR/ALA	1,4405	2.1+/-5.4	0,1,2202	108.0	98.0	101.0		2311,2395	5.1	1.0	9		101	0,8600		0,0,4300	no	missense,missense	VLDLR	NM_001018056.1,NM_003383.3	58,58	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging	771/846,799/874	2651933	1,13005	2203	4300	6503	SO:0001583	missense	7436	exon17			TCTGCCGCATGGG		CCDS6446.1, CCDS34979.1	9p24	2014-01-24			ENSG00000147852	ENSG00000147852		"""Low density lipoprotein receptors"""	12698	protein-coding gene	gene with protein product		192977				8294473	Standard	XM_006716864		Approved	CARMQ1, CHRMQ1, VLDLRCH	uc003zhk.1	P98155	OTTHUMG00000019447	ENST00000382100.3:c.2395G>A	9.37:g.2651933G>A	ENSP00000371532:p.Ala799Thr	Somatic	123	2		WXS	Illumina HiSeq	Phase_I	177	50	NM_003383	0	0	4	5	1	B2RMZ7|D3DRH6|Q5VVF6	Missense_Mutation	SNP	ENST00000382100.3	37	CCDS6446.1	.	.	.	.	.	.	.	.	.	.	G	15.30	2.791586	0.50102	2.27E-4	0.0	ENSG00000147852	ENST00000382100;ENST00000382099;ENST00000382092	T;T	0.72942	-0.7;-0.7	5.11	5.11	0.69529	.	0.303026	0.23627	N	0.046179	T	0.68220	0.2977	L	0.31752	0.955	0.58432	D	0.999999	D;D;P	0.62365	0.991;0.984;0.946	P;B;B	0.50490	0.642;0.439;0.306	T	0.64659	-0.6355	10	0.22706	T	0.39	.	18.8988	0.92434	0.0:0.0:1.0:0.0	.	771;771;799	P98155-2;Q5VVF5;P98155	.;.;VLDLR_HUMAN	T	799;771;678	ENSP00000371532:A799T;ENSP00000371531:A771T	ENSP00000371524:A678T	A	+	1	0	VLDLR	2641933	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	8.532000	0.90613	2.526000	0.85167	0.591000	0.81541	GCA	G|0.999;T|0.000		0.433	VLDLR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051519.2	NM_003383	
TYRP1	7306	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	9	12704628	12704628	+	Missense_Mutation	SNP	C	C	A			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr9:12704628C>A	ENST00000388918.5	+	6	1313	c.1184C>A	c.(1183-1185)cCa>cAa	p.P395Q	RP11-3L8.3_ENST00000417638.1_RNA|TYRP1_ENST00000381136.2_Missense_Mutation_p.P105Q|TYRP1_ENST00000381137.2_Missense_Mutation_p.P104Q	NM_000550.2	NP_000541.1	P17643	TYRP1_HUMAN	tyrosinase-related protein 1	395				PN -> SQ (in Ref. 7; CAA35820). {ECO:0000305}.	acetoacetic acid metabolic process (GO:0043438)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome organization (GO:0032438)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)|melanosome membrane (GO:0033162)	copper ion binding (GO:0005507)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, another compound as one donor, and incorporation of one atom of oxygen (GO:0016716)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|stomach(1)	22		all_cancers(3;3.1e-05)|all_lung(3;1.7e-06)|Lung NSC(3;2.09e-06)|all_epithelial(3;0.000695)|all_hematologic(3;0.0033)|Acute lymphoblastic leukemia(23;0.0744)		GBM - Glioblastoma multiforme(50;9.85e-06)		CATTTGTCTCCAAATGATCCT	0.443									Oculocutaneous Albinism																												p.P395Q		.											.	TYRP1-226	0			c.C1184A						.						122.0	105.0	111.0					9																	12704628		2203	4300	6503	SO:0001583	missense	7306	exon6	Familial Cancer Database		TGTCTCCAAATGA	L33830	CCDS34990.1	9p23	2013-01-08			ENSG00000107165	ENSG00000107165			12450	protein-coding gene	gene with protein product		115501		TYRP, CAS2		9434945	Standard	NM_000550		Approved	GP75, CATB, TRP, b-PROTEIN, OCA3	uc003zkv.4	P17643	OTTHUMG00000021034	ENST00000388918.5:c.1184C>A	9.37:g.12704628C>A	ENSP00000373570:p.Pro395Gln	Somatic	188	0		WXS	Illumina HiSeq	Phase_I	380	111	NM_000550	0	0	0	0	0	P78468|P78469|Q13721|Q15679	Missense_Mutation	SNP	ENST00000388918.5	37	CCDS34990.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.173865	0.78452	.	.	ENSG00000107165	ENST00000381137;ENST00000388918;ENST00000381136	D;D;D	0.99089	-5.41;-5.41;-5.41	5.5	5.5	0.81552	Tyrosinase (1);Uncharacterised domain, di-copper centre (2);	0.000000	0.85682	D	0.000000	D	0.99468	0.9811	M	0.91768	3.24	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98693	1.0697	10	0.72032	D	0.01	-20.7972	19.7537	0.96281	0.0:1.0:0.0:0.0	.	395	P17643	TYRP1_HUMAN	Q	104;395;105	ENSP00000370529:P104Q;ENSP00000373570:P395Q;ENSP00000370528:P105Q	ENSP00000370528:P105Q	P	+	2	0	TYRP1	12694628	1.000000	0.71417	0.999000	0.59377	0.634000	0.38068	7.370000	0.79589	2.736000	0.93811	0.591000	0.81541	CCA	.		0.443	TYRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055502.3	NM_000550	
C9orf24	84688	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	9	34397497	34397497	+	Splice_Site	SNP	C	C	T			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr9:34397497C>T	ENST00000297623.2	-	1	333	c.135G>A	c.(133-135)ccG>ccA	p.P45P		NM_032596.3	NP_115985.2	Q8NCR6	SMRP1_HUMAN	chromosome 9 open reading frame 24	45					cell differentiation (GO:0030154)|cellular protein complex assembly (GO:0043623)|spermatogenesis (GO:0007283)	manchette (GO:0002177)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)	5			LUSC - Lung squamous cell carcinoma(29;0.0107)	GBM - Glioblastoma multiforme(74;0.123)		TCCCACTTACCGGAGTCAGAA	0.522																																					p.P45P		.											.	C9orf24-91	0			c.G135A						.						125.0	117.0	120.0					9																	34397497		2203	4300	6503	SO:0001630	splice_region_variant	84688	exon1			ACTTACCGGAGTC	BC029484	CCDS6553.1, CCDS6554.1, CCDS6555.1, CCDS59121.1	9p11.2	2013-01-11			ENSG00000164972	ENSG00000164972			19919	protein-coding gene	gene with protein product	"""ciliated bronchial epithelium 1"", ""spermatid-specific manchette-related protein 1"""					12029067	Standard	NM_147168		Approved	bA573M23.4, NYD-SP22, MGC32921, MGC33614, CBE1, SMRP1	uc003zuh.1	Q8NCR6	OTTHUMG00000000437	ENST00000297623.2:c.135+1G>A	9.37:g.34397497C>T		Somatic	215	0		WXS	Illumina HiSeq	Phase_I	308	87	NM_032596	0	0	2	2	0	Q5T598|Q5T599|Q5T5A0|Q8N9G4|Q96KD1|Q96LN1	Silent	SNP	ENST00000297623.2	37	CCDS6554.1	.	.	.	.	.	.	.	.	.	.	C	14.01	2.408871	0.42715	.	.	ENSG00000164972	ENST00000444429	.	.	.	5.44	4.53	0.55603	.	.	.	.	.	T	0.61739	0.2371	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59721	-0.7401	4	.	.	.	-0.9559	10.3744	0.44073	0.0:0.9067:0.0:0.0933	.	.	.	.	R	11	.	.	G	-	1	0	C9orf24	34387497	0.988000	0.35896	0.992000	0.48379	0.887000	0.51463	2.922000	0.48860	1.271000	0.44313	0.467000	0.42956	GGG	.		0.522	C9orf24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001098.3	NM_147169	Silent
ALDH1B1	219	hgsc.bcm.edu;broad.mit.edu	37	9	38396007	38396007	+	Missense_Mutation	SNP	C	C	T			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr9:38396007C>T	ENST00000377698.3	+	2	415	c.262C>T	c.(262-264)Cgc>Tgc	p.R88C		NM_000692.4	NP_000683.3	P30837	AL1B1_HUMAN	aldehyde dehydrogenase 1 family, member B1	88					carbohydrate metabolic process (GO:0005975)|ethanol catabolic process (GO:0006068)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	aldehyde dehydrogenase (NAD) activity (GO:0004029)			NS(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(1)|stomach(2)|urinary_tract(2)	32				GBM - Glioblastoma multiforme(29;0.043)|Lung(182;0.115)		GGAAGCCTTCCGCCTGGGGTC	0.677																																					p.R88C		.											.	ALDH1B1-227	0			c.C262T						.						62.0	67.0	65.0					9																	38396007		2203	4300	6503	SO:0001583	missense	219	exon2			GCCTTCCGCCTGG	M63967	CCDS6615.1	9p13	2008-02-05			ENSG00000137124	ENSG00000137124	1.2.1.3	"""Aldehyde dehydrogenases"""	407	protein-coding gene	gene with protein product		100670		ALDH5		2061311	Standard	NM_000692		Approved	ALDHX	uc004aay.3	P30837	OTTHUMG00000019938	ENST00000377698.3:c.262C>T	9.37:g.38396007C>T	ENSP00000366927:p.Arg88Cys	Somatic	221	0		WXS	Illumina HiSeq	Phase_I	313	22	NM_000692	0	0	5	5	0	B2R8F0|Q8WX76|Q9BV45	Missense_Mutation	SNP	ENST00000377698.3	37	CCDS6615.1	.	.	.	.	.	.	.	.	.	.	C	13.05	2.121727	0.37436	.	.	ENSG00000137124	ENST00000377698	T	0.77358	-1.09	5.61	2.7	0.31948	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.373330	0.22798	N	0.055518	T	0.71443	0.3340	M	0.67625	2.065	0.43377	D	0.995473	B	0.14012	0.009	B	0.18561	0.022	T	0.68349	-0.5432	10	0.87932	D	0	.	4.9629	0.14076	0.2807:0.5588:0.0:0.1605	.	88	P30837	AL1B1_HUMAN	C	88	ENSP00000366927:R88C	ENSP00000366927:R88C	R	+	1	0	ALDH1B1	38386007	0.002000	0.14202	0.982000	0.44146	0.995000	0.86356	-0.376000	0.07465	0.750000	0.32877	0.655000	0.94253	CGC	.		0.677	ALDH1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052492.1		
CAMSAP1	157922	ucsc.edu	37	9	138713398	138713398	+	Missense_Mutation	SNP	C	C	T			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr9:138713398C>T	ENST00000389532.4	-	11	3173	c.3109G>A	c.(3109-3111)Gcc>Acc	p.A1037T	CAMSAP1_ENST00000312405.6_Missense_Mutation_p.A759T|CAMSAP1_ENST00000483991.1_5'UTR|CAMSAP1_ENST00000409386.3_Missense_Mutation_p.A1048T	NM_015447.3	NP_056262.3	Q5T5Y3	CAMP1_HUMAN	calmodulin regulated spectrin-associated protein 1	1037					cytoskeleton organization (GO:0007010)|neuron projection development (GO:0031175)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|spectrin binding (GO:0030507)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(11)|lung(16)|ovary(3)|pancreas(1)|skin(1)	47				OV - Ovarian serous cystadenocarcinoma(145;1.4e-06)|Epithelial(140;1.11e-05)		TTCAGGATGGCCTGCTGCAGC	0.527																																					p.A1037T													.	CAMSAP1-92	0			c.G3109A						.						74.0	69.0	71.0					9																	138713398		2203	4300	6503	SO:0001583	missense	157922	exon11			GGATGGCCTGCTG	AJ519841	CCDS35176.2	9q34.3	2008-02-05			ENSG00000130559	ENSG00000130559			19946	protein-coding gene	gene with protein product		613774				12477932	Standard	NM_015447		Approved	FLJ31228, DKFZp434F195	uc004cgr.4	Q5T5Y3	OTTHUMG00000020918	ENST00000389532.4:c.3109G>A	9.37:g.138713398C>T	ENSP00000374183:p.Ala1037Thr	Somatic	103	1		WXS	Illumina HiSeq		57	3	NM_015447	0	0	6	9	3	A1L4L2|B2REB2|B2REB3|Q70W33|Q8NCY0|Q96E80|Q96FM3|Q9UFJ5	Missense_Mutation	SNP	ENST00000389532.4	37	CCDS35176.2	.	.	.	.	.	.	.	.	.	.	C	16.79	3.220917	0.58560	.	.	ENSG00000130559	ENST00000389532;ENST00000312405;ENST00000409386	T;T;T	0.14893	2.47;2.47;2.47	4.91	4.91	0.64330	.	0.114253	0.64402	D	0.000010	T	0.43590	0.1254	M	0.73598	2.24	0.44462	D	0.997399	D;D	0.89917	1.0;0.97	D;P	0.69142	0.962;0.839	T	0.45249	-0.9274	10	0.87932	D	0	-2.6208	18.4729	0.90781	0.0:1.0:0.0:0.0	.	1037;1048	Q5T5Y3;Q5T5Y3-3	CAMP1_HUMAN;.	T	1037;759;1048	ENSP00000374183:A1037T;ENSP00000312463:A759T;ENSP00000386420:A1048T	ENSP00000312463:A759T	A	-	1	0	CAMSAP1	137853219	1.000000	0.71417	1.000000	0.80357	0.019000	0.09904	4.748000	0.62148	2.413000	0.81919	0.655000	0.94253	GCC	.		0.527	CAMSAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055024.2	XM_351857	
C9orf69	90120	hgsc.bcm.edu	37	9	139008746	139008746	+	Start_Codon_SNP	SNP	T	T	C			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr9:139008746T>C	ENST00000418388.1	-	2	503	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	C9orf69_ENST00000561457.1_Silent_p.Q25Q			H0YL14	CI069_HUMAN	chromosome 9 open reading frame 69	1					cell cycle (GO:0007049)|positive regulation of cell proliferation (GO:0008284)|positive regulation of viral process (GO:0048524)|viral process (GO:0016032)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	GTP binding (GO:0005525)			endometrium(1)	1		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;9.58e-07)|Epithelial(140;6.42e-06)		ATGACCGGCATTgggccccgg	0.766																																					p.M1V		.											.	.	0			c.A1G						.						6.0	8.0	7.0					9																	139008746		1561	3546	5107	SO:0001582	initiator_codon_variant	90120	exon2			CCGGCATTGGGCC		CCDS59155.1	9q34.3	2012-11-26	2012-07-05	2012-07-05	ENSG00000238227	ENSG00000238227			31009	protein-coding gene	gene with protein product						21667337	Standard	NM_152833		Approved	bA83N9.1	uc004cgx.5	H0YL14	OTTHUMG00000020922	ENST00000418388.1:c.1A>G	9.37:g.139008746T>C	ENSP00000453019:p.Met1Val	Somatic	6	1		WXS	Illumina HiSeq	Phase_I	4	3	NM_152833	0	0	1	1	0		Missense_Mutation	SNP	ENST00000418388.1	37	CCDS59155.1																																																																																			.		0.766	C9orf69-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055043.3	NM_152833	Missense_Mutation
STAG2	10735	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	123176469	123176469	+	Nonsense_Mutation	SNP	C	C	T			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chrX:123176469C>T	ENST00000371160.1	+	7	726	c.436C>T	c.(436-438)Cga>Tga	p.R146*	STAG2_ENST00000371145.3_Nonsense_Mutation_p.R146*|STAG2_ENST00000354548.5_Nonsense_Mutation_p.R77*|STAG2_ENST00000469481.1_Intron|STAG2_ENST00000218089.9_Nonsense_Mutation_p.R146*|STAG2_ENST00000371157.3_Nonsense_Mutation_p.R146*|STAG2_ENST00000371144.3_Nonsense_Mutation_p.R146*	NM_001282418.1	NP_001269347.1	Q8N3U4	STAG2_HUMAN	stromal antigen 2	146					meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of DNA endoreduplication (GO:0032876)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	actin cytoskeleton (GO:0015629)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(9)|lung(21)|ovary(5)|prostate(2)|skin(5)|urinary_tract(4)	78						TGAGATAATTCGAAAAATGAC	0.284																																					p.R146X		.											.	STAG2-134	0			c.C436T						.						79.0	75.0	76.0					X																	123176469		2203	4300	6503	SO:0001587	stop_gained	10735	exon7			ATAATTCGAAAAA	Z75331	CCDS14607.1, CCDS43990.1	Xq25	2014-09-17			ENSG00000101972	ENSG00000101972			11355	protein-coding gene	gene with protein product		300826				9305759	Standard	NM_001042750		Approved	SA-2, SCC3B	uc004eua.3	Q8N3U4	OTTHUMG00000022725	ENST00000371160.1:c.436C>T	X.37:g.123176469C>T	ENSP00000360202:p.Arg146*	Somatic	63	0		WXS	Illumina HiSeq	Phase_I	98	85	NM_001042749	0	0	1	8	7	B1AMT5|D3DTF5|O00540|Q5JTI6|Q68DE9|Q9H1N8	Nonsense_Mutation	SNP	ENST00000371160.1	37	CCDS14607.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.683809	0.88639	.	.	ENSG00000101972	ENST00000218089;ENST00000455404;ENST00000354548;ENST00000371160;ENST00000435103;ENST00000371157;ENST00000371145;ENST00000371144;ENST00000428941;ENST00000435215	.	.	.	5.74	4.86	0.63082	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-21.2847	12.9796	0.58555	0.2934:0.7066:0.0:0.0	.	.	.	.	X	146;146;77;146;146;146;146;146;146;146	.	ENSP00000218089:R146X	R	+	1	2	STAG2	123004150	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	1.312000	0.33574	1.156000	0.42514	0.522000	0.50473	CGA	.		0.284	STAG2-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000156159.2	NM_006603	
IL9R	3581	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	155232601	155232601	+	Missense_Mutation	SNP	G	G	A			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chrX:155232601G>A	ENST00000244174.5	+	2	238	c.59G>A	c.(58-60)cGa>cAa	p.R20Q	IL9R_ENST00000424344.3_5'UTR|IL9R_ENST00000540897.1_Missense_Mutation_p.R57Q|IL9R_ENST00000369423.2_Missense_Mutation_p.R67Q	NM_002186.2	NP_002177.2	Q01113	IL9R_HUMAN	interleukin 9 receptor	20					cell proliferation (GO:0008283)|positive regulation of cell growth (GO:0030307)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	interleukin-9 receptor activity (GO:0004919)			NS(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(1)|lung(12)|upper_aerodigestive_tract(1)	23	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					GCCCTGAGGCGAGACATGGGC	0.612																																					p.R67Q		.											.	IL9R-40	0			c.G200A						.	G	GLN/ARG	1,4405		0,1,2202	164.0	163.0	163.0		59	-2.3	0.0	X		163	0,8592		0,0,4296	no	missense	IL9R	NM_002186.2	43	0,1,6498	AA,AG,GG		0.0,0.0227,0.0077	benign	20/522	155232601	1,12997	2203	4296	6499	SO:0001583	missense	3581	exon3			TGAGGCGAGACAT	M84747	CCDS14771.4, CCDS59180.1	Xq28 and Yq12	2008-02-05			ENSG00000124334	ENSG00000124334		"""Pseudoautosomal regions / PAR2"", ""Interleukins and interleukin receptors"", ""CD molecules"""	6030	protein-coding gene	gene with protein product		300007				1376929, 8666384	Standard	NM_002186		Approved	CD129	uc004fnv.1	Q01113	OTTHUMG00000022720	ENST00000244174.5:c.59G>A	X.37:g.155232601G>A	ENSP00000244174:p.Arg20Gln	Somatic	282	1		WXS	Illumina HiSeq	Phase_I	236	84	NM_176786	0	0	0	0	0	B9ZVT0|Q14634|Q8WWU1|Q96TF0	Missense_Mutation	SNP	ENST00000244174.5	37	CCDS14771.4	.	.	.	.	.	.	.	.	.	.	g	5.676	0.309355	0.10733	2.27E-4	0.0	ENSG00000124334	ENST00000244174;ENST00000369423;ENST00000540897	T;T;T	0.22743	2.98;1.94;1.94	1.18	-2.35	0.06684	.	4.396220	0.00735	N	0.000961	T	0.09512	0.0234	.	.	.	0.09310	N	1	B;B	0.28419	0.021;0.211	B;B	0.10450	0.002;0.005	T	0.11324	-1.0592	9	0.13108	T	0.6	-13.6917	3.8243	0.08848	0.2084:0.4817:0.3099:0.0	.	20;67	Q01113;B9ZVT0	IL9R_HUMAN;.	Q	20;67;57	ENSP00000244174:R20Q;ENSP00000358431:R67Q;ENSP00000438112:R57Q	ENSP00000244174:R20Q	R	+	2	0	IL9R	154885795	0.000000	0.05858	0.000000	0.03702	0.739000	0.42172	-0.677000	0.05215	-1.521000	0.01771	-0.733000	0.03571	CGA	.		0.612	IL9R-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058981.1	NM_002186	
CORO1B	57175	hgsc.bcm.edu;broad.mit.edu	37	11	67207603	67207603	+	Frame_Shift_Del	DEL	C	C	-			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr11:67207603delC	ENST00000341356.5	-	8	1103	c.993delG	c.(991-993)aagfs	p.K331fs	CORO1B_ENST00000539724.1_Intron|PTPRCAP_ENST00000326294.3_5'Flank|CORO1B_ENST00000393893.1_Frame_Shift_Del_p.K331fs	NM_020441.2	NP_065174.1	Q9BR76	COR1B_HUMAN	coronin, actin binding protein, 1B	331					actin cytoskeleton organization (GO:0030036)|actin filament branching (GO:0090135)|actin filament bundle assembly (GO:0051017)|cell migration (GO:0016477)|endothelial cell chemotaxis (GO:0035767)|negative regulation of Arp2/3 complex-mediated actin nucleation (GO:0034316)|positive regulation of lamellipodium morphogenesis (GO:2000394)|protein localization to cell leading edge (GO:1902463)|ruffle organization (GO:0031529)|wound healing (GO:0042060)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)|Arp2/3 complex binding (GO:0071933)|identical protein binding (GO:0042802)			cervix(1)|endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)	13			BRCA - Breast invasive adenocarcinoma(15;3.26e-06)			CGATCTCGCACTTGCTGACCT	0.622																																					p.K331fs		.											.	CORO1B-108	0			c.993delG						.						65.0	67.0	66.0					11																	67207603		2200	4295	6495	SO:0001589	frameshift_variant	57175	exon8			.	AK000860	CCDS8164.1	11q13.1	2013-01-10	2001-11-28		ENSG00000172725	ENSG00000172725		"""Coronins"", ""WD repeat domain containing"""	2253	protein-coding gene	gene with protein product		609849	"""coronin, actin-binding protein, 1B"""			9778037	Standard	NM_001018070		Approved	coronin-2	uc001olk.1	Q9BR76	OTTHUMG00000167775	ENST00000341356.5:c.993delG	11.37:g.67207603delC	ENSP00000340211:p.Lys331fs	Somatic	172	0		WXS	Illumina HiSeq	Phase_I	139	65	NM_020441	0	0	0	0	0	B2RD45	Frame_Shift_Del	DEL	ENST00000341356.5	37	CCDS8164.1																																																																																			.		0.622	CORO1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396220.1	NM_020441	
SMPD2	6610	hgsc.bcm.edu;broad.mit.edu	37	6	109763791	109763791	+	Frame_Shift_Del	DEL	C	C	-	rs534167199		TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr6:109763791delC	ENST00000258052.3	+	6	813	c.454delC	c.(454-456)cgtfs	p.R152fs	PPIL6_ENST00000424445.2_5'Flank|PPIL6_ENST00000440797.2_5'Flank|PPIL6_ENST00000521072.2_5'Flank	NM_003080.2	NP_003071.2	O60906	NSMA_HUMAN	sphingomyelin phosphodiesterase 2, neutral membrane (neutral sphingomyelinase)	152					apoptotic signaling pathway (GO:0097190)|ceramide biosynthetic process (GO:0046513)|glycosphingolipid metabolic process (GO:0006687)|neurotrophin TRK receptor signaling pathway (GO:0048011)|response to mechanical stimulus (GO:0009612)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin metabolic process (GO:0006684)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|sphingomyelin phosphodiesterase activity (GO:0004767)	p.R152C(1)		endometrium(2)|lung(3)|stomach(1)|upper_aerodigestive_tract(2)	8		all_cancers(87;1.1e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000144)|all_lung(197;0.0221)|Colorectal(196;0.0488)|Lung SC(18;0.0548)		Epithelial(106;0.0137)|all cancers(137;0.0188)|OV - Ovarian serous cystadenocarcinoma(136;0.0228)|BRCA - Breast invasive adenocarcinoma(108;0.0566)		CCTAGCACATCGTGTGGCCCA	0.537																																					p.R152fs		.											.	SMPD2-90	1	Substitution - Missense(1)	endometrium(1)	c.454delC						.						169.0	147.0	154.0					6																	109763791		2203	4300	6503	SO:0001589	frameshift_variant	6610	exon6			.	AJ222801	CCDS5075.1	6q21	2009-10-23			ENSG00000135587	ENSG00000135587	3.1.4.12		11121	protein-coding gene	gene with protein product		603498				9520418	Standard	XM_005267109		Approved	nSMase, ISC1	uc003pti.3	O60906	OTTHUMG00000015348	ENST00000258052.3:c.454delC	6.37:g.109763791delC	ENSP00000258052:p.Arg152fs	Somatic	205	0		WXS	Illumina HiSeq	Phase_I	259	117	NM_003080	0	0	0	0	0	Q5TED1|Q9BWR3	Frame_Shift_Del	DEL	ENST00000258052.3	37	CCDS5075.1																																																																																			.		0.537	SMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041755.1		
GRM1	2911	broad.mit.edu	37	6	146350671	146350672	+	Frame_Shift_Ins	INS	-	-	T			TCGA-B3-4104-01A-01D-1458-08	TCGA-B3-4104-10A-01D-1458-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	368382d0-ad7f-4735-b04a-e806d2a2d9a4	23886794-9d4c-4511-82ee-830db88796d5	g.chr6:146350671_146350672insT	ENST00000282753.1	+	1	253_254	c.18_19insT	c.(19-21)tttfs	p.F7fs	GRM1_ENST00000392299.2_Frame_Shift_Ins_p.F7fs|GRM1_ENST00000355289.4_Frame_Shift_Ins_p.F7fs|GRM1_ENST00000361719.2_Frame_Shift_Ins_p.F7fs|GRM1_ENST00000507907.1_Frame_Shift_Ins_p.F7fs|GRM1_ENST00000492807.2_Frame_Shift_Ins_p.F7fs			Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1	7					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|cell death (GO:0008219)|cellular response to electrical stimulus (GO:0071257)|dimeric G-protein coupled receptor signaling pathway (GO:0038042)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|G-protein coupled receptor dimeric complex (GO:0038037)|G-protein coupled receptor homodimeric complex (GO:0038038)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(2)|breast(5)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(54)|ovary(7)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	126		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)		GGCTCCTTTTGTTTTTTTTCCC	0.644																																					p.L6fs													.	GRM1-1080	0			c.18_19insT						.		,	13,4249		0,13,2118					,	5.4	0.9			109	6,8248		0,6,4121	no	frameshift,frameshift	GRM1	NM_001114329.1,NM_000838.3	,	0,19,6239	A1A1,A1R,RR		0.0727,0.305,0.1518	,	,		19,12497				SO:0001589	frameshift_variant	2911	exon2			CCTTTTGTTTTTT	U31215	CCDS5209.1, CCDS47497.1, CCDS64548.1	6q24	2014-06-12			ENSG00000152822	ENSG00000152822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4593	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 85"""	604473				9076744, 9376535	Standard	NM_001278064		Approved	GPRC1A, mGlu1, MGLUR1, PPP1R85	uc010khw.2	Q13255	OTTHUMG00000015752	ENST00000282753.1:c.26dupT	6.37:g.146350679_146350679dupT	ENSP00000282753:p.Phe7fs	Somatic	339	0		WXS	Illumina HiSeq	Phase_I	339	6	NM_000838	0	0	0	0	0	B9EG79|F8W805|Q13256|Q14757|Q14758|Q5VTF7|Q5VTF8|Q9NU10|Q9UGS9|Q9UGT0	Frame_Shift_Ins	INS	ENST00000282753.1	37	CCDS5209.1																																																																																			.		0.644	GRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042574.1	NM_000838	
