#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CTRC	11330	hgsc.bcm.edu	37	1	15766798	15766798	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr1:15766798T>C	ENST00000375949.4	+	2	69	c.43T>C	c.(43-45)Tcc>Ccc	p.S15P	CTRC_ENST00000375943.2_Intron	NM_007272.2	NP_009203.2	Q99895	CTRC_HUMAN	chymotrypsin C (caldecrin)	15					proteolysis (GO:0006508)		peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|prostate(1)	13		Breast(348;0.000207)|all_lung(284;0.00021)|Colorectal(325;0.000257)|Lung NSC(340;0.000269)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)|Hepatocellular(190;0.0634)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.56e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CTCCCCAGCCTCCAGCTGTGG	0.662																																					p.S15P		.											.	CTRC-90	0			c.T43C						.						13.0	15.0	14.0					1																	15766798		2195	4289	6484	SO:0001583	missense	11330	exon2			CCAGCCTCCAGCT	BC015118	CCDS156.1	1p36.21	2009-02-18			ENSG00000162438	ENSG00000162438	3.4.21.2		2523	protein-coding gene	gene with protein product	"""elastase 4"""	601405				8635596	Standard	NM_007272		Approved	CLCR, ELA4	uc001awi.1	Q99895	OTTHUMG00000002255	ENST00000375949.4:c.43T>C	1.37:g.15766798T>C	ENSP00000365116:p.Ser15Pro	Somatic	15	0		WXS	Illumina HiSeq	Phase_I	26	4	NM_007272	0	0	0	0	0	A8K082|O00765|Q9NUH5	Missense_Mutation	SNP	ENST00000375949.4	37	CCDS156.1	.	.	.	.	.	.	.	.	.	.	.	12.00	1.806468	0.31961	.	.	ENSG00000162438	ENST00000375949	D	0.92699	-3.09	4.94	3.78	0.43462	.	0.380815	0.30293	N	0.009943	D	0.82522	0.5055	N	0.12961	0.28	0.80722	D	1	P;B	0.34837	0.472;0.198	B;B	0.30943	0.122;0.122	T	0.78914	-0.2016	10	0.35671	T	0.21	-29.5492	10.7713	0.46325	0.0:0.0:0.1596:0.8404	.	15;15	A8MTQ9;Q99895	.;CTRC_HUMAN	P	15	ENSP00000365116:S15P	ENSP00000365116:S15P	S	+	1	0	CTRC	15639385	1.000000	0.71417	1.000000	0.80357	0.574000	0.36063	1.777000	0.38604	0.881000	0.35993	0.533000	0.62120	TCC	.		0.662	CTRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006435.1	NM_007272	
YBX1	4904	hgsc.bcm.edu	37	1	43166460	43166460	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr1:43166460C>T	ENST00000321358.7	+	7	888	c.749C>T	c.(748-750)cCt>cTt	p.P250L		NM_004559.3	NP_004550.2	P67809	YBOX1_HUMAN	Y box binding protein 1	250					CRD-mediated mRNA stabilization (GO:0070934)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of striated muscle cell differentiation (GO:0051154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell division (GO:0051781)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|histone pre-mRNA 3'end processing complex (GO:0071204)|intracellular membrane-bounded organelle (GO:0043231)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|U12-type spliceosomal complex (GO:0005689)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)			large_intestine(2)|lung(4)|ovary(4)|prostate(4)|upper_aerodigestive_tract(2)	16	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				AGGGGCCCTCCTCGCCAAAGA	0.498																																					p.P250L		.											.	YBX1-95	0			c.C749T						.						28.0	25.0	26.0					1																	43166460		2203	4300	6503	SO:0001583	missense	4904	exon7			GCCCTCCTCGCCA	BC013838	CCDS470.1	1p34	2008-02-05	2005-08-11	2005-08-11	ENSG00000065978	ENSG00000065978			8014	protein-coding gene	gene with protein product		154030	"""nuclease sensitive element binding protein 1"""	NSEP1		1891370, 3174636	Standard	NM_004559		Approved	YB-1, YB1, DBPB, NSEP-1, MDR-NF1, BP-8, CSDB, CSDA2	uc001chs.3	P67809	OTTHUMG00000007523	ENST00000321358.7:c.749C>T	1.37:g.43166460C>T	ENSP00000361626:p.Pro250Leu	Somatic	18	0		WXS	Illumina HiSeq	Phase_I	24	4	NM_004559	0	0	0	0	0	P16990|P16991|Q14972|Q15325|Q5FVF0	Missense_Mutation	SNP	ENST00000321358.7	37	CCDS470.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.49|17.49	3.403460|3.403460	0.62288|0.62288	.|.	.|.	ENSG00000065978|ENSG00000065978	ENST00000318612;ENST00000436427|ENST00000321358	.|T	.|0.36340	.|1.26	5.35|5.35	5.35|5.35	0.76521|0.76521	.|.	.|0.148105	.|0.64402	.|D	.|0.000006	T|T	0.41050|0.41050	0.1142|0.1142	M|M	0.65975|0.65975	2.015|2.015	0.80722|0.80722	D|D	1|1	.|B	.|0.29862	.|0.259	.|B	.|0.30179	.|0.112	T|T	0.36817|0.36817	-0.9732|-0.9732	6|10	0.30078|0.56958	T|D	0.28|0.05	-2.6639|-2.6639	16.6288|16.6288	0.85011|0.85011	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|250	.|P67809	.|YBOX1_HUMAN	F|L	241;300|250	.|ENSP00000361626:P250L	ENSP00000361621:L241F|ENSP00000361626:P250L	L|P	+|+	1|2	0|0	YBX1|YBX1	42939047|42939047	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	7.152000|7.152000	0.77419|0.77419	2.501000|2.501000	0.84356|0.84356	0.552000|0.552000	0.68991|0.68991	CTC|CCT	.		0.498	YBX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019786.2	NM_004559	
BCAN	63827	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	156628454	156628454	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr1:156628454C>A	ENST00000329117.5	+	13	2893	c.2557C>A	c.(2557-2559)Ctg>Atg	p.L853M	RP11-284F21.7_ENST00000448869.1_RNA	NM_021948.4	NP_068767.3	Q96GW7	PGCB_HUMAN	brevican	853	Sushi. {ECO:0000255|PROSITE- ProRule:PRU00302}.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|hippocampus development (GO:0021766)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	55	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CCAGCGCAATCTGCCGCTGAT	0.647																																					p.L853M		.											.	BCAN-516	0			c.C2557A						.						76.0	82.0	80.0					1																	156628454		2203	4300	6503	SO:0001583	missense	63827	exon13			CGCAATCTGCCGC	BC027971	CCDS1149.1, CCDS1150.1	1q31	2013-05-07			ENSG00000132692	ENSG00000132692		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	23059	protein-coding gene	gene with protein product	"""chondroitin sulfate proteoglycan 7"", ""brevican proteoglycan"""	600347				11054543, 11873941	Standard	NM_021948		Approved	BEHAB, MGC13038, CSPG7	uc001fpp.3	Q96GW7	OTTHUMG00000033322	ENST00000329117.5:c.2557C>A	1.37:g.156628454C>A	ENSP00000331210:p.Leu853Met	Somatic	138	0		WXS	Illumina HiSeq	Phase_I	203	83	NM_021948	0	0	0	0	0	D3DVC2|Q5SZ10|Q5T3I5|Q8TBB9|Q9HBK1|Q9HBK4	Missense_Mutation	SNP	ENST00000329117.5	37	CCDS1149.1	.	.	.	.	.	.	.	.	.	.	C	14.28	2.488032	0.44249	.	.	ENSG00000132692	ENST00000329117	T	0.63744	-0.06	4.96	2.91	0.33838	Complement control module (2);Sushi/SCR/CCP (3);	0.749157	0.11026	N	0.607755	T	0.48352	0.1495	L	0.45051	1.395	0.30868	N	0.73272	D	0.56287	0.975	P	0.55011	0.766	T	0.36456	-0.9747	10	0.44086	T	0.13	-3.4908	5.7222	0.17992	0.0:0.6921:0.0:0.3079	.	853	Q96GW7	PGCB_HUMAN	M	853	ENSP00000331210:L853M	ENSP00000331210:L853M	L	+	1	2	BCAN	154895078	0.002000	0.14202	0.999000	0.59377	0.591000	0.36615	0.020000	0.13466	1.299000	0.44798	0.555000	0.69702	CTG	.		0.647	BCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081844.2	NM_021948	
HMCN1	83872	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	186072770	186072770	+	Silent	SNP	A	A	G			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr1:186072770A>G	ENST00000271588.4	+	69	10969	c.10740A>G	c.(10738-10740)ggA>ggG	p.G3580G	HMCN1_ENST00000367492.2_Silent_p.G3580G	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	3580	Ig-like C2-type 34.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CTCTAGGAGGAGGAGAGGTTC	0.433																																					p.G3580G		.											.	HMCN1-113	0			c.A10740G						.						58.0	60.0	59.0					1																	186072770		2203	4299	6502	SO:0001819	synonymous_variant	83872	exon69			AGGAGGAGGAGAG	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.10740A>G	1.37:g.186072770A>G		Somatic	61	0		WXS	Illumina HiSeq	Phase_I	74	18	NM_031935	0	0	0	0	0	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Silent	SNP	ENST00000271588.4	37	CCDS30956.1																																																																																			.		0.433	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
TRIM17	51127	ucsc.edu;bcgsc.ca	37	1	228596833	228596833	+	Intron	SNP	G	G	T			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr1:228596833G>T	ENST00000366697.2	-	5	1840				TRIM11_ENST00000366699.3_5'Flank|TRIM11_ENST00000284551.6_5'Flank|TRIM17_ENST00000366698.2_Intron|TRIM17_ENST00000456946.2_Missense_Mutation_p.S308Y|RP11-245P10.4_ENST00000436779.1_RNA|TRIM17_ENST00000295033.3_Intron			Q9Y577	TRI17_HUMAN	tripartite motif containing 17						protein autoubiquitination (GO:0051865)	intracellular (GO:0005622)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)	10		Prostate(94;0.0724)				ATCGCCAAGAGATCCTGGGTC	0.587																																					p.S308Y													.	TRIM17-659	0			c.C923A						.						80.0	84.0	83.0					1																	228596833		2203	4300	6503	SO:0001627	intron_variant	51127	exon6			CCAAGAGATCCTG	AF156271	CCDS1571.1, CCDS44327.1	1q42	2013-01-09	2011-01-25	2001-11-30	ENSG00000162931	ENSG00000162931		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	13430	protein-coding gene	gene with protein product	"""ring finger protein 16"", ""RING finger protein terf"", ""testis RING finger protein"""	606123	"""tripartite motif-containing 17"""	RNF16		9792805, 10894938	Standard	NM_016102		Approved	terf, RBCC	uc001hsv.3	Q9Y577	OTTHUMG00000039974	ENST00000366697.2:c.883+39C>A	1.37:g.228596833G>T		Somatic	94	1		WXS	Illumina HiSeq		133	47	NM_001134855	0	0	0	1	1	B4DVJ2|Q5VST8	Missense_Mutation	SNP	ENST00000366697.2	37	CCDS1571.1	.	.	.	.	.	.	.	.	.	.	G	8.908	0.958055	0.18507	.	.	ENSG00000162931	ENST00000456946	T	0.34859	1.34	2.77	0.748	0.18376	.	.	.	.	.	T	0.18383	0.0441	N	0.14661	0.345	0.09310	N	1	P	0.35328	0.495	B	0.31191	0.125	T	0.13098	-1.0522	9	0.59425	D	0.04	.	6.2084	0.20615	0.1192:0.1894:0.6914:0.0	.	308	Q9Y577-2	.	Y	308	ENSP00000403312:S308Y	ENSP00000403312:S308Y	S	-	2	0	TRIM17	226663456	0.000000	0.05858	0.001000	0.08648	0.030000	0.12068	0.072000	0.14617	0.191000	0.20236	0.655000	0.94253	TCT	.		0.587	TRIM17-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096439.2	NM_016102	
EXOC8	149371	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	231472695	231472695	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr1:231472695T>A	ENST00000360394.2	-	1	883	c.797A>T	c.(796-798)aAt>aTt	p.N266I	SPRTN_ENST00000391858.4_5'Flank|SPRTN_ENST00000295050.7_5'Flank|EXOC8_ENST00000366645.1_Missense_Mutation_p.N262I|SPRTN_ENST00000008440.9_5'Flank	NM_175876.3	NP_787072.2	Q8IYI6	EXOC8_HUMAN	exocyst complex component 8	266	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cellular protein localization (GO:0034613)|cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|exocyst (GO:0000145)|membrane (GO:0016020)|plasma membrane (GO:0005886)				cervix(2)|endometrium(1)|large_intestine(2)|liver(1)|lung(5)|prostate(1)|skin(1)|stomach(1)	14	Breast(184;0.0871)	all_cancers(173;0.151)|Prostate(94;0.183)				GATTTTAGCATTTTCGGCCTG	0.547																																					p.N266I		.											.	EXOC8-91	0			c.A797T						.						69.0	70.0	69.0					1																	231472695		2203	4300	6503	SO:0001583	missense	149371	exon1			TTAGCATTTTCGG	AL117352	CCDS1593.1	1q42.2	2013-01-22			ENSG00000116903	ENSG00000116903			24659	protein-coding gene	gene with protein product		615283				12477932	Standard	NM_175876		Approved	SEC84, EXO84, Exo84p	uc001huq.3	Q8IYI6	OTTHUMG00000038025	ENST00000360394.2:c.797A>T	1.37:g.231472695T>A	ENSP00000353564:p.Asn266Ile	Somatic	123	0		WXS	Illumina HiSeq	Phase_I	172	67	NM_175876	0	0	6	12	6	B3KU33|Q5TE82	Missense_Mutation	SNP	ENST00000360394.2	37	CCDS1593.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.175994	0.78564	.	.	ENSG00000116903	ENST00000360394;ENST00000366645	T;T	0.79653	-1.29;-1.29	5.69	5.69	0.88448	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.85682	D	0.000000	D	0.88130	0.6354	M	0.64997	1.995	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	D	0.88677	0.3199	10	0.56958	D	0.05	-22.853	15.9478	0.79806	0.0:0.0:0.0:1.0	.	266	Q8IYI6	EXOC8_HUMAN	I	266;262	ENSP00000353564:N266I;ENSP00000355605:N262I	ENSP00000353564:N266I	N	-	2	0	EXOC8	229539318	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.040000	0.89188	2.165000	0.68154	0.459000	0.35465	AAT	.		0.547	EXOC8-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_175876	
PCDH15	65217	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	55626411	55626411	+	Silent	SNP	G	G	A	rs374185988		TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr10:55626411G>A	ENST00000320301.6	-	27	4102	c.3708C>T	c.(3706-3708)gcC>gcT	p.A1236A	PCDH15_ENST00000361849.3_Silent_p.A1236A|PCDH15_ENST00000373965.2_Silent_p.A1243A|PCDH15_ENST00000395438.1_Silent_p.A1236A|PCDH15_ENST00000463095.1_5'UTR|PCDH15_ENST00000437009.1_Silent_p.A1165A|PCDH15_ENST00000373957.3_Intron|PCDH15_ENST00000409834.1_Silent_p.A847A|PCDH15_ENST00000395445.1_Silent_p.A1243A|PCDH15_ENST00000395432.2_Silent_p.A1199A|PCDH15_ENST00000414778.1_Silent_p.A1241A|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000395430.1_Silent_p.A1236A|PCDH15_ENST00000395433.1_Silent_p.A1214A|PCDH15_ENST00000395442.1_Intron	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	1236	Cadherin 11. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				CGAGTACATCGGCTTTGCCGC	0.383										HNSCC(58;0.16)																											p.A1241A		.											.	PCDH15-193	0			c.C3723T						.	G	,,,,,,,,,,,	0,4406		0,0,2203	94.0	81.0	86.0		3723,3708,3495,3708,3597,3642,3744,3708,3723,3708,3642,3708	-2.8	1.0	10		86	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PCDH15	NM_001142763.1,NM_001142764.1,NM_001142765.1,NM_001142766.1,NM_001142767.1,NM_001142768.1,NM_001142769.1,NM_001142770.1,NM_001142771.1,NM_001142772.1,NM_001142773.1,NM_033056.3	,,,,,,,,,,,	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	,,,,,,,,,,,	1241/1963,1236/1958,1165/1887,1236/1953,1199/1916,1214/1936,1248/1791,1236/1540,1241/1683,1236/1678,1214/1933,1236/1956	55626411	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	65217	exon28			TACATCGGCTTTG	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.3708C>T	10.37:g.55626411G>A		Somatic	71	0		WXS	Illumina HiSeq	Phase_I	118	31	NM_001142763	0	0	0	0	0	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Silent	SNP	ENST00000320301.6	37	CCDS7248.1																																																																																			.		0.383	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056	
CFAP70	118491	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	75037057	75037057	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr10:75037057G>A	ENST00000310715.3	-	22	2791	c.2671C>T	c.(2671-2673)Caa>Taa	p.Q891*	TTC18_ENST00000394865.1_Nonsense_Mutation_p.Q891*|TTC18_ENST00000401621.2_Nonsense_Mutation_p.Q891*|TTC18_ENST00000493787.1_Intron|TTC18_ENST00000355577.3_Nonsense_Mutation_p.Q360*|RNU6-833P_ENST00000363486.1_RNA|TTC18_ENST00000340329.3_Intron|DNAJC9-AS1_ENST00000440197.2_RNA	NM_145170.3	NP_660153.3	Q5T0N1	TTC18_HUMAN		891						extracellular vesicular exosome (GO:0070062)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(2)|prostate(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	Prostate(51;0.0119)					GTGGTAGTTTGAGAAACACCA	0.378																																					p.Q891X		.											.	TTC18-92	0			c.C2671T						.						127.0	123.0	124.0					10																	75037057		2203	4300	6503	SO:0001587	stop_gained	118491	exon22			TAGTTTGAGAAAC																												ENST00000310715.3:c.2671C>T	10.37:g.75037057G>A	ENSP00000310829:p.Gln891*	Somatic	161	0		WXS	Illumina HiSeq	Phase_I	195	64	NM_145170	0	0	5	5	0	C9JIZ9|Q5T0M4|Q5T0M9|Q5T0N0|Q69YH9|Q8IYZ8|Q8N7D5|Q8NI30|Q8NI31	Nonsense_Mutation	SNP	ENST00000310715.3	37	CCDS7324.3	.	.	.	.	.	.	.	.	.	.	G	39	7.846379	0.98522	.	.	ENSG00000156042	ENST00000310715;ENST00000401621;ENST00000355577;ENST00000433268;ENST00000394865	.	.	.	5.62	4.66	0.58398	.	0.570630	0.17764	N	0.162782	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15499	T	0.54	1.6662	11.0106	0.47661	0.0:0.0:0.8145:0.1855	.	.	.	.	X	891;891;891;298;891	.	ENSP00000310829:Q891X	Q	-	1	0	TTC18	74707063	0.996000	0.38824	0.998000	0.56505	0.827000	0.46813	3.669000	0.54561	2.642000	0.89623	0.655000	0.94253	CAA	.		0.378	TTC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
CFAP70	118491	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	75104981	75104981	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr10:75104981C>T	ENST00000310715.3	-	6	571	c.451G>A	c.(451-453)Gta>Ata	p.V151I	TTC18_ENST00000394865.1_Missense_Mutation_p.V151I|TTC18_ENST00000401621.2_Missense_Mutation_p.V151I|TTC18_ENST00000493787.1_5'UTR|TTC18_ENST00000355577.3_5'UTR|Y_RNA_ENST00000384742.1_RNA|TTC18_ENST00000340329.3_Missense_Mutation_p.V151I	NM_145170.3	NP_660153.3	Q5T0N1	TTC18_HUMAN		151						extracellular vesicular exosome (GO:0070062)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(2)|prostate(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	Prostate(51;0.0119)					GCCACTAATACTTTAACTTCA	0.413																																					p.V151I		.											.	TTC18-92	0			c.G451A						.						91.0	89.0	90.0					10																	75104981		2203	4300	6503	SO:0001583	missense	118491	exon6			CTAATACTTTAAC																												ENST00000310715.3:c.451G>A	10.37:g.75104981C>T	ENSP00000310829:p.Val151Ile	Somatic	132	1		WXS	Illumina HiSeq	Phase_I	132	45	NM_145170	0	0	0	0	0	C9JIZ9|Q5T0M4|Q5T0M9|Q5T0N0|Q69YH9|Q8IYZ8|Q8N7D5|Q8NI30|Q8NI31	Missense_Mutation	SNP	ENST00000310715.3	37	CCDS7324.3	.	.	.	.	.	.	.	.	.	.	C	13.80	2.344903	0.41498	.	.	ENSG00000156042	ENST00000310715;ENST00000401621;ENST00000355577;ENST00000340329;ENST00000372928;ENST00000394865	T;T;T;T	0.28255	1.62;1.62;1.62;1.62	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.29288	0.0729	L	0.52011	1.625	0.51767	D	0.999936	P	0.41910	0.764	B	0.35971	0.215	T	0.03287	-1.1052	10	0.31617	T	0.26	-11.3704	17.4191	0.87510	0.0:1.0:0.0:0.0	.	151	Q5T0N1	TTC18_HUMAN	I	151	ENSP00000310829:V151I;ENSP00000384479:V151I;ENSP00000343650:V151I;ENSP00000378334:V151I	ENSP00000310829:V151I	V	-	1	0	TTC18	74774987	1.000000	0.71417	0.994000	0.49952	0.152000	0.21847	4.158000	0.58150	2.692000	0.91855	0.650000	0.86243	GTA	.		0.413	TTC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
NUTM2D	728130	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	89118099	89118099	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr10:89118099C>A	ENST00000381697.2	+	1	675	c.77C>A	c.(76-78)tCt>tAt	p.S26Y	NUTM2D_ENST00000412718.1_Missense_Mutation_p.S26Y|LINC00863_ENST00000439559.2_lincRNA			Q5VT03	NTM2D_HUMAN	NUT family member 2D	26																	CCAGGTCACTCTCTGGGTCTT	0.507																																					.													.	FAM22D-22	0			.						.						189.0	225.0	214.0					10																	89118099		1943	4159	6102	SO:0001583	missense	728130	.			GTCACTCTCTGGG			10q23.31	2013-03-14	2013-03-14	2013-03-14	ENSG00000214562	ENSG00000214562			23447	protein-coding gene	gene with protein product			"""family with sequence similarity 22, member D"""	FAM22D			Standard	NR_075100		Approved		uc001kes.3	Q5VT03	OTTHUMG00000018672	ENST00000381697.2:c.77C>A	10.37:g.89118099C>A	ENSP00000371116:p.Ser26Tyr	Somatic	284	0		WXS	Illumina HiSeq	Phase_I	312	52	.	0	0	7	10	3	A6NGV9	RNA	SNP	ENST00000381697.2	37		.	.	.	.	.	.	.	.	.	.	C	6.550	0.469839	0.12461	.	.	ENSG00000214562	ENST00000330762;ENST00000381697;ENST00000412718	T;T	0.27720	2.47;1.65	0.86	0.86	0.19042	.	.	.	.	.	T	0.19005	0.0456	.	.	.	0.09310	N	1	B;B	0.30664	0.289;0.191	B;B	0.23275	0.045;0.02	T	0.20273	-1.0280	8	0.72032	D	0.01	.	5.11	0.14804	0.0:1.0:0.0:0.0	.	26;26	Q5VT03-2;Q5VT03	.;FA22D_HUMAN	Y	97;26;26	ENSP00000371116:S26Y;ENSP00000396080:S26Y	ENSP00000328439:S97Y	S	+	2	0	FAM22D	89108079	0.086000	0.21541	0.013000	0.15412	0.054000	0.15201	0.919000	0.28692	0.769000	0.33313	0.175000	0.17021	TCT	.		0.507	NUTM2D-004	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000470142.1	NR_075100	
CFAP43	80217	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	105944865	105944865	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr10:105944865G>T	ENST00000278064.2	-	16	2168	c.1843C>A	c.(1843-1845)Cat>Aat	p.H615N	WDR96_ENST00000357060.3_Missense_Mutation_p.H684N|WDR96_ENST00000428666.1_Missense_Mutation_p.H685N														p.H684Y(1)		NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(14)|lung(21)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						TGAATCCCATGACCCTGGTGA	0.403																																					p.H684N		.											.	WDR96-95	1	Substitution - Missense(1)	lung(1)	c.C2050A						.						174.0	152.0	160.0					10																	105944865		2203	4300	6503	SO:0001583	missense	80217	exon16			TCCCATGACCCTG																												ENST00000278064.2:c.1843C>A	10.37:g.105944865G>T	ENSP00000278064:p.His615Asn	Somatic	127	1		WXS	Illumina HiSeq	Phase_I	150	52	NM_025145	0	0	0	0	0		Missense_Mutation	SNP	ENST00000278064.2	37		.	.	.	.	.	.	.	.	.	.	G	0.191	-1.053696	0.01965	.	.	ENSG00000197748	ENST00000357060;ENST00000428666;ENST00000278064	T;T;T	0.12879	2.65;2.64;2.66	5.24	3.28	0.37604	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	1.001350	0.08054	N	0.997084	T	0.16300	0.0392	L	0.57536	1.79	0.09310	N	1	B;B	0.12013	0.005;0.001	B;B	0.09377	0.004;0.003	T	0.06881	-1.0802	10	0.51188	T	0.08	.	9.3605	0.38192	0.0:0.2545:0.6054:0.1402	.	685;684	B4DHB6;Q8NDM7	.;WDR96_HUMAN	N	684;685;615	ENSP00000349568:H684N;ENSP00000400289:H685N;ENSP00000278064:H615N	ENSP00000278064:H615N	H	-	1	0	WDR96	105934855	0.000000	0.05858	0.014000	0.15608	0.983000	0.72400	0.646000	0.24797	2.439000	0.82584	0.655000	0.94253	CAT	.		0.403	WDR96-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000050200.1		
MUC2	4583	hgsc.bcm.edu;ucsc.edu	37	11	1087972	1087972	+	Missense_Mutation	SNP	C	C	G	rs10902088	byFrequency	TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr11:1087972C>G	ENST00000441003.2	+	25	3474	c.3447C>G	c.(3445-3447)aaC>aaG	p.N1149K	MUC2_ENST00000359061.5_Missense_Mutation_p.N1149K	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	1149					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	GGACCATCAACGGCATCCACT	0.622																																					p.N1149K		.											.	MUC2-90	0			c.C3447G						.						56.0	61.0	60.0					11																	1087972		2138	4242	6380	SO:0001583	missense	4583	exon25			CATCAACGGCATC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.3447C>G	11.37:g.1087972C>G	ENSP00000415183:p.Asn1149Lys	Somatic	18	1		WXS	Illumina HiSeq	Phase_I	17	9	NM_002457	0	0	0	0	0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	c	5.692	0.312306	0.10789	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.54675	0.56;0.56	3.98	-2.94	0.05581	.	1.123720	0.07056	N	0.832867	T	0.52306	0.1726	L	0.56769	1.78	0.80722	P	0.0	P	0.35628	0.513	P	0.44477	0.451	T	0.56080	-0.8038	9	0.12430	T	0.62	.	11.5782	0.50877	0.0:0.3997:0.0:0.6003	.	1149	E7EUV1	.	K	1149	ENSP00000415183:N1149K;ENSP00000351956:N1149K	ENSP00000351956:N1149K	N	+	3	2	MUC2	1077972	0.000000	0.05858	0.042000	0.18584	0.284000	0.27059	-1.939000	0.01545	-0.522000	0.06417	-1.075000	0.02238	AAC	C|0.712;T|0.288		0.622	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
LSP1	4046	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	1907965	1907965	+	Missense_Mutation	SNP	G	G	T	rs370626038		TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr11:1907965G>T	ENST00000311604.3	+	8	896	c.721G>T	c.(721-723)Gct>Tct	p.A241S	LSP1_ENST00000485341.1_3'UTR|LSP1_ENST00000406638.2_Missense_Mutation_p.A179S|LSP1_ENST00000405957.2_Missense_Mutation_p.A179S|LSP1_ENST00000381775.1_Missense_Mutation_p.A369S	NM_002339.2	NP_002330.1	P33241	LSP1_HUMAN	lymphocyte-specific protein 1	241					cellular component movement (GO:0006928)|cellular defense response (GO:0006968)|chemotaxis (GO:0006935)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|signal transducer activity (GO:0004871)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(9)|prostate(1)|skin(1)	16		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|Lung(200;0.0729)|LUSC - Lung squamous cell carcinoma(625;0.0856)		TCTGCAGACCGCTGGCCGGAC	0.602																																					p.A369S		.											.	LSP1-90	0			c.G1105T						.						76.0	81.0	79.0					11																	1907965		2202	4299	6501	SO:0001583	missense	4046	exon9			CAGACCGCTGGCC	M33552	CCDS31334.1, CCDS31335.1, CCDS58110.1	11p15.5	2008-02-05			ENSG00000130592	ENSG00000130592			6707	protein-coding gene	gene with protein product		153432				2174784	Standard	NM_001242932		Approved	WP34	uc001luj.3	P33241	OTTHUMG00000012252	ENST00000311604.3:c.721G>T	11.37:g.1907965G>T	ENSP00000308383:p.Ala241Ser	Somatic	147	0		WXS	Illumina HiSeq	Phase_I	106	44	NM_001242932	0	0	0	0	0	B3KPP1|B3KRR6|E9PBV6|E9PFP3|Q16096|Q53H48|Q6FHM3|Q9BUY8	Missense_Mutation	SNP	ENST00000311604.3	37	CCDS31334.1	.	.	.	.	.	.	.	.	.	.	.	0.003	-2.516709	0.00151	.	.	ENSG00000130592	ENST00000311604;ENST00000381775;ENST00000405957;ENST00000457279;ENST00000406638;ENST00000417766;ENST00000432093	T;T;T;T;T;T;T	0.37584	1.19;1.19;1.19;1.19;1.19;1.19;1.19	3.3	1.31	0.21738	.	0.438819	0.16421	N	0.215179	T	0.19565	0.0470	N	0.16307	0.4	0.09310	N	0.99999	B;B	0.33299	0.407;0.039	B;B	0.37387	0.248;0.056	T	0.25813	-1.0121	10	0.02654	T	1	-10.7455	10.0636	0.42290	0.0:0.0:0.3863:0.6137	.	369;241	E9PFP3;P33241	.;LSP1_HUMAN	S	241;369;179;232;179;179;179	ENSP00000308383:A241S;ENSP00000371194:A369S;ENSP00000383932:A179S;ENSP00000400346:A232S;ENSP00000384022:A179S;ENSP00000416363:A179S;ENSP00000412405:A179S	ENSP00000308383:A241S	A	+	1	0	LSP1	1864541	0.342000	0.24809	0.255000	0.24374	0.071000	0.16799	1.196000	0.32198	0.203000	0.20529	-0.493000	0.04662	GCT	.		0.602	LSP1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000034045.3	NM_002339	
TNKS1BP1	85456	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	57080232	57080232	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr11:57080232G>T	ENST00000532437.1	-	4	2241	c.1930C>A	c.(1930-1932)Ctg>Atg	p.L644M	TNKS1BP1_ENST00000358252.3_Missense_Mutation_p.L644M|TNKS1BP1_ENST00000530920.1_5'Flank			Q9C0C2	TB182_HUMAN	tankyrase 1 binding protein 1, 182kDa	644	Acidic.|Pro-rich.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|RNA metabolic process (GO:0016070)|telomere maintenance via telomerase (GO:0007004)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear telomeric heterochromatin (GO:0005724)|nucleus (GO:0005634)	ankyrin binding (GO:0030506)|enzyme binding (GO:0019899)			breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	64		all_epithelial(135;0.21)				TCAACAGGCAGTGCCTGTCCA	0.652																																					p.L644M		.											.	TNKS1BP1-91	0			c.C1930A						.						40.0	43.0	42.0					11																	57080232		2201	4296	6497	SO:0001583	missense	85456	exon5			CAGGCAGTGCCTG	AB051528	CCDS7951.1	11q12.2	2008-07-21			ENSG00000149115	ENSG00000149115			19081	protein-coding gene	gene with protein product		607104				11854288	Standard	NM_033396		Approved	TAB182, KIAA1741, FLJ45975	uc001njs.3	Q9C0C2	OTTHUMG00000167022	ENST00000532437.1:c.1930C>A	11.37:g.57080232G>T	ENSP00000437271:p.Leu644Met	Somatic	72	0		WXS	Illumina HiSeq	Phase_I	62	17	NM_033396	0	0	22	30	8	A7E2F8|Q6PJ35|Q6ZV74	Missense_Mutation	SNP	ENST00000532437.1	37	CCDS7951.1	.	.	.	.	.	.	.	.	.	.	G	3.119	-0.180918	0.06380	.	.	ENSG00000149115	ENST00000358252;ENST00000532437	T;T	0.33865	1.39;1.39	3.52	-7.04	0.01578	.	0.599176	0.12691	N	0.447197	T	0.14743	0.0356	L	0.27053	0.805	0.09310	N	1	B	0.32101	0.356	B	0.28305	0.088	T	0.11991	-1.0565	10	0.32370	T	0.25	-3.6489	2.1814	0.03876	0.1527:0.1225:0.4815:0.2434	.	644	Q9C0C2	TB182_HUMAN	M	644	ENSP00000350990:L644M;ENSP00000437271:L644M	ENSP00000350990:L644M	L	-	1	2	TNKS1BP1	56836808	0.000000	0.05858	0.005000	0.12908	0.035000	0.12851	-1.072000	0.03434	-0.816000	0.04340	0.455000	0.32223	CTG	.		0.652	TNKS1BP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392455.1	NM_033396	
FAM86C1	55199	hgsc.bcm.edu	37	11	71502832	71502832	+	Intron	SNP	T	T	A	rs551563338	byFrequency	TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr11:71502832T>A	ENST00000359244.4	+	3	182				FAM86C1_ENST00000426628.2_Nonsense_Mutation_p.Y69*|FAM86C1_ENST00000346333.6_Intron	NM_018172.2	NP_060642.2	Q9NVL1	FA86C_HUMAN	family with sequence similarity 86, member C1											lung(1)	1						CAGTCAAGTATGCCCGGTGCT	0.542													.|||	5	0.000998403	0.003	0.0	5008	,	,		20899	0.0		0.0	False		,,,				2504	0.001				p.Y69X		.											.	FAM86C1-90	0			c.T207A						.						82.0	80.0	81.0					11																	71502832		2200	4290	6490	SO:0001627	intron_variant	55199	exon3			CAAGTATGCCCGG	AK130709	CCDS8202.1, CCDS41686.1, CCDS44664.1	11q13.4	2011-07-07	2011-07-07	2011-07-07	ENSG00000158483	ENSG00000158483			25561	protein-coding gene	gene with protein product			"""family with sequence similarity 86, member C"""	FAM86C		12477932	Standard	NM_152563		Approved	FLJ10661, FLJ27199	uc001oqv.4	Q9NVL1	OTTHUMG00000160552	ENST00000359244.4:c.160-1594T>A	11.37:g.71502832T>A		Somatic	58	1		WXS	Illumina HiSeq	Phase_I	61	4	NM_001099653	0	0	16	16	0	Q8N5D3	Nonsense_Mutation	SNP	ENST00000359244.4	37	CCDS41686.1	.	.	.	.	.	.	.	.	.	.	.	16.40	3.112858	0.56398	.	.	ENSG00000158483	ENST00000426628	.	.	.	2.05	0.827	0.18835	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	3.9584	0.09399	0.0:0.2031:0.0:0.7969	.	.	.	.	X	69	.	ENSP00000391329:Y69X	Y	+	3	2	FAM86C1	71180480	0.111000	0.22076	0.018000	0.16275	0.584000	0.36387	-0.008000	0.12788	0.061000	0.16311	0.155000	0.16302	TAT	.		0.542	FAM86C1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000361120.1	NM_152563	
CACNA1C	775	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	2760913	2760913	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr12:2760913G>T	ENST00000347598.4	+	34	4197	c.4197G>T	c.(4195-4197)tgG>tgT	p.W1399C	CACNA1C_ENST00000399601.1_Missense_Mutation_p.W1351C|CACNA1C_ENST00000399638.1_Missense_Mutation_p.W1379C|CACNA1C_ENST00000399641.1_Missense_Mutation_p.W1351C|CACNA1C_ENST00000399603.1_Missense_Mutation_p.W1351C|CACNA1C_ENST00000335762.5_Missense_Mutation_p.W1376C|CACNA1C_ENST00000399644.1_Missense_Mutation_p.W1351C|CACNA1C_ENST00000402845.3_Missense_Mutation_p.W1351C|CACNA1C_ENST00000399649.1_Missense_Mutation_p.W1338C|CACNA1C_ENST00000399591.1_Missense_Mutation_p.W1340C|CACNA1C_ENST00000399597.1_Missense_Mutation_p.W1351C|CACNA1C_ENST00000344100.3_Missense_Mutation_p.W1373C|CACNA1C_ENST00000399655.1_Missense_Mutation_p.W1351C|CACNA1C_ENST00000399637.1_Missense_Mutation_p.W1351C|CACNA1C_ENST00000399617.1_Missense_Mutation_p.W1351C|CACNA1C_ENST00000399595.1_Missense_Mutation_p.W1340C|CACNA1C_ENST00000327702.7_Missense_Mutation_p.W1351C|CACNA1C_ENST00000399634.1_Missense_Mutation_p.W1351C|CACNA1C_ENST00000406454.3_Missense_Mutation_p.W1351C|CACNA1C_ENST00000399629.1_Missense_Mutation_p.W1368C|CACNA1C_ENST00000399621.1_Missense_Mutation_p.W1351C|CACNA1C_ENST00000399606.1_Missense_Mutation_p.W1371C	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	1399					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CGCTGCTGTGGACCTTCATCA	0.632																																					p.W1399C		.											.	CACNA1C-34	0			c.G4197T						.						44.0	53.0	50.0					12																	2760913		2195	4295	6490	SO:0001583	missense	775	exon34			GCTGTGGACCTTC	AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.4197G>T	12.37:g.2760913G>T	ENSP00000266376:p.Trp1399Cys	Somatic	30	0		WXS	Illumina HiSeq	Phase_I	50	14	NM_199460	0	0	1	2	1	B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	ENST00000347598.4	37	CCDS44788.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.274714	0.80580	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595;ENST00000322367	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.98512	-4.97;-4.97;-4.97;-4.97;-4.97;-4.97;-4.97;-4.97;-4.97;-4.97;-4.97;-4.97;-4.97;-4.97;-4.97;-4.97;-4.97;-4.97;-4.97;-4.97;-4.97;-4.97	5.17	4.27	0.50696	Ion transport (1);	0.125129	0.64402	D	0.000017	D	0.99275	0.9747	H	0.97186	3.955	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;0.999;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97110	0.998;0.998;0.995;0.999;0.998;0.995;0.995;0.996;0.999;0.999;0.995;0.995;0.999;0.999;0.999;0.998;0.995;1.0;0.999;0.997;0.995;0.999;0.999;0.995;0.995	D	0.98781	1.0732	10	0.87932	D	0	.	13.5755	0.61873	0.0758:0.0:0.9242:0.0	.	42;1373;1348;1399;1351;1351;1351;1368;1379;1351;1371;1351;1311;1399;1351;1351;1351;1340;1338;1340;1340;1351;1351;1351;1351	B7Z7Z5;Q13936-14;Q13936-35;Q13936;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-28;Q13936-11;E9PDJ1;E9PDJ0;F5GY28;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;Q13936-12	.;.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	C	1376;1351;1351;1379;1351;1351;1351;1340;1351;1399;1371;1351;1373;1368;1351;1338;1351;1351;1351;1351;1351;1340;1181	ENSP00000336982:W1376C;ENSP00000382563:W1351C;ENSP00000382552:W1351C;ENSP00000382547:W1379C;ENSP00000382506:W1351C;ENSP00000382530:W1351C;ENSP00000382546:W1351C;ENSP00000382500:W1340C;ENSP00000382549:W1351C;ENSP00000266376:W1399C;ENSP00000382515:W1371C;ENSP00000382510:W1351C;ENSP00000341092:W1373C;ENSP00000382537:W1368C;ENSP00000329877:W1351C;ENSP00000382557:W1338C;ENSP00000385724:W1351C;ENSP00000382512:W1351C;ENSP00000382542:W1351C;ENSP00000382526:W1351C;ENSP00000385896:W1351C;ENSP00000382504:W1340C	ENSP00000323129:W1181C	W	+	3	0	CACNA1C	2631174	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.805000	0.99149	1.171000	0.42768	0.491000	0.48974	TGG	.		0.632	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1	NM_000719	
GPR133	283383	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	131439188	131439188	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr12:131439188G>C	ENST00000261654.5	+	2	645	c.86G>C	c.(85-87)aGa>aCa	p.R29T	GPR133_ENST00000535015.1_Missense_Mutation_p.R29T	NM_198827.3	NP_942122.2	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133	29					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(2)|endometrium(6)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|pancreas(6)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	67	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		GTCTACTCCAGATCGCAGGAC	0.562																																					p.R29T		.											.	GPR133-191	0			c.G86C						.						114.0	98.0	103.0					12																	131439188		2203	4300	6503	SO:0001583	missense	283383	exon2			ACTCCAGATCGCA	AY278561	CCDS9272.1	12q24.33	2014-08-08			ENSG00000111452	ENSG00000111452		"""-"", ""GPCR / Class B : Orphans"""	19893	protein-coding gene	gene with protein product		613639					Standard	NM_198827		Approved	DKFZp434B1272, PGR25	uc001uit.4	Q6QNK2	OTTHUMG00000168339	ENST00000261654.5:c.86G>C	12.37:g.131439188G>C	ENSP00000261654:p.Arg29Thr	Somatic	119	0		WXS	Illumina HiSeq	Phase_I	163	37	NM_198827	0	0	3	3	0	B2CKK9|B7ZLF7|Q2M1L3|Q6ZMQ1|Q7Z7M2|Q86SM4	Missense_Mutation	SNP	ENST00000261654.5	37	CCDS9272.1	.	.	.	.	.	.	.	.	.	.	G	11.63	1.695276	0.30052	.	.	ENSG00000111452	ENST00000261654;ENST00000543826;ENST00000542091;ENST00000535015	T;T	0.41400	1.0;1.03	4.42	1.96	0.26148	.	0.754074	0.11519	N	0.555971	T	0.33673	0.0871	L	0.56769	1.78	0.09310	N	1	B;B	0.29432	0.244;0.118	B;B	0.26770	0.073;0.023	T	0.37798	-0.9690	10	0.72032	D	0.01	.	2.9661	0.05908	0.2203:0.2806:0.4991:0.0	.	29;29	B7ZLF7;Q6QNK2	.;GP133_HUMAN	T	29	ENSP00000261654:R29T;ENSP00000444425:R29T	ENSP00000261654:R29T	R	+	2	0	GPR133	130005141	0.001000	0.12720	0.007000	0.13788	0.055000	0.15305	0.979000	0.29500	2.023000	0.59567	0.561000	0.74099	AGA	.		0.562	GPR133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399356.1	NM_198827	
JPH4	84502	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	24040204	24040204	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr14:24040204C>G	ENST00000397118.3	-	6	2638	c.1736G>C	c.(1735-1737)gGt>gCt	p.G579A	JPH4_ENST00000544177.1_Missense_Mutation_p.G244A|RP11-66N24.3_ENST00000555968.1_RNA|JPH4_ENST00000356300.4_Missense_Mutation_p.G579A|AP1G2_ENST00000308724.5_5'Flank	NM_032452.2	NP_115828.2	Q96JJ6	JPH4_HUMAN	junctophilin 4	579					calcium ion transport into cytosol (GO:0060402)|learning (GO:0007612)|neuromuscular process controlling balance (GO:0050885)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of synaptic plasticity (GO:0048167)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)				endometrium(1)|large_intestine(2)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00654)		AGCATCAGGACCCCTCGAGGA	0.687																																					p.G579A		.											.	JPH4-92	0			c.G1736C						.						31.0	33.0	32.0					14																	24040204		2203	4299	6502	SO:0001583	missense	84502	exon5			TCAGGACCCCTCG	AB058734	CCDS9603.1	14q11	2004-05-28	2004-05-28	2004-05-28	ENSG00000092051	ENSG00000092051			20156	protein-coding gene	gene with protein product			"""junctophilin like 1"""	JPHL1		11347906	Standard	NM_032452		Approved	KIAA1831	uc001wkr.2	Q96JJ6	OTTHUMG00000028769	ENST00000397118.3:c.1736G>C	14.37:g.24040204C>G	ENSP00000380307:p.Gly579Ala	Somatic	55	0		WXS	Illumina HiSeq	Phase_I	46	15	NM_001146028	0	0	0	0	0	D3DS53|Q8ND44|Q96DQ0	Missense_Mutation	SNP	ENST00000397118.3	37	CCDS9603.1	.	.	.	.	.	.	.	.	.	.	C	11.95	1.792770	0.31685	.	.	ENSG00000092051	ENST00000356300;ENST00000397118;ENST00000543864;ENST00000267407;ENST00000544177	T;T;T	0.54866	0.55;0.55;0.93	4.93	0.601	0.17529	.	0.326972	0.16970	U	0.192130	T	0.27419	0.0673	N	0.12182	0.205	0.26864	N	0.967898	B;B	0.11235	0.004;0.001	B;B	0.11329	0.006;0.002	T	0.17410	-1.0370	10	0.16420	T	0.52	.	6.9268	0.24419	0.3209:0.3658:0.3132:0.0	.	244;579	F5H1L9;Q96JJ6	.;JPH4_HUMAN	A	579;579;579;580;244	ENSP00000348648:G579A;ENSP00000380307:G579A;ENSP00000439562:G244A	ENSP00000267407:G580A	G	-	2	0	JPH4	23110044	0.797000	0.28877	0.998000	0.56505	0.975000	0.68041	0.344000	0.19962	0.546000	0.28920	-0.152000	0.13540	GGT	.		0.687	JPH4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413853.1	NM_032452	
FBXO33	254170	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	39868808	39868808	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr14:39868808G>A	ENST00000298097.7	-	4	1917	c.1580C>T	c.(1579-1581)gCa>gTa	p.A527V	FBXO33_ENST00000554190.1_3'UTR	NM_203301.3	NP_976046.1	Q7Z6M2	FBX33_HUMAN	F-box protein 33	527					protein ubiquitination (GO:0016567)					endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(4)|urinary_tract(1)	9	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00121)|Epithelial(34;0.169)	GBM - Glioblastoma multiforme(112;0.0425)		GTCCATGACTGCATGCCAAGG	0.438																																					p.A527V		.											.	FBXO33-658	0			c.C1580T						.						127.0	98.0	108.0					14																	39868808		2203	4300	6503	SO:0001583	missense	254170	exon4			ATGACTGCATGCC	BI460761	CCDS9677.1	14q13.3	2004-08-24	2004-06-15		ENSG00000165355	ENSG00000165355		"""F-boxes /  ""other"""""	19833	protein-coding gene	gene with protein product		609103	"""F-box only protein 33"""				Standard	NM_203301		Approved	Fbx33	uc001wvk.3	Q7Z6M2	OTTHUMG00000140257	ENST00000298097.7:c.1580C>T	14.37:g.39868808G>A	ENSP00000298097:p.Ala527Val	Somatic	60	0		WXS	Illumina HiSeq	Phase_I	52	18	NM_203301	0	0	5	8	3	Q6PIR2|Q86TR2|Q86YE0	Missense_Mutation	SNP	ENST00000298097.7	37	CCDS9677.1	.	.	.	.	.	.	.	.	.	.	G	17.27	3.347997	0.61183	.	.	ENSG00000165355	ENST00000298097	T	0.34072	1.38	5.85	5.85	0.93711	.	0.051431	0.85682	D	0.000000	T	0.38108	0.1028	N	0.14661	0.345	0.80722	D	1	D	0.60575	0.988	P	0.54759	0.76	T	0.09885	-1.0654	9	.	.	.	-19.5419	20.1542	0.98100	0.0:0.0:1.0:0.0	.	527	Q7Z6M2	FBX33_HUMAN	V	527	ENSP00000298097:A527V	.	A	-	2	0	FBXO33	38938559	1.000000	0.71417	0.508000	0.27688	0.970000	0.65996	9.124000	0.94394	2.767000	0.95098	0.563000	0.77884	GCA	.		0.438	FBXO33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276769.2		
NUMB	8650	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	73750966	73750966	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr14:73750966G>A	ENST00000355058.3	-	10	1050	c.772C>T	c.(772-774)Cct>Tct	p.P258S	NUMB_ENST00000555238.1_Missense_Mutation_p.P258S|NUMB_ENST00000359560.3_Missense_Mutation_p.P247S|NUMB_ENST00000555738.2_Intron|NUMB_ENST00000559312.1_Intron|NUMB_ENST00000535282.1_Missense_Mutation_p.P247S|NUMB_ENST00000554521.2_Intron|NUMB_ENST00000556772.1_Missense_Mutation_p.P114S|NUMB_ENST00000555394.1_Missense_Mutation_p.P258S|NUMB_ENST00000554546.1_Missense_Mutation_p.P247S|NUMB_ENST00000560335.1_Intron|NUMB_ENST00000356296.4_Missense_Mutation_p.P258S|NUMB_ENST00000454166.4_Intron|NUMB_ENST00000544991.3_Intron|NUMB_ENST00000557597.1_Missense_Mutation_p.P247S			P49757	NUMB_HUMAN	numb homolog (Drosophila)	258					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|lateral ventricle development (GO:0021670)|lung epithelial cell differentiation (GO:0060487)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of protein localization to plasma membrane (GO:1903077)|neuroblast division in subventricular zone (GO:0021849)|Notch signaling pathway (GO:0007219)|positive regulation of cell migration (GO:0030335)|positive regulation of neurogenesis (GO:0050769)|positive regulation of polarized epithelial cell differentiation (GO:0030862)	apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|extrinsic component of plasma membrane (GO:0019897)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	28				BRCA - Breast invasive adenocarcinoma(234;0.00471)|OV - Ovarian serous cystadenocarcinoma(108;0.161)		ATGGCATGAGGATTGTTCATC	0.542																																					p.P258S		.											.	NUMB-1062	0			c.C772T						.						177.0	165.0	169.0					14																	73750966		2203	4300	6503	SO:0001583	missense	8650	exon10			CATGAGGATTGTT	L40393	CCDS9814.1, CCDS32115.1, CCDS32116.1, CCDS55927.1	14q24.3	2011-11-25	2001-11-28			ENSG00000133961			8060	protein-coding gene	gene with protein product		603728	"""numb (Drosophila) homolog"", ""chromosome 14 open reading frame 41"""	C14orf41			Standard	NM_003744		Approved		uc001xny.1	P49757		ENST00000355058.3:c.772C>T	14.37:g.73750966G>A	ENSP00000347169:p.Pro258Ser	Somatic	186	0		WXS	Illumina HiSeq	Phase_I	210	62	NM_001005744	0	0	41	69	28	B1P2N5|B1P2N6|B1P2N7|B1P2N8|B1P2N9|B4E2B1|Q6NUQ7|Q86SY1|Q8WW73|Q9UBG1|Q9UEQ4|Q9UKE8|Q9UKE9|Q9UKF0|Q9UQJ4	Missense_Mutation	SNP	ENST00000355058.3	37	CCDS32116.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.596077	0.86953	.	.	ENSG00000133961	ENST00000554546;ENST00000356296;ENST00000557597;ENST00000555238;ENST00000556772;ENST00000355058;ENST00000359560;ENST00000555394;ENST00000535282;ENST00000326018;ENST00000555859;ENST00000555307;ENST00000554394	T;T;T;T;T;T;T;T;T;T;T	0.66815	0.28;0.24;0.66;0.66;1.27;0.66;0.66;0.24;0.66;-0.23;-0.23	5.39	5.39	0.77823	NUMB domain (1);	0.000000	0.85682	D	0.000000	T	0.76564	0.4005	L	0.38175	1.15	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;0.999	D;D;D;D;D;D	0.97110	1.0;0.998;0.999;0.992;0.992;0.98	T	0.77616	-0.2521	10	0.66056	D	0.02	-12.4282	19.34	0.94337	0.0:0.0:1.0:0.0	.	4;247;247;258;247;258	B1P2N9;B2RCI6;P49757-4;P49757-2;P49757-3;P49757	.;.;.;.;.;NUMB_HUMAN	S	247;258;247;258;114;258;247;258;247;222;222;258;258	ENSP00000452416:P247S;ENSP00000348644:P258S;ENSP00000451117:P247S;ENSP00000451300:P258S;ENSP00000451513:P114S;ENSP00000347169:P258S;ENSP00000352563:P247S;ENSP00000451625:P258S;ENSP00000441258:P247S;ENSP00000452357:P258S;ENSP00000451374:P258S	ENSP00000315193:P222S	P	-	1	0	NUMB	72820719	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.343000	0.72986	2.808000	0.96608	0.655000	0.94253	CCT	.		0.542	NUMB-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414416.1		
CLMN	79789	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	95660233	95660233	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr14:95660233C>G	ENST00000298912.4	-	12	2906	c.2793G>C	c.(2791-2793)ttG>ttC	p.L931F	CLMN_ENST00000556441.1_5'UTR|CLMN_ENST00000557215.1_5'UTR	NM_024734.3	NP_079010.2	Q96JQ2	CLMN_HUMAN	calmin (calponin-like, transmembrane)	931					negative regulation of cell proliferation (GO:0008285)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(17)|prostate(3)|skin(3)	44				Epithelial(152;0.193)		CTGCGTTCCTCAACTGAACAT	0.373																																					p.L931F		.											.	CLMN-90	0			c.G2793C						.						116.0	111.0	112.0					14																	95660233		2203	4300	6503	SO:0001583	missense	79789	exon12			GTTCCTCAACTGA	AB033014	CCDS9933.1	14q32.13	2012-10-02			ENSG00000165959	ENSG00000165959			19972	protein-coding gene	gene with protein product		611121				11386753	Standard	NM_024734		Approved	FLJ12383, KIAA1188, KIAA0500	uc001yef.2	Q96JQ2	OTTHUMG00000171629	ENST00000298912.4:c.2793G>C	14.37:g.95660233C>G	ENSP00000298912:p.Leu931Phe	Somatic	88	0		WXS	Illumina HiSeq	Phase_I	100	19	NM_024734	0	0	7	9	2	B2RAR7|Q9H713|Q9HA23|Q9HA57|Q9UFP4|Q9ULN2	Missense_Mutation	SNP	ENST00000298912.4	37	CCDS9933.1	.	.	.	.	.	.	.	.	.	.	C	16.76	3.211197	0.58343	.	.	ENSG00000165959	ENST00000298912	D	0.93426	-3.22	4.77	3.87	0.44632	.	0.800724	0.10248	N	0.697563	D	0.94571	0.8251	M	0.64997	1.995	0.80722	D	1	D	0.59767	0.986	P	0.56916	0.809	D	0.91007	0.4847	10	0.46703	T	0.11	.	10.1749	0.42933	0.1987:0.8012:0.0:0.0	.	931	Q96JQ2	CLMN_HUMAN	F	931	ENSP00000298912:L931F	ENSP00000298912:L931F	L	-	3	2	CLMN	94729986	0.998000	0.40836	0.922000	0.36590	0.861000	0.49209	3.347000	0.52200	1.223000	0.43536	-0.314000	0.08810	TTG	.		0.373	CLMN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414518.2		
AK7	122481	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	96924426	96924426	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr14:96924426A>T	ENST00000267584.4	+	12	1278	c.1234A>T	c.(1234-1236)Att>Ttt	p.I412F		NM_152327.3	NP_689540.2	Q96M32	KAD7_HUMAN	adenylate kinase 7	412	Adenylate kinase.|NMPbind. {ECO:0000250}.				axoneme assembly (GO:0035082)|brain development (GO:0007420)|epithelial cilium movement (GO:0003351)|inflammatory response to antigenic stimulus (GO:0002437)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)			breast(2)|cervix(2)|endometrium(3)|large_intestine(8)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	31		all_cancers(154;0.0482)|all_epithelial(191;0.128)|Melanoma(154;0.155)		Epithelial(152;0.134)|COAD - Colon adenocarcinoma(157;0.228)		GCAGGAGGCGATTGTTGCCCC	0.493																																					p.I412F		.											.	AK7-228	0			c.A1234T						.						98.0	86.0	90.0					14																	96924426		2203	4300	6503	SO:0001583	missense	122481	exon12			GAGGCGATTGTTG	AK057426	CCDS9945.1	14q32.31	2012-08-15			ENSG00000140057	ENSG00000140057		"""Adenylate kinases"""	20091	protein-coding gene	gene with protein product		615364					Standard	NM_152327		Approved	FLJ32864	uc001yfn.3	Q96M32	OTTHUMG00000171421	ENST00000267584.4:c.1234A>T	14.37:g.96924426A>T	ENSP00000267584:p.Ile412Phe	Somatic	43	0		WXS	Illumina HiSeq	Phase_I	70	20	NM_152327	0	0	0	0	0	Q8IYP6	Missense_Mutation	SNP	ENST00000267584.4	37	CCDS9945.1	.	.	.	.	.	.	.	.	.	.	A	3.590	-0.083768	0.07141	.	.	ENSG00000140057	ENST00000267584	D	0.92858	-3.12	4.89	2.31	0.28768	.	0.577652	0.18744	N	0.132380	D	0.85418	0.5692	L	0.29908	0.895	0.09310	N	0.999999	B	0.13594	0.008	B	0.24394	0.053	T	0.76263	-0.3023	10	0.52906	T	0.07	-2.9231	7.0702	0.25173	0.7494:0.1595:0.0911:0.0	.	412	Q96M32	KAD7_HUMAN	F	412	ENSP00000267584:I412F	ENSP00000267584:I412F	I	+	1	0	AK7	95994179	0.939000	0.31865	0.041000	0.18516	0.049000	0.14656	2.486000	0.45259	0.720000	0.32209	0.260000	0.18958	ATT	.		0.493	AK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413340.1		
CAPN3	825	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	42691695	42691695	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr15:42691695C>G	ENST00000397163.3	+	10	1418	c.1199C>G	c.(1198-1200)tCc>tGc	p.S400C	CAPN3_ENST00000357568.3_Missense_Mutation_p.S400C|CAPN3_ENST00000356316.3_Missense_Mutation_p.S313C|CAPN3_ENST00000349748.3_Missense_Mutation_p.S352C|CAPN3_ENST00000318023.7_Missense_Mutation_p.S400C|CAPN3_ENST00000397200.4_5'Flank|RP11-164J13.1_ENST00000495723.1_RNA	NM_000070.2	NP_000061.1	P20807	CAN3_HUMAN	calpain 3, (p94)	400	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				apoptotic process (GO:0006915)|autolysis (GO:0001896)|cellular response to calcium ion (GO:0071277)|cellular response to salt stress (GO:0071472)|G1 to G0 transition involved in cell differentiation (GO:0070315)|muscle cell cellular homeostasis (GO:0046716)|muscle organ development (GO:0007517)|muscle structure development (GO:0061061)|myofibril assembly (GO:0030239)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of proteolysis (GO:0045862)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of satellite cell activation involved in skeletal muscle regeneration (GO:0014718)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein localization to membrane (GO:0072657)|proteolysis (GO:0006508)|regulation of catalytic activity (GO:0050790)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of myoblast differentiation (GO:0045661)|response to calcium ion (GO:0051592)|response to muscle activity (GO:0014850)|sarcomere organization (GO:0045214)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|myofibril (GO:0030016)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)|ligase regulator activity (GO:0055103)|peptidase activity (GO:0008233)|protein complex scaffold (GO:0032947)|signal transducer activity (GO:0004871)|sodium ion binding (GO:0031402)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	47		all_cancers(109;1.65e-16)|all_epithelial(112;8.34e-15)|Lung NSC(122;3.56e-09)|all_lung(180;1.68e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;7.36e-07)		CTCAGGATGTCCTATGAGGAT	0.498																																					p.S400C		.											.	CAPN3-514	0			c.C1199G						.						79.0	77.0	78.0					15																	42691695		2203	4299	6502	SO:0001583	missense	825	exon10			GGATGTCCTATGA	X85030	CCDS10085.1, CCDS10086.1, CCDS32207.1, CCDS45245.1, CCDS45246.1	15q15.1	2014-09-17			ENSG00000092529	ENSG00000092529	3.4.22.52	"""EF-hand domain containing"""	1480	protein-coding gene	gene with protein product		114240		LGMD2, LGMD2A		2555341, 7720071	Standard	NM_024344		Approved	CANP3, p94, nCL-1	uc001zpn.1	P20807	OTTHUMG00000130619	ENST00000397163.3:c.1199C>G	15.37:g.42691695C>G	ENSP00000380349:p.Ser400Cys	Somatic	104	1		WXS	Illumina HiSeq	Phase_I	63	23	NM_000070	0	0	0	0	0	A6H8K6|Q7L4R0|Q9BQC8|Q9BTU4|Q9Y5S6|Q9Y5S7	Missense_Mutation	SNP	ENST00000397163.3	37	CCDS45245.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.513014	0.85389	.	.	ENSG00000092529	ENST00000356316;ENST00000397163;ENST00000357568;ENST00000349748;ENST00000318023	D;D;D;D;D	0.91945	-2.94;-2.94;-2.94;-2.94;-2.94	5.16	5.16	0.70880	Peptidase C2, calpain, catalytic domain (3);	0.074033	0.56097	U	0.000031	D	0.91372	0.7278	L	0.42008	1.315	0.80722	D	1	P;B;P;P;P;B	0.44478	0.691;0.289;0.836;0.482;0.538;0.049	P;B;B;B;P;B	0.45998	0.5;0.33;0.367;0.333;0.464;0.111	D	0.92205	0.5771	10	0.66056	D	0.02	.	18.8563	0.92254	0.0:1.0:0.0:0.0	.	265;313;352;400;400;313	C6EVS4;C6EVS3;P20807-2;P20807-3;P20807;Q762C8	.;.;.;.;CAN3_HUMAN;.	C	313;400;400;352;400	ENSP00000348667:S313C;ENSP00000380349:S400C;ENSP00000350181:S400C;ENSP00000183936:S352C;ENSP00000326281:S400C	ENSP00000326281:S400C	S	+	2	0	CAPN3	40478987	1.000000	0.71417	0.986000	0.45419	0.956000	0.61745	7.651000	0.83577	2.679000	0.91253	0.650000	0.86243	TCC	.		0.498	CAPN3-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000421075.1		
DUOX1	53905	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	45445603	45445603	+	Silent	SNP	G	G	C			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr15:45445603G>C	ENST00000321429.4	+	27	3857	c.3450G>C	c.(3448-3450)gtG>gtC	p.V1150V	CTD-2651B20.1_ENST00000558039.1_lincRNA|DUOX1_ENST00000389037.3_Silent_p.V1150V|DUOX1_ENST00000561166.1_Silent_p.V796V|DUOX1_ENST00000559221.1_3'UTR	NM_017434.3	NP_059130.2	Q9NRD9	DUOX1_HUMAN	dual oxidase 1	1150	Ferric oxidoreductase.|Interaction with TXNDC11. {ECO:0000250}.				cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide biosynthetic process (GO:0050665)|hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|superoxide anion generation (GO:0042554)|thyroid hormone generation (GO:0006590)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|NADP binding (GO:0050661)|peroxidase activity (GO:0004601)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|lung(16)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)	57		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)		GCCATGTGGTGAATGTGTACC	0.547																																					p.V1150V		.											.	DUOX1-142	0			c.G3450C						.						311.0	237.0	262.0					15																	45445603		2198	4298	6496	SO:0001819	synonymous_variant	53905	exon27			TGTGGTGAATGTG	AF213465	CCDS32221.1	15q21	2013-01-10				ENSG00000137857		"""EF-hand domain containing"""	3062	protein-coding gene	gene with protein product	"""NADPH thyroid oxidase 1"", ""flavoprotein NADPH oxidase"", ""nicotinamide adenine dinucleotide phosphate oxidase"""	606758				10806195	Standard	XM_005254463		Approved	NOXEF1, THOX1, LNOX1	uc001zut.1	Q9NRD9		ENST00000321429.4:c.3450G>C	15.37:g.45445603G>C		Somatic	167	0		WXS	Illumina HiSeq	Phase_I	194	69	NM_017434	0	0	7	7	0	A6NH28|Q14C94|Q6ZMB3|Q6ZR09|Q9NZC1	Silent	SNP	ENST00000321429.4	37	CCDS32221.1																																																																																			.		0.547	DUOX1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416251.1	NM_017434	
CILP	8483	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	65490142	65490142	+	Silent	SNP	G	G	A			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr15:65490142G>A	ENST00000261883.4	-	9	2648	c.2482C>T	c.(2482-2484)Ctg>Ttg	p.L828L		NM_003613.3	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein, nucleotide pyrophosphohydrolase	828					negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(17)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	55						TCCCCAGCCAGGCTTGCCAAG	0.557																																					p.L828L		.											.	CILP-97	0			c.C2482T						.						63.0	57.0	59.0					15																	65490142		2200	4295	6495	SO:0001819	synonymous_variant	8483	exon9			CAGCCAGGCTTGC	AY358904	CCDS10203.1	15q22	2013-01-14			ENSG00000138615	ENSG00000138615		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1980	protein-coding gene	gene with protein product		603489				9722584, 9722583	Standard	NM_003613		Approved	HsT18872	uc002aon.2	O75339	OTTHUMG00000133140	ENST00000261883.4:c.2482C>T	15.37:g.65490142G>A		Somatic	118	0		WXS	Illumina HiSeq	Phase_I	98	31	NM_003613	0	0	0	0	0	B2R8F7|Q6UW99|Q8IYI5	Silent	SNP	ENST00000261883.4	37	CCDS10203.1																																																																																			.		0.557	CILP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256829.1	NM_003613	
ZNF598	90850	hgsc.bcm.edu	37	16	2059674	2059674	+	Missense_Mutation	SNP	T	T	C	rs71384660		TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr16:2059674T>C	ENST00000431526.1	-	2	88	c.74A>G	c.(73-75)gAa>gGa	p.E25G	ZNF598_ENST00000562103.1_5'UTR|ZNF598_ENST00000563630.1_5'UTR	NM_178167.2	NP_835461.2	Q86UK7	ZN598_HUMAN	zinc finger protein 598	25							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|lung(7)|skin(1)|urinary_tract(1)	16						GCTCCCGCCTTCCCGCTCAGG	0.766													C|||	5008	1.0	1.0	1.0	5008	,	,		5162	1.0		1.0	False		,,,				2504	1.0				p.E25G		.											.	ZNF598-432	0			c.A74G						.						1.0	2.0	2.0					16																	2059674		1089	2314	3403	SO:0001583	missense	90850	exon2			CCGCCTTCCCGCT	BC029270		16p13.3	2008-05-02				ENSG00000167962		"""Zinc fingers, C2H2-type"""	28079	protein-coding gene	gene with protein product							Standard	NM_178167		Approved	FLJ00086	uc002cof.2	Q86UK7		ENST00000431526.1:c.74A>G	16.37:g.2059674T>C	ENSP00000411409:p.Glu25Gly	Somatic	0	0		WXS	Illumina HiSeq	Phase_I	3	3	NM_178167	0	0	0	4	4	Q8IW49|Q8N3D9|Q96FG3|Q9H7J3	Missense_Mutation	SNP	ENST00000431526.1	37		2168	0.9926739926739927	487	0.9898373983739838	361	0.9972375690607734	568	0.993006993006993	752	0.9920844327176781	N	1.560	-0.537056	0.04082	.	.	ENSG00000167962	ENST00000431526	T	0.77098	-1.07	3.3	3.3	0.37823	.	0.415485	0.23105	N	0.051871	T	0.00012	0.0000	.	.	.	0.48696	P	3.1000000000003247E-4	.	.	.	.	.	.	T	0.34650	-0.9820	6	0.22706	T	0.39	-7.8624	8.393	0.32540	0.0:0.8796:0.0:0.1204	.	.	.	.	G	25	ENSP00000411409:E25G	ENSP00000411409:E25G	E	-	2	0	ZNF598	1999675	1.000000	0.71417	1.000000	0.80357	0.107000	0.19398	0.911000	0.28584	0.691000	0.31592	-0.642000	0.03964	GAA	T|0.007;C|0.993		0.766	ZNF598-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_178167	
SRRM2	23524	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	2817459	2817459	+	Silent	SNP	T	T	C			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr16:2817459T>C	ENST00000301740.8	+	11	7479	c.6930T>C	c.(6928-6930)agT>agC	p.S2310S	AC092117.2_ENST00000581119.1_RNA	NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	2310	Ala-rich.|Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						CAGCTCTGAGTCTCACAGGCT	0.622																																					p.S2310S		.											.	SRRM2-93	0			c.T6930C						.						162.0	169.0	166.0					16																	2817459		2198	4300	6498	SO:0001819	synonymous_variant	23524	exon11			TCTGAGTCTCACA	AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.6930T>C	16.37:g.2817459T>C		Somatic	409	1		WXS	Illumina HiSeq	Phase_I	501	143	NM_016333	0	0	130	229	99	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Silent	SNP	ENST00000301740.8	37	CCDS32373.1																																																																																			.		0.622	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1		
ANKS4B	257629	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	21261659	21261659	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr16:21261659G>A	ENST00000311620.5	+	2	845	c.772G>A	c.(772-774)Ggc>Agc	p.G258S		NM_145865.2	NP_665872.2	Q8N8V4	ANS4B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 4B	258					response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum membrane (GO:0005789)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|lung(11)|ovary(2)	20				GBM - Glioblastoma multiforme(48;0.0565)		AGAGGAGGACGGCAGTGTGCA	0.478																																					p.G258S		.											.	ANKS4B-92	0			c.G772A						.						105.0	113.0	111.0					16																	21261659		2087	4214	6301	SO:0001583	missense	257629	exon2			GAGGACGGCAGTG	AK096138	CCDS42130.1	16p12.2	2013-01-10				ENSG00000175311		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	26795	protein-coding gene	gene with protein product		609901					Standard	NM_145865		Approved	FLJ38819, HARP	uc010bwp.1	Q8N8V4		ENST00000311620.5:c.772G>A	16.37:g.21261659G>A	ENSP00000308772:p.Gly258Ser	Somatic	96	0		WXS	Illumina HiSeq	Phase_I	90	17	NM_145865	0	0	0	1	1		Missense_Mutation	SNP	ENST00000311620.5	37	CCDS42130.1	.	.	.	.	.	.	.	.	.	.	A	3.131	-0.178370	0.06380	.	.	ENSG00000175311	ENST00000311620	T	0.39997	1.05	5.77	-1.61	0.08399	.	1.096410	0.06713	N	0.773573	T	0.22513	0.0543	N	0.04880	-0.145	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.29549	-1.0008	10	0.08179	T	0.78	0.0056	16.0383	0.80645	0.3534:0.0:0.6466:0.0	.	258	Q8N8V4	ANS4B_HUMAN	S	258	ENSP00000308772:G258S	ENSP00000308772:G258S	G	+	1	0	ANKS4B	21169160	0.000000	0.05858	0.000000	0.03702	0.834000	0.47266	0.038000	0.13862	-0.644000	0.05465	-0.332000	0.08345	GGC	.		0.478	ANKS4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436535.1	NM_145865	
SALL1	6299	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	51174769	51174769	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr16:51174769G>C	ENST00000251020.4	-	2	1397	c.1364C>G	c.(1363-1365)gCg>gGg	p.A455G	SALL1_ENST00000440970.1_Missense_Mutation_p.A358G|SALL1_ENST00000541611.1_Intron|SALL1_ENST00000562674.1_5'Flank|SALL1_ENST00000566102.1_Intron	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	455					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			AAAGACCTTCGCGCAGAACCT	0.512																																					p.A455G	GBM(103;1352 1446 1855 4775 8890)	.											.	SALL1-98	0			c.C1364G						.						104.0	96.0	99.0					16																	51174769		2198	4300	6498	SO:0001583	missense	6299	exon2			ACCTTCGCGCAGA	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.1364C>G	16.37:g.51174769G>C	ENSP00000251020:p.Ala455Gly	Somatic	132	0		WXS	Illumina HiSeq	Phase_I	188	57	NM_002968	0	0	30	65	35	Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	ENST00000251020.4	37	CCDS10747.1	.	.	.	.	.	.	.	.	.	.	G	11.14	1.550286	0.27739	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559	T;T	0.07800	3.16;3.16	5.18	5.18	0.71444	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.048774	0.85682	D	0.000000	T	0.05090	0.0136	N	0.11560	0.145	0.58432	D	0.999992	B	0.17667	0.023	B	0.13407	0.009	T	0.17899	-1.0354	10	0.02654	T	1	.	18.685	0.91560	0.0:0.0:1.0:0.0	.	455	Q9NSC2	SALL1_HUMAN	G	455;358;419	ENSP00000251020:A455G;ENSP00000407914:A358G	ENSP00000251020:A455G	A	-	2	0	SALL1	49732270	1.000000	0.71417	0.817000	0.32601	0.990000	0.78478	6.217000	0.72218	2.386000	0.81285	0.563000	0.77884	GCG	.		0.512	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968	
SLC6A2	6530	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	55705980	55705980	+	Silent	SNP	C	C	T			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr16:55705980C>T	ENST00000379906.2	+	3	792	c.537C>T	c.(535-537)acC>acT	p.T179T	SLC6A2_ENST00000567238.1_Silent_p.T74T|SLC6A2_ENST00000414754.3_Silent_p.T179T|SLC6A2_ENST00000566163.1_Silent_p.T179T|SLC6A2_ENST00000219833.8_Silent_p.T179T|SLC6A2_ENST00000568943.1_Silent_p.T179T|SLC6A2_ENST00000561820.1_Silent_p.T179T	NM_001043.3	NP_001034.1	P23975	SC6A2_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 2	179					monoamine transport (GO:0015844)|norepinephrine transport (GO:0015874)|response to drug (GO:0042493)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	monoamine transmembrane transporter activity (GO:0008504)|norepinephrine:sodium symporter activity (GO:0005334)			breast(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(20)|ovary(3)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(1)	41				BRCA - Breast invasive adenocarcinoma(181;0.01)|Kidney(780;0.0267)	Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Bupropion(DB01156)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Clomipramine(DB01242)|Cocaine(DB00907)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desvenlafaxine(DB06700)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Dextromethorphan(DB00514)|Diethylpropion(DB00937)|Dopamine(DB00988)|Doxepin(DB01142)|Droxidopa(DB06262)|Duloxetine(DB00476)|Ephedra(DB01363)|Ephedrine(DB01364)|Ergotamine(DB00696)|Escitalopram(DB01175)|Ginkgo biloba(DB01381)|Guanadrel(DB00226)|Guanethidine(DB01170)|Imipramine(DB00458)|Iobenguane(DB06704)|Ketamine(DB01221)|Levomilnacipran(DB08918)|Levonordefrin(DB06707)|Loxapine(DB00408)|Maprotiline(DB00934)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Milnacipran(DB04896)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Orphenadrine(DB01173)|Paroxetine(DB00715)|Pethidine(DB00454)|Phendimetrazine(DB01579)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Protriptyline(DB00344)|Pseudoephedrine(DB00852)|Reboxetine(DB00234)|Sibutramine(DB01105)|Tapentadol(DB06204)|Tramadol(DB00193)|Trimipramine(DB00726)|Venlafaxine(DB00285)	GTGGCCACACCTGGAACAGCC	0.567																																					p.T179T		.											.	SLC6A2-526	0			c.C537T						.						164.0	114.0	131.0					16																	55705980		2198	4300	6498	SO:0001819	synonymous_variant	6530	exon4			CCACACCTGGAAC		CCDS10754.1, CCDS54011.1, CCDS58463.1	16q12.2	2013-07-19	2013-07-19		ENSG00000103546	ENSG00000103546		"""Solute carriers"""	11048	protein-coding gene	gene with protein product	"""norepinephrine transporter"""	163970	"""solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2"""	NET1, NAT1, SLC6A5		2008212	Standard	NM_001043		Approved	NET	uc021tio.1	P23975	OTTHUMG00000133208	ENST00000379906.2:c.537C>T	16.37:g.55705980C>T		Somatic	61	0		WXS	Illumina HiSeq	Phase_I	66	15	NM_001172501	0	0	0	0	0	B2R707|B4DX48|Q96KH8	Silent	SNP	ENST00000379906.2	37	CCDS10754.1																																																																																			.		0.567	SLC6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256922.2		
SPAG7	9552	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	4862852	4862852	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr17:4862852C>T	ENST00000206020.3	-	7	728	c.661G>A	c.(661-663)Gaa>Aaa	p.E221K	SPAG7_ENST00000573366.1_Missense_Mutation_p.E170K|SPAG7_ENST00000575142.1_3'UTR	NM_004890.2	NP_004881.2	O75391	SPAG7_HUMAN	sperm associated antigen 7	221						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			central_nervous_system(1)|endometrium(1)|kidney(2)|lung(3)|ovary(2)|urinary_tract(1)	10						GGCAACTCTTCCCCACTCTGC	0.622																																					p.E221K		.											.	SPAG7-91	0			c.G661A						.						69.0	71.0	70.0					17																	4862852		1938	4137	6075	SO:0001583	missense	9552	exon7			ACTCTTCCCCACT	AF047437	CCDS42240.1	17p13.2	2008-07-18				ENSG00000091640			11216	protein-coding gene	gene with protein product		610056				9653160	Standard	NM_004890		Approved	FSA-1, ACRP, MGC20134	uc002gae.3	O75391		ENST00000206020.3:c.661G>A	17.37:g.4862852C>T	ENSP00000206020:p.Glu221Lys	Somatic	142	1		WXS	Illumina HiSeq	Phase_I	156	33	NM_004890	0	0	116	184	68	Q96EU5	Missense_Mutation	SNP	ENST00000206020.3	37	CCDS42240.1	.	.	.	.	.	.	.	.	.	.	C	16.70	3.195946	0.58126	.	.	ENSG00000091640	ENST00000206020	.	.	.	5.26	5.26	0.73747	.	0.117279	0.56097	D	0.000023	T	0.26304	0.0642	N	0.08118	0	0.47994	D	0.999564	P	0.45044	0.849	B	0.37015	0.239	T	0.09228	-1.0684	9	0.16896	T	0.51	-8.7006	16.4689	0.84094	0.0:1.0:0.0:0.0	.	221	O75391	SPAG7_HUMAN	K	221	.	ENSP00000206020:E221K	E	-	1	0	SPAG7	4803575	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.103000	0.57783	2.753000	0.94483	0.650000	0.86243	GAA	.		0.622	SPAG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438747.1	NM_004890	
MYH4	4622	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	10366488	10366488	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr17:10366488G>A	ENST00000255381.2	-	10	933	c.823C>T	c.(823-825)Cga>Tga	p.R275*	RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	275	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						AAAGTAACTCGGGACTTCTCT	0.353																																					p.R275X		.											.	MYH4-102	0			c.C823T						.						76.0	78.0	77.0					17																	10366488		2203	4300	6503	SO:0001587	stop_gained	4622	exon10			TAACTCGGGACTT		CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.823C>T	17.37:g.10366488G>A	ENSP00000255381:p.Arg275*	Somatic	69	0		WXS	Illumina HiSeq	Phase_I	103	20	NM_017533	0	0	0	0	0		Nonsense_Mutation	SNP	ENST00000255381.2	37	CCDS11154.1	.	.	.	.	.	.	.	.	.	.	G	34	5.353656	0.95830	.	.	ENSG00000141048	ENST00000255381	.	.	.	5.37	-0.0246	0.13938	.	0.000000	0.35320	U	0.003296	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.5683	0.76313	0.0:0.0:0.2102:0.7898	.	.	.	.	X	275	.	ENSP00000255381:R275X	R	-	1	2	MYH4	10307213	0.139000	0.22563	0.530000	0.27963	0.997000	0.91878	0.358000	0.20216	0.248000	0.21435	0.650000	0.86243	CGA	.		0.353	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252731.1	NM_017533	
PLD6	201164	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	17106274	17106274	+	Missense_Mutation	SNP	G	G	A	rs139543758		TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr17:17106274G>A	ENST00000321560.3	-	2	594	c.566C>T	c.(565-567)aCg>aTg	p.T189M	RP11-45M22.4_ENST00000427497.3_3'UTR	NM_178836.3	NP_849158.2	Q8N2A8	PLD6_HUMAN	phospholipase D family, member 6	189					DNA methylation involved in gamete generation (GO:0043046)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|meiotic nuclear division (GO:0007126)|mitochondrial fusion (GO:0008053)|P granule organization (GO:0030719)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|piRNA metabolic process (GO:0034587)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)	cardiolipin hydrolase activity (GO:0035755)|endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)			endometrium(1)|lung(1)	2						GTCGTCCTCCGTGATGAGAAC	0.488																																					p.T189M		.											.	PLD6-90	0			c.C566T						.						158.0	143.0	148.0					17																	17106274		2203	4300	6503	SO:0001583	missense	201164	exon2			TCCTCCGTGATGA	AK090899	CCDS11182.1	17p11.2	2008-08-14			ENSG00000179598	ENSG00000179598			30447	protein-coding gene	gene with protein product		614960				12477932	Standard	NM_178836		Approved		uc002gqz.3	Q8N2A8	OTTHUMG00000059278	ENST00000321560.3:c.566C>T	17.37:g.17106274G>A	ENSP00000317177:p.Thr189Met	Somatic	82	0		WXS	Illumina HiSeq	Phase_I	109	29	NM_178836	0	0	11	22	11	Q8N5Y1	Missense_Mutation	SNP	ENST00000321560.3	37	CCDS11182.1	.	.	.	.	.	.	.	.	.	.	A	10.27	1.302941	0.23736	.	.	ENSG00000179598	ENST00000321560	T	0.24350	1.86	5.6	5.6	0.85130	.	0.181068	0.49916	N	0.000129	T	0.27629	0.0679	M	0.74258	2.255	0.24632	N	0.993617	B	0.29136	0.234	B	0.28784	0.094	T	0.27434	-1.0074	10	0.26408	T	0.33	-6.0E-4	8.0312	0.30465	0.782:0.0:0.218:0.0	.	189	Q8N2A8	PLD6_HUMAN	M	189	ENSP00000317177:T189M	ENSP00000317177:T189M	T	-	2	0	PLD6	17046999	0.974000	0.33945	0.967000	0.41034	0.665000	0.39181	2.538000	0.45710	0.963000	0.38082	-0.254000	0.11334	ACG	G|1.000;T|0.000		0.488	PLD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131600.2	NM_178836	
MYO15A	51168	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	18039921	18039921	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr17:18039921T>G	ENST00000205890.5	+	15	5038	c.4700T>G	c.(4699-4701)cTc>cGc	p.L1567R		NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	1567	Myosin motor.				inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					TTCAGCTGGCTCATCACCAGG	0.622																																					p.L1567R		.											.	MYO15A-97	0			c.T4700G						.						68.0	73.0	71.0					17																	18039921		2194	4278	6472	SO:0001583	missense	51168	exon14			GCTGGCTCATCAC	AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.4700T>G	17.37:g.18039921T>G	ENSP00000205890:p.Leu1567Arg	Somatic	61	0		WXS	Illumina HiSeq	Phase_I	71	19	NM_016239	0	0	0	0	0	B4DFC7	Missense_Mutation	SNP	ENST00000205890.5	37	CCDS42271.1	.	.	.	.	.	.	.	.	.	.	T	18.05	3.536870	0.65085	.	.	ENSG00000091536	ENST00000205890	D	0.89939	-2.59	5.7	5.7	0.88788	Myosin head, motor domain (2);	.	.	.	.	D	0.96599	0.8890	H	0.97564	4.03	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.98055	1.0390	9	0.87932	D	0	.	15.97	0.80008	0.0:0.0:0.0:1.0	.	1567	Q9UKN7	MYO15_HUMAN	R	1567	ENSP00000205890:L1567R	ENSP00000205890:L1567R	L	+	2	0	MYO15A	17980646	1.000000	0.71417	0.982000	0.44146	0.669000	0.39330	7.902000	0.87389	2.189000	0.69895	0.459000	0.35465	CTC	.		0.622	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132048.1	NM_016239	
KRTAP1-5	83895	hgsc.bcm.edu	37	17	39183083	39183083	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr17:39183083T>C	ENST00000361883.5	-	1	371	c.325A>G	c.(325-327)Agt>Ggt	p.S109G		NM_031957.1	NP_114163.1	Q9BYS1	KRA15_HUMAN	keratin associated protein 1-5	109	15 X 5 AA repeats of C-C-[QEPVRC]- [TPIVLE]-[SRHVP].					keratin filament (GO:0045095)				central_nervous_system(1)|endometrium(2)|kidney(1)|lung(9)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	17		Breast(137;0.00043)	STAD - Stomach adenocarcinoma(17;0.000371)			ACAGCTCCACTGCTGCCCTCC	0.642																																					p.S109G		.											.	.	0			c.A325G						.																																			SO:0001583	missense	83895	exon1			CTCCACTGCTGCC	AJ406928	CCDS42321.1	17q21.2	2013-06-25			ENSG00000221852	ENSG00000221852		"""Keratin associated proteins"""	16777	protein-coding gene	gene with protein product		608822				11279113	Standard	NM_031957		Approved	KAP1.5	uc002hvu.3	Q9BYS1	OTTHUMG00000133587	ENST00000361883.5:c.325A>G	17.37:g.39183083T>C	ENSP00000355302:p.Ser109Gly	Somatic	31	1		WXS	Illumina HiSeq	Phase_I	48	5	NM_031957	0	0	2	2	0	A6NJW6|A6NLZ6|B6ZDR1|Q52LP6	Missense_Mutation	SNP	ENST00000361883.5	37	CCDS42321.1	.	.	.	.	.	.	.	.	.	.	T	3.113	-0.182242	0.06340	.	.	ENSG00000221852	ENST00000361883;ENST00000543389	T	0.38077	1.16	5.49	-11.0	0.00169	.	.	.	.	.	T	0.18383	0.0441	L	0.31578	0.945	0.09310	N	1	B	0.09022	0.002	B	0.10450	0.005	T	0.18681	-1.0329	9	0.42905	T	0.14	.	4.8707	0.13631	0.1605:0.1834:0.0639:0.5922	.	109	Q9BYS1	KRA15_HUMAN	G	109;99	ENSP00000355302:S109G	ENSP00000355302:S109G	S	-	1	0	KRTAP1-5	36436609	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-1.571000	0.02138	-2.795000	0.00354	-1.982000	0.00454	AGT	.		0.642	KRTAP1-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257691.1		
KRTAP1-5	83895	hgsc.bcm.edu	37	17	39183129	39183129	+	Silent	SNP	A	A	G			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr17:39183129A>G	ENST00000361883.5	-	1	325	c.279T>C	c.(277-279)acT>acC	p.T93T		NM_031957.1	NP_114163.1	Q9BYS1	KRA15_HUMAN	keratin associated protein 1-5	93	15 X 5 AA repeats of C-C-[QEPVRC]- [TPIVLE]-[SRHVP].					keratin filament (GO:0045095)				central_nervous_system(1)|endometrium(2)|kidney(1)|lung(9)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	17		Breast(137;0.00043)	STAD - Stomach adenocarcinoma(17;0.000371)			TGCCACAGCCAGTTCCGCAGG	0.637																																					p.T93T		.											.	.	0			c.T279C						.						24.0	28.0	26.0					17																	39183129		2076	4218	6294	SO:0001819	synonymous_variant	83895	exon1			ACAGCCAGTTCCG	AJ406928	CCDS42321.1	17q21.2	2013-06-25			ENSG00000221852	ENSG00000221852		"""Keratin associated proteins"""	16777	protein-coding gene	gene with protein product		608822				11279113	Standard	NM_031957		Approved	KAP1.5	uc002hvu.3	Q9BYS1	OTTHUMG00000133587	ENST00000361883.5:c.279T>C	17.37:g.39183129A>G		Somatic	40	0		WXS	Illumina HiSeq	Phase_I	51	4	NM_031957	0	0	0	0	0	A6NJW6|A6NLZ6|B6ZDR1|Q52LP6	Silent	SNP	ENST00000361883.5	37	CCDS42321.1																																																																																			.		0.637	KRTAP1-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257691.1		
NSF	4905	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	44806264	44806264	+	Silent	SNP	G	G	A			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr17:44806264G>A	ENST00000398238.4	+	17	1979	c.1872G>A	c.(1870-1872)caG>caA	p.Q624Q	NSF_ENST00000575068.1_Silent_p.Q619Q|NSF_ENST00000225282.8_Silent_p.Q530Q	NM_006178.3	NP_006169.2	P46459	NSF_HUMAN	N-ethylmaleimide-sensitive factor	624					exocytosis (GO:0006887)|plasma membrane fusion (GO:0045026)|positive regulation of receptor recycling (GO:0001921)|potassium ion transport (GO:0006813)|protein transport (GO:0015031)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|syntaxin-1 binding (GO:0017075)			kidney(2)|large_intestine(1)|liver(2)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)	14		Melanoma(429;0.203)	BRCA - Breast invasive adenocarcinoma(9;0.0257)	BRCA - Breast invasive adenocarcinoma(366;0.241)		TTGTATTACAGGCTCTTCTCG	0.323																																					p.Q624Q	Ovarian(25;472 742 1472 36813 50223)	.											.	NSF-91	0			c.G1872A						.						141.0	120.0	126.0					17																	44806264		1805	4065	5870	SO:0001819	synonymous_variant	4905	exon17			ATTACAGGCTCTT		CCDS42354.1	17q21	2010-04-21			ENSG00000073969	ENSG00000073969		"""ATPases / AAA-type"""	8016	protein-coding gene	gene with protein product	"""N-ethylmaleimide-sensitive factor-like protein"""	601633				1315316, 8875895	Standard	NM_006178		Approved	SKD2	uc002iku.3	P46459	OTTHUMG00000134315	ENST00000398238.4:c.1872G>A	17.37:g.44806264G>A		Somatic	148	0		WXS	Illumina HiSeq	Phase_I	118	40	NM_006178	0	0	23	32	9	A8K2D9|B4DFA2|Q8N6D7|Q9UKZ2	Silent	SNP	ENST00000398238.4	37	CCDS42354.1																																																																																			.		0.323	NSF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259348.2	NM_006178	
USP32	84669	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	58348812	58348812	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr17:58348812T>G	ENST00000300896.4	-	6	796	c.602A>C	c.(601-603)aAa>aCa	p.K201T	USP32_ENST00000393003.3_Missense_Mutation_p.K201T	NM_032582.3	NP_115971.2	Q8NFA0	UBP32_HUMAN	ubiquitin specific peptidase 32	201					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			NS(3)|breast(5)|endometrium(5)|kidney(4)|large_intestine(12)|liver(1)|lung(24)|pancreas(1)|prostate(3)|skin(3)|urinary_tract(1)	62	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;2.02e-11)|all cancers(12;5.23e-10)|Colorectal(3;0.198)			CCAATAGCGTTTCTCAAGATC	0.398																																					p.K201T		.											.	USP32-704	0			c.A602C						.						137.0	119.0	125.0					17																	58348812		2203	4300	6503	SO:0001583	missense	84669	exon6			TAGCGTTTCTCAA	AF533230	CCDS32697.1	17q23.3	2013-01-10	2005-08-08		ENSG00000170832	ENSG00000170832		"""Ubiquitin-specific peptidases"", ""EF-hand domain containing"""	19143	protein-coding gene	gene with protein product		607740	"""ubiquitin specific protease 32"""			12838346	Standard	NM_032582		Approved	NY-REN-60, USP10	uc002iyo.1	Q8NFA0		ENST00000300896.4:c.602A>C	17.37:g.58348812T>G	ENSP00000300896:p.Lys201Thr	Somatic	81	0		WXS	Illumina HiSeq	Phase_I	138	42	NM_032582	0	0	15	28	13	Q7Z5T3|Q9BX85|Q9Y591	Missense_Mutation	SNP	ENST00000300896.4	37	CCDS32697.1	.	.	.	.	.	.	.	.	.	.	T	27.3	4.820035	0.90873	.	.	ENSG00000170832	ENST00000300896;ENST00000393003	T;T	0.68765	-0.35;-0.35	5.35	5.35	0.76521	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.79811	0.4510	M	0.62723	1.935	0.80722	D	1	D;D	0.89917	0.993;1.0	D;D	0.85130	0.968;0.997	T	0.82137	-0.0606	10	0.87932	D	0	.	15.332	0.74219	0.0:0.0:0.0:1.0	.	201;201	Q7Z5T3;Q8NFA0	.;UBP32_HUMAN	T	201	ENSP00000300896:K201T;ENSP00000376727:K201T	ENSP00000300896:K201T	K	-	2	0	USP32	55703594	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.983000	0.88140	2.014000	0.59158	0.460000	0.39030	AAA	.		0.398	USP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449235.2	NM_032582	
SPHK1	8877	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	74383269	74383269	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr17:74383269C>G	ENST00000545180.1	+	8	1566	c.757C>G	c.(757-759)Ccc>Gcc	p.P253A	SPHK1_ENST00000590959.1_Missense_Mutation_p.P267A|SPHK1_ENST00000592299.1_Missense_Mutation_p.P253A|SPHK1_ENST00000323374.4_Missense_Mutation_p.P339A|SPHK1_ENST00000392496.3_Missense_Mutation_p.P253A			Q9NYA1	SPHK1_HUMAN	sphingosine kinase 1	253					'de novo' posttranslational protein folding (GO:0051084)|blood vessel development (GO:0001568)|brain development (GO:0007420)|calcium-mediated signaling (GO:0019722)|cellular protein metabolic process (GO:0044267)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to starvation (GO:0009267)|cyclooxygenase pathway (GO:0019371)|female pregnancy (GO:0007565)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|lipid phosphorylation (GO:0046834)|negative regulation of apoptotic process (GO:0043066)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of neuron projection development (GO:0010976)|positive regulation of neurotransmitter secretion (GO:0001956)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of smooth muscle contraction (GO:0045987)|protein folding (GO:0006457)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of interleukin-1 beta production (GO:0032651)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)|response to amine (GO:0014075)|response to ATP (GO:0033198)|response to interleukin-1 (GO:0070555)|response to magnesium ion (GO:0032026)|response to progesterone (GO:0032570)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingoid catabolic process (GO:0046521)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine metabolic process (GO:0006670)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|D-erythro-sphingosine kinase activity (GO:0017050)|diacylglycerol kinase activity (GO:0004143)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|NAD+ kinase activity (GO:0003951)|protein phosphatase 2A binding (GO:0051721)|sphinganine kinase activity (GO:0008481)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)	11					Fingolimod(DB08868)	GACAGTGGTGCCCGACGAGGA	0.627																																					p.P339A	GBM(90;966 1307 27369 33775 44498)	.											.	SPHK1-1107	0			c.C1015G						.						57.0	43.0	48.0					17																	74383269		2203	4300	6503	SO:0001583	missense	8877	exon6			GTGGTGCCCGACG	BC030553	CCDS11744.1, CCDS45785.1, CCDS59297.1	17q25.2	2004-02-18				ENSG00000176170			11240	protein-coding gene	gene with protein product		603730				9726979	Standard	NM_182965		Approved	SPHK	uc002jrj.2	Q9NYA1		ENST00000545180.1:c.757C>G	17.37:g.74383269C>G	ENSP00000440970:p.Pro253Ala	Somatic	24	0		WXS	Illumina HiSeq	Phase_I	37	8	NM_182965	0	0	13	17	4	Q8N632|Q96GK1|Q9HD92|Q9NY70|Q9NYL3	Missense_Mutation	SNP	ENST00000545180.1	37	CCDS45785.1	.	.	.	.	.	.	.	.	.	.	C	17.37	3.373733	0.61624	.	.	ENSG00000176170	ENST00000545180;ENST00000323374;ENST00000392496;ENST00000543830	T;T;T	0.13778	2.56;2.56;2.56	5.08	5.08	0.68730	.	0.252689	0.40144	N	0.001161	T	0.17746	0.0426	M	0.70595	2.14	0.37430	D	0.914003	B;P;P	0.51351	0.175;0.756;0.944	B;B;P	0.45343	0.088;0.374;0.477	T	0.10497	-1.0627	10	0.06236	T	0.91	-5.9695	13.4531	0.61182	0.1567:0.8433:0.0:0.0	.	339;267;253	Q9NYA1-2;Q96GK1;Q9NYA1	.;.;SPHK1_HUMAN	A	253;339;253;252	ENSP00000440970:P253A;ENSP00000313681:P339A;ENSP00000376285:P253A	ENSP00000313681:P339A	P	+	1	0	SPHK1	71894864	0.949000	0.32298	0.993000	0.49108	0.818000	0.46254	2.111000	0.41883	2.346000	0.79739	0.563000	0.77884	CCC	.		0.627	SPHK1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450113.1	NM_182965, NM_021972	
DCC	1630	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	51025752	51025752	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr18:51025752G>T	ENST00000442544.2	+	27	4599	c.3983G>T	c.(3982-3984)aGc>aTc	p.S1328I	DCC_ENST00000581580.1_Missense_Mutation_p.S961I|RP11-671P2.1_ENST00000582064.1_RNA	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	1328					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		GAGGCACCAAGCAGAACCATC	0.537																																					p.S1328I		.											.	DCC-225	0			c.G3983T						.						232.0	178.0	196.0					18																	51025752		2203	4300	6503	SO:0001583	missense	1630	exon27			CACCAAGCAGAAC	X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.3983G>T	18.37:g.51025752G>T	ENSP00000389140:p.Ser1328Ile	Somatic	142	0		WXS	Illumina HiSeq	Phase_I	96	53	NM_005215	0	0	0	0	0		Missense_Mutation	SNP	ENST00000442544.2	37	CCDS11952.1	.	.	.	.	.	.	.	.	.	.	G	14.17	2.454949	0.43634	.	.	ENSG00000187323	ENST00000442544	T	0.46819	0.86	6.17	6.17	0.99709	Neogenin, C-terminal (1);	0.168925	0.51477	D	0.000094	T	0.53802	0.1819	L	0.47716	1.5	0.54753	D	0.999981	P	0.49696	0.927	P	0.48952	0.596	T	0.46133	-0.9213	10	0.44086	T	0.13	-9.5941	19.6509	0.95805	0.0:0.0:1.0:0.0	.	1328	P43146	DCC_HUMAN	I	1328	ENSP00000389140:S1328I	ENSP00000389140:S1328I	S	+	2	0	DCC	49279750	1.000000	0.71417	1.000000	0.80357	0.855000	0.48748	7.871000	0.87180	2.941000	0.99782	0.655000	0.94253	AGC	.		0.537	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255996.3	NM_005215	
SHC2	25759	hgsc.bcm.edu	37	19	438830	438830	+	Missense_Mutation	SNP	T	T	C	rs140148508	byFrequency	TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr19:438830T>C	ENST00000264554.6	-	4	607	c.608A>G	c.(607-609)aAc>aGc	p.N203S		NM_012435.2	NP_036567.2	P98077	SHC2_HUMAN	SHC (Src homology 2 domain containing) transforming protein 2	203	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				activation of MAPK activity (GO:0000187)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Ras protein signal transduction (GO:0007265)	cytosol (GO:0005829)				endometrium(2)|kidney(1)|large_intestine(2)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	21		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGGGCCTTGTTGGGGGCCTG	0.682													T|||	39	0.00778754	0.0287	0.0014	5008	,	,		10768	0.0		0.0	False		,,,				2504	0.0				p.N203S		.											.	SHC2-392	0			c.A608G						.	T	SER/ASN	78,3948		0,78,1935	25.0	29.0	28.0		608	3.7	1.0	19	dbSNP_134	28	1,8257		0,1,4128	yes	missense	SHC2	NM_012435.2	46	0,79,6063	CC,CT,TT		0.0121,1.9374,0.6431	benign	203/583	438830	79,12205	2013	4129	6142	SO:0001583	missense	25759	exon4			GCCTTGTTGGGGG	AB001451	CCDS45891.1	19p13.3	2013-02-14				ENSG00000129946		"""SH2 domain containing"""	29869	protein-coding gene	gene with protein product	"""neuronal Shc adaptor homolog"""	605217				7527937, 9507002	Standard	NM_012435		Approved	SLI, SCK, SHCB	uc002loq.4	P98077		ENST00000264554.6:c.608A>G	19.37:g.438830T>C	ENSP00000264554:p.Asn203Ser	Somatic	3	1		WXS	Illumina HiSeq	Phase_I	7	5	NM_012435	0	0	0	0	0	O60230|Q9NPL5|Q9UCX4	Missense_Mutation	SNP	ENST00000264554.6	37	CCDS45891.1	21	0.009615384615384616	20	0.04065040650406504	1	0.0027624309392265192	0	0.0	0	0.0	T	2.476	-0.320733	0.05386	0.019374	1.21E-4	ENSG00000129946	ENST00000264554	T	0.13538	2.58	3.67	3.67	0.42095	Phosphotyrosine interaction domain (3);Pleckstrin homology-type (1);	0.047852	0.85682	D	0.000000	T	0.01156	0.0038	N	0.11064	0.09	0.47153	D	0.999335	B	0.24963	0.115	B	0.24701	0.055	T	0.23048	-1.0199	10	0.02654	T	1	-52.872	8.7866	0.34825	0.0:0.0989:0.0:0.9011	.	203	P98077	SHC2_HUMAN	S	203	ENSP00000264554:N203S	ENSP00000264554:N203S	N	-	2	0	SHC2	389830	1.000000	0.71417	1.000000	0.80357	0.840000	0.47671	2.390000	0.44416	1.632000	0.50472	0.402000	0.26972	AAC	T|0.990;C|0.010		0.682	SHC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451840.3		
ARID3A	1820	hgsc.bcm.edu	37	19	971962	971962	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr19:971962A>G	ENST00000263620.3	+	9	2006	c.1679A>G	c.(1678-1680)aAc>aGc	p.N560S		NM_005224.2	NP_005215.1	Q99856	ARI3A_HUMAN	AT rich interactive domain 3A (BRIGHT-like)	560	Gly-rich.					cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		agcagcagcAACGCAGGCGGC	0.662																																					p.N560S	Pancreas(29;54 1022 32760 50921)	.											.	ARID3A-90	0			c.A1679G						.						25.0	30.0	28.0					19																	971962		2200	4292	6492	SO:0001583	missense	1820	exon9			GCAGCAACGCAGG	U88047	CCDS12050.1	19p13.3	2013-02-07	2006-11-08	2004-01-30		ENSG00000116017		"""-"""	3031	protein-coding gene	gene with protein product		603265	"""dead ringer-like 1 (Drosophila)"", ""AT rich interactive domain 3A (BRIGHT- like)"""	DRIL1		9722953	Standard	NM_005224		Approved	BRIGHT	uc002lql.3	Q99856		ENST00000263620.3:c.1679A>G	19.37:g.971962A>G	ENSP00000263620:p.Asn560Ser	Somatic	45	0		WXS	Illumina HiSeq	Phase_I	59	3	NM_005224	0	0	0	0	0	Q5I858|Q6P9C6|Q8IZA7|Q8N4Z3	Missense_Mutation	SNP	ENST00000263620.3	37	CCDS12050.1	.	.	.	.	.	.	.	.	.	.	A	0.003	-2.446385	0.00178	.	.	ENSG00000116017	ENST00000263620	T	0.34667	1.35	2.91	-2.46	0.06461	.	3.447310	0.01123	N	0.005824	T	0.20700	0.0498	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.08229	-1.0732	10	0.09843	T	0.71	-5.2858	3.9526	0.09375	0.257:0.2085:0.5345:0.0	.	560	Q99856	ARI3A_HUMAN	S	560	ENSP00000263620:N560S	ENSP00000263620:N560S	N	+	2	0	ARID3A	922962	0.003000	0.15002	0.000000	0.03702	0.004000	0.04260	-0.806000	0.04525	-0.772000	0.04602	0.418000	0.28097	AAC	.		0.662	ARID3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458219.1	NM_005224	
BTBD2	55643	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	1986877	1986877	+	Silent	SNP	C	C	G			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr19:1986877C>G	ENST00000255608.4	-	8	1384	c.1368G>C	c.(1366-1368)ccG>ccC	p.P456P	AC005306.3_ENST00000587498.1_RNA	NM_017797.3	NP_060267.2	Q9BX70	BTBD2_HUMAN	BTB (POZ) domain containing 2	456						cytoplasmic mRNA processing body (GO:0000932)				endometrium(5)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|stomach(1)	12		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCACCTCCACCGGCTCCTTGA	0.632																																					p.P456P		.											.	BTBD2-92	0			c.G1368C						.						52.0	54.0	53.0					19																	1986877		2203	4300	6503	SO:0001819	synonymous_variant	55643	exon8			CTCCACCGGCTCC	AF355797	CCDS12078.1	19p13.3	2013-10-02			ENSG00000133243	ENSG00000133243		"""BTB/POZ domain containing"""	15504	protein-coding gene	gene with protein product		608531				11179693	Standard	XM_005259593		Approved		uc002lup.1	Q9BX70	OTTHUMG00000180017	ENST00000255608.4:c.1368G>C	19.37:g.1986877C>G		Somatic	59	0		WXS	Illumina HiSeq	Phase_I	62	12	NM_017797	1	0	114	172	57	O60418|O75248|Q4VBZ1|Q6IAC5|Q7Z5W0|Q96SX8|Q9NPS1|Q9NX81	Silent	SNP	ENST00000255608.4	37	CCDS12078.1																																																																																			.		0.632	BTBD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449300.2		
SLC44A2	57153	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	10745556	10745556	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr19:10745556G>C	ENST00000335757.5	+	11	1324	c.948G>C	c.(946-948)ttG>ttC	p.L316F	SLC44A2_ENST00000407327.4_Missense_Mutation_p.L314F|SLC44A2_ENST00000586078.1_Missense_Mutation_p.L316F			Q8IWA5	CTL2_HUMAN	solute carrier family 44 (choline transporter), member 2	316					choline transport (GO:0015871)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	choline transmembrane transporter activity (GO:0015220)|signal transducer activity (GO:0004871)			NS(1)|breast(3)|endometrium(5)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	27			Epithelial(33;8.7e-06)|all cancers(31;2.77e-05)		Choline(DB00122)	AGACCTGGTTGGCCTTTAGTG	0.597																																					p.L316F		.											.	SLC44A2-91	0			c.G948C						.						151.0	140.0	144.0					19																	10745556		2203	4300	6503	SO:0001583	missense	57153	exon11			CTGGTTGGCCTTT	AF070636	CCDS12245.1, CCDS54216.1	19p13.2	2014-08-12	2013-07-17		ENSG00000129353	ENSG00000129353		"""Solute carriers"""	17292	protein-coding gene	gene with protein product		606106				10677542, 15715662	Standard	NM_001145056		Approved	CTL2	uc002mpf.3	Q8IWA5	OTTHUMG00000180585	ENST00000335757.5:c.948G>C	19.37:g.10745556G>C	ENSP00000336888:p.Leu316Phe	Somatic	166	0		WXS	Illumina HiSeq	Phase_I	206	58	NM_020428	0	0	0	0	0	B2RBB1|B3KNH3|B4DFJ0|F2Q9D7|Q658V1|Q658Z2|Q6PJV7|Q8N2F0|Q9NY68	Missense_Mutation	SNP	ENST00000335757.5	37	CCDS12245.1	.	.	.	.	.	.	.	.	.	.	G	13.24	2.177297	0.38413	.	.	ENSG00000129353	ENST00000407327;ENST00000335757;ENST00000380614	T;T	0.14266	2.52;2.53	5.46	3.27	0.37495	.	0.532611	0.23295	N	0.049756	T	0.17534	0.0421	L	0.58101	1.795	0.45161	D	0.998171	B;B;B	0.20887	0.049;0.013;0.014	B;B;B	0.35727	0.209;0.04;0.16	T	0.03175	-1.1064	10	0.30854	T	0.27	-23.7844	9.2861	0.37758	0.0773:0.0:0.7775:0.1453	.	316;316;314	Q8IWA5-2;Q8IWA5;Q8IWA5-3	.;CTL2_HUMAN;.	F	314;316;316	ENSP00000385135:L314F;ENSP00000336888:L316F	ENSP00000336888:L316F	L	+	3	2	SLC44A2	10606556	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.740000	0.62087	0.641000	0.30601	0.557000	0.71058	TTG	.		0.597	SLC44A2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452045.1		
DOCK6	57572	hgsc.bcm.edu	37	19	11326077	11326077	+	Silent	SNP	T	T	C			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr19:11326077T>C	ENST00000294618.7	-	32	4103	c.4092A>G	c.(4090-4092)tcA>tcG	p.S1364S	DOCK6_ENST00000319867.7_Silent_p.S703S|CTC-510F12.2_ENST00000588634.1_RNA	NM_020812.3	NP_065863.2	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	1364					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(8)|liver(2)|lung(9)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	39						CCACGCGGTCTGAGGTTTGCT	0.587																																					p.S1364S		.											.	DOCK6-93	0			c.A4092G						.						59.0	61.0	60.0					19																	11326077		2074	4199	6273	SO:0001819	synonymous_variant	57572	exon32			GCGGTCTGAGGTT		CCDS45975.1	19p13.2	2011-08-04			ENSG00000130158	ENSG00000130158			19189	protein-coding gene	gene with protein product		614194				12432077	Standard	NM_020812		Approved	KIAA1395, ZIR1	uc002mqs.5	Q96HP0		ENST00000294618.7:c.4092A>G	19.37:g.11326077T>C		Somatic	28	0		WXS	Illumina HiSeq	Phase_I	35	2	NM_020812	0	0	9	9	0	A6H8X5|Q7Z7P4|Q9P2F2	Silent	SNP	ENST00000294618.7	37	CCDS45975.1																																																																																			.		0.587	DOCK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453155.1	NM_020812	
ZNF823	55552	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	11833231	11833231	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr19:11833231G>C	ENST00000341191.6	-	4	1271	c.1118C>G	c.(1117-1119)tCg>tGg	p.S373W	ZNF823_ENST00000545749.1_Missense_Mutation_p.S191W	NM_001080493.2	NP_001073962.1	P16415	ZN823_HUMAN	zinc finger protein 823	373					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)	26						TCGAAAGCTCGAGCTATGAGA	0.423										HNSCC(68;0.2)																											p.S373W		.											.	ZNF823-24	0			c.C1118G						.						109.0	114.0	112.0					19																	11833231		2203	4300	6503	SO:0001583	missense	55552	exon4			AAGCTCGAGCTAT	X51760	CCDS45981.1	19p13.2	2013-01-08			ENSG00000197933	ENSG00000197933		"""Zinc fingers, C2H2-type"", ""-"""	30936	protein-coding gene	gene with protein product	"""ZFP 36 for a zinc finger protein"""						Standard	XM_006722789		Approved	HSZFP36	uc002msm.2	P16415	OTTHUMG00000156528	ENST00000341191.6:c.1118C>G	19.37:g.11833231G>C	ENSP00000340683:p.Ser373Trp	Somatic	126	0		WXS	Illumina HiSeq	Phase_I	154	47	NM_001080493	0	0	1	7	6	A0PJL4|B7Z8D4|Q6P4A9	Missense_Mutation	SNP	ENST00000341191.6	37	CCDS45981.1	.	.	.	.	.	.	.	.	.	.	N	11.84	1.757736	0.31137	.	.	ENSG00000197933	ENST00000545749;ENST00000341191;ENST00000431998	T;T;T	0.08282	3.11;3.11;3.11	0.632	0.632	0.17705	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.30293	0.0760	M	0.90425	3.115	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.03384	-1.1042	9	0.87932	D	0	.	7.1241	0.25461	1.0E-4:0.0:0.9999:0.0	.	373	P16415	ZN823_HUMAN	W	191;373;329	ENSP00000440162:S191W;ENSP00000340683:S373W;ENSP00000410654:S329W	ENSP00000340683:S373W	S	-	2	0	ZNF823	11694231	0.000000	0.05858	0.001000	0.08648	0.423000	0.31445	-0.236000	0.09003	0.618000	0.30179	0.298000	0.19748	TCG	.		0.423	ZNF823-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344516.2	NM_001080493	
PODNL1	79883	hgsc.bcm.edu	37	19	14044017	14044017	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr19:14044017T>C	ENST00000339560.5	-	8	1313	c.1040A>G	c.(1039-1041)aAt>aGt	p.N347S	PODNL1_ENST00000254320.3_Missense_Mutation_p.N265S|PODNL1_ENST00000538517.2_Missense_Mutation_p.N256S|PODNL1_ENST00000538371.2_Missense_Mutation_p.N345S	NM_024825.3	NP_079101.3	Q6PEZ8	PONL1_HUMAN	podocan-like 1	347	Leu-rich.					proteinaceous extracellular matrix (GO:0005578)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|skin(1)	8			OV - Ovarian serous cystadenocarcinoma(19;5.26e-23)			GTCCAGCCCATTGCCATAGAG	0.726																																					p.N347S		.											.	PODNL1-90	0			c.A1040G						.						4.0	6.0	5.0					19																	14044017		1952	3807	5759	SO:0001583	missense	79883	exon8			AGCCCATTGCCAT	AK027100	CCDS12300.1, CCDS54225.1, CCDS54226.1	19p13.12	2008-02-05							26275	protein-coding gene	gene with protein product						12477932	Standard	NM_024825		Approved	FLJ23447, SLRR5B	uc010xnj.2	Q6PEZ8		ENST00000339560.5:c.1040A>G	19.37:g.14044017T>C	ENSP00000345175:p.Asn347Ser	Somatic	3	1		WXS	Illumina HiSeq	Phase_I	5	3	NM_024825	0	0	1	2	1	B7Z564|Q9H5G9	Missense_Mutation	SNP	ENST00000339560.5	37	CCDS12300.1	.	.	.	.	.	.	.	.	.	.	T	13.50	2.256351	0.39896	.	.	ENSG00000132000	ENST00000538371;ENST00000538517;ENST00000339560;ENST00000545071;ENST00000254320	T;T;T;T	0.72505	-0.66;-0.66;-0.66;-0.66	4.58	2.44	0.29823	.	0.141451	0.31936	U	0.006840	D	0.84479	0.5481	H	0.94222	3.51	0.25906	N	0.983291	B;P;D;D	0.64830	0.286;0.883;0.994;0.969	B;P;D;P	0.63877	0.28;0.531;0.919;0.725	T	0.75897	-0.3155	10	0.72032	D	0.01	.	7.2206	0.25985	0.0:0.1948:0.0:0.8052	.	345;265;256;347	F5H7F9;B7Z3M0;G3V1J6;Q6PEZ8	.;.;.;PONL1_HUMAN	S	345;256;347;197;265	ENSP00000442553:N345S;ENSP00000440080:N256S;ENSP00000345175:N347S;ENSP00000254320:N265S	ENSP00000254320:N265S	N	-	2	0	PODNL1	13905017	1.000000	0.71417	0.729000	0.30791	0.099000	0.18886	4.215000	0.58534	0.613000	0.30089	-0.371000	0.07208	AAT	.		0.726	PODNL1-003	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457967.1	NM_024825	
ZFP82	284406	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	36883897	36883897	+	Missense_Mutation	SNP	G	G	T	rs143115887		TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr19:36883897G>T	ENST00000392161.3	-	5	1587	c.1345C>A	c.(1345-1347)Cct>Act	p.P449T	ZFP82_ENST00000392171.1_Missense_Mutation_p.P449T	NM_133466.2	NP_597723.1	Q8N141	ZFP82_HUMAN	ZFP82 zinc finger protein	449					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P449S(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						CATTTATAAGGTTTCTCACCA	0.413																																					p.P449T		.											.	ZFP82-91	1	Substitution - Missense(1)	skin(1)	c.C1345A						.						92.0	90.0	91.0					19																	36883897		2203	4300	6503	SO:0001583	missense	284406	exon5			TATAAGGTTTCTC	AL834267	CCDS12493.1	19q13.13	2013-01-08	2012-11-27	2008-07-01		ENSG00000181007		"""Zinc fingers, C2H2-type"", ""-"""	28682	protein-coding gene	gene with protein product			"""zinc finger protein 545"", ""zinc finger protein 82 homolog (mouse)"", ""zinc finger protein 82"""	ZNF545		11853319	Standard	NM_133466		Approved	MGC45380, KIAA1948	uc002ody.1	Q8N141		ENST00000392161.3:c.1345C>A	19.37:g.36883897G>T	ENSP00000431265:p.Pro449Thr	Somatic	164	0		WXS	Illumina HiSeq	Phase_I	170	54	NM_133466	0	0	3	4	1	Q8NC63|Q8TF53	Missense_Mutation	SNP	ENST00000392161.3	37	CCDS12493.1	.	.	.	.	.	.	.	.	.	.	G	18.05	3.536339	0.65085	.	.	ENSG00000181007	ENST00000392161;ENST00000392171	T;T	0.16897	2.31;2.31	4.2	4.2	0.49525	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.41294	D	0.000902	T	0.42698	0.1214	M	0.79343	2.45	0.49915	D	0.999832	D	0.89917	1.0	D	0.97110	1.0	T	0.44003	-0.9356	10	0.72032	D	0.01	.	14.447	0.67359	0.0:0.0:1.0:0.0	.	449	Q8N141	ZFP82_HUMAN	T	449	ENSP00000431265:P449T;ENSP00000446080:P449T	ENSP00000431265:P449T	P	-	1	0	ZFP82	41575737	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	7.542000	0.82095	2.352000	0.79861	0.591000	0.81541	CCT	.		0.413	ZFP82-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109552.2	NM_133466	
SPTBN4	57731	hgsc.bcm.edu	37	19	41018832	41018832	+	Silent	SNP	A	A	G	rs814533	byFrequency	TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr19:41018832A>G	ENST00000352632.3	+	14	2222	c.2136A>G	c.(2134-2136)cgA>cgG	p.R712R	SPTBN4_ENST00000344104.3_Silent_p.R712R|SPTBN4_ENST00000338932.3_Silent_p.R712R|SPTBN4_ENST00000598249.1_Silent_p.R712R|SPTBN4_ENST00000595535.1_Silent_p.R712R			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	712					actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GCGGGCGGCGAGCGTTGCTGC	0.751													G|||	1110	0.221645	0.4758	0.1239	5008	,	,		9743	0.1052		0.1372	False		,,,				2504	0.1544				p.R712R		.											.	SPTBN4-94	0			c.A2136G						.	G		502,1916		17,468,724	1.0	2.0	2.0		2136	3.2	1.0	19	dbSNP_86	2	282,4934		4,274,2330	no	coding-synonymous	SPTBN4	NM_020971.2		21,742,3054	GG,GA,AA		5.4064,20.761,10.2698		712/2565	41018832	784,6850	1209	2608	3817	SO:0001819	synonymous_variant	57731	exon14			GCGGCGAGCGTTG	AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.2136A>G	19.37:g.41018832A>G		Somatic	0	0		WXS	Illumina HiSeq	Phase_I	2	2	NM_020971	0	0	0	0	0	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Silent	SNP	ENST00000352632.3	37	CCDS12559.1																																																																																			A|0.806;G|0.194		0.751	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462559.2		
CPT1C	126129	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	50200612	50200612	+	Silent	SNP	C	C	A			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr19:50200612C>A	ENST00000392518.4	+	4	543	c.171C>A	c.(169-171)gcC>gcA	p.A57A	CPT1C_ENST00000354199.5_Silent_p.A57A|CPT1C_ENST00000323446.5_Silent_p.A57A|CPT1C_ENST00000405931.2_Silent_p.A57A|CPT1C_ENST00000598293.1_Silent_p.A57A	NM_001199752.1	NP_001186681.1	Q8TCG5	CPT1C_HUMAN	carnitine palmitoyltransferase 1C	57					carnitine metabolic process (GO:0009437)|fatty acid beta-oxidation (GO:0006635)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|endoplasmic reticulum membrane (GO:0005789)|mitochondrial outer membrane (GO:0005741)|synapse (GO:0045202)	carnitine O-palmitoyltransferase activity (GO:0004095)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0011)|GBM - Glioblastoma multiforme(134;0.00786)		TGTTTCCTGCCAGCCCCCTCA	0.542																																					p.A57A		.											.	CPT1C-92	0			c.C171A						.						194.0	139.0	158.0					19																	50200612		2203	4300	6503	SO:0001819	synonymous_variant	126129	exon4			TCCTGCCAGCCCC	AF357970	CCDS12779.1, CCDS46147.1	19q13.33	2014-03-14				ENSG00000169169			18540	protein-coding gene	gene with protein product		608846				12376098, 11001805	Standard	NM_001136052		Approved	FLJ23809, CPTIC, CPT1P	uc010eng.3	Q8TCG5		ENST00000392518.4:c.171C>A	19.37:g.50200612C>A		Somatic	87	0		WXS	Illumina HiSeq	Phase_I	101	27	NM_001199752	0	0	4	4	0	A8K0Z8|Q5K6N5|Q8N6Q9|Q8NDS6|Q8TE84	Silent	SNP	ENST00000392518.4	37	CCDS12779.1																																																																																			.		0.542	CPT1C-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465873.1	NM_152359	
ZNF613	79898	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	52447643	52447643	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr19:52447643T>A	ENST00000293471.6	+	6	1186	c.507T>A	c.(505-507)caT>caA	p.H169Q	ZNF613_ENST00000391794.4_Missense_Mutation_p.H133Q	NM_001031721.3	NP_001026891.2	Q6PF04	ZN613_HUMAN	zinc finger protein 613	169					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	19		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.0183)		ATGCCAAGCATGAACAATTTC	0.348																																					p.H169Q		.											.	ZNF613-91	0			c.T507A						.						94.0	102.0	99.0					19																	52447643		2203	4300	6503	SO:0001583	missense	79898	exon6			CAAGCATGAACAA	AK027565	CCDS12844.1, CCDS33089.1	19q13.41	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	25827	protein-coding gene	gene with protein product						12477932	Standard	NM_001031721		Approved	FLJ13590	uc002pxz.2	Q6PF04		ENST00000293471.6:c.507T>A	19.37:g.52447643T>A	ENSP00000293471:p.His169Gln	Somatic	203	0		WXS	Illumina HiSeq	Phase_I	196	77	NM_001031721	0	0	7	10	3	Q96SS9	Missense_Mutation	SNP	ENST00000293471.6	37	CCDS33089.1	.	.	.	.	.	.	.	.	.	.	T	10.57	1.386951	0.25031	.	.	ENSG00000176024	ENST00000293471;ENST00000391794	T;T	0.28454	1.61;1.61	2.9	1.88	0.25563	.	0.429945	0.17365	N	0.176876	T	0.18882	0.0453	N	0.24115	0.695	0.25401	N	0.988446	P	0.51791	0.948	B	0.42555	0.391	T	0.08973	-1.0696	10	0.62326	D	0.03	.	6.0884	0.19980	0.0:0.1332:0.0:0.8668	.	169	Q6PF04	ZN613_HUMAN	Q	169;133	ENSP00000293471:H169Q;ENSP00000375671:H133Q	ENSP00000293471:H169Q	H	+	3	2	ZNF613	57139455	0.003000	0.15002	0.186000	0.23195	0.107000	0.19398	0.002000	0.13061	0.531000	0.28639	0.528000	0.53228	CAT	.		0.348	ZNF613-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461104.2	NM_024840	
VN1R4	317703	hgsc.bcm.edu	37	19	53770133	53770133	+	Silent	SNP	G	G	A	rs202014957		TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr19:53770133G>A	ENST00000311170.4	-	1	839	c.786C>T	c.(784-786)ccC>ccT	p.P262P	CTD-2245F17.9_ENST00000599803.1_lincRNA	NM_173857.2	NP_776256.2	Q7Z5H5	VN1R4_HUMAN	vomeronasal 1 receptor 4	262					response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	pheromone receptor activity (GO:0016503)			central_nervous_system(1)|large_intestine(4)|lung(10)|ovary(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	22				GBM - Glioblastoma multiforme(134;0.00294)		GTAAACTATTGGGATTATCCA	0.453										HNSCC(26;0.072)																											p.P262P		.											.	VN1R4-92	0			c.C786T						.						61.0	57.0	58.0					19																	53770133		2203	4300	6503	SO:0001819	synonymous_variant	317703	exon1			ACTATTGGGATTA	AY114733	CCDS33099.1	19q13.42	2012-08-22			ENSG00000228567	ENSG00000228567		"""Vomeronasal receptors / Type 1"", ""GPCR / Unclassified : Vomeronasal receptors, type 1"""	19871	protein-coding gene	gene with protein product						12123587	Standard	NM_173857		Approved	V1RL4	uc010ydu.2	Q7Z5H5		ENST00000311170.4:c.786C>T	19.37:g.53770133G>A		Somatic	60	0		WXS	Illumina HiSeq	Phase_I	60	4	NM_173857	0	0	0	0	0	Q2M3E2|Q7Z5H6|Q7Z5H7|Q8TDU2	Silent	SNP	ENST00000311170.4	37	CCDS33099.1																																																																																			G|0.250;A|0.750		0.453	VN1R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464287.1	NM_173857	
MZF1	7593	hgsc.bcm.edu;broad.mit.edu	37	19	59082617	59082617	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr19:59082617A>G	ENST00000215057.2	-	2	700	c.140T>C	c.(139-141)tTc>tCc	p.F47S	MZF1_ENST00000599369.1_Missense_Mutation_p.F47S|MZF1_ENST00000594234.1_Missense_Mutation_p.F47S|AC016629.8_ENST00000593642.1_RNA|AC016629.8_ENST00000600726.1_RNA|AC016629.8_ENST00000600534.1_RNA|MZF1_ENST00000594108.1_Missense_Mutation_p.F47S	NM_001267033.1|NM_198055.1	NP_001253962.1|NP_932172.1	P28698	MZF1_HUMAN	myeloid zinc finger 1	47	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0443)|all cancers(4;7.92e-14)|Epithelial(4;5.57e-11)|OV - Ovarian serous cystadenocarcinoma(4;1.13e-09)|GBM - Glioblastoma multiforme(193;0.0108)|Lung(386;0.182)		GAAGCACCGGAAACGCAGGCG	0.642																																					p.F47S		.											.	MZF1-91	0			c.T140C						.						22.0	25.0	24.0					19																	59082617		2203	4299	6502	SO:0001583	missense	7593	exon2			CACCGGAAACGCA	M58297	CCDS12988.1, CCDS59427.1	19q13.43	2014-08-22	2006-06-15	2006-06-15	ENSG00000099326	ENSG00000099326		"""-"", ""Zinc fingers, C2H2-type"""	13108	protein-coding gene	gene with protein product		194550	"""zinc finger protein 42 (myeloid-specific retinoic acid-responsive)"""	ZNF42		1860835	Standard	NM_198055		Approved	ZSCAN6, MZF1B, MZF-1, Zfp98	uc002qtn.3	P28698	OTTHUMG00000183550	ENST00000215057.2:c.140T>C	19.37:g.59082617A>G	ENSP00000215057:p.Phe47Ser	Somatic	28	0		WXS	Illumina HiSeq	Phase_I	38	3	NM_198055	0	0	7	7	0	M0QXU0|Q7Z729|Q96I71|Q9NRY0|Q9UBW2	Missense_Mutation	SNP	ENST00000215057.2	37	CCDS12988.1	.	.	.	.	.	.	.	.	.	.	.	15.85	2.955202	0.53293	.	.	ENSG00000099326	ENST00000215057	T	0.12984	2.63	4.35	4.35	0.52113	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	0.000000	0.42420	D	0.000720	T	0.47248	0.1435	H	0.96943	3.91	0.09310	N	0.999996	D;B	0.76494	0.999;0.261	D;B	0.67231	0.95;0.247	T	0.54622	-0.8266	9	.	.	.	-23.3828	10.1266	0.42654	1.0:0.0:0.0:0.0	.	47;47	Q7Z729;P28698	.;MZF1_HUMAN	S	47	ENSP00000215057:F47S	.	F	-	2	0	MZF1	63774429	0.001000	0.12720	0.022000	0.16811	0.835000	0.47333	1.122000	0.31295	1.959000	0.56917	0.460000	0.39030	TTC	.		0.642	MZF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467112.1	NM_198055	
NBAS	51594	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	15542368	15542368	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr2:15542368T>G	ENST00000281513.5	-	26	3020	c.2995A>C	c.(2995-2997)Atc>Ctc	p.I999L	NBAS_ENST00000441750.1_Missense_Mutation_p.I879L	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	999					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)				NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						CAGGTATAGATGCACTCTAGT	0.383																																					p.I999L		.											.	NBAS-94	0			c.A2995C						.						156.0	148.0	151.0					2																	15542368		2203	4300	6503	SO:0001583	missense	51594	exon26			TATAGATGCACTC	BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.2995A>C	2.37:g.15542368T>G	ENSP00000281513:p.Ile999Leu	Somatic	145	0		WXS	Illumina HiSeq	Phase_I	137	43	NM_015909	0	0	21	28	7	O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Missense_Mutation	SNP	ENST00000281513.5	37	CCDS1685.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.90|16.90	3.250228|3.250228	0.59212|0.59212	.|.	.|.	ENSG00000151779|ENSG00000151779	ENST00000429842|ENST00000441750;ENST00000281513;ENST00000441755	.|T;T;T	.|0.18016	.|2.24;2.24;2.24	5.65|5.65	4.5|4.5	0.54988|0.54988	.|Secretory pathway Sec39 (1);	.|0.044348	.|0.85682	.|D	.|0.000000	T|T	0.24890|0.24890	0.0604|0.0604	M|M	0.67953|0.67953	2.075|2.075	0.58432|0.58432	D|D	0.999998|0.999998	.|P;P	.|0.43024	.|0.798;0.771	.|B;P	.|0.45428	.|0.39;0.48	T|T	0.01613|0.01613	-1.1312|-1.1312	5|10	.|0.87932	.|D	.|0	.|.	10.3793|10.3793	0.44101|0.44101	0.0:0.0774:0.0:0.9226|0.0:0.0774:0.0:0.9226	.|.	.|879;999	.|A2RRP1-2;A2RRP1	.|.;NBAS_HUMAN	P|L	96|879;999;46	.|ENSP00000413201:I879L;ENSP00000281513:I999L;ENSP00000396501:I46L	.|ENSP00000281513:I999L	H|I	-|-	2|1	0|0	NBAS|NBAS	15459819|15459819	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.939000|0.939000	0.58152|0.58152	4.514000|4.514000	0.60482|0.60482	0.976000|0.976000	0.38417|0.38417	0.533000|0.533000	0.62120|0.62120	CAT|ATC	.		0.383	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241638.1	NM_015909	
CENPA	1058	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	27016052	27016052	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr2:27016052T>C	ENST00000335756.4	+	4	528	c.328T>C	c.(328-330)Tat>Cat	p.Y110H	CENPA_ENST00000233505.8_Missense_Mutation_p.Y84H|CENPA_ENST00000475662.1_3'UTR	NM_001809.3	NP_001800.1	P49450	CENPA_HUMAN	centromere protein A	110	CATD.|H3-like.				CENP-A containing nucleosome assembly (GO:0034080)|establishment of mitotic spindle orientation (GO:0000132)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)|protein localization to chromosome, centromeric region (GO:0071459)|viral process (GO:0016032)	chromosome, centromeric region (GO:0000775)|condensed chromosome inner kinetochore (GO:0000939)|condensed nuclear chromosome kinetochore (GO:0000778)|condensed nuclear chromosome, centromeric region (GO:0000780)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(1)|large_intestine(3)|lung(3)|urinary_tract(1)	8	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGAGGACGCCTATCTCCTCAC	0.542																																					p.Y110H	Pancreas(28;769 878 30250 30578 41330)	.											.	CENPA-181	0			c.T328C						.						185.0	191.0	189.0					2																	27016052		2203	4300	6503	SO:0001583	missense	1058	exon4			GACGCCTATCTCC	U14518	CCDS1729.1, CCDS42662.1	2p23.3	2013-11-05	2006-06-16		ENSG00000115163	ENSG00000115163			1851	protein-coding gene	gene with protein product	"""centromere-specific histone"", ""histone H3-like centromeric protein A"""	117139	"""centromere protein A (17kD)"", ""centromere protein A, 17kDa"""				Standard	NM_001042426		Approved	CENP-A, CenH3	uc002rhr.3	P49450	OTTHUMG00000097073	ENST00000335756.4:c.328T>C	2.37:g.27016052T>C	ENSP00000336868:p.Tyr110His	Somatic	336	1		WXS	Illumina HiSeq	Phase_I	433	159	NM_001809	0	0	3	3	0	D6W544|Q53T74|Q9BVW2	Missense_Mutation	SNP	ENST00000335756.4	37	CCDS1729.1	.	.	.	.	.	.	.	.	.	.	T	16.66	3.184197	0.57800	.	.	ENSG00000115163	ENST00000335756;ENST00000233505	T;T	0.68331	-0.32;-0.32	5.96	5.96	0.96718	Histone-fold (2);Histone core (1);	0.408748	0.26258	N	0.025404	T	0.79137	0.4395	L	0.61387	1.9	0.41321	D	0.987178	D;D	0.76494	0.999;0.999	D;D	0.71184	0.968;0.972	T	0.81182	-0.1049	10	0.72032	D	0.01	-24.0282	14.3967	0.67015	0.0:0.0:0.0:1.0	.	84;110	P49450-2;P49450	.;CENPA_HUMAN	H	110;84	ENSP00000336868:Y110H;ENSP00000233505:Y84H	ENSP00000233505:Y84H	Y	+	1	0	CENPA	26869556	1.000000	0.71417	0.741000	0.31004	0.367000	0.29736	4.210000	0.58500	2.284000	0.76573	0.528000	0.53228	TAT	.		0.542	CENPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214190.2	NM_001809	
SLC5A6	8884	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	27427450	27427450	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr2:27427450T>C	ENST00000310574.3	-	9	1357	c.884A>G	c.(883-885)tAt>tGt	p.Y295C	SLC5A6_ENST00000461319.1_5'Flank|SLC5A6_ENST00000408041.1_Missense_Mutation_p.Y295C	NM_021095.2	NP_066918.2	Q9Y289	SC5A6_HUMAN	solute carrier family 5 (sodium/multivitamin and iodide cotransporter), member 6	295					biotin metabolic process (GO:0006768)|biotin transport (GO:0015878)|pantothenate metabolic process (GO:0015939)|pantothenate transmembrane transport (GO:0015887)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	sodium-dependent multivitamin transmembrane transporter activity (GO:0008523)			endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|ovary(3)|prostate(1)|skin(1)	20	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Biotin(DB00121)|gabapentin enacarbil(DB08872)|Lipoic Acid(DB00166)	GAACACTGCATAACAGGAGCT	0.572																																					p.Y295C		.											.	SLC5A6-92	0			c.A884G						.						80.0	74.0	76.0					2																	27427450		2203	4300	6503	SO:0001583	missense	8884	exon9			ACTGCATAACAGG	AF069307	CCDS1740.1	2p23	2013-07-19	2013-07-19		ENSG00000138074	ENSG00000138074		"""Solute carriers"""	11041	protein-coding gene	gene with protein product		604024	"""solute carrier family 5 (sodium-dependent vitamin transporter), member 6"""			9516450, 10329687	Standard	NM_021095		Approved	SMVT	uc002rjd.3	Q9Y289	OTTHUMG00000097075	ENST00000310574.3:c.884A>G	2.37:g.27427450T>C	ENSP00000310208:p.Tyr295Cys	Somatic	55	0		WXS	Illumina HiSeq	Phase_I	104	35	NM_021095	0	0	0	0	0	B2RB85|D6W549|Q969Y5	Missense_Mutation	SNP	ENST00000310574.3	37	CCDS1740.1	.	.	.	.	.	.	.	.	.	.	T	17.44	3.389077	0.61956	.	.	ENSG00000138074	ENST00000310574;ENST00000408041	D;D	0.87809	-2.3;-2.3	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	D	0.92714	0.7684	M	0.81802	2.56	0.80722	D	1	D	0.76494	0.999	D	0.70935	0.971	D	0.93087	0.6496	10	0.54805	T	0.06	.	12.8283	0.57733	0.0:0.0:0.0:1.0	.	295	Q9Y289	SC5A6_HUMAN	C	295	ENSP00000310208:Y295C;ENSP00000384853:Y295C	ENSP00000310208:Y295C	Y	-	2	0	SLC5A6	27280954	1.000000	0.71417	0.958000	0.39756	0.397000	0.30659	5.786000	0.69006	1.986000	0.57962	0.533000	0.62120	TAT	.		0.572	SLC5A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214194.1	NM_021095	
TTC27	55622	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	33036148	33036148	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr2:33036148G>A	ENST00000317907.4	+	17	2287	c.2056G>A	c.(2056-2058)Gtt>Att	p.V686I		NM_001193509.1|NM_017735.4	NP_001180438.1|NP_060205.3	Q6P3X3	TTC27_HUMAN	tetratricopeptide repeat domain 27	686										breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	38						AAGTGGAGATGTTGCAACTGG	0.428																																					p.V686I		.											.	TTC27-90	0			c.G2056A						.						129.0	122.0	125.0					2																	33036148		2203	4300	6503	SO:0001583	missense	55622	exon17			GGAGATGTTGCAA	BC063791, AK000279	CCDS33176.1	2p22.3	2013-01-10			ENSG00000018699	ENSG00000018699		"""Tetratricopeptide (TTC) repeat domain containing"""	25986	protein-coding gene	gene with protein product							Standard	NM_001193509		Approved	FLJ20272	uc002rom.3	Q6P3X3	OTTHUMG00000152134	ENST00000317907.4:c.2056G>A	2.37:g.33036148G>A	ENSP00000313953:p.Val686Ile	Somatic	111	0		WXS	Illumina HiSeq	Phase_I	130	51	NM_017735	0	0	13	25	12	A6NKJ0|Q96SS5|Q9BVF1|Q9NWR4|Q9NXG4	Missense_Mutation	SNP	ENST00000317907.4	37	CCDS33176.1	.	.	.	.	.	.	.	.	.	.	G	1.700	-0.501793	0.04261	.	.	ENSG00000018699	ENST00000317907	T	0.37584	1.19	5.22	2.23	0.28157	.	0.494754	0.21950	N	0.066749	T	0.11153	0.0272	N	0.01352	-0.895	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.19031	-1.0318	10	0.32370	T	0.25	-11.2027	5.2727	0.15634	0.2963:0.0:0.5626:0.1412	.	686	Q6P3X3	TTC27_HUMAN	I	686	ENSP00000313953:V686I	ENSP00000313953:V686I	V	+	1	0	TTC27	32889652	0.000000	0.05858	0.868000	0.34077	0.084000	0.17831	0.052000	0.14163	0.765000	0.33221	0.650000	0.86243	GTT	.		0.428	TTC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325395.1	NM_017735	
PSME4	23198	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	54125075	54125075	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr2:54125075C>G	ENST00000404125.1	-	31	3593	c.3538G>C	c.(3538-3540)Gtg>Ctg	p.V1180L	PSME4_ENST00000421748.2_Missense_Mutation_p.V324L	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4	1180					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|spermatoproteasome complex (GO:1990111)	lysine-acetylated histone binding (GO:0070577)|peptidase activator activity (GO:0016504)			breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			AGAGGCAACACTCGGTCATCT	0.408																																					p.V1180L		.											.	PSME4-275	0			c.G3538C						.						155.0	149.0	151.0					2																	54125075		2203	4300	6503	SO:0001583	missense	23198	exon31			GCAACACTCGGTC	D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878		"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705				7584044, 12093752	Standard	NM_014614		Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852	ENST00000404125.1:c.3538G>C	2.37:g.54125075C>G	ENSP00000384211:p.Val1180Leu	Somatic	132	0		WXS	Illumina HiSeq	Phase_I	162	44	NM_014614	0	0	19	28	9	Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	Missense_Mutation	SNP	ENST00000404125.1	37	CCDS33197.2	.	.	.	.	.	.	.	.	.	.	C	13.13	2.143792	0.37825	.	.	ENSG00000068878	ENST00000421748;ENST00000404125	T;T	0.63417	-0.04;-0.04	5.64	5.64	0.86602	Armadillo-like helical (1);Armadillo-type fold (1);	0.196755	0.45361	D	0.000375	T	0.47525	0.1450	N	0.22421	0.69	0.37075	D	0.898738	B;B;B	0.15473	0.009;0.013;0.013	B;B;B	0.15484	0.007;0.013;0.008	T	0.47686	-0.9098	10	0.25106	T	0.35	.	13.4018	0.60887	0.0:0.9192:0.0:0.0808	.	555;324;1180	Q14997-2;Q14997-3;Q14997	.;.;PSME4_HUMAN	L	324;1180	ENSP00000410830:V324L;ENSP00000384211:V1180L	ENSP00000384211:V1180L	V	-	1	0	PSME4	53978579	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.276000	0.58933	2.667000	0.90743	0.655000	0.94253	GTG	.		0.408	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324163.1	XM_040158	
RANBP2	5903	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	109392304	109392304	+	Silent	SNP	T	T	C			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr2:109392304T>C	ENST00000283195.6	+	24	8535	c.8409T>C	c.(8407-8409)atT>atC	p.I2803I		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	2803					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						CCAAATCCATTAGTTCACCAT	0.363																																					p.I2803I		.											.	RANBP2-675	0			c.T8409C						.						130.0	130.0	130.0					2																	109392304		2203	4300	6503	SO:0001819	synonymous_variant	5903	exon24			ATCCATTAGTTCA	D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.8409T>C	2.37:g.109392304T>C		Somatic	113	0		WXS	Illumina HiSeq	Phase_I	113	46	NM_006267	0	0	27	44	17	Q13074|Q15280|Q53TE2|Q59FH7	Silent	SNP	ENST00000283195.6	37	CCDS2079.1																																																																																			.		0.363	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1	NM_006267	
TMEM87B	84910	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	112863589	112863589	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr2:112863589A>G	ENST00000283206.4	+	16	1830	c.1461A>G	c.(1459-1461)atA>atG	p.I487M		NM_032824.2	NP_116213.1	Q96K49	TM87B_HUMAN	transmembrane protein 87B	487						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(11)|ovary(1)	19						CCGAAGGAATAAAATTAAGAG	0.284																																					p.I487M		.											.	TMEM87B-90	0			c.A1461G						.						136.0	144.0	142.0					2																	112863589		2203	4300	6503	SO:0001583	missense	84910	exon16			AGGAATAAAATTA	AC092645	CCDS33275.1	2q13	2008-02-05			ENSG00000153214	ENSG00000153214			25913	protein-coding gene	gene with protein product							Standard	NM_032824		Approved	FLJ14681	uc002thm.2	Q96K49	OTTHUMG00000153266	ENST00000283206.4:c.1461A>G	2.37:g.112863589A>G	ENSP00000283206:p.Ile487Met	Somatic	216	1		WXS	Illumina HiSeq	Phase_I	250	87	NM_032824	0	0	0	0	0	A8K2M9|Q1RLN2|Q53R54	Missense_Mutation	SNP	ENST00000283206.4	37	CCDS33275.1	.	.	.	.	.	.	.	.	.	.	A	1.631	-0.518867	0.04171	.	.	ENSG00000153214	ENST00000283206	.	.	.	5.36	5.36	0.76844	.	0.129072	0.64402	D	0.000002	T	0.26666	0.0652	N	0.11131	0.1	0.37625	D	0.92144	B	0.11235	0.004	B	0.10450	0.005	T	0.23013	-1.0200	9	0.02654	T	1	-18.044	7.9709	0.30127	0.9085:0.0:0.0915:0.0	.	487	Q96K49	TM87B_HUMAN	M	487	.	ENSP00000283206:I487M	I	+	3	3	TMEM87B	112580060	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	1.770000	0.38532	2.027000	0.59764	0.533000	0.62120	ATA	.		0.284	TMEM87B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330500.1	NM_032824	
ORC2	4999	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	201790562	201790562	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr2:201790562C>A	ENST00000234296.2	-	13	1393	c.1144G>T	c.(1144-1146)Gaa>Taa	p.E382*	RN7SL694P_ENST00000584245.1_RNA	NM_006190.4	NP_006181.1	Q13416	ORC2_HUMAN	origin recognition complex, subunit 2	382					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	condensed chromosome inner kinetochore (GO:0000939)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)|plasma membrane (GO:0005886)	DNA replication origin binding (GO:0003688)			breast(1)|endometrium(1)|large_intestine(2)|lung(10)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	20						ATGTTACCTTCTTTAAATTTG	0.308																																					p.E382X		.											.	ORC2-209	0			c.G1144T						.						139.0	133.0	135.0					2																	201790562		2203	4300	6503	SO:0001587	stop_gained	4999	exon13			TACCTTCTTTAAA		CCDS2334.1	2q33	2010-10-12	2010-10-12	2010-10-12	ENSG00000115942	ENSG00000115942			8488	protein-coding gene	gene with protein product		601182	"""origin recognition complex, subunit 2 (yeast homolog)-like"", ""origin recognition complex, subunit 2-like (yeast)"", ""origin recognition complex, subunit 2 homolog (yeast)"""	ORC2L		8808289	Standard	NM_006190		Approved		uc002uwr.3	Q13416	OTTHUMG00000132783	ENST00000234296.2:c.1144G>T	2.37:g.201790562C>A	ENSP00000234296:p.Glu382*	Somatic	130	0		WXS	Illumina HiSeq	Phase_I	168	49	NM_006190	0	0	0	0	0	Q13204|Q53TX5	Nonsense_Mutation	SNP	ENST00000234296.2	37	CCDS2334.1	.	.	.	.	.	.	.	.	.	.	C	39	7.716939	0.98450	.	.	ENSG00000115942	ENST00000234296	.	.	.	5.34	5.34	0.76211	.	0.148032	0.64402	D	0.000011	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07644	T	0.81	.	19.3943	0.94601	0.0:1.0:0.0:0.0	.	.	.	.	X	382	.	ENSP00000234296:E382X	E	-	1	0	ORC2	201498807	1.000000	0.71417	1.000000	0.80357	0.770000	0.43624	3.237000	0.51344	2.671000	0.90904	0.585000	0.79938	GAA	.		0.308	ORC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256191.2	NM_006190	
UGT1A1	54658	broad.mit.edu	37	2	234526363	234526363	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr2:234526363A>G	ENST00000373450.4	+	1	73	c.10A>G	c.(10-12)Aca>Gca	p.T4A		NM_019076.4	NP_061949.3	P22309	UD11_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A1	0					acute-phase response (GO:0006953)|bilirubin conjugation (GO:0006789)|biphenyl catabolic process (GO:0070980)|cellular glucuronidation (GO:0052695)|cellular response to ethanol (GO:0071361)|cellular response to glucocorticoid stimulus (GO:0071385)|digestion (GO:0007586)|drug metabolic process (GO:0017144)|estrogen metabolic process (GO:0008210)|flavone metabolic process (GO:0051552)|flavonoid glucuronidation (GO:0052696)|heme catabolic process (GO:0042167)|heterocycle metabolic process (GO:0046483)|liver development (GO:0001889)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cellular glucuronidation (GO:2001030)|negative regulation of steroid metabolic process (GO:0045939)|organ regeneration (GO:0031100)|porphyrin-containing compound metabolic process (GO:0006778)|response to drug (GO:0042493)|response to lipopolysaccharide (GO:0032496)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|retinoic acid metabolic process (GO:0042573)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic glucuronidation (GO:0052697)|xenobiotic metabolic process (GO:0006805)	cytochrome complex (GO:0070069)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)|steroid binding (GO:0005496)	p.T4A(3)		breast(1)|central_nervous_system(2)|endometrium(7)|large_intestine(5)|lung(9)|skin(4)|urinary_tract(2)	30		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0461)|Lung SC(224;0.128)		Epithelial(121;4.1e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000435)|Lung(119;0.00211)|LUSC - Lung squamous cell carcinoma(224;0.0054)	Abacavir(DB01048)|Acetaminophen(DB00316)|Adenine(DB00173)|Atorvastatin(DB01076)|Axitinib(DB06626)|Diclofenac(DB00586)|Dolutegravir(DB08930)|Eltrombopag(DB06210)|Erlotinib(DB00530)|Estradiol(DB00783)|Etoposide(DB00773)|Ezetimibe(DB00973)|Ezogabine(DB04953)|Flunitrazepam(DB01544)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Ibuprofen(DB01050)|Indacaterol(DB05039)|Indomethacin(DB00328)|Irinotecan(DB00762)|Losartan(DB00678)|Lovastatin(DB00227)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Naltrexone(DB00704)|Naproxen(DB00788)|Nilotinib(DB04868)|Pazopanib(DB06589)|Propofol(DB00818)|Raltegravir(DB06817)|Regorafenib(DB08896)|Rifampicin(DB01045)|Simvastatin(DB00641)|Sorafenib(DB00398)|Suprofen(DB00870)|Testosterone Propionate(DB01420)	CATGGCTCGCACAGGGTGGAC	0.562																																					p.T4A													.	UGT1A8-27	3	Substitution - Missense(3)	prostate(1)|lung(1)|kidney(1)	c.A10G						.						61.0	53.0	56.0					2																	234526363		2203	4300	6503	SO:0001583	missense	54576	exon1			GCTCGCACAGGGT	M57899	CCDS2510.1	2q37.1	2014-09-17	2005-07-20		ENSG00000242366	ENSG00000242366	2.4.1.17	"""UDP glucuronosyltransferases"""	12530	other	complex locus constituent		191740	"""UDP glycosyltransferase 1 family, polypeptide A1"""	UGT1, GNT1		9295054, 9535849	Standard	NM_000463		Approved	UGT1A		P22309	OTTHUMG00000059117	ENST00000373450.4:c.10A>G	2.37:g.234526363A>G	ENSP00000362549:p.Thr4Ala	Somatic	71	1		WXS	Illumina HiSeq	Phase_I	76	4	NM_019076	0	0	0	1	1	A6NJC3|B8K286	Missense_Mutation	SNP	ENST00000373450.4	37	CCDS33402.1	.	.	.	.	.	.	.	.	.	.	A	1.349	-0.591910	0.03799	.	.	ENSG00000242366	ENST00000373450	T	0.57273	0.41	3.96	-1.46	0.08800	.	.	.	.	.	T	0.20577	0.0495	N	0.03115	-0.41	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.27331	-1.0077	9	0.06891	T	0.86	.	5.6018	0.17357	0.3817:0.1909:0.4274:0.0	.	4;4	Q5DSZ6;Q9HAW9	.;UD18_HUMAN	A	4	ENSP00000362549:T4A	ENSP00000362549:T4A	T	+	1	0	UGT1A8	234191102	0.000000	0.05858	0.003000	0.11579	0.000000	0.00434	0.041000	0.13927	-0.096000	0.12329	-1.318000	0.01297	ACA	A|1.000;G|0.000		0.562	UGT1A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000130994.1		
ZNF341	84905	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	32357951	32357951	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr20:32357951A>C	ENST00000375200.1	+	10	1840	c.1475A>C	c.(1474-1476)gAg>gCg	p.E492A	ZNF341_ENST00000342427.2_Missense_Mutation_p.E485A	NM_001282933.1	NP_001269862.1	Q9BYN7	ZN341_HUMAN	zinc finger protein 341	492					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|skin(1)|urinary_tract(3)	31						ACATTTCTGGAGCACATCAAG	0.597																																					p.E485A		.											.	ZNF341-92	0			c.A1454C						.						69.0	58.0	61.0					20																	32357951		2203	4300	6503	SO:0001583	missense	84905	exon10			TTCTGGAGCACAT	AK027550	CCDS13227.1, CCDS74719.1	20q11.22	2013-01-08			ENSG00000131061	ENSG00000131061		"""Zinc fingers, C2H2-type"""	15992	protein-coding gene	gene with protein product							Standard	NM_001282933		Approved	dJ553F4.3	uc002wzx.3	Q9BYN7	OTTHUMG00000032275	ENST00000375200.1:c.1475A>C	20.37:g.32357951A>C	ENSP00000364346:p.Glu492Ala	Somatic	40	0		WXS	Illumina HiSeq	Phase_I	43	15	NM_032819	0	0	4	5	1	A2RUF4|B2RXE5|B7ZM09|Q5JXM8|Q96ST5	Missense_Mutation	SNP	ENST00000375200.1	37		.	.	.	.	.	.	.	.	.	.	A	25.6	4.651504	0.88056	.	.	ENSG00000131061	ENST00000342427;ENST00000375200	T;T	0.31247	1.5;1.5	5.35	5.35	0.76521	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.051359	0.85682	D	0.000000	T	0.30696	0.0773	N	0.17872	0.535	0.53005	D	0.999962	P;P;P	0.50819	0.792;0.939;0.925	B;P;P	0.53809	0.257;0.735;0.616	T	0.03608	-1.1020	10	0.13470	T	0.59	-36.6794	15.6282	0.76878	1.0:0.0:0.0:0.0	.	433;492;485	Q504V9;Q9BYN7;Q9BYN7-2	.;ZN341_HUMAN;.	A	485;492	ENSP00000344308:E485A;ENSP00000364346:E492A	ENSP00000344308:E485A	E	+	2	0	ZNF341	31821612	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.898000	0.92538	2.152000	0.67230	0.443000	0.29094	GAG	.		0.597	ZNF341-201	KNOWN	basic	protein_coding	protein_coding			
MORC3	23515	hgsc.bcm.edu	37	21	37692578	37692578	+	Missense_Mutation	SNP	C	C	A	rs202025634	byFrequency	TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr21:37692578C>A	ENST00000400485.1	+	1	92	c.16C>A	c.(16-18)Ccc>Acc	p.P6T	AP000692.10_ENST00000608391.1_RNA|MORC3_ENST00000487909.1_3'UTR	NM_015358.2	NP_056173.1	Q14149	MORC3_HUMAN	MORC family CW-type zinc finger 3	6					cell aging (GO:0007569)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of fibroblast proliferation (GO:0048147)|peptidyl-serine phosphorylation (GO:0018105)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)	PML body (GO:0016605)	zinc ion binding (GO:0008270)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(9)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	35						GGCGCAGCCACCCCGCGGGAT	0.726													C|||	3	0.000599042	0.0023	0.0	5008	,	,		9802	0.0		0.0	False		,,,				2504	0.0				p.P6T		.											.	MORC3-92	0			c.C16A						.						8.0	10.0	9.0					21																	37692578		1849	4043	5892	SO:0001583	missense	23515	exon1			CAGCCACCCCGCG	AK025327	CCDS42924.1	21q22.13	2005-06-15	2005-06-15	2005-06-15	ENSG00000159256	ENSG00000159256			23572	protein-coding gene	gene with protein product		610078	"""zinc finger, CW-type with coiled-coil domain 3"", ""zinc finger, CW type with coiled-coil domain 3"""	ZCWCC3		14607086	Standard	NM_015358		Approved	ZCW5, NXP2, KIAA0136	uc002yvi.3	Q14149	OTTHUMG00000086620	ENST00000400485.1:c.16C>A	21.37:g.37692578C>A	ENSP00000383333:p.Pro6Thr	Somatic	6	1		WXS	Illumina HiSeq	Phase_I	8	5	NM_015358	0	0	0	0	0	A8KA92|Q9UEZ2	Missense_Mutation	SNP	ENST00000400485.1	37	CCDS42924.1	.	.	.	.	.	.	.	.	.	.	C	12.61	1.990603	0.35131	.	.	ENSG00000159256	ENST00000400485	T	0.13778	2.56	4.65	2.84	0.33178	.	0.737086	0.13416	N	0.389504	T	0.06781	0.0173	N	0.14661	0.345	0.27815	N	0.941991	B	0.06786	0.001	B	0.06405	0.002	T	0.41034	-0.9531	10	0.07990	T	0.79	-2.4018	8.1544	0.31160	0.0:0.8113:0.0:0.1887	.	6	Q14149	MORC3_HUMAN	T	6	ENSP00000383333:P6T	ENSP00000383333:P6T	P	+	1	0	MORC3	36614448	0.999000	0.42202	1.000000	0.80357	0.985000	0.73830	1.816000	0.38992	0.561000	0.29186	0.563000	0.77884	CCC	.		0.726	MORC3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000194640.1	NM_015358	
CECR6	27439	hgsc.bcm.edu	37	22	17600589	17600589	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr22:17600589C>G	ENST00000331437.3	-	1	1554	c.1429G>C	c.(1429-1431)Gtg>Ctg	p.V477L	CECR6_ENST00000399875.1_Missense_Mutation_p.V122L|AC006946.15_ENST00000441544.1_5'Flank	NM_031890.3	NP_114096.1	Q9BXQ6	CECR6_HUMAN	cat eye syndrome chromosome region, candidate 6	477										haematopoietic_and_lymphoid_tissue(1)	1		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)		Colorectal(9;0.221)		GGCACGTCCACCAGGCAGCCG	0.697																																					p.V477L		.											.	CECR6-90	0			c.G1429C						.						4.0	4.0	4.0					22																	17600589		2023	4042	6065	SO:0001583	missense	27439	exon1			CGTCCACCAGGCA	AF307451	CCDS13740.1, CCDS54494.1	22q11.2	2008-06-12			ENSG00000183307	ENSG00000183307			1844	protein-coding gene	gene with protein product						11381032	Standard	NM_031890		Approved		uc002zmb.2	Q9BXQ6	OTTHUMG00000030471	ENST00000331437.3:c.1429G>C	22.37:g.17600589C>G	ENSP00000329318:p.Val477Leu	Somatic	1	0		WXS	Illumina HiSeq	Phase_I	5	2	NM_031890	0	0	0	0	0	A8MYY1	Missense_Mutation	SNP	ENST00000331437.3	37	CCDS13740.1	.	.	.	.	.	.	.	.	.	.	C	13.11	2.137885	0.37728	.	.	ENSG00000183307	ENST00000399875;ENST00000331437	.	.	.	4.32	4.32	0.51571	.	0.000000	0.53938	U	0.000050	T	0.47820	0.1466	N	0.20986	0.625	0.40994	D	0.984875	P	0.35745	0.518	B	0.39531	0.302	T	0.56571	-0.7957	9	0.59425	D	0.04	.	14.668	0.68924	0.0:1.0:0.0:0.0	.	477	Q9BXQ6	CECR6_HUMAN	L	122;477	.	ENSP00000329318:V477L	V	-	1	0	CECR6	15980589	1.000000	0.71417	1.000000	0.80357	0.501000	0.33797	4.385000	0.59613	2.116000	0.64780	0.462000	0.41574	GTG	.		0.697	CECR6-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000075359.4	NM_031890	
CABIN1	23523	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	24447376	24447376	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr22:24447376C>T	ENST00000398319.2	+	8	1131	c.746C>T	c.(745-747)gCg>gTg	p.A249V	CABIN1_ENST00000263119.5_Missense_Mutation_p.A249V|CABIN1_ENST00000405822.2_Intron	NM_001199281.1	NP_001186210.1	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	249					cell surface receptor signaling pathway (GO:0007166)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of catalytic activity (GO:0043086)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(13)|liver(1)|lung(18)|ovary(5)|pancreas(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						AAGAGGCAAGCGCTGATTGTG	0.542																																					p.A249V		.											.	CABIN1-94	0			c.C746T						.						117.0	102.0	107.0					22																	24447376		2203	4300	6503	SO:0001583	missense	23523	exon8			GGCAAGCGCTGAT	AF072441	CCDS13823.1, CCDS74830.1	22q11.23	2008-09-16			ENSG00000099991	ENSG00000099991			24187	protein-coding gene	gene with protein product		604251				9655484, 9205841	Standard	NM_001199281		Approved	KIAA0330, PPP3IN	uc002zzi.1	Q9Y6J0	OTTHUMG00000150797	ENST00000398319.2:c.746C>T	22.37:g.24447376C>T	ENSP00000381364:p.Ala249Val	Somatic	68	0		WXS	Illumina HiSeq	Phase_I	58	25	NM_001199281	0	0	3	9	6	G5E9F3|Q6PHY0|Q9Y460	Missense_Mutation	SNP	ENST00000398319.2	37	CCDS13823.1	.	.	.	.	.	.	.	.	.	.	C	18.70	3.679191	0.68042	.	.	ENSG00000099991	ENST00000454754;ENST00000263119;ENST00000445422;ENST00000398319;ENST00000536026	T;T;T;T	0.63096	0.33;-0.02;0.33;-0.02	5.32	5.32	0.75619	.	0.105434	0.64402	D	0.000006	T	0.73969	0.3655	L	0.56769	1.78	0.80722	D	1	D;D;D	0.71674	0.986;0.963;0.998	P;B;P	0.61132	0.457;0.373;0.884	T	0.72418	-0.4300	10	0.40728	T	0.16	.	18.4214	0.90591	0.0:1.0:0.0:0.0	.	204;249;249	C9J068;F5H5W5;Q9Y6J0	.;.;CABIN_HUMAN	V	204;249;204;249;249	ENSP00000394209:A204V;ENSP00000263119:A249V;ENSP00000412389:A204V;ENSP00000381364:A249V	ENSP00000263119:A249V	A	+	2	0	CABIN1	22777376	1.000000	0.71417	0.979000	0.43373	0.279000	0.26890	6.486000	0.73629	2.666000	0.90696	0.551000	0.68910	GCG	.		0.542	CABIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320161.2	NM_012295	
NF2	4771	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	30050709	30050709	+	Nonsense_Mutation	SNP	A	A	T			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr22:30050709A>T	ENST00000338641.4	+	5	952	c.511A>T	c.(511-513)Aaa>Taa	p.K171*	NF2_ENST00000413209.2_Intron|NF2_ENST00000347330.5_Intron|NF2_ENST00000403435.1_Nonsense_Mutation_p.K171*|NF2_ENST00000361452.4_Nonsense_Mutation_p.K130*|NF2_ENST00000353887.4_Nonsense_Mutation_p.K88*|NF2_ENST00000334961.7_Nonsense_Mutation_p.K88*|NF2_ENST00000403999.3_Nonsense_Mutation_p.K171*|NF2_ENST00000361676.4_Nonsense_Mutation_p.K129*|NF2_ENST00000361166.4_Nonsense_Mutation_p.K171*|NF2_ENST00000397789.3_Nonsense_Mutation_p.K171*	NM_000268.3|NM_016418.5|NM_181832.2	NP_000259.1|NP_057502.2|NP_861970.1	P35240	MERL_HUMAN	neurofibromin 2 (merlin)	171	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actin cytoskeleton organization (GO:0030036)|cell-cell junction organization (GO:0045216)|ectoderm development (GO:0007398)|hippocampus development (GO:0021766)|lens fiber cell differentiation (GO:0070306)|mesoderm formation (GO:0001707)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of DNA replication (GO:0008156)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of cell differentiation (GO:0045597)|positive regulation of stress fiber assembly (GO:0051496)|regulation of hippo signaling (GO:0035330)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of protein localization to nucleus (GO:1900180)|regulation of protein stability (GO:0031647)|Schwann cell proliferation (GO:0014010)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|cleavage furrow (GO:0032154)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|early endosome (GO:0005769)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)		p.?(3)		NS(1)|bone(2)|breast(5)|central_nervous_system(21)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(17)|large_intestine(9)|liver(1)|lung(9)|meninges(372)|ovary(2)|pituitary(1)|pleura(9)|prostate(1)|skin(7)|soft_tissue(303)|stomach(2)|thyroid(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	776						ATTGCTTCCAAAAAGGGTAAG	0.423			"""D, Mis, N, F, S, O"""		"""meningioma, acoustic neuroma, renal """	"""meningioma, acoustic neuroma"""			Neurofibromatosis, type 2																												p.K171X		.	yes	Rec	yes	Neurofibromatosis type 2	22	22q12.2	4771	neurofibromatosis type 2 gene		O	.	NF2-4696	3	Unknown(3)	large_intestine(1)|stomach(1)|central_nervous_system(1)	c.A511T						.						113.0	114.0	114.0					22																	30050709		2203	4300	6503	SO:0001587	stop_gained	4771	exon5	Familial Cancer Database	NF2, Central Neurofibromatosis, Bilateral Acoustic Neurofibromatosis	CTTCCAAAAAGGG	L11353	CCDS13861.1, CCDS13862.1, CCDS13863.1, CCDS13864.1, CCDS13865.1, CCDS54516.1	22q12.2	2014-09-17	2007-12-17		ENSG00000186575	ENSG00000186575		"""A-kinase anchor proteins"""	7773	protein-coding gene	gene with protein product	"""moesin-ezrin-radixin like"", ""schwannomin"""	607379	"""neurofibromin 2 (bilateral acoustic neuroma)"""			10591208	Standard	NM_000268		Approved	merlin	uc003age.4	P35240	OTTHUMG00000030727	ENST00000338641.4:c.511A>T	22.37:g.30050709A>T	ENSP00000344666:p.Lys171*	Somatic	209	0		WXS	Illumina HiSeq	Phase_I	145	73	NM_000268	0	0	0	0	0	O95683|Q8WUJ2|Q969N0|Q969Q3|Q96T30|Q96T31|Q96T32|Q96T33|Q9BTW3|Q9UNG9|Q9UNH3|Q9UNH4	Nonsense_Mutation	SNP	ENST00000338641.4	37	CCDS13861.1	.	.	.	.	.	.	.	.	.	.	A	41	8.773705	0.98948	.	.	ENSG00000186575	ENST00000338641;ENST00000403435;ENST00000361452;ENST00000397822;ENST00000403999;ENST00000334961;ENST00000353887;ENST00000397789;ENST00000361676;ENST00000361166	.	.	.	5.99	5.99	0.97316	.	0.049049	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.4943	0.84223	1.0:0.0:0.0:0.0	.	.	.	.	X	171;171;130;171;171;88;88;171;129;171	.	.	K	+	1	0	NF2	28380709	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.185000	0.94900	2.291000	0.77112	0.533000	0.62120	AAA	.		0.423	NF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075615.3	NM_000268	
KAT2B	8850	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	20187858	20187858	+	Silent	SNP	C	C	T			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr3:20187858C>T	ENST00000263754.4	+	14	2510	c.2055C>T	c.(2053-2055)taC>taT	p.Y685Y		NM_003884.4	NP_003875.3	Q92831	KAT2B_HUMAN	K(lysine) acetyltransferase 2B	685					cell cycle arrest (GO:0007050)|cellular response to insulin stimulus (GO:0032869)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|gene expression (GO:0010467)|histone H3 acetylation (GO:0043966)|histone H3-K9 acetylation (GO:0043970)|internal peptidyl-lysine acetylation (GO:0018393)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|Notch signaling pathway (GO:0007219)|peptidyl-lysine acetylation (GO:0018394)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein acetylation (GO:0006473)|regulation of protein ADP-ribosylation (GO:0010835)|rhythmic process (GO:0048511)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	A band (GO:0031672)|actomyosin (GO:0042641)|Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|I band (GO:0031674)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)	acetyltransferase activity (GO:0016407)|cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|histone acetyltransferase activity (GO:0004402)|histone deacetylase binding (GO:0042826)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	40						GAAAAGTTTACCCTGGACTTT	0.333																																					p.Y685Y		.											.	KAT2B-228	0			c.C2055T						.						127.0	135.0	132.0					3																	20187858		2203	4300	6503	SO:0001819	synonymous_variant	8850	exon14			AGTTTACCCTGGA	U57316	CCDS2634.1	3p24	2011-07-01	2008-07-04	2008-07-04	ENSG00000114166	ENSG00000114166		"""Chromatin-modifying enzymes / K-acetyltransferases"""	8638	protein-coding gene	gene with protein product		602303	"""p300/CBP-associated factor"""	PCAF		8684459, 9722949	Standard	NM_003884		Approved	P/CAF, GCN5, GCN5L	uc003cbq.3	Q92831	OTTHUMG00000130481	ENST00000263754.4:c.2055C>T	3.37:g.20187858C>T		Somatic	209	0		WXS	Illumina HiSeq	Phase_I	146	70	NM_003884	0	0	5	29	24	Q6NSK1	Silent	SNP	ENST00000263754.4	37	CCDS2634.1																																																																																			.		0.333	KAT2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252880.1	NM_003884	
BAP1	8314	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	52439900	52439900	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr3:52439900A>G	ENST00000460680.1	-	10	1283	c.812T>C	c.(811-813)aTt>aCt	p.I271T	BAP1_ENST00000296288.5_Missense_Mutation_p.I253T	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.I271fs*61(1)		NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		GTGGGTCTGAATCAGCTCTGG	0.542			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															p.I271T	GBM(101;493 1458 7992 21037 25532)	.		Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	.	BAP1-1032	1	Deletion - Frameshift(1)	eye(1)	c.T812C						.						67.0	68.0	68.0					3																	52439900		2203	4300	6503	SO:0001583	missense	8314	exon10			GTCTGAATCAGCT	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.812T>C	3.37:g.52439900A>G	ENSP00000417132:p.Ile271Thr	Somatic	66	0		WXS	Illumina HiSeq	Phase_I	37	14	NM_004656	0	0	8	34	26	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Missense_Mutation	SNP	ENST00000460680.1	37	CCDS2853.1	.	.	.	.	.	.	.	.	.	.	A	15.54	2.864400	0.51482	.	.	ENSG00000163930	ENST00000460680;ENST00000296288	T;T	0.56275	0.47;0.49	5.35	5.35	0.76521	Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (1);	0.102540	0.64402	D	0.000002	T	0.46249	0.1383	L	0.54323	1.7	0.50813	D	0.999895	B	0.27068	0.167	B	0.16722	0.016	T	0.39722	-0.9600	10	0.15066	T	0.55	-9.2188	15.6343	0.76937	1.0:0.0:0.0:0.0	.	271	Q92560	BAP1_HUMAN	T	271;253	ENSP00000417132:I271T;ENSP00000296288:I253T	ENSP00000296288:I253T	I	-	2	0	BAP1	52414940	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.318000	0.72866	2.152000	0.67230	0.459000	0.35465	ATT	.		0.542	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1		
CCDC80	151887	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	112324460	112324460	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr3:112324460A>T	ENST00000206423.3	-	8	3610	c.2657T>A	c.(2656-2658)aTg>aAg	p.M886K	CCDC80_ENST00000439685.2_Missense_Mutation_p.M886K	NM_199511.1|NM_199512.1	NP_955805.1|NP_955806.1	Q76M96	CCD80_HUMAN	coiled-coil domain containing 80	886					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(21)|ovary(3)|pancreas(2)|prostate(4)	51						CACAATCACCATGGACCACAT	0.463																																					p.M886K		.											.	CCDC80-92	0			c.T2657A						.						122.0	101.0	108.0					3																	112324460		2203	4300	6503	SO:0001583	missense	151887	exon8			ATCACCATGGACC	AY333429	CCDS2968.1	3q13.2	2010-12-24			ENSG00000091986	ENSG00000091986			30649	protein-coding gene	gene with protein product	"""steroid sensitive gene 1"""	608298				15325258, 18178152	Standard	XM_005247135		Approved	URB, SSG1, DRO1	uc003dzf.3	Q76M96	OTTHUMG00000159265	ENST00000206423.3:c.2657T>A	3.37:g.112324460A>T	ENSP00000206423:p.Met886Lys	Somatic	76	0		WXS	Illumina HiSeq	Phase_I	51	20	NM_199511	0	0	46	59	13	D3DN67|Q5PR20|Q6GPG9|Q8IVT6|Q8NBV1|Q8NHY8	Missense_Mutation	SNP	ENST00000206423.3	37	CCDS2968.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	24.1|24.1	4.497724|4.497724	0.85069|0.85069	.|.	.|.	ENSG00000091986|ENSG00000091986	ENST00000461431|ENST00000206423;ENST00000439685;ENST00000444594;ENST00000479368	.|T;T;T	.|0.43688	.|0.94;0.94;0.94	5.83|5.83	5.83|5.83	0.93111|0.93111	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.64918|0.64918	0.2642|0.2642	M|M	0.71581|0.71581	2.175|2.175	0.80722|0.80722	D|D	1|1	.|D;D	.|0.58268	.|0.978;0.982	.|D;D	.|0.77004	.|0.98;0.989	T|T	0.67856|0.67856	-0.5562|-0.5562	5|10	.|0.72032	.|D	.|0.01	-33.8731|-33.8731	16.1894|16.1894	0.81975|0.81975	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|897;886	.|Q76M96-2;Q76M96	.|.;CCD80_HUMAN	Q|K	256|886;886;487;164	.|ENSP00000206423:M886K;ENSP00000411814:M886K;ENSP00000418188:M164K	.|ENSP00000206423:M886K	H|M	-|-	3|2	2|0	CCDC80|CCDC80	113807150|113807150	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.287000|9.287000	0.95975|0.95975	2.222000|2.222000	0.72286|0.72286	0.477000|0.477000	0.44152|0.44152	CAT|ATG	.		0.463	CCDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354219.1	NM_199511	
MCF2L2	23101	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	183013205	183013205	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr3:183013205G>A	ENST00000328913.3	-	13	1855	c.1558C>T	c.(1558-1560)Caa>Taa	p.Q520*	MCF2L2_ENST00000414362.2_Nonsense_Mutation_p.Q520*|MCF2L2_ENST00000473233.1_Nonsense_Mutation_p.Q520*|B3GNT5_ENST00000462559.1_Intron|MCF2L2_ENST00000447025.2_Nonsense_Mutation_p.Q520*	NM_015078.2	NP_055893	Q86YR7	MF2L2_HUMAN	MCF.2 cell line derived transforming sequence-like 2	520							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(25)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			AGACTCACTTGCCTCTTGTGA	0.468																																					p.Q520X		.											.	MCF2L2-293	0			c.C1558T						.						173.0	146.0	156.0					3																	183013205		2203	4300	6503	SO:0001587	stop_gained	23101	exon13			TCACTTGCCTCTT	AB020668	CCDS3243.1	3q27	2012-07-24			ENSG00000053524	ENSG00000053524		"""Rho guanine nucleotide exchange factors"""	30319	protein-coding gene	gene with protein product							Standard	NM_015078		Approved	KIAA0861, ARHGEF22	uc003fli.1	Q86YR7	OTTHUMG00000158388	ENST00000328913.3:c.1558C>T	3.37:g.183013205G>A	ENSP00000328118:p.Gln520*	Somatic	87	0		WXS	Illumina HiSeq	Phase_I	118	39	NM_015078	0	0	0	0	0	O94942|Q6P2B8|Q6ZVJ5|Q8N318	Nonsense_Mutation	SNP	ENST00000328913.3	37	CCDS3243.1	.	.	.	.	.	.	.	.	.	.	G	39	7.604425	0.98384	.	.	ENSG00000053524	ENST00000328913;ENST00000473233;ENST00000447025;ENST00000437431;ENST00000414362	.	.	.	4.82	4.82	0.62117	.	0.064498	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	18.1577	0.89699	0.0:0.0:1.0:0.0	.	.	.	.	X	520;520;520;56;520	.	ENSP00000328118:Q520X	Q	-	1	0	MCF2L2	184495899	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.725000	0.68507	2.535000	0.85469	0.650000	0.86243	CAA	.		0.468	MCF2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350868.1	NM_015078	
CLCN2	1181	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	184071937	184071937	+	Missense_Mutation	SNP	C	C	T	rs199539697		TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr3:184071937C>T	ENST00000265593.4	-	15	1844	c.1673G>A	c.(1672-1674)cGa>cAa	p.R558Q	CLCN2_ENST00000423355.2_3'UTR|CLCN2_ENST00000457512.1_Missense_Mutation_p.R558Q|CLCN2_ENST00000475279.1_5'Flank|CLCN2_ENST00000344937.7_Missense_Mutation_p.R541Q|EIF2B5_ENST00000444495.1_Intron|CLCN2_ENST00000434054.2_Missense_Mutation_p.R514Q	NM_004366.5	NP_004357.3	P51788	CLCN2_HUMAN	chloride channel, voltage-sensitive 2	558					cell differentiation involved in salivary gland development (GO:0060689)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|retina development in camera-type eye (GO:0060041)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|voltage-gated chloride channel activity (GO:0005247)			breast(2)|central_nervous_system(4)|endometrium(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	27	all_cancers(143;6.66e-11)|Ovarian(172;0.0339)		Epithelial(37;2.22e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Lubiprostone(DB01046)	TTTCTTGATTCGGATGATGCT	0.632											OREG0015949	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	1	0.000199681	0.0	0.0	5008	,	,		18861	0.0		0.001	False		,,,				2504	0.0				p.R558Q		.											.	CLCN2-90	0			c.G1673A						.						71.0	66.0	68.0					3																	184071937		2203	4300	6503	SO:0001583	missense	1181	exon15			TTGATTCGGATGA	S77770	CCDS3263.1, CCDS54690.1, CCDS54691.1, CCDS54692.1	3q27.1	2013-09-19	2012-02-23		ENSG00000114859	ENSG00000114859		"""Ion channels / Chloride channels : Voltage-sensitive"""	2020	protein-coding gene	gene with protein product		600570	"""chloride channel 2"""			7795595	Standard	NM_004366		Approved	CLC2, EJM6, ClC-2	uc003foi.4	P51788	OTTHUMG00000156747	ENST00000265593.4:c.1673G>A	3.37:g.184071937C>T	ENSP00000265593:p.Arg558Gln	Somatic	66	0	1989	WXS	Illumina HiSeq	Phase_I	90	26	NM_004366	0	0	5	7	2	B4DQT9|B4DZ58|E9PBD9|E9PCD2|O14864|Q6IPA9|Q8WU13	Missense_Mutation	SNP	ENST00000265593.4	37	CCDS3263.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	c	16.38	3.108237	0.56291	.	.	ENSG00000114859	ENST00000265593;ENST00000344937;ENST00000434054;ENST00000457512	D;D;D;D	0.92858	-3.12;-3.12;-3.12;-3.12	5.32	5.32	0.75619	Chloride channel, core (2);	0.000000	0.85682	D	0.000000	D	0.91676	0.7369	L	0.28556	0.865	0.80722	D	1	D;D;D;D;P	0.65815	0.995;0.985;0.991;0.974;0.898	P;P;P;P;B	0.59056	0.714;0.447;0.851;0.447;0.369	D	0.88415	0.3024	10	0.11182	T	0.66	-1.4549	18.635	0.91374	0.0:1.0:0.0:0.0	.	514;558;541;558;514	E9PBD9;E9PCD2;P51788-3;P51788;B4DZ58	.;.;.;CLCN2_HUMAN;.	Q	558;541;514;558	ENSP00000265593:R558Q;ENSP00000345056:R541Q;ENSP00000400425:R514Q;ENSP00000391928:R558Q	ENSP00000265593:R558Q	R	-	2	0	CLCN2	185554631	0.998000	0.40836	0.996000	0.52242	0.995000	0.86356	3.905000	0.56333	2.494000	0.84150	0.563000	0.77884	CGA	C|1.000;T|0.000		0.632	CLCN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345571.1		
TACC3	10460	hgsc.bcm.edu	37	4	1741486	1741486	+	Missense_Mutation	SNP	G	G	A	rs148906614		TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr4:1741486G>A	ENST00000313288.4	+	11	2105	c.1999G>A	c.(1999-2001)Ggg>Agg	p.G667R		NM_006342.2	NP_006333.1	Q9Y6A5	TACC3_HUMAN	transforming, acidic coiled-coil containing protein 3	667					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|cytoplasmic sequestering of transcription factor (GO:0042994)|hemopoiesis (GO:0030097)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of cell cycle (GO:0051726)|regulation of microtubule-based process (GO:0032886)|response to hypoxia (GO:0001666)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(4)|large_intestine(1)|lung(10)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	25		Breast(71;0.212)|all_epithelial(65;0.241)	OV - Ovarian serous cystadenocarcinoma(23;0.00765)|Epithelial(3;0.0126)			GGAGCTCCACGGGAAGAACCT	0.652																																					p.G667R	Ovarian(120;482 2294 11894 35824)	.											.	TACC3-91	0			c.G1999A						.	G	ARG/GLY	1,4379		0,1,2189	95.0	70.0	78.0		1999	0.3	0.0	4	dbSNP_134	78	1,8585		0,1,4292	yes	missense	TACC3	NM_006342.1	125	0,2,6481	AA,AG,GG		0.0116,0.0228,0.0154	benign	667/839	1741486	2,12964	2190	4293	6483	SO:0001583	missense	10460	exon11			CTCCACGGGAAGA	AF093543	CCDS3352.1	4p16.3	2008-07-29			ENSG00000013810	ENSG00000013810			11524	protein-coding gene	gene with protein product		605303				17675670	Standard	NM_006342		Approved	ERIC1	uc003gdo.3	Q9Y6A5	OTTHUMG00000089535	ENST00000313288.4:c.1999G>A	4.37:g.1741486G>A	ENSP00000326550:p.Gly667Arg	Somatic	7	1		WXS	Illumina HiSeq	Phase_I	12	6	NM_006342	0	0	21	36	15	Q2NKK4|Q3KQS5|Q9UMQ1	Missense_Mutation	SNP	ENST00000313288.4	37	CCDS3352.1	.	.	.	.	.	.	.	.	.	.	G	5.473	0.272328	0.10349	2.28E-4	1.16E-4	ENSG00000013810	ENST00000313288	T	0.40225	1.04	4.17	0.332	0.15938	.	1.934300	0.02905	N	0.135884	T	0.15003	0.0362	N	0.01297	-0.9	0.09310	N	1	B;B	0.26081	0.002;0.141	B;B	0.17722	0.002;0.019	T	0.12167	-1.0558	10	0.15952	T	0.53	-3.4805	4.2667	0.10766	0.2974:0.3231:0.3795:0.0	.	667;667	Q2NKK4;Q9Y6A5	.;TACC3_HUMAN	R	667	ENSP00000326550:G667R	ENSP00000326550:G667R	G	+	1	0	TACC3	1711284	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.537000	0.06128	-0.081000	0.12662	-0.827000	0.03088	GGG	G|1.000;A|0.000		0.652	TACC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000203730.2		
TRIM2	23321	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	154249812	154249812	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr4:154249812G>A	ENST00000437508.2	+	11	2273	c.2072G>A	c.(2071-2073)aGc>aAc	p.S691N	TRIM2_ENST00000338700.5_Missense_Mutation_p.S718N	NM_001130067.1	NP_001123539.1	Q9C040	TRIM2_HUMAN	tripartite motif containing 2	691					cell death (GO:0008219)|regulation of neuron apoptotic process (GO:0043523)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|prostate(1)	19	all_hematologic(180;0.093)	Medulloblastoma(177;0.00225)		GBM - Glioblastoma multiforme(119;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0703)		TGGGGAAACAGCAGGATCCAG	0.418																																					p.S718N		.											.	TRIM2-650	0			c.G2153A						.						150.0	142.0	144.0					4																	154249812		2203	4300	6503	SO:0001583	missense	23321	exon11			GAAACAGCAGGAT	AF220018	CCDS3781.2, CCDS47147.1	4q31.3	2013-01-09	2011-01-25		ENSG00000109654	ENSG00000109654		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	15974	protein-coding gene	gene with protein product		614141	"""tripartite motif-containing 2"""			9628581, 11331580	Standard	NM_015271		Approved	KIAA0517, RNF86	uc003inh.2	Q9C040	OTTHUMG00000155991	ENST00000437508.2:c.2072G>A	4.37:g.154249812G>A	ENSP00000415812:p.Ser691Asn	Somatic	88	0		WXS	Illumina HiSeq	Phase_I	121	44	NM_015271	0	0	0	0	0	D3DP09|O60272|Q9BSI9|Q9UFZ1	Missense_Mutation	SNP	ENST00000437508.2	37	CCDS47147.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.058382	0.76074	.	.	ENSG00000109654	ENST00000437508;ENST00000338700	T;T	0.71222	-0.55;-0.55	5.42	5.42	0.78866	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	T	0.69052	0.3068	N	0.10664	0.02	0.80722	D	1	D;D	0.62365	0.991;0.991	D;D	0.74023	0.982;0.982	T	0.65709	-0.6102	10	0.11485	T	0.65	-19.2289	19.2133	0.93766	0.0:0.0:1.0:0.0	.	718;691	D3DP09;Q9C040	.;TRIM2_HUMAN	N	691;718	ENSP00000415812:S691N;ENSP00000339659:S718N	ENSP00000339659:S718N	S	+	2	0	TRIM2	154469262	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.865000	0.99609	2.534000	0.85438	0.650000	0.86243	AGC	.		0.418	TRIM2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342652.1		
FAT1	2195	hgsc.bcm.edu;bcgsc.ca	37	4	187541246	187541246	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr4:187541246G>A	ENST00000441802.2	-	10	6703	c.6494C>T	c.(6493-6495)tCa>tTa	p.S2165L		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	2165	Cadherin 19. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						AACTTCCGCTGAAAAGGCCGG	0.423										HNSCC(5;0.00058)																											p.S2165L	Colon(197;1040 2055 4143 4984 49344)	.											.	FAT1-34	0			c.C6494T						.						59.0	58.0	59.0					4																	187541246		1893	4111	6004	SO:0001583	missense	2195	exon10			TCCGCTGAAAAGG	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.6494C>T	4.37:g.187541246G>A	ENSP00000406229:p.Ser2165Leu	Somatic	58	0		WXS	Illumina HiSeq	Phase_I	55	5	NM_005245	0	0	44	44	0		Missense_Mutation	SNP	ENST00000441802.2	37	CCDS47177.1	.	.	.	.	.	.	.	.	.	.	G	14.60	2.585000	0.46110	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	T	0.03553	3.89	5.05	5.05	0.67936	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.19927	0.0479	M	0.85099	2.735	0.80722	D	1	D	0.59767	0.986	D	0.63033	0.91	T	0.00679	-1.1613	10	0.44086	T	0.13	.	18.5902	0.91208	0.0:0.0:1.0:0.0	.	2165	Q14517	FAT1_HUMAN	L	2165;2167	ENSP00000406229:S2165L	ENSP00000260147:S2167L	S	-	2	0	FAT1	187778240	1.000000	0.71417	0.148000	0.22405	0.036000	0.12997	9.615000	0.98356	2.619000	0.88677	0.655000	0.94253	TCA	.		0.423	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245	
MAP1B	4131	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	71479648	71479648	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr5:71479648C>A	ENST00000296755.7	+	3	663	c.365C>A	c.(364-366)aCc>aAc	p.T122N		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	122					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		GCAGTCAGCACCGAGGTAAGC	0.527																																					p.T122N	Melanoma(17;367 822 11631 31730 47712)	.											.	MAP1B-155	0			c.C365A						.						129.0	124.0	126.0					5																	71479648		2203	4300	6503	SO:0001583	missense	4131	exon3			TCAGCACCGAGGT	L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.365C>A	5.37:g.71479648C>A	ENSP00000296755:p.Thr122Asn	Somatic	109	0		WXS	Illumina HiSeq	Phase_I	143	44	NM_005909	0	0	0	0	0	A2BDK5	Missense_Mutation	SNP	ENST00000296755.7	37	CCDS4012.1	.	.	.	.	.	.	.	.	.	.	C	19.54	3.846103	0.71603	.	.	ENSG00000131711	ENST00000512974;ENST00000296755;ENST00000511641	T;T;T	0.19806	3.77;2.12;2.12	5.14	5.14	0.70334	.	0.000000	0.64402	D	0.000004	T	0.44435	0.1293	L	0.54323	1.7	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.28996	-1.0026	10	0.56958	D	0.05	-15.6336	18.9656	0.92695	0.0:1.0:0.0:0.0	.	122	P46821	MAP1B_HUMAN	N	122	ENSP00000426312:T122N;ENSP00000296755:T122N;ENSP00000423444:T122N	ENSP00000296755:T122N	T	+	2	0	MAP1B	71515404	1.000000	0.71417	0.983000	0.44433	0.241000	0.25554	7.301000	0.78850	2.543000	0.85770	0.637000	0.83480	ACC	.		0.527	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218561.6	NM_005909	
ARHGEF28	64283	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	73165934	73165934	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr5:73165934T>A	ENST00000426542.2	+	20	2486	c.2466T>A	c.(2464-2466)gaT>gaA	p.D822E	ARHGEF28_ENST00000287898.5_Missense_Mutation_p.D822E|ARHGEF28_ENST00000296794.6_Missense_Mutation_p.D822E|ARHGEF28_ENST00000545377.1_Missense_Mutation_p.D822E|ARHGEF28_ENST00000437974.1_Missense_Mutation_p.D822E|ARHGEF28_ENST00000296799.4_Missense_Mutation_p.D509E|ARHGEF28_ENST00000513042.2_Missense_Mutation_p.D822E			Q8N1W1	ARG28_HUMAN	Rho guanine nucleotide exchange factor (GEF) 28	822					central nervous system neuron axonogenesis (GO:0021955)|intracellular signal transduction (GO:0035556)|neurofilament cytoskeleton organization (GO:0060052)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|RNA binding (GO:0003723)										TCAGCAGTGATGCCCAGGAGT	0.413																																					p.D822E		.											.	.	0			c.T2466A						.						196.0	184.0	188.0					5																	73165934		1924	4131	6055	SO:0001583	missense	64283	exon21			CAGTGATGCCCAG		CCDS47231.1, CCDS47231.2, CCDS54870.1, CCDS58957.1	5q13.2	2012-08-08			ENSG00000214944	ENSG00000214944			30322	protein-coding gene	gene with protein product		612790				9199174, 11058585	Standard	NM_001177693		Approved	RGNEF, p190RhoGEF, RIP2	uc010izf.3	Q8N1W1	OTTHUMG00000162454	ENST00000426542.2:c.2466T>A	5.37:g.73165934T>A	ENSP00000412175:p.Asp822Glu	Somatic	168	0		WXS	Illumina HiSeq	Phase_I	185	67	NM_001080479	0	0	28	56	28	B2RXG7|B4E3K4|B5MDA3|B7ZW32|E9PC75|Q8NCM7|Q96E37|Q9H6L3|Q9H6W0	Missense_Mutation	SNP	ENST00000426542.2	37	CCDS54870.1	.	.	.	.	.	.	.	.	.	.	T	13.25	2.182575	0.38511	.	.	ENSG00000214944	ENST00000296794;ENST00000545377;ENST00000513042;ENST00000287898;ENST00000437974;ENST00000426542;ENST00000296799	T;T;T;T;T;T;T	0.11821	2.92;2.91;2.91;2.8;2.91;2.91;2.74	5.95	-3.02	0.05446	.	.	.	.	.	T	0.10294	0.0252	L	0.55834	1.745	0.26232	N	0.979	B;B;B;B	0.26318	0.146;0.09;0.017;0.029	B;B;B;B	0.23852	0.036;0.047;0.049;0.045	T	0.35226	-0.9797	9	0.25106	T	0.35	.	4.0067	0.09605	0.1088:0.3977:0.1124:0.3811	.	509;822;822;822	B5MDA3;Q8N1W1;E9PC75;Q8N1W1-4	.;RGNEF_HUMAN;.;.	E	822;822;822;822;822;822;509	ENSP00000296794:D822E;ENSP00000441913:D822E;ENSP00000441436:D822E;ENSP00000287898:D822E;ENSP00000411459:D822E;ENSP00000412175:D822E;ENSP00000296799:D509E	ENSP00000287898:D822E	D	+	3	2	RP11-428C6.1	73201690	0.517000	0.26226	0.967000	0.41034	0.996000	0.88848	-0.287000	0.08388	-0.749000	0.04747	-0.250000	0.11733	GAT	.		0.413	ARHGEF28-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000368975.1		
SNCAIP	9627	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	121787084	121787084	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr5:121787084T>G	ENST00000261368.8	+	10	2804	c.2542T>G	c.(2542-2544)Tcc>Gcc	p.S848A	CTC-210G5.1_ENST00000505546.1_RNA|CTC-210G5.1_ENST00000506053.1_RNA|CTC-210G5.1_ENST00000503529.1_RNA|SNCAIP_ENST00000379538.3_Missense_Mutation_p.S482A|SNCAIP_ENST00000542191.1_Missense_Mutation_p.S406A|SNCAIP_ENST00000504884.2_3'UTR|SNCAIP_ENST00000379533.2_Missense_Mutation_p.S895A|CTC-210G5.1_ENST00000509993.1_RNA|SNCAIP_ENST00000503116.2_3'UTR|SNCAIP_ENST00000261367.7_Missense_Mutation_p.S895A|SNCAIP_ENST00000414317.2_Missense_Mutation_p.S450A|CTC-210G5.1_ENST00000510972.1_RNA|SNCAIP_ENST00000379536.2_Missense_Mutation_p.S788A	NM_005460.2	NP_005451.2	Q9Y6H5	SNCAP_HUMAN	synuclein, alpha interacting protein	848					cell death (GO:0008219)|dopamine metabolic process (GO:0042417)|regulation of inclusion body assembly (GO:0090083)|regulation of neurotransmitter secretion (GO:0046928)	cytoplasm (GO:0005737)|neuronal cell body (GO:0043025)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	identical protein binding (GO:0042802)|ubiquitin protein ligase binding (GO:0031625)			NS(3)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	39		all_cancers(142;0.00787)|Prostate(80;0.0327)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000625)|Epithelial(69;0.00216)|all cancers(49;0.0232)		CCAGCGGACCTCCACAAGTAA	0.463																																					p.S848A		.											.	SNCAIP-92	0			c.T2542G						.						88.0	92.0	91.0					5																	121787084		2203	4300	6503	SO:0001583	missense	9627	exon10			CGGACCTCCACAA	AF167306	CCDS4131.1, CCDS58964.1	5q23.2	2013-01-10	2008-07-31		ENSG00000064692	ENSG00000064692		"""Ankyrin repeat domain containing"""	11139	protein-coding gene	gene with protein product	"""synphilin"""	603779				10319874	Standard	NM_001242935		Approved	SYPH1	uc003ksw.1	Q9Y6H5	OTTHUMG00000128915	ENST00000261368.8:c.2542T>G	5.37:g.121787084T>G	ENSP00000261368:p.Ser848Ala	Somatic	104	0		WXS	Illumina HiSeq	Phase_I	96	31	NM_005460	0	0	2	2	0	D3DSZ1|Q05BS1|Q1PSC2|Q49AC6|Q504U9|Q6L984|Q6L985|Q6L986|Q9HC59	Missense_Mutation	SNP	ENST00000261368.8	37	CCDS4131.1	.	.	.	.	.	.	.	.	.	.	T	10.08	1.252348	0.22880	.	.	ENSG00000064692	ENST00000542191;ENST00000509154;ENST00000261368;ENST00000379533;ENST00000379536;ENST00000379538;ENST00000261367;ENST00000414317	T;T;T;T;T;T;T;T	0.14266	4.35;4.88;2.57;2.52;4.88;4.81;2.52;4.56	5.69	2.03	0.26663	.	0.412591	0.28730	N	0.014337	T	0.08935	0.0221	L	0.36672	1.1	0.22737	N	0.998792	B;B;B;B;B;B;B;B	0.33777	0.3;0.048;0.252;0.264;0.425;0.264;0.264;0.104	B;B;B;B;B;B;B;B	0.31101	0.049;0.024;0.035;0.124;0.105;0.124;0.124;0.058	T	0.25257	-1.0137	10	0.31617	T	0.26	-3.6974	6.4307	0.21794	0.0:0.5607:0.0:0.4393	.	788;476;450;788;482;482;895;848	D6R9G8;Q9NVG1;B7Z995;Q9Y6H5-4;Q9Y6H5-5;Q9Y6H5-2;Q9Y6H5-3;Q9Y6H5	.;.;.;.;.;.;.;SNCAP_HUMAN	A	406;788;848;895;788;482;895;450	ENSP00000441681:S406A;ENSP00000422106:S788A;ENSP00000261368:S848A;ENSP00000368848:S895A;ENSP00000368851:S788A;ENSP00000368854:S482A;ENSP00000261367:S895A;ENSP00000394392:S450A	ENSP00000261367:S895A	S	+	1	0	SNCAIP	121814983	0.997000	0.39634	0.066000	0.19879	0.144000	0.21451	1.753000	0.38359	0.438000	0.26450	0.533000	0.62120	TCC	.		0.463	SNCAIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250888.1		
FAT2	2196	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	150946163	150946163	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr5:150946163G>C	ENST00000261800.5	-	1	2342	c.2330C>G	c.(2329-2331)cCc>cGc	p.P777R		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	777	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ATAGTCCAAGGGAGCAGCTAC	0.498																																					p.P777R		.											.	FAT2-96	0			c.C2330G						.						60.0	60.0	60.0					5																	150946163		2203	4300	6503	SO:0001583	missense	2196	exon1			TCCAAGGGAGCAG	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.2330C>G	5.37:g.150946163G>C	ENSP00000261800:p.Pro777Arg	Somatic	68	0		WXS	Illumina HiSeq	Phase_I	69	25	NM_001447	0	0	0	0	0	O75091|Q9NSR7	Missense_Mutation	SNP	ENST00000261800.5	37	CCDS4317.1	.	.	.	.	.	.	.	.	.	.	G	15.69	2.907163	0.52333	.	.	ENSG00000086570	ENST00000261800	T	0.54071	0.59	5.78	4.91	0.64330	Cadherin (4);Cadherin-like (1);	0.317848	0.27336	N	0.019825	T	0.64227	0.2579	M	0.76002	2.32	0.35862	D	0.827587	D	0.55172	0.97	P	0.57101	0.813	T	0.69771	-0.5055	10	0.21540	T	0.41	.	12.0874	0.53706	0.1385:0.0:0.8615:0.0	.	777	Q9NYQ8	FAT2_HUMAN	R	777	ENSP00000261800:P777R	ENSP00000261800:P777R	P	-	2	0	FAT2	150926356	1.000000	0.71417	0.369000	0.25952	0.700000	0.40528	6.639000	0.74314	1.580000	0.49851	0.655000	0.94253	CCC	.		0.498	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447	
ATP6V0E1	8992	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	172410944	172410944	+	Silent	SNP	C	C	T			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr5:172410944C>T	ENST00000519374.1	+	1	185	c.81C>T	c.(79-81)ttC>ttT	p.F27F	ATP6V0E1_ENST00000265093.4_Silent_p.F27F|ATP6V0E1_ENST00000517669.1_Silent_p.F27F|ATP6V0E1_ENST00000519911.1_Silent_p.F27F	NM_003945.3	NP_003936.1	O15342	VA0E1_HUMAN	ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e1	27					ATP hydrolysis coupled proton transport (GO:0015991)|cell growth (GO:0016049)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|response to amino acid (GO:0043200)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|vacuolar acidification (GO:0007035)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|phagocytic vesicle membrane (GO:0030670)|proton-transporting V-type ATPase, V0 domain (GO:0033179)	ATPase activity, coupled to transmembrane movement of ions (GO:0042625)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transporter activity (GO:0005215)			lung(2)	2	Renal(175;0.000159)|Lung NSC(126;0.00223)|all_lung(126;0.00391)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TGCCTTGGTTCATCCCTAAGG	0.647																																					p.F27F		.											.	ATP6V0E1-90	0			c.C81T						.						188.0	172.0	177.0					5																	172410944		2203	4300	6503	SO:0001819	synonymous_variant	8992	exon1			TTGGTTCATCCCT	Y15286	CCDS4383.1	5q35.2	2010-04-21	2006-10-12	2006-10-12	ENSG00000113732	ENSG00000113732		"""ATPases / V-type"""	863	protein-coding gene	gene with protein product		603931	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) 9kD"", ""ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e"""	ATP6H, ATP6V0E		9556572, 14970230	Standard	NM_003945		Approved	M9.2	uc003mcd.1	O15342	OTTHUMG00000130518	ENST00000519374.1:c.81C>T	5.37:g.172410944C>T		Somatic	228	0		WXS	Illumina HiSeq	Phase_I	261	93	NM_003945	0	0	233	388	155	B2R557|D3DQM1|Q6IBE8	Silent	SNP	ENST00000519374.1	37	CCDS4383.1																																																																																			.		0.647	ATP6V0E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252935.2	NM_003945	
DSP	1832	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	7562980	7562980	+	Nonsense_Mutation	SNP	T	T	A			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr6:7562980T>A	ENST00000379802.3	+	5	1034	c.693T>A	c.(691-693)taT>taA	p.Y231*	DSP_ENST00000418664.2_Nonsense_Mutation_p.Y231*	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	231	Globular 1.|Interacts with plakophilin 1 and junction plakoglobin.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		TCGGCGACTATCGCTGGCAGC	0.522																																					p.Y231X		.											.	DSP-518	0			c.T693A						.						119.0	121.0	120.0					6																	7562980		2203	4300	6503	SO:0001587	stop_gained	1832	exon5			CGACTATCGCTGG	J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.693T>A	6.37:g.7562980T>A	ENSP00000369129:p.Tyr231*	Somatic	97	0		WXS	Illumina HiSeq	Phase_I	117	82	NM_004415	0	0	1	2	1	B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Nonsense_Mutation	SNP	ENST00000379802.3	37	CCDS4501.1	.	.	.	.	.	.	.	.	.	.	T	39	7.901730	0.98551	.	.	ENSG00000096696	ENST00000379802;ENST00000418664;ENST00000397483	.	.	.	5.76	-1.12	0.09808	.	0.000000	0.53938	D	0.000046	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20519	T	0.43	.	11.7621	0.51910	0.0:0.2532:0.0:0.7468	.	.	.	.	X	231;231;36	.	ENSP00000369129:Y231X	Y	+	3	2	DSP	7507979	0.948000	0.32251	0.998000	0.56505	0.948000	0.59901	0.032000	0.13732	-0.099000	0.12263	0.533000	0.62120	TAT	.		0.522	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039786.2	NM_004415	
HCRTR2	3062	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	55142265	55142265	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr6:55142265T>C	ENST00000370862.3	+	5	1186	c.850T>C	c.(850-852)Tcc>Ccc	p.S284P		NM_001526.3	NP_001517.2	O43614	OX2R_HUMAN	hypocretin (orexin) receptor 2	284					circadian sleep/wake cycle process (GO:0022410)|feeding behavior (GO:0007631)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|orexin receptor activity (GO:0016499)			breast(3)|endometrium(2)|kidney(1)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	46	Lung NSC(77;0.107)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			GCCAACGAAGTCCCGGATGAG	0.507																																					p.S284P		.											.	HCRTR2-525	0			c.T850C						.						70.0	74.0	73.0					6																	55142265		2203	4300	6503	SO:0001583	missense	3062	exon5			ACGAAGTCCCGGA	AF041245	CCDS4956.1	6p12.1	2012-09-20			ENSG00000137252	ENSG00000137252		"""GPCR / Class A : Hypocretin (orexin) receptors"""	4849	protein-coding gene	gene with protein product		602393				9491897	Standard	NM_001526		Approved	OX2R	uc003pcl.3	O43614	OTTHUMG00000016150	ENST00000370862.3:c.850T>C	6.37:g.55142265T>C	ENSP00000359899:p.Ser284Pro	Somatic	57	0		WXS	Illumina HiSeq	Phase_I	75	28	NM_001526	0	0	0	0	0	Q5VTM0	Missense_Mutation	SNP	ENST00000370862.3	37	CCDS4956.1	.	.	.	.	.	.	.	.	.	.	T	9.734	1.163040	0.21538	.	.	ENSG00000137252	ENST00000370862	T	0.63580	-0.05	5.84	2.09	0.27110	GPCR, rhodopsin-like superfamily (1);	0.177378	0.51477	D	0.000100	T	0.28896	0.0717	L	0.44542	1.39	0.33540	D	0.594739	B	0.02656	0.0	B	0.08055	0.003	T	0.04607	-1.0939	10	0.25751	T	0.34	.	8.2143	0.31503	0.0:0.0661:0.262:0.6719	.	284	O43614	OX2R_HUMAN	P	284	ENSP00000359899:S284P	ENSP00000359899:S284P	S	+	1	0	HCRTR2	55250224	1.000000	0.71417	0.999000	0.59377	0.622000	0.37654	2.200000	0.42724	0.123000	0.18342	0.528000	0.53228	TCC	.		0.507	HCRTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043392.1		
AMD1	262	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	111213388	111213388	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr6:111213388G>A	ENST00000368885.3	+	5	788	c.452G>A	c.(451-453)cGt>cAt	p.R151H	AMD1_ENST00000368877.5_Missense_Mutation_p.R122H|AMD1_ENST00000368876.1_Missense_Mutation_p.R82H|AMD1_ENST00000368882.3_Missense_Mutation_p.R3H|AMD1_ENST00000451850.2_Intron	NM_001634.4	NP_001625.2	P17707	DCAM_HUMAN	adenosylmethionine decarboxylase 1	151					cellular nitrogen compound metabolic process (GO:0034641)|polyamine metabolic process (GO:0006595)|S-adenosylmethioninamine biosynthetic process (GO:0006557)|small molecule metabolic process (GO:0044281)|spermidine biosynthetic process (GO:0008295)|spermine biosynthetic process (GO:0006597)	cytosol (GO:0005829)	adenosylmethionine decarboxylase activity (GO:0004014)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(2)	8		all_cancers(87;3.83e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0209)		OV - Ovarian serous cystadenocarcinoma(136;0.0522)|Epithelial(106;0.111)|all cancers(137;0.143)	S-Adenosylmethionine(DB00118)	TGTATGGGACGTATGAATTCT	0.333																																					p.R151H		.											.	AMD1-91	0			c.G452A						.						316.0	293.0	301.0					6																	111213388		2203	4300	6503	SO:0001583	missense	262	exon5			TGGGACGTATGAA	M88006	CCDS5086.1, CCDS75504.1, CCDS75505.1	6q21	2014-05-13			ENSG00000123505	ENSG00000123505	4.1.1.50		457	protein-coding gene	gene with protein product		180980	"""S-adenosylmethionine decarboxylase 1"""				Standard	NM_001634		Approved	SAMDC	uc003puk.1	P17707	OTTHUMG00000015369	ENST00000368885.3:c.452G>A	6.37:g.111213388G>A	ENSP00000357880:p.Arg151His	Somatic	358	0		WXS	Illumina HiSeq	Phase_I	392	130	NM_001634	0	0	17	35	18	E1P5F7|Q5VXN4|Q5VXN6|Q9BWK4	Missense_Mutation	SNP	ENST00000368885.3	37	CCDS5086.1	.	.	.	.	.	.	.	.	.	.	G	15.38	2.816905	0.50633	.	.	ENSG00000123505	ENST00000368885;ENST00000368882;ENST00000368877;ENST00000368876	.	.	.	5.3	4.43	0.53597	S-adenosylmethionine decarboxylase, core (2);	0.108147	0.64402	D	0.000006	T	0.26011	0.0634	N	0.20304	0.555	0.58432	D	0.999999	B;B	0.24721	0.038;0.11	B;B	0.21546	0.007;0.035	T	0.13019	-1.0525	9	0.46703	T	0.11	.	12.2225	0.54441	0.0796:0.0:0.9204:0.0	.	122;151	A6NNH3;P17707	.;DCAM_HUMAN	H	151;3;122;82	.	ENSP00000357870:R82H	R	+	2	0	AMD1	111320081	1.000000	0.71417	0.985000	0.45067	0.991000	0.79684	7.503000	0.81632	1.237000	0.43756	0.491000	0.48974	CGT	.		0.333	AMD1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041816.1		
MTFR2	113115	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	136562761	136562761	+	Missense_Mutation	SNP	C	C	T	rs150447506		TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr6:136562761C>T	ENST00000420702.1	-	5	724	c.335G>A	c.(334-336)cGa>cAa	p.R112Q	MTFR2_ENST00000451457.2_Missense_Mutation_p.R112Q	NM_001099286.1	NP_001092756.1	Q6P444	MTFR2_HUMAN	mitochondrial fission regulator 2	112					aerobic respiration (GO:0009060)|mitochondrial fission (GO:0000266)|mitochondrion organization (GO:0007005)	mitochondrion (GO:0005739)											CCGAACTAGTCGCAAAGGATG	0.368																																					p.R112Q		.											.	.	0			c.G335A						.	C	GLN/ARG,GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	103.0	98.0	100.0		335,335	0.4	0.0	6	dbSNP_134	100	0,8600		0,0,4300	no	missense,missense	FAM54A	NM_001099286.1,NM_138419.3	43,43	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign,benign	112/386,112/386	136562761	1,13005	2203	4300	6503	SO:0001583	missense	113115	exon5			ACTAGTCGCAAAG	BC011716	CCDS5176.1	6q23.2	2012-11-30	2012-11-29	2012-11-29	ENSG00000146410	ENSG00000146410			21115	protein-coding gene	gene with protein product			"""DUF729 domain containing 1"", ""family with sequence similarity 54, member A"""	DUFD1, FAM54A			Standard	NM_138419		Approved		uc003qgt.1	Q6P444	OTTHUMG00000015643	ENST00000420702.1:c.335G>A	6.37:g.136562761C>T	ENSP00000395232:p.Arg112Gln	Somatic	110	0		WXS	Illumina HiSeq	Phase_I	108	26	NM_138419	0	0	3	3	0	A8K8D8|E1P585|Q5JWR7|Q6ZUE8|Q7L3U6|Q9BZ39	Missense_Mutation	SNP	ENST00000420702.1	37	CCDS5176.1	.	.	.	.	.	.	.	.	.	.	C	7.761	0.705340	0.15172	2.27E-4	0.0	ENSG00000146410	ENST00000451457;ENST00000420702;ENST00000418509	T;T;T	0.40225	1.04;1.04;1.04	5.59	0.386	0.16254	.	1.138940	0.06310	N	0.702535	T	0.04543	0.0124	N	0.01576	-0.805	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34875	-0.9811	10	0.12103	T	0.63	-2.0017	7.6241	0.28202	0.0:0.1662:0.5365:0.2973	.	112	Q6P444	FA54A_HUMAN	Q	112;112;69	ENSP00000407010:R112Q;ENSP00000395232:R112Q;ENSP00000410861:R69Q	ENSP00000410861:R69Q	R	-	2	0	FAM54A	136604454	0.001000	0.12720	0.029000	0.17559	0.165000	0.22458	0.681000	0.25320	0.072000	0.16694	-1.673000	0.00743	CGA	C|1.000;T|0.000		0.368	MTFR2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042378.2	NM_138419	
POU6F2	11281	hgsc.bcm.edu	37	7	39379265	39379265	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr7:39379265T>C	ENST00000403058.1	+	6	690	c.536T>C	c.(535-537)cTc>cCc	p.L179P	POU6F2_ENST00000518318.2_Missense_Mutation_p.L179P|POU6F2_ENST00000559001.1_Missense_Mutation_p.L171P|POU6F2_ENST00000517348.1_3'UTR	NM_001166018.1|NM_007252.3	NP_001159490.1|NP_009183.3	P78424	PO6F2_HUMAN	POU class 6 homeobox 2	179	Gln-rich.				central nervous system development (GO:0007417)|ganglion mother cell fate determination (GO:0007402)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(16)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	42						AACTCCCAGCTCcagcagctc	0.597																																					p.L179P		.											.	POU6F2-90	0			c.T536C						.						23.0	22.0	22.0					7																	39379265		2157	4246	6403	SO:0001583	missense	11281	exon6			CCCAGCTCCAGCA	U91934	CCDS34620.2, CCDS55103.1	7p14.1	2011-06-20	2007-07-13		ENSG00000106536	ENSG00000106536		"""Homeoboxes / POU class"""	21694	protein-coding gene	gene with protein product	"""Retina-derived POU-domain factor-1"""	609062	"""POU domain, class 6, transcription factor 2"""			8601806	Standard	NM_007252		Approved	RPF-1	uc003thb.2	P78424	OTTHUMG00000150803	ENST00000403058.1:c.536T>C	7.37:g.39379265T>C	ENSP00000384004:p.Leu179Pro	Somatic	37	1		WXS	Illumina HiSeq	Phase_I	40	2	NM_007252	0	0	0	0	0	A4D1W2|C4AMB9|P78425|Q75ME8|Q86UM6|Q9UDS7	Missense_Mutation	SNP	ENST00000403058.1	37	CCDS34620.2	.	.	.	.	.	.	.	.	.	.	T	15.61	2.885697	0.51908	.	.	ENSG00000106536	ENST00000403058;ENST00000518318	T;D	0.87966	0.92;-2.32	4.81	4.81	0.61882	.	0.558894	0.15782	U	0.244891	D	0.90995	0.7168	L	0.46157	1.445	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.91635	0.999;0.995	D	0.90270	0.4307	10	0.49607	T	0.09	.	14.3463	0.66665	0.0:0.0:0.0:1.0	.	179;179	P78424-2;P78424	.;PO6F2_HUMAN	P	179	ENSP00000384004:L179P;ENSP00000430514:L179P	ENSP00000384004:L179P	L	+	2	0	POU6F2	39345790	1.000000	0.71417	0.912000	0.35992	0.996000	0.88848	6.212000	0.72188	1.785000	0.52413	0.455000	0.32223	CTC	.		0.597	POU6F2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320146.3	NM_007252	
ABCA13	154664	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	48284203	48284203	+	Silent	SNP	G	G	A			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr7:48284203G>A	ENST00000435803.1	+	11	1317	c.1293G>A	c.(1291-1293)ttG>ttA	p.L431L		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	431					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TGCAAAGCTTGCTGCAAAACC	0.388																																					p.L431L		.											.	ABCA13-521	0			c.G1293A						.						58.0	57.0	57.0					7																	48284203		1824	4082	5906	SO:0001819	synonymous_variant	154664	exon11			AAGCTTGCTGCAA	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.1293G>A	7.37:g.48284203G>A		Somatic	47	0		WXS	Illumina HiSeq	Phase_I	54	21	NM_152701	0	0	0	0	0	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Silent	SNP	ENST00000435803.1	37	CCDS47584.1																																																																																			.		0.388	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
CTAGE6	340307	hgsc.bcm.edu	37	7	143454218	143454218	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr7:143454218T>G	ENST00000470691.2	-	1	571	c.534A>C	c.(532-534)gaA>gaC	p.E178D	RNU6-267P_ENST00000516714.1_RNA	NM_178561.4	NP_848656.2	Q86UF2	CTGE6_HUMAN	CTAGE family, member 6	178						integral component of membrane (GO:0016021)						Melanoma(164;0.0903)					TTGACTCATCTTCTAGAGACT	0.338																																					p.E178D		.											.	.	0			c.A534C						.						1.0	1.0	1.0					7																	143454218		5	6	11	SO:0001583	missense	340307	exon1			CTCATCTTCTAGA	BC043153	CCDS64790.1	7q35	2013-05-22	2013-02-25	2013-02-25	ENSG00000271321	ENSG00000271321			28644	protein-coding gene	gene with protein product			"""CTAGE family, member 6, pseudogene"""	CTAGE6P		12477932	Standard	NM_178561		Approved	MGC41943	uc003wdk.4	Q86UF2	OTTHUMG00000157770	ENST00000470691.2:c.534A>C	7.37:g.143454218T>G	ENSP00000474388:p.Glu178Asp	Somatic	194	0		WXS	Illumina HiSeq	Phase_I	215	17	NM_178561	0	0	18	18	0	A4FU29|Q3ZCM5	Missense_Mutation	SNP	ENST00000470691.2	37																																																																																				.		0.338	CTAGE6-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000349580.2	NM_178561	
EBF2	64641	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	25766046	25766046	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr8:25766046A>C	ENST00000520164.1	-	7	1114	c.577T>G	c.(577-579)Tgc>Ggc	p.C193G	EBF2_ENST00000408929.3_Missense_Mutation_p.C45G	NM_022659.3	NP_073150.2	Q9HAK2	COE2_HUMAN	early B-cell factor 2	193					adipose tissue development (GO:0060612)|brown fat cell differentiation (GO:0050873)|cell fate determination (GO:0001709)|positive regulation of chromatin binding (GO:0035563)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(3)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	39		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)		TTCTGATTGCACTTGAGGAAA	0.373																																					p.C193G	Esophageal Squamous(166;1018 1046 3854 8328 13429 13634 14071 26624 32918)	.											.	EBF2-26	0			c.T577G						.						73.0	71.0	72.0					8																	25766046		1820	4100	5920	SO:0001583	missense	64641	exon7			GATTGCACTTGAG	AK021562, AK001144	CCDS43726.1	8p21.1	2007-07-26			ENSG00000221818	ENSG00000221818			19090	protein-coding gene	gene with protein product		609934				9151732	Standard	NM_022659		Approved	FLJ11500, COE2	uc003xes.2	Q9HAK2	OTTHUMG00000163838	ENST00000520164.1:c.577T>G	8.37:g.25766046A>C	ENSP00000430241:p.Cys193Gly	Somatic	56	1		WXS	Illumina HiSeq	Phase_I	65	23	NM_022659	0	0	0	0	0	A0PJM4|A6NMF7|F5H645|Q66VZ3|Q6DK36|Q6IS86|Q6ISA4	Missense_Mutation	SNP	ENST00000520164.1	37	CCDS43726.1	.	.	.	.	.	.	.	.	.	.	A	19.14	3.770471	0.69992	.	.	ENSG00000221818	ENST00000520164;ENST00000408929	T;T	0.52057	0.69;0.68	5.77	5.77	0.91146	.	0.000000	0.85682	U	0.000000	T	0.69984	0.3172	M	0.80183	2.485	0.80722	D	1	D	0.71674	0.998	D	0.67231	0.95	T	0.74621	-0.3604	10	0.87932	D	0	.	16.383	0.83481	1.0:0.0:0.0:0.0	.	193	Q9HAK2	COE2_HUMAN	G	193;45	ENSP00000430241:C193G;ENSP00000386178:C45G	ENSP00000386178:C45G	C	-	1	0	EBF2	25821963	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.287000	0.95975	2.326000	0.78906	0.533000	0.62120	TGC	.		0.373	EBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375886.2	NM_022659	
ZBTB10	65986	hgsc.bcm.edu	37	8	81431606	81431606	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr8:81431606T>C	ENST00000430430.1	+	7	3238	c.2459T>C	c.(2458-2460)gTa>gCa	p.V820A	ZBTB10_ENST00000379091.4_Missense_Mutation_p.V528A|ZBTB10_ENST00000426744.2_Missense_Mutation_p.V796A|ZBTB10_ENST00000455036.3_Missense_Mutation_p.V820A	NM_001277145.1	NP_001264074.1	Q96DT7	ZBT10_HUMAN	zinc finger and BTB domain containing 10	820					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|upper_aerodigestive_tract(4)	20	all_cancers(3;1.68e-09)|all_epithelial(4;5.13e-11)|Lung NSC(7;1.75e-07)|all_lung(9;7.38e-07)|Breast(3;2.96e-06)		BRCA - Breast invasive adenocarcinoma(6;0.000434)|Epithelial(68;0.00486)|all cancers(69;0.0296)			CAAGAAGGTGTAGATCAGGGA	0.453																																					p.V820A		.											.	ZBTB10-522	0			c.T2459C						.						103.0	100.0	101.0					8																	81431606		1932	4142	6074	SO:0001583	missense	65986	exon6			AAGGTGTAGATCA	AK022814	CCDS47880.1, CCDS64920.1	8q13-q21.1	2013-01-09			ENSG00000205189	ENSG00000205189		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	30953	protein-coding gene	gene with protein product						12477932	Standard	NM_001105539		Approved	RINZF, FLJ12752	uc003ybx.5	Q96DT7	OTTHUMG00000155016	ENST00000430430.1:c.2459T>C	8.37:g.81431606T>C	ENSP00000387462:p.Val820Ala	Somatic	38	0		WXS	Illumina HiSeq	Phase_I	41	3	NM_001105539	0	0	23	23	0	A4FVD0|Q86W96|Q8IXI9|Q96MH9	Missense_Mutation	SNP	ENST00000430430.1	37	CCDS47880.1	.	.	.	.	.	.	.	.	.	.	T	4.550	0.102223	0.08731	.	.	ENSG00000205189	ENST00000379091;ENST00000430430;ENST00000455036;ENST00000426744;ENST00000519370	T;T	0.09445	2.98;2.98	5.54	5.54	0.83059	.	0.615543	0.16142	N	0.227662	T	0.07007	0.0178	N	0.14661	0.345	0.26201	N	0.979445	B;B;B;B	0.15473	0.0;0.0;0.013;0.001	B;B;B;B	0.10450	0.001;0.001;0.004;0.005	T	0.30995	-0.9959	10	0.25751	T	0.34	.	10.3859	0.44140	0.0:0.0827:0.0:0.9173	.	674;820;796;528	A8E4L4;Q96DT7;Q96DT7-2;Q96DT7-4	.;ZBT10_HUMAN;.;.	A	528;820;796;820;646	ENSP00000368384:V528A;ENSP00000387462:V820A	ENSP00000368384:V528A	V	+	2	0	ZBTB10	81594161	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.649000	0.37281	2.107000	0.64212	0.482000	0.46254	GTA	.		0.453	ZBTB10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338055.2	NM_023929	
EEF1D	1936	hgsc.bcm.edu	37	8	144658981	144658981	+	IGR	SNP	C	C	A			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr8:144658981C>A	ENST00000529272.1	-	0	1311				RP11-661A12.7_ENST00000529247.1_RNA|NAPRT1_ENST00000449291.2_Missense_Mutation_p.G239V|NAPRT1_ENST00000435154.3_Missense_Mutation_p.G239V|NAPRT1_ENST00000276844.7_Missense_Mutation_p.G239V|NAPRT1_ENST00000460623.1_5'Flank|NAPRT1_ENST00000426292.3_Missense_Mutation_p.G239V|RP11-661A12.9_ENST00000531730.1_RNA			P29692	EF1D_HUMAN	eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)|translation elongation factor activity (GO:0003746)|translation factor activity, nucleic acid binding (GO:0008135)			breast(2)|cervix(1)|endometrium(1)|kidney(4)|lung(2)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)			CAGGTCCACCCCAGGGCCCTC	0.672																																					p.G239V		.											.	NAPRT1-91	0			c.G716T						.						10.0	13.0	12.0					8																	144658981		2168	4249	6417	SO:0001628	intergenic_variant	93100	exon6			TCCACCCCAGGGC	AK024550	CCDS6404.1, CCDS6405.1, CCDS47930.1, CCDS56559.1	8q24	2011-09-15			ENSG00000104529	ENSG00000104529			3211	protein-coding gene	gene with protein product		130592				8334168	Standard	NM_001960		Approved	EF-1D, FLJ20897	uc003yyt.3	P29692	OTTHUMG00000165191		8.37:g.144658981C>A		Somatic	22	0		WXS	Illumina HiSeq	Phase_I	30	7	NM_145201	0	0	9	36	27	B4DDU4|D3DWK3|E9PBQ9|Q4VBZ6|Q969J1|Q96I38	Missense_Mutation	SNP	ENST00000529272.1	37	CCDS6405.1	.	.	.	.	.	.	.	.	.	.	C	8.836	0.941072	0.18281	.	.	ENSG00000147813	ENST00000435154;ENST00000449291;ENST00000340490;ENST00000426292;ENST00000276844	T;T;T;T;T	0.43688	0.98;0.99;0.94;0.98;0.98	4.42	-8.84	0.00803	Quinolinate phosphoribosyl transferase, C-terminal (1);	1.965940	0.02914	N	0.137039	T	0.20007	0.0481	N	0.08118	0	0.09310	N	1	B;B;B;B	0.23249	0.049;0.01;0.082;0.029	B;B;B;B	0.18871	0.01;0.01;0.023;0.01	T	0.13710	-1.0499	10	0.25106	T	0.35	-1.437	9.7047	0.40209	0.0:0.2126:0.439:0.3484	.	239;239;239;239	C9J8U2;G5E977;Q6XQN6-3;Q6XQN6	.;.;.;PNCB_HUMAN	V	239	ENSP00000405670:G239V;ENSP00000401508:G239V;ENSP00000341136:G239V;ENSP00000390949:G239V;ENSP00000276844:G239V	ENSP00000276844:G239V	G	-	2	0	NAPRT1	144730124	0.000000	0.05858	0.000000	0.03702	0.204000	0.24138	-5.716000	0.00102	-2.660000	0.00419	-0.119000	0.15052	GGG	.		0.672	EEF1D-006	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382592.2	NM_032378	
FOCAD	54914	bcgsc.ca	37	9	20758140	20758140	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr9:20758140G>A	ENST00000380249.1	+	8	808	c.444G>A	c.(442-444)tgG>tgA	p.W148*	FOCAD_ENST00000338382.6_Nonsense_Mutation_p.W148*	NM_017794.3	NP_060264.3	Q5VW36	FOCAD_HUMAN	focadhesin	148						focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)											CTGATTGCTGGCCAGTGTTTT	0.413																																					p.W148X													.	.	0			c.G444A						.						106.0	95.0	99.0					9																	20758140		2203	4300	6503	SO:0001587	stop_gained	54914	exon8			TTGCTGGCCAGTG	AB058700	CCDS34993.1	9p21	2012-03-23	2012-03-23	2012-03-23	ENSG00000188352	ENSG00000188352			23377	protein-coding gene	gene with protein product		614606	"""KIAA1797"""	KIAA1797		22427331	Standard	XM_006716794		Approved	FLJ20375	uc003zog.1	Q5VW36	OTTHUMG00000066930	ENST00000380249.1:c.444G>A	9.37:g.20758140G>A	ENSP00000369599:p.Trp148*	Somatic	90	0		WXS	Illumina HiSeq	Phase_1	106	5	NM_017794	0	0	5	5	0	D3DRJ9|Q6ZME1|Q8IZG0|Q96JM8|Q96MS9|Q9BVF3|Q9NX87	Nonsense_Mutation	SNP	ENST00000380249.1	37	CCDS34993.1	.	.	.	.	.	.	.	.	.	.	G	40	8.252373	0.98727	.	.	ENSG00000188352	ENST00000380249;ENST00000338382	.	.	.	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.1331	16.8915	0.86088	0.0:0.0:1.0:0.0	.	.	.	.	X	148	.	ENSP00000344307:W148X	W	+	3	0	KIAA1797	20748140	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	6.575000	0.74018	2.521000	0.84997	0.555000	0.69702	TGG	.		0.413	FOCAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143442.1	NM_017794	
SPINK4	27290	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	33246702	33246702	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr9:33246702A>G	ENST00000379721.3	+	3	236	c.191A>G	c.(190-192)gAa>gGa	p.E64G	SPINK4_ENST00000379723.1_Missense_Mutation_p.E87G|SPINK4_ENST00000379725.1_Missense_Mutation_p.E87G	NM_014471.1	NP_055286.1	O60575	ISK4_HUMAN	serine peptidase inhibitor, Kazal type 4	64	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.				response to drug (GO:0042493)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			lung(1)	1			LUSC - Lung squamous cell carcinoma(29;0.00506)			TATACGAATGAATGCCAGCTC	0.552																																					p.E64G		.											.	SPINK4-90	0			c.A191G						.						173.0	145.0	154.0					9																	33246702		2203	4300	6503	SO:0001583	missense	27290	exon3			CGAATGAATGCCA	AF048700	CCDS6536.1	9p13.3	2011-08-31	2005-08-17		ENSG00000122711	ENSG00000122711		"""Serine peptidase inhibitors, Kazal type"""	16646	protein-coding gene	gene with protein product		613929	"""serine protease inhibitor, Kazal type 4"""			1400298, 17333166	Standard	NM_014471		Approved	PEC-60, MGC133107	uc003zsh.3	O60575	OTTHUMG00000019762	ENST00000379721.3:c.191A>G	9.37:g.33246702A>G	ENSP00000369045:p.Glu64Gly	Somatic	86	0		WXS	Illumina HiSeq	Phase_I	128	39	NM_014471	0	0	0	0	0	Q2YDT7	Missense_Mutation	SNP	ENST00000379721.3	37	CCDS6536.1	.	.	.	.	.	.	.	.	.	.	A	15.12	2.738172	0.49045	.	.	ENSG00000122711	ENST00000379725;ENST00000379723;ENST00000379721	T;T;T	0.79554	-1.28;-1.28;-1.28	4.81	4.81	0.61882	Proteinase inhibitor I1, Kazal (3);	0.000000	0.64402	D	0.000001	D	0.86698	0.5995	.	.	.	0.46564	D	0.999105	D	0.58620	0.983	P	0.60473	0.875	D	0.88001	0.2756	9	0.87932	D	0	-33.3681	10.9375	0.47253	1.0:0.0:0.0:0.0	.	64	O60575	ISK4_HUMAN	G	87;87;64	ENSP00000369048:E87G;ENSP00000369046:E87G;ENSP00000369045:E64G	ENSP00000369045:E64G	E	+	2	0	SPINK4	33236702	1.000000	0.71417	0.995000	0.50966	0.167000	0.22549	4.175000	0.58263	2.165000	0.68154	0.379000	0.24179	GAA	.		0.552	SPINK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052035.1	NM_014471	
USP9Y	8287	hgsc.bcm.edu	37	Y	14847584	14847584	+	Silent	SNP	A	A	G			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chrY:14847584A>G	ENST00000338981.3	+	8	1641	c.696A>G	c.(694-696)ttA>ttG	p.L232L	USP9Y_ENST00000426564.2_3'UTR	NM_004654.3	NP_004645.2	O00507	USP9Y_HUMAN	ubiquitin specific peptidase 9, Y-linked	232					BMP signaling pathway (GO:0030509)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)	co-SMAD binding (GO:0070410)|cysteine-type peptidase activity (GO:0008234)|ubiquitin-specific protease activity (GO:0004843)			kidney(1)|large_intestine(8)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						TTGGCACATTAAATGGGTTCC	0.289																																					p.L232L		.											.	USP9Y-136	0			c.A696G						.						51.0	52.0	52.0					Y																	14847584		591	1915	2506	SO:0001819	synonymous_variant	8287	exon8			CACATTAAATGGG	Y13618	CCDS14781.1	Yq11.2	2010-04-09	2009-03-17		ENSG00000114374	ENSG00000114374		"""Ubiquitin-specific peptidases"""	12633	protein-coding gene	gene with protein product	"""fat facets-like homolog (Drosophila)"""	400005	"""ubiquitin specific peptidase 9, Y-linked (fat facets-like, Drosophila)"""			8922996, 9384609, 19246359	Standard	NM_004654		Approved	DFFRY	uc004fst.1	O00507	OTTHUMG00000036469	ENST00000338981.3:c.696A>G	Y.37:g.14847584A>G		Somatic	47	0		WXS	Illumina HiSeq	Phase_I	26	2	NM_004654	0	0	2	2	0	O14601	Silent	SNP	ENST00000338981.3	37	CCDS14781.1																																																																																			.		0.289	USP9Y-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088703.2	NM_004654	
USP9Y	8287	hgsc.bcm.edu	37	Y	14847619	14847619	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chrY:14847619A>C	ENST00000338981.3	+	8	1676	c.731A>C	c.(730-732)aAt>aCt	p.N244T	USP9Y_ENST00000426564.2_3'UTR	NM_004654.3	NP_004645.2	O00507	USP9Y_HUMAN	ubiquitin specific peptidase 9, Y-linked	244					BMP signaling pathway (GO:0030509)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)	co-SMAD binding (GO:0070410)|cysteine-type peptidase activity (GO:0008234)|ubiquitin-specific protease activity (GO:0004843)			kidney(1)|large_intestine(8)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						CGTTTTTTTAATGGATCAGCA	0.274																																					p.N244T		.											.	USP9Y-136	0			c.A731C						.						46.0	46.0	46.0					Y																	14847619		590	1912	2502	SO:0001583	missense	8287	exon8			TTTTTAATGGATC	Y13618	CCDS14781.1	Yq11.2	2010-04-09	2009-03-17		ENSG00000114374	ENSG00000114374		"""Ubiquitin-specific peptidases"""	12633	protein-coding gene	gene with protein product	"""fat facets-like homolog (Drosophila)"""	400005	"""ubiquitin specific peptidase 9, Y-linked (fat facets-like, Drosophila)"""			8922996, 9384609, 19246359	Standard	NM_004654		Approved	DFFRY	uc004fst.1	O00507	OTTHUMG00000036469	ENST00000338981.3:c.731A>C	Y.37:g.14847619A>C	ENSP00000342812:p.Asn244Thr	Somatic	39	0		WXS	Illumina HiSeq	Phase_I	23	2	NM_004654	0	0	0	0	0	O14601	Missense_Mutation	SNP	ENST00000338981.3	37	CCDS14781.1																																																																																			.		0.274	USP9Y-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088703.2	NM_004654	
KIF21B	23046	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	200974516	200974517	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	TC	TC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr1:200974516_200974517delTC	ENST00000422435.2	-	5	967_968	c.651_652delGA	c.(649-654)cagatgfs	p.QM217fs	KIF21B_ENST00000332129.2_Frame_Shift_Del_p.QM217fs|KIF21B_ENST00000461742.2_Frame_Shift_Del_p.QM217fs|KIF21B_ENST00000360529.5_Frame_Shift_Del_p.QM217fs	NM_001252100.1	NP_001239029.1	O75037	KI21B_HUMAN	kinesin family member 21B	217	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(4)|large_intestine(8)|liver(1)|lung(27)|ovary(3)|pancreas(1)|prostate(5)|skin(8)|stomach(2)|urinary_tract(2)	83						TGCACGTTCATCTGGGTGCTGG	0.639																																					p.217_218del		.											.	KIF21B-96	0			c.651_652del						.																																			SO:0001589	frameshift_variant	23046	exon5			.	BC031927	CCDS30965.1, CCDS58054.1, CCDS58055.1, CCDS58056.1	1q32.1	2013-01-10			ENSG00000116852	ENSG00000116852		"""Kinesins"", ""WD repeat domain containing"""	29442	protein-coding gene	gene with protein product		608322				9455484	Standard	NM_001252100		Approved	DKFZP434J212, KIAA0449	uc001gvs.2	O75037	OTTHUMG00000035787	ENST00000422435.2:c.651_652delGA	1.37:g.200974516_200974517delTC	ENSP00000411831:p.Gln217fs	Somatic	96	0		WXS	Illumina HiSeq	Phase_I	142	48	NM_017596	0	0	0	0	0	B2RP62|B7ZMI0|Q5T4J3	Frame_Shift_Del	DEL	ENST00000422435.2	37	CCDS58056.1																																																																																			.		0.639	KIF21B-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382635.1	XM_371332	
EBF3	253738	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	131755589	131755589	+	Splice_Site	DEL	G	G	-			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr10:131755589delG	ENST00000355311.5	-	6	559	c.487delC	c.(487-489)cgg>gg	p.R163fs	EBF3_ENST00000368648.3_Splice_Site_p.R163fs			Q9H4W6	COE3_HUMAN	early B-cell factor 3	163		Interaction with DNA. {ECO:0000250}.			multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	44		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)		OV - Ovarian serous cystadenocarcinoma(35;0.00513)		TCACAGCACCGGCTGTGGAGC	0.388																																					p.R163fs		.											.	EBF3-91	0			c.487delC						.						127.0	119.0	121.0					10																	131755589		2203	4300	6503	SO:0001630	splice_region_variant	253738	exon6			.		CCDS31314.1	10q26.3	2007-03-30			ENSG00000108001	ENSG00000108001			19087	protein-coding gene	gene with protein product		607407				12355068	Standard	NM_001005463		Approved	COE3, DKFZp667B0210	uc001lki.2	Q9H4W6	OTTHUMG00000019265	ENST00000355311.5:c.486-1C>-	10.37:g.131755589delG		Somatic	142	0		WXS	Illumina HiSeq	Phase_I	181	50	NM_001005463	0	0	0	0	0	A0AUY1|Q5T6H9|Q9H4W5	Frame_Shift_Del	DEL	ENST00000355311.5	37																																																																																				.		0.388	EBF3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051015.2	NM_001005463	Frame_Shift_Del
SPON1	10418	broad.mit.edu	37	11	14276276	14276277	+	RNA	DEL	GT	GT	-	rs144833103		TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	GT	GT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr11:14276276_14276277delGT	ENST00000310358.7	+	0	1627							Q9HCB6	SPON1_HUMAN	spondin 1, extracellular matrix protein						cell adhesion (GO:0007155)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|endometrium(1)|large_intestine(5)|lung(11)|prostate(2)|upper_aerodigestive_tract(1)	21				Epithelial(150;0.00898)		GACCTATGAGGTGTGTGTGTGT	0.594																																					.													.	SPON1-1	0			.						.			1,106,4101		0,0,1,3,100,2000						5.7	1.0		dbSNP_134	77	4,167,8025		0,0,4,1,165,3928	no	splice-5	SPON1	NM_006108.3		0,0,5,4,265,5928	A1A1,A1A2,A1R,A2A2,A2R,RR		2.0864,2.5428,2.2412				5,273,12126						10418	.			TATGAGGTGTGTG	AB018305	CCDS73262.1	11p15.2	2014-05-06	2004-03-05		ENSG00000152268	ENSG00000262655			11252	protein-coding gene	gene with protein product		604989	"""spondin 1, (f-spondin) extracellular matrix protein"""			9872452	Standard	NM_006108		Approved	KIAA0762, f-spondin	uc001mle.3	Q9HCB6	OTTHUMG00000181576		11.37:g.14276286_14276287delGT		Somatic	56	0		WXS	Illumina HiSeq	Phase_I	43	6	.	0	0	0	0	0	A8K6W5|O94862|Q8NCD7|Q8WUR5	Splice_Site	DEL	ENST00000310358.7	37																																																																																				.		0.594	SPON1-201	KNOWN	basic	processed_transcript	processed_transcript		NM_145584	
MALAT1	378938	hgsc.bcm.edu;bcgsc.ca	37	11	65271312	65271314	+	lincRNA	DEL	ATA	ATA	-	rs371287219		TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	ATA	ATA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr11:65271312_65271314delATA	ENST00000534336.1	+	0	6080_6082					NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		TGATGAGCATATAATAATTCCAG	0.365																																					.		.											.	.	0			.						.																																					378938	.			.	AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65271315_65271317delATA		Somatic	30	0		WXS	Illumina HiSeq	Phase_I	36	13	.	0	0	0	0	0		RNA	DEL	ENST00000534336.1	37																																																																																				.		0.365	MALAT1-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000389143.1	NR_002819	
NYNRIN	57523	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	24885007	24885007	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr14:24885007delC	ENST00000382554.3	+	9	4370	c.4052delC	c.(4051-4053)accfs	p.T1351fs		NM_025081.2	NP_079357.2	Q9P2P1	NYNRI_HUMAN	NYN domain and retroviral integrase containing	1351					DNA integration (GO:0015074)	integral component of membrane (GO:0016021)	nucleic acid binding (GO:0003676)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(8)|lung(21)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	56						TACACGCCAACCTATGCCCAC	0.602																																					p.T1351fs		.											.	NYNRIN-3	0			c.4052delC						.						95.0	101.0	99.0					14																	24885007		2016	4157	6173	SO:0001589	frameshift_variant	57523	exon9			.	AB037726	CCDS45090.1	14q11.2	2009-10-14	2009-10-14	2009-10-14		ENSG00000205978			20165	protein-coding gene	gene with protein product	"""Cousin of GIN1"""		"""KIAA1305"""	KIAA1305		19561090, 17114934	Standard	NM_025081		Approved	FLJ11811, CGIN1	uc001wpf.4	Q9P2P1		ENST00000382554.3:c.4052delC	14.37:g.24885007delC	ENSP00000371994:p.Thr1351fs	Somatic	120	0		WXS	Illumina HiSeq	Phase_I	152	48	NM_025081	0	0	0	0	0	Q6P153|Q86TR3|Q9HAC4	Frame_Shift_Del	DEL	ENST00000382554.3	37	CCDS45090.1																																																																																			.		0.602	NYNRIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412939.1		
IRX5	10265	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	54966812	54966813	+	Frame_Shift_Del	DEL	GC	GC	-			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr16:54966812_54966813delGC	ENST00000394636.4	+	2	989_990	c.652_653delGC	c.(652-654)gcafs	p.A218fs	IRX5_ENST00000560154.1_Intron|IRX5_ENST00000320990.5_Frame_Shift_Del_p.A218fs|CTD-3032H12.2_ENST00000560487.1_lincRNA|IRX5_ENST00000558597.1_Frame_Shift_Del_p.A152fs			P78411	IRX5_HUMAN	iroquois homeobox 5	218					embryonic cranial skeleton morphogenesis (GO:0048701)|gonad development (GO:0008406)|neuron maturation (GO:0042551)|regulation of heart rate (GO:0002027)|regulation of transcription, DNA-templated (GO:0006355)|response to stimulus (GO:0050896)|retinal bipolar neuron differentiation (GO:0060040)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|vitamin D binding (GO:0005499)			kidney(3)|large_intestine(6)|lung(4)|prostate(1)	14						GGGCCCCGAAGCAGGTTGGTGG	0.649																																					p.218_218del		.											.	IRX5-90	0			c.652_653del						.																																			SO:0001589	frameshift_variant	10265	exon2			.	U90309	CCDS10751.1, CCDS58462.1	16q12.2	2011-06-20	2007-07-13		ENSG00000176842	ENSG00000176842		"""Homeoboxes / TALE class"""	14361	protein-coding gene	gene with protein product		606195					Standard	NM_005853		Approved	IRX-2a	uc002ehv.3	P78411	OTTHUMG00000133201	ENST00000394636.4:c.652_653delGC	16.37:g.54966812_54966813delGC	ENSP00000378132:p.Ala218fs	Somatic	172	0		WXS	Illumina HiSeq	Phase_I	225	71	NM_001252197	0	0	0	0	0	H0YMS7|P78416|Q7Z2E1	Frame_Shift_Del	DEL	ENST00000394636.4	37	CCDS10751.1																																																																																			.		0.649	IRX5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256911.2		
PPM1F	9647	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	22285579	22285579	+	Frame_Shift_Del	DEL	T	T	-	rs376795506		TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr22:22285579delT	ENST00000263212.5	-	6	937	c.832delA	c.(832-834)attfs	p.I278fs	PPM1F_ENST00000538191.1_Frame_Shift_Del_p.I174fs|PPM1F_ENST00000397495.4_Frame_Shift_Del_p.I278fs|PPM1F_ENST00000407142.1_Frame_Shift_Del_p.I110fs	NM_014634.3	NP_055449.1	P49593	PPM1F_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1F	278					cellular response to drug (GO:0035690)|histone dephosphorylation (GO:0016576)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-threonine dephosphorylation (GO:0035970)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of gene expression (GO:0010628)|positive regulation of growth (GO:0045927)|positive regulation of stress fiber assembly (GO:0051496)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	calmodulin-dependent protein phosphatase activity (GO:0033192)|metal ion binding (GO:0046872)|phosphatase activity (GO:0016791)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	12	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.155)		TGTACCAAAATGACCTGGGAA	0.637																																					p.I278fs		.											.	PPM1F-292	0			c.832delA						.						124.0	98.0	107.0					22																	22285579		2203	4300	6503	SO:0001589	frameshift_variant	9647	exon6			.	D13640	CCDS13796.1	22q11.22	2012-04-17	2010-03-05		ENSG00000100034	ENSG00000100034	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	19388	protein-coding gene	gene with protein product	"""partner of PIX 2"", ""Ca(2+)/calmodulin-dependent protein kinase phosphatase"""		"""protein phosphatase 1F (PP2C domain containing)"""			11864573, 11559703	Standard	NM_014634		Approved	FEM-2, KIAA0015, POPX2, CaMKPase, CAMKP	uc002zvp.2	P49593	OTTHUMG00000150835	ENST00000263212.5:c.832delA	22.37:g.22285579delT	ENSP00000263212:p.Ile278fs	Somatic	109	0		WXS	Illumina HiSeq	Phase_I	90	41	NM_014634	0	0	0	0	0	A8K6G3|B7Z2C3|Q96PM2	Frame_Shift_Del	DEL	ENST00000263212.5	37	CCDS13796.1																																																																																			.		0.637	PPM1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320267.2	NM_014634	
SYN2	6854	broad.mit.edu	37	3	12046124	12046126	+	RNA	DEL	AGC	AGC	-	rs76272937|rs74800608|rs375843790|rs74185804|rs202010288	byFrequency	TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	AGC	AGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr3:12046124_12046126delAGC	ENST00000432424.2	+	0	245_247							Q92777	SYN2_HUMAN	synapsin II						neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)			breast(5)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)	18						AGCCCCAGCAAGCGCCGAcgccg	0.764														5004	0.999201	0.9992	1.0	5008	,	,		2724	1.0		0.999	False		,,,				2504	0.998				.													.	SYN2-24	0			.						.																																					6854	.			CCAGCAAGCGCCG		CCDS74900.1, CCDS74901.1	3p25.2	2013-09-20			ENSG00000157152	ENSG00000157152			11495	protein-coding gene	gene with protein product		600755				8530057	Standard	XM_006713311		Approved	SYNII, SYNIIa, SYNIIb	uc003bwm.3	Q92777	OTTHUMG00000155335		3.37:g.12046124_12046126delAGC		Somatic	7	0		WXS	Illumina HiSeq	Phase_I	5	2	.	0	0	0	0	0	A8MY98	In_Frame_Del	DEL	ENST00000432424.2	37																																																																																				.		0.764	SYN2-002	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000339528.3	NM_133625	
SETD2	29072	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	47161751	47161757	+	Frame_Shift_Del	DEL	GCTGTGG	GCTGTGG	-			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	GCTGTGG	GCTGTGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr3:47161751_47161757delGCTGTGG	ENST00000409792.3	-	3	4411_4417	c.4369_4375delCCACAGC	c.(4369-4377)ccacagcgafs	p.PQR1457fs		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1457					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		TCCTTCCATCGCTGTGGGTCCCTGAAG	0.444			"""N, F, S, Mis"""		clear cell renal carcinoma																																p.1457_1459del		.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	.	SETD2-1273	0			c.4369_4375del						.																																			SO:0001589	frameshift_variant	29072	exon3			.	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.4369_4375delCCACAGC	3.37:g.47161751_47161757delGCTGTGG	ENSP00000386759:p.Pro1457fs	Somatic	180	0		WXS	Illumina HiSeq	Phase_I	92	40	NM_014159	0	0	0	0	0	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Frame_Shift_Del	DEL	ENST00000409792.3	37	CCDS2749.2																																																																																			.		0.444	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
FAT1	2195	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	187541245	187541245	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr4:187541245delT	ENST00000441802.2	-	10	6704	c.6495delA	c.(6493-6495)tcafs	p.S2165fs		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	2165	Cadherin 19. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						TAACTTCCGCTGAAAAGGCCG	0.423										HNSCC(5;0.00058)																											p.S2165fs	Colon(197;1040 2055 4143 4984 49344)	.											.	FAT1-34	0			c.6495delA						.						59.0	58.0	59.0					4																	187541245		1894	4111	6005	SO:0001589	frameshift_variant	2195	exon10			.	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.6495delA	4.37:g.187541245delT	ENSP00000406229:p.Ser2165fs	Somatic	55	0		WXS	Illumina HiSeq	Phase_I	79	26	NM_005245	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000441802.2	37	CCDS47177.1																																																																																			.		0.423	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245	
FAT1	2195	hgsc.bcm.edu	37	4	187541250	187541250	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr4:187541250delA	ENST00000441802.2	-	10	6699	c.6490delT	c.(6490-6492)tttfs	p.F2164fs		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	2164	Cadherin 19. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						TCCGCTGAAAAGGCCGGGTTC	0.423										HNSCC(5;0.00058)																											p.F2164fs	Colon(197;1040 2055 4143 4984 49344)	.											.	FAT1-34	0			c.6490delT						.						60.0	59.0	59.0					4																	187541250		1892	4111	6003	SO:0001589	frameshift_variant	2195	exon10			.	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.6490delT	4.37:g.187541250delA	ENSP00000406229:p.Phe2164fs	Somatic	63	0		WXS	Illumina HiSeq	Phase_I	79	12	NM_005245	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000441802.2	37	CCDS47177.1																																																																																			.		0.423	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245	
XKR4	114786	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	56015502	56015504	+	In_Frame_Del	DEL	GTG	GTG	-			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	GTG	GTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr8:56015502_56015504delGTG	ENST00000327381.6	+	1	554_556	c.454_456delGTG	c.(454-456)gtgdel	p.V153del		NM_052898.1	NP_443130.1	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related family, member 4	153						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34			Epithelial(17;0.000117)|all cancers(17;0.000836)			GCTCTTCTTCGTGGTGCTCGGCT	0.655																																					p.152_152del		.											.	XKR4-92	0			c.454_456del						.																																			SO:0001651	inframe_deletion	114786	exon1			.	AY534241	CCDS34893.1	8q12.1	2006-01-12	2006-01-12		ENSG00000206579	ENSG00000206579			29394	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 4"""				Standard	NM_052898		Approved	KIAA1889	uc003xsf.3	Q5GH76	OTTHUMG00000164288	ENST00000327381.6:c.454_456delGTG	8.37:g.56015505_56015507delGTG	ENSP00000328326:p.Val153del	Somatic	57	0		WXS	Illumina HiSeq	Phase_I	80	22	NM_052898	0	0	0	0	0	Q96PZ8	In_Frame_Del	DEL	ENST00000327381.6	37	CCDS34893.1																																																																																			.		0.655	XKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378129.2	NM_052898	
TG	7038	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	133898849	133898849	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr8:133898849delC	ENST00000220616.4	+	9	1272	c.1232delC	c.(1231-1233)acgfs	p.T411fs	TG_ENST00000377869.1_Frame_Shift_Del_p.T411fs	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	411					hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		TGCCCACCCACGATCAAGGAG	0.537																																					p.T411fs		.											.	TG-145	0			c.1232delC						.						144.0	152.0	150.0					8																	133898849		2203	4300	6503	SO:0001589	frameshift_variant	7038	exon9			.	AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.1232delC	8.37:g.133898849delC	ENSP00000220616:p.Thr411fs	Somatic	258	0		WXS	Illumina HiSeq	Phase_I	368	113	NM_003235	0	0	0	0	0	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Frame_Shift_Del	DEL	ENST00000220616.4	37	CCDS34944.1																																																																																			.		0.537	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1	NM_003235	
TMEM206	55248	hgsc.bcm.edu	37	1	212588063	212588064	+	Splice_Site	INS	-	-	CTCCTGGTAGGATGTGGAGCG			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr1:212588063_212588064insCTCCTGGTAGGATGTGGAGCG	ENST00000261455.4	-	1	173_174		c.e1+1		TMEM206_ENST00000471937.1_Splice_Site|TMEM206_ENST00000535273.1_Splice_Site	NM_018252.2	NP_060722.2	Q9H813	TM206_HUMAN	transmembrane protein 206							cell surface (GO:0009986)|integral component of membrane (GO:0016021)				breast(1)|kidney(3)|large_intestine(4)|lung(6)|prostate(1)|skin(2)	17				all cancers(67;0.012)|OV - Ovarian serous cystadenocarcinoma(81;0.0121)|GBM - Glioblastoma multiforme(131;0.0377)|Epithelial(68;0.148)		CAACCTCGTACCTCCTGGTAGG	0.703																																					.		.											.	TMEM206-153	0			c.36+1->CGCTCCACATCCTACCAGGAG						.																																			SO:0001630	splice_region_variant	55248	exon2			.	AK024066	CCDS1504.1, CCDS55687.1	1q32.3	2008-02-05	2008-01-17	2008-01-17	ENSG00000065600	ENSG00000065600			25593	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 75"""	C1orf75		12477932	Standard	NM_018252		Approved	FLJ10874	uc010pte.2	Q9H813	OTTHUMG00000036751	ENST00000261455.4:c.36+1->CGCTCCACATCCTACCAGGAG	1.37:g.212588063_212588064insCTCCTGGTAGGATGTGGAGCG		Somatic	33	0		WXS	Illumina HiSeq	Phase_I	50	10	NM_001198862	0	0	0	0	0	B7Z4D6|Q6IA87|Q9NV85	Splice_Site	INS	ENST00000261455.4	37	CCDS1504.1																																																																																			.		0.703	TMEM206-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089306.1	NM_018252	Intron
MEFV	4210	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	3297239	3297240	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr16:3297239_3297240insT	ENST00000219596.1	-	5	1402_1403	c.1363_1364insA	c.(1363-1365)actfs	p.T455fs	MEFV_ENST00000339854.4_Frame_Shift_Ins_p.T275fs|MEFV_ENST00000541159.1_Frame_Shift_Ins_p.T244fs|MEFV_ENST00000536379.1_Frame_Shift_Ins_p.T244fs	NM_000243.2	NP_000234.1	O15553	MEFV_HUMAN	Mediterranean fever	455	Required for homotrimerization and induction of pyroptosomes.				inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of macrophage inflammatory protein 1 alpha production (GO:0071641)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)			NS(2)|biliary_tract(1)|breast(5)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(3)|prostate(1)|skin(6)	50						CAGCGCTTCAGTTTGTTTCTGG	0.594																																					p.T455fs		.											.	MEFV-228	0			c.1364_1365insA						.																																			SO:0001589	frameshift_variant	4210	exon5			.	AF018080	CCDS10498.1, CCDS55981.1	16p13.3	2014-09-17			ENSG00000103313	ENSG00000103313		"""Tripartite motif containing / Tripartite motif containing"""	6998	protein-coding gene	gene with protein product	"""pyrin"""	608107		MEF		9288094	Standard	NM_000243		Approved	FMF, TRIM20	uc002cun.1	O15553	OTTHUMG00000129324	ENST00000219596.1:c.1364dupA	16.37:g.3297242_3297242dupT	ENSP00000219596:p.Thr455fs	Somatic	96	0		WXS	Illumina HiSeq	Phase_I	146	45	NM_000243	0	0	0	0	0	D3DUC0|F5H0Q3|Q3MJ84|Q96PN4|Q96PN5	Frame_Shift_Ins	INS	ENST00000219596.1	37	CCDS10498.1																																																																																			.		0.594	MEFV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251464.1	NM_000243	
GRAMD1A	57655	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	35500801	35500802	+	Frame_Shift_Ins	INS	-	-	CA			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr19:35500801_35500802insCA	ENST00000317991.5	+	4	442_443	c.250_251insCA	c.(250-252)cccfs	p.P84fs	GRAMD1A_ENST00000424536.2_Frame_Shift_Ins_p.P84fs|GRAMD1A_ENST00000411896.2_Frame_Shift_Ins_p.P77fs|GRAMD1A_ENST00000504615.2_5'UTR|GRAMD1A_ENST00000598073.1_3'UTR|GRAMD1A_ENST00000599564.1_Frame_Shift_Ins_p.P171fs	NM_020895.3	NP_065946.2	Q96CP6	GRM1A_HUMAN	GRAM domain containing 1A	84						integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	19	all_lung(56;2.66e-08)|Lung NSC(56;4.13e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)			GATGCTGAGCCCCACTTATAAG	0.559																																					p.P84fs		.											.	GRAMD1A-90	0			c.250_251insCA						.																																			SO:0001589	frameshift_variant	57655	exon4			.	AK074864	CCDS42546.1, CCDS46046.1	19q13.13	2008-02-05	2005-11-02	2005-11-02		ENSG00000089351			29305	protein-coding gene	gene with protein product			"""KIAA1533"""	KIAA1533		10819331	Standard	NM_020895		Approved	FLJ90346	uc010xse.1	Q96CP6		Exception_encountered	19.37:g.35500801_35500802insCA	ENSP00000441032:p.Pro84fs	Somatic	142	0		WXS	Illumina HiSeq	Phase_I	147	50	NM_020895	0	0	0	0	0	A6NKY7|Q8NC77|Q9P1Z5	Frame_Shift_Ins	INS	ENST00000317991.5	37	CCDS42546.1																																																																																			.		0.559	GRAMD1A-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000461557.1	NM_020895	
THUMPD2	80745	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	39983057	39983058	+	Frame_Shift_Ins	INS	-	-	T	rs202183716		TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr2:39983057_39983058insT	ENST00000505747.1	-	7	961_962	c.934_935insA	c.(934-936)atafs	p.I312fs	THUMPD2_ENST00000260619.6_Frame_Shift_Ins_p.I282fs	NM_025264.4	NP_079540.2	Q9BTF0	THUM2_HUMAN	THUMP domain containing 2	312							methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)			endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|skin(1)	17		all_hematologic(82;0.248)				TTCCAAAAGTATTGTTCCAAGT	0.322																																					p.I312fs		.											.	THUMPD2-91	0			c.935_936insA						.																																			SO:0001589	frameshift_variant	80745	exon7			.	AF380576	CCDS1805.1, CCDS1805.2	2p22.2	2004-06-04	2004-06-04	2004-06-04	ENSG00000138050	ENSG00000138050			14890	protein-coding gene	gene with protein product		611751	"""chromosome 2 open reading frame 8"""	C2orf8		12063391	Standard	NM_025264		Approved	MGC2454	uc002rru.2	Q9BTF0	OTTHUMG00000102149	ENST00000505747.1:c.935dupA	2.37:g.39983059_39983059dupT	ENSP00000423933:p.Ile312fs	Somatic	101	0		WXS	Illumina HiSeq	Phase_I	98	32	NM_025264	0	0	0	0	0	A8K7I7|Q53TT8|Q53TV0	Frame_Shift_Ins	INS	ENST00000505747.1	37	CCDS1805.2																																																																																			.		0.322	THUMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219991.2	NM_025264	
RGPD2	729857	hgsc.bcm.edu	37	2	88081658	88081659	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr2:88081658_88081659insA	ENST00000398146.3	-	20	5106_5107	c.4884_4885insT	c.(4882-4887)tttaaafs	p.K1629fs	RGPD2_ENST00000420840.2_Frame_Shift_Ins_p.K1621fs|RGPD2_ENST00000327544.6_Frame_Shift_Ins_p.K886fs|RGPD2_ENST00000494592.1_5'UTR			P0DJD1	RGPD2_HUMAN	RANBP2-like and GRIP domain containing 2	1629					protein targeting to Golgi (GO:0000042)					breast(1)|pancreas(1)	2						TCTGGTGTTTTAAATGTGTAGT	0.342																																					p.K1629_T1630delinsX		.											.	.	0			c.4885_4886insT						.																																			SO:0001589	frameshift_variant	729857	exon20			.		CCDS42710.1, CCDS42710.2	2p11.2	2013-01-10			ENSG00000185304	ENSG00000185304		"""Tetratricopeptide (TTC) repeat domain containing"""	32415	protein-coding gene	gene with protein product		612705				15710750, 15815621	Standard	NM_001078170		Approved	RGP2, RANBP2L2		P0DJD1	OTTHUMG00000153276	ENST00000398146.3:c.4885dupT	2.37:g.88081661_88081661dupA	ENSP00000381214:p.Lys1629fs	Somatic	417	0		WXS	Illumina HiSeq	Phase_I	532	88	NM_001078170	0	0	0	0	0	P0C839|Q68DN6|Q6V1X0	Nonsense_Mutation	INS	ENST00000398146.3	37	CCDS42710.2																																																																																			.		0.342	RGPD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330534.2	NM_001078170	
CPXM1	56265	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	2775062	2775063	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr20:2775062_2775063insA	ENST00000380605.2	-	14	2042_2043	c.1978_1979insT	c.(1978-1980)tatfs	p.Y660fs		NM_001184699.1|NM_019609.4	NP_001171628.1|NP_062555.1	Q96SM3	CPXM1_HUMAN	carboxypeptidase X (M14 family), member 1	660					cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(8)|lung(17)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43						CAGACGCCAATAATCCCCGCCC	0.599																																					p.Y660fs		.											.	CPXM1-94	0			c.1979_1980insT						.																																			SO:0001589	frameshift_variant	56265	exon14			.	AL035460	CCDS13033.1	20p13	2012-02-10	2006-08-24	2006-08-24	ENSG00000088882	ENSG00000088882			15771	protein-coding gene	gene with protein product	"""carboxypeptidase-like protein X1"""	609555	"""carboxypeptidase X (M14 family)"""	CPXM		14702039	Standard	NM_019609		Approved	CPX-1, CPX1	uc002wgu.3	Q96SM3	OTTHUMG00000031706	ENST00000380605.2:c.1979dupT	20.37:g.2775064_2775064dupA	ENSP00000369979:p.Tyr660fs	Somatic	66	0		WXS	Illumina HiSeq	Phase_I	73	28	NM_019609	0	0	0	0	0	Q6P4G8|Q6UW65|Q9NUB5	Frame_Shift_Ins	INS	ENST00000380605.2	37	CCDS13033.1																																																																																			.		0.599	CPXM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077643.2	NM_019609	
CADM2	253559	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	86114798	86114799	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BQ-5877-01A-11D-1589-08	TCGA-BQ-5877-11A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7377aeb8-7349-4771-96c7-26f8e493de59	0a320a35-d24f-4c14-9e58-8ac73b6a4c03	g.chr3:86114798_86114799insT	ENST00000407528.2	+	9	1169_1170	c.1107_1108insT	c.(1108-1110)atafs	p.I370fs	CADM2_ENST00000383699.3_Frame_Shift_Ins_p.I339fs|CADM2_ENST00000405615.2_Frame_Shift_Ins_p.I372fs	NM_001167674.1	NP_001161146.1	Q8N3J6	CADM2_HUMAN	cell adhesion molecule 2	370					adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|synapse (GO:0045202)				endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(15)|ovary(1)|prostate(1)|skin(4)	38		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)		ACCATGCTCTCATAGGAGGAAT	0.406																																					p.L371fs		.											.	CADM2-228	0			c.1113_1114insT						.																																			SO:0001589	frameshift_variant	253559	exon9			.	AF538973	CCDS33792.1, CCDS54613.1, CCDS54614.1	3p12.2	2013-01-11	2007-02-07	2007-02-07	ENSG00000175161	ENSG00000175161		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	29849	protein-coding gene	gene with protein product	"""nectin-like 3"""	609938	"""immunoglobulin superfamily, member 4D"""	IGSF4D			Standard	NM_153184		Approved	NECL3, Necl-3, SynCAM2	uc003dqj.3	Q8N3J6	OTTHUMG00000158990	Exception_encountered	3.37:g.86114798_86114799insT	ENSP00000384575:p.Ile370fs	Somatic	82	0		WXS	Illumina HiSeq	Phase_I	62	28	NM_153184	0	0	0	0	0	G3XHN7|G3XHN8|Q3KQY9|Q658Q7|Q8IZP8	Frame_Shift_Ins	INS	ENST00000407528.2	37	CCDS54614.1																																																																																			.		0.406	CADM2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352822.1	NM_153184	
