#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SKI	6497	hgsc.bcm.edu	37	1	2160390	2160390	+	Missense_Mutation	SNP	C	C	G	rs28384811	byFrequency	TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr1:2160390C>G	ENST00000378536.4	+	1	257	c.185C>G	c.(184-186)gCg>gGg	p.A62G		NM_003036.3	NP_003027.1	P12755	SKI_HUMAN	SKI proto-oncogene	62					anterior/posterior axis specification (GO:0009948)|BMP signaling pathway (GO:0030509)|bone morphogenesis (GO:0060349)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell motility (GO:0048870)|cell proliferation (GO:0008283)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|gene expression (GO:0010467)|lens morphogenesis in camera-type eye (GO:0002089)|myelination in peripheral nervous system (GO:0022011)|myotube differentiation (GO:0014902)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neural tube closure (GO:0001843)|nose morphogenesis (GO:0043585)|olfactory bulb development (GO:0021772)|palate development (GO:0060021)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|protein homotrimerization (GO:0070207)|regulation of apoptotic process (GO:0042981)|retina development in camera-type eye (GO:0060041)|skeletal muscle fiber development (GO:0048741)|SMAD protein signal transduction (GO:0060395)|somatic stem cell maintenance (GO:0035019)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase inhibitor activity (GO:0046811)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|repressing transcription factor binding (GO:0070491)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(2)|lung(5)|prostate(1)|stomach(1)	10	all_cancers(77;0.000139)|all_epithelial(69;4.45e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)			Epithelial(90;2.14e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.72e-29)|GBM - Glioblastoma multiforme(42;2.45e-08)|Colorectal(212;5.33e-05)|COAD - Colon adenocarcinoma(227;0.000228)|Kidney(185;0.00268)|BRCA - Breast invasive adenocarcinoma(365;0.00471)|STAD - Stomach adenocarcinoma(132;0.0147)|KIRC - Kidney renal clear cell carcinoma(229;0.0385)|Lung(427;0.207)		gcggtgccggcgccggTGCCC	0.776													C|||	229	0.0457268	0.0234	0.0576	5008	,	,		4535	0.0079		0.0706	False		,,,				2504	0.0808				p.A62G	Ovarian(177;144 1678 13697 20086 27838 40755)	.											.	SKI-838	0			c.C185G						.						1.0	1.0	1.0					1																	2160390		788	1840	2628	SO:0001583	missense	6497	exon1			TGCCGGCGCCGGT	X15218	CCDS39.1	1p36.33	2014-06-25	2014-06-25		ENSG00000157933	ENSG00000157933		"""SKI transcriptional corepressors"""	10896	protein-coding gene	gene with protein product		164780	"""v-ski avian sarcoma viral oncogene homolog"""			2762147	Standard	NM_003036		Approved		uc001aja.4	P12755	OTTHUMG00000001407	ENST00000378536.4:c.185C>G	1.37:g.2160390C>G	ENSP00000367797:p.Ala62Gly	Somatic	2	1		WXS	Illumina HiSeq	Phase_I	3	2	NM_003036	0	0	0	0	0	Q5SYT7	Missense_Mutation	SNP	ENST00000378536.4	37	CCDS39.1	102	0.046703296703296704	20	0.04065040650406504	28	0.07734806629834254	3	0.005244755244755245	51	0.06728232189973615	C	9.688	1.151208	0.21371	.	.	ENSG00000157933	ENST00000378536	D	0.95821	-3.82	2.3	2.3	0.28687	.	.	.	.	.	T	0.47857	0.1468	N	0.08118	0	0.45733	P	0.001363000000000003	D	0.57899	0.981	P	0.58520	0.84	T	0.76271	-0.3020	8	0.20519	T	0.43	-11.9718	7.7374	0.28823	0.0:1.0:0.0:0.0	rs28384811	62	P12755	SKI_HUMAN	G	62	ENSP00000367797:A62G	ENSP00000367797:A62G	A	+	2	0	SKI	2150250	0.994000	0.37717	0.998000	0.56505	0.971000	0.66376	0.878000	0.28126	1.104000	0.41587	0.185000	0.17295	GCG	C|0.953;G|0.047		0.776	SKI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004070.1	NM_003036	
SRRM1	10250	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	24979017	24979017	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr1:24979017A>T	ENST00000323848.9	+	7	1133	c.818A>T	c.(817-819)aAg>aTg	p.K273M	SRRM1_ENST00000479034.1_3'UTR|SRRM1_ENST00000374389.4_Missense_Mutation_p.K273M|SRRM1_ENST00000537199.1_Missense_Mutation_p.K142M|SRRM1_ENST00000447431.2_Missense_Mutation_p.K273M	NM_005839.3	NP_005830.2	Q8IYB3	SRRM1_HUMAN	serine/arginine repetitive matrix 1	273	Arg-rich.|Pro-rich.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(2)|prostate(1)|urinary_tract(2)	36		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;1.01e-24)|Colorectal(126;5.95e-08)|COAD - Colon adenocarcinoma(152;3.24e-06)|GBM - Glioblastoma multiforme(114;0.000148)|BRCA - Breast invasive adenocarcinoma(304;0.00177)|KIRC - Kidney renal clear cell carcinoma(1967;0.00348)|STAD - Stomach adenocarcinoma(196;0.00483)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		GAGAAGGAGAAGACCCGACCA	0.502																																					p.K273M	Ovarian(68;897 1494 3282 17478)	.											.	SRRM1-93	0			c.A818T						.						34.0	36.0	36.0					1																	24979017		2203	4300	6503	SO:0001583	missense	10250	exon7			AGGAGAAGACCCG	AF048977	CCDS255.1	1p36	2010-04-22			ENSG00000133226	ENSG00000133226			16638	protein-coding gene	gene with protein product	"""Ser/Arg-related nuclear matrix protein"", ""plenty of prolines 101-like"""	605975				9531537	Standard	NM_005839		Approved	SRM160, POP101, MGC39488	uc001bjm.3	Q8IYB3	OTTHUMG00000003320	ENST00000323848.9:c.818A>T	1.37:g.24979017A>T	ENSP00000326261:p.Lys273Met	Somatic	44	0		WXS	Illumina HiSeq	Phase_I	25	7	NM_005839	0	0	39	68	29	O60585|Q5VVN4	Missense_Mutation	SNP	ENST00000323848.9	37	CCDS255.1	.	.	.	.	.	.	.	.	.	.	A	16.33	3.093181	0.56075	.	.	ENSG00000133226	ENST00000323848;ENST00000447431;ENST00000374389;ENST00000537199	T;T;T;T	0.52754	0.76;0.76;0.76;0.65	6.05	6.05	0.98169	.	0.000000	0.64402	D	0.000003	T	0.46347	0.1388	N	0.19112	0.55	0.45791	D	0.998673	D;D	0.58620	0.983;0.971	P;P	0.55824	0.785;0.615	T	0.50233	-0.8852	10	0.66056	D	0.02	-2.6317	10.596	0.45338	0.9281:0.0:0.0719:0.0	.	273;273	E9PCT1;Q8IYB3	.;SRRM1_HUMAN	M	273;273;273;142	ENSP00000326261:K273M;ENSP00000391430:K273M;ENSP00000363510:K273M;ENSP00000441776:K142M	ENSP00000326261:K273M	K	+	2	0	SRRM1	24851604	1.000000	0.71417	1.000000	0.80357	0.736000	0.42039	3.872000	0.56085	2.320000	0.78422	0.528000	0.53228	AAG	.		0.502	SRRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009292.2	NM_005839	
SRRM1	10250	hgsc.bcm.edu	37	1	24993412	24993412	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr1:24993412C>G	ENST00000323848.9	+	13	2050	c.1735C>G	c.(1735-1737)Cga>Gga	p.R579G	snoU13_ENST00000459464.1_RNA|SRRM1_ENST00000479034.1_3'UTR|SRRM1_ENST00000374389.4_Missense_Mutation_p.R588G|SRRM1_ENST00000447431.2_Missense_Mutation_p.R591G	NM_005839.3	NP_005830.2	Q8IYB3	SRRM1_HUMAN	serine/arginine repetitive matrix 1	579	Arg-rich.|Necessary for speckles and matrix localization.|Pro-rich.|Ser-rich.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(2)|prostate(1)|urinary_tract(2)	36		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;1.01e-24)|Colorectal(126;5.95e-08)|COAD - Colon adenocarcinoma(152;3.24e-06)|GBM - Glioblastoma multiforme(114;0.000148)|BRCA - Breast invasive adenocarcinoma(304;0.00177)|KIRC - Kidney renal clear cell carcinoma(1967;0.00348)|STAD - Stomach adenocarcinoma(196;0.00483)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		ACCACCACGACGAAGGTACTT	0.577																																					p.R579G	Ovarian(68;897 1494 3282 17478)	.											.	SRRM1-93	0			c.C1735G						.						52.0	43.0	46.0					1																	24993412		2203	4300	6503	SO:0001583	missense	10250	exon13			CCACGACGAAGGT	AF048977	CCDS255.1	1p36	2010-04-22			ENSG00000133226	ENSG00000133226			16638	protein-coding gene	gene with protein product	"""Ser/Arg-related nuclear matrix protein"", ""plenty of prolines 101-like"""	605975				9531537	Standard	NM_005839		Approved	SRM160, POP101, MGC39488	uc001bjm.3	Q8IYB3	OTTHUMG00000003320	ENST00000323848.9:c.1735C>G	1.37:g.24993412C>G	ENSP00000326261:p.Arg579Gly	Somatic	54	2		WXS	Illumina HiSeq	Phase_I	42	3	NM_005839	0	0	0	0	0	O60585|Q5VVN4	Missense_Mutation	SNP	ENST00000323848.9	37	CCDS255.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.306626	0.81247	.	.	ENSG00000133226	ENST00000323848;ENST00000447431;ENST00000374389	T;T;T	0.36699	1.24;1.24;1.24	5.66	5.66	0.87406	.	0.000000	0.52532	D	0.000077	T	0.60090	0.2242	M	0.62723	1.935	0.80722	D	1	D;D	0.67145	0.996;0.993	D;D	0.76575	0.988;0.972	T	0.60016	-0.7345	10	0.62326	D	0.03	-1.8915	19.3453	0.94361	0.0:1.0:0.0:0.0	.	591;579	E9PCT1;Q8IYB3	.;SRRM1_HUMAN	G	579;591;588	ENSP00000326261:R579G;ENSP00000391430:R591G;ENSP00000363510:R588G	ENSP00000326261:R579G	R	+	1	2	SRRM1	24865999	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	4.350000	0.59392	2.654000	0.90174	0.650000	0.86243	CGA	.		0.577	SRRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009292.2	NM_005839	
PEF1	553115	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	32100869	32100869	+	Silent	SNP	T	T	C			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr1:32100869T>C	ENST00000373703.4	-	2	301	c.279A>G	c.(277-279)ccA>ccG	p.P93P	PEF1_ENST00000440872.2_Silent_p.P93P|PEF1_ENST00000492061.1_5'UTR	NM_012392.3	NP_036524.1	Q9UBV8	PEF1_HUMAN	penta-EF-hand domain containing 1	93	9 X 9 AA approximate tandem repeat of [AP]-P-G-G-P-Y-G-G-P-P.				proteolysis (GO:0006508)|response to calcium ion (GO:0051592)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|poly(A) RNA binding (GO:0044822)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|prostate(2)|upper_aerodigestive_tract(1)	7		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)|all_neural(195;0.186)		STAD - Stomach adenocarcinoma(196;0.0546)		AACTTGGAGGTGGCTGACCAT	0.587																																					p.P93P		.											.	PEF1-68	0			c.A279G						.						49.0	51.0	50.0					1																	32100869		2203	4300	6503	SO:0001819	synonymous_variant	553115	exon2			TGGAGGTGGCTGA		CCDS345.1	1p34	2013-01-10			ENSG00000162517	ENSG00000162517		"""EF-hand domain containing"""	30009	protein-coding gene	gene with protein product	"""peflin"""	610033				10486255, 11883899	Standard	NM_012392		Approved	PEF1A	uc001bth.2	Q9UBV8	OTTHUMG00000003877	ENST00000373703.4:c.279A>G	1.37:g.32100869T>C		Somatic	126	0		WXS	Illumina HiSeq	Phase_I	93	21	NM_012392	0	1	43	88	44		Silent	SNP	ENST00000373703.4	37	CCDS345.1																																																																																			.		0.587	PEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011046.1	NM_012392	
AKR1A1	10327	ucsc.edu	37	1	46032694	46032694	+	Splice_Site	SNP	T	T	C			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr1:46032694T>C	ENST00000372070.3	+	5	1103		c.e5+2		AKR1A1_ENST00000351829.4_Splice_Site|AKR1A1_ENST00000471651.1_Nonstop_Mutation_p.*120R	NM_001202413.1|NM_001202414.1|NM_006066.3	NP_001189342.1|NP_001189343.1|NP_006057.1	P14550	AK1A1_HUMAN	aldo-keto reductase family 1, member A1 (aldehyde reductase)						aldehyde catabolic process (GO:0046185)|cellular aldehyde metabolic process (GO:0006081)|D-glucuronate catabolic process (GO:0042840)|glucose metabolic process (GO:0006006)|L-ascorbic acid biosynthetic process (GO:0019853)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|electron carrier activity (GO:0009055)|L-glucuronate reductase activity (GO:0047939)			lung(3)|prostate(1)|urinary_tract(1)	5	Acute lymphoblastic leukemia(166;0.155)				Doxorubicin(DB00997)	TGCCTTTGAGTGAGCCTTGCC	0.552																																					.													.	AKR1A1-226	0			c.356+2T>C						.						110.0	96.0	101.0					1																	46032694		2203	4300	6503	SO:0001630	splice_region_variant	10327	exon5			TTTGAGTGAGCCT	J04794	CCDS523.1	1p33-p32	2010-04-08			ENSG00000117448	ENSG00000117448	1.1.1.2	"""Aldo-keto reductases"""	380	protein-coding gene	gene with protein product	"""dihydrodiol dehydrogenase 3"""	103830				2498333, 10393438	Standard	NM_001202414		Approved	ALR, DD3	uc001coe.3	P14550	OTTHUMG00000007740	ENST00000372070.3:c.356+2T>C	1.37:g.46032694T>C		Somatic	113	0		WXS	Illumina HiSeq		92	2	NM_001202413	0	0	6	6	0	A8KAL8|D3DQ04|Q6IAZ4	Splice_Site	SNP	ENST00000372070.3	37	CCDS523.1	.	.	.	.	.	.	.	.	.	.	T	15.75	2.924867	0.52759	.	.	ENSG00000117448	ENST00000372070;ENST00000434299;ENST00000351829	.	.	.	5.83	3.48	0.39840	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.1397	0.31076	0.1203:0.0654:0.0:0.8143	.	.	.	.	.	-1	.	.	.	+	.	.	AKR1A1	45805281	1.000000	0.71417	1.000000	0.80357	0.776000	0.43924	7.965000	0.87945	0.454000	0.26884	-0.352000	0.07741	.	.		0.552	AKR1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020851.1	NM_006066	Intron
SLC1A7	6512	broad.mit.edu	37	1	53555558	53555558	+	Silent	SNP	G	G	A			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr1:53555558G>A	ENST00000371494.4	-	9	1402	c.1275C>T	c.(1273-1275)gcC>gcT	p.A425A	SLC1A7_ENST00000488036.1_5'UTR	NM_006671.4	NP_006662.3	O00341	EAA5_HUMAN	solute carrier family 1 (glutamate transporter), member 7	425					dicarboxylic acid transport (GO:0006835)|ion transport (GO:0006811)|L-glutamate transport (GO:0015813)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)	p.A425A(1)		NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)	26				Colorectal(1306;0.234)		TGACGAGGCCGGCCTGGGGGA	0.627																																					p.A425A	NSCLC(128;80 1811 21245 38490 51715)												.	SLC1A7-155	1	Substitution - coding silent(1)	lung(1)	c.C1275T						.						73.0	66.0	69.0					1																	53555558		2203	4300	6503	SO:0001819	synonymous_variant	6512	exon9			GAGGCCGGCCTGG	U76362	CCDS574.1, CCDS72796.1, CCDS72797.1, CCDS72798.1	1p32.3	2013-05-22			ENSG00000162383	ENSG00000162383		"""Solute carriers"""	10945	protein-coding gene	gene with protein product		604471				9108121	Standard	NM_001287597		Approved	EAAT5	uc001cuy.3	O00341	OTTHUMG00000008937	ENST00000371494.4:c.1275C>T	1.37:g.53555558G>A		Somatic	80	0		WXS	Illumina HiSeq	Phase_I	70	3	NM_006671	0	0	0	0	0	Q5VVZ0|Q969Z8|Q9BW45	Silent	SNP	ENST00000371494.4	37	CCDS574.1																																																																																			.		0.627	SLC1A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024746.1	NM_006671	
SIPA1L2	57568	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	232650793	232650793	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr1:232650793A>C	ENST00000366630.1	-	2	651	c.293T>G	c.(292-294)cTg>cGg	p.L98R	SIPA1L2_ENST00000262861.4_Missense_Mutation_p.L98R			Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like 2	98					regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(49)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	103		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				GCTTTCCCACAGTGCCTTGCA	0.517																																					p.L98R		.											.	SIPA1L2-95	0			c.T293G						.						156.0	154.0	155.0					1																	232650793		2020	4187	6207	SO:0001583	missense	57568	exon1			TCCCACAGTGCCT	AB037810	CCDS41474.1	1q42.2	2008-02-05			ENSG00000116991	ENSG00000116991			23800	protein-coding gene	gene with protein product		611609					Standard	NM_020808		Approved	KIAA1389	uc001hvg.3	Q9P2F8	OTTHUMG00000037820	ENST00000366630.1:c.293T>G	1.37:g.232650793A>C	ENSP00000355589:p.Leu98Arg	Somatic	224	0		WXS	Illumina HiSeq	Phase_I	177	39	NM_020808	0	0	3	4	1	Q2TV88|Q5VXR7|Q5VXR8|Q641Q4|Q8NA38|Q96DZ3|Q9H9F6	Missense_Mutation	SNP	ENST00000366630.1	37	CCDS41474.1	.	.	.	.	.	.	.	.	.	.	A	0.689	-0.795281	0.02862	.	.	ENSG00000116991	ENST00000366630;ENST00000262861	T;T	0.78816	-1.21;-1.21	5.19	4.02	0.46733	.	0.630597	0.14001	N	0.348152	T	0.50171	0.1600	N	0.08118	0	0.09310	N	1	P	0.39216	0.664	B	0.32289	0.143	T	0.35325	-0.9793	10	0.14252	T	0.57	-9.9849	5.5611	0.17144	0.6384:0.0:0.3616:0.0	.	98	Q9P2F8	SI1L2_HUMAN	R	98	ENSP00000355589:L98R;ENSP00000262861:L98R	ENSP00000262861:L98R	L	-	2	0	SIPA1L2	230717416	0.005000	0.15991	0.062000	0.19696	0.262000	0.26303	1.251000	0.32862	0.942000	0.37525	0.528000	0.53228	CTG	.		0.517	SIPA1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092318.1	XM_045839	
CUBN	8029	hgsc.bcm.edu;broad.mit.edu	37	10	16871011	16871011	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr10:16871011T>A	ENST00000377833.4	-	66	10622	c.10557A>T	c.(10555-10557)agA>agT	p.R3519S		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	3519	CUB 27. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TGAATGAGCCTCTGTCTCCAT	0.502																																					p.R3519S		.											.	CUBN-166	0			c.A10557T						.						88.0	61.0	70.0					10																	16871011		2203	4300	6503	SO:0001583	missense	8029	exon66			TGAGCCTCTGTCT	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.10557A>T	10.37:g.16871011T>A	ENSP00000367064:p.Arg3519Ser	Somatic	50	0		WXS	Illumina HiSeq	Phase_I	40	10	NM_001081	0	0	0	0	0	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	37	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	T	1.506	-0.550649	0.03996	.	.	ENSG00000107611	ENST00000377833;ENST00000545090	T	0.15603	2.41	5.94	-11.9	0.00025	CUB (5);	2.229840	0.01788	N	0.032161	T	0.03915	0.0110	N	0.02275	-0.615	0.80722	D	1	B	0.10296	0.003	B	0.10450	0.005	T	0.40308	-0.9570	10	0.08599	T	0.76	.	2.155	0.03810	0.4694:0.1443:0.1281:0.2582	.	3519	O60494	CUBN_HUMAN	S	3519;360	ENSP00000367064:R3519S	ENSP00000367064:R3519S	R	-	3	2	CUBN	16911017	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.866000	0.00723	-2.526000	0.00494	-0.366000	0.07423	AGA	.		0.502	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
EPC1	80314	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	32582651	32582651	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr10:32582651C>A	ENST00000263062.8	-	3	597	c.328G>T	c.(328-330)Gct>Tct	p.A110S	EPC1_ENST00000375110.2_Missense_Mutation_p.A60S|EPC1_ENST00000319778.6_Missense_Mutation_p.A110S	NM_025209.2	NP_079485.1	Q9H2F5	EPC1_HUMAN	enhancer of polycomb homolog 1 (Drosophila)	110					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Piccolo NuA4 histone acetyltransferase complex (GO:0032777)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(5)|urinary_tract(1)	24		Prostate(175;0.0199)				GGCTGTTCAGCATCCAAACTA	0.368																																					p.A110S		.											.	EPC1-93	0			c.G328T						.						51.0	46.0	48.0					10																	32582651		2203	4300	6503	SO:0001583	missense	80314	exon3			GTTCAGCATCCAA	AF277374	CCDS7172.1, CCDS60511.1, CCDS73083.1	10p11	2005-12-12			ENSG00000120616	ENSG00000120616			19876	protein-coding gene	gene with protein product		610999				10976108	Standard	NM_025209		Approved	Epl1	uc001iwg.2	Q9H2F5	OTTHUMG00000017925	ENST00000263062.8:c.328G>T	10.37:g.32582651C>A	ENSP00000263062:p.Ala110Ser	Somatic	54	0		WXS	Illumina HiSeq	Phase_I	37	11	NM_025209	0	0	0	0	0	B4DSC3|D3DRX7|Q5VW54|Q5VW56|Q5VW58|Q8NAQ4|Q8NE21|Q96LF4|Q96RR6|Q9H7T7	Missense_Mutation	SNP	ENST00000263062.8	37	CCDS7172.1	.	.	.	.	.	.	.	.	.	.	C	10.97	1.501195	0.26861	.	.	ENSG00000120616	ENST00000375110;ENST00000319778;ENST00000263062	T;T;T	0.40476	1.03;1.03;1.03	5.67	4.76	0.60689	Enhancer of polycomb-like, N-terminal (1);	0.091656	0.85682	D	0.000000	T	0.17959	0.0431	N	0.04508	-0.205	0.42849	D	0.994075	B;P;B;B	0.39022	0.073;0.655;0.02;0.073	B;B;B;B	0.30855	0.105;0.121;0.037;0.105	T	0.09509	-1.0671	10	0.10902	T	0.67	-6.3339	14.4806	0.67579	0.0:0.9292:0.0:0.0708	.	110;60;110;110	B8XCX7;Q9H2F5-3;Q9H2F5-2;Q9H2F5	.;.;.;EPC1_HUMAN	S	60;110;110	ENSP00000364251:A60S;ENSP00000318559:A110S;ENSP00000263062:A110S	ENSP00000263062:A110S	A	-	1	0	EPC1	32622657	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.957000	0.56730	1.389000	0.46526	0.467000	0.42956	GCT	.		0.368	EPC1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047484.1		
ZNF33B	7582	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	43088537	43088537	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr10:43088537T>G	ENST00000359467.3	-	5	1975	c.1861A>C	c.(1861-1863)Aag>Cag	p.K621Q	ZNF33B_ENST00000486187.1_RNA	NM_006955.1	NP_008886.1	Q06732	ZN33B_HUMAN	zinc finger protein 33B	621					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(15)|skin(1)|stomach(1)	29						AGTTGTGACTTCTGGCAGAAG	0.363																																					p.K621Q	Melanoma(137;1247 1767 16772 25727 43810)	.											.	ZNF33B-90	0			c.A1861C						.						96.0	96.0	96.0					10																	43088537		2203	4300	6503	SO:0001583	missense	7582	exon5			GTGACTTCTGGCA	X68688, AJ491697	CCDS7198.1	10q11.2	2013-01-08	2005-03-18		ENSG00000196693	ENSG00000196693		"""Zinc fingers, C2H2-type"", ""-"""	13097	protein-coding gene	gene with protein product		194522	"""zinc finger protein 33b (KOX 31)"", ""zinc finger protein 11B"""	ZNF11B		2014798	Standard	NM_006955		Approved	KOX31, KOX2	uc001jaf.1	Q06732	OTTHUMG00000018014	ENST00000359467.3:c.1861A>C	10.37:g.43088537T>G	ENSP00000352444:p.Lys621Gln	Somatic	205	0		WXS	Illumina HiSeq	Phase_I	183	42	NM_006955	0	0	24	48	24	Q06731|Q32MA2|Q86XY8|Q8NDW3	Missense_Mutation	SNP	ENST00000359467.3	37	CCDS7198.1	.	.	.	.	.	.	.	.	.	.	T	9.434	1.086178	0.20390	.	.	ENSG00000196693	ENST00000359467;ENST00000395836	T	0.01015	5.44	2.58	2.58	0.30949	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.35646	N	0.003071	T	0.02807	0.0084	L	0.56124	1.755	0.09310	N	1	D	0.71674	0.998	D	0.68621	0.959	T	0.40021	-0.9585	10	0.38643	T	0.18	.	9.025	0.36224	0.0:0.0:0.0:1.0	.	621	Q06732	ZN33B_HUMAN	Q	621;587	ENSP00000352444:K621Q	ENSP00000352444:K621Q	K	-	1	0	ZNF33B	42408543	0.000000	0.05858	1.000000	0.80357	0.991000	0.79684	0.848000	0.27710	1.446000	0.47643	0.336000	0.21669	AAG	.		0.363	ZNF33B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_006955	
MICU1	10367	hgsc.bcm.edu	37	10	74322781	74322781	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr10:74322781T>G	ENST00000361114.5	-	3	298	c.202A>C	c.(202-204)Agt>Cgt	p.S68R	MICU1_ENST00000604025.1_5'UTR|MICU1_ENST00000401998.3_Missense_Mutation_p.S68R|MICU1_ENST00000398761.4_Missense_Mutation_p.S68R	NM_001195518.1|NM_006077.3	NP_001182447.1|NP_006068.2	Q9BPX6	MICU1_HUMAN	mitochondrial calcium uptake 1	68					calcium ion import (GO:0070509)|calcium ion transmembrane import into mitochondrion (GO:0036444)|defense response (GO:0006952)|mitochondrial calcium ion homeostasis (GO:0051560)|mitochondrial calcium ion transport (GO:0006851)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|protein homooligomerization (GO:0051260)	calcium channel complex (GO:0034704)|integral component of mitochondrial membrane (GO:0032592)|intracellular (GO:0005622)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|uniplex complex (GO:1990246)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)										CCGATGTCACTTTTTAGGTTG	0.393																																					p.S68R		.											.	.	0			c.A202C						.						161.0	136.0	143.0					10																	74322781		1859	4107	5966	SO:0001583	missense	10367	exon3			TGTCACTTTTTAG	Y17711	CCDS55714.1, CCDS55715.1	10q22.1	2013-01-10	2011-06-23	2011-06-23	ENSG00000107745	ENSG00000107745		"""EF-hand domain containing"""	1530	protein-coding gene	gene with protein product		605084	"""calcium binding atopy-related autoantigen 1"""	CBARA1		9806765, 20693986	Standard	NM_006077		Approved	CALC, EFHA3, FLJ12684	uc001jtb.2	Q9BPX6	OTTHUMG00000018437	ENST00000361114.5:c.202A>C	10.37:g.74322781T>G	ENSP00000354415:p.Ser68Arg	Somatic	40	0		WXS	Illumina HiSeq	Phase_I	40	5	NM_001195518	0	0	144	144	0	A8MV96|B3KN20|B4DJH9|B4DPI1|B5MBY3|D3YTJ3|O75785|Q9H9N6|Q9UFX0	Missense_Mutation	SNP	ENST00000361114.5	37	CCDS55715.1	.	.	.	.	.	.	.	.	.	.	T	8.049	0.765559	0.15914	.	.	ENSG00000107745	ENST00000361114;ENST00000398761;ENST00000401998	T;T;T	0.79247	-1.25;-1.25;-1.25	5.5	0.333	0.15943	.	1.158280	0.05998	N	0.647136	T	0.61426	0.2346	L	0.34521	1.04	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.54403	-0.8299	10	0.16896	T	0.51	.	0.8372	0.01142	0.1531:0.2187:0.1588:0.4694	.	68	Q9BPX6	MICU1_HUMAN	R	68	ENSP00000354415:S68R;ENSP00000381745:S68R;ENSP00000384068:S68R	ENSP00000354415:S68R	S	-	1	0	MICU1	73992787	0.952000	0.32445	0.979000	0.43373	0.067000	0.16453	0.143000	0.16115	0.086000	0.17137	-0.371000	0.07208	AGT	.		0.393	MICU1-002	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048586.1	NM_006077	
IFIT3	3437	broad.mit.edu	37	10	91098669	91098669	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr10:91098669C>A	ENST00000371818.4	+	2	437	c.257C>A	c.(256-258)gCt>gAt	p.A86D	LIPA_ENST00000371837.1_Intron|LIPA_ENST00000487618.1_Intron|IFIT3_ENST00000371811.4_Missense_Mutation_p.A86D	NM_001549.4	NP_001540.2	O14879	IFIT3_HUMAN	interferon-induced protein with tetratricopeptide repeats 3	86					cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)	identical protein binding (GO:0042802)			breast(1)|central_nervous_system(3)|endometrium(1)|large_intestine(4)|lung(3)|skin(2)|urinary_tract(1)	15						CAAGAACATGCTGACCAAGCA	0.453																																					p.A86D													.	IFIT3-90	0			c.C257A						.						97.0	98.0	97.0					10																	91098669		2203	4300	6503	SO:0001583	missense	3437	exon2			AACATGCTGACCA	U52513	CCDS7402.1, CCDS31241.1	10q23.31	2014-05-22	2004-07-16	2004-07-16	ENSG00000119917	ENSG00000119917		"""Tetratricopeptide (TTC) repeat domain containing"""	5411	protein-coding gene	gene with protein product		604650	"""interferon-induced protein with tetratricopeptide repeats 4"""	IFIT4		9828129, 9391139	Standard	NM_001031683		Approved	ISG60, RIG-G, CIG-49, IFI60, GARG-49, IRG2	uc001kgg.3	O14879	OTTHUMG00000018708	ENST00000371818.4:c.257C>A	10.37:g.91098669C>A	ENSP00000360883:p.Ala86Asp	Somatic	96	0		WXS	Illumina HiSeq	Phase_I	66	3	NM_001549	0	0	42	42	0	Q99634|Q9BSK7	Missense_Mutation	SNP	ENST00000371818.4	37	CCDS7402.1	.	.	.	.	.	.	.	.	.	.	C	4.933	0.173346	0.09391	.	.	ENSG00000119917	ENST00000371818;ENST00000371811	D;D	0.92858	-3.12;-3.12	4.57	-1.1	0.09872	Tetratricopeptide-like helical (1);	1.363970	0.04700	N	0.415647	D	0.89319	0.6681	L	0.50333	1.59	0.09310	N	1	B	0.19583	0.037	B	0.27608	0.081	T	0.74529	-0.3635	10	0.29301	T	0.29	0.4225	9.4267	0.38583	0.3562:0.4198:0.224:0.0	.	86	O14879	IFIT3_HUMAN	D	86	ENSP00000360883:A86D;ENSP00000360876:A86D	ENSP00000360876:A86D	A	+	2	0	IFIT3	91088649	0.000000	0.05858	0.000000	0.03702	0.277000	0.26821	-0.095000	0.11077	-0.170000	0.10816	0.650000	0.86243	GCT	.		0.453	IFIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049294.1	NM_001549	
PDE6C	5146	broad.mit.edu;bcgsc.ca	37	10	95400272	95400272	+	Silent	SNP	G	G	A	rs200781437		TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr10:95400272G>A	ENST00000371447.3	+	13	1833	c.1695G>A	c.(1693-1695)cgG>cgA	p.R565R		NM_006204.3	NP_006195.3	P51160	PDE6C_HUMAN	phosphodiesterase 6C, cGMP-specific, cone, alpha prime	565				R -> Q (in Ref. 1; AAA96392 and 2; AAA92886). {ECO:0000305}.	phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|visual perception (GO:0007601)	plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(12)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	42		Colorectal(252;0.123)			Caffeine(DB00201)	ACAATTGGCGGCATGGGTTCA	0.453													G|||	1	0.000199681	0.0	0.0014	5008	,	,		18596	0.0		0.0	False		,,,				2504	0.0				p.R565R													.	PDE6C-94	0			c.G1695A						.						181.0	162.0	169.0					10																	95400272		2203	4300	6503	SO:0001819	synonymous_variant	5146	exon13			TTGGCGGCATGGG	U31973	CCDS7429.1	10q24	2013-01-23			ENSG00000095464	ENSG00000095464	3.1.4.17	"""Phosphodiesterases"""	8787	protein-coding gene	gene with protein product		600827					Standard	NM_006204		Approved	PDEA2, ACHM5, COD4	uc001kiu.4	P51160	OTTHUMG00000018775	ENST00000371447.3:c.1695G>A	10.37:g.95400272G>A		Somatic	235	0		WXS	Illumina HiSeq	Phase_I	192	7	NM_006204	0	0	0	0	0	A6NCR6|Q5VY29	Silent	SNP	ENST00000371447.3	37	CCDS7429.1																																																																																			G|1.000;A|0.000		0.453	PDE6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049437.1	NM_006204	
PGM2L1	283209	hgsc.bcm.edu	37	11	74085550	74085550	+	Silent	SNP	G	G	A			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr11:74085550G>A	ENST00000298198.4	-	2	500	c.189C>T	c.(187-189)tgC>tgT	p.C63C		NM_173582.3	NP_775853.2	Q6PCE3	PGM2L_HUMAN	phosphoglucomutase 2-like 1	63					glucose metabolic process (GO:0006006)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	glucose-1,6-bisphosphate synthase activity (GO:0047933)|intramolecular transferase activity, phosphotransferases (GO:0016868)			NS(2)|breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	Breast(11;3.32e-06)					AAGTCATTCGGCAACAAAGAC	0.403																																					p.C63C		.											.	PGM2L1-91	0			c.C189T						.						142.0	118.0	126.0					11																	74085550		2200	4293	6493	SO:0001819	synonymous_variant	283209	exon2			CATTCGGCAACAA	AB019210	CCDS8231.1	11q13.3	2008-12-01			ENSG00000165434	ENSG00000165434			20898	protein-coding gene	gene with protein product	"""glucose-1,6-bisphosphate synthase"""	611610				17804405	Standard	NM_173582		Approved	FLJ32029, BM32A	uc001ovb.1	Q6PCE3	OTTHUMG00000168132	ENST00000298198.4:c.189C>T	11.37:g.74085550G>A		Somatic	96	1		WXS	Illumina HiSeq	Phase_I	87	5	NM_173582	0	0	24	24	0	Q96MQ7|Q9UIK3	Silent	SNP	ENST00000298198.4	37	CCDS8231.1																																																																																			.		0.403	PGM2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398324.1	NM_173582	
ZC3H12C	85463	broad.mit.edu;ucsc.edu	37	11	110036283	110036283	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr11:110036283T>A	ENST00000278590.3	+	6	2524	c.2473T>A	c.(2473-2475)Tgt>Agt	p.C825S	ZC3H12C_ENST00000453089.2_Missense_Mutation_p.C794S|ZC3H12C_ENST00000528673.1_Missense_Mutation_p.C826S	NM_033390.1	NP_203748.1	Q9C0D7	ZC12C_HUMAN	zinc finger CCCH-type containing 12C	825							endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		all_cancers(61;3.24e-13)|all_epithelial(67;1.27e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.72e-06)|BRCA - Breast invasive adenocarcinoma(274;1.17e-05)|all cancers(92;9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0279)		GATCCCATACTGTGGAATGCC	0.502																																					p.C825S													.	ZC3H12C-68	0			c.T2473A						.						34.0	37.0	36.0					11																	110036283		1901	4119	6020	SO:0001583	missense	85463	exon6			CCATACTGTGGAA		CCDS44727.1	11q22.3	2012-07-05			ENSG00000149289	ENSG00000149289		"""Zinc fingers, CCCH-type domain containing"""	29362	protein-coding gene	gene with protein product	"""MCP induced protein 3"""	615001				11214970, 18178554	Standard	NM_033390		Approved	KIAA1726, MCPIP3	uc009yxw.3	Q9C0D7	OTTHUMG00000166572	ENST00000278590.3:c.2473T>A	11.37:g.110036283T>A	ENSP00000278590:p.Cys825Ser	Somatic	24	0		WXS	Illumina HiSeq	Phase_I	24	4	NM_033390	0	0	14	29	15	B4DI65|B4DR47	Missense_Mutation	SNP	ENST00000278590.3	37	CCDS44727.1	.	.	.	.	.	.	.	.	.	.	T	12.83	2.055314	0.36277	.	.	ENSG00000149289	ENST00000278590;ENST00000528673;ENST00000453089	T;T;T	0.28666	1.61;1.6;1.61	6.03	6.03	0.97812	.	0.448650	0.27936	N	0.017258	T	0.45236	0.1332	L	0.43152	1.355	0.38492	D	0.948009	D;D;D	0.63880	0.993;0.993;0.993	P;D;P	0.72338	0.777;0.977;0.777	T	0.28332	-1.0047	10	0.09843	T	0.71	-20.173	16.5582	0.84512	0.0:0.0:0.0:1.0	.	826;825;825	B4DR47;B4DI65;Q9C0D7	.;.;ZC12C_HUMAN	S	825;826;794	ENSP00000278590:C825S;ENSP00000431821:C826S;ENSP00000413094:C794S	ENSP00000278590:C825S	C	+	1	0	ZC3H12C	109541493	0.995000	0.38212	0.997000	0.53966	0.088000	0.18126	1.600000	0.36762	2.308000	0.77769	0.533000	0.62120	TGT	.		0.502	ZC3H12C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000390491.1	NM_033390	
CD27	939	hgsc.bcm.edu	37	12	6554354	6554354	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr12:6554354C>A	ENST00000266557.3	+	1	322	c.93C>A	c.(91-93)caC>caA	p.H31Q	CD27-AS1_ENST00000399492.2_RNA|CD27-AS1_ENST00000545339.1_RNA	NM_001242.4	NP_001233	P26842	CD27_HUMAN	CD27 molecule	31					cell surface receptor signaling pathway (GO:0007166)|extrinsic apoptotic signaling pathway (GO:0097191)|immunoglobulin mediated immune response (GO:0016064)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of T cell apoptotic process (GO:0070233)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of JNK cascade (GO:0046330)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|response to ethanol (GO:0045471)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|transmembrane signaling receptor activity (GO:0004888)			kidney(1)|large_intestine(5)|lung(1)|urinary_tract(3)	10						CAGAGAGGCACTACTGGGCTC	0.632																																					p.H31Q		.											.	CD27-659	0			c.C93A						.						27.0	29.0	29.0					12																	6554354		2203	4300	6503	SO:0001583	missense	939	exon1			GAGGCACTACTGG	M63928	CCDS8545.1	12p13	2014-09-17	2006-10-27	2006-10-27	ENSG00000139193	ENSG00000139193		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11922	protein-coding gene	gene with protein product		186711	"""tumor necrosis factor receptor superfamily, member 7"""	TNFRSF7		2442250, 8530100	Standard	NM_001242		Approved	S152, Tp55	uc001qod.3	P26842	OTTHUMG00000168316	ENST00000266557.3:c.93C>A	12.37:g.6554354C>A	ENSP00000266557:p.His31Gln	Somatic	34	0		WXS	Illumina HiSeq	Phase_I	22	2	NM_001242	0	0	6	6	0	B2RDZ0	Missense_Mutation	SNP	ENST00000266557.3	37	CCDS8545.1	.	.	.	.	.	.	.	.	.	.	C	13.92	2.381098	0.42207	.	.	ENSG00000139193	ENST00000266557	D	0.90676	-2.71	4.91	-0.44	0.12261	TNFR/CD27/30/40/95 cysteine-rich region (2);	0.313247	0.24409	N	0.038774	T	0.77226	0.4099	L	0.34521	1.04	0.29291	N	0.869361	B	0.27013	0.166	B	0.25759	0.063	T	0.61153	-0.7120	10	0.08381	T	0.77	-12.4844	1.0852	0.01651	0.302:0.3719:0.1473:0.1789	.	31	P26842	CD27_HUMAN	Q	31	ENSP00000266557:H31Q	ENSP00000266557:H31Q	H	+	3	2	CD27	6424615	0.060000	0.20803	0.879000	0.34478	0.789000	0.44602	-0.784000	0.04633	0.244000	0.21351	0.557000	0.71058	CAC	.		0.632	CD27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399258.1		
ESPL1	9700	broad.mit.edu	37	12	53687097	53687097	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr12:53687097G>A	ENST00000257934.4	+	31	6293	c.6202G>A	c.(6202-6204)Gac>Aac	p.D2068N	PFDN5_ENST00000351500.3_5'Flank|PFDN5_ENST00000550846.1_5'Flank|PFDN5_ENST00000551018.1_5'Flank|PFDN5_ENST00000334478.4_5'Flank|ESPL1_ENST00000552462.1_Missense_Mutation_p.D2068N	NM_012291.4	NP_036423.4	Q14674	ESPL1_HUMAN	extra spindle pole bodies homolog 1 (S. cerevisiae)	2068					apoptotic process (GO:0006915)|cytokinesis (GO:0000910)|establishment of mitotic spindle localization (GO:0040001)|homologous chromosome segregation (GO:0045143)|meiotic spindle organization (GO:0000212)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(10)|large_intestine(12)|lung(21)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(8)	70						GACTGACCGCGACATTGACCG	0.532																																					p.D2068N	Colon(53;1069 1201 2587 5382)												.	ESPL1-228	0			c.G6202A						.						58.0	59.0	59.0					12																	53687097		2203	4300	6503	SO:0001583	missense	9700	exon31			GACCGCGACATTG	D79987	CCDS8852.1	12q13.13	2014-08-04	2013-05-03		ENSG00000135476	ENSG00000135476	3.4.22.49		16856	protein-coding gene	gene with protein product	"""separin"", ""separase"", ""separin, cysteine protease"""	604143	"""extra spindle poles like 1 (S. cerevisiae)"""			8724849, 16258266	Standard	NM_012291		Approved	KIAA0165, ESP1, SEPA	uc001sck.2	Q14674	OTTHUMG00000169674	ENST00000257934.4:c.6202G>A	12.37:g.53687097G>A	ENSP00000257934:p.Asp2068Asn	Somatic	73	0		WXS	Illumina HiSeq	Phase_I	63	3	NM_012291	0	0	7	7	0		Missense_Mutation	SNP	ENST00000257934.4	37	CCDS8852.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.410077	0.83340	.	.	ENSG00000135476	ENST00000257934;ENST00000552671;ENST00000552462	T;T	0.39229	1.09;1.09	4.6	4.6	0.57074	.	0.054909	0.64402	D	0.000001	T	0.72819	0.3508	M	0.93197	3.39	0.52501	D	0.999956	D	0.89917	1.0	D	0.72625	0.978	T	0.81040	-0.1113	10	0.72032	D	0.01	.	16.7111	0.85385	0.0:0.0:1.0:0.0	.	2068	Q14674	ESPL1_HUMAN	N	2068;1743;2068	ENSP00000257934:D2068N;ENSP00000449831:D2068N	ENSP00000257934:D2068N	D	+	1	0	ESPL1	51973364	1.000000	0.71417	1.000000	0.80357	0.628000	0.37860	9.207000	0.95064	2.576000	0.86940	0.563000	0.77884	GAC	.		0.532	ESPL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406899.2	NM_012291	
SLC39A5	283375	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	12	56630209	56630209	+	Silent	SNP	C	C	G	rs139155884	byFrequency	TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr12:56630209C>G	ENST00000266980.4	+	7	1268	c.975C>G	c.(973-975)ctC>ctG	p.L325L	ANKRD52_ENST00000548241.1_5'Flank|SLC39A5_ENST00000454355.2_Silent_p.L325L	NM_001135195.1	NP_001128667.1	Q6ZMH5	S39A5_HUMAN	solute carrier family 39 (zinc transporter), member 5	325					cellular response to zinc ion starvation (GO:0034224)|G1 to G0 transition involved in cell differentiation (GO:0070315)|neural precursor cell proliferation (GO:0061351)|transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	metal ion transmembrane transporter activity (GO:0046873)			NS(1)|cervix(6)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						GAAGGAATCTCGAAACACGCA	0.557																																					p.L325L		.											.	SLC39A5-92	0			c.C975G						.						134.0	129.0	131.0					12																	56630209		2203	4300	6503	SO:0001819	synonymous_variant	283375	exon9			GAATCTCGAAACA		CCDS8912.2	12q13.3	2013-07-17	2013-07-17		ENSG00000139540	ENSG00000139540		"""Solute carriers"""	20502	protein-coding gene	gene with protein product		608730	"""solute carrier family 39 (metal ion transporter), member 5"""				Standard	NM_173596		Approved		uc010sqj.2	Q6ZMH5	OTTHUMG00000156962	ENST00000266980.4:c.975C>G	12.37:g.56630209C>G		Somatic	86	0		WXS	Illumina HiSeq	Phase_I	100	27	NM_173596	0	0	4	6	2	B2R808|Q8N6Y3	Silent	SNP	ENST00000266980.4	37	CCDS8912.2																																																																																			C|0.999;T|0.001		0.557	SLC39A5-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346834.1	NM_173596	
STAT2	6773	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	56742947	56742947	+	Splice_Site	SNP	C	C	T			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr12:56742947C>T	ENST00000314128.4	-	16	1463	c.1440G>A	c.(1438-1440)caG>caA	p.Q480Q	STAT2_ENST00000556539.1_5'UTR|STAT2_ENST00000418572.2_Intron|STAT2_ENST00000557235.1_Splice_Site_p.Q476Q			P52630	STAT2_HUMAN	signal transducer and activator of transcription 2, 113kDa	480					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			NS(1)|endometrium(2)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|skin(3)	31						ACTCCCCTACCTGAAGGTTTG	0.562																																					p.Q480Q		.											.	STAT2-847	0			c.G1440A						.						93.0	93.0	93.0					12																	56742947		2203	4300	6503	SO:0001630	splice_region_variant	6773	exon16			CCCTACCTGAAGG	BC051284	CCDS8917.1, CCDS55836.1	12q13.2	2013-02-14	2002-08-29			ENSG00000170581		"""SH2 domain containing"""	11363	protein-coding gene	gene with protein product		600556	"""signal transducer and activator of transcription 2, 113kD"""			7885841	Standard	NM_005419		Approved	STAT113	uc001slc.3	P52630		ENST00000314128.4:c.1440+1G>A	12.37:g.56742947C>T		Somatic	165	0		WXS	Illumina HiSeq	Phase_I	160	41	NM_005419	0	0	0	0	0	B4DLC7|G3V2M6|Q16430|Q16431|Q9UDL4	Silent	SNP	ENST00000314128.4	37	CCDS8917.1																																																																																			.		0.562	STAT2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410277.1	NM_005419	Silent
FREM2	341640	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	39265553	39265553	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr13:39265553A>G	ENST00000280481.7	+	1	4288	c.4072A>G	c.(4072-4074)Act>Gct	p.T1358A		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	1358					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		ACGAAAACCTACTGGTGCCTT	0.383																																					p.T1358A		.											.	FREM2-100	0			c.A4072G						.						64.0	65.0	64.0					13																	39265553		2203	4300	6503	SO:0001583	missense	341640	exon1			AAACCTACTGGTG	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.4072A>G	13.37:g.39265553A>G	ENSP00000280481:p.Thr1358Ala	Somatic	97	0		WXS	Illumina HiSeq	Phase_I	98	23	NM_207361	0	0	2	3	1	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	37	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	A	0.011	-1.720360	0.00700	.	.	ENSG00000150893	ENST00000280481	T	0.40756	1.02	5.81	-0.554	0.11811	.	1.289890	0.04720	N	0.419174	T	0.13927	0.0337	N	0.01874	-0.695	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.19063	-1.0317	10	0.08837	T	0.75	.	1.7548	0.02980	0.3096:0.2411:0.3249:0.1243	.	1358	Q5SZK8	FREM2_HUMAN	A	1358	ENSP00000280481:T1358A	ENSP00000280481:T1358A	T	+	1	0	FREM2	38163553	0.000000	0.05858	0.001000	0.08648	0.731000	0.41821	0.004000	0.13106	0.122000	0.18314	0.533000	0.62120	ACT	.		0.383	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
TPT1	7178	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	45913688	45913688	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr13:45913688T>A	ENST00000530705.1	-	4	643	c.343A>T	c.(343-345)Atg>Ttg	p.M115L	TPT1-AS1_ENST00000523506.1_RNA|TPT1-AS1_ENST00000520590.1_RNA|TPT1-AS1_ENST00000521336.1_RNA|TPT1_ENST00000309246.5_Missense_Mutation_p.M115L|TPT1-AS1_ENST00000517509.1_RNA|TPT1-AS1_ENST00000520310.1_RNA|TPT1_ENST00000529421.1_5'UTR|TPT1_ENST00000379060.4_Missense_Mutation_p.M103L|TPT1-AS1_ENST00000412946.2_RNA|SNORA31_ENST00000362607.1_RNA|TPT1_ENST00000379055.1_Missense_Mutation_p.M81L|RP11-290D2.6_ENST00000610057.1_RNA|TPT1_ENST00000379056.1_Missense_Mutation_p.M81L|TPT1-AS1_ENST00000520622.1_RNA			P13693	TCTP_HUMAN	tumor protein, translationally-controlled 1	115					calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ectoderm development (GO:2000384)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|regulation of apoptotic process (GO:0042981)|response to virus (GO:0009615)|stem cell maintenance (GO:0019827)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|multivesicular body (GO:0005771)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			lung(1)	1		Lung NSC(96;0.00227)|Prostate(109;0.00578)|Breast(56;0.0192)|Lung SC(185;0.0367)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000232)		GCCCCTGTCATAAAAGGTTTT	0.328																																					p.M115L		.											.	TPT1-90	0			c.A343T						.						110.0	112.0	111.0					13																	45913688		2203	4299	6502	SO:0001583	missense	7178	exon4			CTGTCATAAAAGG	X16064	CCDS9397.1, CCDS66538.1, CCDS73566.1	13q14	2010-08-18			ENSG00000133112	ENSG00000133112			12022	protein-coding gene	gene with protein product		600763				2813067, 10343127	Standard	NM_001286273		Approved	TCTP, fortilin	uc001uzy.1	P13693	OTTHUMG00000016845	ENST00000530705.1:c.343A>T	13.37:g.45913688T>A	ENSP00000431872:p.Met115Leu	Somatic	204	1		WXS	Illumina HiSeq	Phase_I	196	44	NM_003295	1	1	4056	5590	1532	B2R7E5|Q6YLS2|Q7Z4J4|Q8TBK7|Q96EE2|Q9UC70	Missense_Mutation	SNP	ENST00000530705.1	37	CCDS9397.1	.	.	.	.	.	.	.	.	.	.	.	16.97	3.267590	0.59540	.	.	ENSG00000133112	ENST00000379056;ENST00000530705;ENST00000379060;ENST00000379055;ENST00000309246;ENST00000527226	T;T;T;T;T;T	0.41758	0.99;0.99;0.99;0.99;0.99;0.99	4.79	4.79	0.61399	Mss4-like (1);Mss4/translationally controlled tumour-associated TCTP (1);	0.037685	0.85682	D	0.000000	T	0.43122	0.1233	M	0.83774	2.66	0.80722	D	1	B	0.02656	0.0	B	0.17433	0.018	T	0.47142	-0.9140	10	0.02654	T	1	.	13.8369	0.63415	0.0:0.0:0.0:1.0	.	115	P13693	TCTP_HUMAN	L	81;115;103;81;115;114	ENSP00000368345:M81L;ENSP00000431872:M115L;ENSP00000368350:M103L;ENSP00000368344:M81L;ENSP00000339051:M115L;ENSP00000433738:M114L	ENSP00000339051:M115L	M	-	1	0	TPT1	44811688	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.581000	0.67471	1.931000	0.55961	0.533000	0.62120	ATG	.		0.328	TPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044758.3		
MLNR	2862	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	49796387	49796387	+	Silent	SNP	C	C	G			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr13:49796387C>G	ENST00000218721.1	+	2	1113	c.1113C>G	c.(1111-1113)ctC>ctG	p.L371L	MLNR_ENST00000398307.1_3'UTR	NM_001507.1	NP_001498.1	O43193	MTLR_HUMAN	motilin receptor	371					digestion (GO:0007586)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|growth hormone-releasing hormone receptor activity (GO:0016520)			endometrium(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)	14		all_lung(13;8.31e-06)|Lung NSC(96;0.000251)|Breast(56;0.0008)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;6.1e-09)		AACTGCTGCTCGCAAGGAAGT	0.547																																					p.L371L		.											.	MLNR-90	0			c.C1113G						.						81.0	81.0	81.0					13																	49796387		2203	4300	6503	SO:0001819	synonymous_variant	2862	exon2			GCTGCTCGCAAGG	AF034632	CCDS9414.1	13q14-q21	2012-08-08	2004-05-27	2004-05-28	ENSG00000102539	ENSG00000102539		"""GPCR / Class A : Motilin receptors"""	4495	protein-coding gene	gene with protein product		602885	"""G protein-coupled receptor 38"""	GPR38		9441746	Standard	NM_001507		Approved		uc010tgj.2	O43193	OTTHUMG00000016909	ENST00000218721.1:c.1113C>G	13.37:g.49796387C>G		Somatic	119	1		WXS	Illumina HiSeq	Phase_I	85	24	NM_001507	0	0	3	4	1		Silent	SNP	ENST00000218721.1	37	CCDS9414.1																																																																																			.		0.547	MLNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044897.1	NM_001507	
APEX1	328	ucsc.edu	37	14	20925021	20925021	+	Splice_Site	SNP	T	T	C			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr14:20925021T>C	ENST00000216714.3	+	4	707		c.e4+2		OSGEP_ENST00000556252.1_5'Flank|APEX1_ENST00000557054.1_Intron|OSGEP_ENST00000206542.4_5'Flank|APEX1_ENST00000398030.4_Splice_Site|APEX1_ENST00000557365.1_Splice_Site|APEX1_ENST00000555414.1_Splice_Site	NM_001244249.1|NM_001641.3	NP_001231178.1|NP_001632.2	P27695	APEX1_HUMAN	APEX nuclease (multifunctional DNA repair enzyme) 1						aging (GO:0007568)|base-excision repair (GO:0006284)|cell redox homeostasis (GO:0045454)|cellular response to cAMP (GO:0071320)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to peptide hormone stimulus (GO:0071375)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA demethylation (GO:0080111)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|negative regulation of smooth muscle cell migration (GO:0014912)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|oxidation-reduction process (GO:0055114)|positive regulation of DNA repair (GO:0045739)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribosome (GO:0005840)|transcription factor complex (GO:0005667)	3'-5' exonuclease activity (GO:0008408)|chromatin DNA binding (GO:0031490)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|double-stranded DNA 3'-5' exodeoxyribonuclease activity (GO:0008311)|endodeoxyribonuclease activity (GO:0004520)|endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)|phosphodiesterase I activity (GO:0004528)|phosphoric diester hydrolase activity (GO:0008081)|poly(A) RNA binding (GO:0044822)|RNA-DNA hybrid ribonuclease activity (GO:0004523)|site-specific endodeoxyribonuclease activity, specific for altered base (GO:0016890)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|uracil DNA N-glycosylase activity (GO:0004844)			breast(2)|endometrium(1)|large_intestine(4)|ovary(2)	9	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;1.09e-07)|all cancers(55;1.19e-06)	GBM - Glioblastoma multiforme(265;0.0224)|READ - Rectum adenocarcinoma(17;0.193)	Lucanthone(DB04967)	ACGGCATAGGTGAGACCCTAT	0.473								Other BER factors																													.													.	APEX1-661	0			c.439+2T>C						.						35.0	34.0	34.0					14																	20925021		2203	4300	6503	SO:0001630	splice_region_variant	328	exon4			CATAGGTGAGACC	X59764	CCDS9550.1	14q11.2	2008-02-05	2002-09-11	2002-09-13	ENSG00000100823	ENSG00000100823	4.2.99.18		587	protein-coding gene	gene with protein product		107748	"""APEX nuclease (multifunctional DNA repair enzyme)"""	APEX			Standard	NM_001641		Approved	APE, REF1, HAP1, APX, APEN, REF-1, APE-1	uc021rnr.1	P27695	OTTHUMG00000029544	ENST00000216714.3:c.439+2T>C	14.37:g.20925021T>C		Somatic	39	0		WXS	Illumina HiSeq		28	1	NM_001641	0	0	0	0	0	Q969L5|Q99775	Splice_Site	SNP	ENST00000216714.3	37	CCDS9550.1	.	.	.	.	.	.	.	.	.	.	T	18.63	3.666222	0.67814	.	.	ENSG00000100823	ENST00000555414;ENST00000216714;ENST00000553681;ENST00000398030;ENST00000555839;ENST00000556054;ENST00000557592;ENST00000557150;ENST00000438886	.	.	.	5.79	5.79	0.91817	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.118	0.72419	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	APEX1	19994861	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.152000	0.77419	2.207000	0.71202	0.533000	0.62120	.	.		0.473	APEX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073641.3	NM_001641	Intron
TSC2	7249	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	2122849	2122849	+	Splice_Site	SNP	G	G	A	rs45517218		TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr16:2122849G>A	ENST00000219476.3	+	21	2850		c.e21-1		TSC2_ENST00000350773.4_Splice_Site|TSC2_ENST00000439673.2_Splice_Site|TSC2_ENST00000401874.2_Splice_Site|TSC2_ENST00000382538.6_Splice_Site|TSC2_ENST00000568454.1_Splice_Site|TSC2_ENST00000353929.4_Splice_Site	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2						acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				TTGGTCATCAGCTTTCAGGCC	0.627			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																												.		.	yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	.	TSC2-1908	0			c.2221-1G>A						.						53.0	58.0	56.0					16																	2122849		2198	4300	6498	SO:0001630	splice_region_variant	7249	exon21	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	TCATCAGCTTTCA	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.2221-1G>A	16.37:g.2122849G>A		Somatic	102	0		WXS	Illumina HiSeq	Phase_I	60	29	NM_000548	0	0	0	0	0	A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Splice_Site	SNP	ENST00000219476.3	37	CCDS10458.1	.	.	.	.	.	.	.	.	.	.	G	13.55	2.269512	0.40095	.	.	ENSG00000103197	ENST00000219476;ENST00000401874;ENST00000353929;ENST00000439673;ENST00000382538;ENST00000350773	.	.	.	5.46	5.46	0.80206	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.3044	0.94155	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TSC2	2062850	1.000000	0.71417	0.996000	0.52242	0.714000	0.41099	7.284000	0.78650	2.551000	0.86045	0.655000	0.94253	.	.		0.627	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250657.2	NM_000548	Intron
NLRC3	197358	hgsc.bcm.edu	37	16	3598164	3598164	+	RNA	SNP	T	T	C			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr16:3598164T>C	ENST00000301749.7	-	0	3147				NLRC3_ENST00000448023.2_RNA|NLRC3_ENST00000603507.1_RNA|NLRC3_ENST00000359128.5_RNA|NLRC3_ENST00000419350.2_RNA|LA16c-390H2.4_ENST00000573820.1_RNA	NM_178844.2	NP_849172.2	Q7RTR2	NLRC3_HUMAN	NLR family, CARD domain containing 3						I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|regulation of protein ubiquitination (GO:0031396)|response to lipopolysaccharide (GO:0032496)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(16)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						TGTTGAGCTGTAGTGCTTGTC	0.587																																					p.L914L		.											.	NLRC3-96	0			c.A2742G						.						33.0	35.0	34.0					16																	3598164		1962	4132	6094			197358	exon16			GAGCTGTAGTGCT	BK001112	CCDS73817.1	16p13.3	2014-03-25			ENSG00000167984	ENSG00000167984		"""Nucleotide-binding domain and leucine rich repeat containing"""	29889	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 3"", ""NOD-like receptor C3"""	615648				15705585, 12766759	Standard	NM_178844		Approved	CLR16.2, FLJ00348, NOD3	uc010btn.3	Q7RTR2	OTTHUMG00000177561		16.37:g.3598164T>C		Somatic	10	0		WXS	Illumina HiSeq	Phase_I	9	8	NM_178844	0	0	3	3	0	Q5EY36|Q8NF48|Q8NI01|Q8NI02|Q8TEL3	Silent	SNP	ENST00000301749.7	37																																																																																				.		0.587	NLRC3-201	KNOWN	basic|appris_principal	protein_coding	polymorphic_pseudogene		NM_178844	
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y|TVP23C_ENST00000584811.1_5'UTR|TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y|TVP23C_ENST00000519970.1_Intron|TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y|TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y													.	.	0			c.G152A						.						274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	201158	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr	Somatic	506	50		WXS	Illumina HiSeq		444	67	NM_145301	0	0	13	59	46	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT	.		0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130705.2	NM_145301	
KRTAP4-9	100132386	broad.mit.edu	37	17	39261742	39261742	+	Silent	SNP	C	C	T	rs549296843	byFrequency	TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr17:39261742C>T	ENST00000391415.1	+	1	159	c.102C>T	c.(100-102)tgC>tgT	p.C34C		NM_001146041.1	NP_001139513.1	Q9BYQ8	KRA49_HUMAN	keratin associated protein 4-9	34	29 X 5 AA repeats of C-C-[RQVHIEK]- [SPTR]-[VSTQCRNP].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|urinary_tract(3)	14						AGACCACCTGCTGCAGGACCA	0.652													C|||	9	0.00179712	0.003	0.0	5008	,	,		17191	0.0		0.0	False		,,,				2504	0.0051				p.C34C													.	.	0			c.C102T						.						16.0	21.0	20.0					17																	39261742		692	1591	2283	SO:0001819	synonymous_variant	100132386	exon1			CACCTGCTGCAGG	AJ406941	CCDS54124.1	17q21.2	2013-06-25			ENSG00000212722	ENSG00000212722		"""Keratin associated proteins"""	18910	protein-coding gene	gene with protein product							Standard	NM_001146041		Approved	KAP4.9	uc010wfp.2	Q9BYQ8	OTTHUMG00000133584	ENST00000391415.1:c.102C>T	17.37:g.39261742C>T		Somatic	41	1		WXS	Illumina HiSeq	Phase_I	56	4	NM_001146041	0	0	0	0	0		Silent	SNP	ENST00000391415.1	37	CCDS54124.1																																																																																			.		0.652	KRTAP4-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257688.1	NM_001146041	
RSAD1	55316	broad.mit.edu	37	17	48559512	48559512	+	Silent	SNP	C	C	A	rs373296180		TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr17:48559512C>A	ENST00000258955.2	+	4	620	c.535C>A	c.(535-537)Cgg>Agg	p.R179R		NM_018346.1	NP_060816.1	Q9HA92	RSAD1_HUMAN	radical S-adenosyl methionine domain containing 1	179					porphyrin-containing compound biosynthetic process (GO:0006779)	mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|coproporphyrinogen oxidase activity (GO:0004109)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	16	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)			CGATGCTCTGCGGACGCTGGC	0.657											OREG0024567	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R179R													.	RSAD1-90	0			c.C535A						.						63.0	71.0	69.0					17																	48559512		2201	4297	6498	SO:0001819	synonymous_variant	55316	exon4			GCTCTGCGGACGC	AK002026	CCDS11569.1	17q21.33	2004-11-08			ENSG00000136444	ENSG00000136444			25634	protein-coding gene	gene with protein product						12477932	Standard	NM_018346		Approved	FLJ11164	uc002iqw.1	Q9HA92	OTTHUMG00000162126	ENST00000258955.2:c.535C>A	17.37:g.48559512C>A		Somatic	167	0	955	WXS	Illumina HiSeq	Phase_I	131	4	NM_018346	0	0	51	51	0	B4DMW0|Q53HV8|Q86VC4|Q9BRY7|Q9NUS7	Silent	SNP	ENST00000258955.2	37	CCDS11569.1																																																																																			.		0.657	RSAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367413.1	NM_018346	
TBC1D16	125058	bcgsc.ca	37	17	77915895	77915895	+	Silent	SNP	C	C	A			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr17:77915895C>A	ENST00000310924.2	-	11	2134	c.2019G>T	c.(2017-2019)ctG>ctT	p.L673L	TBC1D16_ENST00000340848.7_Silent_p.L311L|TBC1D16_ENST00000576768.1_Silent_p.L298L	NM_001271844.1|NM_001271845.1|NM_019020.2	NP_001258773.1|NP_001258774.1|NP_061893.2	Q8TBP0	TBC16_HUMAN	TBC1 domain family, member 16	673							Rab GTPase activator activity (GO:0005097)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(3)	28	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.00739)|BRCA - Breast invasive adenocarcinoma(99;0.0819)			TGTGCATGGCCAGGTTTCCGA	0.652																																					p.L673L	Ovarian(14;397 562 4850 31922 49378)												.	TBC1D16-90	0			c.G2019T						.						70.0	48.0	55.0					17																	77915895		2202	4300	6502	SO:0001819	synonymous_variant	125058	exon11			CATGGCCAGGTTT	AL157485	CCDS11766.1, CCDS62351.1, CCDS62352.1, CCDS62353.1	17q25.3	2013-07-10				ENSG00000167291			28356	protein-coding gene	gene with protein product						23019362	Standard	NM_019020		Approved	MGC25062, FLJ20748	uc002jxj.4	Q8TBP0		ENST00000310924.2:c.2019G>T	17.37:g.77915895C>A		Somatic	32	0		WXS	Illumina HiSeq	Phase_1	30	4	NM_019020	0	0	75	75	0	B9A6L7|I3L1E0|I3L4U2|Q8N3Z4|Q96DH7	Silent	SNP	ENST00000310924.2	37	CCDS11766.1																																																																																			.		0.652	TBC1D16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437145.1	NM_019020	
SLC38A10	124565	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	79220316	79220316	+	Silent	SNP	C	C	T			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr17:79220316C>T	ENST00000374759.3	-	16	2783	c.2400G>A	c.(2398-2400)caG>caA	p.Q800Q		NM_001037984.1	NP_001033073.1	Q9HBR0	S38AA_HUMAN	solute carrier family 38, member 10	800					amino acid transport (GO:0006865)|bone development (GO:0060348)|sodium ion transport (GO:0006814)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(2)|lung(7)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			CCAGGGAGCGCTGGTTAAGGT	0.682																																					p.Q800Q		.											.	SLC38A10-70	0			c.G2400A						.						18.0	20.0	19.0					17																	79220316		1869	4067	5936	SO:0001819	synonymous_variant	124565	exon16			GGAGCGCTGGTTA	BC014642	CCDS11780.1, CCDS42397.1	17q25.3	2013-05-22			ENSG00000157637	ENSG00000157637		"""Solute carriers"""	28237	protein-coding gene	gene with protein product							Standard	XM_005257019		Approved	MGC15523, PP1744	uc002jzz.1	Q9HBR0	OTTHUMG00000168049	ENST00000374759.3:c.2400G>A	17.37:g.79220316C>T		Somatic	53	0		WXS	Illumina HiSeq	Phase_I	45	13	NM_001037984	0	0	60	146	86	Q6ZRC5|Q8NA99|Q96C66	Silent	SNP	ENST00000374759.3	37	CCDS42397.1																																																																																			.		0.682	SLC38A10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397747.1	NM_138570	
ZNF532	55205	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	56587630	56587630	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr18:56587630C>T	ENST00000336078.4	+	4	2887	c.2111C>T	c.(2110-2112)aCt>aTt	p.T704I	ZNF532_ENST00000591808.1_Missense_Mutation_p.T704I|ZNF532_ENST00000591083.1_Missense_Mutation_p.T704I|ZNF532_ENST00000589288.1_Missense_Mutation_p.T704I|ZNF532_ENST00000591230.1_Missense_Mutation_p.T704I	NM_018181.4	NP_060651.2	Q9HCE3	ZN532_HUMAN	zinc finger protein 532	704					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(14)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(4)|urinary_tract(1)	52						TCAACTTCCACTCTTCAGAGC	0.473																																					p.T704I		.											.	ZNF532-154	0			c.C2111T						.						63.0	67.0	65.0					18																	56587630		2203	4300	6503	SO:0001583	missense	55205	exon4			CTTCCACTCTTCA	AB046849	CCDS11969.1	18q21.32	2005-08-22			ENSG00000074657	ENSG00000074657		"""Zinc fingers, C2H2-type"""	30940	protein-coding gene	gene with protein product						10997877	Standard	XM_005266723		Approved	FLJ10697	uc002lho.3	Q9HCE3	OTTHUMG00000132759	ENST00000336078.4:c.2111C>T	18.37:g.56587630C>T	ENSP00000338217:p.Thr704Ile	Somatic	74	0		WXS	Illumina HiSeq	Phase_I	80	18	NM_018181	0	0	12	20	8	Q4G0V6|Q7L7Z7|Q96QR7|Q9NVJ6	Missense_Mutation	SNP	ENST00000336078.4	37	CCDS11969.1	.	.	.	.	.	.	.	.	.	.	c	2.772	-0.255447	0.05829	.	.	ENSG00000074657	ENST00000336078	T	0.32515	1.45	5.43	4.55	0.56014	.	0.394325	0.27526	N	0.018974	T	0.17023	0.0409	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.13845	-1.0494	10	0.35671	T	0.21	-5.4027	8.1333	0.31039	0.0:0.7358:0.1536:0.1107	.	704	Q9HCE3	ZN532_HUMAN	I	704	ENSP00000338217:T704I	ENSP00000338217:T704I	T	+	2	0	ZNF532	54738610	0.026000	0.19158	0.014000	0.15608	0.567000	0.35839	2.740000	0.47418	1.298000	0.44778	0.544000	0.68410	ACT	.		0.473	ZNF532-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256130.1	NM_018181	
CCNE1	898	hgsc.bcm.edu;broad.mit.edu	37	19	30308341	30308341	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr19:30308341A>G	ENST00000262643.3	+	6	634	c.355A>G	c.(355-357)Atc>Gtc	p.I119V	CCNE1_ENST00000357943.5_Missense_Mutation_p.I119V|CCNE1_ENST00000444983.2_Missense_Mutation_p.I104V	NM_001238.2	NP_001229.1	P24864	CCNE1_HUMAN	cyclin E1	119					androgen receptor signaling pathway (GO:0030521)|cell division (GO:0051301)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|Wnt signaling pathway (GO:0016055)	cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)|kinase activity (GO:0016301)|transcription coactivator activity (GO:0003713)			endometrium(1)|kidney(2)|large_intestine(4)|lung(12)|skin(1)	20	all_cancers(1;2.19e-31)|all_epithelial(1;1.49e-30)|all_lung(1;1.37e-11)|Lung NSC(1;2.35e-11)|Ovarian(5;0.000902)|Breast(6;0.0203)|Esophageal squamous(110;0.195)		UCEC - Uterine corpus endometrioid carcinoma (4;2.65e-06)|Epithelial(1;6.85e-98)|all cancers(1;1.38e-94)|OV - Ovarian serous cystadenocarcinoma(1;1.38e-90)|STAD - Stomach adenocarcinoma(5;5.8e-07)|GBM - Glioblastoma multiforme(4;0.0394)|Lung(7;0.092)|LUAD - Lung adenocarcinoma(5;0.115)|BRCA - Breast invasive adenocarcinoma(6;0.183)|COAD - Colon adenocarcinoma(1;0.188)|Colorectal(1;0.202)			AGTCTGGAAAATCATGTTAAA	0.423			A		serous ovarian																																p.I119V		.		Dom	yes		19	19q12	898	cyclin E1		E	.	CCNE1-1270	0			c.A355G						.						135.0	126.0	129.0					19																	30308341		2203	4300	6503	SO:0001583	missense	898	exon6			TGGAAAATCATGT	M73812	CCDS12419.1	19q12	2014-07-03			ENSG00000105173	ENSG00000105173			1589	protein-coding gene	gene with protein product	"""cyclin Es"", ""cyclin Et"""	123837		CCNE		1833066	Standard	NM_001238		Approved		uc002nsn.3	P24864	OTTHUMG00000177626	ENST00000262643.3:c.355A>G	19.37:g.30308341A>G	ENSP00000262643:p.Ile119Val	Somatic	118	0		WXS	Illumina HiSeq	Phase_I	108	6	NM_001238	0	0	8	9	1	A8K684|Q14091|Q8NFG1|Q92501|Q9UD21	Missense_Mutation	SNP	ENST00000262643.3	37	CCDS12419.1	.	.	.	.	.	.	.	.	.	.	A	11.52	1.663508	0.29515	.	.	ENSG00000105173	ENST00000262643;ENST00000357943;ENST00000444983	T;T;T	0.10960	2.82;2.82;2.82	6.06	5.02	0.67125	Cyclin, N-terminal (1);Cyclin-like (1);	0.091237	0.64402	D	0.000001	T	0.07234	0.0183	N	0.12569	0.235	0.39397	D	0.966517	P	0.44380	0.834	B	0.41723	0.365	T	0.45279	-0.9272	10	0.23891	T	0.37	.	12.6906	0.56972	0.8623:0.1377:0.0:0.0	.	119	P24864	CCNE1_HUMAN	V	119;119;104	ENSP00000262643:I119V;ENSP00000350625:I119V;ENSP00000410179:I104V	ENSP00000262643:I119V	I	+	1	0	CCNE1	35000181	1.000000	0.71417	0.955000	0.39395	0.625000	0.37756	6.248000	0.72418	1.071000	0.40834	0.533000	0.62120	ATC	.		0.423	CCNE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438138.1	NM_001238	
HNRNPUL1	11100	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	41800265	41800265	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr19:41800265C>G	ENST00000392006.3	+	9	1462	c.1289C>G	c.(1288-1290)cCt>cGt	p.P430R	HNRNPUL1_ENST00000352456.3_Missense_Mutation_p.P330R|HNRNPUL1_ENST00000593587.1_Missense_Mutation_p.P330R|HNRNPUL1_ENST00000378215.4_Missense_Mutation_p.P316R|HNRNPUL1_ENST00000263367.3_Missense_Mutation_p.P341R|HNRNPUL1_ENST00000602130.1_Missense_Mutation_p.P430R|HNRNPUL1_ENST00000595018.1_Missense_Mutation_p.P330R	NM_007040.3	NP_008971.2	Q9BUJ2	HNRL1_HUMAN	heterogeneous nuclear ribonucleoprotein U-like 1	430	Necessary for interaction with TP53.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	29						GTGGGCCTGCCTGCTGCTGGC	0.537																																					p.P430R		.											.	HNRNPUL1-69	0			c.C1289G						.						166.0	120.0	135.0					19																	41800265		2203	4300	6503	SO:0001583	missense	11100	exon9			GCCTGCCTGCTGC	AJ007509	CCDS12576.1, CCDS12577.1	19q13.2	2013-06-12		2008-04-18	ENSG00000105323	ENSG00000105323			17011	protein-coding gene	gene with protein product	"""E1B 55kDa associated protein 5"""	605800		HNRPUL1		9733834, 12489984	Standard	XM_005258459		Approved	E1B-AP5, E1BAP5, FLJ12944	uc002oqb.4	Q9BUJ2	OTTHUMG00000182740	ENST00000392006.3:c.1289C>G	19.37:g.41800265C>G	ENSP00000375863:p.Pro430Arg	Somatic	89	0		WXS	Illumina HiSeq	Phase_I	69	15	NM_007040	0	0	94	147	53	B3KMW7|O76022|Q6ZSZ0|Q7L8P4|Q8N6Z4|Q96G37|Q9HAL3|Q9UG75	Missense_Mutation	SNP	ENST00000392006.3	37	CCDS12576.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.717475	0.89205	.	.	ENSG00000105323	ENST00000352456;ENST00000392006;ENST00000378215;ENST00000263367	T;T;T;T	0.54479	0.57;0.57;0.57;0.57	5.46	5.46	0.80206	.	0.105015	0.64402	D	0.000003	T	0.78685	0.4322	M	0.90425	3.115	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.973;1.0;1.0	D;D;D;P;D;D	0.97110	0.999;0.999;0.999;0.816;1.0;0.999	T	0.82489	-0.0432	10	0.87932	D	0	-7.8178	18.2528	0.90009	0.0:1.0:0.0:0.0	.	341;330;430;316;430;330	B7Z4B8;A8K3W4;Q9BUJ2-2;Q9BUJ2-3;Q9BUJ2;Q9BUJ2-4	.;.;.;.;HNRL1_HUMAN;.	R	330;430;316;341	ENSP00000340857:P330R;ENSP00000375863:P430R;ENSP00000367460:P316R;ENSP00000263367:P341R	ENSP00000263367:P341R	P	+	2	0	HNRNPUL1	46492105	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.557000	0.82243	2.840000	0.97914	0.655000	0.94253	CCT	.		0.537	HNRNPUL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463406.1	NM_144732, NM_007040	
DNMT3A	1788	broad.mit.edu	37	2	25469548	25469548	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr2:25469548A>G	ENST00000264709.3	-	10	1557	c.1220T>C	c.(1219-1221)aTt>aCt	p.I407T	DNMT3A_ENST00000380746.4_Missense_Mutation_p.I218T|DNMT3A_ENST00000402667.1_Missense_Mutation_p.I184T|DNMT3A_ENST00000321117.5_Missense_Mutation_p.I407T|DNMT3A_ENST00000474887.1_5'Flank	NM_175629.2	NP_783328.1	Q9Y6K1	DNM3A_HUMAN	DNA (cytosine-5-)-methyltransferase 3 alpha	407					C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|DNA methylation on cytosine within a CG sequence (GO:0010424)|hypermethylation of CpG island (GO:0044027)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression by genetic imprinting (GO:0006349)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)|spermatogenesis (GO:0007283)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|euchromatin (GO:0000791)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|unmethylated CpG binding (GO:0045322)	p.I407S(1)|p.I407T(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(964)|kidney(3)|large_intestine(10)|lung(29)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	1021	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGCCCATTCAATCATGGGCTT	0.647			"""Mis, F, N, S"""		AML																																p.I407T				Rec	yes		2	2p23	1788	DNA (cytosine-5-)-methyltransferase 3 alpha		L	.	DNMT3A-1924	2	Substitution - Missense(2)	haematopoietic_and_lymphoid_tissue(2)	c.T1220C						.						67.0	66.0	66.0					2																	25469548		2203	4298	6501	SO:0001583	missense	1788	exon10			CATTCAATCATGG		CCDS1718.2, CCDS33157.1, CCDS46232.1	2p23	2014-09-17			ENSG00000119772	ENSG00000119772			2978	protein-coding gene	gene with protein product		602769				9662389, 10433969	Standard	NM_175630		Approved		uc002rgc.4	Q9Y6K1	OTTHUMG00000094777	ENST00000264709.3:c.1220T>C	2.37:g.25469548A>G	ENSP00000264709:p.Ile407Thr	Somatic	150	0		WXS	Illumina HiSeq	Phase_I	123	3	NM_175629	0	0	14	14	0	E9PEB8|Q86TE8|Q86XF5|Q8IZV0|Q8WXU9	Missense_Mutation	SNP	ENST00000264709.3	37	CCDS33157.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.184390	0.78677	.	.	ENSG00000119772	ENST00000380746;ENST00000321117;ENST00000264709;ENST00000402667	T;T;T;T	0.70282	-0.47;-0.47;-0.47;-0.47	4.87	4.87	0.63330	.	0.000000	0.85682	D	0.000000	T	0.80470	0.4629	M	0.61703	1.905	0.80722	D	1	D;D	0.63880	0.993;0.99	D;P	0.68192	0.956;0.852	T	0.82352	-0.0500	10	0.72032	D	0.01	-7.9615	12.4658	0.55757	1.0:0.0:0.0:0.0	.	407;218	Q9Y6K1;E9PEB8	DNM3A_HUMAN;.	T	218;407;407;184	ENSP00000370122:I218T;ENSP00000324375:I407T;ENSP00000264709:I407T;ENSP00000384237:I184T	ENSP00000264709:I407T	I	-	2	0	DNMT3A	25323052	1.000000	0.71417	0.998000	0.56505	0.770000	0.43624	8.987000	0.93497	2.050000	0.60909	0.533000	0.62120	ATT	.		0.647	DNMT3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000211587.1	NM_022552	
SOS1	6654	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	39285904	39285904	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr2:39285904C>T	ENST00000426016.1	-	4	341	c.255G>A	c.(253-255)tgG>tgA	p.W85*	SOS1_ENST00000402219.2_Nonsense_Mutation_p.W85*|SOS1_ENST00000395038.2_Nonsense_Mutation_p.W85*|SOS1_ENST00000428721.2_Nonsense_Mutation_p.W28*			Q07889	SOS1_HUMAN	son of sevenless homolog 1 (Drosophila)	85					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|Ras protein signal transduction (GO:0007265)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	DNA binding (GO:0003677)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(29)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	75		all_hematologic(82;0.21)				CAGCTATTGCCCATTTATCAA	0.338									Noonan syndrome																												p.W85X		.											.	SOS1-851	0			c.G255A						.						75.0	76.0	76.0					2																	39285904		2202	4300	6502	SO:0001587	stop_gained	6654	exon3	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	TATTGCCCATTTA	L13857	CCDS1802.1	2p21	2014-09-17	2002-11-05		ENSG00000115904	ENSG00000115904		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11187	protein-coding gene	gene with protein product		182530	"""gingival fibromatosis, hereditary, 1"""	GINGF		8276400, 10995566	Standard	NM_005633		Approved	HGF, GF1	uc002rrk.4	Q07889	OTTHUMG00000102109	ENST00000426016.1:c.255G>A	2.37:g.39285904C>T	ENSP00000387784:p.Trp85*	Somatic	156	0		WXS	Illumina HiSeq	Phase_I	109	33	NM_005633	0	0	11	16	5	A8K2G3|B4DXG2	Nonsense_Mutation	SNP	ENST00000426016.1	37	CCDS1802.1	.	.	.	.	.	.	.	.	.	.	C	29.4	5.005675	0.93287	.	.	ENSG00000115904	ENST00000426016;ENST00000402219;ENST00000395038;ENST00000263879;ENST00000428721;ENST00000451331	.	.	.	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.9598	0.97242	0.0:1.0:0.0:0.0	.	.	.	.	X	85;85;85;85;28;28	.	ENSP00000263879:W85X	W	-	3	0	SOS1	39139408	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.711000	0.84669	2.716000	0.92895	0.655000	0.94253	TGG	.		0.338	SOS1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219948.3	NM_005633	
TANC1	85461	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	160086335	160086335	+	Silent	SNP	C	C	A			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr2:160086335C>A	ENST00000263635.6	+	27	4635	c.4398C>A	c.(4396-4398)ccC>ccA	p.P1466P	TANC1_ENST00000454300.1_Silent_p.P1360P	NM_001145909.1|NM_033394.2	NP_001139381.1|NP_203752.2	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1	1466					dendritic spine maintenance (GO:0097062)|myoblast fusion (GO:0007520)|visual learning (GO:0008542)	axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)				breast(3)|central_nervous_system(4)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(25)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	77						AAACTTCTCCCCAGGAAGAAT	0.517																																					p.P1466P		.											.	TANC1-92	0			c.C4398A						.						94.0	104.0	101.0					2																	160086335		1964	4133	6097	SO:0001819	synonymous_variant	85461	exon27			TTCTCCCCAGGAA	AB051515	CCDS42766.1	2q24.2	2013-01-11			ENSG00000115183	ENSG00000115183		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29364	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	611397				15673434	Standard	NM_033394		Approved	KIAA1728, ROLSB	uc002uag.3	Q9C0D5	OTTHUMG00000153945	ENST00000263635.6:c.4398C>A	2.37:g.160086335C>A		Somatic	146	1		WXS	Illumina HiSeq	Phase_I	144	36	NM_033394	0	0	7	9	2	C9JD88|Q49AI8	Silent	SNP	ENST00000263635.6	37	CCDS42766.1																																																																																			.		0.517	TANC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333135.1		
IRS1	3667	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	227662872	227662872	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr2:227662872C>T	ENST00000305123.5	-	1	1603	c.583G>A	c.(583-585)Gtg>Atg	p.V195M	IRS1_ENST00000498335.1_5'Flank|RP11-395N3.2_ENST00000607970.1_lincRNA	NM_005544.2	NP_005535.1	P35568	IRS1_HUMAN	insulin receptor substrate 1	195	IRS-type PTB. {ECO:0000255|PROSITE- ProRule:PRU00389}.				cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid catabolic process (GO:0016042)|mammary gland development (GO:0030879)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein kinase B signaling (GO:0043491)|protein localization to nucleus (GO:0034504)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	caveola (GO:0005901)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|insulin receptor complex (GO:0005899)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(10)|lung(33)|ovary(6)|pancreas(1)|prostate(1)|urinary_tract(2)	69		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		TTCAGCTTCACGAAGCTGATG	0.567											OREG0015248	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V195M		.											.	IRS1-1272	0			c.G583A						.						57.0	55.0	56.0					2																	227662872		2203	4300	6503	SO:0001583	missense	3667	exon1			GCTTCACGAAGCT		CCDS2463.1	2q36	2013-01-10			ENSG00000169047	ENSG00000169047		"""Pleckstrin homology (PH) domain containing"""	6125	protein-coding gene	gene with protein product		147545				1648180	Standard	NM_005544		Approved	HIRS-1	uc002voh.4	P35568	OTTHUMG00000133179	ENST00000305123.5:c.583G>A	2.37:g.227662872C>T	ENSP00000304895:p.Val195Met	Somatic	86	0	2321	WXS	Illumina HiSeq	Phase_I	93	23	NM_005544	0	0	7	10	3		Missense_Mutation	SNP	ENST00000305123.5	37	CCDS2463.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.366266	0.82463	.	.	ENSG00000169047	ENST00000305123	T	0.74526	-0.85	5.79	5.79	0.91817	Pleckstrin homology-type (1);Insulin receptor substrate-1, PTB (4);	0.000000	0.64402	D	0.000017	D	0.87661	0.6233	M	0.81497	2.545	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87579	0.2483	10	0.56958	D	0.05	-29.8384	20.0212	0.97504	0.0:1.0:0.0:0.0	.	195	P35568	IRS1_HUMAN	M	195	ENSP00000304895:V195M	ENSP00000304895:V195M	V	-	1	0	IRS1	227371116	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.735000	0.93741	0.561000	0.74099	GTG	.		0.567	IRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256886.3	NM_005544	
ZFP64	55734	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	50769885	50769885	+	Silent	SNP	C	C	T			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr20:50769885C>T	ENST00000216923.4	-	6	1195	c.846G>A	c.(844-846)tcG>tcA	p.S282S	ZFP64_ENST00000477786.1_Intron|ZFP64_ENST00000361387.2_Intron|ZFP64_ENST00000371518.2_Intron|ZFP64_ENST00000371515.4_Silent_p.S280S|ZFP64_ENST00000346617.4_Silent_p.S228S	NM_018197.2|NM_199426.1	NP_060667.2|NP_955458.1	Q9NPA5	ZF64A_HUMAN	ZFP64 zinc finger protein	282					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(5)|large_intestine(8)|lung(11)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	33						GCTTCTCCCCCGAGTGCACCC	0.552																																					p.S282S		.											.	ZFP64-155	0			c.G846A						.						80.0	72.0	75.0					20																	50769885		2203	4300	6503	SO:0001819	synonymous_variant	55734	exon6			CTCCCCCGAGTGC	AK001596	CCDS13439.1, CCDS13440.1, CCDS13441.1, CCDS13442.1	20q13.11-q13.13	2013-01-08	2012-11-27		ENSG00000020256	ENSG00000020256		"""Zinc fingers, C2H2-type"""	15940	protein-coding gene	gene with protein product			"""zinc finger protein 338"", ""zinc finger protein 64 homolog (mouse)"", ""zinc finger protein 64"""	ZNF338		9034307	Standard	NM_199427		Approved	FLJ10734, dJ831D17.1, FLJ12628, dJ548G19.1	uc002xwl.3	Q9NPA5	OTTHUMG00000032756	ENST00000216923.4:c.846G>A	20.37:g.50769885C>T		Somatic	75	0		WXS	Illumina HiSeq	Phase_I	46	16	NM_018197	0	0	6	11	5	Q9NTS7|Q9NVH4	Silent	SNP	ENST00000216923.4	37	CCDS13440.1																																																																																			.		0.552	ZFP64-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079744.1	NM_018197	
IFNGR2	3460	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	34799207	34799207	+	Silent	SNP	A	A	T			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr21:34799207A>T	ENST00000290219.6	+	4	1077	c.429A>T	c.(427-429)ccA>ccT	p.P143P	IFNGR2_ENST00000381995.1_Silent_p.P162P|IFNGR2_ENST00000405436.1_Silent_p.P64P	NM_005534.3	NP_005525.2	P38484	INGR2_HUMAN	interferon gamma receptor 2 (interferon gamma transducer 1)	143	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|response to virus (GO:0009615)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	interferon-gamma receptor activity (GO:0004906)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|urinary_tract(1)	13					Interferon gamma-1b(DB00033)	TCGGGCCTCCAGAAAACATTG	0.388																																					p.P143P		.											.	IFNGR2-186	0			c.A429T						.						162.0	158.0	159.0					21																	34799207		2203	4300	6503	SO:0001819	synonymous_variant	3460	exon4			GCCTCCAGAAAAC		CCDS33544.1	21q22.1	2014-09-17			ENSG00000159128	ENSG00000159128		"""Interferons"", ""Fibronectin type III domain containing"""	5440	protein-coding gene	gene with protein product		147569		IFNGT1		3136170	Standard	NM_005534		Approved	AF-1	uc002yrp.4	P38484	OTTHUMG00000065188	ENST00000290219.6:c.429A>T	21.37:g.34799207A>T		Somatic	372	1		WXS	Illumina HiSeq	Phase_I	297	78	NM_005534	0	0	104	165	61	Q9BTL5	Silent	SNP	ENST00000290219.6	37	CCDS33544.1																																																																																			.		0.388	IFNGR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139916.1		
MKL1	57591	broad.mit.edu	37	22	40813489	40813489	+	Silent	SNP	G	G	A			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr22:40813489G>A	ENST00000355630.3	-	13	2663	c.2073C>T	c.(2071-2073)tcC>tcT	p.S691S	MKL1_ENST00000396617.3_Silent_p.S691S|MKL1_ENST00000402042.1_Silent_p.S641S|RP5-1042K10.13_ENST00000609279.1_RNA|MKL1_ENST00000407029.1_Silent_p.S691S	NM_020831.3	NP_065882.1	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia (translocation) 1	691	Pro-rich.				negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription via serum response element binding (GO:0010735)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	actin binding (GO:0003779)|actin monomer binding (GO:0003785)|leucine zipper domain binding (GO:0043522)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(13)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	30						AGCCAGGCTGGGACGAGGGCT	0.692			T	RBM15	acute megakaryocytic leukemia																																p.S691S				Dom	yes		22	22q13	57591	megakaryoblastic leukemia (translocation) 1		L	.	MKL1-948	0			c.C2073T						.						10.0	11.0	11.0					22																	40813489		2200	4296	6496	SO:0001819	synonymous_variant	57591	exon13			AGGCTGGGACGAG	AB037859	CCDS14003.1, CCDS74865.1, CCDS74866.1	22q13	2008-06-12			ENSG00000196588	ENSG00000196588			14334	protein-coding gene	gene with protein product	"""megakaryocytic acute leukemia"", ""myocardin-related transcription factor A"", ""basic, SAP and coiled-coil domain"""	606078				11431691, 12019265, 14970199	Standard	XM_005261692		Approved	KIAA1438, MAL, MRTF-A, BSAC	uc003ayw.1	Q969V6	OTTHUMG00000151146	ENST00000355630.3:c.2073C>T	22.37:g.40813489G>A		Somatic	13	0		WXS	Illumina HiSeq	Phase_I	7	2	NM_020831	0	0	1	1	0	Q8TCL1|Q96SC5|Q96SC6|Q9P2B0	Silent	SNP	ENST00000355630.3	37	CCDS14003.1																																																																																			.		0.692	MKL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321522.1	NM_020831	
ALS2CL	259173	broad.mit.edu	37	3	46725271	46725271	+	Splice_Site	SNP	C	C	T			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr3:46725271C>T	ENST00000318962.4	-	9	996		c.e9+1		ALS2CL_ENST00000415953.1_Splice_Site	NM_147129.3	NP_667340.2	Q60I27	AL2CL_HUMAN	ALS2 C-terminal like						endosome organization (GO:0007032)|protein localization (GO:0008104)	cytoplasmic membrane-bounded vesicle (GO:0016023)	GTPase activator activity (GO:0005096)|identical protein binding (GO:0042802)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|skin(3)|stomach(2)	29				BRCA - Breast invasive adenocarcinoma(193;0.000726)|KIRC - Kidney renal clear cell carcinoma(197;0.0171)|Kidney(197;0.0202)		CCCACACTCACCTGGCCCTGG	0.617																																					.													.	ALS2CL-155	0			c.912+1G>A						.						139.0	141.0	140.0					3																	46725271		2203	4300	6503	SO:0001630	splice_region_variant	259173	exon10			CACTCACCTGGCC	AK074118	CCDS2743.1, CCDS43080.1	3p21.31	2008-01-30			ENSG00000178038	ENSG00000178038			20605	protein-coding gene	gene with protein product		612402				15388334, 8889548, 17239822	Standard	NM_147129		Approved	FLJ36525, RN49018, DKFZp686I0110	uc003cqb.2	Q60I27	OTTHUMG00000128673	ENST00000318962.4:c.912+1G>A	3.37:g.46725271C>T		Somatic	327	0		WXS	Illumina HiSeq	Phase_I	235	7	NM_001190707	0	0	0	0	0	Q32MA1|Q6AI56|Q6ZNC5|Q6ZNC7|Q6ZTL4|Q86YD2|Q8N9U1|Q8NAL7	Splice_Site	SNP	ENST00000318962.4	37	CCDS2743.1	.	.	.	.	.	.	.	.	.	.	C	19.11	3.764058	0.69878	.	.	ENSG00000178038	ENST00000318962;ENST00000415953	.	.	.	5.01	5.01	0.66863	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.8568	0.78983	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ALS2CL	46700275	1.000000	0.71417	0.988000	0.46212	0.799000	0.45148	4.474000	0.60203	2.609000	0.88269	0.655000	0.94253	.	.		0.617	ALS2CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250567.3	NM_147129	Intron
SEMA5B	54437	hgsc.bcm.edu	37	3	122632248	122632248	+	Missense_Mutation	SNP	C	C	G	rs183401039	byFrequency	TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr3:122632248C>G	ENST00000357599.3	-	17	2690	c.2304G>C	c.(2302-2304)gaG>gaC	p.E768D	SEMA5B_ENST00000451055.2_Missense_Mutation_p.E822D|SEMA5B_ENST00000195173.4_Missense_Mutation_p.E767D	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	768	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		CGGGGCAGCCCTCGGGGTTGC	0.701													C|||	39	0.00778754	0.028	0.0029	5008	,	,		12549	0.0		0.0	False		,,,				2504	0.0				p.E822D		.											.	SEMA5B-157	0			c.G2466C						.	C	ASP/GLU	67,4271		0,67,2102	8.0	10.0	9.0		2304	-1.4	0.5	3		9	0,8524		0,0,4262	yes	missense	SEMA5B	NM_001031702.2	45	0,67,6364	GG,GC,CC		0.0,1.5445,0.5209	benign	768/1152	122632248	67,12795	2169	4262	6431	SO:0001583	missense	54437	exon17			GCAGCCCTCGGGG	AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.2304G>C	3.37:g.122632248C>G	ENSP00000350215:p.Glu768Asp	Somatic	10	1		WXS	Illumina HiSeq	Phase_I	17	3	NM_001256347	0	0	0	0	0	A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Missense_Mutation	SNP	ENST00000357599.3	37	CCDS35491.1	15	0.006868131868131868	14	0.028455284552845527	1	0.0027624309392265192	0	0.0	0	0.0	C	9.118	1.008295	0.19199	0.015445	0.0	ENSG00000082684	ENST00000357599;ENST00000195173;ENST00000418793;ENST00000451055;ENST00000393583	T;T;T;T	0.52526	0.66;0.66;0.66;0.66	4.21	-1.36	0.09085	.	0.290114	0.36444	N	0.002595	T	0.11410	0.0278	N	0.20986	0.625	0.33813	D	0.628111	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.15052	0.007;0.012;0.012	T	0.11792	-1.0573	10	0.27082	T	0.32	.	12.3916	0.55362	0.0:0.4912:0.4387:0.07	.	710;768;768	D3YTI7;B5ME80;Q9P283	.;.;SEM5B_HUMAN	D	768;767;710;822;768	ENSP00000350215:E768D;ENSP00000195173:E767D;ENSP00000389588:E822D;ENSP00000377208:E768D	ENSP00000195173:E767D	E	-	3	2	SEMA5B	124114938	0.655000	0.27376	0.474000	0.27266	0.617000	0.37484	0.231000	0.17872	-0.948000	0.03668	-1.268000	0.01426	GAG	C|0.993;G|0.007		0.701	SEMA5B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000277165.1	NM_001031702	
CPNE4	131034	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	131254172	131254172	+	Splice_Site	SNP	G	G	A			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr3:131254172G>A	ENST00000512055.1	-	20	3667	c.1541C>T	c.(1540-1542)gCa>gTa	p.A514V	CPNE4_ENST00000511604.1_Splice_Site_p.A514V|CPNE4_ENST00000502818.1_Splice_Site_p.A532V|CPNE4_ENST00000503204.1_5'UTR|CPNE4_ENST00000429747.1_Splice_Site_p.A514V|CPNE4_ENST00000512332.1_Splice_Site_p.A532V			Q96A23	CPNE4_HUMAN	copine IV	514						extracellular vesicular exosome (GO:0070062)				central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|liver(1)|lung(16)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	39						AGCTGGAGATGCCTGCAGGGA	0.453																																					p.A514V		.											.	CPNE4-92	0			c.C1541T						.						97.0	91.0	93.0					3																	131254172		2203	4300	6503	SO:0001630	splice_region_variant	131034	exon16			GGAGATGCCTGCA	H29499	CCDS3072.1, CCDS75010.1	3q22.1	2014-09-04			ENSG00000196353	ENSG00000196353			2317	protein-coding gene	gene with protein product	"""copine 8"""	604208				9430674, 12670487	Standard	XM_005247107		Approved	COPN4, CPN4	uc003eok.3	Q96A23	OTTHUMG00000159631	ENST00000512055.1:c.1540-1C>T	3.37:g.131254172G>A		Somatic	124	0		WXS	Illumina HiSeq	Phase_I	114	25	NM_130808	0	0	0	0	0	D3DNC5|Q8TEX1	Missense_Mutation	SNP	ENST00000512055.1	37	CCDS3072.1	.	.	.	.	.	.	.	.	.	.	G	19.12	3.766296	0.69878	.	.	ENSG00000196353	ENST00000512055;ENST00000429747;ENST00000512332;ENST00000511604;ENST00000502818	T;T;T;T;T	0.54866	0.55;0.55;0.55;0.55;0.55	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.70996	0.3288	M	0.76838	2.35	0.80722	D	1	P;B	0.44627	0.839;0.361	P;B	0.56563	0.801;0.134	T	0.72050	-0.4407	10	0.48119	T	0.1	-15.9346	18.8677	0.92300	0.0:0.0:1.0:0.0	.	532;514	Q96A23-2;Q96A23	.;CPNE4_HUMAN	V	514;514;532;514;532	ENSP00000421705:A514V;ENSP00000411904:A514V;ENSP00000424853:A532V;ENSP00000423811:A514V;ENSP00000421646:A532V	ENSP00000411904:A514V	A	-	2	0	CPNE4	132736862	1.000000	0.71417	0.998000	0.56505	0.601000	0.36947	9.476000	0.97823	2.460000	0.83146	0.557000	0.71058	GCA	.		0.453	CPNE4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356583.4	NM_130808	Missense_Mutation
TIFA	92610	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	113199250	113199250	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr4:113199250T>G	ENST00000361717.3	-	2	604	c.323A>C	c.(322-324)aAa>aCa	p.K108T	TIFA_ENST00000500655.2_Missense_Mutation_p.K108T	NM_052864.2	NP_443096.1	Q96CG3	TIFA_HUMAN	TRAF-interacting protein with forkhead-associated domain	108					I-kappaB kinase/NF-kappaB signaling (GO:0007249)					breast(2)|endometrium(1)|large_intestine(1)|lung(1)|skin(1)	6		Ovarian(17;0.0443)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00172)		CAGGTCCATTTTATTTAGGTA	0.388																																					p.K108T		.											.	TIFA-90	0			c.A323C						.						45.0	42.0	43.0					4																	113199250		2203	4300	6503	SO:0001583	missense	92610	exon2			TCCATTTTATTTA	BC008294	CCDS34051.1	4q25	2008-03-17				ENSG00000145365			19075	protein-coding gene	gene with protein product	"""TRAF2 binding protein"", ""TRAF6 binding protein"""	609028				1179819	Standard	NM_052864		Approved	MGC20791, T2BP, T6BP, TIFAA	uc003ial.3	Q96CG3		ENST00000361717.3:c.323A>C	4.37:g.113199250T>G	ENSP00000354911:p.Lys108Thr	Somatic	86	0		WXS	Illumina HiSeq	Phase_I	56	16	NM_052864	0	1	8	16	7		Missense_Mutation	SNP	ENST00000361717.3	37	CCDS34051.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.382639	0.82792	.	.	ENSG00000145365	ENST00000361717;ENST00000500655	D;D	0.86694	-2.16;-2.16	5.79	5.79	0.91817	Forkhead-associated (FHA) domain (2);	0.092657	0.64402	D	0.000001	D	0.92916	0.7746	M	0.71581	2.175	0.50813	D	0.999896	D	0.89917	1.0	D	0.91635	0.999	D	0.93532	0.6870	10	0.72032	D	0.01	-34.6044	16.1303	0.81428	0.0:0.0:0.0:1.0	.	108	Q96CG3	TIFA_HUMAN	T	108	ENSP00000354911:K108T;ENSP00000424231:K108T	ENSP00000354911:K108T	K	-	2	0	TIFA	113418699	1.000000	0.71417	0.077000	0.20336	0.992000	0.81027	3.462000	0.53042	2.218000	0.71995	0.533000	0.62120	AAA	.		0.388	TIFA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363647.2	NM_052864	
METTL14	57721	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	119631350	119631350	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr4:119631350T>A	ENST00000388822.5	+	11	1431	c.1264T>A	c.(1264-1266)Tct>Act	p.S422T	METTL14_ENST00000506780.1_Missense_Mutation_p.S384T			Q9HCE5	MET14_HUMAN	methyltransferase like 14	422	Gly-rich.				mRNA destabilization (GO:0061157)|mRNA methylation (GO:0080009)|stem cell maintenance (GO:0019827)	MIS complex (GO:0036396)|nucleus (GO:0005634)	mRNA (2'-O-methyladenosine-N6-)-methyltransferase activity (GO:0016422)|RNA binding (GO:0003723)			endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|stomach(1)	16						AGGTGGAACTTCTGCTGGCCG	0.527																																					p.S422T		.											.	METTL14-90	0			c.T1264A						.						56.0	58.0	58.0					4																	119631350		2203	4300	6503	SO:0001583	missense	57721	exon11			GGAACTTCTGCTG	AB046847	CCDS34053.1	4q26	2009-02-24			ENSG00000145388	ENSG00000145388			29330	protein-coding gene	gene with protein product						10997877	Standard	NM_020961		Approved	KIAA1627	uc003icf.3	Q9HCE5	OTTHUMG00000161167	ENST00000388822.5:c.1264T>A	4.37:g.119631350T>A	ENSP00000373474:p.Ser422Thr	Somatic	88	0		WXS	Illumina HiSeq	Phase_I	93	16	NM_020961	0	0	13	22	9	A6NIG1|Q969V2	Missense_Mutation	SNP	ENST00000388822.5	37	CCDS34053.1	.	.	.	.	.	.	.	.	.	.	T	14.22	2.469312	0.43839	.	.	ENSG00000145388	ENST00000388822;ENST00000506780	.	.	.	5.62	4.42	0.53409	.	0.215770	0.49305	D	0.000149	T	0.30448	0.0765	N	0.14661	0.345	0.38962	D	0.958572	B;B	0.29037	0.231;0.139	B;B	0.19946	0.027;0.027	T	0.11916	-1.0568	9	0.08381	T	0.77	-2.7465	12.8488	0.57846	0.0:0.0:0.1363:0.8637	.	384;422	D6RBL4;Q9HCE5	.;MTL14_HUMAN	T	422;384	.	ENSP00000373474:S422T	S	+	1	0	METTL14	119850798	1.000000	0.71417	0.961000	0.40146	0.958000	0.62258	4.909000	0.63314	0.937000	0.37394	0.528000	0.53228	TCT	.		0.527	METTL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364034.3	NM_020961	
KIAA1109	84162	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	123161284	123161284	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr4:123161284G>C	ENST00000264501.4	+	29	4820	c.4447G>C	c.(4447-4449)Gaa>Caa	p.E1483Q	KIAA1109_ENST00000455637.1_Missense_Mutation_p.E1483Q|KIAA1109_ENST00000388738.3_Missense_Mutation_p.E1483Q			Q2LD37	K1109_HUMAN	KIAA1109	1483					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						ATATATTGTAGAAGGTGAGAA	0.398																																					p.E1483Q		.											.	KIAA1109-80	0			c.G4447C						.						118.0	113.0	114.0					4																	123161284		1871	4109	5980	SO:0001583	missense	84162	exon27			ATTGTAGAAGGTG	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.4447G>C	4.37:g.123161284G>C	ENSP00000264501:p.Glu1483Gln	Somatic	117	0		WXS	Illumina HiSeq	Phase_I	103	23	NM_015312	0	0	13	28	15	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	37	CCDS43267.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.16|17.16	3.318796|3.318796	0.60524|0.60524	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000455637|ENST00000446180	T;T;T|.	0.24908|.	2.42;2.42;1.83|.	5.91|5.91	5.91|5.91	0.95273|0.95273	.|.	0.000000|.	0.44285|.	U|.	0.000466|.	T|.	0.57125|.	0.2032|.	N|N	0.24115|0.24115	0.695|0.695	0.49798|0.49798	D|D	0.999822|0.999822	B;B|.	0.32245|.	0.361;0.247|.	B;B|.	0.42343|.	0.384;0.214|.	T|.	0.49184|.	-0.8966|.	10|.	0.66056|.	D|.	0.02|.	.|.	20.2885|20.2885	0.98538|0.98538	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1482;1483|.	Q2LD37-2;Q2LD37|.	.;K1109_HUMAN|.	Q|Y	1483|55	ENSP00000264501:E1483Q;ENSP00000373390:E1483Q;ENSP00000389925:E1483Q|.	ENSP00000264501:E1483Q|.	E|X	+|+	1|3	0|2	KIAA1109|KIAA1109	123380734|123380734	1.000000|1.000000	0.71417|0.71417	0.874000|0.874000	0.34290|0.34290	0.951000|0.951000	0.60555|0.60555	8.632000|8.632000	0.90995|0.90995	2.791000|2.791000	0.96007|0.96007	0.650000|0.650000	0.86243|0.86243	GAA|TAG	.		0.398	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
ATG10	83734	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	81474374	81474374	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr5:81474374C>A	ENST00000282185.3	+	5	715	c.421C>A	c.(421-423)Cta>Ata	p.L141I	ATG10_ENST00000458350.3_Missense_Mutation_p.L141I|ATG10_ENST00000513634.1_Missense_Mutation_p.L141I|ATG10_ENST00000514253.2_3'UTR	NM_031482.4	NP_113670.1	Q9H0Y0	ATG10_HUMAN	autophagy related 10	141					autophagy (GO:0006914)|autophagy in response to ER overload (GO:0034263)|positive regulation of protein modification process (GO:0031401)|protein lipidation (GO:0006497)|protein modification by small protein conjugation (GO:0032446)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|intracellular (GO:0005622)	Atg12 ligase activity (GO:0019777)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(2)	9		Lung NSC(167;0.0258)|all_lung(232;0.0294)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;9.94e-41)|Epithelial(54;6.3e-36)|all cancers(79;2.31e-30)		GATGCGACTGCTACAGGGACC	0.418																																					p.L141I		.											.	ATG10-90	0			c.C421A						.						209.0	180.0	190.0					5																	81474374		2203	4300	6503	SO:0001583	missense	83734	exon6			CGACTGCTACAGG	AK024016	CCDS4057.1	5q14.1	2014-02-12	2012-06-06	2005-09-11	ENSG00000152348	ENSG00000152348			20315	protein-coding gene	gene with protein product		610800	"""APG10 autophagy 10-like (S. cerevisiae)"", ""ATG10 autophagy related 10 homolog (S. cerevisiae)"""	APG10L			Standard	NM_031482		Approved	DKFZP586I0418, FLJ13954	uc003khr.3	Q9H0Y0	OTTHUMG00000119041	ENST00000282185.3:c.421C>A	5.37:g.81474374C>A	ENSP00000282185:p.Leu141Ile	Somatic	89	1		WXS	Illumina HiSeq	Phase_I	69	15	NM_001131028	0	0	15	25	10	B2RE09|Q6PIX1|Q9H842	Missense_Mutation	SNP	ENST00000282185.3	37	CCDS4057.1	.	.	.	.	.	.	.	.	.	.	C	17.53	3.413463	0.62511	.	.	ENSG00000152348	ENST00000282185;ENST00000458350;ENST00000513634	T;T;T	0.45276	1.9;1.9;0.9	5.37	3.56	0.40772	Autophagy-related protein 3 (1);	0.380233	0.27105	N	0.020920	T	0.43344	0.1243	L	0.55990	1.75	0.28013	N	0.934837	B;P	0.42620	0.175;0.785	B;P	0.46419	0.174;0.516	T	0.32161	-0.9917	10	0.37606	T	0.19	-3.2788	10.6892	0.45860	0.0:0.8444:0.0:0.1556	.	141;141	D6RDX3;Q9H0Y0	.;ATG10_HUMAN	I	141	ENSP00000282185:L141I;ENSP00000404938:L141I;ENSP00000425225:L141I	ENSP00000282185:L141I	L	+	1	2	ATG10	81510130	0.946000	0.32159	0.933000	0.37362	0.790000	0.44656	0.765000	0.26546	1.392000	0.46585	0.305000	0.20034	CTA	.		0.418	ATG10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239252.2	NM_001131028	
WDR36	134430	broad.mit.edu	37	5	110428267	110428267	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr5:110428267G>T	ENST00000513710.2	+	1	285	c.281G>T	c.(280-282)cGc>cTc	p.R94L	WDR36_ENST00000506538.2_Missense_Mutation_p.R94L|CTC-551A13.2_ENST00000507269.3_RNA|WDR36_ENST00000505303.1_Missense_Mutation_p.R38L			Q8NI36	WDR36_HUMAN	WD repeat domain 36	94					regulation of axon extension (GO:0030516)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|rRNA processing (GO:0006364)|visual perception (GO:0007601)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(9)|kidney(4)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(142;2.72e-05)|all_epithelial(76;4.4e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0418)|Ovarian(225;0.0443)|Colorectal(57;0.0465)|all_lung(232;0.0508)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.39e-08)|Epithelial(69;1.82e-07)|all cancers(49;2.04e-05)|COAD - Colon adenocarcinoma(37;0.111)		GCGCTCAAGCGCCGGTTCTAT	0.567																																					p.R94L													.	WDR36-92	0			c.G281T						.						37.0	37.0	37.0					5																	110428267		2202	4300	6502	SO:0001583	missense	134430	exon1			TCAAGCGCCGGTT	AF385437	CCDS4102.1	5q22.2	2013-01-09			ENSG00000134987	ENSG00000134987		"""WD repeat domain containing"""	30696	protein-coding gene	gene with protein product		609669	"""glaucoma 1, open angle, G"""	GLC1G		15590835, 15677485	Standard	NM_139281		Approved	TA-WDRP, UTP21	uc003kpd.3	Q8NI36	OTTHUMG00000128790	ENST00000513710.2:c.281G>T	5.37:g.110428267G>T	ENSP00000424628:p.Arg94Leu	Somatic	55	0		WXS	Illumina HiSeq	Phase_I	38	5	NM_139281	0	0	11	12	1	A2RUS4|Q68E02|Q8N1Q2	Missense_Mutation	SNP	ENST00000513710.2	37	CCDS4102.1	.	.	.	.	.	.	.	.	.	.	G	19.24	3.789609	0.70337	.	.	ENSG00000134987	ENST00000506538;ENST00000513710;ENST00000505303	T;T;T	0.28454	1.61;1.61;3.28	5.98	5.11	0.69529	WD40 repeat-like-containing domain (1);	0.108665	0.64402	D	0.000010	T	0.28599	0.0708	M	0.67397	2.05	0.58432	D	0.999996	P	0.38767	0.646	B	0.30855	0.121	T	0.15206	-1.0445	10	0.87932	D	0	-5.4709	9.7297	0.40352	0.0738:0.1425:0.7836:0.0	.	94	Q8NI36	WDR36_HUMAN	L	94;94;38	ENSP00000423067:R94L;ENSP00000424628:R94L;ENSP00000422158:R38L	ENSP00000422158:R38L	R	+	2	0	WDR36	110456166	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.469000	0.60169	1.520000	0.48965	0.650000	0.86243	CGC	.		0.567	WDR36-008	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000373504.3	NM_139281	
ARHGAP26	23092	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	142283206	142283206	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr5:142283206G>C	ENST00000274498.4	+	8	1182	c.804G>C	c.(802-804)atG>atC	p.M268I	ARHGAP26_ENST00000378004.3_Missense_Mutation_p.M268I	NM_015071.4	NP_055886.1	Q9UNA1	RHG26_HUMAN	Rho GTPase activating protein 26	268	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|filopodium assembly (GO:0046847)|nervous system development (GO:0007399)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)	phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(7)|ovary(1)	25		all_hematologic(541;0.0416)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCTACACCATGGAGGGATACC	0.473																																					p.M268I		.											.	ARHGAP26-660	0			c.G804C						.						97.0	84.0	88.0					5																	142283206		2203	4300	6503	SO:0001583	missense	23092	exon8			CACCATGGAGGGA	AB014521	CCDS4277.1, CCDS47297.1	5q31	2011-06-29			ENSG00000145819	ENSG00000145819		"""Rho GTPase activating proteins"""	17073	protein-coding gene	gene with protein product	"""GTPase regulator associated with the focal adhesion kinase pp125"""	605370				9858476, 8649427	Standard	NM_001135608		Approved	GRAF, KIAA0621, OPHN1L, OPHN1L1	uc011dbj.2	Q9UNA1	OTTHUMG00000059705	ENST00000274498.4:c.804G>C	5.37:g.142283206G>C	ENSP00000274498:p.Met268Ile	Somatic	60	0		WXS	Illumina HiSeq	Phase_I	54	11	NM_015071	0	0	24	37	13	O75117|Q5D035|Q9BYS6|Q9BYS7|Q9UJ00	Missense_Mutation	SNP	ENST00000274498.4	37	CCDS4277.1	.	.	.	.	.	.	.	.	.	.	G	12.71	2.018359	0.35606	.	.	ENSG00000145819	ENST00000274498;ENST00000378004	T;T	0.04317	3.65;3.65	5.49	5.49	0.81192	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.85682	D	0.000000	T	0.09379	0.0231	L	0.38953	1.18	0.80722	D	1	P;P	0.37548	0.481;0.599	B;P	0.46076	0.186;0.503	T	0.39231	-0.9624	10	0.25751	T	0.34	.	19.3843	0.94550	0.0:0.0:1.0:0.0	.	268;268	Q9UNA1;Q9UNA1-2	RHG26_HUMAN;.	I	268	ENSP00000274498:M268I;ENSP00000367243:M268I	ENSP00000274498:M268I	M	+	3	0	ARHGAP26	142263390	1.000000	0.71417	1.000000	0.80357	0.801000	0.45260	6.162000	0.71874	2.574000	0.86865	0.563000	0.77884	ATG	.		0.473	ARHGAP26-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000132744.3	NM_015071	
GABRB2	2561	broad.mit.edu	37	5	160753381	160753381	+	Silent	SNP	C	C	G			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr5:160753381C>G	ENST00000393959.1	-	9	1184	c.1185G>C	c.(1183-1185)ctG>ctC	p.L395L	GABRB2_ENST00000353437.6_Intron|GABRB2_ENST00000274547.2_Silent_p.L395L|GABRB2_ENST00000517547.1_Intron|GABRB2_ENST00000520240.1_Intron|GABRB2_ENST00000517901.1_Intron			P47870	GBRB2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 2	395					cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|cochlea development (GO:0090102)|gamma-aminobutyric acid signaling pathway (GO:0007214)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|GABA-A receptor activity (GO:0004890)|inhibitory extracellular ligand-gated ion channel activity (GO:0005237)	p.L395L(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|liver(1)|lung(9)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	26	Renal(175;0.00259)	Medulloblastoma(196;0.021)|all_neural(177;0.0463)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Fospropofol(DB06716)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TAACCGTATACAGAGAGAAAT	0.388																																					p.L395L													.	GABRB2-91	1	Substitution - coding silent(1)	endometrium(1)	c.G1185C						.						110.0	107.0	108.0					5																	160753381		2203	4299	6502	SO:0001819	synonymous_variant	2561	exon10			CGTATACAGAGAG		CCDS4354.1, CCDS4355.1	5q34	2012-06-22			ENSG00000145864	ENSG00000145864		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4082	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 2"""	600232				7851879	Standard	NM_000813		Approved		uc003lys.1	P47870	OTTHUMG00000130349	ENST00000393959.1:c.1185G>C	5.37:g.160753381C>G		Somatic	133	0		WXS	Illumina HiSeq	Phase_I	113	4	NM_021911	0	0	0	0	0	A8K115|A8K1A0|D1LYT0|D1LYT1|Q16323|Q4FZB2	Silent	SNP	ENST00000393959.1	37	CCDS4355.1																																																																																			.		0.388	GABRB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252704.1		
DOCK2	1794	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	169477372	169477372	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr5:169477372G>C	ENST00000256935.8	+	41	4264	c.4184G>C	c.(4183-4185)gGa>gCa	p.G1395A	DOCK2_ENST00000540750.1_Missense_Mutation_p.G456A|DOCK2_ENST00000520908.1_Missense_Mutation_p.G887A|DOCK2_ENST00000523351.1_3'UTR	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1395	DHR-2.|Interaction with CRKL.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TCTGCCCCGGGAGATGATGTG	0.562																																					p.G1395A		.											.	DOCK2-97	0			c.G4184C						.						119.0	111.0	114.0					5																	169477372		2203	4300	6503	SO:0001583	missense	1794	exon41			CCCCGGGAGATGA	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.4184G>C	5.37:g.169477372G>C	ENSP00000256935:p.Gly1395Ala	Somatic	148	0		WXS	Illumina HiSeq	Phase_I	137	32	NM_004946	0	0	49	49	0	Q2M3I0|Q96AK7	Missense_Mutation	SNP	ENST00000256935.8	37	CCDS4371.1	.	.	.	.	.	.	.	.	.	.	G	14.85	2.658712	0.47467	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	T;T;T	0.08896	3.7;3.33;3.04	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.27313	0.0670	M	0.63428	1.95	0.58432	D	0.999999	D;D	0.71674	0.998;0.994	D;P	0.72075	0.976;0.839	T	0.00320	-1.1820	10	0.30854	T	0.27	.	19.427	0.94746	0.0:0.0:1.0:0.0	.	887;1395	E7ERW7;Q92608	.;DOCK2_HUMAN	A	1395;887;456	ENSP00000256935:G1395A;ENSP00000429283:G887A;ENSP00000438827:G456A	ENSP00000256935:G1395A	G	+	2	0	DOCK2	169409950	1.000000	0.71417	0.332000	0.25469	0.198000	0.23893	7.884000	0.87274	2.603000	0.88011	0.655000	0.94253	GGA	.		0.562	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946	
F12	2161	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	176831305	176831305	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr5:176831305G>A	ENST00000253496.3	-	9	958	c.910C>T	c.(910-912)Ccg>Tcg	p.P304S	F12_ENST00000514943.1_5'Flank	NM_000505.3	NP_000496.2	P00748	FA12_HUMAN	coagulation factor XII (Hageman factor)	304	Pro-rich.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|Factor XII activation (GO:0002542)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|plasma kallikrein-kinin cascade (GO:0002353)|positive regulation of blood coagulation (GO:0030194)|positive regulation of fibrinolysis (GO:0051919)|positive regulation of plasminogen activation (GO:0010756)|protein autoprocessing (GO:0016540)|protein processing (GO:0016485)|response to misfolded protein (GO:0051788)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	misfolded protein binding (GO:0051787)|serine-type aminopeptidase activity (GO:0070009)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	12	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Ethanolamine Oleate(DB06689)	ACCGGGGTCGGAGGCGCCGCC	0.701									Hereditary Angioedema		OREG0017088	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P304S		.											.	F12-90	0			c.C910T						.						16.0	21.0	19.0					5																	176831305		2200	4295	6495	SO:0001583	missense	2161	exon9	Familial Cancer Database	HAE, type I-III, Hereditary Angioneurotic Edema, HANE,	GGGTCGGAGGCGC	M31315	CCDS34302.1	5q35.3	2014-09-17			ENSG00000131187	ENSG00000131187	3.4.21.38		3530	protein-coding gene	gene with protein product		610619					Standard	NM_000505		Approved		uc003mgo.4	P00748	OTTHUMG00000163403	ENST00000253496.3:c.910C>T	5.37:g.176831305G>A	ENSP00000253496:p.Pro304Ser	Somatic	38	0	1934	WXS	Illumina HiSeq	Phase_I	30	7	NM_000505	0	0	5	10	5	P78339	Missense_Mutation	SNP	ENST00000253496.3	37	CCDS34302.1	.	.	.	.	.	.	.	.	.	.	G	12.87	2.068656	0.36470	.	.	ENSG00000131187	ENST00000253496	T	0.62364	0.03	3.94	1.0	0.19881	Kringle-like fold (1);	0.463200	0.16155	N	0.227071	T	0.32912	0.0845	N	0.14661	0.345	0.19300	N	0.999975	B	0.34103	0.437	B	0.27500	0.08	T	0.22103	-1.0226	10	0.09084	T	0.74	.	6.3798	0.21527	0.0:0.1784:0.4636:0.358	.	304	P00748	FA12_HUMAN	S	304	ENSP00000253496:P304S	ENSP00000253496:P304S	P	-	1	0	F12	176763911	0.000000	0.05858	0.000000	0.03702	0.121000	0.20230	-0.786000	0.04623	0.206000	0.20587	0.561000	0.74099	CCG	.		0.701	F12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373217.1		
MAML1	9794	broad.mit.edu;bcgsc.ca	37	5	179193285	179193285	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr5:179193285G>T	ENST00000292599.3	+	2	1537	c.1274G>T	c.(1273-1275)gGc>gTc	p.G425V	MAML1_ENST00000503050.1_3'UTR	NM_014757.4	NP_055572.1			mastermind-like 1 (Drosophila)											central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	36	all_cancers(89;0.000197)|all_epithelial(37;6.7e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0308)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCAGCCCCGGGCCAGATGTCC	0.637																																					p.G425V													.	MAML1-848	0			c.G1274T						.						70.0	84.0	79.0					5																	179193285		2203	4300	6503	SO:0001583	missense	9794	exon2			CCCCGGGCCAGAT	D83785	CCDS34315.1	5q35	2008-07-18	2001-11-28			ENSG00000161021			13632	protein-coding gene	gene with protein product	"""mastermind homolog"""	605424	"""mastermind (drosophila)-like 1"""			11101851, 11390662	Standard	NM_014757		Approved	KIAA0200, Mam-1	uc003mkm.3	Q92585		ENST00000292599.3:c.1274G>T	5.37:g.179193285G>T	ENSP00000292599:p.Gly425Val	Somatic	255	0		WXS	Illumina HiSeq	Phase_I	204	8	NM_014757	0	0	31	33	2		Missense_Mutation	SNP	ENST00000292599.3	37	CCDS34315.1	.	.	.	.	.	.	.	.	.	.	G	9.410	1.080166	0.20309	.	.	ENSG00000161021	ENST00000292599;ENST00000376951	T	0.23147	1.92	4.74	3.86	0.44501	.	0.282061	0.31884	N	0.006919	T	0.26412	0.0645	L	0.40543	1.245	0.31149	N	0.705712	D;P	0.55385	0.971;0.855	P;B	0.51999	0.687;0.282	T	0.24941	-1.0146	10	0.56958	D	0.05	-12.2642	4.2806	0.10831	0.2122:0.2049:0.5829:0.0	.	462;425	Q59GH4;Q92585	.;MAML1_HUMAN	V	425;462	ENSP00000292599:G425V	ENSP00000292599:G425V	G	+	2	0	MAML1	179125891	0.002000	0.14202	0.998000	0.56505	0.572000	0.35998	0.082000	0.14847	0.963000	0.38082	0.313000	0.20887	GGC	.		0.637	MAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372316.2	NM_014757	
ZBTB9	221504	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	33423041	33423041	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr6:33423041A>G	ENST00000395064.2	+	2	432	c.164A>G	c.(163-165)cAg>cGg	p.Q55R		NM_152735.3	NP_689948.1	Q96C00	ZBTB9_HUMAN	zinc finger and BTB domain containing 9	55	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(6)|skin(1)|upper_aerodigestive_tract(2)	11						CTCCTGGTGCAGGGCCGGGAA	0.552																																					p.Q55R		.											.	ZBTB9-90	0			c.A164G						.						173.0	168.0	170.0					6																	33423041		2203	4300	6503	SO:0001583	missense	221504	exon2			TGGTGCAGGGCCG	AK122644	CCDS4780.1	6p21.31	2013-01-09			ENSG00000213588	ENSG00000213588		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	28323	protein-coding gene	gene with protein product						12477932	Standard	NM_152735		Approved	MGC23166, ZNF919	uc003oeq.3	Q96C00	OTTHUMG00000140180	ENST00000395064.2:c.164A>G	6.37:g.33423041A>G	ENSP00000378503:p.Gln55Arg	Somatic	296	2		WXS	Illumina HiSeq	Phase_I	247	65	NM_152735	0	0	9	16	7	A2AB19	Missense_Mutation	SNP	ENST00000395064.2	37	CCDS4780.1	.	.	.	.	.	.	.	.	.	.	A	22.2	4.251348	0.80135	.	.	ENSG00000213588	ENST00000395064	T	0.21932	1.98	4.97	4.97	0.65823	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.113982	0.34460	U	0.003959	T	0.30166	0.0756	L	0.55743	1.74	0.46774	D	0.999196	D	0.89917	1.0	D	0.87578	0.998	T	0.02942	-1.1091	10	0.51188	T	0.08	.	12.6511	0.56761	1.0:0.0:0.0:0.0	.	55	Q96C00	ZBTB9_HUMAN	R	55	ENSP00000378503:Q55R	ENSP00000378503:Q55R	Q	+	2	0	ZBTB9	33531019	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.599000	0.74127	2.070000	0.61991	0.460000	0.39030	CAG	.		0.552	ZBTB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276533.1	NM_152735	
EEF1A1	1915	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	74229620	74229620	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr6:74229620T>C	ENST00000316292.9	-	1	1121	c.130A>G	c.(130-132)Aag>Gag	p.K44E	EEF1A1_ENST00000491404.1_5'Flank|EEF1A1_ENST00000331523.2_Missense_Mutation_p.K44E|EEF1A1_ENST00000309268.6_Missense_Mutation_p.K44E	NM_001402.5	NP_001393.1	P68104	EF1A1_HUMAN	eukaryotic translation elongation factor 1 alpha 1	44	tr-type G.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|translation elongation factor activity (GO:0003746)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(6)|prostate(2)|skin(3)	18						GCAGCCTCCTTCTCAAATTTT	0.423																																					p.K44E		.											.	EEF1A1-226	0			c.A130G						.						127.0	129.0	128.0					6																	74229620		2203	4300	6503	SO:0001583	missense	1915	exon2			CCTCCTTCTCAAA	BC019669	CCDS4980.1	6q14.1	2010-06-30	2004-11-19		ENSG00000156508	ENSG00000156508			3189	protein-coding gene	gene with protein product		130590	"""leukocyte receptor cluster (LRC) member 7"""	EF1A, EEF1A, LENG7		8812466, 10941842	Standard	NM_001402		Approved	EE1A1	uc003phj.3	P68104	OTTHUMG00000015031	ENST00000316292.9:c.130A>G	6.37:g.74229620T>C	ENSP00000339063:p.Lys44Glu	Somatic	185	0		WXS	Illumina HiSeq	Phase_I	162	13	NM_001402	0	0	24	26	2	P04719|P04720|Q6IQ15	Missense_Mutation	SNP	ENST00000316292.9	37	CCDS4980.1	.	.	.	.	.	.	.	.	.	.	T	13.92	2.380554	0.42207	.	.	ENSG00000156508	ENST00000316292;ENST00000358190;ENST00000309268;ENST00000331523;ENST00000391977;ENST00000456206;ENST00000356303;ENST00000455918	T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91	4.15	4.15	0.48705	Protein synthesis factor, GTP-binding (2);	0.000000	0.85682	U	0.000000	T	0.23965	0.0580	L	0.39326	1.205	0.80722	D	1	B;B;B;B;B	0.14012	0.002;0.009;0.009;0.009;0.009	B;B;B;B;B	0.26416	0.013;0.069;0.069;0.069;0.069	T	0.21999	-1.0229	10	0.87932	D	0	.	13.6597	0.62359	0.0:0.0:0.0:1.0	.	44;44;44;44;44	A6PW80;P68104;Q53HR5;Q6IPS9;Q5VTE0	.;EF1A1_HUMAN;.;.;EF1A3_HUMAN	E	44	ENSP00000339063:K44E;ENSP00000339053:K44E;ENSP00000330054:K44E;ENSP00000348651:K44E;ENSP00000392366:K44E	ENSP00000339053:K44E	K	-	1	0	EEF1A1	74286341	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	7.669000	0.83911	1.874000	0.54306	0.454000	0.30748	AAG	.		0.423	EEF1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041210.2	NM_001402	
ZNF292	23036	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	87964665	87964665	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr6:87964665T>C	ENST00000369577.3	+	8	1361	c.1318T>C	c.(1318-1320)Tgg>Cgg	p.W440R	ZNF292_ENST00000339907.4_Missense_Mutation_p.W435R	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	440						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		GAAAACTCAATGGCCCTTTGA	0.378																																					p.W440R		.											.	ZNF292-72	0			c.T1318C						.						75.0	69.0	71.0					6																	87964665		1844	4086	5930	SO:0001583	missense	23036	exon8			ACTCAATGGCCCT	AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.1318T>C	6.37:g.87964665T>C	ENSP00000358590:p.Trp440Arg	Somatic	53	0		WXS	Illumina HiSeq	Phase_I	38	5	NM_015021	0	0	5	9	4	Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Missense_Mutation	SNP	ENST00000369577.3	37	CCDS47457.1	.	.	.	.	.	.	.	.	.	.	T	16.87	3.241783	0.58995	.	.	ENSG00000188994	ENST00000369577;ENST00000339907	T;T	0.39787	1.06;1.06	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.58424	0.2121	M	0.72894	2.215	0.58432	D	0.999997	D	0.89917	1.0	D	0.91635	0.999	T	0.63435	-0.6638	10	0.87932	D	0	.	16.6245	0.84952	0.0:0.0:0.0:1.0	.	440	O60281	ZN292_HUMAN	R	440;435	ENSP00000358590:W440R;ENSP00000342847:W435R	ENSP00000342847:W435R	W	+	1	0	ZNF292	88021384	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	8.040000	0.89188	2.323000	0.78572	0.528000	0.53228	TGG	.		0.378	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376192.2	NM_015021	
HOXA4	3201	hgsc.bcm.edu	37	7	27169876	27169876	+	Silent	SNP	C	C	A	rs112274824	byFrequency	TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr7:27169876C>A	ENST00000360046.5	-	1	542	c.477G>T	c.(475-477)gcG>gcT	p.A159A	HOXA-AS3_ENST00000518848.1_RNA|HOXA4_ENST00000428284.2_Silent_p.A159A|HOXA-AS2_ENST00000517550.1_RNA|HOXA-AS2_ENST00000521687.1_RNA|HOXA-AS2_ENST00000521159.1_RNA|RP1-170O19.22_ENST00000467897.2_RNA|HOXA3_ENST00000521401.1_Intron	NM_002141.4	NP_002132.3	Q00056	HXA4_HUMAN	homeobox A4	159	Pro-rich (part of the transcriptional activation domain).				anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(6)	12						tggcgggggccgcctcgcagc	0.801													C|||	24	0.00479233	0.0174	0.0014	5008	,	,		4363	0.0		0.0	False		,,,				2504	0.0				p.A159A		.											.	HOXA4-153	0			c.G477T						.						1.0	2.0	1.0					7																	27169876		1066	2267	3333	SO:0001819	synonymous_variant	3201	exon1			GGGGGCCGCCTCG		CCDS5405.1	7p15.2	2011-06-20	2005-12-22		ENSG00000197576	ENSG00000197576		"""Homeoboxes / ANTP class : HOXL subclass"""	5105	protein-coding gene	gene with protein product		142953	"""homeo box A4"""	HOX1D, HOX1		1973146, 1358459	Standard	NM_002141		Approved		uc003sym.4	Q00056	OTTHUMG00000023213	ENST00000360046.5:c.477G>T	7.37:g.27169876C>A		Somatic	4	0		WXS	Illumina HiSeq	Phase_I	6	4	NM_002141	0	0	0	0	0	A4D180|O43366	Silent	SNP	ENST00000360046.5	37	CCDS5405.1																																																																																			C|0.500;A|0.500		0.801	HOXA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059534.4		
CHN2	1124	broad.mit.edu	37	7	29440319	29440319	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr7:29440319C>A	ENST00000222792.6	+	6	981	c.451C>A	c.(451-453)Ccc>Acc	p.P151T	CHN2_ENST00000495789.2_Missense_Mutation_p.P164T|CHN2_ENST00000546235.1_Missense_Mutation_p.P136T|CHN2_ENST00000539389.1_Intron|CHN2_ENST00000539406.1_Missense_Mutation_p.P226T|CHN2_ENST00000435288.2_Intron	NM_004067.2	NP_004058.1	P52757	CHIO_HUMAN	chimerin 2	151					positive regulation of GTPase activity (GO:0043547)|positive regulation of signal transduction (GO:0009967)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|endometrium(3)|large_intestine(2)|lung(12)|ovary(2)|urinary_tract(2)	23						GACAACTAACCCCATCTATGA	0.403																																					p.P151T	Ovarian(1;44 48 13232 18918 31480)												.	CHN2-229	0			c.C451A						.						99.0	92.0	95.0					7																	29440319		2203	4300	6503	SO:0001583	missense	1124	exon6			ACTAACCCCATCT	L29126	CCDS5420.1	7p15.3	2013-02-14	2012-10-17		ENSG00000106069	ENSG00000106069		"""Rho GTPase activating proteins"", ""SH2 domain containing"""	1944	protein-coding gene	gene with protein product	"""beta chimerin"", ""chimaerin 2"""	602857	"""chimerin (chimaerin) 2"""			8175705	Standard	XM_005249602		Approved	ARHGAP3, RhoGAP3	uc003szz.3	P52757	OTTHUMG00000023063	ENST00000222792.6:c.451C>A	7.37:g.29440319C>A	ENSP00000222792:p.Pro151Thr	Somatic	97	0		WXS	Illumina HiSeq	Phase_I	116	4	NM_004067	0	0	38	38	0	A4D1A2|B3VCF1|B3VCF2|B3VCF3|B3VCF7|B3VCG1|C9J7B0|E9PGE0|F8QPL9|Q2M203|Q75MM2	Missense_Mutation	SNP	ENST00000222792.6	37	CCDS5420.1	.	.	.	.	.	.	.	.	.	.	C	29.9	5.048036	0.93740	.	.	ENSG00000106069	ENST00000539406;ENST00000222792;ENST00000409350;ENST00000495789;ENST00000546235;ENST00000446446	T;T;T;T;T;D	0.89343	-0.02;-0.02;-0.02;-0.02;-0.02;-2.5	6.17	6.17	0.99709	.	0.200984	0.53938	D	0.000046	D	0.92893	0.7739	L	0.50333	1.59	0.80722	D	1	D;D;D;D;D	0.89917	0.996;1.0;1.0;1.0;0.999	D;D;D;D;D	0.91635	0.937;0.996;0.999;0.994;0.991	D	0.89325	0.3643	10	0.22706	T	0.39	.	20.4745	0.99168	0.0:1.0:0.0:0.0	.	136;164;226;151;151	B7Z1W9;B7Z1V0;F5H003;A4D1A2;P52757	.;.;.;.;CHIO_HUMAN	T	226;151;164;164;136;2	ENSP00000444063:P226T;ENSP00000222792:P151T;ENSP00000386968:P164T;ENSP00000438587:P164T;ENSP00000442812:P136T;ENSP00000396867:P2T	ENSP00000222792:P151T	P	+	1	0	CHN2	29406844	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.538000	0.82048	2.941000	0.99782	0.655000	0.94253	CCC	.		0.403	CHN2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214228.2	NM_004067	
SEMA3A	10371	broad.mit.edu	37	7	83636753	83636753	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr7:83636753G>C	ENST00000265362.4	-	10	1370	c.1056C>G	c.(1054-1056)ttC>ttG	p.F352L	SEMA3A_ENST00000436949.1_Missense_Mutation_p.F352L	NM_006080.2	NP_006071.1	Q14563	SEM3A_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A	352	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				apoptotic process (GO:0006915)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|dendrite morphogenesis (GO:0048813)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of epithelial cell migration (GO:0010633)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neural crest cell migration involved in sympathetic nervous system development (GO:1903045)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of male gonad development (GO:2000020)|positive regulation of neuron migration (GO:2001224)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of heart rate (GO:0002027)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sensory system development (GO:0048880)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular region (GO:0005576)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|neuropilin binding (GO:0038191)|receptor activity (GO:0004872)			breast(3)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53						ATGGACCAAGGAACACCCTTC	0.453																																					p.F352L													.	SEMA3A-156	0			c.C1056G						.						152.0	122.0	132.0					7																	83636753		2203	4300	6503	SO:0001583	missense	10371	exon10			ACCAAGGAACACC	L26081	CCDS5599.1	7p12.1	2013-01-11			ENSG00000075213	ENSG00000075213		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10723	protein-coding gene	gene with protein product	"""sema III"""	603961		SEMAD		8269517, 7748561	Standard	NM_006080		Approved	SEMA1, SemD, coll-1, Hsema-I	uc003uhz.3	Q14563	OTTHUMG00000023443	ENST00000265362.4:c.1056C>G	7.37:g.83636753G>C	ENSP00000265362:p.Phe352Leu	Somatic	95	0		WXS	Illumina HiSeq	Phase_I	99	3	NM_006080	0	0	0	0	0		Missense_Mutation	SNP	ENST00000265362.4	37	CCDS5599.1	.	.	.	.	.	.	.	.	.	.	G	19.45	3.829227	0.71258	.	.	ENSG00000075213	ENST00000265362;ENST00000436949	T;T	0.49432	0.78;0.78	4.72	2.86	0.33363	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.66386	0.2784	M	0.82716	2.605	0.58432	D	0.999993	D	0.89917	1.0	D	0.97110	1.0	T	0.68530	-0.5384	10	0.87932	D	0	.	8.1244	0.30990	0.3363:0.0:0.6637:0.0	.	352	Q14563	SEM3A_HUMAN	L	352	ENSP00000265362:F352L;ENSP00000415260:F352L	ENSP00000265362:F352L	F	-	3	2	SEMA3A	83474689	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.144000	0.31565	1.109000	0.41680	0.561000	0.74099	TTC	.		0.453	SEMA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253355.2	NM_006080	
ANKIB1	54467	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	92019370	92019370	+	Silent	SNP	T	T	C			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr7:92019370T>C	ENST00000265742.3	+	15	2368	c.1992T>C	c.(1990-1992)taT>taC	p.Y664Y		NM_019004.1	NP_061877.1	Q9P2G1	AKIB1_HUMAN	ankyrin repeat and IBR domain containing 1	664							zinc ion binding (GO:0008270)			cervix(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(19)|skin(1)	41	all_cancers(62;2.06e-09)|all_epithelial(64;9.24e-09)|Breast(17;0.0034)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|all cancers(6;0.00183)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			AGTGTTCTTATCCATATGGAT	0.333																																					p.Y664Y		.											.	ANKIB1-432	0			c.T1992C						.						107.0	102.0	103.0					7																	92019370		1828	4082	5910	SO:0001819	synonymous_variant	54467	exon15			TTCTTATCCATAT	AB037807	CCDS47639.1	7q21.3	2013-01-10			ENSG00000001629	ENSG00000001629		"""Ankyrin repeat domain containing"""	22215	protein-coding gene	gene with protein product							Standard	NM_019004		Approved	DKFZP434A0225, KIAA1386	uc003ulw.2	Q9P2G1	OTTHUMG00000155859	ENST00000265742.3:c.1992T>C	7.37:g.92019370T>C		Somatic	109	0		WXS	Illumina HiSeq	Phase_I	120	29	NM_019004	0	0	100	160	60	Q6GMS4|Q6P3S9|Q9NTD7|Q9NW49	Silent	SNP	ENST00000265742.3	37	CCDS47639.1																																																																																			.		0.333	ANKIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342018.1		
SLC26A5	375611	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	103019735	103019735	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr7:103019735A>C	ENST00000306312.3	-	16	1893	c.1632T>G	c.(1630-1632)atT>atG	p.I544M	SLC26A5_ENST00000393735.2_Intron|SLC26A5_ENST00000393723.1_Missense_Mutation_p.I512M|SLC26A5_ENST00000356767.4_Intron|SLC26A5_ENST00000393730.1_Missense_Mutation_p.I512M|SLC26A5_ENST00000354356.4_De_novo_Start_InFrame|SLC26A5_ENST00000393729.1_Missense_Mutation_p.I507M|SLC26A5_ENST00000432958.2_Missense_Mutation_p.I512M|SLC26A5_ENST00000339444.6_Missense_Mutation_p.I544M|SLC26A5_ENST00000393727.1_Missense_Mutation_p.I544M	NM_198999.2	NP_945350.1	P58743	S26A5_HUMAN	solute carrier family 26 (anion exchanger), member 5	544	STAS. {ECO:0000255|PROSITE- ProRule:PRU00198}.				regulation of cell shape (GO:0008360)|regulation of membrane potential (GO:0042391)|sensory perception of sound (GO:0007605)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)	secondary active sulfate transmembrane transporter activity (GO:0008271)			endometrium(5)|kidney(2)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)	43						TTGCATAGTAAATTGGTGCAT	0.318																																					p.I544M		.											.	SLC26A5-91	0			c.T1632G						.						112.0	107.0	109.0					7																	103019735		2203	4299	6502	SO:0001583	missense	375611	exon16			ATAGTAAATTGGT	AC005064	CCDS5733.1, CCDS43630.1, CCDS55150.1, CCDS5732.1, CCDS43629.1	7q22	2013-07-18	2013-07-18	2005-09-13	ENSG00000170615	ENSG00000170615		"""Solute carriers"""	9359	protein-coding gene	gene with protein product	"""deafness, neurosensory, autosomal recessive, 61"""	604943	"""prestin (motor protein)"""	PRES		10821263	Standard	NM_206883		Approved	DFNB61	uc003vbz.3	P58743	OTTHUMG00000149911	ENST00000306312.3:c.1632T>G	7.37:g.103019735A>C	ENSP00000304783:p.Ile544Met	Somatic	113	0		WXS	Illumina HiSeq	Phase_I	100	34	NM_206883	0	0	0	0	0	Q496J2|Q7Z7F3|Q86UF8|Q86UF9|Q86UG0	Missense_Mutation	SNP	ENST00000306312.3	37	CCDS5733.1	.	.	.	.	.	.	.	.	.	.	A	16.19	3.052577	0.55218	.	.	ENSG00000170615	ENST00000339444;ENST00000306312;ENST00000393730;ENST00000432958;ENST00000393729;ENST00000393727;ENST00000393723	D;D;D;D;D;D;D	0.94862	-3.54;-3.54;-3.54;-3.54;-3.54;-3.54;-3.54	6.13	4.99	0.66335	Sulphate transporter/antisigma-factor antagonist STAS (4);	0.151455	0.56097	D	0.000021	D	0.96288	0.8789	M	0.82056	2.57	0.80722	D	1	P;D;D	0.67145	0.645;0.996;0.995	P;D;D	0.67382	0.643;0.951;0.918	D	0.95580	0.8645	10	0.49607	T	0.09	.	8.2331	0.31610	0.8582:0.0:0.1418:0.0	.	544;512;544	P58743;Q496J2;P58743-2	S26A5_HUMAN;.;.	M	544;544;512;512;507;544;512	ENSP00000342396:I544M;ENSP00000304783:I544M;ENSP00000377331:I512M;ENSP00000389733:I512M;ENSP00000377330:I507M;ENSP00000377328:I544M;ENSP00000377324:I512M	ENSP00000304783:I544M	I	-	3	3	SLC26A5	102806971	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.023000	0.30065	2.364000	0.80123	0.524000	0.50904	ATT	.		0.318	SLC26A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313860.1	NM_198999	
UBE3C	9690	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	157046775	157046775	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr7:157046775A>G	ENST00000348165.5	+	20	3182	c.2822A>G	c.(2821-2823)cAg>cGg	p.Q941R		NM_014671.2	NP_055486.2	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C	941	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(2)|endometrium(3)|kidney(16)|large_intestine(13)|lung(25)|ovary(2)|prostate(1)|urinary_tract(1)	63		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)		GCTTTCCGCCAGGGCCTTGCC	0.567																																					p.Q941R		.											.	UBE3C-704	0			c.A2822G						.						56.0	53.0	54.0					7																	157046775		2203	4300	6503	SO:0001583	missense	9690	exon20			TCCGCCAGGGCCT	AK127280	CCDS34789.1	7q36.3	2004-05-04			ENSG00000009335	ENSG00000009335			16803	protein-coding gene	gene with protein product		614454				7584026, 11278995	Standard	NM_014671		Approved	KIAA0010, KIAA10	uc010lqs.3	Q15386	OTTHUMG00000157239	ENST00000348165.5:c.2822A>G	7.37:g.157046775A>G	ENSP00000309198:p.Gln941Arg	Somatic	59	0		WXS	Illumina HiSeq	Phase_I	60	21	NM_014671	0	0	34	83	49	A4D235|A6NCP3|Q8TC15|Q96CR4|Q9UDU3	Missense_Mutation	SNP	ENST00000348165.5	37	CCDS34789.1	.	.	.	.	.	.	.	.	.	.	A	22.3	4.268398	0.80469	.	.	ENSG00000009335	ENST00000348165	T	0.56103	0.48	5.31	5.31	0.75309	HECT (4);	0.000000	0.85682	D	0.000000	T	0.45115	0.1326	N	0.20610	0.595	0.80722	D	1	B;P	0.38677	0.437;0.642	P;P	0.48334	0.475;0.574	T	0.30357	-0.9981	10	0.05833	T	0.94	.	15.5565	0.76200	1.0:0.0:0.0:0.0	.	941;794	Q15386;B4DHJ9	UBE3C_HUMAN;.	R	941	ENSP00000309198:Q941R	ENSP00000309198:Q941R	Q	+	2	0	UBE3C	156739536	1.000000	0.71417	0.996000	0.52242	0.769000	0.43574	8.946000	0.92992	2.143000	0.66587	0.533000	0.62120	CAG	.		0.567	UBE3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348108.1	NM_014671	
PDLIM2	64236	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	22452077	22452077	+	IGR	SNP	C	C	T			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr8:22452077C>T	ENST00000397760.4	+	0	1837				AC037459.4_ENST00000430850.2_Intron|PDLIM2_ENST00000265810.4_Missense_Mutation_p.S339L			Q96JY6	PDLI2_HUMAN	PDZ and LIM domain 2 (mystique)							actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|urinary_tract(1)	9		Prostate(55;0.0421)|Breast(100;0.102)|all_epithelial(46;0.142)		BRCA - Breast invasive adenocarcinoma(99;0.00579)|Colorectal(74;0.0152)|COAD - Colon adenocarcinoma(73;0.0626)		ATGAGATTGTCACTGGAAGCT	0.527																																					p.S339L		.											.	PDLIM2-90	0			c.C1016T						.						167.0	167.0	167.0					8																	22452077		2203	4300	6503	SO:0001628	intergenic_variant	64236	exon10			GATTGTCACTGGA	AY007729	CCDS34860.1, CCDS6032.1, CCDS34861.1, CCDS6032.2	8p21.3	2012-06-27			ENSG00000120913	ENSG00000120913			13992	protein-coding gene	gene with protein product		609722					Standard	NM_021630		Approved		uc003xby.4	Q96JY6	OTTHUMG00000164270		8.37:g.22452077C>T		Somatic	193	0		WXS	Illumina HiSeq	Phase_I	167	11	NM_176871	0	0	0	0	0	D3DSR5|J3KNH4|Q7Z584|Q86WM8|Q8WZ29|Q9H4L9|Q9H7I2	Missense_Mutation	SNP	ENST00000397760.4	37		.	.	.	.	.	.	.	.	.	.	C	13.63	2.293984	0.40594	.	.	ENSG00000120913	ENST00000265810	T	0.13538	2.58	1.84	0.907	0.19321	.	.	.	.	.	T	0.08582	0.0213	.	.	.	0.09310	N	0.999999	B	0.23185	0.081	B	0.15052	0.012	T	0.31971	-0.9924	8	0.49607	T	0.09	.	3.5437	0.07820	0.0:0.7384:0.0:0.2616	.	339	Q96JY6-3	.	L	339	ENSP00000265810:S339L	ENSP00000265810:S339L	S	+	2	0	PDLIM2	22508022	0.004000	0.15560	0.006000	0.13384	0.019000	0.09904	0.023000	0.13533	0.318000	0.23185	0.491000	0.48974	TCA	.		0.527	PDLIM2-202	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000334167.1		
SLC7A13	157724	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	87226722	87226722	+	Nonsense_Mutation	SNP	T	T	A			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr8:87226722T>A	ENST00000297524.3	-	4	1436	c.1333A>T	c.(1333-1335)Aga>Tga	p.R445*	SLC7A13_ENST00000419776.2_3'UTR|CTD-3118D11.3_ENST00000523112.1_RNA	NM_138817.2	NP_620172.2	Q8TCU3	S7A13_HUMAN	solute carrier family 7 (anionic amino acid transporter), member 13	445						integral component of membrane (GO:0016021)	amino acid transmembrane transporter activity (GO:0015171)	p.R445*(1)		breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	45						CAAGCCAATCTTATTTTAAAA	0.348																																					p.R445X		.											.	SLC7A13-90	1	Substitution - Nonsense(1)	large_intestine(1)	c.A1333T						.						56.0	61.0	60.0					8																	87226722		2203	4300	6503	SO:0001587	stop_gained	157724	exon4			CCAATCTTATTTT	AJ417661	CCDS34917.1	8q21.3	2013-07-15	2011-07-12		ENSG00000164893	ENSG00000164893		"""Solute carriers"""	23092	protein-coding gene	gene with protein product						11907033, 11943479	Standard	XM_005250804		Approved	AGT-1, XAT2	uc003ydq.1	Q8TCU3	OTTHUMG00000163663	ENST00000297524.3:c.1333A>T	8.37:g.87226722T>A	ENSP00000297524:p.Arg445*	Somatic	72	0		WXS	Illumina HiSeq	Phase_I	53	17	NM_138817	0	0	0	0	0	Q05C37|Q08AH9|Q96N84	Nonsense_Mutation	SNP	ENST00000297524.3	37	CCDS34917.1	.	.	.	.	.	.	.	.	.	.	T	12.75	2.030925	0.35797	.	.	ENSG00000164893	ENST00000297524	.	.	.	4.13	-0.155	0.13395	.	0.844613	0.10208	N	0.702444	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.19590	T	0.45	.	5.8345	0.18599	0.0:0.1058:0.4904:0.4039	.	.	.	.	X	445	.	ENSP00000297524:R445X	R	-	1	2	SLC7A13	87295838	0.001000	0.12720	0.000000	0.03702	0.068000	0.16541	1.079000	0.30766	0.195000	0.20347	0.533000	0.62120	AGA	.		0.348	SLC7A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374704.1	NM_138817	
ZHX2	22882	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	123965936	123965936	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr8:123965936A>C	ENST00000314393.4	+	3	3021	c.2186A>C	c.(2185-2187)cAa>cCa	p.Q729P		NM_014943.3	NP_055758.1	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2	729					mRNA catabolic process (GO:0006402)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	45	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)			GTGGTTCCACAATATTACAAG	0.527																																					p.Q729P	Esophageal Squamous(94;1056 1388 11767 13799 49639)	.											.	ZHX2-227	0			c.A2186C						.						96.0	101.0	100.0					8																	123965936		2203	4300	6503	SO:0001583	missense	22882	exon3			TTCCACAATATTA	AB020661	CCDS6336.1	8q24.13	2012-03-09	2004-01-23		ENSG00000178764	ENSG00000178764		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	18513	protein-coding gene	gene with protein product		609185	"""zinc-fingers and homeoboxes 2"""			10048485, 12741956	Standard	XM_005250837		Approved	KIAA0854	uc003ypk.1	Q9Y6X8	OTTHUMG00000165077	ENST00000314393.4:c.2186A>C	8.37:g.123965936A>C	ENSP00000314709:p.Gln729Pro	Somatic	128	0		WXS	Illumina HiSeq	Phase_I	107	27	NM_014943	0	0	12	36	24		Missense_Mutation	SNP	ENST00000314393.4	37	CCDS6336.1	.	.	.	.	.	.	.	.	.	.	A	4.171	0.030196	0.08101	.	.	ENSG00000178764	ENST00000314393	T	0.18502	2.21	5.94	0.233	0.15386	.	0.814635	0.11109	N	0.598853	T	0.09202	0.0227	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.33085	-0.9882	10	0.36615	T	0.2	-0.5406	4.2111	0.10512	0.4285:0.383:0.0659:0.1227	.	729	Q9Y6X8	ZHX2_HUMAN	P	729	ENSP00000314709:Q729P	ENSP00000314709:Q729P	Q	+	2	0	ZHX2	124035117	0.000000	0.05858	0.002000	0.10522	0.014000	0.08584	0.379000	0.20585	0.099000	0.17552	-0.466000	0.05196	CAA	.		0.527	ZHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381709.1	NM_014943	
MROH5	389690	broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	142477599	142477599	+	RNA	SNP	G	G	A	rs567666900	byFrequency	TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr8:142477599G>A	ENST00000430863.1	-	0	2302					NM_207414.2	NP_997297.2	Q6ZUA9	MROH5_HUMAN	maestro heat-like repeat family member 5																		GTCGATGGCCGTCCAGATGAG	0.662																																					.													.	.	0			.						.						56.0	65.0	62.0					8																	142477599		2100	4222	6322			389690	.			ATGGCCGTCCAGA			8q24.3	2012-12-20			ENSG00000226807	ENSG00000226807		"""maestro heat-like repeat containing"""	42976	protein-coding gene	gene with protein product							Standard	NM_207414		Approved	FLJ43860	uc003ywi.2	Q6ZUA9	OTTHUMG00000155944		8.37:g.142477599G>A		Somatic	62	0		WXS	Illumina HiSeq	Phase_I	31	7	.	0	0	0	0	0		Missense_Mutation	SNP	ENST00000430863.1	37																																																																																				.		0.662	MROH5-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000342412.4	NM_207414	
FAM83H	286077	hgsc.bcm.edu	37	8	144810122	144810122	+	Silent	SNP	G	G	A			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr8:144810122G>A	ENST00000388913.3	-	5	1634	c.1509C>T	c.(1507-1509)gaC>gaT	p.D503D		NM_198488.3	NP_940890	Q6ZRV2	FA83H_HUMAN	family with sequence similarity 83, member H	503					biomineral tissue development (GO:0031214)					central_nervous_system(2)|endometrium(1)|large_intestine(1)|lung(12)|pancreas(1)|prostate(3)|urinary_tract(1)	21	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			GCTGGTGCCCGTCGGGTCCGA	0.761																																					p.D503D		.											.	FAM83H-92	0			c.C1509T						.						3.0	5.0	4.0					8																	144810122		1410	3264	4674	SO:0001819	synonymous_variant	286077	exon5			GTGCCCGTCGGGT	AK127960	CCDS6410.2	8q24.3	2014-03-13			ENSG00000180921	ENSG00000180921			24797	protein-coding gene	gene with protein product		611927				18252228	Standard	NM_198488		Approved	FLJ46072	uc003yzk.3	Q6ZRV2	OTTHUMG00000133559	ENST00000388913.3:c.1509C>T	8.37:g.144810122G>A		Somatic	4	1		WXS	Illumina HiSeq	Phase_I	5	4	NM_198488	0	0	2	7	5	A0JLS2|Q8N4W0	Silent	SNP	ENST00000388913.3	37	CCDS6410.2																																																																																			.		0.761	FAM83H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257632.2	NM_198488	
VCP	7415	ucsc.edu	37	9	35062136	35062136	+	Splice_Site	SNP	C	C	T			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr9:35062136C>T	ENST00000358901.6	-	9	1841		c.e9-1			NM_007126.3	NP_009057.1	P55072	TERA_HUMAN	valosin containing protein						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|aggresome assembly (GO:0070842)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|establishment of protein localization (GO:0045184)|positive regulation of Lys63-specific deubiquitinase activity (GO:1903007)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein K63-linked deubiquitination (GO:1903006)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein homooligomerization (GO:0051260)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|retrograde protein transport, ER to cytosol (GO:0030970)|translesion synthesis (GO:0019985)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Hrd1p ubiquitin ligase complex (GO:0000836)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|proteasome complex (GO:0000502)|site of double-strand break (GO:0035861)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|deubiquitinase activator activity (GO:0035800)|lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)|polyubiquitin binding (GO:0031593)|protein domain specific binding (GO:0019904)|protein phosphatase binding (GO:0019903)|ubiquitin-specific protease binding (GO:1990381)			breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			CGCCATGAGTCTGCCAGAACA	0.527																																					.													.	VCP-228	0			c.946-1G>A						.						181.0	158.0	166.0					9																	35062136		2203	4300	6503	SO:0001630	splice_region_variant	7415	exon10			ATGAGTCTGCCAG	AC004472	CCDS6573.1	9p13.3	2014-09-17	2011-01-25		ENSG00000165280	ENSG00000165280		"""ATPases / AAA-type"""	12666	protein-coding gene	gene with protein product		601023	"""valosin-containing protein"""			8595912, 7553851	Standard	NM_007126		Approved	IBMPFD, p97	uc003zvy.2	P55072	OTTHUMG00000019855	ENST00000358901.6:c.946-1G>A	9.37:g.35062136C>T		Somatic	129	0		WXS	Illumina HiSeq		101	1	NM_007126	0	0	3	3	0	B2R5T8|Q0V924|Q2TAI5|Q969G7|Q9UCD5	Splice_Site	SNP	ENST00000358901.6	37	CCDS6573.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.079345	0.76528	.	.	ENSG00000165280	ENST00000358901	.	.	.	6.17	6.17	0.99709	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	VCP	35052136	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	.	.		0.527	VCP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052290.1	NM_007126	Intron
SLC28A3	64078	hgsc.bcm.edu;broad.mit.edu	37	9	86955546	86955546	+	Start_Codon_SNP	SNP	C	C	A			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr9:86955546C>A	ENST00000376238.4	-	1	52	c.3G>T	c.(1-3)atG>atT	p.M1I	SLC28A3_ENST00000537648.1_5'UTR|SLC28A3_ENST00000495823.1_5'UTR	NM_001199633.1|NM_022127.2	NP_001186562.1|NP_071410.1	Q9HAS3	S28A3_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 3	1					pyrimidine nucleoside transport (GO:0015864)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|purine-specific nucleoside:sodium symporter activity (GO:0015390)|pyrimidine- and adenine-specific:sodium symporter activity (GO:0015389)			endometrium(2)|large_intestine(6)|lung(17)|ovary(1)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31					Adenosine(DB00640)|Cladribine(DB00242)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Mercaptopurine(DB01033)|Ribavirin(DB00811)	TCCTCAGCTCCATGCTCTTTT	0.537																																					p.M1I	Ovarian(106;425 1539 34835 42413 43572)	.											.	SLC28A3-94	0			c.G3T						.						133.0	116.0	122.0					9																	86955546		2203	4300	6503	SO:0001582	initiator_codon_variant	64078	exon1			CAGCTCCATGCTC	AF305210	CCDS6670.1	9q21.33	2013-07-17	2013-07-17		ENSG00000197506	ENSG00000197506		"""Solute carriers"""	16484	protein-coding gene	gene with protein product		608269	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 3"""			11032837	Standard	NM_001199633		Approved	CNT3	uc010mpz.3	Q9HAS3	OTTHUMG00000020117	ENST00000376238.4:c.3G>T	9.37:g.86955546C>A	ENSP00000365413:p.Met1Ile	Somatic	135	0		WXS	Illumina HiSeq	Phase_I	94	5	NM_001199633	0	0	0	0	0	A8K9Y4|B1AML0|B2RA51|B4E2S8|F5GYE3	Missense_Mutation	SNP	ENST00000376238.4	37	CCDS6670.1	.	.	.	.	.	.	.	.	.	.	C	11.47	1.647438	0.29246	.	.	ENSG00000197506	ENST00000376238	T	0.01474	4.85	4.29	4.29	0.51040	.	0.797299	0.11261	N	0.582605	T	0.02304	0.0071	.	.	.	0.80722	D	1	B	0.11235	0.004	B	0.06405	0.002	T	0.53683	-0.8404	9	0.56958	D	0.05	-0.1929	12.552	0.56231	0.0:1.0:0.0:0.0	.	1	Q9HAS3	S28A3_HUMAN	I	1	ENSP00000365413:M1I	ENSP00000365413:M1I	M	-	3	0	SLC28A3	86145366	0.994000	0.37717	0.992000	0.48379	0.379000	0.30106	1.598000	0.36740	2.687000	0.91594	0.561000	0.74099	ATG	.		0.537	SLC28A3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052874.1	NM_022127	Missense_Mutation
KIAA0368	23392	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	114178598	114178598	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr9:114178598A>G	ENST00000338205.5	-	17	1937	c.1718T>C	c.(1717-1719)aTg>aCg	p.M573T	KIAA0368_ENST00000259335.4_Missense_Mutation_p.M751T			Q5VYK3	ECM29_HUMAN	KIAA0368	579					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	centrosome (GO:0005813)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|late endosome (GO:0005770)|membrane (GO:0016020)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|proteasome complex (GO:0000502)				NS(2)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(23)|prostate(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	65						GGTCCCGGTCATGTACTTGAC	0.383																																					p.M751T		.											.	KIAA0368-68	0			c.T2252C						.						96.0	93.0	94.0					9																	114178598		1848	4097	5945	SO:0001583	missense	23392	exon19			CCGGTCATGTACT	AK025689	CCDS48006.1	9q32	2012-11-29	2006-11-23	2006-11-23	ENSG00000136813	ENSG00000136813			29020	protein-coding gene	gene with protein product	"""ECM29 homolog (S. cerevisiae)"""					9205841, 15496406, 20682791	Standard	NM_001080398		Approved	FLJ22036, ECM29	uc004bfe.1	Q5VYK3	OTTHUMG00000020489	ENST00000338205.5:c.1718T>C	9.37:g.114178598A>G	ENSP00000339889:p.Met573Thr	Somatic	58	1		WXS	Illumina HiSeq	Phase_I	54	13	NM_001080398	0	0	59	115	56	O15074|Q8WU82	Missense_Mutation	SNP	ENST00000338205.5	37		.	.	.	.	.	.	.	.	.	.	A	3.455	-0.111276	0.06881	.	.	ENSG00000136813	ENST00000338205;ENST00000259335;ENST00000543827	T	0.42513	0.97	5.44	5.44	0.79542	Armadillo-type fold (1);	0.192897	0.56097	D	0.000038	T	0.29389	0.0732	N	0.19112	0.55	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.01281	0.0;0.0	T	0.07290	-1.0780	10	0.20519	T	0.43	-4.3236	15.4926	0.75619	1.0:0.0:0.0:0.0	.	579;48	Q5VYK3;B3KXF2	ECM29_HUMAN;.	T	573;751;48	ENSP00000259335:M751T	ENSP00000259335:M751T	M	-	2	0	KIAA0368	113218419	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.946000	0.70234	2.058000	0.61347	0.528000	0.53228	ATG	.		0.383	KIAA0368-001	NOVEL	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000053637.2	NM_014686	
NOTCH1	4851	hgsc.bcm.edu	37	9	139410162	139410162	+	Missense_Mutation	SNP	G	G	A	rs376055493		TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr9:139410162G>A	ENST00000277541.6	-	11	1751	c.1676C>T	c.(1675-1677)aCg>aTg	p.T559M		NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	559	EGF-like 14; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		GTGCGTCCCCGTGTACCCTGG	0.682			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																											p.T559M		.		Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	.	NOTCH1-5459	0			c.C1676T						.	G	MET/THR	1,4033		0,1,2016	9.0	13.0	12.0		1676	5.1	1.0	9		12	0,8174		0,0,4087	no	missense	NOTCH1	NM_017617.3	81	0,1,6103	AA,AG,GG		0.0,0.0248,0.0082	probably-damaging	559/2556	139410162	1,12207	2017	4087	6104	SO:0001583	missense	4851	exon11			GTCCCCGTGTACC	AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.1676C>T	9.37:g.139410162G>A	ENSP00000277541:p.Thr559Met	Somatic	4	1		WXS	Illumina HiSeq	Phase_I	6	5	NM_017617	0	0	0	0	0	Q59ED8|Q5SXM3	Missense_Mutation	SNP	ENST00000277541.6	37	CCDS43905.1	.	.	.	.	.	.	.	.	.	.	G	19.66	3.868363	0.72065	2.48E-4	0.0	ENSG00000148400	ENST00000277541	D	0.91843	-2.92	5.05	5.05	0.67936	EGF (1);EGF-like region, conserved site (2);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.266386	0.34750	N	0.003702	D	0.95658	0.8588	M	0.77616	2.38	0.58432	D	0.999999	D	0.65815	0.995	D	0.64595	0.927	D	0.96151	0.9108	10	0.72032	D	0.01	.	17.3792	0.87400	0.0:0.0:1.0:0.0	.	559	P46531	NOTC1_HUMAN	M	559	ENSP00000277541:T559M	ENSP00000277541:T559M	T	-	2	0	NOTCH1	138529983	1.000000	0.71417	0.996000	0.52242	0.326000	0.28443	6.414000	0.73318	2.327000	0.79052	0.557000	0.71058	ACG	.		0.682	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055087.1	NM_017617	
AKAP17A	8227	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	1718090	1718090	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chrX:1718090A>T	ENST00000313871.3	+	4	1113	c.917A>T	c.(916-918)cAa>cTa	p.Q306L	AKAP17A_ENST00000381261.3_Missense_Mutation_p.Q306L	NM_005088.2	NP_005079.2	Q02040	AK17A_HUMAN	A kinase (PRKA) anchor protein 17A	306					B cell activation (GO:0042113)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)	nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein kinase A binding (GO:0051018)			breast(2)|endometrium(5)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)	26						CACAGGAAACAAAAGGAGCTG	0.577																																					p.Q306L													.	AKAP17A-40	0			c.A917T						.						62.0	70.0	67.0					X																	1718090		2203	4296	6499	SO:0001583	missense	8227	exon4			GGAAACAAAAGGA	L03426	CCDS14116.1	Xp22.33 and Yp11.32	2010-09-08	2010-09-08	2010-09-08	ENSG00000197976	ENSG00000197976		"""Pseudoautosomal regions / PAR1"", ""A-kinase anchor proteins"""	18783	protein-coding gene	gene with protein product		312095, 465000	"""chromosome X and Y open reading frame 3"", ""splicing factor, arginine/serine-rich 17A"""	CXYorf3, SFRS17A		9736779, 1438229, 19840947	Standard	NR_027383		Approved	XE7, XE7Y, DXYS155E, MGC39904, 721P, CCDC133	uc004cqa.3	Q02040	OTTHUMG00000021063	ENST00000313871.3:c.917A>T	X.37:g.1718090A>T	ENSP00000324827:p.Gln306Leu	Somatic	41	0		WXS	Illumina HiSeq	Phase_I	30	5	NM_005088	0	0	0	1	1	Q02832|Q2TB98|Q5JQ74|Q5JQ76|Q8N6U9	Missense_Mutation	SNP	ENST00000313871.3	37	CCDS14116.1	.	.	.	.	.	.	.	.	.	.	a	3.057	-0.194055	0.06259	.	.	ENSG00000197976	ENST00000313871;ENST00000381261	T;T	0.27890	1.64;3.24	1.58	1.58	0.23477	.	0.086316	0.48767	U	0.000170	T	0.24044	0.0582	.	.	.	0.80722	D	1	B;B	0.22211	0.001;0.066	B;B	0.25987	0.0;0.065	T	0.06844	-1.0804	9	0.51188	T	0.08	.	9.1449	0.36925	1.0:0.0:0.0:0.0	.	306;306	Q02040-3;Q02040	.;AK17A_HUMAN	L	306	ENSP00000324827:Q306L;ENSP00000370660:Q306L	ENSP00000324827:Q306L	Q	+	2	0	AKAP17A	1678090	1.000000	0.71417	0.598000	0.28837	0.160000	0.22226	3.143000	0.50608	0.442000	0.26555	0.084000	0.15446	CAA	.		0.577	AKAP17A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055609.2	NM_005088	
SHROOM4	57477	hgsc.bcm.edu	37	X	50350751	50350751	+	Missense_Mutation	SNP	G	G	C	rs201290098		TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chrX:50350751G>C	ENST00000289292.7	-	6	3674	c.3391C>G	c.(3391-3393)Cag>Gag	p.Q1131E	SHROOM4_ENST00000460112.3_Missense_Mutation_p.Q1015E|SHROOM4_ENST00000376020.2_Missense_Mutation_p.Q1131E			Q9ULL8	SHRM4_HUMAN	shroom family member 4	1131	Gln-rich.			KQQ -> QQQQKQQE (in Ref. 1; BAA86516 and 3; AAI51241). {ECO:0000305}.	actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|brain development (GO:0007420)|cognition (GO:0050890)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	52	Ovarian(276;0.236)					tcctcctcctgttgcttctgc	0.582																																					p.Q1131E		.											.	SHROOM4-131	0			c.C3391G						.						15.0	14.0	15.0					X																	50350751		2199	4294	6493	SO:0001583	missense	57477	exon6			CCTCCTGTTGCTT	AB033028	CCDS35277.1	Xp11.22	2008-02-05			ENSG00000158352	ENSG00000158352			29215	protein-coding gene	gene with protein product		300579				10574462, 16615870	Standard	NR_027121		Approved	KIAA1202	uc004dpe.2	Q9ULL8	OTTHUMG00000021521	ENST00000289292.7:c.3391C>G	X.37:g.50350751G>C	ENSP00000289292:p.Gln1131Glu	Somatic	35	0		WXS	Illumina HiSeq	Phase_I	18	2	NM_020717	0	0	6	6	0	A7E2X9|D6RFW0|Q96LA0	Missense_Mutation	SNP	ENST00000289292.7	37	CCDS35277.1	.	.	.	.	.	.	.	.	.	.	G	0.015	-1.554911	0.00918	.	.	ENSG00000158352	ENST00000289292;ENST00000376020;ENST00000460112	T;T;T	0.06449	3.3;3.3;3.3	4.89	-0.0454	0.13851	.	1.383290	0.04423	N	0.367895	T	0.03827	0.0108	N	0.24115	0.695	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.36456	-0.9747	10	0.02654	T	1	.	4.0399	0.09746	0.093:0.4322:0.3193:0.1556	.	1131	Q9ULL8	SHRM4_HUMAN	E	1131;1131;1015	ENSP00000289292:Q1131E;ENSP00000365188:Q1131E;ENSP00000421450:Q1015E	ENSP00000289292:Q1131E	Q	-	1	0	SHROOM4	50367491	0.000000	0.05858	0.001000	0.08648	0.009000	0.06853	0.374000	0.20501	-0.047000	0.13423	-0.434000	0.05882	CAG	.		0.582	SHROOM4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056564.4	NM_020717	
MICU1	10367	broad.mit.edu	37	10	74322786	74322786	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr10:74322786delA	ENST00000361114.5	-	3	293	c.197delT	c.(196-198)ctafs	p.L66fs	MICU1_ENST00000604025.1_5'UTR|MICU1_ENST00000401998.3_Frame_Shift_Del_p.L66fs|MICU1_ENST00000398761.4_Frame_Shift_Del_p.L66fs	NM_001195518.1|NM_006077.3	NP_001182447.1|NP_006068.2	Q9BPX6	MICU1_HUMAN	mitochondrial calcium uptake 1	66					calcium ion import (GO:0070509)|calcium ion transmembrane import into mitochondrion (GO:0036444)|defense response (GO:0006952)|mitochondrial calcium ion homeostasis (GO:0051560)|mitochondrial calcium ion transport (GO:0006851)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|protein homooligomerization (GO:0051260)	calcium channel complex (GO:0034704)|integral component of mitochondrial membrane (GO:0032592)|intracellular (GO:0005622)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|uniplex complex (GO:1990246)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)										GTCACTTTTTAGGTTGTCTAC	0.398																																					p.L66fs													.	.	0			c.197delT						.						154.0	130.0	137.0					10																	74322786		1861	4104	5965	SO:0001589	frameshift_variant	10367	exon3			CTTTTTAGGTTGT	Y17711	CCDS55714.1, CCDS55715.1	10q22.1	2013-01-10	2011-06-23	2011-06-23	ENSG00000107745	ENSG00000107745		"""EF-hand domain containing"""	1530	protein-coding gene	gene with protein product		605084	"""calcium binding atopy-related autoantigen 1"""	CBARA1		9806765, 20693986	Standard	NM_006077		Approved	CALC, EFHA3, FLJ12684	uc001jtb.2	Q9BPX6	OTTHUMG00000018437	ENST00000361114.5:c.197delT	10.37:g.74322786delA	ENSP00000354415:p.Leu66fs	Somatic	40	0		WXS	Illumina HiSeq	Phase_I	36	7	NM_001195518	0	0	0	0	0	A8MV96|B3KN20|B4DJH9|B4DPI1|B5MBY3|D3YTJ3|O75785|Q9H9N6|Q9UFX0	Frame_Shift_Del	DEL	ENST00000361114.5	37	CCDS55715.1																																																																																			.		0.398	MICU1-002	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048586.1	NM_006077	
AMOTL1	154810	broad.mit.edu	37	11	94602565	94602565	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr11:94602565delC	ENST00000433060.2	+	12	2832	c.2691delC	c.(2689-2691)ggcfs	p.G897fs	AMOTL1_ENST00000317829.8_Frame_Shift_Del_p.G847fs|AMOTL1_ENST00000317837.9_Frame_Shift_Del_p.G484fs	NM_130847.2	NP_570899.1	Q8IY63	AMOL1_HUMAN	angiomotin like 1	897					establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|hippo signaling (GO:0035329)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|tight junction (GO:0005923)	identical protein binding (GO:0042802)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(2)	36		Acute lymphoblastic leukemia(157;2.38e-05)|all_hematologic(158;0.00824)				CCAGCCGCGGCCGGCTGAGCA	0.647																																					p.G897fs													.	AMOTL1-91	0			c.2691delC						.						23.0	29.0	27.0					11																	94602565		2105	4230	6335	SO:0001589	frameshift_variant	154810	exon12			CCGCGGCCGGCTG	AF453742	CCDS44712.1, CCDS73368.1	11q21	2008-07-18				ENSG00000166025			17811	protein-coding gene	gene with protein product	"""junction-enriched and associated protein"""	614657				11733531	Standard	XM_005273798		Approved	JEAP	uc001pfb.3	Q8IY63		ENST00000433060.2:c.2691delC	11.37:g.94602565delC	ENSP00000387739:p.Gly897fs	Somatic	12	0		WXS	Illumina HiSeq	Phase_I	7	3	NM_130847	0	0	0	0	0	Q63HK7|Q8NDN0|Q8TEN8|Q8WXD1|Q96CM5	Frame_Shift_Del	DEL	ENST00000433060.2	37	CCDS44712.1																																																																																			.		0.647	AMOTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396474.3	NM_130847	
DENR	8562	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	123253468	123253468	+	Splice_Site	DEL	G	G	-			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr12:123253468delG	ENST00000280557.6	+	7	738	c.552delG	c.(550-552)gag>ga	p.E184fs	DENR_ENST00000455982.2_Intron|Y_RNA_ENST00000384187.1_RNA	NM_003677.3	NP_003668.2	O43583	DENR_HUMAN	density-regulated protein	184					formation of translation preinitiation complex (GO:0001731)|IRES-dependent translational initiation (GO:0002192)|ribosome disassembly (GO:0032790)		translation initiation factor activity (GO:0003743)			kidney(1)|large_intestine(1)|urinary_tract(1)	3	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.28e-05)|Epithelial(86;6.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.199)		AATGGCCAGAGGTGAGTGCAT	0.363																																					p.E184fs		.											.	.	0			c.552delG						.						70.0	67.0	68.0					12																	123253468		1874	4097	5971	SO:0001630	splice_region_variant	8562	exon7			.	AF038554	CCDS45003.1	12q24.31	1999-06-17			ENSG00000139726	ENSG00000139726			2769	protein-coding gene	gene with protein product		604550				9628587	Standard	NM_003677		Approved	DRP, DRP1, SMAP-3	uc001uda.3	O43583	OTTHUMG00000168844	ENST00000280557.6:c.552+1G>-	12.37:g.123253468delG		Somatic	60	0		WXS	Illumina HiSeq	Phase_I	54	16	NM_003677	0	0	0	0	0	Q9H3U6|Q9UKZ0	Frame_Shift_Del	DEL	ENST00000280557.6	37	CCDS45003.1																																																																																			.		0.363	DENR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401336.1	NM_003677	Frame_Shift_Del
LRP2	4036	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	170034511	170034513	+	In_Frame_Del	DEL	GAT	GAT	-	rs80338752		TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	GAT	GAT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr2:170034511_170034513delGAT	ENST00000263816.3	-	53	10478_10480	c.10193_10195delATC	c.(10192-10197)catcga>cga	p.H3398del	LRP2_ENST00000461418.1_5'UTR	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	3398					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.R3399*(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	ACCGTGTGTCGATGGTGGCCCTC	0.424																																					p.3398_3399del		.											.	LRP2-175	1	Substitution - Nonsense(1)	large_intestine(1)	c.10193_10195del	GRCh37	CM073183	LRP2	M	rs80338752	.																																			SO:0001651	inframe_deletion	4036	exon53			.		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.10193_10195delATC	2.37:g.170034511_170034513delGAT	ENSP00000263816:p.His3398del	Somatic	63	0		WXS	Illumina HiSeq	Phase_I	58	12	NM_004525	0	0	0	0	0	O00711|Q16215	In_Frame_Del	DEL	ENST00000263816.3	37	CCDS2232.1																																																																																			.		0.424	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
ZNF318	24149	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	43333130	43333130	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr6:43333130delT	ENST00000361428.2	-	2	525	c.448delA	c.(448-450)atcfs	p.I150fs	ZNF318_ENST00000318149.3_Frame_Shift_Del_p.I150fs	NM_014345.2	NP_055160.2	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	150					meiotic nuclear division (GO:0007126)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(21)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	61			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			CCAACAGTGATCCTTAAGCTC	0.473																																					p.I150fs		.											.	ZNF318-157	0			c.448delA						.						104.0	99.0	101.0					6																	43333130		2203	4300	6503	SO:0001589	frameshift_variant	24149	exon2			.	AF090114	CCDS4895.2	6p21.1	2013-09-19			ENSG00000171467	ENSG00000171467		"""Zinc fingers, C2H2-type"""	13578	protein-coding gene	gene with protein product						10873617	Standard	NM_014345		Approved	HRIHFB2436, ZFP318	uc003oux.3	Q5VUA4	OTTHUMG00000014732	ENST00000361428.2:c.448delA	6.37:g.43333130delT	ENSP00000354964:p.Ile150fs	Somatic	85	0		WXS	Illumina HiSeq	Phase_I	73	25	NM_014345	0	0	0	0	0	O94796|Q4G0E4|Q8NEM6|Q9UNU8|Q9Y2W9	Frame_Shift_Del	DEL	ENST00000361428.2	37	CCDS4895.2																																																																																			.		0.473	ZNF318-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040601.2	NM_014345	
IFIT5	24138	broad.mit.edu;bcgsc.ca	37	10	91178386	91178387	+	Frame_Shift_Ins	INS	-	-	GCTC			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr10:91178386_91178387insGCTC	ENST00000371795.4	+	2	1643_1644	c.1430_1431insGCTC	c.(1429-1434)gagctcfs	p.-478fs	IFIT5_ENST00000416601.1_Frame_Shift_Ins_p.-430fs	NM_012420.2	NP_036552.1	Q13325	IFIT5_HUMAN	interferon-induced protein with tetratricopeptide repeats 5						defense response to virus (GO:0051607)|innate immune response (GO:0045087)	actin cytoskeleton (GO:0015629)|apical part of cell (GO:0045177)|ruffle membrane (GO:0032587)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)|tRNA binding (GO:0000049)			endometrium(1)|large_intestine(4)|lung(4)	9						GCTCTCTGTGAGCTCCGACTTT	0.371																																					p.E477fs													.	IFIT5-90	0			c.1430_1431insGCTC						.																																			SO:0001589	frameshift_variant	24138	exon2			TCTGTGAGCTCCG	U34605	CCDS7403.1	10q23.31	2013-01-10			ENSG00000152778	ENSG00000152778		"""Tetratricopeptide (TTC) repeat domain containing"""	13328	protein-coding gene	gene with protein product	"""retinoic acid- and interferon-inducible protein (58kD)"""					9398535	Standard	NM_012420		Approved	RI58	uc010qnh.2	Q13325	OTTHUMG00000018713	ENST00000371795.4:c.1431_1434dupGCTC	10.37:g.91178387_91178390dupGCTC	ENSP00000360860:p.Leu478fs	Somatic	119	0		WXS	Illumina HiSeq	Phase_I	106	11	NM_012420	0	0	0	0	0	B2R5X9|B4DDV1|Q5T7I9|Q6IAX3	Frame_Shift_Ins	INS	ENST00000371795.4	37	CCDS7403.1																																																																																			.		0.371	IFIT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049303.1	NM_012420	
EIF4G2	1982	hgsc.bcm.edu;bcgsc.ca	37	11	10823073	10823074	+	Intron	INS	-	-	A	rs140592159	byFrequency	TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr11:10823073_10823074insA	ENST00000526148.1	-	14	1924				RP11-685M7.5_ENST00000532365.1_RNA|EIF4G2_ENST00000339995.5_Intron|EIF4G2_ENST00000396525.2_Intron|SNORD97_ENST00000459187.1_RNA|EIF4G2_ENST00000525681.1_Intron	NM_001172705.1	NP_001166176			eukaryotic translation initiation factor 4 gamma, 2											NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	43				all cancers(16;2.8e-07)|Epithelial(150;4.18e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		GAAAGAAAAAGAAGTATAGAAA	0.371																																					.		.											.	.	0			.						.																																			SO:0001627	intron_variant	692223	.			.	U73824	CCDS31428.1, CCDS41618.1	11p15	2005-09-29			ENSG00000110321	ENSG00000110321			3297	protein-coding gene	gene with protein product		602325				9030685, 9032289	Standard	NM_001042559		Approved	DAP5, NAT1, p97	uc001mjc.3	P78344	OTTHUMG00000165823	ENST00000526148.1:c.1413+133->T	11.37:g.10823075_10823075dupA		Somatic	119	0		WXS	Illumina HiSeq	Phase_I	110	32	.	0	0	0	0	0		RNA	INS	ENST00000526148.1	37	CCDS31428.1																																																																																			.		0.371	EIF4G2-006	KNOWN	alternative_5_UTR|non_ATG_start|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000386603.1	NM_001418	
OR4N5	390437	bcgsc.ca	37	14	20612342	20612343	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr14:20612342_20612343insT	ENST00000333629.1	+	1	448_449	c.448_449insT	c.(448-450)cttfs	p.L150fs	RNA5SP381_ENST00000516076.1_RNA	NM_001004724.1	NP_001004724.1	Q8IXE1	OR4N5_HUMAN	olfactory receptor, family 4, subfamily N, member 5	150						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|lung(23)|ovary(1)|skin(2)|urinary_tract(1)	29	all_cancers(95;0.00108)		Epithelial(56;7.58e-07)|all cancers(55;3.84e-06)	GBM - Glioblastoma multiforme(265;0.0143)		GGTTCTGTGGCTTGGGGGCTTT	0.49																																					p.L150fs													.	OR4N5-69	0			c.448_449insT						.																																			SO:0001589	frameshift_variant	390437	exon1			CTGTGGCTTGGGG		CCDS32031.1	14q11.2	2013-09-23			ENSG00000184394	ENSG00000184394		"""GPCR / Class A : Olfactory receptors"""	15358	protein-coding gene	gene with protein product							Standard	NM_001004724		Approved		uc010tla.2	Q8IXE1	OTTHUMG00000170784	ENST00000333629.1:c.450dupT	14.37:g.20612344_20612344dupT	ENSP00000332110:p.Leu150fs	Somatic	326	28		WXS	Illumina HiSeq	Phase_1	265	29	NM_001004724	0	0	0	0	0	Q6IF11	Frame_Shift_Ins	INS	ENST00000333629.1	37	CCDS32031.1																																																																																			.		0.490	OR4N5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410347.1		
SUCNR1	56670	broad.mit.edu	37	3	151599109	151599110	+	Frame_Shift_Ins	INS	-	-	T	rs368899419		TCGA-BQ-5884-01A-11D-1589-08	TCGA-BQ-5884-11A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4f2fe918-229b-4e08-a866-96bb1c6fc7d9	9f67477d-e1e3-4aa5-9789-db50e9359ddd	g.chr3:151599109_151599110insT	ENST00000362032.5	+	3	883_884	c.778_779insT	c.(778-780)ctgfs	p.L260fs	RP11-454C18.2_ENST00000475855.1_RNA|RP11-454C18.2_ENST00000483843.2_RNA	NM_033050.4	NP_149039.2	Q9BXA5	SUCR1_HUMAN	succinate receptor 1	260						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	14			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)		Succinic acid(DB00139)	CGCTTCACGCCTGGGGAGTTGG	0.49																																					p.L260fs													.	SUCNR1-711	0			c.778_779insT						.																																			SO:0001589	frameshift_variant	56670	exon3			TCACGCCTGGGGA	AF348078	CCDS3162.1	3q25.1	2012-08-21	2004-07-08	2004-07-09	ENSG00000198829	ENSG00000198829		"""GPCR / Class A : Orphans"""	4542	protein-coding gene	gene with protein product		606381	"""G protein-coupled receptor 91"""	GPR91		11273702, 15141213, 17192395	Standard	NM_033050		Approved		uc003ezf.2	Q9BXA5	OTTHUMG00000159880	ENST00000362032.5:c.779dupT	3.37:g.151599110_151599110dupT	ENSP00000355156:p.Leu260fs	Somatic	286	0		WXS	Illumina HiSeq	Phase_I	244	13	NM_033050	0	0	0	0	0	A8K305|Q8TDQ8	Frame_Shift_Ins	INS	ENST00000362032.5	37	CCDS3162.1																																																																																			.		0.490	SUCNR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357897.2	NM_033050	
