#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
JAK1	3716	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	65344759	65344759	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr1:65344759C>T	ENST00000342505.4	-	4	526	c.278G>A	c.(277-279)cGc>cAc	p.R93H		NM_002227.2	NP_002218.2	P23458	JAK1_HUMAN	Janus kinase 1	93	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-2-mediated signaling pathway (GO:0038110)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to antibiotic (GO:0046677)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)			breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(48)|kidney(3)|large_intestine(8)|liver(2)|lung(19)|ovary(1)|prostate(12)|skin(1)|soft_tissue(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	120				BRCA - Breast invasive adenocarcinoma(111;0.0485)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	GGTGATGGTGCGATTTGGAGC	0.507			Mis		ALL																																p.R93H		.		Dom	yes		1	1p32.3-p31.3	3716	Janus kinase 1		L	.	JAK1-3900	0			c.G278A						.						134.0	132.0	133.0					1																	65344759		2051	4200	6251	SO:0001583	missense	3716	exon4			ATGGTGCGATTTG	M64174	CCDS41346.1	1p32.3-p31.3	2009-07-10	2009-04-23		ENSG00000162434	ENSG00000162434	2.7.10.1		6190	protein-coding gene	gene with protein product		147795		JAK1B		1848670, 7698020	Standard	NM_002227		Approved	JAK1A, JTK3	uc001dbu.1	P23458	OTTHUMG00000009310	ENST00000342505.4:c.278G>A	1.37:g.65344759C>T	ENSP00000343204:p.Arg93His	Somatic	53	0		WXS	Illumina HiSeq	Phase_I	45	25	NM_002227	0	0	95	137	42	Q59GQ2|Q9UD26	Missense_Mutation	SNP	ENST00000342505.4	37	CCDS41346.1	.	.	.	.	.	.	.	.	.	.	C	0.013	-1.643910	0.00792	.	.	ENSG00000162434	ENST00000342505	T	0.60797	0.16	5.17	-4.45	0.03546	Band 4.1 domain (1);FERM domain (1);	.	.	.	.	T	0.03564	0.0102	N	0.00044	-2.46	0.20926	N	0.999829	B	0.02656	0.0	B	0.01281	0.0	T	0.48091	-0.9065	9	0.02654	T	1	-0.1135	14.8839	0.70553	0.0:0.2045:0.0:0.7955	.	93	P23458	JAK1_HUMAN	H	93	ENSP00000343204:R93H	ENSP00000343204:R93H	R	-	2	0	JAK1	65117347	0.002000	0.14202	0.069000	0.20011	0.073000	0.16967	-0.194000	0.09559	-0.765000	0.04645	-0.794000	0.03295	CGC	.		0.507	JAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025791.1	NM_002227	
ARHGAP29	9411	bcgsc.ca	37	1	94696978	94696978	+	Missense_Mutation	SNP	C	C	T	rs200189126		TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr1:94696978C>T	ENST00000260526.6	-	2	372	c.190G>A	c.(190-192)Gaa>Aaa	p.E64K	ARHGAP29_ENST00000370217.3_Missense_Mutation_p.E64K	NM_004815.3	NP_004806.3	Q52LW3	RHG29_HUMAN	Rho GTPase activating protein 29	64					positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|Rho GTPase activator activity (GO:0005100)			NS(1)|breast(5)|endometrium(6)|kidney(2)|large_intestine(9)|lung(19)|ovary(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		AATATGGCTTCTTTCAAATAT	0.363																																					p.E64K													.	ARHGAP29-296	0			c.G190A						.						74.0	73.0	74.0					1																	94696978		2203	4300	6503	SO:0001583	missense	9411	exon2			TGGCTTCTTTCAA		CCDS748.1	1p22.1	2011-06-29			ENSG00000137962	ENSG00000137962		"""Rho GTPase activating proteins"""	30207	protein-coding gene	gene with protein product		610496				9305890	Standard	NM_004815		Approved	PARG1	uc001dqj.4	Q52LW3	OTTHUMG00000010643	ENST00000260526.6:c.190G>A	1.37:g.94696978C>T	ENSP00000260526:p.Glu64Lys	Somatic	90	1		WXS	Illumina HiSeq	Phase_1	74	18	NM_004815	0	0	21	21	0	O15463|Q59H86|Q5VYZ0|Q6NVX2|Q8TBI6	Missense_Mutation	SNP	ENST00000260526.6	37	CCDS748.1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.826469	0.90955	.	.	ENSG00000137962	ENST00000260526;ENST00000370217	T;T	0.27720	1.65;1.68	5.83	5.83	0.93111	.	0.000000	0.37219	N	0.002196	T	0.36358	0.0964	L	0.55990	1.75	0.48632	D	0.999685	D;P	0.56035	0.974;0.521	P;B	0.54499	0.754;0.443	T	0.08269	-1.0730	10	0.72032	D	0.01	-21.095	17.0506	0.86517	0.0:1.0:0.0:0.0	.	64;64	Q52LW3-2;Q52LW3	.;RHG29_HUMAN	K	64	ENSP00000260526:E64K;ENSP00000359237:E64K	ENSP00000260526:E64K	E	-	1	0	ARHGAP29	94469566	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.413000	0.59795	2.770000	0.95276	0.655000	0.94253	GAA	.		0.363	ARHGAP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029376.2	NM_004815	
SNX7	51375	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	99150445	99150445	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr1:99150445C>A	ENST00000306121.3	+	2	194	c.185C>A	c.(184-186)gCc>gAc	p.A62D	SNX7_ENST00000529992.1_Missense_Mutation_p.A62D|SNX7_ENST00000370189.5_5'UTR	NM_015976.4	NP_057060.2	Q9UNH6	SNX7_HUMAN	sorting nexin 7	200	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				apoptotic process (GO:0006915)|intracellular protein transport (GO:0006886)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	13		all_epithelial(167;7.64e-07)|all_lung(203;0.0006)|Lung NSC(277;0.00137)		Epithelial(280;0.0521)|all cancers(265;0.0687)|COAD - Colon adenocarcinoma(174;0.15)|Lung(183;0.207)|Colorectal(170;0.234)		TCTTAGGATGCCTCATTGATG	0.303																																					p.A62D													.	SNX7-229	0			c.C185A						.						97.0	88.0	91.0					1																	99150445		2203	4300	6503	SO:0001583	missense	51375	exon2			AGGATGCCTCATT	AF121857	CCDS755.2, CCDS756.1, CCDS756.2	1p21	2008-05-22			ENSG00000162627	ENSG00000162627		"""Sorting nexins"""	14971	protein-coding gene	gene with protein product		614904					Standard	NM_015976		Approved		uc010ouc.2	Q9UNH6	OTTHUMG00000010723	ENST00000306121.3:c.185C>A	1.37:g.99150445C>A	ENSP00000304429:p.Ala62Asp	Somatic	105	0		WXS	Illumina HiSeq	Phase_I	104	37	NM_015976	0	0	0	0	0	A8KAF3|D3DT50|Q53FQ3|Q5VT09|Q5VT10|Q86U82|Q8WVD4|Q96FW9|Q9Y3Z7	Missense_Mutation	SNP	ENST00000306121.3	37	CCDS755.2	.	.	.	.	.	.	.	.	.	.	C	18.44	3.624884	0.66901	.	.	ENSG00000162627	ENST00000529992;ENST00000306121	T;T	0.32753	2.12;1.44	5.29	4.36	0.52297	.	.	.	.	.	T	0.15522	0.0374	N	0.19112	0.55	0.80722	D	1	B;D	0.53462	0.003;0.96	B;P	0.51229	0.003;0.663	T	0.03221	-1.1059	9	0.16896	T	0.51	.	15.2016	0.73142	0.142:0.858:0.0:0.0	.	62;62	E9PNL2;Q9UNH6-3	.;.	D	62	ENSP00000434731:A62D;ENSP00000304429:A62D	ENSP00000304429:A62D	A	+	2	0	SNX7	98923033	1.000000	0.71417	0.998000	0.56505	0.970000	0.65996	3.677000	0.54619	1.212000	0.43366	0.650000	0.86243	GCC	.		0.303	SNX7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029609.2		
ANKRD35	148741	bcgsc.ca	37	1	145560900	145560900	+	Missense_Mutation	SNP	G	G	A	rs202165652		TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr1:145560900G>A	ENST00000355594.4	+	9	844	c.757G>A	c.(757-759)Gtc>Atc	p.V253I	ANKRD35_ENST00000544626.1_3'UTR	NM_144698.3	NP_653299.4	Q8N283	ANR35_HUMAN	ankyrin repeat domain 35	253										NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(16)|ovary(4)|prostate(3)|skin(2)|urinary_tract(1)	47	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TCAGAGGCTAGTCCAGCACCC	0.473																																					p.V253I	Melanoma(9;127 754 22988 51047)												.	ANKRD35-95	0			c.G757A						.						130.0	128.0	129.0					1																	145560900		2203	4300	6503	SO:0001583	missense	148741	exon9			AGGCTAGTCCAGC	AK091120	CCDS72867.1, CCDS72868.1	1q21.1	2013-01-10			ENSG00000198483	ENSG00000198483		"""Ankyrin repeat domain containing"""	26323	protein-coding gene	gene with protein product							Standard	NM_144698		Approved	FLJ25124	uc001eob.1	Q8N283	OTTHUMG00000013743	ENST00000355594.4:c.757G>A	1.37:g.145560900G>A	ENSP00000347802:p.Val253Ile	Somatic	134	0		WXS	Illumina HiSeq	Phase_1	101	21	NM_144698	0	0	0	0	0	A6NEU0|B4DL62|Q3MJ10|Q96LS3	Missense_Mutation	SNP	ENST00000355594.4	37	CCDS919.1	.	.	.	.	.	.	.	.	.	.	G	12.38	1.919305	0.33908	.	.	ENSG00000198483	ENST00000453670;ENST00000355594	T	0.65364	-0.15	5.39	5.39	0.77823	.	0.274245	0.26013	N	0.026876	T	0.37183	0.0994	L	0.34521	1.04	0.80722	D	1	P	0.37955	0.612	B	0.34536	0.185	T	0.32693	-0.9897	10	0.34782	T	0.22	-6.4309	14.5188	0.67838	0.0:0.0:1.0:0.0	.	253	Q8N283	ANR35_HUMAN	I	162;253	ENSP00000347802:V253I	ENSP00000347802:V253I	V	+	1	0	ANKRD35	144272257	0.999000	0.42202	0.923000	0.36655	0.658000	0.38924	4.107000	0.57811	2.808000	0.96608	0.655000	0.94253	GTC	.		0.473	ANKRD35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038515.1	NM_144698	
NTRK1	4914	broad.mit.edu	37	1	156837966	156837966	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr1:156837966C>A	ENST00000524377.1	+	5	540	c.499C>A	c.(499-501)Ctg>Atg	p.L167M	NTRK1_ENST00000392302.2_Missense_Mutation_p.L137M|NTRK1_ENST00000368196.3_Missense_Mutation_p.L167M|NTRK1_ENST00000358660.3_Missense_Mutation_p.L167M	NM_002529.3	NP_002520.2	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1	167	LRRCT.				activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|axon guidance (GO:0007411)|axonogenesis involved in innervation (GO:0060385)|B cell differentiation (GO:0030183)|cellular response to nerve growth factor stimulus (GO:1990090)|cellular response to nicotine (GO:0071316)|circadian rhythm (GO:0007623)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|developmental programmed cell death (GO:0010623)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory nerve development (GO:0021553)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of angiogenesis (GO:0045766)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of programmed cell death (GO:0043068)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|response to activity (GO:0014823)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to ethanol (GO:0045471)|response to hydrostatic pressure (GO:0051599)|response to nutrient levels (GO:0031667)|response to radiation (GO:0009314)|Sertoli cell development (GO:0060009)|small GTPase mediated signal transduction (GO:0007264)|sympathetic nervous system development (GO:0048485)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	axon (GO:0030424)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome (GO:0005769)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|nerve growth factor binding (GO:0048406)|nerve growth factor receptor activity (GO:0010465)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(35)|ovary(8)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	74	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Amitriptyline(DB00321)|Imatinib(DB00619)|Regorafenib(DB08896)	GGAGGAGGGACTGGGCGGAGT	0.657			T	"""TPM3, TPR, TFG"""	papillary thyroid					TSP Lung(10;0.080)																											p.L167M				Dom	yes		1	1q21-q22	4914	"""neurotrophic tyrosine kinase, receptor, type 1"""		E	.	NTRK1-1393	0			c.C499A						.						61.0	63.0	62.0					1																	156837966		2203	4300	6503	SO:0001583	missense	4914	exon5			GAGGGACTGGGCG	Y09028	CCDS1161.1, CCDS30890.1, CCDS30891.1	1q21-q22	2014-09-17			ENSG00000198400	ENSG00000198400	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8031	protein-coding gene	gene with protein product	"""high affinity nerve growth factor receptor"""	191315				2869410	Standard	NM_001007792		Approved	TRK, TRKA, MTC	uc001fqh.1	P04629	OTTHUMG00000041304	ENST00000524377.1:c.499C>A	1.37:g.156837966C>A	ENSP00000431418:p.Leu167Met	Somatic	104	0		WXS	Illumina HiSeq	Phase_I	154	4	NM_001012331	0	0	0	0	0	B2R6T5|B7ZM34|P08119|Q15655|Q15656|Q5D056|Q5VZS2|Q7Z5C3|Q9UIU7	Missense_Mutation	SNP	ENST00000524377.1	37	CCDS1161.1	.	.	.	.	.	.	.	.	.	.	C	16.37	3.105615	0.56291	.	.	ENSG00000198400	ENST00000392302;ENST00000368196;ENST00000524377;ENST00000358660	D;D;D;D	0.90444	-2.67;-2.67;-2.67;-2.67	5.21	3.22	0.36961	Cysteine-rich flanking region, C-terminal (1);	1.036150	0.07713	N	0.942312	T	0.79299	0.4422	L	0.47716	1.5	0.09310	N	1	B;P;P;B	0.35745	0.142;0.518;0.51;0.383	B;B;B;B	0.36030	0.133;0.216;0.143;0.155	T	0.69483	-0.5133	10	0.32370	T	0.25	.	9.2994	0.37835	0.1431:0.7786:0.0:0.0783	.	167;167;167;137	A8K3Z4;P04629-2;P04629;A6NF12	.;.;NTRK1_HUMAN;.	M	137;167;167;167	ENSP00000376120:L137M;ENSP00000357179:L167M;ENSP00000431418:L167M;ENSP00000351486:L167M	ENSP00000351486:L167M	L	+	1	2	NTRK1	155104590	0.058000	0.20735	0.176000	0.23000	0.933000	0.57130	0.782000	0.26788	1.166000	0.42689	0.462000	0.41574	CTG	.		0.657	NTRK1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392279.1	NM_002529	
FCGR2A	2212	bcgsc.ca	37	1	161480669	161480669	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr1:161480669T>G	ENST00000271450.6	+	5	703	c.665T>G	c.(664-666)gTg>gGg	p.V222G	RP11-25K21.6_ENST00000537821.2_RNA|FCGR2A_ENST00000367972.4_Missense_Mutation_p.V221G	NM_001136219.1|NM_021642.3	NP_001129691.1|NP_067674.2	P12318	FCG2A_HUMAN	Fc fragment of IgG, low affinity IIa, receptor (CD32)	222					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(2)|endometrium(2)|large_intestine(2)|lung(11)|ovary(1)	19	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	ATTGTGGCTGTGGTCATTGCG	0.512																																					p.V222G													.	FCGR2A-91	0			c.T665G						.						232.0	230.0	231.0					1																	161480669		2203	4300	6503	SO:0001583	missense	2212	exon5			TGGCTGTGGTCAT	J03619	CCDS30922.1, CCDS44264.1	1q23	2013-01-11	2005-02-02		ENSG00000143226	ENSG00000143226		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3616	protein-coding gene	gene with protein product	"""Immunoglobulin G Fc receptor II"""	146790	"""Fc fragment of IgG, low affinity IIa, receptor for (CD32)"""	FCG2, FCGR2A1, FCGR2		2139735	Standard	NM_021642		Approved	CD32, CD32A, IGFR2, CDw32	uc001gan.3	P12318	OTTHUMG00000034469	ENST00000271450.6:c.665T>G	1.37:g.161480669T>G	ENSP00000271450:p.Val222Gly	Somatic	238	1		WXS	Illumina HiSeq	Phase_1	260	35	NM_001136219	0	0	2	2	0	Q8WUN1|Q8WW64	Missense_Mutation	SNP	ENST00000271450.6	37	CCDS44264.1	.	.	.	.	.	.	.	.	.	.	.	12.98	2.101851	0.37048	.	.	ENSG00000143226	ENST00000367972;ENST00000271450	T;T	0.01998	4.51;4.51	2.27	-0.676	0.11361	.	2.881450	0.01271	N	0.009457	T	0.01695	0.0054	L	0.60455	1.87	0.25785	N	0.984687	D;P	0.54601	0.967;0.955	P;P	0.48454	0.576;0.578	T	0.35176	-0.9799	9	0.87932	D	0	.	5.0419	0.14463	0.0:0.5402:0.0:0.4598	.	222;221	P12318;P12318-2	FCG2A_HUMAN;.	G	221;222	ENSP00000356949:V221G;ENSP00000271450:V222G	ENSP00000271450:V222G	V	+	2	0	FCGR2A	159747293	0.000000	0.05858	0.006000	0.13384	0.027000	0.11550	-0.017000	0.12590	-0.155000	0.11098	0.459000	0.35465	GTG	.		0.512	FCGR2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000083318.3	NM_021642	
PRRC2C	23215	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	171501662	171501662	+	Silent	SNP	A	A	C	rs14798|rs11546357		TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr1:171501662A>C	ENST00000338920.4	+	12	1666	c.1429A>C	c.(1429-1431)Agg>Cgg	p.R477R	PRRC2C_ENST00000476522.1_3'UTR|PRRC2C_ENST00000392078.3_Silent_p.R479R|PRRC2C_ENST00000426496.2_Silent_p.R477R|PRRC2C_ENST00000367742.3_Silent_p.R479R	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	477	Glu-rich.				hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										GGAAGAACAAAGGAAGGCAGC	0.458																																					p.R477R		.											.	.	0			c.A1429C						.						81.0	72.0	75.0					1																	171501662		2203	4298	6501	SO:0001819	synonymous_variant	23215	exon12			GAACAAAGGAAGG	AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.1429A>C	1.37:g.171501662A>C		Somatic	21	1		WXS	Illumina HiSeq	Phase_I	14	14	NM_015172	0	1	8	128	119	Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Silent	SNP	ENST00000338920.4	37	CCDS1296.2																																																																																			A|1.000;T|0.000		0.458	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314826.4	NM_015172	
SLC9C2	284525	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	173505010	173505010	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr1:173505010G>T	ENST00000367714.3	-	15	2156	c.1734C>A	c.(1732-1734)ttC>ttA	p.F578L	SLC9C2_ENST00000466087.1_5'UTR|SLC9C2_ENST00000536496.1_Intron	NM_178527.3	NP_848622.2	Q5TAH2	SL9C2_HUMAN	solute carrier family 9, member C2 (putative)	578					sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)	p.F578L(1)									AATATTCCAAGAAAGTTAAAA	0.259																																					p.F578L		.											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1734A						.						30.0	36.0	34.0					1																	173505010		2143	4195	6338	SO:0001583	missense	284525	exon15			TTCCAAGAAAGTT	AK128104	CCDS1308.1	1q25.1	2013-07-18	2013-07-18	2012-03-22	ENSG00000162753	ENSG00000162753		"""Solute carriers"""	28664	protein-coding gene	gene with protein product			"""solute carrier family 9, isoform 11"", ""solute carrier family 9, member 11"", ""solute carrier family 9, member C2"""	SLC9A11			Standard	NM_178527		Approved	MGC43026	uc001giz.2	Q5TAH2	OTTHUMG00000034800	ENST00000367714.3:c.1734C>A	1.37:g.173505010G>T	ENSP00000356687:p.Phe578Leu	Somatic	77	0		WXS	Illumina HiSeq	Phase_I	113	29	NM_178527	0	0	0	0	0	Q86UF3	Missense_Mutation	SNP	ENST00000367714.3	37	CCDS1308.1	.	.	.	.	.	.	.	.	.	.	G	1.013	-0.687321	0.03328	.	.	ENSG00000162753	ENST00000367714	T	0.04275	3.66	5.81	2.48	0.30137	.	0.605739	0.15672	N	0.250356	T	0.00967	0.0032	L	0.36672	1.1	0.09310	N	1	B	0.22346	0.068	B	0.15484	0.013	T	0.47898	-0.9081	10	0.11485	T	0.65	-5.8685	3.7288	0.08485	0.2435:0.2051:0.5513:0.0	.	578	Q5TAH2	S9A11_HUMAN	L	578	ENSP00000356687:F578L	ENSP00000356687:F578L	F	-	3	2	SLC9A11	171771633	0.739000	0.28196	0.234000	0.24042	0.083000	0.17756	1.040000	0.30278	0.747000	0.32809	0.603000	0.83216	TTC	.		0.259	SLC9C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084205.1	NM_178527	
PRG4	10216	broad.mit.edu	37	1	186276981	186276981	+	Silent	SNP	A	A	G			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr1:186276981A>G	ENST00000445192.2	+	7	2175	c.2130A>G	c.(2128-2130)aaA>aaG	p.K710K	PRG4_ENST00000367483.4_Silent_p.K669K|PRG4_ENST00000367484.3_Intron|PRG4_ENST00000367485.4_Silent_p.K617K|PRG4_ENST00000367486.3_Silent_p.K667K	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	710	59 X 8 AA repeats of K-X-P-X-P-T-T-X.				cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						CTACCCCTAAAGGGACTGCTC	0.582																																					p.K710K													.	PRG4-91	0			c.A2130G						.						162.0	175.0	171.0					1																	186276981		2203	4300	6503	SO:0001819	synonymous_variant	10216	exon7			CCCTAAAGGGACT	U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.2130A>G	1.37:g.186276981A>G		Somatic	166	0		WXS	Illumina HiSeq	Phase_I	230	5	NM_005807	0	0	0	0	0	Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Silent	SNP	ENST00000445192.2	37	CCDS1369.1																																																																																			.		0.582	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086346.1	NM_005807	
PTGS2	5743	hgsc.bcm.edu	37	1	186649374	186649374	+	Missense_Mutation	SNP	T	T	C	rs199946406		TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr1:186649374T>C	ENST00000367468.5	-	1	185	c.49A>G	c.(49-51)Aca>Gca	p.T17A	PTGS2_ENST00000490885.2_5'UTR|RP5-973M2.2_ENST00000608917.1_lincRNA	NM_000963.2	NP_000954.1	P35354	PGH2_HUMAN	prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)	17					anagen (GO:0042640)|angiogenesis (GO:0001525)|arachidonic acid metabolic process (GO:0019369)|bone mineralization (GO:0030282)|brown fat cell differentiation (GO:0050873)|cellular component movement (GO:0006928)|cellular response to ATP (GO:0071318)|cellular response to hypoxia (GO:0071456)|cellular response to mechanical stimulus (GO:0071260)|cellular response to UV (GO:0034644)|cyclooxygenase pathway (GO:0019371)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|inflammatory response (GO:0006954)|learning (GO:0007612)|lipoxygenase pathway (GO:0019372)|maintenance of blood-brain barrier (GO:0035633)|memory (GO:0007613)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of smooth muscle contraction (GO:0045986)|negative regulation of synaptic transmission, dopaminergic (GO:0032227)|ovulation (GO:0030728)|positive regulation of apoptotic process (GO:0043065)|positive regulation of brown fat cell differentiation (GO:0090336)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of fever generation (GO:0031622)|positive regulation of fibroblast growth factor production (GO:0090271)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of platelet-derived growth factor production (GO:0090362)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transforming growth factor beta production (GO:0071636)|positive regulation of vasoconstriction (GO:0045907)|positive regulation vascular endothelial growth factor production (GO:0010575)|prostaglandin biosynthetic process (GO:0001516)|prostaglandin metabolic process (GO:0006693)|regulation of blood pressure (GO:0008217)|regulation of inflammatory response (GO:0050727)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to fatty acid (GO:0070542)|response to fructose (GO:0009750)|response to glucocorticoid (GO:0051384)|response to lipopolysaccharide (GO:0032496)|response to lithium ion (GO:0010226)|response to manganese ion (GO:0010042)|response to oxidative stress (GO:0006979)|response to tumor necrosis factor (GO:0034612)|response to vitamin D (GO:0033280)|sensory perception of pain (GO:0019233)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|neuron projection (GO:0043005)|nucleus (GO:0005634)|protein complex (GO:0043234)	arachidonate 15-lipoxygenase activity (GO:0050473)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)|prostaglandin-endoperoxide synthase activity (GO:0004666)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	27					Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Aldesleukin(DB00041)|Aminosalicylic Acid(DB00233)|Antipyrine(DB01435)|Antrafenine(DB01419)|Balsalazide(DB01014)|Bromfenac(DB00963)|Bumetanide(DB00887)|Carprofen(DB00821)|Celecoxib(DB00482)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Clodronate(DB00720)|Dapsone(DB00250)|Desmopressin(DB00035)|Diclofenac(DB00586)|Diflunisal(DB00861)|Dihomo-gamma-linolenic acid(DB00154)|Drospirenone(DB01395)|Etanercept(DB00005)|Etodolac(DB00749)|Etoposide(DB00773)|Etoricoxib(DB01628)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|Ginseng(DB01404)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lenalidomide(DB00480)|Lornoxicam(DB06725)|Lumiracoxib(DB01283)|Magnesium salicylate(DB01397)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Mesalazine(DB00244)|Nabumetone(DB00461)|Naproxen(DB00788)|Nepafenac(DB06802)|Niflumic Acid(DB04552)|Nonoxynol-9(DB06804)|Oxaprozin(DB00991)|Phenylbutazone(DB00812)|Piroxicam(DB00554)|Pomalidomide(DB08910)|Risedronate(DB00884)|Salicylate-sodium(DB01398)|Salicylic acid(DB00936)|Salsalate(DB01399)|Sulfasalazine(DB00795)|Sulindac(DB00605)|Suprofen(DB00870)|Tafluprost(DB08819)|Tenoxicam(DB00469)|Tetrahydrobiopterin(DB00360)|Thalidomide(DB01041)|Tiaprofenic acid(DB01600)|Tolmetin(DB00500)|Triamcinolone(DB00620)|Trisalicylate-choline(DB01401)	TACTCACCTGTATGGCTGAGC	0.706											OREG0014057	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T17A		.											.	PTGS2-227	0			c.A49G						.						5.0	8.0	7.0					1																	186649374		1841	3707	5548	SO:0001583	missense	5743	exon1			CACCTGTATGGCT	D28235	CCDS1371.1	1q25.2-q25.3	2008-02-05			ENSG00000073756	ENSG00000073756	1.14.99.1		9605	protein-coding gene	gene with protein product		600262				1380156	Standard	NM_000963		Approved	COX2	uc001gsb.3	P35354	OTTHUMG00000035473	ENST00000367468.5:c.49A>G	1.37:g.186649374T>C	ENSP00000356438:p.Thr17Ala	Somatic	6	1	2009	WXS	Illumina HiSeq	Phase_I	6	6	NM_000963	0	0	0	0	0	A8K802|Q16876	Missense_Mutation	SNP	ENST00000367468.5	37	CCDS1371.1	.	.	.	.	.	.	.	.	.	.	T	0.215	-1.033430	0.02029	.	.	ENSG00000073756	ENST00000367468	T	0.62232	0.04	4.37	3.46	0.39613	Epidermal growth factor-like, type 3 (1);	0.546358	0.18770	N	0.131621	T	0.29190	0.0726	N	0.02286	-0.61	0.20703	N	0.999861	B	0.02656	0.0	B	0.04013	0.001	T	0.22591	-1.0212	10	0.02654	T	1	.	9.1985	0.37242	0.0:0.8948:0.0:0.1052	.	17	P35354	PGH2_HUMAN	A	17	ENSP00000356438:T17A	ENSP00000356438:T17A	T	-	1	0	PTGS2	184915997	0.849000	0.29639	0.819000	0.32651	0.031000	0.12232	1.317000	0.33631	1.137000	0.42214	-0.220000	0.12472	ACA	.		0.706	PTGS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086157.2	NM_000963	
AKT3	10000	hgsc.bcm.edu	37	1	243668589	243668589	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr1:243668589A>G	ENST00000366539.1	-	14	1602	c.1402T>C	c.(1402-1404)Ttc>Ctc	p.F468L	AKT3_ENST00000263826.5_Missense_Mutation_p.F468L|AKT3_ENST00000336199.5_Intron|AKT3_ENST00000366540.1_Intron			Q9Y243	AKT3_HUMAN	v-akt murine thymoma viral oncogene homolog 3	468	AGC-kinase C-terminal.				mitochondrial genome maintenance (GO:0000002)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|skin(3)|stomach(1)	26	all_cancers(71;0.000307)|all_epithelial(71;0.000374)|all_lung(81;0.0323)|Ovarian(71;0.0619)|all_neural(11;0.101)|Lung NSC(105;0.168)	all_cancers(173;0.0274)	all cancers(7;4.3e-08)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00196)			AATTGAGGGAAATGCGGCCGC	0.393																																					p.F468L		.											.	AKT3-1423	0			c.T1402C						.						108.0	105.0	106.0					1																	243668589		2203	4300	6503	SO:0001583	missense	10000	exon13			GAGGGAAATGCGG	AF124141	CCDS31076.1, CCDS31077.1	1q44	2013-07-09	2013-07-09		ENSG00000117020	ENSG00000117020	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	393	protein-coding gene	gene with protein product	"""protein kinase B, gamma"""	611223				10092583, 10208883	Standard	NM_005465		Approved	PKBG, RAC-gamma, PRKBG	uc001iab.2	Q9Y243	OTTHUMG00000039994	ENST00000366539.1:c.1402T>C	1.37:g.243668589A>G	ENSP00000355497:p.Phe468Leu	Somatic	95	0		WXS	Illumina HiSeq	Phase_I	57	3	NM_005465	0	0	35	35	0	Q0VAA6|Q5VTI1|Q5VTI2|Q96QV3|Q9UFP5	Missense_Mutation	SNP	ENST00000366539.1	37	CCDS31077.1	.	.	.	.	.	.	.	.	.	.	A	25.8	4.676997	0.88445	.	.	ENSG00000117020	ENST00000366539;ENST00000263826	D;D	0.91464	-2.85;-2.85	5.4	5.4	0.78164	Protein kinase, C-terminal (1);AGC-kinase, C-terminal (2);Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	D	0.95893	0.8663	M	0.88450	2.955	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.96629	0.9465	10	0.87932	D	0	.	15.5974	0.76595	1.0:0.0:0.0:0.0	.	468	Q9Y243	AKT3_HUMAN	L	468	ENSP00000355497:F468L;ENSP00000263826:F468L	ENSP00000263826:F468L	F	-	1	0	AKT3	241735212	1.000000	0.71417	0.994000	0.49952	0.906000	0.53458	9.139000	0.94554	2.271000	0.75665	0.533000	0.62120	TTC	.		0.393	AKT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096479.1	NM_181690	
OR13G1	441933	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	247835611	247835611	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr1:247835611C>G	ENST00000359688.2	-	1	754	c.733G>C	c.(733-735)Gtg>Ctg	p.V245L	RP11-634B7.4_ENST00000449298.1_RNA	NM_001005487.1	NP_001005487.1	Q8NGZ3	O13G1_HUMAN	olfactory receptor, family 13, subfamily G, member 1	245						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|kidney(1)|large_intestine(2)|lung(28)|skin(2)	35	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			TAAAGGGTCACCACTGTGAGA	0.448																																					p.V245L		.											.	OR13G1-69	0			c.G733C						.						162.0	139.0	147.0					1																	247835611		2203	4300	6503	SO:0001583	missense	441933	exon1			GGGTCACCACTGT	AB065623	CCDS31094.1	1q44	2012-08-09			ENSG00000197437	ENSG00000197437		"""GPCR / Class A : Olfactory receptors"""	14999	protein-coding gene	gene with protein product		611677					Standard	NM_001005487		Approved		uc001idi.1	Q8NGZ3	OTTHUMG00000040212	ENST00000359688.2:c.733G>C	1.37:g.247835611C>G	ENSP00000352717:p.Val245Leu	Somatic	122	0		WXS	Illumina HiSeq	Phase_I	122	32	NM_001005487	0	0	0	0	0	B2RN80|Q5T2T2|Q6IF86	Missense_Mutation	SNP	ENST00000359688.2	37	CCDS31094.1	.	.	.	.	.	.	.	.	.	.	C	10.52	1.373546	0.24857	.	.	ENSG00000197437	ENST00000359688	T	0.00355	7.91	4.2	3.29	0.37713	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39615	N	0.001320	T	0.00815	0.0027	M	0.86740	2.835	0.09310	N	1	D	0.76494	0.999	D	0.77557	0.99	T	0.26258	-1.0108	10	0.66056	D	0.02	-60.5376	10.2821	0.43545	0.0:0.9016:0.0:0.0984	.	245	Q8NGZ3	O13G1_HUMAN	L	245	ENSP00000352717:V245L	ENSP00000352717:V245L	V	-	1	0	OR13G1	245902234	0.021000	0.18746	0.037000	0.18230	0.096000	0.18686	0.139000	0.16036	1.126000	0.42016	-0.214000	0.12660	GTG	.		0.448	OR13G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096869.1	NM_001005487	
PIP4K2A	5305	bcgsc.ca	37	10	22856802	22856802	+	Missense_Mutation	SNP	C	C	T	rs201266267		TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr10:22856802C>T	ENST00000376573.4	-	6	884	c.656G>A	c.(655-657)aGa>aAa	p.R219K	PIP4K2A_ENST00000422321.1_5'UTR|PIP4K2A_ENST00000323883.7_Missense_Mutation_p.R79K|PIP4K2A_ENST00000545335.1_Missense_Mutation_p.R160K	NM_005028.4	NP_005019.2	P48426	PI42A_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type II, alpha	219	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				megakaryocyte development (GO:0035855)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|1-phosphatidylinositol-5-phosphate 4-kinase activity (GO:0016309)|ATP binding (GO:0005524)			endometrium(4)|kidney(13)|large_intestine(4)|lung(6)|ovary(1)|skin(1)	29						ACTAGCTTCTCTAGCCACTGT	0.453																																					p.R219K													.	PIP4K2A-665	0			c.G656A						.						140.0	123.0	129.0					10																	22856802		2203	4300	6503	SO:0001583	missense	5305	exon6			GCTTCTCTAGCCA	S78798	CCDS7141.1	10p12.2	2007-08-21	2007-08-14	2007-08-14	ENSG00000150867	ENSG00000150867			8997	protein-coding gene	gene with protein product		603140	"""phosphatidylinositol-4-phosphate 5-kinase, type II, alpha"""	PIP5K2A		7852364, 9367159	Standard	NM_005028		Approved	PIP5KIIA, PIP5KIIalpha	uc001irl.4	P48426	OTTHUMG00000017810	ENST00000376573.4:c.656G>A	10.37:g.22856802C>T	ENSP00000365757:p.Arg219Lys	Somatic	177	1		WXS	Illumina HiSeq	Phase_1	115	20	NM_005028	0	0	36	36	0	B0YJ66|B4DGX2|D3DRV1|P53807|Q5VUX3	Missense_Mutation	SNP	ENST00000376573.4	37	CCDS7141.1	.	.	.	.	.	.	.	.	.	.	C	35	5.513277	0.96402	.	.	ENSG00000150867	ENST00000376573;ENST00000323883;ENST00000545335;ENST00000422321;ENST00000376565	T;T;T	0.69306	-0.39;-0.39;-0.39	5.36	5.36	0.76844	Phosphatidylinositol-4-phosphate 5-kinase, core (2);Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (1);	0.000000	0.85682	D	0.000000	D	0.88130	0.6354	H	0.96301	3.8	0.80722	D	1	D;D	0.71674	0.998;0.995	D;D	0.80764	0.994;0.971	D	0.91774	0.5430	10	0.87932	D	0	-22.5481	19.0839	0.93194	0.0:1.0:0.0:0.0	.	79;219	B4DH09;P48426	.;PI42A_HUMAN	K	219;79;160;171;178	ENSP00000365757:R219K;ENSP00000326294:R79K;ENSP00000442098:R160K	ENSP00000326294:R79K	R	-	2	0	PIP4K2A	22896808	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.252000	0.78309	2.530000	0.85305	0.650000	0.86243	AGA	.		0.453	PIP4K2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047193.1	NM_005028	
SVIL	6840	bcgsc.ca	37	10	29813511	29813511	+	Missense_Mutation	SNP	A	A	G	rs201719880		TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr10:29813511A>G	ENST00000355867.4	-	14	3228	c.2476T>C	c.(2476-2478)Tcc>Ccc	p.S826P	SVIL_ENST00000375398.2_Missense_Mutation_p.S826P|SVIL_ENST00000375400.3_Missense_Mutation_p.S400P|SVIL_ENST00000535393.1_5'Flank	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin	826					cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				ACTGGCTGGGACAATTTGTTA	0.488																																					p.S826P													.	SVIL-96	0			c.T2476C						.						157.0	146.0	149.0					10																	29813511		2203	4300	6503	SO:0001583	missense	6840	exon14			GCTGGGACAATTT	AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.2476T>C	10.37:g.29813511A>G	ENSP00000348128:p.Ser826Pro	Somatic	157	8		WXS	Illumina HiSeq	Phase_1	138	32	NM_021738	0	0	30	30	0	D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	Missense_Mutation	SNP	ENST00000355867.4	37	CCDS7164.1	.	.	.	.	.	.	.	.	.	.	A	22.3	4.266428	0.80358	.	.	ENSG00000197321	ENST00000375400;ENST00000375398;ENST00000355867	T;T;T	0.48522	0.81;0.81;0.81	5.82	1.87	0.25490	.	0.199679	0.53938	D	0.000048	T	0.59555	0.2202	M	0.71581	2.175	0.80722	D	1	D;D	0.67145	0.996;0.987	D;P	0.63703	0.917;0.719	T	0.57046	-0.7878	9	.	.	.	-16.6333	8.422	0.32707	0.6211:0.2563:0.0:0.1226	.	400;826	O95425-2;O95425	.;SVIL_HUMAN	P	400;826;826	ENSP00000364549:S400P;ENSP00000364547:S826P;ENSP00000348128:S826P	.	S	-	1	0	SVIL	29853517	0.999000	0.42202	0.982000	0.44146	0.936000	0.57629	1.744000	0.38268	0.418000	0.25898	0.459000	0.35465	TCC	.		0.488	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047395.1		
OR13A1	79290	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	45799786	45799786	+	Missense_Mutation	SNP	C	C	T	rs200530280		TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr10:45799786C>T	ENST00000553795.1	-	4	393	c.85G>A	c.(85-87)Gag>Aag	p.E29K	OR13A1_ENST00000536058.1_Missense_Mutation_p.E29K|OR13A1_ENST00000374401.2_Missense_Mutation_p.E29K	NM_001004297.2	NP_001004297.2	Q8NGR1	O13A1_HUMAN	olfactory receptor, family 13, subfamily A, member 1	29						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E29K(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|skin(2)|urinary_tract(1)	19						AGGATGAACTCGGTTACCAAC	0.517																																					p.E29K		.											.	OR13A1-68	1	Substitution - Missense(1)	skin(1)	c.G85A						.						70.0	81.0	77.0					10																	45799786		2203	4300	6503	SO:0001583	missense	79290	exon4			TGAACTCGGTTAC	AB065728	CCDS31188.1	10q11.21	2012-10-03			ENSG00000256574	ENSG00000256574		"""GPCR / Class A : Olfactory receptors"""	14772	protein-coding gene	gene with protein product							Standard	NM_001004297		Approved		uc001jcc.1	Q8NGR1	OTTHUMG00000018080	ENST00000553795.1:c.85G>A	10.37:g.45799786C>T	ENSP00000451950:p.Glu29Lys	Somatic	95	0		WXS	Illumina HiSeq	Phase_I	84	38	NM_001004297	0	0	0	0	0	Q2M3M4|Q5VV57|Q6IFH5|Q6ZMN6	Missense_Mutation	SNP	ENST00000553795.1	37	CCDS31188.1	.	.	.	.	.	.	.	.	.	.	c	10.75	1.438543	0.25900	.	.	ENSG00000256574	ENST00000553795;ENST00000536058;ENST00000374401	T;T;T	0.01119	5.31;5.31;5.31	5.09	3.18	0.36537	.	0.350510	0.20650	N	0.088225	T	0.02380	0.0073	M	0.80028	2.48	0.29732	N	0.837839	B	0.25743	0.133	B	0.27715	0.082	T	0.04678	-1.0934	10	0.72032	D	0.01	-21.4609	8.6395	0.33968	0.0:0.7602:0.1539:0.0858	.	29	Q8NGR1	O13A1_HUMAN	K	29	ENSP00000451950:E29K;ENSP00000438657:E29K;ENSP00000363522:E29K	ENSP00000311379:E29K	E	-	1	0	OR13A1	45119792	0.008000	0.16893	0.368000	0.25939	0.065000	0.16274	0.141000	0.16076	0.625000	0.30304	0.603000	0.83216	GAG	C|0.999;A|0.001		0.517	OR13A1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047779.2	NM_001004297	
AGAP10	728127	broad.mit.edu	37	10	47207813	47207813	+	Splice_Site	SNP	T	T	C	rs202014361	byFrequency	TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr10:47207813T>C	ENST00000452145.2	-	4	506	c.395A>G	c.(394-396)cAt>cGt	p.H132R	AGAP10_ENST00000413193.2_Splice_Site_p.H228R|RP11-144G6.12_ENST00000605970.1_RNA|AGAP10_ENST00000355232.3_Splice_Site_p.H157R			Q5T2P9	AGA10_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 10	132					regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.H228R(20)		endometrium(5)|kidney(3)|lung(1)|prostate(2)|urinary_tract(1)	12						TTTACTTACATGGTTTGTACA	0.294																																					p.H132R													.	.	20	Substitution - Missense(20)	endometrium(10)|prostate(4)|kidney(4)|urinary_tract(2)	c.A395G						.																																			SO:0001630	splice_region_variant	642517	exon4			CTTACATGGTTTG	BC075841		10q11.22	2013-01-11	2008-09-22	2008-09-22	ENSG00000204172	ENSG00000204172		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	23462	protein-coding gene	gene with protein product			"""centaurin, gamma-like family, member 7"""	CTGLF7			Standard	XM_006709937		Approved	bA144G6.2		Q5T2P9	OTTHUMG00000018115	ENST00000452145.2:c.396+1A>G	10.37:g.47207813T>C		Somatic	40	0		WXS	Illumina HiSeq	Phase_I	80	3	NM_001190810	0	0	0	0	0		Missense_Mutation	SNP	ENST00000452145.2	37		.	.	.	.	.	.	.	.	.	.	t	0.012	-1.675265	0.00751	.	.	ENSG00000204172	ENST00000452145;ENST00000413193;ENST00000355232	D;T;D	0.87966	-2.32;2.68;-2.32	1.4	1.4	0.22301	.	0.264128	0.34555	N	0.003879	T	0.72486	0.3466	.	.	.	0.20764	N	0.999856	B	0.22003	0.063	B	0.19666	0.026	T	0.55471	-0.8136	9	0.16896	T	0.51	.	6.9024	0.24291	0.0:0.0:0.0:1.0	.	132	Q5T2P9	AGA10_HUMAN	R	132;228;157	ENSP00000392206:H132R;ENSP00000407436:H228R;ENSP00000347372:H157R	ENSP00000347372:H157R	H	-	2	0	AGAP10	46627819	1.000000	0.71417	1.000000	0.80357	0.105000	0.19272	3.704000	0.54815	0.898000	0.36418	0.163000	0.16589	CAT	T|1.000;|0.000		0.294	AGAP10-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000047845.2	XM_001714786.2	Missense_Mutation
ADAMTS14	140766	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	72517740	72517740	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr10:72517740G>T	ENST00000373207.1	+	20	2960	c.2960G>T	c.(2959-2961)gGc>gTc	p.G987V	ADAMTS14_ENST00000373208.1_Missense_Mutation_p.G990V	NM_080722.3	NP_542453.2	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 14	987	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(15)|ovary(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50						TGTGGAGAGGGCATCCAGCAG	0.652																																					p.G990V		.											.	ADAMTS14-232	0			c.G2969T						.						55.0	56.0	56.0					10																	72517740		2201	4298	6499	SO:0001583	missense	140766	exon20			GAGAGGGCATCCA	AF358666	CCDS7306.1, CCDS7307.1	10q21	2008-08-01	2005-08-19		ENSG00000138316	ENSG00000138316		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14899	protein-coding gene	gene with protein product		607506	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 14"""			11779638	Standard	NM_139155		Approved		uc001jrg.3	Q8WXS8	OTTHUMG00000018414	ENST00000373207.1:c.2960G>T	10.37:g.72517740G>T	ENSP00000362303:p.Gly987Val	Somatic	122	1		WXS	Illumina HiSeq	Phase_I	138	46	NM_139155	0	0	0	0	0	Q5T4G0|Q5T4G1|Q8TE55|Q8TEY8	Missense_Mutation	SNP	ENST00000373207.1	37	CCDS7306.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.964690	0.74131	.	.	ENSG00000138316	ENST00000373208;ENST00000373207	D;D	0.83755	-1.76;-1.76	4.34	4.34	0.51931	.	0.000000	0.85682	D	0.000000	D	0.95623	0.8577	H	0.99842	4.835	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98126	1.0428	10	0.87932	D	0	.	16.6601	0.85238	0.0:0.0:1.0:0.0	.	987;990	Q8WXS8;Q5T4G1	ATS14_HUMAN;.	V	990;987	ENSP00000362304:G990V;ENSP00000362303:G987V	ENSP00000362303:G987V	G	+	2	0	ADAMTS14	72187746	1.000000	0.71417	0.979000	0.43373	0.585000	0.36419	7.829000	0.86735	2.250000	0.74265	0.561000	0.74099	GGC	.		0.652	ADAMTS14-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000048522.1	NM_080722	
MUC2	4583	hgsc.bcm.edu	37	11	1092966	1092966	+	Silent	SNP	C	C	A			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr11:1092966C>A	ENST00000441003.2	+	30	4812	c.4785C>A	c.(4783-4785)acC>acA	p.T1595T	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_Intron|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	tgaccccaaccccaacaccca	0.637																																					p.T1595T		.											.	MUC2-90	0			c.C4785A						.						48.0	83.0	71.0					11																	1092966		1785	3239	5024	SO:0001819	synonymous_variant	4583	exon30			CCCAACCCCAACA	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4785C>A	11.37:g.1092966C>A		Somatic	2	0		WXS	Illumina HiSeq	Phase_I	30	5	NM_002457	0	0	0	0	0	Q14878	Silent	SNP	ENST00000441003.2	37																																																																																				.		0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
KRTAP5-2	440021	broad.mit.edu	37	11	1619504	1619504	+	5'UTR	SNP	G	G	T			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr11:1619504G>T	ENST00000412090.1	-	0	20				KRTAP5-AS1_ENST00000534077.1_RNA|KRTAP5-AS1_ENST00000524947.1_RNA|KRTAP5-AS1_ENST00000424148.1_RNA|KRTAP5-AS1_ENST00000532922.1_RNA	NM_001004325.1	NP_001004325.1	Q701N4	KRA52_HUMAN	keratin associated protein 5-2							keratin filament (GO:0045095)				large_intestine(1)|lung(2)|skin(1)	4		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		TGAGGGTGGAGCAGGTAGAGG	0.622																																					.													.	.	0			.						.						77.0	88.0	84.0					11																	1619504		2197	4293	6490	SO:0001623	5_prime_UTR_variant	0	.			GGTGGAGCAGGTA	AB126071	CCDS31331.1	11p15.5	2008-02-05				ENSG00000205867		"""Keratin associated proteins"""	23597	protein-coding gene	gene with protein product						15144888	Standard	NM_001004325		Approved	KRTAP5.2, KRTAP5-8	uc001ltv.3	Q701N4		ENST00000412090.1:c.-24C>A	11.37:g.1619504G>T		Somatic	218	1		WXS	Illumina HiSeq	Phase_I	232	5	.	0	0	1	1	0	A9JTZ1	RNA	SNP	ENST00000412090.1	37	CCDS31331.1																																																																																			.		0.622	KRTAP5-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384775.1	NM_001004325	
OR52N4	390072	bcgsc.ca	37	11	5776805	5776805	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr11:5776805G>T	ENST00000317254.3	+	1	883	c.835G>T	c.(835-837)Gta>Tta	p.V279L	TRIM5_ENST00000380027.1_Intron	NM_001005175.2	NP_001005175.3	Q8NGI2	O52N4_HUMAN	olfactory receptor, family 52, subfamily N, member 4 (gene/pseudogene)	279						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;1.87e-10)|LUSC - Lung squamous cell carcinoma(625;0.114)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.197)		CCACATCATTGTAGCCAATAT	0.448																																					p.V279L													.	OR52N4-2	0			c.G835T						.						144.0	137.0	139.0					11																	5776805		1919	4152	6071	SO:0001583	missense	390072	exon1			ATCATTGTAGCCA	AB065813	CCDS44528.1	11p15.4	2013-10-10	2013-10-10		ENSG00000181074	ENSG00000181074		"""GPCR / Class A : Olfactory receptors"""	15230	protein-coding gene	gene with protein product			"""olfactory receptor, family 52, subfamily N, member 4"""				Standard	NM_001005175		Approved		uc001mbu.3	Q8NGI2	OTTHUMG00000066887	ENST00000317254.3:c.835G>T	11.37:g.5776805G>T	ENSP00000323224:p.Val279Leu	Somatic	186	0		WXS	Illumina HiSeq	Phase_1	144	16	NM_001005175	0	0	0	0	0	B2RNP8|Q6IF77	Missense_Mutation	SNP	ENST00000317254.3	37	CCDS44528.1	.	.	.	.	.	.	.	.	.	.	G	0.992	-0.693650	0.03303	.	.	ENSG00000181074	ENST00000317254	T	0.37235	1.21	5.65	1.4	0.22301	GPCR, rhodopsin-like superfamily (1);	0.454632	0.16039	N	0.232498	T	0.15262	0.0368	N	0.11131	0.1	0.22926	N	0.998553	B	0.11235	0.004	B	0.27170	0.077	T	0.36138	-0.9760	10	0.02654	T	1	.	5.6937	0.17843	0.2359:0.3658:0.3983:0.0	.	279	Q8NGI2	O52N4_HUMAN	L	279	ENSP00000323224:V279L	ENSP00000323224:V279L	V	+	1	0	OR52N4	5733381	0.000000	0.05858	0.998000	0.56505	0.862000	0.49288	-1.801000	0.01743	0.321000	0.23259	-0.147000	0.13772	GTA	.		0.448	OR52N4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143350.1	NM_001005175	
PPFIBP2	8495	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	7618800	7618800	+	Missense_Mutation	SNP	C	C	G	rs17851928		TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr11:7618800C>G	ENST00000299492.4	+	5	770	c.382C>G	c.(382-384)Ctc>Gtc	p.L128V	PPFIBP2_ENST00000533792.1_5'UTR|PPFIBP2_ENST00000528883.1_Missense_Mutation_p.L16V	NM_003621.3	NP_003612	Q8ND30	LIPB2_HUMAN	PTPRF interacting protein, binding protein 2 (liprin beta 2)	128				L -> I (in Ref. 2; AAH21714). {ECO:0000305}.	cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|intracellular (GO:0005622)|presynaptic active zone (GO:0048786)	DNA binding (GO:0003677)|integrase activity (GO:0008907)			breast(8)|cervix(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32				Epithelial(150;2.01e-07)|BRCA - Breast invasive adenocarcinoma(625;0.236)		GGTGAGTGTCCTCACAGACCA	0.512																																					p.L128V		.											.	PPFIBP2-273	0			c.C382G						.						63.0	58.0	60.0					11																	7618800		2201	4296	6497	SO:0001583	missense	8495	exon5			AGTGTCCTCACAG	AF034803	CCDS31419.1, CCDS58116.1, CCDS58117.1	11p15.4	2013-01-10			ENSG00000166387	ENSG00000166387		"""Sterile alpha motif (SAM) domain containing"""	9250	protein-coding gene	gene with protein product		603142				9624153	Standard	NM_003621		Approved	Cclp1	uc001mfj.5	Q8ND30	OTTHUMG00000165617	ENST00000299492.4:c.382C>G	11.37:g.7618800C>G	ENSP00000299492:p.Leu128Val	Somatic	33	0		WXS	Illumina HiSeq	Phase_I	19	9	NM_003621	0	0	0	0	0	B7Z433|E9PK77|O75337|Q8WW26	Missense_Mutation	SNP	ENST00000299492.4	37	CCDS31419.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.718828	0.89205	.	.	ENSG00000166387	ENST00000299492;ENST00000527790;ENST00000541115;ENST00000528883	T;T;T	0.49720	2.55;2.55;0.77	5.5	5.5	0.81552	.	0.000000	0.53938	D	0.000044	T	0.70202	0.3197	M	0.78344	2.41	0.80722	D	1	D;D;D;D	0.89917	1.0;0.996;1.0;1.0	D;D;D;D	0.91635	0.999;0.929;0.999;0.997	T	0.72626	-0.4236	10	0.59425	D	0.04	-6.6607	16.8778	0.86056	0.0:1.0:0.0:0.0	.	16;16;51;128	E9PK77;B7Z433;F5GWB0;Q8ND30	.;.;.;LIPB2_HUMAN	V	128;128;51;16	ENSP00000299492:L128V;ENSP00000434981:L128V;ENSP00000435469:L16V	ENSP00000299492:L128V	L	+	1	0	PPFIBP2	7575376	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.639000	0.61361	2.600000	0.87896	0.655000	0.94253	CTC	.		0.512	PPFIBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385345.2	NM_003621	
TTC17	55761	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	43380551	43380551	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr11:43380551G>A	ENST00000039989.4	+	1	61	c.47G>A	c.(46-48)tGc>tAc	p.C16Y	RP11-484D2.2_ENST00000526220.1_RNA|TTC17_ENST00000299240.6_Missense_Mutation_p.C16Y	NM_018259.5	NP_060729.2	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17	16					actin filament polymerization (GO:0030041)|cilium organization (GO:0044782)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(27)|ovary(5)|prostate(3)|skin(3)	53						CTGCCGCCTTGCTCCGGCCCA	0.711																																					p.C16Y		.											.	TTC17-95	0			c.G47A						.						10.0	13.0	12.0					11																	43380551		2188	4280	6468	SO:0001583	missense	55761	exon1			CGCCTTGCTCCGG	AK001540	CCDS31466.1	11p11.2	2013-01-10			ENSG00000052841	ENSG00000052841		"""Tetratricopeptide (TTC) repeat domain containing"""	25596	protein-coding gene	gene with protein product						12477932	Standard	NM_018259		Approved	FLJ10890	uc001mxi.3	Q96AE7	OTTHUMG00000166398	ENST00000039989.4:c.47G>A	11.37:g.43380551G>A	ENSP00000039989:p.Cys16Tyr	Somatic	25	0		WXS	Illumina HiSeq	Phase_I	20	10	NM_018259	0	0	1	2	1	G3XAB3|Q8NEC0	Missense_Mutation	SNP	ENST00000039989.4	37	CCDS31466.1	.	.	.	.	.	.	.	.	.	.	G	15.19	2.759055	0.49468	.	.	ENSG00000052841	ENST00000299240;ENST00000039989	T;T	0.30981	1.51;1.52	5.5	5.5	0.81552	.	0.471757	0.22070	N	0.065056	T	0.13114	0.0318	N	0.08118	0	0.23611	N	0.99729	B;B	0.33379	0.41;0.021	B;B	0.26094	0.066;0.037	T	0.17623	-1.0363	10	0.17832	T	0.49	-0.8355	9.4046	0.38453	0.0:0.1538:0.6866:0.1596	.	16;16	Q96AE7;G3XAB3	TTC17_HUMAN;.	Y	16	ENSP00000299240:C16Y;ENSP00000039989:C16Y	ENSP00000039989:C16Y	C	+	2	0	TTC17	43337127	0.979000	0.34478	0.972000	0.41901	0.951000	0.60555	3.441000	0.52893	2.868000	0.98415	0.555000	0.69702	TGC	.		0.711	TTC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389577.2	NM_018259	
PICALM	8301	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	85714416	85714416	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr11:85714416C>A	ENST00000393346.3	-	9	1034	c.886G>T	c.(886-888)Gca>Tca	p.A296S	PICALM_ENST00000356360.5_Missense_Mutation_p.A296S|PICALM_ENST00000526033.1_Missense_Mutation_p.A296S|PICALM_ENST00000532317.1_Missense_Mutation_p.A296S|PICALM_ENST00000528398.1_Missense_Mutation_p.A245S			Q13492	PICAL_HUMAN	phosphatidylinositol binding clathrin assembly protein	296					axonogenesis (GO:0007409)|cargo loading into vesicle (GO:0035459)|cell proliferation (GO:0008283)|clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|hemopoiesis (GO:0030097)|iron ion homeostasis (GO:0055072)|iron ion import into cell (GO:0097459)|negative regulation of gene expression (GO:0010629)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of receptor-mediated endocytosis (GO:0048261)|positive regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902961)|positive regulation of beta-amyloid formation (GO:1902004)|positive regulation of neuron death (GO:1901216)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902959)|regulation of endocytosis (GO:0030100)|regulation of protein localization (GO:0032880)|synaptic vesicle maturation (GO:0016188)|vesicle-mediated transport (GO:0016192)	clathrin coat (GO:0030118)|coated pit (GO:0005905)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neurofibrillary tangle (GO:0097418)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|vesicle (GO:0031982)	1-phosphatidylinositol binding (GO:0005545)|clathrin adaptor activity (GO:0035615)|clathrin binding (GO:0030276)|clathrin heavy chain binding (GO:0032050)			endometrium(1)|kidney(2)|large_intestine(2)|liver(1)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	19		Acute lymphoblastic leukemia(157;7.42e-07)|all_hematologic(158;0.00092)				TACCTGCTTGCAGCTGTAGAA	0.388			T	"""MLLT10, MLL"""	"""TALL, AML, """																																p.A296S		.		Dom	yes		11	11q14	8301	phosphatidylinositol binding clathrin assembly protein (CALM)		L	.	PICALM-659	0			c.G886T						.						97.0	93.0	94.0					11																	85714416		2203	4299	6502	SO:0001583	missense	8301	exon9			TGCTTGCAGCTGT	BC048259	CCDS8272.1, CCDS31653.1, CCDS55783.1, CCDS55784.1	11q14	2008-02-01			ENSG00000073921	ENSG00000073921			15514	protein-coding gene	gene with protein product		603025				8643484	Standard	NM_001206947		Approved	CALM, CLTH	uc001pbm.3	Q13492	OTTHUMG00000166981	ENST00000393346.3:c.886G>T	11.37:g.85714416C>A	ENSP00000377015:p.Ala296Ser	Somatic	74	0		WXS	Illumina HiSeq	Phase_I	99	27	NM_007166	0	0	0	0	0	B4DTM3|E9PN05|F8VPG7|O60700|Q4LE54|Q6GMQ6|Q86XZ9	Missense_Mutation	SNP	ENST00000393346.3	37	CCDS8272.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.559328	0.86335	.	.	ENSG00000073921	ENST00000532317;ENST00000526033;ENST00000447890;ENST00000393346;ENST00000528398;ENST00000356360	T;T;T;T;T	0.58210	0.35;0.35;0.35;0.35;0.35	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.72574	0.3477	M	0.71036	2.16	0.80722	D	1	D;D;B;P	0.69078	0.997;0.968;0.356;0.95	D;P;B;P	0.75020	0.985;0.854;0.178;0.716	T	0.71533	-0.4564	9	.	.	.	-9.5668	19.5037	0.95106	0.0:1.0:0.0:0.0	.	245;296;296;296	E9PN05;F8VPG7;Q13492;Q13492-3	.;.;PICAL_HUMAN;.	S	296;296;296;296;245;296	ENSP00000436958:A296S;ENSP00000433846:A296S;ENSP00000377015:A296S;ENSP00000434884:A245S;ENSP00000348718:A296S	.	A	-	1	0	PICALM	85392064	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.818000	0.86416	2.596000	0.87737	0.655000	0.94253	GCA	.		0.388	PICALM-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392224.1	NM_007166	
USP28	57646	broad.mit.edu	37	11	113679909	113679909	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr11:113679909G>T	ENST00000003302.4	-	17	2108	c.2040C>A	c.(2038-2040)taC>taA	p.Y680*	USP28_ENST00000260188.5_Nonsense_Mutation_p.Y680*|USP28_ENST00000545540.1_Nonsense_Mutation_p.Y555*|USP28_ENST00000544967.1_Nonsense_Mutation_p.Y388*	NM_020886.2	NP_065937.1	Q96RU2	UBP28_HUMAN	ubiquitin specific peptidase 28	680					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|protein deubiquitination (GO:0016579)|response to ionizing radiation (GO:0010212)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(4)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(12)|lung(24)|ovary(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	59		all_cancers(61;3.74e-18)|all_epithelial(67;3.75e-11)|Melanoma(852;1.46e-05)|all_hematologic(158;4.65e-05)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|Prostate(24;0.0153)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|Epithelial(105;0.000122)|all cancers(92;0.00104)		CCTCCTGAATGTAATGCTTGA	0.463																																					p.Y680X	Melanoma(4;162 555 7664)|GBM(79;500 2010 17506)|Esophageal Squamous(9;463 924 15765)												.	USP28-706	0			c.C2040A						.						363.0	369.0	367.0					11																	113679909		2201	4296	6497	SO:0001587	stop_gained	57646	exon17			CTGAATGTAATGC	AB040948	CCDS31680.1, CCDS73394.1	11q23	2008-04-11	2005-08-08		ENSG00000048028	ENSG00000048028		"""Ubiquitin-specific peptidases"""	12625	protein-coding gene	gene with protein product		610748	"""ubiquitin specific protease 28"""			12838346, 11597335	Standard	XM_005271630		Approved	KIAA1515	uc001poh.3	Q96RU2	OTTHUMG00000168205	ENST00000003302.4:c.2040C>A	11.37:g.113679909G>T	ENSP00000003302:p.Tyr680*	Somatic	591	0		WXS	Illumina HiSeq	Phase_I	568	7	NM_020886	0	0	12	12	0	B0YJC0|B0YJC1|Q9P213	Nonsense_Mutation	SNP	ENST00000003302.4	37	CCDS31680.1	.	.	.	.	.	.	.	.	.	.	G	41	9.146417	0.99080	.	.	ENSG00000048028	ENST00000003302;ENST00000260188;ENST00000544967;ENST00000545540	.	.	.	5.56	1.87	0.25490	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.1715	10.5421	0.45039	0.3142:0.0:0.6858:0.0	.	.	.	.	X	680;680;388;555	.	ENSP00000003302:Y680X	Y	-	3	2	USP28	113185119	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.477000	0.35431	0.584000	0.29591	0.563000	0.77884	TAC	.		0.463	USP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398789.1		
Unknown	0	broad.mit.edu	37	11	124095997	124095997	+	IGR	SNP	C	C	A			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr11:124095997C>A								OR10D3 (39045 upstream) : OR8G1 (24425 downstream)																							TCTTGGGGCTCTCCTGCTCCA	0.418																																					p.L200L													.	.	0			c.C600A						.						153.0	158.0	157.0					11																	124095997		1963	4182	6145	SO:0001628	intergenic_variant	26492	exon1			GGGGCTCTCCTGC																													11.37:g.124095997C>A		Somatic	268	0		WXS	Illumina HiSeq	Phase_I	249	5	NM_001007249	0	0	0	0	0		Silent	SNP		37																																																																																				.	0	0.418								
KMT2D	8085	hgsc.bcm.edu	37	12	49427265	49427265	+	Silent	SNP	T	T	C	rs398123707		TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr12:49427265T>C	ENST00000301067.7	-	39	11222	c.11223A>G	c.(11221-11223)caA>caG	p.Q3741Q	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	3741	Gln-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										gctgctgctgttgctgctgct	0.587																																					p.Q3741Q		.											.	MLL2-612	0			c.A11223G						.						15.0	18.0	17.0					12																	49427265		2197	4294	6491	SO:0001819	synonymous_variant	8085	exon39			CTGCTGTTGCTGC	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.11223A>G	12.37:g.49427265T>C		Somatic	34	0		WXS	Illumina HiSeq	Phase_I	24	2	NM_003482	0	0	7	25	18	O14687	Silent	SNP	ENST00000301067.7	37	CCDS44873.1																																																																																			.		0.587	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
LRP1	4035	broad.mit.edu	37	12	57566959	57566959	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr12:57566959C>A	ENST00000243077.3	+	21	3638	c.3172C>A	c.(3172-3174)Ccc>Acc	p.P1058T		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	1058					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)	p.P1058T(3)		NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	AGCCACGAGGCCCCCTGGTGG	0.672											OREG0021936	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P1058T													.	LRP1-596	3	Substitution - Missense(3)	prostate(2)|endometrium(1)	c.C3172A						.						45.0	42.0	43.0					12																	57566959		2203	4300	6503	SO:0001583	missense	4035	exon21			ACGAGGCCCCCTG	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.3172C>A	12.37:g.57566959C>A	ENSP00000243077:p.Pro1058Thr	Somatic	83	1	1024	WXS	Illumina HiSeq	Phase_I	37	5	NM_002332	0	0	0	0	0	Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	37	CCDS8932.1	.	.	.	.	.	.	.	.	.	.	C	18.28	3.589375	0.66105	.	.	ENSG00000123384	ENST00000243077	D	0.91237	-2.81	5.08	4.19	0.49359	.	0.000000	0.64402	D	0.000001	D	0.89255	0.6663	N	0.13140	0.3	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.85355	0.1104	10	0.10902	T	0.67	.	14.634	0.68676	0.0:0.8532:0.1468:0.0	.	1058	Q07954	LRP1_HUMAN	T	1058	ENSP00000243077:P1058T	ENSP00000243077:P1058T	P	+	1	0	LRP1	55853226	1.000000	0.71417	0.993000	0.49108	0.962000	0.63368	7.488000	0.81441	1.355000	0.45865	0.561000	0.74099	CCC	.		0.672	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332	
ZCCHC8	55596	bcgsc.ca	37	12	122958214	122958214	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr12:122958214T>G	ENST00000336229.4	-	14	2084	c.1954A>C	c.(1954-1956)Acg>Ccg	p.T652P	ZCCHC8_ENST00000543897.1_Missense_Mutation_p.T414P|ZCCHC8_ENST00000536306.1_Missense_Mutation_p.T414P|ZCCHC8_ENST00000538116.1_Missense_Mutation_p.T263P	NM_017612.3	NP_060082.2	Q6NZY4	ZCHC8_HUMAN	zinc finger, CCHC domain containing 8	652					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(2)|large_intestine(8)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	23	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.25e-05)|Epithelial(86;0.000113)|BRCA - Breast invasive adenocarcinoma(302;0.202)		TTAGTGGCCGTTGAAGGACTG	0.458																																					p.T652P													.	ZCCHC8-90	0			c.A1954C						.						161.0	162.0	161.0					12																	122958214		1914	4125	6039	SO:0001583	missense	55596	exon14			TGGCCGTTGAAGG	BC017704		12q24.31	2014-04-14				ENSG00000033030		"""Zinc fingers, CCHC domain containing"""	25265	protein-coding gene	gene with protein product						12477932	Standard	XM_005253581		Approved	DKFZp434E2220	uc001ucn.3	Q6NZY4		ENST00000336229.4:c.1954A>C	12.37:g.122958214T>G	ENSP00000337313:p.Thr652Pro	Somatic	313	2		WXS	Illumina HiSeq	Phase_1	208	29	NM_017612	0	0	36	36	0	Q7L2P6|Q8N2K5|Q96SK7|Q9NSS2|Q9NSS3	Missense_Mutation	SNP	ENST00000336229.4	37		.	.	.	.	.	.	.	.	.	.	T	12.63	1.996555	0.35226	.	.	ENSG00000033030	ENST00000536306;ENST00000543897;ENST00000336229;ENST00000538116	T;T;T;T	0.45276	0.93;0.93;0.92;0.9	5.88	-11.8	0.00035	.	1.320320	0.04424	N	0.368136	T	0.23806	0.0576	L	0.44542	1.39	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.09796	-1.0658	10	0.30078	T	0.28	1.7467	2.1097	0.03700	0.2227:0.3696:0.1514:0.2563	.	652	Q6NZY4	ZCHC8_HUMAN	P	414;414;652;263	ENSP00000441423:T414P;ENSP00000438993:T414P;ENSP00000337313:T652P;ENSP00000440028:T263P	ENSP00000337313:T652P	T	-	1	0	ZCCHC8	121524167	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.508000	0.00960	-1.689000	0.01434	-2.007000	0.00441	ACG	.		0.458	ZCCHC8-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_017612	
SPATA13	221178	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	24825881	24825881	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr13:24825881C>A	ENST00000382095.4	+	3	577	c.170C>A	c.(169-171)gCt>gAt	p.A57D	SPATA13-AS1_ENST00000430733.1_RNA|RP11-307N16.6_ENST00000382141.4_Missense_Mutation_p.A560D|SPATA13_ENST00000382108.3_Missense_Mutation_p.A682D|SPATA13_ENST00000424834.2_Missense_Mutation_p.A682D	NM_153023.2	NP_694568.1	Q96N96	SPT13_HUMAN	spermatogenesis associated 13	57					cell migration (GO:0016477)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of cell migration (GO:0030334)	cytoplasm (GO:0005737)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			breast(4)|endometrium(2)|large_intestine(9)|lung(4)|ovary(1)|prostate(1)|skin(2)	23		all_cancers(29;4.05e-15)|all_lung(29;2.77e-14)|all_epithelial(30;7.77e-13)|Lung SC(185;0.0279)		all cancers(112;0.00616)|Epithelial(112;0.0195)|OV - Ovarian serous cystadenocarcinoma(117;0.0705)|Lung(94;0.231)		CCCATGCCTGCTCACCAGGTG	0.622																																					p.A682D		.											.	SPATA13-229	0			c.C2045A						.						60.0	65.0	63.0					13																	24825881		2203	4300	6503	SO:0001583	missense	221178	exon4			TGCCTGCTCACCA	AK055770	CCDS9305.1, CCDS53857.1, CCDS66517.1, CCDS66518.1, CCDS73553.1	13q12.13	2013-01-10			ENSG00000182957	ENSG00000182957		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	23222	protein-coding gene	gene with protein product		613324					Standard	NM_001286795		Approved	FLJ31208, ARHGEF29	uc021rhg.1	Q96N96	OTTHUMG00000016578	ENST00000382095.4:c.170C>A	13.37:g.24825881C>A	ENSP00000371527:p.Ala57Asp	Somatic	117	0		WXS	Illumina HiSeq	Phase_I	118	49	NM_001166271	0	0	3	4	1	A2VEA9|A6NF85|B4DQB1|B4DSZ0|B4DVM8|J3KPJ7|J3KQH2|Q5VX68|Q6ZML1|Q8N873|Q8TEK6	Missense_Mutation	SNP	ENST00000382095.4	37	CCDS9305.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.7|25.7	4.662502|4.662502	0.88251|0.88251	.|.	.|.	ENSG00000182957|ENSG00000182957	ENST00000382108;ENST00000382095;ENST00000434675;ENST00000438694|ENST00000424834	T;T;T|.	0.35789|.	1.29;1.29;1.29|.	5.97|5.97	5.13|5.13	0.70059|0.70059	.|.	0.125113|.	0.56097|.	D|.	0.000034|.	T|.	0.61173|.	0.2326|.	L|L	0.46157|0.46157	1.445|1.445	0.80722|0.80722	D|D	1|1	P;D;B|.	0.53462|.	0.634;0.96;0.361|.	B;P;B|.	0.48795|.	0.3;0.59;0.074|.	T|.	0.55866|.	-0.8073|.	10|.	0.46703|.	T|.	0.11|.	.|.	13.7166|13.7166	0.62700|0.62700	0.0:0.927:0.0:0.073|0.0:0.927:0.0:0.073	.|.	3;3;57|.	Q96N96-5;Q96N96-4;Q96N96|.	.;.;SPT13_HUMAN|.	D|X	682;57;17;3|719	ENSP00000371542:A682D;ENSP00000371527:A57D;ENSP00000401605:A17D|.	ENSP00000371527:A57D|.	A|C	+|+	2|3	0|2	SPATA13|SPATA13	23723881|23723881	1.000000|1.000000	0.71417|0.71417	0.636000|0.636000	0.29352|0.29352	0.775000|0.775000	0.43874|0.43874	5.552000|5.552000	0.67281|0.67281	2.836000|2.836000	0.97738|0.97738	0.655000|0.655000	0.94253|0.94253	GCT|TGC	.		0.622	SPATA13-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000044180.2	NM_153023	
SHISA2	387914	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	26620708	26620708	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr13:26620708C>G	ENST00000319420.3	-	2	886	c.831G>C	c.(829-831)caG>caC	p.Q277H		NM_001007538.1	NP_001007539.1	Q6UWI4	SHSA2_HUMAN	shisa family member 2	277					multicellular organismal development (GO:0007275)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(2)|skin(1)	17						GGAAGGGGGACTGAATCTGCC	0.567																																					p.Q277H		.											.	SHISA2-69	0			c.G831C						.						104.0	91.0	96.0					13																	26620708		2203	4300	6503	SO:0001583	missense	387914	exon2			GGGGGACTGAATC		CCDS31951.1	13q12.13	2013-07-31	2013-07-31	2008-04-01	ENSG00000180730	ENSG00000180730		"""Shisa homologs"""	20366	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 13"", ""transmembrane protein 46"", ""shisa homolog 2 (Xenopus laevis)"""	C13orf13, TMEM46			Standard	NM_001007538		Approved	bA398O19.2, PRO28631, WGAR9166, hShisa	uc001uqm.1	Q6UWI4	OTTHUMG00000016612	ENST00000319420.3:c.831G>C	13.37:g.26620708C>G	ENSP00000313079:p.Gln277His	Somatic	87	0		WXS	Illumina HiSeq	Phase_I	85	30	NM_001007538	0	0	1	1	0	B9EH70|Q5W0G8	Missense_Mutation	SNP	ENST00000319420.3	37	CCDS31951.1	.	.	.	.	.	.	.	.	.	.	C	18.33	3.599692	0.66332	.	.	ENSG00000180730	ENST00000319420	T	0.52057	0.68	5.58	4.74	0.60224	.	0.149265	0.46758	D	0.000272	T	0.55924	0.1951	L	0.27053	0.805	0.80722	D	1	D	0.71674	0.998	D	0.79784	0.993	T	0.60530	-0.7245	10	0.66056	D	0.02	-21.8958	14.6091	0.68504	0.0:0.9296:0.0:0.0704	.	277	Q6UWI4	SHSA2_HUMAN	H	277	ENSP00000313079:Q277H	ENSP00000313079:Q277H	Q	-	3	2	SHISA2	25518708	1.000000	0.71417	0.996000	0.52242	0.854000	0.48673	2.473000	0.45145	1.364000	0.46038	0.650000	0.86243	CAG	.		0.567	SHISA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044239.2	NM_001007538	
TTBK2	146057	bcgsc.ca	37	15	43132600	43132600	+	Missense_Mutation	SNP	A	A	C	rs141523080		TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr15:43132600A>C	ENST00000267890.6	-	4	357	c.249T>G	c.(247-249)tgT>tgG	p.C83W	TTBK2_ENST00000567274.1_Missense_Mutation_p.C83W|TTBK2_ENST00000567840.1_Missense_Mutation_p.C83W	NM_173500.3	NP_775771.3	Q6IQ55	TTBK2_HUMAN	tau tubulin kinase 2	83	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell death (GO:0008219)|cilium assembly (GO:0042384)|peptidyl-serine phosphorylation (GO:0018105)|smoothened signaling pathway (GO:0007224)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|ciliary transition zone (GO:0035869)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(2)	43		all_cancers(109;6.11e-16)|all_epithelial(112;5.5e-14)|Lung NSC(122;1.76e-08)|all_lung(180;6.04e-08)|Melanoma(134;0.0179)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;3.23e-07)		CATTCCTCCCACAGCCAATAA	0.318																																					p.C83W													.	TTBK2-338	0			c.T249G						.						133.0	126.0	128.0					15																	43132600		1820	4084	5904	SO:0001583	missense	146057	exon4			CCTCCCACAGCCA	AB020654	CCDS42029.1	15q15.2	2014-01-21			ENSG00000128881	ENSG00000128881			19141	protein-coding gene	gene with protein product		611695	"""spinocerebellar ataxia 11"""	SCA11		10048485	Standard	NM_173500		Approved	KIAA0847	uc001zqo.2	Q6IQ55	OTTHUMG00000175802	ENST00000267890.6:c.249T>G	15.37:g.43132600A>C	ENSP00000267890:p.Cys83Trp	Somatic	187	0		WXS	Illumina HiSeq	Phase_1	132	26	NM_173500	0	0	1	1	0	O94932|Q6ZN52|Q8IVV1	Missense_Mutation	SNP	ENST00000267890.6	37	CCDS42029.1	.	.	.	.	.	.	.	.	.	.	A	11.81	1.750201	0.30955	.	.	ENSG00000128881	ENST00000267890;ENST00000399479;ENST00000263802	T	0.64438	-0.1	5.31	4.18	0.49190	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.082061	0.85682	D	0.000000	T	0.73892	0.3645	L	0.60455	1.87	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.999;0.999	T	0.75193	-0.3404	10	0.87932	D	0	.	11.2089	0.48786	0.9264:0.0:0.0736:0.0	.	63;14;83;83	Q8IWY7;Q6IQ55-2;Q6IQ55-3;Q6IQ55	.;.;.;TTBK2_HUMAN	W	83;13;63	ENSP00000267890:C83W	ENSP00000263802:C63W	C	-	3	2	TTBK2	40919892	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.929000	0.48916	0.955000	0.37878	0.477000	0.44152	TGT	.		0.318	TTBK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000431106.2	NM_173500	
DENND4A	10260	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	65983020	65983020	+	Silent	SNP	C	C	T			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr15:65983020C>T	ENST00000431932.2	-	22	3988	c.3780G>A	c.(3778-3780)gtG>gtA	p.V1260V	DENND4A_ENST00000567323.1_5'Flank|DENND4A_ENST00000443035.3_Silent_p.V1303V	NM_005848.3	NP_005839.3	Q7Z401	MYCPP_HUMAN	DENN/MADD domain containing 4A	1260					positive regulation of Rab GTPase activity (GO:0032851)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(11)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	51						TGGTAAGTCTCACTGGCTTAG	0.413																																					p.V1303V		.											.	DENND4A-229	0			c.G3909A						.						101.0	104.0	103.0					15																	65983020		1893	4107	6000	SO:0001819	synonymous_variant	10260	exon23			AAGTCTCACTGGC	AF534403	CCDS45285.1, CCDS53949.1	15q22.31	2012-10-03	2006-01-27	2006-01-27				"""DENN/MADD domain containing"""	24321	protein-coding gene	gene with protein product		600382	"""c-myc promoter binding protein"""	MYCPBP		8056341, 12906859	Standard	NM_005848		Approved	IRLB	uc002api.3	Q7Z401		ENST00000431932.2:c.3780G>A	15.37:g.65983020C>T		Somatic	133	0		WXS	Illumina HiSeq	Phase_I	100	29	NM_001144823	0	0	4	8	4	E7EPL3|Q14655|Q86T77|Q8IVX2|Q8NB93	Silent	SNP	ENST00000431932.2	37	CCDS45285.1																																																																																			.		0.413	DENND4A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419611.1	NM_005848	
SIN3A	25942	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	75692465	75692465	+	Silent	SNP	C	C	T	rs373830836		TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr15:75692465C>T	ENST00000394947.3	-	12	2084	c.1770G>A	c.(1768-1770)tcG>tcA	p.S590S	SIN3A_ENST00000360439.4_Silent_p.S590S|SIN3A_ENST00000394949.4_Silent_p.S590S	NM_001145358.1	NP_001138830.1			SIN3 transcription regulator family member A											breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	63						CCTCAGACCACGAAGGGAAGG	0.393																																					p.S590S		.											.	SIN3A-230	0			c.G1770A						.	C	,,	0,4394		0,0,2197	96.0	91.0	93.0		1770,1770,1770	-12.2	0.2	15		93	1,8587	1.2+/-3.3	0,1,4293	no	coding-synonymous,coding-synonymous,coding-synonymous	SIN3A	NM_001145357.1,NM_001145358.1,NM_015477.2	,,	0,1,6490	TT,TC,CC		0.0116,0.0,0.0077	,,	590/1274,590/1274,590/1274	75692465	1,12981	2197	4294	6491	SO:0001819	synonymous_variant	25942	exon12			AGACCACGAAGGG	AK027559	CCDS10279.1	15q22.33	2013-08-21	2013-08-21		ENSG00000169375	ENSG00000169375			19353	protein-coding gene	gene with protein product		607776	"""SIN3 homolog A, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog A (yeast)"""			10773092, 7601471	Standard	NM_001145357		Approved	KIAA0700, DKFZP434K2235	uc002bai.3	Q96ST3	OTTHUMG00000142834	ENST00000394947.3:c.1770G>A	15.37:g.75692465C>T		Somatic	86	0		WXS	Illumina HiSeq	Phase_I	87	32	NM_001145358	0	0	3	7	4		Silent	SNP	ENST00000394947.3	37	CCDS10279.1																																																																																			.		0.393	SIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286469.1	NM_015477	
ZNF598	90850	hgsc.bcm.edu	37	16	2059674	2059674	+	Missense_Mutation	SNP	T	T	C	rs71384660		TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr16:2059674T>C	ENST00000431526.1	-	2	88	c.74A>G	c.(73-75)gAa>gGa	p.E25G	ZNF598_ENST00000562103.1_5'UTR|ZNF598_ENST00000563630.1_5'UTR	NM_178167.2	NP_835461.2	Q86UK7	ZN598_HUMAN	zinc finger protein 598	25							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|lung(7)|skin(1)|urinary_tract(1)	16						GCTCCCGCCTTCCCGCTCAGG	0.766													C|||	5008	1.0	1.0	1.0	5008	,	,		5162	1.0		1.0	False		,,,				2504	1.0				p.E25G		.											.	ZNF598-432	0			c.A74G						.						1.0	2.0	2.0					16																	2059674		1089	2314	3403	SO:0001583	missense	90850	exon2			CCGCCTTCCCGCT	BC029270		16p13.3	2008-05-02				ENSG00000167962		"""Zinc fingers, C2H2-type"""	28079	protein-coding gene	gene with protein product							Standard	NM_178167		Approved	FLJ00086	uc002cof.2	Q86UK7		ENST00000431526.1:c.74A>G	16.37:g.2059674T>C	ENSP00000411409:p.Glu25Gly	Somatic	0	0		WXS	Illumina HiSeq	Phase_I	2	2	NM_178167	0	0	0	10	10	Q8IW49|Q8N3D9|Q96FG3|Q9H7J3	Missense_Mutation	SNP	ENST00000431526.1	37		2168	0.9926739926739927	487	0.9898373983739838	361	0.9972375690607734	568	0.993006993006993	752	0.9920844327176781	N	1.560	-0.537056	0.04082	.	.	ENSG00000167962	ENST00000431526	T	0.77098	-1.07	3.3	3.3	0.37823	.	0.415485	0.23105	N	0.051871	T	0.00012	0.0000	.	.	.	0.48696	P	3.1000000000003247E-4	.	.	.	.	.	.	T	0.34650	-0.9820	6	0.22706	T	0.39	-7.8624	8.393	0.32540	0.0:0.8796:0.0:0.1204	.	.	.	.	G	25	ENSP00000411409:E25G	ENSP00000411409:E25G	E	-	2	0	ZNF598	1999675	1.000000	0.71417	1.000000	0.80357	0.107000	0.19398	0.911000	0.28584	0.691000	0.31592	-0.642000	0.03964	GAA	T|0.007;C|0.993		0.766	ZNF598-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_178167	
PKD1	5310	broad.mit.edu	37	16	2142592	2142592	+	Splice_Site	SNP	A	A	C			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr16:2142592A>C	ENST00000262304.4	-	39	11366	c.11158T>G	c.(11158-11160)Tct>Gct	p.S3720A	RP11-304L19.1_ENST00000570072.1_RNA|RP11-304L19.3_ENST00000565937.1_RNA|MIR1225_ENST00000408729.1_RNA|PKD1_ENST00000423118.1_Splice_Site_p.S3719A	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	3720					anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						AGCTCCTCAGACCTGCCACAG	0.687																																					p.S3720A													.	PKD1-91	0			c.T11158G						.																																			SO:0001630	splice_region_variant	5310	exon39			CCTCAGACCTGCC	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.11157-1T>G	16.37:g.2142592A>C		Somatic	38	6		WXS	Illumina HiSeq	Phase_I	27	11	NM_001009944	0	0	4	5	1	Q15140|Q15141	Missense_Mutation	SNP	ENST00000262304.4	37	CCDS32369.1	.	.	.	.	.	.	.	.	.	.	A	10.20	1.283947	0.23392	.	.	ENSG00000008710	ENST00000262304;ENST00000423118;ENST00000306101	T;T	0.70516	-0.49;-0.49	3.74	2.63	0.31362	Polycystin cation channel, PKD1/PKD2 (1);	0.495398	0.20598	N	0.089201	T	0.76040	0.3932	M	0.66939	2.045	0.31441	N	0.671983	D;B	0.69078	0.997;0.374	D;B	0.80764	0.994;0.268	T	0.71087	-0.4694	10	0.16420	T	0.52	.	5.0637	0.14570	0.7478:0.0:0.0904:0.1618	.	3719;3720	P98161-3;P98161	.;PKD1_HUMAN	A	3720;3719;3054	ENSP00000262304:S3720A;ENSP00000399501:S3719A	ENSP00000262304:S3720A	S	-	1	0	PKD1	2082593	0.984000	0.35163	1.000000	0.80357	0.583000	0.36354	1.268000	0.33062	0.492000	0.27815	0.260000	0.18958	TCT	.		0.687	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1		Missense_Mutation
NLRC3	197358	hgsc.bcm.edu	37	16	3613197	3613197	+	RNA	SNP	G	G	A			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr16:3613197G>A	ENST00000301749.7	-	0	2146				NLRC3_ENST00000448023.2_RNA|NLRC3_ENST00000324659.8_RNA|NLRC3_ENST00000419350.2_RNA|NLRC3_ENST00000359128.5_RNA|NLRC3_ENST00000603507.1_RNA	NM_178844.2	NP_849172.2	Q7RTR2	NLRC3_HUMAN	NLR family, CARD domain containing 3						I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|regulation of protein ubiquitination (GO:0031396)|response to lipopolysaccharide (GO:0032496)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(16)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						TCCACGCTGCGGGCCAGCTCG	0.706																																					p.R581C		.											.	NLRC3-96	0			c.C1741T						.																																					197358	exon5			CGCTGCGGGCCAG	BK001112	CCDS73817.1	16p13.3	2014-03-25			ENSG00000167984	ENSG00000167984		"""Nucleotide-binding domain and leucine rich repeat containing"""	29889	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 3"", ""NOD-like receptor C3"""	615648				15705585, 12766759	Standard	NM_178844		Approved	CLR16.2, FLJ00348, NOD3	uc010btn.3	Q7RTR2	OTTHUMG00000177561		16.37:g.3613197G>A		Somatic	19	2		WXS	Illumina HiSeq	Phase_I	17	14	NM_178844	0	0	0	0	0	Q5EY36|Q8NF48|Q8NI01|Q8NI02|Q8TEL3	Missense_Mutation	SNP	ENST00000301749.7	37		.	.	.	.	.	.	.	.	.	.	G	2.943	-0.218437	0.06101	.	.	ENSG00000167984	ENST00000419350;ENST00000301749;ENST00000359128;ENST00000448023;ENST00000324659	D;D;D;D	0.84442	-1.85;-1.85;-1.85;-1.85	4.89	1.09	0.20402	.	0.489205	0.20893	N	0.083782	T	0.72606	0.3481	.	.	.	0.21020	N	0.999808	B	0.21821	0.061	B	0.16289	0.015	T	0.59423	-0.7457	9	0.39692	T	0.17	.	5.1383	0.14947	0.2107:0.0:0.563:0.2263	.	628	C9JLH9	.	C	581;581;581;628;563	ENSP00000301749:R581C;ENSP00000352039:R581C;ENSP00000414415:R628C;ENSP00000323897:R563C	ENSP00000301749:R581C	R	-	1	0	NLRC3	3553198	0.000000	0.05858	0.422000	0.26621	0.013000	0.08279	-0.179000	0.09768	0.380000	0.24823	-0.345000	0.07892	CGC	.		0.706	NLRC3-201	KNOWN	basic|appris_principal	protein_coding	polymorphic_pseudogene		NM_178844	
CIITA	4261	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	10992850	10992850	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr16:10992850C>A	ENST00000324288.8	+	5	560	c.427C>A	c.(427-429)Cag>Aag	p.Q143K	CIITA_ENST00000381835.5_Missense_Mutation_p.Q143K|CIITA_ENST00000537380.1_3'UTR	NM_000246.3	NP_000237	P33076	C2TA_HUMAN	class II, major histocompatibility complex, transactivator	143					aging (GO:0007568)|cellular response to electrical stimulus (GO:0071257)|cellular response to exogenous dsRNA (GO:0071360)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to antibiotic (GO:0046677)|response to interferon-gamma (GO:0034341)|transcription, DNA-templated (GO:0006351)	cell surface (GO:0009986)|nucleoplasm (GO:0005654)|PML body (GO:0016605)	activating transcription factor binding (GO:0033613)|ATP binding (GO:0005524)|GTP binding (GO:0005525)|kinase activity (GO:0016301)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transferase activity, transferring acyl groups (GO:0016746)			central_nervous_system(1)|large_intestine(7)|ovary(1)|skin(1)|stomach(2)	12						GCAGAAAAGTCAGAAAAGACG	0.507			T	"""FLJ27352, CD274, CD273, RALGDS, RUNDC2A, C16orf75, BCL6"""	"""PMBL, Hodgkin Lymphona, """																																p.Q143K		.		Dom	yes		16	16p13	4261	"""class II, major histocompatibility complex, transactivator"""		L	.	CIITA-226	0			c.C427A						.						159.0	151.0	154.0					16																	10992850		2197	4300	6497	SO:0001583	missense	4261	exon5			AAAAGTCAGAAAA	U18259	CCDS10544.1, CCDS66943.1, CCDS73826.1	16p13	2014-09-17	2005-08-12	2005-08-12	ENSG00000179583	ENSG00000179583		"""Nucleotide-binding domain and leucine rich repeat containing"""	7067	protein-coding gene	gene with protein product	"""NLR family, acid domain containing"", ""nucleotide-binding oligomerization domain, leucine rich repeat and acid domain containing"""	600005	"""MHC class II transactivator"""	MHC2TA		8402893	Standard	NM_000246		Approved	C2TA, NLRA	uc002dai.4	P33076	OTTHUMG00000129753	ENST00000324288.8:c.427C>A	16.37:g.10992850C>A	ENSP00000316328:p.Gln143Lys	Somatic	115	0		WXS	Illumina HiSeq	Phase_I	137	29	NM_000246	0	0	0	0	0	A0N0N9|D3DUG0|E9PFE0|Q29675|Q8SNB8|Q96KL4	Missense_Mutation	SNP	ENST00000324288.8	37	CCDS10544.1	.	.	.	.	.	.	.	.	.	.	C	14.14	2.446255	0.43429	.	.	ENSG00000179583	ENST00000324288;ENST00000381835;ENST00000388910;ENST00000537380	T;T	0.74842	-0.88;1.54	3.81	3.81	0.43845	.	0.428781	0.17282	N	0.179967	T	0.66626	0.2808	L	0.50333	1.59	0.25966	N	0.982563	P;P;B;B;P;B	0.40398	0.649;0.455;0.126;0.126;0.716;0.323	B;B;B;B;B;B	0.36567	0.228;0.094;0.049;0.049;0.228;0.079	T	0.64118	-0.6482	10	0.54805	T	0.06	.	11.3836	0.49771	0.0:1.0:0.0:0.0	.	143;143;143;143;144;143	F5H2J4;E9PFE0;A0N0N9;P33076;F2Z2G8;Q96KL4	.;.;.;C2TA_HUMAN;.;.	K	143;143;144;143	ENSP00000316328:Q143K;ENSP00000371257:Q143K	ENSP00000316328:Q143K	Q	+	1	0	CIITA	10900351	0.989000	0.36119	0.889000	0.34880	0.900000	0.52787	3.160000	0.50739	2.134000	0.65973	0.557000	0.71058	CAG	.		0.507	CIITA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251966.2	NM_000246	
C16orf70	80262	hgsc.bcm.edu	37	16	67184342	67184342	+	IGR	SNP	A	A	G			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr16:67184342A>G	ENST00000219139.3	+	0	2865				B3GNT9_ENST00000449549.3_Missense_Mutation_p.L16P	NM_025187.3	NP_079463.2	Q9BSU1	CP070_HUMAN	chromosome 16 open reading frame 70											cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(3)|skin(1)	17		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0017)|Epithelial(162;0.00655)|all cancers(182;0.0579)		GGCGCCAAGGAGCAGCGTGAG	0.746																																					p.L16P		.											.	.	0			c.T47C						.						4.0	4.0	4.0					16																	67184342		1947	3941	5888	SO:0001628	intergenic_variant	84752	exon2			CCAAGGAGCAGCG	AK022138	CCDS10828.1	16q22.1	2011-01-25	2006-04-12	2006-04-12	ENSG00000125149	ENSG00000125149			29564	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 6"""	C16orf6, LIN10		12477932	Standard	NM_025187		Approved	lin-10, FLJ12076	uc002erd.3	Q9BSU1	OTTHUMG00000137510		16.37:g.67184342A>G		Somatic	5	0		WXS	Illumina HiSeq	Phase_I	9	2	NM_033309	0	0	0	0	0	Q9HA86	Missense_Mutation	SNP	ENST00000219139.3	37	CCDS10828.1	.	.	.	.	.	.	.	.	.	.	a	11.96	1.794201	0.31777	.	.	ENSG00000237172	ENST00000449549	T	0.35789	1.29	4.85	4.85	0.62838	.	.	.	.	.	T	0.32675	0.0837	L	0.48642	1.525	0.52501	D	0.999954	B	0.06786	0.001	B	0.08055	0.003	T	0.13737	-1.0498	9	0.62326	D	0.03	-15.0545	11.8506	0.52410	1.0:0.0:0.0:0.0	.	16	Q6UX72	B3GN9_HUMAN	P	16	ENSP00000400157:L16P	ENSP00000400157:L16P	L	-	2	0	B3GNT9	65741843	0.006000	0.16342	0.876000	0.34364	0.016000	0.09150	1.314000	0.33597	1.828000	0.53243	0.249000	0.18162	CTC	.		0.746	C16orf70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268829.2	NM_025187	
ANKRD11	29123	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	89349917	89349917	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr16:89349917C>G	ENST00000301030.4	-	9	3493	c.3033G>C	c.(3031-3033)aaG>aaC	p.K1011N	ANKRD11_ENST00000378330.2_Missense_Mutation_p.K1011N	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	1011	Lys-rich.				bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		GGCCATCCTTCTTCTCCTTCT	0.517																																					p.K1011N		.											.	ANKRD11-139	0			c.G3033C						.						142.0	139.0	140.0					16																	89349917		2198	4300	6498	SO:0001583	missense	29123	exon9			ATCCTTCTTCTCC	AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.3033G>C	16.37:g.89349917C>G	ENSP00000301030:p.Lys1011Asn	Somatic	187	0		WXS	Illumina HiSeq	Phase_I	122	69	NM_001256183	0	0	2	12	10	Q6NTG1|Q6QMF8	Missense_Mutation	SNP	ENST00000301030.4	37	CCDS32513.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.26|16.26	3.072498|3.072498	0.55646|0.55646	.|.	.|.	ENSG00000167522|ENSG00000167522	ENST00000301030;ENST00000378330|ENST00000330736	T;T|.	0.54071|.	0.59;0.59|.	5.5|5.5	3.5|3.5	0.40072|0.40072	.|.	0.059984|.	0.64402|.	D|.	0.000004|.	T|T	0.69324|0.69324	0.3098|0.3098	M|M	0.64997|0.64997	1.995|1.995	0.80722|0.80722	D|D	1|1	D|.	0.59767|.	0.986|.	P|.	0.62435|.	0.902|.	T|T	0.71626|0.71626	-0.4536|-0.4536	10|6	0.51188|0.54805	T|T	0.08|0.06	.|.	12.1739|12.1739	0.54173|0.54173	0.0:0.8519:0.0:0.1481|0.0:0.8519:0.0:0.1481	.|.	1011|.	Q6UB99|.	ANR11_HUMAN|.	N|T	1011|562	ENSP00000301030:K1011N;ENSP00000367581:K1011N|.	ENSP00000301030:K1011N|ENSP00000330815:R562T	K|R	-|-	3|2	2|0	ANKRD11|ANKRD11	87877418|87877418	1.000000|1.000000	0.71417|0.71417	0.967000|0.967000	0.41034|0.41034	0.198000|0.198000	0.23893|0.23893	4.656000|4.656000	0.61483|0.61483	1.425000|1.425000	0.47237|0.47237	0.655000|0.655000	0.94253|0.94253	AAG|AGA	.		0.517	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430462.3	NM_013275	
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y|TVP23C_ENST00000584811.1_5'UTR|TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y|TVP23C_ENST00000519970.1_Intron|TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y|TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y													.	.	0			c.G152A						.						274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	201158	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr	Somatic	308	18		WXS	Illumina HiSeq		647	69	NM_145301	0	0	14	53	39	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT	.		0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130705.2	NM_145301	
MYO15A	51168	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	18082124	18082124	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr17:18082124C>A	ENST00000205890.5	+	66	10871	c.10533C>A	c.(10531-10533)aaC>aaA	p.N3511K	MYO15A_ENST00000418233.3_Missense_Mutation_p.P793T|MYO15A_ENST00000451725.2_3'UTR|RP11-258F1.1_ENST00000583062.1_RNA|RP11-258F1.1_ENST00000577847.1_RNA	NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	3511	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.|Tail.				inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					ACGTGGAGAACCTGCTCAGTG	0.617																																					p.N3511K		.											.	MYO15A-97	0			c.C10533A						.						128.0	144.0	139.0					17																	18082124		2148	4261	6409	SO:0001583	missense	51168	exon65			GGAGAACCTGCTC	AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.10533C>A	17.37:g.18082124C>A	ENSP00000205890:p.Asn3511Lys	Somatic	80	1		WXS	Illumina HiSeq	Phase_I	100	55	NM_016239	0	0	0	0	0	B4DFC7	Missense_Mutation	SNP	ENST00000205890.5	37	CCDS42271.1	.	.	.	.	.	.	.	.	.	.	C	12.91	2.080015	0.36662	.	.	ENSG00000091536	ENST00000205890	D	0.87256	-2.23	5.66	4.69	0.59074	FERM domain (1);	.	.	.	.	D	0.82314	0.5010	L	0.57536	1.79	0.80722	D	1	B	0.31680	0.335	B	0.28139	0.086	T	0.80151	-0.1502	9	0.51188	T	0.08	.	7.4648	0.27316	0.0:0.7138:0.1379:0.1483	.	3511	Q9UKN7	MYO15_HUMAN	K	3511	ENSP00000205890:N3511K	ENSP00000205890:N3511K	N	+	3	2	MYO15A	18022849	1.000000	0.71417	0.997000	0.53966	0.947000	0.59692	2.577000	0.46042	1.398000	0.46701	-0.422000	0.05995	AAC	.		0.617	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132048.1	NM_016239	
ASIC2	40	hgsc.bcm.edu	37	17	31618997	31618997	+	Intron	SNP	C	C	A	rs112647385	byFrequency	TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr17:31618997C>A	ENST00000359872.6	-	2	1317				ASIC2_ENST00000448983.1_5'Flank|ASIC2_ENST00000225823.2_Missense_Mutation_p.R46L	NM_001094.4	NP_001085.2	Q16515	ASIC2_HUMAN	acid-sensing (proton-gated) ion channel 2						central nervous system development (GO:0007417)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|ion transmembrane transport (GO:0034220)|monovalent inorganic cation transport (GO:0015672)|negative regulation of apoptotic process (GO:0043066)|peripheral nervous system development (GO:0007422)|phototransduction (GO:0007602)|positive regulation of synapse assembly (GO:0051965)|protein localization to synapse (GO:0035418)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of membrane potential (GO:0042391)|regulation of systemic arterial blood pressure by aortic arch baroreceptor feedback (GO:0003026)|regulation of vasoconstriction (GO:0019229)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|sensory perception of sound (GO:0007605)|sensory perception of sour taste (GO:0050915)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ion gated channel activity (GO:0022839)|ligand-gated sodium channel activity (GO:0015280)|voltage-gated sodium channel activity (GO:0005248)									Amiloride(DB00594)	CTGCAGCGCCCGCTCGCCGCC	0.806													C|||	1091	0.217851	0.112	0.1902	5008	,	,		5226	0.3194		0.2664	False		,,,				2504	0.226				p.R46L		.											.	.	0			c.G137T						.						1.0	2.0	2.0					17																	31618997		903	2226	3129	SO:0001627	intron_variant	40	exon1			AGCGCCCGCTCGC	AL834182	CCDS11276.1, CCDS42296.1	17q11.2-q12	2012-02-23	2012-02-22	2012-02-22	ENSG00000108684	ENSG00000108684		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	99	protein-coding gene	gene with protein product	"""degenerin"""	601784	"""amiloride-sensitive cation channel 1, neuronal"""	ACCN, ACCN1		8921408	Standard	NM_183377		Approved	ASIC2a, BNC1, BNaC1, hBNaC1, MDEG	uc002hhu.3	Q16515	OTTHUMG00000132885	ENST00000359872.6:c.556-179912G>T	17.37:g.31618997C>A		Somatic	0	0		WXS	Illumina HiSeq	Phase_I	5	5	NM_183377	0	0	0	0	0	E9PBX2|Q13553|Q6DJU1|Q8N3E2	Missense_Mutation	SNP	ENST00000359872.6	37	CCDS42296.1	567	0.25961538461538464	84	0.17073170731707318	81	0.22375690607734808	197	0.34440559440559443	205	0.2704485488126649	C	13.69	2.313571	0.40996	.	.	ENSG00000108684	ENST00000225823	T	0.65178	-0.14	4.45	-0.0635	0.13776	.	1.386070	0.04769	N	0.427624	T	0.00012	0.0000	N	0.08118	0	0.58432	P	5.000000000032756E-6	B	0.17038	0.02	B	0.10450	0.005	T	0.17715	-1.0360	9	0.29301	T	0.29	-24.8125	4.0823	0.09932	0.0:0.3667:0.3479:0.2854	.	46	E9PBX2	.	L	46	ENSP00000225823:R46L	ENSP00000225823:R46L	R	-	2	0	ACCN1	28643110	0.458000	0.25760	0.926000	0.36857	0.865000	0.49528	1.119000	0.31258	0.274000	0.22072	0.306000	0.20318	CGG	C|0.740;A|0.260		0.806	ASIC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447552.1	NM_183377, NM_001094	
KIAA1468	57614	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	59888685	59888685	+	Silent	SNP	C	C	T			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr18:59888685C>T	ENST00000398130.2	+	5	1045	c.813C>T	c.(811-813)aaC>aaT	p.N271N	KIAA1468_ENST00000256858.6_Silent_p.N271N	NM_020854.3	NP_065905.2	Q9P260	K1468_HUMAN	KIAA1468	271	LisH. {ECO:0000255|PROSITE- ProRule:PRU00126}.									autonomic_ganglia(1)|breast(4)|endometrium(4)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47		Colorectal(73;0.186)				TGAAGAATAACTATAAGCTTA	0.303																																					p.N271N		.											.	KIAA1468-158	0			c.C813T						.						52.0	49.0	50.0					18																	59888685		1803	4062	5865	SO:0001819	synonymous_variant	57614	exon5			GAATAACTATAAG	BC011992	CCDS11979.2	18q21.33	2005-11-03			ENSG00000134444	ENSG00000134444			29289	protein-coding gene	gene with protein product						11973628	Standard	NM_020854		Approved	HsT885, HsT3308, FLJ33841	uc002lil.3	Q9P260	OTTHUMG00000132780	ENST00000398130.2:c.813C>T	18.37:g.59888685C>T		Somatic	68	0		WXS	Illumina HiSeq	Phase_I	98	28	NM_020854	0	0	0	1	1		Silent	SNP	ENST00000398130.2	37	CCDS11979.2																																																																																			.		0.303	KIAA1468-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256187.1	NM_020854	
RHPN2	85415	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	33503622	33503622	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr19:33503622G>C	ENST00000254260.3	-	5	434	c.399C>G	c.(397-399)atC>atG	p.I133M	RHPN2_ENST00000400226.4_De_novo_Start_InFrame	NM_033103.4	NP_149094.3	Q8IUC4	RHPN2_HUMAN	rhophilin, Rho GTPase binding protein 2	133	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(5)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(3)|urinary_tract(1)	44	Esophageal squamous(110;0.137)					AATGTTCCAGGATAAAATCCT	0.348																																					p.I133M		.											.	RHPN2-516	0			c.C399G						.						64.0	63.0	64.0					19																	33503622		2203	4300	6503	SO:0001583	missense	85415	exon5			TTCCAGGATAAAA	AF268032	CCDS12427.1	19q13.12	2008-02-05				ENSG00000131941			19974	protein-coding gene	gene with protein product						12221077	Standard	NM_033103		Approved		uc002nuf.3	Q8IUC4		ENST00000254260.3:c.399C>G	19.37:g.33503622G>C	ENSP00000254260:p.Ile133Met	Somatic	50	0		WXS	Illumina HiSeq	Phase_I	54	24	NM_033103	0	0	0	0	0	B2RCG8|B3KUY8|B4DUS7|Q8N3T7|Q8N9D6|Q8NE33|Q96RU1	Missense_Mutation	SNP	ENST00000254260.3	37	CCDS12427.1	.	.	.	.	.	.	.	.	.	.	G	12.80	2.045171	0.36085	.	.	ENSG00000131941	ENST00000254260	T	0.36340	1.26	4.67	-0.356	0.12583	BRO1 domain (3);	0.000000	0.85682	D	0.000000	T	0.65407	0.2688	H	0.95151	3.63	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.69316	-0.5177	10	0.87932	D	0	4.3606	9.4837	0.38917	0.5257:0.0:0.4743:0.0	.	133	Q8IUC4	RHPN2_HUMAN	M	133	ENSP00000254260:I133M	ENSP00000254260:I133M	I	-	3	3	RHPN2	38195462	1.000000	0.71417	0.998000	0.56505	0.408000	0.30992	0.918000	0.28678	0.003000	0.14656	0.455000	0.32223	ATC	.		0.348	RHPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450828.2	NM_033103	
KIAA0355	9710	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	34832921	34832921	+	Silent	SNP	G	G	A			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr19:34832921G>A	ENST00000299505.6	+	10	2955	c.2082G>A	c.(2080-2082)ctG>ctA	p.L694L		NM_014686.3	NP_055501.2	O15063	K0355_HUMAN	KIAA0355	694										breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	41	Esophageal squamous(110;0.162)					AGCCGTCACTGCCTGTGCCCC	0.632																																					p.L694L		.											.	KIAA0355-91	0			c.G2082A						.						69.0	72.0	71.0					19																	34832921		2203	4299	6502	SO:0001819	synonymous_variant	9710	exon10			GTCACTGCCTGTG		CCDS12436.1	19q13.12	2012-11-29			ENSG00000166398	ENSG00000166398			29016	protein-coding gene	gene with protein product						9205841	Standard	NM_014686		Approved		uc002nvd.4	O15063	OTTHUMG00000180505	ENST00000299505.6:c.2082G>A	19.37:g.34832921G>A		Somatic	133	0		WXS	Illumina HiSeq	Phase_I	111	35	NM_014686	0	0	9	9	0	Q2M3W4	Silent	SNP	ENST00000299505.6	37	CCDS12436.1																																																																																			.		0.632	KIAA0355-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451678.4	NM_014686	
IGFLR1	79713	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	36230750	36230750	+	Silent	SNP	G	G	C			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr19:36230750G>C	ENST00000592537.1	-	4	682	c.582C>G	c.(580-582)gcC>gcG	p.A194A	IGFLR1_ENST00000344990.3_Intron|AD000671.6_ENST00000589807.1_3'UTR|IGFLR1_ENST00000588992.1_Intron|IGFLR1_ENST00000246532.1_Silent_p.A194A|IGFLR1_ENST00000592889.1_Intron|KMT2B_ENST00000607650.1_RNA|IGFLR1_ENST00000587101.1_5'UTR			Q9H665	IGFR1_HUMAN	IGF-like family receptor 1	194						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|kidney(3)|large_intestine(1)|lung(8)|prostate(1)	15						GATAGGGGTCGGCTTTCTCCT	0.617																																					p.A194A		.											.	IGFLR1-90	0			c.C582G						.						88.0	91.0	90.0					19																	36230750		2203	4300	6503	SO:0001819	synonymous_variant	79713	exon4			GGGGTCGGCTTTC	AK026226	CCDS12472.1	19q13.12	2012-10-02	2011-04-04	2011-04-04	ENSG00000126246	ENSG00000126246			23620	protein-coding gene	gene with protein product		614143	"""U2(RNU2) small nuclear RNA auxiliary factor 1-like 4"", ""transmembrane protein 149"""	U2AF1L4, TMEM149		21454693	Standard	NM_024660		Approved	FLJ22573	uc002obd.4	Q9H665		ENST00000592537.1:c.582C>G	19.37:g.36230750G>C		Somatic	197	0		WXS	Illumina HiSeq	Phase_I	159	66	NM_024660	0	0	0	1	1	Q8N5X0	Silent	SNP	ENST00000592537.1	37	CCDS12472.1																																																																																			.		0.617	IGFLR1-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459077.1	NM_024660	
CNFN	84518	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	42893120	42893120	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr19:42893120A>G	ENST00000222032.5	-	2	119	c.70T>C	c.(70-72)Tgg>Cgg	p.W24R	CNFN_ENST00000597255.1_Missense_Mutation_p.W24R	NM_032488.3	NP_115877.2	Q9BYD5	CNFN_HUMAN	cornifelin	24					keratinization (GO:0031424)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				lung(1)|prostate(1)	2		Prostate(69;0.00899)				CCTGTGTGCCAGTCACTGAGC	0.617																																					p.W24R		.											.	CNFN-90	0			c.T70C						.						133.0	99.0	111.0					19																	42893120		2203	4300	6503	SO:0001583	missense	84518	exon2			TGTGCCAGTCACT	AB049591	CCDS12606.1	19q13.31	2006-01-11				ENSG00000105427			30183	protein-coding gene	gene with protein product		611764					Standard	NM_032488		Approved	PLAC8L2	uc002otp.4	Q9BYD5		ENST00000222032.5:c.70T>C	19.37:g.42893120A>G	ENSP00000222032:p.Trp24Arg	Somatic	50	0		WXS	Illumina HiSeq	Phase_I	37	22	NM_032488	0	0	1	1	0	B2R569	Missense_Mutation	SNP	ENST00000222032.5	37	CCDS12606.1	.	.	.	.	.	.	.	.	.	.	A	16.88	3.244613	0.59103	.	.	ENSG00000105427	ENST00000222032	T	0.29655	1.56	5.0	3.97	0.46021	.	0.000000	0.85682	D	0.000000	T	0.53738	0.1815	M	0.89658	3.05	0.46078	D	0.998858	D	0.56746	0.977	P	0.56612	0.802	T	0.60702	-0.7211	10	0.72032	D	0.01	-18.0017	10.0235	0.42057	0.8298:0.1702:0.0:0.0	.	24	Q9BYD5	CNFN_HUMAN	R	24	ENSP00000222032:W24R	ENSP00000222032:W24R	W	-	1	0	CNFN	47584960	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.707000	0.68370	0.847000	0.35167	-0.471000	0.05019	TGG	.		0.617	CNFN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463859.1	NM_032488	
ZNF285	26974	bcgsc.ca	37	19	44896602	44896602	+	Missense_Mutation	SNP	A	A	C	rs149291798		TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr19:44896602A>C	ENST00000330997.4	-	3	108	c.44T>G	c.(43-45)gTt>gGt	p.V15G	ZNF285_ENST00000544719.2_Missense_Mutation_p.V15G|ZNF285_ENST00000591679.1_Missense_Mutation_p.V22G|CTC-512J12.4_ENST00000588655.1_RNA|CTC-512J12.6_ENST00000588212.1_Intron	NM_152354.3	NP_689567.3	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	15	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|prostate(5)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	44						GGTGAAGACAACAGCCACATC	0.448																																					p.V15G													.	ZNF285-94	0			c.T44G						.						126.0	112.0	117.0					19																	44896602		2203	4300	6503	SO:0001583	missense	26974	exon3			AAGACAACAGCCA	AK055309	CCDS12638.1, CCDS74389.1	19q13.32	2013-01-08	2010-04-14	2010-04-14		ENSG00000267508		"""Zinc fingers, C2H2-type"", ""-"""	13079	protein-coding gene	gene with protein product			"""zinc finger protein 285A"""	ZNF285A			Standard	XM_005258734		Approved			Q96NJ3	OTTHUMG00000178848	ENST00000330997.4:c.44T>G	19.37:g.44896602A>C	ENSP00000333595:p.Val15Gly	Somatic	151	0		WXS	Illumina HiSeq	Phase_1	102	19	NM_152354	0	0	1	1	0	Q17RJ3|Q6B0A8|Q6ISR5	Missense_Mutation	SNP	ENST00000330997.4	37	CCDS12638.1	.	.	.	.	.	.	.	.	.	.	A	23.0	4.358004	0.82243	.	.	ENSG00000062370	ENST00000544719;ENST00000330997	T	0.04758	3.56	3.07	3.07	0.35406	Krueppel-associated box (4);	.	.	.	.	T	0.32645	0.0836	H	0.99156	4.45	0.43808	D	0.996368	D;D	0.69078	0.997;0.976	D;P	0.64776	0.929;0.906	T	0.50709	-0.8796	9	0.87932	D	0	.	9.5743	0.39447	1.0:0.0:0.0:0.0	.	39;15	B7ZLR9;Q96NJ3	.;ZN285_HUMAN	G	38;15	ENSP00000333595:V15G	ENSP00000333595:V15G	V	-	2	0	ZNF285	49588442	0.949000	0.32298	0.926000	0.36857	0.886000	0.51366	3.679000	0.54634	1.420000	0.47138	0.369000	0.22263	GTT	.		0.448	ZNF285-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443600.1	NM_152354	
DMPK	1760	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	46280763	46280763	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr19:46280763G>A	ENST00000291270.4	-	8	1093	c.968C>T	c.(967-969)aCa>aTa	p.T323I	DMPK_ENST00000447742.2_Missense_Mutation_p.T323I|DMPK_ENST00000458663.2_Missense_Mutation_p.T323I|DMPK_ENST00000343373.4_Missense_Mutation_p.T333I|DMPK_ENST00000354227.5_Missense_Mutation_p.T323I|DMPK_ENST00000595361.1_5'Flank|DMPK_ENST00000600757.1_Missense_Mutation_p.T333I	NM_004409.3	NP_004400.4	Q09013	DMPK_HUMAN	dystrophia myotonica-protein kinase	323	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular calcium ion homeostasis (GO:0006874)|muscle cell apoptotic process (GO:0010657)|nuclear envelope organization (GO:0006998)|protein phosphorylation (GO:0006468)|regulation of catalytic activity (GO:0050790)|regulation of excitatory postsynaptic membrane potential involved in skeletal muscle contraction (GO:0014853)|regulation of heart contraction (GO:0008016)|regulation of myotube differentiation (GO:0010830)|regulation of skeletal muscle contraction by calcium ion signaling (GO:0014722)|regulation of sodium ion transport (GO:0002028)|regulation of synapse structural plasticity (GO:0051823)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|integral component of mitochondrial outer membrane (GO:0031307)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|myosin phosphatase regulator activity (GO:0017020)|protein serine/threonine kinase activity (GO:0004674)			endometrium(5)|kidney(1)|large_intestine(1)|lung(6)|stomach(1)|urinary_tract(2)	16		Ovarian(192;0.0308)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00616)|GBM - Glioblastoma multiforme(486;0.0825)|Epithelial(262;0.24)		GCCCAGCCGTGTCTCCGGGGG	0.647																																					p.T333I	Esophageal Squamous(35;307 869 9153 24033 28903)	.											.	DMPK-546	0			c.C998T						.						39.0	41.0	40.0					19																	46280763		2203	4300	6503	SO:0001583	missense	1760	exon7			AGCCGTGTCTCCG	L19268	CCDS12674.1, CCDS46117.1, CCDS46118.1, CCDS46119.1, CCDS74400.1	19q13.3	2014-02-05					2.7.11.1		2933	protein-coding gene	gene with protein product	"""dystrophia myotonica 1"", ""DM protein kinase"", ""myotonin protein kinase A"", ""myotonic dystrophy associated protein kinase"", ""thymopoietin homolog"""	605377	"""dystrophia myotonica 1 (includes dystrophia myotonia protein kinase)"""	DM1, DM		1546325, 1546326	Standard	NM_001288765		Approved	DMK, DM1PK, MDPK, MT-PK	uc002pdf.1	Q09013		ENST00000291270.4:c.968C>T	19.37:g.46280763G>A	ENSP00000291270:p.Thr323Ile	Somatic	82	0		WXS	Illumina HiSeq	Phase_I	76	31	NM_001081563	0	0	27	67	40	E5KR08|Q16205|Q6P5Z6	Missense_Mutation	SNP	ENST00000291270.4	37	CCDS12674.1	.	.	.	.	.	.	.	.	.	.	g	6.239	0.412186	0.11812	.	.	ENSG00000104936	ENST00000458663;ENST00000342805;ENST00000291270;ENST00000447742;ENST00000377750;ENST00000343373;ENST00000348168;ENST00000354227	T;T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2;-0.2	4.63	-1.42	0.08913	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.960065	0.08582	N	0.924432	T	0.47985	0.1475	L	0.48935	1.535	0.09310	N	1	B;B;B;B;B;B;B;B	0.10296	0.001;0.0;0.003;0.001;0.001;0.001;0.001;0.0	B;B;B;B;B;B;B;B	0.12156	0.005;0.002;0.003;0.007;0.007;0.004;0.001;0.001	T	0.31392	-0.9945	10	0.21014	T	0.42	.	4.9214	0.13871	0.5892:0.0:0.2497:0.1611	.	323;323;349;323;323;323;370;333	Q09013-12;Q09013-16;G5E982;E5KR07;E5KR05;Q09013;Q59FU6;E5KR08	.;.;.;.;.;DMPK_HUMAN;.;.	I	323;349;323;323;323;333;333;323	ENSP00000401753:T323I;ENSP00000291270:T323I;ENSP00000413417:T323I;ENSP00000345997:T333I;ENSP00000346168:T323I	ENSP00000291270:T323I	T	-	2	0	DMPK	50972603	0.000000	0.05858	0.091000	0.20842	0.655000	0.38815	-1.221000	0.02968	-0.044000	0.13491	-0.254000	0.11334	ACA	.		0.647	DMPK-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460572.1	NM_004409	
VN1R2	317701	broad.mit.edu	37	19	53762720	53762720	+	Silent	SNP	T	T	C			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr19:53762720T>C	ENST00000341702.3	+	1	1176	c.1092T>C	c.(1090-1092)ccT>ccC	p.P364P	VN1R2_ENST00000598458.1_Intron	NM_173856.2	NP_776255.2	Q8NFZ6	VN1R2_HUMAN	vomeronasal 1 receptor 2	364					response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	pheromone receptor activity (GO:0016503)	p.P364P(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(134;0.00301)		CTATTAGCCCTTTTGTTCTCA	0.433																																					p.P364P													.	VN1R2-90	1	Substitution - coding silent(1)	lung(1)	c.T1092C						.						196.0	182.0	187.0					19																	53762720		2203	4300	6503	SO:0001819	synonymous_variant	317701	exon1			TAGCCCTTTTGTT	AF370359	CCDS12862.1	19q13.42	2012-08-22			ENSG00000196131	ENSG00000196131		"""Vomeronasal receptors / Type 1"", ""GPCR / Unclassified : Vomeronasal receptors, type 1"""	19872	protein-coding gene	gene with protein product						12123587	Standard	NM_173856		Approved	V1RL2	uc002qbi.2	Q8NFZ6		ENST00000341702.3:c.1092T>C	19.37:g.53762720T>C		Somatic	217	1		WXS	Illumina HiSeq	Phase_I	240	3	NM_173856	0	0	0	0	0	A1L411|Q8TDU4	Silent	SNP	ENST00000341702.3	37	CCDS12862.1																																																																																			.		0.433	VN1R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464285.1	NM_173856	
PRKCG	5582	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	54385815	54385815	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr19:54385815G>T	ENST00000263431.3	+	1	349	c.67G>T	c.(67-69)Ggg>Tgg	p.G23W	PRKCG_ENST00000540413.1_Missense_Mutation_p.G23W|PRKCG_ENST00000536044.1_Missense_Mutation_p.G23W|PRKCG_ENST00000542049.1_5'Flank	NM_002739.3	NP_002730.1	P05129	KPCG_HUMAN	protein kinase C, gamma	23					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cell death (GO:0008219)|chemosensory behavior (GO:0007635)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein ubiquitination (GO:0031397)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|positive regulation of mismatch repair (GO:0032425)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to morphine (GO:0043278)|response to pain (GO:0048265)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic membrane (GO:0097060)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(4)|ovary(2)|pancreas(2)|skin(1)	10	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)	Tamoxifen(DB00675)	TTGCAGAAAGGGGGCCCTGAG	0.627																																					p.G23W		.											.	PRKCG-1367	0			c.G67T						.						66.0	74.0	71.0					19																	54385815		2203	4300	6503	SO:0001583	missense	5582	exon1			AGAAAGGGGGCCC	M13977	CCDS12867.1	19q13.4	2014-09-17			ENSG00000126583	ENSG00000126583	2.7.11.1		9402	protein-coding gene	gene with protein product	"""PKC-gamma"""	176980		PKCG, SCA14		8432525, 3755548	Standard	NM_002739		Approved	PKCC, MGC57564	uc002qcq.1	P05129	OTTHUMG00000064846	ENST00000263431.3:c.67G>T	19.37:g.54385815G>T	ENSP00000263431:p.Gly23Trp	Somatic	175	0		WXS	Illumina HiSeq	Phase_I	156	72	NM_002739	0	0	0	0	0	B7Z8Q0	Missense_Mutation	SNP	ENST00000263431.3	37	CCDS12867.1	.	.	.	.	.	.	.	.	.	.	G	19.99	3.929442	0.73327	.	.	ENSG00000126583	ENST00000536044;ENST00000540413;ENST00000263431;ENST00000419486	D;D;D	0.95069	-3.6;-3.6;-3.6	4.08	4.08	0.47627	.	.	.	.	.	D	0.96830	0.8965	M	0.77820	2.39	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.999;0.999	D	0.97398	0.9994	9	0.87932	D	0	.	14.1554	0.65415	0.0:0.0:1.0:0.0	.	23;23;23;23	F5H5C4;B7Z870;B7Z3W6;P05129	.;.;.;KPCG_HUMAN	W	23;23;23;46	ENSP00000440541:G23W;ENSP00000443493:G23W;ENSP00000263431:G23W	ENSP00000263431:G23W	G	+	1	0	PRKCG	59077627	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.851000	0.92205	1.996000	0.58369	0.491000	0.48974	GGG	.		0.627	PRKCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139233.3	NM_002739	
KIR3DL3	115653	hgsc.bcm.edu	37	19	55239373	55239373	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr19:55239373G>A	ENST00000291860.1	+	4	670	c.652G>A	c.(652-654)Gta>Ata	p.V218I	KIR2DL4_ENST00000396284.2_Intron|KIR3DL1_ENST00000538269.1_Intron|KIR3DL1_ENST00000541392.1_Intron|KIR3DL1_ENST00000402254.2_Intron|CTB-61M7.1_ENST00000400864.3_RNA	NM_153443.3	NP_703144.2	Q8N743	KI3L3_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 3	218						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(3)|prostate(1)|skin(1)	21				GBM - Glioblastoma multiforme(193;0.0192)		CATCGTGGTCGTAGGTGAGAG	0.542																																					p.V218I		.											.	KIR3DL3-46	0			c.G652A						.						8.0	8.0	8.0					19																	55239373		1846	3121	4967	SO:0001583	missense	115653	exon4			GTGGTCGTAGGTG	AF352324	CCDS12903.1	19q13.4	2014-05-22			ENSG00000242019	ENSG00000242019		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	16312	protein-coding gene	gene with protein product		610095				11513144	Standard	NM_153443		Approved	KIRC1, KIR3DL7, KIR44, CD158z	uc002qgu.1	Q8N743	OTTHUMG00000065884	ENST00000291860.1:c.652G>A	19.37:g.55239373G>A	ENSP00000291860:p.Val218Ile	Somatic	181	0		WXS	Illumina HiSeq	Phase_I	146	65	NM_153443	0	0	0	0	0	A9PL62|A9PL64|A9PL65|A9PL66|A9PL67|A9PL68|A9PZV4|A9PZV7|A9PZV8|A9Q066|A9Q0R5|A9Q242|A9Q250|A9Q251|O95056|Q1X775|Q1X777|Q1X778|Q1X779|Q1X780|Q1X781|Q1X782|Q1X783|Q7Z7N4|Q8NHI2|Q8NHI3|Q9UEI4	Missense_Mutation	SNP	ENST00000291860.1	37	CCDS12903.1	.	.	.	.	.	.	.	.	.	.	-	4.693	0.128795	0.08981	.	.	ENSG00000242019	ENST00000291860	T	0.00730	5.77	1.38	0.293	0.15742	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.958988	0.08407	N	0.950530	T	0.00328	0.0010	N	0.00436	-1.5	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.44345	-0.9334	10	0.45353	T	0.12	.	4.3253	0.11038	0.5511:0.0:0.4489:0.0	.	218	Q8N743	KI3L3_HUMAN	I	218	ENSP00000291860:V218I	ENSP00000291860:V218I	V	+	1	0	KIR3DL3	59931185	0.003000	0.15002	0.002000	0.10522	0.002000	0.02628	-0.697000	0.05098	-0.402000	0.07633	-1.140000	0.01884	GTA	.		0.542	KIR3DL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141147.1	NM_153443	
CEP250	11190	bcgsc.ca	37	20	34092577	34092577	+	Missense_Mutation	SNP	A	A	C	rs200640167		TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr20:34092577A>C	ENST00000397527.1	+	30	7100	c.6380A>C	c.(6379-6381)cAc>cCc	p.H2127P	CEP250_ENST00000342580.4_Missense_Mutation_p.H2071P	NM_007186.3	NP_009117.2	Q9BV73	CP250_HUMAN	centrosomal protein 250kDa	2127	Gln/Glu-rich.				centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of centriole-centriole cohesion (GO:0030997)	centriole (GO:0005814)|centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)|spindle pole centrosome (GO:0031616)	protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			GCCTTACCCCACAGCCACAAA	0.542																																					p.H2127P													.	CEP250-27	0			c.A6380C						.						76.0	83.0	81.0					20																	34092577		2203	4300	6503	SO:0001583	missense	11190	exon30			TACCCCACAGCCA	AF022655	CCDS13255.1	20q11.22	2014-02-20	2006-01-11	2006-01-11	ENSG00000126001	ENSG00000126001			1859	protein-coding gene	gene with protein product		609689	"""centrosomal protein 2"""	CEP2		9506584, 9647649	Standard	NM_007186		Approved	C-NAP1	uc021wco.1	Q9BV73	OTTHUMG00000032343	ENST00000397527.1:c.6380A>C	20.37:g.34092577A>C	ENSP00000380661:p.His2127Pro	Somatic	149	0		WXS	Illumina HiSeq	Phase_1	117	22	NM_007186	0	0	11	11	0	E1P5Q3|O14812|O60588|Q9H450	Missense_Mutation	SNP	ENST00000397527.1	37	CCDS13255.1	.	.	.	.	.	.	.	.	.	.	A	5.343	0.248507	0.10130	.	.	ENSG00000126001	ENST00000397527;ENST00000342580;ENST00000422671	T;T;T	0.41400	3.0;3.0;1.0	4.87	-0.489	0.12052	.	1.268200	0.05263	N	0.516062	T	0.34600	0.0903	L	0.46157	1.445	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.22591	-1.0212	10	0.30854	T	0.27	.	6.7174	0.23310	0.2958:0.5335:0.1707:0.0	.	2127	Q9BV73	CP250_HUMAN	P	2127;2071;615	ENSP00000380661:H2127P;ENSP00000341541:H2071P;ENSP00000395992:H615P	ENSP00000341541:H2071P	H	+	2	0	CEP250	33555991	0.000000	0.05858	0.000000	0.03702	0.116000	0.19942	0.022000	0.13511	-0.272000	0.09259	0.459000	0.35465	CAC	.		0.542	CEP250-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078877.7	NM_007186	
SAMHD1	25939	hgsc.bcm.edu	37	20	35563508	35563508	+	Missense_Mutation	SNP	G	G	C	rs121434517		TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr20:35563508G>C	ENST00000262878.4	-	4	632	c.433C>G	c.(433-435)Cga>Gga	p.R145G	SAMHD1_ENST00000373694.5_5'UTR	NM_015474.3	NP_056289.2	Q9Y3Z3	SAMH1_HUMAN	SAM domain and HD domain 1	145			R -> Q (in AGS5). {ECO:0000269|PubMed:19525956}.		dATP catabolic process (GO:0046061)|defense response to virus (GO:0051607)|dGTP catabolic process (GO:0006203)|immune response (GO:0006955)|innate immune response (GO:0045087)|protein homotetramerization (GO:0051289)|regulation of innate immune response (GO:0045088)	intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dGTP binding (GO:0032567)|dGTPase activity (GO:0008832)|nucleic acid binding (GO:0003676)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(8)|urinary_tract(1)	20		Myeloproliferative disorder(115;0.00878)				TTGATGTATCGAAGACGTTGA	0.433																																					p.R145G		.											.	SAMHD1-90	0			c.C433G						.						135.0	125.0	129.0					20																	35563508		2203	4300	6503	SO:0001583	missense	25939	exon4			TGTATCGAAGACG	AF228421	CCDS13288.1	20q11.23	2014-09-17			ENSG00000101347	ENSG00000101347		"""Sterile alpha motif (SAM) domain containing"""	15925	protein-coding gene	gene with protein product	"""HD domain containing 1"", ""monocyte protein 5"", ""Aicardi-Goutieres syndrome 5"""	606754				11064105, 11230166	Standard	NM_015474		Approved	SBBI88, Mg11, HDDC1, MOP-5, AGS5	uc002xgh.2	Q9Y3Z3	OTTHUMG00000032402	ENST00000262878.4:c.433C>G	20.37:g.35563508G>C	ENSP00000262878:p.Arg145Gly	Somatic	114	0		WXS	Illumina HiSeq	Phase_I	73	4	NM_015474	0	0	34	34	0	B4E2A5|E1P5V2|Q5JXG8|Q8N491|Q9H004|Q9H005|Q9H3U9	Missense_Mutation	SNP	ENST00000262878.4	37	CCDS13288.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.343156	0.82022	.	.	ENSG00000101347	ENST00000262878	D	0.96522	-4.04	6.05	4.04	0.47022	HD domain (1);	0.000000	0.85682	D	0.000000	D	0.98327	0.9445	H	0.94222	3.51	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.98576	1.0648	10	0.87932	D	0	-16.0364	9.3019	0.37851	0.0657:0.0:0.6789:0.2553	.	145	Q9Y3Z3	SAMH1_HUMAN	G	145	ENSP00000262878:R145G	ENSP00000262878:R145G	R	-	1	2	SAMHD1	34996922	1.000000	0.71417	0.967000	0.41034	0.983000	0.72400	3.147000	0.50639	1.571000	0.49722	0.650000	0.86243	CGA	.		0.433	SAMHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079062.2	NM_015474	
PIK3CA	5290	hgsc.bcm.edu;broad.mit.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.E545K	Colon(199;1504 1750 3362 26421 31210 32040)	.		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	.	PIK3CA-27752	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)	c.G1633A						.						61.0	60.0	60.0					3																	178936091		1813	4072	5885	SO:0001583	missense	5290	exon10			ATCACTGAGCAGG		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys	Somatic	92	0		WXS	Illumina HiSeq	Phase_I	68	4	NM_006218	0	0	12	12	0	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG	.		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
ANXA3	306	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	79531260	79531260	+	Silent	SNP	A	A	T			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr4:79531260A>T	ENST00000264908.6	+	13	1342	c.963A>T	c.(961-963)ggA>ggT	p.G321G	ANXA3_ENST00000503570.2_Silent_p.G282G|ANXA3_ENST00000512884.1_Silent_p.G282G	NM_005139.2	NP_005130.1	P12429	ANXA3_HUMAN	annexin A3	321					defense response to bacterium (GO:0042742)|neutrophil degranulation (GO:0043312)|phagocytosis (GO:0006909)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|specific granule (GO:0042581)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|phospholipase A2 inhibitor activity (GO:0019834)			NS(1)|breast(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15						TCTGTGGTGGAGATGACTGAA	0.373																																					p.G321G	GBM(2;126 157 27790 28920 42492)	.											.	ANXA3-90	0			c.A963T						.						90.0	89.0	89.0					4																	79531260		2203	4300	6503	SO:0001819	synonymous_variant	306	exon13			TGGTGGAGATGAC	M63310	CCDS3584.1	4q21.21	2009-07-10			ENSG00000138772	ENSG00000138772	3.1.4.43	"""Annexins"""	541	protein-coding gene	gene with protein product		106490		ANX3		1830024	Standard	XM_005262973		Approved		uc003hld.3	P12429	OTTHUMG00000130198	ENST00000264908.6:c.963A>T	4.37:g.79531260A>T		Somatic	94	1		WXS	Illumina HiSeq	Phase_I	78	39	NM_005139	0	0	71	111	40	B2R9W6|Q6LET2	Silent	SNP	ENST00000264908.6	37	CCDS3584.1																																																																																			.		0.373	ANXA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252516.3	NM_005139	
GAB1	2549	hgsc.bcm.edu	37	4	144354854	144354854	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr4:144354854A>G	ENST00000262994.4	+	3	880	c.578A>G	c.(577-579)aAg>aGg	p.K193R	GAB1_ENST00000262995.4_Missense_Mutation_p.K193R|GAB1_ENST00000505913.1_Missense_Mutation_p.K90R	NM_002039.3	NP_002030.2	Q13480	GAB1_HUMAN	GRB2-associated binding protein 1	193					activation of JUN kinase activity (GO:0007257)|cell proliferation (GO:0008283)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermis development (GO:0008544)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|interleukin-6-mediated signaling pathway (GO:0070102)|labyrinthine layer development (GO:0060711)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|regulation of cell migration (GO:0030334)|response to oxidative stress (GO:0006979)	cytosol (GO:0005829)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			breast(3)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	30	all_hematologic(180;0.158)					CAAAGCAAGAAGCCCGAACCC	0.438																																					p.K193R		.											.	GAB1-1146	0			c.A578G						.						70.0	69.0	69.0					4																	144354854		2203	4300	6503	SO:0001583	missense	2549	exon3			GCAAGAAGCCCGA	U43885	CCDS3759.1, CCDS3760.1	4q31.1	2013-01-10			ENSG00000109458	ENSG00000109458		"""Pleckstrin homology (PH) domain containing"""	4066	protein-coding gene	gene with protein product		604439				8596638	Standard	NM_207123		Approved		uc003ijd.3	Q13480	OTTHUMG00000161432	ENST00000262994.4:c.578A>G	4.37:g.144354854A>G	ENSP00000262994:p.Lys193Arg	Somatic	70	0		WXS	Illumina HiSeq	Phase_I	59	3	NM_207123	0	0	13	13	0	A8K152|Q4W5G2|Q6P1W2	Missense_Mutation	SNP	ENST00000262994.4	37	CCDS3759.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	28.9|28.9	4.960201|4.960201	0.92791|0.92791	.|.	.|.	ENSG00000109458|ENSG00000109458	ENST00000262995;ENST00000262994;ENST00000514639;ENST00000505913;ENST00000509992|ENST00000512843	T;T;T;T;T|.	0.37235|.	2.51;2.52;1.21;2.07;1.29|.	5.91|5.91	5.91|5.91	0.95273|0.95273	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.69904|0.69904	0.3163|0.3163	L|L	0.53249|0.53249	1.67|1.67	0.80722|0.80722	D|D	1|1	D;D|.	0.76494|.	0.996;0.999|.	D;D|.	0.78314|.	0.955;0.991|.	T|T	0.67518|0.67518	-0.5650|-0.5650	10|5	0.10111|.	T|.	0.7|.	-8.8266|-8.8266	16.3483|16.3483	0.83171|0.83171	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	193;193|.	Q13480;Q13480-2|.	GAB1_HUMAN;.|.	R|G	193;193;193;90;172|71	ENSP00000262995:K193R;ENSP00000262994:K193R;ENSP00000427435:K193R;ENSP00000424554:K90R;ENSP00000425921:K172R|.	ENSP00000262994:K193R|.	K|S	+|+	2|1	0|0	GAB1|GAB1	144574304|144574304	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.929000|0.929000	0.56500|0.56500	5.129000|5.129000	0.64739|0.64739	2.254000|2.254000	0.74563|0.74563	0.533000|0.533000	0.62120|0.62120	AAG|AGC	.		0.438	GAB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000364998.1	NM_002039	
CCNB1	891	bcgsc.ca	37	5	68470159	68470159	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr5:68470159G>A	ENST00000256442.5	+	5	881	c.628G>A	c.(628-630)Gta>Ata	p.V210I	snoU13_ENST00000459230.1_RNA	NM_031966.3	NP_114172.1	P14635	CCNB1_HUMAN	cyclin B1	210					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cellular response to fatty acid (GO:0071398)|cellular response to hypoxia (GO:0071456)|cellular response to iron(III) ion (GO:0071283)|cellular response to organic cyclic compound (GO:0071407)|digestive tract development (GO:0048565)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|mitotic metaphase plate congression (GO:0007080)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle checkpoint (GO:0071174)|mitotic spindle stabilization (GO:0043148)|negative regulation of gene expression (GO:0010629)|negative regulation of protein phosphorylation (GO:0001933)|oocyte maturation (GO:0001556)|positive regulation of attachment of spindle microtubules to kinetochore (GO:0051987)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of histone phosphorylation (GO:0033129)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of chromosome condensation (GO:0060623)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to DDT (GO:0046680)|response to drug (GO:0042493)|response to mechanical stimulus (GO:0009612)|spermatogenesis (GO:0007283)|tissue regeneration (GO:0042246)|ventricular cardiac muscle cell development (GO:0055015)	centrosome (GO:0005813)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	kinase activity (GO:0016301)|patched binding (GO:0005113)|protein kinase binding (GO:0019901)			large_intestine(2)|lung(5)|skin(1)	8		Lung NSC(167;5.51e-05)|Prostate(74;0.00634)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.24e-56)|Epithelial(20;1.12e-52)|all cancers(19;2.63e-48)|Lung(70;0.0177)		TGACTGGCTAGTACAGGTTCA	0.433																																					p.V210I													.	CCNB1-650	0			c.G628A						.						181.0	171.0	175.0					5																	68470159		2203	4300	6503	SO:0001583	missense	891	exon5			TGGCTAGTACAGG	U22364	CCDS3997.1	5q12	2008-07-18			ENSG00000134057	ENSG00000134057			1579	protein-coding gene	gene with protein product	"""G2/mitotic-specific cyclin B1"""	123836		CCNB		1386342	Standard	NM_031966		Approved		uc003jvm.3	P14635	OTTHUMG00000097817	ENST00000256442.5:c.628G>A	5.37:g.68470159G>A	ENSP00000256442:p.Val210Ile	Somatic	193	1		WXS	Illumina HiSeq	Phase_1	150	19	NM_031966	0	0	45	45	0	A8K066|Q5TZP9	Missense_Mutation	SNP	ENST00000256442.5	37	CCDS3997.1	.	.	.	.	.	.	.	.	.	.	G	14.30	2.493419	0.44352	.	.	ENSG00000134057	ENST00000256442;ENST00000506572;ENST00000505500;ENST00000507798	T;T;T;T	0.11277	2.79;2.79;2.79;2.79	6.16	3.43	0.39272	Cyclin, N-terminal (2);Cyclin-like (3);	0.063186	0.64402	N	0.000004	T	0.08133	0.0203	N	0.25957	0.775	0.58432	D	0.999993	B;B;B	0.14012	0.006;0.009;0.002	B;B;B	0.27170	0.029;0.077;0.016	T	0.24440	-1.0160	10	0.14656	T	0.56	.	10.5457	0.45058	0.2071:0.0:0.7929:0.0	.	210;210;210	E9PC90;Q5TZP9;P14635	.;.;CCNB1_HUMAN	I	210;210;210;26	ENSP00000256442:V210I;ENSP00000423387:V210I;ENSP00000424588:V210I;ENSP00000426230:V26I	ENSP00000256442:V210I	V	+	1	0	CCNB1	68505915	1.000000	0.71417	0.898000	0.35279	0.993000	0.82548	3.423000	0.52756	0.474000	0.27392	0.650000	0.86243	GTA	.		0.433	CCNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215084.1	NM_031966	
PCDHB2	56133	hgsc.bcm.edu	37	5	140476195	140476195	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr5:140476195G>T	ENST00000194155.4	+	1	1969	c.1821G>T	c.(1819-1821)caG>caT	p.Q607H		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	607	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGTCGTACCAGCTGCTCAAGG	0.721																																					p.Q607H		.											.	PCDHB2-96	0			c.G1821T						.						15.0	17.0	16.0					5																	140476195		1966	3871	5837	SO:0001583	missense	56133	exon1			GTACCAGCTGCTC	AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.1821G>T	5.37:g.140476195G>T	ENSP00000194155:p.Gln607His	Somatic	232	0		WXS	Illumina HiSeq	Phase_I	181	23	NM_018936	0	0	14	14	0	Q4KMU1	Missense_Mutation	SNP	ENST00000194155.4	37	CCDS4244.1	.	.	.	.	.	.	.	.	.	.	G	12.91	2.080942	0.36758	.	.	ENSG00000112852	ENST00000194155	T	0.52983	0.64	4.39	3.5	0.40072	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.29524	0.0736	N	0.11201	0.11	0.31320	N	0.686092	P	0.40032	0.699	B	0.43155	0.41	T	0.19224	-1.0312	9	0.48119	T	0.1	.	4.967	0.14096	0.1693:0.0:0.6498:0.1808	.	607	Q9Y5E7	PCDB2_HUMAN	H	607	ENSP00000194155:Q607H	ENSP00000194155:Q607H	Q	+	3	2	PCDHB2	140456379	0.001000	0.12720	1.000000	0.80357	0.997000	0.91878	-0.515000	0.06290	2.151000	0.67156	0.556000	0.70494	CAG	.		0.721	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251801.2	NM_018936	
PCDHB3	56132	bcgsc.ca	37	5	140481333	140481333	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr5:140481333T>G	ENST00000231130.2	+	1	1100	c.1100T>G	c.(1099-1101)gTt>gGt	p.V367G	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	367	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GTACTGGCTGTTTTCAGTGTT	0.458																																					p.V367G													.	PCDHB3-92	0			c.T1100G						.						85.0	81.0	82.0					5																	140481333		2203	4300	6503	SO:0001583	missense	56132	exon1			TGGCTGTTTTCAG	AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.1100T>G	5.37:g.140481333T>G	ENSP00000231130:p.Val367Gly	Somatic	110	0		WXS	Illumina HiSeq	Phase_1	105	23	NM_018937	0	0	1	1	0	B2R8P2	Missense_Mutation	SNP	ENST00000231130.2	37	CCDS4245.1	.	.	.	.	.	.	.	.	.	.	T	17.38	3.375104	0.61735	.	.	ENSG00000113205	ENST00000231130	T	0.52526	0.66	4.93	4.93	0.64822	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.77260	0.4104	H	0.95328	3.655	0.44123	D	0.996906	D	0.63880	0.993	D	0.72075	0.976	D	0.84871	0.0825	9	0.87932	D	0	.	14.9009	0.70678	0.0:0.0:0.0:1.0	.	367	Q9Y5E6	PCDB3_HUMAN	G	367	ENSP00000231130:V367G	ENSP00000231130:V367G	V	+	2	0	PCDHB3	140461517	0.922000	0.31269	0.997000	0.53966	0.993000	0.82548	6.057000	0.71119	1.975000	0.57531	0.533000	0.62120	GTT	.		0.458	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251817.2	NM_018937	
PCDHB5	26167	broad.mit.edu	37	5	140517124	140517124	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr5:140517124C>G	ENST00000231134.5	+	1	2325	c.2108C>G	c.(2107-2109)tCg>tGg	p.S703W		NM_015669.2	NP_056484.1	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5	703					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|kidney(1)|large_intestine(18)|lung(25)|ovary(3)|prostate(6)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	81			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTCCTCTTTTCGGTGCTCCTG	0.701																																					p.S703W													.	PCDHB5-95	0			c.C2108G						.						88.0	93.0	92.0					5																	140517124		2201	4296	6497	SO:0001583	missense	26167	exon1			TCTTTTCGGTGCT	AF152498	CCDS4247.1	5q31	2010-01-26			ENSG00000113209	ENSG00000113209		"""Cadherins / Protocadherins : Clustered"""	8690	other	protocadherin		606331				10380929	Standard	NM_015669		Approved	DKFZp586B0217, PCDH-BETA5	uc003liq.3	Q9Y5E4	OTTHUMG00000129616	ENST00000231134.5:c.2108C>G	5.37:g.140517124C>G	ENSP00000231134:p.Ser703Trp	Somatic	311	0		WXS	Illumina HiSeq	Phase_I	211	6	NM_015669	0	0	8	8	0	Q549F4|Q9UFU9	Missense_Mutation	SNP	ENST00000231134.5	37	CCDS4247.1	.	.	.	.	.	.	.	.	.	.	C	11.95	1.790762	0.31685	.	.	ENSG00000113209	ENST00000231134	T	0.20738	2.05	4.56	1.56	0.23342	.	.	.	.	.	T	0.40448	0.1117	H	0.96080	3.765	0.09310	N	0.999999	P	0.36110	0.537	B	0.34722	0.188	T	0.47355	-0.9124	9	0.66056	D	0.02	.	15.094	0.72220	0.0:0.5961:0.4039:0.0	.	703	Q9Y5E4	PCDB5_HUMAN	W	703	ENSP00000231134:S703W	ENSP00000231134:S703W	S	+	2	0	PCDHB5	140497308	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-0.034000	0.12225	0.075000	0.16796	0.505000	0.49811	TCG	.		0.701	PCDHB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251811.1	NM_015669	
LARS	51520	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	145533344	145533344	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr5:145533344C>T	ENST00000394434.2	-	12	1349	c.1183G>A	c.(1183-1185)Gac>Aac	p.D395N	LARS_ENST00000274562.9_Missense_Mutation_p.D368N|LARS_ENST00000545646.1_Missense_Mutation_p.D349N|LARS_ENST00000510191.1_Missense_Mutation_p.D341N	NM_020117.9	NP_064502.9	Q9P2J5	SYLC_HUMAN	leucyl-tRNA synthetase	395	Editing domain.				gene expression (GO:0010467)|leucyl-tRNA aminoacylation (GO:0006429)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|leucine-tRNA ligase activity (GO:0004823)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|prostate(1)|skin(2)|stomach(8)	34			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		L-Leucine(DB00149)	TCAGGGGAGTCGGAAGGAACA	0.363																																					p.D395N		.											.	LARS-90	0			c.G1183A						.						128.0	121.0	123.0					5																	145533344		2203	4300	6503	SO:0001583	missense	51520	exon12			GGGAGTCGGAAGG	AF151026	CCDS34265.1	5q32	2012-10-02			ENSG00000133706	ENSG00000133706	6.1.1.4	"""Aminoacyl tRNA synthetases / Class I"""	6512	protein-coding gene	gene with protein product	"""leucine tRNA ligase 1, cytoplasmic"""	151350				6933703	Standard	NM_020117		Approved	HSPC192, FLJ10595, FLJ21788, LARS1, LEUS, RNTLS	uc003lnx.1	Q9P2J5	OTTHUMG00000163429	ENST00000394434.2:c.1183G>A	5.37:g.145533344C>T	ENSP00000377954:p.Asp395Asn	Somatic	35	0		WXS	Illumina HiSeq	Phase_I	67	31	NM_020117	0	0	23	49	26	A2RRR4|A7E266|B4DJ10|Q2TU79|Q9NSE1	Missense_Mutation	SNP	ENST00000394434.2	37	CCDS34265.1	.	.	.	.	.	.	.	.	.	.	C	34	5.346551	0.95807	.	.	ENSG00000133706	ENST00000394434;ENST00000545646;ENST00000510191;ENST00000274562	T;T;T;T	0.35048	1.33;1.33;1.33;1.33	5.59	5.59	0.84812	Valyl/Leucyl/Isoleucyl-tRNA synthetase, class Ia, editing domain (2);Aminoacyl-tRNA synthetase, class Ia (1);	0.000000	0.85682	D	0.000000	T	0.67664	0.2917	M	0.87682	2.9	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.999;0.996;0.948	T	0.70536	-0.4845	10	0.54805	T	0.06	-7.3038	19.956	0.97218	0.0:1.0:0.0:0.0	.	368;349;395	B4DER1;F5H698;Q9P2J5	.;.;SYLC_HUMAN	N	395;349;341;368	ENSP00000377954:D395N;ENSP00000437791:D349N;ENSP00000426005:D341N;ENSP00000274562:D368N	ENSP00000274562:D368N	D	-	1	0	LARS	145513537	1.000000	0.71417	0.998000	0.56505	0.887000	0.51463	5.851000	0.69481	2.788000	0.95919	0.557000	0.71058	GAC	.		0.363	LARS-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000373367.1	NM_020117	
GRPEL2	134266	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	148730749	148730749	+	Silent	SNP	C	C	T			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr5:148730749C>T	ENST00000329271.3	+	4	692	c.582C>T	c.(580-582)acC>acT	p.T194T	GRPEL2_ENST00000507562.1_3'UTR|GRPEL2_ENST00000416916.2_3'UTR|GRPEL2-AS1_ENST00000521295.1_RNA	NM_152407.3	NP_689620.2	Q8TAA5	GRPE2_HUMAN	GrpE-like 2, mitochondrial (E. coli)	194					cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)|protein targeting to mitochondrion (GO:0006626)	mitochondrial inner membrane (GO:0005743)	adenyl-nucleotide exchange factor activity (GO:0000774)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCCTGGCACCGTGGCATTAG	0.527																																					p.T194T		.											.	GRPEL2-91	0			c.C582T						.						119.0	111.0	114.0					5																	148730749		2203	4300	6503	SO:0001819	synonymous_variant	134266	exon4			TGGCACCGTGGCA	AL832325	CCDS4295.1	5q33.1	2008-02-05			ENSG00000164284	ENSG00000164284			21060	protein-coding gene	gene with protein product							Standard	NM_152407		Approved	DKFZp451C205, Mt-GrpE#2, FLJ23713	uc003lqj.3	Q8TAA5	OTTHUMG00000130048	ENST00000329271.3:c.582C>T	5.37:g.148730749C>T		Somatic	150	0		WXS	Illumina HiSeq	Phase_I	105	37	NM_152407	0	0	9	11	2	B4DFA6|Q49AJ6	Silent	SNP	ENST00000329271.3	37	CCDS4295.1																																																																																			.		0.527	GRPEL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252327.1	NM_152407	
HLA-G	3135	ucsc.edu	37	6	29797247	29797247	+	Silent	SNP	C	C	T			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr6:29797247C>T	ENST00000360323.6	+	4	696	c.672C>T	c.(670-672)acC>acT	p.T224T	HLA-G_ENST00000376828.2_Silent_p.T229T|HLA-G_ENST00000376815.3_Intron|HLA-G_ENST00000428701.1_Silent_p.T224T|HLA-G_ENST00000376818.3_Silent_p.T132T			P17693	HLAG_HUMAN	major histocompatibility complex, class I, G	224	Alpha-3.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular defense response (GO:0006968)|cytokine-mediated signaling pathway (GO:0019221)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell tolerance induction (GO:0002666)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)	early endosome membrane (GO:0031901)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(4)|ovary(3)|pancreas(1)|prostate(5)|skin(1)	21						ATGAGGCCACCCTGAGGTGCT	0.582																																					p.T224T													.	HLA-G-517	0			c.C672T						.						95.0	99.0	98.0					6																	29797247		2203	4300	6503	SO:0001819	synonymous_variant	3135	exon5			GGCCACCCTGAGG		CCDS4668.1	6p21.3	2013-01-11	2007-12-12		ENSG00000204632	ENSG00000204632		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4964	protein-coding gene	gene with protein product	"""b2 microglobulin"""	142871	"""HLA-G histocompatibility antigen, class I, G"""				Standard	NM_002127		Approved		uc003nnw.2	P17693	OTTHUMG00000031157	ENST00000360323.6:c.672C>T	6.37:g.29797247C>T		Somatic	158	0		WXS	Illumina HiSeq		288	1	NM_002127	0	0	0	0	0		Silent	SNP	ENST00000360323.6	37	CCDS4668.1																																																																																			.		0.582	HLA-G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076286.2	NM_002127	
CCDC28A	25901	bcgsc.ca	37	6	139106480	139106480	+	Missense_Mutation	SNP	A	A	C	rs147073588|rs77141562		TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr6:139106480A>C	ENST00000332797.6	+	4	864	c.709A>C	c.(709-711)Aca>Cca	p.T237P		NM_015439.2	NP_056254.1	Q8IWP9	CC28A_HUMAN	coiled-coil domain containing 28A	237										autonomic_ganglia(1)|large_intestine(3)|lung(8)|ovary(1)	13				OV - Ovarian serous cystadenocarcinoma(155;0.000201)|GBM - Glioblastoma multiforme(68;0.000306)		TAAGAGAAAAACAGCCAGTGA	0.383																																					p.T237P													.	CCDC28A-90	0			c.A709C						.						95.0	103.0	100.0					6																	139106480		2203	4300	6503	SO:0001583	missense	25901	exon4			AGAAAAACAGCCA	AY167571	CCDS5192.1	6q23.1-q24.1	2008-02-05	2005-09-12	2005-09-12	ENSG00000024862	ENSG00000024862			21098	protein-coding gene	gene with protein product		615353	"""chromosome 6 open reading frame 80"""	C6orf80			Standard	NM_015439		Approved	CCRL1AP, DKFZp586D0623	uc003qie.3	Q8IWP9	OTTHUMG00000015683	ENST00000332797.6:c.709A>C	6.37:g.139106480A>C	ENSP00000332716:p.Thr237Pro	Somatic	177	0		WXS	Illumina HiSeq	Phase_1	150	31	NM_015439	1	0	94	95	0	E1P591|Q32NC7|Q66K67|Q96E23|Q9Y430	Missense_Mutation	SNP	ENST00000332797.6	37	CCDS5192.1	.	.	.	.	.	.	.	.	.	.	A	13.22	2.172686	0.38413	.	.	ENSG00000024862	ENST00000332797;ENST00000026464	T	0.25579	1.79	5.43	-1.13	0.09775	.	1.035910	0.07517	N	0.909962	T	0.11836	0.0288	L	0.59436	1.845	0.09310	N	0.999997	P	0.35821	0.523	B	0.39617	0.305	T	0.35325	-0.9793	10	0.40728	T	0.16	-4.0052	8.2322	0.31605	0.4315:0.1281:0.4404:0.0	.	237	Q8IWP9	CC28A_HUMAN	P	237;124	ENSP00000332716:T237P	ENSP00000026464:T124P	T	+	1	0	CCDC28A	139148173	0.133000	0.22466	0.985000	0.45067	0.993000	0.82548	0.068000	0.14531	-0.445000	0.07159	-0.290000	0.09829	ACA	.		0.383	CCDC28A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042444.1	NM_015439	
HIVEP2	3097	broad.mit.edu	37	6	143090729	143090729	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr6:143090729C>T	ENST00000367604.1	-	4	5786	c.5147G>A	c.(5146-5148)gGc>gAc	p.G1716D	HIVEP2_ENST00000367603.2_Missense_Mutation_p.G1716D|HIVEP2_ENST00000012134.2_Missense_Mutation_p.G1716D			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	1716					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		TGTAAGCTTGCCGGTTCCAGG	0.433																																					p.G1716D	Esophageal Squamous(107;843 1510 13293 16805 42198)												.	HIVEP2-95	0			c.G5147A						.						113.0	104.0	107.0					6																	143090729		1867	4120	5987	SO:0001583	missense	3097	exon5			AGCTTGCCGGTTC	M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.5147G>A	6.37:g.143090729C>T	ENSP00000356576:p.Gly1716Asp	Somatic	91	0		WXS	Illumina HiSeq	Phase_I	129	4	NM_006734	0	0	8	8	0	Q02646|Q5THT5|Q9NS05	Missense_Mutation	SNP	ENST00000367604.1	37	CCDS43510.1	.	.	.	.	.	.	.	.	.	.	C	17.78	3.474421	0.63737	.	.	ENSG00000010818	ENST00000367604;ENST00000367603;ENST00000012134	T;T;T	0.02737	4.18;4.18;4.18	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.04318	0.0119	L	0.31578	0.945	0.80722	D	1	D	0.62365	0.991	P	0.57101	0.813	T	0.56559	-0.7959	10	0.49607	T	0.09	-20.3273	20.031	0.97536	0.0:1.0:0.0:0.0	.	1716	P31629	ZEP2_HUMAN	D	1716	ENSP00000356576:G1716D;ENSP00000356575:G1716D;ENSP00000012134:G1716D	ENSP00000012134:G1716D	G	-	2	0	HIVEP2	143132422	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	4.903000	0.63272	2.735000	0.93741	0.655000	0.94253	GGC	.		0.433	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042495.1		
SAMD5	389432	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	147830100	147830100	+	Silent	SNP	G	G	A			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr6:147830100G>A	ENST00000367474.1	+	1	38	c.36G>A	c.(34-36)gcG>gcA	p.A12A		NM_001030060.2	NP_001025231.1	Q5TGI4	SAMD5_HUMAN	sterile alpha motif domain containing 5	12	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.												Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;9.55e-10)|GBM - Glioblastoma multiforme(68;0.112)		GGCTCAAAGCGCTGCAGCTTC	0.637																																					p.A12A		.											.	SAMD5-68	0			c.G36A						.						53.0	49.0	50.0					6																	147830100		2203	4300	6503	SO:0001819	synonymous_variant	389432	exon1			CAAAGCGCTGCAG	AL354880	CCDS34548.1	6q24.3	2013-01-10			ENSG00000203727	ENSG00000203727		"""Sterile alpha motif (SAM) domain containing"""	21180	protein-coding gene	gene with protein product							Standard	NM_001030060		Approved	dJ875H10.1	uc003qmc.2	Q5TGI4	OTTHUMG00000015767	ENST00000367474.1:c.36G>A	6.37:g.147830100G>A		Somatic	73	0		WXS	Illumina HiSeq	Phase_I	55	12	NM_001030060	0	0	1	4	3		Silent	SNP	ENST00000367474.1	37	CCDS34548.1																																																																																			.		0.637	SAMD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042610.1	NM_001030060	
AP5Z1	9907	hgsc.bcm.edu	37	7	4820940	4820940	+	Missense_Mutation	SNP	G	G	A	rs200423282		TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr7:4820940G>A	ENST00000348624.4	+	2	270	c.176G>A	c.(175-177)cGg>cAg	p.R59Q	AP5Z1_ENST00000401897.1_Missense_Mutation_p.R59Q	NM_014855.2	NP_055670.1	O43299	AP5Z1_HUMAN	adaptor-related protein complex 5, zeta 1 subunit	59					cell death (GO:0008219)|double-strand break repair via homologous recombination (GO:0000724)|endosomal transport (GO:0016197)|protein transport (GO:0015031)	AP-5 adaptor complex (GO:0044599)|AP-type membrane coat adaptor complex (GO:0030119)|cytoplasm (GO:0005737)|nucleus (GO:0005634)											AAGTACAGCCGGAGGTGAGTG	0.647																																					p.R59Q		.											.	.	0			c.G176A						.	G	GLN/ARG	0,4246		0,0,2123	37.0	43.0	41.0		176	5.6	0.8	7		41	1,8497		0,1,4248	yes	missense	KIAA0415	NM_014855.2	43	0,1,6371	AA,AG,GG		0.0118,0.0,0.0078	probably-damaging	59/808	4820940	1,12743	2123	4249	6372	SO:0001583	missense	9907	exon2			ACAGCCGGAGGTG	AB007875	CCDS47528.1	7p22.1	2012-03-20	2012-03-20	2012-03-20	ENSG00000242802	ENSG00000242802			22197	protein-coding gene	gene with protein product		613653	"""KIAA0415"""	KIAA0415		20613862, 22022230	Standard	NM_014855		Approved	SPG48, zeta	uc003sne.3	O43299	OTTHUMG00000151754	ENST00000348624.4:c.176G>A	7.37:g.4820940G>A	ENSP00000297562:p.Arg59Gln	Somatic	76	0		WXS	Illumina HiSeq	Phase_I	40	2	NM_014855	0	0	0	0	0	Q8N3X2|Q96H80	Missense_Mutation	SNP	ENST00000348624.4	37	CCDS47528.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.209170	0.79240	0.0	1.18E-4	ENSG00000242802	ENST00000348624;ENST00000401897	T;T	0.63744	-0.06;0.52	5.58	5.58	0.84498	.	0.122597	0.47093	D	0.000252	T	0.79981	0.4540	M	0.78049	2.395	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.81881	-0.0729	10	0.72032	D	0.01	.	16.7325	0.85439	0.0:0.0:1.0:0.0	.	59	O43299	K0415_HUMAN	Q	59	ENSP00000297562:R59Q;ENSP00000384980:R59Q	ENSP00000297562:R59Q	R	+	2	0	KIAA0415	4787466	1.000000	0.71417	0.799000	0.32177	0.033000	0.12548	8.511000	0.90535	2.627000	0.88993	0.655000	0.94253	CGG	.		0.647	AP5Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323771.1		
PKD1L1	168507	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	47970797	47970797	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr7:47970797G>A	ENST00000289672.2	-	6	691	c.641C>T	c.(640-642)aCg>aTg	p.T214M		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	214					detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						GGTCTCCATCGTGACAGTCCC	0.617																																					p.T214M		.											.	PKD1L1-145	0			c.C641T						.						67.0	68.0	68.0					7																	47970797		2203	4300	6503	SO:0001583	missense	168507	exon6			TCCATCGTGACAG	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.641C>T	7.37:g.47970797G>A	ENSP00000289672:p.Thr214Met	Somatic	110	0		WXS	Illumina HiSeq	Phase_I	85	27	NM_138295	0	0	0	0	0	Q6UWK1	Missense_Mutation	SNP	ENST00000289672.2	37	CCDS34633.1	.	.	.	.	.	.	.	.	.	.	G	8.481	0.859718	0.17178	.	.	ENSG00000158683	ENST00000289672	T	0.23147	1.92	3.26	-2.9	0.05648	.	6.156550	0.00725	N	0.000901	T	0.12817	0.0311	N	0.08118	0	0.09310	N	1	B	0.16802	0.019	B	0.08055	0.003	T	0.20505	-1.0273	10	0.46703	T	0.11	.	4.4996	0.11858	0.4273:0.1738:0.3989:0.0	.	214	Q8TDX9	PK1L1_HUMAN	M	214	ENSP00000289672:T214M	ENSP00000289672:T214M	T	-	2	0	PKD1L1	47937322	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.622000	0.02042	-0.610000	0.05716	-0.225000	0.12378	ACG	.		0.617	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295	
TPK1	27010	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	144245631	144245631	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr7:144245631C>A	ENST00000360057.3	-	8	668	c.566G>T	c.(565-567)gGa>gTa	p.G189V	TPK1_ENST00000538212.2_Missense_Mutation_p.G135V|TPK1_ENST00000549981.1_Missense_Mutation_p.G72V|TPK1_ENST00000378099.3_Missense_Mutation_p.G140V|TPK1_ENST00000547966.1_5'UTR	NM_022445.3	NP_071890.2	Q9H3S4	TPK1_HUMAN	thiamin pyrophosphokinase 1	189					small molecule metabolic process (GO:0044281)|thiamine diphosphate biosynthetic process (GO:0009229)|thiamine metabolic process (GO:0006772)|thiamine-containing compound metabolic process (GO:0042723)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|thiamine binding (GO:0030975)|thiamine diphosphokinase activity (GO:0004788)			large_intestine(3)|lung(12)|ovary(2)|urinary_tract(2)	19					Thiamine(DB00152)	ACAAGGCTGTCCAACAGGAAT	0.418																																					p.G189V	Ovarian(45;88 1034 2073 5829 28455)	.											.	TPK1-188	0			c.G566T						.						200.0	167.0	178.0					7																	144245631		2203	4300	6503	SO:0001583	missense	27010	exon8			GGCTGTCCAACAG	AB028138	CCDS5888.1, CCDS55178.1	7q34-q35	2008-07-18			ENSG00000196511	ENSG00000196511			17358	protein-coding gene	gene with protein product	"""placental protein 20"", ""thiamine pyrophosphokinase 1"", ""thiamine kinase"", ""thiamine diphosphokinase"""	606370				11342111	Standard	NM_022445		Approved	HTPK1, PP20	uc003weq.3	Q9H3S4	OTTHUMG00000152774	ENST00000360057.3:c.566G>T	7.37:g.144245631C>A	ENSP00000353165:p.Gly189Val	Somatic	172	0		WXS	Illumina HiSeq	Phase_I	145	65	NM_022445	0	0	8	11	3	A8K0T7|D3DWG0|I6L9B8|Q6NUR5|Q9H602	Missense_Mutation	SNP	ENST00000360057.3	37	CCDS5888.1	.	.	.	.	.	.	.	.	.	.	C	18.00	3.524985	0.64747	.	.	ENSG00000196511	ENST00000360057;ENST00000538212;ENST00000378099;ENST00000549981	T;T;T;T	0.80214	-1.35;-1.35;-1.35;-1.35	5.95	5.95	0.96441	Thiamin pyrophosphokinase, vitamin B1-binding domain (3);	0.000000	0.85682	D	0.000000	D	0.91402	0.7287	M	0.89968	3.075	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.993;1.0;0.999	D	0.92101	0.5688	10	0.59425	D	0.04	-17.4306	15.8749	0.79154	0.0:1.0:0.0:0.0	.	140;189;135	F5GZG6;Q9H3S4;Q6ZQX6	.;TPK1_HUMAN;.	V	189;135;140;72	ENSP00000353165:G189V;ENSP00000438813:G135V;ENSP00000367339:G140V;ENSP00000448698:G72V	ENSP00000353165:G189V	G	-	2	0	TPK1	143876564	1.000000	0.71417	1.000000	0.80357	0.467000	0.32768	5.315000	0.65810	2.817000	0.96982	0.563000	0.77884	GGA	.		0.418	TPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327777.1	NM_022445	
ZNF767P	79970	broad.mit.edu;bcgsc.ca	37	7	149318520	149318520	+	RNA	SNP	G	G	T			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr7:149318520G>T	ENST00000463567.1	-	0	316					NR_027788.1		Q75MW2	ZN767_HUMAN												central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(1)	5	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00434)			CTCCACGGCTGTCTTCTCGCA	0.617																																					.													.	ZNF767-90	0			.						.						76.0	73.0	74.0					7																	149318520		2203	4298	6501			79970	.			ACGGCTGTCTTCT																													7.37:g.149318520G>T		Somatic	194	0		WXS	Illumina HiSeq	Phase_I	125	57	.	0	0	8	11	3	D3DWG6|Q86WY4|Q9H9J3	RNA	SNP	ENST00000463567.1	37																																																																																				.		0.617	ZNF767-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000352753.2		
KMT2C	58508	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	151845739	151845739	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr7:151845739C>A	ENST00000262189.6	-	52	13491	c.13273G>T	c.(13273-13275)Gat>Tat	p.D4425Y	KMT2C_ENST00000355193.2_Missense_Mutation_p.D4482Y	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	4425					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										ACCCACAGATCCAAGTCAAGG	0.502																																					p.D4425Y		.											.	MLL3-1398	0			c.G13273T						.						97.0	89.0	92.0					7																	151845739		2203	4300	6503	SO:0001583	missense	58508	exon52			ACAGATCCAAGTC	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.13273G>T	7.37:g.151845739C>A	ENSP00000262189:p.Asp4425Tyr	Somatic	128	0		WXS	Illumina HiSeq	Phase_I	102	45	NM_170606	0	0	20	27	7	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.05|17.05	3.290706|3.290706	0.59976|0.59976	.|.	.|.	ENSG00000055609|ENSG00000055609	ENST00000262189;ENST00000355193;ENST00000424877|ENST00000360104	D;D;D|.	0.90385|.	-2.0;-1.98;-2.66|.	5.24|5.24	5.24|5.24	0.73138|0.73138	.|.	0.000000|.	0.44285|.	U|.	0.000480|.	T|T	0.78123|0.78123	0.4234|0.4234	M|M	0.78637|0.78637	2.42|2.42	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.91635|.	0.997;0.999;0.999|.	T|T	0.78221|0.78221	-0.2288|-0.2288	10|5	0.49607|.	T|.	0.09|.	.|.	19.1777|19.1777	0.93609|0.93609	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	4425;3543;4482|.	Q8NEZ4;Q8NEZ4-2;Q8NEZ4-3|.	MLL3_HUMAN;.;.|.	Y|V	4425;4482;1042|1985	ENSP00000262189:D4425Y;ENSP00000347325:D4482Y;ENSP00000410411:D1042Y|.	ENSP00000262189:D4425Y|.	D|G	-|-	1|2	0|0	MLL3|MLL3	151476672|151476672	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.957000|0.957000	0.61999|0.61999	7.776000|7.776000	0.85560|0.85560	2.602000|2.602000	0.87976|0.87976	0.557000|0.557000	0.71058|0.71058	GAT|GGA	.		0.502	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
MYOM2	9172	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	2044224	2044224	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr8:2044224A>G	ENST00000262113.4	+	18	2404	c.2263A>G	c.(2263-2265)Aaa>Gaa	p.K755E	MYOM2_ENST00000523438.1_Missense_Mutation_p.K180E	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	755	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		AGTTCACCATAAAAACTGGCA	0.517																																					p.K755E		.											.	MYOM2-95	0			c.A2263G						.						104.0	92.0	96.0					8																	2044224		2203	4300	6503	SO:0001583	missense	9172	exon18			CACCATAAAAACT		CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.2263A>G	8.37:g.2044224A>G	ENSP00000262113:p.Lys755Glu	Somatic	74	0		WXS	Illumina HiSeq	Phase_I	73	23	NM_003970	0	0	1	1	0	Q7Z3Y2	Missense_Mutation	SNP	ENST00000262113.4	37	CCDS5957.1	.	.	.	.	.	.	.	.	.	.	A	0.005	-2.135743	0.00335	.	.	ENSG00000036448	ENST00000262113;ENST00000523438	T;T	0.54675	0.56;0.56	5.46	0.23	0.15372	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.912312	0.09530	N	0.789730	T	0.32315	0.0825	N	0.25201	0.72	0.09310	N	1	B	0.23540	0.087	B	0.30943	0.122	T	0.31166	-0.9953	10	0.02654	T	1	.	6.2231	0.20693	0.4732:0.3775:0.0689:0.0804	.	755	P54296	MYOM2_HUMAN	E	755;180	ENSP00000262113:K755E;ENSP00000428396:K180E	ENSP00000262113:K755E	K	+	1	0	MYOM2	2031631	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.150000	0.16263	-0.212000	0.10109	-1.477000	0.00996	AAA	.		0.517	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251249.1	NM_003970	
EBF2	64641	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	25766022	25766022	+	Missense_Mutation	SNP	C	C	A	rs200594181		TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr8:25766022C>A	ENST00000520164.1	-	7	1138	c.601G>T	c.(601-603)Gca>Tca	p.A201S	EBF2_ENST00000408929.3_Missense_Mutation_p.A53S	NM_022659.3	NP_073150.2	Q9HAK2	COE2_HUMAN	early B-cell factor 2	201	Interaction with DNA. {ECO:0000250}.				adipose tissue development (GO:0060612)|brown fat cell differentiation (GO:0050873)|cell fate determination (GO:0001709)|positive regulation of chromatin binding (GO:0035563)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(3)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	39		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)		GGGTTTCCTGCTGTTTTCAAA	0.378													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16876	0.0		0.0	False		,,,				2504	0.0				p.A201S	Esophageal Squamous(166;1018 1046 3854 8328 13429 13634 14071 26624 32918)	.											.	EBF2-26	0			c.G601T						.	C	SER/ALA	1,3657		0,1,1828	83.0	83.0	83.0		601	5.8	1.0	8		83	0,8198		0,0,4099	no	missense	EBF2	NM_022659.2	99	0,1,5927	AA,AC,CC		0.0,0.0273,0.0084	benign	201/576	25766022	1,11855	1829	4099	5928	SO:0001583	missense	64641	exon7			TTCCTGCTGTTTT	AK021562, AK001144	CCDS43726.1	8p21.1	2007-07-26			ENSG00000221818	ENSG00000221818			19090	protein-coding gene	gene with protein product		609934				9151732	Standard	NM_022659		Approved	FLJ11500, COE2	uc003xes.2	Q9HAK2	OTTHUMG00000163838	ENST00000520164.1:c.601G>T	8.37:g.25766022C>A	ENSP00000430241:p.Ala201Ser	Somatic	45	0		WXS	Illumina HiSeq	Phase_I	53	25	NM_022659	0	0	0	0	0	A0PJM4|A6NMF7|F5H645|Q66VZ3|Q6DK36|Q6IS86|Q6ISA4	Missense_Mutation	SNP	ENST00000520164.1	37	CCDS43726.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	29.7	5.026717	0.93518	2.73E-4	0.0	ENSG00000221818	ENST00000520164;ENST00000408929	T;T	0.62232	0.14;0.04	5.77	5.77	0.91146	.	0.000000	0.85682	U	0.000000	T	0.78483	0.4290	M	0.85373	2.75	0.80722	D	1	P	0.39940	0.696	P	0.50136	0.632	T	0.80061	-0.1540	10	0.87932	D	0	-0.8376	20.3473	0.98799	0.0:1.0:0.0:0.0	.	201	Q9HAK2	COE2_HUMAN	S	201;53	ENSP00000430241:A201S;ENSP00000386178:A53S	ENSP00000386178:A53S	A	-	1	0	EBF2	25821939	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.776000	0.85560	2.884000	0.98904	0.655000	0.94253	GCA	C|0.999;A|0.000		0.378	EBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375886.2	NM_022659	
FAM110B	90362	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	59059734	59059734	+	Silent	SNP	C	C	T			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr8:59059734C>T	ENST00000361488.3	+	5	1825	c.945C>T	c.(943-945)agC>agT	p.S315S	FAM110B_ENST00000520369.1_Intron	NM_147189.2	NP_671722.1	Q8TC76	F110B_HUMAN	family with sequence similarity 110, member B	315						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(9)|skin(2)	26		all_epithelial(80;0.025)|all_lung(136;0.0274)|Lung NSC(129;0.0355)				GCATGATCAGCTCAGACTGTG	0.483																																					p.S315S		.											.	FAM110B-153	0			c.C945T						.						79.0	75.0	76.0					8																	59059734		2203	4300	6503	SO:0001819	synonymous_variant	90362	exon5			GATCAGCTCAGAC	U79298	CCDS6170.1	8q12.1	2007-06-21	2007-03-21	2007-03-21		ENSG00000169122			28587	protein-coding gene	gene with protein product		611394	"""chromosome 8 open reading frame 72"""	C8orf72		8619474, 9110174, 17499476	Standard	XM_005251324		Approved	MGC39325	uc003xtj.1	Q8TC76		ENST00000361488.3:c.945C>T	8.37:g.59059734C>T		Somatic	60	0		WXS	Illumina HiSeq	Phase_I	45	19	NM_147189	0	1	16	48	31	Q5BM08|Q9Y4K2	Silent	SNP	ENST00000361488.3	37	CCDS6170.1																																																																																			.		0.483	FAM110B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378095.2	NM_147189	
MYBL1	4603	broad.mit.edu;bcgsc.ca	37	8	67477040	67477040	+	Silent	SNP	T	T	A			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr8:67477040T>A	ENST00000522677.3	-	16	2561	c.2151A>T	c.(2149-2151)acA>acT	p.T717T	MYBL1_ENST00000522419.1_5'Flank|MYBL1_ENST00000524176.2_Silent_p.T657T|MYBL1_ENST00000517885.1_Silent_p.T375T	NM_001080416.2|NM_001144755.1	NP_001073885.1|NP_001138227.1	P10243	MYBA_HUMAN	v-myb avian myeloblastosis viral oncogene homolog-like 1	717					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|pancreas(1)|skin(1)	25			Epithelial(68;0.00211)|all cancers(69;0.00726)|OV - Ovarian serous cystadenocarcinoma(28;0.00989)|BRCA - Breast invasive adenocarcinoma(89;0.0938)			CATAAACCACTGTTTCCCATT	0.328																																					p.T717T													.	MYBL1-395	0			c.A2151T						.						108.0	100.0	103.0					8																	67477040		1855	4083	5938	SO:0001819	synonymous_variant	4603	exon16			AACCACTGTTTCC	X13294	CCDS47867.1, CCDS55241.1	8q22	2013-07-09	2013-07-09		ENSG00000185697	ENSG00000185697			7547	protein-coding gene	gene with protein product		159405					Standard	XM_005251251		Approved	AMYB, A-myb	uc003xwj.3	P10243	OTTHUMG00000164559	ENST00000522677.3:c.2151A>T	8.37:g.67477040T>A		Somatic	18	0		WXS	Illumina HiSeq	Phase_I	11	4	NM_001080416	0	0	3	5	2	E7EW29|Q495F9	Silent	SNP	ENST00000522677.3	37	CCDS47867.1																																																																																			.		0.328	MYBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379221.3	XM_034274	
CSMD3	114788	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	113249531	113249531	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr8:113249531G>T	ENST00000297405.5	-	67	10759	c.10515C>A	c.(10513-10515)taC>taA	p.Y3505*	CSMD3_ENST00000455883.2_Nonsense_Mutation_p.Y3336*|CSMD3_ENST00000352409.3_Nonsense_Mutation_p.Y3435*|CSMD3_ENST00000343508.3_Nonsense_Mutation_p.Y3465*	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	3505						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						CTTTGAAATTGTAAGAGCCTT	0.348										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.Y3505X		.											.	CSMD3-1132	0			c.C10515A						.						157.0	144.0	148.0					8																	113249531		2203	4300	6503	SO:0001587	stop_gained	114788	exon67			GAAATTGTAAGAG	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.10515C>A	8.37:g.113249531G>T	ENSP00000297405:p.Tyr3505*	Somatic	99	0		WXS	Illumina HiSeq	Phase_I	104	38	NM_198123	0	0	0	0	0	Q96PZ3	Nonsense_Mutation	SNP	ENST00000297405.5	37	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	G	51	17.550337	0.99888	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	.	.	.	4.77	-1.61	0.08399	.	0.090578	0.46442	D	0.000299	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.6815	0.23123	0.3366:0.1118:0.5516:0.0	.	.	.	.	X	3465;3505;2775;3336;3435	.	ENSP00000297405:Y3505X	Y	-	3	2	CSMD3	113318707	0.982000	0.34865	0.993000	0.49108	0.533000	0.34776	0.213000	0.17521	-0.254000	0.09500	-0.499000	0.04595	TAC	.		0.348	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
CSMD3	114788	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	113249566	113249566	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr8:113249566C>A	ENST00000297405.5	-	67	10724	c.10480G>T	c.(10480-10482)Gta>Tta	p.V3494L	CSMD3_ENST00000455883.2_Missense_Mutation_p.V3325L|CSMD3_ENST00000352409.3_Missense_Mutation_p.V3424L|CSMD3_ENST00000343508.3_Missense_Mutation_p.V3454L	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	3494						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TGGGCAAATACATCATCAGGA	0.303										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.V3494L		.											.	CSMD3-1132	0			c.G10480T						.						110.0	103.0	105.0					8																	113249566		2203	4300	6503	SO:0001583	missense	114788	exon67			CAAATACATCATC	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.10480G>T	8.37:g.113249566C>A	ENSP00000297405:p.Val3494Leu	Somatic	82	0		WXS	Illumina HiSeq	Phase_I	80	25	NM_198123	0	0	0	0	0	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	C	14.53	2.563747	0.45694	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.33865	1.71;1.7;1.78;1.39;1.76	4.77	4.77	0.60923	.	0.000000	0.64402	D	0.000010	T	0.55417	0.1919	M	0.71206	2.165	0.48087	D	0.999581	D;D;B	0.61080	0.989;0.961;0.038	D;P;B	0.63033	0.91;0.741;0.07	T	0.50432	-0.8829	10	0.16896	T	0.51	.	17.9788	0.89134	0.0:1.0:0.0:0.0	.	3325;3494;3454	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	L	3454;3494;2764;3325;3424	ENSP00000345799:V3454L;ENSP00000297405:V3494L;ENSP00000341558:V2764L;ENSP00000412263:V3325L;ENSP00000343124:V3424L	ENSP00000297405:V3494L	V	-	1	0	CSMD3	113318742	1.000000	0.71417	1.000000	0.80357	0.431000	0.31685	7.627000	0.83176	2.467000	0.83353	0.467000	0.42956	GTA	.		0.303	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
DENND3	22898	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	142186773	142186773	+	Silent	SNP	C	C	T	rs374490803		TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr8:142186773C>T	ENST00000262585.2	+	15	2657	c.2379C>T	c.(2377-2379)ttC>ttT	p.F793F	DENND3_ENST00000424248.1_Silent_p.F741F|DENND3_ENST00000519811.1_Silent_p.F873F	NM_014957.2	NP_055772.2	A2RUS2	DEND3_HUMAN	DENN/MADD domain containing 3	793					cellular protein catabolic process (GO:0044257)|endosome to lysosome transport (GO:0008333)|positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(4)|stomach(2)|urinary_tract(1)	55	all_cancers(97;7.36e-15)|all_epithelial(106;2.33e-13)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.105)			AAGAAGTCTTCGAAGCCAACC	0.512																																					p.F793F		.											.	DENND3-91	0			c.C2379T						.	C		0,4406		0,0,2203	117.0	105.0	109.0		2379	-8.0	0.4	8		109	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	DENND3	NM_014957.2		0,2,6501	TT,TC,CC		0.0233,0.0,0.0154		793/1199	142186773	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	22898	exon15			AGTCTTCGAAGCC	AB020677	CCDS34947.1	8q24.3	2013-01-10				ENSG00000105339		"""DENN/MADD domain containing"", ""WD repeat domain containing"""	29134	protein-coding gene	gene with protein product						10048485	Standard	NM_014957		Approved	KIAA0870	uc003yvy.3	A2RUS2		ENST00000262585.2:c.2379C>T	8.37:g.142186773C>T		Somatic	121	0		WXS	Illumina HiSeq	Phase_I	91	40	NM_014957	0	0	7	8	1	B7ZM28|O94947|Q2TAM7|Q6ZMS6|Q96DK3	Silent	SNP	ENST00000262585.2	37	CCDS34947.1	.	.	.	.	.	.	.	.	.	.	C	9.548	1.115101	0.20795	0.0	2.33E-4	ENSG00000105339	ENST00000518668	.	.	.	5.37	-7.98	0.01135	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-17.7694	14.5506	0.68065	0.0:0.5424:0.0:0.4576	.	.	.	.	X	798	.	.	R	+	1	2	DENND3	142255955	0.831000	0.29352	0.363000	0.25875	0.894000	0.52154	-0.115000	0.10741	-1.794000	0.01256	-1.124000	0.02001	CGA	.		0.512	DENND3-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_014957	
FAM83H	286077	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	144809117	144809117	+	Silent	SNP	G	G	C			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr8:144809117G>C	ENST00000388913.3	-	5	2639	c.2514C>G	c.(2512-2514)gcC>gcG	p.A838A		NM_198488.3	NP_940890	Q6ZRV2	FA83H_HUMAN	family with sequence similarity 83, member H	838					biomineral tissue development (GO:0031214)					central_nervous_system(2)|endometrium(1)|large_intestine(1)|lung(12)|pancreas(1)|prostate(3)|urinary_tract(1)	21	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			AGTGGCTCTGGGCAGAGAGGA	0.701																																					p.A838A		.											.	FAM83H-92	0			c.C2514G						.						10.0	11.0	11.0					8																	144809117		1984	4151	6135	SO:0001819	synonymous_variant	286077	exon5			GCTCTGGGCAGAG	AK127960	CCDS6410.2	8q24.3	2014-03-13			ENSG00000180921	ENSG00000180921			24797	protein-coding gene	gene with protein product		611927				18252228	Standard	NM_198488		Approved	FLJ46072	uc003yzk.3	Q6ZRV2	OTTHUMG00000133559	ENST00000388913.3:c.2514C>G	8.37:g.144809117G>C		Somatic	28	0		WXS	Illumina HiSeq	Phase_I	22	8	NM_198488	0	0	10	17	7	A0JLS2|Q8N4W0	Silent	SNP	ENST00000388913.3	37	CCDS6410.2																																																																																			.		0.701	FAM83H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257632.2	NM_198488	
SMARCA2	6595	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	2110312	2110312	+	Silent	SNP	C	C	T			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr9:2110312C>T	ENST00000382203.1	+	24	3560	c.3351C>T	c.(3349-3351)tcC>tcT	p.S1117S	SMARCA2_ENST00000357248.2_Silent_p.S1117S|SMARCA2_ENST00000382194.1_Silent_p.S1117S|SMARCA2_ENST00000349721.2_Silent_p.S1117S			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	1117	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		AACCTGGATCCCAGTATTTCA	0.453																																					p.S1117S		.											.	SMARCA2-653	0			c.C3351T						.						94.0	88.0	90.0					9																	2110312		2203	4300	6503	SO:0001819	synonymous_variant	6595	exon24			TGGATCCCAGTAT	D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.3351C>T	9.37:g.2110312C>T		Somatic	64	0		WXS	Illumina HiSeq	Phase_I	102	32	NM_139045	0	0	16	20	4	B1ALG3|B1ALG4|D3DRH4|D3DRH5	Silent	SNP	ENST00000382203.1	37	CCDS34977.1																																																																																			.		0.453	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051505.1	NM_003070	
MELK	9833	bcgsc.ca	37	9	36651842	36651842	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr9:36651842C>A	ENST00000298048.2	+	12	1205	c.1021C>A	c.(1021-1023)Caa>Aaa	p.Q341K	MELK_ENST00000536329.1_Missense_Mutation_p.Q270K|MELK_ENST00000536987.1_Missense_Mutation_p.Q210K|MELK_ENST00000536860.1_Missense_Mutation_p.Q293K|MELK_ENST00000545008.1_Missense_Mutation_p.Q270K|MELK_ENST00000538311.1_Missense_Mutation_p.Q147K|MELK_ENST00000543751.1_Missense_Mutation_p.Q309K|MELK_ENST00000541717.1_Missense_Mutation_p.Q341K	NM_014791.3	NP_055606.1	Q14680	MELK_HUMAN	maternal embryonic leucine zipper kinase	341	Autoinhibitory region.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|hemopoiesis (GO:0030097)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|neural precursor cell proliferation (GO:0061351)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)	cell cortex (GO:0005938)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(2)	29		Acute lymphoblastic leukemia(2;1.09e-08)|all_hematologic(2;8.15e-06)	STAD - Stomach adenocarcinoma(86;0.228)			CTCCTGTGGACAAGCCAGTGC	0.507																																					p.Q341K	Ovarian(82;980 1317 7225 14391 18624)												.	MELK-760	0			c.C1021A						.						216.0	200.0	205.0					9																	36651842		2203	4300	6503	SO:0001583	missense	9833	exon12			TGTGGACAAGCCA	D79997	CCDS6606.1, CCDS59123.1, CCDS59124.1, CCDS59125.1, CCDS59126.1, CCDS59127.1, CCDS59128.1	9p13.1	2008-02-05			ENSG00000165304	ENSG00000165304			16870	protein-coding gene	gene with protein product		607025				8724849, 9136115	Standard	NM_001256689		Approved	KIAA0175	uc003zzn.4	Q14680	OTTHUMG00000019906	ENST00000298048.2:c.1021C>A	9.37:g.36651842C>A	ENSP00000298048:p.Gln341Lys	Somatic	293	5		WXS	Illumina HiSeq	Phase_1	312	43	NM_014791	0	0	6	6	0	A6P3A7|A6P3A8|B1AMQ6|B7Z1E6|B7Z5M5|B7Z6Q7|B7Z6R8|B7Z6Y0|B7Z7Q1|D3DRP8|F5H0Y0|F5H2R4|F5H689|Q7L3C3	Missense_Mutation	SNP	ENST00000298048.2	37	CCDS6606.1	.	.	.	.	.	.	.	.	.	.	C	11.35	1.612920	0.28712	.	.	ENSG00000165304	ENST00000298048;ENST00000538311;ENST00000536987;ENST00000545008;ENST00000536860;ENST00000536329;ENST00000541717;ENST00000543751	T;T;T;T;T;T;T;T	0.70164	-0.28;0.72;0.5;1.04;0.41;-0.46;-0.28;-0.28	5.63	2.62	0.31277	.	0.927532	0.09315	N	0.819067	T	0.51907	0.1702	L	0.44542	1.39	0.09310	N	1	B;B;B;B;B;B;B	0.18863	0.031;0.015;0.001;0.0;0.031;0.001;0.001	B;B;B;B;B;B;B	0.21360	0.021;0.02;0.003;0.003;0.034;0.002;0.001	T	0.38478	-0.9659	10	0.09084	T	0.74	2.8432	4.2728	0.10794	0.1851:0.6187:0.0:0.1962	.	261;270;293;341;270;309;341	B7Z1G6;F5H2R4;F5H0Y0;F5H689;A6P3A8;A6P3A7;Q14680	.;.;.;.;.;.;MELK_HUMAN	K	341;147;210;270;293;270;341;309	ENSP00000298048:Q341K;ENSP00000438226:Q147K;ENSP00000439184:Q210K;ENSP00000445452:Q270K;ENSP00000439792:Q293K;ENSP00000443550:Q270K;ENSP00000437804:Q341K;ENSP00000441596:Q309K	ENSP00000298048:Q341K	Q	+	1	0	MELK	36641842	0.000000	0.05858	0.005000	0.12908	0.936000	0.57629	-0.116000	0.10724	0.245000	0.21373	0.655000	0.94253	CAA	.		0.507	MELK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052428.3	NM_014791	
SPATA31D1	389763	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	84607771	84607771	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr9:84607771G>T	ENST00000344803.2	+	4	2433	c.2386G>T	c.(2386-2388)Gat>Tat	p.D796Y		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	796					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											TTCAGACAAGGATCTGAGGTC	0.463																																					p.D796Y		.											.	.	0			c.G2386T						.						102.0	99.0	100.0					9																	84607771		1908	4112	6020	SO:0001583	missense	389763	exon4			GACAAGGATCTGA		CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.2386G>T	9.37:g.84607771G>T	ENSP00000341988:p.Asp796Tyr	Somatic	157	0		WXS	Illumina HiSeq	Phase_I	102	37	NM_001001670	0	0	0	0	0		Missense_Mutation	SNP	ENST00000344803.2	37	CCDS47986.1	.	.	.	.	.	.	.	.	.	.	G	11.52	1.664689	0.29604	.	.	ENSG00000214929	ENST00000344803	T	0.07114	3.22	2.85	1.93	0.25924	.	3.256700	0.00687	N	0.000704	T	0.16896	0.0406	L	0.54323	1.7	0.09310	N	1	D	0.57571	0.98	P	0.60012	0.867	T	0.48234	-0.9053	10	0.02654	T	1	1.3602	5.6289	0.17499	0.1558:0.0:0.8442:0.0	.	796	Q6ZQQ2	F75D1_HUMAN	Y	796	ENSP00000341988:D796Y	ENSP00000341988:D796Y	D	+	1	0	FAM75D1	83797591	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	0.442000	0.21628	0.762000	0.33152	0.462000	0.41574	GAT	.		0.463	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402325.1	NM_001001670	
AKAP2	11217	ucsc.edu	37	9	112899612	112899612	+	Missense_Mutation	SNP	C	C	A	rs201181068		TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr9:112899612C>A	ENST00000259318.7	+	2	1302	c.1095C>A	c.(1093-1095)gaC>gaA	p.D365E	AKAP2_ENST00000555236.1_Missense_Mutation_p.D596E|AKAP2_ENST00000374525.1_Missense_Mutation_p.D454E|PALM2-AKAP2_ENST00000374530.3_Missense_Mutation_p.D596E|AKAP2_ENST00000434623.2_Missense_Mutation_p.D454E|PALM2-AKAP2_ENST00000302798.7_Missense_Mutation_p.D596E|AKAP2_ENST00000510514.5_Missense_Mutation_p.D596E	NM_001136562.2	NP_001130034.1	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2	365										breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	33						TCAACTCAGACAAGCCACTGA	0.587																																					p.D596E													.	PALM2-AKAP2-475	0			c.C1788A						.						54.0	59.0	58.0					9																	112899612		2203	4300	6503	SO:0001583	missense	445815	exon8			CTCAGACAAGCCA	AB023137	CCDS43861.1, CCDS48003.1, CCDS56581.1	9q31.3	2009-10-16			ENSG00000241978	ENSG00000241978		"""A-kinase anchor proteins"""	372	protein-coding gene	gene with protein product	"""protein kinase A2"""	604582		PRKA2		10231032	Standard	NM_001136562		Approved	AKAP-KL, KIAA0920, DKFZp564L0716		Q9Y2D5	OTTHUMG00000156811	ENST00000259318.7:c.1095C>A	9.37:g.112899612C>A	ENSP00000259318:p.Asp365Glu	Somatic	124	5		WXS	Illumina HiSeq		98	10	NM_007203	0	0	22	31	9	B1ALX9|B2RTU4|B3KQ00|B4DTZ2|B7ZW07|B9EJB5|Q9UG26	Missense_Mutation	SNP	ENST00000259318.7	37	CCDS48003.1	.	.	.	.	.	.	.	.	.	.	C	8.798	0.932246	0.18131	.	.	ENSG00000157654;ENSG00000157654;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978	ENST00000374530;ENST00000302798;ENST00000555236;ENST00000510514;ENST00000434623;ENST00000374525;ENST00000480388;ENST00000259318	T;T;T;T;T;T;T;T	0.48522	2.14;2.14;2.14;2.14;1.39;0.81;0.81;1.42	5.82	0.372	0.16173	.	0.456370	0.24447	N	0.038444	T	0.22975	0.0555	L	0.33485	1.01	0.19300	N	0.999979	B;B;P;B;B;B;B;B	0.41313	0.004;0.047;0.745;0.047;0.028;0.01;0.01;0.006	B;B;B;B;B;B;B;B	0.34931	0.004;0.056;0.192;0.056;0.025;0.009;0.009;0.004	T	0.09422	-1.0675	10	0.12103	T	0.63	-20.9083	2.4458	0.04506	0.1233:0.4354:0.2404:0.2009	.	365;454;448;454;455;596;596;414	Q9Y2D5;Q9Y2D5-7;B4E2K2;Q9Y2D5-5;B1ALY1;Q9Y2D5-6;Q9Y2D5-4;C9JVY5	AKAP2_HUMAN;.;.;.;.;.;.;.	E	596;596;596;596;454;454;414;365	ENSP00000363654:D596E;ENSP00000305861:D596E;ENSP00000451476:D596E;ENSP00000421522:D596E;ENSP00000404782:D454E;ENSP00000363649:D454E;ENSP00000419268:D414E;ENSP00000259318:D365E	ENSP00000259318:D365E	D	+	3	2	PALM2-AKAP2;AKAP2	111939433	0.632000	0.27172	0.943000	0.38184	0.336000	0.28762	-0.234000	0.09028	0.773000	0.33404	-0.137000	0.14449	GAC	.		0.587	AKAP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346067.3	NM_001004065	
SVEP1	79987	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	113141740	113141740	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr9:113141740T>C	ENST00000401783.2	-	44	10631	c.10295A>G	c.(10294-10296)tAt>tGt	p.Y3432C	SVEP1_ENST00000297826.5_Missense_Mutation_p.Y1358C|SVEP1_ENST00000374469.1_Missense_Mutation_p.Y3409C	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	3432	Sushi 34. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						TCCATATTGATAATGTACGCC	0.403																																					p.Y3432C		.											.	SVEP1-75	0			c.A10295G						.						112.0	100.0	104.0					9																	113141740		1940	4146	6086	SO:0001583	missense	79987	exon44			TATTGATAATGTA	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.10295A>G	9.37:g.113141740T>C	ENSP00000384917:p.Tyr3432Cys	Somatic	79	0		WXS	Illumina HiSeq	Phase_I	71	33	NM_153366	0	0	6	6	0	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	37	CCDS48004.1	.	.	.	.	.	.	.	.	.	.	T	17.46	3.394554	0.62066	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000297826	T;T;T	0.69926	-0.44;-0.44;-0.44	5.87	5.87	0.94306	Complement control module (2);Sushi/SCR/CCP (3);	0.240647	0.43416	D	0.000575	D	0.83912	0.5357	M	0.93720	3.45	0.80722	D	1	D	0.69078	0.997	D	0.63113	0.911	D	0.86941	0.2079	10	0.52906	T	0.07	.	11.9508	0.52954	0.1299:0.0:0.0:0.8701	.	3432	Q4LDE5	SVEP1_HUMAN	C	3432;3409;1358	ENSP00000384917:Y3432C;ENSP00000363593:Y3409C;ENSP00000297826:Y1358C	ENSP00000297826:Y1358C	Y	-	2	0	SVEP1	112181561	1.000000	0.71417	0.989000	0.46669	0.666000	0.39218	4.371000	0.59523	2.248000	0.74166	0.533000	0.62120	TAT	.		0.403	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
OR1B1	347169	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	125391500	125391500	+	Silent	SNP	G	G	A			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr9:125391500G>A	ENST00000304833.3	-	1	352	c.315C>T	c.(313-315)ttC>ttT	p.F105F	RP11-64P14.7_ENST00000431442.1_RNA|RP11-64P14.7_ENST00000419604.1_RNA	NM_001004450.1	NP_001004450.1	Q8NGR6	OR1B1_HUMAN	olfactory receptor, family 1, subfamily B, member 1	105						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(6)|prostate(1)	16						ATGCATAGAAGAAAAAGAACT	0.502																																					p.F105F		.											.	OR1B1-68	0			c.C315T						.						85.0	77.0	79.0					9																	125391500		2203	4300	6503	SO:0001819	synonymous_variant	347169	exon1			ATAGAAGAAAAAG	AC006313	CCDS35126.1	9q33.2	2012-08-09			ENSG00000171484	ENSG00000171484		"""GPCR / Class A : Olfactory receptors"""	8181	protein-coding gene	gene with protein product							Standard	NM_001004450		Approved	OR9-B	uc011lyz.2	Q8NGR6	OTTHUMG00000020616	ENST00000304833.3:c.315C>T	9.37:g.125391500G>A		Somatic	60	0		WXS	Illumina HiSeq	Phase_I	55	21	NM_001004450	0	0	0	0	0	Q6IFN3	Silent	SNP	ENST00000304833.3	37	CCDS35126.1																																																																																			.		0.502	OR1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053947.2	NM_001004450	
EIF1AX	1964	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	20152121	20152121	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chrX:20152121C>A	ENST00000379607.5	-	4	412	c.209G>T	c.(208-210)tGg>tTg	p.W70L	EIF1AX_ENST00000379593.1_Missense_Mutation_p.W42L|snoU2_19_ENST00000364722.1_RNA|snoU2-30_ENST00000365012.1_RNA	NM_001412.3	NP_001403.1	P47813	IF1AX_HUMAN	eukaryotic translation initiation factor 1A, X-linked	70	S1-like.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(2)|lung(1)|ovary(1)|prostate(1)	5						GGTATTTATCCAAACCTACAA	0.323																																					p.W70L		.											.	EIF1AX-131	0			c.G209T						.						56.0	47.0	50.0					X																	20152121		2203	4300	6503	SO:0001583	missense	1964	exon4			TTTATCCAAACCT	L18960	CCDS14196.1	Xp22.13	2014-02-19	2002-11-28	2004-05-26	ENSG00000173674	ENSG00000173674			3250	protein-coding gene	gene with protein product		300186	"""eukaryotic translation initiation factor 1A, X chromosome"""	EIF4C, EIF1A		8106356, 9381176	Standard	NM_001412		Approved	eIF-1A, eIF-4C	uc004czt.3	P47813	OTTHUMG00000022704	ENST00000379607.5:c.209G>T	X.37:g.20152121C>A	ENSP00000368927:p.Trp70Leu	Somatic	37	0		WXS	Illumina HiSeq	Phase_I	33	20	NM_001412	0	0	0	0	0	B2R5U5|Q0VGC2|Q5JPS5|Q5JPS6	Missense_Mutation	SNP	ENST00000379607.5	37	CCDS14196.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.803652	0.90623	.	.	ENSG00000173674	ENST00000379607;ENST00000379593	T;T	0.58652	0.32;0.32	5.64	5.64	0.86602	Nucleic acid-binding, OB-fold-like (1);RNA-binding domain, S1, IF1 type (2);Nucleic acid-binding, OB-fold (1);	.	.	.	.	D	0.86653	0.5984	H	0.99090	4.425	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.92362	0.5898	9	0.87932	D	0	-3.1686	16.8722	0.86043	0.0:1.0:0.0:0.0	.	70	P47813	IF1AX_HUMAN	L	70;42	ENSP00000368927:W70L;ENSP00000368912:W42L	ENSP00000368912:W42L	W	-	2	0	EIF1AX	20062042	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	7.076000	0.76806	2.361000	0.80049	0.600000	0.82982	TGG	.		0.323	EIF1AX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058913.1		
GPR34	2857	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	41555435	41555435	+	Silent	SNP	T	T	A			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chrX:41555435T>A	ENST00000378142.4	+	3	833	c.549T>A	c.(547-549)ctT>ctA	p.L183L	CASK_ENST00000378158.1_Intron|CASK_ENST00000421587.2_Intron|GPR34_ENST00000378138.5_Silent_p.L183L|CASK_ENST00000378154.1_Intron|CASK_ENST00000361962.4_Intron|CASK_ENST00000442742.2_Intron|CASK_ENST00000378163.1_Intron|CASK_ENST00000318588.9_Intron|CASK_ENST00000378166.4_Intron	NM_001097579.1|NM_005300.3	NP_001091048.1|NP_005291.1	Q9UPC5	GPR34_HUMAN	G protein-coupled receptor 34	183					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(1)|large_intestine(6)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	14						TGCTTGCTCTTGGTGGATTCC	0.353																																					p.L183L		.											.	GPR34-131	0			c.T549A						.						63.0	59.0	60.0					X																	41555435		2203	4300	6503	SO:0001819	synonymous_variant	2857	exon3			TGCTCTTGGTGGA	AF039686	CCDS14258.1	Xp11.4	2012-08-21			ENSG00000171659	ENSG00000171659		"""GPCR / Class A : Orphans"""	4490	protein-coding gene	gene with protein product		300241				10395919, 10036181	Standard	NM_005300		Approved		uc004dfq.4	Q9UPC5	OTTHUMG00000021375	ENST00000378142.4:c.549T>A	X.37:g.41555435T>A		Somatic	60	0		WXS	Illumina HiSeq	Phase_I	58	49	NM_001097579	0	0	1	1	0	O95853	Silent	SNP	ENST00000378142.4	37	CCDS14258.1																																																																																			.		0.353	GPR34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056264.1	NM_005300	
GPRASP1	9737	broad.mit.edu	37	X	101908967	101908967	+	Silent	SNP	C	C	A			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chrX:101908967C>A	ENST00000361600.5	+	5	927	c.126C>A	c.(124-126)acC>acA	p.T42T	GPRASP1_ENST00000537097.1_Silent_p.T42T|GPRASP1_ENST00000415986.1_Silent_p.T42T|GPRASP1_ENST00000444152.1_Silent_p.T42T|RP4-769N13.7_ENST00000602441.1_RNA	NM_014710.4	NP_055525.3	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting protein 1	42					endosome to lysosome transport (GO:0008333)|G-protein coupled receptor catabolic process (GO:1990172)	cytoplasm (GO:0005737)				NS(1)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						AGGTTAGGACCCAGGCCCAGA	0.562																																					p.T42T													.	GPRASP1-131	0			c.C126A						.						130.0	128.0	129.0					X																	101908967		2203	4300	6503	SO:0001819	synonymous_variant	9737	exon3			TAGGACCCAGGCC	AB007903	CCDS35352.1	Xq22.1	2014-03-21			ENSG00000198932	ENSG00000198932		"""Armadillo repeat containing"""	24834	protein-coding gene	gene with protein product		300417				9455477, 15086532, 16221301	Standard	NM_014710		Approved	GASP, GASP1	uc010nod.3	Q5JY77	OTTHUMG00000022061	ENST00000361600.5:c.126C>A	X.37:g.101908967C>A		Somatic	145	0		WXS	Illumina HiSeq	Phase_I	125	4	NM_001099411	0	0	0	0	0	O43168|Q96LA1	Silent	SNP	ENST00000361600.5	37	CCDS35352.1																																																																																			.		0.562	GPRASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057634.2	NM_014710	
TXNRD1	7296	broad.mit.edu;bcgsc.ca	37	12	104721450	104721453	+	Splice_Site	DEL	GTGA	GTGA	-			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	GTGA	GTGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr12:104721450_104721453delGTGA	ENST00000529546.1	+	10	1203		c.e10+1		TXNRD1_ENST00000526691.1_Splice_Site|TXNRD1_ENST00000542918.1_Splice_Site|TXNRD1_ENST00000503506.2_Splice_Site|TXNRD1_ENST00000525566.1_Splice_Site|TXNRD1_ENST00000524698.1_Splice_Site|TXNRD1_ENST00000354940.6_Splice_Site|TXNRD1_ENST00000427956.1_Splice_Site|TXNRD1_ENST00000526950.1_Splice_Site|TXNRD1_ENST00000397736.2_Splice_Site|TXNRD1_ENST00000540716.1_Splice_Site|TXNRD1_ENST00000378070.4_Splice_Site|TXNRD1_ENST00000388854.3_Splice_Site|TXNRD1_ENST00000429002.2_Splice_Site|TXNRD1_ENST00000526390.1_Splice_Site			Q16881	TRXR1_HUMAN	thioredoxin reductase 1						cell proliferation (GO:0008283)|cell redox homeostasis (GO:0045454)|cellular lipid metabolic process (GO:0044255)|mesoderm formation (GO:0001707)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|NADP binding (GO:0050661)|protein disulfide oxidoreductase activity (GO:0015035)|thioredoxin-disulfide reductase activity (GO:0004791)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(5)|skin(1)|stomach(1)|urinary_tract(1)	16					Arsenic trioxide(DB01169)|Flavin adenine dinucleotide(DB03147)	CACTGTCAAGGTGAGTGTTGTGCT	0.466																																					.	Ovarian(139;555 1836 9186 9946 10884)												.	TXNRD1-90	0			.						.																																			SO:0001630	splice_region_variant	7296	.			GTCAAGGTGAGTG		CCDS53820.1, CCDS53821.1, CCDS53823.1, CCDS58274.1	12q23-q24.1	2012-03-01							12437	protein-coding gene	gene with protein product		601112				7589432	Standard	NM_001093771		Approved	TXNR, GRIM-12, Trxr1	uc021rcx.2	Q16881		ENST00000529546.1:c.978+1GTGA>-	12.37:g.104721450_104721453delGTGA		Somatic	45	0		WXS	Illumina HiSeq	Phase_I	21	9	.	0	0	0	0	0	B7Z1F4|B7Z3Y8|B7Z904|E9PMY9|F5H780|Q6FI31|Q6VB40|Q6VB41|Q6VB42|Q6VBP2|Q6VBP3|Q6VBP4|Q6VBP5|Q6VBP9|Q6VBQ0|Q6YNQ1|Q76P53|Q7LA96|Q8WVC8|Q99475|Q9UES8|Q9UH79	Splice_Site	DEL	ENST00000529546.1	37	CCDS58274.1																																																																																			.		0.466	TXNRD1-004	PUTATIVE	basic|exp_conf|CCDS|seleno	protein_coding	protein_coding	OTTHUMT00000389969.1	NM_003330	Intron
COL4A3BP	10087	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	74712823	74712828	+	In_Frame_Del	DEL	TACCAT	TACCAT	-			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	TACCAT	TACCAT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr5:74712823_74712828delTACCAT	ENST00000405807.4	-	7	1131_1136	c.710_715delATGGTA	c.(709-717)aatggtata>ata	p.NG237del	COL4A3BP_ENST00000261415.7_In_Frame_Del_p.NG237del|COL4A3BP_ENST00000380494.5_In_Frame_Del_p.NG365del	NM_005713.2	NP_005704.1	Q9Y5P4	C43BP_HUMAN	collagen, type IV, alpha 3 (Goodpasture antigen) binding protein	237					cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|ceramide metabolic process (GO:0006672)|endoplasmic reticulum organization (GO:0007029)|ER to Golgi ceramide transport (GO:0035621)|heart morphogenesis (GO:0003007)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|lipid homeostasis (GO:0055088)|mitochondrion morphogenesis (GO:0070584)|muscle contraction (GO:0006936)|protein phosphorylation (GO:0006468)|response to endoplasmic reticulum stress (GO:0034976)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ceramide binding (GO:0097001)|ceramide transporter activity (GO:0035620)|phosphatidylinositol-4-phosphate binding (GO:0070273)|protein kinase activity (GO:0004672)			breast(1)|kidney(1)|large_intestine(5)|lung(4)|skin(3)|stomach(1)|urinary_tract(1)	16		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)		OV - Ovarian serous cystadenocarcinoma(47;1e-53)		TTAAAGTCTATACCATTAATTCCTTT	0.32																																					p.365_367del		.											.	COL4A3BP-226	0			c.1094_1099del						.																																			SO:0001651	inframe_deletion	10087	exon8			.	AF136450	CCDS4028.1, CCDS4029.1, CCDS47235.1	5q13.3	2013-01-10	2007-06-08	2007-06-08	ENSG00000113163	ENSG00000113163		"""StAR-related lipid transfer (START) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2205	protein-coding gene	gene with protein product	"""ceramide transporter"", ""StAR-related lipid transfer (START) domain containing 11"""	604677				10212244	Standard	NM_001130105		Approved	GPBP, STARD11, CERT	uc003kdt.3	Q9Y5P4	OTTHUMG00000102068	ENST00000405807.4:c.710_715delATGGTA	5.37:g.74712823_74712828delTACCAT	ENSP00000383996:p.Asn237_Gly238del	Somatic	89	0		WXS	Illumina HiSeq	Phase_I	73	26	NM_001130105	0	0	0	0	0	A8K7S2|B3KUB7|Q53YV1|Q53YV2|Q96Q85|Q96Q88|Q9H2S7|Q9H2S8	In_Frame_Del	DEL	ENST00000405807.4	37	CCDS4028.1																																																																																			.		0.320	COL4A3BP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219875.2	NM_005713	
IL32	9235	broad.mit.edu	37	16	3119304	3119305	+	Frame_Shift_Ins	INS	-	-	G	rs398100042|rs2981599		TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr16:3119304_3119305insG	ENST00000534507.1	+	6	864_865	c.653_654insG	c.(652-657)gacaagfs	p.DK218fs	IL32_ENST00000325568.5_Frame_Shift_Ins_p.DK172fs|IL32_ENST00000008180.9_Frame_Shift_Ins_p.DK152fs|IL32_ENST00000552936.1_Frame_Shift_Ins_p.DK196fs|IL32_ENST00000396887.3_Frame_Shift_Ins_p.DK115fs|IL32_ENST00000530890.1_Frame_Shift_Ins_p.DK152fs|RNU1-125P_ENST00000516752.1_RNA|IL32_ENST00000551122.1_Frame_Shift_Ins_p.DK115fs|IL32_ENST00000444393.3_Frame_Shift_Ins_p.DK172fs|IL32_ENST00000525643.2_Frame_Shift_Ins_p.DK172fs|IL32_ENST00000382213.3_Frame_Shift_Ins_p.DK163fs|IL32_ENST00000440815.3_Frame_Shift_Ins_p.DK172fs|IL32_ENST00000526464.2_Frame_Shift_Ins_p.DK172fs|IL32_ENST00000552664.1_Frame_Shift_Ins_p.DK172fs|IL32_ENST00000533097.2_Frame_Shift_Ins_p.DK172fs|IL32_ENST00000530538.2_Frame_Shift_Ins_p.DK172fs|IL32_ENST00000549213.1_Frame_Shift_Ins_p.DK115fs|IL32_ENST00000529550.1_Frame_Shift_Ins_p.DK172fs|IL32_ENST00000551513.1_Frame_Shift_Ins_p.DK209fs|IL32_ENST00000396890.2_Frame_Shift_Ins_p.DK218fs|IL32_ENST00000529699.1_Frame_Shift_Ins_p.DK152fs|IL32_ENST00000548476.1_Frame_Shift_Ins_p.DK218fs|IL32_ENST00000552356.1_Frame_Shift_Ins_p.DK152fs|IL32_ENST00000548652.1_Frame_Shift_Ins_p.DK163fs|IL32_ENST00000528163.2_Frame_Shift_Ins_p.DK172fs|IL32_ENST00000548246.1_Frame_Shift_Ins_p.DK132fs|IL32_ENST00000531965.1_Frame_Shift_Ins_p.DK162fs			P24001	IL32_HUMAN	interleukin 32	218					cell adhesion (GO:0007155)|defense response (GO:0006952)|immune response (GO:0006955)	extracellular space (GO:0005615)|membrane (GO:0016020)				breast(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	15						CCACGGGGGGACAAGGAGGAGC	0.574																																					p.D172fs													.	IL32-92	0			c.515_516insG						.																																			SO:0001589	frameshift_variant	9235	exon7			GGGGGGACAAGGA	M59807	CCDS32377.1, CCDS32378.1, CCDS32379.1, CCDS45394.1	16p13.3	2011-07-21			ENSG00000008517	ENSG00000008517		"""Interleukins and interleukin receptors"""	16830	protein-coding gene	gene with protein product	"""natural killer cell transcript 4"""	606001				1729377, 9653642	Standard	XM_005255686		Approved	NK4, TAIF, TAIFb, TAIFd	uc002ctn.3	P24001	OTTHUMG00000167498	Exception_encountered	16.37:g.3119304_3119305insG	ENSP00000431775:p.Asp218fs	Somatic	227	0		WXS	Illumina HiSeq	Phase_I	447	21	NM_001012632	0	0	0	0	0	A6NNM0|A8MPX0|B4DJM1|B8Q191|D3DUB0|D3DUB2|Q5VFH7|Q5VFH8|Q8WV38|Q96GK9	Frame_Shift_Ins	INS	ENST00000534507.1	37																																																																																				.		0.574	IL32-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000394812.2	NM_004221	
BCORL1	63035	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	129173153	129173154	+	Frame_Shift_Ins	INS	-	-	CTGG			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chrX:129173153_129173154insCTGG	ENST00000218147.7	+	10	4711_4712	c.4514_4515insCTGG	c.(4513-4518)atctggfs	p.-1509fs	BCORL1_ENST00000359304.2_Frame_Shift_Ins_p.-1379fs|BCORL1_ENST00000303743.5_Frame_Shift_Ins_p.-1583fs|BCORL1_ENST00000540052.1_Frame_Shift_Ins_p.-1509fs			Q5H9F3	BCORL_HUMAN	BCL6 corepressor-like 1						chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|liver(3)|lung(30)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	75						CTGGAGACCATCTGGCTCCTGC	0.574																																					p.I1505fs		.											.	BCORL1-294	0			c.4514_4515insCTGG						.																																			SO:0001589	frameshift_variant	63035	exon9			.	AL136450	CCDS14616.1	Xq25-q26.1	2014-09-17	2010-06-10		ENSG00000085185	ENSG00000085185		"""Ankyrin repeat domain containing"""	25657	protein-coding gene	gene with protein product		300688	"""chromosome X open reading frame 10"", ""BCL6 co-repressor-like 1"""	CXorf10			Standard	NM_021946		Approved	FLJ11362	uc022cdu.1	Q5H9F3	OTTHUMG00000022379	ENST00000218147.7:c.4515_4518dupCTGG	X.37:g.129173154_129173157dupCTGG	ENSP00000218147:p.Leu1509fs	Somatic	74	0		WXS	Illumina HiSeq	Phase_I	38	22	NM_021946	0	0	0	0	0	B5MDQ8|Q5H9F2|Q5H9F4|Q6ZVE0|Q8TEN3|Q9Y528	Frame_Shift_Ins	INS	ENST00000218147.7	37	CCDS14616.1																																																																																			.		0.574	BCORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058223.1	NM_021946	
