#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
FUCA1	2517	hgsc.bcm.edu	37	1	24194770	24194770	+	Missense_Mutation	SNP	C	C	G	rs61996282	byFrequency	TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr1:24194770C>G	ENST00000374479.3	-	1	14	c.7G>C	c.(7-9)Gct>Cct	p.A3P		NM_000147.4	NP_000138.2	P04066	FUCO_HUMAN	fucosidase, alpha-L- 1, tissue	3					fucose metabolic process (GO:0006004)|glycosaminoglycan catabolic process (GO:0006027)|glycoside catabolic process (GO:0016139)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-L-fucosidase activity (GO:0004560)|fucose binding (GO:0042806)			breast(1)|endometrium(1)|large_intestine(3)|lung(3)	8		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-24)|Colorectal(126;5.69e-08)|COAD - Colon adenocarcinoma(152;3.15e-06)|GBM - Glioblastoma multiforme(114;9.04e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000986)|KIRC - Kidney renal clear cell carcinoma(1967;0.00342)|STAD - Stomach adenocarcinoma(196;0.0128)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.144)		ATCCCCGGAGCCCGCATCGCT	0.721													C|||	67	0.0133786	0.0008	0.0562	5008	,	,		13629	0.0		0.0109	False		,,,				2504	0.0164				p.A3P		.											.	FUCA1-153	0			c.G7C						.	C	PRO/ALA	4,3362		0,4,1679	2.0	5.0	4.0		7	-3.6	0.0	1	dbSNP_129	4	18,7074		0,18,3528	no	missense	FUCA1	NM_000147.4	27	0,22,5207	GG,GC,CC		0.2538,0.1188,0.2104	possibly-damaging	3/467	24194770	22,10436	1683	3546	5229	SO:0001583	missense	2517	exon1			CCGGAGCCCGCAT	BC017338	CCDS244.2	1p34	2012-10-02			ENSG00000179163	ENSG00000179163	3.2.1.51		4006	protein-coding gene	gene with protein product		612280				2803312	Standard	NM_000147		Approved		uc001bie.3	P04066	OTTHUMG00000002965	ENST00000374479.3:c.7G>C	1.37:g.24194770C>G	ENSP00000363603:p.Ala3Pro	Somatic	5	1		WXS	Illumina HiSeq	Phase_I	11	7	NM_000147	0	0	0	0	0	B2RBG3|Q14334|Q14335|Q3LID0|Q8NAC2	Missense_Mutation	SNP	ENST00000374479.3	37	CCDS244.2	18	0.008241758241758242	1	0.0020325203252032522	11	0.03038674033149171	0	0.0	6	0.0079155672823219	C	19.36	3.813328	0.70912	0.001188	0.002538	ENSG00000179163	ENST00000374479	T	0.53206	0.63	4.9	-3.58	0.04597	.	4.458410	0.00604	N	0.000389	T	0.08223	0.0205	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.06058	-1.0848	10	0.33940	T	0.23	-20.1632	0.5779	0.00707	0.2648:0.318:0.1932:0.2239	rs61996282	3	P04066	FUCO_HUMAN	P	3	ENSP00000363603:A3P	ENSP00000363603:A3P	A	-	1	0	FUCA1	24067357	0.000000	0.05858	0.000000	0.03702	0.036000	0.12997	-2.499000	0.00968	-0.267000	0.09325	0.561000	0.74099	GCT	C|0.960;G|0.040		0.721	FUCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008259.2	NM_000147	
MYOM3	127294	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	24421403	24421403	+	Missense_Mutation	SNP	G	G	T			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr1:24421403G>T	ENST00000374434.3	-	9	1030	c.868C>A	c.(868-870)Ctg>Atg	p.L290M	MYOM3_ENST00000329601.7_Missense_Mutation_p.L290M|MYOM3_ENST00000475306.1_5'UTR|MYOM3_ENST00000330966.7_Missense_Mutation_p.L291M	NM_152372.3	NP_689585.3	Q5VTT5	MYOM3_HUMAN	myomesin 3	290	Ig-like C2-type 2.					M band (GO:0031430)	protein homodimerization activity (GO:0042803)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(3)|lung(40)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	68		Colorectal(325;3.55e-05)|Renal(390;0.000703)|Lung NSC(340;0.001)|all_lung(284;0.0014)|Ovarian(437;0.00351)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;5.31e-24)|Colorectal(126;7.52e-08)|COAD - Colon adenocarcinoma(152;4.01e-06)|GBM - Glioblastoma multiforme(114;4.36e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00108)|KIRC - Kidney renal clear cell carcinoma(1967;0.00404)|STAD - Stomach adenocarcinoma(196;0.00966)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.153)		AAGCATGACAGGGAGAAGGGT	0.562																																					p.L290M													.	MYOM3-93	0			c.C868A						.						56.0	58.0	57.0					1																	24421403		1947	4154	6101	SO:0001583	missense	127294	exon9			ATGACAGGGAGAA	AK093280	CCDS41281.1	1p36	2013-02-11	2012-10-17		ENSG00000142661	ENSG00000142661		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	26679	protein-coding gene	gene with protein product			"""myomesin family, member 3"""			18177667	Standard	NM_152372		Approved	FLJ35961	uc001bin.4	Q5VTT5	OTTHUMG00000002969	ENST00000374434.3:c.868C>A	1.37:g.24421403G>T	ENSP00000363557:p.Leu290Met	Somatic	52	2		WXS	Illumina HiSeq	Phase_I	51	17	NM_152372	0	0	6	11	5	A6NF75|Q5VTT6|Q6AWC0|Q6AWC1|Q6NXF9|Q6ZRG7|Q7Z3G9|Q8NA11|Q96C54	Missense_Mutation	SNP	ENST00000374434.3	37	CCDS41281.1	.	.	.	.	.	.	.	.	.	.	G	15.53	2.860822	0.51482	.	.	ENSG00000142661	ENST00000374434;ENST00000330966;ENST00000329601	T;T;T	0.74842	-0.88;-0.88;-0.88	5.18	2.92	0.33932	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.070081	0.64402	D	0.000019	T	0.82130	0.4970	L	0.59912	1.85	0.31628	N	0.649366	D;D	0.76494	0.997;0.999	D;D	0.72075	0.976;0.942	D	0.83770	0.0219	10	0.87932	D	0	.	12.8254	0.57716	0.1763:0.0:0.8237:0.0	.	290;290	Q5VTT5-2;Q5VTT5	.;MYOM3_HUMAN	M	290;291;290	ENSP00000363557:L290M;ENSP00000332670:L291M;ENSP00000328415:L290M	ENSP00000328415:L290M	L	-	1	2	MYOM3	24293990	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	2.902000	0.48703	0.582000	0.29556	-1.151000	0.01829	CTG	.		0.562	MYOM3-001	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000008272.2	NM_152372	
ARID1A	8289	broad.mit.edu;bcgsc.ca	37	1	27087947	27087947	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr1:27087947G>A	ENST00000324856.7	+	6	2605	c.2234G>A	c.(2233-2235)aGc>aAc	p.S745N	ARID1A_ENST00000374152.2_Missense_Mutation_p.S362N|ARID1A_ENST00000457599.2_Missense_Mutation_p.S745N|RN7SL501P_ENST00000578818.1_RNA	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	745					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		AACCAATCAAGCATTGCCCAA	0.547			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.S745N				Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	ARID1A-584	0			c.G2234A						.						98.0	87.0	90.0					1																	27087947		2203	4300	6503	SO:0001583	missense	8289	exon6			AATCAAGCATTGC	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.2234G>A	1.37:g.27087947G>A	ENSP00000320485:p.Ser745Asn	Somatic	89	0		WXS	Illumina HiSeq	Phase_I	108	8	NM_006015	0	0	4	4	0	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Missense_Mutation	SNP	ENST00000324856.7	37	CCDS285.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.054299	0.75960	.	.	ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152	T;T;T	0.22134	1.97;1.97;4.19	5.85	4.89	0.63831	.	0.218756	0.51477	D	0.000090	T	0.18425	0.0442	L	0.40543	1.245	0.80722	D	1	P;P;P	0.37276	0.454;0.589;0.454	B;B;B	0.33454	0.079;0.164;0.105	T	0.02275	-1.1184	10	0.40728	T	0.16	-14.2837	15.7952	0.78404	0.0:0.2399:0.7601:0.0	.	745;745;399	O14497;O14497-2;Q4LE49	ARI1A_HUMAN;.;.	N	745;745;362	ENSP00000320485:S745N;ENSP00000387636:S745N;ENSP00000363267:S362N	ENSP00000320485:S745N	S	+	2	0	ARID1A	26960534	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.042000	0.49815	2.768000	0.95171	0.655000	0.94253	AGC	.		0.547	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
PEF1	553115	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	32100955	32100955	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr1:32100955C>A	ENST00000373703.4	-	2	215	c.193G>T	c.(193-195)Gga>Tga	p.G65*	PEF1_ENST00000492061.1_5'UTR|PEF1_ENST00000440872.2_Nonsense_Mutation_p.G65*	NM_012392.3	NP_036524.1	Q9UBV8	PEF1_HUMAN	penta-EF-hand domain containing 1	65	9 X 9 AA approximate tandem repeat of [AP]-P-G-G-P-Y-G-G-P-P.				proteolysis (GO:0006508)|response to calcium ion (GO:0051592)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|poly(A) RNA binding (GO:0044822)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|prostate(2)|upper_aerodigestive_tract(1)	7		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)|all_neural(195;0.186)		STAD - Stomach adenocarcinoma(196;0.0546)		TTGGGGTGTCCATAGGGCCCT	0.627																																					p.G65X		.											.	PEF1-68	0			c.G193T						.						23.0	25.0	25.0					1																	32100955		2203	4299	6502	SO:0001587	stop_gained	553115	exon2			GGTGTCCATAGGG		CCDS345.1	1p34	2013-01-10			ENSG00000162517	ENSG00000162517		"""EF-hand domain containing"""	30009	protein-coding gene	gene with protein product	"""peflin"""	610033				10486255, 11883899	Standard	NM_012392		Approved	PEF1A	uc001bth.2	Q9UBV8	OTTHUMG00000003877	ENST00000373703.4:c.193G>T	1.37:g.32100955C>A	ENSP00000362807:p.Gly65*	Somatic	45	0		WXS	Illumina HiSeq	Phase_I	51	18	NM_012392	0	0	12	12	0		Nonsense_Mutation	SNP	ENST00000373703.4	37	CCDS345.1	.	.	.	.	.	.	.	.	.	.	C	34	5.384325	0.95967	.	.	ENSG00000162517	ENST00000373703;ENST00000440872	.	.	.	4.71	4.71	0.59529	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.22109	T	0.4	.	17.2908	0.87156	0.0:1.0:0.0:0.0	.	.	.	.	X	65	.	ENSP00000362807:G65X	G	-	1	0	PEF1	31873542	1.000000	0.71417	0.998000	0.56505	0.930000	0.56654	6.128000	0.71650	2.541000	0.85698	0.561000	0.74099	GGA	.		0.627	PEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011046.1	NM_012392	
CFAP57	149465	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	43649478	43649478	+	Missense_Mutation	SNP	G	G	C			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr1:43649478G>C	ENST00000372492.4	+	4	1015	c.691G>C	c.(691-693)Gag>Cag	p.E231Q	WDR65_ENST00000528956.1_Missense_Mutation_p.E231Q	NM_001195831.2	NP_001182760.2	Q96MR6	WDR65_HUMAN		231										NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				TCAGCGTTGGGAGACCAGCAT	0.502																																					p.E231Q		.											.	WDR65-91	0			c.G691C						.						148.0	138.0	142.0					1																	43649478		2203	4300	6503	SO:0001583	missense	149465	exon4			CGTTGGGAGACCA																												ENST00000372492.4:c.691G>C	1.37:g.43649478G>C	ENSP00000361570:p.Glu231Gln	Somatic	179	1		WXS	Illumina HiSeq	Phase_I	188	50	NM_152498	0	0	0	1	1	A6NKQ3|Q17RI9|Q5TAI0	Missense_Mutation	SNP	ENST00000372492.4	37		.	.	.	.	.	.	.	.	.	.	G	17.74	3.463543	0.63513	.	.	ENSG00000243710	ENST00000372492;ENST00000528956	T;T	0.39592	1.07;3.56	6.07	6.07	0.98685	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.56601	0.1996	M	0.77820	2.39	0.47511	D	0.999446	B;P	0.46277	0.409;0.875	B;P	0.51324	0.082;0.666	T	0.49570	-0.8926	10	0.17832	T	0.49	.	17.5684	0.87927	0.0:0.1231:0.8769:0.0	.	231;231	Q96MR6;Q96MR6-2	WDR65_HUMAN;.	Q	231	ENSP00000361570:E231Q;ENSP00000435310:E231Q	ENSP00000361570:E231Q	E	+	1	0	WDR65	43422065	1.000000	0.71417	1.000000	0.80357	0.778000	0.44026	6.039000	0.70972	2.885000	0.99019	0.655000	0.94253	GAG	.		0.502	WDR65-002	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000384325.1		
DEDD	9191	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	161092019	161092019	+	Missense_Mutation	SNP	A	A	C			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr1:161092019A>C	ENST00000368006.3	-	6	1089	c.875T>G	c.(874-876)cTg>cGg	p.L292R	DEDD_ENST00000490843.2_Missense_Mutation_p.L292R|DEDD_ENST00000458050.2_Missense_Mutation_p.L292R|DEDD_ENST00000368005.1_Missense_Mutation_p.L322R|NIT1_ENST00000368008.1_Intron|DEDD_ENST00000545495.1_Missense_Mutation_p.L292R|DEDD_ENST00000392188.1_Missense_Mutation_p.L322R|DEDD_ENST00000489249.1_5'UTR	NM_032998.2	NP_127491.1	O75618	DEDD_HUMAN	death effector domain containing	292					decidualization (GO:0046697)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901837)|regulation of apoptotic process (GO:0042981)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	DNA binding (GO:0003677)			cervix(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|skin(1)	10	all_cancers(52;3.39e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			ATTTACCAGCAGCTTGATGGC	0.498																																					p.L292R		.											.	DEDD-90	0			c.T875G						.						100.0	93.0	95.0					1																	161092019		2203	4300	6503	SO:0001583	missense	9191	exon5			ACCAGCAGCTTGA	AF043733	CCDS1219.1	1q23.1	2008-02-05	2002-01-14		ENSG00000158796	ENSG00000158796			2755	protein-coding gene	gene with protein product		606841	"""death effector domain-containing"""			9774341, 9832420	Standard	XM_005245597		Approved	DEFT, FLDED1, CASP8IP1, KE05, DEDD1	uc001fxz.3	O75618	OTTHUMG00000033104	ENST00000368006.3:c.875T>G	1.37:g.161092019A>C	ENSP00000356985:p.Leu292Arg	Somatic	95	0		WXS	Illumina HiSeq	Phase_I	95	32	NM_001039711	0	0	36	61	25	D3DVF5|O60737	Missense_Mutation	SNP	ENST00000368006.3	37	CCDS1219.1	.	.	.	.	.	.	.	.	.	.	A	19.68	3.871963	0.72180	.	.	ENSG00000158796	ENST00000368006;ENST00000392188;ENST00000545495;ENST00000458050;ENST00000541906;ENST00000368005;ENST00000535389	.	.	.	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.70386	0.3218	M	0.64997	1.995	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.998	D;D;D	0.87578	0.998;0.997;0.996	T	0.74948	-0.3490	9	0.87932	D	0	.	13.2065	0.59800	1.0:0.0:0.0:0.0	.	249;322;292	B4DKM1;B1AQP5;O75618	.;.;DEDD_HUMAN	R	292;322;292;292;292;322;249	.	ENSP00000356984:L322R	L	-	2	0	DEDD	159358643	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.135000	0.94478	2.209000	0.71365	0.533000	0.62120	CTG	.		0.498	DEDD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080582.1	NM_004216	
RGS1	5996	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	192547354	192547354	+	Missense_Mutation	SNP	G	G	C			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr1:192547354G>C	ENST00000367459.3	+	4	349	c.283G>C	c.(283-285)Ggt>Cgt	p.G95R	RGS1_ENST00000469578.2_Missense_Mutation_p.G95R	NM_002922.3	NP_002913.3	Q08116	RGS1_HUMAN	regulator of G-protein signaling 1	95	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|immune response (GO:0006955)|positive regulation of GTPase activity (GO:0043547)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)			kidney(8)|large_intestine(1)|lung(13)	22		Breast(1374;0.188)				CTTTTTAGCTGGTCAAAATGT	0.343																																					p.G95R		.											.	RGS1-226	0			c.G283C						.						122.0	130.0	127.0					1																	192547354		2203	4300	6503	SO:0001583	missense	5996	exon4			TTAGCTGGTCAAA	AF493925	CCDS1375.2	1q31	2008-02-05	2007-08-14		ENSG00000090104	ENSG00000090104		"""Regulators of G-protein signaling"""	9991	protein-coding gene	gene with protein product		600323	"""regulator of G-protein signalling 1"""	IER1		8241276, 8602223	Standard	NM_002922		Approved	1R20, IR20, BL34	uc001gsi.1	Q08116	OTTHUMG00000035598	ENST00000367459.3:c.283G>C	1.37:g.192547354G>C	ENSP00000356429:p.Gly95Arg	Somatic	187	0		WXS	Illumina HiSeq	Phase_I	151	40	NM_002922	0	0	2	2	0	B2RDM9|B4DZY0|Q07918|Q9H1W2	Missense_Mutation	SNP	ENST00000367459.3	37	CCDS1375.2	.	.	.	.	.	.	.	.	.	.	G	13.87	2.365805	0.41902	.	.	ENSG00000090104	ENST00000367459	T	0.02944	4.1	5.91	5.91	0.95273	Regulator of G protein signalling (4);Regulator of G protein signalling superfamily (1);Regulator of G-protein signaling, domain 1 (1);	0.000000	0.85682	D	0.000000	T	0.25680	0.0625	H	0.94886	3.595	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.12319	-1.0552	10	0.87932	D	0	.	18.8649	0.92287	0.0:0.0:1.0:0.0	.	95;95	Q08116-2;Q08116	.;RGS1_HUMAN	R	95	ENSP00000356429:G95R	ENSP00000356429:G95R	G	+	1	0	RGS1	190813977	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	7.640000	0.83355	2.804000	0.96469	0.650000	0.86243	GGT	.		0.343	RGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086391.1	NM_002922	
PLXNA2	5362	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	208215581	208215581	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr1:208215581C>T	ENST00000367033.3	-	22	4905	c.4148G>A	c.(4147-4149)cGg>cAg	p.R1383Q		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	1383					axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		CACGTTGCCCCGGTCGCGCAT	0.582																																					p.R1383Q		.											.	PLXNA2-92	0			c.G4148A						.						94.0	92.0	92.0					1																	208215581		2203	4300	6503	SO:0001583	missense	5362	exon22			TTGCCCCGGTCGC	X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.4148G>A	1.37:g.208215581C>T	ENSP00000356000:p.Arg1383Gln	Somatic	91	0		WXS	Illumina HiSeq	Phase_I	91	30	NM_025179	0	0	1	2	1	A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Missense_Mutation	SNP	ENST00000367033.3	37	CCDS31013.1	.	.	.	.	.	.	.	.	.	.	C	35	5.504221	0.96371	.	.	ENSG00000076356	ENST00000367033	T	0.15718	2.4	5.15	5.15	0.70609	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.46092	0.1375	M	0.78456	2.415	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.49916	-0.8888	10	0.87932	D	0	.	18.6381	0.91385	0.0:1.0:0.0:0.0	.	1383	O75051	PLXA2_HUMAN	Q	1383	ENSP00000356000:R1383Q	ENSP00000356000:R1383Q	R	-	2	0	PLXNA2	206282204	1.000000	0.71417	0.980000	0.43619	0.826000	0.46750	7.480000	0.81109	2.391000	0.81399	0.455000	0.32223	CGG	.		0.582	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088932.6	NM_025179	
NUP133	55746	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	229631732	229631732	+	Silent	SNP	G	G	T			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr1:229631732G>T	ENST00000261396.3	-	7	973	c.882C>A	c.(880-882)atC>atA	p.I294I	NUP133_ENST00000537506.1_Silent_p.I278I	NM_018230.2	NP_060700.2	Q8WUM0	NU133_HUMAN	nucleoporin 133kDa	294			I -> V (in dbSNP:rs11805194).		carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear pore organization (GO:0006999)|paraxial mesoderm development (GO:0048339)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)			NS(1)|breast(7)|endometrium(1)|kidney(6)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(4)	56	Breast(184;0.104)|Ovarian(103;0.249)	Prostate(94;0.167)				CCCATTTACTGATGTTTGAAC	0.363																																					p.I294I		.											.	NUP133-271	0			c.C882A						.						105.0	101.0	103.0					1																	229631732		2203	4299	6502	SO:0001819	synonymous_variant	55746	exon7			TTTACTGATGTTT		CCDS1579.1	1q42.13	2008-02-05	2002-08-29		ENSG00000069248	ENSG00000069248			18016	protein-coding gene	gene with protein product		607613	"""nucleoporin 133kD"""			11684705	Standard	NM_018230		Approved	FLJ10814	uc001htn.3	Q8WUM0	OTTHUMG00000039462	ENST00000261396.3:c.882C>A	1.37:g.229631732G>T		Somatic	65	0		WXS	Illumina HiSeq	Phase_I	74	31	NM_018230	0	0	6	6	0	B2RAZ8|Q5T8N0|Q9H9W2|Q9NV71|Q9NVC4	Silent	SNP	ENST00000261396.3	37	CCDS1579.1																																																																																			.		0.363	NUP133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095224.1	NM_018230	
PCDH15	65217	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	55570392	55570392	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr10:55570392C>T	ENST00000373965.2	-	35	4821	c.4427G>A	c.(4426-4428)cGa>cAa	p.R1476Q	PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000395445.1_Missense_Mutation_p.R1476Q|PCDH15_ENST00000409834.1_Missense_Mutation_p.D1104N|PCDH15_ENST00000414778.1_Missense_Mutation_p.R1473Q|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000395438.1_Missense_Mutation_p.D1493N	NM_001142771.1|NM_001142772.1	NP_001136243.1|NP_001136244.1	Q96QU1	PCD15_HUMAN	protocadherin-related 15	0					equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				TGGTAACAATCGACGGCGACT	0.393										HNSCC(58;0.16)																											.													.	PCDH15-193	0			.						.						174.0	160.0	164.0					10																	55570392		1568	3582	5150	SO:0001583	missense	65217	.			AACAATCGACGGC	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000373965.2:c.4427G>A	10.37:g.55570392C>T	ENSP00000363076:p.Arg1476Gln	Somatic	213	0		WXS	Illumina HiSeq	Phase_I	210	58	.	0	0	0	0	0	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	ENST00000373965.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	32|32	5.144084|5.144084	0.94603|0.94603	.|.	.|.	ENSG00000150275|ENSG00000150275	ENST00000395438;ENST00000409834|ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395445	T;T|T;T;T	0.58940|0.65916	0.33;0.3|0.11;0.23;-0.18	6.16|6.16	6.16|6.16	0.99307|0.99307	.|.	.|.	.|.	.|.	.|.	T|T	0.69940|0.69940	0.3167|0.3167	L|L	0.40543|0.40543	1.245|1.245	0.80722|0.80722	D|D	1|1	B|D;D;D;B	0.32128|0.76494	0.357|0.999;0.999;0.992;0.308	B|P;P;P;B	0.15870|0.58970	0.014|0.849;0.849;0.644;0.051	T|T	0.63928|0.63928	-0.6526|-0.6526	9|9	0.20519|0.32370	T|T	0.43|0.25	.|.	19.6313|19.6313	0.95704|0.95704	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1493|1474;1476;1467;1473	A2A3E3|C6ZEF5;A2A3E2;C6ZEF7;C9J4F3	.|.;.;.;.	N|Q	1493;1104|1476;1473;1469;1476	ENSP00000378826:D1493N;ENSP00000386693:D1104N|ENSP00000363076:R1476Q;ENSP00000410304:R1473Q;ENSP00000378832:R1476Q	ENSP00000378826:D1493N|ENSP00000363076:R1476Q	D|R	-|-	1|2	0|0	PCDH15|PCDH15	55240398|55240398	1.000000|1.000000	0.71417|0.71417	0.974000|0.974000	0.42286|0.42286	0.984000|0.984000	0.73092|0.73092	4.761000|4.761000	0.62243|0.62243	2.937000|2.937000	0.99478|0.99478	0.650000|0.650000	0.86243|0.86243	GAT|CGA	.		0.393	PCDH15-008	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000291336.1	NM_033056	
KIF20B	9585	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	91498338	91498338	+	Missense_Mutation	SNP	A	A	C			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr10:91498338A>C	ENST00000371728.3	+	20	3805	c.3740A>C	c.(3739-3741)gAa>gCa	p.E1247A	KIF20B_ENST00000416354.1_Missense_Mutation_p.E1277A|KIF20B_ENST00000394289.2_Missense_Mutation_p.E1247A|KIF20B_ENST00000478929.1_3'UTR|KIF20B_ENST00000260753.4_Missense_Mutation_p.E1207A	NM_001284259.1	NP_001271188.1	Q96Q89	KI20B_HUMAN	kinesin family member 20B	1247	Poly-Glu.				ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|neural tube closure (GO:0001843)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization (GO:0070201)|regulation of mitosis (GO:0007088)|regulation of neuron migration (GO:2001222)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|WW domain binding (GO:0050699)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	58						CAATTAAAAGAAGAAGAAGAA	0.279																																					p.E1207A		.											.	KIF20B-93	0			c.A3620C						.						33.0	35.0	34.0					10																	91498338		2006	4193	6199	SO:0001583	missense	9585	exon20			TAAAAGAAGAAGA	L16782	CCDS7407.1, CCDS60590.1	10q23.31	2009-08-06	2008-07-31	2008-07-31	ENSG00000138182	ENSG00000138182			7212	protein-coding gene	gene with protein product	"""cancer/testis antigen 90"""	605498	"""M-phase phosphoprotein 1"""	MPHOSPH1		8885239, 8290587, 11470801	Standard	NM_016195		Approved	MPP1, KRMP1, CT90	uc001kgr.1	Q96Q89	OTTHUMG00000018725	ENST00000371728.3:c.3740A>C	10.37:g.91498338A>C	ENSP00000360793:p.Glu1247Ala	Somatic	46	0		WXS	Illumina HiSeq	Phase_I	59	23	NM_016195	0	0	0	0	0	A8MXM7|O43277|Q09471|Q2KQ73|Q32NE1|Q561V3|Q58EX8|Q5T9M8|Q5T9M9|Q5T9N0|Q5T9N1|Q7KZ68|Q7Z5E0|Q7Z5E1|Q7Z6M9|Q86X82|Q9H3R8|Q9H6Q9|Q9H755|Q9NTC1|Q9UFR5	Missense_Mutation	SNP	ENST00000371728.3	37		.	.	.	.	.	.	.	.	.	.	A	12.72	2.021492	0.35701	.	.	ENSG00000138182	ENST00000260753;ENST00000416354;ENST00000394289;ENST00000371728	T;T;T;T	0.71341	-0.46;-0.48;-0.56;-0.48	5.82	4.62	0.57501	.	0.125962	0.36167	N	0.002752	T	0.65375	0.2685	M	0.62723	1.935	0.32524	N	0.535885	P;P	0.52316	0.919;0.952	B;B	0.43916	0.253;0.436	T	0.75419	-0.3324	10	0.56958	D	0.05	-24.2326	5.4057	0.16320	0.6693:0.0:0.073:0.2577	.	1247;1207	Q96Q89;Q96Q89-3	KI20B_HUMAN;.	A	1207;1277;1247;1247	ENSP00000260753:E1207A;ENSP00000411545:E1277A;ENSP00000377830:E1247A;ENSP00000360793:E1247A	ENSP00000260753:E1207A	E	+	2	0	KIF20B	91488318	1.000000	0.71417	1.000000	0.80357	0.278000	0.26855	4.090000	0.57693	2.222000	0.72286	0.383000	0.25322	GAA	.		0.279	KIF20B-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000049330.1	NM_016195	
TRIM8	81603	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	104404881	104404881	+	Silent	SNP	C	C	T			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr10:104404881C>T	ENST00000302424.7	+	1	629	c.507C>T	c.(505-507)taC>taT	p.Y169Y	RP11-47A8.5_ENST00000607967.1_lincRNA	NM_030912.2	NP_112174.2	Q9BZR9	TRIM8_HUMAN	tripartite motif containing 8	169					innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|PML body (GO:0016605)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15		Colorectal(252;0.122)		Epithelial(162;3.93e-09)|all cancers(201;1.02e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		ACTGCTGCTACTACAGCGGCG	0.662																																					p.Y169Y		.											.	TRIM8-227	0			c.C507T						.						14.0	15.0	15.0					10																	104404881		1665	3276	4941	SO:0001819	synonymous_variant	81603	exon1			CTGCTACTACAGC	AF281046	CCDS31274.1	10q24.3	2013-01-09	2011-01-25	2002-06-14	ENSG00000171206	ENSG00000171206		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	15579	protein-coding gene	gene with protein product	"""glioblastoma expressed ring finger protein"""	606125	"""ring finger protein 27"", ""tripartite motif-containing 8"""	RNF27		11118312, 12163497	Standard	NM_030912		Approved	GERP	uc001kvz.2	Q9BZR9	OTTHUMG00000018964	ENST00000302424.7:c.507C>T	10.37:g.104404881C>T		Somatic	42	0		WXS	Illumina HiSeq	Phase_I	46	9	NM_030912	0	0	34	53	19	A6NI31|Q9C028	Silent	SNP	ENST00000302424.7	37	CCDS31274.1																																																																																			.		0.662	TRIM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050084.3	NM_030912	
PTPRJ	5795	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	48149503	48149503	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr11:48149503C>T	ENST00000418331.2	+	7	1617	c.1265C>T	c.(1264-1266)cCc>cTc	p.P422L	PTPRJ_ENST00000440289.2_Missense_Mutation_p.P422L	NM_002843.3	NP_002834.3	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J	422	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				contact inhibition (GO:0060242)|heart development (GO:0007507)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of vascular permeability (GO:0043116)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of cell adhesion (GO:0045785)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion (GO:0030155)|vasculogenesis (GO:0001570)	cell projection (GO:0042995)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|mitogen-activated protein kinase binding (GO:0051019)|phosphatase activity (GO:0016791)|platelet-derived growth factor receptor binding (GO:0005161)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|endometrium(7)|kidney(7)|large_intestine(5)|lung(15)|ovary(1)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						GCTGTCATCCCCGGACTCCGC	0.552																																					p.P422L		.											.	PTPRJ-541	0			c.C1265T						.						137.0	112.0	121.0					11																	48149503		2201	4298	6499	SO:0001583	missense	5795	exon7			TCATCCCCGGACT	U10886	CCDS7945.1, CCDS44596.1	11p11.2	2013-02-11			ENSG00000149177	ENSG00000149177		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9673	protein-coding gene	gene with protein product		600925				7937872, 7994032	Standard	NM_001098503		Approved	DEP1, HPTPeta, CD148	uc001ngp.4	Q12913	OTTHUMG00000166573	ENST00000418331.2:c.1265C>T	11.37:g.48149503C>T	ENSP00000400010:p.Pro422Leu	Somatic	116	0		WXS	Illumina HiSeq	Phase_I	124	42	NM_001098503	0	0	3	4	1	Q15255|Q6P4H4|Q8NHM2|Q9UDA9	Missense_Mutation	SNP	ENST00000418331.2	37	CCDS7945.1	.	.	.	.	.	.	.	.	.	.	C	10.36	1.329627	0.24167	.	.	ENSG00000149177	ENST00000278456;ENST00000418331;ENST00000440289	T;T	0.57752	0.38;0.38	6.17	-3.83	0.04269	Fibronectin, type III (4);Immunoglobulin-like fold (1);	.	.	.	.	T	0.18635	0.0447	N	0.01352	-0.895	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.09377	0.004;0.004	T	0.18272	-1.0342	9	0.25106	T	0.35	.	6.2032	0.20587	0.0:0.2896:0.327:0.3835	.	422;422	Q12913;Q6P4H4	PTPRJ_HUMAN;.	L	422	ENSP00000400010:P422L;ENSP00000409733:P422L	ENSP00000278456:P422L	P	+	2	0	PTPRJ	48106079	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.846000	0.04336	-1.113000	0.02981	-0.751000	0.03497	CCC	.		0.552	PTPRJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390525.1		
NAALADL1	10004	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	11	64822081	64822081	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr11:64822081C>T	ENST00000358658.3	-	5	760	c.733G>A	c.(733-735)Gag>Aag	p.E245K	NAALADL1_ENST00000355369.2_Missense_Mutation_p.E245K|NAALADL1_ENST00000340252.4_Missense_Mutation_p.E245K|NAALADL1_ENST00000355721.3_Missense_Mutation_p.E204K|NAALADL1_ENST00000356632.3_Missense_Mutation_p.E245K|NAALADL1_ENST00000339885.2_Missense_Mutation_p.E245K	NM_005468.2	NP_005459.2	Q9UQQ1	NALDL_HUMAN	N-acetylated alpha-linked acidic dipeptidase-like 1	245						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	29						GAGCCTCGCTCCACTCCTGAG	0.597											OREG0032001	type=REGULATORY REGION|TFbs=RELA|Dataset=RELA (p65) ChIP-PET Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with paired-end diTag sequencing (ChIP-PET)																									p.E245K		.											.	NAALADL1-90	0			c.G733A						.						56.0	55.0	55.0					11																	64822081		2201	4297	6498	SO:0001583	missense	10004	exon5			CTCGCTCCACTCC	AF010141	CCDS31604.1	11q12	2011-08-16			ENSG00000168060	ENSG00000168060			23536	protein-coding gene	gene with protein product	"""ileal peptidase I100"""	602640				10085079	Standard	NM_005468		Approved		uc001ocn.3	Q9UQQ1	OTTHUMG00000165595	ENST00000358658.3:c.733G>A	11.37:g.64822081C>T	ENSP00000351484:p.Glu245Lys	Somatic	39	0	1079	WXS	Illumina HiSeq	Phase_I	35	8	NM_005468	0	0	0	0	0	C9J8A1|C9J964|C9JL35|C9JSN0|O43176	Missense_Mutation	SNP	ENST00000358658.3	37	CCDS31604.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.798953	0.90538	.	.	ENSG00000168060	ENST00000358658;ENST00000355369;ENST00000339885;ENST00000453486;ENST00000340252;ENST00000355721;ENST00000356632	T;T;T;T;T;T	0.44083	0.93;0.93;0.93;0.93;0.93;0.93	4.7	3.78	0.43462	.	0.000000	0.85682	D	0.000000	T	0.60508	0.2274	M	0.81802	2.56	0.50632	D	0.999881	P	0.51240	0.943	P	0.57720	0.826	T	0.66842	-0.5821	10	0.87932	D	0	-32.0749	12.6604	0.56811	0.0:0.8326:0.1674:0.0	.	245	Q9UQQ1	NALDL_HUMAN	K	245;245;245;245;245;204;245	ENSP00000351484:E245K;ENSP00000347530:E245K;ENSP00000340111:E245K;ENSP00000344244:E245K;ENSP00000347955:E204K;ENSP00000349045:E245K	ENSP00000340111:E245K	E	-	1	0	NAALADL1	64578657	1.000000	0.71417	0.979000	0.43373	0.757000	0.42996	6.561000	0.73955	1.196000	0.43129	0.655000	0.94253	GAG	.		0.597	NAALADL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385162.1	NM_005468	
IL10RA	3587	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	117860196	117860196	+	Missense_Mutation	SNP	C	C	A			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr11:117860196C>A	ENST00000227752.3	+	3	348	c.228C>A	c.(226-228)agC>agA	p.S76R	IL10RA_ENST00000541785.1_Missense_Mutation_p.S56R|IL10RA_ENST00000545409.1_Intron|IL10RA_ENST00000533700.1_3'UTR	NM_001558.3	NP_001549.2	Q13651	I10R1_HUMAN	interleukin 10 receptor, alpha	76					cytokine-mediated signaling pathway (GO:0019221)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-10 receptor activity (GO:0004920)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|ovary(2)|prostate(1)	19	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.07e-05)|Epithelial(105;0.00108)		CCAACTGTAGCCAGACCCTGT	0.557																																					p.S76R		.											.	IL10RA-91	0			c.C228A						.						163.0	133.0	143.0					11																	117860196		2200	4296	6496	SO:0001583	missense	3587	exon3			CTGTAGCCAGACC	U00672	CCDS8388.1	11q23	2014-09-17			ENSG00000110324	ENSG00000110324		"""Interleukins and interleukin receptors"", ""CD molecules"""	5964	protein-coding gene	gene with protein product		146933		IL10R		8120391	Standard	NR_026691		Approved	HIL-10R, CDW210A, CD210a, CD210	uc001prv.3	Q13651	OTTHUMG00000166523	ENST00000227752.3:c.228C>A	11.37:g.117860196C>A	ENSP00000227752:p.Ser76Arg	Somatic	167	1		WXS	Illumina HiSeq	Phase_I	140	50	NM_001558	0	0	7	7	0	A8K6I0|B0YJ27	Missense_Mutation	SNP	ENST00000227752.3	37	CCDS8388.1	.	.	.	.	.	.	.	.	.	.	C	8.842	0.942524	0.18281	.	.	ENSG00000110324	ENST00000227752;ENST00000541785;ENST00000536858	T;T	0.73575	-0.76;-0.76	5.14	1.03	0.20045	Fibronectin, type III (1);Immunoglobulin-like fold (1);	1.091120	0.06723	N	0.775192	T	0.49490	0.1560	N	0.04018	-0.295	0.09310	N	1	B;B	0.13594	0.007;0.008	B;B	0.19391	0.009;0.025	T	0.33317	-0.9873	10	0.15499	T	0.54	-5.1363	5.495	0.16797	0.1338:0.3992:0.3907:0.0762	.	56;76	F5GYV8;Q13651	.;I10R1_HUMAN	R	76;56;56	ENSP00000227752:S76R;ENSP00000441397:S56R	ENSP00000227752:S76R	S	+	3	2	IL10RA	117365406	0.000000	0.05858	0.006000	0.13384	0.031000	0.12232	-0.257000	0.08745	0.004000	0.14682	-0.257000	0.10917	AGC	.		0.557	IL10RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390167.1		
DDX25	29118	hgsc.bcm.edu	37	11	125786980	125786980	+	Missense_Mutation	SNP	A	A	G			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr11:125786980A>G	ENST00000263576.6	+	9	1027	c.872A>G	c.(871-873)gAg>gGg	p.E291G	DDX25_ENST00000525943.1_3'UTR|RP11-680F20.9_ENST00000533033.2_RNA	NM_013264.4	NP_037396.3	Q9UHL0	DDX25_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 25	291	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|ovary(2)|upper_aerodigestive_tract(1)	10	all_hematologic(175;0.177)	Breast(109;0.0021)|all_lung(97;0.0203)|Lung NSC(97;0.0203)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.14e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.046)		CACTTTGCTGAGCGAATCATC	0.488																																					p.E291G		.											.	DDX25-227	0			c.A872G						.						99.0	98.0	98.0					11																	125786980		2087	4218	6305	SO:0001583	missense	29118	exon9			TTGCTGAGCGAAT	AF155140	CCDS44766.1	11q24	2012-02-23	2012-02-23		ENSG00000109832	ENSG00000109832		"""DEAD-boxes"""	18698	protein-coding gene	gene with protein product	"""gonadotropin-regulated testicular RNA helicase"""	607663	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 25"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 25"""			10608860, 15096601	Standard	NM_013264		Approved	GRTH	uc001qcz.5	Q9UHL0	OTTHUMG00000165859	ENST00000263576.6:c.872A>G	11.37:g.125786980A>G	ENSP00000263576:p.Glu291Gly	Somatic	35	0		WXS	Illumina HiSeq	Phase_I	27	2	NM_013264	0	0	0	0	0	B2R6Z0|Q5XVN2|Q86W81|Q8IYP1	Missense_Mutation	SNP	ENST00000263576.6	37	CCDS44766.1	.	.	.	.	.	.	.	.	.	.	A	12.52	1.961278	0.34565	.	.	ENSG00000109832	ENST00000525943;ENST00000263576;ENST00000526875	T	0.04758	3.56	5.79	4.66	0.58398	DEAD-like helicase (2);	0.220031	0.38548	N	0.001645	T	0.05686	0.0149	L	0.41710	1.295	0.41607	D	0.988887	B;B	0.06786	0.001;0.001	B;B	0.01281	0.0;0.0	T	0.24154	-1.0168	10	0.51188	T	0.08	-0.0455	11.4559	0.50181	0.929:0.0:0.071:0.0	.	291;291	B4DHI6;Q9UHL0	.;DDX25_HUMAN	G	177;291;157	ENSP00000263576:E291G	ENSP00000263576:E291G	E	+	2	0	DDX25	125292190	1.000000	0.71417	0.998000	0.56505	0.803000	0.45373	3.983000	0.56916	1.020000	0.39573	0.533000	0.62120	GAG	.		0.488	DDX25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386736.3	NM_013264	
PZP	5858	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	9356427	9356427	+	Missense_Mutation	SNP	T	T	A			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr12:9356427T>A	ENST00000261336.2	-	2	232	c.204A>T	c.(202-204)gaA>gaT	p.E68D	PZP_ENST00000381997.2_5'Flank	NM_002864.2	NP_002855.2	P20742	PZP_HUMAN	pregnancy-zone protein	68					female pregnancy (GO:0007565)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(21)|lung(46)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)	102						GGCTCCTGTTTTCCCTGCCAG	0.557																																					p.E68D	Melanoma(125;1402 1695 4685 34487 38571)	.											.	PZP-157	0			c.A204T						.						114.0	104.0	107.0					12																	9356427		2203	4300	6503	SO:0001583	missense	5858	exon2			CCTGTTTTCCCTG	X54380, M24416, X51541	CCDS8600.1	12p13-p12.2	2008-02-01			ENSG00000126838	ENSG00000126838			9750	protein-coding gene	gene with protein product		176420					Standard	NM_002864		Approved	CPAMD6	uc001qvl.3	P20742	OTTHUMG00000154915	ENST00000261336.2:c.204A>T	12.37:g.9356427T>A	ENSP00000261336:p.Glu68Asp	Somatic	141	0		WXS	Illumina HiSeq	Phase_I	154	51	NM_002864	0	0	0	0	0	A6ND27|Q15273|Q2NKL2|Q7M4N7	Missense_Mutation	SNP	ENST00000261336.2	37	CCDS8600.1	.	.	.	.	.	.	.	.	.	.	T	0.086	-1.175971	0.01646	.	.	ENSG00000126838	ENST00000261336	T	0.08282	3.11	2.08	-0.306	0.12780	.	1.942830	0.04105	U	0.313539	T	0.10121	0.0248	M	0.70275	2.135	0.09310	N	1	B	0.22683	0.073	B	0.19946	0.027	T	0.42378	-0.9455	10	0.12766	T	0.61	.	4.2572	0.10722	0.0:0.3652:0.0:0.6348	.	68	P20742	PZP_HUMAN	D	68	ENSP00000261336:E68D	ENSP00000261336:E68D	E	-	3	2	PZP	9247694	0.000000	0.05858	0.002000	0.10522	0.396000	0.30629	-1.538000	0.02204	-0.076000	0.12775	0.383000	0.25322	GAA	.		0.557	PZP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337624.1	NM_002864	
DNAJC22	79962	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	49743366	49743366	+	Silent	SNP	T	T	C			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr12:49743366T>C	ENST00000549441.2	+	3	1915	c.711T>C	c.(709-711)ctT>ctC	p.L237L	DNAJC22_ENST00000395069.3_Silent_p.L237L			Q8N4W6	DJC22_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 22	237						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|liver(2)|lung(1)|ovary(1)|pancreas(1)	10						TTGTCCTCCTTCTGCCTTACC	0.532																																					p.L237L		.											.	DNAJC22-159	0			c.T711C						.						162.0	163.0	163.0					12																	49743366		2203	4300	6503	SO:0001819	synonymous_variant	79962	exon2			CCTCCTTCTGCCT	AK055747	CCDS8785.1	12q13.12	2011-09-02		2008-07-08	ENSG00000178401	ENSG00000178401		"""Heat shock proteins / DNAJ (HSP40)"""	25802	protein-coding gene	gene with protein product	"""wurst homolog (Drosophila)"""					17558392	Standard	NM_024902		Approved	wus, FLJ13236	uc001rua.3	Q8N4W6		ENST00000549441.2:c.711T>C	12.37:g.49743366T>C		Somatic	307	0		WXS	Illumina HiSeq	Phase_I	277	87	NM_024902	0	0	13	28	15	B3KP54	Silent	SNP	ENST00000549441.2	37	CCDS8785.1																																																																																			.		0.532	DNAJC22-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404302.2	NM_024902	
KRT8	3856	hgsc.bcm.edu	37	12	53298675	53298675	+	Missense_Mutation	SNP	A	A	C			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr12:53298675A>C	ENST00000552551.1	-	2	523	c.91T>G	c.(91-93)Tcc>Gcc	p.S31A	KRT8_ENST00000293308.6_Missense_Mutation_p.S31A|KRT8_ENST00000546897.1_Missense_Mutation_p.S31A|KRT8_ENST00000552150.1_Missense_Mutation_p.S59A			P05787	K2C8_HUMAN	keratin 8	31	Head.|Ser-rich.				cell differentiation involved in embryonic placenta development (GO:0060706)|extrinsic apoptotic signaling pathway (GO:0097191)|hepatocyte apoptotic process (GO:0097284)|response to hydrostatic pressure (GO:0051599)|response to other organism (GO:0051707)|sarcomere organization (GO:0045214)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|viral process (GO:0016032)	cell-cell junction (GO:0005911)|costamere (GO:0043034)|cytoplasm (GO:0005737)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	scaffold protein binding (GO:0097110)|structural molecule activity (GO:0005198)	p.S31A(4)		endometrium(5)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	13				BRCA - Breast invasive adenocarcinoma(357;0.108)	Tenecteplase(DB00031)	CTGATGCGGGAACCGGGCCCA	0.662																																					p.S59A		.											.	KRT8-92	4	Substitution - Missense(4)	endometrium(2)|prostate(1)|liver(1)	c.T175G						.						12.0	14.0	13.0					12																	53298675		2120	4158	6278	SO:0001583	missense	3856	exon2			TGCGGGAACCGGG	BC000654	CCDS8841.1, CCDS58234.1	12q13.13	2013-01-16			ENSG00000170421	ENSG00000170421		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6446	protein-coding gene	gene with protein product		148060				2434381, 1705144, 16831889	Standard	NM_002273		Approved	CARD2, K8, CK8, CYK8, K2C8, KO	uc009zmk.1	P05787	OTTHUMG00000169881	ENST00000552551.1:c.91T>G	12.37:g.53298675A>C	ENSP00000447566:p.Ser31Ala	Somatic	37	1		WXS	Illumina HiSeq	Phase_I	47	7	NM_001256282	1	0	1254	1255	0	A8K4H3|B0AZN5|F8VXB4|Q14099|Q14716|Q14717|Q53GJ0|Q6DHW5|Q6GMY0|Q6P4C7|Q96J60	Missense_Mutation	SNP	ENST00000552551.1	37	CCDS8841.1	.	.	.	.	.	.	.	.	.	.	-	0.012	-1.651707	0.00785	.	.	ENSG00000170421	ENST00000552551;ENST00000293308;ENST00000547916;ENST00000546897;ENST00000552150;ENST00000546826;ENST00000548998;ENST00000547413;ENST00000546542	T;T;T;T;T;T;T;T	0.80393	-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37	4.05	-8.11	0.01082	.	0.706613	0.13676	N	0.370518	T	0.40619	0.1124	N	0.01197	-0.965	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.43589	-0.9382	10	0.05351	T	0.99	.	6.5956	0.22672	0.4212:0.312:0.0:0.2668	.	59;31;31	F8VXB4;F8VU64;P05787	.;.;K2C8_HUMAN	A	31;31;31;31;59;31;71;31;109	ENSP00000447566:S31A;ENSP00000293308:S31A;ENSP00000447402:S31A;ENSP00000449404:S59A;ENSP00000447881:S31A;ENSP00000447040:S71A;ENSP00000448681:S31A;ENSP00000450228:S109A	ENSP00000293308:S31A	S	-	1	0	KRT8	51584942	0.005000	0.15991	0.000000	0.03702	0.065000	0.16274	-0.018000	0.12568	-3.264000	0.00201	-0.290000	0.09829	TCC	.		0.662	KRT8-001	KNOWN	alternative_5_UTR|overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406385.1	NM_002273	
CKAP2	26586	hgsc.bcm.edu	37	13	53042433	53042433	+	Missense_Mutation	SNP	C	C	G			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr13:53042433C>G	ENST00000378037.5	+	7	1590	c.1500C>G	c.(1498-1500)caC>caG	p.H500Q	CKAP2_ENST00000490903.1_Missense_Mutation_p.H451Q|CKAP2_ENST00000258607.5_Missense_Mutation_p.H499Q	NM_001098525.1|NM_018204.3	NP_001091995.1|NP_060674.3			cytoskeleton associated protein 2											breast(2)|kidney(3)|large_intestine(3)|lung(7)|ovary(3)|skin(1)|urinary_tract(1)	20		Breast(56;0.000207)|Lung NSC(96;0.00212)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.6e-08)		AGATGCGACACACGATTGTAG	0.299																																					p.H500Q		.											.	CKAP2-92	0			c.C1500G						.						96.0	99.0	98.0					13																	53042433		2203	4300	6503	SO:0001583	missense	26586	exon7			GCGACACACGATT	AF177227	CCDS9435.1, CCDS41893.1, CCDS66557.1, CCDS73578.1	13q14	2014-03-21			ENSG00000136108	ENSG00000136108			1990	protein-coding gene	gene with protein product		611569				9771967	Standard	XM_005266343		Approved	LB1, FLJ10749, se20-10, TMAP	uc001vgv.2	Q8WWK9	OTTHUMG00000016967	ENST00000378037.5:c.1500C>G	13.37:g.53042433C>G	ENSP00000367276:p.His500Gln	Somatic	38	0		WXS	Illumina HiSeq	Phase_I	27	2	NM_001098525	0	0	1	1	0		Missense_Mutation	SNP	ENST00000378037.5	37	CCDS41893.1	.	.	.	.	.	.	.	.	.	.	.	11.58	1.680018	0.29783	.	.	ENSG00000136108	ENST00000258607;ENST00000378037;ENST00000490903	T;T;T	0.23147	1.92;1.92;1.92	5.53	-0.86	0.10680	.	0.409080	0.25695	N	0.028903	T	0.24005	0.0581	M	0.78049	2.395	0.09310	N	1	B;B;B	0.30281	0.176;0.176;0.275	B;B;B	0.28916	0.046;0.046;0.096	T	0.17806	-1.0357	10	0.56958	D	0.05	-2.4737	5.1939	0.15225	0.0:0.4452:0.1743:0.3804	.	451;500;499	E9PD90;Q8WWK9;B2RMQ4	.;CKAP2_HUMAN;.	Q	499;500;451	ENSP00000258607:H499Q;ENSP00000367276:H500Q;ENSP00000417830:H451Q	ENSP00000258607:H499Q	H	+	3	2	CKAP2	51940434	0.005000	0.15991	0.036000	0.18154	0.942000	0.58702	-0.403000	0.07214	0.055000	0.16094	0.655000	0.94253	CAC	.		0.299	CKAP2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355010.2		
GPR18	2841	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	99908051	99908051	+	Missense_Mutation	SNP	G	G	C			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr13:99908051G>C	ENST00000340807.3	-	3	632	c.76C>G	c.(76-78)Ctt>Gtt	p.L26V	GPR18_ENST00000397470.2_Missense_Mutation_p.L26V|UBAC2_ENST00000403766.3_Intron|GPR18_ENST00000397473.2_Missense_Mutation_p.L26V|UBAC2_ENST00000376440.2_Intron			Q14330	GPR18_HUMAN	G protein-coupled receptor 18	26					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|large_intestine(2)|lung(6)	10	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Glycine(DB00145)	TAGAAGACAAGGGCTGCAATT	0.388																																					p.L26V		.											.	GPR18-90	0			c.C76G						.						131.0	130.0	131.0					13																	99908051		2203	4300	6503	SO:0001583	missense	2841	exon2			AGACAAGGGCTGC	L42324	CCDS9491.1	13q32	2014-01-30			ENSG00000125245	ENSG00000125245		"""GPCR / Class A : Orphans"""	4472	protein-coding gene	gene with protein product		602042				9205118	Standard	NM_005292		Approved		uc010afv.3	Q14330	OTTHUMG00000017266	ENST00000340807.3:c.76C>G	13.37:g.99908051G>C	ENSP00000343428:p.Leu26Val	Somatic	142	0		WXS	Illumina HiSeq	Phase_I	140	31	NM_001098200	0	0	0	0	0	Q6GTM3|Q96HI6|Q9H2L2	Missense_Mutation	SNP	ENST00000340807.3	37	CCDS9491.1	.	.	.	.	.	.	.	.	.	.	G	15.10	2.732792	0.48939	.	.	ENSG00000125245	ENST00000397473;ENST00000397470;ENST00000340807;ENST00000416594	T;T;T;T	0.37058	1.22;1.22;1.22;1.22	5.95	5.08	0.68730	.	0.078514	0.52532	D	0.000062	T	0.20047	0.0482	N	0.08118	0	0.58432	D	0.999996	B	0.30605	0.287	B	0.25987	0.065	T	0.05451	-1.0884	9	.	.	.	-16.1138	16.3083	0.82859	0.0:0.0:0.8666:0.1334	.	26	Q14330	GPR18_HUMAN	V	26	ENSP00000380613:L26V;ENSP00000380610:L26V;ENSP00000343428:L26V;ENSP00000401611:L26V	.	L	-	1	0	GPR18	98706052	1.000000	0.71417	0.847000	0.33407	0.750000	0.42670	5.384000	0.66225	1.475000	0.48197	0.563000	0.77884	CTT	.		0.388	GPR18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045585.1		
SLC7A8	23428	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	23607203	23607203	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr14:23607203C>T	ENST00000316902.7	-	7	1668	c.943G>A	c.(943-945)Gcc>Acc	p.A315T	SLC7A8_ENST00000422941.2_Missense_Mutation_p.A91T|SLC7A8_ENST00000453702.1_Missense_Mutation_p.A112T|SLC7A8_ENST00000529705.2_Missense_Mutation_p.A210T|SLC7A8_ENST00000469263.1_Intron|SLC7A8_ENST00000532568.1_5'Flank	NM_012244.3	NP_036376.2	Q9UHI5	LAT2_HUMAN	solute carrier family 7 (amino acid transporter light chain, L system), member 8	315					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|leukocyte migration (GO:0050900)|metal ion homeostasis (GO:0055065)|neutral amino acid transport (GO:0015804)|organic cation transport (GO:0015695)|response to toxic substance (GO:0009636)|toxin transport (GO:1901998)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|L-amino acid transmembrane transporter activity (GO:0015179)|neutral amino acid transmembrane transporter activity (GO:0015175)|organic cation transmembrane transporter activity (GO:0015101)|peptide antigen binding (GO:0042605)|toxin transporter activity (GO:0019534)			autonomic_ganglia(1)|endometrium(6)|kidney(4)|large_intestine(6)|lung(5)|ovary(1)|skin(1)	24	all_cancers(95;4.6e-05)			GBM - Glioblastoma multiforme(265;0.00809)	L-Alanine(DB00160)|L-DOPA(DB01235)|L-Glutamine(DB00130)|L-Phenylalanine(DB00120)	ATGATCCAGGCCATGACTCCT	0.567																																					p.A315T		.											.	SLC7A8-91	0			c.G943A						.						112.0	104.0	107.0					14																	23607203		2203	4300	6503	SO:0001583	missense	23428	exon7			TCCAGGCCATGAC	Y18483	CCDS9590.1, CCDS41924.1, CCDS58304.1, CCDS58305.1	14q11.2	2013-05-22	2011-07-12		ENSG00000092068	ENSG00000092068		"""Solute carriers"""	11066	protein-coding gene	gene with protein product		604235				10080183, 10391915	Standard	NM_001267036		Approved	LPI-PC1, LAT2	uc001wiz.4	Q9UHI5	OTTHUMG00000028720	ENST00000316902.7:c.943G>A	14.37:g.23607203C>T	ENSP00000320378:p.Ala315Thr	Somatic	119	0		WXS	Illumina HiSeq	Phase_I	113	26	NM_012244	0	0	2	2	0	B2R8Q4|B4DKT4|B4DTV6|D3DS46|F2Z2J4|Q86U05|Q9UKQ6|Q9UKQ7|Q9UKQ8|Q9Y445	Missense_Mutation	SNP	ENST00000316902.7	37	CCDS9590.1	.	.	.	.	.	.	.	.	.	.	C	16.80	3.222325	0.58560	.	.	ENSG00000092068	ENST00000316902;ENST00000334354;ENST00000453702;ENST00000529705;ENST00000422941;ENST00000206514	D;D;D;D	0.90133	-2.62;-2.62;-2.62;-2.62	5.44	4.54	0.55810	Amino acid permease domain (1);	0.306262	0.35772	N	0.002981	D	0.87815	0.6272	L	0.48877	1.53	0.49213	D	0.999763	B;B;B	0.28128	0.201;0.118;0.07	B;B;B	0.28305	0.088;0.088;0.038	D	0.86389	0.1734	10	0.72032	D	0.01	.	14.7754	0.69729	0.1459:0.8541:0.0:0.0	.	210;91;315	B4DKT4;B4DTV6;Q9UHI5	.;.;LAT2_HUMAN	T	315;112;112;210;91;112	ENSP00000320378:A315T;ENSP00000391577:A112T;ENSP00000434345:A210T;ENSP00000416398:A91T	ENSP00000206514:A112T	A	-	1	0	SLC7A8	22677043	0.979000	0.34478	1.000000	0.80357	0.997000	0.91878	0.137000	0.15995	1.409000	0.46915	0.563000	0.77884	GCC	.		0.567	SLC7A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071718.3		
PPP1R36	145376	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	65032084	65032084	+	Missense_Mutation	SNP	T	T	A			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr14:65032084T>A	ENST00000298705.1	+	5	375	c.279T>A	c.(277-279)gaT>gaA	p.D93E	RP11-973N13.3_ENST00000554454.1_RNA|RP11-973N13.3_ENST00000556634.1_RNA	NM_172365.1	NP_758953.1	Q96LQ0	PPR36_HUMAN	protein phosphatase 1, regulatory subunit 36	93					negative regulation of phosphatase activity (GO:0010923)		phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)										GGTTGACAGATAAAAGACTTG	0.338																																					p.D93E		.											.	.	0			c.T279A						.						91.0	80.0	83.0					14																	65032084		2203	4300	6503	SO:0001583	missense	145376	exon5			GACAGATAAAAGA		CCDS9767.1	14q23.2	2012-04-17	2011-10-11	2011-10-11	ENSG00000165807	ENSG00000165807		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	20097	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 50"""	C14orf50			Standard	NM_172365		Approved		uc001xhl.1	Q96LQ0	OTTHUMG00000141316	ENST00000298705.1:c.279T>A	14.37:g.65032084T>A	ENSP00000298705:p.Asp93Glu	Somatic	64	0		WXS	Illumina HiSeq	Phase_I	37	13	NM_172365	0	0	0	0	0	Q6NTH6	Missense_Mutation	SNP	ENST00000298705.1	37	CCDS9767.1	.	.	.	.	.	.	.	.	.	.	T	8.979	0.974851	0.18736	.	.	ENSG00000165807	ENST00000298705	T	0.31247	1.5	5.79	2.16	0.27623	.	0.198907	0.35320	N	0.003286	T	0.17109	0.0411	L	0.39898	1.24	0.25922	N	0.983102	B	0.24721	0.11	B	0.17433	0.018	T	0.30119	-0.9989	10	0.05959	T	0.93	-17.5714	5.9771	0.19387	0.0:0.0945:0.4215:0.4839	.	93	Q96LQ0	PPR36_HUMAN	E	93	ENSP00000298705:D93E	ENSP00000298705:D93E	D	+	3	2	C14orf50	64101837	1.000000	0.71417	1.000000	0.80357	0.843000	0.47879	0.518000	0.22847	0.433000	0.26313	0.533000	0.62120	GAT	.		0.338	PPP1R36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280667.1	NM_172365	
EIF2S1	1965	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	67848335	67848335	+	Silent	SNP	T	T	C			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr14:67848335T>C	ENST00000256383.4	+	6	1067	c.606T>C	c.(604-606)taT>taC	p.Y202Y	EIF2S1_ENST00000466499.2_Silent_p.Y202Y	NM_004094.4	NP_004085.1	P05198	IF2A_HUMAN	eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa	202					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|gene expression (GO:0010467)|protein autophosphorylation (GO:0046777)|regulation of translational initiation in response to stress (GO:0043558)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2 complex (GO:0005850)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|polysome (GO:0005844)	poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)|translation initiation factor activity (GO:0003743)			breast(1)|cervix(2)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	9				all cancers(60;0.000683)|OV - Ovarian serous cystadenocarcinoma(108;0.00579)|BRCA - Breast invasive adenocarcinoma(234;0.00937)		GTTATGGTTATGAAGGCATTG	0.343																																					p.Y202Y		.											.	EIF2S1-91	0			c.T606C						.						89.0	93.0	91.0					14																	67848335		2203	4300	6503	SO:0001819	synonymous_variant	1965	exon6			TGGTTATGAAGGC	J02645	CCDS9781.1	14q21.3	2011-01-07	2002-08-29		ENSG00000134001	ENSG00000134001			3265	protein-coding gene	gene with protein product		603907	"""eukaryotic translation initiation factor 2, subunit 1 (alpha, 35kD )"""	EIF2		2948954	Standard	NM_004094		Approved	EIF-2alpha, EIF2A	uc001xjg.3	P05198	OTTHUMG00000029800	ENST00000256383.4:c.606T>C	14.37:g.67848335T>C		Somatic	117	0		WXS	Illumina HiSeq	Phase_I	166	58	NM_004094	0	0	15	29	14		Silent	SNP	ENST00000256383.4	37	CCDS9781.1	.	.	.	.	.	.	.	.	.	.	T	9.345	1.063966	0.20067	.	.	ENSG00000134001	ENST00000555876	.	.	.	6.0	2.3	0.28687	.	.	.	.	.	T	0.58779	0.2146	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51052	-0.8754	4	.	.	.	-12.7575	9.7872	0.40684	0.0:0.196:0.0:0.804	.	.	.	.	T	159	.	.	M	+	2	0	EIF2S1	66918088	1.000000	0.71417	0.998000	0.56505	0.999000	0.98932	1.756000	0.38390	0.149000	0.19098	0.528000	0.53228	ATG	.		0.343	EIF2S1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074342.3	NM_004094	
ELMSAN1	91748	hgsc.bcm.edu	37	14	74186156	74186156	+	Missense_Mutation	SNP	A	A	G			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr14:74186156A>G	ENST00000286523.5	-	12	3768	c.2986T>C	c.(2986-2988)Tct>Cct	p.S996P	ELMSAN1_ENST00000394071.2_Missense_Mutation_p.S996P	NM_194278.3	NP_919254.2	Q6PJG2	EMSA1_HUMAN	ELM2 and Myb/SANT-like domain containing 1	996					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)										CCACCGGCAGACCCAGGGGCG	0.537																																					p.S996P		.											.	.	0			c.T2986C						.						53.0	47.0	49.0					14																	74186156		2203	4300	6503	SO:0001583	missense	91748	exon12			CGGCAGACCCAGG	BF971739	CCDS9819.1	14q24.3	2012-09-25	2012-09-25	2012-09-25	ENSG00000156030	ENSG00000156030			19853	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 117"", ""chromosome 14 open reading frame 43"""	C14orf117, C14orf43			Standard	NM_194278		Approved	LSR68	uc001xou.3	Q6PJG2	OTTHUMG00000150359	ENST00000286523.5:c.2986T>C	14.37:g.74186156A>G	ENSP00000286523:p.Ser996Pro	Somatic	40	0		WXS	Illumina HiSeq	Phase_I	40	2	NM_194278	0	0	6	6	0	Q6PK13|Q6PK59|Q6ZS23	Missense_Mutation	SNP	ENST00000286523.5	37	CCDS9819.1	.	.	.	.	.	.	.	.	.	.	A	11.32	1.605319	0.28623	.	.	ENSG00000156030	ENST00000394071;ENST00000286523;ENST00000423556;ENST00000435371	T;T;T;T	0.14640	2.49;2.49;2.49;2.49	5.78	2.01	0.26516	.	0.247348	0.29424	N	0.012181	T	0.06554	0.0168	N	0.14661	0.345	0.09310	N	0.999999	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.0	T	0.27739	-1.0065	10	0.36615	T	0.2	-7.298	4.8507	0.13535	0.5626:0.2569:0.1805:0.0	.	996;996	A0PJD3;Q6PJG2	.;CN043_HUMAN	P	996	ENSP00000377634:S996P;ENSP00000286523:S996P;ENSP00000407767:S996P;ENSP00000402380:S996P	ENSP00000286523:S996P	S	-	1	0	C14orf43	73255909	0.001000	0.12720	0.324000	0.25361	0.538000	0.34931	0.213000	0.17521	0.987000	0.38709	0.459000	0.35465	TCT	.		0.537	ELMSAN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317793.1	NM_194278	
CHP1	11261	hgsc.bcm.edu	37	15	41535939	41535939	+	Splice_Site	SNP	T	T	C			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr15:41535939T>C	ENST00000334660.5	+	2	380		c.e2+2		CHP1_ENST00000558351.1_Splice_Site|CHP1_ENST00000560397.1_Splice_Site	NM_007236.4	NP_009167.1	Q99653	CHP1_HUMAN	calcineurin-like EF-hand protein 1						calcium ion-dependent exocytosis (GO:0017156)|cellular response to acidic pH (GO:0071468)|cytoplasmic microtubule organization (GO:0031122)|membrane docking (GO:0022406)|membrane fusion (GO:0061025)|membrane organization (GO:0061024)|microtubule bundle formation (GO:0001578)|negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphatase activity (GO:0010923)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of protein import into nucleus (GO:0042308)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein ubiquitination (GO:0031397)|positive regulation of protein glycosylation (GO:0060050)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of protein transport (GO:0051222)|positive regulation of sodium:proton antiporter activity (GO:0032417)|potassium ion transport (GO:0006813)|protein export from nucleus (GO:0006611)|protein oligomerization (GO:0051259)|protein stabilization (GO:0050821)|regulation of intracellular pH (GO:0051453)|small GTPase mediated signal transduction (GO:0007264)|transcytosis (GO:0045056)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|transport vesicle (GO:0030133)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|kinase binding (GO:0019900)|microtubule binding (GO:0008017)|potassium channel regulator activity (GO:0015459)|protein kinase inhibitor activity (GO:0004860)|transporter activity (GO:0005215)										GACTCTCAGGTAGGCAGTGTT	0.473																																					.		.											.	.	0			c.140+2T>C						.						91.0	82.0	85.0					15																	41535939		2203	4300	6503	SO:0001630	splice_region_variant	11261	exon2			CTCAGGTAGGCAG		CCDS10073.1	15q13.3	2013-01-11	2013-01-11		ENSG00000187446	ENSG00000187446		"""EF-hand domain containing"""	17433	protein-coding gene	gene with protein product	"""calcineurin homologous protein"""	606988				15987692, 20720019	Standard	NM_007236		Approved	Sid470p, CHP, SLC9A1BP, p22, p24	uc001znl.3	Q99653	OTTHUMG00000130233	ENST00000334660.5:c.140+2T>C	15.37:g.41535939T>C		Somatic	43	0		WXS	Illumina HiSeq	Phase_I	39	3	NM_007236	0	0	0	0	0	B2R6H9|Q6FHZ9	Splice_Site	SNP	ENST00000334660.5	37	CCDS10073.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.956306	0.73902	.	.	ENSG00000187446	ENST00000334660;ENST00000392151	.	.	.	5.51	5.51	0.81932	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6022	0.68447	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	AC012652.1	39323231	1.000000	0.71417	0.999000	0.59377	0.746000	0.42486	5.515000	0.67049	2.102000	0.63906	0.528000	0.53228	.	.		0.473	CHP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252554.2	NM_007236	Intron
CACNA1H	8912	hgsc.bcm.edu	37	16	1245531	1245531	+	Missense_Mutation	SNP	T	T	G			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr16:1245531T>G	ENST00000348261.5	+	4	759	c.511T>G	c.(511-513)Tgg>Ggg	p.W171G	CACNA1H_ENST00000358590.4_Missense_Mutation_p.W171G|CACNA1H_ENST00000565831.1_Missense_Mutation_p.W171G	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	171					aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	GGGTGACACGTGGAACAGGCT	0.622																																					p.W171G		.											.	CACNA1H-67	0			c.T511G						.						106.0	99.0	101.0					16																	1245531		1997	4146	6143	SO:0001583	missense	8912	exon4			GACACGTGGAACA	AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.511T>G	16.37:g.1245531T>G	ENSP00000334198:p.Trp171Gly	Somatic	22	0		WXS	Illumina HiSeq	Phase_I	34	2	NM_021098	0	0	1	1	0	B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Missense_Mutation	SNP	ENST00000348261.5	37	CCDS45375.1	.	.	.	.	.	.	.	.	.	.	T	19.70	3.876927	0.72180	.	.	ENSG00000196557	ENST00000348261;ENST00000358590	D;D	0.99186	-5.53;-5.53	3.69	3.69	0.42338	Ion transport (1);	0.258503	0.38164	N	0.001783	D	0.99426	0.9797	H	0.95079	3.62	0.43947	D	0.996619	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	D	0.98492	1.0610	10	0.87932	D	0	.	11.9796	0.53113	0.0:0.0:0.0:1.0	.	171;171	O95180-2;O95180	.;CAC1H_HUMAN	G	171	ENSP00000334198:W171G;ENSP00000351401:W171G	ENSP00000334198:W171G	W	+	1	0	CACNA1H	1185532	1.000000	0.71417	0.975000	0.42487	0.835000	0.47333	5.892000	0.69790	1.673000	0.50895	0.387000	0.25754	TGG	.		0.622	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000421601.1	NM_001005407	
NUBP2	10101	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	1836594	1836594	+	Missense_Mutation	SNP	G	G	C			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr16:1836594G>C	ENST00000262302.9	+	2	193	c.73G>C	c.(73-75)Ggc>Cgc	p.G25R	NUBP2_ENST00000565134.1_Missense_Mutation_p.G25R|NUBP2_ENST00000543305.1_5'UTR|NUBP2_ENST00000568706.1_5'UTR|NUBP2_ENST00000565987.1_5'UTR	NM_001284501.1|NM_012225.2	NP_001271430.1|NP_036357.1			nucleotide binding protein 2											endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	6						AGGAAAGGGGGGCGTTGGGAA	0.657																																					p.G25R													.	NUBP2-90	0			c.G73C						.						67.0	64.0	65.0					16																	1836594		2198	4300	6498	SO:0001583	missense	10101	exon2			AAGGGGGGCGTTG	AF118394	CCDS10445.1, CCDS66898.1	16p13.3	2011-05-19	2011-05-19		ENSG00000095906	ENSG00000095906			8042	protein-coding gene	gene with protein product		610779	"""nucleotide binding protein 2 (E.coli MinD like)"", ""nucleotide binding protein 2 (MinD homolog, E. coli)"""			10486206	Standard	XM_005255025		Approved	CFD1	uc002cmw.4	Q9Y5Y2	OTTHUMG00000128639	ENST00000262302.9:c.73G>C	16.37:g.1836594G>C	ENSP00000262302:p.Gly25Arg	Somatic	127	0		WXS	Illumina HiSeq	Phase_I	143	26	NM_012225	0	0	13	29	16		Missense_Mutation	SNP	ENST00000262302.9	37	CCDS10445.1	.	.	.	.	.	.	.	.	.	.	G	19.32	3.804684	0.70682	.	.	ENSG00000095906	ENST00000262302	D	0.93076	-3.16	4.41	4.41	0.53225	.	0.000000	0.85682	D	0.000000	D	0.97914	0.9314	H	0.97540	4.025	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99577	1.0972	10	0.87932	D	0	-7.9425	15.5493	0.76137	0.0:0.0:1.0:0.0	.	25	Q9Y5Y2	NUBP2_HUMAN	R	25	ENSP00000262302:G25R	ENSP00000262302:G25R	G	+	1	0	NUBP2	1776595	1.000000	0.71417	0.187000	0.23214	0.293000	0.27360	5.973000	0.70456	1.999000	0.58509	0.561000	0.74099	GGC	.		0.657	NUBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250510.1	NM_012225	
ZNF598	90850	hgsc.bcm.edu	37	16	2059674	2059674	+	Missense_Mutation	SNP	T	T	C	rs71384660		TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr16:2059674T>C	ENST00000431526.1	-	2	88	c.74A>G	c.(73-75)gAa>gGa	p.E25G	ZNF598_ENST00000562103.1_5'UTR|ZNF598_ENST00000563630.1_5'UTR	NM_178167.2	NP_835461.2	Q86UK7	ZN598_HUMAN	zinc finger protein 598	25							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|lung(7)|skin(1)|urinary_tract(1)	16						GCTCCCGCCTTCCCGCTCAGG	0.766													C|||	5008	1.0	1.0	1.0	5008	,	,		5162	1.0		1.0	False		,,,				2504	1.0				p.E25G		.											.	ZNF598-432	0			c.A74G						.						1.0	2.0	2.0					16																	2059674		1089	2314	3403	SO:0001583	missense	90850	exon2			CCGCCTTCCCGCT	BC029270		16p13.3	2008-05-02				ENSG00000167962		"""Zinc fingers, C2H2-type"""	28079	protein-coding gene	gene with protein product							Standard	NM_178167		Approved	FLJ00086	uc002cof.2	Q86UK7		ENST00000431526.1:c.74A>G	16.37:g.2059674T>C	ENSP00000411409:p.Glu25Gly	Somatic	0	0		WXS	Illumina HiSeq	Phase_I	8	8	NM_178167	0	0	0	2	2	Q8IW49|Q8N3D9|Q96FG3|Q9H7J3	Missense_Mutation	SNP	ENST00000431526.1	37		2168	0.9926739926739927	487	0.9898373983739838	361	0.9972375690607734	568	0.993006993006993	752	0.9920844327176781	N	1.560	-0.537056	0.04082	.	.	ENSG00000167962	ENST00000431526	T	0.77098	-1.07	3.3	3.3	0.37823	.	0.415485	0.23105	N	0.051871	T	0.00012	0.0000	.	.	.	0.48696	P	3.1000000000003247E-4	.	.	.	.	.	.	T	0.34650	-0.9820	6	0.22706	T	0.39	-7.8624	8.393	0.32540	0.0:0.8796:0.0:0.1204	.	.	.	.	G	25	ENSP00000411409:E25G	ENSP00000411409:E25G	E	-	2	0	ZNF598	1999675	1.000000	0.71417	1.000000	0.80357	0.107000	0.19398	0.911000	0.28584	0.691000	0.31592	-0.642000	0.03964	GAA	T|0.007;C|0.993		0.766	ZNF598-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_178167	
KIAA0556	23247	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	27720066	27720066	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr16:27720066T>C	ENST00000261588.4	+	13	1449	c.1430T>C	c.(1429-1431)aTc>aCc	p.I477T	CTD-2049O4.1_ENST00000568831.1_RNA|CTD-2049O4.1_ENST00000564893.1_RNA|CTD-2049O4.1_ENST00000563052.1_RNA|KIAA0556_ENST00000567894.1_3'UTR	NM_015202.2	NP_056017.2	O60303	K0556_HUMAN	KIAA0556	477						extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(7)|kidney(8)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	76						AAAGATGCCATCTACGTGACC	0.453																																					p.I477T		.											.	KIAA0556-141	0			c.T1430C						.						120.0	105.0	110.0					16																	27720066		2197	4300	6497	SO:0001583	missense	23247	exon13			ATGCCATCTACGT	AB011128	CCDS32415.1	16p12.1-p11.2	2012-11-30			ENSG00000047578	ENSG00000047578			29068	protein-coding gene	gene with protein product						9628581	Standard	NM_015202		Approved		uc002dow.3	O60303	OTTHUMG00000176780	ENST00000261588.4:c.1430T>C	16.37:g.27720066T>C	ENSP00000261588:p.Ile477Thr	Somatic	110	0		WXS	Illumina HiSeq	Phase_I	139	28	NM_015202	0	0	3	5	2	A7E2C2	Missense_Mutation	SNP	ENST00000261588.4	37	CCDS32415.1	.	.	.	.	.	.	.	.	.	.	T	15.39	2.818111	0.50633	.	.	ENSG00000047578	ENST00000261588;ENST00000327217	T	0.13778	2.56	5.49	4.4	0.53042	.	0.797554	0.11412	N	0.566654	T	0.19886	0.0478	M	0.75264	2.295	0.09310	N	0.999996	B	0.21071	0.051	B	0.19391	0.025	T	0.14008	-1.0488	10	0.51188	T	0.08	-4.828	10.5152	0.44885	0.0:0.0775:0.0:0.9225	.	477	O60303	K0556_HUMAN	T	477;384	ENSP00000261588:I477T	ENSP00000261588:I477T	I	+	2	0	KIAA0556	27627567	0.986000	0.35501	0.001000	0.08648	0.582000	0.36321	3.571000	0.53841	0.912000	0.36772	0.379000	0.24179	ATC	.		0.453	KIAA0556-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433724.1	NM_015202	
SNX20	124460	bcgsc.ca	37	16	50707452	50707452	+	Silent	SNP	G	G	T			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr16:50707452G>T	ENST00000330943.4	-	4	987	c.816C>A	c.(814-816)gcC>gcA	p.A272A	RP11-401P9.5_ENST00000570241.2_RNA|RP11-401P9.5_ENST00000570167.1_RNA|SNX20_ENST00000423026.2_Intron|SNX20_ENST00000300590.3_Intron	NM_182854.2	NP_878274.1	Q7Z614	SNX20_HUMAN	sorting nexin 20	272					protein transport (GO:0015031)	endosome (GO:0005768)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)			kidney(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|skin(2)|stomach(1)	15						GGCGGACCATGGCGTCCAGCA	0.721																																					p.A272A													.	SNX20-23	0			c.C816A						.						27.0	28.0	27.0					16																	50707452		2197	4296	6493	SO:0001819	synonymous_variant	124460	exon4			GACCATGGCGTCC	AK055837	CCDS10745.1, CCDS10744.1, CCDS45481.1	16q12.1	2008-03-25	2008-03-25		ENSG00000167208	ENSG00000167208		"""Sorting nexins"""	30390	protein-coding gene	gene with protein product	"""selectin ligand interactor cytoplasmic 1"""	613281				18196517, 16782399	Standard	NM_182854		Approved	SLIC-1, SLIC1	uc002egk.2	Q7Z614	OTTHUMG00000133173	ENST00000330943.4:c.816C>A	16.37:g.50707452G>T		Somatic	78	0		WXS	Illumina HiSeq	Phase_1	104	6	NM_182854	0	0	0	0	0	A8K9D5|Q08E98|Q6P4H2|Q8IV59	Silent	SNP	ENST00000330943.4	37	CCDS10745.1																																																																																			.		0.721	SNX20-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256879.2	NM_153337	
CDH15	1013	hgsc.bcm.edu	37	16	89261313	89261313	+	Missense_Mutation	SNP	A	A	G			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr16:89261313A>G	ENST00000289746.2	+	14	2260	c.2195A>G	c.(2194-2196)gAc>gGc	p.D732G		NM_004933.2	NP_004924.1	P55291	CAD15_HUMAN	cadherin 15, type 1, M-cadherin (myotubule)	732					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)	caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(80;0.0261)		CCGCCTTACGACACAGCCCTC	0.632																																					p.D732G		.											.	CDH15-523	0			c.A2195G						.						35.0	32.0	33.0					16																	89261313		2182	4291	6473	SO:0001583	missense	1013	exon14			CTTACGACACAGC	D83542	CCDS10976.1	16q24.3	2010-01-26	2008-10-30		ENSG00000129910	ENSG00000129910		"""Cadherins / Major cadherins"""	1754	protein-coding gene	gene with protein product		114019	"""cadherin 15, M-cadherin (myotubule)"""	CDH3, CDH14		1427864	Standard	NM_004933		Approved		uc002fmt.3	P55291	OTTHUMG00000138045	ENST00000289746.2:c.2195A>G	16.37:g.89261313A>G	ENSP00000289746:p.Asp732Gly	Somatic	34	0		WXS	Illumina HiSeq	Phase_I	44	3	NM_004933	0	0	0	0	0		Missense_Mutation	SNP	ENST00000289746.2	37	CCDS10976.1	.	.	.	.	.	.	.	.	.	.	A	26.5	4.746646	0.89663	.	.	ENSG00000129910	ENST00000289746	D	0.89485	-2.52	4.93	4.93	0.64822	Cadherin, cytoplasmic domain (1);	0.000000	0.56097	D	0.000039	D	0.96097	0.8728	H	0.95982	3.75	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	D	0.97199	0.9863	10	0.87932	D	0	.	13.5526	0.61740	1.0:0.0:0.0:0.0	.	732	P55291	CAD15_HUMAN	G	732	ENSP00000289746:D732G	ENSP00000289746:D732G	D	+	2	0	CDH15	87788814	1.000000	0.71417	0.967000	0.41034	0.899000	0.52679	8.618000	0.90932	1.848000	0.53677	0.459000	0.35465	GAC	.		0.632	CDH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269920.1	NM_004933	
CLDN7	1366	broad.mit.edu	37	17	7163815	7163815	+	Missense_Mutation	SNP	A	A	C			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr17:7163815A>C	ENST00000360325.7	-	4	948	c.514T>G	c.(514-516)Tct>Gct	p.S172A	RP1-4G17.5_ENST00000577138.1_Intron|CLDN7_ENST00000397317.4_Missense_Mutation_p.S172A|CLDN7_ENST00000573745.1_5'Flank|CLDN7_ENST00000538261.3_Silent_p.G143G	NM_001307.5	NP_001298.3	O95471	CLD7_HUMAN	claudin 7	172					calcium-independent cell-cell adhesion (GO:0016338)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)	p.S172A(1)		kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(1)	6						ACTAGGGCAGACCCTGCCCAG	0.572																																					p.S172A													.	CLDN7-91	1	Substitution - Missense(1)	prostate(1)	c.T514G						.																																			SO:0001583	missense	1366	exon4			GGGCAGACCCTGC	AJ011497	CCDS11096.1, CCDS54081.1	17p13.1	2013-09-20			ENSG00000181885	ENSG00000181885		"""Claudins"""	2049	protein-coding gene	gene with protein product		609131		CEPTRL2, CPETRL2		9892664	Standard	NM_001307		Approved	Hs.84359	uc002gfm.4	O95471	OTTHUMG00000178005	ENST00000360325.7:c.514T>G	17.37:g.7163815A>C	ENSP00000353475:p.Ser172Ala	Somatic	33	12		WXS	Illumina HiSeq	Phase_I	41	21	NM_001307	0	0	667	692	25	B2R9X7|D3DTP0|Q6IPN3|Q7Z4Y7|Q9BVN0	Missense_Mutation	SNP	ENST00000360325.7	37	CCDS11096.1	.	.	.	.	.	.	.	.	.	.	A	3.194	-0.165202	0.06461	.	.	ENSG00000181885	ENST00000360325;ENST00000397317	D;D	0.87650	-2.28;-2.28	4.92	4.92	0.64577	.	0.115272	0.64402	D	0.000011	T	0.71962	0.3402	N	0.11651	0.15	0.80722	D	1	B	0.15141	0.012	B	0.17722	0.019	T	0.66532	-0.5900	10	0.02654	T	1	.	12.8138	0.57654	1.0:0.0:0.0:0.0	.	172	O95471	CLD7_HUMAN	A	172	ENSP00000353475:S172A;ENSP00000396638:S172A	ENSP00000353475:S172A	S	-	1	0	CLDN7	7104539	0.032000	0.19561	1.000000	0.80357	0.949000	0.60115	0.407000	0.21049	2.197000	0.70478	0.402000	0.26972	TCT	.		0.572	CLDN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440204.2	NM_001307	
TOP3A	7156	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	18212208	18212208	+	Silent	SNP	A	A	G			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr17:18212208A>G	ENST00000321105.5	-	2	442	c.228T>C	c.(226-228)caT>caC	p.H76H	TOP3A_ENST00000542570.1_Missense_Mutation_p.I6T|TOP3A_ENST00000582230.1_5'UTR	NM_004618.3	NP_004609.1	Q13472	TOP3A_HUMAN	topoisomerase (DNA) III alpha	76	Toprim. {ECO:0000255|PROSITE- ProRule:PRU00995}.				DNA topological change (GO:0006265)|meiotic nuclear division (GO:0007126)	chromosome (GO:0005694)|nucleus (GO:0005634)|PML body (GO:0016605)	DNA binding (GO:0003677)|DNA topoisomerase type I activity (GO:0003917)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(15)|ovary(1)|skin(6)|stomach(2)|urinary_tract(1)	36						GGCCATACAGATGATAATCAA	0.289																																					p.H76H		.											.	TOP3A-228	0			c.T228C						.						36.0	33.0	34.0					17																	18212208		2201	4295	6496	SO:0001819	synonymous_variant	7156	exon2			ATACAGATGATAA	U43431	CCDS11194.1	17p12-p11.2	2014-02-18			ENSG00000177302	ENSG00000177302			11992	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 7"""	601243		TOP3		9450867	Standard	NM_004618		Approved	ZGRF7	uc002gsx.1	Q13472	OTTHUMG00000059391	ENST00000321105.5:c.228T>C	17.37:g.18212208A>G		Somatic	35	0		WXS	Illumina HiSeq	Phase_I	46	15	NM_004618	0	0	0	0	0	A8KA61|B4DK80|D3DXC7|Q13473	Silent	SNP	ENST00000321105.5	37	CCDS11194.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.18|13.18	2.161482|2.161482	0.38119|0.38119	.|.	.|.	ENSG00000177302|ENSG00000177302	ENST00000542570|ENST00000412083	T|.	0.08282|.	3.11|.	5.04|5.04	-5.1|-5.1	0.02911|0.02911	.|.	.|.	.|.	.|.	.|.	T|T	0.50616|0.50616	0.1626|0.1626	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.53258|0.53258	-0.8464|-0.8464	6|4	0.21014|.	T|.	0.42|.	-4.7873|-4.7873	8.3168|8.3168	0.32104|0.32104	0.5159:0.1661:0.3181:0.0|0.5159:0.1661:0.3181:0.0	.|.	.|.	.|.	.|.	T|P	6|56	ENSP00000442336:I6T|.	ENSP00000442336:I6T|.	I|S	-|-	2|1	0|0	TOP3A|TOP3A	18152933|18152933	0.817000|0.817000	0.29147|0.29147	0.469000|0.469000	0.27204|0.27204	0.893000|0.893000	0.52053|0.52053	-0.001000|-0.001000	0.12947|0.12947	-0.503000|-0.503000	0.06586|0.06586	-0.220000|-0.220000	0.12472|0.12472	ATC|TCT	.		0.289	TOP3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132052.2		
MED1	5469	bcgsc.ca	37	17	37565188	37565188	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr17:37565188T>C	ENST00000300651.6	-	17	3509	c.3286A>G	c.(3286-3288)Agc>Ggc	p.S1096G	MED1_ENST00000394287.3_Intron|CTB-131K11.1_ENST00000582842.1_RNA	NM_004774.3	NP_004765.2	O95243	MBD4_HUMAN	mediator complex subunit 1	0					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|response to radiation (GO:0009314)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endodeoxyribonuclease activity (GO:0004520)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|satellite DNA binding (GO:0003696)			NS(1)|breast(2)|cervix(3)|kidney(3)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(7)|urinary_tract(1)	59		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		CTATGGTGGCTTTTGCTGCCT	0.463										HNSCC(31;0.082)																											p.S1096G	Pancreas(21;279 768 2492 4877 24026)												.	MED1-620	0			c.A3286G						.						85.0	81.0	82.0					17																	37565188		2203	4300	6503	SO:0001583	missense	5469	exon17			GGTGGCTTTTGCT	L40366	CCDS11336.1	17q12	2007-07-30	2007-07-30	2007-07-30	ENSG00000125686	ENSG00000125686			9234	protein-coding gene	gene with protein product		604311	"""PPAR binding protein"""	TRIP2, PPARGBP, PPARBP		9325263, 10485914	Standard	NM_004774		Approved	PBP, TRAP220, RB18A, DRIP230, CRSP200, CRSP1	uc002hrv.4	Q15648	OTTHUMG00000133216	ENST00000300651.6:c.3286A>G	17.37:g.37565188T>C	ENSP00000300651:p.Ser1096Gly	Somatic	148	0		WXS	Illumina HiSeq	Phase_1	170	5	NM_004774	0	0	8	8	0	B4DZN2|D3DNC3|D3DNC4|E9PEE4|Q2MD36|Q7Z4T3|Q96F09	Missense_Mutation	SNP	ENST00000300651.6	37	CCDS11336.1	.	.	.	.	.	.	.	.	.	.	T	9.253	1.041274	0.19669	.	.	ENSG00000125686	ENST00000300651	T	0.35421	1.31	5.87	5.87	0.94306	.	.	.	.	.	T	0.36276	0.0961	N	0.24115	0.695	0.49299	D	0.999771	D	0.63880	0.993	P	0.52758	0.708	T	0.05733	-1.0867	9	0.16896	T	0.51	-9.8436	16.5764	0.84681	0.0:0.0:0.0:1.0	.	1096	Q15648	MED1_HUMAN	G	1096	ENSP00000300651:S1096G	ENSP00000300651:S1096G	S	-	1	0	MED1	34818714	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.195000	0.58400	2.371000	0.80710	0.533000	0.62120	AGC	.		0.463	MED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256943.3	NM_004774	
EFTUD2	9343	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	42945230	42945230	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr17:42945230G>A	ENST00000426333.2	-	13	1391	c.1094C>T	c.(1093-1095)tCc>tTc	p.S365F	EFTUD2_ENST00000591382.1_Missense_Mutation_p.S365F|EFTUD2_ENST00000592576.1_Missense_Mutation_p.S355F|EFTUD2_ENST00000402521.3_Missense_Mutation_p.S330F	NM_001142605.1|NM_001258354.1|NM_004247.3	NP_001136077.1|NP_001245283.1|NP_004238.3	Q15029	U5S1_HUMAN	elongation factor Tu GTP binding domain containing 2	365	tr-type G. {ECO:0000255|PROSITE- ProRule:PRU01059}.				gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	32		Prostate(33;0.109)				ACTTCTCTGGGAGCTGCTAGT	0.483																																					p.S365F	Ovarian(10;65 485 10258 29980 30707)	.											.	EFTUD2-91	0			c.C1094T						.						48.0	47.0	48.0					17																	42945230		2203	4300	6503	SO:0001583	missense	9343	exon13			CTCTGGGAGCTGC	D21163	CCDS11489.1, CCDS45707.1, CCDS59295.1	17q21.31	2014-08-12			ENSG00000108883	ENSG00000108883			30858	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 116 kD"""	603892				9233818	Standard	NM_004247		Approved	U5-116KD, Snrp116, Snu114, SNRNP116	uc002ihn.2	Q15029	OTTHUMG00000179865	ENST00000426333.2:c.1094C>T	17.37:g.42945230G>A	ENSP00000392094:p.Ser365Phe	Somatic	20	0		WXS	Illumina HiSeq	Phase_I	29	17	NM_004247	0	0	6	14	8	B4DK30|B4DMC0|D3DX58|K7EJ81|Q9BUR0	Missense_Mutation	SNP	ENST00000426333.2	37	CCDS11489.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.231134	0.79688	.	.	ENSG00000108883	ENST00000426333;ENST00000262414;ENST00000402521	T;T	0.76839	-1.05;-1.05	6.17	6.17	0.99709	Protein synthesis factor, GTP-binding (1);	0.000000	0.85682	D	0.000000	T	0.81964	0.4934	L	0.56769	1.78	0.80722	D	1	P;P	0.41710	0.76;0.76	P;P	0.47891	0.56;0.56	T	0.77477	-0.2573	10	0.32370	T	0.25	0.1139	20.8794	0.99867	0.0:0.0:1.0:0.0	.	355;365	B4DMC0;Q15029	.;U5S1_HUMAN	F	365;355;330	ENSP00000392094:S365F;ENSP00000385873:S330F	ENSP00000262414:S355F	S	-	2	0	EFTUD2	40300756	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.406000	0.97321	2.941000	0.99782	0.655000	0.94253	TCC	.		0.483	EFTUD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448672.1	NM_004247	
WNT3	7473	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	44845986	44845986	+	Silent	SNP	C	C	T			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr17:44845986C>T	ENST00000225512.5	-	4	930	c.768G>A	c.(766-768)gtG>gtA	p.V256V		NM_030753.4	NP_110380.1	P56703	WNT3_HUMAN	wingless-type MMTV integration site family, member 3	256					anterior/posterior axis specification (GO:0009948)|axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in mesenchymal stem cell differentiation (GO:0044338)|canonical Wnt signaling pathway involved in osteoblast differentiation (GO:0044339)|cell fate commitment (GO:0045165)|cell morphogenesis (GO:0000902)|cellular response to retinoic acid (GO:0071300)|dorsal/ventral axis specification (GO:0009950)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|gamete generation (GO:0007276)|head morphogenesis (GO:0060323)|limb bud formation (GO:0060174)|mammary gland epithelium development (GO:0061180)|mesoderm formation (GO:0001707)|negative regulation of axon extension involved in axon guidance (GO:0048843)|neuron differentiation (GO:0030182)|positive regulation of collateral sprouting in absence of injury (GO:0048697)|positive regulation of gene expression (GO:0010628)|Spemann organizer formation at the anterior end of the primitive streak (GO:0060064)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)			endometrium(2)|large_intestine(6)|lung(4)|prostate(1)	13			BRCA - Breast invasive adenocarcinoma(9;0.0257)			GGAGGGTCTCCACCCAGCCTC	0.592																																					p.G256G		.											.	WNT3-522	0			c.A768A						.						85.0	91.0	89.0					17																	44845986		2203	4300	6503	SO:0001819	synonymous_variant	7473	exon4			GGTCTCCACCCAG	AY009397	CCDS11505.1	17q21-q22	2013-02-28				ENSG00000108379		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12782	protein-coding gene	gene with protein product	"""WNT-3 proto-oncogene protein"""	165330		INT4		8244403	Standard	NM_030753		Approved	MGC131950, MGC138321, MGC138323	uc002ikv.3	P56703		ENST00000225512.5:c.768G>A	17.37:g.44845986C>T		Somatic	146	0		WXS	Illumina HiSeq	Phase_I	174	79	NM_030753	0	0	0	2	2	Q2M237|Q9H1J9	Silent	SNP	ENST00000225512.5	37	CCDS11505.1																																																																																			.		0.592	WNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440427.1	NM_030753	
RNF213	57674	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	78321576	78321576	+	Silent	SNP	C	C	T			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr17:78321576C>T	ENST00000582970.1	+	29	9584	c.9441C>T	c.(9439-9441)cgC>cgT	p.R3147R	RNF213_ENST00000336301.6_Silent_p.R1220R|RNF213_ENST00000508628.2_Silent_p.R3196R	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	3147					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			CCAACTTCCGCCTGATTGTCA	0.552																																					p.R3147R		.											.	RNF213-577	0			c.C9441T						.						55.0	53.0	54.0					17																	78321576		2203	4300	6503	SO:0001819	synonymous_variant	57674	exon29			CTTCCGCCTGATT	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.9441C>T	17.37:g.78321576C>T		Somatic	79	0		WXS	Illumina HiSeq	Phase_I	88	6	NM_001256071	0	0	14	15	1	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Silent	SNP	ENST00000582970.1	37	CCDS58606.1																																																																																			.		0.552	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914	
DSEL	92126	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	65181492	65181492	+	Silent	SNP	A	A	G			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr18:65181492A>G	ENST00000310045.7	-	2	1857	c.384T>C	c.(382-384)aaT>aaC	p.N128N	CTD-2541J13.2_ENST00000581951.1_RNA|RP11-638L3.1_ENST00000583687.1_lincRNA|CTD-2541J13.2_ENST00000583493.1_RNA	NM_032160.2	NP_115536.1	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	118					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	isomerase activity (GO:0016853)|sulfotransferase activity (GO:0008146)			NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(25)|lung(23)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)				CATAAATTTCATTCCACTTGG	0.403																																					p.N128N		.											.	DSEL-157	0			c.T384C						.						114.0	101.0	106.0					18																	65181492		2203	4300	6503	SO:0001819	synonymous_variant	92126	exon2			AATTTCATTCCAC	AF480435	CCDS11995.1	18q22.1	2007-01-29	2007-01-29	2007-01-29	ENSG00000171451	ENSG00000171451			18144	protein-coding gene	gene with protein product		611125	"""chromosome 18 open reading frame 4"""	C18orf4		16505484	Standard	NM_032160		Approved	NCAG1, FLJ11477	uc002lke.1	Q8IZU8	OTTHUMG00000132804	ENST00000310045.7:c.384T>C	18.37:g.65181492A>G		Somatic	107	1		WXS	Illumina HiSeq	Phase_I	132	41	NM_032160	0	0	0	1	1	Q17RH1|Q6P5Z3	Silent	SNP	ENST00000310045.7	37	CCDS11995.1																																																																																			.		0.403	DSEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256221.1	NM_032160	
CFD	1675	hgsc.bcm.edu;broad.mit.edu	37	19	860929	860929	+	Missense_Mutation	SNP	T	T	G			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr19:860929T>G	ENST00000327726.6	+	3	518	c.281T>G	c.(280-282)cTg>cGg	p.L94R	CFD_ENST00000592860.1_Missense_Mutation_p.L101R	NM_001928.2	NP_001919.2	P00746	CFAD_HUMAN	complement factor D (adipsin)	94	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.			Missing (in Ref. 7; AA sequence). {ECO:0000305}.	blood coagulation (GO:0007596)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)						Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCCAAGCGCCTGTACGACGTG	0.721																																					p.L94R		.											.	CFD-514	0			c.T281G						.						18.0	17.0	18.0					19																	860929		2185	4282	6467	SO:0001583	missense	1675	exon3			AGCGCCTGTACGA	M84526	CCDS12046.1	19p13.3	2014-09-17	2006-02-10	2006-02-10		ENSG00000197766		"""Complement system"""	2771	protein-coding gene	gene with protein product		134350	"""D component of complement (adipsin)"", ""properdin factor D"""	DF, PFD		1374388	Standard	NM_001928		Approved	ADN	uc002lqc.3	P00746		ENST00000327726.6:c.281T>G	19.37:g.860929T>G	ENSP00000332139:p.Leu94Arg	Somatic	23	0		WXS	Illumina HiSeq	Phase_I	27	9	NM_001928	0	0	81	82	1	B4DV76|Q5U5S1|Q86VJ5|Q8N4E0|Q8WZB4	Missense_Mutation	SNP	ENST00000327726.6	37	CCDS12046.1	.	.	.	.	.	.	.	.	.	.	T	9.346	1.064348	0.20067	.	.	ENSG00000197766	ENST00000327726	D	0.88277	-2.36	3.66	1.38	0.22167	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.331646	0.15899	U	0.239174	T	0.73071	0.3540	N	0.02674	-0.535	0.09310	N	1	B;B	0.17038	0.02;0.015	B;B	0.16722	0.016;0.006	T	0.63778	-0.6560	10	0.59425	D	0.04	.	10.1812	0.42968	0.0:0.0:0.5042:0.4958	.	101;94	A6XNE2;P00746	.;CFAD_HUMAN	R	94	ENSP00000332139:L94R	ENSP00000332139:L94R	L	+	2	0	CFD	811929	0.000000	0.05858	0.060000	0.19600	0.958000	0.62258	-0.666000	0.05280	-0.029000	0.13827	0.334000	0.21626	CTG	.		0.721	CFD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457891.2	NM_001928	
AP3D1	8943	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	2151253	2151253	+	Missense_Mutation	SNP	G	G	C			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr19:2151253G>C	ENST00000345016.5	-	1	312	c.81C>G	c.(79-81)aaC>aaG	p.N27K	AP3D1_ENST00000350812.6_Missense_Mutation_p.N27K|AP3D1_ENST00000356926.4_Missense_Mutation_p.N27K|AP3D1_ENST00000355272.6_Missense_Mutation_p.N27K	NM_003938.6	NP_003929.4	O14617	AP3D1_HUMAN	adaptor-related protein complex 3, delta 1 subunit	27					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|endosome to melanosome transport (GO:0035646)|eye pigment biosynthetic process (GO:0006726)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein localization to membrane (GO:0072657)|protein localization to organelle (GO:0033365)|regulation of sequestering of zinc ion (GO:0061088)|synaptic vesicle membrane organization (GO:0048499)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane coat (GO:0030117)|terminal bouton (GO:0043195)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(23)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCTCCTTGTGGTTACGGATGC	0.682																																					p.N27K		.											.	AP3D1-90	0			c.C81G						.						29.0	32.0	31.0					19																	2151253		1958	4139	6097	SO:0001583	missense	8943	exon1			CTTGTGGTTACGG	U91930	CCDS42459.1, CCDS58638.1	19p13.3	2014-09-04			ENSG00000065000	ENSG00000065000			568	protein-coding gene	gene with protein product		607246				9151686, 9303295	Standard	NM_003938		Approved	ADTD	uc002lva.4	O14617	OTTHUMG00000180354	ENST00000345016.5:c.81C>G	19.37:g.2151253G>C	ENSP00000344055:p.Asn27Lys	Somatic	29	0		WXS	Illumina HiSeq	Phase_I	34	16	NM_001261826	0	0	3	3	0	O00202|O75262|Q59HF5|Q96G11|Q9H3C6	Missense_Mutation	SNP	ENST00000345016.5	37	CCDS42459.1	.	.	.	.	.	.	.	.	.	.	G	15.05	2.717231	0.48622	.	.	ENSG00000065000	ENST00000356926;ENST00000345016;ENST00000355272;ENST00000343722;ENST00000350812	T;T;T;T	0.18657	2.2;2.65;2.62;2.21	3.89	2.85	0.33270	Armadillo-like helical (1);	0.000000	0.85682	D	0.000000	T	0.32436	0.0829	L	0.40543	1.245	0.25610	N	0.986508	B;B;D	0.67145	0.264;0.058;0.996	B;B;D	0.78314	0.033;0.067;0.991	T	0.02860	-1.1101	10	0.52906	T	0.07	-55.1245	9.2068	0.37293	0.1883:0.0:0.8117:0.0	.	27;27;27	O14617-5;O14617;G5E988	.;AP3D1_HUMAN;.	K	27	ENSP00000349398:N27K;ENSP00000344055:N27K;ENSP00000347416:N27K;ENSP00000342321:N27K	ENSP00000341579:N27K	N	-	3	2	AP3D1	2102253	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.691000	0.37721	0.971000	0.38288	0.436000	0.28706	AAC	.		0.682	AP3D1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450912.1		
ARHGEF18	23370	hgsc.bcm.edu	37	19	7533786	7533786	+	Missense_Mutation	SNP	G	G	A	rs180746700	byFrequency	TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr19:7533786G>A	ENST00000359920.6	+	17	3245	c.2992G>A	c.(2992-2994)Ggc>Agc	p.G998S	ARHGEF18_ENST00000319670.9_Missense_Mutation_p.G840S|CTD-2207O23.3_ENST00000593531.1_Silent_p.P955P	NM_001130955.1	NP_001124427.1	Q6ZSZ5	ARHGI_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 18	998					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transforming growth factor beta receptor signaling pathway (GO:0007179)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(4)|ovary(2)|prostate(2)|stomach(1)|urinary_tract(1)	23		Renal(5;0.0902)				GCTGCCATCCGGCGTGGGGCC	0.687													G|||	3	0.000599042	0.0	0.0	5008	,	,		16123	0.0		0.002	False		,,,				2504	0.001				p.G998S		.											.	ARHGEF18-228	0			c.G2992A						.	G	SER/GLY,SER/GLY	3,4353		0,3,2175	11.0	11.0	11.0		2992,2518	-2.6	0.0	19		11	17,8533		0,17,4258	yes	missense,missense	ARHGEF18	NM_001130955.1,NM_015318.3	56,56	0,20,6433	AA,AG,GG		0.1988,0.0689,0.155	benign,benign	998/1174,840/1016	7533786	20,12886	2178	4275	6453	SO:0001583	missense	23370	exon17			CCATCCGGCGTGG	AK074372	CCDS12177.1, CCDS45946.1	19p13.3	2013-01-10	2009-06-12			ENSG00000104880		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	17090	protein-coding gene	gene with protein product	"""Rho-specific guanine nucleotide exchange factor p114"""		"""rho/rac guanine nucleotide exchange factor (GEF) 18"""			9628581, 11318610	Standard	NM_015318		Approved	P114-RhoGEF, KIAA0521, MGC15913	uc002mgi.3	Q6ZSZ5		ENST00000359920.6:c.2992G>A	19.37:g.7533786G>A	ENSP00000352995:p.Gly998Ser	Somatic	10	2		WXS	Illumina HiSeq	Phase_I	15	10	NM_001130955	0	0	4	6	2	A8MV62|B5ME81|O60274|Q6DD92	Missense_Mutation	SNP	ENST00000359920.6	37	CCDS45946.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	5.500	0.277247	0.10403	6.89E-4	0.001988	ENSG00000104880	ENST00000319670;ENST00000359920	T;T	0.29142	1.59;1.58	4.97	-2.59	0.06209	.	0.977536	0.08305	N	0.966245	T	0.15696	0.0378	N	0.22421	0.69	0.09310	N	1	B;B	0.10296	0.003;0.001	B;B	0.08055	0.003;0.001	T	0.37549	-0.9701	10	0.05833	T	0.94	-0.8582	9.2231	0.37388	0.5011:0.0:0.4989:0.0	.	840;998	Q6ZSZ5-2;Q6ZSZ5	.;ARHGI_HUMAN	S	840;998	ENSP00000319200:G840S;ENSP00000352995:G998S	ENSP00000319200:G840S	G	+	1	0	ARHGEF18	7439786	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	0.169000	0.16641	-0.320000	0.08640	-0.244000	0.11960	GGC	G|0.999;A|0.000		0.687	ARHGEF18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000436340.1	NM_015318	
PTGER1	5731	broad.mit.edu	37	19	14584193	14584193	+	Missense_Mutation	SNP	G	G	T			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr19:14584193G>T	ENST00000292513.3	-	2	1057	c.940C>A	c.(940-942)Ctg>Atg	p.L314M		NM_000955.2	NP_000946.2	P34995	PE2R1_HUMAN	prostaglandin E receptor 1 (subtype EP1), 42kDa	314					G-protein coupled receptor signaling pathway (GO:0007186)|response to lipopolysaccharide (GO:0032496)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	prostaglandin E receptor activity (GO:0004957)									Alprostadil(DB00770)|Bimatoprost(DB00905)|Bupivacaine(DB00297)|Carboprost Tromethamine(DB00429)|Dinoprostone(DB00917)|Iloprost(DB01088)	CCCCTCACCAGCATTGGGCTC	0.687											OREG0025314	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L314M													.	PTGER1-658	0			c.C940A						.						18.0	12.0	14.0					19																	14584193		2160	4237	6397	SO:0001583	missense	5731	exon2			TCACCAGCATTGG		CCDS12309.1	19p13.1	2012-08-08	2002-08-29		ENSG00000160951	ENSG00000160951		"""GPCR / Class A : Prostanoid receptors"""	9593	protein-coding gene	gene with protein product		176802	"""prostaglandin E receptor 1 (subtype EP1), 42kD"""			8253813	Standard	NM_000955		Approved	EP1	uc002mys.3	P34995	OTTHUMG00000039610	ENST00000292513.3:c.940C>A	19.37:g.14584193G>T	ENSP00000292513:p.Leu314Met	Somatic	16	0	696	WXS	Illumina HiSeq	Phase_I	16	5	NM_000955	0	0	0	0	0	Q5U5U4|Q86UH3|Q86VB5|Q8NHB2	Missense_Mutation	SNP	ENST00000292513.3	37	CCDS12309.1	.	.	.	.	.	.	.	.	.	.	G	19.85	3.903916	0.72754	.	.	ENSG00000160951	ENST00000292513	T	0.38240	1.15	3.67	3.67	0.42095	GPCR, rhodopsin-like superfamily (1);	0.224065	0.30575	N	0.009330	T	0.51466	0.1676	M	0.63428	1.95	0.40826	D	0.983548	D	0.89917	1.0	D	0.97110	1.0	T	0.54741	-0.8248	10	0.72032	D	0.01	-9.2521	6.8966	0.24259	0.126:0.0:0.874:0.0	.	314	P34995	PE2R1_HUMAN	M	314	ENSP00000292513:L314M	ENSP00000292513:L314M	L	-	1	2	PTGER1	14445193	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	6.364000	0.73086	1.873000	0.54277	0.561000	0.74099	CTG	.		0.687	PTGER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095509.1		
SLC27A1	376497	hgsc.bcm.edu	37	19	17597401	17597401	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr19:17597401T>C	ENST00000252595.7	+	2	294	c.197T>C	c.(196-198)cTg>cCg	p.L66P	SLC27A1_ENST00000598424.1_5'UTR|SLC27A1_ENST00000442725.1_Missense_Mutation_p.L66P|CTD-3131K8.2_ENST00000596643.1_lincRNA	NM_198580.1	NP_940982.1	Q6PCB7	S27A1_HUMAN	solute carrier family 27 (fatty acid transporter), member 1	66					adiponectin-activated signaling pathway (GO:0033211)|cardiolipin biosynthetic process (GO:0032049)|cellular lipid metabolic process (GO:0044255)|fatty acid metabolic process (GO:0006631)|long-chain fatty acid transport (GO:0015909)|medium-chain fatty acid transport (GO:0001579)|negative regulation of phospholipid biosynthetic process (GO:0071072)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phosphatidylglycerol biosynthetic process (GO:0006655)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylserine biosynthetic process (GO:0006659)|positive regulation of heat generation (GO:0031652)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|response to cold (GO:0009409)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	fatty acid transporter activity (GO:0015245)|nucleotide binding (GO:0000166)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23						CGCGTGCGCCTGGAGCTGCGG	0.721																																					p.L66P		.											.	SLC27A1-226	0			c.T197C						.						8.0	7.0	8.0					19																	17597401		2039	4010	6049	SO:0001583	missense	376497	exon2			TGCGCCTGGAGCT	BC059399	CCDS32953.1	19p13.11	2013-07-15			ENSG00000130304	ENSG00000130304		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10995	protein-coding gene	gene with protein product		600691				10873384	Standard	NM_198580		Approved	FATP1, FATP, MGC71751, FLJ00336, ACSVL5	uc002ngu.1	Q6PCB7	OTTHUMG00000182878	ENST00000252595.7:c.197T>C	19.37:g.17597401T>C	ENSP00000252595:p.Leu66Pro	Somatic	18	0		WXS	Illumina HiSeq	Phase_I	20	3	NM_198580	0	0	1	1	0	A6NIH2|B7Z662	Missense_Mutation	SNP	ENST00000252595.7	37	CCDS32953.1	.	.	.	.	.	.	.	.	.	.	t	15.96	2.985604	0.53934	.	.	ENSG00000130304	ENST00000442725;ENST00000252595	T;T	0.52983	0.64;0.64	4.92	1.22	0.21188	.	0.618824	0.16244	N	0.223002	T	0.41696	0.1170	M	0.64404	1.975	0.58432	D	0.999995	P	0.40875	0.731	B	0.43386	0.418	T	0.35101	-0.9802	10	0.44086	T	0.13	.	1.9726	0.03409	0.155:0.1003:0.1755:0.5692	.	66	Q6PCB7	S27A1_HUMAN	P	66	ENSP00000413424:L66P;ENSP00000252595:L66P	ENSP00000252595:L66P	L	+	2	0	SLC27A1	17458401	0.585000	0.26774	0.997000	0.53966	0.905000	0.53344	0.500000	0.22562	0.706000	0.31912	0.454000	0.30748	CTG	.		0.721	SLC27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464145.1	NM_198580	
PSMC4	5704	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	40478461	40478461	+	Splice_Site	SNP	A	A	G			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr19:40478461A>G	ENST00000157812.2	+	3	519	c.321A>G	c.(319-321)acA>acG	p.T107T	PSMC4_ENST00000455878.2_Splice_Site_p.T76T	NM_006503.3|NM_153001.2	NP_006494.1|NP_694546.1	P43686	PRS6B_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 4	107					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|blastocyst development (GO:0001824)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|inclusion body (GO:0016234)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					GCTCTACCACAGGTGTGCTAA	0.512																																					p.T107T	Colon(105;1478 1543 4034 6132 38638)	.											.	PSMC4-91	0			c.A321G						.						41.0	36.0	38.0					19																	40478461		2203	4300	6503	SO:0001630	splice_region_variant	5704	exon3			TACCACAGGTGTG	U27515	CCDS12547.1, CCDS46076.1	19q13.11-q13.13	2010-04-21			ENSG00000013275	ENSG00000013275		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9551	protein-coding gene	gene with protein product	"""protease 26S subunit 6"", ""Tat-binding protein 7"", ""MB67 interacting protein"""	602707		MIP224		9473509, 8603043	Standard	NM_006503		Approved	TBP7, S6, MGC8570, MGC13687, MGC23214, TBP-7	uc002omq.4	P43686		ENST00000157812.2:c.322+1A>G	19.37:g.40478461A>G		Somatic	30	0		WXS	Illumina HiSeq	Phase_I	46	11	NM_006503	0	0	0	0	0	Q96FV5|Q9UBM3|Q9UEX3	Silent	SNP	ENST00000157812.2	37	CCDS12547.1																																																																																			.		0.512	PSMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462485.1	NM_006503	Silent
MEGF8	1954	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	42861598	42861598	+	Missense_Mutation	SNP	C	C	G			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr19:42861598C>G	ENST00000251268.6	+	28	4873	c.4873C>G	c.(4873-4875)Ctt>Gtt	p.L1625V	MEGF8_ENST00000334370.4_Missense_Mutation_p.L1558V	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	1625					BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				TGGTCACACCCTTACTGCCCG	0.652																																					p.L1625V		.											.	MEGF8-23	0			c.C4873G						.						67.0	68.0	67.0					19																	42861598		2203	4300	6503	SO:0001583	missense	1954	exon28			CACACCCTTACTG	AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.4873C>G	19.37:g.42861598C>G	ENSP00000251268:p.Leu1625Val	Somatic	182	0		WXS	Illumina HiSeq	Phase_I	163	44	NM_001271938	0	0	1	1	0	A8KAY0|O75097	Missense_Mutation	SNP	ENST00000251268.6	37		.	.	.	.	.	.	.	.	.	.	C	22.5	4.302490	0.81136	.	.	ENSG00000105429	ENST00000334370;ENST00000251268	T;T	0.64438	-0.1;-0.1	5.21	5.21	0.72293	Galactose oxidase/kelch, beta-propeller (1);Kelch-type beta propeller (1);	0.000000	0.56097	D	0.000038	T	0.74913	0.3779	L	0.50333	1.59	0.80722	D	1	D;D	0.63046	0.992;0.99	P;D	0.72982	0.792;0.979	T	0.76110	-0.3079	10	0.56958	D	0.05	-13.3833	17.5358	0.87830	0.0:1.0:0.0:0.0	.	1625;1558	Q7Z7M0;Q7Z7M0-2	MEGF8_HUMAN;.	V	1558;1625	ENSP00000334219:L1558V;ENSP00000251268:L1625V	ENSP00000251268:L1625V	L	+	1	0	MEGF8	47553438	1.000000	0.71417	0.980000	0.43619	0.985000	0.73830	4.334000	0.59291	2.453000	0.82957	0.563000	0.77884	CTT	.		0.652	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000463854.1	NM_001410	
ZNF8	7554	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	58805588	58805588	+	Silent	SNP	G	G	A	rs35832841	byFrequency	TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr19:58805588G>A	ENST00000196548.5	+	4	545	c.414G>A	c.(412-414)ggG>ggA	p.G138G	AC010642.1_ENST00000591325.1_3'UTR|ZNF8_ENST00000608843.1_Silent_p.G138G			P17098	ZNF8_HUMAN	zinc finger protein 8	138					BMP signaling pathway (GO:0030509)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|skin(1)	19		all_cancers(17;6.46e-05)|Lung NSC(17;0.0233)|all_neural(62;0.0381)|all_epithelial(17;0.0427)|all_lung(17;0.057)|Ovarian(87;0.17)|Colorectal(82;0.227)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.00619)		CCACGTTAGGGAAAGACAGGG	0.527																																					p.G138G		.											.	ZNF8-91	0			c.G414A						.						65.0	50.0	55.0					19																	58805588		2203	4300	6503	SO:0001819	synonymous_variant	7554	exon4			GTTAGGGAAAGAC	M29581	CCDS12974.1	19q13.43	2013-01-08	2006-05-09					"""Zinc fingers, C2H2-type"", ""-"""	13154	protein-coding gene	gene with protein product		194532	"""zinc finger protein 8 (clone HF.18)"""			2106481	Standard	NM_021089		Approved	HF.18, Zfp128	uc002qry.1	P17098		ENST00000196548.5:c.414G>A	19.37:g.58805588G>A		Somatic	59	1		WXS	Illumina HiSeq	Phase_I	38	9	NM_021089	0	0	2	3	1	Q6PI99	Silent	SNP	ENST00000196548.5	37	CCDS12974.1																																																																																			G|0.995;T|0.005		0.527	ZNF8-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000459135.1	NM_021089	
LPIN1	23175	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	11913751	11913751	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr2:11913751T>C	ENST00000256720.2	+	5	695	c.602T>C	c.(601-603)cTt>cCt	p.L201P	LPIN1_ENST00000449576.2_Missense_Mutation_p.L250P|LPIN1_ENST00000396099.1_Missense_Mutation_p.L207P|LPIN1_ENST00000396098.1_Missense_Mutation_p.L207P|LPIN1_ENST00000425416.2_Missense_Mutation_p.L207P	NM_145693.2	NP_663731.1	Q14693	LPIN1_HUMAN	lipin 1	201					cellular lipid metabolic process (GO:0044255)|fatty acid catabolic process (GO:0009062)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)|triglyceride mobilization (GO:0006642)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(15)|liver(1)|lung(10)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	45	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.173)		TCCAGAACTCTTCCTAATGAT	0.358																																					p.L250P		.											.	LPIN1-156	0			c.T749C						.						81.0	88.0	86.0					2																	11913751		2203	4300	6503	SO:0001583	missense	23175	exon6			GAACTCTTCCTAA	D80010	CCDS1682.1, CCDS58699.1, CCDS58700.1, CCDS58701.1	2p25.1	2008-05-23			ENSG00000134324	ENSG00000134324			13345	protein-coding gene	gene with protein product		605518				11138012, 8724849, 16950137	Standard	NM_145693		Approved	KIAA0188	uc010yjm.3	Q14693	OTTHUMG00000119082	ENST00000256720.2:c.602T>C	2.37:g.11913751T>C	ENSP00000256720:p.Leu201Pro	Somatic	127	0		WXS	Illumina HiSeq	Phase_I	113	35	NM_001261428	0	0	0	0	0	A8MU38|B4DET9|B4DGS4|B4DGZ6|B5MC18|B7Z858|D6W506|E7ESE7|F5GY24|Q53T25	Missense_Mutation	SNP	ENST00000256720.2	37	CCDS1682.1	.	.	.	.	.	.	.	.	.	.	T	5.891	0.348519	0.11126	.	.	ENSG00000134324	ENST00000449576;ENST00000396098;ENST00000396099;ENST00000425416;ENST00000256720	T;D;T;T;T	0.89270	-1.47;-2.49;-1.45;-1.47;-1.47	5.6	3.27	0.37495	.	0.457402	0.18485	N	0.139836	T	0.80884	0.4709	L	0.31926	0.97	0.09310	N	0.999998	B;B;B	0.11235	0.002;0.0;0.004	B;B;B	0.11329	0.006;0.002;0.006	T	0.66929	-0.5799	10	0.31617	T	0.26	-5.5606	7.3106	0.26473	0.0:0.2849:0.0:0.7151	.	250;201;207	F5GY24;Q14693;A8MU38	.;LPIN1_HUMAN;.	P	250;207;207;207;201	ENSP00000397908:L250P;ENSP00000379405:L207P;ENSP00000379406:L207P;ENSP00000401522:L207P;ENSP00000256720:L201P	ENSP00000256720:L201P	L	+	2	0	LPIN1	11831202	0.012000	0.17670	0.131000	0.22000	0.489000	0.33432	1.405000	0.34635	0.974000	0.38366	0.482000	0.46254	CTT	.		0.358	LPIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239296.3	NM_145693	
NBAS	51594	hgsc.bcm.edu	37	2	15691633	15691633	+	Silent	SNP	A	A	G			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr2:15691633A>G	ENST00000281513.5	-	6	388	c.363T>C	c.(361-363)atT>atC	p.I121I	NBAS_ENST00000441750.1_Silent_p.I121I	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	121					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)				NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						ATTTCCCAATAATGGATGTAA	0.294																																					p.I121I		.											.	NBAS-94	0			c.T363C						.						41.0	40.0	40.0					2																	15691633		2201	4297	6498	SO:0001819	synonymous_variant	51594	exon6			CCCAATAATGGAT	BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.363T>C	2.37:g.15691633A>G		Somatic	33	0		WXS	Illumina HiSeq	Phase_I	30	2	NM_015909	0	0	0	0	0	O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Silent	SNP	ENST00000281513.5	37	CCDS1685.1																																																																																			.		0.294	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241638.1	NM_015909	
ANAPC1	64682	hgsc.bcm.edu	37	2	112615903	112615903	+	Silent	SNP	T	T	C			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr2:112615903T>C	ENST00000341068.3	-	11	2110	c.1338A>G	c.(1336-1338)gtA>gtG	p.V446V		NM_022662.3	NP_073153.1	Q9H1A4	APC1_HUMAN	anaphase promoting complex subunit 1	446					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)				NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(7)|lung(16)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	49						GCTGGGACTCTACTAAAAAGC	0.328																																					p.V446V		.											.	ANAPC1-228	0			c.A1338G						.						93.0	86.0	89.0					2																	112615903		2203	4300	6503	SO:0001819	synonymous_variant	64682	exon11			GGACTCTACTAAA	AJ278357	CCDS2093.1	2q12.1	2011-06-15			ENSG00000153107	ENSG00000153107		"""Anaphase promoting complex subunits"""	19988	protein-coding gene	gene with protein product		608473				11179667	Standard	NM_022662		Approved	MCPR, TSG24, APC1	uc002ssh.3	Q9H1A4	OTTHUMG00000131277	ENST00000341068.3:c.1338A>G	2.37:g.112615903T>C		Somatic	66	0		WXS	Illumina HiSeq	Phase_I	58	3	NM_022662	0	0	0	0	0	Q2M3H8|Q9BSE6|Q9H8D0	Silent	SNP	ENST00000341068.3	37	CCDS2093.1																																																																																			.		0.328	ANAPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254045.2	NM_022662	
THSD7B	80731	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	137928319	137928319	+	Missense_Mutation	SNP	A	A	G			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr2:137928319A>G	ENST00000409968.1	+	7	1712	c.1534A>G	c.(1534-1536)Acg>Gcg	p.T512A	THSD7B_ENST00000543459.1_Intron|THSD7B_ENST00000272643.3_Missense_Mutation_p.T512A|THSD7B_ENST00000413152.2_Missense_Mutation_p.T481A|THSD7B_ENST00000485379.1_3'UTR			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	512	TSP type-1 6. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)				NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		AGGATTTAGAACGAGGCAGCG	0.453																																					.													.	THSD7B-75	0			.						.						84.0	78.0	80.0					2																	137928319		1907	4138	6045	SO:0001583	missense	80731	.			TTTAGAACGAGGC			2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.1534A>G	2.37:g.137928319A>G	ENSP00000387145:p.Thr512Ala	Somatic	73	0		WXS	Illumina HiSeq	Phase_I	89	11	.	0	0	0	0	0		Missense_Mutation	SNP	ENST00000409968.1	37		.	.	.	.	.	.	.	.	.	.	A	7.167	0.586912	0.13749	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152	T;T;T	0.61980	0.06;0.06;0.06	5.76	3.08	0.35506	.	0.578922	0.21014	N	0.081637	T	0.49762	0.1576	L	0.42581	1.335	0.80722	D	1	B;B	0.15719	0.014;0.014	B;B	0.17722	0.019;0.019	T	0.35425	-0.9789	10	0.16420	T	0.52	.	10.3016	0.43656	0.7244:0.0:0.0:0.2756	.	512;481	Q9C0I4;C9JKN6	THS7B_HUMAN;.	A	512;512;481	ENSP00000387145:T512A;ENSP00000272643:T512A;ENSP00000413841:T481A	ENSP00000272643:T512A	T	+	1	0	THSD7B	137644789	1.000000	0.71417	0.870000	0.34147	0.031000	0.12232	2.542000	0.45744	0.987000	0.38709	-0.327000	0.08410	ACG	.		0.453	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331769.2	XM_046570.9	
IFIH1	64135	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	163167397	163167397	+	Missense_Mutation	SNP	A	A	G			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr2:163167397A>G	ENST00000263642.2	-	2	895	c.500T>C	c.(499-501)cTa>cCa	p.L167P	IFIH1_ENST00000421365.2_Missense_Mutation_p.L167P	NM_022168.3	NP_071451.2	Q9BYX4	IFIH1_HUMAN	interferon induced with helicase C domain 1	167	CARD 2.				cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|protein sumoylation (GO:0016925)|regulation of apoptotic process (GO:0042981)|regulation of type III interferon production (GO:0034344)|response to virus (GO:0009615)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|ribonucleoprotein complex binding (GO:0043021)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	39						CCTTTTTAGTAGCTCTCTTAC	0.358																																					p.L167P		.											.	IFIH1-91	0			c.T500C						.						81.0	72.0	75.0					2																	163167397		2203	4299	6502	SO:0001583	missense	64135	exon2			TTTAGTAGCTCTC	AF095844	CCDS2217.1	2q24.2	2010-02-09			ENSG00000115267	ENSG00000115267			18873	protein-coding gene	gene with protein product	"""helicard"""	606951					Standard	NM_022168		Approved	MDA-5, Hlcd, MDA5, IDDM19	uc002uce.4	Q9BYX4	OTTHUMG00000132055	ENST00000263642.2:c.500T>C	2.37:g.163167397A>G	ENSP00000263642:p.Leu167Pro	Somatic	55	0		WXS	Illumina HiSeq	Phase_I	54	15	NM_022168	0	0	5	6	1	Q2NKL6|Q6DC96|Q86X56|Q96MX8|Q9H3G6	Missense_Mutation	SNP	ENST00000263642.2	37	CCDS2217.1	.	.	.	.	.	.	.	.	.	.	A	17.16	3.318793	0.60524	.	.	ENSG00000115267	ENST00000263642;ENST00000543192;ENST00000421365	T;T	0.63255	-0.03;-0.03	5.81	5.81	0.92471	DEATH-like (2);Caspase Recruitment (1);	0.140170	0.48286	D	0.000192	T	0.79411	0.4441	M	0.76574	2.34	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.81874	-0.0732	10	0.87932	D	0	-10.3294	16.1677	0.81782	1.0:0.0:0.0:0.0	.	167;167	Q9BYX4-2;Q9BYX4	.;IFIH1_HUMAN	P	167	ENSP00000263642:L167P;ENSP00000408450:L167P	ENSP00000263642:L167P	L	-	2	0	IFIH1	162875643	0.991000	0.36638	0.999000	0.59377	0.237000	0.25408	6.182000	0.71995	2.218000	0.71995	0.528000	0.53228	CTA	.		0.358	IFIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255078.2	NM_022168	
NABP1	64859	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	192543405	192543405	+	Missense_Mutation	SNP	A	A	C			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr2:192543405A>C	ENST00000425611.2	+	1	148	c.65A>C	c.(64-66)aAt>aCt	p.N22T	NABP1_ENST00000410026.2_Intron|NABP1_ENST00000409510.1_Intron	NM_001031716.2	NP_001026886.1	Q96AH0	SOSB2_HUMAN	nucleic acid binding protein 1	22					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|mitotic cell cycle checkpoint (GO:0007093)|response to ionizing radiation (GO:0010212)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SOSS complex (GO:0070876)	RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)										AAAAACTTAAATGTCGTCTTT	0.562																																					p.N22T		.											.	.	0			c.A65C						.						42.0	50.0	47.0					2																	192543405		2203	4300	6503	SO:0001583	missense	64859	exon1			ACTTAAATGTCGT	BC017114	CCDS33352.1, CCDS58745.1	2q32.3	2012-06-19	2012-06-19	2012-06-19	ENSG00000173559	ENSG00000173559			26232	protein-coding gene	gene with protein product	"""single-stranded DNA-binding protein 2"", ""sensor of single-strand DNA complex subunit B2"""	612103	"""oligonucleotide/oligosaccharide-binding fold containing 2A"""	OBFC2A			Standard	NM_001031716		Approved	FLJ22833, DKFZp667M1322, FLJ13624, MGC111163, SSB2, hSSB2, SOSS-B2	uc002usx.3	Q96AH0	OTTHUMG00000132720	ENST00000425611.2:c.65A>C	2.37:g.192543405A>C	ENSP00000403683:p.Asn22Thr	Somatic	113	0		WXS	Illumina HiSeq	Phase_I	100	32	NM_001031716	0	0	1	2	1	Q658Y8|Q9H5X6	Missense_Mutation	SNP	ENST00000425611.2	37	CCDS33352.1	.	.	.	.	.	.	.	.	.	.	A	24.4	4.527945	0.85706	.	.	ENSG00000173559	ENST00000425611	T	0.28255	1.62	5.51	5.51	0.81932	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);	0.107337	0.64402	D	0.000007	T	0.46927	0.1418	M	0.68728	2.09	0.54753	D	0.999989	D	0.63046	0.992	P	0.59487	0.858	T	0.47522	-0.9111	10	0.56958	D	0.05	.	9.7659	0.40561	0.9219:0.0:0.0781:0.0	.	22	Q96AH0	SOSB2_HUMAN	T	22	ENSP00000403683:N22T	ENSP00000307968:N22T	N	+	2	0	OBFC2A	192251650	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.953000	0.70290	2.080000	0.62538	0.533000	0.62120	AAT	.		0.562	NABP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256060.1	NM_022837	
SF3B1	23451	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	198274598	198274598	+	Missense_Mutation	SNP	G	G	T	rs1044635		TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr2:198274598G>T	ENST00000335508.6	-	7	891	c.800C>A	c.(799-801)aCt>aAt	p.T267N		NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	267	Interaction with PPP1R8.|U2AF homology region; mediates interaction with RMB39.				anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)			NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			TCGTCCAGGAGTAGCAGCTCC	0.562			Mis		myelodysplastic syndrome																																p.T267N		.		Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	.	SF3B1-140	0			c.C800A						.						170.0	167.0	168.0					2																	198274598		2203	4300	6503	SO:0001583	missense	23451	exon7			CCAGGAGTAGCAG	AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.800C>A	2.37:g.198274598G>T	ENSP00000335321:p.Thr267Asn	Somatic	197	0		WXS	Illumina HiSeq	Phase_I	222	78	NM_012433	0	0	20	38	18	E9PCH3	Missense_Mutation	SNP	ENST00000335508.6	37	CCDS33356.1	.	.	.	.	.	.	.	.	.	.	G	32	5.179984	0.94846	.	.	ENSG00000115524	ENST00000335508	.	.	.	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.57562	0.2062	L	0.44542	1.39	0.80722	D	1	D	0.55800	0.973	P	0.47346	0.544	T	0.53954	-0.8365	9	0.27082	T	0.32	.	19.0839	0.93194	0.0:0.0:1.0:0.0	.	267	O75533	SF3B1_HUMAN	N	267	.	ENSP00000335321:T267N	T	-	2	0	SF3B1	197982843	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.750000	0.98875	2.502000	0.84385	0.655000	0.94253	ACT	G|1.000;A|0.000		0.562	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335245.2		
PMEPA1	56937	broad.mit.edu	37	20	56227616	56227616	+	Silent	SNP	C	C	T			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr20:56227616C>T	ENST00000341744.3	-	4	676	c.357G>A	c.(355-357)ctG>ctA	p.L119L	PMEPA1_ENST00000265626.4_Silent_p.L69L|PMEPA1_ENST00000395816.3_Silent_p.L69L|PMEPA1_ENST00000347215.4_Silent_p.L84L|PMEPA1_ENST00000395814.1_Silent_p.L69L	NM_020182.4	NP_064567.2	Q969W9	PMEPA_HUMAN	prostate transmembrane protein, androgen induced 1	119					androgen receptor signaling pathway (GO:0030521)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|transforming growth factor beta receptor signaling pathway (GO:0007179)	early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	R-SMAD binding (GO:0070412)|WW domain binding (GO:0050699)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|prostate(1)	16						GCGGCACGGCCAGGCGGTCGG	0.692																																					p.L119L													.	PMEPA1-227	0			c.G357A						.						15.0	17.0	16.0					20																	56227616		2188	4253	6441	SO:0001819	synonymous_variant	56937	exon4			CACGGCCAGGCGG	AF224278	CCDS13462.1, CCDS13463.1, CCDS13464.1	20q13.31-q13.33	2008-04-03	2008-04-03	2008-04-03	ENSG00000124225	ENSG00000124225			14107	protein-coding gene	gene with protein product	"""solid tumor-associated 1"""	606564	"""transmembrane, prostate androgen induced RNA"""	TMEPAI		10873380	Standard	NM_020182		Approved	STAG1	uc002xyq.4	Q969W9	OTTHUMG00000032831	ENST00000341744.3:c.357G>A	20.37:g.56227616C>T		Somatic	10	0		WXS	Illumina HiSeq	Phase_I	14	3	NM_020182	0	0	8	14	6	Q5TDR6|Q8NER4|Q96B72|Q9UJD3	Silent	SNP	ENST00000341744.3	37	CCDS13463.1																																																																																			.		0.692	PMEPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079858.2	NM_020182	
COL9A3	1299	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	61468580	61468580	+	Silent	SNP	C	C	T	rs144216578	byFrequency	TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr20:61468580C>T	ENST00000343916.3	+	30	1752	c.1749C>T	c.(1747-1749)cgC>cgT	p.R583R	COL9A3_ENST00000462700.1_3'UTR	NM_001853.3	NP_001844.3	Q14050	CO9A3_HUMAN	collagen, type IX, alpha 3	583	Triple-helical region 2 (COL2).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female gonad development (GO:0008585)|male gonad development (GO:0008584)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(1)|endometrium(3)|large_intestine(1)|lung(18)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	28	Breast(26;5.68e-08)					CTGGATACCGCGGTCCCACTG	0.667													C|||	2	0.000399361	0.0008	0.0014	5008	,	,		13123	0.0		0.0	False		,,,				2504	0.0				p.R583R		.											.	COL9A3-514	0			c.C1749T						.	C		2,4394		0,2,2196	24.0	33.0	30.0		1749	-9.0	0.9	20	dbSNP_134	30	5,8583		0,5,4289	no	coding-synonymous	COL9A3	NM_001853.3		0,7,6485	TT,TC,CC		0.0582,0.0455,0.0539		583/685	61468580	7,12977	2198	4294	6492	SO:0001819	synonymous_variant	1299	exon30			ATACCGCGGTCCC	AK075240	CCDS13505.1	20q13.3	2013-01-16			ENSG00000092758	ENSG00000092758		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2219	protein-coding gene	gene with protein product	"""collagen type IX proteoglycan"""	120270				8586434, 1429648	Standard	NM_001853		Approved	IDD, MED, EDM3, FLJ90759, DJ885L7.4.1	uc002ydm.3	Q14050	OTTHUMG00000032938	ENST00000343916.3:c.1749C>T	20.37:g.61468580C>T		Somatic	74	1		WXS	Illumina HiSeq	Phase_I	82	25	NM_001853	0	0	0	0	0	Q13681|Q9H4G9|Q9UPE2	Silent	SNP	ENST00000343916.3	37	CCDS13505.1																																																																																			C|1.000;T|0.000		0.667	COL9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080071.2	NM_001853	
DIDO1	11083	ucsc.edu	37	20	61512320	61512320	+	Missense_Mutation	SNP	G	G	T			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr20:61512320G>T	ENST00000266070.4	-	16	5313	c.4988C>A	c.(4987-4989)cCg>cAg	p.P1663Q	DIDO1_ENST00000395343.1_Missense_Mutation_p.P1663Q	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	1663					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					GCCGCAAGGCGGTGTGGGCAG	0.731																																					p.P1663Q	Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)												.	DIDO1-96	0			c.C4988A						.						11.0	13.0	12.0					20																	61512320		2175	4250	6425	SO:0001583	missense	11083	exon16			CAAGGCGGTGTGG	AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.4988C>A	20.37:g.61512320G>T	ENSP00000266070:p.Pro1663Gln	Somatic	29	0		WXS	Illumina HiSeq		35	4	NM_001193369	0	0	1	1	0	A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Missense_Mutation	SNP	ENST00000266070.4	37	CCDS33506.1	.	.	.	.	.	.	.	.	.	.	G	17.01	3.280550	0.59758	.	.	ENSG00000101191	ENST00000266070;ENST00000395343	T;T	0.24151	1.87;1.87	5.31	5.31	0.75309	.	0.000000	0.42821	D	0.000644	T	0.44350	0.1289	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.40040	-0.9584	10	0.87932	D	0	-26.6638	18.9695	0.92709	0.0:0.0:1.0:0.0	.	1663	Q9BTC0	DIDO1_HUMAN	Q	1663	ENSP00000266070:P1663Q;ENSP00000378752:P1663Q	ENSP00000266070:P1663Q	P	-	2	0	DIDO1	60982765	1.000000	0.71417	0.443000	0.26883	0.145000	0.21501	6.992000	0.76238	2.456000	0.83038	0.655000	0.94253	CCG	.		0.731	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080091.2	NM_080796	
NRIP1	8204	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	16337670	16337670	+	Silent	SNP	A	A	G			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr21:16337670A>G	ENST00000400202.1	-	3	3556	c.2844T>C	c.(2842-2844)gaT>gaC	p.D948D	NRIP1_ENST00000400199.1_Silent_p.D948D|AF127577.10_ENST00000446301.1_RNA|NRIP1_ENST00000318948.4_Silent_p.D948D			P48552	NRIP1_HUMAN	nuclear receptor interacting protein 1	948	Interaction with ZNF366.				androgen receptor signaling pathway (GO:0030521)|lipid storage (GO:0019915)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ovarian follicle rupture (GO:0001543)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|glucocorticoid receptor binding (GO:0035259)|nuclear hormone receptor binding (GO:0035257)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			cervix(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(13)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	39				Epithelial(23;1.19e-05)|all cancers(11;4.64e-05)|COAD - Colon adenocarcinoma(22;0.000232)|Colorectal(24;0.0006)|OV - Ovarian serous cystadenocarcinoma(11;0.00418)|Lung(58;0.199)|LUSC - Lung squamous cell carcinoma(23;0.24)		GCGGGGACAAATCTCGCACAC	0.428																																					p.D948D		.											.	NRIP1-186	0			c.T2844C						.						82.0	82.0	82.0					21																	16337670		2203	4299	6502	SO:0001819	synonymous_variant	8204	exon4			GGACAAATCTCGC	X84373	CCDS13568.1	21q11.2	2008-07-31			ENSG00000180530	ENSG00000180530			8001	protein-coding gene	gene with protein product	"""receptor interacting protein 140"", ""nuclear factor RIP140"""	602490				7641693, 9521594	Standard	NM_003489		Approved	RIP140	uc002yjx.2	P48552	OTTHUMG00000074323	ENST00000400202.1:c.2844T>C	21.37:g.16337670A>G		Somatic	150	0		WXS	Illumina HiSeq	Phase_I	157	44	NM_003489	0	0	4	11	7	Q8IWE8	Silent	SNP	ENST00000400202.1	37	CCDS13568.1																																																																																			.		0.428	NRIP1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157926.1	NM_003489	
NCAM2	4685	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	22658662	22658662	+	Silent	SNP	A	A	T			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr21:22658662A>T	ENST00000400546.1	+	4	660	c.411A>T	c.(409-411)cgA>cgT	p.R137R	NCAM2_ENST00000535285.1_Silent_p.R162R|NCAM2_ENST00000486367.1_3'UTR|NCAM2_ENST00000284894.7_Intron	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2	137	Ig-like C2-type 2.				axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		TGGTTTGCCGAGTTAGCAGTT	0.398																																					p.R137R		.											.	NCAM2-94	0			c.A411T						.						119.0	114.0	116.0					21																	22658662		2019	4192	6211	SO:0001819	synonymous_variant	4685	exon4			TTGCCGAGTTAGC		CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.411A>T	21.37:g.22658662A>T		Somatic	64	0		WXS	Illumina HiSeq	Phase_I	55	15	NM_004540	0	0	0	0	0	A8MQ06|B7Z841|Q7Z7F2	Silent	SNP	ENST00000400546.1	37	CCDS42910.1																																																																																			.		0.398	NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000170915.1	NM_004540	
SON	6651	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	21	34932382	34932382	+	Intron	SNP	A	A	G			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr21:34932382A>G	ENST00000356577.4	+	6	7132				SON_ENST00000290239.6_Intron|SON_ENST00000381692.2_Intron|SON_ENST00000300278.4_Missense_Mutation_p.N2286S	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein						cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						CCAAGGTACAACTATTTAGCT	0.473																																					p.N2286S		.											.	SON-97	0			c.A6857G						.						149.0	142.0	145.0					21																	34932382		2203	4300	6503	SO:0001627	intron_variant	6651	exon7			GGTACAACTATTT	AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.6657+301A>G	21.37:g.34932382A>G		Somatic	200	0		WXS	Illumina HiSeq	Phase_I	180	55	NM_032195	0	0	12	14	2	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Missense_Mutation	SNP	ENST00000356577.4	37	CCDS13629.1	.	.	.	.	.	.	.	.	.	.	A	12.33	1.907015	0.33628	.	.	ENSG00000159140	ENST00000300278	T	0.09630	2.96	5.58	5.58	0.84498	.	.	.	.	.	T	0.32071	0.0817	.	.	.	0.80722	D	1	D	0.67145	0.996	D	0.77557	0.99	T	0.03922	-1.0992	8	0.87932	D	0	.	12.1393	0.53989	1.0:0.0:0.0:0.0	.	2286	P18583-3	.	S	2286	ENSP00000300278:N2286S	ENSP00000300278:N2286S	N	+	2	0	SON	33854252	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.247000	0.58750	2.124000	0.65301	0.460000	0.39030	AAC	.		0.473	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140978.2	NM_138927	
CECR2	27443	broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	18021911	18021911	+	Silent	SNP	C	C	T			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr22:18021911C>T	ENST00000400585.2	+	16	2028	c.1590C>T	c.(1588-1590)tgC>tgT	p.C530C	CECR2_ENST00000400573.5_Silent_p.C671C|CECR2_ENST00000262608.8_Silent_p.C672C			Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2	713					apoptotic DNA fragmentation (GO:0006309)|ATP-dependent chromatin remodeling (GO:0043044)|cytokinesis (GO:0000910)|cytoskeleton organization (GO:0007010)|execution phase of apoptosis (GO:0097194)|neural tube development (GO:0021915)|vesicle-mediated transport (GO:0016192)	CERF complex (GO:0090537)|nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	59		all_epithelial(15;0.139)		Lung(27;0.146)		AGCAAATGTGCGGGGGGCTGA	0.557																																					.													.	CECR2-70	0			.						.						33.0	35.0	34.0					22																	18021911		1996	4163	6159	SO:0001819	synonymous_variant	27443	.			AATGTGCGGGGGG	AF336133		22q11.2	2012-04-19			ENSG00000099954	ENSG00000099954			1840	protein-coding gene	gene with protein product		607576				11381032	Standard	XM_006724077		Approved	KIAA1740	uc002zml.2	Q9BXF3	OTTHUMG00000150072	ENST00000400585.2:c.1590C>T	22.37:g.18021911C>T		Somatic	20	0		WXS	Illumina HiSeq	Phase_I	27	8	.	0	0	1	1	0	A8MS90|A8MX16|Q658Z4|Q96P58|Q9C0C3	Silent	SNP	ENST00000400585.2	37																																																																																				.		0.557	CECR2-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000316226.2	NM_031413	
IGLV1-51	28820	ucsc.edu	37	22	22677057	22677057	+	RNA	SNP	G	G	A			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr22:22677057G>A	ENST00000390290.2	+	0	121				BMS1P20_ENST00000426066.1_RNA					immunoglobulin lambda variable 1-51																		GCCGCCCTCAGTGTCTGCGGC	0.562																																					.													.	.	0			.						.						57.0	63.0	61.0					22																	22677057		1955	4144	6099			0	.			CCCTCAGTGTCTG	Z73661		22q11.2	2012-02-08			ENSG00000211644	ENSG00000211644		"""Immunoglobulins / IGL locus"""	5882	other	immunoglobulin gene							Standard	NG_000002		Approved				OTTHUMG00000151035		22.37:g.22677057G>A		Somatic	135	0		WXS	Illumina HiSeq		127	1	.	0	0	5	6	1		RNA	SNP	ENST00000390290.2	37																																																																																				.		0.562	IGLV1-51-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IG_V_gene	OTTHUMT00000321094.1	NG_000002	
RHBDD3	25807	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	29656765	29656765	+	Silent	SNP	C	C	A			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr22:29656765C>A	ENST00000216085.7	-	5	1045	c.621G>T	c.(619-621)ggG>ggT	p.G207G	CTA-984G1.5_ENST00000433125.1_RNA	NM_012265.1	NP_036397.1	Q9Y3P4	RHBD3_HUMAN	rhomboid domain containing 3	207					liver development (GO:0001889)|MAPK cascade (GO:0000165)|negative regulation of natural killer cell activation (GO:0032815)|positive regulation of protein catabolic process (GO:0045732)|regulation of acute inflammatory response (GO:0002673)|regulation of protein secretion (GO:0050708)|response to xenobiotic stimulus (GO:0009410)	integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)			lung(1)|ovary(1)	2						GGGGCCAGCACCCCGCCAAGG	0.692																																					p.G207G		.											.	RHBDD3-91	0			c.G621T						.						17.0	17.0	17.0					22																	29656765		2198	4291	6489	SO:0001819	synonymous_variant	25807	exon5			CCAGCACCCCGCC	AL050346	CCDS13850.1	22q12.2	2006-02-22	2006-02-22	2006-02-22	ENSG00000100263	ENSG00000100263			1308	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 3"""	C22orf3		10591208, 15105437	Standard	NM_012265		Approved	PTAG	uc003aeq.1	Q9Y3P4	OTTHUMG00000151032	ENST00000216085.7:c.621G>T	22.37:g.29656765C>A		Somatic	23	0		WXS	Illumina HiSeq	Phase_I	29	9	NM_012265	0	0	6	8	2	Q6I9X3|Q9UGQ7	Silent	SNP	ENST00000216085.7	37	CCDS13850.1																																																																																			.		0.692	RHBDD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321085.1	NM_012265	
MTMR14	64419	broad.mit.edu;bcgsc.ca	37	3	9691346	9691346	+	Missense_Mutation	SNP	C	C	G			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr3:9691346C>G	ENST00000296003.4	+	1	201	c.79C>G	c.(79-81)Ctg>Gtg	p.L27V	MTMR14_ENST00000420925.1_Missense_Mutation_p.L27V|MTMR14_ENST00000351233.5_Missense_Mutation_p.L27V|MTMR14_ENST00000353332.5_Missense_Mutation_p.L27V	NM_001077525.2	NP_001070993.1	Q8NCE2	MTMRE_HUMAN	myotubularin related protein 14	27					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(3)|kidney(2)|lung(10)|skin(3)|upper_aerodigestive_tract(2)	21	Medulloblastoma(99;0.227)					GCCTCAGGAGCTGGGGCTTGG	0.721																																					p.L27V													.	MTMR14-91	0			c.C79G						.						7.0	9.0	8.0					3																	9691346		1848	4076	5924	SO:0001583	missense	64419	exon1			CAGGAGCTGGGGC	BC001674	CCDS43043.1, CCDS43044.1, CCDS43045.1	3p26	2011-06-09	2006-12-18	2006-12-18	ENSG00000163719	ENSG00000163719		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	26190	protein-coding gene	gene with protein product	"""egg-derived tyrosine phosphatase homolog (Drosophila)"""	611089	"""chromosome 3 open reading frame 29"""	C3orf29		15186772	Standard	NM_022485		Approved	FLJ22405, FLJ90311, hJumpy, hEDTP	uc003brz.3	Q8NCE2	OTTHUMG00000155111	ENST00000296003.4:c.79C>G	3.37:g.9691346C>G	ENSP00000296003:p.Leu27Val	Somatic	19	0		WXS	Illumina HiSeq	Phase_I	16	4	NM_022485	0	0	1	1	0	Q0JTH5|Q0JU83|Q6PIZ4|Q6QE21|Q86VK9|Q8IYK1|Q8TCM7|Q9H6C0	Missense_Mutation	SNP	ENST00000296003.4	37	CCDS43043.1	.	.	.	.	.	.	.	.	.	.	C	14.22	2.468940	0.43839	.	.	ENSG00000163719	ENST00000353332;ENST00000420925;ENST00000296003;ENST00000351233;ENST00000419048	D	0.97161	-4.27	5.23	5.23	0.72850	.	0.517985	0.19981	N	0.101768	D	0.91274	0.7249	N	0.03608	-0.345	0.21527	N	0.999658	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.82573	-0.0390	10	0.42905	T	0.14	-1.7533	15.8007	0.78453	0.0:1.0:0.0:0.0	.	27;27;27;27	C9JSR1;Q8NCE2-3;Q8NCE2-2;Q8NCE2	.;.;.;MTMRE_HUMAN	V	27	ENSP00000401993:L27V	ENSP00000296003:L27V	L	+	1	2	MTMR14	9666346	1.000000	0.71417	0.942000	0.38095	0.493000	0.33554	3.397000	0.52572	2.455000	0.83008	0.650000	0.86243	CTG	.		0.721	MTMR14-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338435.1	NM_022485	
DPPA2	151871	broad.mit.edu	37	3	109023471	109023471	+	Silent	SNP	T	T	C			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr3:109023471T>C	ENST00000478945.1	-	7	951	c.705A>G	c.(703-705)acA>acG	p.T235T		NM_138815.3	NP_620170.3	Q7Z7J5	DPPA2_HUMAN	developmental pluripotency associated 2	235					lung-associated mesenchyme development (GO:0060484)|positive regulation of stem cell proliferation (GO:2000648)|regulation of histone methylation (GO:0031060)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(19)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						CCCAACCCTTTGTGTCTGCCG	0.502																																					p.T235T													.	DPPA2-93	0			c.A705G						.						77.0	71.0	73.0					3																	109023471		2203	4300	6503	SO:0001819	synonymous_variant	151871	exon7			ACCCTTTGTGTCT	AY283672	CCDS2956.1	3q13.13	2010-05-04			ENSG00000163530	ENSG00000163530			19197	protein-coding gene	gene with protein product	"""cancer/testis antigen 100"""	614445				15583978	Standard	NM_138815		Approved	PESCRG1, CT100	uc003dxo.3	Q7Z7J5	OTTHUMG00000159227	ENST00000478945.1:c.705A>G	3.37:g.109023471T>C		Somatic	109	0		WXS	Illumina HiSeq	Phase_I	119	4	NM_138815	0	0	2	2	0	Q8WVF0	Silent	SNP	ENST00000478945.1	37	CCDS2956.1																																																																																			.		0.502	DPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353938.1	NM_138815	
POU4F2	5458	hgsc.bcm.edu	37	4	147561258	147561258	+	Silent	SNP	T	T	C			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr4:147561258T>C	ENST00000281321.3	+	2	776	c.528T>C	c.(526-528)caT>caC	p.H176H	AC093887.1_ENST00000584185.1_RNA	NM_004575.2	NP_004566.2	Q12837	PO4F2_HUMAN	POU class 4 homeobox 2	176	Poly-His.				axon extension (GO:0048675)|axon guidance (GO:0007411)|intracellular estrogen receptor signaling pathway (GO:0030520)|MAPK cascade (GO:0000165)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|retinal ganglion cell axon guidance (GO:0031290)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	33	all_hematologic(180;0.151)					accaccaccatcaccaccacc	0.682																																					p.H176H		.											.	POU4F2-135	0			c.T528C						.						43.0	45.0	44.0					4																	147561258		2203	4299	6502	SO:0001819	synonymous_variant	5458	exon2			CCACCATCACCAC	U06233	CCDS34074.1	4q31.22	2011-06-20	2007-07-13					"""Homeoboxes / POU class"""	9219	protein-coding gene	gene with protein product		113725	"""POU domain, class 4, transcription factor 2"", ""POU domain class 4, transcription factor 2"""	BRN3B		8332509	Standard	NM_004575		Approved	Brn-3b	uc003ikv.3	Q12837		ENST00000281321.3:c.528T>C	4.37:g.147561258T>C		Somatic	20	0		WXS	Illumina HiSeq	Phase_I	33	2	NM_004575	1016	1	16	1137	104	B1PJR6|B2RC84|Q13883|Q14987	Silent	SNP	ENST00000281321.3	37	CCDS34074.1																																																																																			.		0.682	POU4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367020.1	NM_004575	
DDX60	55601	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	169172121	169172121	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr4:169172121C>T	ENST00000393743.3	-	28	4133	c.3842G>A	c.(3841-3843)aGa>aAa	p.R1281K	DDX60_ENST00000505393.1_5'Flank	NM_017631.5	NP_060101.3	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	1281	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|urinary_tract(4)	63		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		ATATCCTTTTCTAAAGAGGAT	0.338																																					p.R1281K		.											.	DDX60-25	0			c.G3842A						.						76.0	79.0	78.0					4																	169172121		2201	4297	6498	SO:0001583	missense	55601	exon28			CCTTTTCTAAAGA	AK001649	CCDS34097.1	4q32.3	2010-02-17			ENSG00000137628	ENSG00000137628			25942	protein-coding gene	gene with protein product		613974				12477932	Standard	NM_017631		Approved	FLJ20035	uc003irp.3	Q8IY21	OTTHUMG00000161350	ENST00000393743.3:c.3842G>A	4.37:g.169172121C>T	ENSP00000377344:p.Arg1281Lys	Somatic	53	0		WXS	Illumina HiSeq	Phase_I	64	16	NM_017631	0	0	6	8	2	Q6PK35|Q9NVE3	Missense_Mutation	SNP	ENST00000393743.3	37	CCDS34097.1	.	.	.	.	.	.	.	.	.	.	C	12.97	2.096722	0.36952	.	.	ENSG00000137628	ENST00000393743	T	0.26957	1.7	5.4	5.4	0.78164	Helicase, C-terminal (3);	0.075985	0.56097	D	0.000034	T	0.27098	0.0664	L	0.39020	1.185	0.39934	D	0.974326	P	0.36768	0.569	B	0.38880	0.284	T	0.05750	-1.0866	10	0.52906	T	0.07	.	18.7821	0.91937	0.0:1.0:0.0:0.0	.	1281	Q8IY21	DDX60_HUMAN	K	1281	ENSP00000377344:R1281K	ENSP00000377344:R1281K	R	-	2	0	DDX60	169408696	1.000000	0.71417	0.408000	0.26446	0.120000	0.20174	4.958000	0.63660	2.549000	0.85964	0.467000	0.42956	AGA	.		0.338	DDX60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364622.1	NM_017631	
PALLD	23022	broad.mit.edu	37	4	169433375	169433375	+	Silent	SNP	G	G	A			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr4:169433375G>A	ENST00000505667.1	+	2	893	c.720G>A	c.(718-720)agG>agA	p.R240R	PALLD_ENST00000333488.4_Silent_p.R117R|PALLD_ENST00000261509.6_Silent_p.R240R|PALLD_ENST00000335742.7_5'UTR			Q8WX93	PALLD_HUMAN	palladin, cytoskeletal associated protein	240					cytoskeleton organization (GO:0007010)	actin filament (GO:0005884)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	muscle alpha-actinin binding (GO:0051371)			breast(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(18)|ovary(3)|prostate(3)|skin(4)	48		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)		CTGGGGCCAGGCATTGCTACC	0.597									Pancreatic Cancer, Familial Clustering of																												p.R240R	Esophageal Squamous(109;1482 1532 18347 40239 51172)												.	PALLD-94	0			c.G720A						.						89.0	86.0	87.0					4																	169433375		2203	4300	6503	SO:0001819	synonymous_variant	23022	exon2	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1	GGCCAGGCATTGC	AB023209	CCDS34098.1, CCDS54818.1, CCDS54819.1, CCDS54820.1	4q32.3	2013-01-11			ENSG00000129116	ENSG00000129116		"""Immunoglobulin superfamily / I-set domain containing"""	17068	protein-coding gene	gene with protein product		608092				10231032, 10931874	Standard	NM_001166108		Approved	KIAA0992, SIH002, CGI-151	uc011cjx.2	Q8WX93	OTTHUMG00000161097	ENST00000505667.1:c.720G>A	4.37:g.169433375G>A		Somatic	116	0		WXS	Illumina HiSeq	Phase_I	115	5	NM_001166108	0	0	0	0	0	B3KTG2|B5MD56|B7ZMM5|Q7L3E0|Q7Z3W0|Q86WE8|Q8N1M2|Q9UGA0|Q9UQF5|Q9Y2J6|Q9Y3E9	Silent	SNP	ENST00000505667.1	37	CCDS54818.1																																																																																			.		0.597	PALLD-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000363762.1	NM_016081	
WWC2	80014	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	184166688	184166688	+	Missense_Mutation	SNP	A	A	C			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr4:184166688A>C	ENST00000403733.3	+	6	921	c.722A>C	c.(721-723)gAt>gCt	p.D241A	WWC2_ENST00000448232.2_Missense_Mutation_p.D241A|WWC2_ENST00000378925.3_Missense_Mutation_p.D143A|WWC2_ENST00000513834.1_Missense_Mutation_p.D241A|WWC2_ENST00000504005.1_Intron	NM_024949.5	NP_079225.5	Q6AWC2	WWC2_HUMAN	WW and C2 domain containing 2	241					negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(15)|ovary(2)|prostate(1)|stomach(1)|urinary_tract(3)	32		all_lung(41;5.28e-14)|Lung NSC(41;1.35e-13)|Colorectal(36;0.00681)|Hepatocellular(41;0.00886)|Renal(120;0.00992)|Prostate(90;0.0237)|all_hematologic(60;0.0592)|Esophageal squamous(56;0.179)|all_neural(102;0.202)		all cancers(43;3.38e-24)|Epithelial(43;1.4e-20)|OV - Ovarian serous cystadenocarcinoma(60;1.09e-09)|GBM - Glioblastoma multiforme(59;3.33e-05)|Colorectal(24;3.58e-05)|STAD - Stomach adenocarcinoma(60;4.21e-05)|COAD - Colon adenocarcinoma(29;0.000171)|LUSC - Lung squamous cell carcinoma(40;0.0145)|READ - Rectum adenocarcinoma(43;0.242)		GAAAAACAAGATCTGATGCAG	0.433																																					p.D241A		.											.	WWC2-93	0			c.A722C						.						50.0	50.0	50.0					4																	184166688		2203	4300	6503	SO:0001583	missense	80014	exon6			AACAAGATCTGAT	BC017957	CCDS34109.2	4q35.1	2010-08-05	2006-11-09		ENSG00000151718	ENSG00000151718		"""WW, C2 and coiled-coil domain containing"""	24148	protein-coding gene	gene with protein product			"""WW, C2 and coiled-coil domain containing 2"""			12477932	Standard	NM_024949		Approved	BOMB, FLJ22029	uc010irx.3	Q6AWC2	OTTHUMG00000150685	ENST00000403733.3:c.722A>C	4.37:g.184166688A>C	ENSP00000384222:p.Asp241Ala	Somatic	54	0		WXS	Illumina HiSeq	Phase_I	50	14	NM_024949	0	0	0	0	0	Q32Q84|Q69YQ1|Q6AWB8|Q6ZSY9|Q6ZU09|Q7Z620|Q8TEB8|Q9H6P0	Missense_Mutation	SNP	ENST00000403733.3	37	CCDS34109.2	.	.	.	.	.	.	.	.	.	.	A	25.0	4.591096	0.86851	.	.	ENSG00000151718	ENST00000403733;ENST00000378925;ENST00000513834;ENST00000448232	T;T;T;T	0.15256	3.17;2.44;3.23;3.03	5.08	5.08	0.68730	.	0.000000	0.64402	D	0.000001	T	0.38904	0.1058	M	0.77820	2.39	0.58432	D	0.999999	D	0.67145	0.996	P	0.60609	0.877	T	0.15925	-1.0420	10	0.33940	T	0.23	-24.0084	15.3161	0.74078	1.0:0.0:0.0:0.0	.	241	Q6AWC2	WWC2_HUMAN	A	241;143;241;241	ENSP00000384222:D241A;ENSP00000368205:D143A;ENSP00000425054:D241A;ENSP00000398577:D241A	ENSP00000368205:D143A	D	+	2	0	WWC2	184403682	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	8.856000	0.92245	2.254000	0.74563	0.533000	0.62120	GAT	.		0.433	WWC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319608.1	NM_024949	
PDZD2	23037	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	32074625	32074625	+	Missense_Mutation	SNP	G	G	T			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr5:32074625G>T	ENST00000438447.1	+	18	3801	c.3413G>T	c.(3412-3414)aGt>aTt	p.S1138I	PDZD2_ENST00000282493.3_Missense_Mutation_p.S1138I			O15018	PDZD2_HUMAN	PDZ domain containing 2	1138					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						GCCAAGCCCAGTGGCTCACAG	0.587																																					p.S1138I		.											.	PDZD2-563	0			c.G3413T						.						42.0	42.0	42.0					5																	32074625		2203	4300	6503	SO:0001583	missense	23037	exon17			AGCCCAGTGGCTC	AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.3413G>T	5.37:g.32074625G>T	ENSP00000402033:p.Ser1138Ile	Somatic	64	0		WXS	Illumina HiSeq	Phase_I	49	19	NM_178140	0	0	0	0	0	Q9BXD4	Missense_Mutation	SNP	ENST00000438447.1	37	CCDS34137.1	.	.	.	.	.	.	.	.	.	.	G	12.67	2.006840	0.35415	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.06933	3.24;3.24	5.21	1.07	0.20283	.	1.010820	0.07935	N	0.978210	T	0.06325	0.0163	L	0.51422	1.61	0.09310	N	1	P;B	0.37864	0.61;0.01	B;B	0.28139	0.086;0.014	T	0.38436	-0.9661	10	0.20519	T	0.43	.	4.0787	0.09916	0.1583:0.1285:0.5814:0.1318	.	964;1138	B4E3P2;O15018	.;PDZD2_HUMAN	I	1138;940;1138	ENSP00000402033:S1138I;ENSP00000282493:S1138I	ENSP00000282493:S1138I	S	+	2	0	PDZD2	32110382	0.002000	0.14202	0.001000	0.08648	0.005000	0.04900	1.151000	0.31651	0.543000	0.28864	0.655000	0.94253	AGT	.		0.587	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1		
SEPP1	6414	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	42807146	42807146	+	Missense_Mutation	SNP	T	T	A			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr5:42807146T>A	ENST00000514985.1	-	3	524	c.268A>T	c.(268-270)Aat>Tat	p.N90Y	SEPP1_ENST00000507920.1_Intron|CTD-2325A15.5_ENST00000606056.1_RNA|SEPP1_ENST00000511224.1_Missense_Mutation_p.N90Y|SEPP1_ENST00000509276.1_Intron|SEPP1_ENST00000506577.1_Missense_Mutation_p.N90Y	NM_005410.2	NP_005401.3	P49908	SEPP1_HUMAN	selenoprotein P, plasma, 1	90					brain development (GO:0007420)|growth (GO:0040007)|locomotory behavior (GO:0007626)|post-embryonic development (GO:0009791)|response to oxidative stress (GO:0006979)|selenium compound metabolic process (GO:0001887)|sexual reproduction (GO:0019953)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	selenium binding (GO:0008430)			kidney(10)|large_intestine(1)|lung(4)	15						CCTTGATGATTAACAACAATA	0.284																																					.													.	SEPP1-68	0			.						.						84.0	82.0	83.0					5																	42807146		1792	4058	5850	SO:0001583	missense	6414	.			GATGATTAACAAC	BC040075	CCDS43311.1	5q31	2012-03-01				ENSG00000250722			10751	protein-coding gene	gene with protein product		601484				8421687	Standard	NM_001085486		Approved	SeP	uc011cpu.2	P49908		ENST00000514985.1:c.268A>T	5.37:g.42807146T>A	ENSP00000420939:p.Asn90Tyr	Somatic	59	0		WXS	Illumina HiSeq	Phase_I	66	13	.	0	0	89	104	15	Q6PD59|Q6PI43|Q6PI87|Q6PJF9	Missense_Mutation	SNP	ENST00000514985.1	37	CCDS43311.1	.	.	.	.	.	.	.	.	.	.	T	19.50	3.839014	0.71373	.	.	ENSG00000250722	ENST00000514985;ENST00000511224;ENST00000506577;ENST00000514218;ENST00000510965	T;T;T;T;T	0.47528	0.84;0.84;0.84;0.84;0.84	5.49	5.49	0.81192	.	0.000000	0.47852	U	0.000216	T	0.67590	0.2909	M	0.80982	2.52	0.80722	D	1	.	.	.	.	.	.	T	0.72978	-0.4127	8	0.87932	D	0	.	15.589	0.76510	0.0:0.0:0.0:1.0	.	.	.	.	Y	90	ENSP00000420939:N90Y;ENSP00000427671:N90Y;ENSP00000425915:N90Y;ENSP00000421626:N90Y;ENSP00000427414:N90Y	ENSP00000425915:N90Y	N	-	1	0	SEPP1	42842903	1.000000	0.71417	1.000000	0.80357	0.752000	0.42762	6.689000	0.74562	2.088000	0.63022	0.528000	0.53228	AAT	.		0.284	SEPP1-001	KNOWN	basic|appris_principal|CCDS|seleno	protein_coding	protein_coding	OTTHUMT00000367483.1	NM_005410	
FCHO2	115548	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	72383545	72383545	+	Missense_Mutation	SNP	A	A	G			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr5:72383545A>G	ENST00000430046.2	+	25	2491	c.2375A>G	c.(2374-2376)tAt>tGt	p.Y792C	FCHO2_ENST00000341845.6_Missense_Mutation_p.Y792C|FCHO2_ENST00000512348.1_Missense_Mutation_p.Y759C	NM_001146032.1|NM_138782.2	NP_001139504.1|NP_620137.2	Q0JRZ9	FCHO2_HUMAN	FCH domain only 2	792	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.|Mediates interaction with DAB2, EPS15, EPS15R and ITSN1.				clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)|membrane invagination (GO:0010324)|protein localization to plasma membrane (GO:0072659)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|prostate(1)	17		Lung NSC(167;0.0465)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;4.6e-53)		GGCACTGGCTATAGGCTTTCC	0.398																																					p.Y792C		.											.	FCHO2-23	0			c.A2375G						.						128.0	126.0	127.0					5																	72383545		1836	4085	5921	SO:0001583	missense	115548	exon25			CTGGCTATAGGCT	AL831971	CCDS47230.1, CCDS54868.1	5q13.2	2005-08-15			ENSG00000157107	ENSG00000157107			25180	protein-coding gene	gene with protein product		613438				15254787	Standard	NM_138782		Approved		uc003kcl.3	Q0JRZ9	OTTHUMG00000162413	ENST00000430046.2:c.2375A>G	5.37:g.72383545A>G	ENSP00000393776:p.Tyr792Cys	Somatic	213	0		WXS	Illumina HiSeq	Phase_I	229	61	NM_138782	0	0	3	6	3	A8K6W7|B2RNQ9|B4DHK0|E9PG79|Q0JTJ3|Q96CF5	Missense_Mutation	SNP	ENST00000430046.2	37	CCDS47230.1	.	.	.	.	.	.	.	.	.	.	A	15.49	2.849389	0.51270	.	.	ENSG00000157107	ENST00000430046;ENST00000341845;ENST00000512348	T;T;T	0.54675	0.56;0.56;0.56	4.77	4.77	0.60923	Muniscin C-terminal mu homology domain (1);	0.000000	0.85682	D	0.000000	T	0.75591	0.3870	M	0.87682	2.9	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.81024	-0.1120	10	0.87932	D	0	-11.6205	14.7503	0.69519	1.0:0.0:0.0:0.0	.	759;792	E9PG79;Q0JRZ9	.;FCHO2_HUMAN	C	792;792;759	ENSP00000393776:Y792C;ENSP00000344034:Y792C;ENSP00000427296:Y759C	ENSP00000344034:Y792C	Y	+	2	0	FCHO2	72419301	1.000000	0.71417	0.960000	0.40013	0.262000	0.26303	8.705000	0.91357	2.124000	0.65301	0.528000	0.53228	TAT	.		0.398	FCHO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000368795.3	XM_291142	
VCAN	1462	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	82785943	82785943	+	Missense_Mutation	SNP	A	A	T			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr5:82785943A>T	ENST00000265077.3	+	3	662	c.97A>T	c.(97-99)Agg>Tgg	p.R33W	VCAN_ENST00000512590.2_De_novo_Start_InFrame|VCAN_ENST00000343200.5_Missense_Mutation_p.R33W|VCAN_ENST00000342785.4_Missense_Mutation_p.R33W|VCAN_ENST00000502527.2_Missense_Mutation_p.R33W|VCAN_ENST00000513984.1_Missense_Mutation_p.R33W	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	33	Ig-like V-type.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	CCCACCGGTGAGGGGCTCCCT	0.403																																					p.R33W		.											.	VCAN-238	0			c.A97T						.						51.0	51.0	51.0					5																	82785943		2202	4293	6495	SO:0001583	missense	1462	exon3			CCGGTGAGGGGCT	X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.97A>T	5.37:g.82785943A>T	ENSP00000265077:p.Arg33Trp	Somatic	102	0		WXS	Illumina HiSeq	Phase_I	115	32	NM_004385	0	0	8	10	2	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	ENST00000265077.3	37	CCDS4060.1	.	.	.	.	.	.	.	.	.	.	A	14.90	2.672502	0.47781	.	.	ENSG00000038427	ENST00000265077;ENST00000343200;ENST00000342785;ENST00000513960;ENST00000513984;ENST00000502527	T;T;T;T;T;T	0.66995	-0.24;-0.24;-0.24;-0.24;-0.24;-0.24	5.99	2.17	0.27698	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	0.395914	0.24213	N	0.040512	T	0.72220	0.3433	L	0.50333	1.59	0.21064	N	0.999792	P;P;D;D;D	0.63880	0.804;0.857;0.986;0.993;0.965	P;P;P;D;P	0.66602	0.87;0.641;0.702;0.945;0.838	T	0.62613	-0.6817	10	0.72032	D	0.01	.	8.4359	0.32786	0.6885:0.2476:0.0639:0.0	.	33;33;33;33;33	P13611-3;P13611-4;P13611-2;P13611;Q86W61	.;.;.;CSPG2_HUMAN;.	W	33	ENSP00000265077:R33W;ENSP00000340062:R33W;ENSP00000342768:R33W;ENSP00000426251:R33W;ENSP00000426715:R33W;ENSP00000421362:R33W	ENSP00000265077:R33W	R	+	1	2	VCAN	82821699	0.054000	0.20591	0.027000	0.17364	0.046000	0.14306	1.559000	0.36320	0.134000	0.18681	-0.316000	0.08728	AGG	.		0.403	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
VARS2	57176	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	30888201	30888201	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr6:30888201T>C	ENST00000321897.5	+	13	2017	c.1385T>C	c.(1384-1386)cTg>cCg	p.L462P	VARS2_ENST00000541562.1_Missense_Mutation_p.L492P|VARS2_ENST00000542001.1_Missense_Mutation_p.L322P|VARS2_ENST00000416670.2_Missense_Mutation_p.L462P|VARS2_ENST00000476162.1_3'UTR			Q5ST30	SYVM_HUMAN	valyl-tRNA synthetase 2, mitochondrial	462					gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|valyl-tRNA aminoacylation (GO:0006438)	mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|valine-tRNA ligase activity (GO:0004832)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(15)|ovary(3)|prostate(3)|skin(4)|urinary_tract(1)	46						CCCATGGTACTGCCCATCTGC	0.527																																					p.L492P		.											.	VARS2-26	0			c.T1475C						.						41.0	43.0	42.0					6																	30888201		2203	4300	6503	SO:0001583	missense	57176	exon14			TGGTACTGCCCAT	AB067472	CCDS34387.1, CCDS54980.1	6p21.33	2012-10-26	2012-10-26	2007-02-23	ENSG00000137411	ENSG00000137411	6.1.1.9	"""Aminoacyl tRNA synthetases / Class I"""	21642	protein-coding gene	gene with protein product	"""valine tRNA ligase 2, mitochondrial"""	612802	"""valyl-tRNA synthetase 2-like"", ""valyl-tRNA synthetase like"", ""valyl-tRNA synthetase 2, mitochondrial (putative)"""	VARS2L, VARSL		1898367, 11572484, 18400783	Standard	NM_001167734		Approved	DKFZP434L1435, KIAA1885, G7a	uc011dmz.2	Q5ST30	OTTHUMG00000031263	ENST00000321897.5:c.1385T>C	6.37:g.30888201T>C	ENSP00000316092:p.Leu462Pro	Somatic	48	0		WXS	Illumina HiSeq	Phase_I	61	19	NM_001167734	0	0	0	0	0	A2ABL7|B4DET4|B4E3P5|F5GXJ0|F5H323|Q2M2A0|Q59FI1|Q5SQ96|Q5SS98|Q6DKJ5|Q6ZV24|Q96GN2|Q96H77|Q96Q02|Q9H6R2|Q9UFH7	Missense_Mutation	SNP	ENST00000321897.5	37	CCDS34387.1	.	.	.	.	.	.	.	.	.	.	T	19.18	3.777854	0.70107	.	.	ENSG00000137411	ENST00000321897;ENST00000416670;ENST00000542001;ENST00000541562	T;T;T;T	0.37752	1.18;1.18;1.18;1.18	4.26	4.26	0.50523	Valyl/Leucyl/Isoleucyl-tRNA synthetase, class Ia, editing domain (1);Aminoacyl-tRNA synthetase, class Ia (1);	0.000000	0.64402	D	0.000002	T	0.56077	0.1961	M	0.88450	2.955	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.996	T	0.65923	-0.6050	10	0.87932	D	0	-11.1733	11.6463	0.51263	0.0:0.0:0.0:1.0	.	460;492;462	B7ZL25;F5GXJ0;Q5ST30	.;.;SYVM_HUMAN	P	462;462;322;492	ENSP00000316092:L462P;ENSP00000394802:L462P;ENSP00000438200:L322P;ENSP00000441000:L492P	ENSP00000316092:L462P	L	+	2	0	VARS2	30996180	1.000000	0.71417	0.999000	0.59377	0.982000	0.71751	7.008000	0.76341	1.708000	0.51301	0.374000	0.22700	CTG	.		0.527	VARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076566.2	NM_020442	
ZNF76	7629	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	35260658	35260658	+	Splice_Site	SNP	C	C	T			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr6:35260658C>T	ENST00000373953.3	+	11	1432	c.1166C>T	c.(1165-1167)gCc>gTc	p.A389V	ZNF76_ENST00000339411.5_Splice_Site_p.A389V|ZNF76_ENST00000440666.2_Splice_Site_p.A363V	NM_003427.3	NP_003418.2	P36508	ZNF76_HUMAN	zinc finger protein 76	389					regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)	16						CCTCTCCCAGCCGCCTCTGCA	0.622																																					p.A389V	Esophageal Squamous(52;92 1039 20612 23956 34676)	.											.	ZNF76-90	0			c.C1166T						.						54.0	58.0	57.0					6																	35260658		2203	4300	6503	SO:0001630	splice_region_variant	7629	exon11			TCCCAGCCGCCTC	M91592	CCDS4801.1, CCDS75435.1	6p21.31	2013-01-08	2011-02-25		ENSG00000065029	ENSG00000065029		"""Zinc fingers, C2H2-type"""	13149	protein-coding gene	gene with protein product		194549	"""zinc finger protein 76 (expressed in testis)"""	D6S229E		1427894	Standard	XM_005249364		Approved	Zfp523, ZNF523	uc003oki.1	P36508	OTTHUMG00000014564	ENST00000373953.3:c.1166-1C>T	6.37:g.35260658C>T		Somatic	129	0		WXS	Illumina HiSeq	Phase_I	148	45	NM_003427	0	0	0	0	0	Q9BQB2	Missense_Mutation	SNP	ENST00000373953.3	37	CCDS4801.1	.	.	.	.	.	.	.	.	.	.	C	14.71	2.615788	0.46631	.	.	ENSG00000065029	ENST00000373953;ENST00000440666;ENST00000339411	T;T;T	0.10668	2.88;2.88;2.85	4.83	4.83	0.62350	.	0.000000	0.36740	N	0.002424	T	0.01835	0.0058	N	0.08118	0	0.26011	N	0.981989	B;B	0.33135	0.392;0.399	B;B	0.34452	0.115;0.183	T	0.43196	-0.9406	9	.	.	.	.	8.2836	0.31915	0.176:0.6542:0.1698:0.0	.	389;389	P36508-2;P36508	.;ZNF76_HUMAN	V	389;363;389	ENSP00000363064:A389V;ENSP00000392243:A363V;ENSP00000344097:A389V	.	A	+	2	0	ZNF76	35368636	0.001000	0.12720	1.000000	0.80357	0.876000	0.50452	1.026000	0.30103	2.487000	0.83934	0.491000	0.48974	GCC	.		0.622	ZNF76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040279.2	NM_003427	Missense_Mutation
DNAH8	1769	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	38709565	38709565	+	Missense_Mutation	SNP	A	A	G			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr6:38709565A>G	ENST00000359357.3	+	6	798	c.544A>G	c.(544-546)Atg>Gtg	p.M182V	RN7SL465P_ENST00000468411.2_RNA|DNAH8_ENST00000441566.1_Missense_Mutation_p.M182V|DNAH8_ENST00000449981.2_Missense_Mutation_p.M399V			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	182					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						CTGGAAACGCATGTCAGCCAA	0.398																																					p.M399V		.											.	DNAH8-615	0			c.A1195G						.						121.0	105.0	110.0					6																	38709565		2203	4300	6503	SO:0001583	missense	1769	exon8			AAACGCATGTCAG	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.544A>G	6.37:g.38709565A>G	ENSP00000352312:p.Met182Val	Somatic	83	0		WXS	Illumina HiSeq	Phase_I	77	27	NM_001206927	0	0	0	0	0	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	37		.	.	.	.	.	.	.	.	.	.	A	16.47	3.131132	0.56828	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.56611	0.45;0.45;0.45	5.91	5.91	0.95273	Dynein heavy chain, domain-1 (1);	0.047100	0.85682	D	0.000000	T	0.36276	0.0961	L	0.29908	0.895	0.40827	D	0.983553	B	0.27765	0.188	B	0.36608	0.229	T	0.42965	-0.9420	10	0.66056	D	0.02	.	16.3429	0.83101	1.0:0.0:0.0:0.0	.	182	Q96JB1	DYH8_HUMAN	V	387;387;182;182	ENSP00000333363:M387V;ENSP00000352312:M182V;ENSP00000402294:M182V	ENSP00000333363:M387V	M	+	1	0	DNAH8	38817543	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.248000	0.72418	2.256000	0.74724	0.523000	0.50628	ATG	.		0.398	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
RUNX2	860	hgsc.bcm.edu;broad.mit.edu	37	6	45390466	45390466	+	Silent	SNP	A	A	G	rs575896136	byFrequency	TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr6:45390466A>G	ENST00000371438.1	+	2	553	c.195A>G	c.(193-195)caA>caG	p.Q65Q	RUNX2_ENST00000359524.5_Silent_p.Q51Q|RUNX2_ENST00000465038.2_Silent_p.Q65Q|RUNX2_ENST00000576263.1_Silent_p.Q65Q|RUNX2_ENST00000352853.5_Silent_p.Q133Q|RP1-244F24.1_ENST00000606796.1_RNA|RUNX2_ENST00000371436.6_Silent_p.Q65Q|RUNX2_ENST00000541979.1_Silent_p.Q133Q|RUNX2_ENST00000371432.3_Silent_p.Q51Q	NM_001024630.3	NP_001019801.3	Q13950	RUNX2_HUMAN	runt-related transcription factor 2	65	Poly-Gln.				BMP signaling pathway (GO:0030509)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|chondrocyte development (GO:0002063)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|endochondral ossification (GO:0001958)|gene expression (GO:0010467)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|osteoblast fate commitment (GO:0002051)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|stem cell differentiation (GO:0048863)|T cell differentiation (GO:0030217)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(18)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						agcagcagcaacagcagcagc	0.731													A|||	8	0.00159744	0.0023	0.0	5008	,	,		7675	0.002		0.0	False		,,,				2504	0.0031				p.Q65Q		.											.	RUNX2-417	0			c.A195G						.						10.0	15.0	14.0					6																	45390466		1452	3071	4523	SO:0001819	synonymous_variant	860	exon3			GCAGCAACAGCAG	AF001450	CCDS43467.1, CCDS43468.1, CCDS43467.2, CCDS43468.2	6p21	2010-08-20			ENSG00000124813	ENSG00000124813			10472	protein-coding gene	gene with protein product		600211		CCD, CBFA1, CCD1		7835892	Standard	NM_001024630		Approved	AML3, PEBP2A1, PEBP2aA1	uc011dvx.2	Q13950	OTTHUMG00000014774	ENST00000371438.1:c.195A>G	6.37:g.45390466A>G		Somatic	40	0		WXS	Illumina HiSeq	Phase_I	32	3	NM_001024630	6	1	73	8081	8001	O14614|O14615|O95181	Silent	SNP	ENST00000371438.1	37	CCDS43467.2																																																																																			.		0.731	RUNX2-003	KNOWN	not_organism_supported|upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040755.2	NM_004348	
BAI3	577	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	69943243	69943243	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr6:69943243C>T	ENST00000370598.1	+	18	3363	c.2542C>T	c.(2542-2544)Cat>Tat	p.H848Y	BAI3_ENST00000238918.8_Missense_Mutation_p.H54Y	NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	848	GPS. {ECO:0000255|PROSITE- ProRule:PRU00098}.				G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				CGATGCATCCCATACGAAATG	0.473																																					p.H848Y		.											.	BAI3-1148	0			c.C2542T						.						203.0	180.0	188.0					6																	69943243		2203	4300	6503	SO:0001583	missense	577	exon18			GCATCCCATACGA	AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.2542C>T	6.37:g.69943243C>T	ENSP00000359630:p.His848Tyr	Somatic	266	0		WXS	Illumina HiSeq	Phase_I	215	68	NM_001704	0	0	0	0	0	B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	ENST00000370598.1	37	CCDS4968.1	.	.	.	.	.	.	.	.	.	.	C	15.82	2.946496	0.53186	.	.	ENSG00000135298	ENST00000370598;ENST00000238918	T;T	0.69175	-0.38;-0.38	5.37	5.37	0.77165	GPS domain (3);	0.000000	0.85682	D	0.000000	T	0.75953	0.3920	L	0.54863	1.705	0.80722	D	1	D;D	0.89917	0.982;1.0	P;D	0.87578	0.824;0.998	T	0.77230	-0.2664	10	0.62326	D	0.03	.	19.1872	0.93648	0.0:1.0:0.0:0.0	.	54;848	B7Z356;O60242	.;BAI3_HUMAN	Y	848;54	ENSP00000359630:H848Y;ENSP00000238918:H54Y	ENSP00000238918:H54Y	H	+	1	0	BAI3	69999964	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.889000	0.69766	2.539000	0.85634	0.454000	0.30748	CAT	.		0.473	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041120.1		
RFX6	222546	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	117245902	117245902	+	Missense_Mutation	SNP	T	T	A			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr6:117245902T>A	ENST00000332958.2	+	15	1642	c.1626T>A	c.(1624-1626)aaT>aaA	p.N542K		NM_173560.3	NP_775831.2	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	542					endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|pancreatic A cell differentiation (GO:0003310)|pancreatic D cell differentiation (GO:0003311)|pancreatic epsilon cell differentiation (GO:0090104)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of insulin secretion (GO:0050796)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell differentiation (GO:0003309)	nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(29)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	59						AGTTTAATAATGACAAAGAGC	0.338																																					p.N542K		.											.	RFX6-93	0			c.T1626A						.						100.0	99.0	99.0					6																	117245902		2203	4300	6503	SO:0001583	missense	222546	exon15			TAATAATGACAAA	BC039248	CCDS5113.1	6q22.31	2008-08-04	2008-08-04	2008-08-04	ENSG00000185002	ENSG00000185002			21478	protein-coding gene	gene with protein product		612659	"""regulatory factor X domain containing 1"""	RFXDC1			Standard	NM_173560		Approved	MGC33442, dJ955L16.1	uc003pxm.3	Q8HWS3	OTTHUMG00000015449	ENST00000332958.2:c.1626T>A	6.37:g.117245902T>A	ENSP00000332208:p.Asn542Lys	Somatic	97	0		WXS	Illumina HiSeq	Phase_I	92	20	NM_173560	0	0	0	0	0	Q5T6B3	Missense_Mutation	SNP	ENST00000332958.2	37	CCDS5113.1	.	.	.	.	.	.	.	.	.	.	T	17.98	3.521372	0.64747	.	.	ENSG00000185002	ENST00000332958	T	0.57107	0.42	5.32	4.15	0.48705	.	0.000000	0.85682	D	0.000000	T	0.46229	0.1382	L	0.49640	1.575	0.53688	D	0.999972	D	0.59357	0.985	P	0.53360	0.724	T	0.50508	-0.8820	10	0.56958	D	0.05	-21.9444	10.8185	0.46591	0.0:0.0743:0.0:0.9257	.	542	Q8HWS3	RFX6_HUMAN	K	542	ENSP00000332208:N542K	ENSP00000332208:N542K	N	+	3	2	RFX6	117352595	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.890000	0.39728	2.138000	0.66242	0.533000	0.62120	AAT	.		0.338	RFX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041970.2	NM_173560	
AEBP1	165	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	44152208	44152208	+	Missense_Mutation	SNP	G	G	C			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr7:44152208G>C	ENST00000223357.3	+	18	2574	c.2269G>C	c.(2269-2271)Gtg>Ctg	p.V757L	AEBP1_ENST00000450684.2_Missense_Mutation_p.V332L|MIR4649_ENST00000582839.1_RNA	NM_001129.3	NP_001120.3	Q8IUX7	AEBP1_HUMAN	AE binding protein 1	757	Interaction with PTEN. {ECO:0000250}.				cell adhesion (GO:0007155)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(13)|upper_aerodigestive_tract(2)	33						GAACCCCTTCGTGCTGGGAGC	0.642																																					p.V757L		.											.	AEBP1-90	0			c.G2269C						.						48.0	52.0	51.0					7																	44152208		2203	4299	6502	SO:0001583	missense	165	exon18			CCCTTCGTGCTGG	D86479	CCDS5476.1	7p	2008-07-18	2001-11-28		ENSG00000106624	ENSG00000106624			303	protein-coding gene	gene with protein product	"""aortic carboxypeptidase-like protein"", ""adipocyte enhancer binding protein 1"""	602981	"""AE-binding protein 1"""			8920928	Standard	NM_001129		Approved	ACLP	uc003tkb.4	Q8IUX7	OTTHUMG00000023362	ENST00000223357.3:c.2269G>C	7.37:g.44152208G>C	ENSP00000223357:p.Val757Leu	Somatic	117	0		WXS	Illumina HiSeq	Phase_I	151	40	NM_001129	0	0	101	145	44	Q14113|Q59ER7|Q6ZSC7|Q7KZ79	Missense_Mutation	SNP	ENST00000223357.3	37	CCDS5476.1	.	.	.	.	.	.	.	.	.	.	G	32	5.147205	0.94603	.	.	ENSG00000106624	ENST00000223357;ENST00000450684	T;T	0.03524	3.9;3.9	5.08	5.08	0.68730	Peptidase M14, carboxypeptidase A (2);	0.000000	0.85682	D	0.000000	T	0.20981	0.0505	M	0.83953	2.67	0.80722	D	1	D;P	0.76494	0.999;0.887	D;P	0.81914	0.995;0.796	T	0.00473	-1.1718	10	0.62326	D	0.03	-39.5208	17.5863	0.87982	0.0:0.0:1.0:0.0	.	332;757	Q8IUX7-2;Q8IUX7	.;AEBP1_HUMAN	L	757;332	ENSP00000223357:V757L;ENSP00000398878:V332L	ENSP00000223357:V757L	V	+	1	0	AEBP1	44118733	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	6.597000	0.74118	2.533000	0.85409	0.491000	0.48974	GTG	.		0.642	AEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250993.2	NM_001129	
OGDH	4967	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	44714122	44714122	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr7:44714122G>A	ENST00000222673.5	+	7	943	c.901G>A	c.(901-903)Ggc>Agc	p.G301S	OGDH_ENST00000459672.1_3'UTR|OGDH_ENST00000444676.1_Missense_Mutation_p.G316S|OGDH_ENST00000443864.2_Missense_Mutation_p.G301S|OGDH_ENST00000449767.1_Missense_Mutation_p.G297S|OGDH_ENST00000439616.2_Missense_Mutation_p.G151S|OGDH_ENST00000447398.1_Missense_Mutation_p.G312S|OGDH_ENST00000543843.1_Missense_Mutation_p.G252S	NM_002541.3	NP_002532.2	Q02218	ODO1_HUMAN	oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)	301					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|cerebellar cortex development (GO:0021695)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hippocampus development (GO:0021766)|lysine catabolic process (GO:0006554)|NADH metabolic process (GO:0006734)|olfactory bulb mitral cell layer development (GO:0061034)|pyramidal neuron development (GO:0021860)|small molecule metabolic process (GO:0044281)|striatum development (GO:0021756)|succinyl-CoA metabolic process (GO:0006104)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)|thalamus development (GO:0021794)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)|oxoglutarate dehydrogenase complex (GO:0045252)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (NAD+) activity (GO:0034602)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			breast(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	36					Valproic Acid(DB00313)	TAGTGAGAATGGCGTGGACTA	0.572																																					p.G301S		.											.	OGDH-228	0			c.G901A						.						136.0	110.0	119.0					7																	44714122		2203	4300	6503	SO:0001583	missense	4967	exon7			GAGAATGGCGTGG	D10523	CCDS34627.1, CCDS47580.1, CCDS55107.1	7p13-p11.2	2010-11-23			ENSG00000105953	ENSG00000105953	1.2.4.2		8124	protein-coding gene	gene with protein product		613022				8020988, 1542694	Standard	NM_002541		Approved	E1k	uc003tln.3	Q02218	OTTHUMG00000155304	ENST00000222673.5:c.901G>A	7.37:g.44714122G>A	ENSP00000222673:p.Gly301Ser	Somatic	104	0		WXS	Illumina HiSeq	Phase_I	126	55	NM_002541	0	0	21	29	8	B4E2U9|D3DVL0|E9PBM1|Q96DD3|Q9UDX0	Missense_Mutation	SNP	ENST00000222673.5	37	CCDS34627.1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.996894	0.93167	.	.	ENSG00000105953	ENST00000439616;ENST00000443864;ENST00000449767;ENST00000447398;ENST00000444676;ENST00000222673;ENST00000543843	D;T;D;D;D;D;D	0.95788	-3.81;2.48;-3.81;-3.81;-3.81;-3.81;-3.81	4.97	4.97	0.65823	Dehydrogenase, E1 component (1);	0.000000	0.85682	D	0.000000	D	0.98061	0.9361	M	0.88570	2.965	0.80722	D	1	D;D;D;D;D;D;D	0.76494	0.999;0.999;0.998;0.998;0.998;0.998;0.999	D;D;D;D;D;D;D	0.87578	0.995;0.996;0.995;0.996;0.992;0.995;0.998	D	0.99091	1.0840	10	0.87932	D	0	-17.2819	18.1993	0.89833	0.0:0.0:1.0:0.0	.	96;151;297;312;203;301;301	B4E3E9;E9PFG7;E9PBM1;E9PDF2;A2VCT2;Q02218;Q96DD3	.;.;.;.;.;ODO1_HUMAN;.	S	151;301;297;312;316;301;252	ENSP00000398576:G151S;ENSP00000388084:G301S;ENSP00000392878:G297S;ENSP00000388183:G312S;ENSP00000414662:G316S;ENSP00000222673:G301S;ENSP00000443821:G252S	ENSP00000222673:G301S	G	+	1	0	OGDH	44680647	1.000000	0.71417	0.169000	0.22859	0.771000	0.43674	9.609000	0.98334	2.462000	0.83206	0.561000	0.74099	GGC	.		0.572	OGDH-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000339391.1		
VSTM2A	222008	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	54617692	54617692	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr7:54617692C>T	ENST00000407838.3	+	4	869	c.463C>T	c.(463-465)Cgc>Tgc	p.R155C	VSTM2A_ENST00000302287.3_Missense_Mutation_p.R155C|VSTM2A_ENST00000402026.2_Missense_Mutation_p.R154C|VSTM2A_ENST00000404951.1_Missense_Mutation_p.R155C|VSTM2A_ENST00000498834.1_3'UTR|VSTM2A_ENST00000402613.3_Missense_Mutation_p.R155C	NM_182546.2	NP_872352.2	Q8TAG5	VTM2A_HUMAN	V-set and transmembrane domain containing 2A	155						extracellular region (GO:0005576)		p.R155C(1)|p.R154C(1)		endometrium(1)|large_intestine(2)|lung(12)|prostate(1)	16			STAD - Stomach adenocarcinoma(5;0.0525)			CAGCCATGCCCGCAGAATGCA	0.577																																					p.R155C		.											.	.	2	Substitution - Missense(2)	endometrium(2)	c.C463T						.						57.0	54.0	55.0					7																	54617692		2203	4299	6502	SO:0001583	missense	222008	exon4			CATGCCCGCAGAA	BC028404	CCDS5512.2, CCDS75604.1	7p11.2	2013-01-11	2007-08-10	2007-08-10	ENSG00000170419	ENSG00000170419		"""Immunoglobulin superfamily / V-set domain containing"""	28499	protein-coding gene	gene with protein product			"""V-set and transmembrane domain containing 2"""	VSTM2		12477932	Standard	XM_006715663		Approved	MGC33530	uc010kzf.3	Q8TAG5	OTTHUMG00000129271	ENST00000407838.3:c.463C>T	7.37:g.54617692C>T	ENSP00000384967:p.Arg155Cys	Somatic	30	0		WXS	Illumina HiSeq	Phase_I	32	13	NM_182546	0	0	2	11	9	A4D2E9|B5MC94	Missense_Mutation	SNP	ENST00000407838.3	37	CCDS5512.2	.	.	.	.	.	.	.	.	.	.	C	20.2	3.950503	0.73787	.	.	ENSG00000170419	ENST00000302287;ENST00000407838;ENST00000404951;ENST00000402026;ENST00000402613	T;T;T;T;T	0.50277	0.75;0.78;0.75;0.75;0.78	5.06	3.17	0.36434	.	0.000000	0.85682	D	0.000000	T	0.64080	0.2566	M	0.68952	2.095	0.52501	D	0.999954	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.996;0.998;0.993	T	0.63440	-0.6637	10	0.51188	T	0.08	-25.8697	11.9552	0.52976	0.334:0.666:0.0:0.0	.	155;155;155	Q8TAG5;Q8TAG5-2;B5MCX6	VTM2A_HUMAN;.;.	C	155;155;155;154;155	ENSP00000303108:R155C;ENSP00000384967:R155C;ENSP00000384701:R155C;ENSP00000385933:R154C;ENSP00000384103:R155C	ENSP00000303108:R155C	R	+	1	0	VSTM2A	54585186	0.357000	0.24938	0.524000	0.27887	0.981000	0.71138	0.571000	0.23669	0.566000	0.29273	0.655000	0.94253	CGC	.		0.577	VSTM2A-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318694.1	NM_182546	
FEZF1	389549	broad.mit.edu	37	7	121944146	121944146	+	Missense_Mutation	SNP	T	T	G			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr7:121944146T>G	ENST00000442488.2	-	1	413	c.346A>C	c.(346-348)Agc>Cgc	p.S116R	FEZF1-AS1_ENST00000428449.1_RNA|FEZF1_ENST00000427185.2_Missense_Mutation_p.S116R|FEZF1_ENST00000331178.4_Missense_Mutation_p.S116R|FEZF1-AS1_ENST00000424404.1_RNA|FEZF1-AS1_ENST00000437317.1_RNA	NM_001024613.2|NM_001160264.1	NP_001019784.2|NP_001153736.1	A0PJY2	FEZF1_HUMAN	FEZ family zinc finger 1	116					axon guidance (GO:0007411)|forebrain anterior/posterior pattern specification (GO:0021797)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)			breast(1)|large_intestine(3)|lung(18)|ovary(2)|prostate(1)	25						TCGCTGCAGCTGAATGCGGGA	0.716																																					p.S116R													.	FEZF1-91	0			c.A346C						.						8.0	9.0	8.0					7																	121944146		2170	4215	6385	SO:0001583	missense	389549	exon1			TGCAGCTGAATGC	AY726588	CCDS34741.1, CCDS34741.2, CCDS55157.1	7q31.32	2013-01-08	2006-08-15	2006-08-15	ENSG00000128610	ENSG00000128610		"""Zinc fingers, C2H2-type"""	22788	protein-coding gene	gene with protein product		613301	"""zinc finger protein 312B"""	ZNF312B			Standard	NM_001024613		Approved		uc003vkd.3	A0PJY2	OTTHUMG00000157091	ENST00000442488.2:c.346A>C	7.37:g.121944146T>G	ENSP00000411145:p.Ser116Arg	Somatic	9	0		WXS	Illumina HiSeq	Phase_I	13	3	NM_001160264	0	0	0	0	0	A0PJY3|A4D0W3|B4DUP9|B7ZM98	Missense_Mutation	SNP	ENST00000442488.2	37	CCDS34741.2	.	.	.	.	.	.	.	.	.	.	T	12.47	1.946839	0.34377	.	.	ENSG00000128610	ENST00000442488;ENST00000331178;ENST00000427185	T;T;T	0.07567	3.25;3.39;3.18	4.65	4.65	0.58169	.	0.048448	0.85682	D	0.000000	T	0.15478	0.0373	L	0.43152	1.355	0.35688	D	0.814606	D;D	0.64830	0.989;0.994	P;P	0.53912	0.55;0.737	T	0.09818	-1.0657	10	0.49607	T	0.09	-24.3744	14.5205	0.67847	0.0:0.0:0.0:1.0	.	116;116	A0PJY2;A0PJY2-2	FEZF1_HUMAN;.	R	116	ENSP00000411145:S116R;ENSP00000332777:S116R;ENSP00000392727:S116R	ENSP00000332777:S116R	S	-	1	0	FEZF1	121731382	1.000000	0.71417	1.000000	0.80357	0.468000	0.32798	3.295000	0.51794	2.069000	0.61940	0.454000	0.30748	AGC	.		0.716	FEZF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347410.1	NM_001024613	
C7orf55-LUC7L2	100996928	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	139107032	139107032	+	Missense_Mutation	SNP	T	T	A			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr7:139107032T>A	ENST00000354926.4	+	10	1479	c.1125T>A	c.(1123-1125)aaT>aaA	p.N375K	C7orf55-LUC7L2_ENST00000541170.3_Missense_Mutation_p.N372K|C7orf55-LUC7L2_ENST00000482860.1_3'UTR|LUC7L2_ENST00000541515.3_Missense_Mutation_p.N441K|C7orf55-LUC7L2_ENST00000263545.6_Missense_Mutation_p.N374K	NM_001270643.1|NM_016019.4	NP_001257572.1|NP_057103.2			C7orf55-LUC7L2 readthrough																		AGAGTGCTAATGGCAGATCAG	0.478																																					p.N441K		.											.	.	0			c.T1323A						.						133.0	136.0	135.0					7																	139107032		1945	4137	6082	SO:0001583	missense	100996928	exon11			TGCTAATGGCAGA		CCDS59084.1	7q34	2013-02-14			ENSG00000146963	ENSG00000146963			44671	other	readthrough							Standard	NM_001244584		Approved		uc011kqt.3		OTTHUMG00000151717	ENST00000354926.4:c.1125T>A	7.37:g.139107032T>A	ENSP00000347005:p.Asn375Lys	Somatic	170	0		WXS	Illumina HiSeq	Phase_I	200	102	NM_001244584	0	0	30	65	35		Missense_Mutation	SNP	ENST00000354926.4	37	CCDS43656.1	.	.	.	.	.	.	.	.	.	.	T	15.60	2.880250	0.51801	.	.	ENSG00000146963	ENST00000541170;ENST00000541515;ENST00000545899;ENST00000354926;ENST00000263545	T;T;T;T	0.41400	1.59;1.59;1.59;1.0	6.03	3.72	0.42706	.	0.255682	0.45126	D	0.000400	T	0.33702	0.0872	L	0.58810	1.83	0.42902	D	0.994235	P;P;P;P	0.40731	0.608;0.608;0.728;0.608	B;B;B;B	0.36186	0.109;0.109;0.219;0.109	T	0.46898	-0.9158	9	0.23891	T	0.37	-21.4412	8.941	0.35729	0.0:0.2436:0.0:0.7564	.	441;372;374;375	B7Z4Q3;B7Z500;Q9Y383-2;Q9Y383	.;.;.;LC7L2_HUMAN	K	372;441;375;375;374	ENSP00000441604:N372K;ENSP00000440222:N441K;ENSP00000347005:N375K;ENSP00000263545:N374K	ENSP00000263545:N374K	N	+	3	2	LUC7L2	138757572	0.999000	0.42202	1.000000	0.80357	0.997000	0.91878	0.312000	0.19397	1.117000	0.41842	0.455000	0.32223	AAT	.		0.478	C7orf55-LUC7L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323618.2		
PRSS55	203074	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	10390473	10390473	+	Nonsense_Mutation	SNP	G	G	A	rs150767306		TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr8:10390473G>A	ENST00000328655.3	+	4	696	c.656G>A	c.(655-657)tGg>tAg	p.W219*	PRSS55_ENST00000522210.1_Nonsense_Mutation_p.W219*|PRSS51_ENST00000523024.1_RNA	NM_198464.3	NP_940866.2	Q6UWB4	PRS55_HUMAN	protease, serine, 55	219	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|skin(1)	31						ATCATGGACTGGGAGGAGTGT	0.473																																					p.W219X		.											.	PRSS55-91	0			c.G656A						.						124.0	112.0	116.0					8																	10390473		2203	4300	6503	SO:0001587	stop_gained	203074	exon4			TGGACTGGGAGGA	AY358867	CCDS5976.1, CCDS56523.1	8p23.1	2014-01-21			ENSG00000184647	ENSG00000184647		"""Serine peptidases / Serine peptidases"""	30824	protein-coding gene	gene with protein product		615144				12975309, 18844450	Standard	NM_198464		Approved	T-SP1, UNQ9391, CT153	uc003wta.3	Q6UWB4	OTTHUMG00000129345	ENST00000328655.3:c.656G>A	8.37:g.10390473G>A	ENSP00000333003:p.Trp219*	Somatic	109	0		WXS	Illumina HiSeq	Phase_I	95	34	NM_001197020	0	0	0	0	0	E5RJX5	Nonsense_Mutation	SNP	ENST00000328655.3	37	CCDS5976.1	.	.	.	.	.	.	.	.	.	.	G	19.40	3.820578	0.71028	.	.	ENSG00000184647	ENST00000328655;ENST00000522210	.	.	.	5.27	4.39	0.52855	.	0.259915	0.20629	N	0.088631	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	.	10.0857	0.42417	0.094:0.0:0.906:0.0	.	.	.	.	X	219	.	ENSP00000333003:W219X	W	+	2	0	PRSS55	10427883	0.948000	0.32251	0.056000	0.19401	0.063000	0.16089	1.788000	0.38714	1.344000	0.45657	0.591000	0.81541	TGG	G|1.000;T|0.000		0.473	PRSS55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251493.3	NM_198464	
NUGGC	389643	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	27888815	27888815	+	Missense_Mutation	SNP	C	C	G			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr8:27888815C>G	ENST00000413272.2	-	15	1995	c.1853G>C	c.(1852-1854)gGg>gCg	p.G618A	NUGGC_ENST00000341513.6_Missense_Mutation_p.G618A	NM_001010906.1	NP_001010906.1	Q68CJ6	SLIP_HUMAN	nuclear GTPase, germinal center associated	618					cellular response to DNA damage stimulus (GO:0006974)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)										ACTTCTTATCCCAATTTCTGT	0.468																																					p.G618A		.											.	.	0			c.G1853C						.						139.0	140.0	140.0					8																	27888815		1863	4103	5966	SO:0001583	missense	389643	exon15			CTTATCCCAATTT	AB075870	CCDS47833.1	8p21.1	2012-06-07	2012-06-07	2012-06-07	ENSG00000189233	ENSG00000189233			33550	protein-coding gene	gene with protein product	"""speckled-like pattern in the germinal center"""		"""chromosome 8 open reading frame 80"""	C8orf80		19734146	Standard	NM_001010906		Approved	HMFN0672, SLIP-GC	uc003xgm.4	Q68CJ6	OTTHUMG00000155970	ENST00000413272.2:c.1853G>C	8.37:g.27888815C>G	ENSP00000408697:p.Gly618Ala	Somatic	202	0		WXS	Illumina HiSeq	Phase_I	192	49	NM_001010906	0	0	0	0	0	Q6ZP73	Missense_Mutation	SNP	ENST00000413272.2	37	CCDS47833.1	.	.	.	.	.	.	.	.	.	.	C	10.38	1.333721	0.24167	.	.	ENSG00000189233	ENST00000413272;ENST00000341513	T;T	0.32753	1.44;1.44	5.23	4.26	0.50523	.	0.580298	0.17797	N	0.161690	T	0.18002	0.0432	L	0.27053	0.805	0.09310	N	1	B	0.27229	0.172	B	0.22386	0.039	T	0.14309	-1.0477	10	0.06625	T	0.88	-16.0958	11.7736	0.51972	0.1875:0.8125:0.0:0.0	.	618	Q68CJ6	SLIP_HUMAN	A	618	ENSP00000408697:G618A;ENSP00000345031:G618A	ENSP00000345031:G618A	G	-	2	0	C8orf80	27944734	0.006000	0.16342	0.846000	0.33378	0.810000	0.45777	1.525000	0.35953	2.441000	0.82636	0.655000	0.94253	GGG	.		0.468	NUGGC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000342494.1	NM_001010906	
NR5A1	2516	hgsc.bcm.edu	37	9	127262609	127262609	+	Silent	SNP	C	C	A			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr9:127262609C>A	ENST00000373588.4	-	4	826	c.630G>T	c.(628-630)ccG>ccT	p.P210P		NM_004959.4	NP_004950.2	Q13285	STF1_HUMAN	nuclear receptor subfamily 5, group A, member 1	210					adrenal gland development (GO:0030325)|cell differentiation (GO:0030154)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|hormone metabolic process (GO:0042445)|intracellular receptor signaling pathway (GO:0030522)|luteinization (GO:0001553)|maintenance of protein location in nucleus (GO:0051457)|male gonad development (GO:0008584)|multicellular organismal aging (GO:0010259)|negative regulation of female gonad development (GO:2000195)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|primary sex determination (GO:0007538)|regulation of steroid biosynthetic process (GO:0050810)|tissue development (GO:0009888)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|phospholipid binding (GO:0005543)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			lung(1)|upper_aerodigestive_tract(1)	2						GGTAGCCGTACGGCAGCCCAG	0.667																																					p.P210P		.											.	NR5A1-186	0			c.G630T						.						5.0	6.0	6.0					9																	127262609		2112	4146	6258	SO:0001819	synonymous_variant	2516	exon4			GCCGTACGGCAGC	D88155	CCDS6856.1	9q33	2013-01-16			ENSG00000136931	ENSG00000136931		"""Nuclear hormone receptors"""	7983	protein-coding gene	gene with protein product		184757		FTZF1		7789992	Standard	NM_004959		Approved	FTZ1, SF-1, ELP, AD4BP	uc004boo.1	Q13285	OTTHUMG00000020655	ENST00000373588.4:c.630G>T	9.37:g.127262609C>A		Somatic	6	2		WXS	Illumina HiSeq	Phase_I	9	5	NM_004959	0	0	0	0	0	O15196|Q5T6F5	Silent	SNP	ENST00000373588.4	37	CCDS6856.1																																																																																			.		0.667	NR5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054029.1	NM_004959	
RPS6KA3	6197	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	20194424	20194424	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chrX:20194424C>T	ENST00000379565.3	-	13	1253	c.1046G>A	c.(1045-1047)gGc>gAc	p.G349D	RPS6KA3_ENST00000379548.4_Missense_Mutation_p.G320D|RPS6KA3_ENST00000544447.1_Missense_Mutation_p.G321D|RPS6KA3_ENST00000540702.1_Missense_Mutation_p.G321D	NM_004586.2	NP_004577.1	P51812	KS6A3_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 3	349	AGC-kinase C-terminal.				axon guidance (GO:0007411)|cell cycle (GO:0007049)|central nervous system development (GO:0007417)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(4)|endometrium(3)|kidney(2)|large_intestine(5)|liver(14)|lung(7)|ovary(1)|stomach(1)	41					Acetylsalicylic acid(DB00945)	TTCAGGCCTGCCCGTTGCAGG	0.328																																					p.G349D													.	RPS6KA3-1504	0			c.G1046A						.						80.0	76.0	78.0					X																	20194424		2203	4300	6503	SO:0001583	missense	6197	exon13			GGCCTGCCCGTTG	U08316	CCDS14197.1	Xp22.2-p22.1	2013-06-03	2002-08-29		ENSG00000177189	ENSG00000177189			10432	protein-coding gene	gene with protein product		300075	"""ribosomal protein S6 kinase, 90kD, polypeptide 3"", ""mental retardation, X-linked 19"", ""Coffin-Lowry syndrome"""	MRX19, CLS		8141249, 11896450, 16879200	Standard	XM_005274573		Approved	RSK, RSK2, HU-3	uc004czu.3	P51812	OTTHUMG00000021231	ENST00000379565.3:c.1046G>A	X.37:g.20194424C>T	ENSP00000368884:p.Gly349Asp	Somatic	39	0		WXS	Illumina HiSeq	Phase_I	47	5	NM_004586	0	0	7	7	0	B2R9V4|Q4VAP3|Q59H26|Q5JPK8|Q7Z3Z7	Missense_Mutation	SNP	ENST00000379565.3	37	CCDS14197.1	.	.	.	.	.	.	.	.	.	.	C	14.47	2.545172	0.45280	.	.	ENSG00000177189	ENST00000379565;ENST00000544447;ENST00000379548;ENST00000540702	T;T;T;T	0.52057	0.68;0.68;0.68;0.68	5.4	4.53	0.55603	AGC-kinase, C-terminal (2);Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.46619	0.1402	L	0.35414	1.06	0.80722	D	1	B;B;P;B	0.45715	0.282;0.254;0.865;0.103	B;B;P;B	0.48524	0.066;0.091;0.58;0.067	T	0.35325	-0.9793	10	0.37606	T	0.19	.	15.3574	0.74437	0.0:0.8638:0.1362:0.0	.	321;320;321;349	B4DG22;F5GYC4;B7ZB17;P51812	.;.;.;KS6A3_HUMAN	D	349;321;320;321	ENSP00000368884:G349D;ENSP00000440220:G321D;ENSP00000368865:G320D;ENSP00000444837:G321D	ENSP00000368865:G320D	G	-	2	0	RPS6KA3	20104345	0.998000	0.40836	0.999000	0.59377	0.986000	0.74619	3.688000	0.54699	1.038000	0.40049	0.513000	0.50165	GGC	.		0.328	RPS6KA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056011.3	NM_004586	
MAP7D3	79649	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	135314169	135314169	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chrX:135314169T>C	ENST00000316077.9	-	8	1167	c.947A>G	c.(946-948)aAc>aGc	p.N316S	MAP7D3_ENST00000370661.1_Missense_Mutation_p.N281S|MAP7D3_ENST00000370663.5_Missense_Mutation_p.N298S	NM_024597.3	NP_078873.2	Q8IWC1	MA7D3_HUMAN	MAP7 domain containing 3	316					microtubule cytoskeleton organization (GO:0000226)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(2)|prostate(1)|skin(1)	44	Acute lymphoblastic leukemia(192;0.000127)					CATGCTTGTGTTGCAGAATAC	0.567																																					p.N316S		.											.	MAP7D3-110	0			c.A947G						.						167.0	168.0	168.0					X																	135314169		2132	4212	6344	SO:0001583	missense	79649	exon8			CTTGTGTTGCAGA	AL832120	CCDS44004.1, CCDS55508.1, CCDS55509.1	Xq26.3	2014-08-13			ENSG00000129680	ENSG00000129680			25742	protein-coding gene	gene with protein product		300930				24927501	Standard	NM_001173516		Approved	FLJ12649	uc004ezt.3	Q8IWC1	OTTHUMG00000022507	ENST00000316077.9:c.947A>G	X.37:g.135314169T>C	ENSP00000318086:p.Asn316Ser	Somatic	209	0		WXS	Illumina HiSeq	Phase_I	192	23	NM_024597	0	0	12	12	0	A2A2J0|A6NCZ7|A6NHR4|B4DWD2|H7BY77|Q5JXI5|Q5JXI6|Q6P2S1|Q9H9M8	Missense_Mutation	SNP	ENST00000316077.9	37	CCDS44004.1	.	.	.	.	.	.	.	.	.	.	T	4.011	-0.000557	0.07819	.	.	ENSG00000129680	ENST00000370661;ENST00000316077;ENST00000370663;ENST00000370660	T;T;T;T	0.11930	2.73;2.73;2.73;2.73	3.62	-1.54	0.08584	.	.	.	.	.	T	0.07773	0.0195	N	0.22421	0.69	0.09310	N	1	B;B;B;B	0.26258	0.09;0.126;0.09;0.145	B;B;B;B	0.26614	0.032;0.039;0.032;0.071	T	0.44467	-0.9326	9	0.13108	T	0.6	0.3015	8.6543	0.34053	0.0:0.6237:0.0:0.3763	.	298;275;316;281	B4DWD2;Q8IWC1-2;Q8IWC1;Q8IWC1-3	.;.;MA7D3_HUMAN;.	S	281;316;298;275	ENSP00000359695:N281S;ENSP00000318086:N316S;ENSP00000359697:N298S;ENSP00000359694:N275S	ENSP00000318086:N316S	N	-	2	0	MAP7D3	135141835	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.087000	0.14958	-0.273000	0.09246	-0.463000	0.05309	AAC	.		0.567	MAP7D3-001	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058487.2		
DDX10	1662	broad.mit.edu	37	11	108788635	108788637	+	In_Frame_Del	DEL	TGA	TGA	-			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	TGA	TGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr11:108788635_108788637delTGA	ENST00000322536.3	+	17	2469_2471	c.2340_2342delTGA	c.(2338-2343)agtgat>agt	p.D788del	DDX10_ENST00000526794.1_In_Frame_Del_p.D788del	NM_004398.2	NP_004389.2	Q13206	DDX10_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 10	788					metabolic process (GO:0008152)		ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			breast(2)|endometrium(5)|kidney(2)|large_intestine(4)|lung(11)|pancreas(1)|prostate(2)	27		all_cancers(61;1.29e-11)|all_epithelial(67;2.96e-07)|Melanoma(852;1.54e-05)|Acute lymphoblastic leukemia(157;4.24e-05)|all_hematologic(158;0.000141)|Breast(348;0.026)|all_neural(223;0.0729)		BRCA - Breast invasive adenocarcinoma(274;2.48e-05)|Epithelial(105;4.35e-05)|all cancers(92;0.000609)|OV - Ovarian serous cystadenocarcinoma(223;0.133)		TGGATTGGAGtgatgatgatgat	0.355			T	NUP98	AML*																																p.780_781del				Dom	yes		11	11q22-q23	1662	DEAD (Asp-Glu-Ala-Asp) box polypeptide 10		L	.	DDX10-1145	0			c.2340_2342del						.			25,260,77,3902		0,2,0,23,4,0,250,5,67,1781						4.9	1.0			85	14,28,155,8057		0,0,0,14,0,0,28,12,131,3942	no	codingComplex	DDX10	NM_004398.2		0,2,0,37,4,0,278,17,198,5723	A1A1,A1A2,A1A3,A1R,A2A2,A2A3,A2R,A3A3,A3R,RR		2.3867,8.4897,4.4656				39,288,232,11959				SO:0001651	inframe_deletion	1662	exon17			TTGGAGTGATGAT	U28042	CCDS8342.1	11q22-q23	2005-10-11	2003-06-13		ENSG00000178105	ENSG00000178105		"""DEAD-boxes"""	2735	protein-coding gene	gene with protein product		601235	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 10 (RNA helicase)"""			8660968	Standard	NM_004398		Approved	HRH-J8	uc001pkm.3	Q13206	OTTHUMG00000166540	ENST00000322536.3:c.2340_2342delTGA	11.37:g.108788644_108788646delTGA	ENSP00000314348:p.Asp788del	Somatic	79	0		WXS	Illumina HiSeq	Phase_I	79	6	NM_004398	0	0	0	0	0	B2RCQ3|Q5BJD8	In_Frame_Del	DEL	ENST00000322536.3	37	CCDS8342.1																																																																																			.		0.355	DDX10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390343.1	NM_004398	
CD3EAP	10849	broad.mit.edu	37	19	45911859	45911861	+	In_Frame_Del	DEL	GAA	GAA	-			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	GAA	GAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr19:45911859_45911861delGAA	ENST00000309424.3	+	3	1121_1123	c.633_635delGAA	c.(631-636)cggaag>cgg	p.K217del	ERCC1_ENST00000588738.1_5'Flank|ERCC1_ENST00000300853.3_3'UTR|CD3EAP_ENST00000589804.1_In_Frame_Del_p.K219del|ERCC1_ENST00000423698.2_3'UTR|PPP1R13L_ENST00000418234.2_5'Flank	NM_012099.1	NP_036231.1	O15446	RPA34_HUMAN	CD3e molecule, epsilon associated protein	217	Poly-Lys.				rRNA transcription (GO:0009303)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|RNA polymerase I transcription factor complex (GO:0000120)	DNA-directed RNA polymerase activity (GO:0003899)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)	11		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0251)		TGGATGTGCGGAAGAAGAAGAAG	0.581																																					p.211_212del													.	CD3EAP-156	0			c.633_635del						.		,,	0,144,4118		0,0,0,13,118,2000					,,	-5.6	0.0			66	5,183,8058		0,0,5,3,177,3938	no	codingComplex,utr-3,utr-3	ERCC1,CD3EAP	NM_012099.1,NM_001983.3,NM_001166049.1	,,	0,0,5,16,295,5938	A1A1,A1A2,A1R,A2A2,A2R,RR		2.2799,3.3787,2.6543	,,	,,		5,327,12176				SO:0001651	inframe_deletion	10849	exon3			TGTGCGGAAGAAG	U86751	CCDS12661.1, CCDS74397.1	19q13.3	2008-02-05	2006-03-28			ENSG00000117877			24219	protein-coding gene	gene with protein product	"""CD3 epsilon associated protein"", ""antisense to ERCC 1"""	107325	"""CD3e antigen, epsilon polypeptide associated protein"""			10373416, 9426281, 15226435	Standard	XM_005258425		Approved	ASE-1, CAST, PAF49	uc002pbq.1	O15446		ENST00000309424.3:c.633_635delGAA	19.37:g.45911868_45911870delGAA	ENSP00000310966:p.Lys217del	Somatic	132	0		WXS	Illumina HiSeq	Phase_I	149	8	NM_012099	0	0	0	0	0	Q32N11|Q7Z5U2|Q9UPF6	In_Frame_Del	DEL	ENST00000309424.3	37	CCDS12661.1																																																																																			.		0.581	CD3EAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000459538.1	NM_012099	
CHD6	84181	broad.mit.edu	37	20	40033403	40033405	+	In_Frame_Del	DEL	TCT	TCT	-	rs572418298|rs146425509|rs573605078	byFrequency	TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	TCT	TCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr20:40033403_40033405delTCT	ENST00000373233.3	-	37	8153_8155	c.7976_7978delAGA	c.(7975-7980)aagaca>aca	p.K2659del	CHD6_ENST00000480022.1_5'UTR	NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	2659					ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				TCCCCCTTTGTCTTCTTCTTCTT	0.586														3	0.000599042	0.0023	0.0	5008	,	,		18233	0.0		0.0	False		,,,				2504	0.0				p.2659_2660del													.	CHD6-238	0			c.7976_7978del						.			5,4259		0,5,2127						5.9	1.0			79	2,8252		0,2,4125	no	coding	CHD6	NM_032221.3		0,7,6252	A1A1,A1R,RR		0.0242,0.1173,0.0559				7,12511				SO:0001651	inframe_deletion	84181	exon37			CCTTTGTCTTCTT	AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.7976_7978delAGA	20.37:g.40033412_40033414delTCT	ENSP00000362330:p.Lys2659del	Somatic	146	0		WXS	Illumina HiSeq	Phase_I	164	10	NM_032221	0	0	0	0	0	Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	In_Frame_Del	DEL	ENST00000373233.3	37	CCDS13317.1																																																																																			.		0.586	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079270.1		
ELF3	1999	broad.mit.edu	37	1	201980419	201980420	+	Frame_Shift_Ins	INS	-	-	G			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr1:201980419_201980420insG	ENST00000359651.3	+	1	3347_3348	c.155_156insG	c.(154-159)gagggtfs	p.EG52fs	ELF3_ENST00000367283.3_Frame_Shift_Ins_p.EG52fs|RP11-465N4.4_ENST00000419190.1_RNA|ELF3_ENST00000495848.1_3'UTR|RP11-510N19.5_ENST00000504773.1_RNA|ELF3_ENST00000367284.5_Frame_Shift_Ins_p.EG52fs					E74-like factor 3 (ets domain transcription factor, epithelial-specific )									p.E52G(2)		breast(2)|endometrium(2)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	20						ATGTCATTGGAGGGTACAGGTG	0.609																																					p.E52fs													.	ELF3-226	2	Substitution - Missense(2)	lung(2)	c.155_156insG						.																																			SO:0001589	frameshift_variant	1999	exon2			CATTGGAGGGTAC	AF016295	CCDS1419.1	1q32.2	2008-02-05			ENSG00000163435	ENSG00000163435			3318	protein-coding gene	gene with protein product		602191		ESX		9395241, 9129154	Standard	NM_001114309		Approved	EPR-1, ESE-1, ERT	uc001gxh.4	P78545	OTTHUMG00000035867	ENST00000359651.3:c.158dupG	1.37:g.201980422_201980422dupG	ENSP00000352673:p.Glu52fs	Somatic	132	0		WXS	Illumina HiSeq	Phase_I	138	11	NM_004433	0	0	0	0	0		Frame_Shift_Ins	INS	ENST00000359651.3	37	CCDS1419.1																																																																																			.		0.609	ELF3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087360.1	NM_004433	
UBR2	23304	broad.mit.edu	37	6	42610219	42610220	+	Splice_Site	INS	-	-	GTAAT			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr6:42610219_42610220insGTAAT	ENST00000372899.1	+	18	2355	c.2097_2097insGTAAT	c.(2098-2100)aca>acGTAATa	p.-700fs	UBR2_ENST00000372901.1_Splice_Site_p.-700fs|UBR2_ENST00000372883.3_Splice_Site_p.-204fs	NM_015255.2	NP_056070.1	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin 2						cellular response to leucine (GO:0071233)|chromatin silencing (GO:0006342)|histone H2A ubiquitination (GO:0033522)|male meiosis I (GO:0007141)|negative regulation of TOR signaling (GO:0032007)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromatin (GO:0000785)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(7)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|skin(5)	64	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			TAATGCTTCAGGTAATGAATTA	0.312																																					p.Q699fs													.	UBR2-94	0			c.2097_2098insGTAAT						.																																			SO:0001630	splice_region_variant	23304	exon18			GCTTCAGGTAATG	BC024217	CCDS4870.1, CCDS55001.1	6p21.1	2008-06-23	2005-01-10	2005-01-12	ENSG00000024048	ENSG00000024048		"""Ubiquitin protein ligase E3 component n-recognins"""	21289	protein-coding gene	gene with protein product		609134	"""chromosome 6 open reading frame 133"""	C6orf133			Standard	NM_015255		Approved	bA49A4.1, dJ392M17.3, KIAA0349	uc011dur.2	Q8IWV8	OTTHUMG00000014703	ENST00000372899.1:c.2097+1->GTAAT	6.37:g.42610220_42610224dupGTAAT		Somatic	25	0		WXS	Illumina HiSeq	Phase_I	37	7	NM_015255	0	0	0	0	0	O15057|Q4VXK2|Q5TFH6|Q6P2I2|Q6ZUD0	Frame_Shift_Ins	INS	ENST00000372899.1	37	CCDS4870.1																																																																																			.		0.312	UBR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040558.2	NM_015255	Frame_Shift_Ins
