#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PEX14	5195	hgsc.bcm.edu	37	1	10535061	10535061	+	Splice_Site	SNP	T	T	C			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr1:10535061T>C	ENST00000356607.4	+	1	116		c.e1+2		DFFA_ENST00000377038.3_5'Flank|PEX14_ENST00000538836.1_Splice_Site|DFFA_ENST00000377036.2_5'Flank	NM_004565.2	NP_004556.1	O75381	PEX14_HUMAN	peroxisomal biogenesis factor 14						microtubule anchoring (GO:0034453)|negative regulation of protein binding (GO:0032091)|negative regulation of protein homotetramerization (GO:1901094)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|peroxisome organization (GO:0007031)|peroxisome transport along microtubule (GO:0036250)|protein complex assembly (GO:0006461)|protein homooligomerization (GO:0051260)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome matrix, substrate release (GO:0044721)|protein import into peroxisome matrix, translocation (GO:0016561)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|microtubule binding (GO:0008017)|protein N-terminus binding (GO:0047485)|receptor binding (GO:0005102)|transcription corepressor activity (GO:0003714)			breast(3)|endometrium(1)|large_intestine(3)|lung(5)|prostate(1)	13	Ovarian(185;0.203)	all_lung(284;6.02e-06)|Lung NSC(185;9.62e-06)|Renal(390;0.000147)|Breast(348;0.000932)|Colorectal(325;0.00215)|Hepatocellular(190;0.00913)|Ovarian(437;0.023)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0292)|Colorectal(212;9.13e-08)|COAD - Colon adenocarcinoma(227;2.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000482)|Kidney(185;0.00174)|KIRC - Kidney renal clear cell carcinoma(229;0.00457)|STAD - Stomach adenocarcinoma(132;0.0249)|READ - Rectum adenocarcinoma(331;0.0419)		CCGAGCCAGGTAAGGGGAGTG	0.692																																					.		.											.	PEX14-90	0			c.36+2T>C						.						18.0	20.0	19.0					1																	10535061		2193	4296	6489	SO:0001630	splice_region_variant	5195	exon1			GCCAGGTAAGGGG	AF045186	CCDS30582.1	1p36.22	2008-05-14			ENSG00000142655	ENSG00000142655			8856	protein-coding gene	gene with protein product		601791				9653144	Standard	NM_004565		Approved		uc001arn.3	O75381	OTTHUMG00000001908	ENST00000356607.4:c.36+2T>C	1.37:g.10535061T>C		Somatic	29	0		WXS	Illumina HiSeq	Phase_I	15	2	NM_004565	0	0	0	0	0	B2R7N1|B3KML6|B7Z1N2|Q8WX51	Splice_Site	SNP	ENST00000356607.4	37	CCDS30582.1	.	.	.	.	.	.	.	.	.	.	T	22.4	4.285608	0.80803	.	.	ENSG00000142655	ENST00000356607	.	.	.	4.85	4.85	0.62838	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.4758	0.67546	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	PEX14	10457648	1.000000	0.71417	0.991000	0.47740	0.989000	0.77384	4.621000	0.61233	1.821000	0.53095	0.533000	0.62120	.	.		0.692	PEX14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005414.1		Intron
TRIM63	84676	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	26386776	26386776	+	Missense_Mutation	SNP	T	T	A			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr1:26386776T>A	ENST00000374272.3	-	4	716	c.578A>T	c.(577-579)gAt>gTt	p.D193V	TRIM63_ENST00000483052.1_5'Flank	NM_032588.3	NP_115977.2	Q969Q1	TRI63_HUMAN	tripartite motif containing 63, E3 ubiquitin protein ligase	193	Interaction with TTN.				cellular response to dexamethasone stimulus (GO:0071549)|muscle contraction (GO:0006936)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of gene expression (GO:0010468)|response to electrical stimulus involved in regulation of muscle adaptation (GO:0014878)|response to interleukin-1 (GO:0070555)|signal transduction (GO:0007165)|skeletal muscle atrophy (GO:0014732)	contractile fiber (GO:0043292)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|titin binding (GO:0031432)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(1)|ovary(1)|skin(1)|stomach(1)	5		Colorectal(325;3.46e-05)|Lung NSC(340;0.000154)|all_lung(284;0.00021)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0133)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;9.15e-26)|Colorectal(126;3.16e-08)|COAD - Colon adenocarcinoma(152;1.72e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000767)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)		TCGACGGGAATCCTCCAGCTG	0.572																																					p.D193V		.											.	TRIM63-226	0			c.A578T						.						122.0	113.0	116.0					1																	26386776		2203	4300	6503	SO:0001583	missense	84676	exon4			CGGGAATCCTCCA	AF353673	CCDS273.1	1p34-p33	2014-09-17	2012-02-23	2004-11-17	ENSG00000158022	ENSG00000158022		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	16007	protein-coding gene	gene with protein product	"""muscle-specific RING finger protein 1"", ""iris ring finger protein"", ""striated muscle RING zinc finger protein"""	606131	"""ring finger protein 28"", ""tripartite motif-containing 63"", ""tripartite motif containing 63"""	RNF28		11243782, 11283016	Standard	NM_032588		Approved	MURF-1, IRF, SMRZ	uc001bli.2	Q969Q1	OTTHUMG00000007510	ENST00000374272.3:c.578A>T	1.37:g.26386776T>A	ENSP00000363390:p.Asp193Val	Somatic	156	0		WXS	Illumina HiSeq	Phase_I	125	25	NM_032588	0	0	0	0	0	B4DN95|Q5T2I1|Q96BD3|Q96KD9|Q9BYV4	Missense_Mutation	SNP	ENST00000374272.3	37	CCDS273.1	.	.	.	.	.	.	.	.	.	.	T	18.01	3.528379	0.64860	.	.	ENSG00000158022	ENST00000374272	T	0.39787	1.06	5.21	5.21	0.72293	.	0.086183	0.85682	D	0.000000	T	0.50222	0.1603	M	0.68593	2.085	0.80722	D	1	B	0.32893	0.389	B	0.40741	0.339	T	0.55792	-0.8085	10	0.87932	D	0	.	15.0417	0.71796	0.0:0.0:0.0:1.0	.	193	Q969Q1	TRI63_HUMAN	V	193	ENSP00000363390:D193V	ENSP00000363390:D193V	D	-	2	0	TRIM63	26259363	1.000000	0.71417	1.000000	0.80357	0.774000	0.43823	5.828000	0.69307	2.081000	0.62600	0.379000	0.24179	GAT	.		0.572	TRIM63-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019750.1	NM_032588	
SERINC2	347735	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	31897695	31897695	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr1:31897695G>A	ENST00000373709.3	+	3	517	c.367G>A	c.(367-369)Gac>Aac	p.D123N	SERINC2_ENST00000536384.1_Missense_Mutation_p.D127N|SERINC2_ENST00000536859.1_Missense_Mutation_p.D127N|SERINC2_ENST00000373710.1_Missense_Mutation_p.D132N|SERINC2_ENST00000491976.1_3'UTR	NM_178865.4	NP_849196.2	Q96SA4	SERC2_HUMAN	serine incorporator 2	123					phosphatidylserine metabolic process (GO:0006658)|positive regulation of transferase activity (GO:0051347)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	L-serine transmembrane transporter activity (GO:0015194)			cervix(1)|endometrium(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(2)	12		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0629)|Breast(348;0.0707)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0541)|READ - Rectum adenocarcinoma(331;0.151)		CAGCAGCCGGGACCCCCGGGC	0.652																																					p.D132N													.	SERINC2-90	0			c.G394A						.																																			SO:0001583	missense	347735	exon4			AGCCGGGACCCCC	AY094595	CCDS30662.1, CCDS55583.1, CCDS55584.1, CCDS55585.1	1p35.1	2008-02-05	2005-11-01	2005-11-01	ENSG00000168528	ENSG00000168528			23231	protein-coding gene	gene with protein product		614549	"""tumor differentially expressed 2-like"""	TDE2L		12949800	Standard	NM_178865		Approved	FKSG84, PRO0899, TDE2	uc010ogh.2	Q96SA4	OTTHUMG00000003796	ENST00000373709.3:c.367G>A	1.37:g.31897695G>A	ENSP00000362813:p.Asp123Asn	Somatic	22	0		WXS	Illumina HiSeq	Phase_I	33	6	NM_001199038	0	0	112	202	90	A0AVB4|B4DJK5|B7Z567|B7ZAP2|E7EUZ9|Q86Y23	Missense_Mutation	SNP	ENST00000373709.3	37	CCDS30662.1	.	.	.	.	.	.	.	.	.	.	G	35	5.477629	0.96291	.	.	ENSG00000168528	ENST00000373710;ENST00000536859;ENST00000373709;ENST00000536384	T;T;T;T	0.15256	2.44;2.44;2.44;2.44	4.24	4.24	0.50183	.	0.000000	0.85682	D	0.000000	T	0.40040	0.1101	L	0.61036	1.89	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.997	T	0.35895	-0.9770	10	0.87932	D	0	-47.5929	16.3974	0.83613	0.0:0.0:1.0:0.0	.	127;132;127;123	B4DJK5;E7EUZ9;B7Z567;Q96SA4	.;.;.;SERC2_HUMAN	N	132;127;123;127	ENSP00000362814:D132N;ENSP00000444307:D127N;ENSP00000362813:D123N;ENSP00000439048:D127N	ENSP00000362813:D123N	D	+	1	0	SERINC2	31670282	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.582000	0.98214	2.204000	0.70986	0.609000	0.83330	GAC	.		0.652	SERINC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010680.1	NM_018565	
KIF2C	11004	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	45206651	45206651	+	Missense_Mutation	SNP	C	C	A			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr1:45206651C>A	ENST00000372224.4	+	2	250	c.137C>A	c.(136-138)gCa>gAa	p.A46E	KIF2C_ENST00000493027.1_3'UTR|KIF2C_ENST00000372218.4_Missense_Mutation_p.A46E	NM_006845.3	NP_006836.2	Q99661	KIF2C_HUMAN	kinesin family member 2C	46	Globular. {ECO:0000255}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of chromosome segregation (GO:0051983)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|centromeric DNA binding (GO:0019237)|microtubule motor activity (GO:0003777)|microtubule plus-end binding (GO:0051010)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(16)|ovary(1)|skin(1)|urinary_tract(1)	34	Acute lymphoblastic leukemia(166;0.155)					GTGGAATGGGCAGAAGGAGGT	0.413																																					p.A46E		.											.	KIF2C-228	0			c.C137A						.						106.0	102.0	103.0					1																	45206651		2203	4300	6503	SO:0001583	missense	11004	exon2			AATGGGCAGAAGG	U63743	CCDS512.1, CCDS72774.1	1p34.1	2014-01-21	2003-01-13	2003-01-17	ENSG00000142945	ENSG00000142945		"""Kinesins"""	6393	protein-coding gene	gene with protein product		604538	"""kinesin-like 6 (mitotic centromere-associated kinesin)"""	KNSL6		9434124	Standard	NM_006845		Approved	MCAK, CT139	uc001cmg.4	Q99661	OTTHUMG00000008416	ENST00000372224.4:c.137C>A	1.37:g.45206651C>A	ENSP00000361298:p.Ala46Glu	Somatic	69	0		WXS	Illumina HiSeq	Phase_I	75	8	NM_006845	0	0	0	0	0	B3ITR9|Q5JR88|Q6ICU1|Q96C18|Q96HB8|Q9BWV8	Missense_Mutation	SNP	ENST00000372224.4	37	CCDS512.1	.	.	.	.	.	.	.	.	.	.	c	15.02	2.708022	0.48412	.	.	ENSG00000142945	ENST00000452259;ENST00000372224;ENST00000372218;ENST00000455186	T;T;T;T	0.74947	1.14;-0.89;-0.72;0.9	5.95	0.825	0.18824	.	1.230180	0.05208	N	0.506277	T	0.64864	0.2637	L	0.43152	1.355	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.17098	0.017;0.017	T	0.55554	-0.8123	10	0.52906	T	0.07	.	2.3087	0.04181	0.1215:0.4871:0.1181:0.2733	.	46;46	B7Z6Q6;Q99661	.;KIF2C_HUMAN	E	46;46;46;37	ENSP00000410346:A46E;ENSP00000361298:A46E;ENSP00000361292:A46E;ENSP00000395050:A37E	ENSP00000361292:A46E	A	+	2	0	KIF2C	44979238	0.981000	0.34729	0.990000	0.47175	0.995000	0.86356	-0.030000	0.12308	-0.083000	0.12618	0.655000	0.94253	GCA	.		0.413	KIF2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023180.1	NM_006845	
ST7L	54879	bcgsc.ca	37	1	113119657	113119657	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr1:113119657G>A	ENST00000358039.4	-	11	1500	c.1196C>T	c.(1195-1197)gCc>gTc	p.A399V	ST7L_ENST00000369666.1_Missense_Mutation_p.A382V|ST7L_ENST00000490067.1_Missense_Mutation_p.A382V|ST7L_ENST00000538187.1_Missense_Mutation_p.A343V|ST7L_ENST00000360743.4_Missense_Mutation_p.A399V|ST7L_ENST00000463235.1_5'UTR|ST7L_ENST00000369668.2_Missense_Mutation_p.A399V|ST7L_ENST00000544629.1_Missense_Mutation_p.A334V|ST7L_ENST00000369669.1_Missense_Mutation_p.A216V|ST7L_ENST00000543570.1_Missense_Mutation_p.A382V|ST7L_ENST00000343210.7_Missense_Mutation_p.A399V	NM_017744.4|NM_138727.3	NP_060214.2|NP_620055.1	Q8TDW4	ST7L_HUMAN	suppression of tumorigenicity 7 like	399					negative regulation of cell growth (GO:0030308)	integral component of membrane (GO:0016021)				endometrium(1)|kidney(4)|large_intestine(3)|lung(1)|prostate(2)|stomach(1)|urinary_tract(3)	15	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGCTTCCACGGCATTAATTTC	0.308																																					p.A399V													.	ST7L-90	0			c.C1196T						.						51.0	55.0	53.0					1																	113119657		2199	4296	6495	SO:0001583	missense	54879	exon11			TCCACGGCATTAA	AB081317	CCDS848.1, CCDS849.1, CCDS850.1, CCDS852.1	1p13.1	2008-06-06			ENSG00000007341	ENSG00000007341			18441	protein-coding gene	gene with protein product						12012006	Standard	NM_138729		Approved	FLJ20284, STLR, ST7R, FAM4B	uc001ecd.3	Q8TDW4	OTTHUMG00000011753	ENST00000358039.4:c.1196C>T	1.37:g.113119657G>A	ENSP00000350734:p.Ala399Val	Somatic	82	0		WXS	Illumina HiSeq	Phase_1	78	5	NM_138728	0	0	10	10	0	A8K4S7|Q49AH6|Q5TEI4|Q5U5K6|Q6N067|Q7Z2Z0|Q7Z3C2|Q8N7P8|Q8TDW1|Q8TDW2|Q8TDW3|Q9NXF3	Missense_Mutation	SNP	ENST00000358039.4	37	CCDS848.1	.	.	.	.	.	.	.	.	.	.	G	35	5.546942	0.96488	.	.	ENSG00000007341	ENST00000358039;ENST00000360743;ENST00000544629;ENST00000369669;ENST00000490067;ENST00000369668;ENST00000343210;ENST00000369666;ENST00000538187;ENST00000543570;ENST00000369665	T;T;T;T;T;T;T;T;T;T	0.59083	1.69;0.29;1.69;1.69;0.29;0.29;0.29;0.29;0.29;1.69	5.51	5.51	0.81932	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.75649	0.3878	M	0.83603	2.65	0.80722	D	1	D;D;D;D;P;P;D;D;D	0.89917	1.0;0.999;1.0;1.0;0.939;0.939;0.969;0.985;0.975	D;D;D;D;P;P;P;P;D	0.87578	0.997;0.998;0.998;0.994;0.779;0.779;0.868;0.868;0.919	T	0.78288	-0.2262	10	0.62326	D	0.03	-9.1746	19.0163	0.92896	0.0:0.0:1.0:0.0	.	382;343;334;334;399;382;382;399;399	B7Z8V6;B7Z7D4;B7Z3J2;F5H2P3;Q8TDW4-5;Q8TDW4-6;Q8TDW4-3;Q8TDW4-2;Q8TDW4	.;.;.;.;.;.;.;.;ST7L_HUMAN	V	399;399;334;216;382;399;399;382;343;382;277	ENSP00000350734:A399V;ENSP00000353972:A399V;ENSP00000445499:A334V;ENSP00000358683:A216V;ENSP00000417140:A382V;ENSP00000358682:A399V;ENSP00000345312:A399V;ENSP00000358680:A382V;ENSP00000444021:A343V;ENSP00000444088:A382V	ENSP00000345312:A399V	A	-	2	0	ST7L	112921180	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.415000	0.97375	2.582000	0.87167	0.467000	0.42956	GCC	.		0.308	ST7L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000032504.3		
ANKRD35	148741	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	145561665	145561665	+	Silent	SNP	C	C	T			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr1:145561665C>T	ENST00000355594.4	+	10	1440	c.1353C>T	c.(1351-1353)acC>acT	p.T451T		NM_144698.3	NP_653299.4	Q8N283	ANR35_HUMAN	ankyrin repeat domain 35	451										NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(16)|ovary(4)|prostate(3)|skin(2)|urinary_tract(1)	47	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GGGCACAGACCTTTGGCCCTG	0.587																																					p.T451T	Melanoma(9;127 754 22988 51047)	.											.	ANKRD35-95	0			c.C1353T						.						59.0	67.0	64.0					1																	145561665		2203	4300	6503	SO:0001819	synonymous_variant	148741	exon10			ACAGACCTTTGGC	AK091120	CCDS72867.1, CCDS72868.1	1q21.1	2013-01-10			ENSG00000198483	ENSG00000198483		"""Ankyrin repeat domain containing"""	26323	protein-coding gene	gene with protein product							Standard	NM_144698		Approved	FLJ25124	uc001eob.1	Q8N283	OTTHUMG00000013743	ENST00000355594.4:c.1353C>T	1.37:g.145561665C>T		Somatic	113	0		WXS	Illumina HiSeq	Phase_I	97	22	NM_144698	0	0	0	0	0	A6NEU0|B4DL62|Q3MJ10|Q96LS3	Silent	SNP	ENST00000355594.4	37	CCDS919.1																																																																																			.		0.587	ANKRD35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038515.1	NM_144698	
HRNR	388697	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	152191362	152191362	+	Missense_Mutation	SNP	G	G	A	rs573793519		TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr1:152191362G>A	ENST00000368801.2	-	3	2818	c.2743C>T	c.(2743-2745)Cgg>Tgg	p.R915W	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	915					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGGAAGACCGACCGGAGCCA	0.627																																					p.R915W		.											.	HRNR-93	0			c.C2743T						.						136.0	149.0	144.0					1																	152191362		2203	4300	6503	SO:0001583	missense	388697	exon3			AAGACCGACCGGA	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.2743C>T	1.37:g.152191362G>A	ENSP00000357791:p.Arg915Trp	Somatic	304	1		WXS	Illumina HiSeq	Phase_I	250	52	NM_001009931	0	0	0	0	0	Q5DT20|Q5U1F4	Missense_Mutation	SNP	ENST00000368801.2	37	CCDS30859.1	.	.	.	.	.	.	.	.	.	.	G	8.431	0.848661	0.17034	.	.	ENSG00000197915	ENST00000368801	T	0.01933	4.55	3.6	2.67	0.31697	.	.	.	.	.	T	0.00695	0.0023	N	0.22421	0.69	0.09310	N	1	B	0.20780	0.048	B	0.10450	0.005	T	0.47636	-0.9102	9	0.48119	T	0.1	.	8.8921	0.35441	0.1155:0.0:0.8845:0.0	.	915	Q86YZ3	HORN_HUMAN	W	915	ENSP00000357791:R915W	ENSP00000357791:R915W	R	-	1	2	HRNR	150457986	0.000000	0.05858	0.001000	0.08648	0.009000	0.06853	-0.046000	0.11983	0.860000	0.35481	0.498000	0.49722	CGG	.		0.627	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868	
FLAD1	80308	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	154961016	154961016	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr1:154961016G>A	ENST00000292180.3	+	2	1130	c.808G>A	c.(808-810)Gga>Aga	p.G270R	FLAD1_ENST00000368431.3_Missense_Mutation_p.G171R|FLAD1_ENST00000295530.2_Missense_Mutation_p.G3R|FLAD1_ENST00000368433.1_Missense_Mutation_p.G270R|FLAD1_ENST00000315144.10_Missense_Mutation_p.G173R|FLAD1_ENST00000405236.2_Missense_Mutation_p.G171R|FLAD1_ENST00000368428.1_5'Flank|FLAD1_ENST00000368432.1_Missense_Mutation_p.G173R	NM_025207.4	NP_079483.3	Q8NFF5	FAD1_HUMAN	flavin adenine dinucleotide synthetase 1	270					FAD biosynthetic process (GO:0006747)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|riboflavin metabolic process (GO:0006771)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|FMN adenylyltransferase activity (GO:0003919)			endometrium(3)|kidney(4)|large_intestine(2)|lung(7)|ovary(3)|skin(3)	22	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			GGGGATGAAGGGACTATTCCA	0.572																																					p.G270R		.											.	FLAD1-93	0			c.G808A						.						43.0	41.0	42.0					1																	154961016		2203	4300	6503	SO:0001583	missense	80308	exon2			ATGAAGGGACTAT		CCDS1078.1, CCDS1079.1, CCDS53371.1, CCDS53372.1	1q22	2013-03-05	2013-03-05		ENSG00000160688	ENSG00000160688	2.7.7.2		24671	protein-coding gene	gene with protein product		610595	"""Fad1, flavin adenine dinucleotide synthetase, homolog (yeast)"", ""FAD1 flavin adenine dinucleotide synthetase homolog (S. cerevisiae)"", ""flavin adenine dinucleotide synthetase"""				Standard	NM_001184891		Approved	PP591, FAD1	uc001fgf.2	Q8NFF5	OTTHUMG00000037416	ENST00000292180.3:c.808G>A	1.37:g.154961016G>A	ENSP00000292180:p.Gly270Arg	Somatic	69	0		WXS	Illumina HiSeq	Phase_I	69	9	NM_025207	0	0	27	36	9	Q8N5J1|Q8N686|Q8WU93|Q8WUJ4|Q96CR8|Q99764|Q9HBN6	Missense_Mutation	SNP	ENST00000292180.3	37	CCDS1078.1	.	.	.	.	.	.	.	.	.	.	G	10.59	1.391696	0.25118	.	.	ENSG00000160688	ENST00000368433;ENST00000315144;ENST00000368432;ENST00000368431;ENST00000292180;ENST00000405236;ENST00000295530	.	.	.	5.51	1.43	0.22495	Molybdopterin binding (2);	0.470755	0.24384	N	0.038987	T	0.05777	0.0151	N	0.25890	0.77	0.09310	N	1	P;B;P	0.45474	0.859;0.05;0.491	B;B;B	0.37304	0.246;0.124;0.076	T	0.32188	-0.9916	9	0.21014	T	0.42	-1.0E-4	6.7182	0.23314	0.2278:0.3684:0.4038:0.0	.	3;270;171	Q5T191;Q8NFF5;Q8NFF5-4	.;FAD1_HUMAN;.	R	270;173;173;171;270;171;3	.	ENSP00000292180:G270R	G	+	1	0	FLAD1	153227640	0.089000	0.21612	0.069000	0.20011	0.879000	0.50718	1.889000	0.39718	0.419000	0.25927	0.561000	0.74099	GGA	.		0.572	FLAD1-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000091089.1	NM_025207	
OBSCN	84033	hgsc.bcm.edu	37	1	228522554	228522554	+	Missense_Mutation	SNP	A	A	G			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr1:228522554A>G	ENST00000422127.1	+	61	16170	c.16126A>G	c.(16126-16128)Agg>Ggg	p.R5376G	OBSCN_ENST00000366707.4_Missense_Mutation_p.R3010G|OBSCN_ENST00000284548.11_Missense_Mutation_p.R5376G|OBSCN_ENST00000570156.2_Missense_Mutation_p.R6333G|OBSCN_ENST00000366709.4_Missense_Mutation_p.R2495G	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	5376	Ig-like 51.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				AATGCTGGAGAGGTTCACCCC	0.612																																					p.R6333G		.											.	OBSCN-403	0			c.A18997G						.						31.0	37.0	35.0					1																	228522554		2041	4158	6199	SO:0001583	missense	84033	exon72			CTGGAGAGGTTCA	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.16126A>G	1.37:g.228522554A>G	ENSP00000409493:p.Arg5376Gly	Somatic	8	0		WXS	Illumina HiSeq	Phase_I	10	2	NM_001271223	0	0	0	0	0	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	a	33	5.261450	0.95368	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.67345	-0.26;-0.26;-0.26;-0.26	5.87	4.72	0.59763	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.381287	0.28327	N	0.015748	T	0.71829	0.3386	L	0.47190	1.495	0.33354	D	0.57147	D;D	0.60575	0.988;0.985	P;P	0.58266	0.836;0.747	T	0.78081	-0.2343	10	0.39692	T	0.17	.	13.1041	0.59237	0.866:0.134:0.0:0.0	.	5376;5376	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	G	5376;5376;3010;2495	ENSP00000284548:R5376G;ENSP00000409493:R5376G;ENSP00000355668:R3010G;ENSP00000355670:R2495G	ENSP00000284548:R5376G	R	+	1	2	OBSCN	226589177	1.000000	0.71417	0.899000	0.35326	0.980000	0.70556	5.690000	0.68241	1.016000	0.39470	0.478000	0.44815	AGG	.		0.612	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
SPRTN	83932	hgsc.bcm.edu	37	1	231474336	231474336	+	Silent	SNP	C	C	T			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr1:231474336C>T	ENST00000295050.7	+	1	543	c.207C>T	c.(205-207)agC>agT	p.S69S	SPRTN_ENST00000391858.4_Silent_p.S69S|EXOC8_ENST00000360394.2_5'Flank|SPRTN_ENST00000008440.9_Silent_p.S69S|EXOC8_ENST00000366645.1_5'Flank	NM_001010984.2|NM_032018.5	NP_001010984.1|NP_114407.3	Q9H040	SPRTN_HUMAN	SprT-like N-terminal domain	69	SprT-like.				cellular response to DNA damage stimulus (GO:0006974)|positive regulation of protein ubiquitination (GO:0031398)|response to UV (GO:0009411)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|K63-linked polyubiquitin binding (GO:0070530)|metal ion binding (GO:0046872)|ubiquitin binding (GO:0043130)										TGAAGTGGAGCGTGCGAATGA	0.602																																					p.S69S		.											.	.	0			c.C207T						.						85.0	92.0	90.0					1																	231474336		2203	4300	6503	SO:0001819	synonymous_variant	83932	exon1			GTGGAGCGTGCGA	AL512744	CCDS1594.1, CCDS31054.1, CCDS58066.1	1q42.12-q43	2013-01-30	2012-06-18	2012-06-18	ENSG00000010072	ENSG00000010072			25356	protein-coding gene	gene with protein product	"""SprT-like domain at the N terminus"", ""DNA damage-targeting VCP (p97) adaptor"""		"""chromosome 1 open reading frame 124"""	C1orf124		22681887	Standard	NM_032018		Approved	DKFZP547N043, Spartan, DVC1	uc001hur.4	Q9H040	OTTHUMG00000038022	ENST00000295050.7:c.207C>T	1.37:g.231474336C>T		Somatic	187	0		WXS	Illumina HiSeq	Phase_I	159	15	NM_032018	0	0	5	10	5	B1AKT0|B5MEF7|Q5TE78|Q6UWW6|Q96BC5|Q96KA0	Silent	SNP	ENST00000295050.7	37	CCDS1594.1																																																																																			.		0.602	SPRTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092858.1	NM_032018	
AKR1C3	8644	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	5139633	5139633	+	Missense_Mutation	SNP	C	C	G			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr10:5139633C>G	ENST00000380554.3	+	3	912	c.260C>G	c.(259-261)tCc>tGc	p.S87C	AKR1C3_ENST00000605149.1_Missense_Mutation_p.S64C|AKR1C3_ENST00000470862.2_3'UTR|AKR1C3_ENST00000439082.2_5'UTR	NM_001253908.1|NM_003739.5	NP_001240837.1|NP_003730.4	P42330	AK1C3_HUMAN	aldo-keto reductase family 1, member C3	87					arachidonic acid metabolic process (GO:0019369)|cellular response to cadmium ion (GO:0071276)|cellular response to calcium ion (GO:0071277)|cellular response to corticosteroid stimulus (GO:0071384)|cellular response to jasmonic acid stimulus (GO:0071395)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to reactive oxygen species (GO:0034614)|cellular response to starvation (GO:0009267)|cyclooxygenase pathway (GO:0019371)|daunorubicin metabolic process (GO:0044597)|doxorubicin metabolic process (GO:0044598)|farnesol catabolic process (GO:0016488)|G-protein coupled receptor signaling pathway (GO:0007186)|keratinocyte differentiation (GO:0030216)|male gonad development (GO:0008584)|multicellular organismal macromolecule metabolic process (GO:0044259)|negative regulation of retinoic acid biosynthetic process (GO:1900053)|oxidation-reduction process (GO:0055114)|phototransduction, visible light (GO:0007603)|positive regulation of cell death (GO:0010942)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|progesterone metabolic process (GO:0042448)|prostaglandin metabolic process (GO:0006693)|protein import into nucleus, translocation (GO:0000060)|regulation of retinoic acid receptor signaling pathway (GO:0048385)|regulation of testosterone biosynthetic process (GO:2000224)|renal absorption (GO:0070293)|response to nutrient (GO:0007584)|response to prostaglandin (GO:0034694)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|testosterone biosynthetic process (GO:0061370)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)	15-hydroxyprostaglandin-D dehydrogenase (NADP+) activity (GO:0047020)|alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|aldo-keto reductase (NADP) activity (GO:0004033)|androsterone dehydrogenase activity (GO:0047023)|delta4-3-oxosteroid 5beta-reductase activity (GO:0047787)|dihydrotestosterone 17-beta-dehydrogenase activity (GO:0035410)|geranylgeranyl reductase activity (GO:0045550)|indanol dehydrogenase activity (GO:0047718)|ketoreductase activity (GO:0045703)|ketosteroid monooxygenase activity (GO:0047086)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|phenanthrene 9,10-monooxygenase activity (GO:0018636)|prostaglandin D2 11-ketoreductase activity (GO:0036131)|prostaglandin F receptor activity (GO:0004958)|prostaglandin-F synthase activity (GO:0047017)|retinal dehydrogenase activity (GO:0001758)|retinol dehydrogenase activity (GO:0004745)|testosterone 17-beta-dehydrogenase (NADP+) activity (GO:0047045)|testosterone dehydrogenase (NAD+) activity (GO:0047035)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)|skin(1)	14					Bimatoprost(DB00905)|Doxorubicin(DB00997)	CAGCTTTGGTCCACTTTTCAT	0.393																																					p.S87C		.											.	AKR1C3-515	0			c.C260G						.						134.0	128.0	130.0					10																	5139633		2203	4300	6503	SO:0001583	missense	8644	exon3			TTTGGTCCACTTT	L43839	CCDS7063.1, CCDS73062.1	10p15-p14	2012-12-04	2012-12-04		ENSG00000196139	ENSG00000196139	1.1.1.213, 1.1.1.188	"""Aldo-keto reductases"""	386	protein-coding gene	gene with protein product	"""dihydrodiol dehydrogenase X"", ""prostaglandin F synthase"", ""3-alpha hydroxysteroid dehydrogenase, type II"""	603966	"""hydroxysteroid (17-beta) dehydrogenase 5"", ""aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II)"""	HSD17B5		7650035, 9792917	Standard	NM_003739		Approved	KIAA0119, DDX, HAKRB, PGFS	uc021pml.1	P42330	OTTHUMG00000017585	ENST00000380554.3:c.260C>G	10.37:g.5139633C>G	ENSP00000369927:p.Ser87Cys	Somatic	137	0		WXS	Illumina HiSeq	Phase_I	134	28	NM_001253908	0	0	0	0	0	A8K2V0|B4DL37|Q5T2L1|Q96DJ1|Q96KI8|Q99530|Q9UCX1|Q9UII3|Q9UKL9	Missense_Mutation	SNP	ENST00000380554.3	37	CCDS7063.1	.	.	.	.	.	.	.	.	.	.	C	0.010	-1.788233	0.00628	.	.	ENSG00000196139	ENST00000380554	T	0.26373	1.74	1.93	-3.27	0.05048	NADP-dependent oxidoreductase domain (3);	1.227770	0.05968	N	0.641929	T	0.11153	0.0272	N	0.11651	0.15	0.58432	D	0.999999	B;B	0.15473	0.011;0.013	B;B	0.23852	0.049;0.048	T	0.47045	-0.9147	10	0.05833	T	0.94	.	7.0923	0.25291	0.0:0.392:0.4898:0.1181	.	87;87	B4DKT3;P42330	.;AK1C3_HUMAN	C	87	ENSP00000369927:S87C	ENSP00000369927:S87C	S	+	2	0	AKR1C3	5129633	0.000000	0.05858	0.013000	0.15412	0.934000	0.57294	-1.103000	0.03329	-0.933000	0.03737	-0.458000	0.05436	TCC	.		0.393	AKR1C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046533.2	NM_003739	
IL15RA	3601	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	6008174	6008174	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr10:6008174T>C	ENST00000379977.3	-	2	314	c.217A>G	c.(217-219)Acg>Gcg	p.T73A	IL15RA_ENST00000397255.3_Missense_Mutation_p.T73A|IL15RA_ENST00000379971.1_Intron|IL15RA_ENST00000397250.2_Intron|IL15RA_ENST00000525219.2_Missense_Mutation_p.T37A|IL15RA_ENST00000397248.2_Missense_Mutation_p.T37A|IL15RA_ENST00000528354.1_Missense_Mutation_p.T73A|IL15RA_ENST00000397251.3_Intron|IL15RA_ENST00000530685.1_Missense_Mutation_p.T73A|IL15RA_ENST00000534292.1_5'UTR			Q13261	I15RA_HUMAN	interleukin 15 receptor, alpha	73	Sushi. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|JAK-STAT cascade (GO:0007259)|negative regulation of neuron projection development (GO:0010977)|positive regulation of natural killer cell differentiation (GO:0032825)|response to nutrient levels (GO:0031667)|signal transduction (GO:0007165)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|signal transducer activity (GO:0004871)			cervix(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	5						ACGCACTCCGTCAGGCTGGAC	0.557																																					p.T159A		.											.	IL15RA-90	0			c.A475G						.						91.0	78.0	82.0					10																	6008174		2203	4300	6503	SO:0001583	missense	3601	exon3			ACTCCGTCAGGCT	U31628	CCDS7074.1, CCDS7075.1, CCDS7075.2, CCDS58069.1, CCDS73065.1	10p15.1	2012-02-27			ENSG00000134470	ENSG00000134470		"""Interleukins and interleukin receptors"", ""CD molecules"""	5978	protein-coding gene	gene with protein product		601070				8530383	Standard	NM_002189		Approved	CD215, IL-15RA	uc021pmo.1	Q13261	OTTHUMG00000017612	ENST00000379977.3:c.217A>G	10.37:g.6008174T>C	ENSP00000369312:p.Thr73Ala	Somatic	65	0		WXS	Illumina HiSeq	Phase_I	40	6	NM_001256765	0	0	5	6	1	B4E2C2|Q3B769|Q5JVA1|Q5JVA2|Q5JVA4|Q6B0J2|Q7LDR4|Q7Z609	Missense_Mutation	SNP	ENST00000379977.3	37	CCDS7074.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.76|15.76	2.927337|2.927337	0.52759|0.52759	.|.	.|.	ENSG00000134470|ENSG00000134470	ENST00000397246;ENST00000379977;ENST00000397248;ENST00000319465;ENST00000528354;ENST00000530685;ENST00000397255;ENST00000429135;ENST00000453922|ENST00000532039	T;T;T;T;T;T;T;T|.	0.29397|.	1.92;1.57;1.57;1.92;1.92;1.57;1.92;1.57|.	4.8|4.8	4.8|4.8	0.61643|0.61643	Complement control module (2);Sushi/SCR/CCP (2);|.	0.149436|.	0.43747|.	D|.	0.000539|.	T|.	0.47414|.	0.1444|.	L|L	0.57536|0.57536	1.79|1.79	0.24971|0.24971	N|N	0.991666|0.991666	D;D|.	0.64830|.	0.994;0.994|.	P;P|.	0.61328|.	0.887;0.887|.	T|.	0.38714|.	-0.9648|.	10|.	0.51188|.	T|.	0.08|.	-16.2672|-16.2672	10.7393|10.7393	0.46143|0.46143	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	73;73|.	Q13261-3;Q13261|.	.;I15RA_HUMAN|.	A|W	37;73;37;37;73;73;73;73;37|43	ENSP00000380420:T37A;ENSP00000369312:T73A;ENSP00000380421:T37A;ENSP00000435454:T73A;ENSP00000435995:T73A;ENSP00000380426:T73A;ENSP00000395113:T73A;ENSP00000405107:T37A|.	ENSP00000322245:T37A|.	T|X	-|-	1|3	0|0	IL15RA|IL15RA	6048180|6048180	0.998000|0.998000	0.40836|0.40836	0.968000|0.968000	0.41197|0.41197	0.304000|0.304000	0.27724|0.27724	3.427000|3.427000	0.52785|0.52785	1.783000|1.783000	0.52377|0.52377	0.379000|0.379000	0.24179|0.24179	ACG|TGA	.		0.557	IL15RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046615.2	NM_172200, NM_002189	
BMS1	9790	ucsc.edu	37	10	43315737	43315737	+	Missense_Mutation	SNP	G	G	T			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr10:43315737G>T	ENST00000374518.5	+	16	2697	c.2634G>T	c.(2632-2634)gaG>gaT	p.E878D		NM_014753.3	NP_055568.3	Q14692	BMS1_HUMAN	BMS1 ribosome biogenesis factor	878					ribosome assembly (GO:0042255)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(23)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						TTCAGTATGAGGGTTTTCGAC	0.433																																					p.E878D													.	BMS1-93	0			c.G2634T						.						120.0	118.0	118.0					10																	43315737		2203	4300	6503	SO:0001583	missense	9790	exon16			GTATGAGGGTTTT	BC043345	CCDS7199.1	10q11.21	2013-05-01	2013-05-01	2007-03-20	ENSG00000165733	ENSG00000165733			23505	protein-coding gene	gene with protein product		611448	"""BMS1-like, ribosome assembly protein (yeast)"", ""BMS1 homolog, ribosome assembly protein (yeast)"""	BMS1L		11779832	Standard	NM_014753		Approved	KIAA0187	uc001jaj.3	Q14692	OTTHUMG00000018020	ENST00000374518.5:c.2634G>T	10.37:g.43315737G>T	ENSP00000363642:p.Glu878Asp	Somatic	190	4		WXS	Illumina HiSeq		181	4	NM_014753	0	0	72	109	37	Q5QPT5|Q86XJ9	Missense_Mutation	SNP	ENST00000374518.5	37	CCDS7199.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.115516	0.77323	.	.	ENSG00000165733	ENST00000374518	T	0.17854	2.25	5.05	-4.55	0.03441	Ribosome biogenesis protein BMS1/TSR1, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.38506	0.1043	M	0.92122	3.275	0.47778	D	0.999516	D	0.53462	0.96	P	0.58077	0.832	T	0.53995	-0.8359	10	0.39692	T	0.17	.	13.1374	0.59417	0.6341:0.0:0.3659:0.0	.	878	Q14692	BMS1_HUMAN	D	878	ENSP00000363642:E878D	ENSP00000363642:E878D	E	+	3	2	BMS1	42635743	0.998000	0.40836	0.969000	0.41365	0.964000	0.63967	0.474000	0.22148	-0.725000	0.04901	-0.396000	0.06452	GAG	.		0.433	BMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047690.2	NM_014753	
TYSND1	219743	hgsc.bcm.edu	37	10	71906010	71906010	+	Silent	SNP	C	C	G	rs11549688	byFrequency	TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr10:71906010C>G	ENST00000287078.6	-	1	332	c.333G>C	c.(331-333)gcG>gcC	p.A111A	TYSND1_ENST00000494143.1_5'Flank|TYSND1_ENST00000335494.5_Silent_p.A111A	NM_173555.2	NP_775826.2	Q2T9J0	TYSD1_HUMAN	trypsin domain containing 1	111		Cleavage. {ECO:0000250}.			protein homooligomerization (GO:0051260)|protein processing (GO:0016485)|proteolysis (GO:0006508)|regulation of fatty acid beta-oxidation (GO:0031998)	membrane (GO:0016020)|peroxisome (GO:0005777)	identical protein binding (GO:0042802)|protease binding (GO:0002020)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|large_intestine(2)|liver(1)|lung(3)|prostate(1)	9						GCTCGAGGCTCGCGCACTGGG	0.791													C|||	169	0.033746	0.0265	0.0072	5008	,	,		9519	0.0526		0.0368	False		,,,				2504	0.0399				p.A111A		.											.	TYSND1-135	0			c.G333C						.	C	,	40,2142		0,40,1051	1.0	2.0	2.0		333,333	-5.2	0.0	10	dbSNP_120	2	121,4671		0,121,2275	no	coding-synonymous,coding-synonymous	TYSND1	NM_001040273.1,NM_173555.2	,	0,161,3326	GG,GC,CC		2.525,1.8332,2.3086	,	111/399,111/567	71906010	161,6813	1091	2396	3487	SO:0001819	synonymous_variant	219743	exon1			GAGGCTCGCGCAC	BC016840	CCDS31213.1, CCDS31214.1	10q22.1	2009-11-06		2006-09-21	ENSG00000156521	ENSG00000156521			28531	protein-coding gene	gene with protein product		611017				17255948	Standard	NM_173555		Approved	MGC34695, NET41	uc001jqr.4	Q2T9J0	OTTHUMG00000018397	ENST00000287078.6:c.333G>C	10.37:g.71906010C>G		Somatic	2	0		WXS	Illumina HiSeq	Phase_I	4	3	NM_173555	0	0	1	1	0	Q5SQT4|Q5SQU1|Q8N6H2|Q96AR5	Silent	SNP	ENST00000287078.6	37	CCDS31213.1																																																																																			C|0.964;G|0.036		0.791	TYSND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048483.1	NM_173555	
VDAC2	7417	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	10	76980587	76980587	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr10:76980587C>T	ENST00000332211.6	+	7	656	c.443C>T	c.(442-444)gCa>gTa	p.A148V	VDAC2_ENST00000313132.4_Missense_Mutation_p.A163V|VDAC2_ENST00000535553.1_Missense_Mutation_p.A109V|VDAC2_ENST00000472137.1_3'UTR|VDAC2_ENST00000543351.1_Missense_Mutation_p.A148V	NM_003375.3	NP_003366.2	P45880	VDAC2_HUMAN	voltage-dependent anion channel 2	148					anion transport (GO:0006820)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of protein polymerization (GO:0032272)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|pore complex (GO:0046930)	nucleotide binding (GO:0000166)|porin activity (GO:0015288)|voltage-gated anion channel activity (GO:0008308)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(1)|ovary(1)|pancreas(2)|prostate(1)|urinary_tract(1)	10	all_cancers(46;0.0642)|all_epithelial(25;0.00604)|Prostate(51;0.0112)|Ovarian(15;0.183)				Dihydroxyaluminium(DB01375)	GCTGGACCTGCAATCCATGGT	0.418																																					p.A163V		.											.	VDAC2-93	0			c.C488T						.						97.0	95.0	95.0					10																	76980587		2203	4297	6500	SO:0001583	missense	7417	exon8			GACCTGCAATCCA	BC000165	CCDS7348.1, CCDS53544.1	10q22	2011-11-15			ENSG00000165637	ENSG00000165637		"""Voltage-dependent anion channels"""	12672	protein-coding gene	gene with protein product		193245				7517385, 10049775	Standard	NM_003375		Approved		uc021ptp.1	P45880	OTTHUMG00000018517	ENST00000332211.6:c.443C>T	10.37:g.76980587C>T	ENSP00000361686:p.Ala148Val	Somatic	165	0		WXS	Illumina HiSeq	Phase_I	129	20	NM_001184783	0	0	164	284	120	Q5VWK1|Q5VWK3|Q6IB40|Q7L3J5|Q9BWK8|Q9Y5I6	Missense_Mutation	SNP	ENST00000332211.6	37	CCDS7348.1	.	.	.	.	.	.	.	.	.	.	C	14.32	2.501060	0.44455	.	.	ENSG00000165637	ENST00000298468;ENST00000543351;ENST00000344036;ENST00000332211;ENST00000535553;ENST00000313132;ENST00000447677	T;T;T;T;T;T;T	0.40756	1.02;1.02;1.02;1.02;1.02;1.02;1.02	5.48	5.48	0.80851	.	0.050056	0.85682	D	0.000000	T	0.26304	0.0642	N	0.05441	-0.05	0.58432	D	0.999999	B;B;B	0.21520	0.025;0.036;0.057	B;B;B	0.22880	0.019;0.036;0.042	T	0.10474	-1.0628	10	0.12766	T	0.61	.	19.3533	0.94401	0.0:1.0:0.0:0.0	.	109;163;148	B4DKM5;P45880-1;P45880	.;.;VDAC2_HUMAN	V	148;148;148;148;109;163;148	ENSP00000298468:A148V;ENSP00000443092:A148V;ENSP00000344876:A148V;ENSP00000361686:A148V;ENSP00000445901:A109V;ENSP00000361635:A163V;ENSP00000401492:A148V	ENSP00000298468:A148V	A	+	2	0	VDAC2	76650593	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.013000	0.70776	2.588000	0.87417	0.563000	0.77884	GCA	.		0.418	VDAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048792.1	NM_003375	
BTAF1	9044	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	93773747	93773747	+	Missense_Mutation	SNP	A	A	T			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr10:93773747A>T	ENST00000265990.6	+	32	4853	c.4545A>T	c.(4543-4545)aaA>aaT	p.K1515N	BTAF1_ENST00000544642.1_Missense_Mutation_p.K343N	NM_003972.2	NP_003963.1	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa	1515					negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(6)	59		Colorectal(252;0.0846)				TTCCACCTAAAATTATTCAAG	0.368																																					p.K1515N		.											.	BTAF1-92	0			c.A4545T						.						134.0	144.0	140.0					10																	93773747		2203	4300	6503	SO:0001583	missense	9044	exon32			ACCTAAAATTATT	AJ001017	CCDS7419.1	10q22-q23	2013-05-01	2013-05-01		ENSG00000095564	ENSG00000095564			17307	protein-coding gene	gene with protein product	"""Mot1 homolog (S. cerevisiae)"""	605191	"""BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170 kD (Mot1 homolog, S. cerevisiae)"""			9342322, 9488487	Standard	NM_003972		Approved	TAFII170, TAF172, MOT1, TAF-172, TAF(II)170	uc001khr.3	O14981	OTTHUMG00000018752	ENST00000265990.6:c.4545A>T	10.37:g.93773747A>T	ENSP00000265990:p.Lys1515Asn	Somatic	262	0		WXS	Illumina HiSeq	Phase_I	184	23	NM_003972	0	0	7	7	0	B4E0W6|O43578	Missense_Mutation	SNP	ENST00000265990.6	37	CCDS7419.1	.	.	.	.	.	.	.	.	.	.	A	22.5	4.299734	0.81136	.	.	ENSG00000095564	ENST00000265990;ENST00000544642;ENST00000538688	D;D	0.94723	-3.5;-3.5	5.8	5.8	0.92144	SNF2-related (1);	0.050554	0.85682	D	0.000000	D	0.98726	0.9572	H	0.99719	4.725	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99525	1.0959	10	0.87932	D	0	-21.227	16.2031	0.82102	1.0:0.0:0.0:0.0	.	1515	O14981	BTAF1_HUMAN	N	1515;343;365	ENSP00000265990:K1515N;ENSP00000439924:K343N	ENSP00000265990:K1515N	K	+	3	2	BTAF1	93763727	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.660000	0.68018	2.231000	0.72958	0.524000	0.50904	AAA	.		0.368	BTAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049380.4	NM_003972	
MMS19	64210	broad.mit.edu	37	10	99222420	99222420	+	Silent	SNP	C	C	T			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr10:99222420C>T	ENST00000438925.2	-	20	2267	c.1932G>A	c.(1930-1932)ctG>ctA	p.L644L	MMS19_ENST00000370782.2_Silent_p.L644L|MMS19_ENST00000327277.7_Silent_p.L280L|MMS19_ENST00000327238.10_Silent_p.L546L|MMS19_ENST00000355839.6_Silent_p.L601L	NM_022362.4	NP_071757.4	Q96T76	MMS19_HUMAN	MMS19 nucleotide excision repair homolog (S. cerevisiae)	644					cellular response to DNA damage stimulus (GO:0006974)|chromosome segregation (GO:0007059)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|iron-sulfur cluster assembly (GO:0016226)|nucleotide-excision repair (GO:0006289)|phosphorelay signal transduction system (GO:0000160)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	CIA complex (GO:0097361)|cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|membrane (GO:0016020)|MMXD complex (GO:0071817)|nucleus (GO:0005634)|spindle (GO:0005819)	estrogen receptor binding (GO:0030331)|protein binding, bridging (GO:0030674)|receptor signaling complex scaffold activity (GO:0030159)|transcription coactivator activity (GO:0003713)			endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|prostate(1)|stomach(1)	16		Colorectal(252;0.0846)		Epithelial(162;3.33e-10)|all cancers(201;2.74e-08)		GTACTTTTCTCAGAACTGAGG	0.468								Direct reversal of damage																													p.L644L													.	.	0			c.G1932A						.						165.0	135.0	145.0					10																	99222420		2203	4300	6503	SO:0001819	synonymous_variant	64210	exon20			TTTTCTCAGAACT	AF007151	CCDS7464.1, CCDS73177.1	10q24-q25	2007-08-15	2007-08-15	2007-08-15	ENSG00000155229	ENSG00000155229			13824	protein-coding gene	gene with protein product	"""MET18 homolog (S. cerevisiae)"""	614777		MMS19L		11071939	Standard	NM_022362		Approved	MET18, hMMS19	uc001kns.4	Q96T76	OTTHUMG00000018857	ENST00000438925.2:c.1932G>A	10.37:g.99222420C>T		Somatic	58	0		WXS	Illumina HiSeq	Phase_I	36	4	NM_022362	0	0	18	25	7	B0QZ75|B3KPE5|B4DQX2|B4E2I3|D3DR55|F8W9Y2|Q17RZ8|Q5T455|Q66K82|Q7L4W8|Q969Z1|Q96DF1|Q96MR1|Q96RK5|Q96SK1|Q9BUE2|Q9BYS9	Silent	SNP	ENST00000438925.2	37	CCDS7464.1																																																																																			.		0.468	MMS19-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049706.2		
PSD	5662	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	104176443	104176443	+	Missense_Mutation	SNP	G	G	C			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr10:104176443G>C	ENST00000020673.5	-	2	879	c.353C>G	c.(352-354)cCt>cGt	p.P118R	PSD_ENST00000406432.1_Missense_Mutation_p.P118R|PSD_ENST00000492902.2_5'Flank	NM_001270966.1|NM_002779.4	NP_001257895.1|NP_002770.3	A5PKW4	PSD1_HUMAN	pleckstrin and Sec7 domain containing	118	Pro-rich.				neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)|signal transducer activity (GO:0004871)			breast(4)|endometrium(2)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				Epithelial(162;1.27e-08)|all cancers(201;2.85e-07)		CCCTGGAGCAGGTAGCCCATT	0.657																																					p.P118R		.											.	PSD-272	0			c.C353G						.						29.0	33.0	32.0					10																	104176443		2203	4296	6499	SO:0001583	missense	5662	exon3			GGAGCAGGTAGCC	X99688	CCDS31272.1, CCDS73187.1	10q24	2013-01-10	2004-04-28		ENSG00000059915	ENSG00000059915		"""Pleckstrin homology (PH) domain containing"""	9507	protein-coding gene	gene with protein product		602327	"""pleckstrin and Sec7 domain protein"""			9417912	Standard	NM_002779		Approved	KIAA2011, TYL, PSD1	uc009xxd.2	A5PKW4	OTTHUMG00000018954	ENST00000020673.5:c.353C>G	10.37:g.104176443G>C	ENSP00000020673:p.Pro118Arg	Somatic	90	0		WXS	Illumina HiSeq	Phase_I	81	17	NM_001270965	0	0	0	0	0	B1AKX7|D3DR87|Q15673|Q8IVG0	Missense_Mutation	SNP	ENST00000020673.5	37	CCDS31272.1	.	.	.	.	.	.	.	.	.	.	G	18.29	3.592108	0.66219	.	.	ENSG00000059915	ENST00000020673;ENST00000406432	T;T	0.28666	1.6;1.6	4.36	4.36	0.52297	.	0.109296	0.37483	N	0.002079	T	0.30665	0.0772	N	0.08118	0	0.35207	D	0.774816	D	0.62365	0.991	P	0.58013	0.831	T	0.51068	-0.8752	10	0.66056	D	0.02	.	15.5617	0.76253	0.0:0.0:1.0:0.0	.	118	A5PKW4	PSD1_HUMAN	R	118	ENSP00000020673:P118R;ENSP00000384830:P118R	ENSP00000020673:P118R	P	-	2	0	PSD	104166433	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	2.473000	0.45145	2.375000	0.81037	0.561000	0.74099	CCT	.		0.657	PSD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050041.2		
BRSK2	9024	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	1459605	1459605	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr11:1459605G>A	ENST00000528841.1	+	3	640	c.256G>A	c.(256-258)Gaa>Aaa	p.E86K	BRSK2_ENST00000526678.1_Missense_Mutation_p.E86K|BRSK2_ENST00000382179.1_Missense_Mutation_p.E132K|BRSK2_ENST00000308219.9_Missense_Mutation_p.E86K|BRSK2_ENST00000528710.1_Missense_Mutation_p.E26K|BRSK2_ENST00000308230.5_Missense_Mutation_p.E86K|BRSK2_ENST00000531197.1_Missense_Mutation_p.E86K			Q8IWQ3	BRSK2_HUMAN	BR serine/threonine kinase 2	86	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|axonogenesis (GO:0007409)|establishment of cell polarity (GO:0030010)|exocytosis (GO:0006887)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|mitotic nuclear division (GO:0007067)|neuron differentiation (GO:0030182)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			endometrium(4)|large_intestine(1)|lung(5)	10		all_epithelial(84;4.17e-05)|Breast(177;0.000307)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00144)|Lung(200;0.0713)|LUSC - Lung squamous cell carcinoma(625;0.0842)		CGACGTTTATGAAAACAAAAA	0.567																																					p.E132K		.											.	BRSK2-333	0			c.G394A						.						94.0	104.0	101.0					11																	1459605		2156	4273	6429	SO:0001583	missense	9024	exon3			GTTTATGAAAACA	AF020089	CCDS41590.1, CCDS58106.1, CCDS58107.1, CCDS58108.1, CCDS60696.1	11p15.5	2008-02-05	2003-09-11	2005-01-27	ENSG00000174672	ENSG00000174672			11405	protein-coding gene	gene with protein product	"""serine/threonine kinase 29"""	609236	"""chromsosome 11 open reading frame 7"""	C11orf7, STK29		9852686, 9929968	Standard	NM_001256629		Approved	PEN11B	uc001ltm.4	Q8IWQ3	OTTHUMG00000167089	ENST00000528841.1:c.256G>A	11.37:g.1459605G>A	ENSP00000432000:p.Glu86Lys	Somatic	136	0		WXS	Illumina HiSeq	Phase_I	127	15	NM_001256630	0	0	0	0	0	B3KVE9|E9PLM7|O60843|O95099|Q5J5B4|Q6ZMQ4|Q8TB60	Missense_Mutation	SNP	ENST00000528841.1	37	CCDS58107.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.766637	0.90020	.	.	ENSG00000174672	ENST00000308219;ENST00000531197;ENST00000308230;ENST00000528841;ENST00000526678;ENST00000528596;ENST00000524702;ENST00000528710;ENST00000382179	T;T;T;T;T;T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21;-0.21;-0.21;-0.21;-0.21;-0.21	2.57	2.57	0.30868	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.063288	0.64402	U	0.000008	T	0.78457	0.4286	M	0.71581	2.175	0.80722	D	1	P;D;B;D;D	0.71674	0.64;0.998;0.411;0.966;0.958	P;D;B;D;P	0.78314	0.602;0.991;0.354;0.923;0.875	T	0.81289	-0.1000	10	0.87932	D	0	.	12.2615	0.54652	0.0:0.0:1.0:0.0	.	86;132;86;86;86	Q8IWQ3-4;Q8IWQ3-5;Q8IWQ3-3;Q8IWQ3;Q8IWQ3-2	.;.;.;BRSK2_HUMAN;.	K	86;86;86;86;86;26;26;26;132	ENSP00000310697:E86K;ENSP00000431152:E86K;ENSP00000310805:E86K;ENSP00000432000:E86K;ENSP00000433370:E86K;ENSP00000434075:E26K;ENSP00000432672:E26K;ENSP00000433235:E26K;ENSP00000371614:E132K	ENSP00000310697:E86K	E	+	1	0	BRSK2	1416181	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.575000	0.74018	1.455000	0.47813	0.313000	0.20887	GAA	.		0.567	BRSK2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000393033.1	NM_003957	
FBXO3	26273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	33770334	33770334	+	Missense_Mutation	SNP	G	G	T			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr11:33770334G>T	ENST00000265651.3	-	9	1055	c.1037C>A	c.(1036-1038)cCt>cAt	p.P346H	FBXO3_ENST00000530401.1_Missense_Mutation_p.P341H|FBXO3_ENST00000534136.1_Missense_Mutation_p.P346H|FBXO3_ENST00000531080.1_Missense_Mutation_p.P33H|FBXO3_ENST00000526785.1_Missense_Mutation_p.P233H|FBXO3_ENST00000532057.1_Missense_Mutation_p.P33H|FBXO3_ENST00000448981.2_Missense_Mutation_p.P346H	NM_012175.3	NP_036307.2	Q9UK99	FBX3_HUMAN	F-box protein 3	346	ApaG. {ECO:0000255|PROSITE- ProRule:PRU00412}.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|pancreas(1)|stomach(1)	13		Lung NSC(402;0.0804)		BRCA - Breast invasive adenocarcinoma(625;0.00315)|Lung(977;0.00488)|LUSC - Lung squamous cell carcinoma(625;0.008)		AACTACTCCAGGTCCTTGAAC	0.368																																					p.P346H		.											.	FBXO3-227	0			c.C1037A						.						103.0	102.0	102.0					11																	33770334		2202	4298	6500	SO:0001583	missense	26273	exon9			ACTCCAGGTCCTT	AK001943	CCDS7887.1, CCDS44566.1	11p13	2006-07-07	2004-06-15		ENSG00000110429	ENSG00000110429		"""F-boxes /  ""other"""""	13582	protein-coding gene	gene with protein product		609089	"""F-box only protein 3"""			10531037	Standard	NM_033406		Approved	FBX3, FBA	uc001muz.3	Q9UK99	OTTHUMG00000166244	ENST00000265651.3:c.1037C>A	11.37:g.33770334G>T	ENSP00000265651:p.Pro346His	Somatic	103	0		WXS	Illumina HiSeq	Phase_I	79	17	NM_012175	0	0	0	0	0	B3KY16|D3DR05|Q86X90|Q9H0V2|Q9NUX2	Missense_Mutation	SNP	ENST00000265651.3	37	CCDS7887.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.768020	0.90020	.	.	ENSG00000110429	ENST00000526785;ENST00000265651;ENST00000530401;ENST00000531080;ENST00000532057;ENST00000534136;ENST00000448981	T;T;T;T;T	0.47869	0.84;0.83;0.86;0.86;0.87	5.61	5.61	0.85477	ApaG domain (4);	0.000000	0.85682	D	0.000000	T	0.70859	0.3272	M	0.77486	2.375	0.80722	D	1	P;P;D	0.89917	0.936;0.936;1.0	P;P;D	0.77004	0.64;0.64;0.989	T	0.69636	-0.5092	10	0.41790	T	0.15	-16.4467	19.6304	0.95699	0.0:0.0:1.0:0.0	.	341;346;346	Q9UK99-3;Q9UK99-2;Q9UK99	.;.;FBX3_HUMAN	H	233;346;341;33;33;346;346	ENSP00000435680:P233H;ENSP00000265651:P346H;ENSP00000433781:P341H;ENSP00000431745:P346H;ENSP00000408836:P346H	ENSP00000265651:P346H	P	-	2	0	FBXO3	33726910	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.230000	0.95299	2.663000	0.90544	0.491000	0.48974	CCT	.		0.368	FBXO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388665.1	NM_012175	
ACY3	91703	hgsc.bcm.edu;broad.mit.edu	37	11	67412339	67412339	+	Splice_Site	SNP	A	A	G			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr11:67412339A>G	ENST00000255082.3	-	7	806	c.636T>C	c.(634-636)ggT>ggC	p.G212G	ACY3_ENST00000529256.1_Splice_Site_p.G91G	NM_080658.1	NP_542389.1	Q96HD9	ACY3_HUMAN	aspartoacylase (aminocyclase) 3	212	Shielding domain. {ECO:0000250}.				viral process (GO:0016032)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	aminoacylase activity (GO:0004046)|hydrolase activity, acting on ester bonds (GO:0016788)|metal ion binding (GO:0046872)			endometrium(1)|lung(5)|prostate(2)	8					L-Aspartic Acid(DB00128)	GAAAGGCCGTACCTGTGTGGG	0.657																																					p.G212G	GBM(56;346 1011 27014 29495 46841)	.											.	ACY3-90	0			c.T636C						.						54.0	41.0	45.0					11																	67412339		2199	4289	6488	SO:0001630	splice_region_variant	91703	exon7			GGCCGTACCTGTG	BC008689	CCDS8175.1	11q13.2	2014-08-08			ENSG00000132744	ENSG00000132744			24104	protein-coding gene	gene with protein product		614413				14656720	Standard	NM_080658		Approved	HCBP1, MGC9740, ACY-3	uc001omq.3	Q96HD9	OTTHUMG00000167283	ENST00000255082.3:c.635-1T>C	11.37:g.67412339A>G		Somatic	21	0		WXS	Illumina HiSeq	Phase_I	24	3	NM_080658	0	0	0	0	0		Silent	SNP	ENST00000255082.3	37	CCDS8175.1																																																																																			.		0.657	ACY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394002.1	NM_080658	Silent
USP5	8078	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	6968684	6968684	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr12:6968684C>T	ENST00000229268.8	+	9	1161	c.1109C>T	c.(1108-1110)aCc>aTc	p.T370I	USP5_ENST00000389231.5_Missense_Mutation_p.T370I	NM_001098536.1	NP_001092006.1	P45974	UBP5_HUMAN	ubiquitin specific peptidase 5 (isopeptidase T)	370	USP.				positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)	lysosome (GO:0005764)	cysteine-type endopeptidase activity (GO:0004197)|omega peptidase activity (GO:0008242)|ubiquitin thiolesterase activity (GO:0004221)|zinc ion binding (GO:0008270)			breast(6)|endometrium(4)|kidney(2)|large_intestine(6)|lung(14)|skin(2)|urinary_tract(2)	36						ACGGACCCTACCCAGGATTTC	0.562																																					p.T370I		.											.	USP5-659	0			c.C1109T						.						91.0	83.0	86.0					12																	6968684		2203	4300	6503	SO:0001583	missense	8078	exon9			ACCCTACCCAGGA	U35116	CCDS31733.1, CCDS41743.1	12p13	2007-03-02	2005-08-08		ENSG00000111667	ENSG00000111667		"""Ubiquitin-specific peptidases"""	12628	protein-coding gene	gene with protein product		601447	"""ubiquitin specific protease 5 (isopeptidase T)"""			12838346, 8723724	Standard	NM_003481		Approved	IsoT	uc001qri.4	P45974	OTTHUMG00000169233	ENST00000229268.8:c.1109C>T	12.37:g.6968684C>T	ENSP00000229268:p.Thr370Ile	Somatic	124	0		WXS	Illumina HiSeq	Phase_I	116	27	NM_003481	0	0	27	44	17	D3DUS7|D3DUS8|Q96J22	Missense_Mutation	SNP	ENST00000229268.8	37	CCDS41743.1	.	.	.	.	.	.	.	.	.	.	C	31	5.072808	0.93950	.	.	ENSG00000111667	ENST00000229268;ENST00000389231	T;T	0.29655	1.56;1.56	5.38	5.38	0.77491	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.046637	0.85682	D	0.000000	T	0.56232	0.1971	M	0.74546	2.27	0.80722	D	1	D;P	0.57899	0.981;0.534	D;P	0.66497	0.944;0.454	T	0.51560	-0.8690	10	0.39692	T	0.17	-8.4151	19.3333	0.94303	0.0:1.0:0.0:0.0	.	370;370	P45974;P45974-2	UBP5_HUMAN;.	I	370	ENSP00000229268:T370I;ENSP00000373883:T370I	ENSP00000229268:T370I	T	+	2	0	USP5	6838945	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.609000	0.82925	2.793000	0.96121	0.655000	0.94253	ACC	.		0.562	USP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402982.1		
ATF7IP	55729	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	14613823	14613823	+	Silent	SNP	C	C	T			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr12:14613823C>T	ENST00000540793.1	+	8	2708	c.2553C>T	c.(2551-2553)ccC>ccT	p.P851P	ATF7IP_ENST00000261168.4_Silent_p.P851P|ATF7IP_ENST00000543189.1_Silent_p.P850P|ATF7IP_ENST00000536444.1_Silent_p.P850P|ATF7IP_ENST00000541654.1_3'UTR|ATF7IP_ENST00000544627.1_Silent_p.P859P			Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting protein	851					DNA methylation (GO:0006306)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045898)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)				cervix(1)|endometrium(7)|kidney(5)|large_intestine(10)|liver(2)|lung(22)|ovary(1)|prostate(4)|skin(1)|urinary_tract(1)	54						CTTCTGTGCCCAGTCCTAGTA	0.488																																					p.P851P		.											.	ATF7IP-252	0			c.C2553T						.						173.0	147.0	156.0					12																	14613823		2203	4300	6503	SO:0001819	synonymous_variant	55729	exon9			TGTGCCCAGTCCT	AJ242978	CCDS8663.1, CCDS66326.1, CCDS66327.1, CCDS73449.1	12p13.1	2005-11-18				ENSG00000171681			20092	protein-coding gene	gene with protein product		613644				10976766, 10777215	Standard	XM_005253424		Approved	FLJ10688, p621	uc001rbw.3	Q6VMQ6		ENST00000540793.1:c.2553C>T	12.37:g.14613823C>T		Somatic	217	1		WXS	Illumina HiSeq	Phase_I	197	27	NM_018179	0	0	8	13	5	F5GX74|G3V1U0|Q4G0T9|Q6P3T3|Q86XW5|Q9NVJ9|Q9NWC2|Q9Y4X8	Silent	SNP	ENST00000540793.1	37	CCDS8663.1																																																																																			.		0.488	ATF7IP-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401400.1	NM_018179	
EIF4B	1975	hgsc.bcm.edu;broad.mit.edu	37	12	53431279	53431279	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr12:53431279C>T	ENST00000262056.9	+	11	1719	c.1393C>T	c.(1393-1395)Ccc>Tcc	p.P465S	RP11-983P16.4_ENST00000546566.1_RNA|EIF4B_ENST00000420463.3_Missense_Mutation_p.P470S|RP11-983P16.4_ENST00000550601.1_RNA|EIF4B_ENST00000416762.3_Missense_Mutation_p.P426S|RP11-983P16.4_ENST00000552905.1_RNA	NM_001417.4	NP_001408.2	P23588	IF4B_HUMAN	eukaryotic translation initiation factor 4B	465					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation initiation factor activity (GO:0003743)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(10)|stomach(1)|upper_aerodigestive_tract(1)	22						TTCTAAACCTCCCAAACCTGA	0.493																																					p.P465S		.											.	EIF4B-568	0			c.C1393T						.						20.0	20.0	20.0					12																	53431279		1805	4043	5848	SO:0001583	missense	1975	exon11			AAACCTCCCAAAC	X55733	CCDS41788.1, CCDS73474.1	12q13.13	2013-02-12			ENSG00000063046	ENSG00000063046		"""RNA binding motif (RRM) containing"""	3285	protein-coding gene	gene with protein product		603928					Standard	XM_005268709		Approved		uc001sbh.4	P23588	OTTHUMG00000169570	ENST00000262056.9:c.1393C>T	12.37:g.53431279C>T	ENSP00000262056:p.Pro465Ser	Somatic	70	0		WXS	Illumina HiSeq	Phase_I	58	7	NM_001417	0	0	248	396	148	Q4G0E3|Q53HQ2|Q6GPH5|Q6IB46|Q8WYK5	Missense_Mutation	SNP	ENST00000262056.9	37	CCDS41788.1	.	.	.	.	.	.	.	.	.	.	C	15.52	2.856483	0.51376	.	.	ENSG00000063046	ENST00000262056;ENST00000420463;ENST00000430205;ENST00000416762	T;T;T	0.36878	1.23;1.23;1.23	5.2	5.2	0.72013	.	0.418940	0.24195	N	0.040661	T	0.36771	0.0979	L	0.57536	1.79	0.54753	D	0.999988	P;P;B;P	0.47106	0.89;0.473;0.002;0.825	B;B;B;B	0.42062	0.374;0.091;0.008;0.207	T	0.10405	-1.0631	10	0.15952	T	0.53	.	17.0418	0.86491	0.0:1.0:0.0:0.0	.	426;470;441;465	B4DS13;E7EX17;E7EPC9;P23588	.;.;.;IF4B_HUMAN	S	465;470;441;426	ENSP00000262056:P465S;ENSP00000388806:P470S;ENSP00000412530:P426S	ENSP00000262056:P465S	P	+	1	0	EIF4B	51717546	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	1.816000	0.38992	2.810000	0.96702	0.585000	0.79938	CCC	.		0.493	EIF4B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404852.2	NM_001417	
IRS2	8660	hgsc.bcm.edu	37	13	110435756	110435756	+	Missense_Mutation	SNP	C	C	G	rs201499247	byFrequency	TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr13:110435756C>G	ENST00000375856.3	-	1	3159	c.2645G>C	c.(2644-2646)gGc>gCc	p.G882A		NM_003749.2	NP_003740.2	Q9Y4H2	IRS2_HUMAN	insulin receptor substrate 2	882			G -> A. {ECO:0000269|Ref.5}.		brain development (GO:0007420)|cell proliferation (GO:0008283)|cellular response to glucose stimulus (GO:0071333)|cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid homeostasis (GO:0055088)|mammary gland development (GO:0030879)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of kinase activity (GO:0033673)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin secretion (GO:0032024)|positive regulation of mesenchymal cell proliferation (GO:0002053)|regulation of lipid metabolic process (GO:0019216)|response to glucose (GO:0009749)|signal transduction (GO:0007165)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)			kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	19	all_cancers(4;7.57e-15)|all_epithelial(4;5.91e-09)|all_lung(23;7.64e-07)|Lung NSC(43;0.000183)|Colorectal(4;0.00159)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0155)	Breast(118;0.159)	all cancers(43;0.00815)|BRCA - Breast invasive adenocarcinoma(86;0.11)|Epithelial(84;0.127)|GBM - Glioblastoma multiforme(44;0.147)			GCCGCGCTGGCCCAAGAAGCC	0.766													.|||	10	0.00199681	0.0	0.0043	5008	,	,		7396	0.0		0.007	False		,,,				2504	0.0				p.G882A	Melanoma(100;613 2409 40847)	.											.	IRS2-1334	0			c.G2645C						.	C	ALA/GLY	1,3269		0,1,1634	2.0	3.0	2.0		2645	-5.4	0.0	13		2	7,6747		0,7,3370	no	missense	IRS2	NM_003749.2	60	0,8,5004	GG,GC,CC		0.1036,0.0306,0.0798	benign	882/1339	110435756	8,10016	1635	3377	5012	SO:0001583	missense	8660	exon1			CGCTGGCCCAAGA	AB000732	CCDS9510.1	13q34	2013-01-10			ENSG00000185950	ENSG00000185950		"""Pleckstrin homology (PH) domain containing"""	6126	protein-coding gene	gene with protein product		600797				9312143	Standard	NM_003749		Approved		uc001vqv.3	Q9Y4H2	OTTHUMG00000017338	ENST00000375856.3:c.2645G>C	13.37:g.110435756C>G	ENSP00000365016:p.Gly882Ala	Somatic	1	1		WXS	Illumina HiSeq	Phase_I	10	5	NM_003749	0	0	0	0	0	Q96RR2|Q9BZG0|Q9Y6I5	Missense_Mutation	SNP	ENST00000375856.3	37	CCDS9510.1	.	.	.	.	.	.	.	.	.	.	C	0.069	-1.206226	0.01568	3.06E-4	0.001036	ENSG00000185950	ENST00000375856	T	0.42513	0.97	4.36	-5.38	0.02673	.	1.016690	0.07871	U	0.967985	T	0.18002	0.0432	N	0.16478	0.41	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.30031	-0.9992	10	0.08837	T	0.75	-1.9461	4.3158	0.10993	0.1295:0.4165:0.3472:0.1068	.	882	Q9Y4H2	IRS2_HUMAN	A	882	ENSP00000365016:G882A	ENSP00000365016:G882A	G	-	2	0	IRS2	109233757	0.005000	0.15991	0.014000	0.15608	0.112000	0.19704	0.077000	0.14738	-0.678000	0.05224	0.561000	0.74099	GGC	.		0.766	IRS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045755.1	NM_003749	
CGRRF1	10668	ucsc.edu	37	14	55005042	55005042	+	Missense_Mutation	SNP	G	G	C			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr14:55005042G>C	ENST00000216420.7	+	6	1072	c.940G>C	c.(940-942)Gaa>Caa	p.E314Q		NM_006568.2	NP_006559.1	Q99675	CGRF1_HUMAN	cell growth regulator with ring finger domain 1	314					cell cycle arrest (GO:0007050)|negative regulation of cell proliferation (GO:0008285)|response to stress (GO:0006950)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|lung(5)|ovary(2)|stomach(1)	13						GTTTGTTCAGGAATCTTTTGC	0.423																																					p.E314Q													.	CGRRF1-91	0			c.G940C						.						97.0	89.0	92.0					14																	55005042		2203	4300	6503	SO:0001583	missense	10668	exon6			GTTCAGGAATCTT	BC015063	CCDS9719.1	14q22.2	2013-09-20			ENSG00000100532	ENSG00000100532		"""RING-type (C3HC4) zinc fingers"""	15528	protein-coding gene	gene with protein product		606138				8968090	Standard	NM_006568		Approved	CGR19, RNF197	uc001xay.3	Q99675	OTTHUMG00000140308	ENST00000216420.7:c.940G>C	14.37:g.55005042G>C	ENSP00000216420:p.Glu314Gln	Somatic	79	0		WXS	Illumina HiSeq		87	4	NM_006568	0	0	14	16	2	Q96BX2	Missense_Mutation	SNP	ENST00000216420.7	37	CCDS9719.1	.	.	.	.	.	.	.	.	.	.	G	19.56	3.850667	0.71719	.	.	ENSG00000100532	ENST00000216420	T	0.67523	-0.27	5.23	3.42	0.39159	Zinc finger, RING/FYVE/PHD-type (1);	0.046947	0.85682	D	0.000000	T	0.60064	0.2240	N	0.25094	0.71	0.43088	D	0.994752	D	0.54601	0.967	P	0.52159	0.691	T	0.57329	-0.7830	10	0.33141	T	0.24	-14.1511	11.656	0.51318	0.143:0.0:0.857:0.0	.	314	Q99675	CGRF1_HUMAN	Q	314	ENSP00000216420:E314Q	ENSP00000216420:E314Q	E	+	1	0	CGRRF1	54074792	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	7.236000	0.78154	0.794000	0.33899	0.462000	0.41574	GAA	.		0.423	CGRRF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276905.2	NM_006568	
GPR135	64582	hgsc.bcm.edu	37	14	59931931	59931931	+	Missense_Mutation	SNP	T	T	G	rs1752428	byFrequency	TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr14:59931931T>G	ENST00000395116.1	-	1	129	c.14A>C	c.(13-15)cAg>cCg	p.Q5P		NM_022571.5	NP_072093.2	Q8IZ08	GP135_HUMAN	G protein-coupled receptor 135	5			Q -> P (in dbSNP:rs1752428).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(1)|large_intestine(1)|liver(1)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13				OV - Ovarian serous cystadenocarcinoma(108;0.134)		GCGGGGCGGCTGCGGCTCCTC	0.781													G|||	2695	0.538139	0.8767	0.5821	5008	,	,		8009	0.2063		0.4722	False		,,,				2504	0.4591				p.Q5P		.											.	GPR135-90	0			c.A14C						.						1.0	1.0	1.0					14																	59931931		555	1498	2053	SO:0001583	missense	64582	exon1			GGCGGCTGCGGCT	AY288418	CCDS9738.1	14q23.1	2012-08-21			ENSG00000181619	ENSG00000181619		"""GPCR / Class A : Orphans"""	19991	protein-coding gene	gene with protein product		607970				14623098	Standard	NM_022571		Approved	HUMNPIIY20, PAFR	uc010apj.3	Q8IZ08	OTTHUMG00000140325	ENST00000395116.1:c.14A>C	14.37:g.59931931T>G	ENSP00000378548:p.Gln5Pro	Somatic	1	1		WXS	Illumina HiSeq	Phase_I	4	4	NM_022571	0	0	0	0	0	Q7Z604|Q86SM3|Q8NH39	Missense_Mutation	SNP	ENST00000395116.1	37	CCDS9738.1	1023	0.4684065934065934	376	0.7642276422764228	199	0.5497237569060773	107	0.18706293706293706	341	0.449868073878628	G	12.20	1.867217	0.32977	.	.	ENSG00000181619	ENST00000395116	T	0.62941	-0.01	3.25	3.25	0.37280	.	.	.	.	.	T	0.00012	0.0000	N	0.03608	-0.345	0.09310	P	0.9999999999999688	B	0.02656	0.0	B	0.01281	0.0	T	0.36311	-0.9753	8	0.35671	T	0.21	-4.9918	9.4599	0.38778	0.0:0.0:0.7862:0.2138	rs1752428;rs3742644	5	Q8IZ08	GP135_HUMAN	P	5	ENSP00000378548:Q5P	ENSP00000378548:Q5P	Q	-	2	0	GPR135	59001684	0.007000	0.16637	0.970000	0.41538	0.076000	0.17211	-0.908000	0.04063	0.581000	0.29539	-0.677000	0.03784	CAG	T|0.531;G|0.469		0.781	GPR135-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276941.1	NM_022571	
SYNE2	23224	broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	64633998	64633998	+	Silent	SNP	G	G	A			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr14:64633998G>A	ENST00000344113.4	+	91	16865	c.16653G>A	c.(16651-16653)ttG>ttA	p.L5551L	SYNE2_ENST00000357395.3_Silent_p.L1936L|SYNE2_ENST00000394768.2_Silent_p.L1936L|SYNE2_ENST00000554584.1_Silent_p.L5426L|SYNE2_ENST00000555002.1_Silent_p.L2185L|SYNE2_ENST00000358025.3_Silent_p.L5551L|ESR2_ENST00000542956.1_Intron	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	5551					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TTGAACATTTGAATGAAGTGA	0.438																																					p.L5551L													.	SYNE2-164	0			c.G16653A						.						65.0	61.0	63.0					14																	64633998		2203	4300	6503	SO:0001819	synonymous_variant	23224	exon91			ACATTTGAATGAA	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.16653G>A	14.37:g.64633998G>A		Somatic	79	0		WXS	Illumina HiSeq	Phase_I	57	5	NM_182914	0	0	8	16	8	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Silent	SNP	ENST00000344113.4	37	CCDS41963.1																																																																																			.		0.438	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
TRIP11	9321	ucsc.edu;bcgsc.ca	37	14	92480875	92480875	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr14:92480875C>T	ENST00000267622.4	-	7	1243	c.870G>A	c.(868-870)atG>atA	p.M290I		NM_004239.3	NP_004230.2	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	290					protein targeting to Golgi (GO:0000042)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|ventricular septum development (GO:0003281)	acrosomal membrane (GO:0002080)|cis-Golgi network (GO:0005801)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(2)|endometrium(1)|kidney(8)|large_intestine(12)|lung(17)|ovary(7)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	58				COAD - Colon adenocarcinoma(157;0.223)		TAGTTTTTTGCATCTCATAGA	0.284			T	PDGFRB	AML																																p.M290I	Ovarian(84;609 1888 9852 42686)			Dom	yes		14	14q31-q32	9321	thyroid hormone receptor interactor 11		L	.	TRIP11-1400	0			c.G870A						.						26.0	27.0	27.0					14																	92480875		2148	4260	6408	SO:0001583	missense	9321	exon7			TTTTTGCATCTCA	L40380	CCDS9899.1	14q31-q32	2008-05-02				ENSG00000100815			12305	protein-coding gene	gene with protein product		604505				7776974, 9373237	Standard	NM_004239		Approved	CEV14, Trip230, GMAP-210	uc001xzy.3	Q15643		ENST00000267622.4:c.870G>A	14.37:g.92480875C>T	ENSP00000267622:p.Met290Ile	Somatic	34	0		WXS	Illumina HiSeq		30	4	NM_004239	0	0	1	1	0	B2RUT2|O14689|O15154|O95949	Missense_Mutation	SNP	ENST00000267622.4	37	CCDS9899.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.38|11.38	1.621245|1.621245	0.28889|0.28889	.|.	.|.	ENSG00000100815|ENSG00000100815	ENST00000554357|ENST00000267622;ENST00000542257	.|T	.|0.60424	.|0.19	5.1|5.1	2.23|2.23	0.28157|0.28157	.|.	.|0.530450	.|0.21569	.|N	.|0.072438	T|T	0.45175|0.45175	0.1329|0.1329	L|L	0.35723|0.35723	1.085|1.085	0.25334|0.25334	N|N	0.989007|0.989007	.|B;B	.|0.06786	.|0.001;0.001	.|B;B	.|0.11329	.|0.002;0.006	T|T	0.38067|0.38067	-0.9678|-0.9678	5|10	.|0.41790	.|T	.|0.15	.|.	10.777|10.777	0.46356|0.46356	0.0:0.783:0.0:0.217|0.0:0.783:0.0:0.217	.|.	.|55;290	.|F5H1Z0;Q15643	.|.;TRIPB_HUMAN	T|I	35|290;55	.|ENSP00000267622:M290I	.|ENSP00000267622:M290I	A|M	-|-	1|3	0|0	TRIP11|TRIP11	91550628|91550628	0.998000|0.998000	0.40836|0.40836	0.526000|0.526000	0.27913|0.27913	0.849000|0.849000	0.48306|0.48306	1.269000|1.269000	0.33074|0.33074	0.651000|0.651000	0.30788|0.30788	0.555000|0.555000	0.69702|0.69702	GCA|ATG	.		0.284	TRIP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411823.1		
CLMN	79789	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	95670344	95670344	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr14:95670344C>T	ENST00000298912.4	-	9	1455	c.1342G>A	c.(1342-1344)Ggg>Agg	p.G448R		NM_024734.3	NP_079010.2	Q96JQ2	CLMN_HUMAN	calmin (calponin-like, transmembrane)	448					negative regulation of cell proliferation (GO:0008285)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(17)|prostate(3)|skin(3)	44				Epithelial(152;0.193)		CTTGGGCTCCCTTCAAAGCAA	0.483																																					p.G448R		.											.	CLMN-90	0			c.G1342A						.						87.0	82.0	84.0					14																	95670344		2203	4300	6503	SO:0001583	missense	79789	exon9			GGCTCCCTTCAAA	AB033014	CCDS9933.1	14q32.13	2012-10-02			ENSG00000165959	ENSG00000165959			19972	protein-coding gene	gene with protein product		611121				11386753	Standard	NM_024734		Approved	FLJ12383, KIAA1188, KIAA0500	uc001yef.2	Q96JQ2	OTTHUMG00000171629	ENST00000298912.4:c.1342G>A	14.37:g.95670344C>T	ENSP00000298912:p.Gly448Arg	Somatic	109	0		WXS	Illumina HiSeq	Phase_I	102	22	NM_024734	0	0	11	16	5	B2RAR7|Q9H713|Q9HA23|Q9HA57|Q9UFP4|Q9ULN2	Missense_Mutation	SNP	ENST00000298912.4	37	CCDS9933.1	.	.	.	.	.	.	.	.	.	.	C	11.56	1.673672	0.29693	.	.	ENSG00000165959	ENST00000298912	D	0.94537	-3.45	5.63	3.66	0.41972	.	0.000000	0.38837	N	0.001556	D	0.90896	0.7139	M	0.66939	2.045	0.18873	N	0.999986	P	0.37122	0.583	B	0.32342	0.144	D	0.86083	0.1545	10	0.87932	D	0	.	5.9466	0.19221	0.3449:0.5687:0.0:0.0864	.	448	Q96JQ2	CLMN_HUMAN	R	448	ENSP00000298912:G448R	ENSP00000298912:G448R	G	-	1	0	CLMN	94740097	0.137000	0.22531	0.209000	0.23619	0.021000	0.10359	0.357000	0.20199	1.337000	0.45525	0.655000	0.94253	GGG	.		0.483	CLMN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414518.2		
SPTBN5	51332	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	42149779	42149779	+	Missense_Mutation	SNP	C	C	G			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr15:42149779C>G	ENST00000320955.6	-	50	8583	c.8356G>C	c.(8356-8358)Gcc>Ccc	p.A2786P		NM_016642.2	NP_057726.4	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	2786					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi organization (GO:0007030)|lysosomal transport (GO:0007041)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|spectrin (GO:0008091)	actin binding (GO:0003779)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|kinesin binding (GO:0019894)|myosin tail binding (GO:0032029)|protein self-association (GO:0043621)|spectrin binding (GO:0030507)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(6)|lung(18)|ovary(5)|prostate(8)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	62		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		ACCTCACAGGCCTTCTGGAGC	0.652																																					p.A2751P		.											.	SPTBN5-91	0			c.G8251C						.						28.0	34.0	32.0					15																	42149779		2004	4170	6174	SO:0001583	missense	51332	exon50			CACAGGCCTTCTG	AF233523	CCDS61599.1	15q21	2010-08-17			ENSG00000137877	ENSG00000137877			15680	protein-coding gene	gene with protein product	"""beta V spectrin"""	605916				10764729	Standard	NM_016642		Approved	HUSPECV, BSPECV, HUBSPECV	uc001zos.4	Q9NRC6		ENST00000320955.6:c.8356G>C	15.37:g.42149779C>G	ENSP00000317790:p.Ala2786Pro	Somatic	21	0		WXS	Illumina HiSeq	Phase_I	23	8	NM_016642	0	0	0	0	0		Missense_Mutation	SNP	ENST00000320955.6	37		.	.	.	.	.	.	.	.	.	.	.	15.93	2.979532	0.53827	.	.	ENSG00000137877	ENST00000320955	T	0.39787	1.06	4.2	3.28	0.37604	.	0.000000	0.56097	D	0.000023	T	0.62720	0.2451	M	0.78049	2.395	0.19300	N	0.99998	D	0.89917	1.0	D	0.77004	0.989	T	0.56463	-0.7975	10	0.72032	D	0.01	.	12.048	0.53491	0.0:0.916:0.0:0.084	.	2786	Q9NRC6	SPTN5_HUMAN	P	2786	ENSP00000317790:A2786P	ENSP00000317790:A2786P	A	-	1	0	SPTBN5	39937071	0.983000	0.35010	0.020000	0.16555	0.009000	0.06853	2.620000	0.46410	0.977000	0.38444	0.467000	0.42956	GCC	.		0.652	SPTBN5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000420237.1	NM_016642	
SPG11	80208	hgsc.bcm.edu	37	15	44861660	44861660	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr15:44861660T>C	ENST00000261866.7	-	35	6537	c.6521A>G	c.(6520-6522)tAc>tGc	p.Y2174C	SPG11_ENST00000427534.2_Missense_Mutation_p.Y2174C|SPG11_ENST00000535302.2_Missense_Mutation_p.Y2061C	NM_025137.3	NP_079413.3	Q96JI7	SPTCS_HUMAN	spastic paraplegia 11 (autosomal recessive)	2174					cell death (GO:0008219)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	72		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		ATCAAATATGTATGTCATCTC	0.478																																					p.Y2174C		.											.	SPG11-95	0			c.A6521G						.						112.0	92.0	99.0					15																	44861660		2197	4298	6495	SO:0001583	missense	80208	exon35			AATATGTATGTCA		CCDS10112.1, CCDS53939.1	15q13-q15	2007-11-13			ENSG00000104133	ENSG00000104133			11226	protein-coding gene	gene with protein product	"""spatacsin"""	610844	"""KIAA1840"""	KIAA1840		10408536, 17322883	Standard	NM_001160227		Approved	FLJ21439	uc001ztx.3	Q96JI7	OTTHUMG00000131199	ENST00000261866.7:c.6521A>G	15.37:g.44861660T>C	ENSP00000261866:p.Tyr2174Cys	Somatic	32	0		WXS	Illumina HiSeq	Phase_I	19	2	NM_025137	0	0	36	36	0	A8KAX9|B9EK60|F5H3N6|Q4VC11|Q58G86|Q69YG6|Q6NW01|Q8N270|Q8TBU9|Q9H734	Missense_Mutation	SNP	ENST00000261866.7	37	CCDS10112.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.109125	0.77096	.	.	ENSG00000104133	ENST00000261866;ENST00000535302;ENST00000427534	D;T;D	0.85013	-1.91;-1.44;-1.93	6.07	6.07	0.98685	.	0.115539	0.64402	D	0.000010	D	0.91945	0.7449	M	0.76002	2.32	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.997;0.999;0.997;0.997	D	0.92596	0.6087	10	0.72032	D	0.01	.	15.1999	0.73126	0.0:0.0:0.0:1.0	.	2174;2061;2174;2174	C4B7M2;F5H3N6;C4B7M4;Q96JI7	.;.;.;SPTCS_HUMAN	C	2174;2061;2174	ENSP00000261866:Y2174C;ENSP00000445278:Y2061C;ENSP00000396110:Y2174C	ENSP00000261866:Y2174C	Y	-	2	0	SPG11	42648952	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.589000	0.82641	2.326000	0.78906	0.533000	0.62120	TAC	.		0.478	SPG11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253927.1		
ZNF598	90850	hgsc.bcm.edu	37	16	2059674	2059674	+	Missense_Mutation	SNP	T	T	C	rs71384660		TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr16:2059674T>C	ENST00000431526.1	-	2	88	c.74A>G	c.(73-75)gAa>gGa	p.E25G	ZNF598_ENST00000562103.1_5'UTR|ZNF598_ENST00000563630.1_5'UTR	NM_178167.2	NP_835461.2	Q86UK7	ZN598_HUMAN	zinc finger protein 598	25							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|lung(7)|skin(1)|urinary_tract(1)	16						GCTCCCGCCTTCCCGCTCAGG	0.766													C|||	5008	1.0	1.0	1.0	5008	,	,		5162	1.0		1.0	False		,,,				2504	1.0				p.E25G		.											.	ZNF598-432	0			c.A74G						.						1.0	2.0	2.0					16																	2059674		1089	2314	3403	SO:0001583	missense	90850	exon2			CCGCCTTCCCGCT	BC029270		16p13.3	2008-05-02				ENSG00000167962		"""Zinc fingers, C2H2-type"""	28079	protein-coding gene	gene with protein product							Standard	NM_178167		Approved	FLJ00086	uc002cof.2	Q86UK7		ENST00000431526.1:c.74A>G	16.37:g.2059674T>C	ENSP00000411409:p.Glu25Gly	Somatic	1	1		WXS	Illumina HiSeq	Phase_I	4	4	NM_178167	0	0	0	3	3	Q8IW49|Q8N3D9|Q96FG3|Q9H7J3	Missense_Mutation	SNP	ENST00000431526.1	37		2168	0.9926739926739927	487	0.9898373983739838	361	0.9972375690607734	568	0.993006993006993	752	0.9920844327176781	N	1.560	-0.537056	0.04082	.	.	ENSG00000167962	ENST00000431526	T	0.77098	-1.07	3.3	3.3	0.37823	.	0.415485	0.23105	N	0.051871	T	0.00012	0.0000	.	.	.	0.48696	P	3.1000000000003247E-4	.	.	.	.	.	.	T	0.34650	-0.9820	6	0.22706	T	0.39	-7.8624	8.393	0.32540	0.0:0.8796:0.0:0.1204	.	.	.	.	G	25	ENSP00000411409:E25G	ENSP00000411409:E25G	E	-	2	0	ZNF598	1999675	1.000000	0.71417	1.000000	0.80357	0.107000	0.19398	0.911000	0.28584	0.691000	0.31592	-0.642000	0.03964	GAA	T|0.007;C|0.993		0.766	ZNF598-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_178167	
SALL1	6299	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	51172851	51172851	+	Silent	SNP	A	A	G			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr16:51172851A>G	ENST00000251020.4	-	2	3315	c.3282T>C	c.(3280-3282)caT>caC	p.H1094H	SALL1_ENST00000566102.1_Intron|SALL1_ENST00000440970.1_Silent_p.H997H|SALL1_ENST00000541611.1_Intron	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	1094					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			GAGGAGAAACATGCACGAAGC	0.572																																					p.H1094H	GBM(103;1352 1446 1855 4775 8890)	.											.	SALL1-98	0			c.T3282C						.						116.0	104.0	108.0					16																	51172851		2198	4300	6498	SO:0001819	synonymous_variant	6299	exon2			AGAAACATGCACG	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.3282T>C	16.37:g.51172851A>G		Somatic	96	0		WXS	Illumina HiSeq	Phase_I	123	18	NM_002968	0	0	25	45	20	Q99881|Q9NSC3|Q9P1R0	Silent	SNP	ENST00000251020.4	37	CCDS10747.1																																																																																			.		0.572	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968	
SLC38A7	55238	hgsc.bcm.edu;broad.mit.edu	37	16	58713827	58713827	+	Silent	SNP	C	C	T			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr16:58713827C>T	ENST00000570101.1	-	2	1087	c.204G>A	c.(202-204)ggG>ggA	p.G68G	SLC38A7_ENST00000566953.1_Intron|SLC38A7_ENST00000219320.4_Silent_p.G68G|SLC38A7_ENST00000564391.1_Silent_p.G68G|SLC38A7_ENST00000564100.1_Silent_p.G68G|SLC38A7_ENST00000564010.1_Intron			Q9NVC3	S38A7_HUMAN	solute carrier family 38, member 7	68					sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	L-alanine transmembrane transporter activity (GO:0015180)|L-amino acid transmembrane transporter activity (GO:0015179)|L-asparagine transmembrane transporter activity (GO:0015182)|L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)|L-glutamine transmembrane transporter activity (GO:0015186)|L-histidine transmembrane transporter activity (GO:0005290)|L-leucine transmembrane transporter activity (GO:0015190)|L-methionine transmembrane transporter activity (GO:0015191)|L-serine transmembrane transporter activity (GO:0015194)			endometrium(1)|large_intestine(2)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	13						AGTTGAGTAACCCTGCACCCA	0.632																																					p.G68G		.											.	SLC38A7-69	0			c.G204A						.						50.0	46.0	48.0					16																	58713827		2198	4300	6498	SO:0001819	synonymous_variant	55238	exon3			GAGTAACCCTGCA	BC001961	CCDS10800.1	16q21	2013-05-22			ENSG00000103042	ENSG00000103042		"""Solute carriers"""	25582	protein-coding gene	gene with protein product		614236					Standard	XM_006721229		Approved	FLJ10815	uc002eod.1	Q9NVC3	OTTHUMG00000133491	ENST00000570101.1:c.204G>A	16.37:g.58713827C>T		Somatic	50	1		WXS	Illumina HiSeq	Phase_I	57	8	NM_018231	0	0	5	6	1	Q53GJ9|Q9H9I5	Silent	SNP	ENST00000570101.1	37	CCDS10800.1																																																																																			.		0.632	SLC38A7-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422206.2	NM_018231	
FAM65A	79567	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	67577079	67577079	+	Missense_Mutation	SNP	T	T	A			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr16:67577079T>A	ENST00000379312.3	+	13	2523	c.2402T>A	c.(2401-2403)cTa>cAa	p.L801Q	FAM65A_ENST00000422602.2_Missense_Mutation_p.L817Q|FAM65A_ENST00000540839.3_Missense_Mutation_p.L817Q|CTD-2012K14.3_ENST00000563083.1_RNA|CTD-2012K14.4_ENST00000564717.1_RNA|FAM65A_ENST00000042381.4_Missense_Mutation_p.L797Q|FAM65A_ENST00000428437.2_Missense_Mutation_p.L811Q	NM_001193522.1|NM_024519.3	NP_001180451.1|NP_078795.2	Q6ZS17	FA65A_HUMAN	family with sequence similarity 65, member A	801						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0474)|Epithelial(162;0.117)		CTGGGGGCCCTAATGGCTGCC	0.642																																					p.L817Q		.											.	FAM65A-92	0			c.T2450A						.						17.0	16.0	17.0					16																	67577079		2198	4298	6496	SO:0001583	missense	79567	exon13			GGGCCCTAATGGC	AK127792	CCDS10840.1, CCDS54026.1, CCDS54027.1, CCDS54028.1	16q22.1	2008-02-05			ENSG00000039523	ENSG00000039523			25836	protein-coding gene	gene with protein product						11572484	Standard	NM_001193522		Approved	FLJ13725	uc010vjp.2	Q6ZS17	OTTHUMG00000137536	ENST00000379312.3:c.2402T>A	16.37:g.67577079T>A	ENSP00000368614:p.Leu801Gln	Somatic	39	0		WXS	Illumina HiSeq	Phase_I	40	14	NM_001193523	0	0	17	39	22	B4DEQ9|B4DIM2|E9PBS3|Q4G0A4|Q7Z5R7|Q8NDA4|Q96J39|Q96PV8|Q9H8D9	Missense_Mutation	SNP	ENST00000379312.3	37	CCDS54028.1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.237952	0.79800	.	.	ENSG00000039523	ENST00000379312;ENST00000042381;ENST00000422602;ENST00000540839	T;T;T	0.49432	0.78;0.78;0.78	5.52	5.52	0.82312	.	0.070064	0.56097	D	0.000022	T	0.67258	0.2874	M	0.72894	2.215	0.09310	N	0.999991	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.68765	0.96;0.96;0.96;0.96	T	0.63664	-0.6586	10	0.87932	D	0	-9.5432	15.6534	0.77115	0.0:0.0:0.0:1.0	.	811;817;801;817	B4DIM2;E9PBS3;Q6ZS17;B4DEQ9	.;.;FA65A_HUMAN;.	Q	801;797;817;811	ENSP00000368614:L801Q;ENSP00000042381:L797Q;ENSP00000400099:L817Q	ENSP00000042381:L797Q	L	+	2	0	FAM65A	66134580	0.901000	0.30685	0.994000	0.49952	0.920000	0.55202	4.728000	0.62000	2.120000	0.65058	0.454000	0.30748	CTA	.		0.642	FAM65A-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000268866.3	NM_024519	
ZFHX3	463	hgsc.bcm.edu	37	16	72821615	72821615	+	Silent	SNP	G	G	A			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr16:72821615G>A	ENST00000268489.5	-	10	11232	c.10560C>T	c.(10558-10560)ggC>ggT	p.G3520G	ZFHX3_ENST00000397992.5_Silent_p.G2606G|RP5-991G20.4_ENST00000569195.1_RNA|RP5-991G20.1_ENST00000563328.2_RNA|AC004943.1_ENST00000584072.1_RNA	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	3520	Poly-Gly.				brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				cgccgccgccgccaccgccgc	0.706																																					p.G3520G		.											.	ZFHX3-72	0			c.C10560T						.						10.0	14.0	12.0					16																	72821615		1455	3158	4613	SO:0001819	synonymous_variant	463	exon10			GCCGCCGCCACCG	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.10560C>T	16.37:g.72821615G>A		Somatic	53	1		WXS	Illumina HiSeq	Phase_I	70	7	NM_006885	0	0	2	2	0	D3DWS8|O15101|Q13719	Silent	SNP	ENST00000268489.5	37	CCDS10908.1																																																																																			.		0.706	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885	
ZZEF1	23140	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	3919676	3919676	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr17:3919676C>A	ENST00000381638.2	-	49	8210	c.8086G>T	c.(8086-8088)Gga>Tga	p.G2696*		NM_015113.3	NP_055928.3	O43149	ZZEF1_HUMAN	zinc finger, ZZ-type with EF-hand domain 1	2696							calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	84						ACCTCCATTCCTGGCTCCTCC	0.597																																					p.G2696X		.											.	ZZEF1-93	0			c.G8086T						.						154.0	114.0	127.0					17																	3919676		2203	4300	6503	SO:0001587	stop_gained	23140	exon49			CCATTCCTGGCTC	BC035319	CCDS11043.1	17p13.3	2013-01-10	2004-11-03		ENSG00000074755	ENSG00000074755		"""Zinc fingers, ZZ-type"", ""EF-hand domain containing"""	29027	protein-coding gene	gene with protein product			"""zinc finger, ZZ-type with EF hand domain 1"""			9455477	Standard	XM_005256560		Approved	KIAA0399, ZZZ4, FLJ10821	uc002fxe.3	O43149	OTTHUMG00000090741	ENST00000381638.2:c.8086G>T	17.37:g.3919676C>A	ENSP00000371051:p.Gly2696*	Somatic	154	0		WXS	Illumina HiSeq	Phase_I	162	39	NM_015113	0	0	14	14	0	A7MBM5|Q6NXG0|Q6ZRA1|Q6ZSF4|Q9NVB9	Nonsense_Mutation	SNP	ENST00000381638.2	37	CCDS11043.1	.	.	.	.	.	.	.	.	.	.	C	50	17.192008	0.99881	.	.	ENSG00000074755	ENST00000381638	.	.	.	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-14.3127	20.0271	0.97525	0.0:1.0:0.0:0.0	.	.	.	.	X	2696	.	ENSP00000371051:G2696X	G	-	1	0	ZZEF1	3866425	1.000000	0.71417	0.961000	0.40146	0.948000	0.59901	7.487000	0.81328	2.744000	0.94065	0.650000	0.86243	GGA	.		0.597	ZZEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207480.1	NM_015113	
ZFP3	124961	hgsc.bcm.edu	37	17	4995909	4995909	+	Silent	SNP	T	T	C			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr17:4995909T>C	ENST00000318833.3	+	2	1446	c.1110T>C	c.(1108-1110)tgT>tgC	p.C370C		NM_153018.2	NP_694563.1	Q96NJ6	ZFP3_HUMAN	ZFP3 zinc finger protein	370					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(11)|lung(3)|prostate(1)	20						GTAAGGAATGTGGGAAGGCCT	0.413																																					p.C370C		.											.	ZFP3-90	0			c.T1110C						.						46.0	48.0	48.0					17																	4995909		2203	4300	6503	SO:0001819	synonymous_variant	124961	exon2			GGAATGTGGGAAG	BX647638	CCDS11067.1	17p13.2	2013-01-08	2012-11-27		ENSG00000180787	ENSG00000180787		"""Zinc fingers, C2H2-type"""	12861	protein-coding gene	gene with protein product		194480	"""zinc finger protein homologous to Zfp-3 in mouse"", ""zinc finger protein 3 homolog (mouse)"""				Standard	NM_153018		Approved	FLJ30726, ZNF752	uc002gaq.3	Q96NJ6		ENST00000318833.3:c.1110T>C	17.37:g.4995909T>C		Somatic	85	0		WXS	Illumina HiSeq	Phase_I	72	4	NM_153018	0	0	0	0	0	A5PLL4	Silent	SNP	ENST00000318833.3	37	CCDS11067.1																																																																																			.		0.413	ZFP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438979.1	NM_153018	
SOX15	6665	hgsc.bcm.edu	37	17	7492829	7492829	+	Missense_Mutation	SNP	A	A	G			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr17:7492829A>G	ENST00000250055.2	-	1	659	c.166T>C	c.(166-168)Ttc>Ctc	p.F56L	SOX15_ENST00000570788.1_Missense_Mutation_p.F56L|SOX15_ENST00000538513.2_Missense_Mutation_p.F56L|MPDU1_ENST00000423172.2_Intron|FXR2_ENST00000573057.1_5'Flank	NM_006942.1	NP_008873.1	O60248	SOX15_HUMAN	SRY (sex determining region Y)-box 15	56					cell differentiation (GO:0030154)|chromatin organization (GO:0006325)|male gonad development (GO:0008584)|myoblast development (GO:0048627)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of G0 to G1 transition (GO:0070318)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of satellite cell activation involved in skeletal muscle regeneration (GO:0014718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle tissue regeneration (GO:0043403)	cytoplasm (GO:0005737)|nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|prostate(1)	2						CACACCATGAACGCGTTCATC	0.687											OREG0024139	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.F56L		.											.	SOX15-135	0			c.T166C						.						24.0	26.0	25.0					17																	7492829		2203	4300	6503	SO:0001583	missense	6665	exon1			CCATGAACGCGTT	AJ006222	CCDS32549.1	17p13.1	2014-08-12	2002-07-22	2002-07-26	ENSG00000129194	ENSG00000129194		"""SRY (sex determining region Y)-boxes"""	11196	protein-coding gene	gene with protein product		601297	"""SRY (sex determining region Y)-box 20"""	SOX20		8978787, 9730625	Standard	NM_006942		Approved	SOX27, SOX26	uc002ghz.1	O60248	OTTHUMG00000178146	ENST00000250055.2:c.166T>C	17.37:g.7492829A>G	ENSP00000355354:p.Phe56Leu	Somatic	35	0	642	WXS	Illumina HiSeq	Phase_I	32	2	NM_006942	0	0	0	0	0	B4DWU7|D3DTQ0|P35717|Q9Y6W7	Missense_Mutation	SNP	ENST00000250055.2	37	CCDS32549.1	.	.	.	.	.	.	.	.	.	.	A	37	6.038607	0.97226	.	.	ENSG00000129194	ENST00000250055;ENST00000538513	D;D	0.99239	-5.61;-5.61	5.38	5.38	0.77491	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.000000	0.56097	D	0.000029	D	0.99606	0.9857	H	0.96777	3.88	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97827	1.0260	10	0.87932	D	0	.	13.4332	0.61068	1.0:0.0:0.0:0.0	.	56	O60248	SOX15_HUMAN	L	56	ENSP00000355354:F56L;ENSP00000439311:F56L	ENSP00000355354:F56L	F	-	1	0	SOX15	7433553	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	9.139000	0.94554	2.276000	0.75962	0.454000	0.30748	TTC	.		0.687	SOX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440757.1	NM_006942	
WIPF2	147179	hgsc.bcm.edu;bcgsc.ca	37	17	38420806	38420806	+	Silent	SNP	A	A	G	rs139121244		TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr17:38420806A>G	ENST00000323571.4	+	5	618	c.378A>G	c.(376-378)ccA>ccG	p.P126P	WIPF2_ENST00000536600.1_Intron|WIPF2_ENST00000583130.1_Silent_p.P126P|WIPF2_ENST00000494757.1_3'UTR|WIPF2_ENST00000394103.3_Intron|WIPF2_ENST00000585043.1_Silent_p.P126P	NM_133264.4	NP_573571.1	Q8TF74	WIPF2_HUMAN	WAS/WASL interacting protein family, member 2	126					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)				NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	30						CAAGGCCTCCAGTATCTGCCG	0.582										HNSCC(43;0.11)																											p.P126P		.											.	WIPF2-93	0			c.A378G						.			1,4405	2.1+/-5.4	0,1,2202	60.0	69.0	66.0		378	-5.5	0.3	17	dbSNP_134	66	0,8600		0,0,4300	no	coding-synonymous	WIPF2	NM_133264.4		0,1,6502	GG,GA,AA		0.0,0.0227,0.0077		126/441	38420806	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	147179	exon5			GCCTCCAGTATCT	BC025965	CCDS11364.1	17q21.2	2006-10-12			ENSG00000171475	ENSG00000171475			30923	protein-coding gene	gene with protein product		609692				12213210, 11829459	Standard	XM_005257083		Approved	WICH, WIRE	uc002hug.1	Q8TF74	OTTHUMG00000133331	ENST00000323571.4:c.378A>G	17.37:g.38420806A>G		Somatic	168	0		WXS	Illumina HiSeq	Phase_I	151	35	NM_133264	0	0	7	7	0	A8K0L3|Q658J8|Q71RE1|Q8TE44	Silent	SNP	ENST00000323571.4	37	CCDS11364.1																																																																																			A|1.000;G|0.000		0.582	WIPF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257157.2	NM_133264	
KRT37	8688	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	39577782	39577782	+	Missense_Mutation	SNP	C	C	G			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr17:39577782C>G	ENST00000225550.3	-	6	1077	c.1078G>C	c.(1078-1080)Gcc>Ccc	p.A360P	AC003958.2_ENST00000432258.1_RNA	NM_003770.4	NP_003761.3	O76014	KRT37_HUMAN	keratin 37	360	Coil 2.|Rod.					extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(6)|skin(3)	25		Breast(137;0.000496)				TGCATCTGGGCCAGCTCTGTG	0.567																																					p.A360P		.											.	KRT37-91	0			c.G1078C						.						66.0	63.0	64.0					17																	39577782		2203	4300	6503	SO:0001583	missense	8688	exon6			TCTGGGCCAGCTC	Y16793	CCDS32653.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000108417	ENSG00000108417		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6455	protein-coding gene	gene with protein product		604541	"""keratin, hair, acidic, 7"""	KRTHA7		9756910, 16831889	Standard	NM_003770		Approved		uc002hwp.1	O76014	OTTHUMG00000133606	ENST00000225550.3:c.1078G>C	17.37:g.39577782C>G	ENSP00000225550:p.Ala360Pro	Somatic	89	0		WXS	Illumina HiSeq	Phase_I	101	13	NM_003770	0	0	0	0	0		Missense_Mutation	SNP	ENST00000225550.3	37	CCDS32653.1	.	.	.	.	.	.	.	.	.	.	C	16.14	3.037494	0.54896	.	.	ENSG00000108417	ENST00000225550	T	0.14640	2.49	5.44	2.17	0.27698	Filament (1);	0.000000	0.49305	D	0.000155	T	0.32763	0.0840	H	0.96861	3.895	0.28206	N	0.92715	B	0.34349	0.45	B	0.37239	0.244	T	0.42582	-0.9443	10	0.66056	D	0.02	.	13.3764	0.60741	0.5453:0.4547:0.0:0.0	.	360	O76014	KRT37_HUMAN	P	360	ENSP00000225550:A360P	ENSP00000225550:A360P	A	-	1	0	KRT37	36831308	0.000000	0.05858	1.000000	0.80357	0.990000	0.78478	-0.196000	0.09532	0.197000	0.20387	0.655000	0.94253	GCC	.		0.567	KRT37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257714.2	NM_003770	
MED13	9969	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	60023946	60023946	+	Missense_Mutation	SNP	C	C	G			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr17:60023946C>G	ENST00000397786.2	-	30	6484	c.6408G>C	c.(6406-6408)caG>caC	p.Q2136H		NM_005121.2	NP_005112.2	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	2136					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(4)|central_nervous_system(1)|endometrium(10)|kidney(24)|large_intestine(15)|liver(1)|lung(20)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						GTGCATTGTACTGTTCCAAAA	0.378																																					p.Q2136H		.											.	MED13-136	0			c.G6408C						.						79.0	74.0	76.0					17																	60023946		1866	4104	5970	SO:0001583	missense	9969	exon30			ATTGTACTGTTCC	AB011165	CCDS42366.1	17q22-q23	2007-07-30	2007-07-30	2007-07-30		ENSG00000108510			22474	protein-coding gene	gene with protein product		603808	"""thyroid hormone receptor associated protein 1"""	THRAP1		1019863	Standard	NM_005121		Approved	KIAA0593, TRAP240	uc002izo.3	Q9UHV7		ENST00000397786.2:c.6408G>C	17.37:g.60023946C>G	ENSP00000380888:p.Gln2136His	Somatic	49	0		WXS	Illumina HiSeq	Phase_I	77	24	NM_005121	0	0	7	19	12	B2RU05|O60334	Missense_Mutation	SNP	ENST00000397786.2	37	CCDS42366.1	.	.	.	.	.	.	.	.	.	.	C	14.58	2.576706	0.45902	.	.	ENSG00000108510	ENST00000397786;ENST00000262436	D	0.83837	-1.77	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	D	0.90748	0.7096	M	0.75447	2.3	0.80722	D	1	D	0.67145	0.996	D	0.81914	0.995	D	0.90884	0.4756	10	0.48119	T	0.1	-4.4995	18.2754	0.90081	0.0:1.0:0.0:0.0	.	2136	Q9UHV7	MED13_HUMAN	H	2136;2135	ENSP00000380888:Q2136H	ENSP00000262436:Q2135H	Q	-	3	2	MED13	57378728	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.403000	0.79983	2.315000	0.78130	0.591000	0.81541	CAG	.		0.378	MED13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445461.1	NM_005121	
RNF157	114804	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	74163165	74163165	+	Missense_Mutation	SNP	C	C	A			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr17:74163165C>A	ENST00000269391.6	-	5	618	c.486G>T	c.(484-486)caG>caT	p.Q162H	RNF157_ENST00000319945.6_Missense_Mutation_p.Q162H	NM_052916.2	NP_443148.1	Q96PX1	RN157_HUMAN	ring finger protein 157	162							zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	25			LUSC - Lung squamous cell carcinoma(166;0.187)			CTCGCTTGTACTGCACAGTCT	0.567																																					p.Q162H	GBM(186;507 2120 27388 27773 52994)	.											.	RNF157-228	0			c.G486T						.						127.0	114.0	118.0					17																	74163165		2203	4300	6503	SO:0001583	missense	114804	exon5			CTTGTACTGCACA	AK091467	CCDS32740.1	17q25.3	2004-02-27			ENSG00000141576	ENSG00000141576		"""RING-type (C3HC4) zinc fingers"""	29402	protein-coding gene	gene with protein product						11572484	Standard	NM_052916		Approved	KIAA1917	uc002jqz.3	Q96PX1	OTTHUMG00000132627	ENST00000269391.6:c.486G>T	17.37:g.74163165C>A	ENSP00000269391:p.Gln162His	Somatic	215	0		WXS	Illumina HiSeq	Phase_I	219	29	NM_052916	0	0	4	7	3	Q8NB72|Q96N56	Missense_Mutation	SNP	ENST00000269391.6	37	CCDS32740.1	.	.	.	.	.	.	.	.	.	.	C	4.577	0.107271	0.08780	.	.	ENSG00000141576	ENST00000269391;ENST00000319945;ENST00000301610	T;T	0.27890	1.64;1.64	5.43	2.38	0.29361	.	0.131468	0.64402	N	0.000001	T	0.05593	0.0147	N	0.00152	-1.975	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.40757	-0.9546	10	0.02654	T	1	-4.6639	10.0104	0.41984	0.0971:0.1243:0.7785:0.0	.	162;162	Q96PX1-2;Q96PX1	.;RN157_HUMAN	H	162;162;124	ENSP00000269391:Q162H;ENSP00000321837:Q162H	ENSP00000269391:Q162H	Q	-	3	2	RNF157	71674760	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.577000	0.23758	0.271000	0.22005	-0.128000	0.14901	CAG	.		0.567	RNF157-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255874.2	XM_290732	
BIRC5	332	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	76212806	76212806	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr17:76212806G>A	ENST00000350051.3	+	3	402	c.283G>A	c.(283-285)Gaa>Aaa	p.E95K	BIRC5_ENST00000301633.4_Missense_Mutation_p.E118K|BIRC5_ENST00000374948.2_Intron|AC087645.1_ENST00000600484.1_Missense_Mutation_p.S264F|BIRC5_ENST00000589892.1_3'UTR|BIRC5_ENST00000592734.1_Intron	NM_001168.2	NP_001159.2	O15392	BIRC5_HUMAN	baculoviral IAP repeat containing 5	95					apoptotic process (GO:0006915)|cell division (GO:0051301)|chromosome segregation (GO:0007059)|cytokinesis (GO:0000910)|establishment of chromosome localization (GO:0051303)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of exit from mitosis (GO:0031536)|positive regulation of mitotic cell cycle (GO:0045931)|protein complex localization (GO:0031503)|protein phosphorylation (GO:0006468)|spindle checkpoint (GO:0031577)|transcription, DNA-templated (GO:0006351)	centriole (GO:0005814)|chromosome passenger complex (GO:0032133)|chromosome, centromeric region (GO:0000775)|condensed chromosome kinetochore (GO:0000777)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|interphase microtubule organizing center (GO:0031021)|microtubule (GO:0005874)|midbody (GO:0030496)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	chaperone binding (GO:0051087)|cobalt ion binding (GO:0050897)|cofactor binding (GO:0048037)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|microtubule binding (GO:0008017)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|Ran GTPase binding (GO:0008536)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			kidney(1)|urinary_tract(1)	2			BRCA - Breast invasive adenocarcinoma(99;0.00269)|OV - Ovarian serous cystadenocarcinoma(97;0.153)			GCAGTTTGAAGAATTAACCCT	0.398																																					p.E118K		.											.	BIRC5-1083	0			c.G352A						.						72.0	79.0	77.0					17																	76212806		2203	4300	6503	SO:0001583	missense	332	exon4			TTTGAAGAATTAA	U75285	CCDS11755.1, CCDS32751.1, CCDS32752.1	17q25.3	2013-01-17	2011-01-25		ENSG00000089685	ENSG00000089685		"""Baculoviral IAP repeat containing"""	593	protein-coding gene	gene with protein product	"""survivin variant 3 alpha"""	603352	"""apoptosis inhibitor 4"", ""baculoviral IAP repeat-containing 5"""	API4		8106347, 7947793	Standard	XR_243654		Approved	EPR-1, survivin	uc002jvf.3	O15392		ENST00000350051.3:c.283G>A	17.37:g.76212806G>A	ENSP00000324180:p.Glu95Lys	Somatic	126	0		WXS	Illumina HiSeq	Phase_I	117	29	NM_001012271	0	0	0	0	0	A2SUH6|B2R4R1|Q2I3N8|Q4VGX0|Q53F61|Q5MGC6|Q6FHL2|Q75SP2|Q9P2W8	Missense_Mutation	SNP	ENST00000350051.3	37	CCDS11755.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.456362	0.84317	.	.	ENSG00000089685	ENST00000301633;ENST00000350051;ENST00000432014	T;T	0.03920	3.76;3.76	5.62	5.62	0.85841	Baculoviral inhibition of apoptosis protein repeat (1);	0.384181	0.30762	N	0.008935	T	0.07728	0.0194	L	0.59436	1.845	0.80722	D	1	B;B;B;P	0.50617	0.18;0.118;0.415;0.937	B;B;B;B	0.39590	0.053;0.036;0.202;0.304	T	0.18335	-1.0340	10	0.40728	T	0.16	-19.2617	17.1223	0.86705	0.0:0.0:1.0:0.0	.	95;95;118;95	O15392-4;O15392;O15392-2;A3E0Z5	.;BIRC5_HUMAN;.;.	K	118;95;118	ENSP00000301633:E118K;ENSP00000324180:E95K	ENSP00000301633:E118K	E	+	1	0	BIRC5	73724401	1.000000	0.71417	0.995000	0.50966	0.987000	0.75469	4.796000	0.62496	2.648000	0.89879	0.462000	0.41574	GAA	.		0.398	BIRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437231.2	NM_001168	
APCDD1	147495	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	10471914	10471914	+	Silent	SNP	G	G	A			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr18:10471914G>A	ENST00000355285.5	+	3	984	c.630G>A	c.(628-630)caG>caA	p.Q210Q	APCDD1_ENST00000578882.1_Intron	NM_153000.4	NP_694545.1			adenomatosis polyposis coli down-regulated 1											NS(1)|breast(1)|endometrium(3)|large_intestine(5)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22				READ - Rectum adenocarcinoma(15;0.08)		ATGAACTTCAGCTCATCCGGG	0.582																																					p.Q210Q		.											.	APCDD1-90	0			c.G630A						.						145.0	132.0	136.0					18																	10471914		2203	4300	6503	SO:0001819	synonymous_variant	147495	exon3			ACTTCAGCTCATC	AB056722	CCDS11849.1	18p11.21	2006-07-07			ENSG00000154856	ENSG00000154856			15718	protein-coding gene	gene with protein product		607479				12384519	Standard	NM_153000		Approved	B7323	uc002kom.4	Q8J025	OTTHUMG00000131635	ENST00000355285.5:c.630G>A	18.37:g.10471914G>A		Somatic	271	0		WXS	Illumina HiSeq	Phase_I	219	38	NM_153000	0	0	0	1	1		Silent	SNP	ENST00000355285.5	37	CCDS11849.1																																																																																			.		0.582	APCDD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254529.2	NM_153000	
CEP192	55125	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	13071144	13071144	+	Missense_Mutation	SNP	G	G	T			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr18:13071144G>T	ENST00000325971.8	+	26	5086	c.3493G>T	c.(3493-3495)Gat>Tat	p.D1165Y	CEP192_ENST00000506447.1_Missense_Mutation_p.D1761Y|CEP192_ENST00000430049.2_Missense_Mutation_p.D1286Y			Q8TEP8	CE192_HUMAN	centrosomal protein 192kDa	1165					centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(36)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						ACCTTGCTTAGATATTCCATC	0.423																																					p.D1761Y		.											.	CEP192-27	0			c.G5281T						.						110.0	110.0	110.0					18																	13071144		2203	4300	6503	SO:0001583	missense	55125	exon28			TGCTTAGATATTC	AK074074	CCDS32792.1, CCDS32792.2	18p11.21	2014-02-20				ENSG00000101639		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25515	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 62"""					11230166, 14654843	Standard	NM_032142		Approved	KIAA1569, FLJ10352, PPP1R62	uc010xac.2	Q8TEP8		ENST00000325971.8:c.3493G>T	18.37:g.13071144G>T	ENSP00000317156:p.Asp1165Tyr	Somatic	56	0		WXS	Illumina HiSeq	Phase_I	61	14	NM_032142	0	0	2	2	0	A0A060A9S4|E9PF99|Q8WYT8|Q9H0F4|Q9NW27	Missense_Mutation	SNP	ENST00000325971.8	37		.	.	.	.	.	.	.	.	.	.	G	17.34	3.365339	0.61513	.	.	ENSG00000101639	ENST00000506447;ENST00000325971;ENST00000399863;ENST00000430049	T;T;T	0.47869	0.83;0.83;0.83	5.35	3.54	0.40534	.	0.121003	0.53938	D	0.000055	T	0.64875	0.2638	M	0.73962	2.25	0.58432	D	0.999998	B;D;B	0.89917	0.368;1.0;0.328	B;D;B	0.79108	0.091;0.992;0.104	T	0.67692	-0.5605	10	0.87932	D	0	-11.9129	9.8383	0.40982	0.0725:0.0:0.7869:0.1406	.	1286;1761;363	C9JT09;E9PF99;Q9HCK3	.;.;.	Y	1761;1165;1165;1286	ENSP00000427550:D1761Y;ENSP00000317156:D1165Y;ENSP00000389190:D1286Y	ENSP00000317156:D1165Y	D	+	1	0	CEP192	13061144	1.000000	0.71417	0.650000	0.29550	0.606000	0.37113	3.512000	0.53407	1.230000	0.43646	0.650000	0.86243	GAT	.		0.423	CEP192-201	KNOWN	basic	protein_coding	protein_coding		NM_032142	
ZNF519	162655	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	14105675	14105675	+	Silent	SNP	T	T	C			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr18:14105675T>C	ENST00000590202.1	-	3	1016	c.864A>G	c.(862-864)ggA>ggG	p.G288G	RP11-411B10.3_ENST00000592926.1_RNA|ZNF519_ENST00000589498.1_Intron|ZNF519_ENST00000589203.1_Intron	NM_145287.3	NP_660330.2	Q8TB69	ZN519_HUMAN	zinc finger protein 519	288					negative regulation of transcription during meiosis (GO:0051038)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|urinary_tract(1)	18						AAGGTTTCTCTCCAGTATGAA	0.363																																					p.G288G		.											.	ZNF519-90	0			c.A864G						.						49.0	53.0	52.0					18																	14105675		2203	4299	6502	SO:0001819	synonymous_variant	162655	exon3			TTTCTCTCCAGTA	BC024227	CCDS32797.1	18p11.21	2014-06-18			ENSG00000175322	ENSG00000175322		"""Zinc fingers, C2H2-type"", ""-"""	30574	protein-coding gene	gene with protein product	"""similar to Zinc finger protein 85 (Zinc finger protein HPF4) (HTF1)"""					12477932	Standard	NM_145287		Approved	HsT2362, FLJ36809	uc002kst.2	Q8TB69	OTTHUMG00000182055	ENST00000590202.1:c.864A>G	18.37:g.14105675T>C		Somatic	78	0		WXS	Illumina HiSeq	Phase_I	83	18	NM_145287	0	0	11	12	1		Silent	SNP	ENST00000590202.1	37	CCDS32797.1																																																																																			.		0.363	ZNF519-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459037.1	NM_145287	
LAMA3	3909	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	21451430	21451430	+	Silent	SNP	G	G	T			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr18:21451430G>T	ENST00000313654.9	+	38	5044	c.4803G>T	c.(4801-4803)gtG>gtT	p.V1601V	LAMA3_ENST00000587184.1_5'Flank|LAMA3_ENST00000399516.3_Silent_p.V1601V|LAMA3_ENST00000269217.6_5'Flank	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	1601	Laminin IV type A. {ECO:0000255|PROSITE- ProRule:PRU00458}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					GTGCCCCAGTGTCTAGGGAGG	0.552																																					p.V1601V		.											.	LAMA3-100	0			c.G4803T						.						66.0	69.0	68.0					18																	21451430		2040	4193	6233	SO:0001819	synonymous_variant	3909	exon38			CCCAGTGTCTAGG	L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.4803G>T	18.37:g.21451430G>T		Somatic	112	0		WXS	Illumina HiSeq	Phase_I	85	14	NM_001127717	0	0	0	0	0	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Silent	SNP	ENST00000313654.9	37	CCDS42419.1																																																																																			.		0.552	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129	
ZNF521	25925	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	22805629	22805629	+	Silent	SNP	G	G	C			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr18:22805629G>C	ENST00000361524.3	-	4	2401	c.2253C>G	c.(2251-2253)gtC>gtG	p.V751V	ZNF521_ENST00000538137.2_Silent_p.V751V|ZNF521_ENST00000584787.1_Silent_p.V531V|ZNF521_ENST00000579111.1_5'Flank	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	751					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					TGCACCTATAGACTTTCTTTT	0.468			T	PAX5	ALL																																p.V751V		.		Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	.	ZNF521-275	0			c.C2253G						.						75.0	71.0	72.0					18																	22805629		2203	4300	6503	SO:0001819	synonymous_variant	25925	exon4			CCTATAGACTTTC	AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.2253C>G	18.37:g.22805629G>C		Somatic	79	0		WXS	Illumina HiSeq	Phase_I	83	16	NM_015461	0	0	0	0	0	A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Silent	SNP	ENST00000361524.3	37	CCDS32806.1																																																																																			.		0.468	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446781.2	NM_015461	
KIAA1328	57536	broad.mit.edu	37	18	34802114	34802114	+	Missense_Mutation	SNP	G	G	C			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr18:34802114G>C	ENST00000280020.5	+	10	1680	c.1658G>C	c.(1657-1659)cGg>cCg	p.R553P	KIAA1328_ENST00000591619.1_Missense_Mutation_p.R549P|KIAA1328_ENST00000543923.1_Intron|KIAA1328_ENST00000586135.1_3'UTR	NM_020776.1	NP_065827.1	Q86T90	K1328_HUMAN	KIAA1328	553										central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|skin(2)|upper_aerodigestive_tract(1)	14				COAD - Colon adenocarcinoma(74;0.195)		AAATCAACCCGGAAGAAGATG	0.463																																					p.R553P													.	KIAA1328-90	0			c.G1658C						.						32.0	30.0	31.0					18																	34802114		1845	4092	5937	SO:0001583	missense	57536	exon10			CAACCCGGAAGAA	AB037749	CCDS45855.1	18q12.2	2011-12-12			ENSG00000150477	ENSG00000150477			29248	protein-coding gene	gene with protein product						10718198	Standard	XM_005258317		Approved		uc002kzz.3	Q86T90		ENST00000280020.5:c.1658G>C	18.37:g.34802114G>C	ENSP00000280020:p.Arg553Pro	Somatic	12	0		WXS	Illumina HiSeq	Phase_I	14	6	NM_020776	0	0	0	0	0	Q05DL0|Q49AG6|Q9P2L8	Missense_Mutation	SNP	ENST00000280020.5	37	CCDS45855.1	.	.	.	.	.	.	.	.	.	.	G	5.413	0.261419	0.10239	.	.	ENSG00000150477	ENST00000280020;ENST00000383055	T	0.46819	0.86	5.93	5.93	0.95920	.	0.517672	0.19767	N	0.106536	T	0.38427	0.1040	N	0.08118	0	0.46954	D	0.999262	P;D	0.58268	0.721;0.982	P;P	0.51999	0.567;0.687	T	0.20505	-1.0273	10	0.34782	T	0.22	.	12.7607	0.57363	0.077:0.0:0.923:0.0	.	553;553	A8K8C3;Q86T90	.;K1328_HUMAN	P	553	ENSP00000280020:R553P	ENSP00000280020:R553P	R	+	2	0	KIAA1328	33056112	0.994000	0.37717	0.943000	0.38184	0.043000	0.13939	3.760000	0.55235	2.814000	0.96858	0.591000	0.81541	CGG	.		0.463	KIAA1328-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440455.1	NM_020776	
ADNP2	22850	broad.mit.edu	37	18	77896690	77896690	+	Nonstop_Mutation	SNP	T	T	A			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr18:77896690T>A	ENST00000262198.4	+	4	3849	c.3394T>A	c.(3394-3396)Taa>Aaa	p.*1132K		NM_014913.3	NP_055728.1	Q6IQ32	ADNP2_HUMAN	ADNP homeobox 2	0					cellular response to oxidative stress (GO:0034599)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell death (GO:0060548)|neuron differentiation (GO:0030182)|positive regulation of cell growth (GO:0030307)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(9)|liver(1)|lung(15)|ovary(5)|prostate(2)	42		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)		ATATGAACCATAAAACTTGCA	0.303																																					p.X1132K													.	ADNP2-140	0			c.T3394A						.						9.0	9.0	9.0					18																	77896690		1999	4153	6152	SO:0001578	stop_lost	22850	exon4			GAACCATAAAACT	AB020670	CCDS32853.1	18q23	2013-01-07	2007-07-17	2007-07-17	ENSG00000101544	ENSG00000101544		"""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	23803	protein-coding gene	gene with protein product			"""zinc finger protein 508"""	ZNF508			Standard	NM_014913		Approved	KIAA0863	uc002lnw.3	Q6IQ32	OTTHUMG00000172535	ENST00000262198.4:c.3394T>A	18.37:g.77896690T>A	ENSP00000262198:p.*1132Lysext*12	Somatic	22	2		WXS	Illumina HiSeq	Phase_I	14	7	NM_014913	0	0	10	10	0	A8K951|O94943|Q9H9P3	Missense_Mutation	SNP	ENST00000262198.4	37	CCDS32853.1	.	.	.	.	.	.	.	.	.	.	T	0.086	-1.175421	0.01646	.	.	ENSG00000101544	ENST00000262198	.	.	.	4.43	1.55	0.23275	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.8593	0.18736	0.0:0.2467:0.4957:0.2576	.	.	.	.	K	1132	.	.	X	+	1	0	ADNP2	75997681	0.028000	0.19301	0.887000	0.34795	0.103000	0.19146	-0.208000	0.09371	0.109000	0.17891	-0.366000	0.07423	TAA	.		0.303	ADNP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418979.1	NM_014913	
ZNF430	80264	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	21240780	21240780	+	Missense_Mutation	SNP	C	C	G			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr19:21240780C>G	ENST00000261560.5	+	5	1847	c.1666C>G	c.(1666-1668)Ctt>Gtt	p.L556V	AC012627.1_ENST00000578233.1_RNA	NM_001172671.1|NM_025189.3	NP_001166142.1|NP_079465.3	Q9H8G1	ZN430_HUMAN	zinc finger protein 430	556					regulation of transcription, DNA-templated (GO:0006355)|substantia nigra development (GO:0021762)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(8)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	23						GTCCTCAAACCTTATTGAACA	0.383																																					p.L556V		.											.	ZNF430-516	0			c.C1666G						.						36.0	41.0	40.0					19																	21240780		2182	4285	6467	SO:0001583	missense	80264	exon5			TCAAACCTTATTG	AK023721	CCDS32978.1	19p12	2013-01-08				ENSG00000118620		"""Zinc fingers, C2H2-type"", ""-"""	20808	protein-coding gene	gene with protein product							Standard	NM_025189		Approved	FLJ13659	uc002npj.3	Q9H8G1		ENST00000261560.5:c.1666C>G	19.37:g.21240780C>G	ENSP00000261560:p.Leu556Val	Somatic	49	0		WXS	Illumina HiSeq	Phase_I	39	10	NM_025189	0	0	3	3	0	Q86V70	Missense_Mutation	SNP	ENST00000261560.5	37	CCDS32978.1	.	.	.	.	.	.	.	.	.	.	.	7.976	0.750166	0.15778	.	.	ENSG00000118620	ENST00000261560	T	0.68331	-0.32	1.01	1.01	0.19927	Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.81341	0.4802	M	0.88105	2.93	0.09310	N	1	D;P	0.57571	0.98;0.457	D;B	0.68353	0.957;0.329	T	0.68685	-0.5343	9	0.87932	D	0	.	8.8921	0.35441	0.0:1.0:0.0:0.0	.	555;556	Q2NKJ9;Q9H8G1	.;ZN430_HUMAN	V	556	ENSP00000261560:L556V	ENSP00000261560:L556V	L	+	1	0	ZNF430	21032620	0.000000	0.05858	0.014000	0.15608	0.014000	0.08584	-0.502000	0.06390	0.453000	0.26858	0.456000	0.33151	CTT	.		0.383	ZNF430-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463539.1	NM_025189	
DPY19L3	147991	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	32930113	32930113	+	Missense_Mutation	SNP	T	T	G			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr19:32930113T>G	ENST00000342179.5	+	7	907	c.692T>G	c.(691-693)cTg>cGg	p.L231R	DPY19L3_ENST00000392250.2_Missense_Mutation_p.L231R|DPY19L3_ENST00000586987.1_Missense_Mutation_p.L231R	NM_207325.2	NP_997208.2	Q6ZPD9	D19L3_HUMAN	dpy-19-like 3 (C. elegans)	231						integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(17)|ovary(4)|pancreas(1)	32	Esophageal squamous(110;0.162)					ACATATTTCCTGAGACCAAAC	0.363																																					p.L231R		.											.	DPY19L3-72	0			c.T692G						.						133.0	131.0	132.0					19																	32930113		2203	4300	6503	SO:0001583	missense	147991	exon7			ATTTCCTGAGACC		CCDS12422.1	19q13.11	2008-02-05				ENSG00000178904			27120	protein-coding gene	gene with protein product		613894					Standard	NM_207325		Approved		uc002ntg.3	Q6ZPD9		ENST00000342179.5:c.692T>G	19.37:g.32930113T>G	ENSP00000344937:p.Leu231Arg	Somatic	124	0		WXS	Illumina HiSeq	Phase_I	80	15	NM_001172774	0	0	2	4	2	Q68DC7|Q6ZTB7|Q6ZTS2	Missense_Mutation	SNP	ENST00000342179.5	37	CCDS12422.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.333525	0.81801	.	.	ENSG00000178904	ENST00000392250;ENST00000319326;ENST00000342179	T;T	0.65549	-0.16;-0.16	5.66	5.66	0.87406	.	0.075638	0.53938	D	0.000041	T	0.81331	0.4800	M	0.84683	2.71	0.53005	D	0.99996	D	0.76494	0.999	D	0.76575	0.988	D	0.84659	0.0705	10	0.87932	D	0	-8.1242	15.8965	0.79338	0.0:0.0:0.0:1.0	.	231	Q6ZPD9	D19L3_HUMAN	R	231	ENSP00000376081:L231R;ENSP00000344937:L231R	ENSP00000315672:L231R	L	+	2	0	DPY19L3	37621953	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.816000	0.86201	2.163000	0.67991	0.460000	0.39030	CTG	.		0.363	DPY19L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450311.1	NM_207325	
SERTAD1	29950	hgsc.bcm.edu;ucsc.edu	37	19	40928862	40928862	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr19:40928862G>A	ENST00000357949.4	-	2	750	c.592C>T	c.(592-594)Cct>Tct	p.P198S		NM_013376.3	NP_037508.2	Q9UHV2	SRTD1_HUMAN	SERTA domain containing 1	198					positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|transcription, DNA-templated (GO:0006351)					endometrium(2)|lung(1)|prostate(1)|skin(1)	5			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CCATCCTCAGGGCCTGGTTTG	0.582																																					p.P198S		.											.	SERTAD1-226	0			c.C592T						.						25.0	22.0	23.0					19																	40928862		2203	4300	6503	SO:0001583	missense	29950	exon2			CCTCAGGGCCTGG	AF117959	CCDS12557.1	19q13.1-q13.2	2008-02-05				ENSG00000197019			17932	protein-coding gene	gene with protein product	"""CDK4-binding protein p34SEI"", ""transcriptional regulator interacting with the PHD-bromodomain 1"""					6434876, 10580009	Standard	NM_013376		Approved	SEI1, TRIP-Br1	uc002ont.4	Q9UHV2		ENST00000357949.4:c.592C>T	19.37:g.40928862G>A	ENSP00000350633:p.Pro198Ser	Somatic	16	0		WXS	Illumina HiSeq	Phase_I	15	3	NM_013376	0	0	36	50	14	Q9BUE7	Missense_Mutation	SNP	ENST00000357949.4	37	CCDS12557.1	.	.	.	.	.	.	.	.	.	.	G	4.055	0.007937	0.07866	.	.	ENSG00000197019	ENST00000357949	T	0.45668	0.89	5.3	1.48	0.22813	.	0.429768	0.23577	N	0.046681	T	0.16471	0.0396	N	0.11064	0.09	0.09310	N	0.99999	B	0.10296	0.003	B	0.06405	0.002	T	0.29941	-0.9995	10	0.02654	T	1	6.2956	6.6333	0.22869	0.2439:0.1426:0.6135:0.0	.	198	Q9UHV2	SRTD1_HUMAN	S	198	ENSP00000350633:P198S	ENSP00000350633:P198S	P	-	1	0	SERTAD1	45620702	0.995000	0.38212	0.483000	0.27378	0.010000	0.07245	2.607000	0.46300	0.623000	0.30267	-0.314000	0.08810	CCT	.		0.582	SERTAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462571.1	NM_013376	
CD177	57126	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	43858482	43858482	+	RNA	SNP	A	A	G			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr19:43858482A>G	ENST00000607517.1	+	0	373				CD177_ENST00000378012.2_RNA|CD177_ENST00000378009.4_RNA			Q8N6Q3	CD177_HUMAN	CD177 molecule						blood coagulation (GO:0007596)|leukocyte migration (GO:0050900)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	5		Prostate(69;0.00682)				GTGTGCCGCCAGGAGGACTTC	0.682																																					.													.	CD177-22	0			.						.						63.0	70.0	68.0					19																	43858482		1963	4126	6089			57126	.			GCCGCCAGGAGGA	AF146747	CCDS62700.1	19q13.31	2013-10-02	2006-03-28		ENSG00000204936	ENSG00000204936		"""CD molecules"""	30072	protein-coding gene	gene with protein product	"""polycythemia rubra vera 1"""	162860	"""CD177 antigen"""			10753836, 5552408	Standard	NM_020406		Approved	PRV1, HNA2A, NB1	uc002owi.3	Q8N6Q3	OTTHUMG00000185320		19.37:g.43858482A>G		Somatic	122	0		WXS	Illumina HiSeq	Phase_I	82	14	.	0	0	1	1	0	Q711Q2|Q8NCV9|Q96QH1|Q9HDA5	Missense_Mutation	SNP	ENST00000607517.1	37		.	.	.	.	.	.	.	.	.	.	a	1.488	-0.555479	0.03967	.	.	ENSG00000204936	ENST00000378009;ENST00000378012;ENST00000457794	T;T;T	0.14022	3.11;2.54;2.54	3.05	0.928	0.19443	.	.	.	.	.	T	0.07324	0.0185	N	0.22421	0.69	0.09310	N	1	B	0.28636	0.218	B	0.24006	0.05	T	0.36311	-0.9753	9	0.32370	T	0.25	.	3.442	0.07466	0.6353:0.2352:0.1295:0.0	.	106	Q8N6Q3	CD177_HUMAN	R	106	ENSP00000367248:Q106R;ENSP00000367251:Q106R;ENSP00000388794:Q106R	ENSP00000367248:Q106R	Q	+	2	0	CD177	48550322	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	0.400000	0.20932	0.123000	0.18342	-0.256000	0.11100	CAG	.		0.682	CD177-001	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000470162.1	NM_020406	
FUT2	2524	hgsc.bcm.edu;broad.mit.edu	37	19	49206557	49206557	+	Missense_Mutation	SNP	A	A	C			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr19:49206557A>C	ENST00000425340.2	+	2	461	c.344A>C	c.(343-345)cAc>cCc	p.H115P	FUT2_ENST00000391876.4_Missense_Mutation_p.H115P	NM_000511.5|NM_001097638.2	NP_000502.4|NP_001091107.1	Q10981	FUT2_HUMAN	fucosyltransferase 2 (secretor status included)	115					carbohydrate metabolic process (GO:0005975)|fucosylation (GO:0036065)|L-fucose catabolic process (GO:0042355)|protein glycosylation (GO:0006486)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	fucosyltransferase activity (GO:0008417)|galactoside 2-alpha-L-fucosyltransferase activity (GO:0008107)			breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(1)|lung(2)	7		all_lung(116;4.89e-06)|all_epithelial(76;7.04e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.00011)|all cancers(93;0.000238)|GBM - Glioblastoma multiforme(486;0.0164)|Epithelial(262;0.017)		CCGGTGCTGCACAGCGCCACG	0.652																																					p.H115P		.											.	FUT2-90	0			c.A344C						.						24.0	25.0	25.0					19																	49206557		2202	4293	6495	SO:0001583	missense	2524	exon2			TGCTGCACAGCGC		CCDS33069.1	19q13.33	2014-07-19			ENSG00000176920	ENSG00000176920		"""Fucosyltransferases"""	4013	protein-coding gene	gene with protein product	"""alpha (1,2) fucosyltransferase"", ""galactoside 2-alpha-L-fucosyltransferase 2"", ""GDP-L-fucose:beta-D-galactoside 2-alpha-L-fucosyltransferase 2"", ""alpha(1,2)FT2"", ""secretor factor"", ""secretor blood group alpha-2-fucosyltransferase"""	182100		SE		1763885	Standard	NM_000511		Approved	sej, Se2, SEC2	uc010emc.3	Q10981	OTTHUMG00000164427	ENST00000425340.2:c.344A>C	19.37:g.49206557A>C	ENSP00000387498:p.His115Pro	Somatic	106	1		WXS	Illumina HiSeq	Phase_I	84	6	NM_001097638	0	0	0	0	0	Q0VAG5|Q14338|Q5D0G2	Missense_Mutation	SNP	ENST00000425340.2	37	CCDS33069.1	.	.	.	.	.	.	.	.	.	.	A	7.979	0.750695	0.15778	.	.	ENSG00000176920	ENST00000522966;ENST00000425340;ENST00000391876	D;D;D	0.96522	-4.04;-4.04;-4.04	4.77	-2.42	0.06542	.	.	.	.	.	D	0.96346	0.8808	M	0.74881	2.28	0.09310	N	1	D	0.63046	0.992	P	0.61800	0.894	D	0.90292	0.4323	9	0.26408	T	0.33	.	6.7207	0.23328	0.3886:0.4411:0.1703:0.0	.	115	Q10981	FUT2_HUMAN	P	115	ENSP00000430227:H115P;ENSP00000387498:H115P;ENSP00000375748:H115P	ENSP00000375748:H115P	H	+	2	0	FUT2	53898369	0.000000	0.05858	0.004000	0.12327	0.053000	0.15095	-0.018000	0.12568	-0.254000	0.09500	-0.504000	0.04507	CAC	.		0.652	FUT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378731.2	NM_000511	
ZNF473	25888	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	50550199	50550199	+	Silent	SNP	G	G	T			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr19:50550199G>T	ENST00000595661.1	+	6	2994	c.2499G>T	c.(2497-2499)ctG>ctT	p.L833L	CTD-2126E3.3_ENST00000599410.1_RNA|ZNF473_ENST00000601364.1_Intron|ZNF473_ENST00000445728.3_Silent_p.L821L|ZNF473_ENST00000391821.2_Silent_p.L833L|ZNF473_ENST00000270617.3_Silent_p.L833L|CTD-2126E3.3_ENST00000599914.1_RNA			Q8WTR7	ZN473_HUMAN	zinc finger protein 473	833					gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	Cajal body (GO:0015030)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(9)|liver(2)|lung(12)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37		all_neural(266;0.0459)|Ovarian(192;0.0728)		GBM - Glioblastoma multiforme(134;0.00111)|OV - Ovarian serous cystadenocarcinoma(262;0.0058)		ACCAGCACCTGAGAGTTCACA	0.517											OREG0025632	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L833L		.											.	ZNF473-91	0			c.G2499T						.						68.0	71.0	70.0					19																	50550199		2203	4300	6503	SO:0001819	synonymous_variant	25888	exon5			GCACCTGAGAGTT	AB032967	CCDS33077.1	19q13.33	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	23239	protein-coding gene	gene with protein product						11782445	Standard	NM_015428		Approved	KIAA1141, DKFZP434N043, HZFP100	uc002prn.3	Q8WTR7		ENST00000595661.1:c.2499G>T	19.37:g.50550199G>T		Somatic	77	0	970	WXS	Illumina HiSeq	Phase_I	79	18	NM_015428	0	0	1	1	0	A8K8T7|Q9ULS9|Q9Y4Q7	Silent	SNP	ENST00000595661.1	37	CCDS33077.1																																																																																			.		0.517	ZNF473-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464833.1	XM_046390	
SIGLEC12	89858	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	52004707	52004707	+	Missense_Mutation	SNP	T	T	A			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr19:52004707T>A	ENST00000291707.3	-	1	336	c.281A>T	c.(280-282)cAc>cTc	p.H94L	SIGLEC12_ENST00000598614.1_5'Flank	NM_053003.2	NP_443729.1	Q96PQ1	SIG12_HUMAN	sialic acid binding Ig-like lectin 12 (gene/pseudogene)	94	Ig-like V-type 1.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(2)|biliary_tract(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(1)|lung(23)|ovary(4)|prostate(2)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)	61		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.0102)		CCCAAGGAGGTGGAATCGGTC	0.552																																					p.H94L		.											.	SIGLEC12-96	0			c.A281T						.						164.0	144.0	151.0					19																	52004707		2203	4300	6503	SO:0001583	missense	89858	exon1			AGGAGGTGGAATC	AF282256	CCDS12833.1, CCDS59416.1	19q13.41	2013-01-29	2011-06-29	2004-10-20	ENSG00000254521	ENSG00000254521		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15482	protein-coding gene	gene with protein product		606094	"""SIGLEC-like 1"", ""sialic acid binding Ig-like lectin 12"""	SIGLECL1		11409877, 11328818, 21555517	Standard	NM_053003		Approved	SLG, S2V, Siglec-XII, Siglec-12, Siglec-L1	uc002pwx.1	Q96PQ1	OTTHUMG00000165524	ENST00000291707.3:c.281A>T	19.37:g.52004707T>A	ENSP00000291707:p.His94Leu	Somatic	275	1		WXS	Illumina HiSeq	Phase_I	243	30	NM_053003	0	0	22	22	0	Q8IYH7	Missense_Mutation	SNP	ENST00000291707.3	37	CCDS12833.1	.	.	.	.	.	.	.	.	.	.	.	5.108	0.205613	0.09704	.	.	ENSG00000254521	ENST00000291707	T	0.65178	-0.14	2.42	-1.97	0.07503	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.48714	0.1515	L	0.54323	1.7	0.09310	N	1	B	0.23540	0.087	B	0.17098	0.017	T	0.39272	-0.9622	9	0.56958	D	0.05	.	2.2193	0.03968	0.4626:0.1603:0.0:0.3772	.	94	Q96PQ1	SIG12_HUMAN	L	94	ENSP00000291707:H94L	ENSP00000291707:H94L	H	-	2	0	SIGLEC12	56696519	0.000000	0.05858	0.002000	0.10522	0.333000	0.28666	-1.760000	0.01806	-1.003000	0.03425	0.325000	0.21440	CAC	.		0.552	SIGLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384641.2	NM_053003	
ZNF28	7576	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	53303801	53303801	+	Missense_Mutation	SNP	G	G	C			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr19:53303801G>C	ENST00000457749.2	-	4	1416	c.1297C>G	c.(1297-1299)Cac>Gac	p.H433D	ZNF28_ENST00000414252.2_Missense_Mutation_p.H380D|ZNF28_ENST00000438150.2_Missense_Mutation_p.H380D|ZNF28_ENST00000360272.4_Missense_Mutation_p.H380D	NM_006969.3	NP_008900.3	P17035	ZNF28_HUMAN	zinc finger protein 28	433					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H380Y(2)|p.H433Y(1)		breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|liver(1)|lung(10)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(134;0.0386)|Lung(386;0.145)		TCTCCAGTGTGAATTATACTA	0.373																																					p.H433D		.											.	ZNF28-91	3	Substitution - Missense(3)	breast(3)	c.C1297G						.						113.0	120.0	118.0					19																	53303801		2203	4300	6503	SO:0001583	missense	7576	exon4			CAGTGTGAATTAT	X52355	CCDS33093.1, CCDS33093.2	19q13.41	2013-01-08	2006-05-10		ENSG00000198538	ENSG00000198538		"""Zinc fingers, C2H2-type"", ""-"""	13073	protein-coding gene	gene with protein product			"""zinc finger protein 28 (KOX 24)"""				Standard	NR_036599		Approved	KOX24, DKFZp781D0275	uc002qad.3	P17035	OTTHUMG00000154564	ENST00000457749.2:c.1297C>G	19.37:g.53303801G>C	ENSP00000397693:p.His433Asp	Somatic	289	0		WXS	Illumina HiSeq	Phase_I	200	30	NM_006969	0	0	2	3	1	A8KAK9|B4E3G0|B9EIK7|Q5H9V1|Q5HYM9|Q6ZML9|Q6ZN56	Missense_Mutation	SNP	ENST00000457749.2	37	CCDS33093.2	.	.	.	.	.	.	.	.	.	.	-	14.52	2.559448	0.45590	.	.	ENSG00000198538	ENST00000438150;ENST00000457749;ENST00000360272;ENST00000414252;ENST00000391783	T;T;T;T;T	0.67698	-0.28;-0.28;-0.28;-0.28;-0.28	1.74	0.624	0.17659	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.84433	0.5471	H	0.96460	3.825	0.27520	N	0.951416	D	0.63880	0.993	D	0.79784	0.993	T	0.73257	-0.4040	9	0.87932	D	0	.	6.9561	0.24572	0.1616:0.0:0.8384:0.0	.	433	P17035	ZNF28_HUMAN	D	380;433;380;380;380	ENSP00000412143:H380D;ENSP00000397693:H433D;ENSP00000353410:H380D;ENSP00000444965:H380D;ENSP00000375661:H380D	ENSP00000353410:H380D	H	-	1	0	ZNF28	57995613	1.000000	0.71417	0.003000	0.11579	0.128000	0.20619	4.471000	0.60182	0.072000	0.16694	0.186000	0.17326	CAC	.		0.373	ZNF28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336038.2	NM_006969	
ZNF761	388561	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	53958007	53958007	+	RNA	SNP	T	T	G			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr19:53958007T>G	ENST00000454407.1	+	0	699							Q86XN6	ZN761_HUMAN	zinc finger protein 761						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	30				GBM - Glioblastoma multiforme(134;0.00786)		GTCATCACAATGGAGATTTTT	0.398																																					p.N82K		.											.	ZNF761-91	0			c.T246G						.						89.0	86.0	87.0					19																	53958007		2203	4300	6503			388561	exon7			TCACAATGGAGAT	AB107355		19q13.42	2007-10-05	2006-08-11	2006-08-11	ENSG00000160336	ENSG00000160336		"""Zinc fingers, C2H2-type"""	23179	protein-coding gene	gene with protein product							Standard	NM_001008401		Approved	KIAA2033, FLJ16231, FLJ35333	uc010eqp.3	Q86XN6	OTTHUMG00000156999		19.37:g.53958007T>G		Somatic	111	1		WXS	Illumina HiSeq	Phase_I	100	9	NM_001008401	0	0	0	2	2	Q6ZNB9	Missense_Mutation	SNP	ENST00000454407.1	37																																																																																				.		0.398	ZNF761-203	KNOWN	basic	processed_transcript	processed_transcript		NM_001008401	
ADCY3	109	bcgsc.ca	37	2	25141697	25141697	+	Missense_Mutation	SNP	G	G	A	rs368104984		TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr2:25141697G>A	ENST00000260600.5	-	1	1011	c.160C>T	c.(160-162)Cgg>Tgg	p.R54W		NM_004036.3	NP_004027.2	O60266	ADCY3_HUMAN	adenylate cyclase 3	54					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			NS(1)|breast(5)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|prostate(4)|skin(2)	44	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					AAAGTCAGCCGCATGAAGCGA	0.642																																					p.R54W													.	ADCY3-94	0			c.C160T						.						43.0	48.0	46.0					2																	25141697		2203	4300	6503	SO:0001583	missense	109	exon1			TCAGCCGCATGAA	AF033861	CCDS1715.1	2p23.3	2013-02-04			ENSG00000138031	ENSG00000138031	4.6.1.1	"""Adenylate cyclases"""	234	protein-coding gene	gene with protein product		600291				9920776	Standard	NM_004036		Approved	AC3	uc002rfs.4	O60266	OTTHUMG00000094765	ENST00000260600.5:c.160C>T	2.37:g.25141697G>A	ENSP00000260600:p.Arg54Trp	Somatic	67	0		WXS	Illumina HiSeq	Phase_1	80	5	NM_004036	0	0	0	0	0	B3KT86|Q53T54|Q9UDB1	Missense_Mutation	SNP	ENST00000260600.5	37	CCDS1715.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.186456	0.78789	.	.	ENSG00000138031	ENST00000260600;ENST00000415879;ENST00000435135;ENST00000438445	T;T;T	0.81330	-1.48;-1.11;0.58	4.27	3.39	0.38822	.	0.131649	0.52532	D	0.000068	D	0.85570	0.5727	L	0.54323	1.7	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.68483	0.941;0.958	D	0.86290	0.1673	10	0.87932	D	0	.	12.2745	0.54726	0.0:0.0:0.8291:0.1709	.	54;54	B7ZLX9;O60266	.;ADCY3_HUMAN	W	54;29;54;54	ENSP00000260600:R54W;ENSP00000389799:R54W;ENSP00000406153:R54W	ENSP00000260600:R54W	R	-	1	2	ADCY3	24995201	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.317000	0.51968	0.996000	0.38943	0.563000	0.77884	CGG	.		0.642	ADCY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211574.2		
LOXL3	84695	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	74761483	74761483	+	Silent	SNP	G	G	A			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr2:74761483G>A	ENST00000264094.3	-	11	1970	c.1899C>T	c.(1897-1899)caC>caT	p.H633H	LOXL3_ENST00000409249.1_Intron|LOXL3_ENST00000409549.1_Silent_p.H577H|LOXL3_ENST00000393937.2_Silent_p.H488H|LOXL3_ENST00000409986.1_Silent_p.H488H	NM_032603.2	NP_115992.1	P58215	LOXL3_HUMAN	lysyl oxidase-like 3	633	Lysyl-oxidase like.				epithelial to mesenchymal transition (GO:0001837)|negative regulation of transcription, DNA-templated (GO:0045892)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)|nucleus (GO:0005634)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)			endometrium(7)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	30						AACTAGCTTTGTGGCCCTCAG	0.502																																					p.H633H		.											.	LOXL3-226	0			c.C1899T						.						190.0	183.0	185.0					2																	74761483		2203	4300	6503	SO:0001819	synonymous_variant	84695	exon11			AGCTTTGTGGCCC	AF282619	CCDS1953.1, CCDS74527.1	2p13	2008-05-23			ENSG00000115318	ENSG00000115318			13869	protein-coding gene	gene with protein product		607163				11386757	Standard	NM_032603		Approved		uc002smp.1	P58215	OTTHUMG00000129953	ENST00000264094.3:c.1899C>T	2.37:g.74761483G>A		Somatic	117	0		WXS	Illumina HiSeq	Phase_I	121	20	NM_032603	0	0	3	3	0	D6W5J1|Q2EHP2|Q6IPL7|Q96RS1	Silent	SNP	ENST00000264094.3	37	CCDS1953.1																																																																																			.		0.502	LOXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252215.1	NM_032603	
POLR1A	25885	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	86279952	86279952	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr2:86279952C>T	ENST00000263857.6	-	16	2758	c.2380G>A	c.(2380-2382)Ggc>Agc	p.G794S	POLR1A_ENST00000483538.1_5'Flank|POLR1A_ENST00000409681.1_Missense_Mutation_p.G794S			O95602	RPA1_HUMAN	polymerase (RNA) I polypeptide A, 194kDa	794					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	63						AAGGTGAAGCCTCTGTAGAGC	0.652																																					p.G794S		.											.	POLR1A-93	0			c.G2380A						.						31.0	35.0	34.0					2																	86279952		1926	4147	6073	SO:0001583	missense	25885	exon16			TGAAGCCTCTGTA	AK025568	CCDS42706.1	2p11.2	2013-01-21			ENSG00000068654	ENSG00000068654		"""RNA polymerase subunits"""	17264	protein-coding gene	gene with protein product						9236775	Standard	NM_015425		Approved	DKFZP586M0122, FLJ21915, RPO1-4, RPA1	uc002sqs.3	O95602	OTTHUMG00000153165	ENST00000263857.6:c.2380G>A	2.37:g.86279952C>T	ENSP00000263857:p.Gly794Ser	Somatic	91	1		WXS	Illumina HiSeq	Phase_I	76	9	NM_015425	0	0	0	0	0	B7Z7T0|D6W5M0|Q0VG05|Q9UEH0|Q9UFT9	Missense_Mutation	SNP	ENST00000263857.6	37	CCDS42706.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.675456	0.88445	.	.	ENSG00000068654	ENST00000263857;ENST00000409681	T;T	0.78481	-1.18;-1.18	4.79	4.79	0.61399	RNA polymerase Rpb1, domain 3 (1);	0.000000	0.85682	D	0.000000	D	0.90834	0.7121	M	0.92268	3.29	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.92973	0.6399	10	0.72032	D	0.01	-20.0332	17.6405	0.88135	0.0:1.0:0.0:0.0	.	794	O95602	RPA1_HUMAN	S	794	ENSP00000263857:G794S;ENSP00000386300:G794S	ENSP00000263857:G794S	G	-	1	0	POLR1A	86133463	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.614000	0.67695	2.496000	0.84212	0.655000	0.94253	GGC	.		0.652	POLR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329830.2	NM_015425	
TUBA3D	113457	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	132236969	132236969	+	Silent	SNP	G	G	A			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr2:132236969G>A	ENST00000321253.6	+	3	422	c.315G>A	c.(313-315)agG>agA	p.R105R	TUBA3D_ENST00000409047.2_3'UTR	NM_080386.3	NP_525125.2	Q13748	TBA3C_HUMAN	tubulin, alpha 3d	105					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	32				BRCA - Breast invasive adenocarcinoma(221;0.13)		ATTACGCCAGGGGCCATTACA	0.527																																					p.R105R	Ovarian(137;2059 2432 35543 39401)	.											.	TUBA3D-44	0			c.G315A						.						209.0	172.0	184.0					2																	132236969		2203	4300	6503	SO:0001819	synonymous_variant	113457	exon3			CGCCAGGGGCCAT	K03460	CCDS33290.1	2q21.1	2007-03-16			ENSG00000075886	ENSG00000075886		"""Tubulins"""	24071	protein-coding gene	gene with protein product	"""alpha-tubulin isotype H2-alpha"""					3785200	Standard	NM_080386		Approved	H2-ALPHA	uc002tsu.4	Q13748	OTTHUMG00000153600	ENST00000321253.6:c.315G>A	2.37:g.132236969G>A		Somatic	273	0		WXS	Illumina HiSeq	Phase_I	256	40	NM_080386	0	0	0	0	0	A6NJQ0|Q5W099|Q6PEY3|Q96F18	Silent	SNP	ENST00000321253.6	37	CCDS33290.1																																																																																			.		0.527	TUBA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331800.2	NM_080386	
FIGN	55137	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	164466515	164466515	+	Missense_Mutation	SNP	A	A	T			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr2:164466515A>T	ENST00000333129.3	-	3	2141	c.1827T>A	c.(1825-1827)ttT>ttA	p.F609L	FIGN_ENST00000409634.1_Intron|FIGN_ENST00000482917.1_5'Flank	NM_018086.2	NP_060556.2	Q5HY92	FIGN_HUMAN	fidgetin	609					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)			breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(1)|prostate(2)|skin(1)	47						GTTGCATCAGAAATTCGGTTC	0.458																																					p.F609L		.											.	FIGN-156	0			c.T1827A						.						105.0	99.0	101.0					2																	164466515		1948	4151	6099	SO:0001583	missense	55137	exon3			CATCAGAAATTCG	AK001267	CCDS2221.2	2q24	2010-04-21			ENSG00000182263	ENSG00000182263		"""ATPases / AAA-type"""	13285	protein-coding gene	gene with protein product		605295				11017077	Standard	XM_005246661		Approved		uc002uck.1	Q5HY92	OTTHUMG00000074059	ENST00000333129.3:c.1827T>A	2.37:g.164466515A>T	ENSP00000333836:p.Phe609Leu	Somatic	153	0		WXS	Illumina HiSeq	Phase_I	105	23	NM_018086	0	0	0	0	0	B3KWM0|Q9H6M5|Q9NVZ9	Missense_Mutation	SNP	ENST00000333129.3	37	CCDS2221.2	.	.	.	.	.	.	.	.	.	.	A	12.72	2.023844	0.35701	.	.	ENSG00000182263	ENST00000333129	D	0.86865	-2.18	5.47	2.81	0.32909	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.055714	0.64402	D	0.000001	T	0.74504	0.3725	N	0.00771	-1.2	0.58432	D	0.999996	B	0.32324	0.364	P	0.51999	0.687	T	0.66767	-0.5840	10	0.21014	T	0.42	-19.2916	5.9791	0.19397	0.6913:0.0:0.3087:0.0	.	609	Q5HY92	FIGN_HUMAN	L	609	ENSP00000333836:F609L	ENSP00000333836:F609L	F	-	3	2	FIGN	164174761	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	1.691000	0.37721	1.009000	0.39289	0.383000	0.25322	TTT	.		0.458	FIGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157220.2	NM_018086	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	179650403	179650403	+	Missense_Mutation	SNP	T	T	A			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr2:179650403T>A	ENST00000591111.1	-	15	2661	c.2437A>T	c.(2437-2439)Agc>Tgc	p.S813C	TTN_ENST00000359218.5_Missense_Mutation_p.S767C|TTN_ENST00000460472.2_Missense_Mutation_p.S767C|TTN_ENST00000360870.5_Missense_Mutation_p.S813C|TTN_ENST00000589042.1_Missense_Mutation_p.S813C|TTN_ENST00000342992.6_Missense_Mutation_p.S813C|TTN_ENST00000342175.6_Missense_Mutation_p.S767C			Q8WZ42	TITIN_HUMAN	titin	33644					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AAGTGAGGGCTAGCTGTGCGG	0.373																																					p.S813C		.											.	TTN-636	0			c.A2437T						.						172.0	167.0	169.0					2																	179650403		2203	4300	6503	SO:0001583	missense	7273	exon15			GAGGGCTAGCTGT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.2437A>T	2.37:g.179650403T>A	ENSP00000465570:p.Ser813Cys	Somatic	94	0		WXS	Illumina HiSeq	Phase_I	88	16	NM_001267550	0	0	0	0	0	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	T	12.88	2.071468	0.36566	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.67523	-0.27;-0.03;-0.03;-0.04;0.15	5.51	5.51	0.81932	Ribonuclease H-like (1);	.	.	.	.	T	0.70159	0.3192	L	0.27053	0.805	0.24564	N	0.993953	D;D;D;D;D	0.89917	0.993;0.993;0.993;0.993;1.0	P;P;P;P;D	0.69479	0.628;0.628;0.628;0.628;0.964	T	0.62699	-0.6799	9	0.87932	D	0	.	10.3027	0.43661	0.0:0.0737:0.0:0.9263	.	767;767;767;813;813	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	C	813;767;767;767;767;813	ENSP00000343764:S813C;ENSP00000434586:S767C;ENSP00000340554:S767C;ENSP00000352154:S767C;ENSP00000354117:S813C	ENSP00000340554:S767C	S	-	1	0	TTN	179358648	1.000000	0.71417	0.998000	0.56505	0.978000	0.69477	2.566000	0.45948	2.210000	0.71456	0.533000	0.62120	AGC	.		0.373	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
COL6A3	1293	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	238303376	238303376	+	Missense_Mutation	SNP	A	A	G			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr2:238303376A>G	ENST00000295550.4	-	3	1015	c.563T>C	c.(562-564)aTa>aCa	p.I188T	COL6A3_ENST00000472056.1_Intron|COL6A3_ENST00000353578.4_Intron|COL6A3_ENST00000347401.3_Missense_Mutation_p.I188T|COL6A3_ENST00000392004.3_Intron|COL6A3_ENST00000409809.1_Intron|COL6A3_ENST00000346358.4_Missense_Mutation_p.I188T|COL6A3_ENST00000392003.2_Intron	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	188	Nonhelical region.|VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		TTCACTTGCTATTTCTTTTAA	0.433																																					p.I188T		.											.	COL6A3-526	0			c.T563C						.						127.0	124.0	125.0					2																	238303376		2203	4300	6503	SO:0001583	missense	1293	exon3			CTTGCTATTTCTT	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.563T>C	2.37:g.238303376A>G	ENSP00000295550:p.Ile188Thr	Somatic	122	0		WXS	Illumina HiSeq	Phase_I	85	13	NM_004369	0	0	1	1	0	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	CCDS33412.1	.	.	.	.	.	.	.	.	.	.	A	6.536	0.467096	0.12402	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000346358;ENST00000433762	D;D;D;D	0.84146	-1.81;-1.81;-1.81;-1.81	4.9	3.72	0.42706	von Willebrand factor, type A (3);	0.267710	0.25584	U	0.029678	D	0.88437	0.6436	H	0.94886	3.595	0.47778	D	0.999513	B;B	0.19445	0.009;0.036	B;B	0.20767	0.021;0.031	D	0.85506	0.1194	10	0.62326	D	0.03	.	10.6923	0.45877	0.9233:0.0:0.0766:0.0	.	188;188	E9PCV6;P12111	.;CO6A3_HUMAN	T	188	ENSP00000295550:I188T;ENSP00000315609:I188T;ENSP00000295546:I188T;ENSP00000389539:I188T	ENSP00000295550:I188T	I	-	2	0	COL6A3	237968115	1.000000	0.71417	0.997000	0.53966	0.219000	0.24729	6.121000	0.71602	0.699000	0.31761	0.374000	0.22700	ATA	.		0.433	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
RNPEPL1	57140	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	241516157	241516157	+	Silent	SNP	C	C	T			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr2:241516157C>T	ENST00000270357.4	+	9	1616	c.1023C>T	c.(1021-1023)ctC>ctT	p.L341L	RNPEPL1_ENST00000464550.1_3'UTR	NM_018226.4	NP_060696.4	Q9HAU8	RNPL1_HUMAN	arginyl aminopeptidase (aminopeptidase B)-like 1	341					leukotriene biosynthetic process (GO:0019370)		aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	13		all_epithelial(40;1.13e-11)|Breast(86;0.000169)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.204)|Melanoma(123;0.238)		Epithelial(32;3.05e-31)|all cancers(36;8.2e-29)|OV - Ovarian serous cystadenocarcinoma(60;8.55e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.12e-06)|Lung(119;0.00168)|Colorectal(34;0.005)|LUSC - Lung squamous cell carcinoma(224;0.00813)|COAD - Colon adenocarcinoma(134;0.0322)		TGGACCGGCTCCTGGATGGGT	0.687																																					p.L572L		.											.	RNPEPL1-154	0			c.C1716T						.						29.0	33.0	32.0					2																	241516157		2196	4289	6485	SO:0001819	synonymous_variant	57140	exon9			CCGGCTCCTGGAT			2q37.3	2012-03-06			ENSG00000142327	ENSG00000142327			10079	protein-coding gene	gene with protein product		605287				19508204	Standard	NM_018226		Approved		uc002vzi.4	Q9HAU8	OTTHUMG00000133357	ENST00000270357.4:c.1023C>T	2.37:g.241516157C>T		Somatic	99	0		WXS	Illumina HiSeq	Phase_I	83	11	NM_018226	0	0	42	62	20	Q5XKC3|Q6NX56|Q96AC9|Q9H033|Q9NVD0	Silent	SNP	ENST00000270357.4	37																																																																																				.		0.687	RNPEPL1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000257190.4	NM_018226	
NCOA6	23054	hgsc.bcm.edu;broad.mit.edu	37	20	33345744	33345744	+	Silent	SNP	C	C	T			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr20:33345744C>T	ENST00000374796.2	-	8	3377	c.807G>A	c.(805-807)caG>caA	p.Q269Q	NCOA6_ENST00000359003.2_Silent_p.Q269Q			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	269	CREBBP-binding region.|Gln-rich.|NCOA1-binding region.|TBP/GTF2A-binding region.				brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)	p.Q269Q(15)		NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						gctgctgctgctgttgttgtt	0.537																																					p.Q269Q		.											.	NCOA6-292	15	Substitution - coding silent(15)	lung(5)|prostate(4)|endometrium(3)|central_nervous_system(1)|urinary_tract(1)|kidney(1)	c.G807A						.						64.0	52.0	56.0					20																	33345744		2203	4300	6503	SO:0001819	synonymous_variant	23054	exon7			CTGCTGCTGTTGT	AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.807G>A	20.37:g.33345744C>T		Somatic	73	2		WXS	Illumina HiSeq	Phase_I	46	4	NM_014071	0	0	5	5	0	A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Silent	SNP	ENST00000374796.2	37	CCDS13241.1																																																																																			.		0.537	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078811.2	NM_014071	
WFDC12	128488	broad.mit.edu;bcgsc.ca	37	20	43752864	43752864	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr20:43752864C>T	ENST00000372785.3	-	2	139	c.122G>A	c.(121-123)tGc>tAc	p.C41Y		NM_080869.1	NP_543145.1	Q8WWY7	WFD12_HUMAN	WAP four-disulfide core domain 12	41	WAP. {ECO:0000255|PROSITE- ProRule:PRU00722}.				defense response to bacterium (GO:0042742)|negative regulation of endopeptidase activity (GO:0010951)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			endometrium(1)|large_intestine(2)|lung(2)|skin(1)	6		Myeloproliferative disorder(115;0.0122)				GGACTTGAAGCAGCGTACGTT	0.547																																					p.C41Y													.	WFDC12-90	0			c.G122A						.						119.0	96.0	104.0					20																	43752864		2203	4300	6503	SO:0001583	missense	128488	exon2			TTGAAGCAGCGTA	Z93016	CCDS13343.1	20q13.12	2013-01-21	2003-02-21	2003-02-21	ENSG00000168703	ENSG00000168703		"""WAP four-disulfide core domain containing"""	16115	protein-coding gene	gene with protein product		609872	"""chromosome 20 open reading frame 122"""	C20orf122		11779191, 12206714	Standard	NM_080869		Approved	dJ211D12.4, WAP2	uc002xnf.1	Q8WWY7	OTTHUMG00000046412	ENST00000372785.3:c.122G>A	20.37:g.43752864C>T	ENSP00000361871:p.Cys41Tyr	Somatic	114	0		WXS	Illumina HiSeq	Phase_I	126	7	NM_080869	0	0	10	13	3	Q5H980|Q9BR31	Missense_Mutation	SNP	ENST00000372785.3	37	CCDS13343.1	.	.	.	.	.	.	.	.	.	.	C	12.86	2.065496	0.36470	.	.	ENSG00000168703	ENST00000372785	T	0.80214	-1.35	3.46	2.48	0.30137	Whey acidic protein, 4-disulphide core (5);	.	.	.	.	D	0.92335	0.7568	H	0.98111	4.15	0.09310	N	1	D	0.89917	1.0	D	0.74674	0.984	T	0.83064	-0.0146	9	0.87932	D	0	-3.5146	8.5723	0.33576	0.0:0.7615:0.2385:0.0	.	41	Q8WWY7	WFD12_HUMAN	Y	41	ENSP00000361871:C41Y	ENSP00000361871:C41Y	C	-	2	0	WFDC12	43186278	0.197000	0.23362	0.003000	0.11579	0.043000	0.13939	0.984000	0.29565	0.405000	0.25532	0.557000	0.71058	TGC	.		0.547	WFDC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000107194.1		
LAMA5	3911	hgsc.bcm.edu	37	20	60887506	60887506	+	Missense_Mutation	SNP	T	T	G			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr20:60887506T>G	ENST00000252999.3	-	68	9376	c.9310A>C	c.(9310-9312)Aag>Cag	p.K3104Q		NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	3104	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			TTCAGCCGCTTGAGGTCCACA	0.682																																					p.K3104Q		.											.	LAMA5-93	0			c.A9310C						.						43.0	39.0	40.0					20																	60887506		2190	4296	6486	SO:0001583	missense	3911	exon68			GCCGCTTGAGGTC	AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.9310A>C	20.37:g.60887506T>G	ENSP00000252999:p.Lys3104Gln	Somatic	23	0		WXS	Illumina HiSeq	Phase_I	37	2	NM_005560	0	0	71	71	0	Q8TDF8|Q8WZA7|Q9H1P1	Missense_Mutation	SNP	ENST00000252999.3	37	CCDS33502.1	.	.	.	.	.	.	.	.	.	.	t	22.3	4.275756	0.80580	.	.	ENSG00000130702	ENST00000252999	T	0.41400	1.0	4.26	4.26	0.50523	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.052784	0.64402	D	0.000001	T	0.53318	0.1789	M	0.64997	1.995	0.80722	D	1	D	0.69078	0.997	P	0.58520	0.84	T	0.50346	-0.8839	10	0.23891	T	0.37	.	13.1986	0.59754	0.0:0.0:0.0:1.0	.	3104	O15230	LAMA5_HUMAN	Q	3104	ENSP00000252999:K3104Q	ENSP00000252999:K3104Q	K	-	1	0	LAMA5	60320901	0.989000	0.36119	0.997000	0.53966	0.953000	0.61014	1.425000	0.34859	1.794000	0.52575	0.454000	0.30748	AAG	.		0.682	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080014.2	NM_005560	
SLC2A4RG	56731	hgsc.bcm.edu;broad.mit.edu	37	20	62374341	62374341	+	Nonstop_Mutation	SNP	T	T	C			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr20:62374341T>C	ENST00000266077.2	+	8	1214	c.1162T>C	c.(1162-1164)Taa>Caa	p.*388Q	SLC2A4RG_ENST00000493772.1_3'UTR|RP4-583P15.10_ENST00000433905.2_RNA|RP4-583P15.10_ENST00000447343.2_RNA	NM_020062.3	NP_064446.2	Q9NR83	S2A4R_HUMAN	SLC2A4 regulator	0					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|kidney(1)|lung(2)|prostate(2)|skin(1)	7	all_cancers(38;1.13e-12)|all_epithelial(29;2.64e-14)|Lung NSC(23;4.79e-10)|all_lung(23;1.7e-09)					GTTCCTGGACTAAGTCCGGCT	0.652																																					p.X388Q		.											.	SLC2A4RG-90	0			c.T1162C						.						25.0	34.0	31.0					20																	62374341		2200	4300	6500	SO:0001578	stop_lost	56731	exon8			CTGGACTAAGTCC	AF249267	CCDS13537.1	20q13.33	2010-03-11			ENSG00000125520	ENSG00000125520			15930	protein-coding gene	gene with protein product	"""GLUT4 enhancer factor"", ""Huntington's disease gene regulatory region-binding protein 1"""	609493				10825161	Standard	NM_020062		Approved	GEF, HDBP1, Si-1-2, Si-1-2-19	uc002ygq.3	Q9NR83	OTTHUMG00000032997	ENST00000266077.2:c.1162T>C	20.37:g.62374341T>C	ENSP00000266077:p.*388Glnext*69	Somatic	22	0		WXS	Illumina HiSeq	Phase_I	23	6	NM_020062	0	0	41	67	26	Q2PHL5|Q6F6I6|Q6F6I7|Q6GTK5|Q8TAH5|Q8WVW7|Q96QD3|Q9BV85	Missense_Mutation	SNP	ENST00000266077.2	37	CCDS13537.1	.	.	.	.	.	.	.	.	.	.	T	13.44	2.238393	0.39598	.	.	ENSG00000125520	ENST00000266077	.	.	.	4.17	4.17	0.49024	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.0424	0.53460	0.0:0.0:0.0:1.0	.	.	.	.	Q	388	.	.	X	+	1	0	SLC2A4RG	61844785	1.000000	0.71417	1.000000	0.80357	0.515000	0.34225	4.553000	0.60753	1.525000	0.49052	0.260000	0.18958	TAA	.		0.652	SLC2A4RG-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080202.1	NM_020062	
SCAP	22937	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	47456625	47456625	+	Silent	SNP	C	C	T			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr3:47456625C>T	ENST00000265565.5	-	19	3514	c.3102G>A	c.(3100-3102)ttG>ttA	p.L1034L	SCAP_ENST00000441517.2_Silent_p.L778L|SCAP_ENST00000545718.1_Silent_p.L641L	NM_012235.2	NP_036367.2	Q12770	SCAP_HUMAN	SREBF chaperone	1034	Interaction with SREBF2. {ECO:0000250}.				aging (GO:0007568)|cholesterol metabolic process (GO:0008203)|negative regulation of cholesterol biosynthetic process (GO:0045541)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|regulation of fatty acid biosynthetic process (GO:0042304)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)|SREBP signaling pathway (GO:0032933)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|protein complex (GO:0043234)	unfolded protein binding (GO:0051082)			endometrium(4)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	26				BRCA - Breast invasive adenocarcinoma(193;0.000278)|KIRC - Kidney renal clear cell carcinoma(197;0.00592)|Kidney(197;0.00679)		TGTGGGTCTCCAAGGAGAAGA	0.632																																					p.L1034L	Pancreas(149;978 1908 29304 37806 46700)	.											.	SCAP-91	0			c.G3102A						.						51.0	53.0	52.0					3																	47456625		2202	4299	6501	SO:0001819	synonymous_variant	22937	exon19			GGTCTCCAAGGAG	BC020987	CCDS2755.2	3p21.31	2013-01-10			ENSG00000114650	ENSG00000114650		"""WD repeat domain containing"""	30634	protein-coding gene	gene with protein product	"""SREBP cleavage activating protein"""	601510				8898195, 8724849, 10570913	Standard	XM_005264967		Approved	KIAA0199	uc003crh.1	Q12770	OTTHUMG00000125539	ENST00000265565.5:c.3102G>A	3.37:g.47456625C>T		Somatic	65	0		WXS	Illumina HiSeq	Phase_I	69	17	NM_012235	0	0	32	44	12	Q8N2E0|Q8WUA1	Silent	SNP	ENST00000265565.5	37	CCDS2755.2																																																																																			.		0.632	SCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246872.2	NM_012235	
C3orf18	51161	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	50602964	50602964	+	Missense_Mutation	SNP	G	G	A	rs559763162		TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr3:50602964G>A	ENST00000357203.3	-	3	706	c.167C>T	c.(166-168)aCg>aTg	p.T56M	C3orf18_ENST00000449241.1_Missense_Mutation_p.T56M|C3orf18_ENST00000426034.1_Missense_Mutation_p.T56M|C3orf18_ENST00000441239.1_Missense_Mutation_p.T56M|C3orf18_ENST00000486175.1_Intron	NM_016210.4	NP_057294.2	Q9UK00	CC018_HUMAN	chromosome 3 open reading frame 18	56						integral component of membrane (GO:0016021)				lung(1)|pancreas(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.000278)|KIRC - Kidney renal clear cell carcinoma(197;0.0175)|Kidney(197;0.0207)		CACGCCGGCCGTGCCACCAGC	0.607																																					p.T56M		.											.	C3orf18-279	0			c.C167T						.						88.0	76.0	80.0					3																	50602964		2202	4300	6502	SO:0001583	missense	51161	exon3			CCGGCCGTGCCAC	AF188706	CCDS2829.1, CCDS54589.1	3p21.3	2006-01-11			ENSG00000088543	ENSG00000088543			24837	protein-coding gene	gene with protein product						12477932	Standard	NM_016210		Approved	G20	uc010hlp.3	Q9UK00	OTTHUMG00000156854	ENST00000357203.3:c.167C>T	3.37:g.50602964G>A	ENSP00000349732:p.Thr56Met	Somatic	67	0		WXS	Illumina HiSeq	Phase_I	65	13	NM_016210	0	0	0	1	1	C9JNP0	Missense_Mutation	SNP	ENST00000357203.3	37	CCDS2829.1	.	.	.	.	.	.	.	.	.	.	G	10.95	1.495028	0.26774	.	.	ENSG00000088543	ENST00000426034;ENST00000357203;ENST00000449241;ENST00000441239	T;T;T;T	0.42513	2.52;2.52;2.52;0.97	5.24	3.36	0.38483	.	0.821587	0.11279	N	0.580514	T	0.24851	0.0603	N	0.19112	0.55	0.21105	N	0.999781	P;P	0.52577	0.89;0.954	B;B	0.37780	0.258;0.251	T	0.05920	-1.0856	10	0.52906	T	0.07	-12.7022	7.5988	0.28065	0.0:0.3237:0.5385:0.1378	.	56;56	C9JNP0;Q9UK00	.;CC018_HUMAN	M	56	ENSP00000387606:T56M;ENSP00000349732:T56M;ENSP00000404913:T56M;ENSP00000414124:T56M	ENSP00000349732:T56M	T	-	2	0	C3orf18	50577968	0.019000	0.18553	0.001000	0.08648	0.388000	0.30384	2.265000	0.43311	1.193000	0.43086	0.462000	0.41574	ACG	.		0.607	C3orf18-014	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346260.2	NM_016210	
BBX	56987	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	107491690	107491690	+	Missense_Mutation	SNP	G	G	C			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr3:107491690G>C	ENST00000325805.8	+	11	1409	c.1122G>C	c.(1120-1122)gaG>gaC	p.E374D	BBX_ENST00000415149.2_Missense_Mutation_p.E374D|BBX_ENST00000406780.1_Missense_Mutation_p.E374D|BBX_ENST00000416476.2_Intron|BBX_ENST00000402543.1_Missense_Mutation_p.E374D			Q8WY36	BBX_HUMAN	bobby sox homolog (Drosophila)	374					bone development (GO:0060348)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(18)|ovary(4)|pancreas(1)|skin(2)	49			OV - Ovarian serous cystadenocarcinoma(3;0.112)			GAAATTTTGAGGCATTGCAAA	0.323																																					p.E374D		.											.	BBX-94	0			c.G1122C						.						58.0	68.0	64.0					3																	107491690		2203	4298	6501	SO:0001583	missense	56987	exon11			TTTTGAGGCATTG	AF168718	CCDS2950.1, CCDS46881.1, CCDS63712.1	3q13.1	2008-07-18			ENSG00000114439	ENSG00000114439			14422	protein-coding gene	gene with protein product	"""x 001 protein"""					11680820	Standard	NM_001142568		Approved	MDS001, HSPC339, HBP2	uc010hpr.4	Q8WY36	OTTHUMG00000150360	ENST00000325805.8:c.1122G>C	3.37:g.107491690G>C	ENSP00000319974:p.Glu374Asp	Somatic	99	0		WXS	Illumina HiSeq	Phase_I	109	48	NM_001142568	0	0	2	7	5	A2RRM7|Q2TAJ1|Q7L3J8|Q7LBY8|Q8NDB0|Q8WY35|Q9H0J6	Missense_Mutation	SNP	ENST00000325805.8	37	CCDS46881.1	.	.	.	.	.	.	.	.	.	.	G	4.952	0.176823	0.09443	.	.	ENSG00000114439	ENST00000415149;ENST00000325767;ENST00000402543;ENST00000325805;ENST00000402163;ENST00000406780	D;D;D;D;D	0.98747	-4.6;-4.6;-4.61;-5.11;-4.6	6.16	-0.709	0.11237	.	0.342008	0.33253	N	0.005119	D	0.94486	0.8225	N	0.24115	0.695	0.28521	N	0.91307	B;B;B	0.18461	0.012;0.028;0.009	B;B;B	0.14023	0.004;0.01;0.009	D	0.88666	0.3192	10	0.45353	T	0.12	-10.7263	7.4111	0.27017	0.5975:0.0:0.282:0.1205	.	374;374;374	C9JA69;Q8WY36;Q8WY36-2	.;BBX_HUMAN;.	D	374;225;374;374;374;374	ENSP00000408358:E374D;ENSP00000385317:E374D;ENSP00000319974:E374D;ENSP00000385518:E374D;ENSP00000385530:E374D	ENSP00000319742:E225D	E	+	3	2	BBX	108974380	0.991000	0.36638	0.873000	0.34254	0.130000	0.20726	0.223000	0.17719	-0.449000	0.07117	-1.871000	0.00553	GAG	.		0.323	BBX-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317820.1	NM_020235	
EHHADH	1962	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	184922367	184922367	+	Silent	SNP	G	G	A	rs149294851		TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr3:184922367G>A	ENST00000231887.3	-	6	822	c.747C>T	c.(745-747)atC>atT	p.I249I	EHHADH_ENST00000456310.1_Silent_p.I153I	NM_001166415.1|NM_001966.3	NP_001159887.1|NP_001957.2	Q08426	ECHP_HUMAN	enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase	249	Enoyl-CoA hydratase / isomerase.				fatty acid beta-oxidation (GO:0006635)|internal protein amino acid acetylation (GO:0006475)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisome (GO:0005777)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|coenzyme binding (GO:0050662)|dodecenoyl-CoA delta-isomerase activity (GO:0004165)|enoyl-CoA hydratase activity (GO:0004300)|enzyme binding (GO:0019899)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|prostate(2)|skin(3)	24	all_cancers(143;4.04e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.98e-32)|OV - Ovarian serous cystadenocarcinoma(80;5.55e-21)			CCTCCTTCTTGATGCCCACTT	0.517																																					p.I249I		.											.	EHHADH-93	0			c.C747T						.						131.0	128.0	129.0					3																	184922367		2203	4300	6503	SO:0001819	synonymous_variant	1962	exon6			CTTCTTGATGCCC	L07077	CCDS33901.1, CCDS54694.1	3q26.3-q28	2012-07-13	2010-04-30		ENSG00000113790	ENSG00000113790	4.2.1.17, 1.1.1.35, 5.3.3.8		3247	protein-coding gene	gene with protein product		607037	"""enoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase"""	ECHD		8188243	Standard	NM_001966		Approved		uc003fpf.3	Q08426	OTTHUMG00000156698	ENST00000231887.3:c.747C>T	3.37:g.184922367G>A		Somatic	234	0		WXS	Illumina HiSeq	Phase_I	289	88	NM_001966	0	0	5	32	27	A8K6Y3|B4DWG3|D3DNU0|Q58EZ5	Silent	SNP	ENST00000231887.3	37	CCDS33901.1																																																																																			G|1.000;C|0.000		0.517	EHHADH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345326.1		
MFSD10	10227	hgsc.bcm.edu	37	4	2934901	2934901	+	Missense_Mutation	SNP	G	G	C			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr4:2934901G>C	ENST00000329687.4	-	3	838	c.304C>G	c.(304-306)Ctg>Gtg	p.L102V	NOP14-AS1_ENST00000505731.1_RNA|MFSD10_ENST00000514800.1_Missense_Mutation_p.L102V|NOP14-AS1_ENST00000515194.1_RNA|NOP14-AS1_ENST00000507999.1_RNA|MFSD10_ENST00000508221.1_Missense_Mutation_p.L102V|NOP14-AS1_ENST00000512712.2_RNA|MFSD10_ENST00000507555.1_Missense_Mutation_p.L102V|MFSD10_ENST00000355443.4_Missense_Mutation_p.L102V	NM_001120.4	NP_001111.3	Q14728	MFS10_HUMAN	major facilitator superfamily domain containing 10	102					apoptotic process (GO:0006915)|tetracycline transport (GO:0015904)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)	tetracycline transporter activity (GO:0008493)			breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|skin(1)	7				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		GGCGCACACAGAAACTGCAGG	0.617																																					p.L102V		.											.	MFSD10-68	0			c.C304G						.						53.0	53.0	53.0					4																	2934901		2202	4299	6501	SO:0001583	missense	10227	exon3			CACACAGAAACTG	L11669	CCDS3365.1	4p16.3	2008-03-03			ENSG00000109736	ENSG00000109736			16894	protein-coding gene	gene with protein product	"""tetracycline transporter like protein"""	610977				8353488, 17362938	Standard	NM_001120		Approved	TETRAN, IT10C3	uc003gfz.3	Q14728	OTTHUMG00000122081	ENST00000329687.4:c.304C>G	4.37:g.2934901G>C	ENSP00000332646:p.Leu102Val	Somatic	38	0		WXS	Illumina HiSeq	Phase_I	54	9	NM_001120	0	0	26	64	38	Q07706	Missense_Mutation	SNP	ENST00000329687.4	37	CCDS3365.1	.	.	.	.	.	.	.	.	.	.	G	5.826	0.336718	0.11013	.	.	ENSG00000109736	ENST00000514800;ENST00000355443;ENST00000329687;ENST00000508221;ENST00000507555	T;T;T;T;T	0.57107	0.42;0.42;0.42;0.42;0.42	4.19	-0.214	0.13161	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.370891	0.28062	N	0.016760	T	0.33585	0.0868	L	0.45422	1.42	0.20307	N	0.999916	B;B;B;B	0.23735	0.012;0.022;0.09;0.007	B;B;B;B	0.29267	0.042;0.078;0.1;0.032	T	0.09796	-1.0658	10	0.14656	T	0.56	-10.5579	0.8156	0.01102	0.2667:0.3381:0.2238:0.1713	.	102;102;102;102	D6RIZ4;D6RE79;D6RA47;Q14728	.;.;.;MFS10_HUMAN	V	102	ENSP00000426907:L102V;ENSP00000347619:L102V;ENSP00000332646:L102V;ENSP00000425757:L102V;ENSP00000423402:L102V	ENSP00000332646:L102V	L	-	1	2	MFSD10	2904699	0.985000	0.35326	0.153000	0.22517	0.211000	0.24417	0.178000	0.16820	0.045000	0.15804	0.561000	0.74099	CTG	.		0.617	MFSD10-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358072.2	NM_001120	
JAKMIP1	152789	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	6066676	6066676	+	Silent	SNP	C	C	T			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr4:6066676C>T	ENST00000282924.5	-	9	1847	c.1362G>A	c.(1360-1362)ttG>ttA	p.L454L	JAKMIP1_ENST00000410077.2_Silent_p.L289L|JAKMIP1_ENST00000457227.2_5'UTR|JAKMIP1_ENST00000409831.1_Silent_p.L454L|JAKMIP1_ENST00000409021.3_Silent_p.L454L|JAKMIP1_ENST00000409371.3_Silent_p.L269L	NM_144720.3	NP_653321.1	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein 1	454	Mediates interaction with TYK2 and GABBR1.				cognition (GO:0050890)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|microtubule (GO:0005874)|ribonucleoprotein complex (GO:0030529)	GABA receptor binding (GO:0050811)|RNA binding (GO:0003723)			NS(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						ATGTTTCGGACAACGTTTCTG	0.488																																					p.L454L		.											.	JAKMIP1-292	0			c.G1362A						.						192.0	163.0	173.0					4																	6066676		2203	4300	6503	SO:0001819	synonymous_variant	152789	exon9			TTCGGACAACGTT	AK056126	CCDS3385.1, CCDS47005.1	4p16.1	2013-10-11	2009-08-13		ENSG00000152969	ENSG00000152969			26460	protein-coding gene	gene with protein product		611195				18941173	Standard	NM_144720		Approved	MARLIN1, JAMIP1, Gababrbp, FLJ31564	uc010idb.1	Q96N16	OTTHUMG00000125491	ENST00000282924.5:c.1362G>A	4.37:g.6066676C>T		Somatic	125	0		WXS	Illumina HiSeq	Phase_I	92	6	NM_001099433	0	0	0	0	0	A6H2J2|A6H2J3|A6H2J4|A6H2J5|A8MTK6|B4DHZ8|B8ZZR7|D3DVT0|Q86Y69|Q8N7G3	Silent	SNP	ENST00000282924.5	37	CCDS3385.1																																																																																			.		0.488	JAKMIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246816.2	NM_144720	
BOD1L1	259282	broad.mit.edu;bcgsc.ca	37	4	13601157	13601157	+	Missense_Mutation	SNP	A	A	G			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr4:13601157A>G	ENST00000040738.5	-	10	7502	c.7367T>C	c.(7366-7368)cTc>cCc	p.L2456P		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	2456						nucleus (GO:0005634)	DNA binding (GO:0003677)										TGCATTTATGAGGTGTAAAGT	0.468											OREG0016115	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L2456P													.	.	0			c.T7367C						.						164.0	147.0	153.0					4																	13601157		2203	4300	6503	SO:0001583	missense	259282	exon10			TTTATGAGGTGTA	AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.7367T>C	4.37:g.13601157A>G	ENSP00000040738:p.Leu2456Pro	Somatic	109	0	688	WXS	Illumina HiSeq	Phase_I	107	5	NM_148894	0	0	4	5	1	Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	ENST00000040738.5	37	CCDS3411.2	.	.	.	.	.	.	.	.	.	.	A	13.05	2.120234	0.37436	.	.	ENSG00000038219	ENST00000040738	T	0.09350	2.99	4.17	-0.642	0.11486	.	0.433636	0.16546	N	0.209707	T	0.06781	0.0173	L	0.27053	0.805	0.09310	N	1	B	0.12630	0.006	B	0.08055	0.003	T	0.30937	-0.9961	10	0.40728	T	0.16	.	8.0002	0.30293	0.597:0.0:0.403:0.0	.	2456	Q8NFC6	BOD1L_HUMAN	P	2456	ENSP00000040738:L2456P	ENSP00000040738:L2456P	L	-	2	0	BOD1L	13210255	0.000000	0.05858	0.003000	0.11579	0.018000	0.09664	0.222000	0.17699	-0.013000	0.14199	0.454000	0.30748	CTC	.		0.468	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207321.1	NM_148894	
RELL1	768211	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	37650975	37650975	+	Missense_Mutation	SNP	T	T	A			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr4:37650975T>A	ENST00000454158.2	-	2	324	c.236A>T	c.(235-237)cAc>cTc	p.H79L	RELL1_ENST00000314117.4_Missense_Mutation_p.H79L	NM_001085400.1	NP_001078869.1	Q8IUW5	RELL1_HUMAN	RELT-like 1	79						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(3)|lung(1)|skin(1)	6						CTTAAGCAGGTGGCAAATGAG	0.443																																					p.H79L		.											.	RELL1-68	0			c.A236T						.						174.0	179.0	178.0					4																	37650975		1930	4130	6060	SO:0001583	missense	768211	exon2			AGCAGGTGGCAAA	AK025431	CCDS43221.1	4p14	2011-10-11				ENSG00000181826			27379	protein-coding gene	gene with protein product		611212				16389068	Standard	NM_001085399		Approved		uc003gsz.2	Q8IUW5		ENST00000454158.2:c.236A>T	4.37:g.37650975T>A	ENSP00000398778:p.His79Leu	Somatic	274	1		WXS	Illumina HiSeq	Phase_I	258	29	NM_001085399	0	0	8	16	8	Q8NBK1	Missense_Mutation	SNP	ENST00000454158.2	37	CCDS43221.1	.	.	.	.	.	.	.	.	.	.	T	26.9	4.783032	0.90282	.	.	ENSG00000181826	ENST00000314117;ENST00000454158;ENST00000512114	T;T;T	0.38560	1.19;1.19;1.13	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.64349	0.2590	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.68390	-0.5421	10	0.87932	D	0	-7.8098	15.2746	0.73732	0.0:0.0:0.0:1.0	.	79	Q8IUW5	RELL1_HUMAN	L	79;79;100	ENSP00000313385:H79L;ENSP00000398778:H79L;ENSP00000424031:H100L	ENSP00000313385:H79L	H	-	2	0	RELL1	37327370	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.515000	0.73751	2.084000	0.62774	0.533000	0.62120	CAC	.		0.443	RELL1-002	KNOWN	alternative_3_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360485.1	NM_001085400	
DMP1	1758	broad.mit.edu	37	4	88583660	88583660	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr4:88583660G>A	ENST00000339673.6	+	6	829	c.730G>A	c.(730-732)Gaa>Aaa	p.E244K	RP11-742B18.1_ENST00000506480.1_RNA|DMP1_ENST00000282479.7_Missense_Mutation_p.E228K|RP11-742B18.1_ENST00000506814.1_RNA|RP11-742B18.1_ENST00000507894.1_RNA	NM_004407.3	NP_004398.1	Q13316	DMP1_HUMAN	dentin matrix acidic phosphoprotein 1	244					biomineral tissue development (GO:0031214)|extracellular matrix organization (GO:0030198)|ossification (GO:0001503)|positive regulation of cell-substrate adhesion (GO:0010811)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|integrin binding (GO:0005178)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(1)|stomach(1)	32		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.227)		OV - Ovarian serous cystadenocarcinoma(123;0.000516)		AGAATCTGGAGAAAACAGTGA	0.468																																					p.E244K													.	DMP1-132	0			c.G730A						.						51.0	49.0	50.0					4																	88583660		2203	4300	6503	SO:0001583	missense	1758	exon6			TCTGGAGAAAACA	U34037	CCDS3623.1, CCDS43249.1	4q21	2008-08-29	2008-08-29		ENSG00000152592	ENSG00000152592			2932	protein-coding gene	gene with protein product		600980	"""dentin matrix acidic phosphoprotein"""			8586437, 9177774	Standard	NM_001079911		Approved		uc003hqv.3	Q13316	OTTHUMG00000130598	ENST00000339673.6:c.730G>A	4.37:g.88583660G>A	ENSP00000340935:p.Glu244Lys	Somatic	32	0		WXS	Illumina HiSeq	Phase_I	45	3	NM_004407	0	0	0	0	0	A1L4L3|O43265	Missense_Mutation	SNP	ENST00000339673.6	37	CCDS3623.1	.	.	.	.	.	.	.	.	.	.	G	7.750	0.703146	0.15172	.	.	ENSG00000152592	ENST00000339673;ENST00000282479	T;T	0.43688	0.94;0.94	4.89	3.09	0.35607	.	1.553400	0.03623	N	0.236681	T	0.45538	0.1347	L	0.34521	1.04	0.09310	N	1	P;P	0.38167	0.567;0.621	P;P	0.48873	0.458;0.593	T	0.39440	-0.9614	10	0.27082	T	0.32	-2.3267	8.1076	0.30896	0.0847:0.2894:0.6259:0.0	.	228;244	Q13316-2;Q13316	.;DMP1_HUMAN	K	244;228	ENSP00000340935:E244K;ENSP00000282479:E228K	ENSP00000282479:E228K	E	+	1	0	DMP1	88802684	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.456000	0.21859	1.072000	0.40860	0.650000	0.86243	GAA	.		0.468	DMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253047.1		
CENPE	1062	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	104070327	104070327	+	Missense_Mutation	SNP	A	A	T			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr4:104070327A>T	ENST00000265148.3	-	27	3724	c.3635T>A	c.(3634-3636)tTt>tAt	p.F1212Y	CENPE_ENST00000380026.3_Missense_Mutation_p.F1187Y	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	1212					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)			NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		CTCTGTTTCAAATGACTTCTG	0.323																																					p.F1212Y		.											.	CENPE-277	0			c.T3635A						.						82.0	88.0	86.0					4																	104070327		2203	4298	6501	SO:0001583	missense	1062	exon27			GTTTCAAATGACT	Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.3635T>A	4.37:g.104070327A>T	ENSP00000265148:p.Phe1212Tyr	Somatic	89	1		WXS	Illumina HiSeq	Phase_I	74	17	NM_001813	0	0	1	1	0	A6NKY9|A8K2U7|Q4LE75	Missense_Mutation	SNP	ENST00000265148.3	37	CCDS34042.1	.	.	.	.	.	.	.	.	.	.	A	14.70	2.613801	0.46631	.	.	ENSG00000138778	ENST00000265148;ENST00000394771;ENST00000380026	T;T	0.72167	-0.63;-0.63	4.01	2.82	0.32997	.	.	.	.	.	T	0.68247	0.2980	L	0.60455	1.87	0.26955	N	0.965944	P;P	0.50528	0.886;0.936	P;B	0.46825	0.528;0.322	T	0.58053	-0.7704	9	0.41790	T	0.15	.	7.9506	0.30012	0.9036:0.0:0.0964:0.0	.	1187;1212	Q02224-3;Q02224	.;CENPE_HUMAN	Y	1212;1212;1187	ENSP00000265148:F1212Y;ENSP00000369365:F1187Y	ENSP00000265148:F1212Y	F	-	2	0	CENPE	104289776	0.093000	0.21703	0.999000	0.59377	0.848000	0.48234	2.181000	0.42547	0.699000	0.31761	0.533000	0.62120	TTT	.		0.323	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
KIAA0825	285600	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	93856481	93856481	+	Missense_Mutation	SNP	A	A	C			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr5:93856481A>C	ENST00000329378.7	-	5	691	c.442T>G	c.(442-444)Tct>Gct	p.S148A	KIAA0825_ENST00000513200.3_Missense_Mutation_p.S148A|KIAA0825_ENST00000312498.7_Missense_Mutation_p.S148A|KIAA0825_ENST00000427991.2_Missense_Mutation_p.S148A	NM_173665.2	NP_775936.1	Q8IV33	K0825_HUMAN	KIAA0825	148										breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(1)|pancreas(1)|prostate(1)|skin(1)	13						TCTTCAACAGAATGAAGAGAC	0.418																																					p.S148A		.											.	KIAA0825-91	0			c.T442G						.						68.0	68.0	68.0					5																	93856481		2203	4299	6502	SO:0001583	missense	285600	exon5			CAACAGAATGAAG	BX648338	CCDS4070.1	5q15	2011-02-23	2011-02-23	2011-02-23	ENSG00000185261	ENSG00000185261			28532	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 36"""	C5orf36		12477932	Standard	NM_173665		Approved	DKFZp686F0372, MGC34713	uc011cuk.2	Q8IV33	OTTHUMG00000131331	ENST00000329378.7:c.442T>G	5.37:g.93856481A>C	ENSP00000331385:p.Ser148Ala	Somatic	55	0		WXS	Illumina HiSeq	Phase_I	60	15	NM_173665	0	0	0	0	0	O94914|Q6ZNN2	Missense_Mutation	SNP	ENST00000329378.7	37	CCDS4070.1	.	.	.	.	.	.	.	.	.	.	A	0.007	-1.938185	0.00484	.	.	ENSG00000185261	ENST00000513200;ENST00000427991;ENST00000312498;ENST00000329378	T;T;T;T	0.38077	1.18;1.18;1.16;1.18	5.27	4.16	0.48862	.	1.670800	0.02660	N	0.107410	T	0.19644	0.0472	N	0.11560	0.145	0.21445	N	0.999683	B;B	0.11235	0.001;0.004	B;B	0.08055	0.002;0.003	T	0.37197	-0.9716	10	0.05436	T	0.98	.	6.5441	0.22397	0.4544:0.4284:0.0:0.1172	.	148;148	Q8IV33;Q8IV33-2	K0825_HUMAN;.	A	148	ENSP00000424618:S148A;ENSP00000400288:S148A;ENSP00000312205:S148A;ENSP00000331385:S148A	ENSP00000312205:S148A	S	-	1	0	KIAA0825	93882237	1.000000	0.71417	0.939000	0.37840	0.025000	0.11179	2.208000	0.42797	1.984000	0.57885	0.477000	0.44152	TCT	.		0.418	KIAA0825-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371180.2	NM_173665	
HSD17B4	3295	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	118824931	118824931	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr5:118824931C>T	ENST00000256216.6	+	9	800	c.667C>T	c.(667-669)Ctt>Ttt	p.L223F	HSD17B4_ENST00000513628.1_Missense_Mutation_p.L86F|HSD17B4_ENST00000504811.1_Missense_Mutation_p.L248F|HSD17B4_ENST00000510025.1_Missense_Mutation_p.L199F|HSD17B4_ENST00000509514.1_5'UTR|HSD17B4_ENST00000414835.2_Missense_Mutation_p.L83F|HSD17B4_ENST00000515320.1_Missense_Mutation_p.L205F	NM_000414.3	NP_000405.1	P51659	DHB4_HUMAN	hydroxysteroid (17-beta) dehydrogenase 4	223	(3R)-hydroxyacyl-CoA dehydrogenase.				alpha-linolenic acid metabolic process (GO:0036109)|androgen metabolic process (GO:0008209)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|estrogen metabolic process (GO:0008210)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|medium-chain fatty-acyl-CoA metabolic process (GO:0036112)|metabolic process (GO:0008152)|osteoblast differentiation (GO:0001649)|oxidation-reduction process (GO:0055114)|Sertoli cell development (GO:0060009)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid metabolic process (GO:0000038)|very long-chain fatty-acyl-CoA metabolic process (GO:0036111)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	17-beta-hydroxysteroid dehydrogenase (NAD+) activity (GO:0044594)|3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|3alpha,7alpha,12alpha-trihydroxy-5beta-cholest-24-enoyl-CoA hydratase activity (GO:0033989)|isomerase activity (GO:0016853)|long-chain-enoyl-CoA hydratase activity (GO:0016508)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			breast(2)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(2)	25		all_cancers(142;0.0206)|Prostate(80;0.0322)		OV - Ovarian serous cystadenocarcinoma(64;0.000247)|Epithelial(69;0.000849)|all cancers(49;0.0122)		ACCTCTTGTCCTTTGGCTTTG	0.378																																					p.L248F	Colon(35;490 801 34689 41394 43344)	.											.	HSD17B4-92	0			c.C742T						.						221.0	214.0	217.0					5																	118824931		2202	4300	6502	SO:0001583	missense	3295	exon10			CTTGTCCTTTGGC		CCDS4126.1, CCDS56378.1, CCDS56379.1	5q2	2011-09-20			ENSG00000133835	ENSG00000133835	4.2.1.107, 1.1.1.35	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	5213	protein-coding gene	gene with protein product	"""17beta-estradiol dehydrogenase type IV"", ""peroxisomal multifunctional protein 2"", ""17-beta-HSD IV"", ""17-beta-hydroxysteroid dehydrogenase 4"", ""D-bifunctional protein, peroxisomal"", ""D-3-hydroxyacyl-CoA dehydratase"", ""3-alpha,7-alpha,12-alpha-trihydroxy-5-beta-cholest-24-enoyl-CoA hydratase"", ""beta-keto-reductase"", ""beta-hydroxyacyl dehydrogenase"", ""short chain dehydrogenase/reductase family 8C, member 1"""	601860				8938456, 19027726	Standard	NM_000414		Approved	MFE-2, DBP, SDR8C1	uc003ksj.3	P51659	OTTHUMG00000128899	ENST00000256216.6:c.667C>T	5.37:g.118824931C>T	ENSP00000256216:p.Leu223Phe	Somatic	87	0		WXS	Illumina HiSeq	Phase_I	186	61	NM_001199291	0	0	49	116	67	B4DNV1|B4DVS5|E9PB82|F5HE57	Missense_Mutation	SNP	ENST00000256216.6	37	CCDS4126.1	.	.	.	.	.	.	.	.	.	.	C	17.85	3.490542	0.64074	.	.	ENSG00000133835	ENST00000256216;ENST00000515320;ENST00000510025;ENST00000504811;ENST00000414835;ENST00000513628	D;D;D;D;D;D	0.90955	-2.76;-2.76;-2.76;-2.76;-2.76;-2.76	5.97	5.97	0.96955	NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.95262	0.8463	M	0.87381	2.88	0.80722	D	1	D;P;P;P	0.71674	0.998;0.891;0.746;0.891	D;B;B;B	0.71414	0.973;0.266;0.266;0.194	D	0.94345	0.7574	10	0.39692	T	0.17	-19.2226	13.265	0.60128	0.0:0.9271:0.0:0.0729	.	248;205;199;223	F5HE57;E9PB82;E7EWE5;P51659	.;.;.;DHB4_HUMAN	F	223;205;199;248;83;86	ENSP00000256216:L223F;ENSP00000424613:L205F;ENSP00000424940:L199F;ENSP00000420914:L248F;ENSP00000411960:L83F;ENSP00000425993:L86F	ENSP00000256216:L223F	L	+	1	0	HSD17B4	118852830	0.999000	0.42202	1.000000	0.80357	0.393000	0.30537	3.986000	0.56937	2.834000	0.97654	0.650000	0.86243	CTT	.		0.378	HSD17B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250863.3	NM_000414	
ZNF608	57507	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	123980011	123980011	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr5:123980011G>A	ENST00000306315.5	-	5	4484	c.4049C>T	c.(4048-4050)cCt>cTt	p.P1350L	ZNF608_ENST00000504926.1_Missense_Mutation_p.P923L|ZNF608_ENST00000513985.1_5'UTR	NM_020747.2	NP_065798.2	Q9ULD9	ZN608_HUMAN	zinc finger protein 608	1350							metal ion binding (GO:0046872)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(12)|ovary(3)|skin(6)|urinary_tract(1)	46		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		CTGTGGGTAAGGATAAGCATG	0.502																																					p.P1350L		.											.	ZNF608-229	0			c.C4049T						.						216.0	161.0	179.0					5																	123980011		2203	4300	6503	SO:0001583	missense	57507	exon5			GGGTAAGGATAAG	AB033107	CCDS34219.1	5q23.2	2008-05-02			ENSG00000168916	ENSG00000168916		"""Zinc fingers, C2H2-type"""	29238	protein-coding gene	gene with protein product						10574462, 10508479	Standard	NM_020747		Approved	KIAA1281, DKFZp434M098, NY-REN-36	uc003ktq.1	Q9ULD9	OTTHUMG00000162999	ENST00000306315.5:c.4049C>T	5.37:g.123980011G>A	ENSP00000307746:p.Pro1350Leu	Somatic	86	0		WXS	Illumina HiSeq	Phase_I	105	17	NM_020747	0	0	12	16	4	A7E2W9|Q3SYM6|Q68D12|Q8IY05|Q9Y5A1	Missense_Mutation	SNP	ENST00000306315.5	37	CCDS34219.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.704307	0.88924	.	.	ENSG00000168916	ENST00000504926;ENST00000306315	T;T	0.50813	0.78;0.73	5.55	5.55	0.83447	.	0.063529	0.64402	D	0.000002	T	0.68961	0.3058	M	0.65498	2.005	0.80722	D	1	D	0.76494	0.999	D	0.74023	0.982	T	0.70439	-0.4871	10	0.87932	D	0	-13.536	19.8645	0.96799	0.0:0.0:1.0:0.0	.	1350	Q9ULD9	ZN608_HUMAN	L	923;1350	ENSP00000427657:P923L;ENSP00000307746:P1350L	ENSP00000307746:P1350L	P	-	2	0	ZNF608	124007910	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.896000	0.87350	2.766000	0.95052	0.643000	0.83706	CCT	.		0.502	ZNF608-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371300.1	XM_114432	
GPR116	221395	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	46867766	46867766	+	Splice_Site	SNP	C	C	A	rs145334563	byFrequency	TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr6:46867766C>A	ENST00000283296.7	-	3	445	c.157G>T	c.(157-159)Gtt>Ttt	p.V53F	GPR116_ENST00000362015.4_Splice_Site_p.V53F|GPR116_ENST00000456426.2_Splice_Site_p.V53F|GPR116_ENST00000265417.7_Splice_Site_p.V53F	NM_001098518.1	NP_001091988.1	Q8IZF2	GP116_HUMAN	G protein-coupled receptor 116	53					energy reserve metabolic process (GO:0006112)|fat cell differentiation (GO:0045444)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|neuropeptide signaling pathway (GO:0007218)|regulation of lipid metabolic process (GO:0019216)|surfactant homeostasis (GO:0043129)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(21)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59			Lung(136;0.192)			GTTTACATACCGGCTCGTTTT	0.383																																					p.V53F	NSCLC(59;410 1274 8751 36715 50546)	.											.	GPR116-91	0			c.G157T						.						109.0	98.0	102.0					6																	46867766		2203	4300	6503	SO:0001630	splice_region_variant	221395	exon3			ACATACCGGCTCG	AB018301	CCDS4919.1	6p12.3	2014-08-08			ENSG00000069122	ENSG00000069122		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19030	protein-coding gene	gene with protein product						12435584	Standard	NM_001098518		Approved	DKFZp564O1923, KIAA0758	uc003oyo.3	Q8IZF2	OTTHUMG00000014793	ENST00000283296.7:c.157+1G>T	6.37:g.46867766C>A		Somatic	119	0		WXS	Illumina HiSeq	Phase_I	100	22	NM_015234	0	0	0	0	0	O94858|Q5TF06|Q6RGN2|Q86SP0|Q9Y3Z2	Missense_Mutation	SNP	ENST00000283296.7	37	CCDS4919.1	.	.	.	.	.	.	.	.	.	.	C	14.20	2.464871	0.43839	.	.	ENSG00000069122	ENST00000452370;ENST00000283296;ENST00000362015;ENST00000456426;ENST00000265417	T;T;T;T	0.29655	1.62;2.0;1.56;1.62	4.96	4.96	0.65561	.	0.286307	0.24695	N	0.036356	T	0.36082	0.0954	M	0.64997	1.995	0.80722	D	1	P;P;P	0.52842	0.956;0.911;0.956	P;P;P	0.56474	0.632;0.799;0.632	T	0.05468	-1.0883	9	.	.	.	-3.8272	14.057	0.64776	0.0:1.0:0.0:0.0	.	53;53;53	A8K0D8;Q8IZF2-3;Q8IZF2	.;.;GP116_HUMAN	F	53	ENSP00000283296:V53F;ENSP00000354563:V53F;ENSP00000412866:V53F;ENSP00000265417:V53F	.	V	-	1	0	GPR116	46975725	0.983000	0.35010	0.886000	0.34754	0.036000	0.12997	3.364000	0.52328	2.479000	0.83701	0.462000	0.41574	GTT	C|0.999;T|0.001		0.383	GPR116-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040806.2	NM_015234	Missense_Mutation
COL9A1	1297	hgsc.bcm.edu;bcgsc.ca	37	6	70944522	70944522	+	Missense_Mutation	SNP	C	C	A			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr6:70944522C>A	ENST00000357250.6	-	34	2392	c.2234G>T	c.(2233-2235)gGc>gTc	p.G745V	COL9A1_ENST00000320755.7_Missense_Mutation_p.G502V|COL9A1_ENST00000489611.1_5'UTR|COL9A1_ENST00000370499.4_Missense_Mutation_p.G502V|RP1-149L1.1_ENST00000522264.1_RNA	NM_001851.4	NP_001842.3	P20849	CO9A1_HUMAN	collagen, type IX, alpha 1	745	Collagen-like 8.|Triple-helical region (COL2).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|organ morphogenesis (GO:0009887)|tissue homeostasis (GO:0001894)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(44)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)	80						ACCAGGCAGGCCGGTGGCACC	0.647																																					p.G745V		.											.	COL9A1-94	0			c.G2234T						.						36.0	38.0	37.0					6																	70944522		2203	4300	6503	SO:0001583	missense	1297	exon34			GGCAGGCCGGTGG		CCDS4971.1, CCDS47447.1	6q13	2013-05-07			ENSG00000112280	ENSG00000112280		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2217	protein-coding gene	gene with protein product		120210				1429648	Standard	NM_001851		Approved		uc003pfg.4	P20849	OTTHUMG00000014988	ENST00000357250.6:c.2234G>T	6.37:g.70944522C>A	ENSP00000349790:p.Gly745Val	Somatic	55	0		WXS	Illumina HiSeq	Phase_I	53	5	NM_001851	0	0	0	0	0	Q13699|Q13700|Q5TF52|Q6P467|Q96BM8|Q99225|Q9H151|Q9H152|Q9Y6P2|Q9Y6P3	Missense_Mutation	SNP	ENST00000357250.6	37	CCDS4971.1	.	.	.	.	.	.	.	.	.	.	C	19.89	3.911377	0.72983	.	.	ENSG00000112280	ENST00000357250;ENST00000320755;ENST00000370499	D;D;D	0.99637	-6.29;-6.29;-6.29	5.74	5.74	0.90152	.	0.149132	0.64402	D	0.000011	D	0.99846	0.9929	H	0.97758	4.07	0.80722	D	1	D;D;P	0.76494	0.999;0.996;0.918	D;D;P	0.75484	0.986;0.941;0.806	D	0.96911	0.9667	10	0.87932	D	0	.	19.9077	0.97014	0.0:1.0:0.0:0.0	.	745;502;294	P20849;P20849-2;B3KWS8	CO9A1_HUMAN;.;.	V	745;502;502	ENSP00000349790:G745V;ENSP00000315252:G502V;ENSP00000359530:G502V	ENSP00000315252:G502V	G	-	2	0	COL9A1	71001243	1.000000	0.71417	0.988000	0.46212	0.907000	0.53573	7.556000	0.82233	2.714000	0.92807	0.585000	0.79938	GGC	.		0.647	COL9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041131.2		
RFX6	222546	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	117249981	117249981	+	Missense_Mutation	SNP	C	C	A			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr6:117249981C>A	ENST00000332958.2	+	18	2474	c.2458C>A	c.(2458-2460)Cag>Aag	p.Q820K		NM_173560.3	NP_775831.2	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	820					endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|pancreatic A cell differentiation (GO:0003310)|pancreatic D cell differentiation (GO:0003311)|pancreatic epsilon cell differentiation (GO:0090104)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of insulin secretion (GO:0050796)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell differentiation (GO:0003309)	nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(29)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	59						AATGGTGAATCAGCACGTTTC	0.433																																					p.Q820K		.											.	RFX6-93	0			c.C2458A						.						160.0	141.0	148.0					6																	117249981		2203	4300	6503	SO:0001583	missense	222546	exon18			GTGAATCAGCACG	BC039248	CCDS5113.1	6q22.31	2008-08-04	2008-08-04	2008-08-04	ENSG00000185002	ENSG00000185002			21478	protein-coding gene	gene with protein product		612659	"""regulatory factor X domain containing 1"""	RFXDC1			Standard	NM_173560		Approved	MGC33442, dJ955L16.1	uc003pxm.3	Q8HWS3	OTTHUMG00000015449	ENST00000332958.2:c.2458C>A	6.37:g.117249981C>A	ENSP00000332208:p.Gln820Lys	Somatic	194	1		WXS	Illumina HiSeq	Phase_I	172	32	NM_173560	0	0	0	0	0	Q5T6B3	Missense_Mutation	SNP	ENST00000332958.2	37	CCDS5113.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.756755	0.89843	.	.	ENSG00000185002	ENST00000332958	T	0.57752	0.38	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.51312	0.1667	L	0.34521	1.04	0.80722	D	1	D	0.65815	0.995	P	0.55260	0.772	T	0.54200	-0.8329	10	0.72032	D	0.01	-16.3509	20.0442	0.97604	0.0:1.0:0.0:0.0	.	820	Q8HWS3	RFX6_HUMAN	K	820	ENSP00000332208:Q820K	ENSP00000332208:Q820K	Q	+	1	0	RFX6	117356674	1.000000	0.71417	0.999000	0.59377	0.763000	0.43281	7.398000	0.79919	2.814000	0.96858	0.655000	0.94253	CAG	.		0.433	RFX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041970.2	NM_173560	
HEBP2	23593	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	138727187	138727187	+	Silent	SNP	C	C	A			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr6:138727187C>A	ENST00000607197.1	+	3	595	c.318C>A	c.(316-318)acC>acA	p.T106T	HEBP2_ENST00000448741.1_Intron|HEBP2_ENST00000367697.3_Intron	NM_014320.2	NP_055135.1	Q9Y5Z4	HEBP2_HUMAN	heme binding protein 2	106					negative regulation of mitochondrial membrane potential (GO:0010917)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of necrotic cell death (GO:0010940)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)				endometrium(1)|large_intestine(1)|lung(3)	5	Breast(32;0.0933)			GBM - Glioblastoma multiforme(68;0.000732)|OV - Ovarian serous cystadenocarcinoma(155;0.00171)		CTACCATTACCATTTCCCTGT	0.423																																					p.T106T		.											.	HEBP2-90	0			c.C318A						.						169.0	158.0	162.0					6																	138727187		2203	4300	6503	SO:0001819	synonymous_variant	23593	exon3			CATTACCATTTCC	AF117616	CCDS5191.1	6q24	2008-08-29	2002-09-23	2002-09-27	ENSG00000051620	ENSG00000051620			15716	protein-coding gene	gene with protein product		605825	"""chromosome 6 open reading frame 34"""	C6orf34		10640688, 17098234	Standard	NM_014320		Approved	SOUL	uc003qhw.1	Q9Y5Z4	OTTHUMG00000015671	ENST00000607197.1:c.318C>A	6.37:g.138727187C>A		Somatic	245	1		WXS	Illumina HiSeq	Phase_I	197	36	NM_014320	0	0	56	138	82	Q96P57	Silent	SNP	ENST00000607197.1	37	CCDS5191.1																																																																																			.		0.423	HEBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042426.2		
PMS2	5395	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	6035170	6035170	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr7:6035170C>T	ENST00000265849.7	-	8	1003	c.898G>A	c.(898-900)Gca>Aca	p.A300T	PMS2_ENST00000406569.3_Missense_Mutation_p.A300T|PMS2_ENST00000469652.1_Intron|PMS2_ENST00000382321.4_Intron|PMS2_ENST00000441476.2_Missense_Mutation_p.A194T	NM_000535.5	NP_000526	P54278	PMS2_HUMAN	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)	300					ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|single base insertion or deletion binding (GO:0032138)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(6)|kidney(2)|large_intestine(11)|lung(13)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;4.39e-15)		AATACCTTTGCTGGGTCACAA	0.383			"""Mis, N, F"""			"""colorectal, endometrial, ovarian, medulloblastoma, glioma"""		Direct reversal of damage;Mismatch excision repair (MMR)	Turcot syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																												p.A300T		.	yes	Rec		"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	7	7p22	5395	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)		E	.	PMS2-1083	0			c.G898A						.						89.0	84.0	86.0					7																	6035170		2203	4300	6503	SO:0001583	missense	5395	exon8	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	CCTTTGCTGGGTC		CCDS5343.1	7p22.1	2014-09-17	2001-11-28		ENSG00000122512	ENSG00000122512			9122	protein-coding gene	gene with protein product		600259	"""postmeiotic segregation increased (S. cerevisiae) 2"""	PMSL2		8072530	Standard	NM_000535		Approved	H_DJ0042M02.9, HNPCC4	uc003spl.3	P54278	OTTHUMG00000023135	ENST00000265849.7:c.898G>A	7.37:g.6035170C>T	ENSP00000265849:p.Ala300Thr	Somatic	95	0		WXS	Illumina HiSeq	Phase_I	104	31	NM_000535	0	0	0	0	0	B2R610|Q52LH6|Q5FBW9|Q5FBX1|Q5FBX2|Q75MR2	Missense_Mutation	SNP	ENST00000265849.7	37	CCDS5343.1	.	.	.	.	.	.	.	.	.	.	c	15.72	2.917497	0.52546	.	.	ENSG00000122512	ENST00000265849;ENST00000382322;ENST00000441476;ENST00000406569	D;D;D	0.83992	-1.79;-1.79;-1.79	5.85	4.96	0.65561	Ribosomal protein S5 domain 2-type fold (1);DNA mismatch repair protein, N-terminal (1);Ribosomal protein S5 domain 2-type fold, subgroup (1);DNA mismatch repair protein, C-terminal (1);	0.410133	0.26345	N	0.024920	T	0.73969	0.3655	L	0.49350	1.555	0.42490	D	0.992891	B;B;B	0.34241	0.012;0.068;0.444	B;B;B	0.27262	0.007;0.013;0.078	T	0.69367	-0.5164	10	0.14656	T	0.56	-8.6094	10.6468	0.45626	0.1337:0.7984:0.0:0.0678	.	300;300;194	P54278-3;P54278;C9J167	.;PMS2_HUMAN;.	T	300;253;194;300	ENSP00000265849:A300T;ENSP00000392843:A194T;ENSP00000384308:A300T	ENSP00000265849:A300T	A	-	1	0	PMS2	6001696	0.544000	0.26441	1.000000	0.80357	0.989000	0.77384	0.265000	0.18515	1.469000	0.48083	0.650000	0.86243	GCA	.		0.383	PMS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207353.3	NM_000535	
POU6F2	11281	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	39446255	39446255	+	Silent	SNP	C	C	T			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr7:39446255C>T	ENST00000403058.1	+	7	1096	c.942C>T	c.(940-942)tcC>tcT	p.S314S	POU6F2_ENST00000559001.1_Intron|POU6F2_ENST00000518318.2_Silent_p.S314S|POU6F2-AS1_ENST00000433519.1_RNA	NM_001166018.1|NM_007252.3	NP_001159490.1|NP_009183.3	P78424	PO6F2_HUMAN	POU class 6 homeobox 2	314	Gln-rich.				central nervous system development (GO:0007417)|ganglion mother cell fate determination (GO:0007402)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(16)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	42						CCATGAGCTCCATAGCAAGCT	0.532																																					p.S314S		.											.	POU6F2-90	0			c.C942T						.						57.0	57.0	57.0					7																	39446255		2203	4300	6503	SO:0001819	synonymous_variant	11281	exon7			GAGCTCCATAGCA	U91934	CCDS34620.2, CCDS55103.1	7p14.1	2011-06-20	2007-07-13		ENSG00000106536	ENSG00000106536		"""Homeoboxes / POU class"""	21694	protein-coding gene	gene with protein product	"""Retina-derived POU-domain factor-1"""	609062	"""POU domain, class 6, transcription factor 2"""			8601806	Standard	NM_007252		Approved	RPF-1	uc003thb.2	P78424	OTTHUMG00000150803	ENST00000403058.1:c.942C>T	7.37:g.39446255C>T		Somatic	103	0		WXS	Illumina HiSeq	Phase_I	99	31	NM_007252	0	0	0	0	0	A4D1W2|C4AMB9|P78425|Q75ME8|Q86UM6|Q9UDS7	Silent	SNP	ENST00000403058.1	37	CCDS34620.2																																																																																			.		0.532	POU6F2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320146.3	NM_007252	
ZMIZ2	83637	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	44805818	44805818	+	Silent	SNP	C	C	G			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr7:44805818C>G	ENST00000309315.4	+	17	2421	c.2298C>G	c.(2296-2298)ccC>ccG	p.P766P	ZMIZ2_ENST00000463931.1_3'UTR|ZMIZ2_ENST00000441627.1_Silent_p.P766P|ZMIZ2_ENST00000413916.1_Silent_p.P708P|ZMIZ2_ENST00000433667.1_Silent_p.P734P|ZMIZ2_ENST00000265346.7_Silent_p.P740P	NM_031449.3	NP_113637.3	Q8NF64	ZMIZ2_HUMAN	zinc finger, MIZ-type containing 2	766	Pro-rich.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|zinc ion binding (GO:0008270)			breast(3)|endometrium(2)|kidney(3)|large_intestine(6)|lung(10)|ovary(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						CCACCACGCCCAGCACCCCAA	0.632																																					p.P766P	NSCLC(20;604 852 1948 16908 50522)	.											.	ZMIZ2-137	0			c.C2298G						.						58.0	66.0	64.0					7																	44805818		1960	4127	6087	SO:0001819	synonymous_variant	83637	exon17			CACGCCCAGCACC	AK090415	CCDS43576.1, CCDS43577.1, CCDS75591.1	7p13	2009-11-06			ENSG00000122515	ENSG00000122515		"""Zinc fingers, MIZ-type"""	22229	protein-coding gene	gene with protein product		611196					Standard	XM_005249866		Approved	KIAA1886, hZIMP7, ZIMP7, DKFZp761I2123, NET27	uc003tlr.3	Q8NF64	OTTHUMG00000155817	ENST00000309315.4:c.2298C>G	7.37:g.44805818C>G		Somatic	113	0		WXS	Illumina HiSeq	Phase_I	138	19	NM_031449	0	0	36	60	24	A4D2K7|D3DVL1|O94790|Q0VGB4|Q659A8|Q6JKL5|Q8WTX8|Q96Q01|Q9BQH7	Silent	SNP	ENST00000309315.4	37	CCDS43576.1																																																																																			.		0.632	ZMIZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341790.1	NM_031449	
ABCB4	5244	hgsc.bcm.edu;bcgsc.ca	37	7	87051487	87051487	+	Silent	SNP	A	A	G			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr7:87051487A>G	ENST00000265723.4	-	18	2377	c.2266T>C	c.(2266-2268)Ttg>Ctg	p.L756L	ABCB4_ENST00000545634.1_Silent_p.L756L|ABCB4_ENST00000453593.1_Silent_p.L756L|ABCB4_ENST00000359206.3_Silent_p.L756L|ABCB4_ENST00000358400.3_Silent_p.L756L	NM_000443.3|NM_018849.2	NP_000434.1|NP_061337.1	P21439	MDR3_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 4	756	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular lipid metabolic process (GO:0044255)|lipid metabolic process (GO:0006629)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|xenobiotic-transporting ATPase activity (GO:0008559)			breast(5)|endometrium(7)|kidney(2)|large_intestine(15)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				Colchicine(DB01394)|Etravirine(DB06414)|Silodosin(DB06207)	AAGAAAATCAAAGAGAATATG	0.338																																					p.L756L		.											.	ABCB4-96	0			c.T2266C						.						56.0	56.0	56.0					7																	87051487		2203	4300	6503	SO:0001819	synonymous_variant	5244	exon18			AAATCAAAGAGAA	M23234	CCDS5605.1, CCDS5606.1, CCDS5607.1	7q21	2012-03-14			ENSG00000005471	ENSG00000005471		"""ATP binding cassette transporters / subfamily B"""	45	protein-coding gene	gene with protein product		171060		PGY3, MDR3		2892668, 11313316	Standard	NM_018850		Approved	MDR2, PFIC-3, GBD1	uc003uiv.1	P21439	OTTHUMG00000023396	ENST00000265723.4:c.2266T>C	7.37:g.87051487A>G		Somatic	59	0		WXS	Illumina HiSeq	Phase_I	58	4	NM_018850	0	0	3	3	0	A0A2V7|A4D1D3|A4D1D4|A4D1D5|D6W5P3|D6W5P4|Q14813	Silent	SNP	ENST00000265723.4	37	CCDS5606.1																																																																																			.		0.338	ABCB4-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000336083.1	NM_000443	
CYP3A43	64816	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	99454477	99454477	+	Missense_Mutation	SNP	C	C	A			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr7:99454477C>A	ENST00000354829.2	+	9	923	c.820C>A	c.(820-822)Cag>Aag	p.Q274K	CYP3A43_ENST00000222382.5_Missense_Mutation_p.Q274K|CYP3A43_ENST00000342499.4_Missense_Mutation_p.Q134K|CYP3A43_ENST00000477658.1_3'UTR|CYP3A43_ENST00000415413.1_Missense_Mutation_p.Q63K|CYP3A43_ENST00000312017.5_Missense_Mutation_p.Q274K|CYP3A43_ENST00000444905.1_Missense_Mutation_p.Q21K|CYP3A43_ENST00000417625.1_Missense_Mutation_p.Q164K	NM_022820.3|NM_057095.1	NP_073731.1|NP_476436.1	Q9HB55	CP343_HUMAN	cytochrome P450, family 3, subfamily A, polypeptide 43	274			Missing (in allele CYP3A43*2).		small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|skin(1)	19	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)				Dexamethasone(DB01234)|Dolutegravir(DB08930)|Ethosuximide(DB00593)|Oxazepam(DB00842)|Phenelzine(DB00780)|Praziquantel(DB01058)|Rifampicin(DB01045)|Rifapentine(DB01201)|Testosterone(DB00624)|Troleandomycin(DB01361)|Zalcitabine(DB00943)	TTTCTTTCAACAGATGATCGA	0.438																																					p.Q274K		.											.	CYP3A43-92	0			c.C820A						.						92.0	99.0	97.0					7																	99454477		2203	4300	6503	SO:0001583	missense	64816	exon9			TTTCAACAGATGA	AF319634	CCDS5675.1, CCDS5676.1, CCDS5677.1, CCDS64723.1	7q21.1	2007-12-14	2003-01-14		ENSG00000021461	ENSG00000021461		"""Cytochrome P450s"""	17450	protein-coding gene	gene with protein product		606534	"""cytochrome P450, subfamily IIIA, polypeptide 43"""			11160876, 11266076	Standard	NM_022820		Approved		uc003ury.1	Q9HB55	OTTHUMG00000156498	ENST00000354829.2:c.820C>A	7.37:g.99454477C>A	ENSP00000346887:p.Gln274Lys	Somatic	215	0		WXS	Illumina HiSeq	Phase_I	188	18	NM_057096	0	0	0	0	0	Q495Y1|Q75MK2|Q75MK3|Q9HB52|Q9HB53|Q9HB54|Q9HB57	Missense_Mutation	SNP	ENST00000354829.2	37	CCDS5676.1	.	.	.	.	.	.	.	.	.	.	C	11.75	1.731904	0.30684	.	.	ENSG00000021461	ENST00000354829;ENST00000417625;ENST00000342499;ENST00000444905;ENST00000415413;ENST00000312017;ENST00000222382	T;T;T;T;T;T;T	0.67698	-0.28;-0.28;-0.28;-0.28;-0.23;-0.28;-0.28	2.26	0.94	0.19513	.	0.176318	0.37623	U	0.002017	T	0.55625	0.1932	L	0.37697	1.125	0.20873	N	0.999837	B;P;B;B;B	0.39094	0.048;0.659;0.023;0.029;0.012	B;P;B;B;B	0.44732	0.067;0.459;0.006;0.011;0.011	T	0.50742	-0.8792	10	0.87932	D	0	.	4.1559	0.10260	0.0:0.6974:0.0:0.3026	.	164;134;274;274;274	Q495Y1;F8W6L8;Q9HB55-3;Q75MK2;Q9HB55	.;.;.;.;CP343_HUMAN	K	274;164;134;21;63;274;274	ENSP00000346887:Q274K;ENSP00000416581:Q164K;ENSP00000345351:Q134K;ENSP00000405557:Q21K;ENSP00000401521:Q63K;ENSP00000312110:Q274K;ENSP00000222382:Q274K	ENSP00000222382:Q274K	Q	+	1	0	CYP3A43	99292413	0.985000	0.35326	0.730000	0.30809	0.247000	0.25773	0.188000	0.17018	0.257000	0.21650	0.195000	0.17529	CAG	.		0.438	CYP3A43-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000344379.1		
ZAN	7455	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	100361742	100361742	+	RNA	SNP	C	C	T			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr7:100361742C>T	ENST00000348028.3	+	0	4355				ZAN_ENST00000443370.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000427578.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			CTGCTGTGCACACACATGTCC	0.607																																					.													.	ZAN-142	0			.						.						39.0	39.0	39.0					7																	100361742		2160	4267	6427			7455	.			TGTGCACACACAT	U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100361742C>T		Somatic	49	0		WXS	Illumina HiSeq	Phase_I	50	21	.	0	0	0	0	0	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Missense_Mutation	SNP	ENST00000348028.3	37		.	.	.	.	.	.	.	.	.	.	C	6.803	0.517130	0.13005	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585	T;T;T	0.77098	-1.07;-1.07;-1.07	4.01	-0.285	0.12866	Uncharacterised domain, cysteine-rich (2);	2.329540	0.02057	N	0.050511	T	0.76104	0.3941	M	0.78049	2.395	0.27427	N	0.954134	B;B	0.13145	0.005;0.007	B;B	0.13407	0.005;0.009	T	0.54057	-0.8350	10	0.54805	T	0.06	.	2.8794	0.05642	0.1982:0.4601:0.0:0.3417	.	1397;1397	F5H0T8;Q9Y493	.;ZAN_HUMAN	I	1397	ENSP00000445943:T1397I;ENSP00000445091:T1397I;ENSP00000444427:T1397I	ENSP00000423579:T1397I	T	+	2	0	ZAN	100199678	0.000000	0.05858	0.007000	0.13788	0.070000	0.16714	0.105000	0.15333	0.097000	0.17492	0.561000	0.74099	ACA	.		0.607	ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000347214.1	NM_003386	
CPA4	51200	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	129962495	129962495	+	Silent	SNP	T	T	C			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr7:129962495T>C	ENST00000222482.4	+	11	1273	c.1245T>C	c.(1243-1245)caT>caC	p.H415H	CPA4_ENST00000493259.1_Silent_p.H311H|CPA4_ENST00000445470.2_Silent_p.H382H	NM_016352.3	NP_057436.2	Q9UI42	CBPA4_HUMAN	carboxypeptidase A4	415					histone acetylation (GO:0016573)	extracellular region (GO:0005576)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	21	Melanoma(18;0.0435)					TCATGGAGCATGTGCGGGACA	0.537																																					p.H415H		.											.	CPA4-515	0			c.T1245C						.						198.0	161.0	173.0					7																	129962495		2203	4300	6503	SO:0001819	synonymous_variant	51200	exon11			GGAGCATGTGCGG	AF095719	CCDS5818.1, CCDS55163.1	7q32	2008-07-18			ENSG00000128510	ENSG00000128510			15740	protein-coding gene	gene with protein product	"""carboxypeptidase A3"""	607635				10383164, 10860668	Standard	NM_016352		Approved	CPA3	uc003vpr.3	Q9UI42	OTTHUMG00000157825	ENST00000222482.4:c.1245T>C	7.37:g.129962495T>C		Somatic	159	0		WXS	Illumina HiSeq	Phase_I	188	39	NM_016352	0	0	4	4	0	B7Z576|Q86UY9	Silent	SNP	ENST00000222482.4	37	CCDS5818.1																																																																																			.		0.537	CPA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349725.1	NM_016352	
CPA4	51200	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	129962499	129962499	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr7:129962499C>T	ENST00000222482.4	+	11	1277	c.1249C>T	c.(1249-1251)Cgg>Tgg	p.R417W	CPA4_ENST00000493259.1_Missense_Mutation_p.R313W|CPA4_ENST00000445470.2_Missense_Mutation_p.R384W	NM_016352.3	NP_057436.2	Q9UI42	CBPA4_HUMAN	carboxypeptidase A4	417					histone acetylation (GO:0016573)	extracellular region (GO:0005576)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	21	Melanoma(18;0.0435)					GGAGCATGTGCGGGACAACCT	0.542																																					p.R417W		.											.	CPA4-515	0			c.C1249T						.						193.0	157.0	169.0					7																	129962499		2203	4300	6503	SO:0001583	missense	51200	exon11			CATGTGCGGGACA	AF095719	CCDS5818.1, CCDS55163.1	7q32	2008-07-18			ENSG00000128510	ENSG00000128510			15740	protein-coding gene	gene with protein product	"""carboxypeptidase A3"""	607635				10383164, 10860668	Standard	NM_016352		Approved	CPA3	uc003vpr.3	Q9UI42	OTTHUMG00000157825	ENST00000222482.4:c.1249C>T	7.37:g.129962499C>T	ENSP00000222482:p.Arg417Trp	Somatic	154	0		WXS	Illumina HiSeq	Phase_I	185	42	NM_016352	0	0	2	2	0	B7Z576|Q86UY9	Missense_Mutation	SNP	ENST00000222482.4	37	CCDS5818.1	.	.	.	.	.	.	.	.	.	.	C	13.60	2.286285	0.40494	.	.	ENSG00000128510	ENST00000445470;ENST00000222482;ENST00000538687;ENST00000493259	T;T;T	0.03468	3.92;3.92;3.92	5.75	2.87	0.33458	.	0.218110	0.40908	D	0.000989	T	0.13970	0.0338	M	0.79475	2.455	0.09310	N	1	D;D	0.89917	0.999;1.0	P;D	0.65443	0.827;0.935	T	0.01956	-1.1240	10	0.56958	D	0.05	.	9.1872	0.37178	0.2596:0.6719:0.0:0.0685	.	384;417	B7Z576;Q9UI42	.;CBPA4_HUMAN	W	384;417;222;313	ENSP00000412947:R384W;ENSP00000222482:R417W;ENSP00000419660:R313W	ENSP00000222482:R417W	R	+	1	2	CPA4	129749735	0.000000	0.05858	0.981000	0.43875	0.111000	0.19643	0.043000	0.13971	0.763000	0.33175	0.563000	0.77884	CGG	.		0.542	CPA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349725.1	NM_016352	
AKR1B15	441282	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	134260620	134260620	+	Silent	SNP	C	C	T	rs267601304		TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr7:134260620C>T	ENST00000457545.2	+	8	944	c.684C>T	c.(682-684)tgC>tgT	p.C228C	AKR1B15_ENST00000423958.1_Silent_p.C200C	NM_001080538.2	NP_001074007.2	C9JRZ8	AK1BF_HUMAN	aldo-keto reductase family 1, member B15	228							oxidoreductase activity (GO:0016491)			endometrium(1)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|urinary_tract(1)	18						TCCAGTACTGCCACTCCAAGG	0.532																																					p.C228C		.											.	AKR1B15-23	0			c.C684T						.						111.0	88.0	96.0					7																	134260620		2203	4300	6503	SO:0001819	synonymous_variant	441282	exon8			GTACTGCCACTCC		CCDS47715.1, CCDS47715.2	7q33	2009-09-09			ENSG00000227471	ENSG00000227471		"""Aldo-keto reductases"""	37281	protein-coding gene	gene with protein product							Standard	NM_001080538		Approved		uc011kpr.2	C9JRZ8	OTTHUMG00000155376	ENST00000457545.2:c.684C>T	7.37:g.134260620C>T		Somatic	129	0		WXS	Illumina HiSeq	Phase_I	105	20	NM_001080538	0	0	307	312	5	C9J3V2	Silent	SNP	ENST00000457545.2	37	CCDS47715.2																																																																																			.		0.532	AKR1B15-001	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000339726.2		
SVOPL	136306	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	138281232	138281232	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr7:138281232G>A	ENST00000419765.3	-	14	1430	c.1397C>T	c.(1396-1398)tCa>tTa	p.S466L	SVOPL_ENST00000463557.1_5'UTR|SVOPL_ENST00000421622.1_Missense_Mutation_p.S346L|SVOPL_ENST00000436657.1_Missense_Mutation_p.S314L|SVOPL_ENST00000288513.5_Missense_Mutation_p.S314L	NM_001139456.1	NP_001132928.1	Q8N434	SVOPL_HUMAN	SVOP-like	466						integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	19						ACAGACAGATGAGAAGAGACA	0.463																																					p.S466L		.											.	SVOPL-68	0			c.C1397T						.						117.0	111.0	113.0					7																	138281232		2203	4300	6503	SO:0001583	missense	136306	exon14			ACAGATGAGAAGA	BC036796	CCDS5848.1, CCDS47721.1	7q34	2011-07-12	2007-04-04		ENSG00000157703	ENSG00000157703			27034	protein-coding gene	gene with protein product		611700	"""SV2 related protein homolog (rat)-like"""				Standard	NM_001139456		Approved	MGC46715	uc011kqh.2	Q8N434	OTTHUMG00000155870	ENST00000419765.3:c.1397C>T	7.37:g.138281232G>A	ENSP00000405482:p.Ser466Leu	Somatic	80	0		WXS	Illumina HiSeq	Phase_I	107	14	NM_001139456	0	0	0	1	1		Missense_Mutation	SNP	ENST00000419765.3	37	CCDS47721.1	.	.	.	.	.	.	.	.	.	.	G	12.07	1.826903	0.32329	.	.	ENSG00000157703	ENST00000288513;ENST00000421622;ENST00000436657;ENST00000419765	T;T;T;T	0.58210	0.35;0.35;0.35;0.35	5.48	5.48	0.80851	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.260251	0.37483	N	0.002067	T	0.40145	0.1105	N	0.22421	0.69	0.35878	D	0.828749	B;B	0.33171	0.012;0.4	B;B	0.28011	0.055;0.085	T	0.51317	-0.8721	10	0.45353	T	0.12	-3.3112	17.1313	0.86727	0.0:0.0:1.0:0.0	.	466;314	Q8N434;Q8N434-2	SVOPL_HUMAN;.	L	314;346;314;466	ENSP00000288513:S314L;ENSP00000412830:S346L;ENSP00000417018:S314L;ENSP00000405482:S466L	ENSP00000288513:S314L	S	-	2	0	SVOPL	137931772	1.000000	0.71417	0.821000	0.32701	0.024000	0.10985	5.924000	0.70054	2.563000	0.86464	0.655000	0.94253	TCA	.		0.463	SVOPL-005	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342092.4	NM_174959	
ZNF783	100289678	broad.mit.edu	37	7	148979208	148979208	+	Missense_Mutation	SNP	G	G	A	rs201974383	byFrequency	TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr7:148979208G>A	ENST00000434415.1	+	6	1578	c.1415G>A	c.(1414-1416)gGc>gAc	p.G472D	ZNF783_ENST00000489518.1_Intron	NM_001195220.1	NP_001182149.1	Q6ZMS7	ZN783_HUMAN	zinc finger family member 783	0					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|prostate(1)	22	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.0014)			CCCTACTGCGGCAAGGCCTTC	0.706																																					p.G472D													.	.	0			c.G1415A						.						12.0	15.0	14.0					7																	148979208		2139	4217	6356	SO:0001583	missense	0	exon6			ACTGCGGCAAGGC	AK131504	CCDS56519.1	7q36.1	2013-01-08	2008-05-28		ENSG00000204946	ENSG00000204946		"""Zinc fingers, C2H2-type"", ""-"""	27222	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_001195220		Approved	DKFZp667J212	uc011kuo.2	Q6ZMS7	OTTHUMG00000158969	ENST00000434415.1:c.1415G>A	7.37:g.148979208G>A	ENSP00000410890:p.Gly472Asp	Somatic	40	0		WXS	Illumina HiSeq	Phase_I	46	3	NM_001195220	0	0	2	2	0	C9J9J2	Missense_Mutation	SNP	ENST00000434415.1	37	CCDS56519.1	.	.	.	.	.	.	.	.	.	.	G	18.52	3.641260	0.67244	.	.	ENSG00000204946	ENST00000434415	T	0.20881	2.04	4.37	4.37	0.52481	.	.	.	.	.	T	0.28732	0.0712	L	0.50847	1.595	0.80722	D	1	.	.	.	.	.	.	T	0.01440	-1.1354	7	0.56958	D	0.05	.	8.3901	0.32522	0.1058:0.0:0.8941:0.0	.	.	.	.	D	472	ENSP00000410890:G472D	ENSP00000410890:G472D	G	+	2	0	ZNF783	148610141	0.676000	0.27567	1.000000	0.80357	0.975000	0.68041	0.964000	0.29306	2.447000	0.82792	0.462000	0.41574	GGC	.		0.706	ZNF783-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352715.1	NM_001195220	
ZNF777	27153	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	149152518	149152518	+	Missense_Mutation	SNP	A	A	T			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr7:149152518A>T	ENST00000247930.4	-	2	919	c.596T>A	c.(595-597)cTg>cAg	p.L199Q		NM_015694.2	NP_056509.2	Q9ULD5	ZN777_HUMAN	zinc finger protein 777	199					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(5)|lung(17)|ovary(1)|skin(2)|urinary_tract(1)	26	Melanoma(164;0.165)		OV - Ovarian serous cystadenocarcinoma(82;0.00358)			CTGGGCCTCCAGCTTCCTCTC	0.597																																					p.L199Q		.											.	ZNF777-136	0			c.T596A						.						67.0	76.0	73.0					7																	149152518		2188	4291	6479	SO:0001583	missense	27153	exon2			GCCTCCAGCTTCC	AB033111	CCDS43675.1	7q36.1	2013-01-08			ENSG00000196453	ENSG00000196453		"""Zinc fingers, C2H2-type"", ""-"""	22213	protein-coding gene	gene with protein product							Standard	NM_015694		Approved	KIAA1285	uc003wfv.3	Q9ULD5	OTTHUMG00000158967	ENST00000247930.4:c.596T>A	7.37:g.149152518A>T	ENSP00000247930:p.Leu199Gln	Somatic	204	0		WXS	Illumina HiSeq	Phase_I	209	46	NM_015694	0	0	8	15	7	Q8N2R2|Q8N659	Missense_Mutation	SNP	ENST00000247930.4	37	CCDS43675.1	.	.	.	.	.	.	.	.	.	.	A	19.31	3.802961	0.70682	.	.	ENSG00000196453	ENST00000247930	T	0.06294	3.32	4.93	4.93	0.64822	.	0.234968	0.21936	N	0.066956	T	0.06554	0.0168	N	0.08118	0	0.33892	D	0.637431	D	0.54207	0.965	P	0.51355	0.667	T	0.32322	-0.9911	10	0.72032	D	0.01	-14.7997	11.0022	0.47614	1.0:0.0:0.0:0.0	.	199	Q9ULD5-2	.	Q	199	ENSP00000247930:L199Q	ENSP00000247930:L199Q	L	-	2	0	ZNF777	148783451	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	5.489000	0.66875	1.856000	0.53863	0.533000	0.62120	CTG	.		0.597	ZNF777-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352708.1	NM_015694	
USP17L2	377630	hgsc.bcm.edu	37	8	11996075	11996075	+	Missense_Mutation	SNP	C	C	G	rs267601745		TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr8:11996075C>G	ENST00000333796.3	-	1	511	c.195G>C	c.(193-195)agG>agC	p.R65S	FAM66D_ENST00000434078.2_RNA	NM_001256869.1|NM_001256871.1|NM_001256872.1|NM_001256873.1|NM_001256874.1|NM_201402.2	NP_001243798.1|NP_001243800.1|NP_001243801.1|NP_001243802.1|NP_001243803.1|NP_958804.2	Q6R6M4	U17L2_HUMAN	ubiquitin specific peptidase 17-like family member 2	65					apoptotic process (GO:0006915)|CAAX-box protein processing (GO:0071586)|cell cycle checkpoint (GO:0000075)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of histone deacetylation (GO:0031064)|negative regulation of protein processing (GO:0010955)|negative regulation of protein targeting to membrane (GO:0090315)|negative regulation of Ras GTPase activity (GO:0034261)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of RIG-I signaling pathway (GO:1900246)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of apoptotic process (GO:0042981)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of defense response to virus by host (GO:0050691)|regulation of ruffle assembly (GO:1900027)|ubiquitin-dependent protein catabolic process (GO:0006511)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			central_nervous_system(1)|kidney(1)|large_intestine(11)|liver(1)|lung(8)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	29						GAAGCTTCTTCCTGGGAGCAA	0.572																																					p.R65S		.											.	USP17L2-435	0			c.G195C						.						43.0	58.0	53.0					8																	11996075		1248	2766	4014	SO:0001583	missense	377630	exon1			CTTCTTCCTGGGA	BC156290	CCDS43713.1	8p23.1	2012-10-09	2012-10-09		ENSG00000223443	ENSG00000223443			34434	protein-coding gene	gene with protein product	"""deubiquitinating enzyme 3"""	610186	"""ubiquitin specific peptidase 17-like 2"""				Standard	NM_201402		Approved	DUB3	uc003wvc.1	Q6R6M4	OTTHUMG00000165295	ENST00000333796.3:c.195G>C	8.37:g.11996075C>G	ENSP00000333329:p.Arg65Ser	Somatic	6	1		WXS	Illumina HiSeq	Phase_I	9	2	NM_201402	0	0	0	0	0		Missense_Mutation	SNP	ENST00000333796.3	37	CCDS43713.1	.	.	.	.	.	.	.	.	.	.	c	1.018	-0.685613	0.03328	.	.	ENSG00000223443	ENST00000333796	T	0.11821	2.74	0.36	0.36	0.16097	.	3.094940	0.01992	U	0.045606	T	0.06462	0.0166	N	0.08118	0	0.26403	N	0.976385	B	0.06786	0.001	B	0.06405	0.002	T	0.30238	-0.9985	10	0.02654	T	1	.	6.6522	0.22969	0.0:0.9999:0.0:1.0E-4	.	65	Q6R6M4	U17L2_HUMAN	S	65	ENSP00000333329:R65S	ENSP00000333329:R65S	R	-	3	2	USP17L2	12033484	0.005000	0.15991	0.016000	0.15963	0.015000	0.08874	-0.190000	0.09615	0.469000	0.27268	0.472000	0.43445	AGG	.		0.572	USP17L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383303.2	NM_201402	
TSNARE1	203062	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	143381927	143381927	+	Missense_Mutation	SNP	C	C	G			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr8:143381927C>G	ENST00000307180.3	-	10	1327	c.1210G>C	c.(1210-1212)Gag>Cag	p.E404Q	TSNARE1_ENST00000518928.1_5'UTR|TSNARE1_ENST00000524325.1_Missense_Mutation_p.E403Q|TSNARE1_ENST00000519651.1_Missense_Mutation_p.E185Q|TSNARE1_ENST00000520166.1_Missense_Mutation_p.E404Q	NM_145003.3	NP_659440.2	Q96NA8	TSNA1_HUMAN	t-SNARE domain containing 1	404					intracellular protein transport (GO:0006886)|synaptic vesicle exocytosis (GO:0016079)	integral component of membrane (GO:0016021)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)|SNARE binding (GO:0000149)			breast(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(6)|ovary(2)|stomach(2)|urinary_tract(1)	20	all_cancers(97;7.39e-11)|all_epithelial(106;8.98e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000332)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					AGCGCCTGCTCCTGGCCCTGC	0.617																																					p.E404Q		.											.	TSNARE1-90	0			c.G1210C						.						73.0	66.0	69.0					8																	143381927		2203	4300	6503	SO:0001583	missense	203062	exon10			CCTGCTCCTGGCC			8q24.3	2005-08-18							26437	protein-coding gene	gene with protein product						14702039	Standard	XM_005250828		Approved	FLJ31164	uc003ywk.3	Q96NA8		ENST00000307180.3:c.1210G>C	8.37:g.143381927C>G	ENSP00000303437:p.Glu404Gln	Somatic	109	0		WXS	Illumina HiSeq	Phase_I	103	14	NM_145003	0	0	8	9	1	B7ZLB0|Q14D03	Missense_Mutation	SNP	ENST00000307180.3	37	CCDS6384.1	.	.	.	.	.	.	.	.	.	.	C	7.933	0.741084	0.15642	.	.	ENSG00000171045	ENST00000524325;ENST00000307180;ENST00000520166;ENST00000519651	T;T;T;T	0.20463	2.07;2.07;2.07;2.07	4.76	3.89	0.44902	t-SNARE (1);	0.233173	0.21158	U	0.079203	T	0.16214	0.0390	L	0.37630	1.12	0.23254	N	0.998034	P;B;P;P	0.47409	0.895;0.421;0.895;0.895	B;B;B;B	0.41299	0.353;0.058;0.353;0.353	T	0.08351	-1.0726	10	0.27082	T	0.32	-20.6332	10.2182	0.43182	0.0:0.9055:0.0:0.0945	.	403;185;404;405	B7ZLB0;E5RHT3;Q96NA8;A0AVG3	.;.;TSNA1_HUMAN;.	Q	403;404;404;185	ENSP00000428763:E403Q;ENSP00000303437:E404Q;ENSP00000427770:E404Q;ENSP00000429679:E185Q	ENSP00000303437:E404Q	E	-	1	0	TSNARE1	143379834	0.970000	0.33590	0.175000	0.22980	0.206000	0.24218	1.184000	0.32053	1.001000	0.39076	-0.137000	0.14449	GAG	.		0.617	TSNARE1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_145003	
HRCT1	646962	broad.mit.edu	37	9	35906559	35906559	+	Missense_Mutation	SNP	A	A	C			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr9:35906559A>C	ENST00000354323.2	+	1	371	c.275A>C	c.(274-276)cAc>cCc	p.H92P	LINC00961_ENST00000443779.1_lincRNA	NM_001039792.1	NP_001034881.1	Q6UXD1	HRCT1_HUMAN	histidine rich carboxyl terminus 1	92	His-rich.					integral component of membrane (GO:0016021)		p.H92P(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|prostate(1)	4						caccaccaccacccccgccac	0.682																																					p.H92P													.	HRCT1-22	1	Substitution - Missense(1)	prostate(1)	c.A275C						.						24.0	19.0	20.0					9																	35906559		2189	4276	6465	SO:0001583	missense	646962	exon1			ACCACCACCCCCG		CCDS35012.1	9p13.3	2008-09-30			ENSG00000196196	ENSG00000196196			33872	protein-coding gene	gene with protein product						12975309	Standard	NM_001039792		Approved	LGLL338, PRO537, UNQ338	uc003zyr.1	Q6UXD1	OTTHUMG00000154146	ENST00000354323.2:c.275A>C	9.37:g.35906559A>C	ENSP00000346283:p.His92Pro	Somatic	44	14		WXS	Illumina HiSeq	Phase_I	24	13	NM_001039792	0	0	3	3	0	B7ZBJ1	Missense_Mutation	SNP	ENST00000354323.2	37	CCDS35012.1	.	.	.	.	.	.	.	.	.	.	A	6.244	0.413193	0.11812	.	.	ENSG00000196196	ENST00000354323	.	.	.	2.44	-4.88	0.03113	.	2.969780	0.02194	N	0.061627	T	0.16257	0.0391	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.12682	-1.0538	9	0.87932	D	0	-35.0854	0.2739	0.00235	0.2845:0.1811:0.2905:0.2438	.	92	Q6UXD1	HRCT1_HUMAN	P	92	.	ENSP00000346283:H92P	H	+	2	0	HRCT1	35896559	0.200000	0.23398	0.000000	0.03702	0.183000	0.23260	0.845000	0.27668	-1.085000	0.03088	0.383000	0.25322	CAC	.		0.682	HRCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334099.1	NM_001039792	
TSTD2	158427	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	100368460	100368460	+	Missense_Mutation	SNP	G	G	T			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr9:100368460G>T	ENST00000341170.4	-	7	1301	c.919C>A	c.(919-921)Ctt>Att	p.L307I	TSTD2_ENST00000354801.2_Missense_Mutation_p.L47I	NM_139246.4	NP_640339.4	Q5T7W7	TSTD2_HUMAN	thiosulfate sulfurtransferase (rhodanese)-like domain containing 2	307	Rhodanese. {ECO:0000255|PROSITE- ProRule:PRU00173}.							p.L307I(1)		large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	15						CAATCAAGAAGGATAGTATCA	0.353																																					p.L307I		.											.	TSTD2-92	1	Substitution - Missense(1)	ovary(1)	c.C919A						.						117.0	116.0	117.0					9																	100368460		2203	4300	6503	SO:0001583	missense	158427	exon7			CAAGAAGGATAGT	AF258575	CCDS6727.2	9q22.33	2013-09-20	2009-08-12	2009-08-12	ENSG00000136925	ENSG00000136925			30087	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 97"""	C9orf97		12477932	Standard	NM_139246		Approved	PP4189	uc004axn.3	Q5T7W7	OTTHUMG00000020328	ENST00000341170.4:c.919C>A	9.37:g.100368460G>T	ENSP00000342499:p.Leu307Ile	Somatic	103	0		WXS	Illumina HiSeq	Phase_I	72	9	NM_139246	0	0	4	4	0	A6NMJ4|A8K584|Q6ZQZ6|Q8IYM3|Q8WY73|Q96ML6|Q96MU1	Missense_Mutation	SNP	ENST00000341170.4	37	CCDS6727.2	.	.	.	.	.	.	.	.	.	.	G	14.49	2.552202	0.45487	.	.	ENSG00000136925	ENST00000375172;ENST00000341170;ENST00000375165;ENST00000354801	T;T;T	0.27104	1.69;1.69;1.69	5.18	3.31	0.37934	Rhodanese-like (5);	0.066943	0.64402	N	0.000014	T	0.17916	0.0430	L	0.41492	1.28	0.32895	D	0.512421	B;B	0.33477	0.013;0.413	B;B	0.35607	0.032;0.206	T	0.14172	-1.0482	10	0.20046	T	0.44	-5.0176	5.6795	0.17767	0.1448:0.0:0.666:0.1892	.	81;307	B3KVC7;Q5T7W7	.;TSTD2_HUMAN	I	81;307;47;47	ENSP00000342499:L307I;ENSP00000364308:L47I;ENSP00000346856:L47I	ENSP00000342499:L307I	L	-	1	0	TSTD2	99408281	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	1.989000	0.40707	1.490000	0.48466	0.655000	0.94253	CTT	.		0.353	TSTD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053325.4	NM_139246	
FKBP15	23307	hgsc.bcm.edu	37	9	115973833	115973833	+	Silent	SNP	A	A	G			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr9:115973833A>G	ENST00000238256.3	-	2	210	c.93T>C	c.(91-93)gcT>gcC	p.A31A		NM_015258.1	NP_056073.1	Q5T1M5	FKB15_HUMAN	FK506 binding protein 15, 133kDa	31					endocytosis (GO:0006897)|negative regulation of phosphatase activity (GO:0010923)|protein folding (GO:0006457)	actin filament (GO:0005884)|axon (GO:0030424)|endosome (GO:0005768)|growth cone (GO:0030426)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(9)|ovary(3)|urinary_tract(1)	26						CATGGCCAGCAGCTGCCTGAT	0.423																																					p.A31A		.											.	FKBP15-25	0			c.T93C						.						80.0	77.0	78.0					9																	115973833		1885	4142	6027	SO:0001819	synonymous_variant	23307	exon2			GCCAGCAGCTGCC	AB014574	CCDS48007.1	9q33.1	2014-05-09	2006-10-31	2006-10-31	ENSG00000119321	ENSG00000119321		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	23397	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 76"", ""WASP and FKBP-like protein"""		"""KIAA0674"""	KIAA0674		16756961, 20376207	Standard	NM_015258		Approved	PPP1R76, FKBP133, WAFL	uc004bgs.2	Q5T1M5	OTTHUMG00000020518	ENST00000238256.3:c.93T>C	9.37:g.115973833A>G		Somatic	24	0		WXS	Illumina HiSeq	Phase_I	27	2	NM_015258	0	0	6	6	0	Q05DK8|Q5T1M2|Q6DD85|Q9Y4D0	Silent	SNP	ENST00000238256.3	37	CCDS48007.1																																																																																			.		0.423	FKBP15-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_015258	
HSPA5	3309	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	9	128001454	128001454	+	Silent	SNP	A	A	G			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr9:128001454A>G	ENST00000324460.6	-	5	965	c.762T>C	c.(760-762)ggT>ggC	p.G254G	RP11-65N13.8_ENST00000468244.1_RNA	NM_005347.4	NP_005338.1	P11021	GRP78_HUMAN	heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa)	254					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|cellular response to antibiotic (GO:0071236)|cellular response to glucose starvation (GO:0042149)|cellular response to interleukin-4 (GO:0071353)|cerebellar Purkinje cell layer development (GO:0021680)|cerebellum structural organization (GO:0021589)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|maintenance of protein localization in endoplasmic reticulum (GO:0035437)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cell migration (GO:0030335)|positive regulation of protein ubiquitination (GO:0031398)|regulation of protein folding in endoplasmic reticulum (GO:0060904)|substantia nigra development (GO:0021762)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum chaperone complex (GO:0034663)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|chaperone binding (GO:0051087)|enzyme binding (GO:0019899)|glycoprotein binding (GO:0001948)|misfolded protein binding (GO:0051787)|protein domain specific binding (GO:0019904)|ribosome binding (GO:0043022)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(4)|prostate(2)|skin(1)	23					Acetylsalicylic acid(DB00945)|Antihemophilic Factor(DB00025)	AGTCTTCTCCACCCAGATGAG	0.468										Prostate(1;0.17)																											p.G254G		.											.	HSPA5-230	0			c.T762C						.						58.0	57.0	57.0					9																	128001454		2203	4300	6503	SO:0001819	synonymous_variant	3309	exon5			TTCTCCACCCAGA		CCDS6863.1	9q33.3	2011-09-02	2002-08-29		ENSG00000044574	ENSG00000044574		"""Heat shock proteins / HSP70"""	5238	protein-coding gene	gene with protein product		138120	"""heat shock 70kD protein 5 (glucose-regulated protein, 78kD)"""	GRP78			Standard	NM_005347		Approved	BiP	uc004bpn.3	P11021	OTTHUMG00000020672	ENST00000324460.6:c.762T>C	9.37:g.128001454A>G		Somatic	68	0		WXS	Illumina HiSeq	Phase_I	52	7	NM_005347	5	0	253	488	230	B0QZ61|Q2EF78|Q9NPF1|Q9UK02	Silent	SNP	ENST00000324460.6	37	CCDS6863.1																																																																																			.		0.468	HSPA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054062.1		
GARNL3	84253	hgsc.bcm.edu	37	9	130149608	130149608	+	Missense_Mutation	SNP	A	A	G			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr9:130149608A>G	ENST00000373387.4	+	25	2877	c.2525A>G	c.(2524-2526)gAa>gGa	p.E842G	GARNL3_ENST00000314904.5_Intron|GARNL3_ENST00000496711.1_3'UTR|GARNL3_ENST00000435213.2_Missense_Mutation_p.E820G	NM_032293.4	NP_115669.3	Q5VVW2	GARL3_HUMAN	GTPase activating Rap/RanGAP domain-like 3	842					regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)|small GTPase regulator activity (GO:0005083)			NS(1)|central_nervous_system(1)|endometrium(6)|large_intestine(5)|lung(24)|ovary(1)|skin(1)|urinary_tract(2)	41						TCCCTGGGGGAAGGTGAAGTC	0.438																																					p.E842G		.											.	GARNL3-516	0			c.A2525G						.						42.0	44.0	44.0					9																	130149608		2203	4300	6503	SO:0001583	missense	84253	exon25			TGGGGGAAGGTGA	BC034983	CCDS6869.2, CCDS69663.1	9q34.13	2009-09-14	2004-08-09		ENSG00000136895	ENSG00000136895			25425	protein-coding gene	gene with protein product			"""GTPase activating RANGAP domain-like 3"""			11230166	Standard	NM_032293		Approved	DKFZp761J1523, bA356B19.1	uc011mae.2	Q5VVW2	OTTHUMG00000020700	ENST00000373387.4:c.2525A>G	9.37:g.130149608A>G	ENSP00000362485:p.Glu842Gly	Somatic	55	0		WXS	Illumina HiSeq	Phase_I	39	2	NM_032293	0	0	0	0	0	B4DEP7|B7Z3Q6|Q8IYU1|Q8N951|Q8ND89|Q9BQH6	Missense_Mutation	SNP	ENST00000373387.4	37	CCDS6869.2	.	.	.	.	.	.	.	.	.	.	A	18.50	3.636537	0.67130	.	.	ENSG00000136895	ENST00000435213;ENST00000373387	D;D	0.88277	-2.36;-2.36	5.66	5.66	0.87406	.	0.097775	0.64402	D	0.000001	T	0.82245	0.4995	L	0.32530	0.975	0.80722	D	1	B;P	0.37781	0.421;0.608	B;B	0.32980	0.081;0.156	T	0.81134	-0.1071	9	.	.	.	.	14.7222	0.69314	1.0:0.0:0.0:0.0	.	842;820	Q5VVW2;B7Z3Q6	GARL3_HUMAN;.	G	820;842	ENSP00000396205:E820G;ENSP00000362485:E842G	.	E	+	2	0	GARNL3	129189429	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	8.066000	0.89486	2.140000	0.66376	0.533000	0.62120	GAA	.		0.438	GARNL3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054151.3	NM_032293	
PKN3	29941	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	131476565	131476565	+	Missense_Mutation	SNP	C	C	A			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr9:131476565C>A	ENST00000291906.4	+	11	1795	c.1402C>A	c.(1402-1404)Ccg>Acg	p.P468T		NM_013355.3	NP_037487.2	Q6P5Z2	PKN3_HUMAN	protein kinase N3	468	Pro-rich.				epithelial cell migration (GO:0010631)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(9)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24						CTGCAGCTCCCCGAGCACAAT	0.647																																					p.P468T		.											.	PKN3-521	0			c.C1402A						.						62.0	70.0	67.0					9																	131476565		2203	4300	6503	SO:0001583	missense	29941	exon11			AGCTCCCCGAGCA	AB019692	CCDS6908.1	9q34.13	2008-02-05			ENSG00000160447	ENSG00000160447			17999	protein-coding gene	gene with protein product		610714				10441506	Standard	NM_013355		Approved	PKNbeta	uc004bvw.3	Q6P5Z2	OTTHUMG00000020757	ENST00000291906.4:c.1402C>A	9.37:g.131476565C>A	ENSP00000291906:p.Pro468Thr	Somatic	243	0		WXS	Illumina HiSeq	Phase_I	240	42	NM_013355	0	0	2	4	2	Q9UM03	Missense_Mutation	SNP	ENST00000291906.4	37	CCDS6908.1	.	.	.	.	.	.	.	.	.	.	C	6.729	0.503216	0.12822	.	.	ENSG00000160447	ENST00000291906	T	0.27256	1.68	5.3	4.36	0.52297	.	.	.	.	.	T	0.22742	0.0549	L	0.51422	1.61	0.26351	N	0.977203	P	0.42827	0.791	B	0.40901	0.343	T	0.05616	-1.0874	9	0.09590	T	0.72	.	11.1984	0.48726	0.3181:0.6818:0.0:0.0	.	468	Q6P5Z2	PKN3_HUMAN	T	468	ENSP00000291906:P468T	ENSP00000291906:P468T	P	+	1	0	PKN3	130516386	0.031000	0.19500	0.911000	0.35937	0.516000	0.34256	1.330000	0.33781	2.478000	0.83669	0.563000	0.77884	CCG	.		0.647	PKN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054487.1	NM_013355	
ZER1	10444	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	131512978	131512978	+	Missense_Mutation	SNP	A	A	G			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr9:131512978A>G	ENST00000291900.2	-	8	1682	c.1276T>C	c.(1276-1278)Tac>Cac	p.Y426H	ZER1_ENST00000494461.1_5'Flank|snoU13_ENST00000459043.1_RNA	NM_006336.2	NP_006327.2	Q7Z7L7	ZER1_HUMAN	zyg-11 related, cell cycle regulator	426					protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein transferase activity (GO:0051438)	Cul2-RING ubiquitin ligase complex (GO:0031462)	ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	15						TCTGAGCGGTACTCGGAATTT	0.562																																					p.Y426H		.											.	ZER1-91	0			c.T1276C						.						102.0	89.0	94.0					9																	131512978		2203	4300	6503	SO:0001583	missense	10444	exon8			AGCGGTACTCGGA	X99802	CCDS6910.1	9q33.3	2013-01-17	2012-12-10	2007-01-04	ENSG00000160445	ENSG00000160445		"""ZYG11 cell cycle regulator family"""	30960	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 60"", ""zyg-11 homolog B (C. elegans)-like"", ""zer-1 homolog (C. elegans)"""	C9orf60, ZYG11BL		11719588	Standard	NM_006336		Approved	ZYG, Hzyg	uc004bwa.2	Q7Z7L7	OTTHUMG00000020759	ENST00000291900.2:c.1276T>C	9.37:g.131512978A>G	ENSP00000291900:p.Tyr426His	Somatic	82	0		WXS	Illumina HiSeq	Phase_I	100	16	NM_006336	0	0	19	27	8	O00156|Q5T272|Q5T273	Missense_Mutation	SNP	ENST00000291900.2	37	CCDS6910.1	.	.	.	.	.	.	.	.	.	.	A	12.92	2.082101	0.36758	.	.	ENSG00000160445	ENST00000291900	T	0.06218	3.33	4.35	4.35	0.52113	Armadillo-like helical (1);Armadillo-type fold (1);	0.146987	0.47455	D	0.000229	T	0.07234	0.0183	L	0.44542	1.39	0.58432	D	0.999999	B	0.26258	0.145	B	0.31191	0.125	T	0.29181	-1.0020	10	0.15499	T	0.54	-31.0091	12.8828	0.58026	1.0:0.0:0.0:0.0	.	426	Q7Z7L7	ZER1_HUMAN	H	426	ENSP00000291900:Y426H	ENSP00000291900:Y426H	Y	-	1	0	ZER1	130552799	1.000000	0.71417	1.000000	0.80357	0.583000	0.36354	8.478000	0.90428	1.832000	0.53329	0.383000	0.25322	TAC	.		0.562	ZER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054491.1	NM_006336	
POLA1	5422	hgsc.bcm.edu	37	X	24906193	24906193	+	Missense_Mutation	SNP	C	C	G			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chrX:24906193C>G	ENST00000379059.3	+	35	4115	c.4100C>G	c.(4099-4101)aCt>aGt	p.T1367S	POLA1_ENST00000379068.3_Missense_Mutation_p.T1373S	NM_016937.3	NP_058633.2	P09884	DPOLA_HUMAN	polymerase (DNA directed), alpha 1, catalytic subunit	1367	DNA-binding region. {ECO:0000255}.				cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair via nonhomologous end joining (GO:0006303)|G1/S transition of mitotic cell cycle (GO:0000082)|lagging strand elongation (GO:0006273)|leading strand elongation (GO:0006272)|mitotic cell cycle (GO:0000278)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|translesion synthesis (GO:0019985)|viral process (GO:0016032)	alpha DNA polymerase:primase complex (GO:0005658)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleoside binding (GO:0001882)|nucleotide binding (GO:0000166)|protein kinase binding (GO:0019901)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|skin(2)	11					Cladribine(DB00242)|Clofarabine(DB00631)|Fludarabine(DB01073)|Nelarabine(DB01280)	TTCTCCCGAACTGGGCCTCTT	0.493																																					p.T1367S		.											.	POLA1-229	0			c.C4100G						.						130.0	102.0	112.0					X																	24906193		2203	4300	6503	SO:0001583	missense	5422	exon35			CCCGAACTGGGCC		CCDS14214.1	Xp22.1-p21.3	2014-01-30	2008-08-07	2006-09-26	ENSG00000101868	ENSG00000101868	2.7.7.7	"""DNA polymerases"""	9173	protein-coding gene	gene with protein product		312040	"""polymerase (DNA directed), alpha"", ""polymerase (DNA directed), alpha 1"", ""N syndrome (mental retardation, malformations, chromosome breakage)"""	POLA, NSX		1689958	Standard	NM_016937		Approved	p180	uc004dbl.3	P09884	OTTHUMG00000021277	ENST00000379059.3:c.4100C>G	X.37:g.24906193C>G	ENSP00000368349:p.Thr1367Ser	Somatic	56	0		WXS	Illumina HiSeq	Phase_I	60	3	NM_016937	0	0	6	6	0	Q86UQ7	Missense_Mutation	SNP	ENST00000379059.3	37	CCDS14214.1	.	.	.	.	.	.	.	.	.	.	C	3.682	-0.065364	0.07273	.	.	ENSG00000101868	ENST00000379068;ENST00000379059	T;T	0.16597	2.33;2.33	5.58	0.599	0.17519	Zinc finger, DNA-directed DNA polymerase, family B, alpha (1);	0.491223	0.22316	N	0.061661	T	0.04679	0.0127	N	0.02539	-0.55	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.41928	-0.9481	10	0.09338	T	0.73	-4.7704	5.5775	0.17231	0.4882:0.1503:0.3615:0.0	.	1367	P09884	DPOLA_HUMAN	S	1373;1367	ENSP00000368358:T1373S;ENSP00000368349:T1367S	ENSP00000368349:T1367S	T	+	2	0	POLA1	24816114	0.966000	0.33281	0.851000	0.33527	0.481000	0.33189	1.521000	0.35910	-0.000000	0.14550	-1.090000	0.02178	ACT	.		0.493	POLA1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000056111.1	NM_016937	
DDX3X	1654	hgsc.bcm.edu	37	X	41200810	41200810	+	Silent	SNP	T	T	C			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chrX:41200810T>C	ENST00000399959.2	+	4	1080	c.225T>C	c.(223-225)cgT>cgC	p.R75R	DDX3X_ENST00000457138.2_Silent_p.R59R|DDX3X_ENST00000441189.2_Silent_p.R75R|DDX3X_ENST00000478993.1_3'UTR|DDX3X_ENST00000542215.1_Silent_p.R119R	NM_001193416.1|NM_001193417.1|NM_001356.3	NP_001180345.1|NP_001180346.1|NP_001347.3	O00571	DDX3X_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 3, X-linked	75	Interaction with EIF4E.|Required for TBK1 and IKBKE-dependent IFN-beta activation.				ATP catabolic process (GO:0006200)|cellular response to arsenic-containing substance (GO:0071243)|cellular response to osmotic stress (GO:0071470)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway (GO:0097193)|mature ribosome assembly (GO:0042256)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell growth (GO:0030307)|positive regulation of chemokine (C-C motif) ligand 5 production (GO:0071651)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of translation (GO:0045727)|positive regulation of translational initiation (GO:0045948)|response to virus (GO:0009615)|RNA secondary structure unwinding (GO:0010501)|stress granule assembly (GO:0034063)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 5'-UTR binding (GO:0048027)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)|transcription factor binding (GO:0008134)|translation initiation factor binding (GO:0031369)			NS(3)|breast(8)|central_nervous_system(36)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84						TTGGATCTCGTAGTGATTCAA	0.383										HNSCC(61;0.18)																											p.R75R		.											.	DDX3X-715	0			c.T225C						.						130.0	127.0	128.0					X																	41200810		2169	4284	6453	SO:0001819	synonymous_variant	1654	exon4			ATCTCGTAGTGAT	U50553	CCDS43931.1, CCDS55404.1	Xp11.3-p11.23	2013-07-16	2013-07-16	2003-06-20	ENSG00000215301	ENSG00000215301		"""DEAD-boxes"""	2745	protein-coding gene	gene with protein product		300160	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked"""	DDX3		9381176, 9730595	Standard	NM_001193416		Approved	DBX, HLP2, DDX14	uc004dfe.3	O00571	OTTHUMG00000021369	ENST00000399959.2:c.225T>C	X.37:g.41200810T>C		Somatic	65	0		WXS	Illumina HiSeq	Phase_I	60	3	NM_001193416	0	0	86	86	0	A8K538|B4E3E8|O15536	Silent	SNP	ENST00000399959.2	37	CCDS43931.1																																																																																			.		0.383	DDX3X-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056253.1	NM_024005	
ZXDB	158586	hgsc.bcm.edu;broad.mit.edu	37	X	57619097	57619097	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chrX:57619097G>A	ENST00000374888.1	+	1	829	c.616G>A	c.(616-618)Ggg>Agg	p.G206R		NM_007157.3	NP_009088.1	P98169	ZXDB_HUMAN	zinc finger, X-linked, duplicated B	206					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.G206R(2)		NS(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(2)|skin(6)	27						CCAGCAGCCCGGGTGTCTGAT	0.711																																					p.G206R		.											.	ZXDB-130	2	Substitution - Missense(2)	lung(1)|prostate(1)	c.G616A						.						12.0	14.0	13.0					X																	57619097		2186	4257	6443	SO:0001583	missense	158586	exon1			CAGCCCGGGTGTC	L14788	CCDS35313.1	Xp11.1	2013-01-08			ENSG00000198455	ENSG00000198455		"""Zinc fingers, C2H2-type"""	13199	protein-coding gene	gene with protein product		300236				8268913	Standard	NM_007157		Approved	ZNF905	uc004dvd.3	P98169	OTTHUMG00000021685	ENST00000374888.1:c.616G>A	X.37:g.57619097G>A	ENSP00000364023:p.Gly206Arg	Somatic	20	0		WXS	Illumina HiSeq	Phase_I	20	3	NM_007157	0	0	1	2	1	A8K151|Q9UBB3	Missense_Mutation	SNP	ENST00000374888.1	37	CCDS35313.1	.	.	.	.	.	.	.	.	.	.	.	0	-2.654782	0.00108	.	.	ENSG00000198455	ENST00000374888	T	0.11063	2.81	2.65	1.78	0.24846	.	0.160870	0.29602	N	0.011697	T	0.04452	0.0122	N	0.12182	0.205	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.41787	-0.9489	10	0.15952	T	0.53	.	4.3042	0.10938	0.3435:0.0:0.6565:0.0	.	206	P98169	ZXDB_HUMAN	R	206	ENSP00000364023:G206R	ENSP00000364023:G206R	G	+	1	0	ZXDB	57635822	0.000000	0.05858	0.002000	0.10522	0.045000	0.14185	-0.287000	0.08388	0.520000	0.28426	0.556000	0.70494	GGG	.		0.711	ZXDB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056922.1	NM_007157	
KIF4A	24137	broad.mit.edu	37	X	69595071	69595071	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chrX:69595071G>A	ENST00000374403.3	+	17	1878	c.1796G>A	c.(1795-1797)cGc>cAc	p.R599H	KIF4A_ENST00000374388.3_Missense_Mutation_p.R599H	NM_012310.4	NP_036442.3	O95239	KIF4A_HUMAN	kinesin family member 4A	599					anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle organization (GO:0006996)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(6)|endometrium(9)|kidney(3)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	51						GAGCGCCGCCGCAAACGTCTC	0.468																																					p.R599H													.	KIF4A-134	0			c.G1796A						.						67.0	58.0	61.0					X																	69595071		2203	4300	6503	SO:0001583	missense	24137	exon17			GCCGCCGCAAACG	AF179308	CCDS14401.1	Xq13.1	2008-08-11			ENSG00000090889	ENSG00000090889		"""Kinesins"""	13339	protein-coding gene	gene with protein product	"""chromokinesin"""	300521				10773663	Standard	NM_012310		Approved	KIF4-G1, KIF4, HSA271784, FLJ12530, FLJ12655, FLJ14204, FLJ20631	uc004dyg.3	O95239	OTTHUMG00000021775	ENST00000374403.3:c.1796G>A	X.37:g.69595071G>A	ENSP00000363524:p.Arg599His	Somatic	34	0		WXS	Illumina HiSeq	Phase_I	34	3	NM_012310	0	0	0	0	0	B2R7V5|D3DVU4|Q86TN3|Q86XX7|Q9NNY6|Q9NY24|Q9UMW3	Missense_Mutation	SNP	ENST00000374403.3	37	CCDS14401.1	.	.	.	.	.	.	.	.	.	.	G	18.87	3.716466	0.68844	.	.	ENSG00000090889	ENST00000374388;ENST00000374403	T;T	0.70869	2.3;-0.52	5.53	5.53	0.82687	.	0.000000	0.56097	D	0.000035	T	0.76292	0.3967	M	0.83483	2.645	0.80722	D	1	B;B	0.28713	0.143;0.22	B;B	0.33254	0.038;0.16	T	0.76394	-0.2975	10	0.52906	T	0.07	.	17.3242	0.87243	0.0:0.0:1.0:0.0	.	599;599	O95239;O95239-2	KIF4A_HUMAN;.	H	599	ENSP00000363509:R599H;ENSP00000363524:R599H	ENSP00000363509:R599H	R	+	2	0	KIF4A	69511796	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.912000	0.92726	2.562000	0.86427	0.600000	0.82982	CGC	.		0.468	KIF4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057068.1	NM_012310	
PAK3	5063	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	110366494	110366494	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chrX:110366494G>A	ENST00000372010.1	+	5	605	c.163G>A	c.(163-165)Gga>Aga	p.G55R	PAK3_ENST00000518291.1_Missense_Mutation_p.G55R|PAK3_ENST00000519681.1_Missense_Mutation_p.G55R|PAK3_ENST00000417227.1_Missense_Mutation_p.G55R|PAK3_ENST00000446737.1_Missense_Mutation_p.G55R|PAK3_ENST00000425146.1_Missense_Mutation_p.G55R|PAK3_ENST00000372007.5_Missense_Mutation_p.G55R|PAK3_ENST00000360648.4_Missense_Mutation_p.G55R|PAK3_ENST00000262836.4_Missense_Mutation_p.G55R			O75914	PAK3_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 3	55					activation of MAPK activity (GO:0000187)|axonogenesis (GO:0007409)|dendrite development (GO:0016358)|dendritic spine morphogenesis (GO:0060997)|MAPK cascade (GO:0000165)|regulation of actin filament polymerization (GO:0030833)|synapse organization (GO:0050808)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(15)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	41						CTTCCCAGGAGGAGGGGATAA	0.448										TSP Lung(19;0.15)																											p.G55R		.											.	PAK3-1043	0			c.G163A						.						70.0	69.0	70.0					X																	110366494		2203	4300	6503	SO:0001583	missense	5063	exon3			CCAGGAGGAGGGG	AF068864	CCDS14554.1, CCDS48151.1, CCDS48152.1, CCDS48153.1	Xq22.3	2008-06-17	2008-06-17		ENSG00000077264	ENSG00000077264			8592	protein-coding gene	gene with protein product		300142	"""mental retardation, X-linked 47"", ""p21 (CDKN1A)-activated kinase 3"""	MRX30, MRX47		8826460, 9731525	Standard	NM_002578		Approved	hPAK3, bPAK	uc010npv.1	O75914	OTTHUMG00000022202	ENST00000372010.1:c.163G>A	X.37:g.110366494G>A	ENSP00000361080:p.Gly55Arg	Somatic	50	0		WXS	Illumina HiSeq	Phase_I	47	15	NM_001128166	0	0	0	1	1	A8K389|B1GX77|B1GX78|B1GX79|Q5JWX1|Q5JWX2|Q7Z2D6|Q7Z2E4|Q7Z3Z8|Q8WWK5|Q8WX23|Q9P0J8	Missense_Mutation	SNP	ENST00000372010.1	37	CCDS48153.1	.	.	.	.	.	.	.	.	.	.	G	16.93	3.257186	0.59321	.	.	ENSG00000077264	ENST00000446737;ENST00000425146;ENST00000372010;ENST00000519681;ENST00000372007;ENST00000518291;ENST00000429193;ENST00000360648;ENST00000417227;ENST00000262836	T;T;T;T;T;T;T;T;T	0.71461	-0.55;-0.55;-0.57;-0.56;-0.55;-0.54;-0.54;-0.56;-0.57	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.68284	0.2984	L	0.29908	0.895	0.80722	D	1	P;P;B;B	0.43607	0.801;0.812;0.399;0.037	P;P;B;B	0.48454	0.578;0.578;0.194;0.049	T	0.64322	-0.6435	10	0.22706	T	0.39	.	18.4314	0.90627	0.0:0.0:1.0:0.0	.	55;55;55;55	O75914-4;O75914-3;O75914;O75914-2	.;.;PAK3_HUMAN;.	R	55	ENSP00000410853:G55R;ENSP00000401982:G55R;ENSP00000361080:G55R;ENSP00000429113:G55R;ENSP00000361077:G55R;ENSP00000428921:G55R;ENSP00000353864:G55R;ENSP00000389172:G55R;ENSP00000262836:G55R	ENSP00000262836:G55R	G	+	1	0	PAK3	110253150	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.143000	0.94623	2.380000	0.81148	0.600000	0.82982	GGA	.		0.448	PAK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057918.1	NM_002578	
WDR47	22911	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	109554105	109554105	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr1:109554105delT	ENST00000369962.3	-	5	785	c.563delA	c.(562-564)aagfs	p.K188fs	WDR47_ENST00000369965.4_Frame_Shift_Del_p.K188fs|WDR47_ENST00000361054.3_Frame_Shift_Del_p.K160fs|WDR47_ENST00000400794.3_Frame_Shift_Del_p.K195fs|WDR47_ENST00000357672.3_Frame_Shift_Del_p.K160fs			O94967	WDR47_HUMAN	WD repeat domain 47	188					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	20		all_lung(203;0.00519)|all_epithelial(167;0.00611)|Lung NSC(277;0.00822)		Colorectal(144;0.0165)|Lung(183;0.0484)|COAD - Colon adenocarcinoma(174;0.128)|Epithelial(280;0.168)|all cancers(265;0.201)|LUSC - Lung squamous cell carcinoma(189;0.244)		GTTACTAGCCTTAAAACCAGC	0.413																																					p.K195fs		.											.	WDR47-91	0			c.584delA						.						206.0	212.0	210.0					1																	109554105		2203	4296	6499	SO:0001589	frameshift_variant	22911	exon5			.	AB020700	CCDS30787.1, CCDS44186.1, CCDS44187.1	1p13.3	2013-01-09			ENSG00000085433	ENSG00000085433		"""WD repeat domain containing"""	29141	protein-coding gene	gene with protein product		615734				10048485	Standard	NM_014969		Approved	KIAA0893	uc001dwl.3	O94967	OTTHUMG00000011734	ENST00000369962.3:c.563delA	1.37:g.109554105delT	ENSP00000358979:p.Lys188fs	Somatic	435	0		WXS	Illumina HiSeq	Phase_I	342	55	NM_001142550	0	0	0	0	0	A8MX09|Q5TYV7|Q5TYV8|Q5TYV9|Q8IXT7|Q8IYU9	Frame_Shift_Del	DEL	ENST00000369962.3	37	CCDS44187.1																																																																																			.		0.413	WDR47-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000032414.2	NM_014969	
MMRN2	79812	broad.mit.edu;bcgsc.ca	37	10	88705024	88705026	+	Splice_Site	DEL	ATC	ATC	-			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	ATC	ATC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr10:88705024_88705026delATC	ENST00000372027.5	-	4	722_723	c.401_402delGAT	c.(400-402)gga>g	p.G134del	MMRN2_ENST00000488950.1_5'Flank	NM_024756.2	NP_079032.2	Q9H8L6	MMRN2_HUMAN	multimerin 2	134					angiogenesis (GO:0001525)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|kidney(1)|large_intestine(6)|lung(7)|prostate(2)|skin(1)|stomach(1)	19						TTGCCATGGAATCTGCAGAAGAA	0.571																																					p.134_134del													.	MMRN2-153	0			c.401_402del						.																																			SO:0001630	splice_region_variant	79812	exon4			CATGGAATCTGCA	AK023527	CCDS7379.1	10q23.31	2004-03-10	2004-03-02	2004-03-02	ENSG00000173269	ENSG00000173269		"""EMI domain containing"""	19888	protein-coding gene	gene with protein product		608925	"""elastin microfibril interfacer 3"""	EMILIN3		11559704	Standard	NM_024756		Approved	EndoGlyx-1, FLJ13465	uc001kea.3	Q9H8L6	OTTHUMG00000018663	ENST00000372027.5:c.401-1GAT>-	10.37:g.88705024_88705026delATC		Somatic	69	0		WXS	Illumina HiSeq	Phase_I	61	8	NM_024756	0	0	0	0	0	Q504V7|Q6P2N2	Frame_Shift_Del	DEL	ENST00000372027.5	37	CCDS7379.1																																																																																			.		0.571	MMRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049179.2	NM_024756	In_Frame_Del
C16orf92	146378	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	30035201	30035219	+	Splice_Site	DEL	ACTCAGGTATGAACCAGCT	ACTCAGGTATGAACCAGCT	-			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	ACTCAGGTATGAACCAGCT	ACTCAGGTATGAACCAGCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr16:30035201_30035219delACTCAGGTATGAACCAGCT	ENST00000300575.2	+	2	305_310	c.284_289delACTCAGGTATGAACCAGCT	c.(283-291)aactcaggt>agt	p.NSG95fs	DOC2A_ENST00000567824.1_5'Flank	NM_001109659.1|NM_001109660.1	NP_001103129.1|NP_001103130.1	Q96LL3	CP092_HUMAN	chromosome 16 open reading frame 92	95						integral component of membrane (GO:0016021)				breast(3)|lung(3)	6						GTGTTCATTAACTCAGGTATGAACCAGCTTGAGAAGGGA	0.543																																					p.95_97del		.											.	C16orf92-68	0			c.284_289del						.																																			SO:0001630	splice_region_variant	146378	exon2			.	AK058133	CCDS42146.1	16p11.2	2012-05-30			ENSG00000167194	ENSG00000167194			26346	protein-coding gene	gene with protein product							Standard	NM_001109659		Approved	FLJ25404	uc002dvs.2	Q96LL3	OTTHUMG00000177107	ENST00000300575.2:c.289+1ACTCAGGTATGAACCAGCT>-	16.37:g.30035201_30035219delACTCAGGTATGAACCAGCT		Somatic	82	0		WXS	Illumina HiSeq	Phase_I	73	15	NM_001109660	0	0	0	0	0	Q494R8	In_Frame_Del	DEL	ENST00000300575.2	37	CCDS42146.1																																																																																			.		0.543	C16orf92-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435351.1	NM_001109659	Frame_Shift_Del
WIPF2	147179	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	38420795	38420800	+	In_Frame_Del	DEL	CCAAGG	CCAAGG	-			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	CCAAGG	CCAAGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr17:38420795_38420800delCCAAGG	ENST00000323571.4	+	5	607_612	c.367_372delCCAAGG	c.(367-372)ccaaggdel	p.PR123del	WIPF2_ENST00000536600.1_Intron|WIPF2_ENST00000583130.1_In_Frame_Del_p.PR123del|WIPF2_ENST00000494757.1_3'UTR|WIPF2_ENST00000394103.3_Intron|WIPF2_ENST00000585043.1_In_Frame_Del_p.PR123del	NM_133264.4	NP_573571.1	Q8TF74	WIPF2_HUMAN	WAS/WASL interacting protein family, member 2	123					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)		p.R124G(1)		NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	30						AGCTGCTGCCCCAAGGCCTCCAGTAT	0.573										HNSCC(43;0.11)																											p.123_124del		.											.	WIPF2-93	1	Substitution - Missense(1)	kidney(1)	c.367_372del						.																																			SO:0001651	inframe_deletion	147179	exon5			.	BC025965	CCDS11364.1	17q21.2	2006-10-12			ENSG00000171475	ENSG00000171475			30923	protein-coding gene	gene with protein product		609692				12213210, 11829459	Standard	XM_005257083		Approved	WICH, WIRE	uc002hug.1	Q8TF74	OTTHUMG00000133331	ENST00000323571.4:c.367_372delCCAAGG	17.37:g.38420795_38420800delCCAAGG	ENSP00000320924:p.Pro123_Arg124del	Somatic	163	0		WXS	Illumina HiSeq	Phase_I	141	24	NM_133264	0	0	0	0	0	A8K0L3|Q658J8|Q71RE1|Q8TE44	In_Frame_Del	DEL	ENST00000323571.4	37	CCDS11364.1																																																																																			.		0.573	WIPF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257157.2	NM_133264	
SCRN2	90507	broad.mit.edu	37	17	45916884	45916884	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr17:45916884delA	ENST00000290216.9	-	4	607	c.482delT	c.(481-483)ttcfs	p.F161fs	SCRN2_ENST00000407215.3_Frame_Shift_Del_p.F161fs|SCRN2_ENST00000584123.1_Frame_Shift_Del_p.F169fs	NM_001145023.1|NM_138355.3	NP_001138495.1|NP_612364.2	Q96FV2	SCRN2_HUMAN	secernin 2	161						extracellular vesicular exosome (GO:0070062)	dipeptidase activity (GO:0016805)			cervix(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	14						AGCCAGCAGGAAGGTGCTATG	0.617																																					p.F161fs													.	SCRN2-91	0			c.482delT						.						106.0	99.0	102.0					17																	45916884		2203	4300	6503	SO:0001589	frameshift_variant	90507	exon4			AGCAGGAAGGTGC	BC002980	CCDS11519.1, CCDS45723.1	17q21	2008-02-05							30381	protein-coding gene	gene with protein product		614966				12221138	Standard	NM_001145023		Approved		uc002imd.3	Q96FV2		ENST00000290216.9:c.482delT	17.37:g.45916884delA	ENSP00000290216:p.Phe161fs	Somatic	185	0		WXS	Illumina HiSeq	Phase_I	198	11	NM_138355	0	0	0	0	0	A8K3N1|B7Z8S7|E9PBV5|Q96AC3|Q9BU04	Frame_Shift_Del	DEL	ENST00000290216.9	37	CCDS11519.1																																																																																			.		0.617	SCRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441383.1	NM_138355	
ZNF227	7770	broad.mit.edu;bcgsc.ca	37	19	44739499	44739499	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr19:44739499delT	ENST00000313040.7	+	6	1121	c.916delT	c.(916-918)ttcfs	p.F306fs	ZNF227_ENST00000391961.2_Frame_Shift_Del_p.F255fs|ZNF227_ENST00000589005.1_Frame_Shift_Del_p.F255fs	NM_182490.1	NP_872296.1	Q86WZ6	ZN227_HUMAN	zinc finger protein 227	306					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(12)|ovary(2)|stomach(1)|urinary_tract(1)	24		Prostate(69;0.0435)				TGGTGATTGCTTCAATAAGAG	0.418																																					p.F306fs													.	ZNF227-91	0			c.916delT						.						58.0	58.0	58.0					19																	44739499		2203	4300	6503	SO:0001589	frameshift_variant	7770	exon6			GATTGCTTCAATA	AK092253	CCDS12636.1, CCDS74388.1	19q13.32	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	13020	protein-coding gene	gene with protein product							Standard	XM_005259232		Approved		uc002oyu.3	Q86WZ6		ENST00000313040.7:c.916delT	19.37:g.44739499delT	ENSP00000321049:p.Phe306fs	Somatic	112	0		WXS	Illumina HiSeq	Phase_I	82	9	NM_182490	0	0	0	0	0	B3KRU7|B7Z5P9	Frame_Shift_Del	DEL	ENST00000313040.7	37	CCDS12636.1																																																																																			.		0.418	ZNF227-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460720.1	NM_182490	
ADCY5	111	broad.mit.edu	37	3	123166392	123166392	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr3:123166392delA	ENST00000462833.1	-	1	2213	c.1001delT	c.(1000-1002)ttcfs	p.F335fs		NM_183357.2	NP_899200.1	O95622	ADCY5_HUMAN	adenylate cyclase 5	335					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(22)|ovary(5)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(114;0.0342)		GTAGATGAAGAACACGGTCCA	0.692																																					p.F334fs													.	ADCY5-94	0			c.1001delT						.						31.0	31.0	31.0					3																	123166392		2202	4297	6499	SO:0001589	frameshift_variant	111	exon1			ATGAAGAACACGG	U65473	CCDS3022.1, CCDS56274.1	3q21.1	2013-02-04			ENSG00000173175	ENSG00000173175	4.6.1.1	"""Adenylate cyclases"""	236	protein-coding gene	gene with protein product		600293				10481931	Standard	NM_183357		Approved	AC5	uc003egh.2	O95622	OTTHUMG00000159517	ENST00000462833.1:c.1001delT	3.37:g.123166392delA	ENSP00000419361:p.Phe335fs	Somatic	24	0		WXS	Illumina HiSeq	Phase_I	36	8	NM_183357	0	0	0	0	0	B7Z8A6|Q7RTV7|Q8NFM3	Frame_Shift_Del	DEL	ENST00000462833.1	37	CCDS3022.1																																																																																			.		0.692	ADCY5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355889.4	XM_171048	
GPR98	84059	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	89953910	89953915	+	In_Frame_Del	DEL	AAATCA	AAATCA	-			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	AAATCA	AAATCA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr5:89953910_89953915delAAATCA	ENST00000405460.2	+	21	4663_4668	c.4567_4572delAAATCA	c.(4567-4572)aaatcadel	p.KS1523del		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	1523	Calx-beta 10. {ECO:0000305|PubMed:11606593}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		AGAAACTAACAAATCATTCATTATTT	0.374																																					p.1523_1524del		.											.	GPR98-103	0			c.4567_4572del						.																																			SO:0001651	inframe_deletion	84059	exon21			.	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.4567_4572delAAATCA	5.37:g.89953910_89953915delAAATCA	ENSP00000384582:p.Lys1523_Ser1524del	Somatic	124	0		WXS	Illumina HiSeq	Phase_I	126	30	NM_032119	0	0	0	0	0	O75171|Q8TF58|Q9H0X5|Q9UL61	In_Frame_Del	DEL	ENST00000405460.2	37	CCDS47246.1																																																																																			.		0.374	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
DMTF1	9988	hgsc.bcm.edu;broad.mit.edu	37	7	86808890	86808890	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr7:86808890delC	ENST00000394703.5	+	10	1112	c.549delC	c.(547-549)atcfs	p.I184fs	DMTF1_ENST00000331242.7_Frame_Shift_Del_p.I184fs|DMTF1_ENST00000411766.2_Frame_Shift_Del_p.I143fs|DMTF1_ENST00000413276.2_Frame_Shift_Del_p.I184fs|DMTF1_ENST00000432937.2_Frame_Shift_Del_p.I96fs|DMTF1_ENST00000394702.3_Frame_Shift_Del_p.I184fs|DMTF1_ENST00000414194.2_5'UTR	NM_021145.3	NP_066968.3	Q9Y222	DMTF1_HUMAN	cyclin D binding myb-like transcription factor 1	184	Interaction with CCND1, CCND2 and CCND3. {ECO:0000250}.|Interaction with CCND2. {ECO:0000250}.|Required for DNA-binding. {ECO:0000250}.				cell cycle (GO:0007049)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)	16	Esophageal squamous(14;0.0058)					CTACAGAAATCATCTTTGAGA	0.363																																					p.I183fs		.											.	DMTF1-91	0			c.549delC						.						63.0	58.0	60.0					7																	86808890		2203	4300	6503	SO:0001589	frameshift_variant	9988	exon8			.	AF084530	CCDS5601.1, CCDS47633.1	7q21	2014-06-25			ENSG00000135164	ENSG00000135164			14603	protein-coding gene	gene with protein product	"""cyclin D-binding Myb-like protein"""	608491				10095122, 24958102	Standard	NR_024549		Approved	DMP1, DMTF, hDMP1, MRUL	uc003uih.3	Q9Y222	OTTHUMG00000154135	ENST00000394703.5:c.549delC	7.37:g.86808890delC	ENSP00000378193:p.Ile184fs	Somatic	39	0		WXS	Illumina HiSeq	Phase_I	51	10	NM_001142327	0	0	0	0	0	B2RBE1|B4DJS5|Q05C48|Q59G79|Q6IS13|Q969T2|Q9H2Z2|Q9H2Z3	Frame_Shift_Del	DEL	ENST00000394703.5	37	CCDS5601.1																																																																																			.		0.363	DMTF1-002	KNOWN	alternative_5_UTR|non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334025.5	NM_021145	
VIPR2	7434	broad.mit.edu;bcgsc.ca	37	7	158902583	158902587	+	Frame_Shift_Del	DEL	GTGAT	GTGAT	-			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	GTGAT	GTGAT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr7:158902583_158902587delGTGAT	ENST00000262178.2	-	3	360_364	c.175_179delATCAC	c.(175-180)atcacgfs	p.IT59fs	VIPR2_ENST00000402066.1_Frame_Shift_Del_p.IT200fs	NM_003382.4	NP_003373.2	P41587	VIPR2_HUMAN	vasoactive intestinal peptide receptor 2	59					activation of adenylate cyclase activity (GO:0007190)|cell-cell signaling (GO:0007267)|negative regulation of smooth muscle cell proliferation (GO:0048662)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|vasoactive intestinal polypeptide receptor activity (GO:0004999)			central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	22	Ovarian(565;0.152)	all_cancers(7;1.13e-11)|all_epithelial(9;0.000545)|all_hematologic(28;0.00603)	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)|STAD - Stomach adenocarcinoma(7;0.18)		CCGCCAGCACGTGATGTTGTCCCAG	0.527																																					p.59_60del	Pancreas(154;1876 1931 2329 17914 20079)												.	VIPR2-91	0			c.175_179del						.																																			SO:0001589	frameshift_variant	7434	exon3			CAGCACGTGATGT	CA449700, X95097	CCDS5950.1	7q36.3	2012-08-10			ENSG00000106018	ENSG00000106018		"""GPCR / Class B : VIP and PACAP (ADCYAP1) receptors"""	12695	protein-coding gene	gene with protein product	"""VIP and PACAP receptor 2"""	601970				7811244	Standard	NM_003382		Approved	VPAC2, VPAC2R	uc003woh.3	P41587	OTTHUMG00000151446	ENST00000262178.2:c.175_179delATCAC	7.37:g.158902583_158902587delGTGAT	ENSP00000262178:p.Ile59fs	Somatic	139	0		WXS	Illumina HiSeq	Phase_I	111	7	NM_003382	0	0	0	0	0	Q13053|Q15870|Q53Y09|Q6ZN22|Q9UCW0	Frame_Shift_Del	DEL	ENST00000262178.2	37	CCDS5950.1																																																																																			.		0.527	VIPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322675.1	NM_003382	
OR1N2	138882	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	125316283	125316283	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr9:125316283delC	ENST00000373688.2	+	1	893	c.835delC	c.(835-837)cctfs	p.P280fs		NM_001004457.1	NP_001004457.1	Q8NGR9	OR1N2_HUMAN	olfactory receptor, family 1, subfamily N, member 2	280						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|large_intestine(6)|lung(10)|ovary(2)|skin(3)|stomach(3)	26						GTATTTACTTCCTCCATCAAC	0.463																																					p.P279fs		.											.	OR1N2-72	0			c.835delC						.						196.0	199.0	198.0					9																	125316283		2203	4300	6503	SO:0001589	frameshift_variant	138882	exon1			.		CCDS35123.1	9q33.2	2013-09-20			ENSG00000171501	ENSG00000171501		"""GPCR / Class A : Olfactory receptors"""	15111	protein-coding gene	gene with protein product							Standard	NM_001004457		Approved		uc011lyx.2	Q8NGR9	OTTHUMG00000020607	ENST00000373688.2:c.835delC	9.37:g.125316283delC	ENSP00000362792:p.Pro280fs	Somatic	115	0		WXS	Illumina HiSeq	Phase_I	140	21	NM_001004457	0	0	0	0	0	A3KFM2|B2RNY4|Q6IF17|Q96RA3	Frame_Shift_Del	DEL	ENST00000373688.2	37	CCDS35123.1																																																																																			.		0.463	OR1N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053937.2		
SLC31A1	1317	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	116018468	116018469	+	Frame_Shift_Ins	INS	-	-	C			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr9:116018468_116018469insC	ENST00000374212.4	+	2	192_193	c.40_41insC	c.(40-42)tccfs	p.S14fs	SLC31A1_ENST00000374210.6_Frame_Shift_Ins_p.S14fs|CDC26_ENST00000490408.1_Intron	NM_001859.3	NP_001850.1	O15431	COPT1_HUMAN	solute carrier family 31 (copper transporter), member 1	14					cellular copper ion homeostasis (GO:0006878)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	copper ion transmembrane transporter activity (GO:0005375)|copper uptake transmembrane transporter activity (GO:0015088)			breast(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)	7					Bortezomib(DB00188)|Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	CTATATGGACTCCAACAGTACC	0.436																																					p.S14fs	Ovarian(135;1049 1799 4519 17564 28677)	.											.	SLC31A1-90	0			c.40_41insC						.																																			SO:0001589	frameshift_variant	1317	exon2			.	U83460	CCDS6789.1	9q32	2013-07-17	2013-07-17		ENSG00000136868	ENSG00000136868		"""Solute carriers"""	11016	protein-coding gene	gene with protein product	copper transport 1 homolog (S. cerevisiae)	603085		COPT1		9207117	Standard	NM_001859		Approved	hCTR1, CTR1	uc004bgu.3	O15431	OTTHUMG00000020519	ENST00000374212.4:c.42dupC	9.37:g.116018470_116018470dupC	ENSP00000363329:p.Ser14fs	Somatic	134	0		WXS	Illumina HiSeq	Phase_I	118	18	NM_001859	0	0	0	0	0	A8K8Z6|Q53GR5|Q5T1M4	Frame_Shift_Ins	INS	ENST00000374212.4	37	CCDS6789.1																																																																																			.		0.436	SLC31A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053715.1	NM_001859	
FCAR	2204	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	55401195	55401196	+	Missense_Mutation	DNP	TG	TG	GT			TCGA-DW-7838-01A-11D-2136-08	TCGA-DW-7838-10A-01D-2136-08	TG	TG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c7897a3f-6f47-41e8-b9b6-29bceb9d3c54	a0033479-cc47-403c-a95a-2fca2634ddbf	g.chr19:55401195_55401196TG>GT	ENST00000355524.3	+	5	840_841	c.830_831TG>GT	c.(829-831)tTG>tGT	p.L277C	FCAR_ENST00000391725.3_Missense_Mutation_p.L255C|FCAR_ENST00000353758.4_Missense_Mutation_p.L168C|FCAR_ENST00000391726.3_Missense_Mutation_p.L169C|FCAR_ENST00000391724.3_Missense_Mutation_p.L243C|FCAR_ENST00000359272.4_Missense_Mutation_p.L265C|FCAR_ENST00000482092.2_3'UTR|CTB-61M7.2_ENST00000594721.1_lincRNA|FCAR_ENST00000391723.3_3'UTR|FCAR_ENST00000345937.4_Missense_Mutation_p.L181C	NM_002000.2	NP_001991.1	P24071	FCAR_HUMAN	Fc fragment of IgA, receptor for	277					immune response (GO:0006955)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(1)|skin(2)	24				GBM - Glioblastoma multiforme(193;0.0443)		CAGCCAGGATTGACCTTTGCAC	0.525																																					p.L277C		.											.	FCAR	0			c.G831T						.																																			SO:0001583	missense	2204	exon5			AGGATTGACCTTT	X54150	CCDS12907.1, CCDS12908.1, CCDS12909.1, CCDS12910.1, CCDS42622.1, CCDS42623.1, CCDS42624.1, CCDS42625.1, CCDS46180.1	19q13.42	2013-01-29			ENSG00000186431	ENSG00000186431		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3608	protein-coding gene	gene with protein product		147045				1577457	Standard	NM_133269		Approved	CD89	uc002qhr.1	P24071	OTTHUMG00000065936	Exception_encountered	19.37:g.55401195_55401196delinsGT	ENSP00000347714:p.Leu277Cys	Somatic	207.0	0.0		WXS	Illumina HiSeq	Phase_I	228.0	36.0		0	0	0	0	0	Q13603|Q13604|Q15727|Q15728|Q1AJL7|Q1AJL8|Q1AJL9|Q53X38|Q53X39|Q92587|Q92588|Q92590|Q92592|Q92593|Q9UEK0	Missense_Mutation	DNP	ENST00000355524.3	37	CCDS12907.1																																																																																			.		0.525	FCAR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000141243.1	NM_002000	
