#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
VPS13D	55187	bcgsc.ca	37	1	12304650	12304650	+	Silent	SNP	T	T	C			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr1:12304650T>C	ENST00000358136.3	+	5	553	c.423T>C	c.(421-423)gtT>gtC	p.V141V	VPS13D_ENST00000356315.4_Silent_p.V141V	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		CCTCCGTAGTTACAAGGATTG	0.413																																					p.V141V													.	VPS13D-95	0			c.T423C						.						143.0	133.0	137.0					1																	12304650		2203	4300	6503	SO:0001819	synonymous_variant	55187	exon5			CGTAGTTACAAGG	AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.423T>C	1.37:g.12304650T>C		Somatic	99	0		WXS	Illumina HiSeq	Phase_1	92	4	NM_015378	0	0	6	6	0		Silent	SNP	ENST00000358136.3	37	CCDS30588.1																																																																																			.		0.413	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036897.2	NM_015378	
INADL	10207	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	62550317	62550317	+	Silent	SNP	C	C	T			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr1:62550317C>T	ENST00000371158.2	+	33	4488	c.4374C>T	c.(4372-4374)ccC>ccT	p.P1458P	INADL_ENST00000545929.1_Silent_p.P131P|INADL_ENST00000543708.1_Silent_p.P242P|INADL_ENST00000316485.6_Silent_p.P1458P	NM_176877.2	NP_795352	Q8NI35	INADL_HUMAN	InaD-like (Drosophila)	1458	PDZ 8. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|intracellular signal transduction (GO:0035556)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)		p.P1458P(1)		breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(8)|liver(1)|lung(51)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)	103						AAGACACACCCTTGGTAAGTT	0.448																																					p.P1458P		.											.	INADL-94	1	Substitution - coding silent(1)	lung(1)	c.C4374T						.						88.0	89.0	89.0					1																	62550317		2203	4300	6503	SO:0001819	synonymous_variant	10207	exon33			CACACCCTTGGTA	AB044807	CCDS617.2	1p31	2008-02-05			ENSG00000132849	ENSG00000132849			28881	protein-coding gene	gene with protein product		603199				9280290, 11374908	Standard	NM_176877		Approved	Cipp, PATJ	uc001dab.3	Q8NI35	OTTHUMG00000008560	ENST00000371158.2:c.4374C>T	1.37:g.62550317C>T		Somatic	120	1		WXS	Illumina HiSeq	Phase_I	109	31	NM_176877	0	0	0	0	0	O15249|O43742|O60833|Q5VUA5|Q5VUA6|Q5VUA7|Q5VUA8|Q5VUA9|Q5VUB0|Q8WU78|Q9H3N9	Silent	SNP	ENST00000371158.2	37	CCDS617.2																																																																																			.		0.448	INADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023639.2	NM_170605	
LY9	4063	broad.mit.edu	37	1	160783509	160783509	+	Missense_Mutation	SNP	G	G	A	rs568376272		TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr1:160783509G>A	ENST00000263285.6	+	3	568	c.538G>A	c.(538-540)Gtg>Atg	p.V180M	LY9_ENST00000471816.1_3'UTR|LY9_ENST00000368037.5_Missense_Mutation_p.V180M|LY9_ENST00000368041.2_Missense_Mutation_p.V140M|LY9_ENST00000341032.4_Missense_Mutation_p.V180M|LY9_ENST00000392203.4_Missense_Mutation_p.V180M|LY9_ENST00000368040.1_5'UTR			Q9HBG7	LY9_HUMAN	lymphocyte antigen 9	180	Ig-like C2-type 1.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			AATGTGCTCCGTGAAGGGGGC	0.537													G|||	1	0.000199681	0.0	0.0014	5008	,	,		20846	0.0		0.0	False		,,,				2504	0.0				p.V180M													.	LY9-91	0			c.G538A						.						113.0	109.0	111.0					1																	160783509		2203	4300	6503	SO:0001583	missense	4063	exon3			TGCTCCGTGAAGG	L42621	CCDS30916.1, CCDS30917.1, CCDS65695.1, CCDS65696.1	1q23.3	2013-01-11			ENSG00000122224	ENSG00000122224		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6730	protein-coding gene	gene with protein product		600684				8537117, 7797269	Standard	NM_001261457		Approved	CD229, mLY9, SLAMF3, hly9	uc001fwu.4	Q9HBG7	OTTHUMG00000024007	ENST00000263285.6:c.538G>A	1.37:g.160783509G>A	ENSP00000263285:p.Val180Met	Somatic	135	0		WXS	Illumina HiSeq	Phase_I	131	5	NM_001261457	0	0	0	0	0	A8K7N3|Q14775|Q5VYI3|Q6P2J4|Q9H4N5|Q9NQ24	Missense_Mutation	SNP	ENST00000263285.6	37	CCDS30916.1	.	.	.	.	.	.	.	.	.	.	G	13.30	2.195454	0.38806	.	.	ENSG00000122224	ENST00000368041;ENST00000341032;ENST00000263285;ENST00000542780;ENST00000392203;ENST00000368037;ENST00000368036	T;T	0.03951	3.75;3.75	4.12	0.914	0.19360	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.153604	0.42964	N	0.000624	T	0.03390	0.0098	M	0.70275	2.135	0.22050	N	0.999398	D;D;D;D;D;D	0.59357	0.981;0.981;0.96;0.962;0.967;0.985	P;P;B;P;B;P	0.48795	0.509;0.509;0.235;0.516;0.328;0.59	T	0.30650	-0.9971	10	0.56958	D	0.05	-4.7988	6.5251	0.22297	0.3552:0.0:0.6447:0.0	.	180;140;140;180;180;180	B4E0J5;Q5VYH7;Q5VYH9;E7EME5;Q9HBG7-2;Q9HBG7	.;.;.;.;.;LY9_HUMAN	M	180;180;180;180;140;140;82	ENSP00000342921:V180M;ENSP00000263285:V180M	ENSP00000263285:V180M	V	+	1	0	LY9	159050133	0.001000	0.12720	0.004000	0.12327	0.008000	0.06430	-0.026000	0.12392	0.069000	0.16605	0.557000	0.71058	GTG	.		0.537	LY9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060457.3	NM_002348	
LRRC52	440699	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	165514059	165514059	+	Missense_Mutation	SNP	C	C	G			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr1:165514059C>G	ENST00000294818.1	+	1	816	c.526C>G	c.(526-528)Ctg>Gtg	p.L176V	RP11-280O1.2_ENST00000416424.1_RNA|RP11-280O1.2_ENST00000438275.1_RNA|RP11-280O1.2_ENST00000421273.1_RNA	NM_001005214.3	NP_001005214.2	Q8N7C0	LRC52_HUMAN	leucine rich repeat containing 52	176					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)	18	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)					CCTCACTACTCTGGAGACCCT	0.512																																					p.L176V		.											.	LRRC52-91	0			c.C526G						.						148.0	152.0	151.0					1																	165514059		2203	4300	6503	SO:0001583	missense	440699	exon1			ACTACTCTGGAGA	AK098677	CCDS30930.1	1q23.3	2008-02-05			ENSG00000162763	ENSG00000162763			32156	protein-coding gene	gene with protein product		615218					Standard	NM_001005214		Approved	FLJ25811	uc001gde.2	Q8N7C0	OTTHUMG00000034625	ENST00000294818.1:c.526C>G	1.37:g.165514059C>G	ENSP00000294818:p.Leu176Val	Somatic	200	0		WXS	Illumina HiSeq	Phase_I	188	52	NM_001005214	0	0	0	0	0	A2RUN7|Q5T9K5	Missense_Mutation	SNP	ENST00000294818.1	37	CCDS30930.1	.	.	.	.	.	.	.	.	.	.	C	12.19	1.863665	0.32884	.	.	ENSG00000162763	ENST00000294818	T	0.06449	3.3	5.39	5.39	0.77823	.	0.089285	0.53938	D	0.000042	T	0.17195	0.0413	M	0.74881	2.28	0.34422	D	0.697524	D	0.65815	0.995	D	0.67231	0.95	T	0.00436	-1.1740	9	0.72032	D	0.01	.	16.6547	0.85225	0.0:1.0:0.0:0.0	.	176	Q8N7C0	LRC52_HUMAN	V	176	ENSP00000294818:L176V	ENSP00000294818:L176V	L	+	1	2	LRRC52	163780683	1.000000	0.71417	0.049000	0.19019	0.023000	0.10783	5.468000	0.66743	2.517000	0.84864	0.563000	0.77884	CTG	.		0.512	LRRC52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083793.1	NM_001005214	
DIEXF	27042	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	210015618	210015618	+	Missense_Mutation	SNP	G	G	A			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr1:210015618G>A	ENST00000491415.2	+	9	1551	c.1494G>A	c.(1492-1494)atG>atA	p.M498I		NM_014388.6	NP_055203.4	Q68CQ4	DIEXF_HUMAN	digestive organ expansion factor homolog (zebrafish)	498					multicellular organismal development (GO:0007275)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(15)|large_intestine(7)|lung(12)|ovary(1)|skin(3)|stomach(1)|urinary_tract(2)	53						AGCATTTGATGAATCACATGA	0.418																																					p.M498I		.											.	DIEXF-91	0			c.G1494A						.						82.0	74.0	76.0					1																	210015618		2203	4300	6503	SO:0001583	missense	27042	exon9			TTTGATGAATCAC	BC022964	CCDS1493.1	1q32.2	2011-08-12	2011-02-16	2011-02-16	ENSG00000117597	ENSG00000117597			28440	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 107"""	C1orf107		16322560	Standard	NM_014388		Approved	MGC29875, DEF, UTP25	uc001hhr.2	Q68CQ4	OTTHUMG00000036654	ENST00000491415.2:c.1494G>A	1.37:g.210015618G>A	ENSP00000419005:p.Met498Ile	Somatic	60	0		WXS	Illumina HiSeq	Phase_I	67	17	NM_014388	0	0	0	0	0	O75992|Q4VY00|Q63HL9	Missense_Mutation	SNP	ENST00000491415.2	37	CCDS1493.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.076476	0.76415	.	.	ENSG00000117597	ENST00000491415	T	0.37411	1.2	6.17	6.17	0.99709	.	0.069797	0.85682	D	0.000000	T	0.36580	0.0972	L	0.45228	1.405	0.58432	D	0.999996	P	0.45044	0.849	B	0.39971	0.315	T	0.03315	-1.1049	10	0.35671	T	0.21	-37.8963	20.8794	0.99867	0.0:0.0:1.0:0.0	.	498	Q68CQ4	DIEXF_HUMAN	I	498	ENSP00000419005:M498I	ENSP00000419005:M498I	M	+	3	0	DIEXF	208082241	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.791000	0.85805	2.941000	0.99782	0.655000	0.94253	ATG	.		0.418	DIEXF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089127.2	NM_014388	
LARP4B	23185	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	858887	858887	+	Silent	SNP	A	A	G			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr10:858887A>G	ENST00000316157.3	-	17	2236	c.2196T>C	c.(2194-2196)acT>acC	p.T732T	LARP4B_ENST00000469487.1_5'Flank	NM_015155.1	NP_055970.1	Q92615	LAR4B_HUMAN	La ribonucleoprotein domain family, member 4B	732					positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(2)|skin(2)|urinary_tract(2)	38						ACTTGGGGGGAGTGCTCTGCT	0.662																																					p.T732T		.											.	LARP4B-92	0			c.T2196C						.						36.0	40.0	39.0					10																	858887		2202	4298	6500	SO:0001819	synonymous_variant	23185	exon18			GGGGGGAGTGCTC	D86971	CCDS31131.1	10p15.3	2011-08-24	2009-06-09	2009-06-09	ENSG00000107929	ENSG00000107929		"""La ribonucleoprotein domain containing"""	28987	protein-coding gene	gene with protein product			"""KIAA0217"", ""La ribonucleoprotein domain family, member 5"""	KIAA0217, LARP5		9039502, 20573744	Standard	NM_015155		Approved		uc031ptb.1	Q92615	OTTHUMG00000017534	ENST00000316157.3:c.2196T>C	10.37:g.858887A>G		Somatic	113	0		WXS	Illumina HiSeq	Phase_I	111	34	NM_015155	0	0	7	14	7	A7MD20|Q5T3R3|Q5T3R4|Q5T3R5|Q68CY4	Silent	SNP	ENST00000316157.3	37	CCDS31131.1	.	.	.	.	.	.	.	.	.	.	A	6.457	0.452392	0.12283	.	.	ENSG00000107929	ENST00000448368	.	.	.	6.07	-5.87	0.02297	.	.	.	.	.	T	0.39036	0.1063	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41270	-0.9518	4	.	.	.	-3.3912	3.9687	0.09443	0.1675:0.3281:0.3845:0.12	.	.	.	.	P	333	.	.	S	-	1	0	LARP4B	848887	0.998000	0.40836	0.905000	0.35620	0.944000	0.59088	0.260000	0.18424	-0.881000	0.03992	-1.236000	0.01555	TCC	.		0.662	LARP4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046395.2	NM_015155	
PITRM1	10531	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	3191832	3191832	+	Missense_Mutation	SNP	A	A	C			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr10:3191832A>C	ENST00000224949.4	-	16	1886	c.1852T>G	c.(1852-1854)Ttc>Gtc	p.F618V	PITRM1_ENST00000380989.2_Missense_Mutation_p.F618V|PITRM1-AS1_ENST00000598280.1_RNA|PITRM1_ENST00000464395.1_5'Flank|PITRM1_ENST00000380994.1_Missense_Mutation_p.F176V|PITRM1_ENST00000451104.2_Missense_Mutation_p.F586V|PITRM1-AS1_ENST00000601046.1_RNA			Q5JRX3	PREP_HUMAN	pitrilysin metallopeptidase 1	618					positive regulation of catalytic activity (GO:0043085)|proteolysis (GO:0006508)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	enzyme activator activity (GO:0008047)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|urinary_tract(3)	33						ACGCTGCAGAAGAGGGGCACA	0.517																																					p.F618V		.											.	PITRM1-91	0			c.T1852G						.						183.0	187.0	186.0					10																	3191832		2033	4194	6227	SO:0001583	missense	10531	exon16			TGCAGAAGAGGGG	AB029027	CCDS55699.1, CCDS55700.1, CCDS59208.1	10p15.2	2008-07-30	2005-08-17		ENSG00000107959	ENSG00000107959			17663	protein-coding gene	gene with protein product	"""PreP peptidasome"""		"""pitrilysin metalloproteinase 1"""			1036083, 10470851, 16849325	Standard	NM_014889		Approved	MP1, KIAA1104, hMP1, PreP	uc009xhv.2	Q5JRX3	OTTHUMG00000017557	ENST00000224949.4:c.1852T>G	10.37:g.3191832A>C	ENSP00000224949:p.Phe618Val	Somatic	338	0		WXS	Illumina HiSeq	Phase_I	280	78	NM_014889	0	0	47	85	38	B3KMJ6|B4E0J8|C9JSL2|E7ES23|O95204|Q2M2G6|Q4VBR1|Q5JRW7|Q7L5Z7|Q9BSI6|Q9BVJ5|Q9UPP8	Missense_Mutation	SNP	ENST00000224949.4	37	CCDS59208.1	.	.	.	.	.	.	.	.	.	.	a	22.4	4.280763	0.80692	.	.	ENSG00000107959	ENST00000224949;ENST00000380980;ENST00000380989;ENST00000380994;ENST00000451104	T;T;T;T	0.46063	0.88;0.88;0.88;0.88	5.41	4.28	0.50868	Peptidase M16C associated (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.000000	0.85682	D	0.000000	T	0.68559	0.3014	M	0.90309	3.105	0.58432	D	0.999998	D;D;D;D;D	0.89917	0.97;0.997;1.0;1.0;1.0	P;D;D;D;D	0.85130	0.824;0.994;0.997;0.997;0.997	T	0.73582	-0.3937	10	0.87932	D	0	.	11.2282	0.48897	0.9278:0.0:0.0722:0.0	.	611;586;618;618;611	E9PDX6;E7ES23;C9JSL2;Q5JRX3;B4DH07	.;.;.;PREP_HUMAN;.	V	618;611;618;176;586	ENSP00000224949:F618V;ENSP00000370377:F618V;ENSP00000370382:F176V;ENSP00000401201:F586V	ENSP00000224949:F618V	F	-	1	0	PITRM1	3181832	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	7.161000	0.77505	0.900000	0.36469	0.454000	0.30748	TTC	.		0.517	PITRM1-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000046469.2		
CSGALNACT2	55454	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	43651227	43651227	+	Silent	SNP	A	A	G			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr10:43651227A>G	ENST00000374466.3	+	2	965	c.630A>G	c.(628-630)aaA>aaG	p.K210K	CSGALNACT2_ENST00000374464.1_Silent_p.K210K	NM_018590.3	NP_061060.3	Q8N6G5	CGAT2_HUMAN	chondroitin sulfate N-acetylgalactosaminyltransferase 2	210					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050653)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|dermatan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050652)|glycosaminoglycan metabolic process (GO:0030203)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	acetylgalactosaminyltransferase activity (GO:0008376)|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047237)|metal ion binding (GO:0046872)			endometrium(12)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						TTGGAGAGAAACTGATATTTA	0.363																																					p.K210K		.											.	CSGALNACT2-69	0			c.A630G						.						44.0	46.0	46.0					10																	43651227		2203	4299	6502	SO:0001819	synonymous_variant	55454	exon2			AGAGAAACTGATA	AF116646	CCDS7201.1	10q11.21	2013-02-19			ENSG00000169826	ENSG00000169826		"""Beta 4-glycosyltransferases"""	24292	protein-coding gene	gene with protein product	"""chondroitin beta1,4 N-acetylgalactosaminyltransferase 2"""					12446672	Standard	NM_018590		Approved	GALNACT2, MGC40204, PRO0082, GALNACT-2	uc001jan.4	Q8N6G5	OTTHUMG00000018023	ENST00000374466.3:c.630A>G	10.37:g.43651227A>G		Somatic	85	0		WXS	Illumina HiSeq	Phase_I	71	17	NM_018590	0	0	6	8	2	B3KWL7|Q6MZJ5|Q6MZP6|Q8TCH4|Q9P1I6	Silent	SNP	ENST00000374466.3	37	CCDS7201.1																																																																																			.		0.363	CSGALNACT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047693.1	NM_018590	
POLR3A	11128	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	79741971	79741971	+	Missense_Mutation	SNP	C	C	G			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr10:79741971C>G	ENST00000372371.3	-	28	3837	c.3700G>C	c.(3700-3702)Gca>Cca	p.A1234P		NM_007055.3	NP_008986.2	O14802	RPC1_HUMAN	polymerase (RNA) III (DNA directed) polypeptide A, 155kDa	1234					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|ribonucleoside binding (GO:0032549)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	all_cancers(46;0.0356)|all_epithelial(25;0.00102)|Breast(12;0.00124)|Prostate(51;0.0095)		Epithelial(14;0.00161)|OV - Ovarian serous cystadenocarcinoma(4;0.00323)|all cancers(16;0.00646)			GCCATGACTGCCCGCAGGTTA	0.567																																					p.A1234P		.											.	POLR3A-90	0			c.G3700C						.						188.0	151.0	163.0					10																	79741971		2203	4300	6503	SO:0001583	missense	11128	exon28			TGACTGCCCGCAG	AF021351	CCDS7354.1	10q22-q23	2013-01-21			ENSG00000148606	ENSG00000148606		"""RNA polymerase subunits"""	30074	protein-coding gene	gene with protein product		614258				9331371, 12391170	Standard	NM_007055		Approved	RPC1, RPC155, hRPC155	uc001jzn.3	O14802	OTTHUMG00000018550	ENST00000372371.3:c.3700G>C	10.37:g.79741971C>G	ENSP00000361446:p.Ala1234Pro	Somatic	89	0		WXS	Illumina HiSeq	Phase_I	115	34	NM_007055	0	0	5	10	5	Q8IW34|Q8TCW5	Missense_Mutation	SNP	ENST00000372371.3	37	CCDS7354.1	.	.	.	.	.	.	.	.	.	.	C	16.69	3.192613	0.58017	.	.	ENSG00000148606	ENST00000539141;ENST00000372371;ENST00000540842	T	0.78126	-1.15	5.99	5.99	0.97316	RNA polymerase Rpb1, domain 5 (1);	0.051369	0.85682	D	0.000000	D	0.83718	0.5315	M	0.87097	2.86	0.58432	D	0.999998	P	0.35155	0.487	B	0.42112	0.376	T	0.83056	-0.0150	9	.	.	.	-11.4876	15.1985	0.73116	0.1408:0.8591:0.0:0.0	.	1234	O14802	RPC1_HUMAN	P	50;1234;1213	ENSP00000361446:A1234P	.	A	-	1	0	POLR3A	79411977	1.000000	0.71417	0.998000	0.56505	0.938000	0.57974	4.200000	0.58433	2.843000	0.97960	0.655000	0.94253	GCA	.		0.567	POLR3A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048923.1	NM_007055	
KIAA1598	57698	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	118689489	118689489	+	Missense_Mutation	SNP	C	C	T			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr10:118689489C>T	ENST00000355371.4	-	10	1380	c.883G>A	c.(883-885)Gaa>Aaa	p.E295K	KIAA1598_ENST00000260777.10_Missense_Mutation_p.E295K|KIAA1598_ENST00000497044.1_5'UTR|KIAA1598_ENST00000392903.2_Missense_Mutation_p.E295K|KIAA1598_ENST00000392901.4_Missense_Mutation_p.E235K	NM_001127211.2|NM_001258298.1|NM_001258299.1	NP_001120683.1|NP_001245227.1|NP_001245228.1	A0MZ66	SHOT1_HUMAN	KIAA1598	295					axon guidance (GO:0007411)|regulation of establishment of cell polarity (GO:2000114)|regulation of neuron migration (GO:2001222)	axonal growth cone (GO:0044295)				endometrium(1)|kidney(1)|large_intestine(5)|lung(3)	10				all cancers(201;0.00494)		GTTTCATTTTCTAGTTGCTCT	0.308																																					p.E295K		.											.	KIAA1598-90	0			c.G883A						.						163.0	152.0	155.0					10																	118689489		2201	4298	6499	SO:0001583	missense	57698	exon10			CATTTTCTAGTTG	BC022348	CCDS31293.1, CCDS44482.1, CCDS58097.1, CCDS73207.1, CCDS73208.1	10q26.12	2007-01-30			ENSG00000187164	ENSG00000187164			29319	protein-coding gene	gene with protein product		611171				10997877, 17030985	Standard	NM_001127211		Approved	shootin1, shootin-1	uc009xyw.4	A0MZ66	OTTHUMG00000019114	ENST00000355371.4:c.883G>A	10.37:g.118689489C>T	ENSP00000347532:p.Glu295Lys	Somatic	148	0		WXS	Illumina HiSeq	Phase_I	137	35	NM_001258299	0	0	11	11	0	A8MYU7|B3KRD3|B3KRH2|B3KTE0|B3KTJ7|B3KTJ8|B4E3U1|B7Z7Z9|Q68DG1|Q6PIM5|Q9HCH4|Q9NUV0	Missense_Mutation	SNP	ENST00000355371.4	37	CCDS44482.1	.	.	.	.	.	.	.	.	.	.	C	12.59	1.982973	0.34942	.	.	ENSG00000187164	ENST00000392903;ENST00000260777;ENST00000355371;ENST00000392901	T;T;T;T	0.75260	1.61;1.61;1.61;-0.92	5.35	4.45	0.53987	.	0.493073	0.23371	N	0.048907	T	0.65626	0.2709	L	0.52573	1.65	0.32981	D	0.52363	B;B;B	0.26845	0.069;0.008;0.161	B;B;B	0.24701	0.055;0.022;0.033	T	0.67643	-0.5618	10	0.23891	T	0.37	-14.1816	9.9478	0.41621	0.1475:0.6917:0.1608:0.0	.	295;295;265	A0MZ66;A0MZ66-2;A0MZ66-6	SHOT1_HUMAN;.;.	K	295;295;295;235	ENSP00000376636:E295K;ENSP00000260777:E295K;ENSP00000347532:E295K;ENSP00000376635:E235K	ENSP00000260777:E295K	E	-	1	0	KIAA1598	118679479	0.984000	0.35163	0.971000	0.41717	0.986000	0.74619	2.414000	0.44627	1.404000	0.46819	0.561000	0.74099	GAA	.		0.308	KIAA1598-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_018330	
KIAA1598	57698	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	118689491	118689491	+	Missense_Mutation	SNP	A	A	G			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr10:118689491A>G	ENST00000355371.4	-	10	1378	c.881T>C	c.(880-882)cTa>cCa	p.L294P	KIAA1598_ENST00000260777.10_Missense_Mutation_p.L294P|KIAA1598_ENST00000497044.1_5'UTR|KIAA1598_ENST00000392903.2_Missense_Mutation_p.L294P|KIAA1598_ENST00000392901.4_Missense_Mutation_p.L234P	NM_001127211.2|NM_001258298.1|NM_001258299.1	NP_001120683.1|NP_001245227.1|NP_001245228.1	A0MZ66	SHOT1_HUMAN	KIAA1598	294					axon guidance (GO:0007411)|regulation of establishment of cell polarity (GO:2000114)|regulation of neuron migration (GO:2001222)	axonal growth cone (GO:0044295)				endometrium(1)|kidney(1)|large_intestine(5)|lung(3)	10				all cancers(201;0.00494)		TTCATTTTCTAGTTGCTCTTC	0.303																																					p.L294P		.											.	KIAA1598-90	0			c.T881C						.						161.0	150.0	154.0					10																	118689491		2201	4298	6499	SO:0001583	missense	57698	exon10			TTTTCTAGTTGCT	BC022348	CCDS31293.1, CCDS44482.1, CCDS58097.1, CCDS73207.1, CCDS73208.1	10q26.12	2007-01-30			ENSG00000187164	ENSG00000187164			29319	protein-coding gene	gene with protein product		611171				10997877, 17030985	Standard	NM_001127211		Approved	shootin1, shootin-1	uc009xyw.4	A0MZ66	OTTHUMG00000019114	ENST00000355371.4:c.881T>C	10.37:g.118689491A>G	ENSP00000347532:p.Leu294Pro	Somatic	146	0		WXS	Illumina HiSeq	Phase_I	133	34	NM_001258299	0	0	10	10	0	A8MYU7|B3KRD3|B3KRH2|B3KTE0|B3KTJ7|B3KTJ8|B4E3U1|B7Z7Z9|Q68DG1|Q6PIM5|Q9HCH4|Q9NUV0	Missense_Mutation	SNP	ENST00000355371.4	37	CCDS44482.1	.	.	.	.	.	.	.	.	.	.	A	18.91	3.723729	0.68959	.	.	ENSG00000187164	ENST00000392903;ENST00000260777;ENST00000355371;ENST00000392901	T;T;T;T	0.24538	2.72;2.72;2.72;1.85	5.35	5.35	0.76521	.	0.239875	0.36268	N	0.002695	T	0.48978	0.1530	M	0.66939	2.045	0.80722	D	1	D;D;D	0.89917	0.999;0.997;1.0	D;D;D	0.87578	0.998;0.994;0.996	T	0.49273	-0.8957	10	0.59425	D	0.04	-9.5016	13.8675	0.63598	1.0:0.0:0.0:0.0	.	294;294;264	A0MZ66;A0MZ66-2;A0MZ66-6	SHOT1_HUMAN;.;.	P	294;294;294;234	ENSP00000376636:L294P;ENSP00000260777:L294P;ENSP00000347532:L294P;ENSP00000376635:L234P	ENSP00000260777:L294P	L	-	2	0	KIAA1598	118679481	0.999000	0.42202	0.840000	0.33206	0.981000	0.71138	5.819000	0.69243	2.163000	0.67991	0.459000	0.35465	CTA	.		0.303	KIAA1598-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_018330	
GLRX3	10539	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	131964822	131964822	+	Missense_Mutation	SNP	G	G	T			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr10:131964822G>T	ENST00000368644.1	+	5	552	c.530G>T	c.(529-531)aGc>aTc	p.S177I	GLRX3_ENST00000331244.5_Missense_Mutation_p.S177I	NM_001199868.1	NP_001186797.1	O76003	GLRX3_HUMAN	glutaredoxin 3	177	Glutaredoxin 1. {ECO:0000255|PROSITE- ProRule:PRU00686}.				cell redox homeostasis (GO:0045454)|negative regulation of cardiac muscle hypertrophy (GO:0010614)|regulation of the force of heart contraction (GO:0002026)	extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	electron carrier activity (GO:0009055)|iron-sulfur cluster binding (GO:0051536)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein disulfide oxidoreductase activity (GO:0015035)			endometrium(1)|large_intestine(5)|lung(7)	13		all_cancers(35;9.59e-07)|all_epithelial(44;1.48e-06)|Lung NSC(174;0.00566)|all_lung(145;0.00949)|Colorectal(57;0.142)|all_neural(114;0.16)|Breast(234;0.173)|Glioma(114;0.222)		OV - Ovarian serous cystadenocarcinoma(35;0.00218)		ATTCAGTTTAGCAGTTTTGAT	0.393																																					p.S177I		.											.	GLRX3-22	0			c.G530T						.						122.0	121.0	122.0					10																	131964822		2203	4300	6503	SO:0001583	missense	10539	exon5			AGTTTAGCAGTTT	AJ010841	CCDS7661.1	10q26	2009-05-29	2007-08-16	2007-08-16	ENSG00000108010	ENSG00000108010			15987	protein-coding gene	gene with protein product	"""glutaredoxin 4"""	612754	"""thioredoxin-like 2"""	TXNL2		10636891, 11124703	Standard	NM_006541		Approved	PICOT, bA500G10.4, GRX3, GLRX4, GRX4	uc001lkm.2	O76003	OTTHUMG00000019267	ENST00000368644.1:c.530G>T	10.37:g.131964822G>T	ENSP00000357633:p.Ser177Ile	Somatic	162	0		WXS	Illumina HiSeq	Phase_I	131	31	NM_006541	0	0	15	37	22	B3KMP7|B3KMQ5|D3DRG2|Q5JV01|Q96CE0|Q9P1B0|Q9P1B1	Missense_Mutation	SNP	ENST00000368644.1	37	CCDS7661.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.573832	0.86542	.	.	ENSG00000108010	ENST00000331244;ENST00000368644	T;T	0.29917	1.55;1.55	5.0	5.0	0.66597	Glutaredoxin (2);Thioredoxin-like fold (2);	0.000000	0.85682	D	0.000000	T	0.43523	0.1251	L	0.28649	0.875	0.80722	D	1	D	0.63046	0.992	D	0.70487	0.969	T	0.23440	-1.0188	10	0.35671	T	0.21	-14.9931	17.3131	0.87215	0.0:0.0:1.0:0.0	.	177	O76003	GLRX3_HUMAN	I	177	ENSP00000330836:S177I;ENSP00000357633:S177I	ENSP00000330836:S177I	S	+	2	0	GLRX3	131854812	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.365000	0.97139	2.323000	0.78572	0.655000	0.94253	AGC	.		0.393	GLRX3-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051021.1	NM_006541	
LRRC56	115399	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	552211	552211	+	Missense_Mutation	SNP	C	C	T			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr11:552211C>T	ENST00000270115.7	+	12	1660	c.1160C>T	c.(1159-1161)gCc>gTc	p.A387V		NM_198075.3	NP_932341.1	Q8IYG6	LRC56_HUMAN	leucine rich repeat containing 56	387										kidney(1)|lung(4)|skin(1)	6		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;7.63e-28)|Epithelial(43;7.29e-27)|OV - Ovarian serous cystadenocarcinoma(40;7.15e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGGCTCAGGGCCTGGAGGGAA	0.657																																					p.A387V		.											.	LRRC56-91	0			c.C1160T						.						41.0	44.0	43.0					11																	552211		2202	4300	6502	SO:0001583	missense	115399	exon12			TCAGGGCCTGGAG		CCDS7700.1	11p15.5	2005-10-18			ENSG00000161328	ENSG00000161328			25430	protein-coding gene	gene with protein product						12477932	Standard	NM_198075		Approved	FLJ00101, DKFZp761L1518	uc010qvz.2	Q8IYG6	OTTHUMG00000132003	ENST00000270115.7:c.1160C>T	11.37:g.552211C>T	ENSP00000270115:p.Ala387Val	Somatic	72	0		WXS	Illumina HiSeq	Phase_I	78	25	NM_198075	0	0	6	11	5	Q8N3Q4	Missense_Mutation	SNP	ENST00000270115.7	37	CCDS7700.1	.	.	.	.	.	.	.	.	.	.	C	17.56	3.420638	0.62622	.	.	ENSG00000161328	ENST00000270115	T	0.15952	2.38	4.38	4.38	0.52667	.	0.301734	0.24145	N	0.041134	T	0.14570	0.0352	L	0.27053	0.805	0.35067	D	0.762095	P	0.43287	0.802	B	0.42245	0.381	T	0.15549	-1.0433	10	0.59425	D	0.04	0.5026	12.6067	0.56527	0.0:1.0:0.0:0.0	.	387	Q8IYG6	LRC56_HUMAN	V	387	ENSP00000270115:A387V	ENSP00000270115:A387V	A	+	2	0	LRRC56	542211	0.208000	0.23494	0.120000	0.21714	0.036000	0.12997	2.410000	0.44592	2.441000	0.82636	0.561000	0.74099	GCC	.		0.657	LRRC56-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254969.1	NM_198075	
OR51A7	119687	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	4929158	4929158	+	Silent	SNP	C	C	T			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr11:4929158C>T	ENST00000359350.4	+	1	559	c.559C>T	c.(559-561)Ctg>Ttg	p.L187L	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001004749.1	NP_001004749.1	Q8NH64	O51A7_HUMAN	olfactory receptor, family 51, subfamily A, member 7	187						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(7)|lung(13)|ovary(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		TACCATGAAGCTGGCCTGCTC	0.398																																					p.L187L		.											.	OR51A7-70	0			c.C559T						.						199.0	164.0	176.0					11																	4929158		2201	4298	6499	SO:0001819	synonymous_variant	119687	exon1			ATGAAGCTGGCCT	AB065525	CCDS31364.1	11p15.4	2012-08-09			ENSG00000176895	ENSG00000176895		"""GPCR / Class A : Olfactory receptors"""	15188	protein-coding gene	gene with protein product							Standard	NM_001004749		Approved		uc010qyq.2	Q8NH64	OTTHUMG00000066502	ENST00000359350.4:c.559C>T	11.37:g.4929158C>T		Somatic	181	1		WXS	Illumina HiSeq	Phase_I	163	51	NM_001004749	0	0	0	0	0	Q6IFH8	Silent	SNP	ENST00000359350.4	37	CCDS31364.1																																																																																			.		0.398	OR51A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142175.1	NM_001004749	
DCHS1	8642	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	6640045	6640045	+	IGR	SNP	A	A	C			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr11:6640045A>C	ENST00000299441.3	-	0	10763				TPP1_ENST00000534644.1_Intron|TPP1_ENST00000528657.1_3'UTR|TPP1_ENST00000299427.6_Missense_Mutation_p.L64R|RP11-732A19.5_ENST00000526456.1_RNA|TPP1_ENST00000533371.1_5'UTR|RP11-732A19.9_ENST00000545572.1_RNA	NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1						branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGCCTGCACCAGCTCCGAGAG	0.622																																					p.L64R		.											.	TPP1-90	0			c.T191G						.						77.0	68.0	71.0					11																	6640045		2201	4296	6497	SO:0001628	intergenic_variant	1200	exon3			TGCACCAGCTCCG	AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398		11.37:g.6640045A>C		Somatic	112	0		WXS	Illumina HiSeq	Phase_I	88	24	NM_000391	0	0	91	150	59	O15098	Missense_Mutation	SNP	ENST00000299441.3	37	CCDS7771.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.196515	0.79015	.	.	ENSG00000166340	ENST00000299427;ENST00000453338;ENST00000436873	T;T	0.70516	-0.49;-0.49	5.64	4.45	0.53987	Proteinase inhibitor, propeptide (1);Peptidase S53, propeptide (2);	0.231767	0.37530	N	0.002054	T	0.72407	0.3456	L	0.48260	1.515	0.80722	D	1	D;D	0.61697	0.99;0.972	P;P	0.59288	0.855;0.639	T	0.68633	-0.5357	10	0.25751	T	0.34	-18.2713	9.3741	0.38272	0.8409:0.0:0.0:0.1591	.	64;64	B4DEQ3;O14773	.;TPP1_HUMAN	R	64	ENSP00000299427:L64R;ENSP00000398136:L64R	ENSP00000299427:L64R	L	-	2	0	TPP1	6596621	1.000000	0.71417	0.996000	0.52242	0.992000	0.81027	3.517000	0.53443	2.146000	0.66826	0.379000	0.24179	CTG	.		0.622	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1	NM_003737	
F2	2147	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	46740795	46740795	+	Missense_Mutation	SNP	G	G	A			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr11:46740795G>A	ENST00000311907.5	+	1	66	c.10G>A	c.(10-12)Gtc>Atc	p.V4I	F2_ENST00000530231.1_Missense_Mutation_p.V4I	NM_000506.3	NP_000497.1	P00734	THRB_HUMAN	coagulation factor II (thrombin)	4					acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell surface receptor signaling pathway (GO:0007166)|cellular protein metabolic process (GO:0044267)|cytosolic calcium ion homeostasis (GO:0051480)|fibrinolysis (GO:0042730)|leukocyte migration (GO:0050900)|multicellular organismal development (GO:0007275)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of platelet activation (GO:0010544)|negative regulation of proteolysis (GO:0045861)|peptidyl-glutamic acid carboxylation (GO:0017187)|platelet activation (GO:0030168)|positive regulation of blood coagulation (GO:0030194)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C-activating G-protein coupled receptor signaling pathway (GO:1900738)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|regulation of blood coagulation (GO:0030193)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|receptor binding (GO:0005102)|serine-type endopeptidase activity (GO:0004252)|thrombospondin receptor activity (GO:0070053)			endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	27		all_lung(304;0.000414)|Lung NSC(402;0.0011)		BRCA - Breast invasive adenocarcinoma(625;0.146)	Antihemophilic Factor(DB00025)|Argatroban(DB00278)|ART-123(DB05777)|Bivalirudin(DB00006)|Coagulation Factor IX(DB00100)|Dabigatran etexilate(DB06695)|Drotrecogin alfa(DB00055)|Lepirudin(DB00001)|Menadione(DB00170)|Proflavine(DB01123)|Suramin(DB04786)|Ximelagatran(DB04898)	TATGGCGCACGTCCGAGGCTT	0.577																																					p.V4I	Esophageal Squamous(147;1147 1808 2148 38609 51144)	.											.	F2-93	0			c.G10A						.						47.0	40.0	42.0					11																	46740795		2201	4299	6500	SO:0001583	missense	2147	exon1			GCGCACGTCCGAG	M33031	CCDS31476.1	11p11.2	2013-02-28			ENSG00000180210	ENSG00000180210	3.4.21.5	"""Endogenous ligands"""	3535	protein-coding gene	gene with protein product	"""prepro-coagulation factor II"""	176930					Standard	NM_000506		Approved		uc001ndf.4	P00734	OTTHUMG00000150344	ENST00000311907.5:c.10G>A	11.37:g.46740795G>A	ENSP00000308541:p.Val4Ile	Somatic	50	0		WXS	Illumina HiSeq	Phase_I	45	14	NM_000506	0	0	0	0	0	B2R7F7|B4E1A7|Q4QZ40|Q53H04|Q53H06|Q69EZ7|Q7Z7P3|Q9UCA1	Missense_Mutation	SNP	ENST00000311907.5	37	CCDS31476.1	.	.	.	.	.	.	.	.	.	.	G	4.679	0.126175	0.08931	.	.	ENSG00000180210	ENST00000311907;ENST00000530231	D;D	0.91295	-2.61;-2.82	5.76	1.65	0.23941	.	1.055420	0.07341	N	0.880761	D	0.84293	0.5440	L	0.34521	1.04	0.09310	N	1	B	0.14438	0.01	B	0.06405	0.002	T	0.71258	-0.4646	10	0.87932	D	0	.	4.8209	0.13390	0.3861:0.1476:0.4664:0.0	.	4	P00734	THRB_HUMAN	I	4	ENSP00000308541:V4I;ENSP00000433907:V4I	ENSP00000308541:V4I	V	+	1	0	F2	46697371	0.575000	0.26692	0.994000	0.49952	0.981000	0.71138	0.307000	0.19296	0.047000	0.15862	-0.140000	0.14226	GTC	.		0.577	F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317706.1		
LRFN4	78999	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	66627368	66627368	+	Nonsense_Mutation	SNP	T	T	A			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr11:66627368T>A	ENST00000309602.4	+	2	1853	c.1610T>A	c.(1609-1611)tTg>tAg	p.L537*	PC_ENST00000393958.2_Intron|LRFN4_ENST00000393952.3_Intron|PC_ENST00000393955.2_Intron|PC_ENST00000393960.1_Intron	NM_024036.4	NP_076941.2	Q6PJG9	LRFN4_HUMAN	leucine rich repeat and fibronectin type III domain containing 4	537						integral component of membrane (GO:0016021)				breast(1)|lung(1)|prostate(1)	3						ACTGTGGCCTTGCTGGTTCGG	0.711																																					p.L537X		.											.	LRFN4-90	0			c.T1610A						.						34.0	28.0	30.0					11																	66627368		2188	4284	6472	SO:0001587	stop_gained	78999	exon2			TGGCCTTGCTGGT	BC007718	CCDS8153.1	11q13.1	2013-02-11				ENSG00000173621		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	28456	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 6"""	612810				16495444, 16828986	Standard	NM_024036		Approved	MGC3103, SALM3., FIGLER6	uc001ojr.3	Q6PJG9		ENST00000309602.4:c.1610T>A	11.37:g.66627368T>A	ENSP00000312535:p.Leu537*	Somatic	32	0		WXS	Illumina HiSeq	Phase_I	31	13	NM_024036	0	0	1	1	0	Q4VBZ3|Q59GV4|Q8N644|Q9BWJ0	Nonsense_Mutation	SNP	ENST00000309602.4	37	CCDS8153.1	.	.	.	.	.	.	.	.	.	.	T	39	7.854370	0.98525	.	.	ENSG00000173621	ENST00000309602	.	.	.	4.79	4.79	0.61399	.	0.484734	0.15470	N	0.260642	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.2823	0.54771	0.0:0.0:0.0:1.0	.	.	.	.	X	537	.	ENSP00000312535:L537X	L	+	2	0	LRFN4	66383944	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.178000	0.58284	1.799000	0.52666	0.379000	0.24179	TTG	.		0.711	LRFN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393127.1	NM_024036	
PCF11	51585	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	82877690	82877690	+	Missense_Mutation	SNP	A	A	T			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr11:82877690A>T	ENST00000298281.4	+	5	2203	c.1751A>T	c.(1750-1752)aAt>aTt	p.N584I		NM_015885.3	NP_056969.2	O94913	PCF11_HUMAN	PCF11 cleavage and polyadenylation factor subunit	584					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)				cervix(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(22)|ovary(1)|urinary_tract(1)	33						CCAAAGGAGAATGTAGAAAAC	0.393																																					p.N584I		.											.	PCF11-23	0			c.A1751T						.						66.0	66.0	66.0					11																	82877690		1824	4044	5868	SO:0001583	missense	51585	exon5			AGGAGAATGTAGA	AB020631	CCDS44689.1	11q13	2013-07-02	2013-07-02		ENSG00000165494	ENSG00000165494			30097	protein-coding gene	gene with protein product		608876	"""PCF11, cleavage and polyadenylation factor II subunit, homolog (S. cerevisiae)"", ""PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)"""			11060040	Standard	NM_015885		Approved	KIAA0824	uc001ozx.4	O94913	OTTHUMG00000167031	ENST00000298281.4:c.1751A>T	11.37:g.82877690A>T	ENSP00000298281:p.Asn584Ile	Somatic	81	0		WXS	Illumina HiSeq	Phase_I	83	14	NM_015885	0	0	9	10	1	A6H8W7|O43671|Q6P0X8	Missense_Mutation	SNP	ENST00000298281.4	37	CCDS44689.1	.	.	.	.	.	.	.	.	.	.	A	16.07	3.019444	0.54576	.	.	ENSG00000165494	ENST00000298281;ENST00000530660;ENST00000530304	T;T;T	0.53206	1.58;0.64;0.63	6.07	6.07	0.98685	.	0.000000	0.64402	D	0.000005	T	0.54775	0.1879	L	0.29908	0.895	0.33890	D	0.637211	D;P	0.71674	0.998;0.915	P;B	0.61940	0.896;0.294	T	0.62798	-0.6778	9	.	.	.	.	16.6406	0.85098	1.0:0.0:0.0:0.0	.	584;584	E9PQ01;O94913	.;PCF11_HUMAN	I	584	ENSP00000298281:N584I;ENSP00000434540:N584I;ENSP00000431567:N584I	.	N	+	2	0	PCF11	82555338	1.000000	0.71417	0.991000	0.47740	0.967000	0.64934	3.827000	0.55745	2.326000	0.78906	0.533000	0.62120	AAT	.		0.393	PCF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392548.2	NM_015885	
PCF11	51585	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	82878314	82878314	+	Missense_Mutation	SNP	G	G	C			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr11:82878314G>C	ENST00000298281.4	+	6	2417	c.1965G>C	c.(1963-1965)gaG>gaC	p.E655D		NM_015885.3	NP_056969.2	O94913	PCF11_HUMAN	PCF11 cleavage and polyadenylation factor subunit	655					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)				cervix(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(22)|ovary(1)|urinary_tract(1)	33						TTCCTAAAGAGTTAACTCTTG	0.368																																					p.E655D		.											.	PCF11-23	0			c.G1965C						.						62.0	61.0	61.0					11																	82878314		1875	4100	5975	SO:0001583	missense	51585	exon6			TAAAGAGTTAACT	AB020631	CCDS44689.1	11q13	2013-07-02	2013-07-02		ENSG00000165494	ENSG00000165494			30097	protein-coding gene	gene with protein product		608876	"""PCF11, cleavage and polyadenylation factor II subunit, homolog (S. cerevisiae)"", ""PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)"""			11060040	Standard	NM_015885		Approved	KIAA0824	uc001ozx.4	O94913	OTTHUMG00000167031	ENST00000298281.4:c.1965G>C	11.37:g.82878314G>C	ENSP00000298281:p.Glu655Asp	Somatic	88	0		WXS	Illumina HiSeq	Phase_I	80	20	NM_015885	0	0	3	3	0	A6H8W7|O43671|Q6P0X8	Missense_Mutation	SNP	ENST00000298281.4	37	CCDS44689.1	.	.	.	.	.	.	.	.	.	.	G	16.59	3.165064	0.57476	.	.	ENSG00000165494	ENST00000298281;ENST00000530660;ENST00000530304	T;T;T	0.48836	1.78;0.82;0.8	5.98	1.48	0.22813	.	0.000000	0.64402	D	0.000015	T	0.42381	0.1200	L	0.29908	0.895	0.26221	N	0.979152	D;D	0.67145	0.996;0.985	P;P	0.54499	0.754;0.541	T	0.25398	-1.0133	9	.	.	.	.	8.1397	0.31076	0.5069:0.0:0.4931:0.0	.	655;655	E9PQ01;O94913	.;PCF11_HUMAN	D	655	ENSP00000298281:E655D;ENSP00000434540:E655D;ENSP00000431567:E655D	.	E	+	3	2	PCF11	82555962	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.998000	0.29744	0.412000	0.25729	0.591000	0.81541	GAG	.		0.368	PCF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392548.2	NM_015885	
TRIM49	57093	hgsc.bcm.edu	37	11	89537575	89537575	+	Nonsense_Mutation	SNP	G	G	C			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr11:89537575G>C	ENST00000329758.1	-	3	391	c.63C>G	c.(61-63)taC>taG	p.Y21*	TRIM49_ENST00000532501.2_Nonsense_Mutation_p.Y21*	NM_020358.2	NP_065091.1	P0CI25	TRI49_HUMAN	tripartite motif containing 49	21						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(14)|prostate(1)|skin(2)|stomach(1)	27		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				GGTCTATGAAGTAGTTCATGC	0.473																																					p.Y21X		.											.	TRIM49-84	0			c.C63G						.						21.0	21.0	21.0					11																	89537575		2185	4268	6453	SO:0001587	stop_gained	57093	exon3			TATGAAGTAGTTC	AB037682	CCDS8287.1	11p11.12-q12	2012-05-21	2011-01-25	2004-11-17	ENSG00000168930	ENSG00000168930		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	13431	protein-coding gene	gene with protein product		606124	"""ring finger protein 18"", ""tripartite motif-containing 49"""	RNF18		11018261	Standard	NM_020358		Approved	TRIM49A	uc001pdb.3	P0CI25		ENST00000329758.1:c.63C>G	11.37:g.89537575G>C	ENSP00000327604:p.Tyr21*	Somatic	117	0		WXS	Illumina HiSeq	Phase_I	111	28	NM_020358	0	0	0	0	0	A0AVR7|A0AVR9|Q6DJV1|Q9NS80	Nonsense_Mutation	SNP	ENST00000329758.1	37	CCDS8287.1	.	.	.	.	.	.	.	.	.	.	G	11.69	1.713868	0.30413	.	.	ENSG00000168930	ENST00000329758;ENST00000532501	.	.	.	0.821	-0.817	0.10836	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	2.9772	0.05941	0.6362:0.0:0.3638:0.0	.	.	.	.	X	21	.	.	Y	-	3	2	TRIM49	89177223	0.000000	0.05858	0.011000	0.14972	0.050000	0.14768	-0.246000	0.08878	-0.218000	0.10018	0.194000	0.17425	TAC	.		0.473	TRIM49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395435.1	NM_020358	
RPUSD4	84881	broad.mit.edu	37	11	126079570	126079570	+	Missense_Mutation	SNP	C	C	T			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr11:126079570C>T	ENST00000298317.4	-	3	456	c.403G>A	c.(403-405)Gca>Aca	p.A135T	RP11-50B3.4_ENST00000532866.1_RNA|FAM118B_ENST00000360194.4_5'Flank|RPUSD4_ENST00000533628.1_Missense_Mutation_p.A135T|RPUSD4_ENST00000534393.1_5'UTR|FAM118B_ENST00000529731.1_5'Flank|FAM118B_ENST00000533050.1_5'Flank	NM_032795.2	NP_116184.2	Q96CM3	RUSD4_HUMAN	RNA pseudouridylate synthase domain containing 4	135					pseudouridine synthesis (GO:0001522)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(8)|skin(1)	17	all_hematologic(175;0.145)	Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0919)|all_lung(97;0.0994)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0761)		AGCATCTTTGCCAGGATAGGT	0.532																																					p.A135T													.	RPUSD4-153	0			c.G403A						.						212.0	196.0	202.0					11																	126079570		2201	4299	6500	SO:0001583	missense	84881	exon3			TCTTTGCCAGGAT	BC014131	CCDS8469.1, CCDS53721.1	11q24.2	2013-02-11			ENSG00000165526	ENSG00000165526		"""RNA pseudouridylate synthase domain containing"""	25898	protein-coding gene	gene with protein product							Standard	NM_032795		Approved	FLJ14494	uc001qde.3	Q96CM3	OTTHUMG00000165815	ENST00000298317.4:c.403G>A	11.37:g.126079570C>T	ENSP00000298317:p.Ala135Thr	Somatic	279	1		WXS	Illumina HiSeq	Phase_I	285	6	NM_001144827	0	0	16	16	0	E9PML2|Q96K56	Missense_Mutation	SNP	ENST00000298317.4	37	CCDS8469.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.656196	0.88056	.	.	ENSG00000165526	ENST00000298317;ENST00000533628;ENST00000532674	T;T;T	0.21543	2.0;2.0;2.0	5.33	5.33	0.75918	Pseudouridine synthase, RsuA and RluB/C/D/E/F (1);Pseudouridine synthase, catalytic domain (1);	0.054402	0.64402	D	0.000001	T	0.36880	0.0983	L	0.53561	1.675	0.45172	D	0.998189	P;P	0.47191	0.872;0.891	P;P	0.57720	0.688;0.826	T	0.02471	-1.1154	10	0.15066	T	0.55	-6.8966	18.0365	0.89305	0.0:1.0:0.0:0.0	.	135;135	E9PML2;Q96CM3	.;RUSD4_HUMAN	T	135	ENSP00000298317:A135T;ENSP00000433065:A135T;ENSP00000433709:A135T	ENSP00000298317:A135T	A	-	1	0	RPUSD4	125584780	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.771000	0.55318	2.495000	0.84180	0.655000	0.94253	GCA	.		0.532	RPUSD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386336.1	NM_032795	
SLC6A13	6540	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	346349	346349	+	Missense_Mutation	SNP	C	C	G			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr12:346349C>G	ENST00000343164.4	-	6	723	c.671G>C	c.(670-672)tGg>tCg	p.W224S	SLC6A13_ENST00000445055.2_Missense_Mutation_p.W132S	NM_016615.4	NP_057699.2	Q9NSD5	S6A13_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 13	224					neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(11)|prostate(1)|urinary_tract(1)	28	all_cancers(10;0.0416)|all_epithelial(11;0.0537)|all_lung(10;0.0989)|Lung NSC(10;0.139)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00153)|BRCA - Breast invasive adenocarcinoma(9;0.239)			CACCCCCTTCCAGATGCAGAA	0.632																																					p.W224S		.											.	SLC6A13-90	0			c.G671C						.						87.0	83.0	84.0					12																	346349		2203	4300	6503	SO:0001583	missense	6540	exon6			CCCTTCCAGATGC	U76343	CCDS8502.1, CCDS53729.1, CCDS58198.1	12p13.33	2013-07-19	2013-07-19		ENSG00000010379	ENSG00000010379		"""Solute carriers"""	11046	protein-coding gene	gene with protein product	"""GABA transporter 2"""	615097	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 13"""				Standard	NM_001243392		Approved	GAT2	uc001qic.2	Q9NSD5	OTTHUMG00000168053	ENST00000343164.4:c.671G>C	12.37:g.346349C>G	ENSP00000339260:p.Trp224Ser	Somatic	190	0		WXS	Illumina HiSeq	Phase_I	123	30	NM_016615	0	0	21	37	16	B4DJL1|Q8TCC2|Q8WW56	Missense_Mutation	SNP	ENST00000343164.4	37	CCDS8502.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.782040	0.90282	.	.	ENSG00000010379	ENST00000445055;ENST00000313154;ENST00000343164;ENST00000546319	T;T;T	0.74842	-0.88;-0.88;-0.88	5.5	5.5	0.81552	.	0.054680	0.85682	D	0.000000	D	0.85013	0.5600	M	0.76170	2.325	0.80722	D	1	D;D;D	0.57257	0.979;0.971;0.971	P;P;P	0.59546	0.859;0.827;0.827	D	0.85988	0.1487	10	0.87932	D	0	.	19.6592	0.95857	0.0:1.0:0.0:0.0	.	132;203;224	B4DJL1;B4DJS3;Q9NSD5	.;.;S6A13_HUMAN	S	132;203;224;132	ENSP00000407104:W132S;ENSP00000339260:W224S;ENSP00000444606:W132S	ENSP00000318097:W203S	W	-	2	0	SLC6A13	216610	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.905000	0.69893	2.880000	0.98712	0.650000	0.86243	TGG	.		0.632	SLC6A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397801.1	NM_016615	
DCP1B	196513	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	2064679	2064679	+	Missense_Mutation	SNP	G	G	C			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr12:2064679G>C	ENST00000280665.6	-	6	649	c.570C>G	c.(568-570)atC>atG	p.I190M	DCP1B_ENST00000541700.1_Intron|DCP1B_ENST00000540622.1_Missense_Mutation_p.I64M|DCP1B_ENST00000397173.4_Missense_Mutation_p.I88M	NM_152640.3	NP_689853.3	Q8IZD4	DCP1B_HUMAN	decapping mRNA 1B	190					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(3)|lung(10)|skin(1)	24			OV - Ovarian serous cystadenocarcinoma(31;0.00193)			GATTGTCATAGATGGCAGAGG	0.413																																					p.I190M		.											.	DCP1B-91	0			c.C570G						.						239.0	227.0	231.0					12																	2064679		2203	4300	6503	SO:0001583	missense	196513	exon6			GTCATAGATGGCA	AY146652	CCDS31727.1	12p13.33	2013-05-02	2013-05-02		ENSG00000151065	ENSG00000151065			24451	protein-coding gene	gene with protein product		609843	"""DCP1 decapping enzyme homolog B (S. cerevisiae)"""			12417715, 15067023	Standard	NM_152640		Approved	FLJ31638	uc001qjx.1	Q8IZD4	OTTHUMG00000168113	ENST00000280665.6:c.570C>G	12.37:g.2064679G>C	ENSP00000280665:p.Ile190Met	Somatic	256	0		WXS	Illumina HiSeq	Phase_I	207	69	NM_152640	0	0	5	7	2	B4DRD1|Q86XH9|Q96BP8|Q96MZ8	Missense_Mutation	SNP	ENST00000280665.6	37	CCDS31727.1	.	.	.	.	.	.	.	.	.	.	G	18.95	3.732160	0.69189	.	.	ENSG00000151065	ENST00000280665;ENST00000397173;ENST00000540622	T;T;T	0.23950	2.1;2.1;1.88	5.73	4.84	0.62591	.	0.054750	0.64402	D	0.000001	T	0.49029	0.1533	M	0.67953	2.075	0.45791	D	0.998674	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.971	T	0.51849	-0.8653	10	0.72032	D	0.01	-25.192	13.8354	0.63406	0.0731:0.0:0.9269:0.0	.	88;190	B4DRD1;Q8IZD4	.;DCP1B_HUMAN	M	190;88;64	ENSP00000280665:I190M;ENSP00000380358:I88M;ENSP00000444374:I64M	ENSP00000280665:I190M	I	-	3	3	DCP1B	1934940	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	1.749000	0.38319	1.426000	0.47256	0.655000	0.94253	ATC	.		0.413	DCP1B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398244.1	NM_152640	
DDX47	51202	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	12980185	12980185	+	Missense_Mutation	SNP	A	A	C			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr12:12980185A>C	ENST00000358007.3	+	11	1134	c.1112A>C	c.(1111-1113)gAt>gCt	p.D371A	DDX47_ENST00000352940.4_Missense_Mutation_p.D322A	NM_016355.3	NP_057439.2	Q9H0S4	DDX47_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 47	371	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|rRNA processing (GO:0006364)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16		Prostate(47;0.0526)		BRCA - Breast invasive adenocarcinoma(232;0.0354)		CTCAGGTATGATGTGGAACTC	0.448																																					p.D371A		.											.	DDX47-226	0			c.A1112C						.						110.0	109.0	110.0					12																	12980185		2203	4300	6503	SO:0001583	missense	51202	exon11			GGTATGATGTGGA	AK127712	CCDS8655.1, CCDS8656.1	12p13.2	2010-07-06			ENSG00000213782	ENSG00000213782		"""DEAD-boxes"""	18682	protein-coding gene	gene with protein product		615428					Standard	NM_016355		Approved	DKFZp564O176, FLJ30012, HQ0256, RRP3	uc001rax.3	Q9H0S4	OTTHUMG00000168709	ENST00000358007.3:c.1112A>C	12.37:g.12980185A>C	ENSP00000350698:p.Asp371Ala	Somatic	133	0		WXS	Illumina HiSeq	Phase_I	126	42	NM_016355	0	0	0	0	0	B3KXP4|G5E955|Q96GM0|Q96NV8|Q9UI98	Missense_Mutation	SNP	ENST00000358007.3	37	CCDS8655.1	.	.	.	.	.	.	.	.	.	.	A	20.1	3.939470	0.73557	.	.	ENSG00000213782	ENST00000352940;ENST00000358007	T;T	0.52983	0.64;3.36	5.64	5.64	0.86602	Helicase, C-terminal (1);	0.050495	0.85682	D	0.000000	T	0.73560	0.3602	M	0.89287	3.02	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.74023	0.982;0.971	T	0.79650	-0.1715	10	0.87932	D	0	-16.8971	15.8578	0.78994	1.0:0.0:0.0:0.0	.	322;371	G5E955;Q9H0S4	.;DDX47_HUMAN	A	322;371	ENSP00000319578:D322A;ENSP00000350698:D371A	ENSP00000319578:D322A	D	+	2	0	DDX47	12871452	1.000000	0.71417	0.944000	0.38274	0.435000	0.31806	8.932000	0.92897	2.147000	0.66899	0.533000	0.62120	GAT	.		0.448	DDX47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400674.1	NM_016355	
ITPR2	3709	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	26810769	26810769	+	Missense_Mutation	SNP	A	A	T			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr12:26810769A>T	ENST00000381340.3	-	18	2479	c.2063T>A	c.(2062-2064)aTt>aAt	p.I688N		NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	688					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	TTCATCATCAATGTCATCTGA	0.423																																					p.I688N		.											.	ITPR2-542	0			c.T2063A						.						117.0	109.0	112.0					12																	26810769		1908	4126	6034	SO:0001583	missense	3709	exon18			TCATCAATGTCAT	D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.2063T>A	12.37:g.26810769A>T	ENSP00000370744:p.Ile688Asn	Somatic	119	0		WXS	Illumina HiSeq	Phase_I	108	33	NM_002223	0	0	0	0	0	O94773	Missense_Mutation	SNP	ENST00000381340.3	37	CCDS41764.1	.	.	.	.	.	.	.	.	.	.	A	8.672	0.902956	0.17760	.	.	ENSG00000123104	ENST00000381340	D	0.91894	-2.93	4.4	4.4	0.53042	.	0.556787	0.20935	N	0.083032	D	0.83815	0.5336	N	0.14661	0.345	0.80722	D	1	B	0.06786	0.001	B	0.10450	0.005	T	0.78633	-0.2128	10	0.23891	T	0.37	.	12.6771	0.56901	1.0:0.0:0.0:0.0	.	688	Q14571	ITPR2_HUMAN	N	688	ENSP00000370744:I688N	ENSP00000370744:I688N	I	-	2	0	ITPR2	26702036	0.839000	0.29477	0.973000	0.42090	0.226000	0.24999	3.396000	0.52565	1.983000	0.57843	0.533000	0.62120	ATT	.		0.423	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402732.1	NM_002223	
SLC2A13	114134	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	40265609	40265609	+	Missense_Mutation	SNP	T	T	C			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr12:40265609T>C	ENST00000280871.4	-	5	1239	c.1189A>G	c.(1189-1191)Agt>Ggt	p.S397G		NM_052885.3	NP_443117.3	Q96QE2	MYCT_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 13	397					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	29		Lung NSC(34;0.105)|all_lung(34;0.123)				CCTGCTAAACTACCAAAGGTA	0.378										HNSCC(50;0.14)																											p.S397G		.											.	SLC2A13-515	0			c.A1189G						.						55.0	54.0	54.0					12																	40265609		2203	4300	6503	SO:0001583	missense	114134	exon5			CTAAACTACCAAA	AJ315644	CCDS8736.2	12q12	2013-05-22			ENSG00000151229	ENSG00000151229		"""Solute carriers"""	15956	protein-coding gene	gene with protein product	"""H(+)-myo-inositol symporter"""	611036				11500374	Standard	NM_052885		Approved	HMIT	uc010skm.2	Q96QE2	OTTHUMG00000059743	ENST00000280871.4:c.1189A>G	12.37:g.40265609T>C	ENSP00000280871:p.Ser397Gly	Somatic	83	0		WXS	Illumina HiSeq	Phase_I	90	33	NM_052885	0	0	0	0	0	Q17S07	Missense_Mutation	SNP	ENST00000280871.4	37	CCDS8736.2	.	.	.	.	.	.	.	.	.	.	T	25.2	4.609414	0.87258	.	.	ENSG00000151229	ENST00000280871	T	0.58797	0.31	5.48	5.48	0.80851	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);Sugar transporter, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.59487	0.2197	N	0.19112	0.55	0.80722	D	1	D	0.65815	0.995	D	0.67382	0.951	T	0.54556	-0.8276	10	0.14252	T	0.57	-16.2802	15.8683	0.79084	0.0:0.0:0.0:1.0	.	397	Q96QE2	MYCT_HUMAN	G	397	ENSP00000280871:S397G	ENSP00000280871:S397G	S	-	1	0	SLC2A13	38551876	1.000000	0.71417	0.996000	0.52242	0.977000	0.68977	7.745000	0.85046	2.214000	0.71695	0.528000	0.53228	AGT	.		0.378	SLC2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132849.2		
CCNT1	904	broad.mit.edu	37	12	49088009	49088009	+	Missense_Mutation	SNP	G	G	A			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr12:49088009G>A	ENST00000261900.3	-	9	1210	c.988C>T	c.(988-990)Ccg>Tcg	p.P330S		NM_001240.3	NP_001231.2	O60563	CCNT1_HUMAN	cyclin T1	330					cell cycle (GO:0007049)|cell division (GO:0051301)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|positive transcription elongation factor complex b (GO:0008024)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|snRNA binding (GO:0017069)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(3)|skin(2)	27						CGCTTGCCCGGCAACATCTCC	0.488																																					p.P330S													.	CCNT1-418	0			c.C988T						.						123.0	111.0	115.0					12																	49088009		2203	4300	6503	SO:0001583	missense	904	exon9			TGCCCGGCAACAT	AF048730	CCDS8766.1, CCDS61109.1	12q13.11	2010-11-15			ENSG00000129315	ENSG00000129315			1599	protein-coding gene	gene with protein product		143055	"""human immunodeficiency virus type 1 (HIV-1) expression (elevated) 1"""	HIVE1		9491887, 9499409	Standard	NM_001240		Approved	CCNT, CYCT1	uc001rsd.4	O60563	OTTHUMG00000170393	ENST00000261900.3:c.988C>T	12.37:g.49088009G>A	ENSP00000261900:p.Pro330Ser	Somatic	104	0		WXS	Illumina HiSeq	Phase_I	113	4	NM_001240	0	0	11	11	0	A9XU13|E7EX76|O60581	Missense_Mutation	SNP	ENST00000261900.3	37	CCDS8766.1	.	.	.	.	.	.	.	.	.	.	G	0.006	-2.037628	0.00402	.	.	ENSG00000129315	ENST00000261900	T	0.40476	1.03	5.49	4.6	0.57074	.	0.466481	0.20096	N	0.099336	T	0.17195	0.0413	N	0.08118	0	0.19575	N	0.999967	B	0.02656	0.0	B	0.01281	0.0	T	0.31308	-0.9948	10	0.02654	T	1	-0.5634	6.0824	0.19948	0.166:0.1564:0.6776:0.0	.	330	O60563	CCNT1_HUMAN	S	330	ENSP00000261900:P330S	ENSP00000261900:P330S	P	-	1	0	CCNT1	47374276	0.206000	0.23470	0.888000	0.34837	0.341000	0.28922	2.581000	0.46077	1.327000	0.45338	0.491000	0.48974	CCG	.		0.488	CCNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408853.1	NM_001240	
MARS	4141	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	57891971	57891971	+	Missense_Mutation	SNP	A	A	C			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr12:57891971A>C	ENST00000262027.5	+	8	936	c.802A>C	c.(802-804)Atc>Ctc	p.I268L	MARS_ENST00000447721.2_3'UTR|MARS_ENST00000315473.5_Missense_Mutation_p.I34L	NM_004990.3	NP_004981.2	P56192	SYMC_HUMAN	methionyl-tRNA synthetase	268					gene expression (GO:0010467)|methionyl-tRNA aminoacylation (GO:0006431)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|methionine-tRNA ligase activity (GO:0004825)|tRNA binding (GO:0000049)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	33			GBM - Glioblastoma multiforme(3;4.27e-41)		L-Methionine(DB00134)	GAATGTGCTCATCACCAGTGC	0.537																																					p.I268L		.											.	MARS-654	0			c.A802C						.						182.0	131.0	148.0					12																	57891971		2203	4300	6503	SO:0001583	missense	4141	exon8			GTGCTCATCACCA	X94754	CCDS8942.1	12q13.3	2014-05-06	2007-02-26		ENSG00000166986	ENSG00000166986	6.1.1.10	"""Aminoacyl tRNA synthetases / Class I"""	6898	protein-coding gene	gene with protein product	"""methionine tRNA ligase 1, cytoplasmic"""	156560				10448063, 24482476	Standard	NM_004990		Approved	MetRS, SPG70	uc001sog.3	P56192	OTTHUMG00000169996	ENST00000262027.5:c.802A>C	12.37:g.57891971A>C	ENSP00000262027:p.Ile268Leu	Somatic	128	0		WXS	Illumina HiSeq	Phase_I	89	28	NM_004990	0	0	23	39	16	B3KVK7|Q14895|Q53H14|Q96A15|Q96BZ0|Q9NSE0	Missense_Mutation	SNP	ENST00000262027.5	37	CCDS8942.1	.	.	.	.	.	.	.	.	.	.	A	26.7	4.760542	0.89932	.	.	ENSG00000166986	ENST00000262027;ENST00000315473	T;T	0.54675	1.05;0.56	4.7	4.7	0.59300	Aminoacyl-tRNA synthetase, class I (M) (1);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.070998	0.64402	D	0.000014	T	0.69223	0.3087	M	0.85630	2.765	0.54753	D	0.999982	B;P;P	0.45902	0.338;0.606;0.868	B;P;P	0.55087	0.167;0.46;0.768	T	0.74760	-0.3556	10	0.72032	D	0.01	-16.6576	11.9918	0.53180	1.0:0.0:0.0:0.0	.	34;141;268	A6NC17;B4E0E9;P56192	.;.;SYMC_HUMAN	L	268;34	ENSP00000262027:I268L;ENSP00000314653:I34L	ENSP00000262027:I268L	I	+	1	0	MARS	56178238	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	3.315000	0.51951	1.884000	0.54569	0.459000	0.35465	ATC	.		0.537	MARS-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407014.1	NM_004990	
PEBP1	5037	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	118577332	118577332	+	Missense_Mutation	SNP	G	G	T			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr12:118577332G>T	ENST00000261313.2	+	3	674	c.322G>T	c.(322-324)Ggc>Tgc	p.G108C	PEBP1_ENST00000542939.1_3'UTR	NM_002567.2	NP_002558.1	P30086	PEBP1_HUMAN	phosphatidylethanolamine binding protein 1	108	Interaction with RAF1.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|phosphatidylethanolamine binding (GO:0008429)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|serine-type endopeptidase inhibitor activity (GO:0004867)			ovary(1)	1	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CGATTATGTGGGCTCGGGGCC	0.527																																					p.G108C	NSCLC(44;94 1357 12187 49467)	.											.	PEBP1-779	0			c.G322T						.						125.0	112.0	116.0					12																	118577332		2203	4300	6503	SO:0001583	missense	5037	exon3			TATGTGGGCTCGG	X85033	CCDS9187.1	12q24	2009-06-16	2006-02-16	2006-02-16	ENSG00000089220	ENSG00000089220			8630	protein-coding gene	gene with protein product	"""Raf kinase inhibitory protein"", ""hippocampal cholinergic neurostimulating peptide"""	604591	"""prostatic binding protein"""	PBP		15782137	Standard	NM_002567		Approved	RKIP, HCNP, PEBP	uc001twu.1	P30086	OTTHUMG00000168860	ENST00000261313.2:c.322G>T	12.37:g.118577332G>T	ENSP00000261313:p.Gly108Cys	Somatic	98	0		WXS	Illumina HiSeq	Phase_I	89	16	NM_002567	0	0	430	702	272	B2R4S1	Missense_Mutation	SNP	ENST00000261313.2	37	CCDS9187.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.595001	0.86953	.	.	ENSG00000089220	ENST00000261313;ENST00000418769	T	0.57595	0.39	5.43	4.54	0.55810	.	0.047800	0.85682	D	0.000000	D	0.82614	0.5075	H	0.98426	4.23	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.88953	0.3388	10	0.87932	D	0	.	13.8987	0.63790	0.0734:0.0:0.9265:0.0	.	108;108	B4DRT4;P30086	.;PEBP1_HUMAN	C	108	ENSP00000261313:G108C	ENSP00000261313:G108C	G	+	1	0	PEBP1	117061715	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	9.447000	0.97595	1.280000	0.44463	0.563000	0.77884	GGC	.		0.527	PEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401405.1	NM_002567	
PSPC1	55269	hgsc.bcm.edu;bcgsc.ca	37	13	20356720	20356720	+	Missense_Mutation	SNP	C	C	T			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr13:20356720C>T	ENST00000338910.4	-	1	337	c.178G>A	c.(178-180)Gag>Aag	p.E60K		NM_001042414.2	NP_001035879.1	Q8WXF1	PSPC1_HUMAN	paraspeckle component 1	60					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of circadian rhythm (GO:0042752)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|paraspeckles (GO:0042382)	core promoter binding (GO:0001047)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23		all_cancers(29;1.25e-22)|all_lung(29;1.97e-20)|all_epithelial(30;2.29e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;4.63e-06)|Epithelial(112;2.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00256)|Lung(94;0.00975)|LUSC - Lung squamous cell carcinoma(192;0.0483)		AACCCCATCTCCTCGTCCGGG	0.692																																					p.E60K		.											.	PSPC1-135	0			c.G178A						.						35.0	37.0	36.0					13																	20356720		1929	4130	6059	SO:0001583	missense	55269	exon2			CCATCTCCTCGTC	AK001817	CCDS41870.1	13q11	2013-02-12			ENSG00000121390	ENSG00000121390		"""RNA binding motif (RRM) containing"""	20320	protein-coding gene	gene with protein product		612408				11790299	Standard	NM_001042414		Approved	PSP1, FLJ10955	uc021rgx.1	Q8WXF1	OTTHUMG00000016502	ENST00000338910.4:c.178G>A	13.37:g.20356720C>T	ENSP00000343966:p.Glu60Lys	Somatic	39	0		WXS	Illumina HiSeq	Phase_I	76	24	NM_001042414	0	0	7	9	2	Q5JTQ3|Q8NCZ9|Q8WXE8|Q9NV36	Missense_Mutation	SNP	ENST00000338910.4	37	CCDS41870.1	.	.	.	.	.	.	.	.	.	.	C	13.65	2.301856	0.40694	.	.	ENSG00000121390	ENST00000338910;ENST00000427943	T;T	0.14640	2.49;2.52	4.8	4.8	0.61643	.	0.347470	0.29396	N	0.012262	T	0.12561	0.0305	L	0.36672	1.1	0.45648	D	0.998577	B	0.21688	0.059	B	0.15870	0.014	T	0.11108	-1.0601	10	0.15499	T	0.54	-5.6938	18.0489	0.89341	0.0:1.0:0.0:0.0	.	60	Q8WXF1	PSPC1_HUMAN	K	60	ENSP00000343966:E60K;ENSP00000393069:E60K	ENSP00000343966:E60K	E	-	1	0	PSPC1	19254720	0.983000	0.35010	0.801000	0.32222	0.460000	0.32559	3.317000	0.51968	2.511000	0.84671	0.313000	0.20887	GAG	.		0.692	PSPC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044037.2		
SUPT16H	11198	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	21821861	21821861	+	Splice_Site	SNP	C	C	T			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr14:21821861C>T	ENST00000216297.2	-	24	3259		c.e24+1			NM_007192.3	NP_009123.1	Q9Y5B9	SP16H_HUMAN	suppressor of Ty 16 homolog (S. cerevisiae)						DNA repair (GO:0006281)|DNA replication (GO:0006260)|gene expression (GO:0010467)|nucleosome disassembly (GO:0006337)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27	all_cancers(95;0.00115)		Epithelial(56;1.62e-06)|all cancers(55;1.49e-05)	GBM - Glioblastoma multiforme(265;0.0159)		GTAAGACTAACCTGACTCTTC	0.378																																					.		.											.	SUPT16H-90	0			c.2920+1G>A						.						178.0	155.0	163.0					14																	21821861		2203	4300	6503	SO:0001630	splice_region_variant	11198	exon25			GACTAACCTGACT	AF152961	CCDS9569.1	14q11.1	2008-08-13	2001-11-28		ENSG00000092201	ENSG00000092201			11465	protein-coding gene	gene with protein product	"""facilitates chromatin remodeling 140 kDa subunit"""	605012	"""suppressor of Ty (S.cerevisiae) 16 homolog"""			9489704, 11239457	Standard	NM_007192		Approved	FACT, FACTP140, SPT16/CDC68, FLJ14010, FLJ10857, CDC68	uc001wao.2	Q9Y5B9	OTTHUMG00000029685	ENST00000216297.2:c.2920+1G>A	14.37:g.21821861C>T		Somatic	161	0		WXS	Illumina HiSeq	Phase_I	147	36	NM_007192	0	0	0	3	3	Q6GMT8|Q6P2F1|Q6PJM1|Q9NRX0	Splice_Site	SNP	ENST00000216297.2	37	CCDS9569.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.254717	0.80135	.	.	ENSG00000092201	ENST00000216297	.	.	.	5.21	5.21	0.72293	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.9497	0.89048	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SUPT16H	20891701	1.000000	0.71417	0.998000	0.56505	0.899000	0.52679	6.568000	0.73987	2.602000	0.87976	0.558000	0.71614	.	.		0.378	SUPT16H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074025.2		Intron
OR4E2	26686	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	22133796	22133796	+	Missense_Mutation	SNP	C	C	G			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr14:22133796C>G	ENST00000408935.1	+	1	500	c.500C>G	c.(499-501)cCt>cGt	p.P167R		NM_001001912.1	NP_001001912.1	Q8NGC2	OR4E2_HUMAN	olfactory receptor, family 4, subfamily E, member 2	167						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	15	all_cancers(95;0.00113)	Acute lymphoblastic leukemia(2;0.0279)		GBM - Glioblastoma multiforme(265;0.0137)		ATTCGTCTACCTTACTGTGGC	0.458																																					p.P167R		.											.	OR4E2-94	0			c.C500G						.						166.0	157.0	160.0					14																	22133796		1998	4205	6203	SO:0001583	missense	26686	exon1			GTCTACCTTACTG		CCDS41916.1	14q11.2	2013-09-23			ENSG00000221977	ENSG00000221977		"""GPCR / Class A : Olfactory receptors"""	8297	protein-coding gene	gene with protein product							Standard	NM_001001912		Approved		uc010tmd.2	Q8NGC2	OTTHUMG00000168979	ENST00000408935.1:c.500C>G	14.37:g.22133796C>G	ENSP00000386195:p.Pro167Arg	Somatic	195	1		WXS	Illumina HiSeq	Phase_I	183	58	NM_001001912	0	0	0	0	0	Q6IET6|Q96R62	Missense_Mutation	SNP	ENST00000408935.1	37	CCDS41916.1	.	.	.	.	.	.	.	.	.	.	C	15.79	2.937879	0.52972	.	.	ENSG00000221977	ENST00000408935	T	0.00193	8.58	5.88	5.88	0.94601	GPCR, rhodopsin-like superfamily (1);	0.000000	0.37955	U	0.001868	T	0.00637	0.0021	M	0.85041	2.73	0.39412	D	0.96676	D	0.89917	1.0	D	0.91635	0.999	T	0.70360	-0.4893	10	0.87932	D	0	.	12.6329	0.56667	0.1653:0.8346:0.0:0.0	.	167	Q8NGC2	OR4E2_HUMAN	R	167	ENSP00000386195:P167R	ENSP00000386195:P167R	P	+	2	0	OR4E2	21203636	0.013000	0.17824	0.998000	0.56505	0.982000	0.71751	2.541000	0.45735	2.777000	0.95525	0.585000	0.79938	CCT	.		0.458	OR4E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401874.1		
NIN	51199	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	51219341	51219341	+	Silent	SNP	T	T	A			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr14:51219341T>A	ENST00000382041.3	-	21	5035	c.4845A>T	c.(4843-4845)acA>acT	p.T1615T	NIN_ENST00000389868.3_Silent_p.T902T|NIN_ENST00000245441.5_Silent_p.T1615T|NIN_ENST00000530997.2_Silent_p.T1615T|NIN_ENST00000324330.9_Silent_p.T1615T|NIN_ENST00000382043.4_Silent_p.T902T|NIN_ENST00000453196.1_Silent_p.T1615T	NM_016350.4|NM_182946.1	NP_057434.4|NP_891991	Q8N4C6	NIN_HUMAN	ninein (GSK3B interacting protein)	1615					centrosome localization (GO:0051642)|centrosome-templated microtubule nucleation (GO:0090222)|microtubule anchoring at centrosome (GO:0034454)	centriole (GO:0005814)|centrosome (GO:0005813)|microtubule (GO:0005874)|nucleolus (GO:0005730)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(13)|lung(16)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	71	all_epithelial(31;0.00244)|Breast(41;0.127)					ATAGCATTTCTGTTAGACGTT	0.368			T	PDGFRB	MPD																																p.T1615T		.		Dom	yes		14	14q24	51199	ninein (GSK3B interacting protein)		L	.	NIN-229	0			c.A4845T						.						306.0	295.0	299.0					14																	51219341		2203	4300	6503	SO:0001819	synonymous_variant	51199	exon21			CATTTCTGTTAGA	AF212162	CCDS32078.1, CCDS32079.1, CCDS32078.2	14q21-q22	2013-01-10			ENSG00000100503	ENSG00000100503		"""EF-hand domain containing"""	14906	protein-coding gene	gene with protein product		608684				11004522, 11162463	Standard	NM_020921		Approved		uc001wyi.3	Q8N4C6	OTTHUMG00000029569	ENST00000382041.3:c.4845A>T	14.37:g.51219341T>A		Somatic	579	0		WXS	Illumina HiSeq	Phase_I	540	165	NM_020921	0	0	25	46	21	A6NDB8|B7WPA3|C9JSB6|C9JSG2|C9JXL2|Q5BKU3|Q6P0P6|Q9BWU6|Q9C012|Q9C013|Q9C014|Q9H5I6|Q9HAT7|Q9HBY5|Q9HCK7|Q9UH61	Silent	SNP	ENST00000382041.3	37	CCDS32079.1	.	.	.	.	.	.	.	.	.	.	T	9.123	1.009401	0.19277	.	.	ENSG00000100503	ENST00000530997;ENST00000389869;ENST00000530853	.	.	.	5.74	-2.9	0.05648	.	.	.	.	.	.	.	.	.	.	.	0.38083	D	0.936736	.	.	.	.	.	.	.	.	.	.	.	.	.	-1.4293	2.5367	0.04716	0.1233:0.351:0.1277:0.398	.	.	.	.	X	1106	.	.	R	-	1	2	NIN	50289091	0.799000	0.28903	0.876000	0.34364	0.839000	0.47603	-0.187000	0.09656	-0.385000	0.07833	0.533000	0.62120	AGA	.		0.368	NIN-016	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395207.2	NM_182946	
MNAT1	4331	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	61434986	61434986	+	Silent	SNP	T	T	C			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr14:61434986T>C	ENST00000261245.4	+	8	950	c.849T>C	c.(847-849)ctT>ctC	p.L283L	MNAT1_ENST00000539616.2_Silent_p.L241L|RP11-193F5.1_ENST00000553946.1_RNA	NM_002431.3	NP_002422.1	P51948	MAT1_HUMAN	MNAT CDK-activating kinase assembly factor 1	283					7-methylguanosine mRNA capping (GO:0006370)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|cell proliferation (GO:0008283)|DNA repair (GO:0006281)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to calcium ion (GO:0051592)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|ventricular system development (GO:0021591)|viral process (GO:0016032)	cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein N-terminus binding (GO:0047485)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(2)	11				OV - Ovarian serous cystadenocarcinoma(108;0.0174)		CACAGGACCTTGCTGGAGGCT	0.398								Direct reversal of damage;Direct reversal of damage;Nucleotide excision repair (NER)																													p.L283L		.											.	MNAT1-523	0			c.T849C						.						133.0	119.0	124.0					14																	61434986		2203	4300	6503	SO:0001819	synonymous_variant	4331	exon8			GGACCTTGCTGGA	X87843	CCDS9750.1, CCDS53899.1	14q23	2013-07-31	2013-07-31		ENSG00000020426	ENSG00000020426		"""RING-type (C3HC4) zinc fingers"", ""General transcription factor IIH complex subunits"""	7181	protein-coding gene	gene with protein product	"""CDK-activating kinase assembly factor"""	602659	"""menage a trois 1 (CAK assembly factor)"", ""menage a trois homolog 1, cyclin H assembly factor (Xenopus laevis)"""			9465303	Standard	NM_002431		Approved	MAT1, RNF66	uc001xfd.3	P51948	OTTHUMG00000152340	ENST00000261245.4:c.849T>C	14.37:g.61434986T>C		Somatic	112	0		WXS	Illumina HiSeq	Phase_I	145	51	NM_002431	0	0	7	14	7	G3V1U8|Q15817|Q6ICQ7	Silent	SNP	ENST00000261245.4	37	CCDS9750.1																																																																																			.		0.398	MNAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276956.1	NM_002431	
PAPLN	89932	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	73733497	73733497	+	Missense_Mutation	SNP	T	T	C			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr14:73733497T>C	ENST00000554301.1	+	24	3621	c.3458T>C	c.(3457-3459)tTg>tCg	p.L1153S	PAPLN_ENST00000427855.1_Missense_Mutation_p.L1153S|PAPLN_ENST00000555445.1_Missense_Mutation_p.L1137S|PAPLN_ENST00000340738.5_Missense_Mutation_p.L1126S|PAPLN_ENST00000381166.3_Intron			O95428	PPN_HUMAN	papilin, proteoglycan-like sulfated glycoprotein	1153	Ig-like C2-type 3.					basement membrane (GO:0005604)	metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase inhibitor activity (GO:0004867)|zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(3)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(3)	42				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.0468)		GCCAGGCTATTGTGTGTGGTA	0.542																																					p.L1126S		.											.	PAPLN-70	0			c.T3377C						.						211.0	153.0	173.0					14																	73733497		2203	4300	6503	SO:0001583	missense	89932	exon24			GGCTATTGTGTGT	BC042057	CCDS32114.1	14q24.2	2013-01-11				ENSG00000100767		"""Immunoglobulin superfamily / I-set domain containing"""	19262	protein-coding gene	gene with protein product						11076767, 19734141	Standard	NM_173462		Approved	MGC50452	uc001xnw.4	O95428		ENST00000554301.1:c.3458T>C	14.37:g.73733497T>C	ENSP00000451803:p.Leu1153Ser	Somatic	31	0		WXS	Illumina HiSeq	Phase_I	29	8	NM_173462	0	0	36	78	42	B4DES8|B4DGE6|Q659F2|Q6UXJ4|Q6ZNM1|Q6ZUJ0|Q7Z681|Q8IVU0	Missense_Mutation	SNP	ENST00000554301.1	37		.	.	.	.	.	.	.	.	.	.	T	2.259	-0.369785	0.05069	.	.	ENSG00000100767	ENST00000340738;ENST00000427855;ENST00000554301;ENST00000555445	T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14	5.06	-8.09	0.01090	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.28400	0.0702	N	0.03608	-0.345	0.24632	N	0.993617	P;P;B;P	0.39920	0.646;0.695;0.2;0.622	B;B;B;B	0.43331	0.292;0.416;0.077;0.217	T	0.31392	-0.9945	9	0.08837	T	0.75	.	2.1116	0.03704	0.3364:0.3542:0.1653:0.1441	.	1137;1153;352;1126	O95428-5;O95428;O95428-2;O95428-6	.;PPN_HUMAN;.;.	S	1126;1153;1153;1137	ENSP00000345395:L1126S;ENSP00000403403:L1153S;ENSP00000451803:L1153S;ENSP00000451729:L1137S	ENSP00000345395:L1126S	L	+	2	0	PAPLN	72803250	0.000000	0.05858	0.051000	0.19133	0.088000	0.18126	0.124000	0.15728	-1.220000	0.02594	-0.389000	0.06534	TTG	.		0.542	PAPLN-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000413182.1	NM_173462	
DLK1	8788	broad.mit.edu	37	14	101198410	101198410	+	Silent	SNP	C	C	T			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr14:101198410C>T	ENST00000341267.4	+	4	536	c.294C>T	c.(292-294)gcC>gcT	p.A98A	DLK1_ENST00000331224.6_Silent_p.A98A	NM_003836.5	NP_003827	P80370	DLK1_HUMAN	delta-like 1 homolog (Drosophila)	98	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell differentiation (GO:0030154)|embryonic skeletal system development (GO:0048706)|multicellular organismal development (GO:0007275)|negative regulation of Notch signaling pathway (GO:0045746)|Notch signaling pathway (GO:0007219)|post-embryonic development (GO:0009791)|regulation of gene expression (GO:0010468)	external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(16)|ovary(2)|prostate(1)|skin(1)	29		Melanoma(154;0.155)				CCCCCTGTGCCAACAACAGGA	0.627																																					p.A98A													.	DLK1-949	0			c.C294T						.						64.0	61.0	62.0					14																	101198410		2203	4300	6503	SO:0001819	synonymous_variant	8788	exon4			CTGTGCCAACAAC	U15979	CCDS9963.1	14q32	2011-12-05	2001-12-03			ENSG00000185559			2907	protein-coding gene	gene with protein product		176290	"""delta-like homolog (Drosophila)"""			8095043, 7925474	Standard	NM_003836		Approved	FA1, pG2, Pref-1, ZOG, Delta1	uc001yhs.4	P80370		ENST00000341267.4:c.294C>T	14.37:g.101198410C>T		Somatic	64	0		WXS	Illumina HiSeq	Phase_I	83	3	NM_003836	0	0	0	0	0	P15803|Q96DW5	Silent	SNP	ENST00000341267.4	37	CCDS9963.1																																																																																			.		0.627	DLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414389.1		
ACSBG1	23205	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	78474881	78474881	+	Missense_Mutation	SNP	T	T	G			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr15:78474881T>G	ENST00000258873.4	-	7	1026	c.821A>C	c.(820-822)aAc>aCc	p.N274T	ACSBG1_ENST00000541759.1_Missense_Mutation_p.N32T|ACSBG1_ENST00000560817.1_Missense_Mutation_p.N32T	NM_001199377.1|NM_015162.4	NP_001186306.1|NP_055977.3	Q96GR2	ACBG1_HUMAN	acyl-CoA synthetase bubblegum family member 1	274					long-chain fatty acid metabolic process (GO:0001676)|myelination (GO:0042552)|ovarian follicle atresia (GO:0001552)|response to glucocorticoid (GO:0051384)|very long-chain fatty acid metabolic process (GO:0000038)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			endometrium(2)|kidney(2)|large_intestine(11)|liver(1)|lung(15)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	37						ACAGCACTGGTTGGGCTGCTG	0.587																																					p.N274T		.											.	ACSBG1-91	0			c.A821C						.						81.0	67.0	72.0					15																	78474881		2196	4293	6489	SO:0001583	missense	23205	exon7			CACTGGTTGGGCT	AB014531	CCDS10298.1	15q23-q24	2006-02-09			ENSG00000103740	ENSG00000103740		"""Acyl-CoA synthetase family"""	29567	protein-coding gene	gene with protein product	"""bubblegum"", ""very long-chain acyl-CoA synthetase"", ""lipidosin"""	614362				9734811, 10954726	Standard	NM_015162		Approved	BGM, FLJ30320, MGC14352, BG1, KIAA0631, hBG1, hsBG	uc002bdh.3	Q96GR2	OTTHUMG00000143734	ENST00000258873.4:c.821A>C	15.37:g.78474881T>G	ENSP00000258873:p.Asn274Thr	Somatic	59	2		WXS	Illumina HiSeq	Phase_I	45	8	NM_015162	0	0	0	0	0	B2RB61|O75126|Q76N27|Q9HC26	Missense_Mutation	SNP	ENST00000258873.4	37	CCDS10298.1	.	.	.	.	.	.	.	.	.	.	T	18.36	3.606742	0.66558	.	.	ENSG00000103740	ENST00000258873;ENST00000541759	T;T	0.11063	2.81;2.81	5.27	5.27	0.74061	AMP-dependent synthetase/ligase (1);	0.056615	0.64402	D	0.000003	T	0.20373	0.0490	L	0.52823	1.66	0.53688	D	0.999972	P;B	0.43519	0.809;0.291	P;B	0.50162	0.633;0.363	T	0.00403	-1.1761	10	0.51188	T	0.08	-47.8285	14.4501	0.67379	0.0:0.0:0.0:1.0	.	270;274	B7Z2Y6;Q96GR2	.;ACBG1_HUMAN	T	274;32	ENSP00000258873:N274T;ENSP00000439955:N32T	ENSP00000258873:N274T	N	-	2	0	ACSBG1	76261936	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	7.948000	0.87774	1.991000	0.58162	0.529000	0.55759	AAC	.		0.587	ACSBG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289802.2	NM_015162	
CAPN15	6650	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	599030	599030	+	Missense_Mutation	SNP	G	G	A			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr16:599030G>A	ENST00000219611.2	+	5	1850	c.1487G>A	c.(1486-1488)gGg>gAg	p.G496E	LA16c-366D1.3_ENST00000565879.1_RNA	NM_005632.2	NP_005623.1	O75808	CAN15_HUMAN	calpain 15	496	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				proteolysis (GO:0006508)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cysteine-type peptidase activity (GO:0008234)|peptidase activity (GO:0008233)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										TTCCCTCCCGGGCCCGAGTCT	0.657																																					p.G496E		.											.	SOLH-523	0			c.G1487A						.						105.0	94.0	98.0					16																	599030		2198	4296	6494	SO:0001583	missense	6650	exon5			CTCCCGGGCCCGA	U85647	CCDS10410.1	16p13.3	2013-06-27	2013-06-27	2013-06-27	ENSG00000103326	ENSG00000103326			11182	protein-coding gene	gene with protein product		603267	"""small optic lobes (Drosophila) homolog"", ""small optic lobes homolog (Drosophila)"""	SOLH		9722942	Standard	NM_005632		Approved		uc002chi.3	O75808	OTTHUMG00000119059	ENST00000219611.2:c.1487G>A	16.37:g.599030G>A	ENSP00000219611:p.Gly496Glu	Somatic	166	0		WXS	Illumina HiSeq	Phase_I	156	33	NM_005632	0	0	21	32	11	B1B1M4|Q2KHS2|Q8WTY9|Q9BUW0	Missense_Mutation	SNP	ENST00000219611.2	37	CCDS10410.1	.	.	.	.	.	.	.	.	.	.	g	17.87	3.495721	0.64186	.	.	ENSG00000103326	ENST00000219611	T	0.39056	1.1	5.04	5.04	0.67666	Peptidase C2, calpain, catalytic domain (3);	0.097082	0.64402	D	0.000001	T	0.46776	0.1410	N	0.12920	0.275	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.40496	-0.9560	10	0.21014	T	0.42	.	16.9735	0.86306	0.0:0.0:1.0:0.0	.	496	O75808	CAN15_HUMAN	E	496	ENSP00000219611:G496E	ENSP00000219611:G496E	G	+	2	0	SOLH	539031	1.000000	0.71417	0.994000	0.49952	0.379000	0.30106	7.684000	0.84104	2.347000	0.79759	0.556000	0.70494	GGG	.		0.657	CAPN15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239271.1	NM_005632	
ZNF598	90850	hgsc.bcm.edu	37	16	2059674	2059674	+	Missense_Mutation	SNP	T	T	C	rs71384660		TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr16:2059674T>C	ENST00000431526.1	-	2	88	c.74A>G	c.(73-75)gAa>gGa	p.E25G	ZNF598_ENST00000563630.1_5'UTR|ZNF598_ENST00000562103.1_5'UTR	NM_178167.2	NP_835461.2	Q86UK7	ZN598_HUMAN	zinc finger protein 598	25							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|lung(7)|skin(1)|urinary_tract(1)	16						GCTCCCGCCTTCCCGCTCAGG	0.766													C|||	5008	1.0	1.0	1.0	5008	,	,		5162	1.0		1.0	False		,,,				2504	1.0				p.E25G		.											.	ZNF598-432	0			c.A74G						.						1.0	2.0	2.0					16																	2059674		1089	2314	3403	SO:0001583	missense	90850	exon2			CCGCCTTCCCGCT	BC029270		16p13.3	2008-05-02				ENSG00000167962		"""Zinc fingers, C2H2-type"""	28079	protein-coding gene	gene with protein product							Standard	NM_178167		Approved	FLJ00086	uc002cof.2	Q86UK7		ENST00000431526.1:c.74A>G	16.37:g.2059674T>C	ENSP00000411409:p.Glu25Gly	Somatic	1	1		WXS	Illumina HiSeq	Phase_I	2	2	NM_178167	0	0	0	9	9	Q8IW49|Q8N3D9|Q96FG3|Q9H7J3	Missense_Mutation	SNP	ENST00000431526.1	37		2168	0.9926739926739927	487	0.9898373983739838	361	0.9972375690607734	568	0.993006993006993	752	0.9920844327176781	N	1.560	-0.537056	0.04082	.	.	ENSG00000167962	ENST00000431526	T	0.77098	-1.07	3.3	3.3	0.37823	.	0.415485	0.23105	N	0.051871	T	0.00012	0.0000	.	.	.	0.48696	P	3.1000000000003247E-4	.	.	.	.	.	.	T	0.34650	-0.9820	6	0.22706	T	0.39	-7.8624	8.393	0.32540	0.0:0.8796:0.0:0.1204	.	.	.	.	G	25	ENSP00000411409:E25G	ENSP00000411409:E25G	E	-	2	0	ZNF598	1999675	1.000000	0.71417	1.000000	0.80357	0.107000	0.19398	0.911000	0.28584	0.691000	0.31592	-0.642000	0.03964	GAA	T|0.007;C|0.993		0.766	ZNF598-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_178167	
CORO7	79585	ucsc.edu	37	16	4405363	4405363	+	Missense_Mutation	SNP	G	G	A			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr16:4405363G>A	ENST00000251166.4	-	27	2841	c.2696C>T	c.(2695-2697)gCc>gTc	p.A899V	CORO7_ENST00000539968.1_Missense_Mutation_p.A679V|CORO7-PAM16_ENST00000572467.1_Missense_Mutation_p.A899V|PAM16_ENST00000576217.1_Intron|CORO7-PAM16_ENST00000572274.1_5'UTR|CORO7_ENST00000574025.1_Missense_Mutation_p.A814V|CORO7_ENST00000537233.2_Missense_Mutation_p.A881V	NM_024535.4	NP_078811.3	P57737	CORO7_HUMAN	coronin 7	899					actin filament polymerization (GO:0030041)|Golgi to endosome transport (GO:0006895)|protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)			breast(3)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(8)|prostate(2)|skin(2)|urinary_tract(2)	23						TGCCACCATGGCATTCAGCAG	0.577																																					p.A899V													.	CORO7-90	0			c.C2696T						.						31.0	26.0	28.0					16																	4405363		2197	4300	6497	SO:0001583	missense	79585	exon27			ACCATGGCATTCA	AK097238	CCDS10513.1, CCDS55982.1, CCDS58417.1	16p13.3	2013-01-10			ENSG00000262246	ENSG00000262246		"""Coronins"", ""WD repeat domain containing"""	26161	protein-coding gene	gene with protein product		611668				15327992	Standard	NM_024535		Approved	FLJ22021		P57737	OTTHUMG00000129465	ENST00000251166.4:c.2696C>T	16.37:g.4405363G>A	ENSP00000251166:p.Ala899Val	Somatic	60	0		WXS	Illumina HiSeq		41	4	NM_024535	0	0	0	0	0	B4DFD6|B4DL18|I3L416|Q17RK4	Missense_Mutation	SNP	ENST00000251166.4	37	CCDS10513.1	.	.	.	.	.	.	.	.	.	.	G	17.88	3.497148	0.64186	.	.	ENSG00000103426	ENST00000251166;ENST00000537233;ENST00000539968	T;T;T	0.68331	-0.32;1.48;-0.32	4.96	4.0	0.46444	.	0.486738	0.16832	N	0.197705	T	0.80042	0.4551	M	0.70595	2.14	0.80722	D	1	D;P;P;D	0.89917	1.0;0.911;0.911;1.0	D;B;B;D	0.91635	0.999;0.432;0.432;0.997	T	0.80241	-0.1464	10	0.62326	D	0.03	-20.2483	12.9016	0.58128	0.0801:0.0:0.9199:0.0	.	814;881;899;880	P57737-2;B4DFD6;P57737;B4DKU9	.;.;CORO7_HUMAN;.	V	899;814;679	ENSP00000251166:A899V;ENSP00000440460:A814V;ENSP00000446221:A679V	ENSP00000251166:A899V	A	-	2	0	CORO7	4345364	1.000000	0.71417	0.997000	0.53966	0.200000	0.23975	7.319000	0.79040	1.091000	0.41335	-0.229000	0.12294	GCC	.		0.577	CORO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251628.2	NM_024535	
TMEM186	25880	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	8890423	8890423	+	Missense_Mutation	SNP	T	T	C			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr16:8890423T>C	ENST00000333050.6	-	2	61	c.28A>G	c.(28-30)Agg>Ggg	p.R10G	PMM2_ENST00000539622.1_5'Flank|PMM2_ENST00000268261.4_5'Flank|PMM2_ENST00000537352.1_5'Flank|PMM2_ENST00000569958.1_5'Flank|TMEM186_ENST00000564869.1_Intron|PMM2_ENST00000566983.1_Intron	NM_015421.3	NP_056236.2	Q96B77	TM186_HUMAN	transmembrane protein 186	10						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				NS(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	9						CCCCGAAACCTACGCACAGCT	0.547																																					p.R10G		.											.	TMEM186-91	0			c.A28G						.						67.0	70.0	69.0					16																	8890423		2197	4300	6497	SO:0001583	missense	25880	exon2			GAAACCTACGCAC	BC015912	CCDS10535.1	16p13.2	2008-02-05	2007-02-08	2007-02-08	ENSG00000184857	ENSG00000184857			24530	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 51"""	C16orf51		11230166	Standard	NM_015421		Approved	DKFZP564K2062	uc002cze.3	Q96B77	OTTHUMG00000129696	ENST00000333050.6:c.28A>G	16.37:g.8890423T>C	ENSP00000331640:p.Arg10Gly	Somatic	67	0		WXS	Illumina HiSeq	Phase_I	94	24	NM_015421	0	0	30	40	10	B2RAY0|Q9Y4T4	Missense_Mutation	SNP	ENST00000333050.6	37	CCDS10535.1	.	.	.	.	.	.	.	.	.	.	T	12.60	1.985216	0.35036	.	.	ENSG00000184857	ENST00000333050	.	.	.	4.53	2.24	0.28232	.	0.345193	0.20611	N	0.088971	T	0.34193	0.0889	L	0.57536	1.79	0.09310	N	1	P	0.36535	0.557	B	0.33620	0.167	T	0.15983	-1.0418	9	0.36615	T	0.2	-12.3261	8.7598	0.34667	0.0:0.0:0.3002:0.6998	.	10	Q96B77	TM186_HUMAN	G	10	.	ENSP00000331640:R10G	R	-	1	2	TMEM186	8797924	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	0.134000	0.15932	1.030000	0.39839	0.533000	0.62120	AGG	.		0.547	TMEM186-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251903.1	NM_015421	
SPNS1	83985	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	28989282	28989282	+	Missense_Mutation	SNP	A	A	G			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr16:28989282A>G	ENST00000311008.11	+	3	738	c.361A>G	c.(361-363)Agg>Ggg	p.R121G	SPNS1_ENST00000323081.8_Missense_Mutation_p.R48G|SPNS1_ENST00000334536.8_Missense_Mutation_p.R121G|RP11-264B17.3_ENST00000569969.1_RNA|SPNS1_ENST00000352260.7_Missense_Mutation_p.R99G|SPNS1_ENST00000565975.1_Missense_Mutation_p.R166G|RP11-264B17.4_ENST00000567209.1_RNA|SPNS1_ENST00000561868.1_Intron	NM_032038.2	NP_114427.1	Q9H2V7	SPNS1_HUMAN	spinster homolog 1 (Drosophila)	121					lipid transport (GO:0006869)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|mitochondrial inner membrane (GO:0005743)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|prostate(1)|skin(2)|urinary_tract(1)	21						CCTGGGTGACAGGTACAATCG	0.577											OREG0023711	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R121G		.											.	SPNS1-90	0			c.A361G						.						239.0	183.0	202.0					16																	28989282		2197	4300	6497	SO:0001583	missense	83985	exon3			GGTGACAGGTACA	BC006156	CCDS10646.1, CCDS45452.1, CCDS45453.1, CCDS45454.1	16p11.2	2007-04-12			ENSG00000169682	ENSG00000169682			30621	protein-coding gene	gene with protein product		612583				11340170, 12815463	Standard	NM_032038		Approved	HSpin1, nrs, SPINL, PP2030, SPIN1, LAT	uc010vdi.1	Q9H2V7	OTTHUMG00000131762	ENST00000311008.11:c.361A>G	16.37:g.28989282A>G	ENSP00000309945:p.Arg121Gly	Somatic	166	0	806	WXS	Illumina HiSeq	Phase_I	175	79	NM_001142451	0	0	37	101	64	B5MDM9|Q6P182|Q71RB5|Q7L541|Q86VU7|Q8N953|Q8TCS5|Q9BRN5	Missense_Mutation	SNP	ENST00000311008.11	37	CCDS10646.1	.	.	.	.	.	.	.	.	.	.	A	17.88	3.497831	0.64186	.	.	ENSG00000169682	ENST00000311008;ENST00000334536;ENST00000352260;ENST00000323081	T;T;T;T	0.65732	-0.17;-0.17;-0.17;-0.17	4.68	3.54	0.40534	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.81202	0.4773	M	0.92880	3.355	0.58432	D	0.999996	D;D;D;D;D	0.89917	1.0;1.0;0.996;1.0;1.0	D;D;D;D;D	0.97110	0.998;0.999;0.998;0.999;1.0	T	0.82168	-0.0591	10	0.87932	D	0	.	8.7405	0.34554	0.6228:0.3772:0.0:0.0	.	48;99;121;121;121	Q9H2V7-4;Q9H2V7-3;Q9H2V7;Q9H2V7-2;Q9H2V7-5	.;.;SPNS1_HUMAN;.;.	G	121;121;99;48	ENSP00000309945:R121G;ENSP00000335494:R121G;ENSP00000306050:R99G;ENSP00000318228:R48G	ENSP00000309945:R121G	R	+	1	2	SPNS1	28896783	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.943000	0.56621	0.774000	0.33427	0.402000	0.26972	AGG	.		0.577	SPNS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254690.2	NM_032038	
MT1B	4490	ucsc.edu	37	16	56686910	56686910	+	Missense_Mutation	SNP	G	G	A			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr16:56686910G>A	ENST00000334346.2	+	3	174	c.119G>A	c.(118-120)gGc>gAc	p.G40D	MT1B_ENST00000562399.1_Silent_p.G39G|RP11-249C24.11_ENST00000568608.1_RNA	NM_005947.2	NP_005938.1	P07438	MT1B_HUMAN	metallothionein 1B	40	Alpha.				cellular response to zinc ion (GO:0071294)|negative regulation of growth (GO:0045926)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(1)|lung(1)|ovary(1)	4						TGCCCCGTGGGCTGTGCCAAG	0.592																																					p.G40D													.	MT1B-90	0			c.G119A						.						123.0	121.0	122.0					16																	56686910		2198	4300	6498	SO:0001583	missense	4490	exon3			CCGTGGGCTGTGC	AY168638	CCDS10765.1	16q13	2008-02-05	2007-03-02		ENSG00000169688	ENSG00000169688		"""Metallothioneins"""	7394	protein-coding gene	gene with protein product		156349	"""metallothionein 1Q"""	MT1, MT1Q		6089206, 3785191	Standard	NM_005947		Approved		uc002ejs.3	P07438	OTTHUMG00000133277	ENST00000334346.2:c.119G>A	16.37:g.56686910G>A	ENSP00000334998:p.Gly40Asp	Somatic	204	1		WXS	Illumina HiSeq		251	1	NM_005947	0	0	0	0	0	Q86YX0	Missense_Mutation	SNP	ENST00000334346.2	37	CCDS10765.1	.	.	.	.	.	.	.	.	.	.	G	10.04	1.241689	0.22711	.	.	ENSG00000169688	ENST00000334346	T	0.10288	2.89	2.84	1.84	0.25277	Metallothionein domain, vertebrate (1);Metallothionein domain (1);	0.089620	0.44483	N	0.000445	T	0.09512	0.0234	.	.	.	0.37807	D	0.927896	B	0.06786	0.001	B	0.06405	0.002	T	0.11891	-1.0569	9	0.66056	D	0.02	.	9.9659	0.41723	0.1226:0.0:0.8774:0.0	.	40	P07438	MT1B_HUMAN	D	40	ENSP00000334998:G40D	ENSP00000334998:G40D	G	+	2	0	MT1B	55244411	0.672000	0.27530	0.943000	0.38184	0.706000	0.40770	2.562000	0.45914	0.086000	0.17137	-1.303000	0.01326	GGC	.		0.592	MT1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257057.2	NM_005947	
PMFBP1	83449	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	72198700	72198700	+	Missense_Mutation	SNP	T	T	C			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr16:72198700T>C	ENST00000237353.10	-	3	389	c.128A>G	c.(127-129)aAt>aGt	p.N43S	PMFBP1_ENST00000537465.1_Missense_Mutation_p.N43S|PMFBP1_ENST00000355636.6_5'UTR|PMFBP1_ENST00000543746.1_5'UTR	NM_031293.2	NP_112583.2	Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1	43						cytoplasm (GO:0005737)				NS(1)|breast(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	45		Ovarian(137;0.179)				GCAGAGCTGATTGTCCTGCAA	0.542																																					p.N43S		.											.	PMFBP1-92	0			c.A128G						.						133.0	111.0	119.0					16																	72198700		2198	4300	6498	SO:0001583	missense	83449	exon3			AGCTGATTGTCCT	AF239683	CCDS32483.1	16q23.1	2008-08-04			ENSG00000118557	ENSG00000118557			17728	protein-coding gene	gene with protein product						11468771	Standard	NM_031293		Approved		uc002fcd.3	Q8TBY8	OTTHUMG00000167827	ENST00000237353.10:c.128A>G	16.37:g.72198700T>C	ENSP00000237353:p.Asn43Ser	Somatic	128	0		WXS	Illumina HiSeq	Phase_I	185	81	NM_031293	0	0	0	0	0	B3KVI9|H7BY07|Q8NA09|Q9BY16|Q9H0H4	Missense_Mutation	SNP	ENST00000237353.10	37	CCDS32483.1	.	.	.	.	.	.	.	.	.	.	T	9.847	1.192729	0.21954	.	.	ENSG00000118557	ENST00000537465;ENST00000237353;ENST00000535461;ENST00000539172;ENST00000536211;ENST00000540440	T;T	0.12774	2.65;2.65	5.85	2.17	0.27698	.	0.117279	0.38959	N	0.001506	T	0.05868	0.0153	N	0.19112	0.55	0.80722	D	1	B;B	0.16396	0.017;0.017	B;B	0.12156	0.007;0.007	T	0.30504	-0.9976	10	0.09590	T	0.72	-14.5061	2.3595	0.04304	0.1534:0.0827:0.1601:0.6038	.	43;43	Q8TBY8-2;G3V1Q7	.;.	S	43	ENSP00000443817:N43S;ENSP00000237353:N43S	ENSP00000237353:N43S	N	-	2	0	PMFBP1	70756201	0.858000	0.29795	0.998000	0.56505	0.204000	0.24138	0.499000	0.22546	0.464000	0.27142	-0.290000	0.09829	AAT	.		0.542	PMFBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396473.2	NM_031293	
AIPL1	23746	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	6328845	6328845	+	Missense_Mutation	SNP	C	C	T	rs201875142		TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr17:6328845C>T	ENST00000381129.3	-	6	1170	c.1090G>A	c.(1090-1092)Gca>Aca	p.A364T	AIPL1_ENST00000576776.1_Missense_Mutation_p.A340T|AIPL1_ENST00000570466.1_Missense_Mutation_p.A342T|AIPL1_ENST00000575265.1_3'UTR|AIPL1_ENST00000250087.5_Missense_Mutation_p.A301T|AIPL1_ENST00000576307.1_Missense_Mutation_p.A304T|AIPL1_ENST00000574506.1_Missense_Mutation_p.A352T	NM_001033055.1|NM_014336.3	NP_001028227.1|NP_055151.3	Q9NZN9	AIPL1_HUMAN	aryl hydrocarbon receptor interacting protein-like 1	364					negative regulation of apoptotic process (GO:0043066)|phototransduction, visible light (GO:0007603)|protein farnesylation (GO:0018343)|protein folding (GO:0006457)|regulation of cGMP metabolic process (GO:0030823)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|photoreceptor inner segment (GO:0001917)	farnesylated protein binding (GO:0001918)|unfolded protein binding (GO:0051082)			NS(1)|kidney(1)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|skin(1)	12				COAD - Colon adenocarcinoma(228;0.141)		gggggccctgcggacagctct	0.701																																					p.A364T		.											.	AIPL1-90	0			c.G1090A						.						47.0	47.0	47.0					17																	6328845		2202	4297	6499	SO:0001583	missense	23746	exon6			GCCCTGCGGACAG	AF148864	CCDS11075.1, CCDS32539.1, CCDS32540.1, CCDS67130.1, CCDS67131.1, CCDS67132.1, CCDS67133.1	17p13.1	2013-01-08	2001-11-29		ENSG00000129221	ENSG00000129221			359	protein-coding gene	gene with protein product		604392	"""aryl hydrocarbon receptor-interacting protein-like 1"""	LCA4		10615133, 14555765, 15365173	Standard	NM_001285402		Approved		uc002gcp.3	Q9NZN9	OTTHUMG00000102043	ENST00000381129.3:c.1090G>A	17.37:g.6328845C>T	ENSP00000370521:p.Ala364Thr	Somatic	115	0		WXS	Illumina HiSeq	Phase_I	150	65	NM_014336	0	0	0	0	0	D3DTM4|Q659W3|Q659W4|Q6ZZB6|Q8N6A0|Q9H873|Q9NS10	Missense_Mutation	SNP	ENST00000381129.3	37	CCDS11075.1	.	.	.	.	.	.	.	.	.	.	C	0.009	-1.800010	0.00611	.	.	ENSG00000129221	ENST00000381129;ENST00000381128;ENST00000250087	D;D	0.88354	-2.37;-2.28	2.43	-4.86	0.03132	.	14.175600	0.00357	N	0.000030	T	0.68357	0.2992	N	0.02539	-0.55	0.09310	N	1	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0	T	0.62282	-0.6887	10	0.15066	T	0.55	.	0.3578	0.00359	0.2708:0.2404:0.1332:0.3556	.	340;342;301;304;364	Q659W3;Q659W4;Q9NZN9-3;Q9NZN9-2;Q9NZN9	.;.;.;.;AIPL1_HUMAN	T	364;304;301	ENSP00000370521:A364T;ENSP00000250087:A301T	ENSP00000250087:A301T	A	-	1	0	AIPL1	6269569	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.245000	0.01192	-4.315000	0.00057	-3.419000	0.00038	GCA	.		0.701	AIPL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219828.3	NM_014336	
AIPL1	23746	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	6328868	6328868	+	Missense_Mutation	SNP	G	G	A			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr17:6328868G>A	ENST00000381129.3	-	6	1147	c.1067C>T	c.(1066-1068)aCa>aTa	p.T356I	AIPL1_ENST00000576776.1_Missense_Mutation_p.T332I|AIPL1_ENST00000570466.1_Missense_Mutation_p.T334I|AIPL1_ENST00000575265.1_3'UTR|AIPL1_ENST00000250087.5_Missense_Mutation_p.T293I|AIPL1_ENST00000576307.1_Missense_Mutation_p.T296I|AIPL1_ENST00000574506.1_Missense_Mutation_p.T344I	NM_001033055.1|NM_014336.3	NP_001028227.1|NP_055151.3	Q9NZN9	AIPL1_HUMAN	aryl hydrocarbon receptor interacting protein-like 1	356					negative regulation of apoptotic process (GO:0043066)|phototransduction, visible light (GO:0007603)|protein farnesylation (GO:0018343)|protein folding (GO:0006457)|regulation of cGMP metabolic process (GO:0030823)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|photoreceptor inner segment (GO:0001917)	farnesylated protein binding (GO:0001918)|unfolded protein binding (GO:0051082)			NS(1)|kidney(1)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|skin(1)	12				COAD - Colon adenocarcinoma(228;0.141)		agatggtgctgtgggtggctc	0.692																																					p.T356I		.											.	AIPL1-90	0			c.C1067T						.						72.0	65.0	68.0					17																	6328868		2203	4298	6501	SO:0001583	missense	23746	exon6			GGTGCTGTGGGTG	AF148864	CCDS11075.1, CCDS32539.1, CCDS32540.1, CCDS67130.1, CCDS67131.1, CCDS67132.1, CCDS67133.1	17p13.1	2013-01-08	2001-11-29		ENSG00000129221	ENSG00000129221			359	protein-coding gene	gene with protein product		604392	"""aryl hydrocarbon receptor-interacting protein-like 1"""	LCA4		10615133, 14555765, 15365173	Standard	NM_001285402		Approved		uc002gcp.3	Q9NZN9	OTTHUMG00000102043	ENST00000381129.3:c.1067C>T	17.37:g.6328868G>A	ENSP00000370521:p.Thr356Ile	Somatic	144	0		WXS	Illumina HiSeq	Phase_I	171	79	NM_014336	0	0	0	0	0	D3DTM4|Q659W3|Q659W4|Q6ZZB6|Q8N6A0|Q9H873|Q9NS10	Missense_Mutation	SNP	ENST00000381129.3	37	CCDS11075.1	.	.	.	.	.	.	.	.	.	.	G	9.219	1.032866	0.19590	.	.	ENSG00000129221	ENST00000381129;ENST00000381128;ENST00000250087	D;D	0.88818	-2.43;-2.33	2.56	2.56	0.30785	.	13.968300	0.01841	U	0.035287	T	0.81744	0.4887	N	0.19112	0.55	0.09310	N	0.999999	B;B;B;B;B	0.26775	0.099;0.099;0.159;0.159;0.099	B;B;B;B;B	0.15870	0.005;0.005;0.014;0.011;0.005	T	0.69624	-0.5095	10	0.37606	T	0.19	.	8.5789	0.33617	0.0:0.0:1.0:0.0	.	332;334;293;296;356	Q659W3;Q659W4;Q9NZN9-3;Q9NZN9-2;Q9NZN9	.;.;.;.;AIPL1_HUMAN	I	356;296;293	ENSP00000370521:T356I;ENSP00000250087:T293I	ENSP00000250087:T293I	T	-	2	0	AIPL1	6269592	0.000000	0.05858	0.001000	0.08648	0.012000	0.07955	-1.481000	0.02323	1.405000	0.46838	0.407000	0.27541	ACA	.		0.692	AIPL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219828.3	NM_014336	
SLC35G6	643664	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	7386125	7386125	+	Silent	SNP	C	C	T			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr17:7386125C>T	ENST00000412468.2	+	2	937	c.822C>T	c.(820-822)gtC>gtT	p.V274V	ZBTB4_ENST00000311403.4_Intron|POLR2A_ENST00000572844.1_5'Flank|POLR2A_ENST00000322644.6_5'Flank	NM_001102614.1	NP_001096084.1	P0C7Q6	S35G6_HUMAN	solute carrier family 35, member G6	274	EamA 2.					integral component of membrane (GO:0016021)											GCTATGCGGTCACCAAGGCCC	0.592																																					p.V274V		.											.	.	0			c.C822T						.						146.0	125.0	132.0					17																	7386125		2203	4300	6503	SO:0001819	synonymous_variant	643664	exon2			TGCGGTCACCAAG		CCDS45603.1	17p13.1	2013-05-22	2011-08-03	2011-08-03		ENSG00000259224		"""Solute carriers"""	31351	protein-coding gene	gene with protein product			"""transmembrane protein 21B"", ""acyl-malonyl condensing enzyme 1-like 3"""	TMEM21B, AMAC1L3			Standard	NM_001102614		Approved		uc010cmj.1	P0C7Q6		ENST00000412468.2:c.822C>T	17.37:g.7386125C>T		Somatic	213	1		WXS	Illumina HiSeq	Phase_I	211	30	NM_001102614	0	0	0	0	0		Silent	SNP	ENST00000412468.2	37	CCDS45603.1																																																																																			.		0.592	SLC35G6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001102614	
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C_ENST00000519970.1_Intron|TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y|TVP23C_ENST00000584811.1_5'UTR|TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y|TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y|TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y													.	.	0			c.G152A						.						274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	201158	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr	Somatic	545	73		WXS	Illumina HiSeq		626	86	NM_145301	0	0	18	79	61	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT	.		0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130705.2	NM_145301	
FLCN	201163	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	17119717	17119717	+	Missense_Mutation	SNP	A	A	G			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr17:17119717A>G	ENST00000285071.4	-	11	1731	c.1277T>C	c.(1276-1278)aTc>aCc	p.I426T	RP11-45M22.4_ENST00000427497.3_3'UTR	NM_144997.5	NP_659434.2	Q8NFG4	FLCN_HUMAN	folliculin	426					cell-cell junction assembly (GO:0007043)|hemopoiesis (GO:0030097)|in utero embryonic development (GO:0001701)|negative regulation of ATP biosynthetic process (GO:2001170)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation involved in kidney development (GO:1901723)|negative regulation of energy homeostasis (GO:2000506)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of gene expression (GO:0010629)|negative regulation of mitochondrion organization (GO:0010823)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein localization to nucleus (GO:1900181)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of gene expression (GO:0010628)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cytokinesis (GO:0032465)|regulation of histone acetylation (GO:0035065)|regulation of pro-B cell differentiation (GO:2000973)|regulation of protein phosphorylation (GO:0001932)|regulation of TOR signaling (GO:0032006)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein complex binding (GO:0032403)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(11)|stomach(1)|thyroid(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23						GTGGGGGGGGATCTGCACGTG	0.667									Familial Non-VHL Clear Cell Renal Cancer;Birt-Hogg-Dub syndrome																												p.I426T													.	FLCN-1292	0			c.T1277C						.						81.0	67.0	72.0					17																	17119717		2203	4300	6503	SO:0001583	missense	201163	exon11	Familial Cancer Database	Familial Clear Cell Renal Cell Cancer, FcRCC, Familial Non-VHL Non-Papillary Clear Cell Renal Cancer;BHD, Fibrofolliculomas with Trichodiscomas and Acrochordons, incl.: Hornstein-Knickenberg syndrome, Perifollicular Fibromatosis	GGGGGGATCTGCA	AF517523	CCDS32579.1, CCDS32580.1	17p11.2	2014-09-17			ENSG00000154803	ENSG00000154803			27310	protein-coding gene	gene with protein product		607273					Standard	NM_144997		Approved	BHD, MGC17998, MGC23445	uc002gra.4	Q8NFG4	OTTHUMG00000059275	ENST00000285071.4:c.1277T>C	17.37:g.17119717A>G	ENSP00000285071:p.Ile426Thr	Somatic	37	0		WXS	Illumina HiSeq	Phase_I	41	6	NM_144997	0	0	8	10	2	A6NJJ8|Q6ZRX1|Q96BD2|Q96BE4	Missense_Mutation	SNP	ENST00000285071.4	37	CCDS32579.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.111106	0.77210	.	.	ENSG00000154803	ENST00000285071	D	0.94576	-3.46	5.9	5.9	0.94986	.	0.140262	0.64402	D	0.000005	D	0.93400	0.7895	M	0.68593	2.085	0.80722	D	1	P	0.34462	0.454	B	0.32864	0.154	D	0.93165	0.6561	10	0.72032	D	0.01	-32.1067	16.3313	0.83015	1.0:0.0:0.0:0.0	.	426	Q8NFG4	FLCN_HUMAN	T	426	ENSP00000285071:I426T	ENSP00000285071:I426T	I	-	2	0	FLCN	17060442	1.000000	0.71417	0.996000	0.52242	0.959000	0.62525	8.547000	0.90665	2.266000	0.75297	0.529000	0.55759	ATC	.		0.667	FLCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131577.1	NM_144606	
MYO15A	51168	hgsc.bcm.edu	37	17	18063318	18063318	+	Missense_Mutation	SNP	A	A	G			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr17:18063318A>G	ENST00000205890.5	+	56	9711	c.9373A>G	c.(9373-9375)Acc>Gcc	p.T3125A	MYO15A_ENST00000451725.2_Missense_Mutation_p.T17A|MYO15A_ENST00000418233.3_Missense_Mutation_p.T389A	NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	3125	MyTH4 2. {ECO:0000255|PROSITE- ProRule:PRU00359}.|Tail.				inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					CACAGACAATACCAGCTCCAA	0.562																																					p.T3125A		.											.	MYO15A-97	0			c.A9373G						.						108.0	110.0	110.0					17																	18063318		2118	4230	6348	SO:0001583	missense	51168	exon55			GACAATACCAGCT	AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.9373A>G	17.37:g.18063318A>G	ENSP00000205890:p.Thr3125Ala	Somatic	28	0		WXS	Illumina HiSeq	Phase_I	35	2	NM_016239	0	0	0	0	0	B4DFC7	Missense_Mutation	SNP	ENST00000205890.5	37	CCDS42271.1	.	.	.	.	.	.	.	.	.	.	A	12.13	1.844770	0.32606	.	.	ENSG00000091536	ENST00000205890;ENST00000418233;ENST00000556535;ENST00000557190;ENST00000451725	D;D;D	0.91521	-2.86;-2.86;-2.86	5.6	4.52	0.55395	MyTH4 domain (3);	.	.	.	.	D	0.87842	0.6279	L	0.56396	1.775	0.48135	D	0.999593	B;B;B;B;P	0.44776	0.106;0.039;0.006;0.058;0.843	B;B;B;B;B	0.40659	0.147;0.052;0.02;0.076;0.336	D	0.85057	0.0932	9	0.35671	T	0.21	.	11.4255	0.50007	0.9294:0.0:0.0706:0.0	.	17;114;389;3125;132	B4DQJ3;B4DLV9;B4DFC7;Q9UKN7;Q8TCK0	.;.;.;MYO15_HUMAN;.	A	3125;114;79;17;17	ENSP00000205890:T3125A;ENSP00000451782:T79A;ENSP00000409098:T17A	ENSP00000205890:T3125A	T	+	1	0	MYO15A	18004043	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.660000	0.54496	0.967000	0.38186	0.459000	0.35465	ACC	.		0.562	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132048.1	NM_016239	
ZNF207	7756	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	30687743	30687743	+	Missense_Mutation	SNP	C	C	A			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr17:30687743C>A	ENST00000321233.6	+	4	588	c.434C>A	c.(433-435)cCa>cAa	p.P145Q	ZNF207_ENST00000577908.1_Missense_Mutation_p.P145Q|RP11-227G15.3_ENST00000581915.1_RNA|ZNF207_ENST00000341711.6_Intron|ZNF207_ENST00000342555.6_Missense_Mutation_p.P148Q|ZNF207_ENST00000394673.2_Missense_Mutation_p.P145Q|ZNF207_ENST00000394670.4_Missense_Mutation_p.P145Q	NM_003457.3	NP_003448.1	O43670	ZN207_HUMAN	zinc finger protein 207	145					attachment of spindle microtubules to kinetochore (GO:0008608)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|protein stabilization (GO:0050821)|regulation of chromosome segregation (GO:0051983)|regulation of transcription, DNA-templated (GO:0006355)	kinetochore (GO:0000776)|microtubule (GO:0005874)|nucleus (GO:0005634)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|lung(3)|urinary_tract(2)	10		Breast(31;0.116)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.239)			ATGGCACAGCCAGGACTGCCA	0.443																																					p.P145Q		.											.	ZNF207-90	0			c.C434A						.						60.0	51.0	54.0					17																	30687743		2203	4300	6503	SO:0001583	missense	7756	exon4			CACAGCCAGGACT	AF046001	CCDS11271.1, CCDS32614.1, CCDS42294.1	17q11.2	2008-07-10			ENSG00000010244	ENSG00000010244		"""Zinc fingers, C2H2-type"""	12998	protein-coding gene	gene with protein product		603428				9799612	Standard	NM_001098507		Approved		uc002hhj.4	O43670	OTTHUMG00000132810	ENST00000321233.6:c.434C>A	17.37:g.30687743C>A	ENSP00000322777:p.Pro145Gln	Somatic	48	1		WXS	Illumina HiSeq	Phase_I	69	13	NM_003457	0	0	97	134	37	A8K6Y6|E1P660|E1P661|E1P662|Q53XS9|Q96HW5|Q9BUQ7	Missense_Mutation	SNP	ENST00000321233.6	37	CCDS11271.1	.	.	.	.	.	.	.	.	.	.	C	10.67	1.415696	0.25552	.	.	ENSG00000010244	ENST00000394670;ENST00000394673;ENST00000394679;ENST00000321233;ENST00000342555	T;T;T	0.50813	0.74;0.73;0.74	5.27	5.27	0.74061	.	0.165688	0.53938	D	0.000051	T	0.51873	0.1700	M	0.62723	1.935	0.80722	D	1	P;P;P;P;P	0.49090	0.919;0.919;0.919;0.799;0.799	P;P;P;B;B	0.46110	0.504;0.504;0.504;0.367;0.367	T	0.47873	-0.9083	10	0.18710	T	0.47	.	18.8845	0.92370	0.0:1.0:0.0:0.0	.	145;148;145;145;145	A8MTG3;Q59G94;E1P660;O43670-2;O43670	.;.;.;.;ZN207_HUMAN	Q	145;145;148;145;145	ENSP00000378165:P145Q;ENSP00000378168:P145Q;ENSP00000322777:P145Q	ENSP00000322777:P145Q	P	+	2	0	ZNF207	27711856	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.611000	0.61162	2.463000	0.83235	0.655000	0.94253	CCA	.		0.443	ZNF207-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256251.2		
KRTAP4-6	81871	broad.mit.edu	37	17	39296329	39296329	+	Silent	SNP	T	T	G			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr17:39296329T>G	ENST00000345847.4	-	1	410	c.411A>C	c.(409-411)ccA>ccC	p.P137P		NM_030976.1	NP_112238.1	Q9BYQ5	KRA46_HUMAN	keratin associated protein 4-6	137	30 X 5 AA repeats of C-C-[IRQVEL]-[SPTR]- [STVQRCP].					keratin filament (GO:0045095)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(1)|prostate(1)|urinary_tract(1)	9						ggcagcagGTTGGCTGGCAGC	0.682																																					p.P137P													.	.	0			c.A411C						.																																			SO:0001819	synonymous_variant	81871	exon1			GCAGGTTGGCTGG	AJ406938	CCDS54125.1	17q21.2	2013-06-25			ENSG00000198090	ENSG00000198090		"""Keratin associated proteins"""	18909	protein-coding gene	gene with protein product			"""keratin associated protein 4-15"""	KRTAP4-15			Standard	NM_030976		Approved	KAP4.6, KAP4.15	uc010cxk.2	Q9BYQ5	OTTHUMG00000133634	ENST00000345847.4:c.411A>C	17.37:g.39296329T>G		Somatic	48	0		WXS	Illumina HiSeq	Phase_I	67	4	NM_030976	0	0	0	0	0	Q9BYR1	Silent	SNP	ENST00000345847.4	37	CCDS54125.1																																																																																			.		0.682	KRTAP4-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257779.1		
SKAP1	8631	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	46266785	46266785	+	Splice_Site	SNP	C	C	T			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr17:46266785C>T	ENST00000336915.6	-	5	427	c.358G>A	c.(358-360)Gat>Aat	p.D120N	SKAP1_ENST00000584924.1_Splice_Site_p.D120N|RP11-456D7.1_ENST00000582246.1_RNA	NM_001075099.1|NM_003726.3	NP_001068567.1|NP_003717.3	Q86WV1	SKAP1_HUMAN	src kinase associated phosphoprotein 1	120	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				positive regulation of signal transduction (GO:0009967)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|SH2 domain binding (GO:0042169)|SH3 domain binding (GO:0017124)|SH3/SH2 adaptor activity (GO:0005070)			large_intestine(1)|lung(10)|prostate(2)|skin(4)|urinary_tract(1)	18						TGACCAATACCTTTGCTTTTC	0.433																																					p.D120N		.											.	SKAP1-90	0			c.G358A						.						183.0	146.0	158.0					17																	46266785		2203	4300	6503	SO:0001630	splice_region_variant	8631	exon5			CAATACCTTTGCT	Y11215	CCDS32674.1	17q21.32	2013-01-10	2006-09-28	2006-09-28		ENSG00000141293		"""Pleckstrin homology (PH) domain containing"""	15605	protein-coding gene	gene with protein product		604969	"""src family associated phosphoprotein 1"""	SCAP1		9195899	Standard	NM_003726		Approved	SKAP55	uc002ini.1	Q86WV1		ENST00000336915.6:c.358+1G>A	17.37:g.46266785C>T		Somatic	108	0		WXS	Illumina HiSeq	Phase_I	118	24	NM_003726	0	0	0	0	0	D3DTV1|O15268	Missense_Mutation	SNP	ENST00000336915.6	37	CCDS32674.1	.	.	.	.	.	.	.	.	.	.	C	16.00	2.998944	0.54147	.	.	ENSG00000141293	ENST00000336915	T	0.11821	2.74	5.61	5.61	0.85477	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.35770	0.0943	L	0.60904	1.88	0.58432	D	0.999998	P;D	0.76494	0.536;0.999	P;D	0.79784	0.614;0.993	T	0.00783	-1.1568	9	.	.	.	-29.0873	19.225	0.93815	0.0:1.0:0.0:0.0	.	120;120	Q86WV1-2;Q86WV1	.;SKAP1_HUMAN	N	120	ENSP00000338171:D120N	.	D	-	1	0	SKAP1	43621784	1.000000	0.71417	1.000000	0.80357	0.870000	0.49936	6.108000	0.71522	2.640000	0.89533	0.563000	0.77884	GAT	.		0.433	SKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443432.1	NM_003726	Missense_Mutation
FN3KRP	79672	broad.mit.edu	37	17	80674717	80674717	+	Missense_Mutation	SNP	G	G	A	rs138953335		TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr17:80674717G>A	ENST00000269373.6	+	1	159	c.86G>A	c.(85-87)cGg>cAg	p.R29Q	RP11-388C12.1_ENST00000574471.1_lincRNA|FN3KRP_ENST00000535965.1_5'UTR	NM_024619.3	NP_078895.2	Q9HA64	KT3K_HUMAN	fructosamine 3 kinase related protein	29							kinase activity (GO:0016301)			breast(1)|large_intestine(2)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	7	Breast(20;0.000523)|all_neural(118;0.0952)		BRCA - Breast invasive adenocarcinoma(99;0.0344)|OV - Ovarian serous cystadenocarcinoma(97;0.061)			AGCCAGGGCCGGAGCTACGAC	0.701													G|||	1	0.000199681	0.0	0.0	5008	,	,		8572	0.0		0.001	False		,,,				2504	0.0				p.R29Q													.	FN3KRP-115	0			c.G86A						.	G	GLN/ARG	0,4400		0,0,2200	29.0	31.0	30.0		86	0.5	1.0	17	dbSNP_134	30	2,8588		0,2,4293	yes	missense	FN3KRP	NM_024619.3	43	0,2,6493	AA,AG,GG		0.0233,0.0,0.0154	benign	29/310	80674717	2,12988	2200	4295	6495	SO:0001583	missense	79672	exon1			AGGGCCGGAGCTA	AY360465	CCDS11817.1	17q25.3	2014-08-12			ENSG00000141560	ENSG00000141560			25700	protein-coding gene	gene with protein product		611683				14633848	Standard	NM_024619		Approved	FLJ12171, FN3KL	uc002kfu.3	Q9HA64	OTTHUMG00000177846	ENST00000269373.6:c.86G>A	17.37:g.80674717G>A	ENSP00000269373:p.Arg29Gln	Somatic	50	0		WXS	Illumina HiSeq	Phase_I	56	3	NM_024619	0	0	19	19	0	Q969F4|Q9H0U7	Missense_Mutation	SNP	ENST00000269373.6	37	CCDS11817.1	.	.	.	.	.	.	.	.	.	.	G	10.73	1.433978	0.25813	0.0	2.33E-4	ENSG00000141560	ENST00000269373	T	0.51071	0.72	5.29	0.486	0.16836	Protein kinase-like domain (1);	0.111667	0.64402	N	0.000005	T	0.20495	0.0493	N	0.03154	-0.405	0.80722	D	1	B	0.02656	0.0	B	0.09377	0.004	T	0.04178	-1.0971	10	0.25106	T	0.35	-18.0073	9.3104	0.37900	0.7114:0.0:0.2886:0.0	.	29	Q9HA64	KT3K_HUMAN	Q	29	ENSP00000269373:R29Q	ENSP00000269373:R29Q	R	+	2	0	FN3KRP	78268006	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	2.337000	0.43947	0.065000	0.16485	-0.312000	0.09012	CGG	G|1.000;A|0.000		0.701	FN3KRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439219.1	NM_024619	
PTPRM	5797	broad.mit.edu	37	18	8376563	8376563	+	Missense_Mutation	SNP	C	C	T			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr18:8376563C>T	ENST00000332175.8	+	24	4428	c.3391C>T	c.(3391-3393)Cgg>Tgg	p.R1131W	PTPRM_ENST00000580170.1_Missense_Mutation_p.R1144W|PTPRM_ENST00000400053.4_Missense_Mutation_p.R1069W|PTPRM_ENST00000444013.1_Missense_Mutation_p.R918W|PTPRM_ENST00000400060.4_Missense_Mutation_p.R1145W	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	1131	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				CAGGGAGCTGCGGTCACGGAG	0.572																																					p.R1144W													.	PTPRM-228	0			c.C3430T						.						134.0	107.0	116.0					18																	8376563		2203	4300	6503	SO:0001583	missense	5797	exon26			GAGCTGCGGTCAC	X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.3391C>T	18.37:g.8376563C>T	ENSP00000331418:p.Arg1131Trp	Somatic	84	0		WXS	Illumina HiSeq	Phase_I	67	4	NM_001105244	0	0	39	39	0	A7MBN1|D3DUH8|J3QL11	Missense_Mutation	SNP	ENST00000332175.8	37	CCDS11840.1	.	.	.	.	.	.	.	.	.	.	C	29.5	5.010361	0.93346	.	.	ENSG00000173482	ENST00000332175;ENST00000400060;ENST00000400053;ENST00000444013	D;D;D;D	0.91631	-2.88;-2.88;-2.88;-2.88	5.88	5.88	0.94601	Protein-tyrosine phosphatase, receptor/non-receptor type (4);Protein-tyrosine/Dual-specificity phosphatase (1);	0.000000	0.85682	D	0.000000	D	0.97845	0.9292	H	0.97540	4.025	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.98415	1.0574	10	0.72032	D	0.01	.	20.2314	0.98350	0.0:1.0:0.0:0.0	.	918;1144;1131	E7EVX9;A7MBN1;P28827	.;.;PTPRM_HUMAN	W	1131;1145;1069;918	ENSP00000331418:R1131W;ENSP00000382933:R1145W;ENSP00000382927:R1069W;ENSP00000387608:R918W	ENSP00000331418:R1131W	R	+	1	2	PTPRM	8366563	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.781000	0.62389	2.789000	0.95967	0.591000	0.81541	CGG	.		0.572	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254456.1		
TMX3	54495	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	66378637	66378637	+	Missense_Mutation	SNP	A	A	C			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr18:66378637A>C	ENST00000299608.2	-	3	421	c.105T>G	c.(103-105)ttT>ttG	p.F35L	TMX3_ENST00000562706.1_Missense_Mutation_p.F35L|TMX3_ENST00000443099.2_Missense_Mutation_p.F35L	NM_019022.3	NP_061895.3	Q96JJ7	TMX3_HUMAN	thioredoxin-related transmembrane protein 3	35	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein disulfide isomerase activity (GO:0003756)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	17						GATTTTCTTTAAACCTAAAAA	0.279																																					p.F35L		.											.	TMX3-91	0			c.T105G						.						84.0	90.0	88.0					18																	66378637		2202	4289	6491	SO:0001583	missense	54495	exon3			TTCTTTAAACCTA	BX647846	CCDS32840.1	18q22	2011-10-19	2009-02-23	2009-02-23		ENSG00000166479		"""Protein disulfide isomerases"""	24718	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 13"""		"""thioredoxin domain containing 10"""	TXNDC10		15623505	Standard	NM_019022		Approved	FLJ20793, KIAA1830, PDIA13	uc002lkf.3	Q96JJ7		ENST00000299608.2:c.105T>G	18.37:g.66378637A>C	ENSP00000299608:p.Phe35Leu	Somatic	124	0		WXS	Illumina HiSeq	Phase_I	92	37	NM_019022	0	0	0	0	0	B3KV75|Q52LT7|Q8N5J0|Q9NWJ9	Missense_Mutation	SNP	ENST00000299608.2	37	CCDS32840.1	.	.	.	.	.	.	.	.	.	.	A	25.2	4.615363	0.87359	.	.	ENSG00000166479	ENST00000299608;ENST00000544714;ENST00000443099	T;T;T	0.06608	3.28;3.28;3.28	5.36	5.36	0.76844	Thioredoxin domain (1);Thioredoxin-like fold (3);	0.000000	0.85682	D	0.000000	T	0.26955	0.0660	M	0.83384	2.64	0.80722	D	1	D;D;D	0.89917	1.0;0.998;1.0	D;D;D	0.91635	0.998;0.986;0.999	T	0.01596	-1.1316	10	0.52906	T	0.07	.	13.3017	0.60328	1.0:0.0:0.0:0.0	.	35;35;35	B4DIE3;Q96JJ7-2;Q96JJ7	.;.;TMX3_HUMAN	L	35	ENSP00000299608:F35L;ENSP00000444954:F35L;ENSP00000402605:F35L	ENSP00000299608:F35L	F	-	3	2	TMX3	64529617	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	4.620000	0.61226	2.042000	0.60477	0.528000	0.53228	TTT	.		0.279	TMX3-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420155.1	NM_019022	
ATP8B3	148229	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	1785678	1785678	+	Missense_Mutation	SNP	C	C	A			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr19:1785678C>A	ENST00000310127.6	-	26	3421	c.3183G>T	c.(3181-3183)aaG>aaT	p.K1061N	ATP8B3_ENST00000539485.1_Missense_Mutation_p.K1071N|ATP8B3_ENST00000525591.1_Missense_Mutation_p.K1024N	NM_138813.3	NP_620168.1	O60423	AT8B3_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 3	1061					binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACAGCTCCGGCTTCTCCAGGC	0.602																																					p.K1061N		.											.	.	0			c.G3183T						.						26.0	29.0	28.0					19																	1785678		2120	4237	6357	SO:0001583	missense	148229	exon26			CTCCGGCTTCTCC	AA827939	CCDS45901.1, CCDS54196.1	19p13.3	2010-04-28	2010-04-28		ENSG00000130270	ENSG00000130270		"""ATPases / P-type"""	13535	protein-coding gene	gene with protein product	"""aminophospholipid translocase ATP8B3"", ""potential phospholipid-transporting ATPase IK"""	605866	"""ATPase, Class I, type 8B, member 3"", ""ATPase, class I, type 8B, member 3"""			11015572	Standard	NM_138813		Approved	ATPIK	uc002ltw.4	O60423	OTTHUMG00000166189	ENST00000310127.6:c.3183G>T	19.37:g.1785678C>A	ENSP00000311336:p.Lys1061Asn	Somatic	25	0		WXS	Illumina HiSeq	Phase_I	28	7	NM_138813	0	0	1	1	0	Q7Z485|Q8IVB8|Q8N4Y8|Q96M22	Missense_Mutation	SNP	ENST00000310127.6	37	CCDS45901.1	.	.	.	.	.	.	.	.	.	.	C	8.917	0.960236	0.18507	.	.	ENSG00000130270	ENST00000310127;ENST00000539485;ENST00000525591	T;T;T	0.70516	-0.49;-0.49;-0.49	4.48	3.39	0.38822	.	0.558416	0.19418	N	0.114773	T	0.40815	0.1132	N	0.02697	-0.525	0.23855	N	0.996656	B;B	0.30664	0.289;0.086	B;B	0.23275	0.045;0.045	T	0.33420	-0.9869	10	0.66056	D	0.02	.	6.6084	0.22737	0.149:0.5306:0.3204:0.0	.	1061;1024	O60423;Q7Z485	AT8B3_HUMAN;.	N	1061;1071;1024	ENSP00000311336:K1061N;ENSP00000443574:K1071N;ENSP00000437115:K1024N	ENSP00000311336:K1061N	K	-	3	2	ATP8B3	1736678	0.965000	0.33210	0.457000	0.27056	0.051000	0.14879	1.815000	0.38981	2.027000	0.59764	0.655000	0.94253	AAG	.		0.602	ATP8B3-002	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388279.1	NM_138813	
SUGP2	10147	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	19115397	19115397	+	Missense_Mutation	SNP	G	G	T			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr19:19115397G>T	ENST00000601879.1	-	7	2806	c.2509C>A	c.(2509-2511)Cta>Ata	p.L837I	SUGP2_ENST00000600377.1_Missense_Mutation_p.L851I|SUGP2_ENST00000337018.6_Missense_Mutation_p.L837I|SUGP2_ENST00000452918.2_Missense_Mutation_p.L837I|SUGP2_ENST00000456085.2_Missense_Mutation_p.L606I			Q8IX01	SUGP2_HUMAN	SURP and G patch domain containing 2	837					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	43						GATGGACATAGTTCAAACACT	0.463																																					p.L837I		.											.	SUGP2-91	0			c.C2509A						.						74.0	73.0	73.0					19																	19115397		2203	4300	6503	SO:0001583	missense	10147	exon7			GACATAGTTCAAA	AB002363	CCDS12392.1	19p13	2013-01-28	2010-08-10	2010-08-10	ENSG00000064607	ENSG00000064607		"""G patch domain containing"""	18641	protein-coding gene	gene with protein product		607993	"""splicing factor, arginine/serine-rich 14"""	SFRS14		12594045	Standard	NM_014884		Approved	KIAA0365	uc002nkx.2	Q8IX01		ENST00000601879.1:c.2509C>A	19.37:g.19115397G>T	ENSP00000472286:p.Leu837Ile	Somatic	147	0		WXS	Illumina HiSeq	Phase_I	153	41	NM_014884	0	0	6	11	5	C9JI71|O15071|O60369|Q5JPH7|Q8WUF7	Missense_Mutation	SNP	ENST00000601879.1	37	CCDS12392.1	.	.	.	.	.	.	.	.	.	.	G	18.29	3.590575	0.66219	.	.	ENSG00000064607	ENST00000337018;ENST00000330854;ENST00000452918;ENST00000456085	T;T;T;T	0.39592	1.07;1.07;1.07;1.07	5.26	5.26	0.73747	SWAP/Surp (1);	0.000000	0.42294	D	0.000725	T	0.46151	0.1378	N	0.16307	0.4	0.39998	D	0.975121	D;D;D	0.76494	0.999;0.976;0.999	D;D;D	0.87578	0.998;0.914;0.997	T	0.45366	-0.9266	10	0.41790	T	0.15	-13.6122	11.5508	0.50719	0.086:0.0:0.914:0.0	.	606;837;837	E7ETX7;A8K5G0;Q8IX01	.;.;SUGP2_HUMAN	I	837;837;837;606	ENSP00000337926:L837I;ENSP00000332373:L837I;ENSP00000389380:L837I;ENSP00000409603:L606I	ENSP00000332373:L837I	L	-	1	2	SUGP2	18976397	1.000000	0.71417	1.000000	0.80357	0.820000	0.46376	1.688000	0.37690	2.459000	0.83118	0.563000	0.77884	CTA	.		0.463	SUGP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464627.1	NM_001017392	
ALDH16A1	126133	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	49969107	49969107	+	Missense_Mutation	SNP	G	G	A			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr19:49969107G>A	ENST00000293350.4	+	13	1844	c.1681G>A	c.(1681-1683)Ggt>Agt	p.G561S	ALDH16A1_ENST00000433981.2_Missense_Mutation_p.G396S|ALDH16A1_ENST00000540132.1_Missense_Mutation_p.G398S|CTD-3148I10.9_ENST00000599536.1_Intron|ALDH16A1_ENST00000455361.2_Missense_Mutation_p.G510S	NM_153329.3	NP_699160.2	Q8IZ83	A16A1_HUMAN	aldehyde dehydrogenase 16 family, member A1	561						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			cervix(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|skin(2)|urinary_tract(3)	20		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0251)		CGTGGCTGAGGGTGGAGCCAA	0.642																																					p.G561S		.											.	ALDH16A1-91	0			c.G1681A						.						39.0	40.0	40.0					19																	49969107		2203	4300	6503	SO:0001583	missense	126133	exon13			GCTGAGGGTGGAG	AY007096	CCDS12766.1, CCDS46141.1	19q13.33	2014-08-12			ENSG00000161618	ENSG00000161618		"""Aldehyde dehydrogenases"""	28114	protein-coding gene	gene with protein product		613358					Standard	NM_153329		Approved	MGC10204	uc002pnt.3	Q8IZ83	OTTHUMG00000183163	ENST00000293350.4:c.1681G>A	19.37:g.49969107G>A	ENSP00000293350:p.Gly561Ser	Somatic	69	0		WXS	Illumina HiSeq	Phase_I	55	13	NM_153329	0	1	21	44	22	B4DLQ1|C9JBH6|Q86YF0|Q8IYL4|Q8TEI8	Missense_Mutation	SNP	ENST00000293350.4	37	CCDS12766.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.007403	0.75046	.	.	ENSG00000161618	ENST00000293350;ENST00000455361;ENST00000540132;ENST00000433981	T;T;T;T	0.75938	-0.98;-0.98;-0.98;-0.98	4.77	4.77	0.60923	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.220696	0.37623	N	0.002003	D	0.83751	0.5322	M	0.64567	1.98	0.44254	D	0.997108	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.84182	0.0440	10	0.46703	T	0.11	-20.3157	15.3078	0.74008	0.0:0.0:1.0:0.0	.	398;510;561	F5H4B6;B4DLQ1;Q8IZ83	.;.;A16A1_HUMAN	S	561;510;398;396	ENSP00000293350:G561S;ENSP00000410142:G510S;ENSP00000445088:G398S;ENSP00000398675:G396S	ENSP00000293350:G561S	G	+	1	0	ALDH16A1	54660919	0.985000	0.35326	0.999000	0.59377	0.666000	0.39218	1.078000	0.30754	2.206000	0.71126	0.561000	0.74099	GGT	.		0.642	ALDH16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465358.1	NM_153329	
ZNF836	162962	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	52659397	52659397	+	Silent	SNP	G	G	A			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr19:52659397G>A	ENST00000322146.8	-	5	2060	c.1539C>T	c.(1537-1539)ctC>ctT	p.L513L	CTC-471J1.8_ENST00000594362.1_RNA|ZNF836_ENST00000597252.1_Silent_p.L513L	NM_001102657.1	NP_001096127.1	Q6ZNA1	ZN836_HUMAN	zinc finger protein 836	513					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						TATGTCGAGTGAGTAATGAGC	0.388																																					p.L513L		.											.	ZNF836-46	0			c.C1539T						.						75.0	84.0	81.0					19																	52659397		2186	4294	6480	SO:0001819	synonymous_variant	162962	exon5			TCGAGTGAGTAAT	BC011784	CCDS46162.1	19q13.33	2013-01-08			ENSG00000196267	ENSG00000196267		"""Zinc fingers, C2H2-type"", ""-"""	34333	protein-coding gene	gene with protein product							Standard	NM_001102657		Approved	FLJ16287	uc010ydj.2	Q6ZNA1		ENST00000322146.8:c.1539C>T	19.37:g.52659397G>A		Somatic	131	0		WXS	Illumina HiSeq	Phase_I	109	29	NM_001102657	0	0	3	3	0		Silent	SNP	ENST00000322146.8	37	CCDS46162.1																																																																																			.		0.388	ZNF836-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462456.1	NM_001102657	
NLRP11	204801	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	56329449	56329449	+	Missense_Mutation	SNP	G	G	T			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr19:56329449G>T	ENST00000589093.1	-	2	185	c.92C>A	c.(91-93)gCa>gAa	p.A31E	NLRP11_ENST00000443188.1_Missense_Mutation_p.A31E|NLRP11_ENST00000589824.2_Missense_Mutation_p.A31E|NLRP11_ENST00000592953.1_Intron|NLRP11_ENST00000360133.3_Missense_Mutation_p.A31E			P59045	NAL11_HUMAN	NLR family, pyrin domain containing 11	31	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.						ATP binding (GO:0005524)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen (GO:0016715)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	66		Colorectal(82;0.0002)		GBM - Glioblastoma multiforme(193;0.0325)		AATCTTGCGTGCCAGATACTT	0.413																																					p.A31E		.											.	NLRP11-169	0			c.C92A						.						135.0	126.0	129.0					19																	56329449		2203	4300	6503	SO:0001583	missense	204801	exon4			TTGCGTGCCAGAT	AY095145	CCDS12935.1, CCDS74458.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179873		"""Nucleotide-binding domain and leucine rich repeat containing"""	22945	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 11"""	609664	"""NACHT, leucine rich repeat and PYD containing 11"""	NALP11		12563287, 12019269	Standard	NM_145007		Approved	PYPAF6, NOD17, PAN10, CLR19.6	uc010ygf.2	P59045		ENST00000589093.1:c.92C>A	19.37:g.56329449G>T	ENSP00000466285:p.Ala31Glu	Somatic	129	0		WXS	Illumina HiSeq	Phase_I	113	28	NM_145007	0	0	0	0	0	C9JSF5|Q2TV85|Q2TV86|Q53ZZ0|Q8NBF5	Missense_Mutation	SNP	ENST00000589093.1	37	CCDS12935.1	.	.	.	.	.	.	.	.	.	.	G	0.719	-0.784370	0.02907	.	.	ENSG00000179873	ENST00000443188;ENST00000360133	T;T	0.48522	0.81;0.81	2.56	-5.13	0.02884	Pyrin (2);DEATH-like (2);	.	.	.	.	T	0.23846	0.0577	N	0.22421	0.69	0.09310	N	1	B	0.18461	0.028	B	0.26094	0.066	T	0.26360	-1.0105	9	0.18710	T	0.47	.	0.3757	0.00387	0.2979:0.2202:0.2836:0.1983	.	31	P59045	NAL11_HUMAN	E	31	ENSP00000409898:A31E;ENSP00000353251:A31E	ENSP00000353251:A31E	A	-	2	0	NLRP11	61021261	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.568000	0.02144	-1.980000	0.00990	-2.070000	0.00385	GCA	.		0.413	NLRP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453657.1	NM_145007	
KHK	3795	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	27322367	27322367	+	Missense_Mutation	SNP	T	T	C			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr2:27322367T>C	ENST00000260599.6	+	7	1246	c.733T>C	c.(733-735)Ttc>Ctc	p.F245L	KHK_ENST00000490823.1_3'UTR|KHK_ENST00000260598.5_Missense_Mutation_p.F245L|CGREF1_ENST00000402550.1_3'UTR|CGREF1_ENST00000452318.2_3'UTR	NM_000221.2	NP_000212.1	P50053	KHK_HUMAN	ketohexokinase (fructokinase)	245					carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose catabolic process (GO:0006001)|regulation of glycogen metabolic process (GO:0070873)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ketohexokinase activity (GO:0004454)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(2)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTCGGATGCTTTCCCGCCACC	0.637																																					p.F245L		.											.	KHK-115	0			c.T733C						.						80.0	82.0	82.0					2																	27322367		2203	4300	6503	SO:0001583	missense	3795	exon7			GATGCTTTCCCGC		CCDS1734.1, CCDS1735.1	2p23.3-p23.2	2008-02-05			ENSG00000138030	ENSG00000138030	2.7.1.3		6315	protein-coding gene	gene with protein product		614058				7833921	Standard	NM_000221		Approved		uc002rim.2	P50053	OTTHUMG00000097077	ENST00000260599.6:c.733T>C	2.37:g.27322367T>C	ENSP00000260599:p.Phe245Leu	Somatic	133	0		WXS	Illumina HiSeq	Phase_I	98	27	NM_006488	0	0	5	5	0	Q6IBK2|Q99532|Q9BRJ3|Q9UMN1	Missense_Mutation	SNP	ENST00000260599.6	37	CCDS1734.1	.	.	.	.	.	.	.	.	.	.	T	17.98	3.519838	0.64634	.	.	ENSG00000138030	ENST00000260599;ENST00000260598	T;T	0.75477	-0.94;-0.94	5.29	4.11	0.48088	Carbohydrate/purine kinase (1);	0.048848	0.85682	D	0.000000	T	0.71324	0.3326	M	0.66939	2.045	0.80722	D	1	B;P;B;P	0.51791	0.021;0.948;0.08;0.948	B;B;B;B	0.43052	0.022;0.406;0.049;0.406	T	0.69621	-0.5096	10	0.38643	T	0.18	-12.9402	10.6793	0.45804	0.0:0.0:0.1603:0.8397	.	245;245;245;245	Q53G56;Q6IBK2;P50053-2;P50053	.;.;.;KHK_HUMAN	L	245	ENSP00000260599:F245L;ENSP00000260598:F245L	ENSP00000260598:F245L	F	+	1	0	KHK	27175871	1.000000	0.71417	0.979000	0.43373	0.490000	0.33462	4.841000	0.62824	0.811000	0.34303	0.454000	0.30748	TTC	.		0.637	KHK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214196.1		
DNAJC5G	285126	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	27503082	27503082	+	Nonstop_Mutation	SNP	A	A	T			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr2:27503082A>T	ENST00000296097.3	+	6	987	c.569A>T	c.(568-570)tAa>tTa	p.*190L	DNAJC5G_ENST00000406962.1_Nonsense_Mutation_p.K103*|TRIM54_ENST00000380075.2_5'Flank|TRIM54_ENST00000296098.4_5'Flank|DNAJC5G_ENST00000402462.1_Nonstop_Mutation_p.*190L|DNAJC5G_ENST00000404433.1_Nonstop_Mutation_p.*174L	NM_173650.1	NP_775921.1	Q8N7S2	DNJ5G_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 5 gamma	0						membrane (GO:0016020)				cervix(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GATGATTTTTAAGAGATGAAG	0.333											OREG0014517	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.X190L		.											.	DNAJC5G-226	0			c.A569T						.						141.0	153.0	149.0					2																	27503082		2203	4300	6503	SO:0001578	stop_lost	285126	exon6			ATTTTTAAGAGAT	AF368277	CCDS1744.1	2p23	2011-09-02			ENSG00000163793	ENSG00000163793		"""Heat shock proteins / DNAJ (HSP40)"""	24844	protein-coding gene	gene with protein product		613946					Standard	NM_173650		Approved	FLJ40417, CSP-gamma	uc002rjl.1	Q8N7S2	OTTHUMG00000097079	ENST00000296097.3:c.569A>T	2.37:g.27503082A>T	ENSP00000296097:p.*190Leuext*11	Somatic	244	0	794	WXS	Illumina HiSeq	Phase_I	215	64	NM_173650	0	0	0	0	0	B4DY29|Q53SY5|Q8IYQ4|Q96RJ8	Missense_Mutation	SNP	ENST00000296097.3	37	CCDS1744.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.13|16.13	3.037320|3.037320	0.54896|0.54896	.|.	.|.	ENSG00000163793|ENSG00000163793	ENST00000406962|ENST00000296097;ENST00000402462;ENST00000404433	.|.	.|.	.|.	3.86|3.86	0.87|0.87	0.19102|0.19102	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	2.2003|2.2003	0.03921|0.03921	0.5749:0.0:0.1962:0.2289|0.5749:0.0:0.1962:0.2289	.|.	.|.	.|.	.|.	X|L	103|190;190;174	.|.	.|.	K|X	+|+	1|2	0|2	DNAJC5G|DNAJC5G	27356586|27356586	0.017000|0.017000	0.18338|0.18338	0.000000|0.000000	0.03702|0.03702	0.353000|0.353000	0.29299|0.29299	0.770000|0.770000	0.26618|0.26618	0.154000|0.154000	0.19237|0.19237	0.379000|0.379000	0.24179|0.24179	AAG|TAA	.		0.333	DNAJC5G-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000214200.1	NM_173650	
LTBP1	4052	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	33359941	33359941	+	Missense_Mutation	SNP	A	A	C			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr2:33359941A>C	ENST00000404816.2	+	5	1468	c.1115A>C	c.(1114-1116)aAc>aCc	p.N372T	LTBP1_ENST00000354476.3_Missense_Mutation_p.N372T|LTBP1_ENST00000418533.2_Missense_Mutation_p.N46T|LTBP1_ENST00000407925.1_Missense_Mutation_p.N46T|LTBP1_ENST00000404525.1_Missense_Mutation_p.N46T|LTBP1_ENST00000402934.1_Missense_Mutation_p.N46T|LTBP1_ENST00000390003.4_Missense_Mutation_p.N46T			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	372					extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				AGCTGTCAGAACAGCTGTGAG	0.562																																					p.N372T		.											.	LTBP1-230	0			c.A1115C						.						101.0	86.0	92.0					2																	33359941		2203	4300	6503	SO:0001583	missense	4052	exon5			GTCAGAACAGCTG		CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.1115A>C	2.37:g.33359941A>C	ENSP00000386043:p.Asn372Thr	Somatic	63	0		WXS	Illumina HiSeq	Phase_I	74	23	NM_206943	0	0	18	19	1	A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Missense_Mutation	SNP	ENST00000404816.2	37	CCDS33177.2	.	.	.	.	.	.	.	.	.	.	A	22.4	4.287221	0.80803	.	.	ENSG00000049323	ENST00000404816;ENST00000354476;ENST00000432635;ENST00000390003;ENST00000418533;ENST00000402934;ENST00000404525;ENST00000407925	D;D;D;D;D;D;D	0.84873	-1.91;-1.91;-1.72;-1.66;-1.75;-1.73;-1.69	5.57	5.57	0.84162	.	.	.	.	.	D	0.91133	0.7208	M	0.62723	1.935	0.80722	D	1	D;D;D;D;D;D	0.89917	0.998;0.999;1.0;0.999;0.999;0.999	D;D;D;D;D;D	0.97110	0.995;0.998;1.0;0.998;0.998;0.998	D	0.92071	0.5664	9	0.87932	D	0	.	15.7244	0.77743	1.0:0.0:0.0:0.0	.	372;46;46;46;46;372	Q14766;E7EV71;Q14766-3;Q14766-2;Q14766-5;Q14766-4	LTBP1_HUMAN;.;.;.;.;.	T	372;372;61;46;46;46;46;46	ENSP00000386043:N372T;ENSP00000346467:N372T;ENSP00000374653:N46T;ENSP00000393057:N46T;ENSP00000384373:N46T;ENSP00000385359:N46T;ENSP00000384091:N46T	ENSP00000346467:N372T	N	+	2	0	LTBP1	33213445	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.228000	0.95250	2.110000	0.64415	0.379000	0.24179	AAC	.		0.562	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326227.2	NM_206943	
IMMT	10989	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	86371396	86371396	+	Missense_Mutation	SNP	C	C	G			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr2:86371396C>G	ENST00000410111.3	-	15	2659	c.2272G>C	c.(2272-2274)Gag>Cag	p.E758Q	IMMT_ENST00000254636.5_Missense_Mutation_p.E659Q|IMMT_ENST00000409051.2_Missense_Mutation_p.E711Q|IMMT_ENST00000442664.2_Missense_Mutation_p.E757Q|IMMT_ENST00000449247.2_Missense_Mutation_p.E747Q	NM_001100169.1|NM_001100170.1|NM_006839.2	NP_001093639.1|NP_001093640.1|NP_006830.2	Q16891	MIC60_HUMAN	inner membrane protein, mitochondrial	758				E -> D (in Ref. 3; CAG33074). {ECO:0000305}.	mitochondrial calcium ion homeostasis (GO:0051560)|response to cold (GO:0009409)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)	p.E758Q(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						AAACCTCACTCTGGCTGCACC	0.473																																					p.E758Q		.											.	IMMT-91	1	Substitution - Missense(1)	lung(1)	c.G2272C						.						59.0	57.0	58.0					2																	86371396		1907	4127	6034	SO:0001583	missense	10989	exon15			CTCACTCTGGCTG	D21094	CCDS46355.1, CCDS46356.1, CCDS46357.1	2p11.2	2011-10-04	2010-04-29		ENSG00000132305	ENSG00000132305			6047	protein-coding gene	gene with protein product	"""mitofilin"", ""mitochondrial inner membrane organizing system 2"""	600378	"""inner membrane protein, mitochondrial (mitofilin)"""			9168817, 8039717	Standard	NM_001100169		Approved	P87, P89, HMP, MINOS2	uc002sqz.4	Q16891	OTTHUMG00000153170	ENST00000410111.3:c.2272G>C	2.37:g.86371396C>G	ENSP00000387262:p.Glu758Gln	Somatic	58	0		WXS	Illumina HiSeq	Phase_I	65	21	NM_006839	0	0	56	103	47	B1H0U5|B2R5N6|Q14539|Q15092|Q68D41|Q69HW5|Q6IBL0|Q7Z3X1|Q8TAJ5|Q9P0V2	Missense_Mutation	SNP	ENST00000410111.3	37	CCDS46355.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.72|11.72	1.722342|1.722342	0.30503|0.30503	.|.	.|.	ENSG00000132305|ENSG00000132305	ENST00000254636;ENST00000449247;ENST00000410111;ENST00000442664;ENST00000409051;ENST00000545283;ENST00000377310;ENST00000398211;ENST00000409715|ENST00000419070	T;T;T;T;T|.	0.35236|.	1.32;1.35;1.36;1.35;1.34|.	4.44|4.44	3.55|3.55	0.40652|0.40652	.|.	0.145672|.	0.32041|.	N|.	0.006672|.	T|T	0.13157|0.13157	0.0319|0.0319	N|N	0.02011|0.02011	-0.69|-0.69	0.24917|0.24917	N|N	0.992003|0.992003	D;D;D;D;D|.	0.71674|.	0.994;0.997;0.998;0.998;0.989|.	D;D;D;D;P|.	0.79784|.	0.979;0.985;0.993;0.993;0.742|.	T|T	0.18335|0.18335	-1.0340|-1.0340	10|5	0.49607|.	T|.	0.09|.	-13.9033|-13.9033	8.3828|8.3828	0.32481|0.32481	0.0:0.7575:0.1586:0.0839|0.0:0.7575:0.1586:0.0839	.|.	711;746;747;726;758|.	B9A067;B4DKR1;Q16891-2;Q16891-3;Q16891|.	.;.;.;.;IMMT_HUMAN|.	Q|T	659;747;758;757;711;747;726;372;659|612	ENSP00000254636:E659Q;ENSP00000396899:E747Q;ENSP00000387262:E758Q;ENSP00000407788:E757Q;ENSP00000387227:E711Q|.	ENSP00000254636:E659Q|.	E|R	-|-	1|2	0|0	IMMT|IMMT	86224907|86224907	0.036000|0.036000	0.19791|0.19791	0.972000|0.972000	0.41901|0.41901	0.346000|0.346000	0.29079|0.29079	1.134000|1.134000	0.31442|0.31442	1.467000|1.467000	0.48044|0.48044	0.650000|0.650000	0.86243|0.86243	GAG|AGA	.		0.473	IMMT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000329909.2	NM_006839	
ASTL	431705	broad.mit.edu;bcgsc.ca	37	2	96789883	96789883	+	Silent	SNP	G	G	C			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr2:96789883G>C	ENST00000342380.2	-	9	1001	c.1002C>G	c.(1000-1002)ccC>ccG	p.P334P		NM_001002036.3	NP_001002036.3			astacin-like metallo-endopeptidase (M12 family)											endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|prostate(1)|skin(2)	30						CTGCAGGAACGGGCTGGCCTC	0.672																																					p.P334P													.	ASTL-90	0			c.C1002G						.						34.0	39.0	37.0					2																	96789883		2203	4297	6500	SO:0001819	synonymous_variant	431705	exon9			AGGAACGGGCTGG	AJ537600	CCDS33249.1	2q11.1	2014-07-23	2006-10-10		ENSG00000188886	ENSG00000188886	3.4.24.21		31704	protein-coding gene	gene with protein product	"""sperm acrosomal SLLP1 binding"""	608860	"""astacin-like metalloendopeptidase (M12 family)"""			15087446	Standard	NM_001002036		Approved	ovastacin, SAS1B	uc010yui.2	Q6HA08	OTTHUMG00000155212	ENST00000342380.2:c.1002C>G	2.37:g.96789883G>C		Somatic	120	0		WXS	Illumina HiSeq	Phase_I	112	6	NM_001002036	0	0	0	0	0		Silent	SNP	ENST00000342380.2	37	CCDS33249.1																																																																																			.		0.672	ASTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338801.1		
POTEE	445582	hgsc.bcm.edu;broad.mit.edu	37	2	132020929	132020929	+	Splice_Site	SNP	T	T	G			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr2:132020929T>G	ENST00000356920.5	+	15	1995	c.1901T>G	c.(1900-1902)cTt>cGt	p.L634R	PLEKHB2_ENST00000404460.1_Intron|PLEKHB2_ENST00000303908.3_Intron|POTEE_ENST00000358087.5_3'UTR	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	634					retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)											TTTACTTAGCTTTCTCTTAGT	0.318																																					p.L634R		.											.	.	0			c.T1901G						.						17.0	19.0	18.0					2																	132020929		1871	4085	5956	SO:0001630	splice_region_variant	445582	exon15			CTTAGCTTTCTCT	AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.1900-1T>G	2.37:g.132020929T>G		Somatic	55	0		WXS	Illumina HiSeq	Phase_I	46	6	NM_001083538	0	0	0	0	0	Q6S8J4|Q6S8J5|Q6S8J8	Missense_Mutation	SNP	ENST00000356920.5	37	CCDS46414.1	.	.	.	.	.	.	.	.	.	.	.	10.54	1.377767	0.24944	.	.	ENSG00000188219	ENST00000356920	T	0.78003	-1.14	0.993	-0.489	0.12052	.	.	.	.	.	T	0.51924	0.1703	N	0.22421	0.69	0.22213	N	0.999286	P	0.42993	0.797	B	0.28305	0.088	T	0.51340	-0.8718	9	0.87932	D	0	.	1.3779	0.02224	0.3298:0.2367:0.0:0.4335	.	634	Q6S8J3	POTEE_HUMAN	R	634	ENSP00000439189:L634R	ENSP00000439189:L634R	L	+	2	0	AC131180.1	131737399	0.008000	0.16893	0.656000	0.29637	0.025000	0.11179	1.904000	0.39868	-0.140000	0.11394	0.155000	0.16302	CTT	.		0.318	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001083538	Missense_Mutation
NEB	4703	hgsc.bcm.edu	37	2	152553243	152553243	+	Missense_Mutation	SNP	A	A	G			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr2:152553243A>G	ENST00000172853.10	-	17	1624	c.1477T>C	c.(1477-1479)Tac>Cac	p.Y493H	NEB_ENST00000427231.2_Missense_Mutation_p.Y493H|NEB_ENST00000397345.3_Missense_Mutation_p.Y493H|NEB_ENST00000409198.1_Missense_Mutation_p.Y493H|NEB_ENST00000603639.1_Missense_Mutation_p.Y493H|NEB_ENST00000604864.1_Missense_Mutation_p.Y493H			P20929	NEBU_HUMAN	nebulin	493					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TGGACTTTGTAGGTGTGCTGT	0.463																																					p.Y493H		.											.	NEB-145	0			c.T1477C						.						191.0	188.0	189.0					2																	152553243		1938	4128	6066	SO:0001583	missense	4703	exon17			CTTTGTAGGTGTG	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.1477T>C	2.37:g.152553243A>G	ENSP00000172853:p.Tyr493His	Somatic	40	0		WXS	Illumina HiSeq	Phase_I	44	3	NM_004543	0	0	0	0	0	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	37		.	.	.	.	.	.	.	.	.	.	A	25.8	4.671821	0.88348	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853;ENST00000536533	T;T;T;T	0.12147	2.71;2.79;2.77;2.72	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.36054	0.0953	M	0.79475	2.455	0.80722	D	1	D;D	0.63880	0.993;0.985	P;P	0.61070	0.883;0.845	T	0.13926	-1.0491	10	0.87932	D	0	.	14.6206	0.68582	1.0:0.0:0.0:0.0	.	126;493	Q86TG3;P20929	.;NEBU_HUMAN	H	493;493;493;493;219	ENSP00000386259:Y493H;ENSP00000380505:Y493H;ENSP00000416578:Y493H;ENSP00000172853:Y493H	ENSP00000172853:Y493H	Y	-	1	0	NEB	152261489	1.000000	0.71417	0.999000	0.59377	0.974000	0.67602	3.275000	0.51639	2.268000	0.75426	0.455000	0.32223	TAC	.		0.463	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
CWC22	57703	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	180810243	180810243	+	Silent	SNP	A	A	G			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr2:180810243A>G	ENST00000410053.3	-	20	2639	c.2340T>C	c.(2338-2340)ccT>ccC	p.P780P	CWC22_ENST00000295749.6_Silent_p.P780P	NM_020943.2	NP_065994.1	Q9HCG8	CWC22_HUMAN	CWC22 spliceosome-associated protein	780					mRNA splicing, via spliceosome (GO:0000398)|regulation of mRNA splicing, via spliceosome (GO:0048024)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	RNA binding (GO:0003723)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(7)|kidney(2)|large_intestine(8)|liver(1)|lung(8)|stomach(1)	30						ACTTTGTTATAGGATCTCTCC	0.388																																					p.P780P		.											.	CWC22-90	0			c.T2340C						.						222.0	206.0	211.0					2																	180810243		1860	4108	5968	SO:0001819	synonymous_variant	57703	exon20			TGTTATAGGATCT		CCDS46465.1	2q31.3	2014-07-03	2014-07-03		ENSG00000163510	ENSG00000163510			29322	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein b"""	615186	"""CWC22 spliceosome-associated protein homolog (S. cerevisiae)"""			9136012, 23236153	Standard	NM_020943		Approved	KIAA1604, EIF4GL, fSAPb, NCM	uc010frh.1	Q9HCG8	OTTHUMG00000154244	ENST00000410053.3:c.2340T>C	2.37:g.180810243A>G		Somatic	289	0		WXS	Illumina HiSeq	Phase_I	272	71	NM_020943	0	0	9	15	6	Q05DC2|Q4G135|Q52LF0|Q6PEX2|Q7Z6I0|Q9H5L3|Q9H6Q6	Silent	SNP	ENST00000410053.3	37	CCDS46465.1																																																																																			.		0.388	CWC22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334537.1	NM_020943	
ERBB4	2066	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	212295693	212295693	+	Nonsense_Mutation	SNP	C	C	A			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr2:212295693C>A	ENST00000342788.4	-	21	2930	c.2620G>T	c.(2620-2622)Gag>Tag	p.E874*	ERBB4_ENST00000436443.1_Nonsense_Mutation_p.E874*|ERBB4_ENST00000402597.1_Nonsense_Mutation_p.E864*	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	874	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	GCATTGTACTCTTTTTCATCT	0.373										TSP Lung(8;0.080)																											p.E874X		.											.	ERBB4-1461	0			c.G2620T						.						147.0	139.0	142.0					2																	212295693		2203	4300	6503	SO:0001587	stop_gained	2066	exon21			TGTACTCTTTTTC	L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.2620G>T	2.37:g.212295693C>A	ENSP00000342235:p.Glu874*	Somatic	200	0		WXS	Illumina HiSeq	Phase_I	185	54	NM_001042599	0	0	0	0	0	B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Nonsense_Mutation	SNP	ENST00000342788.4	37	CCDS2394.1	.	.	.	.	.	.	.	.	.	.	C	33	5.264878	0.95399	.	.	ENSG00000178568	ENST00000342788;ENST00000436443;ENST00000402597	.	.	.	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	19.0631	0.93100	0.0:1.0:0.0:0.0	.	.	.	.	X	874;874;864	.	ENSP00000342235:E874X	E	-	1	0	ERBB4	212003938	1.000000	0.71417	1.000000	0.80357	0.028000	0.11728	7.747000	0.85070	2.565000	0.86533	0.563000	0.77884	GAG	.		0.373	ERBB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256597.1	NM_001042599	
ARPC2	10109	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	219103554	219103554	+	Missense_Mutation	SNP	T	T	A			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr2:219103554T>A	ENST00000295685.10	+	5	697	c.436T>A	c.(436-438)Tat>Aat	p.Y146N	ARPC2_ENST00000477992.1_3'UTR|ARPC2_ENST00000315717.5_Missense_Mutation_p.Y146N	NM_005731.2	NP_005722.1	O15144	ARPC2_HUMAN	actin related protein 2/3 complex, subunit 2, 34kDa	146					Arp2/3 complex-mediated actin nucleation (GO:0034314)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural constituent of cytoskeleton (GO:0005200)			cervix(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)	6		Renal(207;0.0474)		Epithelial(149;1.21e-06)|all cancers(144;0.000212)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0103)		AGTTATCCATTATAGGGATGA	0.438																																					p.Y146N		.											.	ARPC2-91	0			c.T436A						.						74.0	70.0	72.0					2																	219103554		2203	4300	6503	SO:0001583	missense	10109	exon5			ATCCATTATAGGG	AF006085	CCDS2410.1	2q36.1	2011-07-06	2002-08-29		ENSG00000163466	ENSG00000163466		"""Actin related protein 2/3 complex subunits"""	705	protein-coding gene	gene with protein product		604224	"""actin related protein 2/3 complex, subunit 2 (34 kD)"""			9359840, 9230079	Standard	NM_005731		Approved	p34-Arc, ARC34	uc002vhd.4	O15144	OTTHUMG00000133618	ENST00000295685.10:c.436T>A	2.37:g.219103554T>A	ENSP00000295685:p.Tyr146Asn	Somatic	112	2		WXS	Illumina HiSeq	Phase_I	105	31	NM_005731	0	0	207	320	113	Q92801|Q9P1D4	Missense_Mutation	SNP	ENST00000295685.10	37	CCDS2410.1	.	.	.	.	.	.	.	.	.	.	T	17.59	3.427174	0.62733	.	.	ENSG00000163466	ENST00000315717;ENST00000295685	.	.	.	5.65	4.48	0.54585	.	0.000000	0.85682	D	0.000000	D	0.85703	0.5758	H	0.94925	3.6	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.88920	0.3365	9	0.87932	D	0	.	12.9852	0.58588	0.0:0.0:0.135:0.865	.	146	O15144	ARPC2_HUMAN	N	146	.	ENSP00000295685:Y146N	Y	+	1	0	ARPC2	218811799	1.000000	0.71417	1.000000	0.80357	0.418000	0.31294	7.868000	0.87116	1.130000	0.42092	0.533000	0.62120	TAT	.		0.438	ARPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256777.2	NM_005731	
HDAC4	9759	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	239988463	239988463	+	Silent	SNP	A	A	T			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr2:239988463A>T	ENST00000345617.3	-	24	3734	c.2943T>A	c.(2941-2943)atT>atA	p.I981I	AC017028.6_ENST00000577291.1_RNA|AC017028.4_ENST00000577359.1_RNA|MIR4440_ENST00000583986.1_RNA|AC017028.5_ENST00000582834.1_RNA|AC017028.9_ENST00000581111.1_RNA|AC017028.2_ENST00000578555.1_RNA|AC017028.3_ENST00000584260.1_RNA|AC017028.10_ENST00000579161.1_RNA|HDAC4_ENST00000543185.1_Silent_p.I565I	NM_006037.3	NP_006028.2	P56524	HDAC4_HUMAN	histone deacetylase 4	981	Histone deacetylase.				B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cardiac muscle hypertrophy in response to stress (GO:0014898)|chromatin remodeling (GO:0006338)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|osteoblast development (GO:0002076)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein sumoylation (GO:0033235)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of gene expression, epigenetic (GO:0040029)|regulation of protein binding (GO:0043393)|regulation of skeletal muscle fiber development (GO:0048742)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|response to drug (GO:0042493)|response to interleukin-1 (GO:0070555)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	A band (GO:0031672)|actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone deacetylase complex (GO:0000118)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)|Z disc (GO:0030018)	activating transcription factor binding (GO:0033613)|core promoter binding (GO:0001047)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|potassium ion binding (GO:0030955)|protein deacetylase activity (GO:0033558)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(5)	62		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)		AGGCGTCGCAAATGGCGGTCA	0.632																																					p.I981I		.											.	HDAC4-291	0			c.T2943A						.						78.0	75.0	76.0					2																	239988463		2203	4300	6503	SO:0001819	synonymous_variant	9759	exon24			GTCGCAAATGGCG	AB006626	CCDS2529.1	2q37.3	2014-02-12			ENSG00000068024	ENSG00000068024			14063	protein-coding gene	gene with protein product		605314	"""brachydactyly-mental retardation syndrome"""	BDMR		10206986, 10220385, 20691407	Standard	NM_006037		Approved	KIAA0288, HDAC-A, HDACA, HD4, HA6116, HDAC-4	uc002vyk.4	P56524	OTTHUMG00000133344	ENST00000345617.3:c.2943T>A	2.37:g.239988463A>T		Somatic	139	0		WXS	Illumina HiSeq	Phase_I	124	31	NM_006037	0	0	1	2	1	Q9UND6	Silent	SNP	ENST00000345617.3	37	CCDS2529.1	.	.	.	.	.	.	.	.	.	.	A	11.87	1.768867	0.31320	.	.	ENSG00000068024	ENST00000430200	.	.	.	4.21	-5.54	0.02544	.	.	.	.	.	T	0.62829	0.2460	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.64305	-0.6439	4	.	.	.	.	14.9101	0.70749	0.3468:0.0:0.6532:0.0	.	.	.	.	Y	72	.	.	F	-	2	0	HDAC4	239653400	0.715000	0.27946	0.962000	0.40283	0.971000	0.66376	-0.071000	0.11505	-1.038000	0.03279	-0.376000	0.06991	TTT	.		0.632	HDAC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257174.2	NM_006037	
FARP2	9855	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	242433435	242433435	+	Silent	SNP	G	G	C			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr2:242433435G>C	ENST00000264042.3	+	27	3230	c.3060G>C	c.(3058-3060)gtG>gtC	p.V1020V	STK25_ENST00000316586.4_3'UTR|STK25_ENST00000478403.1_5'Flank	NM_014808.2	NP_055623.1	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2	1020	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton reorganization (GO:0031532)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|neuron remodeling (GO:0016322)|osteoclast differentiation (GO:0030316)|podosome assembly (GO:0071800)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of integrin activation (GO:0033623)|regulation of Rac GTPase activity (GO:0032314)|semaphorin-plexin signaling pathway (GO:0071526)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	43		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		GGATGGAGGTGATCCAGGGGG	0.637																																					p.V1020V		.											.	FARP2-93	0			c.G3060C						.						51.0	56.0	55.0					2																	242433435		2202	4299	6501	SO:0001819	synonymous_variant	9855	exon27			GGAGGTGATCCAG	AB018336	CCDS33424.1, CCDS63197.1	2q37.3	2013-01-10			ENSG00000006607	ENSG00000006607		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16460	protein-coding gene	gene with protein product						9872452, 12351724	Standard	NM_001282984		Approved	KIAA0793, FIR, PLEKHC3, FRG	uc002wbi.2	O94887	OTTHUMG00000151574	ENST00000264042.3:c.3060G>C	2.37:g.242433435G>C		Somatic	113	0		WXS	Illumina HiSeq	Phase_I	96	22	NM_014808	0	0	0	0	0	B7Z6J8|F5GZ84|Q53QM5|Q8WU27|Q9UFE7	Silent	SNP	ENST00000264042.3	37	CCDS33424.1	.	.	.	.	.	.	.	.	.	.	G	10.70	1.424530	0.25639	.	.	ENSG00000006607	ENST00000444371;ENST00000412332	.	.	.	4.94	4.04	0.47022	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.5752	0.61870	0.0:0.1619:0.8381:0.0	.	.	.	.	S	163;22	.	.	X	+	2	2	FARP2	242082108	1.000000	0.71417	0.997000	0.53966	0.721000	0.41392	0.714000	0.25808	1.176000	0.42840	0.655000	0.94253	TGA	.		0.637	FARP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323153.1		
BPIFB2	80341	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	31601760	31601760	+	Missense_Mutation	SNP	C	C	G			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr20:31601760C>G	ENST00000170150.3	+	5	648	c.453C>G	c.(451-453)aaC>aaG	p.N151K		NM_025227.1	NP_079503.1	Q8N4F0	BPIB2_HUMAN	BPI fold containing family B, member 2	151						extracellular vesicular exosome (GO:0070062)	lipid binding (GO:0008289)										ATGGCAGTAACAGGTGGGTGC	0.582																																					p.N151K		.											.	.	0			c.C453G						.						47.0	41.0	43.0					20																	31601760		2203	4300	6503	SO:0001583	missense	80341	exon5			CAGTAACAGGTGG	AF465765	CCDS13210.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000078898	ENSG00000078898		"""BPI fold containing"""	16177	protein-coding gene	gene with protein product		614108	"""bactericidal/permeability-increasing protein-like 1"""	C20orf184, BPIL1		12185532, 21787333	Standard	NM_025227		Approved	dJ726C3.2, LPLUNC2	uc002wyj.4	Q8N4F0	OTTHUMG00000032232	ENST00000170150.3:c.453C>G	20.37:g.31601760C>G	ENSP00000170150:p.Asn151Lys	Somatic	49	0		WXS	Illumina HiSeq	Phase_I	46	16	NM_025227	0	0	0	0	0	Q6UWN3|Q6ZME0|Q8NFQ7	Missense_Mutation	SNP	ENST00000170150.3	37	CCDS13210.1	.	.	.	.	.	.	.	.	.	.	C	0.777	-0.763664	0.02996	.	.	ENSG00000078898	ENST00000170150	T	0.05025	3.51	3.37	1.32	0.21799	.	1.051320	0.07484	N	0.904509	T	0.04363	0.0120	L	0.27053	0.805	0.21802	N	0.999535	B	0.09022	0.002	B	0.08055	0.003	T	0.43829	-0.9367	10	0.05833	T	0.94	0.1991	7.9791	0.30172	0.4451:0.5549:0.0:0.0	.	151	Q8N4F0	BPIB2_HUMAN	K	151	ENSP00000170150:N151K	ENSP00000170150:N151K	N	+	3	2	BPIFB2	31065421	0.257000	0.24022	0.587000	0.28692	0.145000	0.21501	0.314000	0.19432	0.396000	0.25283	0.491000	0.48974	AAC	.		0.582	BPIFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078652.2	NM_025227	
ZNF341	84905	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	32376706	32376706	+	Silent	SNP	G	G	T			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr20:32376706G>T	ENST00000375200.1	+	13	2255	c.1890G>T	c.(1888-1890)gcG>gcT	p.A630A	RP4-553F4.6_ENST00000423074.1_RNA|RP4-553F4.6_ENST00000443171.1_RNA|RP4-553F4.6_ENST00000439444.1_RNA|ZNF341_ENST00000342427.2_Silent_p.A623A	NM_001282933.1	NP_001269862.1	Q9BYN7	ZN341_HUMAN	zinc finger protein 341	630					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A623A(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|skin(1)|urinary_tract(3)	31						GCGAGTCTGCGTTCAACCGCA	0.547																																					p.A623A		.											.	ZNF341-92	1	Substitution - coding silent(1)	endometrium(1)	c.G1869T						.						122.0	99.0	107.0					20																	32376706		2203	4300	6503	SO:0001819	synonymous_variant	84905	exon13			GTCTGCGTTCAAC	AK027550	CCDS13227.1, CCDS74719.1	20q11.22	2013-01-08			ENSG00000131061	ENSG00000131061		"""Zinc fingers, C2H2-type"""	15992	protein-coding gene	gene with protein product							Standard	NM_001282933		Approved	dJ553F4.3	uc002wzx.3	Q9BYN7	OTTHUMG00000032275	ENST00000375200.1:c.1890G>T	20.37:g.32376706G>T		Somatic	67	0		WXS	Illumina HiSeq	Phase_I	57	19	NM_032819	0	0	1	2	1	A2RUF4|B2RXE5|B7ZM09|Q5JXM8|Q96ST5	Silent	SNP	ENST00000375200.1	37																																																																																				.		0.547	ZNF341-201	KNOWN	basic	protein_coding	protein_coding			
PTPRT	11122	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	40730779	40730779	+	Silent	SNP	G	G	A	rs146474971	byFrequency	TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr20:40730779G>A	ENST00000373187.1	-	26	3698	c.3699C>T	c.(3697-3699)aaC>aaT	p.N1233N	PTPRT_ENST00000373198.4_Silent_p.N1252N|PTPRT_ENST00000356100.2_Silent_p.N1242N|PTPRT_ENST00000373201.1_Silent_p.N1223N|PTPRT_ENST00000373184.1_Silent_p.N1243N|PTPRT_ENST00000373193.3_Silent_p.N1236N|PTPRT_ENST00000373190.1_Silent_p.N1232N			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	1233	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)			NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				TCAGTGCTGCGTTGATGTAAT	0.552													G|||	5	0.000998403	0.0	0.0	5008	,	,		19597	0.005		0.0	False		,,,				2504	0.0				p.N1252N		.											.	PTPRT-664	0			c.C3756T						.	G	,	1,4227		0,1,2113	76.0	76.0	76.0		3699,3756	-4.6	0.5	20	dbSNP_134	76	0,8508		0,0,4254	no	coding-synonymous,coding-synonymous	PTPRT	NM_007050.5,NM_133170.3	,	0,1,6367	AA,AG,GG		0.0,0.0237,0.0079	,	1233/1442,1252/1461	40730779	1,12735	2114	4254	6368	SO:0001819	synonymous_variant	11122	exon27			TGCTGCGTTGATG	AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.3699C>T	20.37:g.40730779G>A		Somatic	109	0		WXS	Illumina HiSeq	Phase_I	102	19	NM_133170	0	0	0	0	0	A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Silent	SNP	ENST00000373187.1	37	CCDS42874.1																																																																																			G|0.998;A|0.002		0.552	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1		
MIS18A	54069	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	21	33651272	33651272	+	Silent	SNP	C	C	T			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr21:33651272C>T	ENST00000290130.3	-	1	108	c.54G>A	c.(52-54)gaG>gaA	p.E18E	MIS18A-AS1_ENST00000453549.1_RNA	NM_018944.2	NP_061817.1	Q9NYP9	MS18A_HUMAN	MIS18 kinetochore protein A	18					CENP-A containing nucleosome assembly (GO:0034080)|chromosome segregation (GO:0007059)|mitotic nuclear division (GO:0007067)|nucleosome assembly (GO:0006334)|regulation of DNA methylation (GO:0044030)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(2)	7						TGTCGCCGCACTCACAGCCGC	0.607																																					p.E18E		.											.	MIS18A-90	0			c.G54A						.						36.0	39.0	38.0					21																	33651272		2202	4296	6498	SO:0001819	synonymous_variant	54069	exon1			GCCGCACTCACAG	AF231921	CCDS13611.1	21q22.11	2013-10-21	2013-10-21	2011-02-23	ENSG00000159055	ENSG00000159055			1286	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 46"", ""chromosome 21 open reading frame 45"", ""MIS18 kinetochore protein homolog A (S. pombe)"""	C21orf46, C21orf45		17199038	Standard	NM_018944		Approved	B28, FASP1, hMis18alpha	uc002ypi.3	Q9NYP9	OTTHUMG00000085308	ENST00000290130.3:c.54G>A	21.37:g.33651272C>T		Somatic	76	0		WXS	Illumina HiSeq	Phase_I	69	16	NM_018944	0	0	2	3	1	B2R562|Q542Z0	Silent	SNP	ENST00000290130.3	37	CCDS13611.1																																																																																			.		0.607	MIS18A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000193090.1	NM_018944	
SON	6651	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	34922663	34922663	+	Missense_Mutation	SNP	T	T	C			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr21:34922663T>C	ENST00000356577.4	+	3	1601	c.1126T>C	c.(1126-1128)Tcg>Ccg	p.S376P	SON_ENST00000381679.4_Missense_Mutation_p.S376P|SON_ENST00000381692.2_Intron|SON_ENST00000290239.6_Missense_Mutation_p.S376P|SON_ENST00000300278.4_Missense_Mutation_p.S376P	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	376					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						GCAGGAGTCGTCGGTGGCCTC	0.627																																					p.S376P		.											.	SON-97	0			c.T1126C						.						78.0	85.0	82.0					21																	34922663		2203	4300	6503	SO:0001583	missense	6651	exon3			GAGTCGTCGGTGG	AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.1126T>C	21.37:g.34922663T>C	ENSP00000348984:p.Ser376Pro	Somatic	153	0		WXS	Illumina HiSeq	Phase_I	93	26	NM_032195	0	0	19	30	11	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Missense_Mutation	SNP	ENST00000356577.4	37	CCDS13629.1	.	.	.	.	.	.	.	.	.	.	T	12.36	1.913625	0.33815	.	.	ENSG00000159140	ENST00000356577;ENST00000290239;ENST00000300278;ENST00000381679	T;T;T;T	0.14022	2.71;2.72;2.72;2.54	5.43	1.29	0.21616	.	0.277107	0.26272	N	0.025322	T	0.05593	0.0147	N	0.14661	0.345	0.21802	N	0.999532	B;B;B	0.22080	0.038;0.064;0.015	B;B;B	0.22880	0.019;0.042;0.023	T	0.36335	-0.9752	10	0.15499	T	0.54	.	2.7433	0.05259	0.1873:0.2368:0.0:0.5759	.	376;376;376	P18583;P18583-3;P18583-6	SON_HUMAN;.;.	P	376	ENSP00000348984:S376P;ENSP00000290239:S376P;ENSP00000300278:S376P;ENSP00000371095:S376P	ENSP00000290239:S376P	S	+	1	0	SON	33844533	0.991000	0.36638	1.000000	0.80357	0.997000	0.91878	0.194000	0.17135	0.413000	0.25759	0.459000	0.35465	TCG	.		0.627	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140978.2	NM_138927	
PICK1	9463	broad.mit.edu	37	22	38461040	38461040	+	Missense_Mutation	SNP	G	G	A			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr22:38461040G>A	ENST00000404072.3	+	4	532	c.185G>A	c.(184-186)gGc>gAc	p.G62D	PICK1_ENST00000468288.1_3'UTR|PICK1_ENST00000356976.3_Missense_Mutation_p.G62D|RP5-1039K5.13_ENST00000445483.1_RNA	NM_001039583.1|NM_001039584.1	NP_001034672.1|NP_001034673.1	Q9NRD5	PICK1_HUMAN	protein interacting with PRKCA 1	62	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				ATP catabolic process (GO:0006200)|cellular response to decreased oxygen levels (GO:0036294)|cellular response to glucose starvation (GO:0042149)|dendritic spine maintenance (GO:0097062)|dendritic spine organization (GO:0097061)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|glial cell development (GO:0021782)|long term synaptic depression (GO:0060292)|monoamine transport (GO:0015844)|negative regulation of Arp2/3 complex-mediated actin nucleation (GO:0034316)|neuronal ion channel clustering (GO:0045161)|positive regulation of receptor internalization (GO:0002092)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)|protein targeting (GO:0006605)|receptor clustering (GO:0043113)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|endocytic vesicle membrane (GO:0030666)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	actin filament binding (GO:0051015)|Arp2/3 complex binding (GO:0071933)|ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein kinase C binding (GO:0005080)|receptor binding (GO:0005102)			cervix(1)|endometrium(3)|large_intestine(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	13	Melanoma(58;0.045)					GCCTTGGACGGCACAGTGGCA	0.542																																					p.G62D													.	PICK1-226	0			c.G185A						.						127.0	106.0	113.0					22																	38461040		2203	4300	6503	SO:0001583	missense	9463	exon4			TGGACGGCACAGT	AL049654	CCDS13965.1	22q13.1	2006-02-14	2006-02-14	2006-02-14	ENSG00000100151	ENSG00000100151			9394	protein-coding gene	gene with protein product		605926	"""protein kinase C, alpha binding protein"", ""protein interacting with PRKCA"""	PRKCABP		10340301, 10591208	Standard	XM_006724377		Approved	dJ1039K5, MGC15204	uc003aus.3	Q9NRD5	OTTHUMG00000151159	ENST00000404072.3:c.185G>A	22.37:g.38461040G>A	ENSP00000385205:p.Gly62Asp	Somatic	140	1		WXS	Illumina HiSeq	Phase_I	138	4	NM_012407	0	0	32	32	0	B3KS52|O95906	Missense_Mutation	SNP	ENST00000404072.3	37	CCDS13965.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.052351	0.75960	.	.	ENSG00000100151	ENST00000404072;ENST00000424694;ENST00000437453;ENST00000356976;ENST00000435166	T;T;T;T;T	0.60299	0.2;0.2;0.2;0.2;0.2	5.12	5.12	0.69794	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.70150	0.3191	M	0.92317	3.295	0.80722	D	1	B	0.14438	0.01	B	0.19391	0.025	T	0.72679	-0.4220	10	0.59425	D	0.04	-35.1501	18.9552	0.92655	0.0:0.0:1.0:0.0	.	62	Q9NRD5	PICK1_HUMAN	D	62	ENSP00000385205:G62D;ENSP00000398141:G62D;ENSP00000410793:G62D;ENSP00000349465:G62D;ENSP00000397588:G62D	ENSP00000349465:G62D	G	+	2	0	PICK1	36790986	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.534000	0.98061	2.562000	0.86427	0.563000	0.77884	GGC	.		0.542	PICK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321569.2	NM_012407	
DENND6B	414918	hgsc.bcm.edu	37	22	50752671	50752671	+	Missense_Mutation	SNP	T	T	C			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr22:50752671T>C	ENST00000413817.3	-	13	1174	c.1103A>G	c.(1102-1104)aAg>aGg	p.K368R	XX-C283C717.1_ENST00000453835.1_RNA	NM_001001794.3	NP_001001794.3	Q8NEG7	DEN6B_HUMAN	DENN/MADD domain containing 6B	368					positive regulation of Rab GTPase activity (GO:0032851)	endosome (GO:0005768)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)										CCTTGAAGGCTTTTTCAGCTT	0.642																																					p.K368R		.											.	.	0			c.A1103G						.						40.0	47.0	45.0					22																	50752671		1956	4125	6081	SO:0001583	missense	414918	exon13			GAAGGCTTTTTCA	AK054743	CCDS46732.1	22q13.33	2012-10-03	2012-10-03	2012-10-03	ENSG00000205593	ENSG00000205593		"""DENN/MADD domain containing"""	32690	protein-coding gene	gene with protein product			"""family with sequence similarity 116, member B"""	FAM116B		21330364	Standard	NM_001001794		Approved	MGC33692, AFI1B	uc011arv.1	Q8NEG7	OTTHUMG00000150210	ENST00000413817.3:c.1103A>G	22.37:g.50752671T>C	ENSP00000391524:p.Lys368Arg	Somatic	41	0		WXS	Illumina HiSeq	Phase_I	33	2	NM_001001794	0	0	28	28	0	A6X8I5	Missense_Mutation	SNP	ENST00000413817.3	37	CCDS46732.1	.	.	.	.	.	.	.	.	.	.	T	26.0	4.692743	0.88735	.	.	ENSG00000205593	ENST00000413817	.	.	.	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	T	0.74419	0.3714	M	0.62723	1.935	0.58432	D	0.999992	D;D	0.69078	0.997;0.997	D;D	0.75020	0.985;0.985	T	0.74172	-0.3751	9	0.39692	T	0.17	-29.4347	12.8207	0.57692	0.0:0.0:0.0:1.0	.	368;368	Q8NEG7;C9JIV6	F116B_HUMAN;.	R	368	.	ENSP00000391524:K368R	K	-	2	0	FAM116B	49095243	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	4.326000	0.59241	1.916000	0.55485	0.379000	0.24179	AAG	.		0.642	DENND6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316845.3	NM_001001794	
EOMES	8320	hgsc.bcm.edu	37	3	27762953	27762953	+	Missense_Mutation	SNP	A	A	G			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr3:27762953A>G	ENST00000295743.4	-	1	1036	c.833T>C	c.(832-834)cTc>cCc	p.L278P	EOMES_ENST00000449599.1_Missense_Mutation_p.L278P|EOMES_ENST00000461503.1_Intron|EOMES_ENST00000537516.1_Intron			O95936	EOMES_HUMAN	eomesodermin	278					brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|CD8-positive, alpha-beta T cell differentiation involved in immune response (GO:0002302)|cell differentiation involved in embryonic placenta development (GO:0060706)|cerebral cortex neuron differentiation (GO:0021895)|cerebral cortex regionalization (GO:0021796)|endoderm formation (GO:0001706)|endodermal cell fate specification (GO:0001714)|interferon-gamma production (GO:0032609)|mesoderm formation (GO:0001707)|mesodermal to mesenchymal transition involved in gastrulation (GO:0060809)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|olfactory bulb development (GO:0021772)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|skeletal muscle cell differentiation (GO:0035914)|stem cell maintenance (GO:0019827)|trophectodermal cell differentiation (GO:0001829)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(3)|prostate(1)	21						GTGGAATTTGAGCCACAGAGG	0.637																																					p.L278P		.											.	EOMES-156	0			c.T833C						.						19.0	25.0	23.0					3																	27762953		2200	4298	6498	SO:0001583	missense	8320	exon1			AATTTGAGCCACA	BC025363	CCDS2646.1, CCDS63585.1	3p24.1	2011-06-13	2010-06-24		ENSG00000163508	ENSG00000163508		"""T-boxes"""	3372	protein-coding gene	gene with protein product	"""T-box brain2"""	604615	"""eomesodermin (Xenopus laevis) homolog"""			9888994, 9434949	Standard	NM_005442		Approved	TBR2	uc003cdy.4	O95936	OTTHUMG00000130570	ENST00000295743.4:c.833T>C	3.37:g.27762953A>G	ENSP00000295743:p.Leu278Pro	Somatic	25	0		WXS	Illumina HiSeq	Phase_I	27	2	NM_005442	0	0	1	1	0	B7Z4I2|B7ZA51|G3XAI5|Q8TAZ2|Q9UPM7	Missense_Mutation	SNP	ENST00000295743.4	37	CCDS2646.1	.	.	.	.	.	.	.	.	.	.	A	21.6	4.174990	0.78564	.	.	ENSG00000163508	ENST00000295743;ENST00000449599;ENST00000535713	T;T	0.80393	-1.37;-1.37	5.08	5.08	0.68730	Transcription factor, T-box, conserved site (1);p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.88941	0.6574	M	0.79926	2.475	0.80722	D	1	D;D;P	0.89917	1.0;0.972;0.953	D;P;P	0.91635	0.999;0.774;0.737	D	0.88000	0.2755	10	0.30854	T	0.27	.	13.8135	0.63276	1.0:0.0:0.0:0.0	.	278;278;278	F5H3K1;G3XAI5;O95936	.;.;EOMES_HUMAN	P	278;278;143	ENSP00000295743:L278P;ENSP00000388620:L278P	ENSP00000295743:L278P	L	-	2	0	EOMES	27737957	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.252000	0.78309	1.901000	0.55032	0.379000	0.24179	CTC	.		0.637	EOMES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252995.1	NM_005442	
CLASP2	23122	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	33552091	33552091	+	Missense_Mutation	SNP	G	G	T			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr3:33552091G>T	ENST00000468888.2	-	37	4346	c.4300C>A	c.(4300-4302)Cta>Ata	p.L1434I	CLASP2_ENST00000307312.7_Missense_Mutation_p.L915I|CLASP2_ENST00000539981.1_3'UTR|CLASP2_ENST00000480013.1_Missense_Mutation_p.L1213I|CLASP2_ENST00000359576.5_Missense_Mutation_p.L1425I|CLASP2_ENST00000461133.3_Missense_Mutation_p.L1193I|CLASP2_ENST00000399362.4_Missense_Mutation_p.L1433I			O75122	CLAP2_HUMAN	cytoplasmic linker associated protein 2	1214					axon guidance (GO:0007411)|establishment or maintenance of cell polarity (GO:0007163)|fucosylation (GO:0036065)|microtubule anchoring (GO:0034453)|microtubule nucleation (GO:0007020)|microtubule organizing center organization (GO:0031023)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of microtubule depolymerization (GO:0007026)|regulation of microtubule polymerization or depolymerization (GO:0031110)|regulation of microtubule-based process (GO:0032886)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|trans-Golgi network (GO:0005802)	galactoside 2-alpha-L-fucosyltransferase activity (GO:0008107)|microtubule plus-end binding (GO:0051010)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	48						AGCAGGTTTAGGGTTTCCTTG	0.393																																					p.L1435I		.											.	CLASP2-93	0			c.C4303A						.						195.0	174.0	181.0					3																	33552091		1882	4117	5999	SO:0001583	missense	23122	exon37			GGTTTAGGGTTTC	AB014527		3p24.3	2013-01-18			ENSG00000163539	ENSG00000163539			17078	protein-coding gene	gene with protein product		605853				9734811, 10899121	Standard	NM_015097		Approved	KIAA0627	uc021wvc.1	O75122	OTTHUMG00000156489	ENST00000468888.2:c.4300C>A	3.37:g.33552091G>T	ENSP00000419974:p.Leu1434Ile	Somatic	93	0		WXS	Illumina HiSeq	Phase_I	74	13	NM_015097	0	0	15	23	8	Q7L8F6|Q8N6R6|Q9BQT3|Q9BQT4|Q9H7A3|Q9NSZ2	Missense_Mutation	SNP	ENST00000468888.2	37		.	.	.	.	.	.	.	.	.	.	G	28.7	4.942933	0.92526	.	.	ENSG00000163539	ENST00000468888;ENST00000399362;ENST00000359576;ENST00000307312;ENST00000480013;ENST00000461133	T;T;T;T;T;T	0.66638	-0.22;-0.22;-0.22;-0.22;-0.22;-0.22	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	T	0.80210	0.4581	L	0.60845	1.875	0.80722	D	1	D;P	0.71674	0.998;0.725	D;P	0.77557	0.99;0.759	T	0.74633	-0.3600	10	0.31617	T	0.26	-16.2438	20.6634	0.99662	0.0:0.0:1.0:0.0	.	1425;1433	F5H604;E7ERI8	.;.	I	1434;1433;1425;915;1213;1193	ENSP00000419974:L1434I;ENSP00000382297:L1433I;ENSP00000352581:L1425I;ENSP00000304743:L915I;ENSP00000417518:L1213I;ENSP00000419305:L1193I	ENSP00000304743:L915I	L	-	1	2	CLASP2	33527095	1.000000	0.71417	0.998000	0.56505	0.972000	0.66771	7.666000	0.83877	2.894000	0.99253	0.655000	0.94253	CTA	.		0.393	CLASP2-001	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000344320.4	NM_001207044	
USP19	10869	broad.mit.edu;ucsc.edu	37	3	49155544	49155544	+	Missense_Mutation	SNP	G	G	A			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr3:49155544G>A	ENST00000398888.2	-	3	452	c.134C>T	c.(133-135)tCt>tTt	p.S45F	USP19_ENST00000434032.2_Missense_Mutation_p.S45F|USP19_ENST00000398898.2_Intron|USP19_ENST00000453664.1_Missense_Mutation_p.S45F|USP19_ENST00000398892.3_Intron|USP19_ENST00000488993.1_5'UTR|USP19_ENST00000398896.1_5'Flank|USP19_ENST00000417901.1_Missense_Mutation_p.S45F	NM_006677.2	NP_006668.1	O94966	UBP19_HUMAN	ubiquitin specific peptidase 19	45					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of skeletal muscle tissue development (GO:0048642)|positive regulation of cell cycle process (GO:0090068)|protein deubiquitination (GO:0016579)|regulation of cellular response to hypoxia (GO:1900037)|regulation of protein stability (GO:0031647)|response to endoplasmic reticulum stress (GO:0034976)|skeletal muscle atrophy (GO:0014732)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|ubiquitin-specific protease activity (GO:0004843)			NS(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(10)|lung(5)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		aacatatcgagaccctgtctc	0.522																																					p.S45F													.	USP19-663	0			c.C134T						.						15.0	15.0	15.0					3																	49155544		1908	4109	6017	SO:0001583	missense	10869	exon3			TATCGAGACCCTG	AB020698	CCDS43090.1, CCDS56254.1, CCDS56255.1, CCDS56256.1	3p21.31	2005-10-13	2005-08-08		ENSG00000172046	ENSG00000172046		"""Zinc fingers, MYND-type"", ""Ubiquitin-specific peptidases"""	12617	protein-coding gene	gene with protein product		614471	"""ubiquitin specific protease 19"""			12838346	Standard	NM_001199160		Approved	KIAA0891, ZMYND9	uc011bch.2	O94966	OTTHUMG00000133611	ENST00000398888.2:c.134C>T	3.37:g.49155544G>A	ENSP00000381863:p.Ser45Phe	Somatic	24	0		WXS	Illumina HiSeq	Phase_I	13	3	NM_001199160	0	0	0	0	0	A5PKX8|A6H8U2|B4DGT3|B4DTZ0|E7EN22|E7ETS0|E9PEG8|Q3KQW4|Q641Q9|Q6NZY8|Q86XV9	Missense_Mutation	SNP	ENST00000398888.2	37	CCDS43090.1	.	.	.	.	.	.	.	.	.	.	G	8.694	0.908135	0.17833	.	.	ENSG00000172046	ENST00000417901;ENST00000453664;ENST00000398888;ENST00000434032;ENST00000306026;ENST00000425298	T;T;T;T;T	0.00648	5.99;5.99;5.99;5.99;5.99	0.418	0.418	0.16429	.	6.701840	0.01692	U	0.026694	T	0.00552	0.0018	N	0.01686	-0.76	0.09310	N	0.999998	B;B;B;B;P	0.42941	0.044;0.054;0.011;0.004;0.794	B;B;B;B;P	0.46110	0.018;0.022;0.007;0.001;0.504	T	0.43589	-0.9382	9	0.59425	D	0.04	.	.	.	.	.	108;45;45;45;45	A5PKX8;E9PEG8;E7EN22;O94966;O94966-2	.;.;.;UBP19_HUMAN;.	F	45	ENSP00000395260:S45F;ENSP00000400090:S45F;ENSP00000381863:S45F;ENSP00000401197:S45F;ENSP00000303503:S45F	ENSP00000303503:S45F	S	-	2	0	USP19	49130548	0.762000	0.28451	0.353000	0.25747	0.354000	0.29330	0.334000	0.19787	0.452000	0.26830	0.460000	0.39030	TCT	.		0.522	USP19-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257721.1	NM_006677	
LAMB2	3913	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	49159166	49159166	+	Missense_Mutation	SNP	G	G	A			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr3:49159166G>A	ENST00000418109.1	-	31	5215	c.5051C>T	c.(5050-5052)gCa>gTa	p.A1684V	USP19_ENST00000434032.2_5'Flank|USP19_ENST00000398898.2_5'Flank|USP19_ENST00000453664.1_5'Flank|USP19_ENST00000398888.2_5'Flank|USP19_ENST00000398892.3_5'Flank|USP19_ENST00000488993.1_5'Flank|LAMB2_ENST00000305544.4_Missense_Mutation_p.A1684V|USP19_ENST00000417901.1_5'Flank	NM_002292.3	NP_002283.3	P55268	LAMB2_HUMAN	laminin, beta 2 (laminin S)	1684	Domain I.				astrocyte development (GO:0014002)|axon extension involved in regeneration (GO:0048677)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|metanephric glomerular basement membrane development (GO:0072274)|metanephric glomerular visceral epithelial cell development (GO:0072249)|neuromuscular junction development (GO:0007528)|retina development in camera-type eye (GO:0060041)|Schwann cell development (GO:0014044)|visual perception (GO:0007601)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-11 complex (GO:0043260)|laminin-3 complex (GO:0005608)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(15)|kidney(3)|large_intestine(6)|lung(21)|ovary(4)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CGTTTCTTCTGCTGTAGAGGC	0.607																																					p.A1684V		.											.	LAMB2-93	0			c.C5051T						.						75.0	78.0	77.0					3																	49159166		2202	4300	6502	SO:0001583	missense	3913	exon30			TCTTCTGCTGTAG		CCDS2789.1	3p21.3-p21.2	2013-03-01			ENSG00000172037	ENSG00000172037		"""Laminins"""	6487	protein-coding gene	gene with protein product	"""laminin S"""	150325		LAMS		2922051, 10393422	Standard	NM_002292		Approved		uc003cwe.3	P55268	OTTHUMG00000156807	ENST00000418109.1:c.5051C>T	3.37:g.49159166G>A	ENSP00000388325:p.Ala1684Val	Somatic	163	0		WXS	Illumina HiSeq	Phase_I	152	43	NM_002292	0	0	171	246	75	Q16321	Missense_Mutation	SNP	ENST00000418109.1	37	CCDS2789.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.107341	0.77096	.	.	ENSG00000172037	ENST00000418109;ENST00000305544	T;T	0.38240	1.15;1.15	5.79	4.92	0.64577	.	0.000000	0.85682	D	0.000000	T	0.49677	0.1571	L	0.49350	1.555	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.44574	-0.9319	10	0.07325	T	0.83	.	14.8494	0.70284	0.0689:0.0:0.9311:0.0	.	1684	P55268	LAMB2_HUMAN	V	1684	ENSP00000388325:A1684V;ENSP00000307156:A1684V	ENSP00000307156:A1684V	A	-	2	0	LAMB2	49134170	1.000000	0.71417	0.027000	0.17364	0.970000	0.65996	9.339000	0.96797	1.451000	0.47736	0.655000	0.94253	GCA	.		0.607	LAMB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345939.1	NM_002292	
ABI3BP	25890	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	100593699	100593699	+	Missense_Mutation	SNP	A	A	C			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr3:100593699A>C	ENST00000284322.5	-	9	1026	c.917T>G	c.(916-918)cTc>cGc	p.L306R	ABI3BP_ENST00000471714.1_Missense_Mutation_p.L306R|ABI3BP_ENST00000495063.1_Missense_Mutation_p.L306R	NM_015429.3	NP_056244.2	Q7Z7G0	TARSH_HUMAN	ABI family, member 3 (NESH) binding protein	306					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular space (GO:0005615)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)			central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	50						TTGTGTCTTGAGTGCATCTGA	0.343																																					p.L306R		.											.	ABI3BP-138	0			c.T917G						.						102.0	95.0	97.0					3																	100593699		1842	4085	5927	SO:0001583	missense	25890	exon9			GTCTTGAGTGCAT	AB056106	CCDS46880.1	3q12.2	2013-02-11	2008-09-12		ENSG00000154175	ENSG00000154175		"""Fibronectin type III domain containing"""	17265	protein-coding gene	gene with protein product	"""target of Nesh-SH3"""	606279				11501947	Standard	NM_015429		Approved	NESHBP, DKFZP586L2024, TARSH	uc003dun.3	Q7Z7G0	OTTHUMG00000159094	ENST00000284322.5:c.917T>G	3.37:g.100593699A>C	ENSP00000284322:p.Leu306Arg	Somatic	18	0		WXS	Illumina HiSeq	Phase_I	14	3	NM_015429	0	0	0	0	0	B3KSL4|Q6ZW20|Q6ZW22|Q9C082|Q9UFI6	Missense_Mutation	SNP	ENST00000284322.5	37	CCDS46880.1	.	.	.	.	.	.	.	.	.	.	A	16.99	3.274771	0.59649	.	.	ENSG00000154175	ENST00000471714;ENST00000284322;ENST00000495063	T;T	0.24723	2.14;1.84	5.38	4.23	0.50019	.	0.912926	0.09478	N	0.796729	T	0.32406	0.0828	L	0.43152	1.355	0.80722	D	1	D;D;P	0.59767	0.971;0.986;0.814	P;P;P	0.54100	0.736;0.742;0.534	T	0.01480	-1.1344	10	0.25106	T	0.35	-1.5191	8.2196	0.31532	0.909:0.0:0.091:0.0	.	299;306;306	Q9H717;Q5JPC9;Q7Z7G0	.;.;TARSH_HUMAN	R	306	ENSP00000420524:L306R;ENSP00000284322:L306R	ENSP00000284322:L306R	L	-	2	0	ABI3BP	102076389	0.995000	0.38212	0.933000	0.37362	0.982000	0.71751	3.127000	0.50484	0.988000	0.38734	0.533000	0.62120	CTC	.		0.343	ABI3BP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353260.1		
POLQ	10721	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	121260262	121260262	+	Missense_Mutation	SNP	C	C	A			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr3:121260262C>A	ENST00000264233.5	-	3	536	c.408G>T	c.(406-408)atG>atT	p.M136I		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	136	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		CTTTCTTCCGCATTTCCAAAA	0.348								DNA polymerases (catalytic subunits)																													p.M136I	Pancreas(152;907 1925 26081 31236 36904)	.											.	POLQ-664	0			c.G408T						.						145.0	161.0	155.0					3																	121260262		2203	4300	6503	SO:0001583	missense	10721	exon3			CTTCCGCATTTCC	AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.408G>T	3.37:g.121260262C>A	ENSP00000264233:p.Met136Ile	Somatic	335	1		WXS	Illumina HiSeq	Phase_I	296	82	NM_199420	0	0	0	0	0	O95160|Q6VMB5	Missense_Mutation	SNP	ENST00000264233.5	37	CCDS33833.1	.	.	.	.	.	.	.	.	.	.	C	13.77	2.335029	0.41398	.	.	ENSG00000051341	ENST00000264233;ENST00000393672	T	0.40225	1.04	5.74	2.71	0.32032	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.437807	0.27891	N	0.017433	T	0.26340	0.0643	N	0.17723	0.515	0.20764	N	0.999854	B	0.29432	0.244	B	0.36030	0.216	T	0.13953	-1.0490	10	0.44086	T	0.13	.	3.6248	0.08109	0.3565:0.3671:0.2011:0.0753	.	136	O75417	DPOLQ_HUMAN	I	136;271	ENSP00000264233:M136I	ENSP00000264233:M136I	M	-	3	0	POLQ	122742952	0.754000	0.28360	0.747000	0.31113	0.988000	0.76386	-0.046000	0.11983	0.703000	0.31848	0.563000	0.77884	ATG	.		0.348	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355097.1	NM_199420	
TNFSF10	8743	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	172227069	172227069	+	Missense_Mutation	SNP	G	G	C	rs369143448		TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr3:172227069G>C	ENST00000241261.2	-	4	478	c.356C>G	c.(355-357)cCt>cGt	p.P119R	TNFSF10_ENST00000420541.2_Intron	NM_003810.3	NP_003801.1	P50591	TNF10_HUMAN	tumor necrosis factor (ligand) superfamily, member 10	119					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell-cell signaling (GO:0007267)|immune response (GO:0006955)|male gonad development (GO:0008584)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|response to insulin (GO:0032868)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	metal ion binding (GO:0046872)|receptor binding (GO:0005102)			breast(2)|cervix(1)|large_intestine(1)|lung(6)|ovary(1)|skin(4)	15	Ovarian(172;0.00197)|Breast(254;0.158)		Lung(28;1.67e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)			TACTCTCTGAGGACCTCTTTC	0.388																																					p.P119R		.											.	TNFSF10-662	0			c.C356G						.						105.0	102.0	103.0					3																	172227069		2203	4300	6503	SO:0001583	missense	8743	exon4			CTCTGAGGACCTC	U37518	CCDS3219.1, CCDS54680.1	3q26	2006-09-20			ENSG00000121858	ENSG00000121858		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11925	protein-coding gene	gene with protein product		603598				8777713, 8663110	Standard	NM_003810		Approved	TRAIL, Apo-2L, TL2, CD253	uc003fid.3	P50591	OTTHUMG00000156917	ENST00000241261.2:c.356C>G	3.37:g.172227069G>C	ENSP00000241261:p.Pro119Arg	Somatic	113	0		WXS	Illumina HiSeq	Phase_I	109	25	NM_003810	1	0	223	552	328	A1Y9B3	Missense_Mutation	SNP	ENST00000241261.2	37	CCDS3219.1	.	.	.	.	.	.	.	.	.	.	G	4.858	0.159457	0.09236	.	.	ENSG00000121858	ENST00000241261	D	0.86769	-2.17	4.71	-4.74	0.03249	.	1.516980	0.03189	N	0.173149	T	0.80325	0.4602	L	0.54323	1.7	0.09310	N	1	B	0.28324	0.207	B	0.23574	0.047	T	0.64097	-0.6487	10	0.08837	T	0.75	5.0717	8.19	0.31363	0.659:0.1329:0.208:0.0	.	119	P50591	TNF10_HUMAN	R	119	ENSP00000241261:P119R	ENSP00000241261:P119R	P	-	2	0	TNFSF10	173709763	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.053000	0.03500	-0.976000	0.03542	-1.113000	0.02065	CCT	.		0.388	TNFSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346601.1		
YEATS2	55689	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	183508727	183508727	+	Missense_Mutation	SNP	T	T	C			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr3:183508727T>C	ENST00000305135.5	+	21	3251	c.3056T>C	c.(3055-3057)gTg>gCg	p.V1019A		NM_018023.4	NP_060493.3	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2	1019					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|mitotic spindle (GO:0072686)	TBP-class protein binding (GO:0017025)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(24)|ovary(3)|prostate(2)|skin(3)	49	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			ACGTCCCTCGTGCCTACACCA	0.532																																					p.V1019A		.											.	YEATS2-138	0			c.T3056C						.						101.0	111.0	108.0					3																	183508727		2042	4199	6241	SO:0001583	missense	55689	exon21			CCCTCGTGCCTAC	AB033023	CCDS43175.1	3q27.3	2004-08-18			ENSG00000163872	ENSG00000163872			25489	protein-coding gene	gene with protein product		613373				10574462	Standard	NM_018023		Approved	FLJ10201, FLJ12841, FLJ13308, KIAA1197	uc003fly.2	Q9ULM3	OTTHUMG00000156898	ENST00000305135.5:c.3056T>C	3.37:g.183508727T>C	ENSP00000306983:p.Val1019Ala	Somatic	131	1		WXS	Illumina HiSeq	Phase_I	89	26	NM_018023	0	0	7	16	9	A7E2B9|D3DNS9|Q641P6|Q9NW96	Missense_Mutation	SNP	ENST00000305135.5	37	CCDS43175.1	.	.	.	.	.	.	.	.	.	.	T	14.14	2.447745	0.43429	.	.	ENSG00000163872	ENST00000421660;ENST00000305135	T	0.35236	1.32	5.68	5.68	0.88126	.	0.173852	0.36591	N	0.002520	T	0.24005	0.0581	N	0.19112	0.55	0.42581	D	0.993217	P;B	0.44139	0.827;0.38	B;B	0.38264	0.269;0.098	T	0.04870	-1.0921	10	0.27082	T	0.32	-14.1917	14.1631	0.65459	0.0:0.0:0.0:1.0	.	181;1019	Q8N5H6;Q9ULM3	.;YETS2_HUMAN	A	1019	ENSP00000306983:V1019A	ENSP00000306983:V1019A	V	+	2	0	YEATS2	184991421	1.000000	0.71417	1.000000	0.80357	0.324000	0.28378	3.246000	0.51414	2.164000	0.68074	0.477000	0.44152	GTG	.		0.532	YEATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346507.2	NM_018023	
FGF12	2257	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	192078247	192078247	+	Missense_Mutation	SNP	C	C	A			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr3:192078247C>A	ENST00000454309.2	-	2	1105	c.280G>T	c.(280-282)Gat>Tat	p.D94Y	FGF12_ENST00000430714.1_Intron|FGF12_ENST00000445105.2_Missense_Mutation_p.D32Y|FGF12_ENST00000450716.1_Missense_Mutation_p.D32Y|FGF12_ENST00000264730.3_Missense_Mutation_p.D32Y	NM_021032.4	NP_066360.1	P61328	FGF12_HUMAN	fibroblast growth factor 12	94					adult locomotory behavior (GO:0008344)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cell-cell signaling (GO:0007267)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|JNK cascade (GO:0007254)|negative regulation of cation channel activity (GO:2001258)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|positive regulation of sodium ion transport (GO:0010765)|regulation of membrane depolarization (GO:0003254)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	extracellular space (GO:0005615)|nucleus (GO:0005634)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)|ion channel binding (GO:0044325)|sodium channel regulator activity (GO:0017080)			endometrium(1)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	30	all_cancers(143;1.72e-08)|Ovarian(172;0.0634)|Breast(254;0.247)	Lung NSC(153;0.21)	LUSC - Lung squamous cell carcinoma(58;5.45e-06)|Lung(62;6.17e-06)	GBM - Glioblastoma multiforme(46;0.00032)		TTGGTCCCATCAATGGTACCA	0.408																																					p.D94Y		.											.	FGF12-949	0			c.G280T						.						178.0	150.0	159.0					3																	192078247		2203	4300	6503	SO:0001583	missense	2257	exon2			TCCCATCAATGGT	U66197	CCDS3301.1, CCDS46983.1	3q28	2008-07-18			ENSG00000114279	ENSG00000114279			3668	protein-coding gene	gene with protein product	"""fibroblast growth factor 12B"", ""fibroblast growth factor homologous factor 1"", ""myocyte-activating factor"", ""fibroblast growth factor FGF-12b"""	601513		FGF12B		8790420, 9345906	Standard	NM_021032		Approved	FHF1	uc003fsx.3	P61328	OTTHUMG00000156132	ENST00000454309.2:c.280G>T	3.37:g.192078247C>A	ENSP00000413496:p.Asp94Tyr	Somatic	82	0		WXS	Illumina HiSeq	Phase_I	79	20	NM_021032	0	0	9	9	0	B2R6B7|B2R976|O35339|P70376|Q8TBG5|Q92912|Q93001	Missense_Mutation	SNP	ENST00000454309.2	37	CCDS3301.1	.	.	.	.	.	.	.	.	.	.	C	19.73	3.882126	0.72294	.	.	ENSG00000114279	ENST00000264730;ENST00000392454;ENST00000445105;ENST00000454309;ENST00000450716;ENST00000448795;ENST00000418610	T;T;T;T;T;T	0.69306	-0.39;-0.39;-0.39;-0.39;-0.39;-0.39	5.53	5.53	0.82687	.	0.192095	0.56097	D	0.000035	D	0.82857	0.5128	M	0.85630	2.765	0.80722	D	1	D;D	0.62365	0.981;0.991	P;P	0.62298	0.838;0.9	D	0.85384	0.1121	10	0.72032	D	0.01	.	18.4573	0.90725	0.0:1.0:0.0:0.0	.	32;94	P61328-2;P61328	.;FGF12_HUMAN	Y	32;32;32;94;32;8;32	ENSP00000264730:D32Y;ENSP00000393686:D32Y;ENSP00000413496:D94Y;ENSP00000397635:D32Y;ENSP00000412904:D8Y;ENSP00000395517:D32Y	ENSP00000264730:D32Y	D	-	1	0	FGF12	193560941	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.390000	0.59646	2.613000	0.88420	0.591000	0.81541	GAT	.		0.408	FGF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343160.1	NM_021032	
MUC4	4585	broad.mit.edu	37	3	195505813	195505813	+	Missense_Mutation	SNP	T	T	C	rs562396488	byFrequency	TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr3:195505813T>C	ENST00000463781.3	-	2	13097	c.12638A>G	c.(12637-12639)gAc>gGc	p.D4213G	MUC4_ENST00000475231.1_Missense_Mutation_p.D4213G|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.D4213G(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGAGGAAGTGTCGGTGACAGG	0.592													.|||	73	0.0145767	0.0151	0.0144	5008	,	,		14193	0.0159		0.0189	False		,,,				2504	0.0082				p.D4213G													.	MUC4-90	2	Substitution - Missense(2)	endometrium(2)	c.A12638G						.						26.0	23.0	24.0					3																	195505813		690	1577	2267	SO:0001583	missense	4585	exon2			GAAGTGTCGGTGA	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12638A>G	3.37:g.195505813T>C	ENSP00000417498:p.Asp4213Gly	Somatic	15	0		WXS	Illumina HiSeq	Phase_I	13	3	NM_018406	0	0	14	14	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	0.010	-1.784645	0.00628	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.32753	1.44;1.46	.	.	.	.	.	.	.	.	T	0.12689	0.0308	N	0.14661	0.345	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	T	0.24190	-1.0167	7	.	.	.	.	3.8908	0.09117	0.0:0.332:0.0:0.668	.	4085	E7ESK3	.	G	4213	ENSP00000417498:D4213G;ENSP00000420243:D4213G	.	D	-	2	0	MUC4	196990592	.	.	0.000000	0.03702	0.000000	0.00434	.	.	-1.874000	0.01133	-1.876000	0.00548	GAC	.		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
SPON2	10417	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	1165206	1165206	+	Missense_Mutation	SNP	A	A	T			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr4:1165206A>T	ENST00000290902.5	-	3	621	c.289T>A	c.(289-291)Ttt>Att	p.F97I	SPON2_ENST00000431380.1_Missense_Mutation_p.F97I	NM_012445.3	NP_036577	Q9BUD6	SPON2_HUMAN	spondin 2, extracellular matrix protein	97	Spondin. {ECO:0000255|PROSITE- ProRule:PRU00364}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|innate immune response (GO:0045087)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|pancreas(1)|skin(1)	9			OV - Ovarian serous cystadenocarcinoma(23;0.00805)	UCEC - Uterine corpus endometrioid carcinoma (64;0.139)|Colorectal(103;0.19)		CGCTCCGCAAAGTCGCGCAGC	0.701																																					p.F97I		.											.	SPON2-90	0			c.T289A						.						26.0	28.0	27.0					4																	1165206		2193	4283	6476	SO:0001583	missense	10417	exon3			CCGCAAAGTCGCG	AB027466	CCDS3347.1	4p16.3	2008-07-29			ENSG00000159674	ENSG00000159674			11253	protein-coding gene	gene with protein product	"""Mindin"", ""M-spondin"""	605918				10512675, 15094111	Standard	NM_012445		Approved	DIL1	uc003gco.4	Q9BUD6	OTTHUMG00000089002	ENST00000290902.5:c.289T>A	4.37:g.1165206A>T	ENSP00000290902:p.Phe97Ile	Somatic	65	0		WXS	Illumina HiSeq	Phase_I	52	8	NM_012445	0	0	136	275	139	D3DVN9|Q4W5N4|Q9ULW1	Missense_Mutation	SNP	ENST00000290902.5	37	CCDS3347.1	.	.	.	.	.	.	.	.	.	.	A	19.08	3.757899	0.69648	.	.	ENSG00000159674	ENST00000290902;ENST00000431380;ENST00000503765	T;T;T	0.44881	0.91;0.91;0.91	4.5	4.5	0.54988	Spondin, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.61236	0.2331	M	0.71296	2.17	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.76071	0.987;0.955;0.967	T	0.61187	-0.7113	10	0.35671	T	0.21	.	13.4453	0.61138	1.0:0.0:0.0:0.0	.	97;97;97	D6RB12;D3DVN9;Q9BUD6	.;.;SPON2_HUMAN	I	97	ENSP00000290902:F97I;ENSP00000394832:F97I;ENSP00000424542:F97I	ENSP00000290902:F97I	F	-	1	0	SPON2	1155206	1.000000	0.71417	0.979000	0.43373	0.095000	0.18619	5.240000	0.65378	1.667000	0.50832	0.418000	0.28097	TTT	.		0.701	SPON2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000202080.2		
UVSSA	57654	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	1347115	1347115	+	Missense_Mutation	SNP	A	A	C			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr4:1347115A>C	ENST00000389851.4	+	5	1295	c.848A>C	c.(847-849)gAg>gCg	p.E283A	UVSSA_ENST00000511216.1_Missense_Mutation_p.E283A|UVSSA_ENST00000507531.1_Missense_Mutation_p.E283A	NM_020894.2	NP_065945.2	Q2YD98	UVSSA_HUMAN	UV-stimulated scaffold protein A	283					protein ubiquitination (GO:0016567)|response to UV (GO:0009411)|transcription-coupled nucleotide-excision repair (GO:0006283)	chromosome (GO:0005694)	RNA polymerase II core binding (GO:0000993)										CCCTCAGATGAGGACGAGGAC	0.657																																					p.E283A		.											.	.	0			c.A848C						.						17.0	18.0	18.0					4																	1347115		2193	4283	6476	SO:0001583	missense	57654	exon5			CAGATGAGGACGA	BC021930	CCDS33938.1	4p16.3	2012-04-27	2012-04-27	2012-04-27		ENSG00000163945			29304	protein-coding gene	gene with protein product		614632	"""KIAA1530"""	KIAA1530		10819331, 22466610, 22466611, 22466612	Standard	NM_020894		Approved		uc003gde.4	Q2YD98		ENST00000389851.4:c.848A>C	4.37:g.1347115A>C	ENSP00000374501:p.Glu283Ala	Somatic	25	0		WXS	Illumina HiSeq	Phase_I	23	6	NM_020894	0	0	1	2	1	A8K9E6|B2RU11|Q8WTX4|Q9P1Z8	Missense_Mutation	SNP	ENST00000389851.4	37	CCDS33938.1	.	.	.	.	.	.	.	.	.	.	A	6.849	0.525889	0.13066	.	.	ENSG00000163945	ENST00000511216;ENST00000389851;ENST00000507531	T;T;T	0.32988	1.43;1.43;1.43	4.13	2.89	0.33648	.	0.479895	0.23176	N	0.051071	T	0.20007	0.0481	L	0.55481	1.735	0.23204	N	0.998124	B	0.30406	0.278	B	0.24974	0.057	T	0.29058	-1.0024	10	0.05721	T	0.95	.	5.9647	0.19318	0.7766:0.0:0.2234:0.0	.	283	Q2YD98	K1530_HUMAN	A	283	ENSP00000425130:E283A;ENSP00000374501:E283A;ENSP00000421741:E283A	ENSP00000374501:E283A	E	+	2	0	KIAA1530	1337115	0.933000	0.31639	0.289000	0.24876	0.208000	0.24298	3.004000	0.49513	0.438000	0.26450	0.260000	0.18958	GAG	.		0.657	UVSSA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359480.1	NM_020894	
KIAA1109	84162	bcgsc.ca	37	4	123109048	123109048	+	Splice_Site	SNP	A	A	T	rs398088870		TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr4:123109048A>T	ENST00000264501.4	+	9	1000		c.e9-1		KIAA1109_ENST00000455637.1_Splice_Site|KIAA1109_ENST00000388738.3_Splice_Site			Q2LD37	K1109_HUMAN	KIAA1109						regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						TTTTTTTTTTAGGGACGTTTG	0.328																																					.													.	KIAA1109-80	0			c.628-2A>T						.						56.0	50.0	52.0					4																	123109048		1799	4060	5859	SO:0001630	splice_region_variant	84162	exon7			TTTTTTAGGGACG	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.628-1A>T	4.37:g.123109048A>T		Somatic	74	2		WXS	Illumina HiSeq	Phase_1	74	7	NM_015312	0	0	0	0	0	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Splice_Site	SNP	ENST00000264501.4	37	CCDS43267.1	.	.	.	.	.	.	.	.	.	.	A	15.47	2.843721	0.51164	.	.	ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000455637;ENST00000424425	.	.	.	5.59	4.39	0.52855	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.9345	0.52866	0.8696:0.0:0.0:0.1304	.	.	.	.	.	-1	.	.	.	+	.	.	KIAA1109	123328498	1.000000	0.71417	0.933000	0.37362	0.597000	0.36814	9.227000	0.95236	0.924000	0.37069	0.459000	0.35465	.	.		0.328	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	Intron
TBC1D9	23158	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	141560501	141560501	+	Missense_Mutation	SNP	T	T	C			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr4:141560501T>C	ENST00000442267.2	-	14	2493	c.2419A>G	c.(2419-2421)Act>Gct	p.T807A		NM_015130.2	NP_055945.2	Q6ZT07	TBCD9_HUMAN	TBC1 domain family, member 9 (with GRAM domain)	807							calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	31	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)				CGTTTCGTAGTATCCTCCAGC	0.458																																					p.T807A		.											.	TBC1D9-23	0			c.A2419G						.						88.0	90.0	89.0					4																	141560501		1980	4151	6131	SO:0001583	missense	23158	exon14			TCGTAGTATCCTC	AB020689	CCDS47136.1	4q31.1	2013-01-10	2006-07-12		ENSG00000109436	ENSG00000109436		"""EF-hand domain containing"""	21710	protein-coding gene	gene with protein product			"""TBC1 domain family, member 9"""			12970790	Standard	NM_015130		Approved	KIAA0882, MDR1	uc010ioj.3	Q6ZT07	OTTHUMG00000161405	ENST00000442267.2:c.2419A>G	4.37:g.141560501T>C	ENSP00000411197:p.Thr807Ala	Somatic	33	0		WXS	Illumina HiSeq	Phase_I	19	4	NM_015130	0	0	13	21	8	A6H8U8|D3DNZ1|O94958	Missense_Mutation	SNP	ENST00000442267.2	37	CCDS47136.1	.	.	.	.	.	.	.	.	.	.	T	22.7	4.330187	0.81690	.	.	ENSG00000109436	ENST00000442267	T	0.08984	3.03	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.16685	0.0401	M	0.66939	2.045	0.80722	D	1	P	0.46656	0.882	P	0.48952	0.596	T	0.07501	-1.0769	10	0.17369	T	0.5	-9.4557	15.4755	0.75474	0.0:0.0:0.0:1.0	.	807	Q6ZT07	TBCD9_HUMAN	A	807	ENSP00000411197:T807A	ENSP00000411197:T807A	T	-	1	0	TBC1D9	141779951	1.000000	0.71417	0.880000	0.34516	0.996000	0.88848	6.093000	0.71422	2.052000	0.61016	0.533000	0.62120	ACT	.		0.458	TBC1D9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364806.1	NM_015130	
ARHGEF28	64283	broad.mit.edu;bcgsc.ca	37	5	73161823	73161823	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr5:73161823C>T	ENST00000426542.2	+	17	2157	c.2137C>T	c.(2137-2139)Cag>Tag	p.Q713*	ARHGEF28_ENST00000287898.5_Nonsense_Mutation_p.Q713*|ARHGEF28_ENST00000513042.2_Nonsense_Mutation_p.Q713*|ARHGEF28_ENST00000296794.6_Nonsense_Mutation_p.Q713*|ARHGEF28_ENST00000545377.1_Nonsense_Mutation_p.Q713*|ARHGEF28_ENST00000437974.1_Nonsense_Mutation_p.Q713*|ARHGEF28_ENST00000296799.4_Nonsense_Mutation_p.Q400*			Q8N1W1	ARG28_HUMAN	Rho guanine nucleotide exchange factor (GEF) 28	713					central nervous system neuron axonogenesis (GO:0021955)|intracellular signal transduction (GO:0035556)|neurofilament cytoskeleton organization (GO:0060052)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|RNA binding (GO:0003723)										GAACAAACCACAGACCATCCT	0.269																																					p.Q713X													.	.	0			c.C2137T						.						53.0	50.0	51.0					5																	73161823		1796	4050	5846	SO:0001587	stop_gained	64283	exon18			AAACCACAGACCA		CCDS47231.1, CCDS47231.2, CCDS54870.1, CCDS58957.1	5q13.2	2012-08-08			ENSG00000214944	ENSG00000214944			30322	protein-coding gene	gene with protein product		612790				9199174, 11058585	Standard	NM_001177693		Approved	RGNEF, p190RhoGEF, RIP2	uc010izf.3	Q8N1W1	OTTHUMG00000162454	ENST00000426542.2:c.2137C>T	5.37:g.73161823C>T	ENSP00000412175:p.Gln713*	Somatic	34	0		WXS	Illumina HiSeq	Phase_I	27	4	NM_001080479	0	0	4	6	2	B2RXG7|B4E3K4|B5MDA3|B7ZW32|E9PC75|Q8NCM7|Q96E37|Q9H6L3|Q9H6W0	Nonsense_Mutation	SNP	ENST00000426542.2	37	CCDS54870.1	.	.	.	.	.	.	.	.	.	.	C	40	8.056392	0.98632	.	.	ENSG00000214944	ENST00000296794;ENST00000545377;ENST00000513042;ENST00000287898;ENST00000437974;ENST00000426542;ENST00000296799	.	.	.	5.77	5.77	0.91146	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	17.7711	0.88493	0.0:1.0:0.0:0.0	.	.	.	.	X	713;713;713;713;713;713;400	.	ENSP00000287898:Q713X	Q	+	1	0	RP11-428C6.1	73197579	0.997000	0.39634	0.994000	0.49952	0.997000	0.91878	4.306000	0.59117	2.729000	0.93468	0.655000	0.94253	CAG	.		0.269	ARHGEF28-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000368975.1		
TMEM161B	153396	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	87521633	87521633	+	Missense_Mutation	SNP	A	A	G			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr5:87521633A>G	ENST00000296595.6	-	4	366	c.242T>C	c.(241-243)aTt>aCt	p.I81T	TMEM161B_ENST00000506536.1_5'UTR|TMEM161B_ENST00000514135.1_Missense_Mutation_p.I81T|TMEM161B_ENST00000509387.1_5'UTR|TMEM161B_ENST00000512429.1_Missense_Mutation_p.I70T	NM_153354.3	NP_699185.1	Q8NDZ6	T161B_HUMAN	transmembrane protein 161B	81						integral component of membrane (GO:0016021)				endometrium(4)|large_intestine(3)|lung(9)|skin(3)|upper_aerodigestive_tract(1)	20		all_cancers(142;0.000275)|Lung NSC(167;0.00901)|all_lung(232;0.0111)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;6.24e-36)|Epithelial(54;6.8e-31)|all cancers(79;1.07e-26)		ATGAAGGTCAATATCCTTTGG	0.299																																					p.I81T		.											.	TMEM161B-92	0			c.T242C						.						132.0	129.0	130.0					5																	87521633		2202	4298	6500	SO:0001583	missense	153396	exon4			AGGTCAATATCCT	BC037287	CCDS4065.1, CCDS75269.1, CCDS75270.1	5q14.3	2008-02-05			ENSG00000164180	ENSG00000164180			28483	protein-coding gene	gene with protein product						12477932	Standard	NM_001289008		Approved	MGC33214	uc003kjc.3	Q8NDZ6	OTTHUMG00000131323	ENST00000296595.6:c.242T>C	5.37:g.87521633A>G	ENSP00000296595:p.Ile81Thr	Somatic	130	0		WXS	Illumina HiSeq	Phase_I	150	30	NM_153354	0	0	2	6	4	Q5CZH7|Q6UWQ6	Missense_Mutation	SNP	ENST00000296595.6	37	CCDS4065.1	.	.	.	.	.	.	.	.	.	.	A	16.80	3.222869	0.58668	.	.	ENSG00000164180	ENST00000514135;ENST00000296595;ENST00000512429;ENST00000443393	.	.	.	5.02	5.02	0.67125	.	0.047070	0.85682	D	0.000000	T	0.55369	0.1916	L	0.44542	1.39	0.80722	D	1	B	0.15719	0.014	B	0.18871	0.023	T	0.52056	-0.8626	9	0.35671	T	0.21	-0.078	15.0267	0.71674	1.0:0.0:0.0:0.0	.	81	Q8NDZ6	T161B_HUMAN	T	81;81;70;81	.	ENSP00000296595:I81T	I	-	2	0	TMEM161B	87557389	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.804000	0.91921	2.025000	0.59659	0.383000	0.25322	ATT	.		0.299	TMEM161B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254094.1	NM_153354	
GALNT10	55568	broad.mit.edu	37	5	153755873	153755873	+	Missense_Mutation	SNP	T	T	C			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr5:153755873T>C	ENST00000297107.6	+	5	742	c.605T>C	c.(604-606)cTt>cCt	p.L202P	GALNT10_ENST00000377661.2_Intron|GALNT10_ENST00000425427.2_Missense_Mutation_p.L202P|SAP30L-AS1_ENST00000519727.1_RNA	NM_198321.3	NP_938080.1	Q86SR1	GLT10_HUMAN	polypeptide N-acetylgalactosaminyltransferase 10	202	Catalytic subdomain A.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(12)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	32	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)|all_hematologic(541;0.21)	Kidney(363;8.21e-05)|KIRC - Kidney renal clear cell carcinoma(527;0.000577)			TACATGGCCCTTTTCCCCAGT	0.502																																					p.L202P													.	GALNT10-92	0			c.T605C						.						137.0	134.0	135.0					5																	153755873		2203	4300	6503	SO:0001583	missense	55568	exon5			TGGCCCTTTTCCC	AK023782	CCDS4325.1	5q34	2014-03-13	2014-03-13		ENSG00000164574	ENSG00000164574	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	19873	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 10"""	608043	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 (GalNAc-T10)"""			12417297	Standard	NM_198321		Approved	GalNAc-T10	uc003lvh.3	Q86SR1	OTTHUMG00000130145	ENST00000297107.6:c.605T>C	5.37:g.153755873T>C	ENSP00000297107:p.Leu202Pro	Somatic	188	0		WXS	Illumina HiSeq	Phase_I	190	4	NM_198321	0	0	23	23	0	B3KXC9|Q6IN56|Q86VP8|Q8IXJ2|Q8TEJ2|Q96IV2|Q9H8E1|Q9Y4M4	Missense_Mutation	SNP	ENST00000297107.6	37	CCDS4325.1	.	.	.	.	.	.	.	.	.	.	T	12.77	2.036802	0.35893	.	.	ENSG00000164574	ENST00000425427;ENST00000297107	T;T	0.59772	0.24;0.24	5.98	-6.42	0.01932	Glycosyl transferase, family 2 (1);	0.438212	0.26923	N	0.021806	T	0.38904	0.1058	L	0.33710	1.025	0.09310	N	0.999996	B;B	0.30634	0.288;0.0	B;B	0.35899	0.213;0.0	T	0.37596	-0.9699	10	0.46703	T	0.11	.	8.2076	0.31465	0.5976:0.0:0.248:0.1545	.	202;202	Q86SR1;Q86SR1-3	GLT10_HUMAN;.	P	202	ENSP00000415210:L202P;ENSP00000297107:L202P	ENSP00000297107:L202P	L	+	2	0	GALNT10	153736066	0.991000	0.36638	0.165000	0.22776	0.896000	0.52359	2.523000	0.45580	-0.512000	0.06505	0.533000	0.62120	CTT	.		0.502	GALNT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252453.1	NM_198321	
LCP2	3937	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	169724562	169724562	+	Missense_Mutation	SNP	G	G	C			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr5:169724562G>C	ENST00000046794.5	-	1	669	c.54C>G	c.(52-54)gaC>gaG	p.D18E		NM_005565.3	NP_005556.1	Q13094	LCP2_HUMAN	lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)	18	SAM.				blood coagulation (GO:0007596)|cytokine secretion (GO:0050663)|Fc-epsilon receptor signaling pathway (GO:0038095)|immune response (GO:0006955)|innate immune response (GO:0045087)|mast cell activation (GO:0045576)|platelet activation (GO:0030168)|T cell receptor signaling pathway (GO:0050852)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)				cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	23	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	OV - Ovarian serous cystadenocarcinoma(192;0.247)		CAGCAAGGCTGTCGGGGTCCC	0.557																																					p.D18E		.											.	LCP2-23	0			c.C54G						.						43.0	45.0	45.0					5																	169724562		2003	4173	6176	SO:0001583	missense	3937	exon1			AAGGCTGTCGGGG		CCDS47339.1	5q35.1	2013-02-14	2002-08-29		ENSG00000043462	ENSG00000043462		"""SH2 domain containing"""	6529	protein-coding gene	gene with protein product	"""76 kDa tyrosine phosphoprotein"", ""SH2 domain-containing leukocyte protein of 76kD"""	601603	"""lymphocyte cytosolic protein 2 (SH2 domain-containing leukocyte protein of 76kD)"""	SLP76		7706237	Standard	NM_005565		Approved	SLP-76	uc003man.1	Q13094	OTTHUMG00000163121	ENST00000046794.5:c.54C>G	5.37:g.169724562G>C	ENSP00000046794:p.Asp18Glu	Somatic	23	0		WXS	Illumina HiSeq	Phase_I	15	3	NM_005565	0	0	9	9	0	A8KA25|Q53XV4	Missense_Mutation	SNP	ENST00000046794.5	37	CCDS47339.1	.	.	.	.	.	.	.	.	.	.	G	10.48	1.361638	0.24684	.	.	ENSG00000043462	ENST00000046794	D	0.83506	-1.73	5.44	2.13	0.27403	Sterile alpha motif domain (1);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 2 (1);	0.236840	0.42964	D	0.000627	T	0.66809	0.2827	L	0.29908	0.895	0.80722	D	1	B	0.10296	0.003	B	0.13407	0.009	T	0.55457	-0.8138	9	.	.	.	-17.5712	3.0362	0.06123	0.2448:0.0:0.5448:0.2105	.	18	Q13094	LCP2_HUMAN	E	18	ENSP00000046794:D18E	.	D	-	3	2	LCP2	169657140	0.998000	0.40836	0.982000	0.44146	0.798000	0.45092	1.020000	0.30027	1.198000	0.43158	-0.345000	0.07892	GAC	.		0.557	LCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371727.1	NM_005565	
NSD1	64324	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	176639042	176639042	+	Silent	SNP	T	T	C			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr5:176639042T>C	ENST00000439151.2	+	5	3687	c.3642T>C	c.(3640-3642)ctT>ctC	p.L1214L	NSD1_ENST00000354179.4_Silent_p.L945L|NSD1_ENST00000361032.4_Silent_p.L1111L|NSD1_ENST00000347982.4_Silent_p.L945L	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	1214					gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		CAAGCATACTTGAGGAACCAC	0.483			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																											p.L1214L		.		Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	.	NSD1-188	0			c.T3642C						.						84.0	82.0	83.0					5																	176639042		2203	4300	6503	SO:0001819	synonymous_variant	64324	exon5	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	CATACTTGAGGAA	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.3642T>C	5.37:g.176639042T>C		Somatic	58	0		WXS	Illumina HiSeq	Phase_I	55	18	NM_022455	0	0	7	14	7	Q96PD8|Q96RN7	Silent	SNP	ENST00000439151.2	37	CCDS4412.1																																																																																			.		0.483	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253412.2	NM_172349	
NUP153	9972	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	17688708	17688708	+	Missense_Mutation	SNP	G	G	A			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr6:17688708G>A	ENST00000262077.2	-	2	252	c.253C>T	c.(253-255)Cat>Tat	p.H85Y	NUP153_ENST00000537253.1_Missense_Mutation_p.H85Y	NM_005124.2	NP_005115.2	P49790	NU153_HUMAN	nucleoporin 153kDa	85					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of RNA export from nucleus (GO:0046832)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)|viral penetration into host nucleus (GO:0075732)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleocytoplasmic transporter activity (GO:0005487)|protein anchor (GO:0043495)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			NS(2)|breast(6)|endometrium(4)|kidney(3)|large_intestine(7)|lung(23)|ovary(3)|skin(3)|urinary_tract(2)	53	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			TATACCAGATGGTCCTCTTTA	0.438																																					p.H85Y		.											.	NUP153-637	0			c.C253T						.						130.0	123.0	125.0					6																	17688708		2203	4300	6503	SO:0001583	missense	9972	exon2			CCAGATGGTCCTC	Z25535	CCDS4541.1, CCDS64359.1, CCDS75407.1	6p22.3	2008-07-29	2002-08-29		ENSG00000124789	ENSG00000124789			8062	protein-coding gene	gene with protein product		603948	"""nucleoporin 153kD"""			8110839	Standard	NM_001278209		Approved	HNUP153	uc003ncd.2	P49790	OTTHUMG00000014312	ENST00000262077.2:c.253C>T	6.37:g.17688708G>A	ENSP00000262077:p.His85Tyr	Somatic	189	0		WXS	Illumina HiSeq	Phase_I	128	39	NM_005124	0	0	12	20	8	B4DIK2|E7EPX5|F6QR24|Q4LE47|Q5T9I7|Q7Z743	Missense_Mutation	SNP	ENST00000262077.2	37	CCDS4541.1	.	.	.	.	.	.	.	.	.	.	G	14.97	2.693922	0.48202	.	.	ENSG00000124789	ENST00000262077;ENST00000430136;ENST00000537253	T;T	0.08282	3.13;3.11	5.37	5.37	0.77165	.	0.125530	0.35805	N	0.002971	T	0.06600	0.0169	L	0.29908	0.895	0.42291	D	0.99213	D;B;P	0.65815	0.995;0.021;0.94	P;B;B	0.60609	0.877;0.008;0.439	T	0.06144	-1.0843	10	0.02654	T	1	-2.2032	16.8895	0.86083	0.0:0.0:1.0:0.0	.	85;107;85	F6QR24;Q4LE47;P49790	.;.;NU153_HUMAN	Y	85;107;85	ENSP00000262077:H85Y;ENSP00000444029:H85Y	ENSP00000262077:H85Y	H	-	1	0	NUP153	17796687	0.927000	0.31430	0.892000	0.35008	0.127000	0.20565	4.623000	0.61247	2.494000	0.84150	0.650000	0.86243	CAT	.		0.438	NUP153-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039953.1		
ZNF184	7738	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	27420017	27420017	+	Missense_Mutation	SNP	T	T	C			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr6:27420017T>C	ENST00000211936.6	-	6	1605	c.1321A>G	c.(1321-1323)Act>Gct	p.T441A	ZNF184_ENST00000377419.1_Missense_Mutation_p.T441A	NM_007149.2	NP_009080.2	Q99676	ZN184_HUMAN	zinc finger protein 184	441					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|kidney(9)|large_intestine(13)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	48						TTCTCCCCAGTATGAGTTTTT	0.403																																					p.T441A		.											.	ZNF184-91	0			c.A1321G						.						86.0	86.0	86.0					6																	27420017		2203	4300	6503	SO:0001583	missense	7738	exon6			CCCCAGTATGAGT	U66561	CCDS4624.1	6p21.3	2013-01-08	2006-06-28		ENSG00000096654	ENSG00000096654		"""Zinc fingers, C2H2-type"", ""-"""	12975	protein-coding gene	gene with protein product		602277	"""zinc finger protein 184 (Kruppel-like)"""				Standard	NM_007149		Approved		uc003nji.3	Q99676	OTTHUMG00000014478	ENST00000211936.6:c.1321A>G	6.37:g.27420017T>C	ENSP00000211936:p.Thr441Ala	Somatic	192	0		WXS	Illumina HiSeq	Phase_I	157	49	NM_007149	0	0	5	8	3	B2R715|O60792|Q8TBA9	Missense_Mutation	SNP	ENST00000211936.6	37	CCDS4624.1	.	.	.	.	.	.	.	.	.	.	T	20.1	3.937528	0.73557	.	.	ENSG00000096654	ENST00000211936;ENST00000377419	T;T	0.26518	1.73;1.73	5.27	5.27	0.74061	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.130826	0.35585	N	0.003116	T	0.11367	0.0277	L	0.33624	1.015	0.42611	D	0.993316	P	0.46706	0.883	B	0.38921	0.285	T	0.03139	-1.1068	10	0.87932	D	0	.	13.1686	0.59585	0.0:0.0:0.0:1.0	.	441	Q99676	ZN184_HUMAN	A	441	ENSP00000211936:T441A;ENSP00000366636:T441A	ENSP00000211936:T441A	T	-	1	0	ZNF184	27527996	0.995000	0.38212	0.769000	0.31535	0.998000	0.95712	2.951000	0.49089	2.214000	0.71695	0.533000	0.62120	ACT	.		0.403	ZNF184-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040146.1	NM_007149	
RGL2	5863	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	33260849	33260849	+	Missense_Mutation	SNP	T	T	C			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr6:33260849T>C	ENST00000497454.1	-	16	2446	c.1951A>G	c.(1951-1953)Atc>Gtc	p.I651V	RGL2_ENST00000437840.2_5'UTR|PFDN6_ENST00000463584.1_Intron	NM_001243738.1|NM_004761.4	NP_001230667.1|NP_004752.1	O15211	RGL2_HUMAN	ral guanine nucleotide dissociation stimulator-like 2	651	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)	intracellular (GO:0005622)	Ras guanyl-nucleotide exchange factor activity (GO:0005088)			breast(2)|cervix(2)|endometrium(7)|kidney(2)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	34						ACTCGGATGATACGGCAATCA	0.597																																					p.I651V		.											.	RGL2-662	0			c.A1951G						.						202.0	229.0	220.0					6																	33260849		2203	4300	6503	SO:0001583	missense	5863	exon16			GGATGATACGGCA		CCDS4774.1	6p21.3	2010-02-17	2004-06-11	2004-06-16	ENSG00000237441	ENSG00000237441			9769	protein-coding gene	gene with protein product		602306	"""RAB2, member RAS oncogene family-like"""	RAB2L		8976381	Standard	NM_001243738		Approved	KE1.5, HKE1.5	uc003odv.3	O15211	OTTHUMG00000031072	ENST00000497454.1:c.1951A>G	6.37:g.33260849T>C	ENSP00000420211:p.Ile651Val	Somatic	409	0		WXS	Illumina HiSeq	Phase_I	440	148	NM_004761	0	0	18	30	12	B4DG72|Q5STK0|Q9Y3F3	Missense_Mutation	SNP	ENST00000497454.1	37	CCDS4774.1	.	.	.	.	.	.	.	.	.	.	T	14.82	2.650468	0.47362	.	.	ENSG00000237441	ENST00000497454;ENST00000421215	T	0.49139	0.79	4.6	4.6	0.57074	Ras-association (3);	0.000000	0.85682	D	0.000000	T	0.46073	0.1374	L	0.40543	1.245	0.80722	D	1	D	0.58620	0.983	D	0.73708	0.981	T	0.45131	-0.9282	10	0.42905	T	0.14	.	10.3298	0.43816	0.0:0.0:0.0:1.0	.	651	O15211	RGL2_HUMAN	V	651;515	ENSP00000420211:I651V	ENSP00000400083:I515V	I	-	1	0	RGL2	33368827	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	5.349000	0.66010	1.937000	0.56155	0.523000	0.50628	ATC	.		0.597	RGL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076098.2		
NUDT3	11165	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	34309651	34309651	+	Missense_Mutation	SNP	T	T	G			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr6:34309651T>G	ENST00000607016.1	-	2	509	c.198A>C	c.(196-198)gaA>gaC	p.E66D	RPS10-NUDT3_ENST00000605528.1_Missense_Mutation_p.E185D	NM_006703.3	NP_006694.1	O95989	NUDT3_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 3	66	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.				cell-cell signaling (GO:0007267)|diadenosine polyphosphate catabolic process (GO:0015961)|diphosphoinositol polyphosphate catabolic process (GO:0071544)|inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	diphosphoinositol-polyphosphate diphosphatase activity (GO:0008486)|inositol diphosphate tetrakisphosphate diphosphatase activity (GO:0052840)|inositol-1,5-bisdiphosphate-2,3,4,6-tetrakisphosphate 1-diphosphatase activity (GO:0052846)|inositol-1,5-bisdiphosphate-2,3,4,6-tetrakisphosphate 5-diphosphatase activity (GO:0052847)|inositol-1-diphosphate-2,3,4,5,6-pentakisphosphate diphosphatase activity (GO:0052843)|inositol-3,5-bisdiphosphate-2,3,4,6-tetrakisphosphate 5-diphosphatase activity (GO:0052848)|inositol-3-diphosphate-1,2,4,5,6-pentakisphosphate diphosphatase activity (GO:0052844)|inositol-5-diphosphate-1,2,3,4,6-pentakisphosphate diphosphatase activity (GO:0052845)|magnesium ion binding (GO:0000287)			lung(2)	2						CCTCACAGACTTCACGAACTG	0.532																																					p.E185D	GBM(96;1206 1939 18658 39482)	.											.	.	0			c.A555C						.						155.0	119.0	131.0					6																	34309651		2203	4300	6503	SO:0001583	missense	0	exon6			ACAGACTTCACGA	AF062530	CCDS4791.1	6p21.2	2014-07-16			ENSG00000272325	ENSG00000272325		"""Nudix motif containing"""	8050	protein-coding gene	gene with protein product		609228				9822604	Standard	NM_006703		Approved	DIPP		O95989	OTTHUMG00000014545	ENST00000607016.1:c.198A>C	6.37:g.34309651T>G	ENSP00000476119:p.Glu66Asp	Somatic	65	0		WXS	Illumina HiSeq	Phase_I	56	12	NM_001202470	0	0	0	3	3	B2R8N4	Missense_Mutation	SNP	ENST00000607016.1	37	CCDS4791.1	.	.	.	.	.	.	.	.	.	.	T	26.3	4.725873	0.89298	.	.	ENSG00000112664	ENST00000358797	T	0.29917	1.55	5.66	4.5	0.54988	NUDIX hydrolase domain (3);NUDIX hydrolase, conserved site (1);NUDIX hydrolase domain-like (1);	0.000000	0.85682	D	0.000000	T	0.65428	0.2690	H	0.99415	4.555	0.80722	D	1	P	0.48589	0.912	D	0.75020	0.985	T	0.76889	-0.2792	10	0.87932	D	0	-14.5823	10.5134	0.44874	0.0:0.0772:0.0:0.9228	.	66	O95989	NUDT3_HUMAN	D	66	ENSP00000351650:E66D	ENSP00000351650:E66D	E	-	3	2	NUDT3	34417629	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.537000	0.45702	0.989000	0.38761	0.477000	0.44152	GAA	.		0.532	NUDT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040224.2		
ENPP4	22875	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	46108114	46108114	+	Missense_Mutation	SNP	T	T	G			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr6:46108114T>G	ENST00000321037.4	+	2	1024	c.794T>G	c.(793-795)tTg>tGg	p.L265W		NM_014936.4	NP_055751.1	Q9Y6X5	ENPP4_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative)	265					blood coagulation (GO:0007596)|positive regulation of blood coagulation (GO:0030194)|purine ribonucleoside catabolic process (GO:0046130)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	bis(5'-adenosyl)-triphosphatase activity (GO:0047710)|metal ion binding (GO:0046872)			central_nervous_system(1)|large_intestine(2)|lung(7)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	18						CTTATAGATTTGAGCCCAGTT	0.418																																					p.L265W		.											.	ENPP4-94	0			c.T794G						.						79.0	78.0	79.0					6																	46108114		2203	4300	6503	SO:0001583	missense	22875	exon2			TAGATTTGAGCCC	AB020686	CCDS34468.1	6p12.3	2010-06-24	2010-06-24		ENSG00000001561	ENSG00000001561			3359	protein-coding gene	gene with protein product						11027689	Standard	NM_014936		Approved	NPP4, KIAA0879	uc003oxy.3	Q9Y6X5	OTTHUMG00000014779	ENST00000321037.4:c.794T>G	6.37:g.46108114T>G	ENSP00000318066:p.Leu265Trp	Somatic	87	0		WXS	Illumina HiSeq	Phase_I	66	16	NM_014936	0	0	15	27	12	A8K5G1|Q7L2N1	Missense_Mutation	SNP	ENST00000321037.4	37	CCDS34468.1	.	.	.	.	.	.	.	.	.	.	T	9.575	1.121947	0.20877	.	.	ENSG00000001561	ENST00000321037;ENST00000371401	T	0.72394	-0.65	5.67	1.87	0.25490	Alkaline-phosphatase-like, core domain (1);	0.743246	0.13551	N	0.379453	T	0.33411	0.0862	L	0.41710	1.295	0.24368	N	0.994846	B	0.14438	0.01	B	0.21917	0.037	T	0.20240	-1.0281	10	0.37606	T	0.19	-1.2896	0.3197	0.00301	0.2449:0.1895:0.2931:0.2725	.	265	Q9Y6X5	ENPP4_HUMAN	W	265	ENSP00000318066:L265W	ENSP00000318066:L265W	L	+	2	0	ENPP4	46216073	0.000000	0.05858	0.992000	0.48379	0.972000	0.66771	-0.065000	0.11617	0.400000	0.25396	0.533000	0.62120	TTG	.		0.418	ENPP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040777.2		
DOPEY1	23033	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	83862020	83862020	+	Silent	SNP	T	T	A			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr6:83862020T>A	ENST00000349129.2	+	30	6323	c.6063T>A	c.(6061-6063)ccT>ccA	p.P2021P	DOPEY1_ENST00000484282.1_3'UTR|DOPEY1_ENST00000237163.5_Intron|DOPEY1_ENST00000369739.3_Silent_p.P2012P	NM_015018.3	NP_055833.2	Q5JWR5	DOP1_HUMAN	dopey family member 1	2021					protein transport (GO:0015031)					breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(16)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	67		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		TGTTATCACCTGCAATGGAAA	0.313																																					p.P2021P		.											.	DOPEY1-155	0			c.T6063A						.						59.0	59.0	59.0					6																	83862020		2203	4292	6495	SO:0001819	synonymous_variant	23033	exon30			ATCACCTGCAATG	AK027030	CCDS4996.1, CCDS64467.1	6q15	2013-03-05	2006-02-02	2006-02-02	ENSG00000083097	ENSG00000083097			21194	protein-coding gene	gene with protein product			"""KIAA1117"""	KIAA1117		16301316, 16303751, 10931277	Standard	NM_015018		Approved	dJ202D23.2	uc011dyy.2	Q5JWR5	OTTHUMG00000016365	ENST00000349129.2:c.6063T>A	6.37:g.83862020T>A		Somatic	71	0		WXS	Illumina HiSeq	Phase_I	55	17	NM_015018	0	0	4	7	3	Q86XV1|Q9H5J5|Q9NSL4|Q9UPN5|Q9Y414	Silent	SNP	ENST00000349129.2	37	CCDS4996.1																																																																																			.		0.313	DOPEY1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043785.2	NM_015018	
CDC40	51362	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	110528715	110528715	+	Missense_Mutation	SNP	C	C	T			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr6:110528715C>T	ENST00000368932.1	+	5	514	c.413C>T	c.(412-414)gCa>gTa	p.A138V	CDC40_ENST00000368930.1_Missense_Mutation_p.A138V|CDC40_ENST00000307731.1_Missense_Mutation_p.A138V			O60508	PRP17_HUMAN	cell division cycle 40	138					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)	18		all_cancers(87;6.23e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		Epithelial(106;0.0221)|all cancers(137;0.0314)|OV - Ovarian serous cystadenocarcinoma(136;0.034)		TCAGGTTATGCATTAGACCCT	0.249																																					p.A138V		.											.	CDC40-90	0			c.C413T						.						98.0	107.0	104.0					6																	110528715		2203	4295	6498	SO:0001583	missense	51362	exon4			GTTATGCATTAGA	AF015044	CCDS5081.1	6q22.1	2013-01-17	2013-01-17		ENSG00000168438	ENSG00000168438		"""WD repeat domain containing"""	17350	protein-coding gene	gene with protein product		605585	"""cell division cycle 40 homolog (yeast)"", ""cell division cycle 40 homolog (S. cerevisiae)"""			9769104, 9830021	Standard	NM_015891		Approved	PRP17, EHB3, PRPF17, FLJ10564	uc003pua.3	O60508	OTTHUMG00000015358	ENST00000368932.1:c.413C>T	6.37:g.110528715C>T	ENSP00000357928:p.Ala138Val	Somatic	182	0		WXS	Illumina HiSeq	Phase_I	176	50	NM_015891	0	0	0	0	0	B2RBC5|O75471|Q5SRN0|Q9UPG1	Missense_Mutation	SNP	ENST00000368932.1	37	CCDS5081.1	.	.	.	.	.	.	.	.	.	.	C	34	5.333199	0.95758	.	.	ENSG00000168438	ENST00000368932;ENST00000368933;ENST00000368930;ENST00000307731;ENST00000439165;ENST00000453107	T;T;T;T	0.67171	-0.09;-0.25;-0.25;-0.09	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.79405	0.4440	M	0.86805	2.84	0.80722	D	1	D	0.67145	0.996	P	0.55965	0.788	T	0.82794	-0.0281	10	0.87932	D	0	-9.413	19.9384	0.97150	0.0:1.0:0.0:0.0	.	138	O60508	PRP17_HUMAN	V	138;138;138;138;138;35	ENSP00000357928:A138V;ENSP00000357929:A138V;ENSP00000357926:A138V;ENSP00000304370:A138V	ENSP00000304370:A138V	A	+	2	0	CDC40	110635408	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.252000	0.78309	2.717000	0.92951	0.585000	0.79938	GCA	.		0.249	CDC40-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041791.1	NM_015891	
SLC16A10	117247	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	111409219	111409219	+	Missense_Mutation	SNP	G	G	T			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr6:111409219G>T	ENST00000368851.5	+	1	439	c.264G>T	c.(262-264)caG>caT	p.Q88H		NM_018593.4	NP_061063.2	Q8TF71	MOT10_HUMAN	solute carrier family 16 (aromatic amino acid transporter), member 10	88					amino acid transport (GO:0006865)|aromatic amino acid transport (GO:0015801)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|prostate(2)	12		all_cancers(87;0.00172)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0313)|Colorectal(196;0.0466)		OV - Ovarian serous cystadenocarcinoma(136;0.0703)|Epithelial(106;0.12)|all cancers(137;0.132)	Droxidopa(DB06262)|Glycine(DB00145)|L-Alanine(DB00160)|L-Arginine(DB00125)|L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)|L-Cysteine(DB00151)|L-Cystine(DB00138)|L-DOPA(DB01235)|L-Glutamine(DB00130)|L-Histidine(DB00117)|L-Isoleucine(DB00167)|L-Leucine(DB00149)|L-Lysine(DB00123)|L-Methionine(DB00134)|L-Phenylalanine(DB00120)|L-Proline(DB00172)|L-Serine(DB00133)|L-Threonine(DB00156)|L-Tryptophan(DB00150)|L-Tyrosine(DB00135)|L-Valine(DB00161)|Liothyronine(DB00279)|Liotrix(DB01583)|Pyruvic acid(DB00119)	TCGGCATCCAGAACGCTTGCG	0.662																																					p.Q88H		.											.	SLC16A10-514	0			c.G264T						.						51.0	41.0	44.0					6																	111409219		2203	4299	6502	SO:0001583	missense	117247	exon1			CATCCAGAACGCT	AF116652	CCDS5089.1	6q21-q22	2014-01-28	2013-07-18		ENSG00000112394	ENSG00000112394		"""Solute carriers"""	17027	protein-coding gene	gene with protein product		607550	"""solute carrier family 16 (monocarboxylic acid transporters), member 10"""			11278508, 11827462	Standard	NM_018593		Approved	TAT1, MCT10	uc003pus.3	Q8TF71	OTTHUMG00000015371	ENST00000368851.5:c.264G>T	6.37:g.111409219G>T	ENSP00000357844:p.Gln88His	Somatic	48	0		WXS	Illumina HiSeq	Phase_I	44	10	NM_018593	0	0	0	0	0	B3KWY0|Q6ZMG0|Q8WVI5	Missense_Mutation	SNP	ENST00000368851.5	37	CCDS5089.1	.	.	.	.	.	.	.	.	.	.	G	19.54	3.846966	0.71603	.	.	ENSG00000112394	ENST00000535637;ENST00000368851	T	0.59364	0.27	3.79	3.79	0.43588	Major facilitator superfamily domain, general substrate transporter (1);	0.071282	0.64402	D	0.000016	T	0.33876	0.0878	N	0.13235	0.315	0.80722	D	1	P;B	0.42375	0.778;0.339	P;B	0.44647	0.456;0.134	T	0.37526	-0.9702	10	0.44086	T	0.13	.	15.8498	0.78921	0.0:0.0:1.0:0.0	.	88;88	Q8TF71;Q05BR4	MOT10_HUMAN;.	H	88	ENSP00000357844:Q88H	ENSP00000357844:Q88H	Q	+	3	2	SLC16A10	111515912	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.303000	0.89955	1.950000	0.56595	0.448000	0.29417	CAG	.		0.662	SLC16A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041822.2		
BRAT1	221927	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	2587034	2587034	+	Missense_Mutation	SNP	C	C	G			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr7:2587034C>G	ENST00000340611.4	-	3	462	c.206G>C	c.(205-207)aGt>aCt	p.S69T		NM_152743.3	NP_689956.2	Q6PJG6	BRAT1_HUMAN	BRCA1-associated ATM activator 1	69					response to ionizing radiation (GO:0010212)	membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	23						GACCCCAGAACTCAGGTCCTG	0.622																																					p.S69T		.											.	BRAT1-229	0			c.G206C						.						85.0	79.0	81.0					7																	2587034		2203	4300	6503	SO:0001583	missense	221927	exon3			CCAGAACTCAGGT	BC015632	CCDS5334.1	7p22.3	2011-03-22	2011-02-28	2011-03-22	ENSG00000106009	ENSG00000106009			21701	protein-coding gene	gene with protein product	"""BRCA1-associated protein required for ATM activation protein 1"""	614506	"""chromosome 7 open reading frame 27"""	C7orf27, BAAT1		16452482	Standard	NM_152743		Approved	MGC22916	uc003smi.3	Q6PJG6	OTTHUMG00000119091	ENST00000340611.4:c.206G>C	7.37:g.2587034C>G	ENSP00000339637:p.Ser69Thr	Somatic	101	0		WXS	Illumina HiSeq	Phase_I	108	49	NM_152743	0	0	28	59	31	A4D200|C9JY24|Q8IW85|Q8IZ43|Q8WVR8|Q96IV9|Q9H7J8|Q9UFA3	Missense_Mutation	SNP	ENST00000340611.4	37	CCDS5334.1	.	.	.	.	.	.	.	.	.	.	C	9.253	1.041205	0.19669	.	.	ENSG00000106009	ENST00000340611	T	0.71103	-0.54	5.01	4.11	0.48088	Armadillo-type fold (1);	0.211492	0.47093	D	0.000255	T	0.68091	0.2963	M	0.72118	2.19	0.09310	N	1	B;P	0.46987	0.184;0.888	B;B	0.42163	0.208;0.378	T	0.66705	-0.5856	10	0.59425	D	0.04	-13.2539	9.9258	0.41492	0.0:0.8427:0.0:0.1573	.	69;69	Q6PJG6-2;Q6PJG6	.;BRAT1_HUMAN	T	69	ENSP00000339637:S69T	ENSP00000339637:S69T	S	-	2	0	BRAT1	2553560	0.000000	0.05858	0.026000	0.17262	0.004000	0.04260	0.191000	0.17076	2.331000	0.79229	0.650000	0.86243	AGT	.		0.622	BRAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239305.2	NM_152743	
SCIN	85477	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	12679988	12679988	+	Missense_Mutation	SNP	G	G	A			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr7:12679988G>A	ENST00000297029.5	+	11	1528	c.1427G>A	c.(1426-1428)gGc>gAc	p.G476D	SCIN_ENST00000519209.1_Missense_Mutation_p.G229D|SCIN_ENST00000445618.2_Missense_Mutation_p.G229D	NM_001112706.2	NP_001106177.1	Q9Y6U3	ADSV_HUMAN	scinderin	476	Ca(2+)-dependent actin binding.			G -> D (in Ref. 1; AAK60494). {ECO:0000305}.	actin filament capping (GO:0051693)|actin filament severing (GO:0051014)|actin nucleation (GO:0045010)|calcium ion-dependent exocytosis (GO:0017156)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of secretion (GO:0051047)|regulation of chondrocyte differentiation (GO:0032330)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	1-phosphatidylinositol binding (GO:0005545)|actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)	17				UCEC - Uterine corpus endometrioid carcinoma (126;0.195)		GTCTCCCAAGGCAAAGAGCCT	0.428																																					p.G476D		.											.	SCIN-24	0			c.G1427A						.						54.0	52.0	53.0					7																	12679988		1843	4090	5933	SO:0001583	missense	85477	exon11			CCCAAGGCAAAGA	AF276507	CCDS47545.1, CCDS47546.1	7p21.3	2006-04-25			ENSG00000006747	ENSG00000006747			21695	protein-coding gene	gene with protein product		613416					Standard	NM_033128		Approved	adseverin, KIAA1905	uc003ssn.4	Q9Y6U3	OTTHUMG00000152385	ENST00000297029.5:c.1427G>A	7.37:g.12679988G>A	ENSP00000297029:p.Gly476Asp	Somatic	35	0		WXS	Illumina HiSeq	Phase_I	91	38	NM_001112706	0	0	148	362	214	A8K2U8|Q8NBZ6|Q8WU97|Q96JC7|Q96PY2	Missense_Mutation	SNP	ENST00000297029.5	37	CCDS47545.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.435588	0.83885	.	.	ENSG00000006747	ENST00000297029;ENST00000519209;ENST00000445618	T;T;T	0.27256	1.68;1.68;1.68	4.56	4.56	0.56223	Gelsolin domain (1);	0.000000	0.85682	D	0.000000	T	0.58779	0.2146	M	0.88906	2.99	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.69807	-0.5045	10	0.87932	D	0	-12.3981	17.3228	0.87240	0.0:0.0:1.0:0.0	.	476	Q9Y6U3	ADSV_HUMAN	D	476;229;229	ENSP00000297029:G476D;ENSP00000430997:G229D;ENSP00000390189:G229D	ENSP00000297029:G476D	G	+	2	0	SCIN	12646513	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.476000	0.97823	2.069000	0.61940	0.561000	0.74099	GGC	.		0.428	SCIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326041.1	NM_033128	
DNAH11	8701	ucsc.edu;bcgsc.ca	37	7	21784089	21784089	+	Missense_Mutation	SNP	G	G	A	rs28549882	byFrequency	TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr7:21784089G>A	ENST00000409508.3	+	50	8219	c.8188G>A	c.(8188-8190)Ggt>Agt	p.G2730S	DNAH11_ENST00000328843.6_Missense_Mutation_p.G2737S	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2737					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						GTGTTTAAAAGGTCCACTTGA	0.363									Kartagener syndrome																												.													.	DNAH11-146	0			.						.						246.0	238.0	241.0					7																	21784089		1834	4086	5920	SO:0001583	missense	8701	.	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	TTAAAAGGTCCAC	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.8188G>A	7.37:g.21784089G>A	ENSP00000475939:p.Gly2730Ser	Somatic	328	0		WXS	Illumina HiSeq		513	156	.	0	0	0	0	0	Q9UJ82	Missense_Mutation	SNP	ENST00000409508.3	37		.	.	.	.	.	.	.	.	.	.	G	0.044	-1.273480	0.01421	.	.	ENSG00000105877	ENST00000328843	T	0.37235	1.21	5.91	0.806	0.18708	.	1.549630	0.03077	N	0.158047	T	0.14485	0.0350	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.17868	-1.0355	9	0.05959	T	0.93	.	1.7176	0.02905	0.142:0.2088:0.3289:0.3203	.	2737	Q96DT5	DYH11_HUMAN	S	2737	ENSP00000330671:G2737S	ENSP00000330671:G2737S	G	+	1	0	DNAH11	21750614	0.003000	0.15002	0.005000	0.12908	0.289000	0.27227	0.518000	0.22847	-0.133000	0.11537	-0.140000	0.14226	GGT	G|0.995;T|0.005		0.363	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	NM_003777	
FBXO24	26261	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	100187679	100187679	+	Missense_Mutation	SNP	A	A	C			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr7:100187679A>C	ENST00000241071.6	+	2	441	c.119A>C	c.(118-120)cAg>cCg	p.Q40P	FBXO24_ENST00000427939.2_Missense_Mutation_p.Q78P|FBXO24_ENST00000468962.1_Missense_Mutation_p.Q28P|PCOLCE-AS1_ENST00000544873.1_RNA|FBXO24_ENST00000465843.1_Missense_Mutation_p.Q40P|PCOLCE-AS1_ENST00000442166.2_RNA|FBXO24_ENST00000360609.2_Missense_Mutation_p.Q40P|FBXO24_ENST00000498195.1_3'UTR	NM_033506.2	NP_277041.1	O75426	FBX24_HUMAN	F-box protein 24	40	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.				protein ubiquitination (GO:0016567)	ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(3)|ovary(3)|skin(4)|urinary_tract(2)	28	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					ATTTCCATCCAGTTGTTCCCC	0.557																																					p.Q78P		.											.	FBXO24-229	0			c.A233C						.						72.0	68.0	69.0					7																	100187679		2203	4300	6503	SO:0001583	missense	26261	exon2			CCATCCAGTTGTT	AF174604	CCDS5698.1, CCDS5699.1, CCDS5699.2, CCDS55138.1	7q22	2005-10-07	2004-06-15		ENSG00000106336	ENSG00000106336		"""F-boxes /  ""other"""""	13595	protein-coding gene	gene with protein product		609097	"""F-box only protein 24"""			10531035, 10531037	Standard	NM_012172		Approved	FBX24	uc011kjz.1	O75426	OTTHUMG00000159543	ENST00000241071.6:c.119A>C	7.37:g.100187679A>C	ENSP00000241071:p.Gln40Pro	Somatic	109	1		WXS	Illumina HiSeq	Phase_I	153	54	NM_012172	0	0	0	0	0	A4D2D4|B4DX91|B4DY42|Q9H0G1	Missense_Mutation	SNP	ENST00000241071.6	37	CCDS5698.1	.	.	.	.	.	.	.	.	.	.	A	16.14	3.038493	0.55003	.	.	ENSG00000106336	ENST00000461079;ENST00000241071;ENST00000360609;ENST00000465843;ENST00000466053;ENST00000468962;ENST00000427939	T;T;T;T;T;T;T	0.54279	0.58;0.58;0.58;0.58;0.58;0.58;0.58	4.67	4.67	0.58626	F-box domain, cyclin-like (2);F-box domain, Skp2-like (1);	0.000000	0.48767	D	0.000177	T	0.45034	0.1322	N	0.03194	-0.395	0.38008	D	0.93445	D;D;D;P	0.67145	0.996;0.996;0.996;0.952	P;P;P;P	0.62089	0.898;0.898;0.898;0.536	T	0.59815	-0.7383	10	0.87932	D	0	-5.3735	10.4753	0.44661	1.0:0.0:0.0:0.0	.	28;78;40;40	B4DY42;B4DX91;O75426;O75426-2	.;.;FBX24_HUMAN;.	P	63;40;40;40;45;28;78	ENSP00000419587:Q63P;ENSP00000241071:Q40P;ENSP00000353821:Q40P;ENSP00000419602:Q40P;ENSP00000417179:Q45P;ENSP00000420239:Q28P;ENSP00000416558:Q78P	ENSP00000241071:Q40P	Q	+	2	0	FBXO24	100025615	1.000000	0.71417	1.000000	0.80357	0.789000	0.44602	4.861000	0.62969	1.968000	0.57251	0.449000	0.29647	CAG	.		0.557	FBXO24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356104.1		
IMMP2L	83943	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	111127299	111127299	+	Silent	SNP	T	T	A	rs201012120		TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr7:111127299T>A	ENST00000405709.2	-	3	676	c.234A>T	c.(232-234)tcA>tcT	p.S78S	IMMP2L_ENST00000415362.1_Silent_p.S78S|IMMP2L_ENST00000331762.3_Silent_p.S78S|IMMP2L_ENST00000452895.1_Silent_p.S78S|IMMP2L_ENST00000437687.1_Silent_p.S78S|IMMP2L_ENST00000447215.1_Silent_p.S78S	NM_032549.3	NP_115938.1	Q96T52	IMP2L_HUMAN	IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae)	78					ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|protein processing involved in protein targeting to mitochondrion (GO:0006627)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|mitochondrial inner membrane peptidase complex (GO:0042720)	peptidase activity (GO:0008233)|serine-type peptidase activity (GO:0008236)			endometrium(3)|large_intestine(6)|lung(5)	14				UCEC - Uterine corpus endometrioid carcinoma (4;0.053)|Epithelial(3;2.27e-07)|all cancers(3;1.36e-05)|STAD - Stomach adenocarcinoma(3;0.00148)|KIRC - Kidney renal clear cell carcinoma(11;0.0339)|Lung(3;0.0375)|Kidney(11;0.0415)|LUSC - Lung squamous cell carcinoma(290;0.173)		CTTACACCAATGATACAATGT	0.363																																					p.S78S		.											.	IMMP2L-93	0			c.A234T						.						102.0	99.0	100.0					7																	111127299		2203	4300	6503	SO:0001819	synonymous_variant	83943	exon3			CACCAATGATACA	AF359563	CCDS5753.1	7q31	2014-01-06	2005-08-17		ENSG00000184903	ENSG00000184903			14598	protein-coding gene	gene with protein product		605977	"""IMP2 inner mitochondrial membrane protease-like (S. cerevisiae)"", ""IMMP2L intronic transcript 1 (non-protein coding)"""	IMMP2L-IT1		11254443	Standard	NM_032549		Approved	IMP2	uc010ljr.2	Q96T52	OTTHUMG00000155023	ENST00000405709.2:c.234A>T	7.37:g.111127299T>A		Somatic	121	0		WXS	Illumina HiSeq	Phase_I	208	67	NM_032549	0	0	0	0	0	Q75MF1|Q75MN9|Q75MP0|Q75MS5|Q75MS8|Q96HJ2	Silent	SNP	ENST00000405709.2	37	CCDS5753.1																																																																																			T|1.000;C|0.000		0.363	IMMP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338109.4	NM_032549	
SSPO	23145	hgsc.bcm.edu;broad.mit.edu	37	7	149509420	149509420	+	RNA	SNP	G	G	A			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr7:149509420G>A	ENST00000378016.2	+	0	9818							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GGAGGCCTGCGGAGCCGGACC	0.726																																					p.R3273Q		.											.	.	0			c.G9818A						.						6.0	7.0	7.0					7																	149509420		1692	3840	5532			23145	exon69			GCCTGCGGAGCCG	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149509420G>A		Somatic	17	0		WXS	Illumina HiSeq	Phase_I	21	5	NM_198455	0	0	0	0	0	Q76B61	Missense_Mutation	SNP	ENST00000378016.2	37																																																																																				.		0.726	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript			
ATP6V1B2	526	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	20068802	20068802	+	Missense_Mutation	SNP	C	C	T	rs374210970		TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr8:20068802C>T	ENST00000276390.2	+	6	618	c.578C>T	c.(577-579)tCt>tTt	p.S193F		NM_001693.3	NP_001684.2	P21281	VATB2_HUMAN	ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2	193					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|proton-transporting V-type ATPase, V1 domain (GO:0033180)|ruffle (GO:0001726)	ATP binding (GO:0005524)|hydrogen ion transmembrane transporter activity (GO:0015078)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)			endometrium(1)|kidney(2)|lung(5)|prostate(1)	9				Colorectal(74;0.0535)|COAD - Colon adenocarcinoma(73;0.211)	Gallium nitrate(DB05260)	CCTATCTTCTCTGCTGCTGGG	0.453																																					p.S193F	Pancreas(119;1230 1726 3901 4036 31644)	.											.	ATP6V1B2-90	0			c.C578T						.						110.0	98.0	102.0					8																	20068802		2203	4300	6503	SO:0001583	missense	526	exon6			TCTTCTCTGCTGC	L35249	CCDS6014.1	8p21.3	2010-04-21	2006-01-13	2002-05-10	ENSG00000147416	ENSG00000147416	3.6.3.14	"""ATPases / V-type"""	854	protein-coding gene	gene with protein product		606939	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), beta polypeptide, 56/58kD, isoform 2"", ""ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B, isoform 2"""	VPP3, ATP6B2		2145275, 14580332	Standard	NM_001693		Approved	VATB, Vma2, HO57	uc003wzp.3	P21281	OTTHUMG00000131073	ENST00000276390.2:c.578C>T	8.37:g.20068802C>T	ENSP00000276390:p.Ser193Phe	Somatic	64	1		WXS	Illumina HiSeq	Phase_I	87	30	NM_001693	0	0	83	118	35	B2R5Z3|D3DSQ5|Q14544|Q15859|Q96IR0	Missense_Mutation	SNP	ENST00000276390.2	37	CCDS6014.1	.	.	.	.	.	.	.	.	.	.	C	33	5.203929	0.95033	.	.	ENSG00000147416	ENST00000276390;ENST00000542368	D	0.83250	-1.7	5.65	5.65	0.86999	ATPase, F1/V1/A1 complex, alpha/beta subunit, nucleotide-binding domain (1);	0.097834	0.64402	D	0.000001	D	0.92519	0.7624	M	0.86573	2.825	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93134	0.6535	10	0.87932	D	0	-15.587	18.6584	0.91463	0.0:1.0:0.0:0.0	.	193	P21281	VATB2_HUMAN	F	193;67	ENSP00000276390:S193F	ENSP00000276390:S193F	S	+	2	0	ATP6V1B2	20113082	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.040000	0.70980	2.822000	0.97130	0.650000	0.86243	TCT	.		0.453	ATP6V1B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253732.1	NM_001693	
BMP1	649	bcgsc.ca	37	8	22020986	22020986	+	5'Flank	SNP	G	G	T			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr8:22020986G>T	ENST00000306385.5	+	0	0				SFTPC_ENST00000521315.1_Missense_Mutation_p.C121F|BMP1_ENST00000397816.3_5'Flank|SFTPC_ENST00000318561.3_Missense_Mutation_p.C121F|BMP1_ENST00000306349.8_5'Flank|SFTPC_ENST00000524255.1_Missense_Mutation_p.C68F|BMP1_ENST00000354870.5_5'Flank|SFTPC_ENST00000520605.1_Missense_Mutation_p.C68F|SFTPC_ENST00000437090.2_Missense_Mutation_p.C121F|SFTPC_ENST00000522109.1_Missense_Mutation_p.C121F|BMP1_ENST00000397814.3_5'Flank	NM_006129.4	NP_006120.1	P13497	BMP1_HUMAN	bone morphogenetic protein 1						cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|lipoprotein metabolic process (GO:0042157)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of cartilage development (GO:0061036)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(3)	30				Colorectal(74;0.00229)|COAD - Colon adenocarcinoma(73;0.0661)|READ - Rectum adenocarcinoma(644;0.11)		GGCACCTGCTGCTACATCATG	0.562																																					p.C121F													.	SFTPC-90	0			c.G362T						.						71.0	74.0	73.0					8																	22020986		1951	4169	6120	SO:0001631	upstream_gene_variant	6440	exon4			CCTGCTGCTACAT		CCDS6026.1, CCDS34856.1	8p21	2013-02-06	2004-08-09		ENSG00000168487	ENSG00000168487	3.4.24.19	"""Bone morphogenetic proteins"""	1067	protein-coding gene	gene with protein product	"""procollagen C-endopeptidase"""	112264	"""procollagen C-endopeptidase"""	PCOLC		2004778	Standard	NM_006129		Approved		uc003xbg.3	P13497	OTTHUMG00000097761		8.37:g.22020986G>T	Exception_encountered	Somatic	40	0		WXS	Illumina HiSeq	Phase_1	44	4	NM_003018	0	0	0	0	0	A8K6F5|B2RN46|D3DSR0|Q13292|Q13872|Q14874|Q99421|Q99422|Q99423|Q9UL38	Missense_Mutation	SNP	ENST00000306385.5	37	CCDS6026.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.197672	0.79015	.	.	ENSG00000168484	ENST00000318561;ENST00000521315;ENST00000437090;ENST00000520605;ENST00000522109;ENST00000524255;ENST00000523296	D;D;D;D;D;D;D	0.98531	-4.98;-4.98;-4.98;-4.98;-4.98;-4.98;-4.98	5.49	5.49	0.81192	BRICHOS (2);	0.000000	0.56097	D	0.000026	D	0.98682	0.9558	M	0.74881	2.28	0.49130	D	0.99975	D;D;D;D	0.76494	0.999;0.996;0.999;0.984	D;P;D;P	0.70716	0.97;0.908;0.97;0.876	D	0.99490	1.0950	10	0.87932	D	0	-27.3137	14.864	0.70401	0.0:0.0:1.0:0.0	.	121;121;121;121	E9PGX3;C9JYF6;P11686;E5RI92	.;.;PSPC_HUMAN;.	F	121;121;121;68;121;68;68	ENSP00000316152:C121F;ENSP00000430410:C121F;ENSP00000407931:C121F;ENSP00000430266:C68F;ENSP00000429496:C121F;ENSP00000429552:C68F;ENSP00000429619:C68F	ENSP00000316152:C121F	C	+	2	0	SFTPC	22076931	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.426000	0.66476	2.570000	0.86706	0.655000	0.94253	TGC	.		0.562	BMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214995.2	NM_006132	
PROSC	11212	broad.mit.edu	37	8	37630321	37630321	+	Missense_Mutation	SNP	C	C	T			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr8:37630321C>T	ENST00000328195.3	+	5	435	c.368C>T	c.(367-369)gCa>gTa	p.A123V		NM_007198.3	NP_009129.1	O94903	PROSC_HUMAN	proline synthetase co-transcribed homolog (bacterial)	123					alpha-amino acid metabolic process (GO:1901605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrion (GO:0005739)	pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|prostate(1)	7		Lung NSC(58;0.174)	BRCA - Breast invasive adenocarcinoma(5;6.14e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)		L-Proline(DB00172)	GTGAAGTTGGCAGACAAAGTG	0.438																																					p.A123V													.	PROSC-90	0			c.C368T						.						128.0	121.0	123.0					8																	37630321		2203	4300	6503	SO:0001583	missense	11212	exon5			AGTTGGCAGACAA	AB018566	CCDS6096.1	8p11.2	2008-01-07	2001-12-04		ENSG00000147471	ENSG00000147471			9457	protein-coding gene	gene with protein product		604436	"""proline synthetase co-transcribed (bacterial homolog)"""				Standard	NM_007198		Approved		uc003xkh.3	O94903	OTTHUMG00000164024	ENST00000328195.3:c.368C>T	8.37:g.37630321C>T	ENSP00000333551:p.Ala123Val	Somatic	161	0		WXS	Illumina HiSeq	Phase_I	137	4	NM_007198	0	0	79	79	0	Q6FI94	Missense_Mutation	SNP	ENST00000328195.3	37	CCDS6096.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	35|35	5.544535|5.544535	0.96488|0.96488	.|.	.|.	ENSG00000147471|ENSG00000147471	ENST00000328195;ENST00000523358;ENST00000523187;ENST00000523521|ENST00000521494	T;T;T;T|.	0.52526|.	0.66;0.66;0.66;0.66|.	5.96|5.96	5.96|5.96	0.96718|0.96718	Alanine racemase, N-terminal (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|.	0.83482|.	0.5264|.	M|M	0.84433|0.84433	2.695|2.695	0.80722|0.80722	D|D	1|1	D|.	0.60575|.	0.988|.	D|.	0.75484|.	0.986|.	D|.	0.83718|.	0.0191|.	10|.	0.87932|.	D|.	0|.	-23.3919|-23.3919	20.017|20.017	0.97481|0.97481	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	123|.	O94903|.	PROSC_HUMAN|.	V|X	123;123;71;42|92	ENSP00000333551:A123V;ENSP00000427778:A123V;ENSP00000427886:A71V;ENSP00000429425:A42V|.	ENSP00000333551:A123V|.	A|Q	+|+	2|1	0|0	PROSC|PROSC	37749479|37749479	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.905000|0.905000	0.53344|0.53344	7.743000|7.743000	0.85020|0.85020	2.832000|2.832000	0.97577|0.97577	0.655000|0.655000	0.94253|0.94253	GCA|CAG	.		0.438	PROSC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376796.1	NM_007198	
RRS1	23212	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	67342373	67342373	+	Missense_Mutation	SNP	G	G	A			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr8:67342373G>A	ENST00000320270.2	+	1	1111	c.1007G>A	c.(1006-1008)gGg>gAg	p.G336E	RP11-346I3.4_ENST00000499642.1_lincRNA|ADHFE1_ENST00000396623.3_5'Flank|ADHFE1_ENST00000379385.4_5'Flank|ADHFE1_ENST00000415254.1_5'Flank	NM_015169.3	NP_055984.1	Q15050	RRS1_HUMAN	RRS1 ribosome biogenesis regulator homolog (S. cerevisiae)	336	Arg/Gly/Lys-rich.				hematopoietic progenitor cell differentiation (GO:0002244)|mitotic metaphase plate congression (GO:0007080)|ribosome biogenesis (GO:0042254)	condensed nuclear chromosome (GO:0000794)|endoplasmic reticulum (GO:0005783)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			kidney(2)|lung(2)	4		Lung NSC(129;0.197)	Epithelial(68;0.0391)|all cancers(69;0.0898)|BRCA - Breast invasive adenocarcinoma(89;0.111)|OV - Ovarian serous cystadenocarcinoma(28;0.226)			AAGAGGAAAGGGGGCTTGGGA	0.602																																					p.G336E		.											.	RRS1-90	0			c.G1007A						.						34.0	44.0	41.0					8																	67342373		2192	4287	6479	SO:0001583	missense	23212	exon1			GGAAAGGGGGCTT	BC001811	CCDS6189.1	8q13.1	2013-10-22			ENSG00000179041	ENSG00000179041			17083	protein-coding gene	gene with protein product						7788527, 10688653	Standard	NM_015169		Approved	KIAA0112	uc003xwa.3	Q15050	OTTHUMG00000164765	ENST00000320270.2:c.1007G>A	8.37:g.67342373G>A	ENSP00000322396:p.Gly336Glu	Somatic	81	0		WXS	Illumina HiSeq	Phase_I	103	27	NM_015169	0	0	3	8	5	Q9BUX8	Missense_Mutation	SNP	ENST00000320270.2	37	CCDS6189.1	.	.	.	.	.	.	.	.	.	.	G	13.22	2.170934	0.38315	.	.	ENSG00000179041	ENST00000320270	D	0.89552	-2.53	5.26	4.38	0.52667	.	0.233360	0.44688	D	0.000435	D	0.87621	0.6223	M	0.77486	2.375	0.52501	D	0.999957	B	0.24043	0.096	B	0.18263	0.021	D	0.85609	0.1257	10	0.62326	D	0.03	-32.1208	10.2291	0.43245	0.1636:0.0:0.8364:0.0	.	336	Q15050	RRS1_HUMAN	E	336	ENSP00000322396:G336E	ENSP00000322396:G336E	G	+	2	0	RRS1	67504927	0.999000	0.42202	0.810000	0.32431	0.561000	0.35649	2.865000	0.48412	1.369000	0.46134	0.537000	0.68136	GGG	.		0.602	RRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380126.1	NM_015169	
EMC2	9694	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	109462688	109462688	+	Silent	SNP	A	A	T			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr8:109462688A>T	ENST00000220853.3	+	3	221	c.186A>T	c.(184-186)gcA>gcT	p.A62A		NM_014673.3	NP_055488.1	Q15006	EMC2_HUMAN	ER membrane protein complex subunit 2	62						cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|ER membrane protein complex (GO:0072546)|mitochondrion (GO:0005739)|nucleus (GO:0005634)											TGATGATTGCAGCACTAGACT	0.308																																					p.A62A		.											.	.	0			c.A186T						.						206.0	200.0	202.0					8																	109462688		2203	4300	6503	SO:0001819	synonymous_variant	9694	exon3			GATTGCAGCACTA	BC021667	CCDS6309.1	8q23.2	2012-05-23	2012-05-23	2012-05-23	ENSG00000104412	ENSG00000104412			28963	protein-coding gene	gene with protein product		607722	"""tetratricopeptide repeat domain 35"""	KIAA0103, TTC35		7788527, 22119785	Standard	NM_014673		Approved		uc003ymw.1	Q15006	OTTHUMG00000164873	ENST00000220853.3:c.186A>T	8.37:g.109462688A>T		Somatic	171	0		WXS	Illumina HiSeq	Phase_I	157	35	NM_014673	0	0	45	73	28	Q8WUE1	Silent	SNP	ENST00000220853.3	37	CCDS6309.1	.	.	.	.	.	.	.	.	.	.	A	8.680	0.904927	0.17760	.	.	ENSG00000104412	ENST00000519642	.	.	.	5.86	-9.77	0.00500	.	.	.	.	.	T	0.43743	0.1261	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52328	-0.8590	4	.	.	.	-10.7326	6.6457	0.22934	0.3445:0.0:0.3347:0.3207	.	.	.	.	L	10	.	.	Q	+	2	0	TTC35	109531864	0.354000	0.24912	0.564000	0.28396	0.612000	0.37316	-0.270000	0.08584	-1.322000	0.02278	-1.132000	0.01976	CAG	.		0.308	EMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380717.1	NM_014673	
COLEC10	10584	broad.mit.edu	37	8	120114630	120114630	+	Silent	SNP	A	A	G			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr8:120114630A>G	ENST00000332843.2	+	4	377	c.336A>G	c.(334-336)aaA>aaG	p.K112K	COLEC10_ENST00000521788.1_3'UTR	NM_006438.3	NP_006429.2	Q9Y6Z7	COL10_HUMAN	collectin sub-family member 10 (C-type lectin)	112	Collagen-like.					collagen trimer (GO:0005581)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)	mannose binding (GO:0005537)	p.K112K(1)		endometrium(2)|kidney(3)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	21	all_cancers(13;4.13e-26)|Lung NSC(37;1.36e-07)|Ovarian(258;0.018)|Hepatocellular(40;0.234)		STAD - Stomach adenocarcinoma(47;0.00113)			CTGGAGAAAAAGGCAAAGCAG	0.294																																					p.K112K													.	COLEC10-229	1	Substitution - coding silent(1)	kidney(1)	c.A336G						.						109.0	114.0	112.0					8																	120114630		2203	4300	6503	SO:0001819	synonymous_variant	10584	exon4			AGAAAAAGGCAAA	AB002631	CCDS6327.1	8q23-q24.1	2007-12-19				ENSG00000184374		"""Collectins"""	2220	protein-coding gene	gene with protein product		607620				10224141	Standard	NM_006438		Approved	CL-L1	uc003yoo.3	Q9Y6Z7		ENST00000332843.2:c.336A>G	8.37:g.120114630A>G		Somatic	88	0		WXS	Illumina HiSeq	Phase_I	69	4	NM_006438	0	0	0	0	0	Q3SYH6|Q6UW19	Silent	SNP	ENST00000332843.2	37	CCDS6327.1																																																																																			.		0.294	COLEC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381225.1		
C9orf72	203228	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	27548367	27548367	+	Missense_Mutation	SNP	T	T	A			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr9:27548367T>A	ENST00000380003.3	-	11	1376	c.1313A>T	c.(1312-1314)gAt>gTt	p.D438V	C9orf72_ENST00000488117.1_5'UTR	NM_001256054.1|NM_018325.3	NP_001242983.1|NP_060795.1	Q96LT7	CI072_HUMAN	chromosome 9 open reading frame 72	438					autophagy (GO:0006914)|cell death (GO:0008219)|endocytosis (GO:0006897)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|extracellular space (GO:0005615)|lysosome (GO:0005764)|nucleus (GO:0005634)	Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|ovary(4)|pancreas(1)	23		all_neural(11;7.57e-10)		LUSC - Lung squamous cell carcinoma(38;0.0001)|Lung(218;0.00016)		TGCTGTTAAATCAAGGTCTAT	0.348																																					p.D438V		.											.	C9orf72-517	0			c.A1313T						.						99.0	100.0	100.0					9																	27548367		2203	4300	6503	SO:0001583	missense	203228	exon11			GTTAAATCAAGGT	AL832467	CCDS6522.1, CCDS6523.1	9p21.1	2014-09-17			ENSG00000147894	ENSG00000147894			28337	protein-coding gene	gene with protein product		614260				21944778, 24549040	Standard	NM_145005		Approved	MGC23980	uc003zqq.3	Q96LT7	OTTHUMG00000019716	ENST00000380003.3:c.1313A>T	9.37:g.27548367T>A	ENSP00000369339:p.Asp438Val	Somatic	107	0		WXS	Illumina HiSeq	Phase_I	143	27	NM_018325	0	0	4	4	0	A8K5W0|D3DRK6|G8I0B6|Q6NUS9	Missense_Mutation	SNP	ENST00000380003.3	37	CCDS6522.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.338256	0.81911	.	.	ENSG00000147894	ENST00000380003	T	0.52057	0.68	5.75	5.75	0.90469	.	0.042474	0.85682	D	0.000000	T	0.52789	0.1756	N	0.19112	0.55	0.80722	D	1	D	0.71674	0.998	D	0.68943	0.961	T	0.51513	-0.8696	9	.	.	.	.	16.0488	0.80740	0.0:0.0:0.0:1.0	.	438	Q96LT7	CI072_HUMAN	V	438	ENSP00000369339:D438V	.	D	-	2	0	C9orf72	27538367	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.698000	0.84413	2.199000	0.70637	0.374000	0.22700	GAT	.		0.348	C9orf72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051969.1	NM_018325	
CCIN	881	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	36170075	36170075	+	Silent	SNP	C	C	T			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr9:36170075C>T	ENST00000335119.2	+	1	687	c.576C>T	c.(574-576)ctC>ctT	p.L192L		NM_005893.2	NP_005884.2	Q13939	CALI_HUMAN	calicin	192	BACK.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				breast(3)|endometrium(2)|large_intestine(4)|liver(2)|lung(5)|ovary(1)|skin(4)	21			STAD - Stomach adenocarcinoma(86;0.228)			TTCACGTGCTCAATGAAGACC	0.507																																					p.L192L		.											.	CCIN-92	0			c.C576T						.						58.0	57.0	58.0					9																	36170075		2203	4300	6503	SO:0001819	synonymous_variant	881	exon1			CGTGCTCAATGAA	Z46967	CCDS6599.1	9p13.1	2013-10-02			ENSG00000185972	ENSG00000185972		"""BTB/POZ domain containing"""	1568	protein-coding gene	gene with protein product		603960				7641791	Standard	NM_005893		Approved	KBTBD14, BTBD20	uc003zzb.4	Q13939	OTTHUMG00000019901	ENST00000335119.2:c.576C>T	9.37:g.36170075C>T		Somatic	87	2		WXS	Illumina HiSeq	Phase_I	83	32	NM_005893	0	0	0	0	0	Q9BXG7	Silent	SNP	ENST00000335119.2	37	CCDS6599.1																																																																																			.		0.507	CCIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052418.1	NM_005893	
SPATA31D1	389763	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	84605892	84605892	+	Silent	SNP	G	G	A			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr9:84605892G>A	ENST00000344803.2	+	4	554	c.507G>A	c.(505-507)tcG>tcA	p.S169S		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	169					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											CTGAGTCATCGTTCACTCTGG	0.562																																					p.S169S		.											.	.	0			c.G507A						.						123.0	123.0	123.0					9																	84605892		2001	4169	6170	SO:0001819	synonymous_variant	389763	exon4			GTCATCGTTCACT		CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.507G>A	9.37:g.84605892G>A		Somatic	79	0		WXS	Illumina HiSeq	Phase_I	73	18	NM_001001670	0	0	0	0	0		Silent	SNP	ENST00000344803.2	37	CCDS47986.1																																																																																			.		0.562	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402325.1	NM_001001670	
PHF2	5253	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	96416716	96416716	+	Missense_Mutation	SNP	A	A	C			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr9:96416716A>C	ENST00000359246.4	+	7	1178	c.811A>C	c.(811-813)Atc>Ctc	p.I271L	PHF2_ENST00000375376.4_Intron	NM_005392.3	NP_005383.3	O75151	PHF2_HUMAN	PHD finger protein 2	271	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				liver development (GO:0001889)|negative regulation of chromatin silencing at rDNA (GO:0061188)|protein demethylation (GO:0006482)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K9 specific) (GO:0032454)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;9.11e-28)		CTTCTATCTCATCAGGCCGGC	0.587																																					p.I271L		.											.	PHF2-91	0			c.A811C						.						59.0	56.0	57.0					9																	96416716		2203	4300	6503	SO:0001583	missense	5253	exon7			TATCTCATCAGGC	AF043725	CCDS35069.1	9q22	2013-01-28			ENSG00000197724	ENSG00000197724		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	8920	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1E"", ""centromere protein 35"""	604351				10051327, 20129925	Standard	NM_005392		Approved	KIAA0662, JHDM1E, CENP-35	uc004aub.3	O75151	OTTHUMG00000020253	ENST00000359246.4:c.811A>C	9.37:g.96416716A>C	ENSP00000352185:p.Ile271Leu	Somatic	79	0		WXS	Illumina HiSeq	Phase_I	63	17	NM_005392	0	0	9	13	4	Q4VXG0|Q8N3K2|Q9Y6N4	Missense_Mutation	SNP	ENST00000359246.4	37	CCDS35069.1	.	.	.	.	.	.	.	.	.	.	A	32	5.129480	0.94473	.	.	ENSG00000197724	ENST00000359246	T	0.74947	-0.89	4.79	4.79	0.61399	Transcription factor jumonji/aspartyl beta-hydroxylase (2);Transcription factor jumonji (1);	0.000000	0.85682	D	0.000000	D	0.87026	0.6075	M	0.86028	2.79	0.80722	D	1	D	0.55385	0.971	D	0.76575	0.988	D	0.89290	0.3618	10	0.87932	D	0	-32.051	14.5008	0.67719	1.0:0.0:0.0:0.0	.	271	O75151	PHF2_HUMAN	L	271	ENSP00000352185:I271L	ENSP00000352185:I271L	I	+	1	0	PHF2	95456537	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.037000	0.93765	2.008000	0.58898	0.477000	0.44152	ATC	.		0.587	PHF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053162.1	NM_005392	
ABCA1	19	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	107599352	107599352	+	Missense_Mutation	SNP	G	G	T			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr9:107599352G>T	ENST00000374736.3	-	11	1614	c.1220C>A	c.(1219-1221)gCt>gAt	p.A407D		NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	407					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	ATGGAACACAGCCAGTTCCTG	0.552																																					p.A407D		.											.	ABCA1-1016	0			c.C1220A						.						86.0	71.0	76.0					9																	107599352		2203	4300	6503	SO:0001583	missense	19	exon11			AACACAGCCAGTT	AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.1220C>A	9.37:g.107599352G>T	ENSP00000363868:p.Ala407Asp	Somatic	69	0		WXS	Illumina HiSeq	Phase_I	53	14	NM_005502	0	0	18	21	3	Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Missense_Mutation	SNP	ENST00000374736.3	37	CCDS6762.1	.	.	.	.	.	.	.	.	.	.	G	15.23	2.773257	0.49786	.	.	ENSG00000165029	ENST00000374736	D	0.85861	-2.04	5.7	4.76	0.60689	.	0.209202	0.49916	D	0.000130	T	0.76807	0.4039	L	0.28192	0.835	0.80722	D	1	B	0.06786	0.001	B	0.13407	0.009	T	0.70454	-0.4867	10	0.27082	T	0.32	.	15.0006	0.71469	0.0:0.2679:0.7321:0.0	.	407	O95477	ABCA1_HUMAN	D	407	ENSP00000363868:A407D	ENSP00000363868:A407D	A	-	2	0	ABCA1	106639173	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	5.271000	0.65553	2.687000	0.91594	0.655000	0.94253	GCT	.		0.552	ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053491.1	NM_005502	
NUP188	23511	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	131755475	131755475	+	Splice_Site	SNP	G	G	A			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr9:131755475G>A	ENST00000372577.2	+	26	2661		c.e26-1			NM_015354.1	NP_056169.1	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa						carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				breast(2)|central_nervous_system(3)|endometrium(6)|kidney(4)|large_intestine(9)|lung(20)|ovary(6)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	60						GTCTCCACCAGGTGGCCCCAA	0.537											OREG0019527	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									.		.											.	NUP188-207	0			c.2641-1G>A						.						100.0	99.0	99.0					9																	131755475		2203	4300	6503	SO:0001630	splice_region_variant	23511	exon26			CCACCAGGTGGCC	D79991	CCDS35156.1	9q34.13	2014-01-28	2004-03-19	2004-03-24	ENSG00000095319	ENSG00000095319			17859	protein-coding gene	gene with protein product		615587	"""KIAA0169"""	KIAA0169		11029043	Standard	NM_015354		Approved		uc004bws.2	Q5SRE5	OTTHUMG00000020768	ENST00000372577.2:c.2641-1G>A	9.37:g.131755475G>A		Somatic	69	0	1590	WXS	Illumina HiSeq	Phase_I	88	22	NM_015354	0	0	0	1	1	Q14675|Q2TA87|Q7Z3K8|Q8IWF1	Splice_Site	SNP	ENST00000372577.2	37	CCDS35156.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.417591	0.83449	.	.	ENSG00000095319	ENST00000356693;ENST00000372577	.	.	.	6.0	6.0	0.97389	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4831	0.95018	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NUP188	130795296	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	7.423000	0.80229	2.848000	0.98002	0.655000	0.94253	.	.		0.537	NUP188-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054529.2		Intron
USP20	10868	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	132618631	132618631	+	Missense_Mutation	SNP	T	T	A			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr9:132618631T>A	ENST00000315480.4	+	4	285	c.127T>A	c.(127-129)Tgt>Agt	p.C43S	USP20_ENST00000372429.3_Missense_Mutation_p.C43S|USP20_ENST00000358355.1_Missense_Mutation_p.C43S			Q9Y2K6	UBP20_HUMAN	ubiquitin specific peptidase 20	43					endocytosis (GO:0006897)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	cysteine-type endopeptidase activity (GO:0004197)|G-protein coupled receptor binding (GO:0001664)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(3)|lung(4)|urinary_tract(1)	11		Ovarian(14;0.00556)				CCTATGGGCCTGTCTGCAGGT	0.582																																					p.C43S		.											.	USP20-658	0			c.T127A						.						136.0	137.0	137.0					9																	132618631		1947	4141	6088	SO:0001583	missense	10868	exon4			TGGGCCTGTCTGC	AB023220	CCDS43892.1	9q34.2	2014-07-15	2005-08-08		ENSG00000136878	ENSG00000136878		"""Ubiquitin-specific peptidases"""	12619	protein-coding gene	gene with protein product		615143	"""ubiquitin specific protease 20"""			12838346	Standard	NM_006676		Approved	KIAA1003	uc004byr.3	Q9Y2K6	OTTHUMG00000020793	ENST00000315480.4:c.127T>A	9.37:g.132618631T>A	ENSP00000313811:p.Cys43Ser	Somatic	225	0		WXS	Illumina HiSeq	Phase_I	215	60	NM_001008563	0	0	0	0	0	Q541F1|Q8IXQ1|Q96LG5|Q9UQN8|Q9UQP0	Missense_Mutation	SNP	ENST00000315480.4	37	CCDS43892.1	.	.	.	.	.	.	.	.	.	.	T	27.3	4.816658	0.90790	.	.	ENSG00000136878	ENST00000372429;ENST00000315480;ENST00000358355	T;T;T	0.72282	-0.64;-0.64;-0.64	4.99	4.99	0.66335	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, UBP-type (2);	0.000000	0.85682	D	0.000000	D	0.89273	0.6668	H	0.97611	4.04	0.80722	D	1	D	0.69078	0.997	D	0.83275	0.996	D	0.92667	0.6146	10	0.87932	D	0	.	13.5285	0.61609	0.0:0.0:0.0:1.0	.	43	Q9Y2K6	UBP20_HUMAN	S	43	ENSP00000361506:C43S;ENSP00000313811:C43S;ENSP00000351122:C43S	ENSP00000313811:C43S	C	+	1	0	USP20	131658452	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.432000	0.80349	1.880000	0.54463	0.460000	0.39030	TGT	.		0.582	USP20-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054604.2		
ABL1	25	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	133730265	133730265	+	Missense_Mutation	SNP	G	G	C			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr9:133730265G>C	ENST00000318560.5	+	3	712	c.331G>C	c.(331-333)Gtc>Ctc	p.V111L		NM_005157.4	NP_005148.2	P00519	ABL1_HUMAN	ABL proto-oncogene 1, non-receptor tyrosine kinase	111	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				actin cytoskeleton organization (GO:0030036)|autophagy (GO:0006914)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to dopamine (GO:1903351)|cellular response to oxidative stress (GO:0034599)|DNA damage induced protein phosphorylation (GO:0006975)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mismatch repair (GO:0006298)|mitochondrial depolarization (GO:0051882)|mitotic nuclear division (GO:0007067)|muscle cell differentiation (GO:0042692)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of autophagy (GO:0010506)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of endocytosis (GO:0030100)|regulation of response to DNA damage stimulus (GO:2001020)|regulation of transcription, DNA-templated (GO:0006355)|response to oxidative stress (GO:0006979)|signal transduction in response to DNA damage (GO:0042770)	actin cytoskeleton (GO:0015629)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|mitogen-activated protein kinase binding (GO:0051019)|nicotinate-nucleotide adenylyltransferase activity (GO:0004515)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|proline-rich region binding (GO:0070064)|protein C-terminus binding (GO:0008022)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|SH3 domain binding (GO:0017124)|syntaxin binding (GO:0019905)			breast(3)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1149)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	1195		all_hematologic(13;0.0361)|Acute lymphoblastic leukemia(5;0.0543)|Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.4e-05)	Adenosine triphosphate(DB00171)|Bosutinib(DB06616)|Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Ponatinib(DB08901)|Regorafenib(DB08896)	CCAAGGCTGGGTCCCAAGCAA	0.522			"""T, Mis"""	"""BCR, ETV6, NUP214"""	"""CML, ALL, T-ALL"""																																p.V130L		.		Dom	yes		9	9q34.1	25	v-abl Abelson murine leukemia viral oncogene homolog 1		L	.	ABL1-3810	0			c.G388C						.						107.0	89.0	95.0					9																	133730265		2203	4300	6503	SO:0001583	missense	25	exon3			GGCTGGGTCCCAA	M14752	CCDS35165.1, CCDS35166.1	9q34.1	2014-09-17	2014-06-26		ENSG00000097007	ENSG00000097007		"""SH2 domain containing"""	76	protein-coding gene	gene with protein product		189980	"""v-abl Abelson murine leukemia viral oncogene homolog 1"", ""c-abl oncogene 1, receptor tyrosine kinase"", ""c-abl oncogene 1, non-receptor tyrosine kinase"""	ABL		1857987, 12626632	Standard	NM_007313		Approved	JTK7, c-ABL, p150	uc004bzv.3	P00519	OTTHUMG00000020813	ENST00000318560.5:c.331G>C	9.37:g.133730265G>C	ENSP00000323315:p.Val111Leu	Somatic	69	0		WXS	Illumina HiSeq	Phase_I	72	15	NM_007313	0	0	34	46	12	A3KFJ3|Q13869|Q13870|Q16133|Q17R61|Q45F09	Missense_Mutation	SNP	ENST00000318560.5	37	CCDS35166.1	.	.	.	.	.	.	.	.	.	.	G	36	5.707803	0.96821	.	.	ENSG00000097007	ENST00000372348;ENST00000438426;ENST00000318560	T;T	0.55930	0.49;0.49	5.67	5.67	0.87782	Src homology-3 domain (3);	0.000000	0.85682	D	0.000000	T	0.75057	0.3798	M	0.90977	3.165	0.80722	D	1	P;P	0.39862	0.692;0.692	P;P	0.51016	0.656;0.656	T	0.79553	-0.1756	10	0.87932	D	0	.	18.8246	0.92111	0.0:0.0:1.0:0.0	.	111;148	P00519;Q59FK4	ABL1_HUMAN;.	L	130;157;111	ENSP00000361423:V130L;ENSP00000323315:V111L	ENSP00000323315:V111L	V	+	1	0	ABL1	132720086	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.812000	0.99227	2.677000	0.91161	0.638000	0.83543	GTC	.		0.522	ABL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054684.1	NM_007313	
ABL1	25	broad.mit.edu	37	9	133750315	133750315	+	Missense_Mutation	SNP	T	T	G			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr9:133750315T>G	ENST00000318560.5	+	7	1527	c.1146T>G	c.(1144-1146)ttT>ttG	p.F382L		NM_005157.4	NP_005148.2	P00519	ABL1_HUMAN	ABL proto-oncogene 1, non-receptor tyrosine kinase	382	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|autophagy (GO:0006914)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to dopamine (GO:1903351)|cellular response to oxidative stress (GO:0034599)|DNA damage induced protein phosphorylation (GO:0006975)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mismatch repair (GO:0006298)|mitochondrial depolarization (GO:0051882)|mitotic nuclear division (GO:0007067)|muscle cell differentiation (GO:0042692)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of autophagy (GO:0010506)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of endocytosis (GO:0030100)|regulation of response to DNA damage stimulus (GO:2001020)|regulation of transcription, DNA-templated (GO:0006355)|response to oxidative stress (GO:0006979)|signal transduction in response to DNA damage (GO:0042770)	actin cytoskeleton (GO:0015629)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|mitogen-activated protein kinase binding (GO:0051019)|nicotinate-nucleotide adenylyltransferase activity (GO:0004515)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|proline-rich region binding (GO:0070064)|protein C-terminus binding (GO:0008022)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|SH3 domain binding (GO:0017124)|syntaxin binding (GO:0019905)	p.?(1)		breast(3)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1149)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	1195		all_hematologic(13;0.0361)|Acute lymphoblastic leukemia(5;0.0543)|Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.4e-05)	Adenosine triphosphate(DB00171)|Bosutinib(DB06616)|Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Ponatinib(DB08901)|Regorafenib(DB08896)	TAGCTGATTTTGGCCTGAGCA	0.537			"""T, Mis"""	"""BCR, ETV6, NUP214"""	"""CML, ALL, T-ALL"""																																p.F401L				Dom	yes		9	9q34.1	25	v-abl Abelson murine leukemia viral oncogene homolog 1		L	.	ABL1-3810	1	Unknown(1)	haematopoietic_and_lymphoid_tissue(1)	c.T1203G						.						163.0	142.0	149.0					9																	133750315		2203	4300	6503	SO:0001583	missense	25	exon7			TGATTTTGGCCTG	M14752	CCDS35165.1, CCDS35166.1	9q34.1	2014-09-17	2014-06-26		ENSG00000097007	ENSG00000097007		"""SH2 domain containing"""	76	protein-coding gene	gene with protein product		189980	"""v-abl Abelson murine leukemia viral oncogene homolog 1"", ""c-abl oncogene 1, receptor tyrosine kinase"", ""c-abl oncogene 1, non-receptor tyrosine kinase"""	ABL		1857987, 12626632	Standard	NM_007313		Approved	JTK7, c-ABL, p150	uc004bzv.3	P00519	OTTHUMG00000020813	ENST00000318560.5:c.1146T>G	9.37:g.133750315T>G	ENSP00000323315:p.Phe382Leu	Somatic	137	0		WXS	Illumina HiSeq	Phase_I	119	3	NM_007313	0	0	42	42	0	A3KFJ3|Q13869|Q13870|Q16133|Q17R61|Q45F09	Missense_Mutation	SNP	ENST00000318560.5	37	CCDS35166.1	.	.	.	.	.	.	.	.	.	.	T	26.7	4.760517	0.89932	.	.	ENSG00000097007	ENST00000444970;ENST00000372348;ENST00000318560	T;T	0.81247	-1.47;-1.47	5.23	-5.23	0.02798	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.86859	0.6034	M	0.89715	3.055	0.80722	D	1	P;P	0.51057	0.941;0.941	P;P	0.56042	0.79;0.79	D	0.87399	0.2368	10	0.87932	D	0	.	14.2212	0.65828	0.0:0.4481:0.0:0.5519	.	382;419	P00519;Q59FK4	ABL1_HUMAN;.	L	197;401;382	ENSP00000361423:F401L;ENSP00000323315:F382L	ENSP00000323315:F382L	F	+	3	2	ABL1	132740136	0.957000	0.32711	0.826000	0.32828	0.970000	0.65996	0.065000	0.14466	-1.415000	0.02022	-0.290000	0.09829	TTT	.		0.537	ABL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054684.1	NM_007313	
AK8	158067	hgsc.bcm.edu;broad.mit.edu	37	9	135601117	135601117	+	Missense_Mutation	SNP	G	G	C	rs184476196	byFrequency	TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr9:135601117G>C	ENST00000298545.3	-	13	1919	c.1398C>G	c.(1396-1398)atC>atG	p.I466M	AK8_ENST00000477396.1_5'UTR	NM_152572.2	NP_689785.1	Q96MA6	KAD8_HUMAN	adenylate kinase 8	466	Adenylate kinase 2.				nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)			NS(1)|kidney(2)|large_intestine(4)|lung(11)|pancreas(2)|prostate(1)|urinary_tract(2)	23						TCCCACTCTCGATGTATTCGA	0.557																																					p.I466M		.											.	AK8-90	0			c.C1398G						.						71.0	55.0	61.0					9																	135601117		2203	4300	6503	SO:0001583	missense	158067	exon13			ACTCTCGATGTAT	AK093446	CCDS6954.1	9q34.13	2013-04-29	2010-12-07	2010-12-07	ENSG00000165695	ENSG00000165695	2.7.4.3	"""Adenylate kinases"""	26526	protein-coding gene	gene with protein product		615365	"""chromosome 9 open reading frame 98"""	C9orf98		21080915	Standard	NM_152572		Approved	FLJ32704	uc004cbu.1	Q96MA6	OTTHUMG00000021009	ENST00000298545.3:c.1398C>G	9.37:g.135601117G>C	ENSP00000298545:p.Ile466Met	Somatic	16	0		WXS	Illumina HiSeq	Phase_I	9	3	NM_152572	0	0	5	11	6	A8K821|Q8N9W9	Missense_Mutation	SNP	ENST00000298545.3	37	CCDS6954.1	.	.	.	.	.	.	.	.	.	.	G	10.81	1.456806	0.26161	.	.	ENSG00000165695	ENST00000298545	T	0.72282	-0.64	5.08	-10.2	0.00374	.	0.233363	0.35013	N	0.003515	T	0.70622	0.3245	M	0.79475	2.455	0.32487	N	0.540767	D	0.54772	0.968	P	0.57720	0.826	T	0.76002	-0.3118	10	0.87932	D	0	-3.3208	5.6233	0.17469	0.1067:0.148:0.5577:0.1876	.	466	Q96MA6	KAD8_HUMAN	M	466	ENSP00000298545:I466M	ENSP00000298545:I466M	I	-	3	3	AK8	134590938	0.221000	0.23642	0.372000	0.25991	0.016000	0.09150	-0.970000	0.03810	-2.541000	0.00485	-1.284000	0.01376	ATC	G|0.999;A|0.001		0.557	AK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055413.1	NM_152572	
HDAC6	10013	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	48682180	48682180	+	Silent	SNP	G	G	A			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chrX:48682180G>A	ENST00000334136.5	+	26	3466	c.3288G>A	c.(3286-3288)agG>agA	p.R1096R	HDAC6_ENST00000444343.2_Silent_p.R1110R|HDAC6_ENST00000376619.2_Silent_p.R1096R			Q9UBN7	HDAC6_HUMAN	histone deacetylase 6	1096					aggresome assembly (GO:0070842)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to misfolded protein (GO:0071218)|cellular response to topologically incorrect protein (GO:0035967)|histone deacetylation (GO:0016575)|Hsp90 deacetylation (GO:0070846)|intracellular protein transport (GO:0006886)|lysosome localization (GO:0032418)|macroautophagy (GO:0016236)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|negative regulation of hydrogen peroxide metabolic process (GO:0010727)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of oxidoreductase activity (GO:0051354)|negative regulation of protein complex disassembly (GO:0043242)|negative regulation of proteolysis (GO:0045861)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine deacetylation (GO:0034983)|polyubiquitinated misfolded protein transport (GO:0070845)|positive regulation of chaperone-mediated protein complex assembly (GO:0090035)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of hydrogen peroxide-mediated programmed cell death (GO:1901300)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of signal transduction (GO:0009967)|protein complex disassembly (GO:0043241)|protein deacetylation (GO:0006476)|protein polyubiquitination (GO:0000209)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of establishment of protein localization (GO:0070201)|regulation of gene expression, epigenetic (GO:0040029)|regulation of microtubule-based movement (GO:0060632)|regulation of receptor activity (GO:0010469)|response to growth factor (GO:0070848)|response to misfolded protein (GO:0051788)|response to organic substance (GO:0010033)|response to toxic substance (GO:0009636)|transcription, DNA-templated (GO:0006351)|tubulin deacetylation (GO:0090042)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	aggresome (GO:0016235)|axon (GO:0030424)|caveola (GO:0005901)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|dendrite (GO:0030425)|histone deacetylase complex (GO:0000118)|inclusion body (GO:0016234)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)	alpha-tubulin binding (GO:0043014)|beta-catenin binding (GO:0008013)|core promoter binding (GO:0001047)|dynein complex binding (GO:0070840)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|Hsp90 protein binding (GO:0051879)|microtubule binding (GO:0008017)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|polyubiquitin binding (GO:0031593)|tau protein binding (GO:0048156)|tubulin deacetylase activity (GO:0042903)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|kidney(5)|large_intestine(8)|lung(9)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	40					Vorinostat(DB02546)	AGGGATCTAGGGGCCTCACTG	0.547																																					p.R1096R	Pancreas(112;205 1675 2305 8976 15959)	.											.	HDAC6-230	0			c.G3288A						.						83.0	66.0	72.0					X																	48682180		2203	4300	6503	SO:0001819	synonymous_variant	10013	exon26			ATCTAGGGGCCTC	AF132609	CCDS14306.1	Xp11.23	2014-06-12			ENSG00000094631	ENSG00000094631			14064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 90"""	300272				10220385, 10048485	Standard	NM_006044		Approved	KIAA0901, JM21, HD6, FLJ16239, PPP1R90	uc004dks.1	Q9UBN7	OTTHUMG00000034496	ENST00000334136.5:c.3288G>A	X.37:g.48682180G>A		Somatic	19	0		WXS	Illumina HiSeq	Phase_I	17	12	NM_006044	0	0	3	39	36	O94975|Q6NT75|Q7L3E5|Q96CY0	Silent	SNP	ENST00000334136.5	37	CCDS14306.1	.	.	.	.	.	.	.	.	.	.	G	3.939	-0.014623	0.07681	.	.	ENSG00000094631	ENST00000430858	.	.	.	5.56	0.474	0.16768	.	.	.	.	.	T	0.23410	0.0566	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.24333	-1.0163	4	.	.	.	0.2517	3.6925	0.08351	0.2664:0.0:0.4392:0.2944	.	.	.	.	E	57	.	.	G	+	2	0	HDAC6	48567124	0.016000	0.18221	0.000000	0.03702	0.048000	0.14542	0.329000	0.19698	-0.044000	0.13491	0.600000	0.82982	GGG	.		0.547	HDAC6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083394.2	NM_006044	
RGAG1	57529	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	109695935	109695935	+	Missense_Mutation	SNP	T	T	G			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chrX:109695935T>G	ENST00000465301.2	+	3	2336	c.2090T>G	c.(2089-2091)aTg>aGg	p.M697R	RGAG1_ENST00000540313.1_Missense_Mutation_p.M697R	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	697								p.M697T(1)		NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						ATGCCACTAATGAGAGCTCAA	0.517																																					p.M697R		.											.	RGAG1-132	1	Substitution - Missense(1)	endometrium(1)	c.T2090G						.						118.0	99.0	105.0					X																	109695935		2203	4300	6503	SO:0001583	missense	57529	exon3			CACTAATGAGAGC	AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.2090T>G	X.37:g.109695935T>G	ENSP00000419786:p.Met697Arg	Somatic	40	0		WXS	Illumina HiSeq	Phase_I	33	20	NM_020769	0	0	0	0	0	Q9P2M8	Missense_Mutation	SNP	ENST00000465301.2	37	CCDS14552.1	.	.	.	.	.	.	.	.	.	.	T	1.022	-0.684599	0.03353	.	.	ENSG00000243978	ENST00000465301;ENST00000540313	T;T	0.48201	0.82;0.82	3.63	2.48	0.30137	.	0.141438	0.32935	N	0.005468	T	0.30792	0.0776	L	0.39898	1.24	0.09310	N	1	P	0.35982	0.531	B	0.35413	0.202	T	0.10989	-1.0606	9	.	.	.	-0.0102	2.2783	0.04108	0.2497:0.1407:0.0:0.6096	.	697	Q8NET4	RGAG1_HUMAN	R	697	ENSP00000419786:M697R;ENSP00000441452:M697R	.	M	+	2	0	RGAG1	109582591	0.001000	0.12720	0.002000	0.10522	0.031000	0.12232	-0.744000	0.04839	0.596000	0.29794	0.486000	0.48141	ATG	.		0.517	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057906.2	NM_020769	
OR2L8	391190	hgsc.bcm.edu	37	1	248112762	248112763	+	Frame_Shift_Del	DEL	TG	TG	-	rs34851853|rs4925790|rs4925789	byFrequency	TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	TG	TG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr1:248112762_248112763delTG	ENST00000357191.3	+	1	603_604	c.603_604delTG	c.(601-606)agtgccfs	p.A202fs	OR2L13_ENST00000366478.2_Intron	NM_001001963.1	NP_001001963.1	Q8NGY9	OR2L8_HUMAN	olfactory receptor, family 2, subfamily L, member 8 (gene/pseudogene)	202			A -> T (in dbSNP:rs4925790).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(3)|large_intestine(3)|lung(30)|ovary(1)|prostate(1)|skin(3)	42	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			TGTTTTTGAGTGCCACCATCTT	0.49																																					p.201_202del		.											.	OR2L8-70	0			c.603_604del						.																																			SO:0001589	frameshift_variant	391190	exon1			.	BK004459	CCDS31101.1	1q44	2013-10-10	2013-10-10		ENSG00000196936	ENSG00000196936		"""GPCR / Class A : Olfactory receptors"""	15014	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily L, member 8"""				Standard	NM_001001963		Approved		uc001idt.1	Q8NGY9	OTTHUMG00000040196	ENST00000357191.3:c.603_604delTG	1.37:g.248112762_248112763delTG	ENSP00000349719:p.Ala202fs	Somatic	57	0		WXS	Illumina HiSeq	Phase_I	69	14	NM_001001963	0	0	0	0	0	Q6IF03	Frame_Shift_Del	DEL	ENST00000357191.3	37	CCDS31101.1																																																																																			.		0.490	OR2L8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096853.2		
AP1G2	8906	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	24036472	24036472	+	Frame_Shift_Del	DEL	C	C	-			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr14:24036472delC	ENST00000308724.5	-	1	807	c.52delG	c.(52-54)gccfs	p.A18fs	AP1G2_ENST00000556277.1_5'UTR|AP1G2_ENST00000397120.3_Frame_Shift_Del_p.A18fs|RP11-66N24.3_ENST00000555968.1_RNA	NM_003917.2	NP_003908.1	O75843	AP1G2_HUMAN	adaptor-related protein complex 1, gamma 2 subunit	18					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	AP-1 adaptor complex (GO:0030121)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi-associated vesicle (GO:0005798)|membrane (GO:0016020)|transport vesicle (GO:0030133)	protein transporter activity (GO:0008565)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(10)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	28	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00672)		TGAGTCTTGGCCCCGCGAATC	0.637											OREG0022606	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A18fs		.											.	AP1G2-45	0			c.52delG						.						53.0	43.0	46.0					14																	24036472		2203	4300	6503	SO:0001589	frameshift_variant	8906	exon2			.	AB015318	CCDS9602.1	14q11.2	2008-07-03			ENSG00000213983	ENSG00000213983			556	protein-coding gene	gene with protein product		603534				9733768, 9762922	Standard	XM_005268167		Approved	G2AD	uc001wkl.2	O75843	OTTHUMG00000028760	ENST00000308724.5:c.52delG	14.37:g.24036472delC	ENSP00000312442:p.Ala18fs	Somatic	63	0	768	WXS	Illumina HiSeq	Phase_I	70	15	NM_003917	0	0	0	0	0	D3DS51|O75504	Frame_Shift_Del	DEL	ENST00000308724.5	37	CCDS9602.1																																																																																			.		0.637	AP1G2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071812.4	NM_003917	
VPS9D1	9605	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	89776218	89776219	+	Frame_Shift_Del	DEL	GA	GA	-	rs565573769		TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	GA	GA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr16:89776218_89776219delGA	ENST00000389386.3	-	11	1478_1479	c.1354_1355delTC	c.(1354-1356)tccfs	p.S452fs	VPS9D1_ENST00000561976.1_Frame_Shift_Del_p.S382fs|VPS9D1-AS1_ENST00000562866.1_RNA|VPS9D1_ENST00000565452.1_5'Flank	NM_004913.2	NP_004904.2	Q9Y2B5	VP9D1_HUMAN	VPS9 domain containing 1	452					ATP synthesis coupled proton transport (GO:0015986)		GTPase activator activity (GO:0005096)|transporter activity (GO:0005215)										CCACAGCGGGGAGAAAAAGGGT	0.619																																					p.452_452del		.											.	.	0			c.1354_1355del						.																																			SO:0001589	frameshift_variant	9605	exon11			.	AB018551	CCDS42220.1	16q24.3	2012-10-09	2012-10-09	2012-10-09	ENSG00000075399	ENSG00000075399			13526	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 7"""	C16orf7		10231027	Standard	NM_004913		Approved	ATP-BL	uc002fom.1	Q9Y2B5	OTTHUMG00000173219	ENST00000389386.3:c.1354_1355delTC	16.37:g.89776220_89776221delGA	ENSP00000374037:p.Ser452fs	Somatic	171	0		WXS	Illumina HiSeq	Phase_I	183	31	NM_004913	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000389386.3	37	CCDS42220.1																																																																																			.		0.619	VPS9D1-002	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422508.1	NM_004913	
RINL	126432	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	39359912	39359925	+	Frame_Shift_Del	DEL	TGCAGCGTCCGCCT	TGCAGCGTCCGCCT	-			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	TGCAGCGTCCGCCT	TGCAGCGTCCGCCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr19:39359912_39359925delTGCAGCGTCCGCCT	ENST00000591812.1	-	11	1686_1699	c.1600_1613delAGGCGGACGCTGCA	c.(1600-1614)aggcggacgctgcacfs	p.RRTLH534fs	RINL_ENST00000340740.3_Frame_Shift_Del_p.RRTLH420fs|CTC-360G5.6_ENST00000593830.1_RNA|RINL_ENST00000602238.1_5'Flank|RINL_ENST00000598904.1_Frame_Shift_Del_p.RRTLH420fs			Q6ZS11	RINL_HUMAN	Ras and Rab interactor-like	534					endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)	actin cytoskeleton (GO:0015629)|cytoplasmic vesicle (GO:0031410)|ruffle (GO:0001726)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(3)|kidney(4)|large_intestine(2)|lung(4)|pancreas(1)|skin(1)|urinary_tract(2)	17						ATCCTTTCTGTGCAGCGTCCGCCTGCGGTGCCAC	0.673																																					p.534_538del		.											.	RINL-91	0			c.1600_1613del						.																																			SO:0001589	frameshift_variant	126432	exon11			.	AK127808	CCDS12522.1, CCDS59386.1	19q13.2	2010-07-13			ENSG00000187994	ENSG00000187994			24795	protein-coding gene	gene with protein product							Standard	NM_001195833		Approved	FLJ45909	uc010xuo.2	Q6ZS11		ENST00000591812.1:c.1600_1613delAGGCGGACGCTGCA	19.37:g.39359912_39359925delTGCAGCGTCCGCCT	ENSP00000467107:p.Arg534fs	Somatic	117	0		WXS	Illumina HiSeq	Phase_I	101	19	NM_001195833	0	0	0	0	0	B4DPG5	Frame_Shift_Del	DEL	ENST00000591812.1	37	CCDS59386.1																																																																																			.		0.673	RINL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460433.1	NM_198445	
SLC35G2	80723	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	136573495	136573495	+	Frame_Shift_Del	DEL	G	G	-			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr3:136573495delG	ENST00000446465.2	+	2	821	c.193delG	c.(193-195)gggfs	p.G65fs	RP11-85F14.5_ENST00000474250.1_RNA|RP11-85F14.5_ENST00000461864.1_RNA|SLC35G2_ENST00000393079.3_Frame_Shift_Del_p.G65fs|RP11-85F14.5_ENST00000470236.1_RNA	NM_025246.2	NP_079522.2			solute carrier family 35, member G2									p.G65R(1)									GAAAAAAAAAGGGAGAGCTTT	0.403																																					p.G65fs		.											.	.	1	Substitution - Missense(1)	lung(1)	c.193delG						.						84.0	94.0	91.0					3																	136573495		2203	4300	6503	SO:0001589	frameshift_variant	80723	exon2			.	BC022557	CCDS3091.1	3q22.3	2013-05-22	2012-03-09	2012-03-09	ENSG00000168917	ENSG00000168917		"""Solute carriers"""	28480	protein-coding gene	gene with protein product			"""transmembrane protein 22"""	TMEM22		11230166	Standard	NM_001097600		Approved	MGC3295, DKFZp564K2464	uc003erf.4	Q8TBE7	OTTHUMG00000159787	ENST00000446465.2:c.193delG	3.37:g.136573495delG	ENSP00000400839:p.Gly65fs	Somatic	146	0		WXS	Illumina HiSeq	Phase_I	162	36	NM_025246	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000446465.2	37	CCDS3091.1																																																																																			.		0.403	SLC35G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357317.1	NM_025246	
DCHS2	54798	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	155180741	155180741	+	Frame_Shift_Del	DEL	C	C	-			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr4:155180741delC	ENST00000357232.4	-	20	5379	c.5380delG	c.(5380-5382)gcafs	p.A1794fs		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1794	Cadherin 16. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		GACACTGATGCCTGGTAAATG	0.413																																					p.A1794fs		.											.	DCHS2-94	0			c.5380delG						.						213.0	191.0	199.0					4																	155180741		2203	4300	6503	SO:0001589	frameshift_variant	54798	exon20			.	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.5380delG	4.37:g.155180741delC	ENSP00000349768:p.Ala1794fs	Somatic	185	0		WXS	Illumina HiSeq	Phase_I	205	45	NM_017639	0	0	0	0	0	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Frame_Shift_Del	DEL	ENST00000357232.4	37	CCDS3785.1																																																																																			.		0.413	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552	
MAP7	9053	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	136693761	136693761	+	Frame_Shift_Del	DEL	A	A	-			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr6:136693761delA	ENST00000354570.3	-	8	1164	c.754delT	c.(754-756)tctfs	p.S252fs	MAP7_ENST00000438100.2_Frame_Shift_Del_p.S237fs|MAP7_ENST00000544465.1_Frame_Shift_Del_p.S237fs|MAP7_ENST00000432797.2_Frame_Shift_Del_p.S106fs|MAP7_ENST00000454590.1_Frame_Shift_Del_p.S274fs	NM_001198616.1|NM_001198617.1|NM_001198619.1|NM_003980.4	NP_001185545.1|NP_001185546.1|NP_001185548.1|NP_003971.1	Q14244	MAP7_HUMAN	microtubule-associated protein 7	252					cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|establishment or maintenance of cell polarity (GO:0007163)|fertilization (GO:0009566)|germ cell development (GO:0007281)|glycosphingolipid metabolic process (GO:0006687)|homeostasis of number of cells (GO:0048872)|Leydig cell differentiation (GO:0033327)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|nucleus organization (GO:0006997)|organ growth (GO:0035265)|protein localization to plasma membrane (GO:0072659)|response to osmotic stress (GO:0006970)|response to retinoic acid (GO:0032526)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)|structural molecule activity (GO:0005198)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(11)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00199)|OV - Ovarian serous cystadenocarcinoma(155;0.00643)		GGGCTGCAAGATGCTGAACGA	0.488																																					p.S282fs		.											.	MAP7-90	0			c.844delT						.						175.0	153.0	161.0					6																	136693761		2203	4300	6503	SO:0001589	frameshift_variant	9053	exon8			.	X73882	CCDS5178.1, CCDS56452.1, CCDS56453.1, CCDS56454.1, CCDS56455.1, CCDS75527.1, CCDS75528.1, CCDS75529.1	6q23.2	2008-07-28			ENSG00000135525	ENSG00000135525			6869	protein-coding gene	gene with protein product		604108				8408219	Standard	NM_003980		Approved	E-MAP-115	uc011edg.2	Q14244	OTTHUMG00000015646	ENST00000354570.3:c.754delT	6.37:g.136693761delA	ENSP00000346581:p.Ser252fs	Somatic	93	0		WXS	Illumina HiSeq	Phase_I	116	24	NM_001198609	0	0	0	0	0	B7Z290|B7Z400|B7Z5S7|B7Z9U7|C9JPS0|E9PCP3|F5H1E2|Q7Z6S0|Q8TAU5|Q9NY82|Q9NY83	Frame_Shift_Del	DEL	ENST00000354570.3	37	CCDS5178.1																																																																																			.		0.488	MAP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042382.2	NM_003980	
SHPRH	257218	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	146264642	146264642	+	Frame_Shift_Del	DEL	T	T	-			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr6:146264642delT	ENST00000367505.2	-	9	2139	c.1875delA	c.(1873-1875)caafs	p.Q625fs	SHPRH_ENST00000367503.3_Frame_Shift_Del_p.Q625fs|SHPRH_ENST00000275233.7_Frame_Shift_Del_p.Q625fs|SHPRH_ENST00000438092.2_Frame_Shift_Del_p.Q625fs			Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase, E3 ubiquitin protein ligase	625					DNA repair (GO:0006281)|nucleosome assembly (GO:0006334)|protein polyubiquitination (GO:0000209)	nucleosome (GO:0000786)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(33)|ovary(3)|pancreas(2)|prostate(7)|skin(1)|urinary_tract(1)	79		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)		TTTCATGTTCTTGGTTGAATT	0.408																																					p.Q625fs		.											.	SHPRH-92	0			c.1875delA						.						196.0	183.0	187.0					6																	146264642		1952	4153	6105	SO:0001589	frameshift_variant	257218	exon9			.	AB095943	CCDS43513.1, CCDS47496.1, CCDS43513.2	6q24.2	2012-02-23	2012-02-23		ENSG00000146414	ENSG00000146414		"""RING-type (C3HC4) zinc fingers"""	19336	protein-coding gene	gene with protein product		608048	"""SNF2 histone linker PHD RING helicase"""			12837266	Standard	NM_001042683		Approved	FLJ90837, KIAA2023, bA545I5.2	uc003qlf.3	Q149N8	OTTHUMG00000015750	ENST00000367505.2:c.1875delA	6.37:g.146264642delT	ENSP00000356475:p.Gln625fs	Somatic	206	0		WXS	Illumina HiSeq	Phase_I	234	64	NM_173082	0	0	0	0	0	Q149N9|Q5VV79|Q68DS5|Q7Z5J5|Q8IVE8|Q8IWQ9|Q8N1S8|Q8NBR7	Frame_Shift_Del	DEL	ENST00000367505.2	37	CCDS43513.2																																																																																			.		0.408	SHPRH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042571.2	NM_173082	
NFX1	4799	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	33319104	33319106	+	In_Frame_Del	DEL	CCT	CCT	-			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	CCT	CCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr9:33319104_33319106delCCT	ENST00000379540.3	+	9	1947_1949	c.1885_1887delCCT	c.(1885-1887)cctdel	p.P629del	NFX1_ENST00000318524.6_In_Frame_Del_p.P629del|NFX1_ENST00000379521.4_In_Frame_Del_p.P629del	NM_002504.4	NP_002495.2	Q12986	NFX1_HUMAN	nuclear transcription factor, X-box binding 1	629					inflammatory response (GO:0006954)|negative regulation of MHC class II biosynthetic process (GO:0045347)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(4)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25			LUSC - Lung squamous cell carcinoma(29;0.00506)	GBM - Glioblastoma multiforme(74;0.224)		GTGCGGCAAGCCTCTGCCTTGTG	0.438																																					p.629_629del		.											.	NFX1-91	0			c.1885_1887del						.																																			SO:0001651	inframe_deletion	4799	exon9			.	U19759	CCDS6538.1, CCDS6539.1, CCDS6540.1	9p12	2013-12-13			ENSG00000086102	ENSG00000086102			7803	protein-coding gene	gene with protein product		603255				7964459, 2511169	Standard	NM_002504		Approved	NFX2, MGC20369, Tex42, TEG-42	uc003zsq.3	Q12986	OTTHUMG00000019772	ENST00000379540.3:c.1885_1887delCCT	9.37:g.33319104_33319106delCCT	ENSP00000368856:p.Pro629del	Somatic	56	0		WXS	Illumina HiSeq	Phase_I	61	22	NM_147134	0	0	0	0	0	A8K6H8|Q5VXW6|Q96EL5|Q9BXI1	In_Frame_Del	DEL	ENST00000379540.3	37	CCDS6538.1																																																																																			.		0.438	NFX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052069.1		
STRIP1	85369	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	110587506	110587507	+	Frame_Shift_Ins	INS	-	-	TA			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr1:110587506_110587507insTA	ENST00000369795.3	+	11	1353_1354	c.1331_1332insTA	c.(1330-1335)tttatafs	p.FI444fs	STRIP1_ENST00000369796.1_Frame_Shift_Ins_p.FI349fs	NM_033088.3	NP_149079.2	Q5VSL9	STRP1_HUMAN	striatin interacting protein 1	444					cortical actin cytoskeleton organization (GO:0030866)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)											CGCAGCAAATTTATAGGTTACA	0.436																																					p.F444fs		.											.	.	0			c.1331_1332insTA						.																																			SO:0001589	frameshift_variant	85369	exon11			.	AK027649	CCDS30798.1, CCDS59197.1	1p13.3	2012-11-05	2012-11-05	2012-11-05	ENSG00000143093	ENSG00000143093			25916	protein-coding gene	gene with protein product	"""FAR11 factor arrest 11 homolog A (yeast)"""		"""family with sequence similarity 40, member A"""	FAM40A		11214970, 12588993, 22782902, 22298706, 18782753	Standard	NM_033088		Approved	FLJ14743, KIAA1761, FAR11A	uc001dza.2	Q5VSL9	OTTHUMG00000170607	ENST00000369795.3:c.1334_1335dupTA	1.37:g.110587509_110587510dupTA	ENSP00000358810:p.Phe444fs	Somatic	127	0		WXS	Illumina HiSeq	Phase_I	107	30	NM_033088	0	0	0	0	0	Q0V925|Q5VSL8|Q658K2|Q6ZV31|Q8N598|Q96SN2|Q9C0A2	Frame_Shift_Ins	INS	ENST00000369795.3	37	CCDS30798.1																																																																																			.		0.436	STRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032213.1	NM_033088	
NAV3	89795	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	78513435	78513436	+	Frame_Shift_Ins	INS	-	-	G			TCGA-EV-5903-01A-11D-1589-08	TCGA-EV-5903-10A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	47cd3f3e-d93f-4343-8212-7656684a197c	f11afb9d-944d-4565-a9df-bdd5c35e0568	g.chr12:78513435_78513436insG	ENST00000397909.2	+	15	3632_3633	c.3459_3460insG	c.(3460-3462)ggcfs	p.G1154fs	NAV3_ENST00000536525.2_Frame_Shift_Ins_p.G1154fs|NAV3_ENST00000266692.7_Frame_Shift_Ins_p.G1154fs|NAV3_ENST00000228327.6_Frame_Shift_Ins_p.G1154fs			Q8IVL0	NAV3_HUMAN	neuron navigator 3	1154	Ser-rich.					membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						CTGGCCGAGGAGGCCACAGATC	0.525										HNSCC(70;0.22)																											p.G1153fs		.											.	NAV3-279	0			c.3459_3460insG						.																																			SO:0001589	frameshift_variant	89795	exon15			.	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.3461dupG	12.37:g.78513437_78513437dupG	ENSP00000381007:p.Gly1154fs	Somatic	68	0		WXS	Illumina HiSeq	Phase_I	73	20	NM_014903	0	0	0	0	0	Q8NFW7|Q9Y2E7	Frame_Shift_Ins	INS	ENST00000397909.2	37																																																																																				.		0.525	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383	
