#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ESPN	83715	hgsc.bcm.edu	37	1	6500833	6500833	+	Missense_Mutation	SNP	C	C	G	rs3817921		TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr1:6500833C>G	ENST00000377828.1	+	4	991	c.823C>G	c.(823-825)Ccg>Gcg	p.P275A	RP1-202O8.2_ENST00000419034.1_RNA	NM_031475.2	NP_113663.2	B1AK53	ESPN_HUMAN	espin	275					locomotory behavior (GO:0007626)|negative regulation of cytoskeleton organization (GO:0051494)|parallel actin filament bundle assembly (GO:0030046)|positive regulation of filopodium assembly (GO:0051491)|sensory perception of sound (GO:0007605)	brush border (GO:0005903)|cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|microvillus (GO:0005902)|stereocilium bundle tip (GO:0032426)	actin filament binding (GO:0051015)|SH3 domain binding (GO:0017124)			NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(1)	17	Ovarian(185;0.0386)|all_lung(157;0.154)	all_cancers(23;3.6e-37)|all_epithelial(116;2.56e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|all_hematologic(16;6.92e-06)|Colorectal(325;4.47e-05)|Acute lymphoblastic leukemia(12;4.92e-05)|Breast(487;7.61e-05)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)		Epithelial(90;1.82e-35)|GBM - Glioblastoma multiforme(13;3e-28)|Kidney(185;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(229;5.63e-08)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;1.41e-05)|BRCA - Breast invasive adenocarcinoma(365;0.000109)|STAD - Stomach adenocarcinoma(132;0.00167)|Lung(427;0.0108)|LUSC - Lung squamous cell carcinoma(448;0.0253)|READ - Rectum adenocarcinoma(331;0.0419)		GGGCGGGACCCCGCTGCACGA	0.746																																					p.P275A		.											.	ESPN-514	0			c.C823G						.																																			SO:0001583	missense	83715	exon4			GGGACCCCGCTGC	AF134401	CCDS70.1	1p36.31	2013-01-10			ENSG00000187017	ENSG00000187017		"""Ankyrin repeat domain containing"""	13281	protein-coding gene	gene with protein product		606351	"""deafness, autosomal recessive 36"""	DFNB36		10975527, 15286153	Standard	NM_031475		Approved		uc001amy.3	B1AK53	OTTHUMG00000000753	ENST00000377828.1:c.823C>G	1.37:g.6500833C>G	ENSP00000367059:p.Pro275Ala	Somatic	12	2		WXS	Illumina HiSeq	Phase_I	10	2	NM_031475	0	0	0	0	0	Q6XYB2|Q9H0A2|Q9Y329	Missense_Mutation	SNP	ENST00000377828.1	37	CCDS70.1	.	.	.	.	.	.	.	.	.	.	C	17.78	3.472642	0.63737	.	.	ENSG00000187017	ENST00000377828;ENST00000418286	T;T	0.67523	-0.27;0.91	3.84	3.84	0.44239	Ankyrin repeat-containing domain (4);	0.437340	0.22224	N	0.062901	T	0.45577	0.1349	N	0.05414	-0.055	0.80722	D	1	B	0.14438	0.01	B	0.18263	0.021	T	0.39057	-0.9632	10	0.32370	T	0.25	-11.7359	12.6418	0.56714	0.0:1.0:0.0:0.0	rs3817921	275	B1AK53	ESPN_HUMAN	A	275;60	ENSP00000367059:P275A;ENSP00000401793:P60A	ENSP00000367059:P275A	P	+	1	0	ESPN	6423420	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	7.267000	0.78462	1.989000	0.58080	0.430000	0.28490	CCG	.		0.746	ESPN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001887.3	NM_031475	
DRAXIN	374946	broad.mit.edu	37	1	11771907	11771907	+	Splice_Site	SNP	G	G	A	rs147444302		TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr1:11771907G>A	ENST00000294485.5	+	4	777		c.e4-1			NM_198545.3	NP_940947.3			dorsal inhibitory axon guidance protein																		ACGGTCTCCAGCAGGCACAGC	0.552																																					.													.	.	0			c.643-1G>A						.						54.0	42.0	46.0					1																	11771907		2203	4300	6503	SO:0001630	splice_region_variant	374946	exon4			TCTCCAGCAGGCA	AY358750	CCDS135.1	1p36.22	2012-08-20	2012-08-14	2012-08-14	ENSG00000162490	ENSG00000162490			25054	protein-coding gene	gene with protein product	"""dorsal repulsive axon guidance protein"", ""neural tissue-specific cysteine-rich protein"""	612682	"""chromosome 1 open reading frame 187"""	C1orf187		19150847	Standard	NM_198545		Approved	FLJ34999, Draxin, Neucrin	uc001asr.1	Q8NBI3	OTTHUMG00000002227	ENST00000294485.5:c.643-1G>A	1.37:g.11771907G>A		Somatic	29	0		WXS	Illumina HiSeq	Phase_I	27	6	NM_198545	0	0	0	0	0		Splice_Site	SNP	ENST00000294485.5	37	CCDS135.1	.	.	.	.	.	.	.	.	.	.	G	3.498	-0.102520	0.06967	.	.	ENSG00000162490	ENST00000294485	.	.	.	5.52	2.29	0.28610	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.5109	0.44862	0.0667:0.1084:0.7246:0.1002	.	.	.	.	.	-1	.	.	.	+	.	.	C1orf187	11694494	1.000000	0.71417	0.453000	0.27007	0.065000	0.16274	3.334000	0.52097	0.276000	0.22118	-0.797000	0.03246	.	G|1.000;C|0.000		0.552	DRAXIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006325.1	NM_198545	Intron
CELSR2	1952	hgsc.bcm.edu	37	1	109792762	109792762	+	Silent	SNP	T	T	C			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr1:109792762T>C	ENST00000271332.3	+	1	122	c.61T>C	c.(61-63)Ttg>Ctg	p.L21L		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	21					cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		gctgctgctgttgctgctgct	0.746																																					p.L21L	NSCLC(158;1285 2011 34800 34852 42084)	.											.	CELSR2-526	0			c.T61C						.						9.0	11.0	11.0					1																	109792762		1973	3925	5898	SO:0001819	synonymous_variant	1952	exon1			CTGCTGTTGCTGC	D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.61T>C	1.37:g.109792762T>C		Somatic	57	1		WXS	Illumina HiSeq	Phase_I	65	4	NM_001408	0	0	5	61	56	Q5T2Y7|Q92566	Silent	SNP	ENST00000271332.3	37	CCDS796.1																																																																																			.		0.746	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033200.1	NM_001408	
DDX20	11218	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	112303729	112303729	+	Missense_Mutation	SNP	T	T	G			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr1:112303729T>G	ENST00000369702.4	+	6	1564	c.944T>G	c.(943-945)tTt>tGt	p.F315C	DDX20_ENST00000536167.1_3'UTR|DDX20_ENST00000475700.1_5'UTR	NM_007204.4	NP_009135.4	Q9UHI6	DDX20_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 20	315	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oogenesis (GO:0048477)|positive regulation of apoptotic process (GO:0043065)|regulation of steroid biosynthetic process (GO:0050810)|RNA metabolic process (GO:0016070)|RNA processing (GO:0006396)|spliceosomal snRNP assembly (GO:0000387)|spliceosomal tri-snRNP complex assembly (GO:0000244)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)|transcriptional repressor complex (GO:0017053)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)			endometrium(3)|kidney(7)|large_intestine(6)|lung(3)|pancreas(1)|prostate(1)	21		all_cancers(81;1.06e-05)|all_epithelial(167;7.36e-06)|all_lung(203;2.44e-05)|Lung NSC(69;4.15e-05)		Lung(183;0.0234)|Colorectal(144;0.0282)|all cancers(265;0.0614)|Epithelial(280;0.0999)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GCTTTAGTCTTTTCTAATTTG	0.353																																					p.F315C		.											.	DDX20-227	0			c.T944G						.						111.0	114.0	113.0					1																	112303729		2203	4300	6503	SO:0001583	missense	11218	exon6			TAGTCTTTTCTAA	AF106019	CCDS842.1	1p21.1-p13.2	2008-02-05	2003-06-13		ENSG00000064703	ENSG00000064703		"""DEAD-boxes"""	2743	protein-coding gene	gene with protein product		606168	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 20, 103kD"""			10383418	Standard	NM_007204		Approved	DP103, GEMIN3	uc001ebs.3	Q9UHI6	OTTHUMG00000011956	ENST00000369702.4:c.944T>G	1.37:g.112303729T>G	ENSP00000358716:p.Phe315Cys	Somatic	97	0		WXS	Illumina HiSeq	Phase_I	96	39	NM_007204	0	0	6	9	3	B4DWV7|Q96F72|Q9NVM3|Q9UF59|Q9UIY0|Q9Y659	Missense_Mutation	SNP	ENST00000369702.4	37	CCDS842.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.962407	0.74016	.	.	ENSG00000064703	ENST00000369702	T	0.11063	2.81	5.62	5.62	0.85841	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.43344	0.1243	H	0.98178	4.165	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.66106	-0.6006	10	0.87932	D	0	-23.1854	15.4768	0.75489	0.0:0.0:0.0:1.0	.	315	Q9UHI6	DDX20_HUMAN	C	315	ENSP00000358716:F315C	ENSP00000358716:F315C	F	+	2	0	DDX20	112105252	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.586000	0.82596	2.152000	0.67230	0.459000	0.35465	TTT	.		0.353	DDX20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033063.2	NM_007204	
RXFP4	339403	broad.mit.edu;bcgsc.ca	37	1	155912175	155912175	+	Silent	SNP	G	G	A			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr1:155912175G>A	ENST00000368318.3	+	1	696	c.675G>A	c.(673-675)ctG>ctA	p.L225L		NM_181885.2	NP_871001.1	Q8TDU9	RL3R2_HUMAN	relaxin/insulin-like family peptide receptor 4	225						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	angiotensin type II receptor activity (GO:0004945)			endometrium(1)|large_intestine(4)|lung(6)|ovary(1)|skin(1)	13	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					CCAGCTACCTGCTGCTGCTGG	0.662																																					p.L225L													.	RXFP4-90	0			c.G675A						.						45.0	49.0	48.0					1																	155912175		2203	4300	6503	SO:0001819	synonymous_variant	339403	exon1			CTACCTGCTGCTG	AB065617	CCDS1124.1	1q22	2012-08-08	2006-05-09	2006-03-15	ENSG00000173080	ENSG00000173080		"""GPCR / Class A : Relaxin family peptide receptors"""	14666	protein-coding gene	gene with protein product		609043	"""G protein-coupled receptor 100"", ""relaxin 3 receptor 2"", ""relaxin family peptide receptor 4"""	GPR100, RLN3R2		15956688, 16507880	Standard	NM_181885		Approved	GPCR142, RXFPR4	uc010pgs.2	Q8TDU9	OTTHUMG00000017463	ENST00000368318.3:c.675G>A	1.37:g.155912175G>A		Somatic	122	0		WXS	Illumina HiSeq	Phase_I	97	10	NM_181885	0	0	0	0	0	B0M0L4|Q3MJB1|Q8NGZ8	Silent	SNP	ENST00000368318.3	37	CCDS1124.1																																																																																			.		0.662	RXFP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046203.1	NM_181885	
DSTYK	25778	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	205132071	205132071	+	Silent	SNP	G	G	A			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr1:205132071G>A	ENST00000367162.3	-	5	1651	c.1621C>T	c.(1621-1623)Cta>Tta	p.L541L	DSTYK_ENST00000367161.3_Silent_p.L541L|DSTYK_ENST00000367160.4_Intron	NM_015375.2	NP_056190.1	Q6XUX3	DUSTY_HUMAN	dual serine/threonine and tyrosine protein kinase	541					cellular response to fibroblast growth factor stimulus (GO:0044344)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of kinase activity (GO:0033674)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(2)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(2)	14						TGCTCCCATAGCATCCTTGTA	0.418																																					p.L541L		.											.	DSTYK-333	0			c.C1621T						.						205.0	191.0	196.0					1																	205132071		2203	4300	6503	SO:0001819	synonymous_variant	25778	exon5			CCCATAGCATCCT	AF068286	CCDS1451.1, CCDS1452.1	1q32	2008-12-18	2008-12-18	2008-12-18	ENSG00000133059	ENSG00000133059			29043	protein-coding gene	gene with protein product		612666	"""receptor interacting protein kinase 5"""	RIPK5		15178406	Standard	NM_015375		Approved	KIAA0472, DustyPK, RIP5	uc001hbw.3	Q6XUX3	OTTHUMG00000037102	ENST00000367162.3:c.1621C>T	1.37:g.205132071G>A		Somatic	147	0		WXS	Illumina HiSeq	Phase_I	154	67	NM_199462	0	0	8	10	2	B7ZL64|O75060|Q17R94|Q5RKT0|Q6IN87|Q6P997|Q86Y03|Q9P1S5	Silent	SNP	ENST00000367162.3	37	CCDS1451.1																																																																																			.		0.418	DSTYK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090345.1	NM_015375	
LEFTY1	10637	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	226075314	226075314	+	Silent	SNP	G	G	A			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr1:226075314G>A	ENST00000272134.5	-	3	601	c.522C>T	c.(520-522)ggC>ggT	p.G174G	LEFTY1_ENST00000492457.1_5'Flank|RP4-559A3.7_ENST00000432920.2_Silent_p.L283L	NM_020997.3	NP_066277.1	O75610	LFTY1_HUMAN	left-right determination factor 1	174					cell growth (GO:0016049)|determination of left/right symmetry (GO:0007368)|heart morphogenesis (GO:0003007)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)				cervix(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	10	Breast(184;0.197)					AGGCCTTCCAGCCGCTCTCGT	0.701																																					p.G174G		.											.	LEFTY1-90	0			c.C522T						.						14.0	18.0	17.0					1																	226075314		2133	4177	6310	SO:0001819	synonymous_variant	10637	exon3			CTTCCAGCCGCTC	AF081507	CCDS1548.1	1q42.1	2008-02-05	2004-11-17	2004-11-17	ENSG00000243709	ENSG00000243709			6552	protein-coding gene	gene with protein product		603037	"""left-right determination, factor B"""	LEFTB		10053005, 10886363	Standard	NM_020997		Approved	LEFTYB	uc001hpo.3	O75610	OTTHUMG00000037443	ENST00000272134.5:c.522C>T	1.37:g.226075314G>A		Somatic	111	1		WXS	Illumina HiSeq	Phase_I	76	28	NM_020997	0	0	0	0	0	B2R7U0|Q53H67|Q5TE94	Silent	SNP	ENST00000272134.5	37	CCDS1548.1																																																																																			.		0.701	LEFTY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091155.1	NM_020997	
AGT	183	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	230841791	230841791	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr1:230841791C>T	ENST00000366667.4	-	3	1226	c.1012G>A	c.(1012-1014)Gag>Aag	p.E338K		NM_000029.3	NP_000020.1	P01019	ANGT_HUMAN	angiotensinogen (serpin peptidase inhibitor, clade A, member 8)	338					activation of NF-kappaB-inducing kinase activity (GO:0007250)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|angiotensin maturation (GO:0002003)|angiotensin mediated vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001998)|angiotensin-mediated drinking behavior (GO:0003051)|artery smooth muscle contraction (GO:0014824)|astrocyte activation (GO:0048143)|blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|branching involved in ureteric bud morphogenesis (GO:0001658)|catenin import into nucleus (GO:0035411)|cell growth involved in cardiac muscle cell development (GO:0061049)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|cellular lipid metabolic process (GO:0044255)|cellular protein metabolic process (GO:0044267)|cellular response to mechanical stimulus (GO:0071260)|cellular sodium ion homeostasis (GO:0006883)|cytokine secretion (GO:0050663)|ERK1 and ERK2 cascade (GO:0070371)|establishment of blood-nerve barrier (GO:0008065)|excretion (GO:0007588)|extracellular matrix organization (GO:0030198)|fibroblast proliferation (GO:0048144)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|kidney development (GO:0001822)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neurotrophin TRK receptor signaling pathway (GO:0051387)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|negative regulation of tissue remodeling (GO:0034104)|nitric oxide mediated signal transduction (GO:0007263)|ovarian follicle rupture (GO:0001543)|peristalsis (GO:0030432)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of activation of JAK2 kinase activity (GO:0010535)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of cytokine production (GO:0001819)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of extracellular matrix constituent secretion (GO:0003331)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of NAD(P)H oxidase activity (GO:0033864)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of organ growth (GO:0046622)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood vessel size by renin-angiotensin (GO:0002034)|regulation of blood volume by renin-angiotensin (GO:0002016)|regulation of calcium ion transport (GO:0051924)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of norepinephrine secretion (GO:0014061)|regulation of proteolysis (GO:0030162)|regulation of renal output by angiotensin (GO:0002019)|regulation of renal sodium excretion (GO:0035813)|regulation of vasoconstriction (GO:0019229)|renal response to blood flow involved in circulatory renin-angiotensin regulation of systemic arterial blood pressure (GO:0001999)|renal system process (GO:0003014)|renin-angiotensin regulation of aldosterone production (GO:0002018)|response to cold (GO:0009409)|response to muscle activity involved in regulation of muscle adaptation (GO:0014873)|response to salt stress (GO:0009651)|small molecule metabolic process (GO:0044281)|smooth muscle cell differentiation (GO:0051145)|smooth muscle cell proliferation (GO:0048659)|stress-activated MAPK cascade (GO:0051403)|uterine smooth muscle contraction (GO:0070471)|vasodilation (GO:0042311)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	growth factor activity (GO:0008083)|hormone activity (GO:0005179)|serine-type endopeptidase inhibitor activity (GO:0004867)|superoxide-generating NADPH oxidase activator activity (GO:0016176)|type 1 angiotensin receptor binding (GO:0031702)|type 2 angiotensin receptor binding (GO:0031703)			endometrium(5)|kidney(1)|large_intestine(6)|lung(7)|pancreas(1)|prostate(5)	25	Breast(184;0.0735)|Ovarian(103;0.183)	all_cancers(173;4.64e-23)|all_epithelial(177;3.61e-18)|Breast(1374;0.00093)|all_neural(198;0.0604)|Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;4.4e-06)|Colorectal(1306;5.46e-06)|COAD - Colon adenocarcinoma(196;0.000256)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		CAGGCGCTCTCAGTGAAGGGC	0.557																																					p.E338K		.											.	AGT-226	0			c.G1012A						.						109.0	103.0	105.0					1																	230841791		2203	4300	6503	SO:0001583	missense	183	exon3			CGCTCTCAGTGAA	K02215	CCDS1585.1	1q42.2	2014-02-18	2005-08-18	2001-06-29	ENSG00000135744	ENSG00000135744		"""Serine (or cysteine) peptidase inhibitors"", ""Endogenous ligands"""	333	protein-coding gene	gene with protein product	"""alpha-1 antiproteinase, antitrypsin"""	106150		SERPINA8		6089875, 24172014	Standard	NM_000029		Approved		uc001hty.4	P01019	OTTHUMG00000037757	ENST00000366667.4:c.1012G>A	1.37:g.230841791C>T	ENSP00000355627:p.Glu338Lys	Somatic	172	1		WXS	Illumina HiSeq	Phase_I	171	61	NM_000029	0	0	17	49	32	Q16358|Q16359|Q96F91	Missense_Mutation	SNP	ENST00000366667.4	37	CCDS1585.1	.	.	.	.	.	.	.	.	.	.	C	0.022	-1.416535	0.01136	.	.	ENSG00000135744	ENST00000366667;ENST00000430091	D	0.87571	-2.27	5.17	1.03	0.20045	Serpin domain (3);	0.577268	0.19344	N	0.116572	T	0.70657	0.3249	N	0.11560	0.145	0.09310	N	1	B;B;B	0.16396	0.006;0.017;0.006	B;B;B	0.12156	0.003;0.007;0.003	T	0.54234	-0.8324	10	0.15499	T	0.54	.	9.4035	0.38447	0.0:0.543:0.0:0.457	.	338;338;338	B0ZBE2;B2R5S1;P01019	.;.;ANGT_HUMAN	K	338;256	ENSP00000355627:E338K	ENSP00000355627:E338K	E	-	1	0	AGT	228908414	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	0.077000	0.14738	0.168000	0.19655	0.655000	0.94253	GAG	.		0.557	AGT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092102.1	NM_000029	
KIAA1279	26128	ucsc.edu	37	10	70775350	70775350	+	Silent	SNP	G	G	A			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr10:70775350G>A	ENST00000361983.4	+	7	1146	c.1044G>A	c.(1042-1044)agG>agA	p.R348R		NM_015634.3	NP_056449.1	Q96EK5	KBP_HUMAN	KIAA1279	348					cell differentiation (GO:0030154)|mitochondrial transport (GO:0006839)|nervous system development (GO:0007399)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)	kinesin binding (GO:0019894)			breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	14						GAGCTTTAAGGAAAAAAGAAC	0.398																																					p.R348R													.	KIAA1279-91	0			c.G1044A						.						81.0	84.0	83.0					10																	70775350		2203	4300	6503	SO:0001819	synonymous_variant	26128	exon7			TTTAAGGAAAAAA	BC012180	CCDS7284.1	10q22.1	2008-02-05			ENSG00000198954	ENSG00000198954			23419	protein-coding gene	gene with protein product		609367					Standard	NM_015634		Approved	DKFZP586B0923, TTC20	uc001joy.3	Q96EK5	OTTHUMG00000018363	ENST00000361983.4:c.1044G>A	10.37:g.70775350G>A		Somatic	112	0		WXS	Illumina HiSeq		99	2	NM_015634	0	0	19	22	3	A8K5M8|Q9BR89|Q9ULE1|Q9Y428	Silent	SNP	ENST00000361983.4	37	CCDS7284.1																																																																																			.		0.398	KIAA1279-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048370.1	NM_015634	
ERLIN1	10613	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	101911987	101911987	+	Silent	SNP	A	A	G			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr10:101911987A>G	ENST00000421367.2	-	11	3655	c.948T>C	c.(946-948)taT>taC	p.Y316Y	ERLIN1_ENST00000407654.3_Silent_p.Y316Y	NM_001100626.1|NM_006459.3	NP_001094096.1|NP_006450.2	O75477	ERLN1_HUMAN	ER lipid raft associated 1	314					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|protein complex (GO:0043234)							Colorectal(252;0.234)		Epithelial(162;3.85e-10)|all cancers(201;3.25e-08)		TAATATCTGAATATTTCAAAG	0.443																																					p.Y316Y		.											.	.	0			c.T948C						.						119.0	115.0	116.0					10																	101911987		2203	4300	6503	SO:0001819	synonymous_variant	10613	exon11			ATCTGAATATTTC	AF064093	CCDS7487.2	10q24.31	2014-03-03	2007-01-26	2007-01-26	ENSG00000107566	ENSG00000107566			16947	protein-coding gene	gene with protein product	"""Band_7 23-211 Keo4 (Interim) similar to C.elegans protein C42C1.9"""	611604	"""chromosome 10 open reading frame 69"", ""SPFH domain family, member 1"""	C10orf69, SPFH1		11118313, 16835267, 24482476	Standard	NM_006459		Approved	KE04, Erlin-1, SPG62	uc001kqo.4	O75477	OTTHUMG00000018900	ENST00000421367.2:c.948T>C	10.37:g.101911987A>G		Somatic	127	0		WXS	Illumina HiSeq	Phase_I	132	50	NM_006459	0	0	17	28	11	B0QZ42|Q53HV0	Silent	SNP	ENST00000421367.2	37	CCDS7487.2																																																																																			.		0.443	ERLIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049840.2	NM_006459	
PPFIBP2	8495	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	7669667	7669667	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr11:7669667T>C	ENST00000299492.4	+	18	2084	c.1696T>C	c.(1696-1698)Tgg>Cgg	p.W566R	PPFIBP2_ENST00000533792.1_Missense_Mutation_p.W408R|PPFIBP2_ENST00000530582.1_3'UTR|PPFIBP2_ENST00000530181.1_Missense_Mutation_p.W423R|PPFIBP2_ENST00000528883.1_Missense_Mutation_p.W454R	NM_003621.3	NP_003612	Q8ND30	LIPB2_HUMAN	PTPRF interacting protein, binding protein 2 (liprin beta 2)	566	SAM 1. {ECO:0000255|PROSITE- ProRule:PRU00184}.				cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|intracellular (GO:0005622)|presynaptic active zone (GO:0048786)	DNA binding (GO:0003677)|integrase activity (GO:0008907)			breast(8)|cervix(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32				Epithelial(150;2.01e-07)|BRCA - Breast invasive adenocarcinoma(625;0.236)		TGTGTGTGCATGGCTGGAGGA	0.547																																					p.W566R		.											.	PPFIBP2-273	0			c.T1696C						.						165.0	124.0	138.0					11																	7669667		2201	4296	6497	SO:0001583	missense	8495	exon18			TGTGCATGGCTGG	AF034803	CCDS31419.1, CCDS58116.1, CCDS58117.1	11p15.4	2013-01-10			ENSG00000166387	ENSG00000166387		"""Sterile alpha motif (SAM) domain containing"""	9250	protein-coding gene	gene with protein product		603142				9624153	Standard	NM_003621		Approved	Cclp1	uc001mfj.5	Q8ND30	OTTHUMG00000165617	ENST00000299492.4:c.1696T>C	11.37:g.7669667T>C	ENSP00000299492:p.Trp566Arg	Somatic	140	0		WXS	Illumina HiSeq	Phase_I	117	44	NM_003621	0	0	5	14	9	B7Z433|E9PK77|O75337|Q8WW26	Missense_Mutation	SNP	ENST00000299492.4	37	CCDS31419.1	.	.	.	.	.	.	.	.	.	.	T	23.7	4.451254	0.84209	.	.	ENSG00000166387	ENST00000299492;ENST00000533792;ENST00000541115;ENST00000528883;ENST00000530181	T;T;T;T	0.61510	0.1;0.1;0.1;0.1	5.74	5.74	0.90152	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.000000	0.64402	D	0.000001	D	0.82660	0.5085	H	0.95114	3.625	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.87696	0.2557	10	0.87932	D	0	-9.1173	13.9867	0.64339	0.0:0.0:0.0:1.0	.	454;454;489;408;423;566	E9PK77;B7Z433;F5GWB0;E9PP16;E9PMU1;Q8ND30	.;.;.;.;.;LIPB2_HUMAN	R	566;408;489;454;423	ENSP00000299492:W566R;ENSP00000436498:W408R;ENSP00000435469:W454R;ENSP00000437321:W423R	ENSP00000299492:W566R	W	+	1	0	PPFIBP2	7626243	1.000000	0.71417	0.926000	0.36857	0.995000	0.86356	8.040000	0.89188	2.194000	0.70268	0.459000	0.35465	TGG	.		0.547	PPFIBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385345.2	NM_003621	
SLC22A20	440044	bcgsc.ca	37	11	64985059	64985059	+	RNA	SNP	G	G	T	rs113875023	byFrequency	TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr11:64985059G>T	ENST00000525437.1	+	0	572							A6NK97	S22AK_HUMAN	solute carrier family 22, member 20						ion transport (GO:0006811)	integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(2)|prostate(2)	8						GCAGCTTCGGGGGCCGCCACA	0.602																																					p.G180V													.	SLC22A20-23	0			c.G539T						.						35.0	41.0	39.0					11																	64985059		1966	4142	6108			440044	exon3			CTTCGGGGGCCGC	DQ053017		11q13.1	2014-02-20			ENSG00000197847	ENSG00000197847		"""Solute carriers"""	29867	other	unknown		611696				15369770, 16478971	Standard	NM_001004326		Approved	Oat6, FLJ16331	uc021qlh.1	A6NK97	OTTHUMG00000165615		11.37:g.64985059G>T		Somatic	56	0		WXS	Illumina HiSeq	Phase_1	46	10	NM_001004326	0	0	0	0	0	B9EJB2|Q6ZN88	Missense_Mutation	SNP	ENST00000525437.1	37																																																																																				G|0.992;A|0.008		0.602	SLC22A20-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000385336.1	NM_001004326	
B3GNT6	192134	hgsc.bcm.edu	37	11	76751585	76751585	+	Splice_Site	SNP	T	T	C	rs11292199		TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr11:76751585T>C	ENST00000354301.5	+	4	1076	c.988T>C	c.(988-990)Tgg>Cgg	p.W330R	B3GNT6_ENST00000421061.1_Splice_Site|B3GNT6_ENST00000533140.1_Silent_p.P330P	NM_138706.3	NP_619651.3	O43505	B3GN1_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase)	0					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|poly-N-acetyllactosamine biosynthetic process (GO:0030311)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase activity (GO:0008532)			central_nervous_system(1)|kidney(2)|lung(4)|prostate(1)	8						GAGGGCATCCTGGCCCTTCGG	0.697																																					.		.											.	.	0			c.988+1T>C						.						6.0	5.0	6.0					11																	76751585		1175	2610	3785	SO:0001630	splice_region_variant	192134	exon3			GCATCCTGGCCCT	AB073740	CCDS53681.1	11q13.4	2013-02-19			ENSG00000198488	ENSG00000198488		"""Beta 3-glycosyltransferases"""	24141	protein-coding gene	gene with protein product		615315				11821425	Standard	NM_138706		Approved	B3Gn-T6	uc021qnp.1	Q6ZMB0		ENST00000354301.5:c.988-1T>C	11.37:g.76751585T>C		Somatic	0	0		WXS	Illumina HiSeq	Phase_I	5	3	NM_138706	0	0	0	0	0	Q4TTN0	Splice_Site	SNP	ENST00000354301.5	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	-|-	0.007|0.007	-1.936685|-1.936685	0.00484|0.00484	.|.	.|.	ENSG00000198488|ENSG00000198488	ENST00000354301;ENST00000421061|ENST00000354301	.|T	.|0.24538	.|1.85	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.11024	.|0.0269	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.26916	.|-1.0089	.|4	.|0.02654	.|T	.|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|R	-1|330	.|ENSP00000346256:W330R	.|ENSP00000346256:W330R	.|W	+|+	.|1	.|0	B3GNT6|B3GNT6	76429233|76429233	0.988000|0.988000	0.35896|0.35896	1.000000|1.000000	0.80357|0.80357	0.975000|0.975000	0.68041|0.68041	0.000000|0.000000	0.12993|0.12993	0.000000|0.000000	0.14550|0.14550	0.000000|0.000000	0.15137|0.15137	.|TGG	.		0.697	B3GNT6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_138706	Missense_Mutation
KLRK1	22914	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	10539567	10539567	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr12:10539567C>T	ENST00000240618.6	-	3	223	c.83G>A	c.(82-84)aGt>aAt	p.S28N	KLRC4-KLRK1_ENST00000539300.1_3'UTR|KLRK1_ENST00000540818.1_Missense_Mutation_p.S28N|RP11-277P12.20_ENST00000500682.1_RNA	NM_001199805.1|NM_007360.3	NP_001186734.1|NP_031386.2	P26718	NKG2D_HUMAN	killer cell lectin-like receptor subfamily K, member 1	28					cell differentiation (GO:0030154)|innate immune response (GO:0045087)|natural killer cell activation (GO:0030101)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|skin(1)	9						TGAAAAATCACTCTTCTTCAG	0.363																																					p.S28N		.											.	.	0			c.G83A						.						171.0	159.0	163.0					12																	10539567		2203	4299	6502	SO:0001583	missense	0	exon8			AAATCACTCTTCT	AJ001687	CCDS8623.1	12p13.2-p12.3	2010-02-17	2003-02-19		ENSG00000213809	ENSG00000213809		"""Killer cell lectin-like receptors"", ""CD molecules"""	18788	protein-coding gene	gene with protein product		611817	"""DNA segment on chromosome 12 (unique) 2489 expressed sequence"""	D12S2489E		9683661, 2007850	Standard	NM_007360		Approved	NKG2D, KLR, NKG2-D, CD314	uc009zhj.3	P26718	OTTHUMG00000168574	ENST00000240618.6:c.83G>A	12.37:g.10539567C>T	ENSP00000240618:p.Ser28Asn	Somatic	70	0		WXS	Illumina HiSeq	Phase_I	56	18	NM_001199805	0	0	0	0	0	A8K7K5|A8K7P4|Q9NR41	Missense_Mutation	SNP	ENST00000240618.6	37	CCDS8623.1	.	.	.	.	.	.	.	.	.	.	C	0.017	-1.506590	0.00992	.	.	ENSG00000213809	ENST00000240618;ENST00000540818	T;T	0.01430	4.9;4.9	4.09	-8.18	0.01053	.	2.508350	0.01286	N	0.009885	T	0.00998	0.0033	L	0.29908	0.895	0.09310	N	1	B;B;B	0.21520	0.0;0.0;0.057	B;B;B	0.15870	0.0;0.001;0.014	T	0.48958	-0.8988	10	0.11794	T	0.64	.	1.9441	0.03353	0.1238:0.2263:0.3731:0.2768	.	28;9;28	Q8WZ67;Q1HEA1;P26718	.;.;NKG2D_HUMAN	N	28	ENSP00000240618:S28N;ENSP00000446003:S28N	ENSP00000240618:S28N	S	-	2	0	KLRK1	10430834	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.256000	0.00538	-1.778000	0.01282	-1.161000	0.01788	AGT	.		0.363	KLRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400269.1	NM_007360	
STK38L	23012	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	27468238	27468238	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr12:27468238C>A	ENST00000389032.3	+	9	961	c.792C>A	c.(790-792)aaC>aaA	p.N264K	STK38L_ENST00000539577.1_Missense_Mutation_p.N171K	NM_015000.3	NP_055815.1			serine/threonine kinase 38 like											breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)|skin(1)	12	Colorectal(261;0.0847)					AGAACATGAACTCAAAGAGGA	0.348																																					p.N264K		.											.	STK38L-980	0			c.C792A						.						65.0	70.0	69.0					12																	27468238		2203	4300	6503	SO:0001583	missense	23012	exon9			CATGAACTCAAAG	AB023182	CCDS31761.1	12p11.23	2014-04-23			ENSG00000211455	ENSG00000211455			17848	protein-coding gene	gene with protein product	"""nuclear Dbf2-related 2"""	615836				16488889	Standard	NM_015000		Approved	KIAA0965, NDR2	uc001rhr.3	Q9Y2H1	OTTHUMG00000169284	ENST00000389032.3:c.792C>A	12.37:g.27468238C>A	ENSP00000373684:p.Asn264Lys	Somatic	115	1		WXS	Illumina HiSeq	Phase_I	116	29	NM_015000	0	0	13	17	4		Missense_Mutation	SNP	ENST00000389032.3	37	CCDS31761.1	.	.	.	.	.	.	.	.	.	.	C	15.85	2.955368	0.53293	.	.	ENSG00000211455	ENST00000389032;ENST00000539577	T;T	0.58358	0.34;0.41	4.5	-0.848	0.10727	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.46502	0.1396	L	0.37800	1.135	0.58432	D	0.999996	P;P	0.37276	0.589;0.589	P;B	0.46208	0.507;0.405	T	0.35226	-0.9797	10	0.48119	T	0.1	.	9.8271	0.40919	0.0:0.5362:0.0:0.4638	.	171;264	B4E3J8;Q9Y2H1	.;ST38L_HUMAN	K	264;171	ENSP00000373684:N264K;ENSP00000446386:N171K	ENSP00000373684:N264K	N	+	3	2	STK38L	27359505	1.000000	0.71417	0.991000	0.47740	0.990000	0.78478	1.582000	0.36568	-0.260000	0.09418	-0.229000	0.12294	AAC	.		0.348	STK38L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403297.1	NM_015000	
KRT18	3875	broad.mit.edu	37	12	53344644	53344644	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr12:53344644A>G	ENST00000388835.3	+	3	821	c.611A>G	c.(610-612)gAg>gGg	p.E204G	AC107016.2_ENST00000581256.1_RNA|KRT18_ENST00000550600.1_Missense_Mutation_p.E204G|KRT18_ENST00000388837.2_Missense_Mutation_p.E204G|KRT8_ENST00000552551.1_5'Flank|KRT8_ENST00000546897.1_5'Flank|KRT8_ENST00000549198.1_5'Flank	NM_000224.2	NP_000215.1	P05783	K1C18_HUMAN	keratin 18	204	Coil 1B.|Necessary for interaction with PNN.|Rod.				anatomical structure morphogenesis (GO:0009653)|cell cycle (GO:0007049)|extrinsic apoptotic signaling pathway (GO:0097191)|Golgi to plasma membrane CFTR protein transport (GO:0043000)|hepatocyte apoptotic process (GO:0097284)|intermediate filament cytoskeleton organization (GO:0045104)|negative regulation of apoptotic process (GO:0043066)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|viral process (GO:0016032)	cell periphery (GO:0071944)|centriolar satellite (GO:0034451)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|scaffold protein binding (GO:0097110)|structural molecule activity (GO:0005198)			central_nervous_system(1)|large_intestine(2)|lung(4)|prostate(3)|skin(1)	11						ACAGAGATCGAGGCTCTCAAG	0.577																																					p.E204G													.	KRT18-91	0			c.A611G						.						20.0	16.0	17.0					12																	53344644		2203	4300	6503	SO:0001583	missense	3875	exon3			AGATCGAGGCTCT		CCDS31809.1	12q13	2013-01-16			ENSG00000111057	ENSG00000111057		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6430	protein-coding gene	gene with protein product		148070				1705144, 16831889	Standard	NM_000224		Approved		uc001sbg.3	P05783	OTTHUMG00000169882	ENST00000388835.3:c.611A>G	12.37:g.53344644A>G	ENSP00000373487:p.Glu204Gly	Somatic	30	0		WXS	Illumina HiSeq	Phase_I	18	4	NM_000224	1	2	679	1446	764	Q53G38|Q5U0N8|Q9BW26	Missense_Mutation	SNP	ENST00000388835.3	37	CCDS31809.1	.	.	.	.	.	.	.	.	.	.	a	23.8	4.456730	0.84317	.	.	ENSG00000111057	ENST00000388837;ENST00000550600;ENST00000388835	D;D;D	0.91351	-2.83;-2.83;-2.83	3.85	3.85	0.44370	Filament (1);	0.000000	0.64402	D	0.000013	D	0.95642	0.8583	M	0.92555	3.32	0.58432	D	0.999999	D;D	0.61697	0.99;0.984	D;D	0.68192	0.927;0.956	D	0.96030	0.9016	10	0.87932	D	0	.	11.2377	0.48951	1.0:0.0:0.0:0.0	.	204;204	F8VZY9;P05783	.;K1C18_HUMAN	G	204	ENSP00000373489:E204G;ENSP00000447278:E204G;ENSP00000373487:E204G	ENSP00000373487:E204G	E	+	2	0	KRT18	51630911	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.068000	0.93961	1.964000	0.57103	0.459000	0.35465	GAG	.		0.577	KRT18-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406405.1	NM_199187	
KRR1	11103	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	75895546	75895546	+	Silent	SNP	T	T	C			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr12:75895546T>C	ENST00000229214.4	-	9	983	c.960A>G	c.(958-960)gcA>gcG	p.A320A	GLIPR1_ENST00000266659.3_3'UTR|KRR1_ENST00000438169.2_Silent_p.A263A	NM_007043.6	NP_008974.5	Q13601	KRR1_HUMAN	KRR1, small subunit (SSU) processome component, homolog (yeast)	320	Lys-rich.				rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(1)|ovary(1)|pancreas(1)|urinary_tract(1)	11						GTGGAATAAATGCTTTGTTTC	0.279																																					p.A320A		.											.	KRR1-92	0			c.A960G						.						125.0	123.0	124.0					12																	75895546		2203	4299	6502	SO:0001819	synonymous_variant	11103	exon9			AATAAATGCTTTG	U55766	CCDS9012.1	12q	2011-03-15	2006-05-18	2006-05-18	ENSG00000111615	ENSG00000111615			5176	protein-coding gene	gene with protein product		612817	"""HIV-1 rev binding protein 2"", ""HIV-1 Rev binding protein 2"""	HRB2		7505766, 11027267, 11359931, 8675026	Standard	NM_007043		Approved	RIP-1	uc001sxt.3	Q13601	OTTHUMG00000169759	ENST00000229214.4:c.960A>G	12.37:g.75895546T>C		Somatic	87	0		WXS	Illumina HiSeq	Phase_I	73	21	NM_007043	0	0	18	22	4	A0FIK6|A0JLP0|B2R989|E7EUQ0|Q8NEA8|Q8TC37|Q96AT5	Silent	SNP	ENST00000229214.4	37	CCDS9012.1																																																																																			.		0.279	KRR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405727.1	NM_007043	
ACACB	32	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	109692084	109692084	+	Silent	SNP	C	C	T			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr12:109692084C>T	ENST00000338432.7	+	44	6230	c.6111C>T	c.(6109-6111)ctC>ctT	p.L2037L	ACACB_ENST00000543201.1_Silent_p.L703L|ACACB_ENST00000377854.5_Silent_p.L1967L|ACACB_ENST00000377848.3_Silent_p.L2037L			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	2037	Carboxyltransferase.				acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	TTGAATTCCTCCCATCCAGAG	0.488																																					p.L2037L		.											.	ACACB-98	0			c.C6111T						.						206.0	202.0	203.0					12																	109692084		2203	4300	6503	SO:0001819	synonymous_variant	32	exon43			ATTCCTCCCATCC	U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.6111C>T	12.37:g.109692084C>T		Somatic	321	0		WXS	Illumina HiSeq	Phase_I	240	95	NM_001093	0	0	8	12	4	A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Silent	SNP	ENST00000338432.7	37	CCDS31898.1																																																																																			.		0.488	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403077.1	NM_001093	
EXOC5	10640	ucsc.edu	37	14	57684753	57684753	+	Silent	SNP	C	C	T			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr14:57684753C>T	ENST00000413566.2	-	15	1919	c.1560G>A	c.(1558-1560)aaG>aaA	p.K520K	EXOC5_ENST00000340918.7_Silent_p.K455K	NM_006544.3	NP_006535.1	O00471	EXOC5_HUMAN	exocyst complex component 5	520					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|vesicle docking (GO:0048278)	cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(3)|endometrium(1)|large_intestine(3)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	22						TTTCTTTTTTCTTCTGAAGGC	0.259																																					p.K520K													.	EXOC5-137	0			c.G1560A						.						67.0	69.0	68.0					14																	57684753		1785	4055	5840	SO:0001819	synonymous_variant	10640	exon15			TTTTTTCTTCTGA	U85946	CCDS45111.1	14q22.3	2013-01-22	2005-11-01	2005-11-01	ENSG00000070367	ENSG00000070367			10696	protein-coding gene	gene with protein product		604469	"""SEC10 (S. cerevisiae)-like 1"", ""SEC10-like 1 (S. cerevisiae)"""	SEC10L1		9119050	Standard	XM_005267272		Approved	SEC10, SEC10P	uc001xct.3	O00471	OTTHUMG00000171309	ENST00000413566.2:c.1560G>A	14.37:g.57684753C>T		Somatic	96	0		WXS	Illumina HiSeq		71	1	NM_006544	0	0	14	16	2	B2R6C5	Silent	SNP	ENST00000413566.2	37	CCDS45111.1																																																																																			.		0.259	EXOC5-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412905.1	NM_006544	
CDAN1	146059	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	43024004	43024004	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr15:43024004C>T	ENST00000356231.3	-	11	1576	c.1553G>A	c.(1552-1554)gGt>gAt	p.G518D		NM_138477.2	NP_612486.2	Q8IWY9	CDAN1_HUMAN	codanin 1	518					chromatin assembly (GO:0031497)|chromatin organization (GO:0006325)|negative regulation of DNA replication (GO:0008156)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|endomembrane system (GO:0012505)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(3)	24		all_cancers(109;5.4e-16)|all_epithelial(112;2.97e-14)|Lung NSC(122;1.75e-08)|all_lung(180;5.99e-08)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;2.49e-07)		GCCCCCAGCACCACCAGGGCT	0.532																																					p.G518D		.											.	CDAN1-92	0			c.G1553A						.						34.0	38.0	36.0					15																	43024004		2203	4299	6502	SO:0001583	missense	146059	exon11			CCAGCACCACCAG	AF525398	CCDS32209.1	15q15.2	2012-04-25	2012-04-25			ENSG00000140326			1713	protein-coding gene	gene with protein product		607465	"""congenital dyserythropoietic anemia, type I"""			8634422, 12434312	Standard	XM_005254177		Approved	CDA-I, CDAI	uc001zql.3	Q8IWY9		ENST00000356231.3:c.1553G>A	15.37:g.43024004C>T	ENSP00000348564:p.Gly518Asp	Somatic	80	0		WXS	Illumina HiSeq	Phase_I	94	26	NM_138477	0	0	2	2	0	Q6NYD0|Q7Z7L5|Q969N3	Missense_Mutation	SNP	ENST00000356231.3	37	CCDS32209.1	.	.	.	.	.	.	.	.	.	.	c	17.73	3.462735	0.63513	.	.	ENSG00000140326	ENST00000356231;ENST00000267892	D	0.86694	-2.16	5.85	4.9	0.64082	.	0.352932	0.32785	N	0.005652	D	0.88526	0.6460	L	0.41236	1.265	0.37581	D	0.919811	D	0.63046	0.992	P	0.57101	0.813	D	0.89548	0.3797	10	0.46703	T	0.11	-7.4334	16.3622	0.83271	0.1325:0.8675:0.0:0.0	.	518	Q8IWY9	CDAN1_HUMAN	D	518;516	ENSP00000348564:G518D	ENSP00000267892:G516D	G	-	2	0	CDAN1	40811296	0.601000	0.26907	0.996000	0.52242	0.629000	0.37895	3.677000	0.54619	2.773000	0.95371	0.651000	0.88453	GGT	.		0.532	CDAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000431103.1	XM_085300	
PSTPIP1	9051	hgsc.bcm.edu	37	15	77328195	77328195	+	Silent	SNP	A	A	G			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr15:77328195A>G	ENST00000558012.1	+	14	1527	c.1038A>G	c.(1036-1038)acA>acG	p.T346T	PSTPIP1_ENST00000559295.1_Silent_p.T327T|PSTPIP1_ENST00000557995.1_3'UTR|PSTPIP1_ENST00000379595.3_Silent_p.T343T|PSTPIP1_ENST00000267939.5_Silent_p.T326T	NM_003978.3	NP_003969.2	O43586	PPIP1_HUMAN	proline-serine-threonine phosphatase interacting protein 1	346					cell adhesion (GO:0007155)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|signal transduction (GO:0007165)	actomyosin contractile ring (GO:0005826)|cell projection (GO:0042995)|cleavage furrow (GO:0032154)|cytosol (GO:0005829)|membrane (GO:0016020)|stress fiber (GO:0001725)				breast(1)|endometrium(3)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)	9						GTGTCTACACAGCCATCGCAG	0.617																																					p.T346T		.											.	PSTPIP1-23	0			c.A1038G						.						36.0	43.0	41.0					15																	77328195		1972	4126	6098	SO:0001819	synonymous_variant	9051	exon14			CTACACAGCCATC	U94778	CCDS45312.1	15q24.3	2014-09-17			ENSG00000140368	ENSG00000140368			9580	protein-coding gene	gene with protein product	"""CD2 cytoplasmic tail-binding protein"", ""CD2 antigen-binding protein 1"", ""PEST phosphatase-interacting protein 1"""	606347				9857189	Standard	NM_003978		Approved	PSTPIP, CD2BP1L, CD2BP1, CD2BP1S, H-PIP, PAPAS	uc002bcf.2	O43586	OTTHUMG00000172594	ENST00000558012.1:c.1038A>G	15.37:g.77328195A>G		Somatic	60	0		WXS	Illumina HiSeq	Phase_I	32	3	NM_003978	0	0	10	10	0	B5BU74|B5BUK4|O43585|O95657	Silent	SNP	ENST00000558012.1	37	CCDS45312.1																																																																																			.		0.617	PSTPIP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000419373.2	NM_003978	
TSC2	7249	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	2138135	2138135	+	Missense_Mutation	SNP	G	G	A	rs137854164|rs137854321|rs201206500		TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr16:2138135G>A	ENST00000219476.3	+	40	5785	c.5155G>A	c.(5155-5157)Gca>Aca	p.A1719T	TSC2_ENST00000439673.2_Missense_Mutation_p.A1616T|MIR1225_ENST00000408729.1_RNA|TSC2_ENST00000350773.4_Missense_Mutation_p.A1696T|TSC2_ENST00000401874.2_Missense_Mutation_p.A1652T|TSC2_ENST00000568454.1_Missense_Mutation_p.A1663T|TSC2_ENST00000353929.4_Missense_Mutation_p.A1676T|TSC2_ENST00000382538.6_Missense_Mutation_p.A1604T	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2	1719	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				GGCCCTGCACGCAAATGTGAG	0.652			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis				G|||	1	0.000199681	0.0	0.0	5008	,	,		16634	0.0		0.001	False		,,,				2504	0.0				p.A1719T		.	yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	.	TSC2-1908	0			c.G5155A						.						81.0	79.0	80.0					16																	2138135		2198	4299	6497	SO:0001583	missense	7249	exon40	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	CTGCACGCAAATG	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.5155G>A	16.37:g.2138135G>A	ENSP00000219476:p.Ala1719Thr	Somatic	160	1		WXS	Illumina HiSeq	Phase_I	121	41	NM_000548	0	0	0	0	0	A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Missense_Mutation	SNP	ENST00000219476.3	37	CCDS10458.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	17.57	3.423704	0.62733	.	.	ENSG00000103197	ENST00000219476;ENST00000401874;ENST00000353929;ENST00000439673;ENST00000382538;ENST00000350773	D;D;D;D;D	0.96554	-4.05;-4.05;-4.05;-4.05;-4.05	4.51	4.51	0.55191	Rap/ran-GAP (2);	0.295757	0.31301	N	0.007885	D	0.97244	0.9099	M	0.90705	3.14	0.58432	D	0.999999	P;P;P;P;P;P;P	0.49635	0.697;0.878;0.797;0.926;0.648;0.648;0.882	P;P;P;P;B;B;P	0.50231	0.547;0.503;0.572;0.635;0.412;0.412;0.478	D	0.97347	0.9961	10	0.54805	T	0.06	-4.9954	12.3699	0.55250	0.0:0.0:0.8315:0.1685	.	1604;1616;1696;494;1675;1652;1719	B4DIL8;P49815-6;P49815-4;B3KSR9;P49815-3;P49815-5;P49815	.;.;.;.;.;.;TSC2_HUMAN	T	1719;1653;1676;1616;1604;1696	ENSP00000219476:A1719T;ENSP00000248099:A1676T;ENSP00000399232:A1616T;ENSP00000371978:A1604T;ENSP00000344383:A1696T	ENSP00000219476:A1719T	A	+	1	0	TSC2	2078136	1.000000	0.71417	0.990000	0.47175	0.076000	0.17211	7.766000	0.85320	2.065000	0.61736	0.313000	0.20887	GCA	G|1.000;A|0.000		0.652	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250657.2	NM_000548	
MGRN1	23295	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	4731570	4731570	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr16:4731570C>A	ENST00000399577.5	+	13	1244	c.1151C>A	c.(1150-1152)cCt>cAt	p.P384H	MGRN1_ENST00000262370.7_Missense_Mutation_p.P384H|MGRN1_ENST00000586183.1_Missense_Mutation_p.P362H|MGRN1_ENST00000415496.1_Missense_Mutation_p.P363H|MGRN1_ENST00000588994.1_Missense_Mutation_p.P362H	NM_001142290.2	NP_001135762.1	O60291	MGRN1_HUMAN	mahogunin ring finger 1, E3 ubiquitin protein ligase	384					endosome to lysosome transport (GO:0008333)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	18						AGCGTCCCACCTGGCTACGAG	0.637																																					p.P384H		.											.	MGRN1-92	0			c.C1151A						.						35.0	41.0	39.0					16																	4731570		2113	4219	6332	SO:0001583	missense	23295	exon13			TCCCACCTGGCTA	AB011116	CCDS42115.1, CCDS45401.1, CCDS45402.1, CCDS45401.2, CCDS59256.1	16p13	2012-02-23	2012-02-23					"""RING-type (C3HC4) zinc fingers"""	20254	protein-coding gene	gene with protein product		607559	"""mahogunin, ring finger 1"""			9628581	Standard	NM_015246		Approved	KIAA0544, RNF156	uc002cxa.3	O60291		ENST00000399577.5:c.1151C>A	16.37:g.4731570C>A	ENSP00000382487:p.Pro384His	Somatic	94	1		WXS	Illumina HiSeq	Phase_I	83	24	NM_015246	0	0	53	104	51	A4URL3|A4URL4|Q86W76	Missense_Mutation	SNP	ENST00000399577.5	37	CCDS45402.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.211518	0.79240	.	.	ENSG00000102858	ENST00000262370;ENST00000399577;ENST00000415496	T;T;T	0.46451	0.87;0.94;1.18	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.59473	0.2196	L	0.52011	1.625	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.997;0.993;0.998;0.999	T	0.61836	-0.6981	10	0.87932	D	0	-15.6411	15.5901	0.76521	0.0:1.0:0.0:0.0	.	362;362;363;384;384	O60291-4;O60291-3;E9PB19;O60291-2;O60291	.;.;.;.;MGRN1_HUMAN	H	384;384;363	ENSP00000262370:P384H;ENSP00000382487:P384H;ENSP00000393311:P363H	ENSP00000262370:P384H	P	+	2	0	MGRN1	4671571	0.998000	0.40836	0.943000	0.38184	0.715000	0.41141	5.746000	0.68681	2.456000	0.83038	0.561000	0.74099	CCT	.		0.637	MGRN1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000432060.2		
PDXDC1	23042	ucsc.edu;bcgsc.ca	37	16	15130101	15130101	+	Nonsense_Mutation	SNP	C	C	A			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr16:15130101C>A	ENST00000396410.4	+	23	2433	c.2336C>A	c.(2335-2337)tCa>tAa	p.S779*	PDXDC1_ENST00000563679.1_Nonsense_Mutation_p.S797*|PDXDC1_ENST00000325823.7_Nonsense_Mutation_p.S764*|PDXDC1_ENST00000569715.1_Nonsense_Mutation_p.S752*|PDXDC1_ENST00000535621.2_Intron|PDXDC1_ENST00000450288.2_Nonsense_Mutation_p.S751*|PDXDC1_ENST00000447912.2_Nonsense_Mutation_p.S688*	NM_015027.2	NP_055842.2	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain containing 1	779					carboxylic acid metabolic process (GO:0019752)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)	carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(10)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GATGACCACTCACAGGTAGAA	0.537																																					p.S779X													.	PDXDC1-91	0			c.C2336A						.						142.0	147.0	146.0					16																	15130101		2197	4300	6497	SO:0001587	stop_gained	23042	exon23			ACCACTCACAGGT	AK025504, BX647809	CCDS32393.1, CCDS66954.1, CCDS66957.1, CCDS73830.1, CCDS73831.1	16p13.11	2008-02-05							28995	protein-coding gene	gene with protein product		614244					Standard	XM_005255173		Approved	KIAA0251	uc002dda.4	Q6P996	OTTHUMG00000166304	ENST00000396410.4:c.2336C>A	16.37:g.15130101C>A	ENSP00000379691:p.Ser779*	Somatic	241	2		WXS	Illumina HiSeq		167	49	NM_015027	0	0	43	102	59	B4DR55|B4DSL3|E7EMH5|E7EPL4|H3BNZ1|O00236|Q4F6X7|Q6PID7|Q86YF1|Q8N4Q9|Q8TBS5	Nonsense_Mutation	SNP	ENST00000396410.4	37	CCDS32393.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.482807	0.84747	.	.	ENSG00000179889	ENST00000325823;ENST00000447912;ENST00000396410;ENST00000450288	.	.	.	5.17	5.17	0.71159	.	0.745129	0.13527	N	0.381244	.	.	.	.	.	.	0.46701	D	0.999161	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	-0.0189	17.8527	0.88752	0.0:1.0:0.0:0.0	.	.	.	.	X	764;688;779;751	.	ENSP00000322807:S764X	S	+	2	0	PDXDC1	15037602	0.001000	0.12720	0.721000	0.30653	0.095000	0.18619	1.280000	0.33202	2.683000	0.91414	0.655000	0.94253	TCA	.		0.537	PDXDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389065.2	NM_015027	
STARD3	10948	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	37817259	37817259	+	Nonsense_Mutation	SNP	G	G	T			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr17:37817259G>T	ENST00000336308.5	+	13	1278	c.1060G>T	c.(1060-1062)Gag>Tag	p.E354*	STARD3_ENST00000544210.2_Nonsense_Mutation_p.E354*|STARD3_ENST00000580611.1_Nonsense_Mutation_p.E328*|STARD3_ENST00000394250.4_Nonsense_Mutation_p.E336*	NM_001165937.1|NM_006804.3	NP_001159409.1|NP_006795.3	Q14849	STAR3_HUMAN	StAR-related lipid transfer (START) domain containing 3	354	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|mitochondrial transport (GO:0006839)|progesterone biosynthetic process (GO:0006701)|steroid metabolic process (GO:0008202)	cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)	cholesterol binding (GO:0015485)			endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|pancreas(1)|prostate(2)|stomach(1)	14	Lung NSC(9;1.15e-09)|all_lung(9;6.24e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|BRCA - Breast invasive adenocarcinoma(8;1.04e-44)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			CCGGCGCATTGAGCGGCGCAG	0.602																																					p.E354X		.											.	STARD3-90	0			c.G1060T						.						75.0	66.0	69.0					17																	37817259		2203	4300	6503	SO:0001587	stop_gained	10948	exon13			CGCATTGAGCGGC		CCDS11341.1, CCDS54117.1, CCDS54118.1	17q11-q12	2011-09-12	2007-08-16		ENSG00000131748	ENSG00000131748		"""StAR-related lipid transfer (START) domain containing"""	17579	protein-coding gene	gene with protein product		607048	"""START domain containing 3"""				Standard	NM_006804		Approved	es64, MLN64	uc002hsd.3	Q14849	OTTHUMG00000133213	ENST00000336308.5:c.1060G>T	17.37:g.37817259G>T	ENSP00000337446:p.Glu354*	Somatic	124	2		WXS	Illumina HiSeq	Phase_I	102	42	NM_006804	0	0	17	18	1	A8MXA4|B4DUY1|F5H0G2|Q53Y53|Q96HM9	Nonsense_Mutation	SNP	ENST00000336308.5	37	CCDS11341.1	.	.	.	.	.	.	.	.	.	.	G	39	7.324673	0.98214	.	.	ENSG00000131748	ENST00000336308;ENST00000544210;ENST00000394250	.	.	.	5.02	5.02	0.67125	.	0.107907	0.64402	D	0.000008	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	.	18.3139	0.90210	0.0:0.0:1.0:0.0	.	.	.	.	X	354;354;336	.	ENSP00000337446:E354X	E	+	1	0	STARD3	35070785	1.000000	0.71417	0.985000	0.45067	0.996000	0.88848	9.015000	0.93640	2.343000	0.79666	0.561000	0.74099	GAG	.		0.602	STARD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256933.1		
TMC8	147138	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	76133427	76133427	+	Silent	SNP	T	T	G			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr17:76133427T>G	ENST00000318430.5	+	10	1613	c.1239T>G	c.(1237-1239)gtT>gtG	p.V413V	TMC8_ENST00000589691.1_Silent_p.V190V	NM_152468.4	NP_689681.2	Q8IU68	TMC8_HUMAN	transmembrane channel-like 8	413					ion transport (GO:0006811)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|regulation of cell growth (GO:0001558)|regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902041)|zinc ion homeostasis (GO:0055069)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	receptor binding (GO:0005102)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	12			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)|OV - Ovarian serous cystadenocarcinoma(97;0.192)			GCTACAACGTTTGTGACTATC	0.587																																					p.V413V		.											.	TMC8-90	0			c.T1239G						.						129.0	116.0	120.0					17																	76133427		2203	4300	6503	SO:0001819	synonymous_variant	147138	exon10			CAACGTTTGTGAC	AY057380	CCDS32749.1	17q25.3	2014-09-17	2005-11-10	2005-11-10	ENSG00000167895	ENSG00000167895			20474	protein-coding gene	gene with protein product		605829	"""epidermodysplasia verruciformis 2"""	EVER2		12426567	Standard	NM_152468		Approved	EVIN2	uc002jup.2	Q8IU68		ENST00000318430.5:c.1239T>G	17.37:g.76133427T>G		Somatic	212	1		WXS	Illumina HiSeq	Phase_I	203	76	NM_152468	0	0	0	0	0	Q2YDC0|Q8IWU7|Q8N358|Q8NF04	Silent	SNP	ENST00000318430.5	37	CCDS32749.1																																																																																			.		0.587	TMC8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436900.3		
APC2	10297	hgsc.bcm.edu	37	19	1469819	1469819	+	Silent	SNP	G	G	C	rs556845921	byFrequency	TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr19:1469819G>C	ENST00000535453.1	+	14	8232	c.6519G>C	c.(6517-6519)acG>acC	p.T2173T	C19orf25_ENST00000588427.1_Intron|APC2_ENST00000238483.4_Silent_p.T1899T|APC2_ENST00000233607.2_Silent_p.T2173T			P02655	APOC2_HUMAN	adenomatosis polyposis coli 2	0					cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|chylomicron remnant clearance (GO:0034382)|chylomicron remodeling (GO:0034371)|high-density lipoprotein particle clearance (GO:0034384)|lipid catabolic process (GO:0016042)|lipoprotein metabolic process (GO:0042157)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cholesterol transport (GO:0032375)|negative regulation of lipid metabolic process (GO:0045833)|negative regulation of receptor-mediated endocytosis (GO:0048261)|negative regulation of very-low-density lipoprotein particle clearance (GO:0010916)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of phospholipid catabolic process (GO:0060697)|positive regulation of triglyceride catabolic process (GO:0010898)|positive regulation of very-low-density lipoprotein particle remodeling (GO:0010902)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)|triglyceride-rich lipoprotein particle remodeling (GO:0034370)|very-low-density lipoprotein particle remodeling (GO:0034372)	chylomicron (GO:0042627)|early endosome (GO:0005769)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate-density lipoprotein particle (GO:0034363)|low-density lipoprotein particle (GO:0034362)|spherical high-density lipoprotein particle (GO:0034366)|very-low-density lipoprotein particle (GO:0034361)	lipase inhibitor activity (GO:0055102)|lipid binding (GO:0008289)|lipoprotein lipase activator activity (GO:0060230)|phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|kidney(4)|large_intestine(2)|lung(5)|pancreas(1)|skin(2)	18		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGGCTCCACGCCCGAGGAcg	0.761													G|||	26	0.00519169	0.0166	0.0058	5008	,	,		8412	0.0		0.0	False		,,,				2504	0.0				p.T2173T		.											.	APC2-290	0			c.G6519C						.																																			SO:0001819	synonymous_variant	10297	exon15			CTCCACGCCCGAG		CCDS12068.1	19p13.3	2013-02-14			ENSG00000115266	ENSG00000115266		"""Armadillo repeat containing"""	24036	protein-coding gene	gene with protein product	"""adenomatous polyposis coli like"""	612034				9823329, 10021369	Standard	XM_005259475		Approved	APCL	uc002lsr.1	O95996		ENST00000535453.1:c.6519G>C	19.37:g.1469819G>C		Somatic	2	1		WXS	Illumina HiSeq	Phase_I	3	3	NM_005883	0	0	0	0	0	C0JYY4|Q9BS39|Q9UDE3|Q9UNK3	Silent	SNP	ENST00000535453.1	37	CCDS12068.1																																																																																			.		0.761	APC2-004	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449539.2	NM_005883	
RAB3D	9545	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	11447891	11447891	+	Missense_Mutation	SNP	T	T	A			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr19:11447891T>A	ENST00000222120.3	-	2	445	c.185A>T	c.(184-186)aAg>aTg	p.K62M	RAB3D_ENST00000589655.1_Missense_Mutation_p.K62M	NM_004283.3	NP_004274.1	O95716	RAB3D_HUMAN	RAB3D, member RAS oncogene family	62					exocytosis (GO:0006887)|GTP catabolic process (GO:0006184)|peptidyl-cysteine methylation (GO:0018125)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|transport vesicle (GO:0030133)|zymogen granule (GO:0042588)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(3)|ovary(2)	14						GTAGACGGTCTTGACCTTGAA	0.577																																					p.K62M		.											.	RAB3D-653	0			c.A185T						.						232.0	208.0	216.0					19																	11447891		2203	4300	6503	SO:0001583	missense	9545	exon2			ACGGTCTTGACCT	AF081353	CCDS12257.1	19p13.2	2012-10-02			ENSG00000105514	ENSG00000105514		"""RAB, member RAS oncogene"""	9779	protein-coding gene	gene with protein product	"""Rab3D upregulated with myeloid differentiation"", ""glioblastoma overexpressed"""	604350		GOV		10023084, 10072586	Standard	NM_004283		Approved	RAB16, D2-2, RAD3D	uc002mqx.3	O95716	OTTHUMG00000180835	ENST00000222120.3:c.185A>T	19.37:g.11447891T>A	ENSP00000222120:p.Lys62Met	Somatic	451	2		WXS	Illumina HiSeq	Phase_I	395	130	NM_004283	0	0	11	22	11		Missense_Mutation	SNP	ENST00000222120.3	37	CCDS12257.1	.	.	.	.	.	.	.	.	.	.	T	21.4	4.150596	0.78001	.	.	ENSG00000105514	ENST00000222120	T	0.79554	-1.28	4.46	3.43	0.39272	Small GTP-binding protein domain (1);	0.045218	0.85682	D	0.000000	D	0.91030	0.7178	H	0.94582	3.555	0.80722	D	1	D	0.76494	0.999	D	0.75484	0.986	D	0.91079	0.4898	10	0.87932	D	0	.	9.368	0.38237	0.0:0.088:0.0:0.912	.	62	O95716	RAB3D_HUMAN	M	62	ENSP00000222120:K62M	ENSP00000222120:K62M	K	-	2	0	RAB3D	11308891	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	7.805000	0.86005	0.847000	0.35167	0.482000	0.46254	AAG	.		0.577	RAB3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453211.1	NM_004283	
FOSL2	2355	ucsc.edu	37	2	28631654	28631654	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr2:28631654G>A	ENST00000264716.4	+	3	1246	c.383G>A	c.(382-384)cGc>cAc	p.R128H	FOSL2_ENST00000545753.1_Missense_Mutation_p.R89H|FOSL2_ENST00000460736.1_3'UTR|FOSL2_ENST00000379619.1_Missense_Mutation_p.R103H	NM_005253.3	NP_005244.1	P15408	FOSL2_HUMAN	FOS-like antigen 2	128	Basic motif. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				cell death (GO:0008219)|cellular response to hormone stimulus (GO:0032870)|female pregnancy (GO:0007565)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to mechanical stimulus (GO:0009612)|response to morphine (GO:0043278)|response to progesterone (GO:0032570)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(1)|large_intestine(3)|lung(1)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	14	Acute lymphoblastic leukemia(172;0.155)					GAGAAGCGTCGCATCCGGCGG	0.537																																					p.R128H													.	FOSL2-712	0			c.G383A						.						35.0	35.0	35.0					2																	28631654		2203	4300	6503	SO:0001583	missense	2355	exon3			AGCGTCGCATCCG		CCDS1766.1	2p23.3	2013-01-10			ENSG00000075426	ENSG00000075426		"""basic leucine zipper proteins"""	3798	protein-coding gene	gene with protein product		601575					Standard	NM_005253		Approved	FRA2, FLJ23306	uc002rma.3	P15408	OTTHUMG00000097832	ENST00000264716.4:c.383G>A	2.37:g.28631654G>A	ENSP00000264716:p.Arg128His	Somatic	47	0		WXS	Illumina HiSeq		42	4	NM_005253	0	0	251	251	0	B2RD58|B3KP27|B4DYV4|Q6FG46	Missense_Mutation	SNP	ENST00000264716.4	37	CCDS1766.1	.	.	.	.	.	.	.	.	.	.	G	36	5.689889	0.96784	.	.	ENSG00000075426	ENST00000379619;ENST00000264716;ENST00000436647;ENST00000545753	T;T;T;T	0.71934	-0.61;-0.61;-0.61;-0.61	5.45	5.45	0.79879	Basic-leucine zipper (bZIP) transcription factor (2);bZIP transcription factor, bZIP-1 (1);	0.000000	0.85682	D	0.000000	D	0.87334	0.6151	M	0.88570	2.965	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.89396	0.3692	10	0.87932	D	0	-12.7055	19.2653	0.93983	0.0:0.0:1.0:0.0	.	128	P15408	FOSL2_HUMAN	H	103;128;89;89	ENSP00000368939:R103H;ENSP00000264716:R128H;ENSP00000396497:R89H;ENSP00000439303:R89H	ENSP00000264716:R128H	R	+	2	0	FOSL2	28485158	1.000000	0.71417	0.994000	0.49952	0.968000	0.65278	9.790000	0.99075	2.554000	0.86153	0.655000	0.94253	CGC	.		0.537	FOSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215116.2	NM_005253	
NRXN1	9378	hgsc.bcm.edu	37	2	50574025	50574025	+	Intron	SNP	G	G	C			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr2:50574025G>C	ENST00000406316.2	-	18	4841				NRXN1_ENST00000401669.2_Intron|NRXN1_ENST00000406859.3_Intron|NRXN1_ENST00000331040.5_Intron|NRXN1_ENST00000404971.1_Intron|NRXN1_ENST00000402717.3_Intron|NRXN1_ENST00000405472.3_Intron|NRXN1_ENST00000342183.5_Silent_p.G21G|NRXN1_ENST00000401710.1_Intron	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1						adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			cgccgccgccgccgccgccgc	0.791																																					p.G21G		.											.	NRXN1-92	0			c.C63G						.						1.0	2.0	2.0					2																	50574025		764	1771	2535	SO:0001627	intron_variant	9378	exon1			GCCGCCGCCGCCG	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.3365-109917C>G	2.37:g.50574025G>C		Somatic	2	1		WXS	Illumina HiSeq	Phase_I	4	3	NM_138735	0	0	1	1	0	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Silent	SNP	ENST00000406316.2	37	CCDS54360.1																																																																																			.		0.791	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2		
CXCR1	3577	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	219029397	219029397	+	Missense_Mutation	SNP	G	G	C			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr2:219029397G>C	ENST00000295683.2	-	2	658	c.538C>G	c.(538-540)Cca>Gca	p.P180A		NM_000634.2	NP_000625.1	P25024	CXCR1_HUMAN	chemokine (C-X-C motif) receptor 1	180					cell surface receptor signaling pathway (GO:0007166)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|dendritic cell chemotaxis (GO:0002407)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|interleukin-8-mediated signaling pathway (GO:0038112)|receptor internalization (GO:0031623)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)|G-protein coupled receptor activity (GO:0004930)|interleukin-8 binding (GO:0019959)|interleukin-8 receptor activity (GO:0004918)			endometrium(1)|large_intestine(2)|lung(7)|prostate(3)	13					Ketoprofen(DB01009)	GAATTGTTTGGATGGTAAGCC	0.512																																					p.P180A		.											.	CXCR1-658	0			c.C538G						.						88.0	77.0	81.0					2																	219029397		2203	4300	6503	SO:0001583	missense	3577	exon2			TGTTTGGATGGTA	U11870	CCDS2409.1	2q35	2012-08-08	2009-11-25	2009-11-25	ENSG00000163464	ENSG00000163464		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"", ""Interleukins and interleukin receptors"""	6026	protein-coding gene	gene with protein product		146929	"""interleukin 8 receptor, alpha"""	CMKAR1, IL8RA		1303245, 1427896	Standard	NM_000634		Approved	CKR-1, CDw128a, CD181	uc002vhc.3	P25024	OTTHUMG00000133108	ENST00000295683.2:c.538C>G	2.37:g.219029397G>C	ENSP00000295683:p.Pro180Ala	Somatic	77	1		WXS	Illumina HiSeq	Phase_I	44	14	NM_000634	0	0	0	0	0	B2R6Q3|Q2YEF8|Q2YEG4|Q2YEG5|Q2YEG7|Q2YEG8|Q53R18|Q6IN95|Q8N6T6|Q9P2T8|Q9P2T9|Q9P2U0|Q9P2U1|Q9P2U2	Missense_Mutation	SNP	ENST00000295683.2	37	CCDS2409.1	.	.	.	.	.	.	.	.	.	.	G	0.035	-1.310146	0.01342	.	.	ENSG00000163464	ENST00000295683;ENST00000421691	T	0.38077	1.16	4.71	2.87	0.33458	GPCR, rhodopsin-like superfamily (1);	0.779117	0.10221	N	0.700944	T	0.26122	0.0637	L	0.39245	1.2	0.09310	N	1	B	0.06786	0.001	B	0.18263	0.021	T	0.29488	-1.0010	10	0.14656	T	0.56	.	6.0111	0.19575	0.1817:0.2623:0.556:0.0	.	180	P25024	CXCR1_HUMAN	A	180;124	ENSP00000295683:P180A	ENSP00000295683:P180A	P	-	1	0	CXCR1	218737642	0.000000	0.05858	0.004000	0.12327	0.003000	0.03518	-0.300000	0.08243	1.109000	0.41680	0.655000	0.94253	CCA	.		0.512	CXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256773.2	NM_000634	
CXCR1	3577	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	219029403	219029403	+	Missense_Mutation	SNP	A	A	T			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr2:219029403A>T	ENST00000295683.2	-	2	652	c.532T>A	c.(532-534)Tac>Aac	p.Y178N		NM_000634.2	NP_000625.1	P25024	CXCR1_HUMAN	chemokine (C-X-C motif) receptor 1	178					cell surface receptor signaling pathway (GO:0007166)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|dendritic cell chemotaxis (GO:0002407)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|interleukin-8-mediated signaling pathway (GO:0038112)|receptor internalization (GO:0031623)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)|G-protein coupled receptor activity (GO:0004930)|interleukin-8 binding (GO:0019959)|interleukin-8 receptor activity (GO:0004918)			endometrium(1)|large_intestine(2)|lung(7)|prostate(3)	13					Ketoprofen(DB01009)	TTTGGATGGTAAGCCTGGCGG	0.512																																					p.Y178N													.	CXCR1-658	0			c.T532A						.						89.0	78.0	82.0					2																	219029403		2203	4300	6503	SO:0001583	missense	3577	exon2			GATGGTAAGCCTG	U11870	CCDS2409.1	2q35	2012-08-08	2009-11-25	2009-11-25	ENSG00000163464	ENSG00000163464		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"", ""Interleukins and interleukin receptors"""	6026	protein-coding gene	gene with protein product		146929	"""interleukin 8 receptor, alpha"""	CMKAR1, IL8RA		1303245, 1427896	Standard	NM_000634		Approved	CKR-1, CDw128a, CD181	uc002vhc.3	P25024	OTTHUMG00000133108	ENST00000295683.2:c.532T>A	2.37:g.219029403A>T	ENSP00000295683:p.Tyr178Asn	Somatic	63	1		WXS	Illumina HiSeq	Phase_I	36	13	NM_000634	0	0	0	0	0	B2R6Q3|Q2YEF8|Q2YEG4|Q2YEG5|Q2YEG7|Q2YEG8|Q53R18|Q6IN95|Q8N6T6|Q9P2T8|Q9P2T9|Q9P2U0|Q9P2U1|Q9P2U2	Missense_Mutation	SNP	ENST00000295683.2	37	CCDS2409.1	.	.	.	.	.	.	.	.	.	.	A	9.226	1.034501	0.19590	.	.	ENSG00000163464	ENST00000295683;ENST00000421691	T	0.70986	-0.53	4.71	0.229	0.15368	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.55065	0.1897	L	0.33245	0.995	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.46205	-0.9208	9	0.62326	D	0.03	.	5.2232	0.15379	0.433:0.0:0.0791:0.4878	.	178	P25024	CXCR1_HUMAN	N	178;122	ENSP00000295683:Y178N	ENSP00000295683:Y178N	Y	-	1	0	CXCR1	218737648	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.010000	0.13242	-0.169000	0.10834	-0.333000	0.08304	TAC	.		0.512	CXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256773.2	NM_000634	
PTPRA	5786	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	3016489	3016489	+	Silent	SNP	G	G	T			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr20:3016489G>T	ENST00000216877.6	+	21	2473	c.2073G>T	c.(2071-2073)gtG>gtT	p.V691V	PTPRA_ENST00000318266.5_Silent_p.V691V|PTPRA_ENST00000356147.3_Silent_p.V691V|PTPRA_ENST00000380393.3_Silent_p.V700V|PTPRA_ENST00000425918.2_Silent_p.V711V|PTPRA_ENST00000399903.2_Silent_p.V700V|PTPRA_ENST00000358719.4_Silent_p.V556V	NM_080840.2	NP_543030.1	P18433	PTPRA_HUMAN	protein tyrosine phosphatase, receptor type, A	700	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axon guidance (GO:0007411)|insulin receptor signaling pathway (GO:0008286)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein phosphorylation (GO:0006468)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(1)|endometrium(3)|large_intestine(3)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						GGCCTGAAGTGGGCATCCCCA	0.587																																					p.V700V		.											.	PTPRA-227	0			c.G2100T						.						78.0	73.0	74.0					20																	3016489		2203	4300	6503	SO:0001819	synonymous_variant	5786	exon26			TGAAGTGGGCATC		CCDS13038.1, CCDS13039.1	20p13	2011-06-09			ENSG00000132670	ENSG00000132670		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9664	protein-coding gene	gene with protein product		176884		PTPRL2, PTPA		2172030, 2169617	Standard	NM_080840		Approved	LRP, HLPR, HPTPA, RPTPA	uc002whn.3	P18433	OTTHUMG00000031718	ENST00000216877.6:c.2073G>T	20.37:g.3016489G>T		Somatic	127	1		WXS	Illumina HiSeq	Phase_I	115	34	NM_002836	0	0	49	91	42	A8K2G8|D3DVX5|Q14513|Q7Z2I2|Q96TD9	Silent	SNP	ENST00000216877.6	37	CCDS13039.1																																																																																			.		0.587	PTPRA-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077682.3		
CST9L	128821	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	23548869	23548869	+	Silent	SNP	G	G	T			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr20:23548869G>T	ENST00000376979.3	-	1	517	c.219C>A	c.(217-219)atC>atA	p.I73I		NM_080610.2	NP_542177.1	Q9H4G1	CST9L_HUMAN	cystatin 9-like	73						extracellular region (GO:0005576)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			breast(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(1)	8	Colorectal(13;0.0431)|Lung NSC(19;0.235)					AGGAATTCAAGATGTGCCCCA	0.547																																					p.I73I		.											.	CST9L-90	0			c.C219A						.						155.0	122.0	133.0					20																	23548869		2203	4300	6503	SO:0001819	synonymous_variant	128821	exon1			ATTCAAGATGTGC		CCDS13157.1	20p11.21	2012-08-14	2008-03-06		ENSG00000101435	ENSG00000101435			16233	protein-coding gene	gene with protein product			"""cystatin 9 (mouse)-like"""			20565543	Standard	NM_080610		Approved	bA218C14.1, CTES7B	uc002wtk.4	Q9H4G1	OTTHUMG00000032073	ENST00000376979.3:c.219C>A	20.37:g.23548869G>T		Somatic	81	0		WXS	Illumina HiSeq	Phase_I	66	19	NM_080610	0	0	0	0	0	B2R5A1	Silent	SNP	ENST00000376979.3	37	CCDS13157.1																																																																																			.		0.547	CST9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078338.1	NM_080610	
PFKL	5211	broad.mit.edu	37	21	45741733	45741733	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr21:45741733G>A	ENST00000349048.4	+	13	1368	c.1313G>A	c.(1312-1314)gGc>gAc	p.G438D	PFKL_ENST00000403390.1_Missense_Mutation_p.G485D	NM_002626.4	NP_002617.3	P17858	PFKAL_HUMAN	phosphofructokinase, liver	438	C-terminal regulatory PFK domain 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 1,6-bisphosphate metabolic process (GO:0030388)|fructose 6-phosphate metabolic process (GO:0006002)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|negative regulation of insulin secretion (GO:0046676)|protein homotetramerization (GO:0051289)|protein oligomerization (GO:0051259)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	6-phosphofructokinase complex (GO:0005945)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	6-phosphofructokinase activity (GO:0003872)|ATP binding (GO:0005524)|fructose binding (GO:0070061)|fructose-6-phosphate binding (GO:0070095)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|metal ion binding (GO:0046872)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	23				Colorectal(79;0.0811)		GTGCACGATGGCTTCGAAGGC	0.642																																					p.G438D													.	PFKL-251	0			c.G1313A						.						93.0	92.0	92.0					21																	45741733		2202	4300	6502	SO:0001583	missense	5211	exon13			ACGATGGCTTCGA		CCDS33582.1	21q22.3	1992-12-17			ENSG00000141959	ENSG00000141959	2.7.1.11		8876	protein-coding gene	gene with protein product		171860					Standard	NR_024108		Approved		uc002zel.3	P17858	OTTHUMG00000086910	ENST00000349048.4:c.1313G>A	21.37:g.45741733G>A	ENSP00000269848:p.Gly438Asp	Somatic	199	0		WXS	Illumina HiSeq	Phase_I	163	6	NM_002626	0	0	181	186	5	Q96A64|Q96IH4|Q9BR91	Missense_Mutation	SNP	ENST00000349048.4	37	CCDS33582.1	.	.	.	.	.	.	.	.	.	.	G	19.09	3.760200	0.69763	.	.	ENSG00000141959	ENST00000349048;ENST00000534847;ENST00000403390	D;D	0.97994	-4.65;-4.65	4.3	4.3	0.51218	Phosphofructokinase domain (2);	0.000000	0.85682	D	0.000000	D	0.99321	0.9762	H	0.99261	4.49	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.98287	1.0511	10	0.87932	D	0	-31.7745	15.5438	0.76077	0.0:0.0:1.0:0.0	.	438;485	P17858;P17858-2	K6PL_HUMAN;.	D	438;231;485	ENSP00000269848:G438D;ENSP00000384038:G485D	ENSP00000269848:G438D	G	+	2	0	PFKL	44566161	1.000000	0.71417	0.993000	0.49108	0.160000	0.22226	9.380000	0.97202	1.912000	0.55364	0.462000	0.41574	GGC	.		0.642	PFKL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195805.1		
MKL1	57591	hgsc.bcm.edu	37	22	40804935	40804935	+	IGR	SNP	A	A	G			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr22:40804935A>G	ENST00000355630.3	-	0	4496				SGSM3_ENST00000248929.9_Splice_Site|SGSM3_ENST00000454798.2_Splice_Site	NM_020831.3	NP_065882.1	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia (translocation) 1						negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription via serum response element binding (GO:0010735)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	actin binding (GO:0003779)|actin monomer binding (GO:0003785)|leucine zipper domain binding (GO:0043522)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(13)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	30						TGCCGTTCCCAGGCTGTGCAG	0.597			T	RBM15	acute megakaryocytic leukemia																																.		.		Dom	yes		22	22q13	57591	megakaryoblastic leukemia (translocation) 1		L	.	SGSM3-494	0			c.1903-2A>G						.						36.0	36.0	36.0					22																	40804935		2203	4298	6501	SO:0001628	intergenic_variant	27352	exon19			GTTCCCAGGCTGT	AB037859	CCDS14003.1, CCDS74865.1, CCDS74866.1	22q13	2008-06-12			ENSG00000196588	ENSG00000196588			14334	protein-coding gene	gene with protein product	"""megakaryocytic acute leukemia"", ""myocardin-related transcription factor A"", ""basic, SAP and coiled-coil domain"""	606078				11431691, 12019265, 14970199	Standard	XM_005261692		Approved	KIAA1438, MAL, MRTF-A, BSAC	uc003ayw.1	Q969V6	OTTHUMG00000151146		22.37:g.40804935A>G		Somatic	42	1		WXS	Illumina HiSeq	Phase_I	30	2	NM_015705	0	0	0	0	0	Q8TCL1|Q96SC5|Q96SC6|Q9P2B0	Splice_Site	SNP	ENST00000355630.3	37	CCDS14003.1	.	.	.	.	.	.	.	.	.	.	A	15.44	2.834085	0.50951	.	.	ENSG00000100359	ENST00000248929;ENST00000454798;ENST00000427834;ENST00000417424	.	.	.	4.56	4.56	0.56223	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.2125	0.65773	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SGSM3	39134881	1.000000	0.71417	0.944000	0.38274	0.077000	0.17291	8.433000	0.90291	1.834000	0.53371	0.260000	0.18958	.	.		0.597	MKL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321522.1	NM_020831	
CTDSPL	10217	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	38009318	38009318	+	Splice_Site	SNP	C	C	G			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr3:38009318C>G	ENST00000273179.5	+	5	397	c.371C>G	c.(370-372)cCt>cGt	p.P124R	MIR26A1_ENST00000362205.1_RNA|CTDSPL_ENST00000310189.3_3'UTR|CTDSPL_ENST00000443503.2_Splice_Site_p.P113R	NM_001008392.1	NP_001008393.1	O15194	CTDSL_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like	124	FCP1 homology. {ECO:0000255|PROSITE- ProRule:PRU00336}.					extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			breast(1)|endometrium(2)|large_intestine(4)|skin(1)	8		Melanoma(1037;0.0122)		KIRC - Kidney renal clear cell carcinoma(284;0.0729)|Kidney(284;0.0902)		TTTCTCTAGCCTATTAGTAAT	0.308											OREG0015472	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P124R		.											.	CTDSPL-90	0			c.C371G						.						64.0	61.0	62.0					3																	38009318		2199	4299	6498	SO:0001630	splice_region_variant	10217	exon5			TCTAGCCTATTAG	D88153	CCDS33734.1, CCDS33735.1	3p21.3	2010-06-21	2003-10-27	2003-10-29	ENSG00000144677	ENSG00000144677	3.1.3.16	"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	16890	protein-coding gene	gene with protein product	"""small CTD phosphatase 3"", ""HYA22 protein"", ""RB protein serine phosphatase from chromosome 3"""	608592	"""chromosome 3 open reading frame 8"""	C3orf8		9179494, 12543795	Standard	NM_005808		Approved	HYA22, SCP3, PSR1, RBSP3	uc003chg.3	O15194	OTTHUMG00000155942	ENST00000273179.5:c.370-1C>G	3.37:g.38009318C>G		Somatic	63	0	874	WXS	Illumina HiSeq	Phase_I	54	13	NM_001008392	0	0	0	0	0	Q3ZTU0|Q70KI4|Q7Z5Q2	Missense_Mutation	SNP	ENST00000273179.5	37	CCDS33734.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.625293	0.87560	.	.	ENSG00000144677	ENST00000443503;ENST00000273179;ENST00000447745	T;T;T	0.17213	2.29;2.29;2.29	5.15	5.15	0.70609	NLI interacting factor (3);Dullard phosphatase domain, eukaryotic (1);HAD-like domain (2);	0.049311	0.85682	D	0.000000	T	0.46756	0.1409	M	0.79926	2.475	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.992;0.995	T	0.49133	-0.8971	10	0.62326	D	0.03	-20.9054	19.0018	0.92837	0.0:1.0:0.0:0.0	.	113;124	O15194-2;O15194	.;CTDSL_HUMAN	R	113;124;13	ENSP00000398288:P113R;ENSP00000273179:P124R;ENSP00000407443:P13R	ENSP00000273179:P124R	P	+	2	0	CTDSPL	37984322	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.720000	0.84759	2.571000	0.86741	0.655000	0.94253	CCT	.		0.308	CTDSPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342392.1	NM_005808	Missense_Mutation
FYCO1	79443	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	46008824	46008824	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr3:46008824C>T	ENST00000296137.2	-	8	2207	c.2002G>A	c.(2002-2004)Gcc>Acc	p.A668T	FYCO1_ENST00000535325.1_Missense_Mutation_p.A668T	NM_024513.3	NP_078789.2	Q9BQS8	FYCO1_HUMAN	FYVE and coiled-coil domain containing 1	668					plus-end-directed vesicle transport along microtubule (GO:0072383)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)			NS(4)|breast(3)|central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(17)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	54				BRCA - Breast invasive adenocarcinoma(193;0.00147)|KIRC - Kidney renal clear cell carcinoma(197;0.0272)|Kidney(197;0.0323)		CGGATGCTGGCCTGCTCGGCC	0.632																																					p.A668T		.											.	FYCO1-91	0			c.G2002A						.						48.0	53.0	52.0					3																	46008824		2203	4299	6502	SO:0001583	missense	79443	exon8			TGCTGGCCTGCTC	AJ292348	CCDS2734.1	3p21.3	2008-02-05			ENSG00000163820	ENSG00000163820		"""Zinc fingers, FYVE domain containing"""	14673	protein-coding gene	gene with protein product		607182				11896456	Standard	NM_024513		Approved	FLJ13335, ZFYVE7	uc003cpb.5	Q9BQS8	OTTHUMG00000133447	ENST00000296137.2:c.2002G>A	3.37:g.46008824C>T	ENSP00000296137:p.Ala668Thr	Somatic	173	0		WXS	Illumina HiSeq	Phase_I	150	62	NM_024513	0	0	3	13	10	B7ZKT7|Q3MJE6|Q86T41|Q86TB1|Q8TEF9|Q96IV5|Q9H8P9	Missense_Mutation	SNP	ENST00000296137.2	37	CCDS2734.1	.	.	.	.	.	.	.	.	.	.	C	14.80	2.644029	0.47258	.	.	ENSG00000163820	ENST00000296137;ENST00000535325	T;T	0.21932	1.98;1.98	5.77	3.98	0.46160	.	0.365546	0.30492	N	0.009502	T	0.29355	0.0731	M	0.62723	1.935	0.25407	N	0.988398	D;D	0.60575	0.988;0.983	P;P	0.57204	0.815;0.766	T	0.12016	-1.0564	10	0.19147	T	0.46	-9.0348	5.1628	0.15070	0.0:0.5992:0.1506:0.2502	.	668;668	B7ZKT7;Q9BQS8	.;FYCO1_HUMAN	T	668	ENSP00000296137:A668T;ENSP00000441178:A668T	ENSP00000296137:A668T	A	-	1	0	FYCO1	45983828	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.289000	0.33307	0.786000	0.33708	0.655000	0.94253	GCC	.		0.632	FYCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257320.2	NM_024513	
IDUA	3425	hgsc.bcm.edu	37	4	980971	980971	+	Missense_Mutation	SNP	T	T	G	rs10794537	byFrequency	TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr4:980971T>G	ENST00000247933.4	+	1	187	c.99T>G	c.(97-99)caT>caG	p.H33Q	IDUA_ENST00000453894.1_Missense_Mutation_p.H33Q|SLC26A1_ENST00000398520.2_Intron	NM_000203.3	NP_000194.2	P35475	IDUA_HUMAN	iduronidase, alpha-L-	33			H -> Q (in dbSNP:rs10794537). {ECO:0000269|PubMed:1362562, ECO:0000269|PubMed:1505961, ECO:0000269|PubMed:1946389, ECO:0000269|PubMed:21394825}.		carbohydrate metabolic process (GO:0005975)|cell morphogenesis (GO:0000902)|chemical homeostasis (GO:0048878)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate catabolic process (GO:0030209)|disaccharide metabolic process (GO:0005984)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|limb morphogenesis (GO:0035108)|lysosome organization (GO:0007040)|skeletal system morphogenesis (GO:0048705)|small molecule metabolic process (GO:0044281)	coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	L-iduronidase activity (GO:0003940)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			ACCTGGTGCATGTGGACGCGG	0.801													G|||	4467	0.891973	0.9826	0.8386	5008	,	,		8604	0.8472		0.8042	False		,,,				2504	0.9438				p.H33Q		.											.	IDUA-91	0			c.T99G						.						1.0	1.0	1.0					4																	980971		552	1375	1927	SO:0001583	missense	3425	exon1			GGTGCATGTGGAC	M74715	CCDS3343.1	4p16.3	2012-10-02			ENSG00000127415	ENSG00000127415	3.2.1.76		5391	protein-coding gene	gene with protein product		252800				1832239	Standard	NM_000203		Approved	MPS1	uc003gby.3	P35475	OTTHUMG00000088901	ENST00000247933.4:c.99T>G	4.37:g.980971T>G	ENSP00000247933:p.His33Gln	Somatic	0	0		WXS	Illumina HiSeq	Phase_I	2	2	NM_000203	0	0	0	7	7	B3KWK6	Missense_Mutation	SNP	ENST00000247933.4	37	CCDS3343.1	1801|1801	0.8246336996336996|0.8246336996336996	464|464	0.943089430894309|0.943089430894309	294|294	0.8121546961325967|0.8121546961325967	448|448	0.7832167832167832|0.7832167832167832	595|595	0.7849604221635884|0.7849604221635884	G|G	3.726|3.726	-0.056533|-0.056533	0.07362|0.07362	.|.	.|.	ENSG00000127415|ENSG00000127415	ENST00000504568|ENST00000247933;ENST00000453894;ENST00000502910	.|D;D;D	.|0.93247	.|-3.18;-3.19;-3.03	3.62|3.62	-0.897|-0.897	0.10553|0.10553	.|.	.|0.728933	.|0.12190	.|N	.|0.491278	T|T	0.00012|0.00012	0.0000|0.0000	N|N	0.08118|0.08118	0|0	0.80722|0.80722	P|P	0.0|0.0	.|B;B	.|0.02656	.|0.0;0.0	.|B;B	.|0.01281	.|0.0;0.0	T|T	0.36817|0.36817	-0.9732|-0.9732	4|9	.|0.10111	.|T	.|0.7	.|.	1.2904|1.2904	0.02059|0.02059	0.1461:0.2669:0.3485:0.2385|0.1461:0.2669:0.3485:0.2385	rs10794537|rs10794537	.|33;33	.|B3KWK6;P35475	.|.;IDUA_HUMAN	G|Q	33|33	.|ENSP00000247933:H33Q;ENSP00000396458:H33Q;ENSP00000422952:H33Q	.|ENSP00000247933:H33Q	C|H	+|+	1|3	0|2	IDUA|IDUA	970971|970971	0.000000|0.000000	0.05858|0.05858	0.992000|0.992000	0.48379|0.48379	0.012000|0.012000	0.07955|0.07955	-2.547000|-2.547000	0.00931|0.00931	-0.253000|-0.253000	0.09514|0.09514	-1.482000|-1.482000	0.00985|0.00985	TGT|CAT	T|0.175;G|0.825		0.801	IDUA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000201812.1	NM_000203	
FNIP2	57600	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	159825696	159825696	+	Silent	SNP	A	A	G			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr4:159825696A>G	ENST00000264433.6	+	17	3420	c.3345A>G	c.(3343-3345)taA>taG	p.*1115*	C4orf45_ENST00000434826.2_Intron|FNIP2_ENST00000379346.3_Silent_p.*1138*|C4orf45_ENST00000508011.1_Intron	NM_020840.1	NP_065891.1	Q9P278	FNIP2_HUMAN	folliculin interacting protein 2	0					intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein phosphorylation (GO:0006468)|regulation of protein phosphorylation (GO:0001932)	cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	9	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.00936)		TACTCTTATAAGCTAAAGCTC	0.388																																					p.X1115X		.											.	FNIP2-68	0			c.A3345G						.						141.0	133.0	136.0					4																	159825696		1847	4095	5942	SO:0001819	synonymous_variant	57600	exon17			CTTATAAGCTAAA	AB040883	CCDS47155.1	4q32.1	2012-10-31			ENSG00000052795	ENSG00000052795			29280	protein-coding gene	gene with protein product	"""O6-methylguanine-induced apoptosis 1"""	612768				18403135	Standard	NM_020840		Approved	KIAA1450, FNIPL, MAPO1	uc003iqe.4	Q9P278	OTTHUMG00000161983	ENST00000264433.6:c.3345A>G	4.37:g.159825696A>G		Somatic	172	0		WXS	Illumina HiSeq	Phase_I	121	46	NM_020840	0	0	9	14	5	Q05DC3|Q96I31|Q9H994	Silent	SNP	ENST00000264433.6	37	CCDS47155.1																																																																																			.		0.388	FNIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366602.1	NM_020840	
SH3RF1	57630	hgsc.bcm.edu	37	4	170043337	170043337	+	Silent	SNP	A	A	G			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr4:170043337A>G	ENST00000284637.9	-	7	1601	c.1260T>C	c.(1258-1260)gcT>gcC	p.A420A	SH3RF1_ENST00000508685.1_5'UTR	NM_020870.3	NP_065921.2	Q7Z6J0	SH3R1_HUMAN	SH3 domain containing ring finger 1	420	Poly-Ala.				negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|protein ubiquitination (GO:0016567)|regulation of JNK cascade (GO:0046328)	cell projection (GO:0042995)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(10)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	31		Prostate(90;0.00267)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)		CAGCAGCAGCAGCGGCGGTGG	0.582																																					p.A420A		.											.	SH3RF1-567	0			c.T1260C						.						47.0	43.0	44.0					4																	170043337		2203	4300	6503	SO:0001819	synonymous_variant	57630	exon7			AGCAGCAGCGGCG	BC033203	CCDS34099.1	4q32.3	2013-01-09	2006-02-13	2006-02-13	ENSG00000154447	ENSG00000154447		"""RING-type (C3HC4) zinc fingers"""	17650	protein-coding gene	gene with protein product	"""plenty of SH3 domains"""		"""SH3 multiple domains 2"""	SH3MD2		9482736	Standard	NM_020870		Approved	POSH, RNF142, KIAA1494	uc003isa.1	Q7Z6J0	OTTHUMG00000161010	ENST00000284637.9:c.1260T>C	4.37:g.170043337A>G		Somatic	76	0		WXS	Illumina HiSeq	Phase_I	50	3	NM_020870	0	0	15	15	0	Q05BT2|Q8IW46|Q9HAM2|Q9P234	Silent	SNP	ENST00000284637.9	37	CCDS34099.1																																																																																			.		0.582	SH3RF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363382.3	NM_020870	
ZCCHC10	54819	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	132334373	132334373	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr5:132334373A>G	ENST00000509437.1	-	5	488	c.481T>C	c.(481-483)Tct>Cct	p.S161P	ZCCHC10_ENST00000508080.1_5'UTR|ZCCHC10_ENST00000355372.2_Missense_Mutation_p.S155P|ZCCHC10_ENST00000513848.1_Missense_Mutation_p.S125P|ZCCHC10_ENST00000324170.3_Missense_Mutation_p.S139P|ZCCHC10_ENST00000509008.1_3'UTR|ZCCHC10_ENST00000513541.1_3'UTR			Q8TBK6	ZCH10_HUMAN	zinc finger, CCHC domain containing 10	161	Ser-rich.						nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TCTGAATCAgaggaggaggaa	0.478																																					p.S139P		.											.	ZCCHC10-90	0			c.T415C						.						84.0	89.0	87.0					5																	132334373		2203	4300	6503	SO:0001583	missense	54819	exon4			AATCAGAGGAGGA	BC005211	CCDS4165.1, CCDS75300.1, CCDS75301.1, CCDS75302.1	5q31.1	2008-05-02			ENSG00000155329	ENSG00000155329		"""Zinc fingers, CCHC domain containing"""	25954	protein-coding gene	gene with protein product						12477932	Standard	XM_005272024		Approved	FLJ20094	uc003kyg.3	Q8TBK6	OTTHUMG00000129013	ENST00000509437.1:c.481T>C	5.37:g.132334373A>G	ENSP00000423276:p.Ser161Pro	Somatic	99	1		WXS	Illumina HiSeq	Phase_I	82	20	NM_017665	0	0	12	21	9	Q9NXR4	Missense_Mutation	SNP	ENST00000509437.1	37		.	.	.	.	.	.	.	.	.	.	A	14.70	2.613809	0.46631	.	.	ENSG00000155329	ENST00000324170;ENST00000355372;ENST00000509437;ENST00000513848	.	.	.	4.82	4.82	0.62117	.	0.135986	0.50627	D	0.000119	T	0.75027	0.3794	.	.	.	0.80722	D	1	D;D;D	0.69078	0.978;0.995;0.997	P;P;P	0.59288	0.629;0.795;0.855	T	0.79420	-0.1811	8	0.87932	D	0	.	14.339	0.66611	1.0:0.0:0.0:0.0	.	125;161;139	G3XAM1;Q8TBK6;Q8TBK6-2	.;ZCH10_HUMAN;.	P	139;155;161;125	.	ENSP00000324274:S139P	S	-	1	0	ZCCHC10	132362272	1.000000	0.71417	0.987000	0.45799	0.813000	0.45954	4.104000	0.57790	1.939000	0.56221	0.460000	0.39030	TCT	.		0.478	ZCCHC10-004	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000370163.1	NM_017665	
PCDHGB3	56102	hgsc.bcm.edu	37	5	140751166	140751166	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr5:140751166A>G	ENST00000576222.1	+	1	1336	c.1205A>G	c.(1204-1206)tAc>tGc	p.Y402C	PCDHGA3_ENST00000253812.6_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA6_ENST00000517434.1_5'Flank|PCDHGA2_ENST00000394576.2_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_018924.2|NM_032097.1	NP_061747.1|NP_115268.1	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3	402	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAAAACACATACAGGTTGGTG	0.448																																					p.Y402C		.											.	.	0			c.A1205G						.						64.0	66.0	66.0					5																	140751166		2002	4173	6175	SO:0001583	missense	56102	exon1			ACACATACAGGTT	AF152519	CCDS58980.1, CCDS75334.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8710	other	protocadherin		606301				10380929	Standard	NM_018924		Approved	PCDH-GAMMA-B3		Q9Y5G1		ENST00000576222.1:c.1205A>G	5.37:g.140751166A>G	ENSP00000461862:p.Tyr402Cys	Somatic	107	0		WXS	Illumina HiSeq	Phase_I	57	3	NM_018924	0	0	1	1	0	A7E229|Q9Y5C7	Missense_Mutation	SNP	ENST00000576222.1	37	CCDS58980.1																																																																																			.		0.448	PCDHGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437094.1	NM_018924	
RBM27	54439	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	145610424	145610424	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr5:145610424C>A	ENST00000265271.5	+	6	960	c.794C>A	c.(793-795)tCt>tAt	p.S265Y	RBM27_ENST00000506502.1_Missense_Mutation_p.S265Y	NM_018989.1	NP_061862.1	Q9P2N5	RBM27_HUMAN	RNA binding motif protein 27	265					mRNA processing (GO:0006397)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(3)|endometrium(4)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AATCATAGCTCTTCCAATTCT	0.428																																					p.S265Y		.											.	RBM27-70	0			c.C794A						.						124.0	108.0	113.0					5																	145610424		1568	3582	5150	SO:0001583	missense	54439	exon6			ATAGCTCTTCCAA	AL833706	CCDS43378.1	5q32	2013-01-09				ENSG00000091009		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	29243	protein-coding gene	gene with protein product	"""acidic rich RS domain containing 1"""					10718198, 15741184	Standard	NM_018989		Approved	KIAA1311, ARRS1, Psc1, ZC3H18	uc003lnz.4	Q9P2N5		ENST00000265271.5:c.794C>A	5.37:g.145610424C>A	ENSP00000265271:p.Ser265Tyr	Somatic	118	0		WXS	Illumina HiSeq	Phase_I	97	37	NM_018989	0	0	5	6	1	Q8IYW9	Missense_Mutation	SNP	ENST00000265271.5	37	CCDS43378.1	.	.	.	.	.	.	.	.	.	.	C	14.96	2.690372	0.48097	.	.	ENSG00000091009	ENST00000265271	T	0.48201	0.82	5.56	5.56	0.83823	.	0.344763	0.28332	N	0.015722	T	0.36496	0.0969	N	0.22421	0.69	0.35199	D	0.774129	P;P	0.51653	0.454;0.947	B;B	0.41374	0.064;0.355	T	0.53514	-0.8428	10	0.59425	D	0.04	-7.8615	15.2609	0.73621	0.1489:0.8511:0.0:0.0	.	265;265	Q9P2N5;B3KY61	RBM27_HUMAN;.	Y	265	ENSP00000265271:S265Y	ENSP00000265271:S265Y	S	+	2	0	RBM27	145590617	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.339000	0.43965	2.614000	0.88457	0.563000	0.77884	TCT	.		0.428	RBM27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373420.1	XM_291128	
ARSI	340075	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	149677576	149677576	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr5:149677576G>A	ENST00000328668.7	-	2	1490	c.911C>T	c.(910-912)tCg>tTg	p.S304L		NM_001012301.2	NP_001012301.1	Q5FYB1	ARSI_HUMAN	arylsulfatase family, member I	304					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	23			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GCTGCCCCCCGAGAAAGTCTG	0.587																																					p.S304L		.											.	ARSI-92	0			c.C911T						.						36.0	32.0	34.0					5																	149677576		2199	4292	6491	SO:0001583	missense	340075	exon2			CCCCCCGAGAAAG	AY875937	CCDS34275.1	5q32	2014-03-03	2006-03-07			ENSG00000183876		"""Arylsulfatase family"""	32521	protein-coding gene	gene with protein product		610009	"""arylsulfatase I"""			16174644, 24482476	Standard	NM_001012301		Approved	FLJ16069, SPG66	uc003lrv.2	Q5FYB1		ENST00000328668.7:c.911C>T	5.37:g.149677576G>A	ENSP00000333395:p.Ser304Leu	Somatic	94	0		WXS	Illumina HiSeq	Phase_I	71	28	NM_001012301	0	0	0	0	0	A1L3B0|B3KV22|B7XD03	Missense_Mutation	SNP	ENST00000328668.7	37	CCDS34275.1	.	.	.	.	.	.	.	.	.	.	G	17.33	3.361900	0.61403	.	.	ENSG00000183876	ENST00000328668;ENST00000515301	D;D	0.96745	-4.11;-4.11	4.46	4.46	0.54185	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.059421	0.64402	D	0.000001	D	0.92473	0.7610	N	0.25426	0.745	0.54753	D	0.999982	B	0.18166	0.026	B	0.18263	0.021	D	0.89036	0.3445	10	0.22109	T	0.4	.	17.6599	0.88189	0.0:0.0:1.0:0.0	.	304	Q5FYB1	ARSI_HUMAN	L	304;161	ENSP00000333395:S304L;ENSP00000426879:S161L	ENSP00000333395:S304L	S	-	2	0	ARSI	149657769	1.000000	0.71417	0.961000	0.40146	0.945000	0.59286	7.738000	0.84966	2.460000	0.83146	0.561000	0.74099	TCG	.		0.587	ARSI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373681.1	NM_001012301	
F12	2161	broad.mit.edu;bcgsc.ca	37	5	176830985	176830985	+	Silent	SNP	G	G	A			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr5:176830985G>A	ENST00000253496.3	-	10	1173	c.1125C>T	c.(1123-1125)ggC>ggT	p.G375G	F12_ENST00000514943.1_5'Flank	NM_000505.3	NP_000496.2	P00748	FA12_HUMAN	coagulation factor XII (Hageman factor)	375	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|Factor XII activation (GO:0002542)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|plasma kallikrein-kinin cascade (GO:0002353)|positive regulation of blood coagulation (GO:0030194)|positive regulation of fibrinolysis (GO:0051919)|positive regulation of plasminogen activation (GO:0010756)|protein autoprocessing (GO:0016540)|protein processing (GO:0016485)|response to misfolded protein (GO:0051788)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	misfolded protein binding (GO:0051787)|serine-type aminopeptidase activity (GO:0070009)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	12	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Ethanolamine Oleate(DB06689)	CCACCAGCCCGCCAACGACGC	0.706									Hereditary Angioedema		OREG0017088	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G375G													.	F12-90	0			c.C1125T						.																																			SO:0001819	synonymous_variant	2161	exon10	Familial Cancer Database	HAE, type I-III, Hereditary Angioneurotic Edema, HANE,	CAGCCCGCCAACG	M31315	CCDS34302.1	5q35.3	2014-09-17			ENSG00000131187	ENSG00000131187	3.4.21.38		3530	protein-coding gene	gene with protein product		610619					Standard	NM_000505		Approved		uc003mgo.4	P00748	OTTHUMG00000163403	ENST00000253496.3:c.1125C>T	5.37:g.176830985G>A		Somatic	44	0	1934	WXS	Illumina HiSeq	Phase_I	28	16	NM_000505	0	0	0	0	0	P78339	Silent	SNP	ENST00000253496.3	37	CCDS34302.1																																																																																			G|1.000;C|0.000		0.706	F12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373217.1		
NDUFAF4	29078	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	97344647	97344647	+	Silent	SNP	A	A	G			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr6:97344647A>G	ENST00000316149.7	-	2	292	c.213T>C	c.(211-213)gaT>gaC	p.D71D	NDUFAF4_ENST00000489477.1_5'UTR	NM_014165.3	NP_054884.1	Q9P032	NDUF4_HUMAN	NADH dehydrogenase (ubiquinone) complex I, assembly factor 4	71					mitochondrial respiratory chain complex I assembly (GO:0032981)	mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)				large_intestine(5)|lung(3)|ovary(1)|skin(1)	10						GATCTTTGGAATCAACATACA	0.358																																					p.D71D		.											.	NDUFAF4-91	0			c.T213C						.						148.0	149.0	149.0					6																	97344647		2203	4300	6503	SO:0001819	synonymous_variant	29078	exon2			TTTGGAATCAACA	AF161474	CCDS5037.1	6q16.3	2012-10-12	2012-05-08	2009-03-18	ENSG00000123545	ENSG00000123545		"""Mitochondrial respiratory chain complex assembly factors"""	21034	protein-coding gene	gene with protein product		611776	"""chromosome 6 open reading frame 66"", ""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 4"""	C6orf66		11042152, 18179882	Standard	NM_014165		Approved	HSPC125, bA22L21.1, My013, HRPAP20	uc003pow.3	Q9P032	OTTHUMG00000015246	ENST00000316149.7:c.213T>C	6.37:g.97344647A>G		Somatic	128	0		WXS	Illumina HiSeq	Phase_I	114	32	NM_014165	0	0	5	12	7	B2R4J5	Silent	SNP	ENST00000316149.7	37	CCDS5037.1																																																																																			.		0.358	NDUFAF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041567.1	NM_014165	
CALU	813	broad.mit.edu	37	7	128407599	128407599	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr7:128407599C>A	ENST00000249364.4	+	6	835	c.733C>A	c.(733-735)Cgt>Agt	p.R245S	CALU_ENST00000535623.1_3'UTR|CALU_ENST00000479257.1_Missense_Mutation_p.R253S|CALU_ENST00000538546.1_Missense_Mutation_p.R94S|CALU_ENST00000535011.2_Intron|CALU_ENST00000542996.2_Missense_Mutation_p.R253S|CALU_ENST00000449187.2_Missense_Mutation_p.R245S	NM_001219.4	NP_001210.1	O43852	CALU_HUMAN	calumenin	245	EF-hand 5. {ECO:0000255|PROSITE- ProRule:PRU00448}.				blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|sarcoplasmic reticulum (GO:0016529)	calcium ion binding (GO:0005509)			kidney(2)|large_intestine(3)|lung(5)	10						GGATAAGAACCGTGATGGGAA	0.488																																					p.R253S													.	CALU-90	0			c.C757A						.						192.0	179.0	183.0					7																	128407599		2203	4300	6503	SO:0001583	missense	813	exon7			AAGAACCGTGATG	AF013759	CCDS5805.1, CCDS47703.1, CCDS56506.1, CCDS56507.1, CCDS56508.1	7q32	2013-01-10			ENSG00000128595	ENSG00000128595		"""EF-hand domain containing"""	1458	protein-coding gene	gene with protein product		603420				9598325	Standard	NM_001219		Approved		uc003vnq.3	O43852	OTTHUMG00000158274	ENST00000249364.4:c.733C>A	7.37:g.128407599C>A	ENSP00000249364:p.Arg245Ser	Somatic	141	0		WXS	Illumina HiSeq	Phase_I	134	5	NM_001199671	0	0	89	89	0	B3KPG9|D6QS48|D6QS49|D6QS50|D6QS51|D6QS52|D6QS53|D6QS54|D6QS55|D6QS56|D6QS57|D6QS58|D6QS59|F5H1Q9|F5H879|O60456|Q6FHB9|Q96RL3|Q9NR43	Missense_Mutation	SNP	ENST00000249364.4	37	CCDS5805.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.93|15.93	2.978015|2.978015	0.53720|0.53720	.|.	.|.	ENSG00000128595|ENSG00000128595	ENST00000493278|ENST00000542996;ENST00000538546;ENST00000249364;ENST00000449187;ENST00000479257	.|T;T;T;T;T	.|0.54866	.|0.55;0.55;0.55;0.55;0.55	5.44|5.44	4.56|4.56	0.56223|0.56223	.|EF-hand-like domain (1);	.|0.267158	.|0.39759	.|N	.|0.001271	T|T	0.34948|0.34948	0.0915|0.0915	N|N	0.17474|0.17474	0.49|0.49	0.38401|0.38401	D|D	0.945668|0.945668	.|B;B	.|0.25007	.|0.116;0.001	.|B;B	.|0.20184	.|0.028;0.003	T|T	0.18304|0.18304	-1.0341|-1.0341	5|10	.|0.20046	.|T	.|0.44	-2.8562|-2.8562	13.5218|13.5218	0.61572|0.61572	0.1568:0.8432:0.0:0.0|0.1568:0.8432:0.0:0.0	.|.	.|253;245	.|D6QS48;O43852	.|.;CALU_HUMAN	Q|S	76|253;94;245;245;253	.|ENSP00000438248:R253S;ENSP00000438994:R94S;ENSP00000249364:R245S;ENSP00000408838:R245S;ENSP00000420381:R253S	.|ENSP00000249364:R245S	P|R	+|+	2|1	0|0	CALU|CALU	128194835|128194835	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	2.613000|2.613000	0.46351|0.46351	1.287000|1.287000	0.44583|0.44583	0.563000|0.563000	0.77884|0.77884	CCG|CGT	.		0.488	CALU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350533.1	NM_001219	
CHCHD3	54927	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	132709362	132709362	+	Missense_Mutation	SNP	T	T	A			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr7:132709362T>A	ENST00000262570.5	-	3	339	c.195A>T	c.(193-195)agA>agT	p.R65S	CHCHD3_ENST00000476546.1_5'UTR|CHCHD3_ENST00000542753.1_Missense_Mutation_p.R65S|CHCHD3_ENST00000448878.1_Missense_Mutation_p.R65S	NM_017812.2	NP_060282.1	Q9NX63	MIC19_HUMAN	coiled-coil-helix-coiled-coil-helix domain containing 3	65					inner mitochondrial membrane organization (GO:0007007)|mitochondrial fusion (GO:0008053)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	phosphatase binding (GO:0019902)|protein complex scaffold (GO:0032947)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	7						CCTCAGCTACTCTTCTTTTCA	0.383																																					p.R65S		.											.	CHCHD3-90	0			c.A195T						.						126.0	127.0	127.0					7																	132709362		2203	4300	6503	SO:0001583	missense	54927	exon3			AGCTACTCTTCTT	BC011596	CCDS5828.1	7q33	2012-10-02			ENSG00000106554	ENSG00000106554		"""Coiled-coil-helix-coiled-coil-helix domain containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21906	protein-coding gene	gene with protein product	"""mitochondrial inner membrane organizing system 3"", ""protein phosphatase 1, regulatory subunit 22"""	613748				22252321, 23019327, 21081504, 17624330	Standard	NM_017812		Approved	FLJ20420, MINOS3, PPP1R22	uc003vre.3	Q9NX63	OTTHUMG00000155231	ENST00000262570.5:c.195A>T	7.37:g.132709362T>A	ENSP00000262570:p.Arg65Ser	Somatic	200	1		WXS	Illumina HiSeq	Phase_I	208	19	NM_017812	0	0	49	62	13		Missense_Mutation	SNP	ENST00000262570.5	37	CCDS5828.1	.	.	.	.	.	.	.	.	.	.	T	24.7	4.556929	0.86231	.	.	ENSG00000106554	ENST00000262570;ENST00000448878;ENST00000542753	T;T;T	0.42513	0.97;0.97;0.97	5.81	3.44	0.39384	.	0.092160	0.85682	D	0.000000	T	0.54631	0.1870	M	0.76574	2.34	0.34318	D	0.686194	P;D;P	0.64830	0.9;0.994;0.772	P;D;B	0.64595	0.65;0.927;0.428	T	0.62144	-0.6916	10	0.09843	T	0.71	-13.2962	9.4483	0.38710	0.0:0.1445:0.0:0.8555	.	65;65;65	G3V1K1;C9JRZ6;Q9NX63	.;.;CHCH3_HUMAN	S	65	ENSP00000262570:R65S;ENSP00000389297:R65S;ENSP00000440267:R65S	ENSP00000262570:R65S	R	-	3	2	CHCHD3	132359902	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.356000	0.44116	0.553000	0.29044	0.496000	0.49642	AGA	.		0.383	CHCHD3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000338899.1	NM_017812	
KRBA1	84626	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	149416749	149416749	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr7:149416749C>T	ENST00000485033.2	+	1	20	c.20C>T	c.(19-21)aCg>aTg	p.T7M	KRBA1_ENST00000479560.1_3'UTR|KRBA1_ENST00000319551.8_Missense_Mutation_p.T7M|KRBA1_ENST00000255992.10_Missense_Mutation_p.T7M			A5PL33	KRBA1_HUMAN	KRAB-A domain containing 1	7										breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(17)|ovary(1)|prostate(1)	27	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			AACTACGAGACGCTGGTCTCT	0.657																																					.													.	KRBA1-91	0			.						.						46.0	59.0	55.0					7																	149416749		2129	4258	6387	SO:0001583	missense	84626	.			ACGAGACGCTGGT	AB058765	CCDS75674.1	7q36	2014-02-12	2006-08-15		ENSG00000133619	ENSG00000133619		"""-"""	22228	protein-coding gene	gene with protein product			"""KRAB A domain containing 1"""				Standard	NM_001290187		Approved	KIAA1862	uc003wfz.3	A5PL33	OTTHUMG00000157886	ENST00000485033.2:c.20C>T	7.37:g.149416749C>T	ENSP00000420112:p.Thr7Met	Somatic	43	0		WXS	Illumina HiSeq	Phase_I	46	10	.	0	0	4	4	0	A7E2F5|E7ENE9|Q8N4X0|Q96JG5	Missense_Mutation	SNP	ENST00000485033.2	37		.	.	.	.	.	.	.	.	.	.	C	10.86	1.468525	0.26335	.	.	ENSG00000133619	ENST00000486744;ENST00000255992;ENST00000319551;ENST00000497895;ENST00000485033	T;T;T	0.34072	1.39;1.38;1.38	4.86	3.03	0.35002	.	0.734681	0.12271	N	0.483815	T	0.15522	0.0374	N	0.14661	0.345	0.19775	N	0.99995	P	0.46220	0.874	B	0.31101	0.124	T	0.11397	-1.0589	10	0.87932	D	0	-3.3573	4.6081	0.12387	0.1745:0.6412:0.0:0.1843	.	7	A5PL33	KRBA1_HUMAN	M	7	ENSP00000255992:T7M;ENSP00000317165:T7M;ENSP00000420112:T7M	ENSP00000255992:T7M	T	+	2	0	KRBA1	149047682	0.005000	0.15991	0.217000	0.23759	0.579000	0.36224	0.249000	0.18216	1.285000	0.44548	0.561000	0.74099	ACG	.		0.657	KRBA1-004	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000349841.3	NM_032534	
PABPC1	26986	hgsc.bcm.edu	37	8	101719226	101719226	+	Splice_Site	SNP	C	C	G	rs112580522		TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr8:101719226C>G	ENST00000318607.5	-	10	2465		c.e10-1		PABPC1_ENST00000519596.1_Intron|PABPC1_ENST00000519004.1_Splice_Site|PABPC1_ENST00000522387.1_Splice_Site|AP001205.1_ENST00000579868.1_RNA	NM_002568.3	NP_002559.2	P11940	PABP1_HUMAN	poly(A) binding protein, cytoplasmic 1						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|mRNA stabilization (GO:0048255)|negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|translation activator activity (GO:0008494)	p.?(1)		breast(2)|endometrium(4)|kidney(15)|large_intestine(4)|lung(13)|prostate(1)|skin(1)	40	all_cancers(14;6.8e-05)|all_epithelial(15;3.16e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;6.37e-11)|all cancers(13;1.11e-08)|OV - Ovarian serous cystadenocarcinoma(57;3.91e-05)|STAD - Stomach adenocarcinoma(118;0.206)			TTTTGGAATGCTGCATTTTAA	0.413																																					.		.											.	PABPC1-68	1	Unknown(1)	lung(1)	c.1337-1G>C						.						39.0	41.0	40.0					8																	101719226		2203	4300	6503	SO:0001630	splice_region_variant	26986	exon11			GGAATGCTGCATT	Y00345	CCDS6289.1	8q22.2-q23	2013-02-12	2004-04-20		ENSG00000070756	ENSG00000070756		"""RNA binding motif (RRM) containing"""	8554	protein-coding gene	gene with protein product		604679	"""poly(A)-binding protein, cytoplasmic 2"""	PAB1, PABPC2		2885805	Standard	XM_005250861		Approved	PABP1, PABPL1	uc003yjs.1	P11940	OTTHUMG00000164779	ENST00000318607.5:c.1337-1G>C	8.37:g.101719226C>G		Somatic	63	1		WXS	Illumina HiSeq	Phase_I	54	6	NM_002568	0	0	0	0	0	Q15097|Q93004	Splice_Site	SNP	ENST00000318607.5	37	CCDS6289.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.096182	0.76870	.	.	ENSG00000070756	ENST00000318607;ENST00000519004;ENST00000522387;ENST00000517403	.	.	.	6.04	6.04	0.98038	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.5891	0.99427	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PABPC1	101788402	1.000000	0.71417	0.998000	0.56505	0.957000	0.61999	5.388000	0.66249	2.876000	0.98609	0.650000	0.86243	.	G|1.000;|0.000		0.413	PABPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380217.1	NM_002568	Intron
TG	7038	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	133931710	133931710	+	Missense_Mutation	SNP	T	T	G			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr8:133931710T>G	ENST00000220616.4	+	21	4508	c.4468T>G	c.(4468-4470)Tgt>Ggt	p.C1490G	TG_ENST00000377869.1_Missense_Mutation_p.C1490G|TG_ENST00000542445.1_5'UTR	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	1490					hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		GAGCTTGGCCTGTGTCCCATG	0.478																																					p.C1490G		.											.	TG-145	0			c.T4468G						.						141.0	112.0	122.0					8																	133931710		2203	4300	6503	SO:0001583	missense	7038	exon21			TTGGCCTGTGTCC	AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.4468T>G	8.37:g.133931710T>G	ENSP00000220616:p.Cys1490Gly	Somatic	102	0		WXS	Illumina HiSeq	Phase_I	109	41	NM_003235	0	0	0	0	0	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	ENST00000220616.4	37	CCDS34944.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.60|16.60	3.168293|3.168293	0.57584|0.57584	.|.	.|.	ENSG00000042832|ENSG00000042832	ENST00000377869;ENST00000543313;ENST00000220616|ENST00000519178	D;D|.	0.86865|.	-2.18;-2.18|.	5.52|5.52	5.52|5.52	0.82312|0.82312	Tyrosine-protein kinase ephrin type A/B receptor-like (1);|.	0.194939|.	0.36703|.	N|.	0.002444|.	T|T	0.80374|0.80374	0.4611|0.4611	H|H	0.97516|0.97516	4.02|4.02	0.28752|0.28752	N|N	0.90136|0.90136	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	T|T	0.80527|0.80527	-0.1343|-0.1343	10|5	0.87932|.	D|.	0|.	.|.	12.3216|12.3216	0.54987|0.54987	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	1490|.	P01266|.	THYG_HUMAN|.	G|R	1490;296;1490|9	ENSP00000367100:C1490G;ENSP00000220616:C1490G|.	ENSP00000220616:C1490G|.	C|L	+|+	1|2	0|0	TG|TG	134000892|134000892	1.000000|1.000000	0.71417|0.71417	0.890000|0.890000	0.34922|0.34922	0.588000|0.588000	0.36517|0.36517	5.096000|5.096000	0.64535|0.64535	2.225000|2.225000	0.72522|0.72522	0.533000|0.533000	0.62120|0.62120	TGT|CTG	.		0.478	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1	NM_003235	
SMARCA2	6595	hgsc.bcm.edu	37	9	2039761	2039761	+	Silent	SNP	A	A	G	rs13296982		TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr9:2039761A>G	ENST00000382203.1	+	4	860	c.651A>G	c.(649-651)caA>caG	p.Q217Q	SMARCA2_ENST00000382194.1_Silent_p.Q217Q|SMARCA2_ENST00000491574.1_3'UTR|SMARCA2_ENST00000349721.2_Silent_p.Q217Q|SMARCA2_ENST00000357248.2_Silent_p.Q217Q|RP11-264I13.2_ENST00000426860.1_RNA			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	217	Poly-Gln.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		GCTTgcagcaacaacagcagc	0.607																																					p.Q217Q		.											.	SMARCA2-653	0			c.A651G						.	A	,	1,4405		0,1,2202	16.0	18.0	17.0		651,651	1.4	1.0	9	dbSNP_121	17	0,8594		0,0,4297	no	coding-synonymous,coding-synonymous	SMARCA2	NM_003070.3,NM_139045.2	,	0,1,6499	GG,GA,AA		0.0,0.0227,0.0077	,	217/1591,217/1573	2039761	1,12999	2203	4297	6500	SO:0001819	synonymous_variant	6595	exon4			GCAGCAACAACAG	D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.651A>G	9.37:g.2039761A>G		Somatic	39	0		WXS	Illumina HiSeq	Phase_I	41	3	NM_139045	0	0	33	33	0	B1ALG3|B1ALG4|D3DRH4|D3DRH5	Silent	SNP	ENST00000382203.1	37	CCDS34977.1																																																																																			A|1.000;|0.000		0.607	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051505.1	NM_003070	
USP11	8237	hgsc.bcm.edu	37	X	47102998	47102998	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chrX:47102998T>C	ENST00000218348.3	+	13	1916	c.1916T>C	c.(1915-1917)cTc>cCc	p.L639P	USP11_ENST00000377107.2_Missense_Mutation_p.L596P	NM_004651.3	NP_004642.2	P51784	UBP11_HUMAN	ubiquitin specific peptidase 11	639	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(14)|ovary(3)|pancreas(1)|stomach(1)	40						ATGTACCGGCTCTCGTAAGTG	0.577																																					p.L639P		.											.	USP11-659	0			c.T1916C						.						45.0	43.0	44.0					X																	47102998		2203	4300	6503	SO:0001583	missense	8237	exon13			ACCGGCTCTCGTA	U44839	CCDS14277.1	Xp11.23	2008-02-05	2005-08-08		ENSG00000102226	ENSG00000102226		"""Ubiquitin-specific peptidases"""	12609	protein-coding gene	gene with protein product		300050	"""ubiquitin specific protease 11"""			12838346	Standard	XM_005272674		Approved	UHX1	uc004dhp.3	P51784	OTTHUMG00000021437	ENST00000218348.3:c.1916T>C	X.37:g.47102998T>C	ENSP00000218348:p.Leu639Pro	Somatic	31	0		WXS	Illumina HiSeq	Phase_I	24	2	NM_004651	0	0	0	0	0	B2RTX1|Q8IUG6|Q9BWE1	Missense_Mutation	SNP	ENST00000218348.3	37	CCDS14277.1	.	.	.	.	.	.	.	.	.	.	T	19.34	3.808542	0.70797	.	.	ENSG00000102226	ENST00000377107;ENST00000218348	T;T	0.25085	1.84;1.82	4.69	4.69	0.59074	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.096142	0.42821	D	0.000655	T	0.47857	0.1468	M	0.75884	2.315	0.80722	D	1	B;D	0.69078	0.389;0.997	B;D	0.68621	0.403;0.959	T	0.51458	-0.8703	10	0.87932	D	0	-17.6823	10.9784	0.47480	0.0:0.0:0.0:1.0	.	366;639	B3KP28;P51784	.;UBP11_HUMAN	P	596;639	ENSP00000366311:L596P;ENSP00000218348:L639P	ENSP00000218348:L639P	L	+	2	0	USP11	46987942	1.000000	0.71417	1.000000	0.80357	0.800000	0.45204	5.422000	0.66453	1.861000	0.53984	0.417000	0.27973	CTC	.		0.577	USP11-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_004651	
GNPTAB	79158	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	102159058	102159058	+	Frame_Shift_Del	DEL	A	A	-			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr12:102159058delA	ENST00000299314.7	-	13	1899	c.1637delT	c.(1636-1638)gtgfs	p.V546fs	RNU6-101P_ENST00000410323.1_RNA	NM_024312.4	NP_077288.2	Q3T906	GNPTA_HUMAN	N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits	546					carbohydrate phosphorylation (GO:0046835)|cell differentiation (GO:0030154)|lysosome organization (GO:0007040)|protein secretion (GO:0009306)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|UDP-N-acetylglucosamine-lysosomal-enzyme N-acetylglucosaminephosphotransferase activity (GO:0003976)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	37						GAGAAGGATCACTTTATACAA	0.358																																					p.V546fs		.											.	GNPTAB-92	0			c.1637delT						.						77.0	77.0	77.0					12																	102159058		2203	4300	6503	SO:0001589	frameshift_variant	79158	exon13			.	AY687932	CCDS9088.1	12q23.3	2013-01-10				ENSG00000111670		"""EF-hand domain containing"""	29670	protein-coding gene	gene with protein product		607840		GNPTA		10574462, 16116615	Standard	NM_024312		Approved	KIAA1208, MGC4170	uc001tit.3	Q3T906	OTTHUMG00000170444	ENST00000299314.7:c.1637delT	12.37:g.102159058delA	ENSP00000299314:p.Val546fs	Somatic	101	0		WXS	Illumina HiSeq	Phase_I	100	33	NM_024312	0	0	0	0	0	A2RRQ9|Q3ZQK2|Q6IPW5|Q86TQ2|Q96N13|Q9ULL2	Frame_Shift_Del	DEL	ENST00000299314.7	37	CCDS9088.1																																																																																			.		0.358	GNPTAB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409182.1		
LACTB	114294	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	63414861	63414861	+	Frame_Shift_Del	DEL	G	G	-			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr15:63414861delG	ENST00000261893.4	+	2	456	c.384delG	c.(382-384)gtgfs	p.V129fs	LACTB_ENST00000413507.2_Frame_Shift_Del_p.V129fs	NM_032857.3	NP_116246.2	P83111	LACTB_HUMAN	lactamase, beta	129						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(1)	12						CGGGCATAGTGGTTGGAGTTT	0.488																																					p.V128fs	Melanoma(85;443 1381 6215 27308 35583)	.											.	LACTB-90	0			c.384delG						.						169.0	148.0	155.0					15																	63414861		2203	4300	6503	SO:0001589	frameshift_variant	114294	exon2			.	AK027808	CCDS10182.1, CCDS45275.1	15q22.1	2012-11-14	2001-12-12	2001-12-14	ENSG00000103642	ENSG00000103642		"""Mitochondrial ribosomal proteins / large subunits"""	16468	protein-coding gene	gene with protein product		608440	"""mitochondrial ribosomal protein L56"""	MRPL56		11707067	Standard	NM_032857		Approved	FLJ14902	uc002alw.3	P83111	OTTHUMG00000132807	ENST00000261893.4:c.384delG	15.37:g.63414861delG	ENSP00000261893:p.Val129fs	Somatic	107	0		WXS	Illumina HiSeq	Phase_I	106	35	NM_171846	0	0	0	0	0	P83096	Frame_Shift_Del	DEL	ENST00000261893.4	37	CCDS10182.1																																																																																			.		0.488	LACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256224.1	NM_032857	
EPG5	57724	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	43464597	43464598	+	Frame_Shift_Ins	INS	-	-	AA			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr18:43464597_43464598insAA	ENST00000282041.5	-	30	5322_5323	c.5288_5289insTT	c.(5287-5289)ttcfs	p.F1763fs	EPG5_ENST00000585906.1_5'UTR	NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)	1763					autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)					NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						TTAGCAGCATGAAAATCATATC	0.421																																					p.F1763fs		.											.	EPG5-580	0			c.5289_5290insTT						.																																			SO:0001589	frameshift_variant	57724	exon30			.	AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.5287_5288dupTT	18.37:g.43464600_43464601dupAA	ENSP00000282041:p.Phe1763fs	Somatic	143	0		WXS	Illumina HiSeq	Phase_I	121	39	NM_020964	0	0	0	0	0	A2BDF3|Q9H8C8	Frame_Shift_Ins	INS	ENST00000282041.5	37	CCDS11926.2																																																																																			.		0.421	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445081.1	NM_020964	
