#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PRAMEF17	391004	hgsc.bcm.edu	37	1	13718601	13718601	+	Missense_Mutation	SNP	C	C	T			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr1:13718601C>T	ENST00000376098.4	+	3	1090	c.1064C>T	c.(1063-1065)aCg>aTg	p.T355M		NM_001099851.1	NP_001093321.1	Q5VTA0	PRA17_HUMAN	PRAME family member 17	355					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					kidney(1)|lung(2)	3	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;9.86e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|COAD - Colon adenocarcinoma(227;0.000502)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GAGATCCTCACGTTAAAGGAC	0.537																																					p.T355M		.											.	.	0			c.C1064T						.						9.0	22.0	19.0					1																	13718601		831	2388	3219	SO:0001583	missense	391004	exon3			TCCTCACGTTAAA		CCDS41264.1	1p36.21	2013-01-17			ENSG00000204479	ENSG00000204479		"""-"""	29485	protein-coding gene	gene with protein product							Standard	NM_001099851		Approved	OTTHUMG00000007909	uc009vnz.1	Q5VTA0	OTTHUMG00000007909	ENST00000376098.4:c.1064C>T	1.37:g.13718601C>T	ENSP00000365266:p.Thr355Met	Somatic	116	2		WXS	Illumina HiSeq	Phase_I	44	4	NM_001099851	0	0	0	0	0	B2RUU4	Missense_Mutation	SNP	ENST00000376098.4	37	CCDS41264.1	.	.	.	.	.	.	.	.	.	.	C	0.396	-0.920692	0.02396	.	.	ENSG00000204479	ENST00000376098	T	0.11821	2.74	1.03	-2.05	0.07321	.	1.024390	0.07732	N	0.945353	T	0.06962	0.0177	N	0.14661	0.345	0.09310	N	1	B	0.14012	0.009	B	0.12837	0.008	T	0.37731	-0.9693	10	0.66056	D	0.02	.	1.9565	0.03377	0.4378:0.2899:0.0:0.2723	.	355	Q5VTA0	PRA17_HUMAN	M	355	ENSP00000365266:T355M	ENSP00000365266:T355M	T	+	2	0	PRAMEF17	13591188	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.801000	0.04550	-1.158000	0.02811	-0.507000	0.04495	ACG	.		0.537	PRAMEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021780.2	NM_001099851	
FAM46B	115572	hgsc.bcm.edu	37	1	27332864	27332864	+	Silent	SNP	G	G	A			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr1:27332864G>A	ENST00000289166.5	-	2	1014	c.849C>T	c.(847-849)tgC>tgT	p.C283C		NM_052943.3	NP_443175.2	Q96A09	FA46B_HUMAN	family with sequence similarity 46, member B	283										breast(1)|central_nervous_system(1)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)	10		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;7.71e-51)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-29)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000272)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|STAD - Stomach adenocarcinoma(196;0.00114)|READ - Rectum adenocarcinoma(331;0.0419)		CCAGGAGGTGGCAGTACTTGA	0.672																																					p.C283C		.											.	FAM46B-90	0			c.C849T						.						19.0	22.0	21.0					1																	27332864		2202	4295	6497	SO:0001819	synonymous_variant	115572	exon2			GAGGTGGCAGTAC	AK122816	CCDS294.2	1p35.3	2008-02-05			ENSG00000158246	ENSG00000158246			28273	protein-coding gene	gene with protein product						12477932	Standard	NM_052943		Approved	MGC16491	uc010ofj.2	Q96A09	OTTHUMG00000004278	ENST00000289166.5:c.849C>T	1.37:g.27332864G>A		Somatic	68	0		WXS	Illumina HiSeq	Phase_I	27	2	NM_052943	0	0	1	1	0		Silent	SNP	ENST00000289166.5	37	CCDS294.2																																																																																			.		0.672	FAM46B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012347.2	NM_052943	
IPO13	9670	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	44423086	44423086	+	Missense_Mutation	SNP	C	C	A			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr1:44423086C>A	ENST00000372343.3	+	7	2067	c.1405C>A	c.(1405-1407)Ctc>Atc	p.L469I	IPO13_ENST00000492152.1_3'UTR	NM_014652.3	NP_055467.3	O94829	IPO13_HUMAN	importin 13	469					protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(13)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0821)				CACAGAGGCCCTCCTCTACGG	0.572																																					p.L469I		.											.	IPO13-226	0			c.C1405A						.						109.0	99.0	103.0					1																	44423086		2203	4300	6503	SO:0001583	missense	9670	exon7			GAGGCCCTCCTCT	AB018267	CCDS503.1	1p34.1	2008-02-05			ENSG00000117408	ENSG00000117408		"""Importins"""	16853	protein-coding gene	gene with protein product		610411				9872452, 11447110	Standard	NM_014652		Approved	IMP13, KIAA0724, RANBP13	uc001ckx.3	O94829	OTTHUMG00000008297	ENST00000372343.3:c.1405C>A	1.37:g.44423086C>A	ENSP00000361418:p.Leu469Ile	Somatic	153	0		WXS	Illumina HiSeq	Phase_I	69	54	NM_014652	0	0	0	14	14	D3DPY4|Q5T4X3|Q7LC04|Q96HS3|Q9H8N3|Q9UFR1	Missense_Mutation	SNP	ENST00000372343.3	37	CCDS503.1	.	.	.	.	.	.	.	.	.	.	C	15.39	2.818926	0.50633	.	.	ENSG00000117408	ENST00000372343	T	0.66995	-0.24	5.69	4.78	0.61160	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.64402	D	0.000002	T	0.53351	0.1791	L	0.47716	1.5	0.80722	D	1	P	0.37663	0.604	B	0.35550	0.205	T	0.49312	-0.8953	10	0.22109	T	0.4	16.3773	7.0228	0.24924	0.0:0.7119:0.0:0.2881	.	469	O94829	IPO13_HUMAN	I	469	ENSP00000361418:L469I	ENSP00000361418:L469I	L	+	1	0	IPO13	44195673	0.942000	0.31987	1.000000	0.80357	0.991000	0.79684	1.613000	0.36900	1.420000	0.47138	0.561000	0.74099	CTC	.		0.572	IPO13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022846.1	NM_014652	
CSDE1	7812	hgsc.bcm.edu	37	1	115280131	115280131	+	Silent	SNP	A	A	G			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr1:115280131A>G	ENST00000358528.4	-	5	789	c.363T>C	c.(361-363)ggT>ggC	p.G121G	CSDE1_ENST00000530886.1_Intron|CSDE1_ENST00000534699.1_Silent_p.G121G|CSDE1_ENST00000261443.5_Intron|CSDE1_ENST00000438362.2_Silent_p.G167G|CSDE1_ENST00000339438.6_Intron|CSDE1_ENST00000369530.1_Intron	NM_001007553.2	NP_001007554.1	O75534	CSDE1_HUMAN	cold shock domain containing E1, RNA-binding	121					male gonad development (GO:0008584)|nuclear-transcribed mRNA catabolic process, no-go decay (GO:0070966)|regulation of transcription, DNA-templated (GO:0006355)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(4)|endometrium(11)|kidney(2)|large_intestine(12)|lung(17)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	51	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;2.21e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TTGGACTCTGACCCGGGGCAG	0.423																																					p.G167G		.											.	CSDE1-227	0			c.T501C						.						78.0	68.0	71.0					1																	115280131		2203	4300	6503	SO:0001819	synonymous_variant	7812	exon6			ACTCTGACCCGGG		CCDS30811.1, CCDS30812.1, CCDS44197.1, CCDS55626.1	1p13.2	2011-11-02			ENSG00000009307	ENSG00000009307			29905	protein-coding gene	gene with protein product	"""upstream of NRAS"""	191510				2204029, 10048485	Standard	NM_007158		Approved	D1S155E, UNR	uc001efi.3	O75534	OTTHUMG00000012060	ENST00000358528.4:c.363T>C	1.37:g.115280131A>G		Somatic	89	0		WXS	Illumina HiSeq	Phase_I	54	3	NM_001242891	0	0	15	15	0	A8K281|E9PGZ0|G5E9Q2|O94961|Q5TF04|Q5TF05|Q68DF1|Q68DI9|Q9Y2S4	Silent	SNP	ENST00000358528.4	37	CCDS30812.1																																																																																			.		0.423	CSDE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033397.1	NM_007158	
C1orf112	55732	hgsc.bcm.edu	37	1	169775219	169775219	+	Missense_Mutation	SNP	T	T	C			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr1:169775219T>C	ENST00000286031.6	+	7	1253	c.553T>C	c.(553-555)Ttt>Ctt	p.F185L	C1orf112_ENST00000413811.2_Missense_Mutation_p.F156L|C1orf112_ENST00000498289.1_3'UTR|C1orf112_ENST00000456684.1_Missense_Mutation_p.F243L|C1orf112_ENST00000359326.4_Missense_Mutation_p.F185L	NM_018186.2	NP_060656.2	Q9NSG2	CA112_HUMAN	chromosome 1 open reading frame 112	185										breast(1)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(8)|lung(9)|ovary(1)|skin(1)|stomach(1)	34	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					TACTTGGAAGTTTATAATTAA	0.269																																					p.F185L		.											.	C1orf112-90	0			c.T553C						.						80.0	76.0	77.0					1																	169775219		2203	4294	6497	SO:0001583	missense	55732	exon7			TGGAAGTTTATAA	AL354614	CCDS1285.1	1q24.2	2012-06-26			ENSG00000000460	ENSG00000000460			25565	protein-coding gene	gene with protein product						12477932	Standard	NM_018186		Approved	FLJ10706	uc001ggq.3	Q9NSG2	OTTHUMG00000035821	ENST00000286031.6:c.553T>C	1.37:g.169775219T>C	ENSP00000286031:p.Phe185Leu	Somatic	35	0		WXS	Illumina HiSeq	Phase_I	18	2	NM_018186	0	0	0	0	0	A6NFP1|B3KU42|Q3KNQ1|Q9H8L5|Q9NVJ0	Missense_Mutation	SNP	ENST00000286031.6	37	CCDS1285.1	.	.	.	.	.	.	.	.	.	.	T	27.6	4.849916	0.91277	.	.	ENSG00000000460	ENST00000413811;ENST00000359326;ENST00000456684;ENST00000286031	T;T;T;T	0.49139	0.79;0.79;0.79;0.79	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	T	0.62551	0.2437	M	0.78637	2.42	0.53005	D	0.999963	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.87578	0.987;0.998;0.998	T	0.69105	-0.5233	10	0.87932	D	0	-24.8356	14.1068	0.65096	0.0:0.0:0.0:1.0	.	156;127;185	B4E0A9;B4DGF2;Q9NSG2	.;.;CA112_HUMAN	L	156;185;243;185	ENSP00000389257:F156L;ENSP00000352276:F185L;ENSP00000415583:F243L;ENSP00000286031:F185L	ENSP00000286031:F185L	F	+	1	0	C1orf112	168041843	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.055000	0.76656	2.067000	0.61834	0.533000	0.62120	TTT	.		0.269	C1orf112-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087126.3	NM_018186	
RRP15	51018	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	218480910	218480910	+	Missense_Mutation	SNP	T	T	G			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr1:218480910T>G	ENST00000366932.3	+	4	671	c.641T>G	c.(640-642)tTg>tGg	p.L214W		NM_016052.3	NP_057136.2	Q9Y3B9	RRP15_HUMAN	ribosomal RNA processing 15 homolog (S. cerevisiae)	214						mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)			ACBD6/RRP15(2)	NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)	14				all cancers(67;0.0315)|OV - Ovarian serous cystadenocarcinoma(81;0.0411)|GBM - Glioblastoma multiforme(131;0.06)|Epithelial(68;0.248)		ATCAGTGTTTTGAGAGGGATG	0.373																																					p.L214W		.											.	RRP15-90	0			c.T641G						.						109.0	106.0	107.0					1																	218480910		2203	4300	6503	SO:0001583	missense	51018	exon4			GTGTTTTGAGAGG		CCDS1520.2	1q41	2008-02-05			ENSG00000067533	ENSG00000067533			24255	protein-coding gene	gene with protein product		611193	"""KIAA0507"""	KIAA0507		15769876	Standard	NM_016052		Approved	CGI-115	uc001hlj.3	Q9Y3B9	OTTHUMG00000039494	ENST00000366932.3:c.641T>G	1.37:g.218480910T>G	ENSP00000355899:p.Leu214Trp	Somatic	59	0		WXS	Illumina HiSeq	Phase_I	28	24	NM_016052	0	0	1	10	9		Missense_Mutation	SNP	ENST00000366932.3	37	CCDS1520.2	.	.	.	.	.	.	.	.	.	.	T	28.0	4.883907	0.91814	.	.	ENSG00000067533	ENST00000366932	T	0.56275	0.47	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.78329	0.4266	M	0.90759	3.145	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	T	0.83015	-0.0170	10	0.87932	D	0	.	16.5764	0.84681	0.0:0.0:0.0:1.0	.	214	Q9Y3B9	RRP15_HUMAN	W	214	ENSP00000355899:L214W	ENSP00000355899:L214W	L	+	2	0	RRP15	216547533	1.000000	0.71417	0.940000	0.37924	0.987000	0.75469	7.935000	0.87658	2.371000	0.80710	0.533000	0.62120	TTG	.		0.373	RRP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095284.1	NM_016052	
GALNT2	2590	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	230385000	230385000	+	Missense_Mutation	SNP	C	C	A			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr1:230385000C>A	ENST00000366672.4	+	9	960	c.888C>A	c.(886-888)aaC>aaA	p.N296K	GALNT2_ENST00000541865.1_Missense_Mutation_p.N206K|GALNT2_ENST00000543760.1_Missense_Mutation_p.N258K	NM_004481.3	NP_004472.1	Q10471	GALT2_HUMAN	polypeptide N-acetylgalactosaminyltransferase 2	296					cellular protein metabolic process (GO:0044267)|immunoglobulin biosynthetic process (GO:0002378)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|protein O-linked glycosylation via serine (GO:0018242)|protein O-linked glycosylation via threonine (GO:0018243)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|manganese ion binding (GO:0030145)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(5)|skin(2)	32	Breast(184;0.193)|Ovarian(103;0.249)	all_cancers(173;0.156)|Prostate(94;0.179)				GGCAGGGGAACCCAGTCGCCC	0.567																																					p.N296K		.											.	GALNT2-92	0			c.C888A						.						68.0	73.0	71.0					1																	230385000		2203	4300	6503	SO:0001583	missense	2590	exon9			GGGGAACCCAGTC	BC041120	CCDS1582.1	1q41-q42	2014-03-13	2014-03-13		ENSG00000143641	ENSG00000143641	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4124	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 2"""	602274	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2)"""			9592121, 7592619	Standard	NM_004481		Approved	GalNAc-T2	uc010pwa.1	Q10471	OTTHUMG00000037771	ENST00000366672.4:c.888C>A	1.37:g.230385000C>A	ENSP00000355632:p.Asn296Lys	Somatic	74	0		WXS	Illumina HiSeq	Phase_I	29	18	NM_004481	0	0	2	13	11	A8K1Y3|B7Z8V8|C5HU00|Q9NPY4	Missense_Mutation	SNP	ENST00000366672.4	37	CCDS1582.1	.	.	.	.	.	.	.	.	.	.	C	12.77	2.038196	0.35989	.	.	ENSG00000143641	ENST00000543760;ENST00000366672;ENST00000543291;ENST00000541865	T;T;T	0.59638	0.25;0.25;0.25	4.99	0.378	0.16204	Glycosyl transferase, family 2 (1);	0.000000	0.85682	D	0.000000	T	0.39118	0.1066	L	0.28649	0.875	0.80722	D	1	B;B	0.27882	0.192;0.063	B;B	0.20577	0.03;0.018	T	0.21690	-1.0238	10	0.66056	D	0.02	.	8.1747	0.31275	0.0:0.5081:0.0:0.4919	.	296;258	Q10471;G3V1S6	GALT2_HUMAN;.	K	258;296;177;206	ENSP00000445017:N258K;ENSP00000355632:N296K;ENSP00000444346:N206K	ENSP00000355632:N296K	N	+	3	2	GALNT2	228451623	0.998000	0.40836	0.988000	0.46212	0.888000	0.51559	0.520000	0.22878	0.244000	0.21351	-0.373000	0.07131	AAC	.		0.567	GALNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092158.1	NM_004481	
RGS7	6000	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	241094065	241094065	+	Missense_Mutation	SNP	G	G	C			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr1:241094065G>C	ENST00000407727.1	-	5	336	c.337C>G	c.(337-339)Ccc>Gcc	p.P113A	RGS7_ENST00000331110.7_Missense_Mutation_p.P87A|RGS7_ENST00000366565.1_Missense_Mutation_p.P113A|RGS7_ENST00000446183.2_Missense_Mutation_p.P29A|RGS7_ENST00000348120.2_Intron|RGS7_ENST00000401882.1_Intron|RGS7_ENST00000366562.4_Missense_Mutation_p.P113A|RGS7_ENST00000366564.1_Missense_Mutation_p.P113A|RGS7_ENST00000366563.1_Missense_Mutation_p.P113A			P49802	RGS7_HUMAN	regulator of G-protein signaling 7	113					G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite terminus (GO:0044292)|heterotrimeric G-protein complex (GO:0005834)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta-subunit binding (GO:0031681)|GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(51)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			CAAAAATAGGGGGTCTGCGGA	0.383																																					p.P113A		.											.	RGS7-232	0			c.C337G						.						102.0	114.0	110.0					1																	241094065		2203	4300	6503	SO:0001583	missense	6000	exon6			AATAGGGGGTCTG	BC022009	CCDS31071.1, CCDS60457.1, CCDS60458.1, CCDS60459.1	1q43	2008-02-05	2007-08-14		ENSG00000182901	ENSG00000182901		"""Regulators of G-protein signaling"""	10003	protein-coding gene	gene with protein product		602517	"""regulator of G-protein signalling 7"""			8548815	Standard	XM_005273218		Approved		uc001hyv.2	P49802	OTTHUMG00000040107	ENST00000407727.1:c.337C>G	1.37:g.241094065G>C	ENSP00000384428:p.Pro113Ala	Somatic	173	0		WXS	Illumina HiSeq	Phase_I	81	68	NM_002924	0	0	0	0	0	Q5T3H4|Q8TD66|Q8TD67|Q8WW09|Q9UNU7|Q9Y6B9	Missense_Mutation	SNP	ENST00000407727.1	37		.	.	.	.	.	.	.	.	.	.	G	25.7	4.660563	0.88154	.	.	ENSG00000182901	ENST00000331110;ENST00000366565;ENST00000366564;ENST00000366563;ENST00000446183;ENST00000366562;ENST00000407727	T;T;T;T;T;T;T	0.47177	1.16;1.1;1.14;1.13;0.85;1.14;1.11	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.74604	0.3738	M	0.88640	2.97	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.987;0.998;0.994;0.999;0.996	T	0.78907	-0.2019	10	0.87932	D	0	-3.1678	17.2744	0.87111	0.0:0.0:1.0:0.0	.	29;87;113;113;113	B7Z223;B7Z257;P49802-2;P49802-5;P49802-3	.;.;.;.;.	A	87;113;113;113;29;113;113	ENSP00000331485:P87A;ENSP00000355523:P113A;ENSP00000355522:P113A;ENSP00000355521:P113A;ENSP00000390138:P29A;ENSP00000355520:P113A;ENSP00000384428:P113A	ENSP00000331485:P87A	P	-	1	0	RGS7	239160688	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	9.000000	0.93564	2.769000	0.95229	0.655000	0.94253	CCC	.		0.383	RGS7-204	KNOWN	basic	protein_coding	protein_coding		NM_002924	
MLLT10	8028	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	22022934	22022934	+	Missense_Mutation	SNP	A	A	T			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr10:22022934A>T	ENST00000307729.7	+	20	2912	c.2734A>T	c.(2734-2736)Att>Ttt	p.I912F	MLLT10_ENST00000377059.3_Missense_Mutation_p.I912F|MLLT10_ENST00000377072.3_Missense_Mutation_p.I928F|MLLT10_ENST00000446906.2_Missense_Mutation_p.I912F			P55197	AF10_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10	912					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6						AATTAATGGCATTGTAGGAGC	0.498			T	"""MLL, PICALM, CDK6"""	AL																																p.I928F		.		Dom	yes		10	10p12	8028	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 (AF10)"""		L	.	MLLT10-658	0			c.A2782T						.						105.0	92.0	96.0					10																	22022934		2203	4300	6503	SO:0001583	missense	8028	exon21			AATGGCATTGTAG	U13948	CCDS7135.1, CCDS55706.1, CCDS55707.1, CCDS55708.1	10p12	2013-01-28	2001-11-28		ENSG00000078403	ENSG00000078403		"""Zinc fingers, PHD-type"""	16063	protein-coding gene	gene with protein product		602409	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 10"""			7888665	Standard	NM_004641		Approved	AF10	uc021pny.1	P55197	OTTHUMG00000017799	ENST00000307729.7:c.2734A>T	10.37:g.22022934A>T	ENSP00000307411:p.Ile912Phe	Somatic	86	0		WXS	Illumina HiSeq	Phase_I	78	33	NM_004641	0	0	3	6	3	B1ANA8|Q5JT37|Q5VX90|Q66K63	Missense_Mutation	SNP	ENST00000307729.7	37	CCDS55708.1	.	.	.	.	.	.	.	.	.	.	A	17.10	3.302680	0.60195	.	.	ENSG00000078403	ENST00000377072;ENST00000446906;ENST00000307729;ENST00000396529;ENST00000377059	T;T;T;T	0.19938	2.21;2.22;2.11;2.22	4.55	4.55	0.56014	.	0.178156	0.48767	D	0.000174	T	0.33731	0.0873	L	0.55481	1.735	0.58432	D	0.999998	D;P;D;P	0.65815	0.96;0.745;0.995;0.883	P;B;P;B	0.56163	0.59;0.169;0.793;0.231	T	0.06954	-1.0798	10	0.56958	D	0.05	.	12.4706	0.55785	1.0:0.0:0.0:0.0	.	607;912;912;928	Q5HYC6;E9PBP4;Q5VX90;P55197	.;.;.;AF10_HUMAN	F	928;912;912;747;912	ENSP00000366272:I928F;ENSP00000401406:I912F;ENSP00000307411:I912F;ENSP00000366258:I912F	ENSP00000307411:I912F	I	+	1	0	MLLT10	22062940	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.644000	0.67902	1.686000	0.51046	0.455000	0.32223	ATT	.		0.498	MLLT10-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047136.1		
ANXA11	311	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	81927005	81927005	+	Missense_Mutation	SNP	A	A	C			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr10:81927005A>C	ENST00000438331.1	-	7	1108	c.626T>G	c.(625-627)cTg>cGg	p.L209R	ANXA11_ENST00000537102.1_Missense_Mutation_p.L176R|ANXA11_ENST00000360615.4_Missense_Mutation_p.L209R|ANXA11_ENST00000535999.1_Missense_Mutation_p.L209R|ANXA11_ENST00000372231.3_Missense_Mutation_p.L209R|ANXA11_ENST00000265447.4_Missense_Mutation_p.L209R|ANXA11_ENST00000422982.3_Missense_Mutation_p.L209R	NM_145869.1	NP_665876.1	P50995	ANX11_HUMAN	annexin A11	209					cytokinesis, completion of separation (GO:0007109)|phagocytosis (GO:0006909)|response to calcium ion (GO:0051592)	azurophil granule (GO:0042582)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|specific granule (GO:0042581)|spindle (GO:0005819)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|MHC class II protein complex binding (GO:0023026)|phosphatidylethanolamine binding (GO:0008429)|poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)			endometrium(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|urinary_tract(1)	17	Prostate(51;0.00985)|all_epithelial(25;0.0951)		Colorectal(32;0.109)			GGCCTTCCGCAGGACCTCGGC	0.577																																					p.L209R		.											.	ANXA11-91	0			c.T626G						.						66.0	61.0	63.0					10																	81927005		2203	4300	6503	SO:0001583	missense	311	exon6			TTCCGCAGGACCT	L19605	CCDS7364.1, CCDS60576.1	10q22.3	2005-11-09			ENSG00000122359	ENSG00000122359		"""Annexins"""	535	protein-coding gene	gene with protein product		602572		ANX11		7508441, 9503022	Standard	NM_001157		Approved		uc001kbt.1	P50995	OTTHUMG00000018604	ENST00000438331.1:c.626T>G	10.37:g.81927005A>C	ENSP00000398610:p.Leu209Arg	Somatic	70	0		WXS	Illumina HiSeq	Phase_I	61	31	NM_145868	0	0	161	286	125	B4DVE7	Missense_Mutation	SNP	ENST00000438331.1	37	CCDS7364.1	.	.	.	.	.	.	.	.	.	.	.	26.1	4.707456	0.89018	.	.	ENSG00000122359	ENST00000372231;ENST00000422982;ENST00000438331;ENST00000372234;ENST00000360615;ENST00000265447;ENST00000535999;ENST00000424188;ENST00000537102	T;T;T;T;T;T;T	0.18338	2.22;2.22;2.22;2.22;2.22;2.22;2.22	5.31	5.31	0.75309	.	0.000000	0.64402	D	0.000001	T	0.61924	0.2386	H	0.99498	4.595	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.995;0.995	T	0.78922	-0.2013	10	0.87932	D	0	.	13.5153	0.61537	1.0:0.0:0.0:0.0	.	309;209;209	B7Z6L0;Q5T0G8;P50995	.;.;ANX11_HUMAN	R	209;209;209;209;209;209;209;116;176	ENSP00000361305:L209R;ENSP00000404412:L209R;ENSP00000398610:L209R;ENSP00000353827:L209R;ENSP00000265447:L209R;ENSP00000441748:L209R;ENSP00000441400:L176R	ENSP00000265447:L209R	L	-	2	0	ANXA11	81916985	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	8.792000	0.91856	2.151000	0.67156	0.459000	0.35465	CTG	.		0.577	ANXA11-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049044.1	NM_145869	
PSTK	118672	hgsc.bcm.edu;broad.mit.edu	37	10	124740205	124740205	+	Silent	SNP	A	A	G			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr10:124740205A>G	ENST00000368887.3	+	1	650	c.210A>G	c.(208-210)cgA>cgG	p.R70R	PSTK_ENST00000405485.1_Silent_p.R70R	NM_153336.2	NP_699167.2	Q8IV42	PSTK_HUMAN	phosphoseryl-tRNA kinase	70					selenocysteine incorporation (GO:0001514)|selenocysteinyl-tRNA(Sec) biosynthetic process (GO:0097056)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|tRNA binding (GO:0000049)			endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(5)|skin(1)|stomach(2)	13		all_neural(114;0.169)|Glioma(114;0.222)		Colorectal(40;0.0686)|COAD - Colon adenocarcinoma(40;0.0725)		CAAGAGCGCGACCGGCGGTCA	0.756											OREG0020597	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R70R		.											.	PSTK-91	0			c.A210G						.						8.0	7.0	8.0					10																	124740205		1998	3971	5969	SO:0001819	synonymous_variant	118672	exon1			AGCGCGACCGGCG	AK127173	CCDS7633.1	10q26.13	2007-04-17	2007-04-17	2007-04-17	ENSG00000179988	ENSG00000179988			28578	protein-coding gene	gene with protein product		611310	"""chromosome 10 open reading frame 89"""	C10orf89		15317934	Standard	NM_153336		Approved	MGC35392	uc001lgy.1	Q8IV42	OTTHUMG00000019191	ENST00000368887.3:c.210A>G	10.37:g.124740205A>G		Somatic	22	0	1536	WXS	Illumina HiSeq	Phase_I	10	4	NM_153336	0	0	0	0	0	Q6ZSS9	Silent	SNP	ENST00000368887.3	37	CCDS7633.1	.	.	.	.	.	.	.	.	.	.	A	9.597	1.127752	0.20959	.	.	ENSG00000179988	ENST00000406217	.	.	.	4.31	-1.6	0.08426	.	.	.	.	.	T	0.18800	0.0451	.	.	.	0.19300	N	0.999975	.	.	.	.	.	.	T	0.24261	-1.0165	4	.	.	.	0.6253	1.3993	0.02267	0.2116:0.3347:0.3029:0.1508	.	.	.	.	G	71	.	.	D	+	2	0	PSTK	124730195	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.142000	0.10311	-0.157000	0.11059	-0.242000	0.12053	GAC	.		0.756	PSTK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050811.1	NM_153336	
MUC5B	727897	hgsc.bcm.edu	37	11	1253368	1253368	+	Silent	SNP	C	C	A			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr11:1253368C>A	ENST00000529681.1	+	15	1879	c.1821C>A	c.(1819-1821)ccC>ccA	p.P607P	MUC5B_ENST00000447027.1_Silent_p.P610P	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	607	VWFD 2. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		TTGAGGACCCCTGCTCCCTCA	0.682																																					p.P607P		.											.	.	0			c.C1821A						.						48.0	57.0	54.0					11																	1253368		2100	4195	6295	SO:0001819	synonymous_variant	727897	exon15			GGACCCCTGCTCC	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.1821C>A	11.37:g.1253368C>A		Somatic	41	0		WXS	Illumina HiSeq	Phase_I	35	2	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	37	CCDS44515.2																																																																																			.		0.682	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
INCENP	3619	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	61912744	61912744	+	Missense_Mutation	SNP	G	G	A			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr11:61912744G>A	ENST00000394818.3	+	13	2021	c.1819G>A	c.(1819-1821)Gac>Aac	p.D607N	INCENP_ENST00000278849.4_Missense_Mutation_p.D603N	NM_001040694.1	NP_001035784.1	Q9NQS7	INCE_HUMAN	inner centromere protein antigens 135/155kDa	607					chromosome segregation (GO:0007059)|cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	central element (GO:0000801)|chromocenter (GO:0010369)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lateral element (GO:0000800)|microtubule (GO:0005874)|midbody (GO:0030496)|pericentric heterochromatin (GO:0005721)|protein complex (GO:0043234)|spindle (GO:0005819)				breast(1)|endometrium(1)|kidney(6)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						TGCTCAGATCGACGAGAAGAC	0.582																																					p.D607N		.											.	INCENP-227	0			c.G1819A						.						103.0	107.0	105.0					11																	61912744		2202	4299	6501	SO:0001583	missense	3619	exon13			CAGATCGACGAGA	AF282265	CCDS31582.1, CCDS44624.1	11q12.3	2013-01-17	2002-08-29		ENSG00000149503	ENSG00000149503			6058	protein-coding gene	gene with protein product		604411	"""inner centromere protein antigens (135kD, 155kD)"""			1860899, 11453556	Standard	NM_001040694		Approved	FLJ31633	uc001nsw.1	Q9NQS7	OTTHUMG00000167470	ENST00000394818.3:c.1819G>A	11.37:g.61912744G>A	ENSP00000378295:p.Asp607Asn	Somatic	124	1		WXS	Illumina HiSeq	Phase_I	105	46	NM_001040694	0	0	2	5	3	A8MQD2|Q5Y192	Missense_Mutation	SNP	ENST00000394818.3	37	CCDS44624.1	.	.	.	.	.	.	.	.	.	.	G	16.50	3.141344	0.57044	.	.	ENSG00000149503	ENST00000394818;ENST00000278849	T;T	0.16457	2.36;2.34	4.7	3.78	0.43462	.	0.232274	0.29916	N	0.010874	T	0.12433	0.0302	L	0.46157	1.445	0.38861	D	0.956484	B;P;B	0.36249	0.436;0.545;0.41	B;B;B	0.23716	0.027;0.048;0.022	T	0.07404	-1.0774	10	0.42905	T	0.14	.	10.2229	0.43207	0.098:0.0:0.902:0.0	.	603;603;607	B3KPD3;Q9NQS7-2;Q9NQS7	.;.;INCE_HUMAN	N	607;603	ENSP00000378295:D607N;ENSP00000278849:D603N	ENSP00000278849:D603N	D	+	1	0	INCENP	61669320	1.000000	0.71417	0.303000	0.25071	0.969000	0.65631	5.818000	0.69236	2.522000	0.85027	0.561000	0.74099	GAC	.		0.582	INCENP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000394723.2	NM_020238	
AP5B1	91056	hgsc.bcm.edu	37	11	65547487	65547487	+	Silent	SNP	G	G	A			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr11:65547487G>A	ENST00000532090.2	-	2	687	c.477C>T	c.(475-477)agC>agT	p.S159S		NM_138368.4	NP_612377.4	Q2VPB7	AP5B1_HUMAN	adaptor-related protein complex 5, beta 1 subunit	159	Leu-rich.				endosomal transport (GO:0016197)|protein transport (GO:0015031)	AP-type membrane coat adaptor complex (GO:0030119)|lysosomal membrane (GO:0005765)				lung(1)	1						CGGGCTTGCAGCTCTCTAGCT	0.716																																					p.S159S		.											.	.	0			c.C477T						.						3.0	5.0	4.0					11																	65547487		1695	3877	5572	SO:0001819	synonymous_variant	91056	exon2			CTTGCAGCTCTCT	JQ313135	CCDS58146.1	11q13.1	2012-02-29			ENSG00000254470	ENSG00000254470			25104	protein-coding gene	gene with protein product		614367				22022230	Standard	NM_138368		Approved	PP1030, AP-5, DKFZp761E198	uc031qbm.1	Q2VPB7	OTTHUMG00000166593	ENST00000532090.2:c.477C>T	11.37:g.65547487G>A		Somatic	6	1		WXS	Illumina HiSeq	Phase_I	7	3	NM_138368	0	0	1	1	0	A1L0S6|H6WUK2|Q0D2Q2|Q8N3J7|Q8WYH6	Silent	SNP	ENST00000532090.2	37	CCDS58146.1																																																																																			.		0.716	AP5B1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390636.2	NM_138368	
EED	8726	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	85956385	85956385	+	Splice_Site	SNP	T	T	A			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr11:85956385T>A	ENST00000263360.6	+	1	800	c.114T>A	c.(112-114)aaT>aaA	p.N38K	EED_ENST00000528180.1_Splice_Site_p.N38K|EED_ENST00000327320.4_Splice_Site_p.N38K|EED_ENST00000351625.6_Splice_Site_p.N38K	NM_003797.3	NP_003788.2	O75530	EED_HUMAN	embryonic ectoderm development	38					negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K27 methylation (GO:0061087)|regulation of gene expression by genetic imprinting (GO:0006349)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|histone methyltransferase activity (GO:0042054)|identical protein binding (GO:0042802)			haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	21		Acute lymphoblastic leukemia(157;7.24e-07)|all_hematologic(158;0.00092)				GAGACGAGAATGTAAGTGCAG	0.572																																					p.N38K		.											.	EED-227	0			c.T114A						.						52.0	42.0	46.0					11																	85956385		2203	4299	6502	SO:0001630	splice_region_variant	8726	exon1			CGAGAATGTAAGT	AF078933	CCDS8273.1, CCDS8274.1	11q14.2-q22.3	2013-01-10			ENSG00000074266	ENSG00000074266		"""WD repeat domain containing"""	3188	protein-coding gene	gene with protein product	"""WD protein associating with integrin cytoplasmic tails 1"""	605984				9765275, 9806832	Standard	NM_003797		Approved	WAIT-1, HEED	uc001pbp.3	O75530	OTTHUMG00000167209	ENST00000263360.6:c.114+1T>A	11.37:g.85956385T>A		Somatic	40	0		WXS	Illumina HiSeq	Phase_I	35	17	NM_003797	0	0	0	0	0	A8K7V5|O00149|Q6NTH2|Q7LDA5|Q7LDG8|Q86VV2|Q9UNY7	Missense_Mutation	SNP	ENST00000263360.6	37	CCDS8273.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.68|15.68	2.906014|2.906014	0.52333|0.52333	.|.	.|.	ENSG00000074266|ENSG00000074266	ENST00000534595|ENST00000263360;ENST00000528180;ENST00000351625;ENST00000327320;ENST00000537092	.|T;T;T;T	.|0.79653	.|-0.79;-1.29;-0.71;-0.72	4.73|4.73	2.47|2.47	0.30058|0.30058	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.80347|0.80347	0.4606|0.4606	L|L	0.36672|0.36672	1.1|1.1	0.80722|0.80722	D|D	1|1	.|B;D;B;B	.|0.57899	.|0.144;0.981;0.022;0.183	.|B;D;B;B	.|0.67900	.|0.055;0.954;0.008;0.028	T|T	0.76203|0.76203	-0.3045|-0.3045	5|9	.|.	.|.	.|.	-22.0933|-22.0933	6.2948|6.2948	0.21079|0.21079	0.0:0.3337:0.0:0.6663|0.0:0.3337:0.0:0.6663	.|.	.|38;38;38;38	.|O75530-3;E9PJK2;O75530-2;O75530	.|.;.;.;EED_HUMAN	N|K	37|38	.|ENSP00000263360:N38K;ENSP00000431778:N38K;ENSP00000338186:N38K;ENSP00000315587:N38K	.|.	I|N	+|+	2|3	0|2	EED|EED	85634033|85634033	0.966000|0.966000	0.33281|0.33281	1.000000|1.000000	0.80357|0.80357	0.966000|0.966000	0.64601|0.64601	0.057000|0.057000	0.14279|0.14279	0.949000|0.949000	0.37715|0.37715	0.533000|0.533000	0.62120|0.62120	ATT|AAT	.		0.572	EED-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393733.1	NM_003797	Missense_Mutation
SLC35F2	54733	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	107677532	107677532	+	Missense_Mutation	SNP	A	A	C			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr11:107677532A>C	ENST00000525815.1	-	4	905	c.485T>G	c.(484-486)gTg>gGg	p.V162G	SLC35F2_ENST00000429869.1_Missense_Mutation_p.V162G|SLC35F2_ENST00000375682.4_Missense_Mutation_p.V115G|SLC35F2_ENST00000265836.7_Missense_Mutation_p.V14G|SLC35F2_ENST00000525071.1_Missense_Mutation_p.V162G	NM_017515.4	NP_059985.2	Q8IXU6	S35F2_HUMAN	solute carrier family 35, member F2	162					transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		all_cancers(61;9.46e-06)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;0.000111)|all_hematologic(158;0.000315)|all_epithelial(67;0.00197)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)|Epithelial(105;0.000105)|all cancers(92;0.00217)		GAAGTGGATCACTCTGTATCT	0.463																																					p.V162G		.											.	SLC35F2-90	0			c.T485G						.						137.0	136.0	136.0					11																	107677532		1983	4179	6162	SO:0001583	missense	54733	exon4			TGGATCACTCTGT		CCDS41709.1	11q22.3	2013-05-22			ENSG00000110660	ENSG00000110660		"""Solute carriers"""	23615	protein-coding gene	gene with protein product						9119394	Standard	NM_017515		Approved	FLJ13018	uc001pjq.3	Q8IXU6	OTTHUMG00000166366	ENST00000525815.1:c.485T>G	11.37:g.107677532A>C	ENSP00000436785:p.Val162Gly	Somatic	100	0		WXS	Illumina HiSeq	Phase_I	81	32	NM_017515	0	0	14	24	10	Q14963|Q5JPA8|Q6ZRQ3|Q9H947	Missense_Mutation	SNP	ENST00000525815.1	37	CCDS41709.1	.	.	.	.	.	.	.	.	.	.	A	16.47	3.133031	0.56828	.	.	ENSG00000110660	ENST00000525815;ENST00000525071;ENST00000265836;ENST00000375682;ENST00000429869	T;T;T;T	0.70986	-0.53;-0.53;-0.53;-0.53	4.86	4.86	0.63082	.	0.341161	0.28140	N	0.016457	T	0.72211	0.3432	L	0.53249	1.67	0.50467	D	0.999875	P;P	0.42296	0.605;0.775	B;P	0.46208	0.405;0.507	T	0.75836	-0.3177	10	0.66056	D	0.02	.	14.4886	0.67634	1.0:0.0:0.0:0.0	.	162;162	E9PJD1;Q8IXU6	.;S35F2_HUMAN	G	162;162;14;115;162	ENSP00000436785:V162G;ENSP00000434307:V162G;ENSP00000364834:V115G;ENSP00000393571:V162G	ENSP00000265836:V14G	V	-	2	0	SLC35F2	107182742	1.000000	0.71417	1.000000	0.80357	0.534000	0.34807	3.837000	0.55820	1.824000	0.53156	0.533000	0.62120	GTG	.		0.463	SLC35F2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389417.1	NM_017515	
SLC6A12	6539	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	308019	308019	+	Missense_Mutation	SNP	A	A	T			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr12:308019A>T	ENST00000428720.1	-	8	1533	c.790T>A	c.(790-792)Tac>Aac	p.Y264N	SLC6A12_ENST00000424061.2_Missense_Mutation_p.Y264N|SLC6A12_ENST00000359674.4_Missense_Mutation_p.Y264N|SLC6A12_ENST00000538272.1_5'UTR|SLC6A12_ENST00000397296.2_Missense_Mutation_p.Y264N|SLC6A12_ENST00000536824.1_Missense_Mutation_p.Y264N	NM_001122848.2	NP_001116320.1	P48065	S6A12_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 12	264					amino acid transport (GO:0006865)|cellular hyperosmotic response (GO:0071474)|cellular water homeostasis (GO:0009992)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|response to organic substance (GO:0010033)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(8)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	26	all_cancers(10;0.0172)|all_epithelial(11;0.0283)|all_lung(10;0.0392)|Lung NSC(10;0.0567)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00227)			ATGCCCTGGTAGGCTCCGGGA	0.562																																					p.Y264N		.											.	SLC6A12-91	0			c.T790A						.						143.0	119.0	127.0					12																	308019		2203	4300	6503	SO:0001583	missense	6539	exon8			CCTGGTAGGCTCC	L42300	CCDS8501.1	12p13	2013-07-19	2013-07-19		ENSG00000111181	ENSG00000111181		"""Solute carriers"""	11045	protein-coding gene	gene with protein product	"""betaine/GABA transporter-1"""	603080	"""solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12"""			7589472	Standard	NM_003044		Approved	BGT-1	uc009zdh.2	P48065	OTTHUMG00000090309	ENST00000428720.1:c.790T>A	12.37:g.308019A>T	ENSP00000388184:p.Tyr264Asn	Somatic	104	0		WXS	Illumina HiSeq	Phase_I	128	69	NM_001122848	1	0	13	28	14	A0AV52|B2R992|D3DUN8	Missense_Mutation	SNP	ENST00000428720.1	37	CCDS8501.1	.	.	.	.	.	.	.	.	.	.	A	8.181	0.793882	0.16327	.	.	ENSG00000111181	ENST00000359674;ENST00000397296;ENST00000428720;ENST00000424061;ENST00000536824	T;T;T;T;T	0.74315	-0.83;-0.83;-0.83;-0.83;-0.83	4.44	3.19	0.36642	.	0.450623	0.22962	N	0.053522	T	0.74245	0.3691	L	0.52905	1.665	0.09310	N	1	P	0.34800	0.469	P	0.48901	0.594	T	0.62163	-0.6912	10	0.28530	T	0.3	.	6.6378	0.22893	0.6374:0.2349:0.0:0.1277	.	264	P48065	S6A12_HUMAN	N	264	ENSP00000352702:Y264N;ENSP00000380464:Y264N;ENSP00000388184:Y264N;ENSP00000399136:Y264N;ENSP00000444268:Y264N	ENSP00000352702:Y264N	Y	-	1	0	SLC6A12	178280	0.021000	0.18746	0.919000	0.36401	0.166000	0.22503	0.594000	0.24014	1.762000	0.52044	0.533000	0.62120	TAC	.		0.562	SLC6A12-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206671.2	NM_003044	
KDM5A	5927	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	401948	401948	+	Missense_Mutation	SNP	A	A	G			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr12:401948A>G	ENST00000399788.2	-	27	5205	c.4843T>C	c.(4843-4845)Tgc>Cgc	p.C1615R	KDM5A_ENST00000540838.1_5'UTR|KDM5A_ENST00000382815.4_Missense_Mutation_p.C1615R	NM_001042603.1	NP_001036068.1	P29375	KDM5A_HUMAN	lysine (K)-specific demethylase 5A	1615					chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|multicellular organismal development (GO:0007275)|negative regulation of histone deacetylase activity (GO:1901726)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			NS(2)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(29)|ovary(1)|prostate(5)|skin(6)|stomach(1)|urinary_tract(2)	77						GGCCTTTGGCAGTTCTGTGCT	0.468			T	NUP98	AML																																p.C1615R		.		Dom	yes		12	12p11	5927	"""lysine (K)-specific demethylase 5A, JARID1A"""		L	.	KDM5A-227	0			c.T4843C						.						118.0	119.0	119.0					12																	401948		2033	4195	6228	SO:0001583	missense	5927	exon27			TTTGGCAGTTCTG		CCDS41736.1	12p13.33	2013-01-28	2009-04-06	2009-04-06	ENSG00000073614	ENSG00000073614		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	9886	protein-coding gene	gene with protein product		180202	"""retinoblastoma-binding protein 2"", ""Jumonji, AT rich interactive domain 1A (RBBP2-like)"", ""jumonji, AT rich interactive domain 1A"""	RBBP2, JARID1A		1857421	Standard	NM_001042603		Approved		uc001qif.1	P29375	OTTHUMG00000168055	ENST00000399788.2:c.4843T>C	12.37:g.401948A>G	ENSP00000382688:p.Cys1615Arg	Somatic	137	0		WXS	Illumina HiSeq	Phase_I	151	48	NM_001042603	0	0	8	15	7	A8MV76|Q4LE72|Q86XZ1	Missense_Mutation	SNP	ENST00000399788.2	37	CCDS41736.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.219116	0.79464	.	.	ENSG00000073614	ENST00000399788;ENST00000382815	D;D	0.99667	-6.34;-3.28	5.48	5.48	0.80851	Zinc finger, PHD-finger (1);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.150326	0.64402	D	0.000005	D	0.99354	0.9773	L	0.59436	1.845	0.80722	D	1	D;D	0.64830	0.99;0.994	P;P	0.60682	0.758;0.878	D	0.98834	1.0752	10	0.87932	D	0	-9.1245	15.575	0.76368	1.0:0.0:0.0:0.0	.	1615;1615	P29375;P29375-2	KDM5A_HUMAN;.	R	1615	ENSP00000382688:C1615R;ENSP00000372265:C1615R	ENSP00000372265:C1615R	C	-	1	0	KDM5A	272209	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.313000	0.96297	2.080000	0.62538	0.528000	0.53228	TGC	.		0.468	KDM5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397812.1	NM_005056	
C12orf5	57103	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	4461705	4461705	+	Missense_Mutation	SNP	C	C	G			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr12:4461705C>G	ENST00000179259.4	+	6	728	c.661C>G	c.(661-663)Ctg>Gtg	p.L221V		NM_020375.2	NP_065108.1	Q9NQ88	TIGAR_HUMAN	chromosome 12 open reading frame 5	221					intestinal epithelial cell development (GO:0060576)|negative regulation of macromitophagy (GO:1901525)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|response to gamma radiation (GO:0010332)|response to xenobiotic stimulus (GO:0009410)	intracellular (GO:0005622)	fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)			endometrium(1)|large_intestine(1)|lung(5)|skin(3)	10			all cancers(3;1.15e-07)|Colorectal(7;0.00165)|OV - Ovarian serous cystadenocarcinoma(31;0.00596)|COAD - Colon adenocarcinoma(12;0.0229)|GBM - Glioblastoma multiforme(3;0.0266)|STAD - Stomach adenocarcinoma(119;0.206)			ACCAGCCACTCTGAGCAGATC	0.423																																					p.L221V	Colon(1;100 192 35375 49454 52532)	.											.	C12orf5-226	0			c.C661G						.						100.0	89.0	93.0					12																	4461705		2203	4300	6503	SO:0001583	missense	57103	exon6			GCCACTCTGAGCA	AJ272206	CCDS8525.1	12p13.32	2014-05-29	2009-11-24	2009-11-24	ENSG00000078237	ENSG00000078237	3.1.3.46		1185	protein-coding gene	gene with protein product	"""TP53-induced glycolysis and apoptosis regulator"""	610775				16140933, 16839880, 18945750, 19713938	Standard	NM_020375		Approved	TIGAR	uc001qmp.3	Q9NQ88		ENST00000179259.4:c.661C>G	12.37:g.4461705C>G	ENSP00000179259:p.Leu221Val	Somatic	136	0		WXS	Illumina HiSeq	Phase_I	125	49	NM_020375	0	0	4	8	4	B2R840	Missense_Mutation	SNP	ENST00000179259.4	37	CCDS8525.1	.	.	.	.	.	.	.	.	.	.	C	3.030	-0.199744	0.06219	.	.	ENSG00000078237	ENST00000179259	T	0.80738	-1.41	5.86	-2.23	0.06930	.	0.842330	0.10652	N	0.649789	T	0.68659	0.3025	L	0.43152	1.355	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.54609	-0.8268	10	0.40728	T	0.16	-13.6183	6.2439	0.20805	0.0912:0.2965:0.4592:0.1531	.	221	Q9NQ88	TIGAR_HUMAN	V	221	ENSP00000179259:L221V	ENSP00000179259:L221V	L	+	1	2	C12orf5	4331966	0.005000	0.15991	0.000000	0.03702	0.066000	0.16364	-0.080000	0.11339	-0.333000	0.08476	-0.219000	0.12488	CTG	.		0.423	C12orf5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398290.1	NM_020375	
GPR162	27239	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	6933600	6933600	+	Missense_Mutation	SNP	T	T	C			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr12:6933600T>C	ENST00000311268.3	+	2	1323	c.536T>C	c.(535-537)tTt>tCt	p.F179S	GPR162_ENST00000382315.3_Intron|GPR162_ENST00000428545.2_Intron	NM_019858.1	NP_062832.1	Q16538	GP162_HUMAN	G protein-coupled receptor 162	179						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(2)|skin(1)	18						GGCCTCGGCTTTGGCGTTTGC	0.597																																					p.F179S		.											.	GPR162-92	0			c.T536C						.						86.0	82.0	84.0					12																	6933600		2203	4300	6503	SO:0001583	missense	27239	exon2			TCGGCTTTGGCGT	U47928, U47929, U47924, U47925	CCDS8563.1, CCDS44819.1	12p13	2012-08-21						"""GPCR / Class A : Orphans"""	16693	protein-coding gene	gene with protein product						15777626	Standard	NM_014449		Approved	A-2, GRCA	uc001qqw.1	Q16538		ENST00000311268.3:c.536T>C	12.37:g.6933600T>C	ENSP00000311528:p.Phe179Ser	Somatic	131	0		WXS	Illumina HiSeq	Phase_I	97	39	NM_019858	0	0	0	2	2	Q16664|Q59EH5|Q66K56	Missense_Mutation	SNP	ENST00000311268.3	37	CCDS8563.1	.	.	.	.	.	.	.	.	.	.	T	19.89	3.910599	0.72983	.	.	ENSG00000250510	ENST00000311268	T	0.72051	-0.62	4.33	3.19	0.36642	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.59321	0.2185	L	0.34521	1.04	0.80722	D	1	P;B	0.41624	0.757;0.156	B;B	0.40602	0.334;0.053	T	0.60234	-0.7303	9	0.87932	D	0	.	9.5237	0.39152	0.0:0.0841:0.0:0.9159	.	179;179	B7Z3U3;Q16538	.;GP162_HUMAN	S	179	ENSP00000311528:F179S	ENSP00000311528:F179S	F	+	2	0	GPR162	6803861	1.000000	0.71417	0.747000	0.31113	0.888000	0.51559	7.858000	0.86971	0.722000	0.32252	0.402000	0.26972	TTT	.		0.597	GPR162-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399478.1	NM_019858	
ITPR2	3709	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	26809443	26809443	+	Missense_Mutation	SNP	C	C	G			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr12:26809443C>G	ENST00000381340.3	-	19	2647	c.2231G>C	c.(2230-2232)cGc>cCc	p.R744P		NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	744					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	CAGATACTGGCGATCCAAGCA	0.453																																					p.R744P		.											.	ITPR2-542	0			c.G2231C						.						68.0	70.0	69.0					12																	26809443		2001	4179	6180	SO:0001583	missense	3709	exon19			TACTGGCGATCCA	D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.2231G>C	12.37:g.26809443C>G	ENSP00000370744:p.Arg744Pro	Somatic	91	0		WXS	Illumina HiSeq	Phase_I	85	27	NM_002223	0	0	2	2	0	O94773	Missense_Mutation	SNP	ENST00000381340.3	37	CCDS41764.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.758328	0.89843	.	.	ENSG00000123104	ENST00000381340	D	0.95656	-3.77	4.62	4.62	0.57501	.	0.000000	0.85682	D	0.000000	D	0.97949	0.9325	M	0.87381	2.88	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98818	1.0746	10	0.87932	D	0	.	18.0329	0.89290	0.0:1.0:0.0:0.0	.	744	Q14571	ITPR2_HUMAN	P	744	ENSP00000370744:R744P	ENSP00000370744:R744P	R	-	2	0	ITPR2	26700710	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.596000	0.82721	2.546000	0.85860	0.655000	0.94253	CGC	.		0.453	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402732.1	NM_002223	
DIP2B	57609	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	51092173	51092173	+	Missense_Mutation	SNP	A	A	G			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr12:51092173A>G	ENST00000301180.5	+	18	2145	c.2111A>G	c.(2110-2112)tAt>tGt	p.Y704C		NM_173602.2	NP_775873.2	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B (Drosophila)	704						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(15)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	60						GGATTGAGCTATGGGGTAATA	0.463																																					p.Y704C		.											.	DIP2B-95	0			c.A2111G						.						108.0	101.0	103.0					12																	51092173		2203	4300	6503	SO:0001583	missense	57609	exon18			TGAGCTATGGGGT	AB040896	CCDS31799.1	12q13.12	2012-10-02	2006-01-13		ENSG00000066084	ENSG00000066084			29284	protein-coding gene	gene with protein product		611379					Standard	XM_005269044		Approved	KIAA1463, FLJ34278	uc001rwv.3	Q9P265	OTTHUMG00000169475	ENST00000301180.5:c.2111A>G	12.37:g.51092173A>G	ENSP00000301180:p.Tyr704Cys	Somatic	117	0		WXS	Illumina HiSeq	Phase_I	104	38	NM_173602	0	0	0	2	2	Q6B011|Q8N1L5|Q8NB38	Missense_Mutation	SNP	ENST00000301180.5	37	CCDS31799.1	.	.	.	.	.	.	.	.	.	.	A	19.81	3.896459	0.72639	.	.	ENSG00000066084	ENST00000301180	T	0.23552	1.9	5.2	5.2	0.72013	AMP-dependent synthetase/ligase (1);	0.113362	0.64402	D	0.000011	T	0.45498	0.1345	M	0.71581	2.175	0.42957	D	0.994399	D	0.63880	0.993	D	0.64687	0.928	T	0.38714	-0.9648	10	0.40728	T	0.16	-14.3821	11.1177	0.48270	0.8536:0.0:0.0:0.1464	.	704	Q9P265	DIP2B_HUMAN	C	704	ENSP00000301180:Y704C	ENSP00000301180:Y704C	Y	+	2	0	DIP2B	49378440	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.169000	0.77578	2.184000	0.69523	0.482000	0.46254	TAT	.		0.463	DIP2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404243.1	NM_173602	
ESPL1	9700	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	53680427	53680427	+	Missense_Mutation	SNP	C	C	A			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr12:53680427C>A	ENST00000257934.4	+	18	3998	c.3907C>A	c.(3907-3909)Cct>Act	p.P1303T	ESPL1_ENST00000552462.1_Missense_Mutation_p.P1303T	NM_012291.4	NP_036423.4	Q14674	ESPL1_HUMAN	extra spindle pole bodies homolog 1 (S. cerevisiae)	1303					apoptotic process (GO:0006915)|cytokinesis (GO:0000910)|establishment of mitotic spindle localization (GO:0040001)|homologous chromosome segregation (GO:0045143)|meiotic spindle organization (GO:0000212)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(10)|large_intestine(12)|lung(21)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(8)	70						AAAAAGTGTCCCTGGCTCAGA	0.527																																					p.P1303T	Colon(53;1069 1201 2587 5382)	.											.	ESPL1-228	0			c.C3907A						.						42.0	44.0	44.0					12																	53680427		2203	4300	6503	SO:0001583	missense	9700	exon18			AGTGTCCCTGGCT	D79987	CCDS8852.1	12q13.13	2014-08-04	2013-05-03		ENSG00000135476	ENSG00000135476	3.4.22.49		16856	protein-coding gene	gene with protein product	"""separin"", ""separase"", ""separin, cysteine protease"""	604143	"""extra spindle poles like 1 (S. cerevisiae)"""			8724849, 16258266	Standard	NM_012291		Approved	KIAA0165, ESP1, SEPA	uc001sck.2	Q14674	OTTHUMG00000169674	ENST00000257934.4:c.3907C>A	12.37:g.53680427C>A	ENSP00000257934:p.Pro1303Thr	Somatic	103	0		WXS	Illumina HiSeq	Phase_I	79	40	NM_012291	0	0	0	1	1		Missense_Mutation	SNP	ENST00000257934.4	37	CCDS8852.1	.	.	.	.	.	.	.	.	.	.	C	0.020	-1.435949	0.01108	.	.	ENSG00000135476	ENST00000257934;ENST00000552671;ENST00000552462	T;T	0.11385	2.78;2.78	5.26	1.4	0.22301	.	0.405202	0.29501	N	0.011979	T	0.05273	0.0140	N	0.21583	0.68	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.42050	-0.9474	10	0.14252	T	0.57	.	3.9836	0.09506	0.1566:0.4565:0.3028:0.0841	.	1303	Q14674	ESPL1_HUMAN	T	1303;978;1303	ENSP00000257934:P1303T;ENSP00000449831:P1303T	ENSP00000257934:P1303T	P	+	1	0	ESPL1	51966694	0.000000	0.05858	0.000000	0.03702	0.056000	0.15407	-0.007000	0.12810	0.093000	0.17368	0.561000	0.74099	CCT	.		0.527	ESPL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406899.2	NM_012291	
RDH5	5959	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	56115258	56115258	+	Missense_Mutation	SNP	A	A	G			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr12:56115258A>G	ENST00000257895.5	+	2	442	c.290A>G	c.(289-291)gAg>gGg	p.E97G	RP11-644F5.10_ENST00000549424.1_Intron|RDH5_ENST00000547072.1_5'UTR|RDH5_ENST00000553160.1_Intron|RP11-644F5.10_ENST00000550412.1_Intron|RDH5_ENST00000548082.1_Missense_Mutation_p.E97G	NM_001199771.1|NM_002905.3	NP_001186700.1|NP_002896.2	Q92781	RDH1_HUMAN	retinol dehydrogenase 5 (11-cis/9-cis)	97					phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|visual perception (GO:0007601)	cell body (GO:0044297)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)	retinol dehydrogenase activity (GO:0004745)			breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|skin(1)	12					Vitamin A(DB00162)	AAGTGGGTGGAGATGCACGTT	0.612																																					p.E97G		.											.	RDH5-91	0			c.A290G						.						65.0	55.0	58.0					12																	56115258		2203	4300	6503	SO:0001583	missense	5959	exon2			GGGTGGAGATGCA	U89717	CCDS31829.1	12q13-q14	2013-06-03	2006-05-09			ENSG00000135437	1.1.1.105	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	9940	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 9C, member 5"""	601617	"""retinol dehydrogenase 5 (11-cis and 9-cis)"""	RDH1		9115228, 8884265, 19027726	Standard	NM_002905		Approved	HSD17B9, SDR9C5	uc001shl.3	Q92781	OTTHUMG00000170126	ENST00000257895.5:c.290A>G	12.37:g.56115258A>G	ENSP00000257895:p.Glu97Gly	Somatic	132	1		WXS	Illumina HiSeq	Phase_I	103	40	NM_001199771	0	0	24	41	17	O00179|Q8TAI2	Missense_Mutation	SNP	ENST00000257895.5	37	CCDS31829.1	.	.	.	.	.	.	.	.	.	.	A	10.33	1.320462	0.23994	.	.	ENSG00000135437	ENST00000257895;ENST00000548082	D;D	0.87650	-2.28;-2.28	5.21	4.04	0.47022	NAD(P)-binding domain (1);	0.327481	0.34700	N	0.003750	T	0.77572	0.4150	N	0.25031	0.7	0.24743	N	0.993021	B	0.06786	0.001	B	0.08055	0.003	T	0.69060	-0.5245	10	0.56958	D	0.05	.	9.7426	0.40427	0.9125:0.0:0.0875:0.0	.	97	Q92781	RDH1_HUMAN	G	97	ENSP00000257895:E97G;ENSP00000447128:E97G	ENSP00000257895:E97G	E	+	2	0	RDH5	54401525	0.003000	0.15002	0.300000	0.25030	0.102000	0.19082	1.965000	0.40471	2.107000	0.64212	0.533000	0.62120	GAG	.		0.612	RDH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407493.1	NM_002905	
PTPRB	5787	hgsc.bcm.edu	37	12	70964842	70964842	+	Missense_Mutation	SNP	C	C	A			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr12:70964842C>A	ENST00000261266.5	-	11	2709	c.2680G>T	c.(2680-2682)Gat>Tat	p.D894Y	PTPRB_ENST00000451516.2_Missense_Mutation_p.D804Y|PTPRB_ENST00000538708.1_Missense_Mutation_p.D894Y|PTPRB_ENST00000334414.6_Missense_Mutation_p.D1112Y|PTPRB_ENST00000550358.1_Missense_Mutation_p.D1024Y|PTPRB_ENST00000550857.1_Missense_Mutation_p.D804Y|PTPRB_ENST00000551525.1_Missense_Mutation_p.D1111Y	NM_002837.4	NP_002828.3	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	894	Fibronectin type-III 10. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			TGCTGTACATCCCCGCTAATC	0.433																																					p.D1112Y		.											.	PTPRB-226	0			c.G3334T						.						76.0	72.0	74.0					12																	70964842		1930	4139	6069	SO:0001583	missense	5787	exon13			GTACATCCCCGCT	X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000261266.5:c.2680G>T	12.37:g.70964842C>A	ENSP00000261266:p.Asp894Tyr	Somatic	46	0		WXS	Illumina HiSeq	Phase_I	60	3	NM_001109754	0	0	1	1	0	B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Missense_Mutation	SNP	ENST00000261266.5	37	CCDS44944.1	.	.	.	.	.	.	.	.	.	.	C	18.59	3.656809	0.67586	.	.	ENSG00000127329	ENST00000334414;ENST00000451516;ENST00000550358;ENST00000538708;ENST00000550857;ENST00000261266;ENST00000551525;ENST00000548122	T;T;T;T;T;T;T;T	0.57907	0.37;0.37;0.37;0.37;0.37;0.37;0.37;0.37	5.9	5.9	0.94986	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.265469	0.44483	D	0.000448	T	0.61311	0.2337	L	0.38838	1.175	0.44523	D	0.997474	P;P;D;B;P;P;D	0.57571	0.937;0.878;0.97;0.25;0.855;0.88;0.98	P;P;P;B;P;P;P	0.62649	0.785;0.785;0.905;0.225;0.69;0.793;0.891	T	0.61686	-0.7012	10	0.62326	D	0.03	.	14.4259	0.67215	0.0:0.9302:0.0:0.0698	.	804;894;991;1111;1112;894;1024	P23467-2;F5H3G6;Q6ZR19;F8VSD5;P23467-3;P23467;F8VU56	.;.;.;.;.;PTPRB_HUMAN;.	Y	1112;804;1024;894;804;894;1111;991	ENSP00000334928:D1112Y;ENSP00000393028:D804Y;ENSP00000448058:D1024Y;ENSP00000438927:D894Y;ENSP00000447302:D804Y;ENSP00000261266:D894Y;ENSP00000448349:D1111Y;ENSP00000446982:D991Y	ENSP00000261266:D894Y	D	-	1	0	PTPRB	69251109	0.997000	0.39634	0.993000	0.49108	0.894000	0.52154	2.145000	0.42207	2.788000	0.95919	0.650000	0.86243	GAT	.		0.433	PTPRB-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404439.1		
GLIPR1L2	144321	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	75785104	75785104	+	Missense_Mutation	SNP	C	C	A			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr12:75785104C>A	ENST00000550916.1	+	1	255	c.208C>A	c.(208-210)Ccc>Acc	p.P70T	GLIPR1L2_ENST00000320460.4_Missense_Mutation_p.P70T|GLIPR1L2_ENST00000435775.1_Missense_Mutation_p.P70T|GLIPR1L2_ENST00000378692.3_5'UTR|GLIPR1L2_ENST00000441218.1_5'Flank|CAPS2_ENST00000442339.2_5'Flank|GLIPR1L2_ENST00000547164.1_Missense_Mutation_p.P70T|GLIPR1L2_ENST00000378689.2_Missense_Mutation_p.P70T	NM_001270396.1	NP_001257325.1	Q4G1C9	GRPL2_HUMAN	GLI pathogenesis-related 1 like 2	70	SCP.					integral component of membrane (GO:0016021)				kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	16						CGACGTCATTCCCCGAGGGTC	0.567											OREG0021999	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P70T		.											.	GLIPR1L2-91	0			c.C208A						.						104.0	80.0	88.0					12																	75785104		2203	4300	6503	SO:0001583	missense	144321	exon1			GTCATTCCCCGAG	BC029557	CCDS9010.1, CCDS58258.1	12q21.1	2014-06-03				ENSG00000180481			28592	protein-coding gene	gene with protein product		610394				12477932	Standard	NM_001270396		Approved	MGC39497	uc001sxr.2	Q4G1C9	OTTHUMG00000169756	ENST00000550916.1:c.208C>A	12.37:g.75785104C>A	ENSP00000448248:p.Pro70Thr	Somatic	92	0	1163	WXS	Illumina HiSeq	Phase_I	81	39	NM_152436	0	0	0	0	0	Q6MZS1|Q8N6N0|Q8NA43	Missense_Mutation	SNP	ENST00000550916.1	37	CCDS58258.1	.	.	.	.	.	.	.	.	.	.	C	12.33	1.906693	0.33628	.	.	ENSG00000180481	ENST00000550916;ENST00000435775;ENST00000378689;ENST00000320460;ENST00000547164	T;T;T;T;T	0.14516	2.5;2.5;2.5;2.5;2.5	3.68	3.68	0.42216	CAP domain (3);	0.000000	0.85682	D	0.000000	T	0.41880	0.1178	M	0.90425	3.115	0.48288	D	0.999624	D;D	0.89917	0.997;1.0	P;D	0.87578	0.897;0.998	T	0.49062	-0.8978	10	0.87932	D	0	.	11.1954	0.48709	0.0:1.0:0.0:0.0	.	70;70	Q4G1C9;Q4G1C9-2	GRPL2_HUMAN;.	T	70	ENSP00000448248:P70T;ENSP00000398328:P70T;ENSP00000367960:P70T;ENSP00000317385:P70T;ENSP00000447980:P70T	ENSP00000317385:P70T	P	+	1	0	GLIPR1L2	74071371	0.067000	0.21026	0.025000	0.17156	0.007000	0.05969	2.883000	0.48554	2.352000	0.79861	0.585000	0.79938	CCC	.		0.567	GLIPR1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405718.1	NM_152436	
CUL4A	8451	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	113915023	113915023	+	Missense_Mutation	SNP	C	C	G			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr13:113915023C>G	ENST00000375440.4	+	19	2218	c.2134C>G	c.(2134-2136)Cat>Gat	p.H712D	CUL4A_ENST00000326335.4_Missense_Mutation_p.H612D|CUL4A_ENST00000451881.1_Missense_Mutation_p.H612D|CUL4A_ENST00000375441.3_Missense_Mutation_p.H612D	NM_001008895.1	NP_001008895.1	Q13619	CUL4A_HUMAN	cullin 4A	712					cell cycle arrest (GO:0007050)|DNA repair (GO:0006281)|G1/S transition of mitotic cell cycle (GO:0000082)|hemopoiesis (GO:0030097)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of cell proliferation (GO:0008285)|negative regulation of granulocyte differentiation (GO:0030853)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of DNA damage checkpoint (GO:2000001)|regulation of nucleotide-excision repair (GO:2000819)|regulation of protein metabolic process (GO:0051246)|somatic stem cell maintenance (GO:0035019)|viral process (GO:0016032)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)				NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|large_intestine(5)|lung(5)|skin(1)	17	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0482)|all_epithelial(44;0.0148)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.112)			GACTCTTGGTCATAATCTTCT	0.328																																					p.H712D		.											.	CUL4A-651	0			c.C2134G						.						75.0	74.0	74.0					13																	113915023		2203	4300	6503	SO:0001583	missense	8451	exon19			CTTGGTCATAATC	U58090	CCDS9533.1, CCDS41908.1, CCDS73604.1	13q34	2011-05-24			ENSG00000139842	ENSG00000139842			2554	protein-coding gene	gene with protein product		603137				8681378	Standard	NM_001008895		Approved		uc021rmv.1	Q13619	OTTHUMG00000017384	ENST00000375440.4:c.2134C>G	13.37:g.113915023C>G	ENSP00000364589:p.His712Asp	Somatic	43	0		WXS	Illumina HiSeq	Phase_I	31	14	NM_001008895	0	0	18	30	12	A2A2W2|O75834|Q589T6|Q5TC62|Q6UP08|Q9UP17	Missense_Mutation	SNP	ENST00000375440.4	37	CCDS41908.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.332500	0.81801	.	.	ENSG00000139842	ENST00000375441;ENST00000451881;ENST00000326335;ENST00000375440	T;T;T;T	0.79454	-1.27;-1.27;-1.27;-1.18	5.52	5.52	0.82312	Cullin protein, neddylation domain (2);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.93588	0.7953	H	0.99011	4.4	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	D	0.95979	0.8976	10	0.87932	D	0	-35.2623	19.4327	0.94778	0.0:1.0:0.0:0.0	.	712;712	Q13619;A8MSH7	CUL4A_HUMAN;.	D	612;612;612;712	ENSP00000364590:H612D;ENSP00000389118:H612D;ENSP00000322132:H612D;ENSP00000364589:H712D	ENSP00000322132:H612D	H	+	1	0	CUL4A	112963024	1.000000	0.71417	0.165000	0.22776	0.878000	0.50629	5.612000	0.67681	2.594000	0.87642	0.561000	0.74099	CAT	.		0.328	CUL4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045888.3	NM_003589	
LAMP1	3916	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	113963979	113963979	+	Missense_Mutation	SNP	T	T	C			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr13:113963979T>C	ENST00000332556.4	+	3	399	c.205T>C	c.(205-207)Tca>Cca	p.S69P	LAMP1_ENST00000397181.3_Missense_Mutation_p.S69P	NM_005561.3	NP_005552.3	P11279	LAMP1_HUMAN	lysosomal-associated membrane protein 1	69	First lumenal domain.				autophagic cell death (GO:0048102)|autophagy (GO:0006914)|establishment of protein localization to organelle (GO:0072594)|Golgi to lysosome transport (GO:0090160)|granzyme-mediated apoptotic signaling pathway (GO:0008626)|positive regulation of natural killer cell degranulation (GO:0043323)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|protein stabilization (GO:0050821)|regulation of organelle transport along microtubule (GO:1902513)	alveolar lamellar body (GO:0097208)|cytolytic granule (GO:0044194)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|melanosome (GO:0042470)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|phagolysosome membrane (GO:0061474)|sarcolemma (GO:0042383)	enzyme binding (GO:0019899)			NS(1)|central_nervous_system(2)|endometrium(3)|large_intestine(4)|lung(2)|prostate(1)|skin(1)|stomach(2)	16	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0482)|all_epithelial(44;0.0148)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.025)|GBM - Glioblastoma multiforme(44;0.206)|Epithelial(84;0.246)			TGACCTGCCATCAGATGCCAC	0.423																																					p.S69P		.											.	LAMP1-514	0			c.T205C						.						89.0	92.0	91.0					13																	113963979		1960	4142	6102	SO:0001583	missense	3916	exon3			CTGCCATCAGATG	J03263	CCDS41909.1	13q34	2011-11-24			ENSG00000185896	ENSG00000185896		"""CD molecules"""	6499	protein-coding gene	gene with protein product		153330					Standard	NM_005561		Approved	CD107a	uc001vtm.1	P11279	OTTHUMG00000017380	ENST00000332556.4:c.205T>C	13.37:g.113963979T>C	ENSP00000333298:p.Ser69Pro	Somatic	110	0		WXS	Illumina HiSeq	Phase_I	115	45	NM_005561	0	0	132	275	143	B4DWL3|Q8WU33|Q96I40|Q9BRD2|Q9NP13	Missense_Mutation	SNP	ENST00000332556.4	37	CCDS41909.1	.	.	.	.	.	.	.	.	.	.	T	10.74	1.434683	0.25813	.	.	ENSG00000185896	ENST00000332556;ENST00000397181	T;T	0.32023	1.47;1.88	5.15	-10.3	0.00346	.	1.186920	0.05805	N	0.612961	T	0.19366	0.0465	L	0.51914	1.62	0.09310	N	1	B;B	0.15141	0.012;0.004	B;B	0.14578	0.011;0.004	T	0.10064	-1.0646	10	0.26408	T	0.33	-1.3993	4.2226	0.10565	0.0888:0.4046:0.2957:0.2108	.	69;69	B4DWL3;P11279	.;LAMP1_HUMAN	P	69	ENSP00000333298:S69P;ENSP00000415354:S69P	ENSP00000333298:S69P	S	+	1	0	LAMP1	113011980	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.754000	0.00790	-2.251000	0.00700	-0.479000	0.04858	TCA	.		0.423	LAMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045876.2		
DTD2	112487	hgsc.bcm.edu	37	14	31926584	31926584	+	Missense_Mutation	SNP	G	G	A	rs17097904	byFrequency	TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr14:31926584G>A	ENST00000310850.4	-	1	132	c.16C>T	c.(16-18)Cgg>Tgg	p.R6W	RP11-176H8.1_ENST00000547378.1_Missense_Mutation_p.R6W|DTD2_ENST00000356180.4_Missense_Mutation_p.R6W	NM_080664.2	NP_542395.1	Q96FN9	DTD2_HUMAN	D-tyrosyl-tRNA deacylase 2 (putative)	6			R -> W (in dbSNP:rs17097904).		D-amino acid catabolic process (GO:0019478)	cytoplasm (GO:0005737)	hydrolase activity, acting on ester bonds (GO:0016788)	p.R6W(1)									TGAGGAATCCGGCTACCCTCA	0.697																																					p.R6W		.											.	.	1	Substitution - Missense(1)	skin(1)	c.C16T						.						12.0	12.0	12.0					14																	31926584		2183	4278	6461	SO:0001583	missense	112487	exon1			GAATCCGGCTACC	BC010618	CCDS9643.1	14q12	2012-09-25	2012-09-25	2012-09-25	ENSG00000129480	ENSG00000129480			20277	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 126"""	C14orf126			Standard	NM_080664		Approved	MGC9912	uc001wrj.3	Q96FN9	OTTHUMG00000140205	ENST00000310850.4:c.16C>T	14.37:g.31926584G>A	ENSP00000312224:p.Arg6Trp	Somatic	7	1		WXS	Illumina HiSeq	Phase_I	10	2	NM_080664	0	0	6	11	5	D3DS87	Missense_Mutation	SNP	ENST00000310850.4	37	CCDS9643.1	.	.	.	.	.	.	.	.	.	.	G	19.08	3.758136	0.69763	.	.	ENSG00000203546;ENSG00000129480;ENSG00000129480	ENST00000547378;ENST00000310850;ENST00000356180	T;T;T	0.55052	0.54;0.71;0.71	4.84	2.97	0.34412	D-Tyr tRNAtyr deacylase-like domain (1);	0.302778	0.30901	N	0.008651	T	0.52419	0.1733	M	0.69823	2.125	0.36855	D	0.888115	D	0.67145	0.996	B	0.43623	0.425	T	0.65220	-0.6221	10	0.87932	D	0	.	11.9711	0.53063	0.0:0.0:0.5428:0.4572	rs17097904	6	Q96FN9	DTD2_HUMAN	W	6	ENSP00000447056:R6W;ENSP00000312224:R6W;ENSP00000348503:R6W	ENSP00000312224:R6W	R	-	1	2	C14orf126;RP11-176H8.1	30996335	0.001000	0.12720	0.005000	0.12908	0.004000	0.04260	0.080000	0.14802	0.618000	0.30179	0.561000	0.74099	CGG	.		0.697	DTD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276614.2	NM_080664	
BAZ1A	11177	hgsc.bcm.edu	37	14	35295323	35295323	+	Silent	SNP	A	A	G			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr14:35295323A>G	ENST00000382422.2	-	3	759	c.432T>C	c.(430-432)caT>caC	p.H144H	BAZ1A_ENST00000360310.1_Silent_p.H144H|BAZ1A_ENST00000553853.1_5'Flank|BAZ1A_ENST00000358716.4_Silent_p.H144H			Q9NRL2	BAZ1A_HUMAN	bromodomain adjacent to zinc finger domain, 1A	144					chromatin remodeling (GO:0006338)|DNA-dependent DNA replication (GO:0006261)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	ACF complex (GO:0016590)|CHRAC (GO:0008623)|nuclear chromosome (GO:0000228)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(2)|large_intestine(7)|lung(19)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48	Breast(36;0.0388)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;7.23e-05)|Lung(238;0.00019)|Epithelial(34;0.0793)|all cancers(34;0.175)	GBM - Glioblastoma multiforme(112;0.0659)		AACCATTTTGATGTGATGGAG	0.338																																					p.H144H		.											.	BAZ1A-291	0			c.T432C						.						105.0	87.0	93.0					14																	35295323		2203	4300	6503	SO:0001819	synonymous_variant	11177	exon4			ATTTTGATGTGAT	AB032252	CCDS9651.1, CCDS41943.1	14q13.2	2013-01-28			ENSG00000198604	ENSG00000198604		"""Zinc fingers, PHD-type"""	960	protein-coding gene	gene with protein product		605680				10662543	Standard	NM_013448		Approved	hACF1, ACF1, WALp1, WCRF180	uc001wsk.3	Q9NRL2	OTTHUMG00000140216	ENST00000382422.2:c.432T>C	14.37:g.35295323A>G		Somatic	50	0		WXS	Illumina HiSeq	Phase_I	18	2	NM_182648	0	0	0	0	0	Q9NZ15|Q9P065|Q9UIG1|Q9Y3V3	Silent	SNP	ENST00000382422.2	37	CCDS9651.1																																																																																			.		0.338	BAZ1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276646.1		
NEMF	9147	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	50292672	50292672	+	Splice_Site	SNP	G	G	A	rs370101877		TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr14:50292672G>A	ENST00000298310.5	-	16	1939	c.1490C>T	c.(1489-1491)gCa>gTa	p.A497V	NEMF_ENST00000556925.1_5'UTR|NEMF_ENST00000546046.1_Splice_Site_p.A497V|NEMF_ENST00000545773.1_Splice_Site_p.A455V|AL627171.2_ENST00000595378.1_3'UTR			O60524	NEMF_HUMAN	nuclear export mediator factor	497					nuclear export (GO:0051168)	nucleus (GO:0005634)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(13)|liver(1)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	36						TGACTTGAATGCCTATTTATA	0.269																																					p.A497V		.											.	NEMF-90	0			c.C1490T						.	G	VAL/ALA	0,4400		0,0,2200	96.0	91.0	93.0		1490	5.3	1.0	14		93	1,8591	1.2+/-3.3	0,1,4295	no	missense-near-splice	NEMF	NM_004713.3	64	0,1,6495	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	497/1077	50292672	1,12991	2200	4296	6496	SO:0001630	splice_region_variant	9147	exon16			TTGAATGCCTATT	AF039687	CCDS9694.1	14q21.3	2012-11-19	2011-01-31	2011-01-31	ENSG00000165525	ENSG00000165525			10663	protein-coding gene	gene with protein product		608378	"""serologically defined colon cancer antigen 1"""	SDCCAG1		9610721, 10575219	Standard	XR_429334		Approved	NY-CO-1, FLJ10051	uc001wxc.3	O60524	OTTHUMG00000170857	ENST00000298310.5:c.1489-1C>T	14.37:g.50292672G>A		Somatic	47	0		WXS	Illumina HiSeq	Phase_I	23	17	NM_004713	0	0	0	0	0	A0JLQ3|B3KSK1|B4DDL3|B4DHA9|B4E3F3|Q32Q66|Q8WW70|Q9NWG1	Missense_Mutation	SNP	ENST00000298310.5	37	CCDS9694.1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.985467	0.93044	0.0	1.16E-4	ENSG00000165525	ENST00000298310;ENST00000545773;ENST00000546046;ENST00000534912;ENST00000555970	T;T;T;T	0.47528	0.84;0.84;0.84;0.84	5.34	5.34	0.76211	Fibronectin-binding A, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.73892	0.3645	M	0.86864	2.845	0.80722	D	1	D;D;D;D;D	0.69078	0.997;0.994;0.985;0.997;0.995	D;D;D;D;D	0.73380	0.966;0.966;0.943;0.966;0.98	T	0.77086	-0.2718	10	0.54805	T	0.06	-18.6685	19.4564	0.94892	0.0:0.0:1.0:0.0	.	497;268;472;455;497	O60524-3;F5H639;O60524-5;O60524-4;O60524	.;.;.;.;NEMF_HUMAN	V	497;455;497;268;455	ENSP00000298310:A497V;ENSP00000438309:A455V;ENSP00000441016:A497V;ENSP00000452540:A455V	ENSP00000298310:A497V	A	-	2	0	NEMF	49362422	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	8.484000	0.90445	2.684000	0.91462	0.644000	0.83932	GCA	.		0.269	NEMF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410798.1	NM_004713	Missense_Mutation
PPM1A	5494	hgsc.bcm.edu;broad.mit.edu	37	14	60712638	60712638	+	5'UTR	SNP	A	A	G			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr14:60712638A>G	ENST00000529574.1	+	0	164				PPM1A_ENST00000325642.3_Missense_Mutation_p.R25G|CTD-2184C24.2_ENST00000529171.1_RNA|CTD-2184C24.2_ENST00000553269.1_RNA|CTD-2184C24.2_ENST00000532515.1_RNA|CTD-2184C24.2_ENST00000553775.1_RNA			P35813	PPM1A_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1A						cell cycle arrest (GO:0007050)|dephosphorylation (GO:0016311)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|N-terminal protein myristoylation (GO:0006499)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|peptidyl-threonine dephosphorylation (GO:0035970)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|protein dephosphorylation (GO:0006470)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|voltage-gated calcium channel complex (GO:0005891)	calmodulin-dependent protein phosphatase activity (GO:0033192)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein serine/threonine phosphatase activity (GO:0004722)|R-SMAD binding (GO:0070412)|signal transducer activity (GO:0004871)			cervix(1)|endometrium(1)|large_intestine(8)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(108;0.046)		agagaaaagaagaatggggaa	0.408																																					p.R25G		.											.	PPM1A-227	0			c.A73G						.						79.0	77.0	78.0					14																	60712638		1568	3578	5146	SO:0001623	5_prime_UTR_variant	5494	exon1			AAAAGAAGAATGG	S87759	CCDS9744.1, CCDS9745.1, CCDS45120.1	14q23.1	2013-01-24	2010-03-05		ENSG00000100614	ENSG00000100614	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9275	protein-coding gene	gene with protein product	"""phosphatase 2C alpha"", ""protein phosphatase 2C, alpha isoform"""	606108	"""protein phosphatase 1A (formerly 2C), magnesium-dependent, alpha isoform"""			1311954	Standard	NM_177952		Approved	MGC9201, PP2Calpha, PP2CA	uc001xew.4	P35813	OTTHUMG00000140333	ENST00000529574.1:c.-234A>G	14.37:g.60712638A>G		Somatic	12	0		WXS	Illumina HiSeq	Phase_I	4	4	NM_177952	0	0	0	0	0	B5BU11|J3KNM0|O75551	Missense_Mutation	SNP	ENST00000529574.1	37	CCDS9744.1	.	.	.	.	.	.	.	.	.	.	A	10.67	1.415786	0.25552	.	.	ENSG00000100614	ENST00000325642	T	0.33438	1.41	3.86	0.196	0.15159	.	.	.	.	.	T	0.14141	0.0342	N	0.08118	0	0.09310	N	0.999997	.	.	.	.	.	.	T	0.23297	-1.0192	7	0.87932	D	0	.	2.3945	0.04386	0.5595:0.0:0.2316:0.2089	.	.	.	.	G	25	ENSP00000327255:R25G	ENSP00000327255:R25G	R	+	1	2	PPM1A	59782391	0.006000	0.16342	0.001000	0.08648	0.216000	0.24613	-0.020000	0.12525	0.023000	0.15187	0.172000	0.16884	AGA	.		0.408	PPM1A-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		NM_021003	
GPHB5	122876	broad.mit.edu	37	14	63779788	63779788	+	RNA	SNP	C	C	A			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr14:63779788C>A	ENST00000539258.1	-	0	302							Q86YW7	GPHB5_HUMAN	glycoprotein hormone beta 5						regulation of thyroid hormone mediated signaling pathway (GO:0002155)	extracellular region (GO:0005576)				breast(1)|endometrium(1)|lung(4)|urinary_tract(1)	7				OV - Ovarian serous cystadenocarcinoma(108;0.00372)|all cancers(60;0.0226)|BRCA - Breast invasive adenocarcinoma(234;0.0978)		TAGGTACAGACTCGATGATGG	0.488																																					.													.	GPHB5-67	0			.						.						85.0	92.0	90.0					14																	63779788		1960	4148	6108			122876	.			TACAGACTCGATG	AF467770	CCDS73643.1	14q23.3	2006-09-25				ENSG00000179600			18055	protein-coding gene	gene with protein product		609652					Standard	NM_145171		Approved	ZLUT1, GPB5	uc021rud.1	Q86YW7			14.37:g.63779788C>A		Somatic	12	0		WXS	Illumina HiSeq	Phase_I	9	3	.	0	0	0	0	0	Q6NTD0|Q8NFW2	Missense_Mutation	SNP	ENST00000539258.1	37																																																																																				.		0.488	GPHB5-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000400582.1	NM_145171	
MYO5A	4644	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	52606371	52606371	+	Silent	SNP	T	T	C			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr15:52606371T>C	ENST00000399231.3	-	40	5607	c.5364A>G	c.(5362-5364)ccA>ccG	p.P1788P	MYO5A_ENST00000399233.2_Silent_p.P1785P|MYO5A_ENST00000358212.6_Silent_p.P1813P|MYO5A_ENST00000553916.1_Silent_p.P1786P|MYO5A_ENST00000356338.6_Silent_p.P1761P	NM_000259.3	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA (heavy chain 12, myoxin)	1788	Dilute. {ECO:0000255|PROSITE- ProRule:PRU00503}.				actin filament-based movement (GO:0030048)|anagen (GO:0042640)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|endoplasmic reticulum localization (GO:0051643)|exocytosis (GO:0006887)|insulin secretion (GO:0030073)|locomotion involved in locomotory behavior (GO:0031987)|long-chain fatty acid biosynthetic process (GO:0042759)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome transport (GO:0032402)|membrane organization (GO:0061024)|myelination (GO:0042552)|odontogenesis (GO:0042476)|post-Golgi vesicle-mediated transport (GO:0006892)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|secretory granule localization (GO:0032252)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vesicle transport along actin filament (GO:0030050)|vesicle-mediated transport (GO:0016192)|visual perception (GO:0007601)	actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium tip (GO:0032433)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|insulin-responsive compartment (GO:0032593)|intermediate filament (GO:0005882)|melanosome (GO:0042470)|membrane (GO:0016020)|microtubule plus-end (GO:0035371)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|microfilament motor activity (GO:0000146)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(12)|lung(19)|ovary(3)|skin(3)|stomach(1)	57				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		ACTCATTAACTGGAGTATACA	0.348																																					p.P1788P		.											.	MYO5A-93	0			c.A5364G						.						88.0	81.0	83.0					15																	52606371		1810	4082	5892	SO:0001819	synonymous_variant	4644	exon40			ATTAACTGGAGTA		CCDS42037.1, CCDS45262.1	15q21	2014-09-17	2006-09-29		ENSG00000197535	ENSG00000197535		"""Myosins / Myosin superfamily : Class V"""	7602	protein-coding gene	gene with protein product	"""myosin, heavy polypeptide kinase"", ""myosin heavy chain 12"", ""myoxin"", ""myosin V"""	160777	"""myosin VA (heavy polypeptide 12, myoxin)"""	MYH12		8188282, 8022818	Standard	NM_000259		Approved	MYO5, GS1, MYR12	uc002aby.2	Q9Y4I1	OTTHUMG00000137383	ENST00000399231.3:c.5364A>G	15.37:g.52606371T>C		Somatic	88	0		WXS	Illumina HiSeq	Phase_I	82	29	NM_000259	0	0	5	6	1	A8MZC5|O60653|Q07902|Q16249|Q9UE30|Q9UE31	Silent	SNP	ENST00000399231.3	37	CCDS42037.1																																																																																			.		0.348	MYO5A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268102.1	NM_000259	
SRRM2	23524	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	2812806	2812806	+	Missense_Mutation	SNP	C	C	G			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr16:2812806C>G	ENST00000301740.8	+	11	2826	c.2277C>G	c.(2275-2277)agC>agG	p.S759R		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	759	Arg-rich.|Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						CAAGGCGGAGCAGGTCTCTCT	0.473																																					p.S759R		.											.	SRRM2-93	0			c.C2277G						.						119.0	123.0	122.0					16																	2812806		2198	4300	6498	SO:0001583	missense	23524	exon11			GCGGAGCAGGTCT	AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.2277C>G	16.37:g.2812806C>G	ENSP00000301740:p.Ser759Arg	Somatic	237	0		WXS	Illumina HiSeq	Phase_I	285	170	NM_016333	0	0	5	21	16	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	ENST00000301740.8	37	CCDS32373.1	.	.	.	.	.	.	.	.	.	.	C	8.634	0.894431	0.17613	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000544933;ENST00000426305	T	0.26373	1.74	5.62	4.67	0.58626	.	0.000000	0.85682	D	0.000000	T	0.32526	0.0832	L	0.27053	0.805	0.33222	D	0.554776	D	0.65815	0.995	P	0.59115	0.852	T	0.48747	-0.9008	10	0.87932	D	0	-13.5853	12.4668	0.55764	0.0:0.9183:0.0:0.0817	.	759	Q9UQ35	SRRM2_HUMAN	R	759;759;11;724	ENSP00000301740:S759R	ENSP00000301740:S759R	S	+	3	2	SRRM2	2752807	0.982000	0.34865	1.000000	0.80357	0.796000	0.44982	0.846000	0.27682	1.367000	0.46095	0.655000	0.94253	AGC	.		0.473	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1		
PRKCB	5579	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	23848699	23848699	+	Silent	SNP	C	C	T			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr16:23848699C>T	ENST00000321728.7	+	2	352	c.177C>T	c.(175-177)ggC>ggT	p.G59G	PRKCB_ENST00000498058.1_Intron|PRKCB_ENST00000303531.7_Silent_p.G59G	NM_212535.2	NP_997700.1	P05771	KPCB_HUMAN	protein kinase C, beta	59					apoptotic process (GO:0006915)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|histone H3-T6 phosphorylation (GO:0035408)|intracellular signal transduction (GO:0035556)|lipoprotein transport (GO:0042953)|negative regulation of glucose transport (GO:0010829)|negative regulation of insulin receptor signaling pathway (GO:0046627)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|histone kinase activity (H3-T6 specific) (GO:0035403)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			central_nervous_system(3)|large_intestine(1)|lung(2)|ovary(3)	9					Tamoxifen(DB00675)|Vitamin E(DB00163)	TTTGCAGGGGCTTCGGGAAGC	0.552																																					p.G59G		.											.	PRKCB-1530	0			c.C177T						.						113.0	123.0	120.0					16																	23848699		2197	4300	6497	SO:0001819	synonymous_variant	5579	exon2			CAGGGGCTTCGGG	M13975	CCDS10618.1, CCDS10619.1	16p12	2009-07-10	2008-08-18	2008-08-18	ENSG00000166501	ENSG00000166501	2.7.11.1		9395	protein-coding gene	gene with protein product		176970	"""protein kinase C, beta 1"""	PRKCB2, PKCB, PRKCB1		3658678	Standard	NM_002738		Approved		uc002dme.3	P05771	OTTHUMG00000131615	ENST00000321728.7:c.177C>T	16.37:g.23848699C>T		Somatic	337	1		WXS	Illumina HiSeq	Phase_I	342	202	NM_212535	0	0	0	0	0	C5IFJ8|D3DWF5|O43744|P05127|Q15138|Q93060|Q9UE49|Q9UE50|Q9UEH8|Q9UJ30|Q9UJ33	Silent	SNP	ENST00000321728.7	37	CCDS10618.1																																																																																			.		0.552	PRKCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254504.2	NM_212535	
ZNF48	197407	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	30408740	30408740	+	Missense_Mutation	SNP	G	G	C			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr16:30408740G>C	ENST00000320159.2	+	2	545	c.169G>C	c.(169-171)Gct>Cct	p.A57P	SEPT1_ENST00000570039.1_5'Flank	NM_001214906.1|NM_001214907.1|NM_001214909.1|NM_152652.2	NP_001201835.1|NP_001201836.1|NP_001201838.1|NP_689865.2	Q96MX3	ZNF48_HUMAN	zinc finger protein 48	57					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(11)|ovary(2)|pancreas(1)|skin(1)	21						AGAAGATTTGGCTCCAGATCA	0.488																																					p.A57P		.											.	ZNF48-90	0			c.G169C						.						117.0	119.0	119.0					16																	30408740		2197	4300	6497	SO:0001583	missense	197407	exon3			GATTTGGCTCCAG	M88358, AK056313	CCDS10679.1, CCDS73868.1	16p11.2	2013-01-08			ENSG00000180035	ENSG00000180035		"""Zinc fingers, C2H2-type"""	13114	protein-coding gene	gene with protein product			"""zinc finger protein 553"""	ZNF553		1505991	Standard	NM_152652		Approved	DKFZp762K013, FLJ31751, MGC43952	uc021tgi.1	Q96MX3	OTTHUMG00000048195	ENST00000320159.2:c.169G>C	16.37:g.30408740G>C	ENSP00000324056:p.Ala57Pro	Somatic	183	1		WXS	Illumina HiSeq	Phase_I	206	46	NM_001214906	0	0	8	16	8	Q15920|Q4G0R3|Q69YP3|Q96IL9	Missense_Mutation	SNP	ENST00000320159.2	37	CCDS10679.1	.	.	.	.	.	.	.	.	.	.	G	9.037	0.988666	0.18966	.	.	ENSG00000180035	ENST00000495929;ENST00000528032;ENST00000524644;ENST00000320159	T;T;T	0.08193	3.42;3.35;3.12	4.61	0.489	0.16854	.	2.071660	0.02505	N	0.090916	T	0.07188	0.0182	N	0.19112	0.55	0.09310	N	1	B	0.22604	0.072	B	0.17433	0.018	T	0.39165	-0.9627	10	0.72032	D	0.01	-5.4461	7.1767	0.25749	0.4784:0.0:0.5216:0.0	.	57	Q96MX3	ZNF48_HUMAN	P	182;57;57;57	ENSP00000435674:A57P;ENSP00000432548:A57P;ENSP00000324056:A57P	ENSP00000324056:A57P	A	+	1	0	ZNF48	30316241	0.815000	0.29118	0.000000	0.03702	0.905000	0.53344	0.926000	0.28804	0.031000	0.15407	-0.251000	0.11542	GCT	.		0.488	ZNF48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255549.2	NM_152652	
ZC3H18	124245	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	88653085	88653085	+	Silent	SNP	C	C	T			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr16:88653085C>T	ENST00000301011.5	+	3	881	c.681C>T	c.(679-681)ttC>ttT	p.F227F	ZC3H18_ENST00000452588.2_Silent_p.F227F	NM_144604.3	NP_653205.3	Q86VM9	ZCH18_HUMAN	zinc finger CCCH-type containing 18	227						nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(9)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	42				BRCA - Breast invasive adenocarcinoma(80;0.0542)		GCCGGTTCTTCATGAAAGGTA	0.587																																					p.F227F	Ovarian(121;375 2276 20373 38669)	.											.	ZC3H18-69	0			c.C681T						.						112.0	88.0	96.0					16																	88653085		2198	4300	6498	SO:0001819	synonymous_variant	124245	exon3			GTTCTTCATGAAA	BC001584	CCDS10967.1, CCDS73924.1	16q24.2-q24.3	2012-07-05			ENSG00000158545	ENSG00000158545		"""Zinc fingers, CCCH-type domain containing"""	25091	protein-coding gene	gene with protein product						17579712	Standard	NM_144604		Approved	NHN1	uc002fky.3	Q86VM9	OTTHUMG00000137679	ENST00000301011.5:c.681C>T	16.37:g.88653085C>T		Somatic	44	0		WXS	Illumina HiSeq	Phase_I	74	18	NM_144604	0	0	0	0	0	Q96DG4|Q96MP7	Silent	SNP	ENST00000301011.5	37	CCDS10967.1																																																																																			.		0.587	ZC3H18-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000269168.1	NM_144604	
SAT2	112483	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	7530935	7530935	+	Nonsense_Mutation	SNP	G	G	A			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr17:7530935G>A	ENST00000269298.5	-	1	238	c.19C>T	c.(19-21)Cga>Tga	p.R7*	SHBG_ENST00000576478.1_Intron|SHBG_ENST00000576728.1_Intron|SHBG_ENST00000572182.1_Intron|SHBG_ENST00000575314.1_Intron|SHBG_ENST00000572262.1_Intron|SHBG_ENST00000340624.5_5'Flank|SHBG_ENST00000416273.3_5'Flank|SAT2_ENST00000573566.1_Nonsense_Mutation_p.R7*|SAT2_ENST00000380466.2_5'UTR|SHBG_ENST00000575903.1_5'Flank|SHBG_ENST00000441599.2_5'Flank|SHBG_ENST00000380450.4_5'Flank|SHBG_ENST00000570547.1_Intron|SHBG_ENST00000574539.1_Intron	NM_133491.3	NP_597998.1	Q96F10	SAT2_HUMAN	spermidine/spermine N1-acetyltransferase family member 2	7	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				nor-spermidine metabolic process (GO:0046204)|putrescine acetylation (GO:0032920)|putrescine catabolic process (GO:0009447)|spermidine acetylation (GO:0032918)|spermine acetylation (GO:0032919)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	diamine N-acetyltransferase activity (GO:0004145)	p.?(1)		kidney(1)|large_intestine(2)	3				READ - Rectum adenocarcinoma(115;0.166)	Spermine(DB00127)	TTGGCCTCTCGGATCCGCACG	0.632																																					p.R7X		.											.	SAT2-90	1	Unknown(1)	haematopoietic_and_lymphoid_tissue(1)	c.C19T						.						50.0	45.0	47.0					17																	7530935		2203	4300	6503	SO:0001587	stop_gained	112483	exon1			CCTCTCGGATCCG	AF348524	CCDS11116.1	17p13.2	2011-11-16	2008-01-07		ENSG00000141504	ENSG00000141504	2.3.1.57		23160	protein-coding gene	gene with protein product	"""diamine N-acetyltransferase 2"""	611463	"""spermidine/spermine N1-acetyltransferase 2"""			15283699, 17558023	Standard	NM_133491		Approved	SSAT2	uc002gic.2	Q96F10	OTTHUMG00000108152	ENST00000269298.5:c.19C>T	17.37:g.7530935G>A	ENSP00000269298:p.Arg7*	Somatic	77	0		WXS	Illumina HiSeq	Phase_I	58	18	NM_133491	0	0	63	102	39		Nonsense_Mutation	SNP	ENST00000269298.5	37	CCDS11116.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	37|37	6.441041|6.441041	0.97568|0.97568	.|.	.|.	ENSG00000141504|ENSG00000141504	ENST00000380466|ENST00000269298	.|.	.|.	.|.	4.71|4.71	4.71|4.71	0.59529|0.59529	.|.	0.000000|.	0.31963|.	U|.	0.006786|.	T|.	0.34658|.	0.0905|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.15752|.	-1.0426|.	6|.	0.72032|0.02654	D|T	0.01|1	-13.2823|-13.2823	13.0369|13.0369	0.58877|0.58877	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	L|X	80|7	.|.	ENSP00000369833:P80L|ENSP00000269298:R7X	P|R	-|-	2|1	0|2	SAT2|SAT2	7471660|7471660	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.852000|0.852000	0.48524|0.48524	3.025000|3.025000	0.49681|0.49681	2.453000|2.453000	0.82957|0.82957	0.655000|0.655000	0.94253|0.94253	CCG|CGA	.		0.632	SAT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440078.1	NM_133491	
KDM6B	23135	hgsc.bcm.edu	37	17	7750183	7750183	+	Missense_Mutation	SNP	C	C	T			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr17:7750183C>T	ENST00000448097.2	+	9	1089	c.758C>T	c.(757-759)cCa>cTa	p.P253L	KDM6B_ENST00000254846.5_Missense_Mutation_p.P253L			O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	253	Pro-rich.			Missing (in Ref. 1; BAA21572 and 3; AAH09994). {ECO:0000305}.	cardiac muscle cell differentiation (GO:0055007)|cellular response to hydrogen peroxide (GO:0070301)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|mesodermal cell differentiation (GO:0048333)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|skin(5)	37						ccattaccaccaccaccacca	0.607																																					p.P253L		.											.	KDM6B-205	0			c.C758T						.						26.0	24.0	25.0					17																	7750183		2194	4283	6477	SO:0001583	missense	23135	exon9			TACCACCACCACC	AB002344	CCDS32552.1	17p13.1	2011-07-01	2009-04-17	2009-04-17		ENSG00000132510		"""Chromatin-modifying enzymes / K-demethylases"""	29012	protein-coding gene	gene with protein product		611577	"""jumonji domain containing 3"", ""jumonji domain containing 3, histone lysine demethylase"""	JMJD3		10662545, 9205841	Standard	NM_001080424		Approved	KIAA0346	uc002giw.1	O15054		ENST00000448097.2:c.758C>T	17.37:g.7750183C>T	ENSP00000412513:p.Pro253Leu	Somatic	44	1		WXS	Illumina HiSeq	Phase_I	38	2	NM_001080424	0	0	0	0	0	C9IZ40|Q96G33	Missense_Mutation	SNP	ENST00000448097.2	37		.	.	.	.	.	.	.	.	.	.	C	5.495	0.276381	0.10403	.	.	ENSG00000132510	ENST00000254846;ENST00000448097	T;T	0.29397	1.57;1.58	0.584	0.584	0.17422	.	0.532596	0.13901	U	0.354930	T	0.27967	0.0689	N	0.08118	0	0.36960	D	0.893296	P	0.51449	0.945	P	0.59056	0.851	T	0.38542	-0.9656	9	0.62326	D	0.03	.	.	.	.	.	253	O15054-1	.	L	253	ENSP00000254846:P253L;ENSP00000412513:P253L	ENSP00000254846:P253L	P	+	2	0	KDM6B	7690908	0.624000	0.27102	0.831000	0.32960	0.645000	0.38454	0.207000	0.17395	0.612000	0.30071	0.089000	0.15464	CCA	.		0.607	KDM6B-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000440248.1	XM_043272	
KDM6B	23135	hgsc.bcm.edu	37	17	7750211	7750211	+	Silent	SNP	A	A	C			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr17:7750211A>C	ENST00000448097.2	+	9	1117	c.786A>C	c.(784-786)ccA>ccC	p.P262P	KDM6B_ENST00000254846.5_Silent_p.P262P			O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	262	Pro-rich.				cardiac muscle cell differentiation (GO:0055007)|cellular response to hydrogen peroxide (GO:0070301)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|mesodermal cell differentiation (GO:0048333)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|skin(5)	37						caccaccaccaccaccCCTGC	0.632																																					p.P262P		.											.	KDM6B-205	0			c.A786C						.						13.0	14.0	13.0					17																	7750211		2187	4288	6475	SO:0001819	synonymous_variant	23135	exon9			ACCACCACCACCC	AB002344	CCDS32552.1	17p13.1	2011-07-01	2009-04-17	2009-04-17		ENSG00000132510		"""Chromatin-modifying enzymes / K-demethylases"""	29012	protein-coding gene	gene with protein product		611577	"""jumonji domain containing 3"", ""jumonji domain containing 3, histone lysine demethylase"""	JMJD3		10662545, 9205841	Standard	NM_001080424		Approved	KIAA0346	uc002giw.1	O15054		ENST00000448097.2:c.786A>C	17.37:g.7750211A>C		Somatic	25	1		WXS	Illumina HiSeq	Phase_I	33	5	NM_001080424	0	0	1	1	0	C9IZ40|Q96G33	Silent	SNP	ENST00000448097.2	37																																																																																				.		0.632	KDM6B-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000440248.1	XM_043272	
TOP3A	7156	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	18181411	18181411	+	Missense_Mutation	SNP	G	G	A	rs201017469		TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr17:18181411G>A	ENST00000321105.5	-	18	2619	c.2405C>T	c.(2404-2406)cCc>cTc	p.P802L	TOP3A_ENST00000540524.1_Missense_Mutation_p.P332L|TOP3A_ENST00000542570.1_Missense_Mutation_p.P707L	NM_004618.3	NP_004609.1	Q13472	TOP3A_HUMAN	topoisomerase (DNA) III alpha	802					DNA topological change (GO:0006265)|meiotic nuclear division (GO:0007126)	chromosome (GO:0005694)|nucleus (GO:0005634)|PML body (GO:0016605)	DNA binding (GO:0003677)|DNA topoisomerase type I activity (GO:0003917)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(15)|ovary(1)|skin(6)|stomach(2)|urinary_tract(1)	36						AGCAGCCGTGGGTGGTGGGAG	0.627													G|||	1	0.000199681	0.0	0.0	5008	,	,		16717	0.001		0.0	False		,,,				2504	0.0				p.P802L		.											.	TOP3A-228	0			c.C2405T						.						57.0	61.0	60.0					17																	18181411		2203	4300	6503	SO:0001583	missense	7156	exon18			GCCGTGGGTGGTG	U43431	CCDS11194.1	17p12-p11.2	2014-02-18			ENSG00000177302	ENSG00000177302			11992	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 7"""	601243		TOP3		9450867	Standard	NM_004618		Approved	ZGRF7	uc002gsx.1	Q13472	OTTHUMG00000059391	ENST00000321105.5:c.2405C>T	17.37:g.18181411G>A	ENSP00000321636:p.Pro802Leu	Somatic	164	0		WXS	Illumina HiSeq	Phase_I	119	45	NM_004618	0	0	3	5	2	A8KA61|B4DK80|D3DXC7|Q13473	Missense_Mutation	SNP	ENST00000321105.5	37	CCDS11194.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	4.844	0.156908	0.09236	.	.	ENSG00000177302	ENST00000321105;ENST00000540524;ENST00000542570	T;T;T	0.12039	3.12;2.72;3.12	5.55	4.55	0.56014	.	0.389850	0.31404	N	0.007707	T	0.12902	0.0313	L	0.40543	1.245	0.18873	N	0.999988	B;B	0.25441	0.014;0.126	B;B	0.15484	0.005;0.013	T	0.11792	-1.0573	10	0.40728	T	0.16	-15.0687	15.7664	0.78128	0.0:0.0:0.863:0.1369	.	707;802	B4DK80;Q13472	.;TOP3A_HUMAN	L	802;332;707	ENSP00000321636:P802L;ENSP00000446425:P332L;ENSP00000442336:P707L	ENSP00000321636:P802L	P	-	2	0	TOP3A	18122136	0.030000	0.19436	0.015000	0.15790	0.233000	0.25261	2.238000	0.43070	2.621000	0.88768	0.549000	0.68633	CCC	G|0.999;A|0.000		0.627	TOP3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132052.2		
GPS1	2873	hgsc.bcm.edu	37	17	80011903	80011903	+	Missense_Mutation	SNP	C	C	A	rs199969665		TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr17:80011903C>A	ENST00000306823.6	+	3	309	c.286C>A	c.(286-288)Cgc>Agc	p.R96S	GPS1_ENST00000355130.2_Missense_Mutation_p.R136S|RFNG_ENST00000310496.4_5'Flank|GPS1_ENST00000578552.1_Missense_Mutation_p.R96S|GPS1_ENST00000320548.4_Missense_Mutation_p.R80S|RFNG_ENST00000429557.3_5'Flank|GPS1_ENST00000392358.2_Missense_Mutation_p.R136S			Q13098	CSN1_HUMAN	G protein pathway suppressor 1	96					cell cycle (GO:0007049)|cullin deneddylation (GO:0010388)|inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTPase inhibitor activity (GO:0005095)			breast(1)|central_nervous_system(1)|endometrium(3)|liver(1)|lung(4)|prostate(1)|skin(2)	13	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0211)			GGAGATCCACCGCAAGCTCTC	0.632																																					p.R136S		.											.	GPS1-226	0			c.C406A						.						46.0	36.0	40.0					17																	80011903		2200	4295	6495	SO:0001583	missense	2873	exon3			ATCCACCGCAAGC		CCDS11800.1, CCDS32774.1	17q25.3	2013-03-14				ENSG00000169727			4549	protein-coding gene	gene with protein product	"""COP9 signalosome subunit 1"""	601934				9535219	Standard	NM_212492		Approved	COPS1, CSN1	uc002kdl.1	Q13098		ENST00000306823.6:c.286C>A	17.37:g.80011903C>A	ENSP00000302873:p.Arg96Ser	Somatic	39	0		WXS	Illumina HiSeq	Phase_I	37	2	NM_212492	0	0	78	78	0	Q8NA10|Q9BWL1	Missense_Mutation	SNP	ENST00000306823.6	37	CCDS32774.1	.	.	.	.	.	.	.	.	.	.	C	13.71	2.318714	0.41096	.	.	ENSG00000169727	ENST00000392358;ENST00000306823;ENST00000355130	.	.	.	4.61	3.63	0.41609	.	.	.	.	.	T	0.40546	0.1121	N	0.19112	0.55	0.58432	D	0.999996	B;P;B;P;P	0.49358	0.005;0.874;0.009;0.577;0.923	B;B;B;B;P	0.45276	0.014;0.283;0.031;0.137;0.475	T	0.18209	-1.0344	8	0.31617	T	0.26	.	12.9552	0.58424	0.3093:0.6907:0.0:0.0	.	88;136;96;96;136	B4DND6;A8K070;Q13098-5;Q13098;Q13098-7	.;.;.;CSN1_HUMAN;.	S	136;96;136	.	ENSP00000302873:R96S	R	+	1	0	GPS1	77605192	1.000000	0.71417	0.997000	0.53966	0.904000	0.53231	4.408000	0.59761	1.126000	0.42016	0.563000	0.77884	CGC	C|0.999;T|0.000		0.632	GPS1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442176.1	NM_212492	
MRO	83876	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	48331527	48331527	+	Silent	SNP	A	A	G			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr18:48331527A>G	ENST00000428869.2	-	6	684	c.426T>C	c.(424-426)gaT>gaC	p.D142D	MRO_ENST00000431965.2_Silent_p.D156D|MRO_ENST00000588444.1_Silent_p.D142D|MRO_ENST00000587291.1_5'UTR|MRO_ENST00000256425.2_Silent_p.D142D|MRO_ENST00000436348.2_Silent_p.D156D|MRO_ENST00000398439.3_Silent_p.D142D			Q9BYG7	MSTRO_HUMAN	maestro	142						nucleolus (GO:0005730)				breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(2)|skin(2)	10		Colorectal(6;0.0596)		Colorectal(21;0.082)		TACTTACGTCATCTAATAAAG	0.448																																					p.D156D		.											.	MRO-90	0			c.T468C						.						85.0	81.0	82.0					18																	48331527		2203	4300	6503	SO:0001819	synonymous_variant	83876	exon4			TACGTCATCTAAT	AK054702	CCDS11947.1, CCDS45867.1, CCDS45868.1, CCDS45869.1	18q21	2012-12-19	2004-06-15		ENSG00000134042	ENSG00000134042		"""maestro heat-like repeat containing"""	24121	protein-coding gene	gene with protein product	"""B29 protein"", ""beside the Ma29 deletion"""	608080	"""chromosome 18 open reading frame 3"""	C18orf3		11401430	Standard	NM_031939		Approved	B29, FLJ30140	uc010dpa.3	Q9BYG7	OTTHUMG00000132692	ENST00000428869.2:c.426T>C	18.37:g.48331527A>G		Somatic	120	1		WXS	Illumina HiSeq	Phase_I	87	34	NM_001127175	0	0	0	0	0	B7Z2I5|B7Z3B2|E9PAT5|E9PBI3|K7EKJ8|Q8N6K5	Silent	SNP	ENST00000428869.2	37	CCDS11947.1																																																																																			.		0.448	MRO-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449478.2	NM_031939	
NEDD4L	23327	hgsc.bcm.edu	37	18	56056373	56056373	+	Silent	SNP	T	T	C			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr18:56056373T>C	ENST00000400345.3	+	28	2887	c.2604T>C	c.(2602-2604)atT>atC	p.I868I	NEDD4L_ENST00000586263.1_Silent_p.I840I|NEDD4L_ENST00000256830.9_Silent_p.I764I|NEDD4L_ENST00000356462.6_Silent_p.I804I|NEDD4L_ENST00000256832.7_Silent_p.I728I|NEDD4L_ENST00000435432.2_Silent_p.I727I|NEDD4L_ENST00000589054.1_Intron|NEDD4L_ENST00000456986.1_Silent_p.I747I|NEDD4L_ENST00000456173.2_Silent_p.I727I|NEDD4L_ENST00000357895.5_Silent_p.I860I|NEDD4L_ENST00000431212.2_Silent_p.I747I|NEDD4L_ENST00000382850.4_Silent_p.I848I	NM_001144967.2	NP_001138439.1	Q96PU5	NED4L_HUMAN	neural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligase	868	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cellular sodium ion homeostasis (GO:0006883)|excretion (GO:0007588)|gene expression (GO:0010467)|ion transmembrane transport (GO:0034220)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of protein localization to cell surface (GO:2000009)|negative regulation of sodium ion transmembrane transport (GO:1902306)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of cation channel activity (GO:2001259)|positive regulation of caveolin-mediated endocytosis (GO:2001288)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of sodium ion transport (GO:0010765)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane depolarization (GO:0003254)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of protein catabolic process (GO:0042176)|regulation of tight junction assembly (GO:2000810)|response to metal ion (GO:0010038)|response to salt stress (GO:0009651)|sodium ion transport (GO:0006814)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|ventricular cardiac muscle cell action potential (GO:0086005)|viral life cycle (GO:0019058)|viral process (GO:0016032)|water homeostasis (GO:0030104)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ion channel binding (GO:0044325)|ligase activity (GO:0016874)|potassium channel inhibitor activity (GO:0019870)|potassium channel regulator activity (GO:0015459)|sodium channel inhibitor activity (GO:0019871)|sodium channel regulator activity (GO:0017080)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(11)|ovary(1)|prostate(4)	37						AGCATTCTATTTACAAGAACG	0.522																																					p.I868I		.											.	NEDD4L-658	0			c.T2604C						.						89.0	89.0	89.0					18																	56056373		1976	4155	6131	SO:0001819	synonymous_variant	23327	exon28			TTCTATTTACAAG	AF210730	CCDS45872.1, CCDS45873.1, CCDS45874.1, CCDS45875.1, CCDS45876.1, CCDS58632.1, CCDS59323.1	18q21.31	2014-08-12	2012-02-23		ENSG00000049759				7728	protein-coding gene	gene with protein product		606384	"""neural precursor cell expressed, developmentally down-regulated 4-like"""			10594025, 11244092, 18322022	Standard	NM_001144965		Approved	KIAA0439, RSP5, NEDD4-2	uc002lgy.3	Q96PU5	OTTHUMG00000179875	ENST00000400345.3:c.2604T>C	18.37:g.56056373T>C		Somatic	48	0		WXS	Illumina HiSeq	Phase_I	40	2	NM_001144967	0	0	33	33	0	O43165|Q3LSM7|Q7Z5F1|Q7Z5F2|Q7Z5N3|Q8N5A7|Q8WUU9|Q9BW58|Q9H2W4|Q9NT88	Silent	SNP	ENST00000400345.3	37	CCDS45872.1																																																																																			.		0.522	NEDD4L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000448749.1		
LINGO3	645191	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	2290213	2290213	+	Silent	SNP	C	C	T			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr19:2290213C>T	ENST00000585527.1	-	1	1810	c.1563G>A	c.(1561-1563)ccG>ccA	p.P521P	LINGO3_ENST00000404279.1_Silent_p.P521P			P0C6S8	LIGO3_HUMAN	leucine rich repeat and Ig domain containing 3	521						integral component of membrane (GO:0016021)				lung(1)|urinary_tract(1)	2						TGAGGTCGAGCGGCGCGCGCA	0.706																																					p.P521P		.											.	.	0			c.G1563A						.						20.0	25.0	24.0					19																	2290213		2039	4177	6216	SO:0001819	synonymous_variant	645191	exon2			GTCGAGCGGCGCG	AK091795	CCDS45905.1	19p13.3	2013-01-11	2007-02-01	2007-02-01		ENSG00000220008		"""Immunoglobulin superfamily / I-set domain containing"""	21206	protein-coding gene	gene with protein product		609792	"""leucine rich repeat neuronal 6B"""	LRRN6B		14686891	Standard	NM_001101391		Approved	LERN2	uc010dsx.1	P0C6S8		ENST00000585527.1:c.1563G>A	19.37:g.2290213C>T		Somatic	47	0		WXS	Illumina HiSeq	Phase_I	59	23	NM_001101391	0	0	0	0	0		Silent	SNP	ENST00000585527.1	37	CCDS45905.1																																																																																			.		0.706	LINGO3-001	KNOWN	upstream_ATG|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000451291.2	NM_001101391	
ZNF557	79230	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	7075688	7075688	+	Splice_Site	SNP	C	C	G			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr19:7075688C>G	ENST00000439035.2	+	4	273	c.33C>G	c.(31-33)gcC>gcG	p.A11A	ZNF557_ENST00000252840.6_Silent_p.A18A|ZNF557_ENST00000414706.1_Silent_p.A18A			Q8N988	ZN557_HUMAN	zinc finger protein 557	11					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(6)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	17				Lung(535;0.179)		TGTTCCCAGCCTCTCAGCGAG	0.532																																					p.A18A		.											.	ZNF557-92	0			c.C54G						.						132.0	139.0	136.0					19																	7075688		2203	4300	6503	SO:0001630	splice_region_variant	79230	exon4			CCCAGCCTCTCAG	AK095524	CCDS42485.1, CCDS45945.1	19p13.2	2013-09-20			ENSG00000130544	ENSG00000130544		"""Zinc fingers, C2H2-type"", ""-"""	28632	protein-coding gene	gene with protein product						12477932	Standard	NM_024341		Approved	MGC4054	uc002mgc.3	Q8N988	OTTHUMG00000181977	ENST00000439035.2:c.32-1C>G	19.37:g.7075688C>G		Somatic	140	0		WXS	Illumina HiSeq	Phase_I	108	52	NM_001044387	0	0	4	4	0	Q6PEJ3|Q9BTZ1	Silent	SNP	ENST00000439035.2	37	CCDS45945.1																																																																																			.		0.532	ZNF557-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458502.1	NM_024341	Silent
CTXN1	404217	hgsc.bcm.edu	37	19	7990272	7990272	+	Missense_Mutation	SNP	C	C	T			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr19:7990272C>T	ENST00000318978.4	-	2	371	c.152G>A	c.(151-153)cGc>cAc	p.R51H	CTD-3193O13.8_ENST00000594308.1_RNA|TIMM44_ENST00000598968.1_5'Flank	NM_206833.3	NP_996664.1	P60606	CTXN1_HUMAN	cortexin 1	51						integral component of membrane (GO:0016021)				ovary(1)	1						GAGCAGGATGCGCACGCAGCG	0.701																																					p.R51H		.											.	CTXN1-69	0			c.G152A						.						21.0	22.0	22.0					19																	7990272		2178	4290	6468	SO:0001583	missense	404217	exon2			AGGATGCGCACGC	AK098834	CCDS12191.1	19p13.2	2012-10-02			ENSG00000178531	ENSG00000178531			31108	protein-coding gene	gene with protein product		600135					Standard	NM_206833		Approved	FLJ25968	uc002miy.4	P60606		ENST00000318978.4:c.152G>A	19.37:g.7990272C>T	ENSP00000313226:p.Arg51His	Somatic	32	0		WXS	Illumina HiSeq	Phase_I	30	3	NM_206833	0	0	35	35	0		Missense_Mutation	SNP	ENST00000318978.4	37	CCDS12191.1	.	.	.	.	.	.	.	.	.	.	C	35	5.551234	0.96501	.	.	ENSG00000178531	ENST00000318978	T	0.39592	1.07	4.36	4.36	0.52297	.	0.000000	0.85682	D	0.000000	T	0.64789	0.2630	.	.	.	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	T	0.70722	-0.4794	9	0.87932	D	0	-4.8528	14.8225	0.70085	0.0:1.0:0.0:0.0	.	51	P60606	CTXN1_HUMAN	H	51	ENSP00000313226:R51H	ENSP00000313226:R51H	R	-	2	0	CTXN1	7896272	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.412000	0.80091	2.167000	0.68274	0.442000	0.29010	CGC	.		0.701	CTXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461614.1		
CACNA1A	773	hgsc.bcm.edu	37	19	13318726	13318726	+	Missense_Mutation	SNP	C	C	T			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr19:13318726C>T	ENST00000360228.5	-	47	6921	c.6922G>A	c.(6922-6924)Ggc>Agc	p.G2308S	CACNA1A_ENST00000573710.2_3'UTR	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	2309					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	GGCCCCGAGCCGCCGGCCTTA	0.756																																					p.G2308S		.											.	CACNA1A-67	0			c.G6922A						.						1.0	1.0	1.0					19																	13318726		584	1526	2110	SO:0001583	missense	773	exon47			CCGAGCCGCCGGC	U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.6922G>A	19.37:g.13318726C>T	ENSP00000353362:p.Gly2308Ser	Somatic	1	1		WXS	Illumina HiSeq	Phase_I	3	2	NM_001127222	0	0	0	0	0	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Missense_Mutation	SNP	ENST00000360228.5	37	CCDS45998.1	.	.	.	.	.	.	.	.	.	.	c	6.449	0.451029	0.12223	.	.	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018	D	0.95238	-3.65	3.04	-1.56	0.08532	.	0.773330	0.09942	U	0.735832	T	0.78868	0.4351	N	0.01352	-0.895	0.09310	N	1	B;B;B	0.06786	0.001;0.0;0.001	B;B;B	0.06405	0.002;0.0;0.001	T	0.70296	-0.4911	10	0.19590	T	0.45	.	4.3532	0.11165	0.1658:0.4876:0.0:0.3466	.	2314;2308;2297	E9PD31;Q9NS88;E7EVF2	.;.;.	S	2308;2314;2297	ENSP00000353362:G2308S	ENSP00000349520:G2297S	G	-	1	0	CACNA1A	13179726	.	.	0.014000	0.15608	0.880000	0.50808	.	.	-0.118000	0.11851	0.281000	0.19383	GGC	.		0.756	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104062.2	NM_000068	
CACNA1A	773	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	13346025	13346025	+	Nonsense_Mutation	SNP	G	G	A			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr19:13346025G>A	ENST00000360228.5	-	33	5130	c.5131C>T	c.(5131-5133)Cag>Tag	p.Q1711*	CACNA1A_ENST00000574822.1_5'UTR|CACNA1A_ENST00000573710.2_Nonsense_Mutation_p.Q1712*	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	1712					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	ACACTCACCTGCATCCCAATG	0.557											OREG0025293	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q1712X		.											.	CACNA1A-67	0			c.C5134T						.						44.0	48.0	47.0					19																	13346025		2021	4185	6206	SO:0001587	stop_gained	773	exon33			TCACCTGCATCCC	U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.5131C>T	19.37:g.13346025G>A	ENSP00000353362:p.Gln1711*	Somatic	21	0	686	WXS	Illumina HiSeq	Phase_I	15	5	NM_001127221	0	0	0	0	0	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Nonsense_Mutation	SNP	ENST00000360228.5	37	CCDS45998.1	.	.	.	.	.	.	.	.	.	.	G	48	14.471052	0.99797	.	.	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018;ENST00000325084	.	.	.	5.17	5.17	0.71159	.	0.140928	0.48767	D	0.000167	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.4899	0.87700	0.0:0.0:1.0:0.0	.	.	.	.	X	1711;1717;1712;1712	.	ENSP00000317661:Q1712X	Q	-	1	0	CACNA1A	13207025	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.808000	0.99193	2.411000	0.81874	0.644000	0.83932	CAG	.		0.557	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104062.2	NM_000068	
SLC1A6	6511	hgsc.bcm.edu	37	19	15067322	15067322	+	Missense_Mutation	SNP	G	G	T			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr19:15067322G>T	ENST00000221742.3	-	6	1142	c.1135C>A	c.(1135-1137)Caa>Aaa	p.Q379K	SLC1A6_ENST00000430939.2_Missense_Mutation_p.Q315K|SLC1A6_ENST00000600144.1_Intron	NM_005071.1	NP_005062.1	P48664	EAA4_HUMAN	solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6	379					aspartate transport (GO:0015810)|ion transport (GO:0006811)|L-glutamate transport (GO:0015813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(8)|liver(1)|lung(12)|ovary(3)|pancreas(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42						ATGAGGGCTTGTAGCATGCCC	0.582																																					p.Q379K		.											.	SLC1A6-186	0			c.C1135A						.						162.0	123.0	136.0					19																	15067322		2203	4300	6503	SO:0001583	missense	6511	exon6			GGGCTTGTAGCAT		CCDS12321.1, CCDS62578.1	19p13.12	2013-07-15			ENSG00000105143	ENSG00000105143		"""Solute carriers"""	10944	protein-coding gene	gene with protein product		600637				7791878	Standard	NM_005071		Approved	EAAT4	uc002naa.2	P48664	OTTHUMG00000183351	ENST00000221742.3:c.1135C>A	19.37:g.15067322G>T	ENSP00000221742:p.Gln379Lys	Somatic	29	0		WXS	Illumina HiSeq	Phase_I	33	2	NM_005071	0	0	41	41	0	Q8N753	Missense_Mutation	SNP	ENST00000221742.3	37	CCDS12321.1	.	.	.	.	.	.	.	.	.	.	g	19.15	3.770991	0.69992	.	.	ENSG00000105143	ENST00000430939;ENST00000221742	T;T	0.58506	0.33;0.34	3.96	3.96	0.45880	.	0.195990	0.47852	D	0.000202	T	0.68531	0.3011	M	0.64676	1.99	0.80722	D	1	D;P	0.56968	0.978;0.88	P;P	0.59012	0.85;0.598	T	0.73347	-0.4011	10	0.87932	D	0	-11.7811	13.8869	0.63714	0.0:0.0:1.0:0.0	.	315;379	E7EV13;P48664	.;EAA4_HUMAN	K	315;379	ENSP00000409386:Q315K;ENSP00000221742:Q379K	ENSP00000221742:Q379K	Q	-	1	0	SLC1A6	14928322	1.000000	0.71417	0.997000	0.53966	0.923000	0.55619	7.423000	0.80229	2.225000	0.72522	0.591000	0.81541	CAA	.		0.582	SLC1A6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466283.1	NM_005071	
GDF15	9518	hgsc.bcm.edu	37	19	18499142	18499142	+	Silent	SNP	C	C	A			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr19:18499142C>A	ENST00000252809.3	+	2	356	c.324C>A	c.(322-324)gcC>gcA	p.A108A	MIR3189_ENST00000578735.1_RNA	NM_004864.2	NP_004855.2	Q99988	GDF15_HUMAN	growth differentiation factor 15	108					cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cytokine activity (GO:0005125)			kidney(2)|large_intestine(1)|liver(1)|lung(5)|prostate(2)|skin(1)	12						TCTCTCGGGCCGCCCTTCCCG	0.687											OREG0025363	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A108A		.											.	GDF15-650	0			c.C324A						.						18.0	21.0	20.0					19																	18499142		2174	4281	6455	SO:0001819	synonymous_variant	9518	exon2			TCGGGCCGCCCTT	BC008962	CCDS12376.1	19p13.11	2008-05-14				ENSG00000130513			30142	protein-coding gene	gene with protein product	"""prostate differentiation factor"""	605312				11895857, 9593718	Standard	NM_004864		Approved	PLAB, MIC-1, PDF, MIC1, NAG-1, PTGFB	uc002niv.2	Q99988		ENST00000252809.3:c.324C>A	19.37:g.18499142C>A		Somatic	67	0	726	WXS	Illumina HiSeq	Phase_I	48	3	NM_004864	0	1	187	191	3	O14629|P78360|Q9BWA0|Q9NRT0	Silent	SNP	ENST00000252809.3	37	CCDS12376.1																																																																																			.		0.687	GDF15-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466340.2	NM_004864	
ZNF461	92283	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	37147417	37147417	+	Missense_Mutation	SNP	G	G	C			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr19:37147417G>C	ENST00000588268.1	-	4	392	c.165C>G	c.(163-165)atC>atG	p.I55M	ZNF461_ENST00000360357.4_Missense_Mutation_p.I55M	NM_153257.2	NP_694989.2	Q8TAF7	ZN461_HUMAN	zinc finger protein 461	55	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|large_intestine(4)|lung(17)|prostate(1)|urinary_tract(2)	29	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			CCAATGAGGAGATTACGGCTG	0.443																																					p.I55M		.											.	.	0			c.C165G						.						72.0	74.0	73.0					19																	37147417		2068	4232	6300	SO:0001583	missense	92283	exon4			TGAGGAGATTACG	BX649031	CCDS54257.1, CCDS74348.1	19q13.13	2013-01-08				ENSG00000197808		"""Zinc fingers, C2H2-type"", ""-"""	21629	protein-coding gene	gene with protein product		608640				11579202, 15004467	Standard	XM_005259402		Approved	GIOT-1, MGC33911	uc002oem.3	Q8TAF7		ENST00000588268.1:c.165C>G	19.37:g.37147417G>C	ENSP00000467931:p.Ile55Met	Somatic	94	0		WXS	Illumina HiSeq	Phase_I	78	32	NM_153257	0	0	0	0	0	A8K9W9|Q6VSF7|Q9ULZ8	Missense_Mutation	SNP	ENST00000588268.1	37	CCDS54257.1	.	.	.	.	.	.	.	.	.	.	G	13.67	2.306002	0.40795	.	.	ENSG00000197808	ENST00000396893;ENST00000360357	T	0.00912	5.55	3.27	-0.373	0.12516	Krueppel-associated box (3);	.	.	.	.	T	0.05090	0.0136	M	0.88704	2.975	0.09310	N	1	D;D	0.64830	0.994;0.994	D;D	0.76071	0.987;0.987	T	0.14364	-1.0475	9	0.87932	D	0	.	5.9972	0.19501	0.3696:0.0:0.6304:0.0	.	55;55	B4DRP8;Q8TAF7	.;ZN461_HUMAN	M	55	ENSP00000353515:I55M	ENSP00000353515:I55M	I	-	3	3	ZNF461	41839257	0.882000	0.30256	0.011000	0.14972	0.955000	0.61496	0.417000	0.21214	-0.071000	0.12886	0.585000	0.79938	ATC	.		0.443	ZNF461-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453202.1	NM_153257	
RYR1	6261	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	39058443	39058443	+	Silent	SNP	C	C	T			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr19:39058443C>T	ENST00000359596.3	+	93	13545	c.13545C>T	c.(13543-13545)ccC>ccT	p.P4515P	RYR1_ENST00000355481.4_Silent_p.P4510P|RYR1_ENST00000360985.3_Silent_p.P4510P			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	4515	Pro-rich.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	AAGAAGTTCCCGAGCCCACAC	0.577																																					p.P4515P		.											.	RYR1-100	0			c.C13545T						.						88.0	94.0	92.0					19																	39058443		2203	4300	6503	SO:0001819	synonymous_variant	6261	exon93			AGTTCCCGAGCCC	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.13545C>T	19.37:g.39058443C>T		Somatic	137	2		WXS	Illumina HiSeq	Phase_I	84	24	NM_000540	0	0	1	1	0	Q16314|Q16368|Q9NPK1|Q9P1U4	Silent	SNP	ENST00000359596.3	37	CCDS33011.1																																																																																			.		0.577	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
ERCC2	2068	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	45868315	45868315	+	Silent	SNP	G	G	A	rs139263710		TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr19:45868315G>A	ENST00000391945.4	-	6	539	c.462C>T	c.(460-462)caC>caT	p.H154H	ERCC2_ENST00000221481.6_Intron|ERCC2_ENST00000391944.3_Intron|ERCC2_ENST00000485403.2_Silent_p.H130H|ERCC2_ENST00000391940.4_Silent_p.H130H	NM_000400.3	NP_000391.1	P18074	ERCC2_HUMAN	excision repair cross-complementation group 2	154	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				7-methylguanosine mRNA capping (GO:0006370)|aging (GO:0007568)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|central nervous system myelin formation (GO:0032289)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)|embryonic cleavage (GO:0040016)|erythrocyte maturation (GO:0043249)|extracellular matrix organization (GO:0030198)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|hair follicle maturation (GO:0048820)|hematopoietic stem cell differentiation (GO:0060218)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|spinal cord development (GO:0021510)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|MMXD complex (GO:0071817)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			large_intestine(4)|lung(2)|ovary(1)|pancreas(1)|stomach(1)	9		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		AGAATCGGCAGTGGGGCAGGC	0.637			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																												p.H154H		.	yes	Rec		Xeroderma pigmentosum (D)	19	19q13.2-q13.3	2068	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D)"""		E	.	ERCC2-848	0			c.C462T						.						61.0	55.0	57.0					19																	45868315		2203	4300	6503	SO:0001819	synonymous_variant	2068	exon6	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	TCGGCAGTGGGGC		CCDS33049.1, CCDS46112.1	19q13.3	2014-09-17	2014-03-07		ENSG00000104884	ENSG00000104884	3.6.4.12	"""General transcription factor IIH complex subunits"""	3434	protein-coding gene	gene with protein product	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 protein"", ""TFIIH basal transcription factor complex helicase XPB subunit"""	126340	"""xeroderma pigmentosum complementary group D"", ""excision repair cross-complementing rodent repair deficiency, complementation group 2"""	XPD		8413672, 2184031	Standard	NM_000400		Approved	MAG, EM9, MGC102762, MGC126218, MGC126219, TFIIH	uc002pbj.2	P18074	OTTHUMG00000048190	ENST00000391945.4:c.462C>T	19.37:g.45868315G>A		Somatic	60	0		WXS	Illumina HiSeq	Phase_I	50	23	NM_000400	0	0	9	18	9	Q2TB78|Q2YDY2|Q7KZU6|Q8N721	Silent	SNP	ENST00000391945.4	37	CCDS33049.1																																																																																			G|1.000;C|0.000		0.637	ERCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109626.2	NM_000400	
BAX	581	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	19	49464330	49464330	+	Intron	SNP	T	T	C			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr19:49464330T>C	ENST00000345358.7	+	5	526				BAX_ENST00000354470.3_Intron|CTD-2639E6.9_ENST00000599784.1_lincRNA|BAX_ENST00000539787.1_Intron|BAX_ENST00000391871.3_Intron|BAX_ENST00000415969.2_Intron|BAX_ENST00000293288.8_Silent_p.Y211Y	NM_138761.3|NM_138764.4	NP_620116.1|NP_620119.2	Q07812	BAX_HUMAN	BCL2-associated X protein						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097296)|apoptotic mitochondrial changes (GO:0008637)|apoptotic process (GO:0006915)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|apoptotic process involved in patterning of blood vessels (GO:1902262)|apoptotic signaling pathway (GO:0097190)|B cell apoptotic process (GO:0001783)|B cell homeostasis (GO:0001782)|B cell homeostatic proliferation (GO:0002358)|B cell negative selection (GO:0002352)|B cell receptor apoptotic signaling pathway (GO:1990117)|blood vessel remodeling (GO:0001974)|cellular response to organic substance (GO:0071310)|cellular response to UV (GO:0034644)|cerebral cortex development (GO:0021987)|development of secondary sexual characteristics (GO:0045136)|ectopic germ cell programmed cell death (GO:0035234)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|establishment or maintenance of transmembrane electrochemical gradient (GO:0010248)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|fertilization (GO:0009566)|germ cell development (GO:0007281)|glycosphingolipid metabolic process (GO:0006687)|homeostasis of number of cells within a tissue (GO:0048873)|hypothalamus development (GO:0021854)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|kidney development (GO:0001822)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrial fusion (GO:0008053)|mitochondrion morphogenesis (GO:0070584)|myeloid cell homeostasis (GO:0002262)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of protein binding (GO:0032091)|neuron apoptotic process (GO:0051402)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|ovarian follicle development (GO:0001541)|positive regulation of apoptotic DNA fragmentation (GO:1902512)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic process involved in mammary gland involution (GO:0060058)|positive regulation of B cell apoptotic process (GO:0002904)|positive regulation of developmental pigmentation (GO:0048087)|positive regulation of endoplasmic reticulum unfolded protein response (GO:1900103)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|post-embryonic camera-type eye morphogenesis (GO:0048597)|protein homooligomerization (GO:0051260)|protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:0001844)|protein oligomerization (GO:0051259)|regulation of cell cycle (GO:0051726)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|regulation of mitochondrial membrane permeability involved in programmed necrotic cell death (GO:1902445)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of nitrogen utilization (GO:0006808)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|release of cytochrome c from mitochondria (GO:0001836)|release of matrix enzymes from mitochondria (GO:0032976)|response to axon injury (GO:0048678)|response to gamma radiation (GO:0010332)|response to salt stress (GO:0009651)|response to toxic substance (GO:0009636)|retina development in camera-type eye (GO:0060041)|retinal cell apoptotic process (GO:1990009)|retinal cell programmed cell death (GO:0046666)|Sertoli cell proliferation (GO:0060011)|spermatid differentiation (GO:0048515)|T cell homeostatic proliferation (GO:0001777)|thymocyte apoptotic process (GO:0070242)|transformed cell apoptotic process (GO:0006927)|vagina development (GO:0060068)|viral process (GO:0016032)	BAX complex (GO:0097144)|Bcl-2 family protein complex (GO:0097136)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrial permeability transition pore complex (GO:0005757)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|pore complex (GO:0046930)	BH3 domain binding (GO:0051434)|channel activity (GO:0015267)|identical protein binding (GO:0042802)|lipid binding (GO:0008289)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(7)|skin(2)|urinary_tract(4)	17		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000159)|all cancers(93;0.00047)|GBM - Glioblastoma multiforme(486;0.018)|Epithelial(262;0.0279)		ATGTGGTCTATAATGCGTTTT	0.567																																					p.Y211Y		.											.	BAX-1271	0			c.T633C						.						89.0	63.0	72.0					19																	49464330		2176	4278	6454	SO:0001627	intron_variant	581	exon5			GGTCTATAATGCG		CCDS12742.1, CCDS12743.1, CCDS12744.1, CCDS12745.1, CCDS12745.2	19q13.3-q13.4	2014-03-07			ENSG00000087088	ENSG00000087088			959	protein-coding gene	gene with protein product		600040				8358790	Standard	NM_138761		Approved	BCL2L4	uc002plf.1	Q07812	OTTHUMG00000160476	ENST00000345358.7:c.474+159T>C	19.37:g.49464330T>C		Somatic	83	0		WXS	Illumina HiSeq	Phase_I	96	45	NM_004324	0	0	7	13	6	A8K4W1|P55269|Q07814|Q07815|Q8WZ49|Q9NR76|Q9NYG7|Q9UCZ6|Q9UCZ7|Q9UQD6	Silent	SNP	ENST00000345358.7	37	CCDS12742.1																																																																																			.		0.567	BAX-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360767.1	NM_138763	
ZNF321P	399669	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	53432286	53432286	+	Missense_Mutation	SNP	A	A	G			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr19:53432286A>G	ENST00000391777.3	-	4	693	c.572T>C	c.(571-573)tTg>tCg	p.L191S	ZNF816_ENST00000434371.2_Missense_Mutation_p.L191S|ZNF816-ZNF321P_ENST00000313956.4_RNA|ZNF816_ENST00000549216.1_Missense_Mutation_p.L122S			Q8N8H1	ZN321_HUMAN	zinc finger protein 321, pseudogene	122										endometrium(1)|large_intestine(1)|lung(1)|ovary(1)	4						TTGGGATGTCAAAATTAAGGA	0.373																																					p.L191S		.											.	.	0			c.T572C						.						94.0	100.0	98.0					19																	53432286		2185	4293	6478	SO:0001583	missense	100529240	exon4			GATGTCAAAATTA	AK096828		19q13.4	2013-01-08	2011-04-19	2011-04-19	ENSG00000221874	ENSG00000221874			13827	pseudogene	pseudogene			"""zinc finger protein 321"""	ZNF321			Standard	NR_037805		Approved	MGC35402		Q8N8H1	OTTHUMG00000167760	ENST00000391777.3:c.572T>C	19.37:g.53432286A>G	ENSP00000375656:p.Leu191Ser	Somatic	214	0		WXS	Illumina HiSeq	Phase_I	200	89	NM_001202473	0	0	3	4	1	B7ZB38|Q68DZ0|Q86SS5	Missense_Mutation	SNP	ENST00000391777.3	37	CCDS56101.1	.	.	.	.	.	.	.	.	.	.	g	0.886	-0.727124	0.03158	.	.	ENSG00000180257;ENSG00000180257;ENSG00000221874	ENST00000549216;ENST00000434371;ENST00000391777	T;T;T	0.01252	5.1;5.95;5.95	1.78	-0.553	0.11815	.	.	.	.	.	T	0.00412	0.0013	N	0.00337	-1.62	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.46512	-0.9186	9	0.02654	T	1	.	4.0322	0.09714	0.4322:0.0:0.5678:0.0	.	122	Q8N8H1	ZN321_HUMAN	S	122;191;191	ENSP00000449832:L122S;ENSP00000438519:L191S;ENSP00000375656:L191S	ENSP00000375656:L191S	L	-	2	0	ZNF321P;ZNF816	58124098	0.000000	0.05858	0.002000	0.10522	0.003000	0.03518	0.088000	0.14979	0.107000	0.17824	-1.981000	0.00455	TTG	.		0.373	ZNF321P-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000396130.1	NR_037805	
NLRP9	338321	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	56244868	56244868	+	Missense_Mutation	SNP	A	A	T			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr19:56244868A>T	ENST00000332836.2	-	2	356	c.329T>A	c.(328-330)aTa>aAa	p.I110K		NM_176820.2	NP_789790.2	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	110						cytoplasm (GO:0005737)	ATP binding (GO:0005524)			NS(2)|breast(5)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(15)|lung(21)|ovary(2)|prostate(3)|skin(7)|urinary_tract(3)	74		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		CTTCTCCCATATGAGTTGAAA	0.363																																					p.I110K		.											.	NLRP9-294	0			c.T329A						.						122.0	122.0	122.0					19																	56244868		2203	4300	6503	SO:0001583	missense	338321	exon2			TCCCATATGAGTT	AY154464	CCDS12934.1	19q13.43	2006-12-08	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22941	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 9"""	609663	"""NACHT, leucine rich repeat and PYD containing 9"""	NALP9		12563287	Standard	NM_176820		Approved	NOD6, PAN12, CLR19.1	uc002qly.3	Q7RTR0		ENST00000332836.2:c.329T>A	19.37:g.56244868A>T	ENSP00000331857:p.Ile110Lys	Somatic	149	0		WXS	Illumina HiSeq	Phase_I	124	57	NM_176820	0	0	0	0	0	B2RN12|Q86W27	Missense_Mutation	SNP	ENST00000332836.2	37	CCDS12934.1	.	.	.	.	.	.	.	.	.	.	A	14.52	2.559517	0.45590	.	.	ENSG00000185792	ENST00000332836;ENST00000333452	T	0.73897	-0.79	3.4	3.4	0.38934	.	.	.	.	.	T	0.60996	0.2312	L	0.39898	1.24	0.18873	N	0.999985	P	0.42827	0.791	B	0.36719	0.231	T	0.49925	-0.8887	9	0.29301	T	0.29	.	8.4613	0.32929	1.0:0.0:0.0:0.0	.	110	Q7RTR0	NALP9_HUMAN	K	110	ENSP00000331857:I110K	ENSP00000331857:I110K	I	-	2	0	NLRP9	60936680	0.004000	0.15560	0.004000	0.12327	0.074000	0.17049	1.274000	0.33132	1.588000	0.49971	0.524000	0.50904	ATA	.		0.363	NLRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453653.1	NM_176820	
ZNF749	388567	hgsc.bcm.edu	37	19	57954667	57954667	+	Missense_Mutation	SNP	C	C	G			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr19:57954667C>G	ENST00000334181.4	+	3	401	c.151C>G	c.(151-153)Cat>Gat	p.H51D	AC004076.9_ENST00000596831.1_Intron	NM_001023561.2	NP_001018855.2	O43361	ZN749_HUMAN	zinc finger protein 749	51	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|lung(3)|prostate(1)	13		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0264)|Lung(386;0.177)		AGGTTGTTGGCATGGAGCCAA	0.507																																					p.H51D		.											.	.	0			c.C151G						.						67.0	64.0	65.0					19																	57954667		2203	4300	6503	SO:0001583	missense	388567	exon3			TGTTGGCATGGAG	AK122740	CCDS33132.2	19q13.43	2013-01-08			ENSG00000186230	ENSG00000186230		"""Zinc fingers, C2H2-type"", ""-"""	32783	protein-coding gene	gene with protein product							Standard	NM_001023561		Approved	FLJ16360	uc002qoq.2	O43361	OTTHUMG00000150372	ENST00000334181.4:c.151C>G	19.37:g.57954667C>G	ENSP00000333980:p.His51Asp	Somatic	66	0		WXS	Illumina HiSeq	Phase_I	40	2	NM_001023561	0	0	0	0	0		Missense_Mutation	SNP	ENST00000334181.4	37	CCDS33132.2	.	.	.	.	.	.	.	.	.	.	C	12.76	2.033661	0.35893	.	.	ENSG00000186230	ENST00000334181	T	0.00801	5.68	2.07	-0.28	0.12886	Krueppel-associated box (3);	.	.	.	.	T	0.00815	0.0027	L	0.34521	1.04	0.09310	N	1	P	0.47409	0.895	B	0.38156	0.266	T	0.53683	-0.8404	9	0.35671	T	0.21	.	6.3111	0.21164	0.0:0.7049:0.0:0.2951	.	51	O43361	ZN749_HUMAN	D	51	ENSP00000333980:H51D	ENSP00000333980:H51D	H	+	1	0	ZNF749	62646479	0.000000	0.05858	0.014000	0.15608	0.316000	0.28119	-1.407000	0.02488	0.007000	0.14760	0.313000	0.20887	CAT	.		0.507	ZNF749-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317879.1	NM_001023561	
ZNF814	730051	broad.mit.edu	37	19	58385546	58385546	+	Missense_Mutation	SNP	G	G	T	rs201682072		TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr19:58385546G>T	ENST00000435989.2	-	3	1446	c.1212C>A	c.(1210-1212)gaC>gaA	p.D404E	ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000600634.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	404					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D404E(10)		NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						AATGTTTTTTGTCAGTGTGAA	0.393																																					p.D404E													.	.	10	Substitution - Missense(10)	urinary_tract(3)|kidney(3)|prostate(2)|NS(1)|skin(1)	c.C1212A						.						117.0	93.0	100.0					19																	58385546		692	1591	2283	SO:0001583	missense	730051	exon3			TTTTTTGTCAGTG		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.1212C>A	19.37:g.58385546G>T	ENSP00000410545:p.Asp404Glu	Somatic	18	0		WXS	Illumina HiSeq	Phase_I	16	3	NM_001144989	0	0	0	2	2	A6NF35	Missense_Mutation	SNP	ENST00000435989.2	37	CCDS46212.1	.	.	.	.	.	.	.	.	.	.	.	11.12	1.545823	0.27652	.	.	ENSG00000204514	ENST00000435989;ENST00000376205	T	0.14640	2.49	2.33	-4.66	0.03329	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04363	0.0120	N	0.03177	-0.4	0.09310	N	1	B	0.13145	0.007	B	0.10450	0.005	T	0.33574	-0.9863	9	0.54805	T	0.06	.	1.2175	0.01917	0.3897:0.3041:0.1331:0.1731	.	404	B7Z6K7	ZN814_HUMAN	E	404;266	ENSP00000410545:D404E	ENSP00000365378:D266E	D	-	3	2	ZNF814	63077358	0.000000	0.05858	0.000000	0.03702	0.038000	0.13279	-1.489000	0.02306	-2.531000	0.00491	-1.292000	0.01352	GAC	.		0.393	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
MZF1	7593	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	59073766	59073766	+	Missense_Mutation	SNP	G	G	T			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr19:59073766G>T	ENST00000215057.2	-	6	2438	c.1878C>A	c.(1876-1878)caC>caA	p.H626Q	AC016629.8_ENST00000600534.1_RNA|AC016629.8_ENST00000593642.1_RNA|MZF1_ENST00000599369.1_Missense_Mutation_p.H626Q|AC016629.8_ENST00000600726.1_RNA|MZF1_ENST00000594234.1_3'UTR	NM_001267033.1|NM_198055.1	NP_001253962.1|NP_932172.1	P28698	MZF1_HUMAN	myeloid zinc finger 1	626					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0443)|all cancers(4;7.92e-14)|Epithelial(4;5.57e-11)|OV - Ovarian serous cystadenocarcinoma(4;1.13e-09)|GBM - Glioblastoma multiforme(193;0.0108)|Lung(386;0.182)		ACTCACCGCAGTGGTAGGGCT	0.682																																					p.H626Q		.											.	MZF1-91	0			c.C1878A						.						33.0	25.0	28.0					19																	59073766		2201	4300	6501	SO:0001583	missense	7593	exon6			ACCGCAGTGGTAG	M58297	CCDS12988.1, CCDS59427.1	19q13.43	2014-08-22	2006-06-15	2006-06-15	ENSG00000099326	ENSG00000099326		"""-"", ""Zinc fingers, C2H2-type"""	13108	protein-coding gene	gene with protein product		194550	"""zinc finger protein 42 (myeloid-specific retinoic acid-responsive)"""	ZNF42		1860835	Standard	NM_198055		Approved	ZSCAN6, MZF1B, MZF-1, Zfp98	uc002qtn.3	P28698	OTTHUMG00000183550	ENST00000215057.2:c.1878C>A	19.37:g.59073766G>T	ENSP00000215057:p.His626Gln	Somatic	16	0		WXS	Illumina HiSeq	Phase_I	17	11	NM_198055	0	0	6	15	9	M0QXU0|Q7Z729|Q96I71|Q9NRY0|Q9UBW2	Missense_Mutation	SNP	ENST00000215057.2	37	CCDS12988.1	.	.	.	.	.	.	.	.	.	.	G	8.359	0.832673	0.16820	.	.	ENSG00000099326	ENST00000215057	T	0.16073	2.37	3.21	2.17	0.27698	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.732947	0.11236	N	0.585150	T	0.04272	0.0118	N	0.00315	-1.66	0.25952	N	0.982731	B	0.27286	0.174	B	0.34722	0.188	T	0.43540	-0.9385	10	0.15499	T	0.54	-9.8517	4.7075	0.12856	0.1258:0.2248:0.6494:0.0	.	626	P28698	MZF1_HUMAN	Q	626	ENSP00000215057:H626Q	ENSP00000215057:H626Q	H	-	3	2	MZF1	63765578	0.000000	0.05858	0.908000	0.35775	0.900000	0.52787	-0.753000	0.04792	0.925000	0.37094	-0.379000	0.06801	CAC	.		0.682	MZF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467112.1	NM_198055	
PSME4	23198	broad.mit.edu;ucsc.edu	37	2	54176408	54176408	+	Silent	SNP	A	A	G			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr2:54176408A>G	ENST00000404125.1	-	2	310	c.255T>C	c.(253-255)ctT>ctC	p.L85L	PSME4_ENST00000421748.2_5'Flank	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4	85					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|spermatoproteasome complex (GO:1990111)	lysine-acetylated histone binding (GO:0070577)|peptidase activator activity (GO:0016504)			breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			TTCTCCCATAAAGTCGAatat	0.333																																					p.L85L													.	PSME4-275	0			c.T255C						.						78.0	64.0	68.0					2																	54176408		692	1591	2283	SO:0001819	synonymous_variant	23198	exon2			CCCATAAAGTCGA	D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878		"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705				7584044, 12093752	Standard	NM_014614		Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852	ENST00000404125.1:c.255T>C	2.37:g.54176408A>G		Somatic	39	0		WXS	Illumina HiSeq	Phase_I	32	9	NM_014614	0	0	0	0	0	Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	Silent	SNP	ENST00000404125.1	37	CCDS33197.2																																																																																			.		0.333	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324163.1	XM_040158	
CHRNA1	1134	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	175624262	175624262	+	Missense_Mutation	SNP	A	A	T			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr2:175624262A>T	ENST00000261007.5	-	2	209	c.143T>A	c.(142-144)gTc>gAc	p.V48D	CHRNA1_ENST00000409219.1_Missense_Mutation_p.V48D|CHRNA1_ENST00000348749.5_Missense_Mutation_p.V48D|AC018890.6_ENST00000442996.1_RNA|CHRNA1_ENST00000409542.1_Missense_Mutation_p.V48D|CHRNA1_ENST00000409323.1_Missense_Mutation_p.V48D	NM_001039523.2	NP_001034612.1	P02708	ACHA_HUMAN	cholinergic receptor, nicotinic, alpha 1 (muscle)	48					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|muscle cell cellular homeostasis (GO:0046716)|musculoskeletal movement (GO:0050881)|neuromuscular junction development (GO:0007528)|neuromuscular process (GO:0050905)|neuromuscular synaptic transmission (GO:0007274)|neuron cellular homeostasis (GO:0070050)|neuronal action potential (GO:0019228)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue growth (GO:0048630)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cell surface (GO:0009986)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ion channel activity (GO:0005216)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(15)|ovary(3)|prostate(3)|skin(4)	37					Galantamine(DB00674)	GACCTCCACGACCTGGCGGTG	0.617																																					p.V48D		.											.	CHRNA1-518	0			c.T143A						.						132.0	130.0	130.0					2																	175624262		2203	4300	6503	SO:0001583	missense	1134	exon2			TCCACGACCTGGC	Y00762	CCDS2261.1, CCDS33331.1	2q31.1	2012-02-11	2006-02-01		ENSG00000138435	ENSG00000138435		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1955	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 1 (muscle)"""	100690	"""cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle)"""	CHRNA			Standard	NM_001039523		Approved		uc002uje.2	P02708	OTTHUMG00000132357	ENST00000261007.5:c.143T>A	2.37:g.175624262A>T	ENSP00000261007:p.Val48Asp	Somatic	288	1		WXS	Illumina HiSeq	Phase_I	277	92	NM_001039523	0	0	1	1	0	B4DRV6|D3DPE8	Missense_Mutation	SNP	ENST00000261007.5	37	CCDS33331.1	.	.	.	.	.	.	.	.	.	.	A	19.63	3.863276	0.71949	.	.	ENSG00000138435	ENST00000348749;ENST00000261007;ENST00000409542;ENST00000409219;ENST00000409323	T;T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19;-1.19	5.91	-8.16	0.01061	Neurotransmitter-gated ion-channel ligand-binding (3);	0.620936	0.18070	N	0.152675	T	0.67021	0.2849	L	0.61036	1.89	0.09310	N	1	B;B;B	0.24043	0.06;0.074;0.096	B;B;B	0.28305	0.066;0.068;0.088	T	0.50717	-0.8795	10	0.22109	T	0.4	.	11.3745	0.49719	0.6712:0.0:0.2368:0.092	.	48;48;48	G5E9G9;Q53SH4;P02708	.;.;ACHA_HUMAN	D	48	ENSP00000261008:V48D;ENSP00000261007:V48D;ENSP00000387026:V48D;ENSP00000386611:V48D;ENSP00000386684:V48D	ENSP00000261007:V48D	V	-	2	0	CHRNA1	175332508	0.000000	0.05858	0.000000	0.03702	0.860000	0.49131	0.097000	0.15168	-1.811000	0.01229	0.379000	0.24179	GTC	.		0.617	CHRNA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000334116.1		
SLC40A1	30061	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	190428363	190428363	+	Missense_Mutation	SNP	A	A	T			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr2:190428363A>T	ENST00000261024.2	-	7	1775	c.1349T>A	c.(1348-1350)gTg>gAg	p.V450E		NM_014585.5	NP_055400.1	Q9NP59	S40A1_HUMAN	solute carrier family 40 (iron-regulated transporter), member 1	450					anatomical structure morphogenesis (GO:0009653)|cellular iron ion homeostasis (GO:0006879)|endothelium development (GO:0003158)|iron ion transmembrane transport (GO:0034755)|lymphocyte homeostasis (GO:0002260)|multicellular organismal iron ion homeostasis (GO:0060586)|negative regulation of apoptotic process (GO:0043066)|regulation of transcription from RNA polymerase II promoter in response to iron (GO:0034395)|spleen trabecula formation (GO:0060345)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	iron ion transmembrane transporter activity (GO:0005381)			endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(117;0.000917)|Epithelial(96;0.014)|all cancers(119;0.0491)			GATTATGGGCACAGATTCAGG	0.368																																					p.V450E		.											.	SLC40A1-91	0			c.T1349A						.						78.0	80.0	80.0					2																	190428363		2203	4300	6503	SO:0001583	missense	30061	exon7			ATGGGCACAGATT	AF215636	CCDS2299.1	2q32	2014-09-17	2003-06-04	2003-06-05	ENSG00000138449	ENSG00000138449		"""Solute carriers"""	10909	protein-coding gene	gene with protein product	"""ferroportin 1"""	604653	"""solute carrier family 11 (proton-coupled divalent metal ion transporters), member 3"""	SLC11A3		10828623	Standard	NM_014585		Approved	MTP1, IREG1, FPN1, HFE4	uc002uqp.4	Q9NP59	OTTHUMG00000132662	ENST00000261024.2:c.1349T>A	2.37:g.190428363A>T	ENSP00000261024:p.Val450Glu	Somatic	118	0		WXS	Illumina HiSeq	Phase_I	95	40	NM_014585	0	0	44	82	38	Q6FI62|Q7Z4F8|Q8IVB2|Q9NRL0	Missense_Mutation	SNP	ENST00000261024.2	37	CCDS2299.1	.	.	.	.	.	.	.	.	.	.	A	13.30	2.195338	0.38806	.	.	ENSG00000138449	ENST00000261024	D	0.92397	-3.03	6.02	0.296	0.15757	Major facilitator superfamily domain, general substrate transporter (1);	0.667620	0.15785	N	0.244735	T	0.81245	0.4782	N	0.16368	0.405	0.22827	N	0.998683	B	0.02656	0.0	B	0.06405	0.002	T	0.61237	-0.7103	10	0.02654	T	1	-0.1187	12.0936	0.53742	0.5205:0.0:0.0:0.4795	.	450	Q9NP59	S40A1_HUMAN	E	450	ENSP00000261024:V450E	ENSP00000261024:V450E	V	-	2	0	SLC40A1	190136608	0.973000	0.33851	0.001000	0.08648	0.433000	0.31745	1.091000	0.30915	-0.201000	0.10284	0.528000	0.53228	GTG	.		0.368	SLC40A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255916.2		
HECW2	57520	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	197187250	197187250	+	Missense_Mutation	SNP	C	C	T			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr2:197187250C>T	ENST00000260983.3	-	7	1018	c.836G>A	c.(835-837)gGg>gAg	p.G279E	HECW2_ENST00000409111.1_5'UTR	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	279	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						GGTTAGTTTCCCCAGAAAACG	0.413																																					p.G279E		.											.	HECW2-668	0			c.G836A						.						123.0	126.0	125.0					2																	197187250		2203	4300	6503	SO:0001583	missense	57520	exon7			AGTTTCCCCAGAA	AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.836G>A	2.37:g.197187250C>T	ENSP00000260983:p.Gly279Glu	Somatic	223	0		WXS	Illumina HiSeq	Phase_I	194	77	NM_020760	0	0	1	1	0	B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Missense_Mutation	SNP	ENST00000260983.3	37	CCDS33354.1	.	.	.	.	.	.	.	.	.	.	C	33	5.280284	0.95489	.	.	ENSG00000138411	ENST00000260983	T	0.77489	-1.1	5.49	5.49	0.81192	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.221358	0.47093	D	0.000253	D	0.88496	0.6452	M	0.75447	2.3	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88816	0.3295	10	0.87932	D	0	.	19.6359	0.95733	0.0:1.0:0.0:0.0	.	279	Q9P2P5	HECW2_HUMAN	E	279	ENSP00000260983:G279E	ENSP00000260983:G279E	G	-	2	0	HECW2	196895495	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.635000	0.83286	2.878000	0.98634	0.650000	0.86243	GGG	.		0.413	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335199.3	NM_020760	
ABCB6	10058	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	220075814	220075814	+	Missense_Mutation	SNP	A	A	G	rs387906909		TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr2:220075814A>G	ENST00000265316.3	-	15	2301	c.1985T>C	c.(1984-1986)cTc>cCc	p.L662P	ABCB6_ENST00000439002.2_Missense_Mutation_p.L616P	NM_005689.2	NP_005680.1	Q9NP58	ABCB6_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 6 (Langereis blood group)	662	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				brain development (GO:0007420)|cellular iron ion homeostasis (GO:0006879)|heme transport (GO:0015886)|porphyrin-containing compound biosynthetic process (GO:0006779)|skin development (GO:0043588)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of mitochondrial outer membrane (GO:0031307)|mitochondrial envelope (GO:0005740)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|efflux transmembrane transporter activity (GO:0015562)|heme binding (GO:0020037)|heme transporter activity (GO:0015232)|heme-transporting ATPase activity (GO:0015439)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	34		Renal(207;0.0474)		Epithelial(149;1.22e-06)|all cancers(144;0.000201)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GTGAGACCGGAGAGAGGCCTG	0.582																																					p.L662P		.											.	ABCB6-153	0			c.T1985C						.						108.0	106.0	106.0					2																	220075814		2203	4300	6503	SO:0001583	missense	10058	exon15			GACCGGAGAGAGG	AF070598	CCDS2436.1	2q36	2014-08-27	2014-08-27		ENSG00000115657	ENSG00000115657		"""ATP binding cassette transporters / subfamily B"""	47	protein-coding gene	gene with protein product	"""ATP-binding cassette half-transporter"""	605452	"""ATP-binding cassette, sub-family B (MDR/TAP), member 6"""			8894702, 9110174	Standard	NM_005689		Approved	EST45597, umat, MTABC3	uc002vkc.2	Q9NP58	OTTHUMG00000133131	ENST00000265316.3:c.1985T>C	2.37:g.220075814A>G	ENSP00000265316:p.Leu662Pro	Somatic	183	0		WXS	Illumina HiSeq	Phase_I	142	55	NM_005689	0	0	34	55	21	O75542|Q49A66|Q59GQ5|Q6ZME6|Q96ME8|Q9HAQ6|Q9HAQ7	Missense_Mutation	SNP	ENST00000265316.3	37	CCDS2436.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	20.9|20.9	4.065625|4.065625	0.76187|0.76187	.|.	.|.	ENSG00000115657|ENSG00000115657	ENST00000265316;ENST00000439002|ENST00000295750	D;D|.	0.92299|.	-3.01;-3.01|.	4.7|4.7	4.7|4.7	0.59300|0.59300	ATPase, AAA+ type, core (1);ABC transporter-like (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.79885|0.79885	0.4523|0.4523	M|M	0.89478|0.89478	3.035|3.035	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.83275|.	0.994;0.996|.	D|D	0.83833|0.83833	0.0253|0.0253	10|5	0.87932|.	D|.	0|.	-18.3339|-18.3339	14.286|14.286	0.66247|0.66247	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	616;662|.	Q9NP58-4;Q9NP58|.	.;ABCB6_HUMAN|.	P|P	662;616|510	ENSP00000265316:L662P;ENSP00000394333:L616P|.	ENSP00000265316:L662P|.	L|S	-|-	2|1	0|0	ABCB6|ABCB6	219784058|219784058	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.828000|0.828000	0.46876|0.46876	8.912000|8.912000	0.92726|0.92726	2.084000|2.084000	0.62774|0.62774	0.528000|0.528000	0.53228|0.53228	CTC|TCC	.		0.582	ABCB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256820.2	NM_005689	
SIRPA	140885	hgsc.bcm.edu	37	20	1895835	1895835	+	Missense_Mutation	SNP	C	C	T	rs17855612	byFrequency	TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr20:1895835C>T	ENST00000358771.4	+	2	322	c.170C>T	c.(169-171)gCg>gTg	p.A57V	SIRPA_ENST00000356025.3_Missense_Mutation_p.A57V|SIRPA_ENST00000400068.3_Missense_Mutation_p.A57V	NM_001040023.1	NP_001035112.1	P78324	SHPS1_HUMAN	signal-regulatory protein alpha	57	Ig-like V-type.		A -> V (in dbSNP:rs17855612). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:9062191, ECO:0000269|PubMed:9070220}.		blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(13)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	21				Colorectal(46;0.018)|READ - Rectum adenocarcinoma(1;0.0556)		CGCTGCACTGCGACCTCTCTG	0.582													C|||	1319	0.263379	0.1445	0.304	5008	,	,		11273	0.4474		0.1849	False		,,,				2504	0.2863				p.A57V	GBM(155;1668 1920 5945 42733 48121)	.											.	SIRPA-227	0			c.C170T						.	C	VAL/ALA,VAL/ALA,VAL/ALA	91,4161		1,89,2036	54.0	48.0	50.0		170,170,170	0.1	0.0	20	dbSNP_123	50	318,7874		0,318,3778	yes	missense,missense,missense	SIRPA	NM_001040022.1,NM_001040023.1,NM_080792.2	64,64,64	1,407,5814	TT,TC,CC		3.8818,2.1402,3.2867	benign,benign,benign	57/505,57/505,57/505	1895835	409,12035	2126	4096	6222	SO:0001583	missense	140885	exon3			GCACTGCGACCTC	D86043	CCDS13022.1	20p13	2013-01-11	2006-03-29	2006-03-29	ENSG00000198053	ENSG00000198053		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	9662	protein-coding gene	gene with protein product		602461	"""protein tyrosine phosphatase, non-receptor type substrate 1"""	PTPNS1		9070220, 9062191, 16339511	Standard	XM_005260669		Approved	SHPS1, SIRP, MYD-1, BIT, P84, SHPS-1, SIRPalpha, CD172a, SIRPalpha2, MFR, SIRP-ALPHA-1	uc002wfr.3	P78324	OTTHUMG00000031682	ENST00000358771.4:c.170C>T	20.37:g.1895835C>T	ENSP00000351621:p.Ala57Val	Somatic	53	2		WXS	Illumina HiSeq	Phase_I	41	5	NM_001040022	0	0	10	10	0	A2A2E1|A8K411|B2R6C3|O00683|O43799|Q8N517|Q8TAL8|Q9H0Z2|Q9UDX2|Q9UIJ6|Q9Y4U9	Missense_Mutation	SNP	ENST00000358771.4	37	CCDS13022.1	706	0.3232600732600733	88	0.17886178861788618	117	0.32320441988950277	308	0.5384615384615384	193	0.2546174142480211	C	0.148	-1.095121	0.01858	0.021402	0.038818	ENSG00000198053	ENST00000400068;ENST00000356025;ENST00000358771	T;T;T	0.63913	-0.07;-0.07;-0.07	5.11	0.0951	0.14484	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.016370	0.07877	N	0.968974	T	0.00012	0.0000	N	0.01576	-0.805	0.80722	P	0.0	B;B;B	0.06786	0.0;0.001;0.001	B;B;B	0.04013	0.001;0.001;0.001	T	0.42344	-0.9457	9	0.02654	T	1	.	8.9342	0.35688	0.0:0.2455:0.0:0.7545	rs17855612	37;57;57	B4DP97;P78324-2;P78324	.;.;SHPS1_HUMAN	V	57	ENSP00000382941:A57V;ENSP00000348307:A57V;ENSP00000351621:A57V	ENSP00000348307:A57V	A	+	2	0	SIRPA	1843835	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	-0.221000	0.09202	0.089000	0.17243	-2.077000	0.00380	GCG	C|0.677;T|0.323		0.582	SIRPA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077568.2	NM_080792	
CPXM1	56265	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	2776796	2776796	+	Silent	SNP	C	C	G			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr20:2776796C>G	ENST00000380605.2	-	10	1318	c.1254G>C	c.(1252-1254)ctG>ctC	p.L418L		NM_001184699.1|NM_019609.4	NP_001171628.1|NP_062555.1	Q96SM3	CPXM1_HUMAN	carboxypeptidase X (M14 family), member 1	418					cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(8)|lung(17)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43						CCCAGCCCACCAGCTCTGAAC	0.602																																					p.L418L		.											.	CPXM1-94	0			c.G1254C						.						56.0	59.0	58.0					20																	2776796		2203	4300	6503	SO:0001819	synonymous_variant	56265	exon10			GCCCACCAGCTCT	AL035460	CCDS13033.1	20p13	2012-02-10	2006-08-24	2006-08-24	ENSG00000088882	ENSG00000088882			15771	protein-coding gene	gene with protein product	"""carboxypeptidase-like protein X1"""	609555	"""carboxypeptidase X (M14 family)"""	CPXM		14702039	Standard	NM_019609		Approved	CPX-1, CPX1	uc002wgu.3	Q96SM3	OTTHUMG00000031706	ENST00000380605.2:c.1254G>C	20.37:g.2776796C>G		Somatic	101	0		WXS	Illumina HiSeq	Phase_I	83	32	NM_001184699	0	0	0	0	0	Q6P4G8|Q6UW65|Q9NUB5	Silent	SNP	ENST00000380605.2	37	CCDS13033.1																																																																																			.		0.602	CPXM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077643.2	NM_019609	
MACROD2	140733	hgsc.bcm.edu	37	20	14066372	14066372	+	Missense_Mutation	SNP	C	C	T			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr20:14066372C>T	ENST00000310348.4	+	3	269	c.269C>T	c.(268-270)gCc>gTc	p.A90V	MACROD2_ENST00000217246.4_Missense_Mutation_p.A90V			A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2	90	Macro. {ECO:0000255|PROSITE- ProRule:PRU00490}.|Substrate binding.				brain development (GO:0007420)|cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)			breast(2)|kidney(4)|large_intestine(5)|lung(8)|skin(1)	20		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				ATAGTCAATGCCGGTGAGTAG	0.308																																					p.A90V		.											.	MACROD2-22	0			c.C269T						.						86.0	80.0	81.0					20																	14066372		1830	4077	5907	SO:0001583	missense	140733	exon3			TCAATGCCGGTGA	BC101218	CCDS13120.2, CCDS33443.1	20p12.1	2011-04-28	2007-07-24	2007-07-24	ENSG00000172264	ENSG00000172264			16126	protein-coding gene	gene with protein product		611567	"""chromosome 20 open reading frame 133"""	C20orf133			Standard	NM_080676		Approved	dJ631M13.5	uc002wot.3	A1Z1Q3	OTTHUMG00000031919	ENST00000310348.4:c.269C>T	20.37:g.14066372C>T	ENSP00000309809:p.Ala90Val	Somatic	37	0		WXS	Illumina HiSeq	Phase_I	39	2	NM_080676	0	0	0	0	0	A6NFF7|B0QZ39|B3KWV0|Q0P6D5|Q495E0|Q5W199|Q6ZN71	Missense_Mutation	SNP	ENST00000310348.4	37	CCDS13120.2	.	.	.	.	.	.	.	.	.	.	C	25.6	4.650091	0.87958	.	.	ENSG00000172264	ENST00000217246;ENST00000310348	T;T	0.44083	0.93;0.93	5.97	5.97	0.96955	Appr-1-p processing (3);	0.064305	0.64402	D	0.000009	T	0.79488	0.4454	H	0.98559	4.265	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.993;0.996	D	0.86855	0.2026	10	0.87932	D	0	-7.7929	17.9263	0.88985	0.0:1.0:0.0:0.0	.	90;90	A1Z1Q3;A1Z1Q3-2	MACD2_HUMAN;.	V	90	ENSP00000217246:A90V;ENSP00000309809:A90V	ENSP00000217246:A90V	A	+	2	0	MACROD2	14014372	1.000000	0.71417	0.992000	0.48379	0.876000	0.50452	5.209000	0.65208	2.833000	0.97629	0.585000	0.79938	GCC	.		0.308	MACROD2-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_080676	
HUNK	30811	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	33371363	33371363	+	Missense_Mutation	SNP	A	A	C			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr21:33371363A>C	ENST00000270112.2	+	11	2371	c.2011A>C	c.(2011-2013)Atg>Ctg	p.M671L		NM_014586.1	NP_055401.1	P57058	HUNK_HUMAN	hormonally up-regulated Neu-associated kinase	671					multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|skin(2)|stomach(1)	30						CATCGGACAGATGTTAAGGAA	0.617																																					p.M671L		.											.	HUNK-334	0			c.A2011C						.						54.0	60.0	58.0					21																	33371363		2203	4300	6503	SO:0001583	missense	30811	exon11			GGACAGATGTTAA	AJ271722	CCDS13610.1	21q22.1	2008-06-05	2008-06-05		ENSG00000142149	ENSG00000142149			13326	protein-coding gene	gene with protein product		606532	"""hormonally upregulated Neu-associated kinase"""			10662544, 10830953	Standard	NM_014586		Approved		uc002yph.3	P57058	OTTHUMG00000085019	ENST00000270112.2:c.2011A>C	21.37:g.33371363A>C	ENSP00000270112:p.Met671Leu	Somatic	143	0		WXS	Illumina HiSeq	Phase_I	114	36	NM_014586	0	0	2	3	1		Missense_Mutation	SNP	ENST00000270112.2	37	CCDS13610.1	.	.	.	.	.	.	.	.	.	.	A	15.78	2.935668	0.52972	.	.	ENSG00000142149	ENST00000270112	T	0.68181	-0.31	4.21	4.21	0.49690	.	0.165227	0.51477	D	0.000092	T	0.64148	0.2572	L	0.29908	0.895	0.45354	D	0.998345	P	0.40970	0.734	P	0.50825	0.651	T	0.60727	-0.7206	10	0.25751	T	0.34	-32.4647	13.4793	0.61326	1.0:0.0:0.0:0.0	.	671	P57058	HUNK_HUMAN	L	671	ENSP00000270112:M671L	ENSP00000270112:M671L	M	+	1	0	HUNK	32293234	1.000000	0.71417	0.997000	0.53966	0.204000	0.24138	5.843000	0.69424	1.767000	0.52121	0.482000	0.46254	ATG	.		0.617	HUNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192782.1	NM_014586	
MICAL3	57553	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	18293513	18293513	+	Missense_Mutation	SNP	T	T	C			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr22:18293513T>C	ENST00000441493.2	-	28	5864	c.5512A>G	c.(5512-5514)Aga>Gga	p.R1838G	XXbac-B461K10.4_ENST00000476405.1_RNA|MICAL3_ENST00000580469.1_5'UTR	NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	1838					actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		TTGGCCTGTCTCCGAGCTGCC	0.572																																					p.R1838G		.											.	MICAL3-68	0			c.A5512G						.						92.0	98.0	96.0					22																	18293513		2184	4283	6467	SO:0001583	missense	57553	exon28			CCTGTCTCCGAGC	AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.5512A>G	22.37:g.18293513T>C	ENSP00000416015:p.Arg1838Gly	Somatic	68	0		WXS	Illumina HiSeq	Phase_I	76	26	NM_015241	0	0	17	21	4	B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Missense_Mutation	SNP	ENST00000441493.2	37	CCDS46659.1	.	.	.	.	.	.	.	.	.	.	T	16.19	3.051801	0.55218	.	.	ENSG00000093100	ENST00000441493	T	0.68025	-0.3	4.81	4.81	0.61882	.	0.102956	0.64402	D	0.000009	T	0.70631	0.3246	L	0.34521	1.04	0.80722	D	1	D	0.63880	0.993	D	0.72338	0.977	T	0.69146	-0.5222	9	.	.	.	.	11.1121	0.48239	0.0:0.0:0.1547:0.8453	.	1838	Q7RTP6	MICA3_HUMAN	G	1838	ENSP00000416015:R1838G	.	R	-	1	2	XXbac-B461K10.4	16673513	0.999000	0.42202	1.000000	0.80357	0.995000	0.86356	2.991000	0.49409	1.799000	0.52666	0.379000	0.24179	AGA	.		0.572	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447351.1		
MTMR3	8897	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	30413918	30413918	+	Silent	SNP	G	G	T			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr22:30413918G>T	ENST00000401950.2	+	16	2019	c.1677G>T	c.(1675-1677)gtG>gtT	p.V559V	MTMR3_ENST00000333027.3_Silent_p.V559V|MTMR3_ENST00000351488.3_Silent_p.V559V|CTA-85E5.10_ENST00000453743.2_RNA|MTMR3_ENST00000323630.5_Silent_p.V423V|MTMR3_ENST00000406629.1_Silent_p.V559V|CTA-85E5.10_ENST00000429350.1_RNA	NM_021090.3	NP_066576.1	Q13615	MTMR3_HUMAN	myotubularin related protein 3	559	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|large_intestine(3)|ovary(2)|skin(8)|upper_aerodigestive_tract(1)	17			OV - Ovarian serous cystadenocarcinoma(5;0.00204)|Epithelial(10;0.06)|all cancers(5;0.107)			CTCCTCAGGTGCTGTACCCTG	0.552																																					p.V559V		.											.	MTMR3-292	0			c.G1677T						.						194.0	153.0	167.0					22																	30413918		2203	4300	6503	SO:0001819	synonymous_variant	8897	exon16			TCAGGTGCTGTAC	U58034	CCDS13870.1, CCDS13871.1, CCDS46682.1	22q12.2	2011-06-09			ENSG00000100330	ENSG00000100330		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7451	protein-coding gene	gene with protein product		603558				8640223, 9736772	Standard	NM_153050		Approved	KIAA0371, ZFYVE10, FYVE-DSP1	uc003agv.4	Q13615	OTTHUMG00000151278	ENST00000401950.2:c.1677G>T	22.37:g.30413918G>T		Somatic	193	1		WXS	Illumina HiSeq	Phase_I	171	55	NM_153050	0	0	1	1	0	A5PL26|A7MD32|Q9NYN5|Q9NYN6|Q9UDX6|Q9UEG3	Silent	SNP	ENST00000401950.2	37	CCDS13870.1																																																																																			.		0.552	MTMR3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000322066.1	NM_021090	
POLR2F	5435	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	38355418	38355418	+	Missense_Mutation	SNP	C	C	G			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr22:38355418C>G	ENST00000442738.2	+	3	281	c.156C>G	c.(154-156)atC>atG	p.I52M	POLR2F_ENST00000407936.1_Missense_Mutation_p.I52M|POLR2F_ENST00000405557.1_Missense_Mutation_p.I52M|POLR2F_ENST00000488684.1_Nonsense_Mutation_p.S72*|POLR2F_ENST00000606538.1_Missense_Mutation_p.I52M|POLR2F_ENST00000460648.1_Intron|POLR2F_ENST00000470701.1_Missense_Mutation_p.I47M	NM_021974.3	NP_068809.1	P61218	RPAB2_HUMAN	polymerase (RNA) II (DNA directed) polypeptide F	52					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of type I interferon production (GO:0032481)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	cytosol (GO:0005829)|DNA-directed RNA polymerase I complex (GO:0005736)|DNA-directed RNA polymerase II, core complex (GO:0005665)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			breast(1)|urinary_tract(2)	3	Melanoma(58;0.045)					AGAAGCGAATCACCACACCAT	0.577																																					p.I52M		.											.	POLR2F-153	0			c.C156G						.						187.0	170.0	176.0					22																	38355418		2203	4300	6503	SO:0001583	missense	5435	exon3			GCGAATCACCACA		CCDS13963.1	22q13.1	2013-01-21			ENSG00000100142	ENSG00000100142		"""RNA polymerase subunits"""	9193	protein-coding gene	gene with protein product	"""DNA directed RNA polymerase II 14.4 kda polypeptide"""	604414				8786150	Standard	XR_112241		Approved	RPB6, HRBP14.4	uc010gxi.3	P61218	OTTHUMG00000151160	ENST00000442738.2:c.156C>G	22.37:g.38355418C>G	ENSP00000403852:p.Ile52Met	Somatic	294	0		WXS	Illumina HiSeq	Phase_I	230	99	NM_021974	0	0	90	209	119	P41584|Q6IAY3	Missense_Mutation	SNP	ENST00000442738.2	37	CCDS13963.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.242366	0.79912	.	.	ENSG00000100142	ENST00000442738;ENST00000407936;ENST00000405557	.	.	.	4.98	4.98	0.66077	RNA polymerase subunit, RPB6/omega (1);	0.000000	0.85682	D	0.000000	T	0.67353	0.2884	L	0.60455	1.87	0.80722	D	1	B	0.11235	0.004	B	0.25140	0.058	T	0.65656	-0.6115	9	0.54805	T	0.06	.	18.6213	0.91322	0.0:1.0:0.0:0.0	.	52	P61218	RPAB2_HUMAN	M	52	.	ENSP00000384112:I52M	I	+	3	3	POLR2F	36685364	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	3.564000	0.53791	2.467000	0.83353	0.655000	0.94253	ATC	.		0.577	POLR2F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321570.1	NM_021974	
KDELR3	11015	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	38875733	38875733	+	Missense_Mutation	SNP	A	A	G			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr22:38875733A>G	ENST00000216014.4	+	3	500	c.328A>G	c.(328-330)Aac>Gac	p.N110D	KDELR3_ENST00000409006.3_Missense_Mutation_p.N110D|KDELR3_ENST00000471268.1_3'UTR	NM_006855.2	NP_006846.1	O43731	ERD23_HUMAN	KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3	110					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|protein retention in ER lumen (GO:0006621)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ER retention sequence binding (GO:0046923)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)	13	Melanoma(58;0.0286)					CTTCCTTGAAAACTACAGTTT	0.473																																					p.N110D	Ovarian(11;103 529 24120 28493 32980)	.											.	KDELR3-92	0			c.A328G						.						226.0	234.0	231.0					22																	38875733		2203	4300	6503	SO:0001583	missense	11015	exon3			CTTGAAAACTACA	AL035081	CCDS13972.1, CCDS46705.1	22q13	2008-05-02			ENSG00000100196	ENSG00000100196			6306	protein-coding gene	gene with protein product							Standard	NM_006855		Approved		uc003avu.3	O43731	OTTHUMG00000153520	ENST00000216014.4:c.328A>G	22.37:g.38875733A>G	ENSP00000216014:p.Asn110Asp	Somatic	418	0		WXS	Illumina HiSeq	Phase_I	386	171	NM_016657	0	0	52	110	58	A8K7T7|B8ZZ26|O95557|Q4V750|Q4V767|Q53FP4|Q53GK1	Missense_Mutation	SNP	ENST00000216014.4	37	CCDS13972.1	.	.	.	.	.	.	.	.	.	.	A	27.4	4.824209	0.90955	.	.	ENSG00000100196	ENST00000216014;ENST00000409006	T;T	0.29142	1.58;1.58	4.39	4.39	0.52855	.	0.000000	0.85682	D	0.000000	T	0.58750	0.2144	M	0.89287	3.02	0.80722	D	1	D;D	0.58970	0.984;0.98	D;P	0.64410	0.925;0.823	T	0.66937	-0.5797	10	0.54805	T	0.06	.	13.8085	0.63248	1.0:0.0:0.0:0.0	.	110;110	O43731;O43731-2	ERD23_HUMAN;.	D	110	ENSP00000216014:N110D;ENSP00000386918:N110D	ENSP00000216014:N110D	N	+	1	0	KDELR3	37205679	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	8.916000	0.92745	1.854000	0.53819	0.533000	0.62120	AAC	.		0.473	KDELR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331474.1		
SEC13	6396	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	10342967	10342967	+	Missense_Mutation	SNP	T	T	C			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr3:10342967T>C	ENST00000350697.3	-	9	1072	c.947A>G	c.(946-948)gAg>gGg	p.E316G	SEC13_ENST00000397109.3_Missense_Mutation_p.E302G|SEC13_ENST00000337354.4_Missense_Mutation_p.E319G|SEC13_ENST00000383801.2_Missense_Mutation_p.E362G|SEC13_ENST00000492602.1_Intron|SEC13_ENST00000397117.1_Intron	NM_183352.1	NP_899195.1	P55735	SEC13_HUMAN	SEC13 homolog (S. cerevisiae)	316					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|nuclear envelope (GO:0005635)|nuclear pore outer ring (GO:0031080)				NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	17						CTGCTGGCCCTCTGTCACTGA	0.612																																					p.E316G		.											.	SEC13-91	0			c.A947G						.						120.0	96.0	104.0					3																	10342967		2203	4300	6503	SO:0001583	missense	6396	exon9			TGGCCCTCTGTCA		CCDS2599.1, CCDS46751.1, CCDS63540.1	3p25-p24	2013-01-10	2006-11-07	2006-11-07	ENSG00000157020	ENSG00000157020		"""WD repeat domain containing"""	10697	protein-coding gene	gene with protein product		600152	"""SEC13 (S. cerevisiae)-like 1"", ""SEC13-like 1 (S. cerevisiae)"""	D3S1231E, SEC13L1		7987303	Standard	NM_183352		Approved	SEC13R, npp-20	uc003bvn.3	P55735	OTTHUMG00000128671	ENST00000350697.3:c.947A>G	3.37:g.10342967T>C	ENSP00000312122:p.Glu316Gly	Somatic	130	0		WXS	Illumina HiSeq	Phase_I	98	40	NM_183352	0	0	110	193	83	A8MV37|B4DXJ1|Q5BJF0|Q9BRM6|Q9BUG7	Missense_Mutation	SNP	ENST00000350697.3	37	CCDS2599.1	.	.	.	.	.	.	.	.	.	.	T	17.66	3.444051	0.63067	.	.	ENSG00000157020	ENST00000397109;ENST00000337354;ENST00000350697;ENST00000383801	T;T;T;T	0.69806	0.84;-0.3;-0.43;-0.37	5.23	5.23	0.72850	.	0.288120	0.41001	D	0.000976	T	0.53706	0.1813	L	0.36672	1.1	0.54753	D	0.999984	P;B	0.34522	0.455;0.0	B;B	0.30105	0.111;0.0	T	0.53229	-0.8468	10	0.27785	T	0.31	.	13.0995	0.59212	0.0:0.0:0.0:1.0	.	362;316	B4DXJ1;P55735	.;SEC13_HUMAN	G	302;319;316;362	ENSP00000380298:E302G;ENSP00000336566:E319G;ENSP00000312122:E316G;ENSP00000373312:E362G	ENSP00000336566:E319G	E	-	2	0	SEC13	10317967	1.000000	0.71417	1.000000	0.80357	0.859000	0.49053	7.914000	0.87478	1.971000	0.57363	0.533000	0.62120	GAG	.		0.612	SEC13-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250563.3		
MLH1	4292	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	37042512	37042512	+	Missense_Mutation	SNP	G	G	A	rs63750133		TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr3:37042512G>A	ENST00000231790.2	+	3	490	c.274G>A	c.(274-276)Gcc>Acc	p.A92T	MLH1_ENST00000435176.1_5'UTR|MLH1_ENST00000536378.1_5'UTR|MLH1_ENST00000458205.2_5'UTR|MLH1_ENST00000539477.1_5'UTR|MLH1_ENST00000492474.1_3'UTR|MLH1_ENST00000455445.2_5'UTR	NM_000249.3|NM_001258273.1	NP_000240.1|NP_001245202.1	P40692	MLH1_HUMAN	mutL homolog 1	92					ATP catabolic process (GO:0006200)|double-strand break repair via nonhomologous end joining (GO:0006303)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|male meiosis chromosome segregation (GO:0007060)|meiotic metaphase I plate congression (GO:0043060)|mismatch repair (GO:0006298)|negative regulation of mitotic recombination (GO:0045950)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|oogenesis (GO:0048477)|resolution of meiotic recombination intermediates (GO:0000712)|somatic hypermutation of immunoglobulin genes (GO:0016446)|spermatogenesis (GO:0007283)|spindle midzone assembly involved in meiosis (GO:0051257)|synapsis (GO:0007129)	chiasma (GO:0005712)|male germ cell nucleus (GO:0001673)|membrane (GO:0016020)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|guanine/thymine mispair binding (GO:0032137)			NS(1)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(54)|lung(13)|oesophagus(7)|ovary(6)|pancreas(5)|prostate(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	127						TGAGGATTTAGCCAGTATTTC	0.348		1	"""D, Mis, N, F, S"""		"""colorectal, endometrial, ovarian, CNS"""	"""colorectal, endometrial, ovarian, CNS"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																												p.A92T		.	yes	Rec	yes	"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	3	3p21.3	4292	E.coli MutL homolog gene		"""E, O"""	.	MLH1-2559	0			c.G274A						.						152.0	151.0	152.0					3																	37042512		2203	4300	6503	SO:0001583	missense	4292	exon3	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	GATTTAGCCAGTA	U07418	CCDS2663.1, CCDS54562.1, CCDS54563.1	3p22.3	2014-09-17	2013-09-12		ENSG00000076242	ENSG00000076242			7127	protein-coding gene	gene with protein product		120436	"""mutL (E. coli) homolog 1 (colon cancer, nonpolyposis type 2)"", ""mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli)"""	COCA2		7903889	Standard	NM_000249		Approved	HNPCC, FCC2, HNPCC2	uc003cgl.3	P40692	OTTHUMG00000130797	ENST00000231790.2:c.274G>A	3.37:g.37042512G>A	ENSP00000231790:p.Ala92Thr	Somatic	111	0		WXS	Illumina HiSeq	Phase_I	82	41	NM_000249	0	0	3	11	8	B4DI13|B4DQ11|E9PCU2	Missense_Mutation	SNP	ENST00000231790.2	37	CCDS2663.1	.	.	.	.	.	.	.	.	.	.	G	13.30	2.195561	0.38806	.	.	ENSG00000076242	ENST00000231790;ENST00000436867;ENST00000537937	D	0.94537	-3.45	5.91	4.11	0.48088	DNA mismatch repair protein, N-terminal (1);ATPase-like, ATP-binding domain (4);	0.269957	0.37669	N	0.001984	D	0.84683	0.5526	N	0.04018	-0.295	0.80722	D	1	B;B	0.16166	0.016;0.009	B;B	0.25405	0.06;0.038	T	0.75434	-0.3319	10	0.20046	T	0.44	-6.4566	8.0469	0.30555	0.0732:0.0:0.6432:0.2836	.	92;92	Q53GX1;P40692	.;MLH1_HUMAN	T	92;58;58	ENSP00000231790:A92T	ENSP00000231790:A92T	A	+	1	0	MLH1	37017516	1.000000	0.71417	0.962000	0.40283	0.992000	0.81027	1.745000	0.38278	0.829000	0.34733	-0.169000	0.13324	GCC	.		0.348	MLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253337.2	NM_000249	
XYLB	9942	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	38404484	38404484	+	Silent	SNP	C	C	G			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr3:38404484C>G	ENST00000207870.3	+	4	357	c.267C>G	c.(265-267)gtC>gtG	p.V89V	XYLB_ENST00000542835.1_Intron	NM_005108.3	NP_005099.2	O75191	XYLB_HUMAN	xylulokinase homolog (H. influenzae)	89					carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|D-xylose metabolic process (GO:0042732)|generation of precursor metabolites and energy (GO:0006091)|xylulose catabolic process (GO:0005998)|xylulose metabolic process (GO:0005997)	extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|xylulokinase activity (GO:0004856)			endometrium(3)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|ovary(1)|prostate(1)	24				KIRC - Kidney renal clear cell carcinoma(284;0.00372)|Kidney(284;0.00405)		TCTCTCAAGTCCTAGCCTTGT	0.532																																					p.V89V		.											.	XYLB-91	0			c.C267G						.						108.0	108.0	108.0					3																	38404484		2203	4300	6503	SO:0001819	synonymous_variant	9942	exon4			TCAAGTCCTAGCC	AB015046	CCDS2678.1	3p22-p21.3	2006-12-18	2001-12-04		ENSG00000093217	ENSG00000093217			12839	protein-coding gene	gene with protein product		604049	"""xylulokinase (H. influenzae) homolog"""			9763671	Standard	NM_005108		Approved	FLJ10343, FLJ12539	uc003cic.2	O75191	OTTHUMG00000131294	ENST00000207870.3:c.267C>G	3.37:g.38404484C>G		Somatic	116	0		WXS	Illumina HiSeq	Phase_I	109	48	NM_005108	0	0	0	0	0	B2RAW4|B4DDT2|B9EH64	Silent	SNP	ENST00000207870.3	37	CCDS2678.1																																																																																			.		0.532	XYLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254062.2	NM_005108	
SLC38A3	10991	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	50257565	50257565	+	RNA	SNP	A	A	G			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr3:50257565A>G	ENST00000420502.1	+	0	1624									solute carrier family 38, member 3											breast(1)|cervix(1)|endometrium(1)|lung(3)	6				BRCA - Breast invasive adenocarcinoma(193;0.000275)|KIRC - Kidney renal clear cell carcinoma(197;0.00548)|Kidney(197;0.00615)		CTTCATCATCATTGACTGGGC	0.557																																					p.I491V		.											.	SLC38A3-67	0			c.A1471G						.						93.0	88.0	89.0					3																	50257565		2026	4180	6206			10991	exon16			ATCATCATTGACT	U49082	CCDS74940.1	3p21.3	2013-05-22			ENSG00000188338	ENSG00000188338		"""Solute carriers"""	18044	protein-coding gene	gene with protein product		604437				10619430, 10823827	Standard	XM_006712954		Approved	G17, SN1	uc003cyn.4	Q99624	OTTHUMG00000156764		3.37:g.50257565A>G		Somatic	14	0		WXS	Illumina HiSeq	Phase_I	13	10	NM_006841	0	0	0	0	0		Missense_Mutation	SNP	ENST00000420502.1	37																																																																																				.		0.557	SLC38A3-001	KNOWN	sequence_error|basic	processed_transcript	processed_transcript	OTTHUMT00000345635.2	NM_006841	
ABHD10	55347	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	111700691	111700691	+	Missense_Mutation	SNP	A	A	G			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr3:111700691A>G	ENST00000273359.3	+	2	230	c.203A>G	c.(202-204)tAt>tGt	p.Y68C	ABHD10_ENST00000494817.1_Missense_Mutation_p.Y68C|ABHD10_ENST00000534857.1_Intron	NM_018394.2	NP_060864.1	Q9NUJ1	ABHDA_HUMAN	abhydrolase domain containing 10	68					glucuronoside catabolic process (GO:0019391)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			large_intestine(2)|lung(7)|skin(1)	10						AACCTGGCTTATAAGAAGCTA	0.378																																					p.Y68C		.											.	ABHD10-90	0			c.A203G						.						126.0	123.0	124.0					3																	111700691		2203	4300	6503	SO:0001583	missense	55347	exon2			TGGCTTATAAGAA	AL713726	CCDS2963.1, CCDS63718.1	3q13.2	2012-03-26			ENSG00000144827	ENSG00000144827		"""Abhydrolase domain containing"""	25656	protein-coding gene	gene with protein product						22294686	Standard	NM_018394		Approved	FLJ11342	uc003dyk.5	Q9NUJ1	OTTHUMG00000159280	ENST00000273359.3:c.203A>G	3.37:g.111700691A>G	ENSP00000273359:p.Tyr68Cys	Somatic	136	0		WXS	Illumina HiSeq	Phase_I	140	62	NM_001272069	0	0	25	59	34	B7Z6A8|C9IZX5|D3DN63|Q8TCF9	Missense_Mutation	SNP	ENST00000273359.3	37	CCDS2963.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.190688	0.78789	.	.	ENSG00000144827	ENST00000273359;ENST00000494817	T	0.48836	0.8	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.69115	0.3075	M	0.77820	2.39	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.72962	-0.4132	10	0.62326	D	0.03	-30.1278	14.7236	0.69326	1.0:0.0:0.0:0.0	.	68	Q9NUJ1	ABHDA_HUMAN	C	68	ENSP00000273359:Y68C	ENSP00000273359:Y68C	Y	+	2	0	ABHD10	113183381	1.000000	0.71417	0.953000	0.39169	0.988000	0.76386	8.935000	0.92923	2.117000	0.64856	0.459000	0.35465	TAT	.		0.378	ABHD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354326.1	NM_018394	
EEFSEC	60678	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	127981023	127981023	+	Missense_Mutation	SNP	G	G	C			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr3:127981023G>C	ENST00000254730.6	+	3	631	c.577G>C	c.(577-579)Gcc>Ccc	p.A193P	EEFSEC_ENST00000483457.1_Missense_Mutation_p.A193P	NM_021937.3	NP_068756.2	P57772	SELB_HUMAN	eukaryotic elongation factor, selenocysteine-tRNA-specific	193	tr-type G. {ECO:0000255|PROSITE- ProRule:PRU01059}.				selenocysteine incorporation (GO:0001514)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|ribonucleoprotein complex binding (GO:0043021)|selenocysteine insertion sequence binding (GO:0035368)|translation elongation factor activity (GO:0003746)|tRNA binding (GO:0000049)			NS(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(10)|ovary(1)	25						GGGACCAGAGGCCCCCGAAAC	0.562																																					p.A193P		.											.	EEFSEC-91	0			c.G577C						.						90.0	104.0	100.0					3																	127981023		2203	4300	6503	SO:0001583	missense	60678	exon3			CCAGAGGCCCCCG		CCDS33849.1	3q21.3	2007-05-25			ENSG00000132394	ENSG00000132394			24614	protein-coding gene	gene with protein product	"""elongation factor for selenoprotein translation"""	607695				10970870, 15229221	Standard	XM_005247696		Approved	SELB, EFSEC	uc003eki.3	P57772	OTTHUMG00000159659	ENST00000254730.6:c.577G>C	3.37:g.127981023G>C	ENSP00000254730:p.Ala193Pro	Somatic	203	2		WXS	Illumina HiSeq	Phase_I	172	75	NM_021937	0	0	9	17	8	Q96HZ6	Missense_Mutation	SNP	ENST00000254730.6	37	CCDS33849.1	.	.	.	.	.	.	.	.	.	.	G	19.11	3.764626	0.69878	.	.	ENSG00000132394	ENST00000254730;ENST00000483457	T;T	0.56941	0.82;0.43	5.45	5.45	0.79879	Protein synthesis factor, GTP-binding (1);	0.000000	0.85682	D	0.000000	T	0.67439	0.2893	L	0.52905	1.665	0.58432	D	0.999998	D;D	0.71674	0.998;0.997	D;D	0.71184	0.972;0.939	T	0.63134	-0.6705	10	0.31617	T	0.26	2.1892	17.4767	0.87661	0.0:0.0:1.0:0.0	.	193;193	C9J8T0;P57772	.;SELB_HUMAN	P	193	ENSP00000254730:A193P;ENSP00000417660:A193P	ENSP00000254730:A193P	A	+	1	0	EEFSEC	129463713	1.000000	0.71417	1.000000	0.80357	0.124000	0.20399	9.064000	0.93933	2.546000	0.85860	0.650000	0.86243	GCC	.		0.562	EEFSEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356738.2	NM_021937	
ZMAT3	64393	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	178785387	178785387	+	Nonsense_Mutation	SNP	C	C	A			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr3:178785387C>A	ENST00000311417.2	-	2	895	c.154G>T	c.(154-156)Gag>Tag	p.E52*	ZMAT3_ENST00000432729.1_Nonsense_Mutation_p.E52*	NM_022470.3	NP_071915.1			zinc finger, matrin-type 3											breast(1)|endometrium(1)|large_intestine(6)|lung(2)|ovary(2)|prostate(1)|skin(1)	14	all_cancers(143;3.31e-18)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;6.74e-27)|GBM - Glioblastoma multiforme(14;0.00448)|BRCA - Breast invasive adenocarcinoma(182;0.0527)			TTCGATAACTCTTCTTCCCCT	0.552																																					p.E52X		.											.	ZMAT3-228	0			c.G154T						.						123.0	116.0	119.0					3																	178785387		2203	4300	6503	SO:0001587	stop_gained	64393	exon2			ATAACTCTTCTTC	AK122768	CCDS3224.1, CCDS46962.1	3q26.32	2012-10-05	2010-09-15		ENSG00000172667	ENSG00000172667		"""Zinc fingers, matrin-type"""	29983	protein-coding gene	gene with protein product		606452				9400996, 11689294	Standard	NM_022470		Approved	WIG1, MGC10613, FLJ12296, WIG-1, PAG608	uc003fjg.3	Q9HA38	OTTHUMG00000157290	ENST00000311417.2:c.154G>T	3.37:g.178785387C>A	ENSP00000311221:p.Glu52*	Somatic	161	0		WXS	Illumina HiSeq	Phase_I	123	45	NM_022470	0	0	5	8	3		Nonsense_Mutation	SNP	ENST00000311417.2	37	CCDS3224.1	.	.	.	.	.	.	.	.	.	.	C	44	11.170319	0.99525	.	.	ENSG00000172667	ENST00000311417;ENST00000432729;ENST00000414084	.	.	.	5.86	5.86	0.93980	.	0.278038	0.40554	N	0.001064	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	-15.196	20.1931	0.98233	0.0:1.0:0.0:0.0	.	.	.	.	X	52	.	ENSP00000311221:E52X	E	-	1	0	ZMAT3	180268081	1.000000	0.71417	0.999000	0.59377	0.928000	0.56348	5.278000	0.65592	2.771000	0.95319	0.563000	0.77884	GAG	.		0.552	ZMAT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348336.2	NM_152240	
PDS5A	23244	ucsc.edu	37	4	39911931	39911931	+	Missense_Mutation	SNP	T	T	G			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr4:39911931T>G	ENST00000303538.8	-	10	1559	c.1020A>C	c.(1018-1020)agA>agC	p.R340S	PDS5A_ENST00000503396.1_Missense_Mutation_p.R340S	NM_001100399.1	NP_001093869.1			PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae)											breast(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(9)|lung(14)|prostate(3)|skin(1)|urinary_tract(1)	39						CACTTTCTAATCTCACAGGAA	0.323																																					p.R340S													.	.	0			c.A1020C						.						70.0	65.0	67.0					4																	39911931		1839	4102	5941	SO:0001583	missense	23244	exon10			TTCTAATCTCACA	AF294791	CCDS47045.1, CCDS54759.1	4p14	2007-06-20			ENSG00000121892	ENSG00000121892			29088	protein-coding gene	gene with protein product		613200				11076961, 15855230	Standard	NM_001100399		Approved	KIAA0648, PIG54, SCC-112	uc003guv.4	Q29RF7	OTTHUMG00000160582	ENST00000303538.8:c.1020A>C	4.37:g.39911931T>G	ENSP00000303427:p.Arg340Ser	Somatic	14	0		WXS	Illumina HiSeq		7	1	NM_001100399	0	0	17	28	11		Missense_Mutation	SNP	ENST00000303538.8	37	CCDS47045.1	.	.	.	.	.	.	.	.	.	.	T	19.61	3.860782	0.71834	.	.	ENSG00000121892	ENST00000303538;ENST00000503396	T;T	0.72394	-0.65;-0.64	5.06	1.03	0.20045	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.80059	0.4554	M	0.81942	2.565	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.999	T	0.76561	-0.2914	9	.	.	.	-15.7137	5.7433	0.18106	0.0:0.1556:0.1419:0.7025	.	340;340	Q29RF7-3;Q29RF7	.;PDS5A_HUMAN	S	340	ENSP00000303427:R340S;ENSP00000426749:R340S	.	R	-	3	2	PDS5A	39588326	0.996000	0.38824	1.000000	0.80357	0.952000	0.60782	0.297000	0.19101	0.366000	0.24427	-0.263000	0.10527	AGA	.		0.323	PDS5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361287.1	NM_015200	
SPOCK3	50859	hgsc.bcm.edu;bcgsc.ca	37	4	167713322	167713322	+	Splice_Site	SNP	G	G	T			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr4:167713322G>T	ENST00000357154.3	-	8	854	c.717C>A	c.(715-717)agC>agA	p.S239R	SPOCK3_ENST00000511531.1_Splice_Site_p.S239R|SPOCK3_ENST00000507137.1_5'UTR|SPOCK3_ENST00000512681.1_Splice_Site_p.S141R|SPOCK3_ENST00000541637.1_Splice_Site_p.S141R|SPOCK3_ENST00000511269.1_Splice_Site_p.S236R|SPOCK3_ENST00000502330.1_Splice_Site_p.S239R|SPOCK3_ENST00000541354.1_Splice_Site_p.S119R|SPOCK3_ENST00000512648.1_Splice_Site_p.S236R|SPOCK3_ENST00000421836.2_Splice_Site_p.S188R|SPOCK3_ENST00000535728.1_Intron|SPOCK3_ENST00000506886.1_Splice_Site_p.S239R|SPOCK3_ENST00000510741.1_Intron|SPOCK3_ENST00000504953.1_Splice_Site_p.S236R|SPOCK3_ENST00000534949.1_Splice_Site_p.S143R|SPOCK3_ENST00000357545.4_Splice_Site_p.S236R	NM_016950.2	NP_058646.2	Q9BQ16	TICN3_HUMAN	sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3	239					negative regulation of endopeptidase activity (GO:0010951)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|signal transduction (GO:0007165)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|metalloendopeptidase inhibitor activity (GO:0008191)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	38	all_hematologic(180;0.221)	Prostate(90;0.0181)|Renal(120;0.0184)|Melanoma(52;0.0198)		GBM - Glioblastoma multiforme(119;0.02)		AAATCTTACTGCTTCTCTCAG	0.373																																					p.S239R		.											.	SPOCK3-136	0			c.C717A						.						101.0	84.0	90.0					4																	167713322		2203	4300	6503	SO:0001630	splice_region_variant	50859	exon8			CTTACTGCTTCTC	AJ001454	CCDS34095.1, CCDS54817.1, CCDS56343.1, CCDS56344.1, CCDS56346.1, CCDS56347.1, CCDS58931.1, CCDS75207.1	4q32.3	2011-10-10			ENSG00000196104	ENSG00000196104			13565	protein-coding gene	gene with protein product		607989				11751414	Standard	NM_001204352		Approved	testican-3	uc003iri.1	Q9BQ16	OTTHUMG00000161190	ENST00000357154.3:c.718+1C>A	4.37:g.167713322G>T		Somatic	75	0		WXS	Illumina HiSeq	Phase_I	60	4	NM_016950	0	0	0	0	0	B2R7M7|B3KR67|B4DGK5|B4DHB4|B4DHV3|B4DI46|B4DJY3|E7EP61|F5H099|O75705|Q6UW53|Q96Q26	Missense_Mutation	SNP	ENST00000357154.3	37	CCDS54817.1	.	.	.	.	.	.	.	.	.	.	G	14.33	2.504073	0.44558	.	.	ENSG00000196104	ENST00000357154;ENST00000357545;ENST00000504953;ENST00000506886;ENST00000511531;ENST00000502330;ENST00000541354;ENST00000512681;ENST00000511269;ENST00000421836;ENST00000541637;ENST00000534949;ENST00000512648;ENST00000510403	T;T;T;T;T;T;T;T;T;T;T;T;T;D	0.87412	1.48;1.49;1.49;1.48;1.48;1.48;1.4;0.92;1.49;1.29;0.92;1.18;2.2;-2.25	5.33	4.47	0.54385	SPARC/Testican, calcium-binding domain (1);EF-hand-like domain (1);	0.410761	0.26800	N	0.022422	D	0.89350	0.6690	L	0.59436	1.845	0.37036	D	0.896894	D;D;D;D;D;D;D	0.64830	0.959;0.967;0.958;0.994;0.967;0.98;0.984	P;P;P;D;P;P;P	0.63192	0.629;0.664;0.821;0.912;0.587;0.711;0.81	D	0.87800	0.2624	10	0.27082	T	0.32	-13.9637	9.7077	0.40225	0.2078:0.0:0.7921:0.0	.	141;143;188;248;239;236;239	B4DGK5;F5H099;B4DHB4;B4DFW5;Q9BQ16-2;Q9BQ16-1;Q9BQ16	.;.;.;.;.;.;TICN3_HUMAN	R	239;236;236;239;239;239;119;141;236;188;141;143;236;118	ENSP00000349677:S239R;ENSP00000350153:S236R;ENSP00000425570:S236R;ENSP00000420920:S239R;ENSP00000423421:S239R;ENSP00000423606:S239R;ENSP00000444789:S119R;ENSP00000426318:S141R;ENSP00000425502:S236R;ENSP00000411344:S188R;ENSP00000445430:S141R;ENSP00000438142:S143R;ENSP00000426177:S236R;ENSP00000423176:S118R	ENSP00000349677:S239R	S	-	3	2	SPOCK3	167949897	1.000000	0.71417	1.000000	0.80357	0.565000	0.35776	2.196000	0.42686	2.650000	0.89964	0.563000	0.77884	AGC	.		0.373	SPOCK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364091.1		Missense_Mutation
CLPTM1L	81037	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	1324927	1324927	+	Splice_Site	SNP	A	A	T			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr5:1324927A>T	ENST00000320895.5	-	11	1405	c.1148T>A	c.(1147-1149)tTt>tAt	p.F383Y	CLPTM1L_ENST00000507807.1_Splice_Site_p.F214Y|CLPTM1L_ENST00000506641.1_5'UTR|CLPTM1L_ENST00000320927.6_Splice_Site_p.F347Y	NM_030782.3	NP_110409.2	Q96KA5	CLP1L_HUMAN	CLPTM1-like	383					apoptotic process (GO:0006915)	integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24	Lung NSC(6;5.78e-14)|all_lung(6;4.47e-13)|all_epithelial(6;4.47e-09)		Epithelial(17;0.00931)|OV - Ovarian serous cystadenocarcinoma(19;0.0116)|all cancers(22;0.0181)	KIRC - Kidney renal clear cell carcinoma(5;0.177)|Kidney(13;0.208)		GTAAGTGCCAAACTGTTGTGA	0.488																																					p.F383Y		.											.	CLPTM1L-153	0			c.T1148A						.						241.0	182.0	202.0					5																	1324927		2203	4300	6503	SO:0001630	splice_region_variant	81037	exon11			GTGCCAAACTGTT	AK027306	CCDS3862.1	5p15.33	2008-02-05			ENSG00000049656	ENSG00000049656			24308	protein-coding gene	gene with protein product	"""cisplatin resistance related protein"""	612585				11162647	Standard	NM_030782		Approved	FLJ14400, CRR9	uc003jch.3	Q96KA5	OTTHUMG00000131015	ENST00000320895.5:c.1147-1T>A	5.37:g.1324927A>T		Somatic	100	1		WXS	Illumina HiSeq	Phase_I	94	43	NM_030782	0	0	1	1	0	D3DTC1|Q658W6|Q7LG29|Q96AZ0|Q9H3N4	Missense_Mutation	SNP	ENST00000320895.5	37	CCDS3862.1	.	.	.	.	.	.	.	.	.	.	A	8.846	0.943427	0.18281	.	.	ENSG00000049656	ENST00000320895;ENST00000507807;ENST00000320927	T;T;T	0.50277	0.75;0.83;0.81	5.15	3.94	0.45596	.	0.280237	0.41097	D	0.000945	T	0.49983	0.1589	M	0.74389	2.26	0.53005	D	0.999963	B;B	0.23990	0.095;0.06	B;B	0.33568	0.166;0.032	T	0.42085	-0.9472	10	0.26408	T	0.33	-15.2716	11.2025	0.48749	0.8456:0.1544:0.0:0.0	.	383;214	Q96KA5;G5E9Z2	CLP1L_HUMAN;.	Y	383;214;347	ENSP00000313854:F383Y;ENSP00000423321:F214Y;ENSP00000315196:F347Y	ENSP00000313854:F383Y	F	-	2	0	CLPTM1L	1377927	1.000000	0.71417	1.000000	0.80357	0.579000	0.36224	5.991000	0.70602	0.856000	0.35383	0.459000	0.35465	TTT	.		0.488	CLPTM1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253649.2	NM_030782	Missense_Mutation
ITGA2	3673	hgsc.bcm.edu	37	5	52368456	52368456	+	Missense_Mutation	SNP	A	A	C			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr5:52368456A>C	ENST00000296585.5	+	19	2503	c.2360A>C	c.(2359-2361)aAa>aCa	p.K787T		NM_002203.3	NP_002194.2	P17301	ITA2_HUMAN	integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)	787					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell proliferation (GO:0008283)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cellular response to hormone stimulus (GO:0032870)|collagen-activated signaling pathway (GO:0038065)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|hepatocyte differentiation (GO:0070365)|hypotonic response (GO:0006971)|integrin-mediated signaling pathway (GO:0007229)|mammary gland development (GO:0030879)|mesodermal cell differentiation (GO:0048333)|organ morphogenesis (GO:0009887)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell projection organization (GO:0031346)|positive regulation of collagen binding (GO:0033343)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA binding (GO:0043388)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of translation (GO:0045727)|positive regulation of transmission of nerve impulse (GO:0051971)|response to amine (GO:0014075)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to L-ascorbic acid (GO:0033591)|response to muscle activity (GO:0014850)|response to organic cyclic compound (GO:0014070)|skin morphogenesis (GO:0043589)|substrate-dependent cell migration (GO:0006929)|tissue homeostasis (GO:0001894)|viral process (GO:0016032)	axon terminus (GO:0043679)|basal part of cell (GO:0045178)|cell outer membrane (GO:0009279)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin alpha2-beta1 complex (GO:0034666)|integrin complex (GO:0008305)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(1)|lung(18)|pancreas(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	47		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)				CCTTTCCACAAAGACTGTGGT	0.343																																					p.K787T		.											.	ITGA2-226	0			c.A2360C						.						82.0	73.0	76.0					5																	52368456		2202	4300	6502	SO:0001583	missense	3673	exon19			TCCACAAAGACTG		CCDS3957.1	5q11.2	2010-03-23			ENSG00000164171	ENSG00000164171		"""CD molecules"", ""Integrins"""	6137	protein-coding gene	gene with protein product		192974		CD49B			Standard	NM_002203		Approved	CD49b	uc003joy.3	P17301	OTTHUMG00000131165	ENST00000296585.5:c.2360A>C	5.37:g.52368456A>C	ENSP00000296585:p.Lys787Thr	Somatic	45	0		WXS	Illumina HiSeq	Phase_I	32	2	NM_002203	0	0	0	0	0	Q14595	Missense_Mutation	SNP	ENST00000296585.5	37	CCDS3957.1	.	.	.	.	.	.	.	.	.	.	A	14.98	2.696313	0.48202	.	.	ENSG00000164171	ENST00000296585	T	0.54675	0.56	5.66	4.5	0.54988	Integrin alpha-2 (1);	0.048740	0.85682	D	0.000000	T	0.57140	0.2033	M	0.69358	2.11	0.54753	D	0.999985	B;P	0.36354	0.314;0.549	B;B	0.43360	0.417;0.364	T	0.58487	-0.7628	10	0.56958	D	0.05	.	11.5138	0.50509	0.93:0.0:0.07:0.0	.	787;787	E7ESP4;P17301	.;ITA2_HUMAN	T	787	ENSP00000296585:K787T	ENSP00000296585:K787T	K	+	2	0	ITGA2	52404213	1.000000	0.71417	0.928000	0.36995	0.683000	0.39861	8.098000	0.89540	0.979000	0.38497	0.460000	0.39030	AAA	.		0.343	ITGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253857.2	NM_002203	
MAST4	375449	hgsc.bcm.edu	37	5	66440576	66440576	+	Missense_Mutation	SNP	C	C	G			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr5:66440576C>G	ENST00000403625.2	+	22	3105	c.2810C>G	c.(2809-2811)aCc>aGc	p.T937S	MAST4_ENST00000403666.1_Missense_Mutation_p.T748S|MAST4_ENST00000405643.1_Missense_Mutation_p.T758S|MAST4_ENST00000261569.7_Missense_Mutation_p.T743S|MAST4_ENST00000404260.3_Missense_Mutation_p.T940S	NM_001164664.1	NP_001158136.1	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase family member 4	940						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|kidney(2)|lung(6)|ovary(2)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		AAAAGCACCACCTTGCCATCC	0.408																																					p.T937S		.											.	MAST4-647	0			c.C2810G						.						65.0	70.0	69.0					5																	66440576		1870	4117	5987	SO:0001583	missense	375449	exon22			GCACCACCTTGCC	AY830839	CCDS47224.1, CCDS47225.1, CCDS54861.1, CCDS75254.1	5q12.3	2007-06-20			ENSG00000069020	ENSG00000069020			19037	protein-coding gene	gene with protein product						9205841	Standard	NM_198828		Approved	KIAA0303	uc021xzk.1	O15021	OTTHUMG00000152471	ENST00000403625.2:c.2810C>G	5.37:g.66440576C>G	ENSP00000385727:p.Thr937Ser	Somatic	26	0		WXS	Illumina HiSeq	Phase_I	37	2	NM_001164664	0	0	2	2	0	A6NL49|B5ME48|Q05EE6|Q6ZN07|Q8N4X4|Q96LY3	Missense_Mutation	SNP	ENST00000403625.2	37	CCDS54861.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.57|11.57	1.677412|1.677412	0.29783|0.29783	.|.	.|.	ENSG00000069020|ENSG00000069020	ENST00000443808|ENST00000404260;ENST00000403625;ENST00000403666;ENST00000405643;ENST00000380908;ENST00000261569;ENST00000432399	.|T;T;T;T;T	.|0.64803	.|-0.09;-0.09;-0.12;-0.11;-0.09	5.69|5.69	4.82|4.82	0.62117|0.62117	.|.	.|0.745634	.|0.13293	.|N	.|0.398827	T|T	0.39733|0.39733	0.1089|0.1089	N|N	0.12569|0.12569	0.235|0.235	0.09310|0.09310	N|N	1|1	.|B;B;B;B	.|0.18310	.|0.027;0.004;0.006;0.007	.|B;B;B;B	.|0.16289	.|0.011;0.007;0.015;0.007	T|T	0.18147|0.18147	-1.0346|-1.0346	5|10	.|0.07175	.|T	.|0.84	-0.0745|-0.0745	10.3504|10.3504	0.43931|0.43931	0.0:0.7952:0.1342:0.0706|0.0:0.7952:0.1342:0.0706	.|.	.|758;940;743;748	.|E7EWQ5;O15021;O15021-2;O15021-3	.|.;MAST4_HUMAN;.;.	Q|S	60|940;937;748;758;758;743;743	.|ENSP00000385048:T940S;ENSP00000385727:T937S;ENSP00000384313:T748S;ENSP00000384099:T758S;ENSP00000261569:T743S	.|ENSP00000261569:T743S	H|T	+|+	3|2	2|0	MAST4|MAST4	66476332|66476332	0.016000|0.016000	0.18221|0.18221	0.082000|0.082000	0.20525|0.20525	0.950000|0.950000	0.60333|0.60333	2.374000|2.374000	0.44274|0.44274	1.422000|1.422000	0.47177|0.47177	0.591000|0.591000	0.81541|0.81541	CAC|ACC	.		0.408	MAST4-001	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326324.2		
ARHGEF28	64283	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	73205322	73205322	+	Missense_Mutation	SNP	T	T	A			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr5:73205322T>A	ENST00000426542.2	+	33	4267	c.4247T>A	c.(4246-4248)aTc>aAc	p.I1416N	ARHGEF28_ENST00000296794.6_Missense_Mutation_p.I1416N|ARHGEF28_ENST00000545377.1_Missense_Mutation_p.I1416N|ARHGEF28_ENST00000513042.2_Missense_Mutation_p.I1416N|ARHGEF28_ENST00000437974.1_Missense_Mutation_p.I1416N|ARHGEF28_ENST00000296799.4_Missense_Mutation_p.I1103N|ARHGEF28_ENST00000287898.5_Missense_Mutation_p.I1372N|ARHGEF28_ENST00000512883.1_Missense_Mutation_p.I336N			Q8N1W1	ARG28_HUMAN	Rho guanine nucleotide exchange factor (GEF) 28	1416					central nervous system neuron axonogenesis (GO:0021955)|intracellular signal transduction (GO:0035556)|neurofilament cytoskeleton organization (GO:0060052)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|RNA binding (GO:0003723)										GGCCACTCTATCCTCCGAGGC	0.622																																					p.I1416N		.											.	.	0			c.T4247A						.						21.0	25.0	24.0					5																	73205322		2019	4181	6200	SO:0001583	missense	64283	exon34			ACTCTATCCTCCG		CCDS47231.1, CCDS47231.2, CCDS54870.1, CCDS58957.1	5q13.2	2012-08-08			ENSG00000214944	ENSG00000214944			30322	protein-coding gene	gene with protein product		612790				9199174, 11058585	Standard	NM_001177693		Approved	RGNEF, p190RhoGEF, RIP2	uc010izf.3	Q8N1W1	OTTHUMG00000162454	ENST00000426542.2:c.4247T>A	5.37:g.73205322T>A	ENSP00000412175:p.Ile1416Asn	Somatic	30	0		WXS	Illumina HiSeq	Phase_I	20	10	NM_001080479	0	0	17	35	18	B2RXG7|B4E3K4|B5MDA3|B7ZW32|E9PC75|Q8NCM7|Q96E37|Q9H6L3|Q9H6W0	Missense_Mutation	SNP	ENST00000426542.2	37	CCDS54870.1	.	.	.	.	.	.	.	.	.	.	T	0.004	-2.374983	0.00207	.	.	ENSG00000214944	ENST00000296794;ENST00000545377;ENST00000513042;ENST00000287898;ENST00000437974;ENST00000426542;ENST00000296799;ENST00000512883	T;T;T;T;T;T;T;T	0.23348	1.91;1.91;1.91;1.91;1.91;1.91;1.91;1.91	0.55	0.55	0.17219	.	.	.	.	.	T	0.11324	0.0276	N	0.08118	0	0.09310	N	1	B;B;B;B;B	0.23990	0.002;0.023;0.04;0.004;0.095	B;B;B;B;B	0.23018	0.0;0.014;0.021;0.006;0.043	T	0.32481	-0.9905	8	0.27082	T	0.32	.	.	.	.	.	1103;1416;1416;336;1416	B5MDA3;Q8N1W1;E9PC75;D6RGZ3;Q8N1W1-4	.;RGNEF_HUMAN;.;.;.	N	1416;1416;1416;1372;1416;1416;1103;336	ENSP00000296794:I1416N;ENSP00000441913:I1416N;ENSP00000441436:I1416N;ENSP00000287898:I1372N;ENSP00000411459:I1416N;ENSP00000412175:I1416N;ENSP00000296799:I1103N;ENSP00000421081:I336N	ENSP00000287898:I1372N	I	+	2	0	RP11-428C6.1	73241078	0.000000	0.05858	0.009000	0.14445	0.029000	0.11900	0.015000	0.13355	0.464000	0.27142	0.454000	0.30748	ATC	.		0.622	ARHGEF28-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000368975.1		
SEMA6A	57556	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	115822558	115822558	+	Silent	SNP	G	G	A			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr5:115822558G>A	ENST00000343348.6	-	10	1636	c.849C>T	c.(847-849)tgC>tgT	p.C283C	SEMA6A_ENST00000257414.8_Silent_p.C283C|CTB-118N6.3_ENST00000508640.1_RNA|SEMA6A_ENST00000510263.1_Silent_p.C283C|CTB-118N6.3_ENST00000514214.1_RNA|CTB-118N6.3_ENST00000510682.1_RNA|SEMA6A_ENST00000503962.1_5'Flank	NM_020796.3	NP_065847	Q9H2E6	SEM6A_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A	283	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|centrosome localization (GO:0051642)|cytoskeleton organization (GO:0007010)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|organ morphogenesis (GO:0009887)|positive regulation of neuron migration (GO:2001224)|semaphorin-plexin signaling pathway (GO:0071526)	axon (GO:0030424)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31		all_cancers(142;0.00316)|all_epithelial(76;5.71e-05)|Prostate(80;0.00845)|Ovarian(225;0.0796)|Lung NSC(810;0.171)|all_lung(232;0.203)		OV - Ovarian serous cystadenocarcinoma(64;1.59e-08)|Epithelial(69;2e-08)|all cancers(49;5.7e-08)|COAD - Colon adenocarcinoma(49;0.151)		CAGGAACTGAGCAGTTCAAGC	0.463																																					p.C283C		.											.	SEMA6A-92	0			c.C849T						.						110.0	110.0	110.0					5																	115822558		2009	4214	6223	SO:0001819	synonymous_variant	57556	exon10			AACTGAGCAGTTC	AB037789	CCDS47256.1, CCDS75288.1	5q23.1	2014-07-29			ENSG00000092421			"""Semaphorins"""	10738	protein-coding gene	gene with protein product	"""sema VIa"""	605885		SEMAQ		9204478, 10993894	Standard	XM_006714663		Approved	KIAA1368, SEMA6A1, SEMA, HT018	uc010jck.3	Q9H2E6	OTTHUMG00000162987	ENST00000343348.6:c.849C>T	5.37:g.115822558G>A		Somatic	136	0		WXS	Illumina HiSeq	Phase_I	137	59	NM_020796	0	0	3	7	4	Q9P2H9	Silent	SNP	ENST00000343348.6	37	CCDS47256.1																																																																																			.		0.463	SEMA6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371270.1	NM_020796	
SLC25A48	153328	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	135178132	135178132	+	Missense_Mutation	SNP	C	C	A			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr5:135178132C>A	ENST00000420621.1	+	2	246	c.74C>A	c.(73-75)cCt>cAt	p.P25H	SLC25A48_ENST00000274513.5_Missense_Mutation_p.P25H|SLC25A48_ENST00000425402.1_Missense_Mutation_p.P25H|SLC25A48_ENST00000433282.2_5'UTR|SLC25A48_ENST00000412661.2_Missense_Mutation_p.P25H			Q6ZT89	S2548_HUMAN	solute carrier family 25, member 48	25					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	10						GTTGGCCACCCTCTGGACACA	0.507																																					p.P25H		.											.	SLC25A48-91	0			c.C74A						.						141.0	154.0	150.0					5																	135178132		2131	4257	6388	SO:0001583	missense	153328	exon2			GCCACCCTCTGGA		CCDS43366.2	5q31.1	2013-05-22			ENSG00000145832	ENSG00000145832		"""Solute carriers"""	30451	protein-coding gene	gene with protein product	"""HCC-down-regulated mitochondrial carrier protein"""					15322095, 19303656	Standard	NM_145282		Approved	FLJ44862, HDMCP	uc003lba.3	Q6ZT89	OTTHUMG00000157007	ENST00000420621.1:c.74C>A	5.37:g.135178132C>A	ENSP00000407973:p.Pro25His	Somatic	180	0		WXS	Illumina HiSeq	Phase_I	204	69	NM_145282	0	0	0	0	0	Q8TAV9	Missense_Mutation	SNP	ENST00000420621.1	37		.	.	.	.	.	.	.	.	.	.	C	18.21	3.574438	0.65878	.	.	ENSG00000145832	ENST00000425402;ENST00000274513;ENST00000420621;ENST00000412661	D;D;D;D	0.96885	-4.16;-4.16;-4.16;-4.16	4.46	4.46	0.54185	.	0.000000	0.85682	D	0.000000	D	0.98912	0.9631	H	0.98918	4.37	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.98808	1.0742	10	0.87932	D	0	-31.2085	14.3274	0.66530	0.0:1.0:0.0:0.0	.	25;25	Q6ZT89-3;Q6ZT89-2	.;.	H	25	ENSP00000408750:P25H;ENSP00000274513:P25H;ENSP00000407973:P25H;ENSP00000413049:P25H	ENSP00000274513:P25H	P	+	2	0	SLC25A48	135206031	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	4.217000	0.58547	2.480000	0.83734	0.563000	0.77884	CCT	.		0.507	SLC25A48-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_145282	
RANBP17	64901	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	170323085	170323085	+	Missense_Mutation	SNP	T	T	A			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr5:170323085T>A	ENST00000523189.1	+	5	619	c.455T>A	c.(454-456)aTa>aAa	p.I152K		NM_022897.3	NP_075048.1	Q9H2T7	RBP17_HUMAN	RAN binding protein 17	152					mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)	GTP binding (GO:0005525)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	50	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			ATAGGAGTAATAATCCTTTCT	0.388			T	TRD@	ALL																																p.I152K		.		Dom	yes		5	5q34	64901	RAN binding protein 17		L	.	RANBP17-524	0			c.T455A						.						116.0	109.0	111.0					5																	170323085		2203	4300	6503	SO:0001583	missense	64901	exon5			GAGTAATAATCCT	AF222747	CCDS34287.1	5q34	2009-01-12			ENSG00000204764	ENSG00000204764			14428	protein-coding gene	gene with protein product		606141				11024021	Standard	NM_022897		Approved		uc003mba.3	Q9H2T7	OTTHUMG00000163203	ENST00000523189.1:c.455T>A	5.37:g.170323085T>A	ENSP00000427975:p.Ile152Lys	Somatic	90	0		WXS	Illumina HiSeq	Phase_I	106	43	NM_022897	0	0	2	2	0	Q8IU74	Missense_Mutation	SNP	ENST00000523189.1	37	CCDS34287.1	.	.	.	.	.	.	.	.	.	.	.	4.832	0.154664	0.09236	.	.	ENSG00000204764	ENST00000523189	T	0.65916	-0.18	5.14	5.14	0.70334	Armadillo-type fold (1);	0.271232	0.32343	N	0.006225	T	0.29620	0.0739	N	0.02181	-0.65	0.49213	D	0.999766	B;B	0.19583	0.004;0.037	B;B	0.13407	0.007;0.009	T	0.35201	-0.9798	10	0.02654	T	1	-4.1259	11.0057	0.47633	0.0:0.0:0.156:0.844	.	152;202	Q9H2T7;B4DQG2	RBP17_HUMAN;.	K	152	ENSP00000427975:I152K	ENSP00000373770:I152K	I	+	2	0	RANBP17	170255663	0.998000	0.40836	0.997000	0.53966	0.968000	0.65278	3.161000	0.50747	2.072000	0.62099	0.460000	0.39030	ATA	.		0.388	RANBP17-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000372036.1	NM_022897	
RNF44	22838	hgsc.bcm.edu	37	5	175957116	175957116	+	Missense_Mutation	SNP	G	G	T			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr5:175957116G>T	ENST00000274811.4	-	7	1417	c.893C>A	c.(892-894)cCa>cAa	p.P298Q	RNF44_ENST00000509404.1_5'Flank|RNF44_ENST00000537487.1_Missense_Mutation_p.P217Q	NM_014901.4	NP_055716.1	Q7L0R7	RNF44_HUMAN	ring finger protein 44	298	Pro-rich.						zinc ion binding (GO:0008270)			endometrium(2)|lung(3)|prostate(1)|skin(1)|stomach(1)	8	all_cancers(89;0.0029)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GTAGTAGGGTggtgggggtgg	0.622																																					p.P298Q		.											.	RNF44-658	0			c.C893A						.						8.0	8.0	8.0					5																	175957116		2165	4263	6428	SO:0001583	missense	22838	exon7			TAGGGTGGTGGGG	AB029023	CCDS4404.1	5q35.3	2013-01-09			ENSG00000146083	ENSG00000146083		"""RING-type (C3HC4) zinc fingers"""	19180	protein-coding gene	gene with protein product						10470851	Standard	NM_014901		Approved	KIAA1100	uc003mek.1	Q7L0R7	OTTHUMG00000130664	ENST00000274811.4:c.893C>A	5.37:g.175957116G>T	ENSP00000274811:p.Pro298Gln	Somatic	8	0		WXS	Illumina HiSeq	Phase_I	5	4	NM_014901	0	0	0	13	13	B4DYE0|Q8ND05|Q9UPQ2	Missense_Mutation	SNP	ENST00000274811.4	37	CCDS4404.1	.	.	.	.	.	.	.	.	.	.	G	16.60	3.169154	0.57584	.	.	ENSG00000146083	ENST00000274811;ENST00000537487	D;D	0.86230	-2.09;-2.09	4.21	3.34	0.38264	.	0.516697	0.16329	N	0.219220	D	0.89128	0.6627	M	0.63843	1.955	0.33426	D	0.580514	D	0.53462	0.96	P	0.55871	0.786	D	0.88730	0.3236	10	0.26408	T	0.33	-9.7863	11.602	0.51008	0.0881:0.0:0.9119:0.0	.	298	Q7L0R7	RNF44_HUMAN	Q	298;217	ENSP00000274811:P298Q;ENSP00000440352:P217Q	ENSP00000274811:P298Q	P	-	2	0	RNF44	175889722	1.000000	0.71417	0.069000	0.20011	0.518000	0.34316	8.688000	0.91260	0.995000	0.38917	0.549000	0.68633	CCA	.		0.622	RNF44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253156.2		
RANBP9	10048	broad.mit.edu	37	6	13711709	13711709	+	Missense_Mutation	SNP	G	G	T			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr6:13711709G>T	ENST00000011619.3	-	1	87	c.29C>A	c.(28-30)cCg>cAg	p.P10Q		NM_005493.2	NP_005484.2	Q96S59	RANB9_HUMAN	RAN binding protein 9	10	Poly-Pro.				axon guidance (GO:0007411)|microtubule nucleation (GO:0007020)|protein complex assembly (GO:0006461)	cytosol (GO:0005829)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|Ran GTPase binding (GO:0008536)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|skin(1)	16	Breast(50;0.00669)|Ovarian(93;0.0634)	all_hematologic(90;0.117)	Epithelial(50;0.223)			ctgctgctgcggcggcggcgg	0.761																																					p.P10Q													.	RANBP9-414	0			c.C29A						.						4.0	5.0	5.0					6																	13711709		764	1870	2634	SO:0001583	missense	10048	exon1			TGCTGCGGCGGCG	AB008515	CCDS4529.1	6p23	2010-05-25			ENSG00000010017	ENSG00000010017			13727	protein-coding gene	gene with protein product	"""Ran Binding Protein in the Microtubule organizing center"""	603854				9817760	Standard	NM_005493		Approved	RanBPM	uc003nbb.3	Q96S59	OTTHUMG00000015642	ENST00000011619.3:c.29C>A	6.37:g.13711709G>T	ENSP00000011619:p.Pro10Gln	Somatic	12	0		WXS	Illumina HiSeq	Phase_I	10	2	NM_005493	0	0	0	0	0	A0PJA2|B2R8E1|O94764|Q6P3T7|Q7LBR2|Q7Z7F9	Missense_Mutation	SNP	ENST00000011619.3	37	CCDS4529.1	.	.	.	.	.	.	.	.	.	.	g	8.018	0.759040	0.15846	.	.	ENSG00000010017	ENST00000011619;ENST00000283152	T	0.78003	-1.14	1.59	-3.18	0.05186	.	.	.	.	.	T	0.30198	0.0757	N	0.08118	0	0.21416	N	0.999694	B	0.18968	0.032	B	0.10450	0.005	T	0.18555	-1.0333	9	0.30854	T	0.27	.	5.1241	0.14875	0.0:0.0:0.4149:0.5851	.	10	Q96S59	RANB9_HUMAN	Q	10	ENSP00000011619:P10Q	ENSP00000011619:P10Q	P	-	2	0	RANBP9	13819688	0.000000	0.05858	0.967000	0.41034	0.688000	0.40055	-1.054000	0.03496	-0.053000	0.13289	0.154000	0.16183	CCG	.		0.761	RANBP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042373.1		
SLC17A4	10050	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	25773825	25773825	+	Missense_Mutation	SNP	G	G	A			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr6:25773825G>A	ENST00000377905.4	+	8	1029	c.910G>A	c.(910-912)Gaa>Aaa	p.E304K	SLC17A4_ENST00000397076.2_Missense_Mutation_p.E74K|SLC17A4_ENST00000439485.2_Intron	NM_005495.2	NP_005486.1	Q9Y2C5	S17A4_HUMAN	solute carrier family 17, member 4	304					phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	sodium:phosphate symporter activity (GO:0005436)			breast(4)|endometrium(1)|kidney(4)|large_intestine(3)|lung(21)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						TTATTTCTGTGAATACTGGCT	0.443																																					p.E304K		.											.	SLC17A4-91	0			c.G910A						.						163.0	144.0	150.0					6																	25773825		2203	4300	6503	SO:0001583	missense	10050	exon8			TTCTGTGAATACT	AB020527	CCDS4564.1, CCDS75411.1	6p22.2	2013-07-18	2013-07-18		ENSG00000146039	ENSG00000146039		"""Solute carriers"""	10932	protein-coding gene	gene with protein product		604216	"""solute carrier family 17 (sodium phosphate), member 4"""			10319585	Standard	NM_005495		Approved	KIAA2138	uc003nfe.3	Q9Y2C5	OTTHUMG00000014410	ENST00000377905.4:c.910G>A	6.37:g.25773825G>A	ENSP00000367137:p.Glu304Lys	Somatic	89	0		WXS	Illumina HiSeq	Phase_I	92	36	NM_005495	0	0	1	1	0	B4DDV9|E7EPE8|E7EU17|Q32MB7|Q32MB8	Missense_Mutation	SNP	ENST00000377905.4	37	CCDS4564.1	.	.	.	.	.	.	.	.	.	.	G	17.76	3.468242	0.63625	.	.	ENSG00000146039	ENST00000377905;ENST00000397076	T;T	0.58797	0.41;0.31	5.34	0.672	0.17935	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.890844	0.09592	N	0.781378	T	0.40645	0.1125	M	0.73598	2.24	0.09310	N	1	P;B	0.38048	0.616;0.082	B;B	0.40901	0.343;0.158	T	0.40365	-0.9567	10	0.54805	T	0.06	.	7.4701	0.27344	0.1347:0.4004:0.4649:0.0	.	74;304	E7EU17;Q9Y2C5	.;S17A4_HUMAN	K	304;74	ENSP00000367137:E304K;ENSP00000380266:E74K	ENSP00000367137:E304K	E	+	1	0	SLC17A4	25881804	0.000000	0.05858	0.079000	0.20413	0.976000	0.68499	-0.078000	0.11375	0.167000	0.19631	0.655000	0.94253	GAA	.		0.443	SLC17A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040068.1		
HLA-G	3135	ucsc.edu	37	6	29797247	29797247	+	Silent	SNP	C	C	T			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr6:29797247C>T	ENST00000360323.6	+	4	696	c.672C>T	c.(670-672)acC>acT	p.T224T	HLA-G_ENST00000376818.3_Silent_p.T132T|HLA-G_ENST00000376815.3_Intron|HLA-G_ENST00000428701.1_Silent_p.T224T|HLA-G_ENST00000376828.2_Silent_p.T229T			P17693	HLAG_HUMAN	major histocompatibility complex, class I, G	224	Alpha-3.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular defense response (GO:0006968)|cytokine-mediated signaling pathway (GO:0019221)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell tolerance induction (GO:0002666)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)	early endosome membrane (GO:0031901)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(4)|ovary(3)|pancreas(1)|prostate(5)|skin(1)	21						ATGAGGCCACCCTGAGGTGCT	0.582																																					p.T224T													.	HLA-G-517	0			c.C672T						.						95.0	99.0	98.0					6																	29797247		2203	4300	6503	SO:0001819	synonymous_variant	3135	exon5			GGCCACCCTGAGG		CCDS4668.1	6p21.3	2013-01-11	2007-12-12		ENSG00000204632	ENSG00000204632		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4964	protein-coding gene	gene with protein product	"""b2 microglobulin"""	142871	"""HLA-G histocompatibility antigen, class I, G"""				Standard	NM_002127		Approved		uc003nnw.2	P17693	OTTHUMG00000031157	ENST00000360323.6:c.672C>T	6.37:g.29797247C>T		Somatic	259	0		WXS	Illumina HiSeq		255	1	NM_002127	0	0	3	3	0		Silent	SNP	ENST00000360323.6	37	CCDS4668.1																																																																																			.		0.582	HLA-G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076286.2	NM_002127	
MUC21	394263	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	30955264	30955264	+	Missense_Mutation	SNP	T	T	A			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr6:30955264T>A	ENST00000376296.3	+	2	1553	c.1312T>A	c.(1312-1314)Tct>Act	p.S438T	MUC21_ENST00000486149.2_De_novo_Start_OutOfFrame	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	438	Ser-rich.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						AGCCACCAACTCTGGGTCCAG	0.577																																					p.S438T		.											.	MUC21-92	0			c.T1312A						.						124.0	120.0	122.0					6																	30955264		2203	4300	6503	SO:0001583	missense	394263	exon2			ACCAACTCTGGGT	AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.1312T>A	6.37:g.30955264T>A	ENSP00000365473:p.Ser438Thr	Somatic	211	0		WXS	Illumina HiSeq	Phase_I	179	75	NM_001010909	0	0	0	0	0	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Missense_Mutation	SNP	ENST00000376296.3	37	CCDS34388.1	.	.	.	.	.	.	.	.	.	.	t	7.419	0.636395	0.14386	.	.	ENSG00000204544	ENST00000450707;ENST00000376296	T	0.02015	4.5	3.96	-1.72	0.08107	.	.	.	.	.	T	0.00328	0.0010	N	0.12746	0.255	0.09310	N	1	B	0.15473	0.013	B	0.17722	0.019	T	0.42275	-0.9461	9	0.07325	T	0.83	0.2489	4.0719	0.09885	0.5071:0.2625:0.0:0.2303	.	438	Q5SSG8	MUC21_HUMAN	T	288;438	ENSP00000365473:S438T	ENSP00000365473:S438T	S	+	1	0	MUC21	31063243	0.002000	0.14202	0.000000	0.03702	0.004000	0.04260	0.031000	0.13710	-0.390000	0.07774	-0.468000	0.05107	TCT	.		0.577	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000128579.3	NM_001010909	
MCM3	4172	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	52141973	52141973	+	Missense_Mutation	SNP	G	G	C			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr6:52141973G>C	ENST00000229854.7	-	8	1133	c.1057C>G	c.(1057-1059)Cag>Gag	p.Q353E	MCM3_ENST00000476448.1_5'UTR|MCM3_ENST00000596288.1_Missense_Mutation_p.Q398E|MCM3_ENST00000419835.2_Missense_Mutation_p.Q307E			P25205	MCM3_HUMAN	minichromosome maintenance complex component 3	353	MCM.				DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	alpha DNA polymerase:primase complex (GO:0005658)|centrosome (GO:0005813)|intracellular membrane-bounded organelle (GO:0043231)|MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)	p.Q353K(1)		endometrium(4)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	20	Lung NSC(77;0.0931)					CGCAGAAGCTGAGACTTGGCA	0.597																																					p.Q398E		.											.	MCM3-228	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)	c.C1192G						.						60.0	58.0	59.0					6																	52141973		2203	4300	6503	SO:0001583	missense	4172	exon8			GAAGCTGAGACTT	X62153	CCDS4940.1, CCDS4940.2, CCDS75468.1	6p12	2008-02-05	2007-04-04		ENSG00000112118	ENSG00000112118			6945	protein-coding gene	gene with protein product		602693	"""minichromosome maintenance deficient (S. cerevisiae) 3"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae)"""			1549468	Standard	NM_002388		Approved		uc011dwu.2	P25205	OTTHUMG00000014844	ENST00000229854.7:c.1057C>G	6.37:g.52141973G>C	ENSP00000229854:p.Gln353Glu	Somatic	65	0		WXS	Illumina HiSeq	Phase_I	39	12	NM_002388	0	0	16	31	15	B4DWW4|Q92660|Q9BTR3|Q9NUE7	Missense_Mutation	SNP	ENST00000229854.7	37		.	.	.	.	.	.	.	.	.	.	G	32	5.114750	0.94339	.	.	ENSG00000112118	ENST00000229854;ENST00000419835	T;T	0.10960	2.82;2.82	5.36	5.36	0.76844	ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	T	0.44726	0.1307	H	0.97131	3.945	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.996	T	0.63510	-0.6621	10	0.87932	D	0	-17.9504	19.2924	0.94105	0.0:0.0:1.0:0.0	.	307;353	B4DUQ9;P25205	.;MCM3_HUMAN	E	353;307	ENSP00000229854:Q353E;ENSP00000388647:Q307E	ENSP00000229854:Q353E	Q	-	1	0	MCM3	52249932	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.657000	0.98554	2.783000	0.95769	0.655000	0.94253	CAG	.		0.597	MCM3-006	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000470784.1		
GPRC6A	222545	hgsc.bcm.edu;bcgsc.ca	37	6	117113765	117113765	+	Missense_Mutation	SNP	T	T	C	rs386705086|rs111974433|rs368671066	byFrequency	TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr6:117113765T>C	ENST00000310357.3	-	6	2342	c.2321A>G	c.(2320-2322)aAa>aGa	p.K774R	GPRC6A_ENST00000368549.3_Missense_Mutation_p.K703R|GPRC6A_ENST00000530250.1_Missense_Mutation_p.K599R	NM_148963.2	NP_683766.2	Q5T6X5	GPC6A_HUMAN	G protein-coupled receptor, class C, group 6, member A	774					calcium-mediated signaling (GO:0019722)|response to amino acid (GO:0043200)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|liver(1)|lung(24)|ovary(5)|pancreas(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)	65		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)		ATTCTCATATTTGCCTTTGAA	0.418																																					p.K774R		.											.	GPRC6A-96	0			c.A2321G						.						42.0	56.0	51.0					6																	117113765		2184	4297	6481	SO:0001583	missense	222545	exon6			TCATATTTGCCTT	AF502962	CCDS5112.1, CCDS69184.1, CCDS69185.1	6q22.31	2014-01-30	2014-01-30		ENSG00000173612	ENSG00000173612		"""GPCR / Class C : Calcium-sensing receptors"""	18510	protein-coding gene	gene with protein product			"""G protein-coupled receptor, family C, group 6, member A"""				Standard	NM_001286354		Approved	bA86F4.3	uc003pxj.1	Q5T6X5	OTTHUMG00000015447	ENST00000310357.3:c.2321A>G	6.37:g.117113765T>C	ENSP00000309493:p.Lys774Arg	Somatic	30	0		WXS	Illumina HiSeq	Phase_I	35	4	NM_148963	0	0	0	0	0	Q6JK43|Q6JK44|Q8NGU8|Q8NHZ9|Q8TDT6	Missense_Mutation	SNP	ENST00000310357.3	37	CCDS5112.1	.	.	.	.	.	.	.	.	.	.	C	2.589	-0.295670	0.05532	.	.	ENSG00000173612	ENST00000310357;ENST00000368549;ENST00000530250	D;D;D	0.84730	-1.89;-1.89;-1.89	4.37	4.37	0.52481	GPCR, family 3, C-terminal (2);	0.000000	0.38837	N	0.001557	T	0.27967	0.0689	N	0.00149	-1.99	0.19300	N	0.99997	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.36720	-0.9736	10	0.02654	T	1	.	13.7321	0.62794	0.0:0.0:0.0:1.0	.	703;599;774	Q5T6X5-3;Q5T6X5-2;Q5T6X5	.;.;GPC6A_HUMAN	R	774;703;599	ENSP00000309493:K774R;ENSP00000357537:K703R;ENSP00000433465:K599R	ENSP00000309493:K774R	K	-	2	0	GPRC6A	117220458	1.000000	0.71417	0.989000	0.46669	0.963000	0.63663	5.809000	0.69172	1.841000	0.53522	0.482000	0.46254	AAA	.		0.418	GPRC6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041966.2		
DPY19L1	23333	hgsc.bcm.edu	37	7	35009095	35009095	+	Missense_Mutation	SNP	C	C	A	rs201226448		TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr7:35009095C>A	ENST00000310974.4	-	9	889	c.745G>T	c.(745-747)Gta>Tta	p.V249L	DPY19L1_ENST00000462134.2_5'UTR	NM_015283.1	NP_056098.1	Q2PZI1	D19L1_HUMAN	dpy-19-like 1 (C. elegans)	249						integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity, transferring glycosyl groups (GO:0016757)			endometrium(3)|kidney(5)|large_intestine(8)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	31						ATGAAAAATACATTGGAAATG	0.343																																					p.V249L		.											.	DPY19L1-68	0			c.G745T						.						89.0	83.0	84.0					7																	35009095		1848	4100	5948	SO:0001583	missense	23333	exon9			AAAATACATTGGA	AB020684	CCDS43567.1	7p14.3-p14.2	2006-04-26			ENSG00000173852	ENSG00000173852			22205	protein-coding gene	gene with protein product		613892					Standard	NM_015283		Approved	KIAA0877	uc003tem.4	Q2PZI1	OTTHUMG00000154888	ENST00000310974.4:c.745G>T	7.37:g.35009095C>A	ENSP00000308695:p.Val249Leu	Somatic	62	0		WXS	Illumina HiSeq	Phase_I	103	7	NM_015283	0	0	15	17	2	O94954|Q4G151	Missense_Mutation	SNP	ENST00000310974.4	37	CCDS43567.1	.	.	.	.	.	.	.	.	.	.	C	12.07	1.826928	0.32329	.	.	ENSG00000173852	ENST00000310974;ENST00000446375	T;T	0.54279	0.58;0.58	5.18	3.16	0.36331	.	0.395856	0.25732	N	0.028676	T	0.39118	0.1066	L	0.41027	1.25	0.37187	D	0.903762	B	0.10296	0.003	B	0.16722	0.016	T	0.25222	-1.0138	10	0.32370	T	0.25	-11.1224	6.2617	0.20903	0.0:0.6081:0.0:0.3919	.	249	Q2PZI1	D19L1_HUMAN	L	249;48	ENSP00000308695:V249L;ENSP00000400510:V48L	ENSP00000308695:V249L	V	-	1	0	DPY19L1	34975620	0.987000	0.35691	0.627000	0.29227	0.878000	0.50629	0.191000	0.17076	0.456000	0.26937	0.491000	0.48974	GTA	.		0.343	DPY19L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337506.1		
KIAA1549	57670	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	138597164	138597164	+	Missense_Mutation	SNP	A	A	C			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr7:138597164A>C	ENST00000422774.1	-	3	2969	c.2921T>G	c.(2920-2922)aTc>aGc	p.I974S	KIAA1549_ENST00000242365.4_Missense_Mutation_p.I924S|KIAA1549_ENST00000440172.1_Missense_Mutation_p.I974S			Q9HCM3	K1549_HUMAN	KIAA1549	974						integral component of membrane (GO:0016021)			KIAA1549/BRAF(703)	large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(2)	7						TACTTCTTTGATTGCTGTAAT	0.463			O	BRAF	pilocytic astrocytoma																																p.I974S	NSCLC(119;1534 1718 44213 46230 50068)	.		Dom	yes		7	7q34	57670	KIAA1549		O	.	KIAA1549-369	0			c.T2921G						.						149.0	145.0	146.0					7																	138597164		2032	4201	6233	SO:0001583	missense	57670	exon3			TCTTTGATTGCTG		CCDS47723.1, CCDS47723.2, CCDS56513.1	7q34	2009-10-09			ENSG00000122778	ENSG00000122778			22219	protein-coding gene	gene with protein product		613344					Standard	NM_020910		Approved		uc011kql.2	Q9HCM3	OTTHUMG00000157214	ENST00000422774.1:c.2921T>G	7.37:g.138597164A>C	ENSP00000416040:p.Ile974Ser	Somatic	71	0		WXS	Illumina HiSeq	Phase_I	71	43	NM_020910	0	0	2	6	4	B6HY55|B6HY56|B6HY58|B6HY60|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q5BJD6|Q8IY15|Q9H0M3	Missense_Mutation	SNP	ENST00000422774.1	37	CCDS56513.1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.284165	0.80803	.	.	ENSG00000122778	ENST00000440172;ENST00000242365;ENST00000422774	T;T;T	0.32515	1.45;1.46;1.46	5.38	5.38	0.77491	.	0.071830	0.56097	D	0.000028	T	0.45994	0.1370	L	0.36672	1.1	0.51482	D	0.999929	D;D	0.89917	1.0;1.0	D;D	0.77004	0.975;0.989	T	0.44544	-0.9321	10	0.87932	D	0	.	14.7359	0.69414	1.0:0.0:0.0:0.0	.	974;974	Q9HCM3;Q9HCM3-2	K1549_HUMAN;.	S	974;924;974	ENSP00000406661:I974S;ENSP00000242365:I924S;ENSP00000416040:I974S	ENSP00000242365:I924S	I	-	2	0	KIAA1549	138247704	1.000000	0.71417	0.998000	0.56505	0.977000	0.68977	7.162000	0.77515	2.254000	0.74563	0.533000	0.62120	ATC	.		0.463	KIAA1549-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348092.1		
ATP6V0E2	155066	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	149576654	149576654	+	3'UTR	SNP	C	C	G			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr7:149576654C>G	ENST00000425642.2	+	0	519				ATP6V0E2-AS1_ENST00000464939.1_RNA|ATP6V0E2_ENST00000421974.2_Missense_Mutation_p.P177R|ATP6V0E2_ENST00000479613.1_Missense_Mutation_p.P151R|ATP6V0E2_ENST00000456496.2_3'UTR|ATP6V0E2_ENST00000606024.1_Missense_Mutation_p.P128R|RP11-445N20.3_ENST00000608912.1_lincRNA			Q8NHE4	VA0E2_HUMAN	ATPase, H+ transporting V0 subunit e2						ATP hydrolysis coupled proton transport (GO:0015991)|cell growth (GO:0016049)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|vacuolar acidification (GO:0007035)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|phagocytic vesicle membrane (GO:0030670)|proton-transporting V-type ATPase, V0 domain (GO:0033179)	ATPase activity, coupled to transmembrane movement of ions (GO:0042625)|hydrogen ion transmembrane transporter activity (GO:0015078)			lung(1)	1			OV - Ovarian serous cystadenocarcinoma(82;0.00256)			CTCCAATACCCGCACTGCTCT	0.637																																					p.P177R		.											.	.	0			c.C530G						.						61.0	69.0	66.0					7																	149576654		1987	4159	6146	SO:0001624	3_prime_UTR_variant	155066	exon3			AATACCCGCACTG	AK057700	CCDS47742.1, CCDS55181.1	7q36.1	2010-04-21	2006-10-12	2006-10-12	ENSG00000171130	ENSG00000171130		"""ATPases / V-type"""	21723	protein-coding gene	gene with protein product		611019	"""chromosome 7 open reading frame 32"", ""ATPase, H+ transporting V0 subunit E isoform 2-like (rat)"""	C7orf32, ATP6V0E2L			Standard	XM_005249958		Approved		uc003wgs.3	Q8NHE4	OTTHUMG00000158094	ENST00000425642.2:c.*250C>G	7.37:g.149576654C>G		Somatic	25	0		WXS	Illumina HiSeq	Phase_I	28	19	NM_001100592	0	0	35	88	53	A2T863|A2T8L7|B5MDP5|J3KQW7|Q6MZW1|Q75L47|Q7Z4R7|Q8N7I8	Missense_Mutation	SNP	ENST00000425642.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	12.45|12.45	1.941217|1.941217	0.34283|0.34283	.|.	.|.	ENSG00000171130|ENSG00000171130	ENST00000421974;ENST00000425642;ENST00000479613|ENST00000307445	.|.	.|.	.|.	2.78|2.78	1.89|1.89	0.25635|0.25635	.|.	.|.	.|.	.|.	.|.	T|T	0.19725|0.19725	0.0474|0.0474	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	P;P|.	0.44090|.	0.826;0.742|.	B;B|.	0.37422|.	0.249;0.238|.	T|T	0.19160|0.19160	-1.0314|-1.0314	8|6	0.72032|0.87932	D|D	0.01|0	.|.	5.6822|5.6822	0.17782|0.17782	0.0:0.8483:0.0:0.1517|0.0:0.8483:0.0:0.1517	.|.	177;151|.	E9PAS2;Q8NHE4-3|.	.;.|.	R|G	177;128;151|96	.|.	ENSP00000411672:P177R|ENSP00000304519:R96G	P|R	+|+	2|1	0|0	ATP6V0E2|ATP6V0E2	149207587|149207587	0.000000|0.000000	0.05858|0.05858	0.003000|0.003000	0.11579|0.11579	0.005000|0.005000	0.04900|0.04900	0.044000|0.044000	0.13992|0.13992	0.750000|0.750000	0.32877|0.32877	0.467000|0.467000	0.42956|0.42956	CCG|CGC	.		0.637	ATP6V0E2-010	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000470874.1	NM_145230	
GOT1L1	137362	hgsc.bcm.edu	37	8	37797478	37797478	+	Missense_Mutation	SNP	A	A	G			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr8:37797478A>G	ENST00000307599.4	-	1	169	c.70T>C	c.(70-72)Tac>Cac	p.Y24H		NM_152413.2	NP_689626.2	Q8NHS2	AATC2_HUMAN	glutamic-oxaloacetic transaminase 1-like 1	24					biosynthetic process (GO:0009058)|cellular amino acid metabolic process (GO:0006520)	cytoplasm (GO:0005737)	pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)			central_nervous_system(1)|endometrium(3)|lung(8)|ovary(1)|prostate(1)	14	Colorectal(12;0.00627)	Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;1.37e-11)			TCTTGTTTGTAGGTCTTTAAC	0.448																																					p.Y24H		.											.	GOT1L1-23	0			c.T70C						.						135.0	123.0	127.0					8																	37797478		1941	4123	6064	SO:0001583	missense	137362	exon1			GTTTGTAGGTCTT	BC029504	CCDS47839.1	8p12	2005-09-22			ENSG00000169154	ENSG00000169154			28487	protein-coding gene	gene with protein product						12477932	Standard	NM_152413		Approved	MGC33309	uc011lbj.1	Q8NHS2	OTTHUMG00000164027	ENST00000307599.4:c.70T>C	8.37:g.37797478A>G	ENSP00000303077:p.Tyr24His	Somatic	29	0		WXS	Illumina HiSeq	Phase_I	36	2	NM_152413	0	0	0	0	0	A8MWL4	Missense_Mutation	SNP	ENST00000307599.4	37	CCDS47839.1	.	.	.	.	.	.	.	.	.	.	A	15.50	2.852246	0.51270	.	.	ENSG00000169154	ENST00000307599;ENST00000524298	T	0.23950	1.88	5.47	5.47	0.80525	Pyridoxal phosphate-dependent transferase, major domain (1);	0.177963	0.36519	N	0.002544	T	0.52869	0.1761	M	0.86097	2.795	0.80722	D	1	D	0.76494	0.999	D	0.68192	0.956	T	0.60198	-0.7310	10	0.87932	D	0	-8.5012	11.9993	0.53222	1.0:0.0:0.0:0.0	.	24	Q8NHS2	AATC2_HUMAN	H	24;17	ENSP00000303077:Y24H	ENSP00000303077:Y24H	Y	-	1	0	GOT1L1	37916635	1.000000	0.71417	0.965000	0.40720	0.173000	0.22820	4.187000	0.58344	2.094000	0.63399	0.454000	0.30748	TAC	.		0.448	GOT1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376823.1	NM_152413	
LYN	4067	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	56922610	56922610	+	Missense_Mutation	SNP	C	C	A			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr8:56922610C>A	ENST00000519728.1	+	13	1776	c.1480C>A	c.(1480-1482)Cag>Aag	p.Q494K	LYN_ENST00000520220.2_Missense_Mutation_p.Q473K	NM_002350.3	NP_002341.1	P07948	LYN_HUMAN	LYN proto-oncogene, Src family tyrosine kinase	494	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to extracellular stimulus (GO:0031668)|cellular response to heat (GO:0034605)|cellular response to retinoic acid (GO:0071300)|cytokine secretion (GO:0050663)|dendritic cell differentiation (GO:0097028)|erythrocyte differentiation (GO:0030218)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|Fc receptor mediated stimulatory signaling pathway (GO:0002431)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|histamine secretion by mast cell (GO:0002553)|immune response-regulating cell surface receptor signaling pathway (GO:0002768)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|leukocyte migration (GO:0050900)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of immune response (GO:0050777)|negative regulation of intracellular signal transduction (GO:1902532)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of mast cell proliferation (GO:0070667)|negative regulation of myeloid leukocyte differentiation (GO:0002762)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|neuron projection development (GO:0031175)|oligodendrocyte development (GO:0014003)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of Fc receptor mediated stimulatory signaling pathway (GO:0060369)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of mast cell proliferation (GO:0070668)|positive regulation of neuron projection development (GO:0010976)|positive regulation of oligodendrocyte progenitor proliferation (GO:0070447)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of stress-activated protein kinase signaling cascade (GO:0070304)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of B cell apoptotic process (GO:0002902)|regulation of B cell receptor signaling pathway (GO:0050855)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of cytokine production (GO:0001817)|regulation of cytokine secretion (GO:0050707)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of erythrocyte differentiation (GO:0045646)|regulation of inflammatory response (GO:0050727)|regulation of mast cell activation (GO:0033003)|regulation of mast cell degranulation (GO:0043304)|regulation of monocyte chemotaxis (GO:0090025)|regulation of platelet aggregation (GO:0090330)|regulation of protein phosphorylation (GO:0001932)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|response to amino acid (GO:0043200)|response to axon injury (GO:0048678)|response to carbohydrate (GO:0009743)|response to drug (GO:0042493)|response to hormone (GO:0009725)|response to insulin (GO:0032868)|response to organic cyclic compound (GO:0014070)|response to sterol depletion (GO:0006991)|response to toxic substance (GO:0009636)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|T cell costimulation (GO:0031295)|tolerance induction to self antigen (GO:0002513)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integrin alpha2-beta1 complex (GO:0034666)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|mitochondrial crista (GO:0030061)|mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|glycosphingolipid binding (GO:0043208)|ion channel binding (GO:0044325)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	22		all_lung(136;0.0555)|Lung NSC(129;0.0726)|all_epithelial(80;0.0772)	Epithelial(17;0.000834)|all cancers(17;0.00598)		Bosutinib(DB06616)|Ponatinib(DB08901)	TGACTACTTACAGAGCGTCCT	0.527																																					p.Q494K		.											.	LYN-1002	0			c.C1480A						.						102.0	94.0	96.0					8																	56922610		2203	4300	6503	SO:0001583	missense	4067	exon13			TACTTACAGAGCG	M16038	CCDS6162.1, CCDS47859.1	8q13	2014-06-25	2014-06-25		ENSG00000254087	ENSG00000254087		"""SH2 domain containing"""	6735	protein-coding gene	gene with protein product		165120	"""v-yes-1 Yamaguchi sarcoma viral related oncogene homolog"""			3561390	Standard	NM_002350		Approved	JTK8	uc003xsk.4	P07948	OTTHUMG00000044345	ENST00000519728.1:c.1480C>A	8.37:g.56922610C>A	ENSP00000428924:p.Gln494Lys	Somatic	125	0		WXS	Illumina HiSeq	Phase_I	103	39	NM_002350	0	0	10	15	5	A0AVQ5	Missense_Mutation	SNP	ENST00000519728.1	37	CCDS6162.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.672813	0.88445	.	.	ENSG00000254087	ENST00000519728;ENST00000520220	T;T	0.10573	2.86;2.86	5.95	5.95	0.96441	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.13500	0.0327	N	0.12422	0.21	0.80722	D	1	P;P	0.41265	0.744;0.59	P;B	0.48189	0.57;0.415	T	0.08106	-1.0738	10	0.54805	T	0.06	.	20.3932	0.98965	0.0:1.0:0.0:0.0	.	564;494	Q6NUK7;P07948	.;LYN_HUMAN	K	494;473	ENSP00000428924:Q494K;ENSP00000428424:Q473K	ENSP00000428924:Q494K	Q	+	1	0	LYN	57085164	1.000000	0.71417	0.967000	0.41034	0.879000	0.50718	7.818000	0.86416	2.824000	0.97209	0.655000	0.94253	CAG	.		0.527	LYN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378155.1	NM_002350	
GEM	2669	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	95262646	95262646	+	Silent	SNP	G	G	A			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr8:95262646G>A	ENST00000297596.2	-	5	1047	c.783C>T	c.(781-783)agC>agT	p.S261S	GEM_ENST00000396194.2_Silent_p.S261S	NM_005261.3	NP_005252.1	P55040	GEM_HUMAN	GTP binding protein overexpressed in skeletal muscle	261					cell surface receptor signaling pathway (GO:0007166)|chromosome organization (GO:0051276)|immune response (GO:0006955)|metaphase plate congression (GO:0051310)|mitotic nuclear division (GO:0007067)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic side of plasma membrane (GO:0009898)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|spindle midzone (GO:0051233)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|magnesium ion binding (GO:0000287)			endometrium(3)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|upper_aerodigestive_tract(1)	22	Breast(36;4.65e-06)	Myeloproliferative disorder(644;0.204)	BRCA - Breast invasive adenocarcinoma(8;0.00691)			TCCTGGGCATGCTCTCCTTCC	0.552																																					p.S261S	GBM(125;80 1653 28655 32188 47338)|Esophageal Squamous(19;97 579 13602 49091 51766)	.											.	GEM-659	0			c.C783T						.						96.0	87.0	90.0					8																	95262646		2203	4300	6503	SO:0001819	synonymous_variant	2669	exon5			GGGCATGCTCTCC		CCDS6261.1	8q13-q21	2014-05-09	2001-11-28		ENSG00000164949	ENSG00000164949			4234	protein-coding gene	gene with protein product	"""kinase-inducible Ras-like protein"""	600164	"""GTP-binding protein overexpressed in skeletal muscle"""			7912851, 11956230	Standard	NM_005261		Approved	KIR	uc003ygj.3	P55040	OTTHUMG00000164392	ENST00000297596.2:c.783C>T	8.37:g.95262646G>A		Somatic	83	0		WXS	Illumina HiSeq	Phase_I	67	25	NM_181702	0	0	2	8	6	B2RA31	Silent	SNP	ENST00000297596.2	37	CCDS6261.1																																																																																			.		0.552	GEM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378566.1	NM_181702	
NDUFAF6	137682	hgsc.bcm.edu	37	8	96037319	96037319	+	Missense_Mutation	SNP	G	G	C	rs201223057	byFrequency	TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr8:96037319G>C	ENST00000396124.4	+	1	106	c.83G>C	c.(82-84)gGt>gCt	p.G28A	NDUFAF6_ENST00000286687.4_5'UTR|NDUFAF6_ENST00000542894.1_Intron|NDUFAF6_ENST00000396111.2_Intron|NDUFAF6_ENST00000396113.1_Intron	NM_152416.3	NP_689629.2	Q330K2	NDUF6_HUMAN	NADH dehydrogenase (ubiquinone) complex I, assembly factor 6	28					biosynthetic process (GO:0009058)|mitochondrial respiratory chain complex I assembly (GO:0032981)	cytoplasm (GO:0005737)|mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	transferase activity (GO:0016740)										CCGCCTCTGGGTCTGTACGCG	0.766													G|||	3	0.000599042	0.0008	0.0	5008	,	,		10023	0.0		0.001	False		,,,				2504	0.001				p.G28A		.											.	.	0			c.G83C						.						2.0	3.0	3.0					8																	96037319		1152	2673	3825	SO:0001583	missense	137682	exon1			CTCTGGGTCTGTA	BC028166	CCDS6266.2	8q22.1	2013-10-21	2012-05-08	2012-05-08	ENSG00000156170	ENSG00000156170		"""Mitochondrial respiratory chain complex assembly factors"""	28625	protein-coding gene	gene with protein product		612392	"""chromosome 8 open reading frame 38"""	C8orf38		22019594, 23509070	Standard	NM_152416		Approved	MGC40214	uc003yhj.3	Q330K2	OTTHUMG00000150173	ENST00000396124.4:c.83G>C	8.37:g.96037319G>C	ENSP00000379430:p.Gly28Ala	Somatic	2	1		WXS	Illumina HiSeq	Phase_I	9	2	NM_152416	0	0	0	0	0	A8MT28|A8MWF0|B4DQ45|Q8N6U6	Missense_Mutation	SNP	ENST00000396124.4	37	CCDS6266.2	.	.	.	.	.	.	.	.	.	.	G	14.63	2.593484	0.46214	.	.	ENSG00000156170	ENST00000396124	D	0.82344	-1.6	4.69	-0.395	0.12431	.	4.915100	0.02393	U	0.079907	T	0.66446	0.2790	N	0.19112	0.55	0.29426	N	0.860208	B	0.23591	0.088	B	0.21360	0.034	T	0.57974	-0.7718	10	0.05620	T	0.96	-0.9879	3.6626	0.08244	0.3757:0.0:0.4557:0.1686	.	28	Q330K2	CH038_HUMAN	A	28	ENSP00000379430:G28A	ENSP00000379430:G28A	G	+	2	0	C8orf38	96106495	0.000000	0.05858	0.000000	0.03702	0.416000	0.31233	0.481000	0.22260	-0.303000	0.08856	0.655000	0.94253	GGT	.		0.766	NDUFAF6-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316700.2	NM_152416	
PTK2	5747	hgsc.bcm.edu	37	8	141684434	141684434	+	Missense_Mutation	SNP	A	A	G			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr8:141684434A>G	ENST00000522684.1	-	29	2901	c.2672T>C	c.(2671-2673)cTc>cCc	p.L891P	PTK2_ENST00000430260.2_Missense_Mutation_p.L201P|PTK2_ENST00000340930.3_Missense_Mutation_p.L901P|PTK2_ENST00000521059.1_Missense_Mutation_p.L891P|PTK2_ENST00000538769.1_Missense_Mutation_p.L559P|PTK2_ENST00000535192.1_Missense_Mutation_p.L845P|PTK2_ENST00000395218.2_Missense_Mutation_p.L901P|PTK2_ENST00000517887.1_Missense_Mutation_p.L935P|PTK2_ENST00000519419.1_Missense_Mutation_p.L935P|PTK2_ENST00000519465.1_Missense_Mutation_p.L519P	NM_153831.3	NP_722560.1	Q05397	FAK1_HUMAN	protein tyrosine kinase 2	891	Interaction with TGFB1I1.|Pro-rich.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell motility (GO:0048870)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|central nervous system neuron axonogenesis (GO:0021955)|embryo development (GO:0009790)|endothelial cell migration (GO:0043542)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|establishment of nucleus localization (GO:0040023)|extracellular matrix organization (GO:0030198)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|growth hormone receptor signaling pathway (GO:0060396)|heart morphogenesis (GO:0003007)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of organ growth (GO:0046621)|negative regulation of synapse assembly (GO:0051964)|netrin-activated signaling pathway (GO:0038007)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|placenta development (GO:0001890)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|regulation of endothelial cell migration (GO:0010594)|regulation of focal adhesion assembly (GO:0051893)|regulation of osteoblast differentiation (GO:0045667)|regulation of Rho GTPase activity (GO:0032319)|signal complex assembly (GO:0007172)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)	apical plasma membrane (GO:0016324)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|stress fiber (GO:0001725)	actin binding (GO:0003779)|ATP binding (GO:0005524)|JUN kinase binding (GO:0008432)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(6)|lung(23)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	48	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			AGGGCTGCTGAGGCTGGCAAG	0.567																																					p.L913P		.											.	PTK2-1517	0			c.T2738C						.						49.0	41.0	43.0					8																	141684434		2203	4300	6503	SO:0001583	missense	5747	exon29			CTGCTGAGGCTGG	L13616	CCDS6381.1, CCDS56557.1	8q24.3	2013-02-18	2013-02-18		ENSG00000169398	ENSG00000169398	2.7.10.1	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9611	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 71"""	600758	"""PTK2 protein tyrosine kinase 2"""			8422239	Standard	NM_153831		Approved	FAK, FADK, FAK1, PPP1R71	uc003yvt.3	Q05397	OTTHUMG00000067438	ENST00000522684.1:c.2672T>C	8.37:g.141684434A>G	ENSP00000429911:p.Leu891Pro	Somatic	18	0		WXS	Illumina HiSeq	Phase_I	13	2	NM_005607	0	0	85	85	0	B4E2N6|F5H4S4|Q14291|Q9UD85	Missense_Mutation	SNP	ENST00000522684.1	37	CCDS6381.1	.	.	.	.	.	.	.	.	.	.	A	16.49	3.137373	0.56936	.	.	ENSG00000169398	ENST00000522684;ENST00000535192;ENST00000519465;ENST00000517887;ENST00000521059;ENST00000395214;ENST00000395218;ENST00000354438;ENST00000395221;ENST00000523539;ENST00000340930;ENST00000538769;ENST00000519419;ENST00000430260;ENST00000521986	T;T;T;T;T;T;T;T;T;T;T;T	0.77098	-1.02;-1.05;-1.02;-1.04;-1.02;-1.07;-1.01;-1.04;-1.0;-1.04;1.37;-1.04	5.96	5.96	0.96718	.	0.148388	0.45606	D	0.000349	T	0.66177	0.2763	N	0.19112	0.55	0.80722	D	1	P;P;B;B;B;B;B;B;B;P	0.43662	0.814;0.574;0.238;0.303;0.357;0.303;0.375;0.075;0.0;0.736	B;B;B;B;B;B;B;B;B;B	0.43052	0.229;0.406;0.167;0.121;0.167;0.121;0.397;0.265;0.002;0.248	T	0.65586	-0.6132	10	0.27785	T	0.31	.	11.5164	0.50524	0.8663:0.0:0.0:0.1337	.	901;586;811;891;913;845;843;718;559;519	B4E2N6;B4DH13;Q59GN8;Q05397;Q658W2;Q8IYN9;Q59GM6;Q05397-2;Q8N9D7;E9PEI4	.;.;.;FAK1_HUMAN;.;.;.;.;.;.	P	891;845;519;935;891;843;901;812;586;563;901;559;935;201;589	ENSP00000429911:L891P;ENSP00000438009:L845P;ENSP00000429170:L519P;ENSP00000429082:L935P;ENSP00000429474:L891P;ENSP00000378644:L901P;ENSP00000428492:L563P;ENSP00000341189:L901P;ENSP00000445742:L559P;ENSP00000429129:L935P;ENSP00000403416:L201P;ENSP00000430603:L589P	ENSP00000341189:L901P	L	-	2	0	PTK2	141753616	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.777000	0.68931	2.284000	0.76573	0.528000	0.53228	CTC	.		0.567	PTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378054.5	NM_005607	
PLEC	5339	hgsc.bcm.edu	37	8	144997533	144997533	+	Silent	SNP	C	C	G			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr8:144997533C>G	ENST00000322810.4	-	31	7144	c.6975G>C	c.(6973-6975)ctG>ctC	p.L2325L	PLEC_ENST00000354958.2_Silent_p.L2166L|PLEC_ENST00000354589.3_Silent_p.L2188L|PLEC_ENST00000345136.3_Silent_p.L2188L|PLEC_ENST00000527096.1_Silent_p.L2211L|PLEC_ENST00000398774.2_Silent_p.L2156L|PLEC_ENST00000436759.2_Silent_p.L2215L|PLEC_ENST00000356346.3_Silent_p.L2174L|PLEC_ENST00000357649.2_Silent_p.L2192L	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2325	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GCAGTGTTGTCAGCTCCTGCT	0.662																																					p.L2325L		.											.	PLEC-141	0			c.G6975C						.						11.0	13.0	12.0					8																	144997533		2137	4243	6380	SO:0001819	synonymous_variant	5339	exon31			TGTTGTCAGCTCC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.6975G>C	8.37:g.144997533C>G		Somatic	35	0		WXS	Illumina HiSeq	Phase_I	22	2	NM_201380	0	0	11	11	0	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			.		0.662	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
GRINA	2907	hgsc.bcm.edu	37	8	145066937	145066937	+	Silent	SNP	G	G	A	rs184930535		TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr8:145066937G>A	ENST00000313269.5	+	7	1322	c.1044G>A	c.(1042-1044)gcG>gcA	p.A348A	GRINA_ENST00000395068.4_Silent_p.A348A	NM_000837.1	NP_000828.1	Q7Z429	LFG1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding)	348						integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(1)|stomach(1)	9	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.31e-40)|Epithelial(56;1.16e-39)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TGTTTGCTGCGCTGAACCTGT	0.572													G|||	1	0.000199681	0.0	0.0	5008	,	,		22289	0.0		0.001	False		,,,				2504	0.0				p.A348A		.											.	GRINA-90	0			c.G1044A						.						199.0	124.0	149.0					8																	145066937		2203	4299	6502	SO:0001819	synonymous_variant	2907	exon7			TGCTGCGCTGAAC	NM_001009184	CCDS34961.1	8q24.3	2010-03-18	2008-04-01						4589	protein-coding gene	gene with protein product	"""transmembrane BAX inhibitor motif containing 3"""	138251		NMDARA1		1719427, 8406459	Standard	XM_005250899		Approved	HNRGW, TMBIM3, LFG1	uc003zao.1	Q7Z429		ENST00000313269.5:c.1044G>A	8.37:g.145066937G>A		Somatic	52	1		WXS	Illumina HiSeq	Phase_I	41	3	NM_001009184	0	0	339	339	0	B3KXM7|O43836|Q8IVW7	Silent	SNP	ENST00000313269.5	37	CCDS34961.1	1|1	4.578754578754579E-4|4.578754578754579E-4	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	1|1	0.0013192612137203166|0.0013192612137203166	G|G	9.946|9.946	1.218930|1.218930	0.22373|0.22373	.|.	.|.	ENSG00000178719|ENSG00000178719	ENST00000533044;ENST00000527194|ENST00000534791	T;T|.	0.59083|.	0.29;0.29|.	4.75|4.75	-9.49|-9.49	0.00587|0.00587	.|.	0.125575|.	0.52532|.	D|.	0.000061|.	T|T	0.42449|0.42449	0.1203|0.1203	.|.	.|.	.|.	0.58432|0.58432	D|D	0.999996|0.999996	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.49072|0.49072	-0.8977|-0.8977	7|4	0.46703|.	T|.	0.11|.	-22.2342|-22.2342	5.2211|5.2211	0.15370|0.15370	0.3542:0.4442:0.1201:0.0815|0.3542:0.4442:0.1201:0.0815	.|.	.|.	.|.	.|.	T|H	171;161|327	ENSP00000432095:A171T;ENSP00000431217:A161T|.	ENSP00000431217:A161T|.	A|R	+|+	1|2	0|0	GRINA|GRINA	145138925|145138925	0.000000|0.000000	0.05858|0.05858	0.016000|0.016000	0.15963|0.15963	0.842000|0.842000	0.47809|0.47809	-5.389000|-5.389000	0.00126|0.00126	-2.455000|-2.455000	0.00540|0.00540	-1.354000|-1.354000	0.01226|0.01226	GCT|CGC	G|0.999;A|0.000		0.572	GRINA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384048.1	NM_001009184	
OR13J1	392309	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	35869823	35869823	+	Silent	SNP	C	C	T			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr9:35869823C>T	ENST00000377981.2	-	1	638	c.576G>A	c.(574-576)acG>acA	p.T192T		NM_001004487.1	NP_001004487.1	Q8NGT2	O13J1_HUMAN	olfactory receptor, family 13, subfamily J, member 1	192						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|large_intestine(1)|lung(3)|skin(1)	6	all_epithelial(49;0.169)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00494)|STAD - Stomach adenocarcinoma(86;0.194)			CGCTGACCGACGTGTTGCCGC	0.597																																					p.T192T		.											.	OR13J1-68	0			c.G576A						.						69.0	57.0	61.0					9																	35869823		2203	4300	6503	SO:0001819	synonymous_variant	392309	exon1			GACCGACGTGTTG		CCDS35011.1	9p13.3	2013-09-24			ENSG00000168828	ENSG00000168828		"""GPCR / Class A : Olfactory receptors"""	15108	protein-coding gene	gene with protein product							Standard	NM_001004487		Approved		uc011lph.2	Q8NGT2	OTTHUMG00000019879	ENST00000377981.2:c.576G>A	9.37:g.35869823C>T		Somatic	89	0		WXS	Illumina HiSeq	Phase_I	56	18	NM_001004487	0	0	0	0	0	B2RN66|Q6IF20|Q96R40	Silent	SNP	ENST00000377981.2	37	CCDS35011.1																																																																																			.		0.597	OR13J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052381.1		
SECISBP2	79048	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	91965762	91965762	+	Missense_Mutation	SNP	C	C	T			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr9:91965762C>T	ENST00000375807.3	+	14	2179	c.2108C>T	c.(2107-2109)tCa>tTa	p.S703L	SECISBP2_ENST00000534113.2_Missense_Mutation_p.S635L|SECISBP2_ENST00000339901.4_Missense_Mutation_p.S630L	NM_001282688.1|NM_001282690.1|NM_024077.3	NP_001269617.1|NP_001269619.1|NP_076982.3	Q96T21	SEBP2_HUMAN	SECIS binding protein 2	703					translation (GO:0006412)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)|selenocysteine insertion sequence binding (GO:0035368)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(3)|skin(2)	32						AAGATACAGTCAAAAGGTAAA	0.498																																					p.S703L		.											.	SECISBP2-93	0			c.C2108T						.						68.0	69.0	69.0					9																	91965762		2203	4300	6503	SO:0001583	missense	79048	exon14			TACAGTCAAAAGG	AF380995	CCDS6683.1, CCDS65076.1, CCDS65077.1	9q22	2008-02-05			ENSG00000187742	ENSG00000187742			30972	protein-coding gene	gene with protein product		607693				11230166	Standard	XM_005252193		Approved		uc004aqj.1	Q96T21	OTTHUMG00000020182	ENST00000375807.3:c.2108C>T	9.37:g.91965762C>T	ENSP00000364965:p.Ser703Leu	Somatic	75	0		WXS	Illumina HiSeq	Phase_I	67	34	NM_024077	0	0	0	0	0	F8W892|Q5HYY1|Q8IYC0|Q9H0A1	Missense_Mutation	SNP	ENST00000375807.3	37	CCDS6683.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.299315	0.81136	.	.	ENSG00000187742	ENST00000375807;ENST00000395669;ENST00000339901;ENST00000534113	T;T;T	0.57273	0.41;0.41;0.41	4.84	4.84	0.62591	Ribosomal protein L7Ae/L30e/S12e/Gadd45 (1);	0.000000	0.85682	D	0.000000	T	0.69342	0.3100	L	0.52905	1.665	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.997;0.998	T	0.70695	-0.4801	10	0.59425	D	0.04	-12.0495	18.4955	0.90864	0.0:1.0:0.0:0.0	.	710;630;703	Q59H19;Q96T21-2;Q96T21	.;.;SEBP2_HUMAN	L	703;709;630;635	ENSP00000364965:S703L;ENSP00000364959:S630L;ENSP00000436650:S635L	ENSP00000364959:S630L	S	+	2	0	SECISBP2	91155582	1.000000	0.71417	0.991000	0.47740	0.546000	0.35178	7.314000	0.78988	2.686000	0.91538	0.561000	0.74099	TCA	.		0.498	SECISBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052990.3	NM_024077	
RAD23B	5887	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	110091836	110091836	+	Missense_Mutation	SNP	G	G	A			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr9:110091836G>A	ENST00000358015.3	+	10	1480	c.1129G>A	c.(1129-1131)Gga>Aga	p.G377R	RAD23B_ENST00000416373.2_Missense_Mutation_p.G305R	NM_001244713.1|NM_002874.4	NP_001231642.1|NP_002865.1	P54727	RD23B_HUMAN	RAD23 homolog B (S. cerevisiae)	377	UBA 2. {ECO:0000255|PROSITE- ProRule:PRU00212}.				DNA repair (GO:0006281)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage recognition (GO:0000715)|nucleotide-excision repair, DNA damage removal (GO:0000718)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|XPC complex (GO:0071942)	damaged DNA binding (GO:0003684)|polyubiquitin binding (GO:0031593)|single-stranded DNA binding (GO:0003697)			breast(3)|cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14						AAAGGCATTAGGATTTCCTGA	0.328								Direct reversal of damage;Nucleotide excision repair (NER)																													p.G377R		.											.	RAD23B-228	0			c.G1129A						.						71.0	73.0	72.0					9																	110091836		2203	4300	6503	SO:0001583	missense	5887	exon10			GCATTAGGATTTC		CCDS6769.1, CCDS59138.1	9q31.2	2008-07-21	2001-11-28		ENSG00000119318	ENSG00000119318			9813	protein-coding gene	gene with protein product	"""XP-C repair complementing protein"", ""XP-C repair complementing complex 58 kDa"""	600062	"""RAD23 (S. cerevisiae) homolog B"""			7851894, 8168482	Standard	NM_002874		Approved	HHR23B, P58, HR23B	uc004bde.3	P54727	OTTHUMG00000020446	ENST00000358015.3:c.1129G>A	9.37:g.110091836G>A	ENSP00000350708:p.Gly377Arg	Somatic	114	0		WXS	Illumina HiSeq	Phase_I	102	33	NM_002874	0	0	0	0	0	B3KWK8|G5E9P0|Q7Z5K8|Q8WUB0	Missense_Mutation	SNP	ENST00000358015.3	37	CCDS6769.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.086513	0.76642	.	.	ENSG00000119318	ENST00000358015;ENST00000416373	D;D	0.93019	-3.15;-3.15	5.27	5.27	0.74061	Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (2);Ubiquitin-associated/translation elongation factor EF1B, N-terminal (1);UBA-like (1);	0.000000	0.85682	D	0.000000	D	0.97804	0.9279	H	0.94503	3.545	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.994	D	0.98693	1.0697	10	0.87932	D	0	-3.6232	19.2454	0.93901	0.0:0.0:1.0:0.0	.	356;377	B7Z4W4;P54727	.;RD23B_HUMAN	R	377;305	ENSP00000350708:G377R;ENSP00000405623:G305R	ENSP00000350708:G377R	G	+	1	0	RAD23B	109131657	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.439000	0.97543	2.623000	0.88846	0.563000	0.77884	GGA	.		0.328	RAD23B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053548.1	NM_002874	
RABGAP1	23637	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	125751642	125751642	+	Silent	SNP	C	C	T			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr9:125751642C>T	ENST00000373647.4	+	5	791	c.657C>T	c.(655-657)gtC>gtT	p.V219V		NM_012197.3	NP_036329.3	Q9Y3P9	RBGP1_HUMAN	RAB GTPase activating protein 1	219	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				cell cycle (GO:0007049)|positive regulation of GTPase activity (GO:0043547)|regulation of GTP catabolic process (GO:0033124)	centrosome (GO:0005813)|cytosol (GO:0005829)|microtubule associated complex (GO:0005875)	DNA binding (GO:0003677)|GTPase activator activity (GO:0005096)|Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)|tubulin binding (GO:0015631)			breast(3)|endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(3)|prostate(4)|stomach(3)|upper_aerodigestive_tract(1)	41						TCTTCTGTGTCAGAGGGCATG	0.413																																					p.V219V		.											.	RABGAP1-500	0			c.C657T						.						117.0	115.0	116.0					9																	125751642		2203	4300	6503	SO:0001819	synonymous_variant	23637	exon5			CTGTGTCAGAGGG	AJ011679	CCDS6848.2	9q34.11	2013-07-09			ENSG00000011454	ENSG00000011454			17155	protein-coding gene	gene with protein product	"""rab6 GTPase activating protein (GAP and centrosome-associated)"", ""TBC1 domain family, member 11"""	615882				10202141	Standard	NM_012197		Approved	GAPCenA, TBC1D11	uc011lzh.2	Q9Y3P9	OTTHUMG00000020633	ENST00000373647.4:c.657C>T	9.37:g.125751642C>T		Somatic	119	0		WXS	Illumina HiSeq	Phase_I	90	44	NM_012197	0	0	8	11	3	B9A6L2|Q05CW2|Q6ZMY1|Q9HA28|Q9P0E2|Q9UG67	Silent	SNP	ENST00000373647.4	37	CCDS6848.2																																																																																			.		0.413	RABGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053976.3	NM_012197	
ZXDB	158586	hgsc.bcm.edu	37	X	57619097	57619097	+	Missense_Mutation	SNP	G	G	A			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chrX:57619097G>A	ENST00000374888.1	+	1	829	c.616G>A	c.(616-618)Ggg>Agg	p.G206R		NM_007157.3	NP_009088.1	P98169	ZXDB_HUMAN	zinc finger, X-linked, duplicated B	206					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.G206R(2)		NS(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(2)|skin(6)	27						CCAGCAGCCCGGGTGTCTGAT	0.711																																					p.G206R		.											.	ZXDB-130	2	Substitution - Missense(2)	lung(1)|prostate(1)	c.G616A						.						12.0	14.0	13.0					X																	57619097		2186	4257	6443	SO:0001583	missense	158586	exon1			CAGCCCGGGTGTC	L14788	CCDS35313.1	Xp11.1	2013-01-08			ENSG00000198455	ENSG00000198455		"""Zinc fingers, C2H2-type"""	13199	protein-coding gene	gene with protein product		300236				8268913	Standard	NM_007157		Approved	ZNF905	uc004dvd.3	P98169	OTTHUMG00000021685	ENST00000374888.1:c.616G>A	X.37:g.57619097G>A	ENSP00000364023:p.Gly206Arg	Somatic	17	0		WXS	Illumina HiSeq	Phase_I	13	2	NM_007157	0	0	0	4	4	A8K151|Q9UBB3	Missense_Mutation	SNP	ENST00000374888.1	37	CCDS35313.1	.	.	.	.	.	.	.	.	.	.	.	0	-2.654782	0.00108	.	.	ENSG00000198455	ENST00000374888	T	0.11063	2.81	2.65	1.78	0.24846	.	0.160870	0.29602	N	0.011697	T	0.04452	0.0122	N	0.12182	0.205	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.41787	-0.9489	10	0.15952	T	0.53	.	4.3042	0.10938	0.3435:0.0:0.6565:0.0	.	206	P98169	ZXDB_HUMAN	R	206	ENSP00000364023:G206R	ENSP00000364023:G206R	G	+	1	0	ZXDB	57635822	0.000000	0.05858	0.002000	0.10522	0.045000	0.14185	-0.287000	0.08388	0.520000	0.28426	0.556000	0.70494	GGG	.		0.711	ZXDB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056922.1	NM_007157	
SLC30A1	7779	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	211749303	211749308	+	In_Frame_Del	DEL	ATCTAA	ATCTAA	-			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	ATCTAA	ATCTAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr1:211749303_211749308delATCTAA	ENST00000367001.4	-	2	1075_1080	c.946_951delTTAGAT	c.(946-951)ttagatdel	p.LD316del		NM_021194.2	NP_067017.2	Q9Y6M5	ZNT1_HUMAN	solute carrier family 30 (zinc transporter), member 1	316					cadmium ion transmembrane transport (GO:0070574)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|cellular zinc ion homeostasis (GO:0006882)|detoxification of cadmium ion (GO:0071585)|in utero embryonic development (GO:0001701)|negative regulation of calcium ion import (GO:0090281)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of zinc ion transmembrane import (GO:0071584)|transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)	calcium channel inhibitor activity (GO:0019855)|zinc ion transmembrane transporter activity (GO:0005385)	p.D317Y(1)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(1)|ovary(3)|prostate(1)	11				OV - Ovarian serous cystadenocarcinoma(81;0.00535)|GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.0604)|Epithelial(68;0.0978)		AAAGAGTTGGATCTAAATATAGCACC	0.364																																					p.316_317del		.											.	SLC30A1-93	1	Substitution - Missense(1)	large_intestine(1)	c.946_951del						.																																			SO:0001651	inframe_deletion	7779	exon2			.	AF323590	CCDS1499.1	1q32.3	2013-05-22			ENSG00000170385	ENSG00000170385		"""Solute carriers"""	11012	protein-coding gene	gene with protein product		609521		ZNT1			Standard	NM_021194		Approved	ZRC1	uc001hio.1	Q9Y6M5	OTTHUMG00000036995	ENST00000367001.4:c.946_951delTTAGAT	1.37:g.211749303_211749308delATCTAA	ENSP00000355968:p.Leu316_Asp317del	Somatic	214	0		WXS	Illumina HiSeq	Phase_I	95	72	NM_021194	0	0	0	0	0	Q0VAK9|Q9BZF6	In_Frame_Del	DEL	ENST00000367001.4	37	CCDS1499.1																																																																																			.		0.364	SLC30A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104738.2		
SIDT2	51092	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	117058116	117058118	+	In_Frame_Del	DEL	TTC	TTC	-			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	TTC	TTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr11:117058116_117058118delTTC	ENST00000324225.4	+	11	1569_1571	c.1038_1040delTTC	c.(1036-1041)gattct>gat	p.S347del	SIDT2_ENST00000431081.2_In_Frame_Del_p.S351del	NM_001040455.1	NP_001035545.1	Q8NBJ9	SIDT2_HUMAN	SID1 transmembrane family, member 2	347					cell morphogenesis (GO:0000902)|dsRNA transport (GO:0033227)|glucose homeostasis (GO:0042593)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to glucose (GO:0009749)|type B pancreatic cell development (GO:0003323)|type B pancreatic cell proliferation (GO:0044342)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	RNA transmembrane transporter activity (GO:0051033)			NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	36	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000219)|all cancers(92;0.00144)		TCCTGGCTGATTCTTTTCCTGGC	0.517																																					p.346_347del		.											.	SIDT2-90	0			c.1038_1040del						.																																			SO:0001651	inframe_deletion	51092	exon11			.	AF151799	CCDS31682.1	11q23.3	2008-02-05			ENSG00000149577	ENSG00000149577			24272	protein-coding gene	gene with protein product						10810093, 12975309	Standard	NM_001040455		Approved	CGI-40	uc001pqh.1	Q8NBJ9	OTTHUMG00000167065	ENST00000324225.4:c.1038_1040delTTC	11.37:g.117058116_117058118delTTC	ENSP00000314023:p.Ser347del	Somatic	170	0		WXS	Illumina HiSeq	Phase_I	153	58	NM_001040455	0	0	0	0	0	Q8NBY7|Q9Y357	In_Frame_Del	DEL	ENST00000324225.4	37	CCDS31682.1																																																																																			.		0.517	SIDT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392836.1	NM_015996	
DISP2	85455	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	40661086	40661086	+	Frame_Shift_Del	DEL	A	A	-			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr15:40661086delA	ENST00000267889.3	+	8	2860	c.2773delA	c.(2773-2775)aatfs	p.N925fs	RP11-64K12.4_ENST00000558421.1_RNA|LINC00594_ENST00000561261.1_lincRNA	NM_033510.1	NP_277045.1	A7MBM2	DISP2_HUMAN	dispatched homolog 2 (Drosophila)	925					smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(12)|ovary(4)	30		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.39e-06)|Colorectal(105;0.0114)|READ - Rectum adenocarcinoma(2;0.0649)|BRCA - Breast invasive adenocarcinoma(123;0.0798)|Lung(196;0.15)|LUAD - Lung adenocarcinoma(183;0.247)		GCTCTTCTACAATGAGGTCAG	0.602																																					p.N925fs		.											.	DISP2-92	0			c.2773delA						.						53.0	58.0	56.0					15																	40661086		2203	4300	6503	SO:0001589	frameshift_variant	85455	exon8			.	AB051529	CCDS10056.1	15q14	2004-01-15			ENSG00000140323	ENSG00000140323			19712	protein-coding gene	gene with protein product		607503				11214970, 10619433	Standard	NM_033510		Approved	DISPB, KIAA1742, HsT16908	uc001zlk.1	A7MBM2	OTTHUMG00000129983	ENST00000267889.3:c.2773delA	15.37:g.40661086delA	ENSP00000267889:p.Asn925fs	Somatic	138	0		WXS	Illumina HiSeq	Phase_I	98	40	NM_033510	0	0	0	0	0	Q6AHW3|Q9C0C1	Frame_Shift_Del	DEL	ENST00000267889.3	37	CCDS10056.1																																																																																			.		0.602	DISP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252249.1	NM_033510	
CHMP3	51652	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	86790455	86790455	+	Frame_Shift_Del	DEL	T	T	-			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr2:86790455delT	ENST00000263856.4	-	1	145	c.17delA	c.(16-18)aagfs	p.K6fs	CHMP3_ENST00000409727.1_Frame_Shift_Del_p.K6fs|CHMP3_ENST00000439940.2_Intron|AC015971.2_ENST00000439077.1_RNA|RNF103-CHMP3_ENST00000604011.1_Intron|AC015971.2_ENST00000597638.1_RNA|CHMP3_ENST00000409225.2_5'UTR	NM_001193517.1|NM_016079.3	NP_001180446.1|NP_057163.1	Q9Y3E7	CHMP3_HUMAN	charged multivesicular body protein 3	6	Intramolecular interaction with C- terminus.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell division (GO:0051301)|endosomal transport (GO:0016197)|membrane organization (GO:0061024)|positive regulation of viral release from host cell (GO:1902188)|protein transport (GO:0015031)|regulation of viral process (GO:0050792)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)											CTCCTGGGTCTTTCCAAACAG	0.632																																					p.K6fs		.											.	.	0			c.17delA						.						120.0	123.0	122.0					2																	86790455		2203	4300	6503	SO:0001589	frameshift_variant	51652	exon1			.	AF219226	CCDS33236.1, CCDS42707.1, CCDS54375.1	2p11.2	2011-09-21	2011-09-21	2011-09-21	ENSG00000115561	ENSG00000115561		"""Charged multivesicular body proteins"""	29865	protein-coding gene	gene with protein product		610052	"""vacuolar protein sorting 24 (yeast)"", ""vacuolar protein sorting 24 homolog (S. cerevisiae)"""	VPS24		11549700, 12878588	Standard	NM_016079		Approved	NEDF, CGI-149		Q9Y3E7	OTTHUMG00000153189	ENST00000263856.4:c.17delA	2.37:g.86790455delT	ENSP00000263856:p.Lys6fs	Somatic	223	0		WXS	Illumina HiSeq	Phase_I	219	93	NM_016079	0	0	0	0	0	A8K3W0|B4DG34|B8ZZM0|B8ZZX5|Q3ZTS9|Q53S71|Q53SU5|Q9NZ51	Frame_Shift_Del	DEL	ENST00000263856.4	37	CCDS33236.1																																																																																			.		0.632	CHMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330015.2	NM_016079	
KIAA1109	84162	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	123229112	123229112	+	Frame_Shift_Del	DEL	T	T	-			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr4:123229112delT	ENST00000264501.4	+	58	10223	c.9850delT	c.(9850-9852)tttfs	p.F3284fs	KIAA1109_ENST00000455637.1_Frame_Shift_Del_p.F3284fs|KIAA1109_ENST00000388738.3_Frame_Shift_Del_p.F3284fs			Q2LD37	K1109_HUMAN	KIAA1109	3284					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						AGCTGTGCTGTTTTGGCTGAA	0.343																																					p.F3284fs		.											.	KIAA1109-80	0			c.9850delT						.						132.0	129.0	130.0					4																	123229112		1827	4092	5919	SO:0001589	frameshift_variant	84162	exon56			.	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.9850delT	4.37:g.123229112delT	ENSP00000264501:p.Phe3284fs	Somatic	193	0		WXS	Illumina HiSeq	Phase_I	171	65	NM_015312	0	0	0	0	0	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Frame_Shift_Del	DEL	ENST00000264501.4	37	CCDS43267.1																																																																																			.		0.343	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
HSPA9	3313	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	137904733	137904733	+	Frame_Shift_Del	DEL	T	T	-			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr5:137904733delT	ENST00000297185.3	-	5	541	c.416delA	c.(415-417)aatfs	p.N139fs	HSPA9_ENST00000501917.2_5'Flank	NM_004134.6	NP_004125.3	P38646	GRP75_HUMAN	heat shock 70kDa protein 9 (mortalin)	139					cellular protein metabolic process (GO:0044267)|negative regulation of apoptotic process (GO:0043066)|protein export from nucleus (GO:0006611)|protein folding (GO:0006457)|protein targeting to mitochondrion (GO:0006626)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			breast(2)|endometrium(1)|kidney(4)|large_intestine(8)|lung(12)|upper_aerodigestive_tract(1)	28			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			AAAGGGAACATTTTTACTGTA	0.403																																					p.N139fs		.											.	HSPA9-226	0			c.416delA						.						61.0	61.0	61.0					5																	137904733		2203	4300	6503	SO:0001589	frameshift_variant	3313	exon5			.	L11066	CCDS4208.1	5q31.1	2011-09-02	2006-10-31	2006-10-31	ENSG00000113013	ENSG00000113013		"""Heat shock proteins / HSP70"""	5244	protein-coding gene	gene with protein product		600548	"""heat shock 70kDa protein 9B (mortalin-2)"""	HSPA9B		7684501	Standard	NM_004134		Approved	GRP75, PBP74, mot-2, mthsp75	uc003ldf.3	P38646	OTTHUMG00000129206	ENST00000297185.3:c.416delA	5.37:g.137904733delT	ENSP00000297185:p.Asn139fs	Somatic	100	0		WXS	Illumina HiSeq	Phase_I	103	40	NM_004134	0	0	0	0	0	B2RCM1|P30036|P31932|Q1HB43|Q53H23|Q6GU03|Q9BWB7|Q9UC56	Frame_Shift_Del	DEL	ENST00000297185.3	37	CCDS4208.1																																																																																			.		0.403	HSPA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251285.1	NM_004134	
COL19A1	1310	broad.mit.edu	37	6	70866589	70866589	+	Frame_Shift_Del	DEL	G	G	-			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr6:70866589delG	ENST00000322773.4	+	34	2368	c.2266delG	c.(2266-2268)gggfs	p.G756fs	COL19A1_ENST00000393344.1_Frame_Shift_Del_p.G378fs	NM_001858.4	NP_001849.2	Q14993	COJA1_HUMAN	collagen, type XIX, alpha 1	756	Collagen-like 7.|Triple-helical region 4 (COL4).				cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)|skeletal muscle tissue development (GO:0007519)|skeletal system development (GO:0001501)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(8)|lung(54)|ovary(3)|prostate(2)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	109						GGGCTACCCTGGGATACCTGG	0.378																																					p.G756fs													.	COL19A1-156	0			c.2266delG						.						78.0	81.0	80.0					6																	70866589		2203	4300	6503	SO:0001589	frameshift_variant	1310	exon34			TACCCTGGGATAC		CCDS4970.1	6q12-q13	2013-01-16			ENSG00000082293	ENSG00000082293		"""Collagens"""	2196	protein-coding gene	gene with protein product		120165				7916703, 9143499	Standard	NM_001858		Approved		uc003pfc.1	Q14993	OTTHUMG00000014987	ENST00000322773.4:c.2266delG	6.37:g.70866589delG	ENSP00000316030:p.Gly756fs	Somatic	25	0		WXS	Illumina HiSeq	Phase_I	20	7	NM_001858	0	0	0	0	0	Q00559|Q05850|Q12885|Q13676|Q14DH1|Q5JUF0|Q5T424|Q9H572|Q9NPZ2|Q9NQP2	Frame_Shift_Del	DEL	ENST00000322773.4	37	CCDS4970.1																																																																																			.		0.378	COL19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041127.1		
FERD3L	222894	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	19184646	19184646	+	Frame_Shift_Del	DEL	T	T	-			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr7:19184646delT	ENST00000275461.3	-	1	398	c.340delA	c.(340-342)atgfs	p.M114fs	AC003986.5_ENST00000452700.1_RNA	NM_152898.2	NP_690862.1	Q96RJ6	FER3L_HUMAN	Fer3-like bHLH transcription factor	114	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				cell development (GO:0048468)|floor plate development (GO:0033504)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of neurogenesis (GO:0050767)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(4)|large_intestine(8)|lung(16)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	35						AGGTTGAACATCCGCTTCCTT	0.612																																					p.M114fs		.											.	FERD3L-153	0			c.340delA						.						103.0	83.0	90.0					7																	19184646		2203	4300	6503	SO:0001589	frameshift_variant	222894	exon1			.	AF369897	CCDS5368.1	7p21.3	2013-10-17	2013-10-17		ENSG00000146618	ENSG00000146618		"""Basic helix-loop-helix proteins"""	16660	protein-coding gene	gene with protein product			"""Fer3-like (Drosophila)"""			11472856, 12217327	Standard	NM_152898		Approved	NATO3, N-TWIST, bHLHa31	uc003suo.1	Q96RJ6	OTTHUMG00000090823	ENST00000275461.3:c.340delA	7.37:g.19184646delT	ENSP00000275461:p.Met114fs	Somatic	64	0		WXS	Illumina HiSeq	Phase_I	80	26	NM_152898	0	0	0	0	0	Q495K0	Frame_Shift_Del	DEL	ENST00000275461.3	37	CCDS5368.1																																																																																			.		0.612	FERD3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207627.1		
SEMA3D	223117	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	84636164	84636164	+	Frame_Shift_Del	DEL	G	G	-			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr7:84636164delG	ENST00000284136.6	-	16	1905	c.1862delC	c.(1861-1863)actfs	p.T621fs	SEMA3D_ENST00000484038.1_5'UTR	NM_152754.2	NP_689967.2	O95025	SEM3D_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D	621	Ig-like C2-type.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|membrane (GO:0016020)	receptor activity (GO:0004872)			NS(1)|breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(19)|lung(29)|ovary(3)|pancreas(1)|prostate(4)|skin(2)	73						CCATTTAATAGTTGCTTGTTG	0.388																																					p.T621fs	Ovarian(63;442 1191 17318 29975 31528)	.											.	SEMA3D-138	0			c.1862delC						.						214.0	198.0	203.0					7																	84636164		2203	4300	6503	SO:0001589	frameshift_variant	223117	exon16			.	BC029590	CCDS34676.1	7q21.11	2013-01-11			ENSG00000153993	ENSG00000153993		"""Semaphorins"", ""Immunoglobulin superfamily / V-set domain containing"""	10726	protein-coding gene	gene with protein product		609907					Standard	NM_152754		Approved	coll-2, Sema-Z2	uc003uic.3	O95025	OTTHUMG00000154569	ENST00000284136.6:c.1862delC	7.37:g.84636164delG	ENSP00000284136:p.Thr621fs	Somatic	276	0		WXS	Illumina HiSeq	Phase_I	441	305	NM_152754	0	0	0	0	0	A6NK46|Q6UW77|Q8NCQ1	Frame_Shift_Del	DEL	ENST00000284136.6	37	CCDS34676.1																																																																																			.		0.388	SEMA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336084.2	NM_152754	
NEIL2	252969	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	11637150	11637150	+	Frame_Shift_Del	DEL	A	A	-			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr8:11637150delA	ENST00000284503.6	+	3	781	c.182delA	c.(181-183)gaafs	p.E61fs	NEIL2_ENST00000436750.3_Frame_Shift_Del_p.E61fs|NEIL2_ENST00000403422.3_5'UTR|NEIL2_ENST00000528323.1_Intron|NEIL2_ENST00000455213.2_Frame_Shift_Del_p.E61fs	NM_145043.2	NP_659480.1	Q969S2	NEIL2_HUMAN	nei endonuclease VIII-like 2 (E. coli)	61					base-excision repair (GO:0006284)|nucleotide-excision repair (GO:0006289)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	damaged DNA binding (GO:0003684)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)	10	all_epithelial(15;0.103)		STAD - Stomach adenocarcinoma(15;0.00225)	COAD - Colon adenocarcinoma(149;0.166)		CTAGATGAAGAAATGGGGCCC	0.527								Base excision repair (BER), DNA glycosylases																													p.E61fs		.											.	NEIL2-659	0			c.182delA						.						59.0	75.0	70.0					8																	11637150		2203	4300	6503	SO:0001589	frameshift_variant	252969	exon3			.	AK056206	CCDS5984.1, CCDS47802.1, CCDS47803.1	8p23.1	2010-04-27	2010-04-27		ENSG00000154328	ENSG00000154328			18956	protein-coding gene	gene with protein product		608933	"""nei like 2 (E. coli)"""			12097317, 17686777	Standard	NM_145043		Approved	NEH2, FLJ31644, MGC2832, MGC4505	uc003wue.2	Q969S2	OTTHUMG00000090753	ENST00000284503.6:c.182delA	8.37:g.11637150delA	ENSP00000284503:p.Glu61fs	Somatic	183	0		WXS	Illumina HiSeq	Phase_I	190	91	NM_001135746	0	0	0	0	0	B4DFR7|Q7Z3Q7|Q8N842|Q8NG52	Frame_Shift_Del	DEL	ENST00000284503.6	37	CCDS5984.1																																																																																			.		0.527	NEIL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207583.3	NM_145043	
RAD54B	25788	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	95419720	95419720	+	Frame_Shift_Del	DEL	T	T	-			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr8:95419720delT	ENST00000336148.5	-	5	852	c.728delA	c.(727-729)aatfs	p.N243fs		NM_012415.3	NP_036547.1	Q9Y620	RA54B_HUMAN	RAD54 homolog B (S. cerevisiae)	243					ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|double-strand break repair via homologous recombination (GO:0000724)|mitotic recombination (GO:0006312)|reciprocal meiotic recombination (GO:0007131)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|RNA helicase activity (GO:0003724)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(10)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(36;4.5e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00217)			ATTCTGTCTATTTTCCTTTGA	0.353								Direct reversal of damage;Homologous recombination																													p.N243fs		.											.	RAD54B-539	0			c.728delA						.						79.0	78.0	79.0					8																	95419720		2203	4300	6503	SO:0001589	frameshift_variant	25788	exon5			.	AF112481	CCDS6262.1, CCDS56546.1, CCDS75768.1	8q22.1	2014-08-08			ENSG00000197275	ENSG00000197275			17228	protein-coding gene	gene with protein product		604289				10362364, 10851248	Standard	NM_012415		Approved	RDH54	uc003ygk.3	Q9Y620	OTTHUMG00000133658	ENST00000336148.5:c.728delA	8.37:g.95419720delT	ENSP00000336606:p.Asn243fs	Somatic	99	0		WXS	Illumina HiSeq	Phase_I	116	58	NM_012415	0	0	0	0	0	F6WBS8	Frame_Shift_Del	DEL	ENST00000336148.5	37	CCDS6262.1																																																																																			.		0.353	RAD54B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257806.3	NM_012415	
DLGAP5	9787	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	55655750	55655751	+	Frame_Shift_Ins	INS	-	-	AT			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr14:55655750_55655751insAT	ENST00000247191.2	-	2	363_364	c.147_148insAT	c.(145-150)gatgtafs	p.V50fs	DLGAP5_ENST00000395425.2_Frame_Shift_Ins_p.V50fs	NM_014750.4	NP_055565.3	Q15398	DLGP5_HUMAN	discs, large (Drosophila) homolog-associated protein 5	50					cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|dephosphorylation (GO:0016311)|mitotic chromosome movement towards spindle pole (GO:0007079)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|spindle pole centrosome (GO:0031616)	phosphoprotein phosphatase activity (GO:0004721)			biliary_tract(1)|breast(2)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	44						GGAATGTTTACATCTTTCAAAC	0.347																																					p.V50fs		.											.	DLGAP5-92	0			c.148_149insAT						.																																			SO:0001589	frameshift_variant	9787	exon2			.	D13633	CCDS9723.1, CCDS53897.1	14q22.3	2008-05-30	2008-05-30	2008-05-30	ENSG00000126787	ENSG00000126787			16864	protein-coding gene	gene with protein product			"""discs, large homolog 7 (Drosophila)"""	DLG7		7584026, 7584028	Standard	NM_014750		Approved	KIAA0008, DLG1, HURP	uc001xbs.3	Q15398	OTTHUMG00000140310	ENST00000247191.2:c.146_147dupAT	14.37:g.55655751_55655752dupAT	ENSP00000247191:p.Val50fs	Somatic	58	0		WXS	Illumina HiSeq	Phase_I	43	28	NM_001146015	0	0	0	0	0	A8MTM6|B4DRM8|Q86T11|Q8NG58	Frame_Shift_Ins	INS	ENST00000247191.2	37	CCDS9723.1																																																																																			.		0.347	DLGAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276908.2	NM_014750	
TTC3	7267	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	21	38568034	38568035	+	Frame_Shift_Ins	INS	-	-	T			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr21:38568034_38568035insT	ENST00000399017.2	+	42	8023_8024	c.5276_5277insT	c.(5275-5280)tctgcafs	p.A1760fs	TTC3_ENST00000479930.1_3'UTR|TTC3-AS1_ENST00000424733.1_RNA|TTC3_ENST00000355666.1_Frame_Shift_Ins_p.A1760fs|TTC3_ENST00000354749.2_Frame_Shift_Ins_p.A1760fs	NM_003316.3	NP_003307.3	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3	1760					negative regulation of cell morphogenesis involved in differentiation (GO:0010771)|negative regulation of neuron differentiation (GO:0045665)|protein K48-linked ubiquitination (GO:0070936)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|vacuole (GO:0005773)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(5)|endometrium(7)|kidney(5)|large_intestine(17)|liver(1)|lung(18)|ovary(4)|prostate(2)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(5)	75		Myeloproliferative disorder(46;0.0412)				CTTGTGACTTCTGCAAGCGACG	0.569																																					p.S1759fs	Ovarian(38;194 1649 35661)	.											.	TTC3-590	0			c.5276_5277insT						.																																			SO:0001589	frameshift_variant	7267	exon42			.	D84296	CCDS13651.1	21q22.2	2013-01-11			ENSG00000182670	ENSG00000182670		"""RING-type (C3HC4) zinc fingers"", ""Tetratricopeptide (TTC) repeat domain containing"""	12393	protein-coding gene	gene with protein product		602259				8947847	Standard	NM_003316		Approved	TPRD, TPRDI, DCRR1, TPRDII, TPRDIII, RNF105	uc002yvz.3	P53804	OTTHUMG00000086654	ENST00000399017.2:c.5277dupT	21.37:g.38568035_38568035dupT	ENSP00000381981:p.Ala1760fs	Somatic	340	0		WXS	Illumina HiSeq	Phase_I	305	129	NM_003316	0	0	0	0	0	A8K7H7|B2RPA7|D3DSG9|D3DSH2|D3DSH3|O60767|P78476|P78477|Q569I2|Q6P578|Q9UEK4	Frame_Shift_Ins	INS	ENST00000399017.2	37	CCDS13651.1																																																																																			.		0.569	TTC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194776.1		
MOCS2	4338	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	52397195	52397196	+	Frame_Shift_Ins	INS	-	-	T			TCGA-GL-8500-01A-11D-2396-08	TCGA-GL-8500-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41177191-296c-48e7-945d-6b382e01efef	c4639d70-5aff-4a23-b1bd-33ce71bff272	g.chr5:52397195_52397196insT	ENST00000396954.3	-	5	1047_1048	c.370_371insA	c.(370-372)agafs	p.R124fs	MOCS2_ENST00000510818.2_3'UTR|MOCS2_ENST00000508922.1_3'UTR|MOCS2_ENST00000361377.4_Intron|MOCS2_ENST00000584946.1_3'UTR|MOCS2_ENST00000450852.3_3'UTR|MOCS2_ENST00000582677.1_Intron|MOCS2_ENST00000527216.1_3'UTR	NM_004531.3	NP_004522.1			molybdenum cofactor synthesis 2											endometrium(1)|lung(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	5		Lung NSC(810;3.08e-05)|Breast(144;0.0848)				ATACCCAAGTCTATGGAACACT	0.342																																					p.R124fs		.											.	MOCS2-90	0			c.371_372insA						.																																			SO:0001589	frameshift_variant	4338	exon5			.	AF117815	CCDS3958.1, CCDS47205.1	5q11	2008-02-05			ENSG00000164172	ENSG00000164172			7193	protein-coding gene	gene with protein product		603708				10053004, 9889283	Standard	NM_004531		Approved	MOCO1	uc003joz.3	O96007	OTTHUMG00000096981	ENST00000396954.3:c.371dupA	5.37:g.52397196_52397196dupT	ENSP00000380157:p.Arg124fs	Somatic	175	0		WXS	Illumina HiSeq	Phase_I	175	83	NM_004531	0	0	0	0	0		Frame_Shift_Ins	INS	ENST00000396954.3	37	CCDS3958.1																																																																																			.		0.342	MOCS2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000214053.3	NM_183418	
