#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PLCH2	9651	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	2418423	2418423	+	Silent	SNP	G	G	A			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr1:2418423G>A	ENST00000419816.2	+	6	1168	c.894G>A	c.(892-894)ggG>ggA	p.G298G	PLCH2_ENST00000449969.1_Silent_p.G271G|PLCH2_ENST00000378486.3_Silent_p.G298G|PLCH2_ENST00000288766.5_Intron|PLCH2_ENST00000378488.3_Silent_p.G298G			O75038	PLCH2_HUMAN	phospholipase C, eta 2	298					inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phosphatidylinositol metabolic process (GO:0046488)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			central_nervous_system(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(3)|skin(1)	20	all_cancers(77;0.000161)|all_epithelial(69;5.98e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;7.32e-16)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.00832)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.44e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.78e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;4.19e-05)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00034)|BRCA - Breast invasive adenocarcinoma(365;0.00443)|KIRC - Kidney renal clear cell carcinoma(229;0.00548)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.2)		AGAGTAAGGGGCTGCTGGGCA	0.632																																					p.G298G		.											.	PLCH2-229	0			c.G894A						.						55.0	59.0	57.0					1																	2418423		2096	4214	6310	SO:0001819	synonymous_variant	9651	exon6			TAAGGGGCTGCTG	AB007919	CCDS59959.1	1p36.32	2013-01-10	2006-03-16	2006-03-16	ENSG00000149527	ENSG00000149527	3.1.4.11	"""EF-hand domain containing"""	29037	protein-coding gene	gene with protein product		612836	"""phospholipase C-like 4"""	PLCL4		15899900	Standard	XM_006711054		Approved	KIAA0450, PLCeta2, RP3-395M20.1, PLC-eta2	uc001aji.1	O75038	OTTHUMG00000000719	ENST00000419816.2:c.894G>A	1.37:g.2418423G>A		Somatic	52	0		WXS	Illumina HiSeq	Phase_I	45	10	NM_014638	0	0	0	0	0	A2VCM3|B9DI80|Q3LUA8|Q86XJ2|Q86XU1|Q86YU7|Q8TEH5|Q8WUS6	Silent	SNP	ENST00000419816.2	37																																																																																				.		0.632	PLCH2-009	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000467514.1	NM_014638	
PER3	8863	broad.mit.edu	37	1	7854051	7854051	+	Silent	SNP	T	T	C			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr1:7854051T>C	ENST00000361923.2	+	5	799	c.624T>C	c.(622-624)ccT>ccC	p.P208P	PER3_ENST00000377541.1_Silent_p.P208P|PER3_ENST00000377532.3_Silent_p.P209P	NM_016831.1	NP_058515.1	P56645	PER3_HUMAN	period circadian clock 3	208					circadian regulation of gene expression (GO:0032922)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(4)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	39	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)		CGGTGAAACCTTTTTTCTGCA	0.443																																					p.P208P													.	PER3-93	0			c.T624C						.						147.0	143.0	144.0					1																	7854051		2203	4300	6503	SO:0001819	synonymous_variant	8863	exon5			GAAACCTTTTTTC	BC026102	CCDS89.1, CCDS72695.1	1p36.23	2012-12-13	2012-12-13		ENSG00000049246	ENSG00000049246			8847	protein-coding gene	gene with protein product		603427	"""period (Drosophila) homolog 3"", ""period homolog 3 (Drosophila)"""			9427249	Standard	XM_005263520		Approved		uc001aoo.3	P56645	OTTHUMG00000001216	ENST00000361923.2:c.624T>C	1.37:g.7854051T>C		Somatic	95	0		WXS	Illumina HiSeq	Phase_I	80	4	NM_016831	0	0	0	0	0	Q5H8X4|Q5H8X5|Q969K6|Q96S77|Q96S78|Q9C0J3|Q9NSP9|Q9UGU8	Silent	SNP	ENST00000361923.2	37	CCDS89.1																																																																																			.		0.443	PER3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000003607.1	NM_016831	
CASZ1	54897	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	10713663	10713663	+	Silent	SNP	G	G	A			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr1:10713663G>A	ENST00000377022.3	-	11	2768	c.2451C>T	c.(2449-2451)acC>acT	p.T817T	CASZ1_ENST00000344008.5_Silent_p.T817T|RP4-734G22.3_ENST00000606802.1_RNA	NM_001079843.2	NP_001073312.1	Q86V15	CASZ1_HUMAN	castor zinc finger 1	817					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|large_intestine(13)|lung(18)|ovary(2)|prostate(5)|skin(2)|urinary_tract(1)	54	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		GGAGGCTGGGGGTGCCCACAG	0.716																																					p.T817T													.	CASZ1-113	0			c.C2451T						.						13.0	18.0	16.0					1																	10713663		2187	4276	6463	SO:0001819	synonymous_variant	54897	exon11			GCTGGGGGTGCCC	AK000328	CCDS120.2, CCDS41246.1	1p36.22	2013-01-07	2007-02-02		ENSG00000130940	ENSG00000130940		"""Zinc fingers, C2H2-type"""	26002	protein-coding gene	gene with protein product	"""zinc finger protein 693"", ""survival related gene"""	609895	"""castor homolog 1, zinc finger (Drosophila)"""			16631614, 21252912	Standard	NM_001079843		Approved	FLJ20321, ZNF693, castor, cst, SRG	uc001aro.4	Q86V15	OTTHUMG00000002035	ENST00000377022.3:c.2451C>T	1.37:g.10713663G>A		Somatic	84	1		WXS	Illumina HiSeq	Phase_I	103	40	NM_001079843	0	0	1	4	3	Q078S9|Q2EN02|Q5T9S1|Q6ZNM8|Q8WX49|Q8WX50|Q9BT16|Q9NXC6	Silent	SNP	ENST00000377022.3	37	CCDS41246.1																																																																																			.		0.716	CASZ1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005673.2	NM_017766	
CASZ1	54897	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	10714628	10714628	+	Silent	SNP	G	G	A			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr1:10714628G>A	ENST00000377022.3	-	10	2003	c.1686C>T	c.(1684-1686)taC>taT	p.Y562Y	CASZ1_ENST00000344008.5_Silent_p.Y562Y|RP4-734G22.3_ENST00000606802.1_RNA	NM_001079843.2	NP_001073312.1	Q86V15	CASZ1_HUMAN	castor zinc finger 1	562					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|large_intestine(13)|lung(18)|ovary(2)|prostate(5)|skin(2)|urinary_tract(1)	54	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		ACGTGCTCGTGTACACCTTGT	0.597																																					p.Y562Y		.											.	CASZ1-113	0			c.C1686T						.						210.0	193.0	199.0					1																	10714628		2203	4300	6503	SO:0001819	synonymous_variant	54897	exon10			GCTCGTGTACACC	AK000328	CCDS120.2, CCDS41246.1	1p36.22	2013-01-07	2007-02-02		ENSG00000130940	ENSG00000130940		"""Zinc fingers, C2H2-type"""	26002	protein-coding gene	gene with protein product	"""zinc finger protein 693"", ""survival related gene"""	609895	"""castor homolog 1, zinc finger (Drosophila)"""			16631614, 21252912	Standard	NM_001079843		Approved	FLJ20321, ZNF693, castor, cst, SRG	uc001aro.4	Q86V15	OTTHUMG00000002035	ENST00000377022.3:c.1686C>T	1.37:g.10714628G>A		Somatic	158	0		WXS	Illumina HiSeq	Phase_I	165	52	NM_001079843	0	0	2	2	0	Q078S9|Q2EN02|Q5T9S1|Q6ZNM8|Q8WX49|Q8WX50|Q9BT16|Q9NXC6	Silent	SNP	ENST00000377022.3	37	CCDS41246.1																																																																																			.		0.597	CASZ1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005673.2	NM_017766	
KDM1A	23028	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	23380289	23380289	+	Silent	SNP	G	G	A			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr1:23380289G>A	ENST00000356634.3	+	4	836	c.687G>A	c.(685-687)ctG>ctA	p.L229L	KDM1A_ENST00000400181.4_Silent_p.L249L|RP1-184J9.2_ENST00000427154.1_RNA|KDM1A_ENST00000542151.1_Silent_p.L249L	NM_015013.3	NP_055828.2	O60341	KDM1A_HUMAN	lysine (K)-specific demethylase 1A	229	SWIRM. {ECO:0000255|PROSITE- ProRule:PRU00247}.				blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|granulocyte differentiation (GO:0030851)|histone H3-K4 demethylation (GO:0034720)|histone H3-K9 demethylation (GO:0033169)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of DNA binding (GO:0043392)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of protein binding (GO:0032091)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pituitary gland development (GO:0021983)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of hormone biosynthetic process (GO:0046886)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein demethylation (GO:0006482)|regulation of primitive erythrocyte differentiation (GO:0010725)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|demethylase activity (GO:0032451)|enzyme binding (GO:0019899)|flavin adenine dinucleotide binding (GO:0050660)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-K4 specific) (GO:0032453)|histone demethylase activity (H3-K9 specific) (GO:0032454)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|MRF binding (GO:0043426)|oxidoreductase activity (GO:0016491)|p53 binding (GO:0002039)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(2)|endometrium(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23						AGATTCAGCTGACATTTGAGG	0.323																																					p.L249L		.											.	KDM1A-206	0			c.G747A						.						92.0	84.0	87.0					1																	23380289		2203	4300	6503	SO:0001819	synonymous_variant	23028	exon5			TCAGCTGACATTT	AL031428	CCDS30627.1, CCDS53278.1	1p36.12	2011-07-01	2009-09-29	2009-09-29	ENSG00000004487	ENSG00000004487		"""Chromatin-modifying enzymes / K-demethylases"""	29079	protein-coding gene	gene with protein product		609132	"""amine oxidase (flavin containing) domain 2"", ""lysine (K)-specific demethylase 1"""	AOF2, KDM1		9628581, 12493763	Standard	NM_015013		Approved	KIAA0601, BHC110, LSD1	uc001bgj.2	O60341	OTTHUMG00000003220	ENST00000356634.3:c.687G>A	1.37:g.23380289G>A		Somatic	314	1		WXS	Illumina HiSeq	Phase_I	133	47	NM_001009999	0	0	3	6	3	A8MWP9|Q5TH94|Q5TH95|Q86VT7|Q8IXK4|Q8NDP6|Q8TAZ3|Q96AW4	Silent	SNP	ENST00000356634.3	37	CCDS30627.1																																																																																			.		0.323	KDM1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000008880.3	NM_015013	
TESK2	10420	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	45812448	45812448	+	Missense_Mutation	SNP	A	A	T			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr1:45812448A>T	ENST00000372086.3	-	9	1196	c.796T>A	c.(796-798)Ttc>Atc	p.F266I	TESK2_ENST00000538496.1_Missense_Mutation_p.F183I|TESK2_ENST00000341771.6_Intron|TESK2_ENST00000372084.1_Intron|TESK2_ENST00000486676.1_5'UTR	NM_007170.2	NP_009101.2	Q96S53	TESK2_HUMAN	testis-specific kinase 2	266	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|focal adhesion assembly (GO:0048041)|protein phosphorylation (GO:0006468)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(1)|lung(9)|ovary(2)|pancreas(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	32	Acute lymphoblastic leukemia(166;0.155)					TCCAGCCCGAAATTCTGTGGA	0.502																																					p.F266I		.											.	TESK2-624	0			c.T796A						.						79.0	82.0	81.0					1																	45812448		1949	4153	6102	SO:0001583	missense	10420	exon9			GCCCGAAATTCTG	AJ132545	CCDS41323.1	1p32	2010-04-27			ENSG00000070759	ENSG00000070759	2.7.12.1		11732	protein-coding gene	gene with protein product		604746				10512679	Standard	NM_007170		Approved		uc001cns.1	Q96S53	OTTHUMG00000007680	ENST00000372086.3:c.796T>A	1.37:g.45812448A>T	ENSP00000361158:p.Phe266Ile	Somatic	107	0		WXS	Illumina HiSeq	Phase_I	116	47	NM_007170	0	0	0	0	0	Q5T422|Q5T423|Q8N520|Q9Y3Q6	Missense_Mutation	SNP	ENST00000372086.3	37	CCDS41323.1	.	.	.	.	.	.	.	.	.	.	A	34	5.297190	0.95574	.	.	ENSG00000070759	ENST00000372086;ENST00000372083;ENST00000538496	D;D	0.81579	-1.51;-1.51	6.08	6.08	0.98989	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000002	D	0.86573	0.5965	L	0.42581	1.335	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.87288	0.2297	10	0.62326	D	0.03	-8.8357	16.6438	0.85155	1.0:0.0:0.0:0.0	.	266	Q96S53	TESK2_HUMAN	I	266;250;183	ENSP00000361158:F266I;ENSP00000441746:F183I	ENSP00000361155:F250I	F	-	1	0	TESK2	45585035	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	9.317000	0.96327	2.333000	0.79357	0.533000	0.62120	TTC	.		0.502	TESK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020523.1	NM_007170	
IPP	3652	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	46206860	46206860	+	Missense_Mutation	SNP	G	G	A			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr1:46206860G>A	ENST00000396478.3	-	3	539	c.437C>T	c.(436-438)tCt>tTt	p.S146F		NM_005897.2	NP_005888.1	Q9Y573	IPP_HUMAN	intracisternal A particle-promoted polypeptide	146						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	actin binding (GO:0003779)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(5)|ovary(1)|stomach(2)	20	Acute lymphoblastic leukemia(166;0.155)					AATTTGCTCAGAGAACTGAAA	0.413																																					p.S146F													.	IPP-91	0			c.C437T						.						85.0	84.0	84.0					1																	46206860		2203	4300	6503	SO:0001583	missense	3652	exon3			TGCTCAGAGAACT	BC032544	CCDS30702.1, CCDS44132.1	1p34-p32	2013-01-30			ENSG00000197429	ENSG00000197429		"""Kelch-like"", ""BTB/POZ domain containing"""	6108	protein-coding gene	gene with protein product	"""kelch-like family member 27"""	147485				1905535, 8432546	Standard	NM_005897		Approved	KLHL27	uc001cou.3	Q9Y573	OTTHUMG00000008004	ENST00000396478.3:c.437C>T	1.37:g.46206860G>A	ENSP00000379739:p.Ser146Phe	Somatic	172	1		WXS	Illumina HiSeq	Phase_I	126	39	NM_001145349	0	0	1	2	1	A2A6V4|D3DQ11|Q8N5C3	Missense_Mutation	SNP	ENST00000396478.3	37	CCDS30702.1	.	.	.	.	.	.	.	.	.	.	G	15.45	2.838259	0.51057	.	.	ENSG00000197429	ENST00000359942;ENST00000396478	T;T	0.71461	-0.57;-0.57	5.19	4.21	0.49690	BTB/Kelch-associated (2);	0.352326	0.31949	N	0.006810	T	0.72875	0.3515	M	0.64997	1.995	0.40491	D	0.980549	P;P	0.44877	0.544;0.845	P;P	0.46110	0.467;0.504	T	0.78966	-0.1995	10	0.87932	D	0	.	15.4999	0.75691	0.0:0.1387:0.8613:0.0	.	146;146	Q9Y573;A2A6V3	IPP_HUMAN;.	F	146	ENSP00000353024:S146F;ENSP00000379739:S146F	ENSP00000353024:S146F	S	-	2	0	IPP	45979447	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.054000	0.64275	2.586000	0.87340	0.655000	0.94253	TCT	.		0.413	IPP-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021974.3	NM_005897	
MCOLN3	55283	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	85506767	85506767	+	Missense_Mutation	SNP	C	C	G			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr1:85506767C>G	ENST00000370589.2	-	3	374	c.322G>C	c.(322-324)Gac>Cac	p.D108H	MCOLN3_ENST00000370587.1_Missense_Mutation_p.D108H|MCOLN3_ENST00000341115.4_Intron|WDR63_ENST00000370596.1_Intron	NM_018298.10	NP_060768.8	Q8TDD5	MCLN3_HUMAN	mucolipin 3	108					auditory receptor cell differentiation (GO:0042491)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|locomotory behavior (GO:0007626)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(6)|kidney(3)|large_intestine(9)|lung(12)|prostate(3)|skin(1)	34				all cancers(265;0.00957)|Epithelial(280;0.0254)		TCCATTCGGTCCATATATCCT	0.378																																					p.D108H		.											.	MCOLN3-91	0			c.G322C						.						235.0	209.0	217.0					1																	85506767		2203	4300	6503	SO:0001583	missense	55283	exon3			TTCGGTCCATATA	AF475085	CCDS701.1, CCDS58009.1	1p22.3	2011-12-16			ENSG00000055732	ENSG00000055732		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	13358	protein-coding gene	gene with protein product		607400				16382100	Standard	NM_018298		Approved	TRPML3, FLJ11006, TRP-ML3	uc001dkp.3	Q8TDD5	OTTHUMG00000009955	ENST00000370589.2:c.322G>C	1.37:g.85506767C>G	ENSP00000359621:p.Asp108His	Somatic	213	0		WXS	Illumina HiSeq	Phase_I	125	44	NM_018298	0	0	0	0	0	Q5T4H5|Q5T4H6|Q9NV09	Missense_Mutation	SNP	ENST00000370589.2	37	CCDS701.1	.	.	.	.	.	.	.	.	.	.	C	18.86	3.712652	0.68730	.	.	ENSG00000055732	ENST00000370589;ENST00000302814;ENST00000370587	T;T	0.62364	0.03;0.03	5.76	5.76	0.90799	.	0.048278	0.85682	D	0.000000	T	0.77239	0.4101	M	0.77820	2.39	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.69824	0.966;0.965	T	0.77608	-0.2524	10	0.56958	D	0.05	-2.0809	19.9857	0.97347	0.0:1.0:0.0:0.0	.	108;108	B1ANB7;Q8TDD5	.;MCLN3_HUMAN	H	108	ENSP00000359621:D108H;ENSP00000359619:D108H	ENSP00000304843:D108H	D	-	1	0	MCOLN3	85279355	1.000000	0.71417	0.506000	0.27664	0.660000	0.38997	5.767000	0.68850	2.706000	0.92434	0.655000	0.94253	GAC	.		0.378	MCOLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027569.2	NM_018298	
TRIM45	80263	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	117660955	117660955	+	Missense_Mutation	SNP	T	T	G			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr1:117660955T>G	ENST00000256649.4	-	2	1449	c.923A>C	c.(922-924)aAt>aCt	p.N308T	TRIM45_ENST00000369464.3_Missense_Mutation_p.N308T|TRIM45_ENST00000369461.3_Missense_Mutation_p.N251T	NM_025188.3	NP_079464.2	Q9H8W5	TRI45_HUMAN	tripartite motif containing 45	308					bone development (GO:0060348)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(9)|prostate(1)	23	Lung SC(450;0.225)	all_cancers(81;0.000979)|all_lung(203;7.65e-05)|all_epithelial(167;0.000134)|Lung NSC(69;0.000389)		Lung(183;0.0537)|Colorectal(144;0.172)|LUSC - Lung squamous cell carcinoma(189;0.187)		CTGCAGGGAATTTTCCTTCTG	0.567																																					p.N308T		.											.	TRIM45-226	0			c.A923C						.						76.0	74.0	74.0					1																	117660955		2203	4300	6503	SO:0001583	missense	80263	exon2			AGGGAATTTTCCT		CCDS893.1, CCDS44200.1	1p13.1	2011-04-20	2011-01-25		ENSG00000134253	ENSG00000134253		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19018	protein-coding gene	gene with protein product		609318	"""tripartite motif-containing 45"""			15351693	Standard	NM_025188		Approved	FLJ13181, RNF99	uc001egz.2	Q9H8W5	OTTHUMG00000012119	ENST00000256649.4:c.923A>C	1.37:g.117660955T>G	ENSP00000256649:p.Asn308Thr	Somatic	101	0		WXS	Illumina HiSeq	Phase_I	99	33	NM_001145635	0	0	1	1	0	Q53GN0|Q5T2K4|Q5T2K5|Q8IYV6	Missense_Mutation	SNP	ENST00000256649.4	37	CCDS893.1	.	.	.	.	.	.	.	.	.	.	T	10.44	1.352209	0.24512	.	.	ENSG00000134253	ENST00000256649;ENST00000369464;ENST00000369461	D;D;D	0.85629	-2.01;-2.01;-2.01	5.11	3.96	0.45880	.	0.242716	0.47852	N	0.000216	T	0.66557	0.2801	L	0.35723	1.085	0.44254	D	0.997108	B;B	0.16802	0.019;0.011	B;B	0.15870	0.014;0.006	T	0.63594	-0.6602	10	0.37606	T	0.19	-26.5032	11.6751	0.51425	0.0:0.0:0.1477:0.8522	.	308;308	Q9H8W5-2;Q9H8W5	.;TRI45_HUMAN	T	308;308;251	ENSP00000256649:N308T;ENSP00000358476:N308T;ENSP00000358473:N251T	ENSP00000256649:N308T	N	-	2	0	TRIM45	117462478	1.000000	0.71417	0.823000	0.32752	0.520000	0.34377	2.680000	0.46918	0.932000	0.37266	0.533000	0.62120	AAT	.		0.567	TRIM45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033503.1	NM_025188	
ABL2	27	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	179076969	179076969	+	Missense_Mutation	SNP	G	G	T			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr1:179076969G>T	ENST00000502732.1	-	12	3636	c.3433C>A	c.(3433-3435)Ctc>Atc	p.L1145I	ABL2_ENST00000344730.3_Missense_Mutation_p.L1027I|ABL2_ENST00000408940.3_Missense_Mutation_p.L1109I|ABL2_ENST00000367623.4_Missense_Mutation_p.L1124I|ABL2_ENST00000511413.1_Missense_Mutation_p.L1042I|ABL2_ENST00000507173.1_Missense_Mutation_p.L1021I|ABL2_ENST00000504405.1_Missense_Mutation_p.L1006I|ABL2_ENST00000512653.1_Missense_Mutation_p.L1130I	NM_001168236.1|NM_001168237.1|NM_001168238.1|NM_007314.3	NP_001161708.1|NP_001161709.1|NP_001161710.1|NP_009298.1	P42684	ABL2_HUMAN	ABL proto-oncogene 2, non-receptor tyrosine kinase	1145	F-actin-binding. {ECO:0000250}.				actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular protein modification process (GO:0006464)|cellular response to retinoic acid (GO:0071300)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of neuron projection development (GO:0010976)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of phospholipase C activity (GO:0010863)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of autophagy (GO:0010506)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)			breast(8)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	65					Adenosine triphosphate(DB00171)|Dasatinib(DB01254)	TGCAGGCTGAGTTCCAGTTTG	0.507			T	ETV6	AML																																p.L1145I				Dom	yes		1	1q24-q25	27	v-abl Abelson murine leukemia viral oncogene homolog 2		L	.	ABL2-1081	0			c.C3433A						.						71.0	72.0	71.0					1																	179076969		2203	4300	6503	SO:0001583	missense	27	exon12			GGCTGAGTTCCAG	M14904	CCDS30947.1, CCDS41441.1, CCDS44282.1, CCDS44283.1, CCDS41441.2, CCDS53435.1, CCDS53436.1, CCDS53437.1, CCDS53438.1	1q25.2	2014-06-26	2014-06-26		ENSG00000143322	ENSG00000143322		"""SH2 domain containing"""	77	protein-coding gene	gene with protein product	"""Abelson-related gene"""	164690	"""v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene)"", ""v-abl Abelson murine leukemia viral oncogene homolog 2"", ""c-abl oncogene 2, non-receptor tyrosine kinase"""	ABLL		3787260	Standard	NM_001136001		Approved	ARG	uc001gmi.4	P42684	OTTHUMG00000035199	ENST00000502732.1:c.3433C>A	1.37:g.179076969G>T	ENSP00000427562:p.Leu1145Ile	Somatic	118	1		WXS	Illumina HiSeq	Phase_I	126	39	NM_007314	0	0	2	6	4	A0M8X0|B7UEF2|B7UEF3|B7UEF4|B7UEF5|Q5T0X6|Q5W0C5|Q6NZY6|Q7Z301	Missense_Mutation	SNP	ENST00000502732.1	37	CCDS30947.1	.	.	.	.	.	.	.	.	.	.	G	12.16	1.854385	0.32791	.	.	ENSG00000143322	ENST00000502732;ENST00000408940;ENST00000344730;ENST00000512653;ENST00000504405;ENST00000367623;ENST00000507173;ENST00000511413	T;T;T;T;T;T;T;T	0.30182	1.54;1.54;1.54;1.54;1.54;1.54;1.54;1.54	5.65	4.72	0.59763	F-actin binding (2);	0.142456	0.32068	N	0.006637	T	0.42877	0.1222	L	0.43152	1.355	0.37518	D	0.917409	D;B;B;D;D;D;D;B	0.76494	0.999;0.003;0.001;0.99;0.999;0.999;0.999;0.005	D;B;B;D;D;D;D;B	0.83275	0.993;0.004;0.004;0.979;0.996;0.993;0.996;0.006	T	0.38090	-0.9677	10	0.20046	T	0.44	.	10.5331	0.44988	0.0:0.1448:0.7048:0.1504	.	1124;1021;1042;1006;1145;1130;1109;1027	P42684-6;P42684-7;P42684-5;P42684-4;P42684;P42684-3;D1MPS6;P42684-10	.;.;.;.;ABL2_HUMAN;.;.;.	I	1145;1109;1027;1130;1006;1124;1021;1042	ENSP00000427562:L1145I;ENSP00000386152:L1109I;ENSP00000339209:L1027I;ENSP00000423578:L1130I;ENSP00000426831:L1006I;ENSP00000356595:L1124I;ENSP00000423413:L1021I;ENSP00000424697:L1042I	ENSP00000339209:L1027I	L	-	1	0	ABL2	177343592	0.997000	0.39634	0.993000	0.49108	0.835000	0.47333	2.092000	0.41700	1.326000	0.45319	0.655000	0.94253	CTC	.		0.507	ABL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085174.3	NM_005158	
ZNF281	23528	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	200378264	200378264	+	Silent	SNP	C	C	T			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr1:200378264C>T	ENST00000294740.3	-	2	694	c.570G>A	c.(568-570)caG>caA	p.Q190Q	ZNF281_ENST00000367353.1_Silent_p.Q190Q|ZNF281_ENST00000367352.3_Silent_p.Q154Q	NM_001281293.1|NM_001281294.1|NM_012482.4	NP_001268222.1|NP_001268223.1|NP_036614.1	Q9Y2X9	ZN281_HUMAN	zinc finger protein 281	190					embryonic body morphogenesis (GO:0010172)|negative regulation of gene expression (GO:0010629)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|stem cell differentiation (GO:0048863)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	core promoter binding (GO:0001047)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			breast(4)|endometrium(3)|kidney(3)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	27						CACGGTGGTGCTGGGCTGGTT	0.562																																					p.Q190Q		.											.	ZNF281-154	0			c.G570A						.						101.0	97.0	98.0					1																	200378264		2203	4300	6503	SO:0001819	synonymous_variant	23528	exon2			GTGGTGCTGGGCT	AF125158	CCDS1402.1, CCDS60384.1	1q32.1	2012-08-08			ENSG00000162702	ENSG00000162702		"""Zinc fingers, C2H2-type"""	13075	protein-coding gene	gene with protein product						10448078	Standard	NM_012482		Approved	ZBP-99	uc001gve.3	Q9Y2X9	OTTHUMG00000035724	ENST00000294740.3:c.570G>A	1.37:g.200378264C>T		Somatic	78	0		WXS	Illumina HiSeq	Phase_I	87	35	NM_012482	0	0	0	0	0	A6NF48|B3KMX2|Q5RKW5|Q9NY92	Silent	SNP	ENST00000294740.3	37	CCDS1402.1																																																																																			.		0.562	ZNF281-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086879.2	NM_012482	
LBR	3930	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	225600280	225600280	+	Missense_Mutation	SNP	A	A	C			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr1:225600280A>C	ENST00000338179.2	-	8	1085	c.960T>G	c.(958-960)caT>caG	p.H320Q	AC092811.1_ENST00000366845.2_5'Flank|LBR_ENST00000272163.4_Missense_Mutation_p.H320Q	NM_194442.2	NP_919424.1	Q14739	LBR_HUMAN	lamin B receptor	320					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|integral component of nuclear inner membrane (GO:0005639)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|lamin binding (GO:0005521)|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor (GO:0016628)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22	Breast(184;0.165)			GBM - Glioblastoma multiforme(131;0.117)		TGTACACGTAATGAAACTCTA	0.413																																					p.H320Q		.											.	LBR-228	0			c.T960G						.						79.0	80.0	80.0					1																	225600280		2203	4300	6503	SO:0001583	missense	3930	exon8			CACGTAATGAAAC	L25931	CCDS1545.1	1q42.1	2013-01-23			ENSG00000143815	ENSG00000143815		"""Tudor domain containing"""	6518	protein-coding gene	gene with protein product	"""tudor domain containing 18"""	600024				8157663, 9878250	Standard	NM_194442		Approved	DHCR14B, TDRD18	uc001hoy.3	Q14739	OTTHUMG00000037520	ENST00000338179.2:c.960T>G	1.37:g.225600280A>C	ENSP00000339883:p.His320Gln	Somatic	540	1		WXS	Illumina HiSeq	Phase_I	407	97	NM_194442	0	0	1	2	1	B2R5P3|Q14740|Q53GU7|Q59FE6	Missense_Mutation	SNP	ENST00000338179.2	37	CCDS1545.1	.	.	.	.	.	.	.	.	.	.	A	10.74	1.434732	0.25813	.	.	ENSG00000143815	ENST00000272163;ENST00000338179	D;D	0.97811	-4.55;-4.55	6.07	-0.357	0.12579	.	1.680490	0.02408	N	0.081343	D	0.92440	0.7600	N	0.04203	-0.255	0.09310	N	1	B	0.23128	0.08	B	0.18263	0.021	D	0.86742	0.1955	10	0.29301	T	0.29	3.4658	9.9056	0.41375	0.6743:0.0:0.3257:0.0	.	320	Q14739	LBR_HUMAN	Q	320	ENSP00000272163:H320Q;ENSP00000339883:H320Q	ENSP00000272163:H320Q	H	-	3	2	LBR	223666903	0.080000	0.21391	0.000000	0.03702	0.029000	0.11900	0.526000	0.22971	-0.299000	0.08909	0.533000	0.62120	CAT	.		0.413	LBR-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091398.1	NM_002296	
PROSER2	254427	broad.mit.edu;bcgsc.ca	37	10	11911626	11911626	+	Missense_Mutation	SNP	G	G	C			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr10:11911626G>C	ENST00000277570.5	+	4	683	c.529G>C	c.(529-531)Gcc>Ccc	p.A177P	PROSER2-AS1_ENST00000445498.1_RNA|PROSER2-AS1_ENST00000453242.1_RNA|PROSER2_ENST00000379200.1_5'Flank	NM_153256.3	NP_694988.3	Q86WR7	PRSR2_HUMAN	proline and serine rich 2	177	Pro-rich.																GGAGCTGCGCGCCCCCTCCCC	0.692																																					p.A177P													.	.	0			c.G529C						.						11.0	13.0	12.0					10																	11911626		2186	4290	6476	SO:0001583	missense	254427	exon4			CTGCGCGCCCCCT	BC017269	CCDS7085.1	10p14	2014-02-19	2014-02-19	2012-12-05	ENSG00000148426	ENSG00000148426			23728	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 47"", ""proline and serine-rich protein 2"""	C10orf47		12477932	Standard	NM_153256		Approved	MGC35403	uc001ikx.3	Q86WR7	OTTHUMG00000017673	ENST00000277570.5:c.529G>C	10.37:g.11911626G>C	ENSP00000277570:p.Ala177Pro	Somatic	149	15		WXS	Illumina HiSeq	Phase_I	145	56	NM_153256	0	0	4	8	4	D3DRR8|Q5W0J9|Q5W0K0|Q5W0K1|Q5W0K2|Q6PJC8|Q8N317	Missense_Mutation	SNP	ENST00000277570.5	37	CCDS7085.1	.	.	.	.	.	.	.	.	.	.	G	3.538	-0.094234	0.07053	.	.	ENSG00000148426	ENST00000379208;ENST00000277570;ENST00000379202	T	0.08008	3.14	4.4	-8.8	0.00817	.	0.716974	0.13006	N	0.421269	T	0.03305	0.0096	N	0.19112	0.55	0.09310	N	0.999999	B	0.09022	0.002	B	0.08055	0.003	T	0.34925	-0.9809	10	0.87932	D	0	3.0E-4	0.8901	0.01252	0.1745:0.2477:0.1899:0.3878	.	177	Q86WR7	CJ047_HUMAN	P	177	ENSP00000277570:A177P	ENSP00000277570:A177P	A	+	1	0	C10orf47	11951632	0.000000	0.05858	0.000000	0.03702	0.051000	0.14879	-0.577000	0.05847	-2.779000	0.00361	0.305000	0.20034	GCC	.		0.692	PROSER2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090189.2	NM_153256	
GPAM	57678	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	113913352	113913352	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr10:113913352G>A	ENST00000348367.4	-	22	2640	c.2443C>T	c.(2443-2445)Cga>Tga	p.R815*	GPAM_ENST00000423155.1_Nonsense_Mutation_p.R815*			Q9HCL2	GPAT1_HUMAN	glycerol-3-phosphate acyltransferase, mitochondrial	815					acyl-CoA metabolic process (GO:0006637)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|defense response to virus (GO:0051607)|fatty acid homeostasis (GO:0055089)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|interleukin-2 secretion (GO:0070970)|negative regulation of activation-induced cell death of T cells (GO:0070236)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of multicellular organism growth (GO:0040018)|regulation of cytokine secretion (GO:0050707)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			breast(2)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31				Epithelial(162;0.0306)|all cancers(201;0.123)		AGTTTTTGTCGGTTGCATTGA	0.383																																					p.R815X	Ovarian(161;1017 2606 18293 52943)	.											.	GPAM-92	0			c.C2443T						.						126.0	131.0	129.0					10																	113913352		2203	4300	6503	SO:0001587	stop_gained	57678	exon22			TTTGTCGGTTGCA	AL832464	CCDS7570.1	10q25.3	2009-07-15			ENSG00000119927	ENSG00000119927			24865	protein-coding gene	gene with protein product	"""glycerol-3-phosphate acyltransferase 1, mitochondrial"""	602395				10997877, 8369314	Standard	NM_020918		Approved	KIAA1560, MGC26846, GPAT1	uc001kzp.3	Q9HCL2	OTTHUMG00000019055	ENST00000348367.4:c.2443C>T	10.37:g.113913352G>A	ENSP00000265276:p.Arg815*	Somatic	106	0		WXS	Illumina HiSeq	Phase_I	91	30	NM_001244949	0	0	0	0	0	Q5VW51|Q86TA3	Nonsense_Mutation	SNP	ENST00000348367.4	37	CCDS7570.1	.	.	.	.	.	.	.	.	.	.	G	40	8.137750	0.98672	.	.	ENSG00000119927	ENST00000348367;ENST00000423155	.	.	.	5.59	4.63	0.57726	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.7284	11.4195	0.49974	0.0:0.0:0.7192:0.2808	.	.	.	.	X	815	.	ENSP00000265276:R815X	R	-	1	2	GPAM	113903342	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.487000	0.45268	2.640000	0.89533	0.655000	0.94253	CGA	.		0.383	GPAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050377.1	NM_020918	
TRIM66	9866	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	8639493	8639493	+	Nonstop_Mutation	SNP	A	A	G			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr11:8639493A>G	ENST00000299550.6	-	20	3843	c.3649T>C	c.(3649-3651)Tga>Cga	p.*1217R	TRIM66_ENST00000402157.2_Nonstop_Mutation_p.*1246R	NM_014818.1	NP_055633.1	O15016	TRI66_HUMAN	tripartite motif containing 66	0						aggresome (GO:0016235)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|kidney(1)|lung(1)|skin(2)	9						TTTGGCTCTCACACCTGAGAG	0.438																																					p.X1217R		.											.	TRIM66-68	0			c.T3649C						.						160.0	146.0	150.0					11																	8639493		692	1591	2283	SO:0001578	stop_lost	9866	exon20			GCTCTCACACCTG	AB002296		11p15.4	2013-01-28	2011-01-25		ENSG00000166436	ENSG00000166436		"""Tripartite motif containing / Tripartite motif containing"", ""Zinc fingers, PHD-type"""	29005	protein-coding gene	gene with protein product		612000	"""chromosome 11 open reading frame 29"", ""tripartite motif-containing 66"""	C11orf29		9205841	Standard	NM_014818		Approved	KIAA0298, TIF1D	uc010rbo.2	O15016	OTTHUMG00000150481	ENST00000299550.6:c.3649T>C	11.37:g.8639493A>G	ENSP00000299550:p.*1217Glyext*33	Somatic	95	0		WXS	Illumina HiSeq	Phase_I	57	14	NM_014818	0	0	0	0	0	Q9BQQ4	Missense_Mutation	SNP	ENST00000299550.6	37		.	.	.	.	.	.	.	.	.	.	A	11.74	1.730043	0.30684	.	.	ENSG00000166436	ENST00000299550;ENST00000402157	.	.	.	5.32	5.32	0.75619	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.3527	0.60611	1.0:0.0:0.0:0.0	.	.	.	.	R	1217;1246	.	.	X	-	1	0	TRIM66	8596069	1.000000	0.71417	1.000000	0.80357	0.267000	0.26476	5.164000	0.64954	2.141000	0.66446	0.440000	0.28878	TGA	.		0.438	TRIM66-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		XM_084529	
IGSF22	283284	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	18731076	18731076	+	Missense_Mutation	SNP	C	C	A			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr11:18731076C>A	ENST00000513874.1	-	18	2995	c.2856G>T	c.(2854-2856)aaG>aaT	p.K952N	RP11-1081L13.4_ENST00000527285.1_RNA	NM_173588.3	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	851										NS(2)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(20)|ovary(4)|prostate(4)|skin(3)	56						AGATGGGGATCTTTGTGCACT	0.577																																					p.K952N		.											.	IGSF22-140	0			c.G2856T						.						100.0	105.0	104.0					11																	18731076		1974	4152	6126	SO:0001583	missense	283284	exon18			GGGGATCTTTGTG	AK095113	CCDS41625.1, CCDS41625.2	11p15.1	2014-06-06			ENSG00000179057	ENSG00000179057		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26750	protein-coding gene	gene with protein product							Standard	NM_173588		Approved	FLJ37794	uc009yht.2	Q8N9C0	OTTHUMG00000160502	ENST00000513874.1:c.2856G>T	11.37:g.18731076C>A	ENSP00000421191:p.Lys952Asn	Somatic	97	0		WXS	Illumina HiSeq	Phase_I	102	34	NM_173588	0	0	0	0	0	A6NNA0|D6RGV7	Missense_Mutation	SNP	ENST00000513874.1	37	CCDS41625.2	.	.	.	.	.	.	.	.	.	.	C	13.80	2.345544	0.41498	.	.	ENSG00000179057	ENST00000513874	T	0.56776	0.44	4.39	2.46	0.29980	.	.	.	.	.	T	0.47948	0.1473	N	0.12182	0.205	0.09310	N	0.999997	D	0.69078	0.997	D	0.80764	0.994	T	0.34104	-0.9842	9	0.18276	T	0.48	.	7.069	0.25167	0.0:0.7288:0.1744:0.0969	.	952	D6RGV7	.	N	952	ENSP00000421191:K952N	ENSP00000322422:K851N	K	-	3	2	IGSF22	18687652	0.000000	0.05858	0.578000	0.28575	0.994000	0.84299	-0.453000	0.06778	0.464000	0.27142	0.655000	0.94253	AAG	.		0.577	IGSF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360850.2	NM_173588	
GRIN2B	2904	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	13768093	13768093	+	Missense_Mutation	SNP	T	T	C			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr12:13768093T>C	ENST00000609686.1	-	7	1818	c.1609A>G	c.(1609-1611)Atg>Gtg	p.M537V		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	537					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CGTGACACCATGACACTGATG	0.517																																					p.M537V		.											.	GRIN2B-231	0			c.A1609G						.						195.0	151.0	166.0					12																	13768093		2203	4300	6503	SO:0001583	missense	2904	exon7			ACACCATGACACT		CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.1609A>G	12.37:g.13768093T>C	ENSP00000477455:p.Met537Val	Somatic	93	0		WXS	Illumina HiSeq	Phase_I	82	21	NM_000834	0	0	0	0	0	Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Missense_Mutation	SNP	ENST00000609686.1	37	CCDS8662.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.266041	0.80358	.	.	ENSG00000150086	ENST00000279593	T	0.22134	1.97	6.17	6.17	0.99709	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	T	0.42720	0.1215	L	0.53780	1.695	0.80722	D	1	D	0.76494	0.999	D	0.67382	0.951	T	0.21655	-1.0239	10	0.87932	D	0	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	537	Q13224	NMDE2_HUMAN	V	537	ENSP00000279593:M537V	ENSP00000279593:M537V	M	-	1	0	GRIN2B	13659360	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.035000	0.88872	2.371000	0.80710	0.533000	0.62120	ATG	.		0.517	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268014.2		
AMHR2	269	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	53825014	53825014	+	Missense_Mutation	SNP	A	A	T			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr12:53825014A>T	ENST00000257863.4	+	11	1559	c.1479A>T	c.(1477-1479)gaA>gaT	p.E493D	AMHR2_ENST00000550311.1_3'UTR|AMHR2_ENST00000379791.3_Missense_Mutation_p.E398D	NM_001164690.1|NM_020547.2	NP_001158162.1|NP_065434.1	Q16671	AMHR2_HUMAN	anti-Mullerian hormone receptor, type II	493	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				Mullerian duct regression (GO:0001880)|negative regulation of anti-Mullerian hormone signaling pathway (GO:1902613)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	integral component of plasma membrane (GO:0005887)	anti-Mullerian hormone receptor activity (GO:1990272)|ATP binding (GO:0005524)|hormone binding (GO:0042562)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta receptor activity, type II (GO:0005026)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|skin(2)	34					Adenosine triphosphate(DB00171)	CAGACCCAGAAGCACGGCTGA	0.607																																					p.E493D		.											.	AMHR2-628	0			c.A1479T						.						88.0	84.0	86.0					12																	53825014		2203	4300	6503	SO:0001583	missense	269	exon11			CCCAGAAGCACGG	AF172932	CCDS8858.1, CCDS53798.1, CCDS55829.1	12q13	2013-03-14							465	protein-coding gene	gene with protein product	"""Muellerian inhibiting substance type II receptor"""	600956				7493017	Standard	NM_001164690		Approved	MISR2, MISRII	uc001scx.2	Q16671	OTTHUMG00000170048	ENST00000257863.4:c.1479A>T	12.37:g.53825014A>T	ENSP00000257863:p.Glu493Asp	Somatic	59	0		WXS	Illumina HiSeq	Phase_I	68	22	NM_020547	0	0	0	0	0	A0AVE1|B9EGB7|E9PGD2|F8W1D2|Q13762|Q647K2	Missense_Mutation	SNP	ENST00000257863.4	37	CCDS8858.1	.	.	.	.	.	.	.	.	.	.	A	19.53	3.844229	0.71488	.	.	ENSG00000135409	ENST00000257863;ENST00000379791	T;D	0.93659	-0.22;-3.26	4.86	3.72	0.42706	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.38959	N	0.001503	D	0.92512	0.7622	N	0.25094	0.71	0.29470	N	0.857082	D	0.76494	0.999	D	0.80764	0.994	D	0.87493	0.2428	10	0.62326	D	0.03	.	8.3026	0.32023	0.9085:0.0:0.0915:0.0	.	493	Q16671	AMHR2_HUMAN	D	493;398	ENSP00000257863:E493D;ENSP00000369117:E398D	ENSP00000257863:E493D	E	+	3	2	AMHR2	52111281	0.998000	0.40836	0.998000	0.56505	0.971000	0.66376	0.443000	0.21644	0.998000	0.38996	0.460000	0.39030	GAA	.		0.607	AMHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407048.1	NM_020547	
NPFF	8620	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	53899840	53899840	+	IGR	SNP	T	T	C			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr12:53899840T>C	ENST00000267017.3	-	0	592				TARBP2_ENST00000552857.1_3'UTR|TARBP2_ENST00000266987.2_Missense_Mutation_p.C337R|TARBP2_ENST00000456234.2_Missense_Mutation_p.C316R|TARBP2_ENST00000394357.2_Missense_Mutation_p.C316R	NM_003717.2	NP_003708.1	O15130	NPFF_HUMAN	neuropeptide FF-amide peptide precursor						acute inflammatory response to antigenic stimulus (GO:0002438)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of appetite (GO:0032099)|negative regulation of heart rate (GO:0010459)|negative regulation of insulin secretion (GO:0046676)|neuropeptide signaling pathway (GO:0007218)|positive regulation of blood pressure (GO:0045777)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of membrane depolarization (GO:0003254)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|response to morphine (GO:0043278)|somatostatin secretion (GO:0070253)|spinal cord development (GO:0021510)|synaptic transmission (GO:0007268)|vasopressin secretion (GO:0030103)	axon terminus (GO:0043679)|dendrite (GO:0030425)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|perikaryon (GO:0043204)|vesicle (GO:0031982)	receptor binding (GO:0005102)			haematopoietic_and_lymphoid_tissue(1)|prostate(1)|urinary_tract(1)	3						GGCCACTGTGTGTCATGGCTC	0.632																																					p.C337R		.											.	TARBP2-226	0			c.T1009C						.						48.0	44.0	46.0					12																	53899840		2203	4300	6503	SO:0001628	intergenic_variant	6895	exon9			ACTGTGTGTCATG	AF005271	CCDS8862.1	12q13.13	2013-02-26			ENSG00000139574	ENSG00000139574		"""Endogenous ligands"""	7901	protein-coding gene	gene with protein product		604643				9224703	Standard	NM_003717		Approved	FMRFAL	uc001sdw.1	O15130	OTTHUMG00000169856		12.37:g.53899840T>C		Somatic	78	0		WXS	Illumina HiSeq	Phase_I	71	20	NM_134323	0	0	19	43	24	Q3SXL4	Missense_Mutation	SNP	ENST00000267017.3	37	CCDS8862.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.437352	0.83885	.	.	ENSG00000139546	ENST00000266987;ENST00000456234;ENST00000394357	D;D;D	0.82255	-1.59;-1.59;-1.59	5.15	5.15	0.70609	Double-stranded RNA-binding (2);	0.000000	0.85682	D	0.000000	D	0.91047	0.7183	M	0.83223	2.63	0.80722	D	1	D	0.65815	0.995	D	0.72982	0.979	D	0.92199	0.5766	10	0.66056	D	0.02	-6.1074	14.2562	0.66053	0.0:0.0:0.0:1.0	.	337	Q15633	TRBP2_HUMAN	R	337;316;316	ENSP00000266987:C337R;ENSP00000416077:C316R;ENSP00000377885:C316R	ENSP00000266987:C337R	C	+	1	0	TARBP2	52186107	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	4.900000	0.63252	2.075000	0.62263	0.402000	0.26972	TGT	.		0.632	NPFF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406301.1	NM_003717	
METTL21B	25895	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	58166555	58166555	+	Silent	SNP	C	C	T			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr12:58166555C>T	ENST00000300209.8	+	1	173	c.48C>T	c.(46-48)ttC>ttT	p.F16F	METTL1_ENST00000257848.7_5'Flank|METTL1_ENST00000548681.1_5'Flank|METTL21B_ENST00000548256.1_Intron|RP11-571M6.15_ENST00000471530.1_5'Flank|METTL1_ENST00000324871.7_5'UTR|AC025165.1_ENST00000582738.1_RNA|METTL21B_ENST00000552307.1_3'UTR|METTL21B_ENST00000333012.5_Silent_p.F16F|METTL21B_ENST00000551420.1_Intron	NM_015433.2	NP_056248.2	Q96AZ1	MT21B_HUMAN	methyltransferase like 21B	16						cytoplasm (GO:0005737)|intracellular (GO:0005622)	methyltransferase activity (GO:0008168)			endometrium(1)|lung(1)	2						AATCGGTGTTCCCGCGGGAGG	0.647																																					p.F16F													.	METTL21B-514	0			c.C48T						.						37.0	36.0	36.0					12																	58166555		2202	4300	6502	SO:0001819	synonymous_variant	25895	exon1			GGTGTTCCCGCGG	AL050100, AF455816	CCDS8957.1, CCDS31848.1	12q14.1	2011-03-03	2011-03-03	2011-03-03	ENSG00000123427	ENSG00000123427			24936	protein-coding gene	gene with protein product		615258	"""family with sequence similarity 119, member B"""	FAM119B		12477932	Standard	NM_015433		Approved	DKFZP586D0919	uc001sqg.3	Q96AZ1	OTTHUMG00000170459	ENST00000300209.8:c.48C>T	12.37:g.58166555C>T		Somatic	128	3		WXS	Illumina HiSeq	Phase_I	106	41	NM_015433	0	0	3	5	2	Q9H749|Q9Y3W2	Silent	SNP	ENST00000300209.8	37	CCDS8957.1																																																																																			.		0.647	METTL21B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409268.1	NM_015433	
ATP2B1	490	broad.mit.edu	37	12	90029004	90029004	+	Missense_Mutation	SNP	T	T	C			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr12:90029004T>C	ENST00000428670.3	-	4	887	c.431A>G	c.(430-432)gAg>gGg	p.E144G	ATP2B1_ENST00000348959.3_Missense_Mutation_p.E144G|ATP2B1_ENST00000359142.3_Missense_Mutation_p.E144G|ATP2B1_ENST00000261173.2_Missense_Mutation_p.E144G			P20020	AT2B1_HUMAN	ATPase, Ca++ transporting, plasma membrane 1	144					blood coagulation (GO:0007596)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	45						ACCTTCTTCCTCCCCAACAGA	0.383																																					p.E144G													.	ATP2B1-516	0			c.A431G						.						81.0	70.0	74.0					12																	90029004		2203	4300	6503	SO:0001583	missense	490	exon3			TCTTCCTCCCCAA	J04027	CCDS9035.1, CCDS41817.1	12q21.33	2010-04-20			ENSG00000070961	ENSG00000070961	3.6.3.8	"""ATPases / P-type"""	814	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 1"""	108731				1674727	Standard	NM_001682		Approved	PMCA1	uc001tbh.3	P20020		ENST00000428670.3:c.431A>G	12.37:g.90029004T>C	ENSP00000392043:p.Glu144Gly	Somatic	63	0		WXS	Illumina HiSeq	Phase_I	33	3	NM_001001323	0	0	0	0	0	Q12992|Q12993|Q13819|Q13820|Q13821|Q16504|Q93082	Missense_Mutation	SNP	ENST00000428670.3	37	CCDS9035.1	.	.	.	.	.	.	.	.	.	.	T	15.53	2.860274	0.51482	.	.	ENSG00000070961	ENST00000261173;ENST00000348959;ENST00000359142;ENST00000428670	D;D;D;D	0.88896	-2.44;-2.44;-2.44;-2.44	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	D	0.85965	0.5820	L	0.54323	1.7	0.51012	D	0.999905	B;B	0.12013	0.001;0.005	B;B	0.25506	0.003;0.061	T	0.80513	-0.1349	9	.	.	.	-19.9952	11.6181	0.51102	0.1327:0.0:0.0:0.8673	.	144;144	P20020-3;P20020-2	.;.	G	144	ENSP00000261173:E144G;ENSP00000343599:E144G;ENSP00000352054:E144G;ENSP00000392043:E144G	.	E	-	2	0	ATP2B1	88553135	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.227000	0.58612	2.367000	0.80283	0.528000	0.53228	GAG	.		0.383	ATP2B1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406653.1	NM_001682	
SBNO1	55206	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	123815855	123815855	+	Missense_Mutation	SNP	C	C	G			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr12:123815855C>G	ENST00000602398.1	-	8	1104	c.977G>C	c.(976-978)gGa>gCa	p.G326A	SBNO1_ENST00000602750.1_Missense_Mutation_p.G325A|SBNO1_ENST00000267176.4_Missense_Mutation_p.G325A|SBNO1_ENST00000420886.2_Missense_Mutation_p.G326A			A3KN83	SBNO1_HUMAN	strawberry notch homolog 1 (Drosophila)	326					regulation of transcription, DNA-templated (GO:0006355)					NS(2)|breast(6)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(11)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(2)	62	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000701)|Epithelial(86;0.00197)		CCTTCCTTTTCCTACACCGGC	0.408																																					p.G326A		.											.	SBNO1-292	0			c.G977C						.						152.0	138.0	143.0					12																	123815855		2203	4300	6503	SO:0001583	missense	55206	exon7			CCTTTTCCTACAC	AK001563	CCDS9246.1, CCDS53844.1	12q24.31	2006-10-06	2006-10-06			ENSG00000139697			22973	protein-coding gene	gene with protein product		614274	"""sno, strawberry notch homolog 1 (Drosophila)"""				Standard	NM_018183		Approved	MOP3, FLJ10701, FLJ10833, Sno	uc010tap.2	A3KN83		ENST00000602398.1:c.977G>C	12.37:g.123815855C>G	ENSP00000473665:p.Gly326Ala	Somatic	92	0		WXS	Illumina HiSeq	Phase_I	94	33	NM_001167856	0	0	1	1	0	Q05C06|Q3ZTS3|Q9H3T8|Q9NVB2	Missense_Mutation	SNP	ENST00000602398.1	37	CCDS53844.1	.	.	.	.	.	.	.	.	.	.	C	32	5.164386	0.94727	.	.	ENSG00000139697	ENST00000420886;ENST00000267176;ENST00000442601	D;D	0.99940	-8.38;-8.38	5.83	5.83	0.93111	Helicase/UvrB domain (1);	0.000000	0.85682	D	0.000000	D	0.99955	0.9981	H	0.96015	3.755	0.80722	D	1	D;D;D	0.89917	1.0;0.998;0.999	D;D;D	0.91635	0.999;0.993;0.998	D	0.96352	0.9259	10	0.87932	D	0	-27.8907	20.1218	0.97964	0.0:1.0:0.0:0.0	.	326;325;324	A3KN83;A3KN83-2;A3KN83-3	SBNO1_HUMAN;.;.	A	326;325;325	ENSP00000387361:G326A;ENSP00000267176:G325A	ENSP00000267176:G325A	G	-	2	0	SBNO1	122381808	1.000000	0.71417	0.958000	0.39756	0.998000	0.95712	7.794000	0.85869	2.763000	0.94921	0.561000	0.74099	GGA	.		0.408	SBNO1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000467684.1	NM_018183	
ZMYM5	9205	bcgsc.ca	37	13	20413049	20413049	+	Silent	SNP	G	G	T			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr13:20413049G>T	ENST00000337963.4	-	5	927	c.663C>A	c.(661-663)gcC>gcA	p.A221A	RP11-61K9.2_ENST00000422148.2_RNA|ZMYM5_ENST00000382907.4_Intron|ZMYM5_ENST00000382905.4_Silent_p.A221A	NM_001142684.1	NP_001136156.1	Q9UJ78	ZMYM5_HUMAN	zinc finger, MYM-type 5	221						nucleus (GO:0005634)	zinc ion binding (GO:0008270)			kidney(1)|large_intestine(5)|lung(9)	15		all_cancers(29;2.96e-22)|all_epithelial(30;3.76e-20)|all_lung(29;4.38e-20)|Lung NSC(5;5.8e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.61e-05)|Epithelial(112;4.89e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00171)|Lung(94;0.00942)|LUSC - Lung squamous cell carcinoma(192;0.0431)		TACGAAGTAAGGCCACTGGTG	0.403																																					p.A221A													.	ZMYM5-90	0			c.C663A						.						159.0	162.0	161.0					13																	20413049		2203	4300	6503	SO:0001819	synonymous_variant	9205	exon5			AAGTAAGGCCACT	AF161535	CCDS31942.1, CCDS31943.1	13q12	2013-01-08	2005-09-12	2005-09-12	ENSG00000132950	ENSG00000132950		"""Zinc fingers, MYM type"""	13029	protein-coding gene	gene with protein product			"""zinc finger protein 237"""	ZNF237			Standard	NM_001039650		Approved	ZNF198L1, MYM	uc010tcn.1	Q9UJ78	OTTHUMG00000016504	ENST00000337963.4:c.663C>A	13.37:g.20413049G>T		Somatic	220	5		WXS	Illumina HiSeq	Phase_1	169	68	NM_001039650	0	0	0	1	1	B2R6V1|Q5T6E1|Q5T6E2|Q5T6E4|Q96IY6|Q9NZY5|Q9UBW0|Q9UJ77	Silent	SNP	ENST00000337963.4	37																																																																																				.		0.403	ZMYM5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_014242	
NBEA	26960	broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	35731352	35731352	+	Missense_Mutation	SNP	A	A	G			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr13:35731352A>G	ENST00000400445.3	+	21	3323	c.2789A>G	c.(2788-2790)tAt>tGt	p.Y930C	NBEA_ENST00000540320.1_Missense_Mutation_p.Y930C|NBEA_ENST00000379939.2_Missense_Mutation_p.Y930C|NBEA_ENST00000310336.4_Missense_Mutation_p.Y930C	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	930					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		GCAATAAAATATGAATGGGGA	0.383																																					p.Y930C													.	NBEA-144	0			c.A2789G						.						71.0	73.0	72.0					13																	35731352		1826	4083	5909	SO:0001583	missense	26960	exon21			TAAAATATGAATG	AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.2789A>G	13.37:g.35731352A>G	ENSP00000383295:p.Tyr930Cys	Somatic	94	1		WXS	Illumina HiSeq	Phase_I	65	16	NM_015678	0	0	0	0	0	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	ENST00000400445.3	37	CCDS45026.1	.	.	.	.	.	.	.	.	.	.	A	23.4	4.414824	0.83449	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336	T;T;T;T	0.67345	-0.26;-0.26;-0.26;-0.26	5.37	5.37	0.77165	.	0.069707	0.64402	D	0.000014	T	0.75280	0.3828	M	0.67953	2.075	0.80722	D	1	D	0.63046	0.992	P	0.54499	0.754	T	0.77827	-0.2443	10	0.54805	T	0.06	.	15.6702	0.77267	1.0:0.0:0.0:0.0	.	930	Q5T321	.	C	930	ENSP00000440951:Y930C;ENSP00000383295:Y930C;ENSP00000369271:Y930C;ENSP00000308534:Y930C	ENSP00000308534:Y930C	Y	+	2	0	NBEA	34629352	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	9.287000	0.95975	2.171000	0.68590	0.528000	0.53228	TAT	.		0.383	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678	
SERPINE3	647174	broad.mit.edu	37	13	51922450	51922450	+	Missense_Mutation	SNP	A	A	C			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr13:51922450A>C	ENST00000521255.1	+	4	862	c.802A>C	c.(802-804)Acc>Ccc	p.T268P	SERPINE3_ENST00000400389.4_Missense_Mutation_p.T268P|MIR5693_ENST00000577722.1_RNA|SERPINE3_ENST00000524365.1_Missense_Mutation_p.T268P	NM_001101320.1	NP_001094790.1	A8MV23	SERP3_HUMAN	serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 3	268					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			ovary(2)	2						TGACAAAGACACCCCCCTGAG	0.612																																					p.T268P													.	SERPINE3-24	0			c.A802C						.						61.0	80.0	74.0					13																	51922450		2118	4246	6364	SO:0001583	missense	647174	exon4			AAAGACACCCCCC	AX772926	CCDS53870.1	13q14.3	2014-02-18			ENSG00000253309	ENSG00000253309		"""Serine (or cysteine) peptidase inhibitors"""	24774	protein-coding gene	gene with protein product						24172014	Standard	NM_001101320		Approved		uc001vfh.2	A8MV23	OTTHUMG00000016943	ENST00000521255.1:c.802A>C	13.37:g.51922450A>C	ENSP00000428316:p.Thr268Pro	Somatic	74	13		WXS	Illumina HiSeq	Phase_I	89	20	NM_001101320	0	0	0	0	0	B1V8P3	Missense_Mutation	SNP	ENST00000521255.1	37	CCDS53870.1	.	.	.	.	.	.	.	.	.	.	A	13.09	2.134471	0.37630	.	.	ENSG00000253309	ENST00000524365;ENST00000521255;ENST00000400389	D;D;D	0.84516	-1.86;-1.86;-1.86	5.19	-5.14	0.02875	Serpin domain (3);	0.090377	0.42964	U	0.000633	D	0.89767	0.6810	M	0.85197	2.74	0.09310	N	1	B;D	0.63046	0.18;0.992	B;D	0.63793	0.067;0.918	D	0.85624	0.1266	10	0.59425	D	0.04	.	12.8081	0.57626	0.492:0.0:0.508:0.0	.	268;268	A8MV23-2;A8MV23	.;SERP3_HUMAN	P	268	ENSP00000430755:T268P;ENSP00000428316:T268P;ENSP00000441468:T268P	ENSP00000441468:T268P	T	+	1	0	SERPINE3	50820451	0.393000	0.25237	0.000000	0.03702	0.099000	0.18886	2.777000	0.47717	-1.107000	0.03004	-0.242000	0.12053	ACC	.		0.612	SERPINE3-001	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045021.2	NM_001101320	
TPP2	7174	broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	103271166	103271166	+	Missense_Mutation	SNP	G	G	T			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr13:103271166G>T	ENST00000376065.4	+	5	626	c.590G>T	c.(589-591)tGc>tTc	p.C197F	TPP2_ENST00000376052.3_Missense_Mutation_p.C197F	NM_003291.2	NP_003282.2	P29144	TPP2_HUMAN	tripeptidyl peptidase II	197	Peptidase S8.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)|tripeptidyl-peptidase activity (GO:0008240)			breast(2)|endometrium(5)|kidney(2)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	52	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GTATATGACTGCTTGGTATGG	0.358																																					p.C197F													.	TPP2-92	0			c.G590T						.						174.0	167.0	169.0					13																	103271166		2203	4300	6503	SO:0001583	missense	7174	exon5			ATGACTGCTTGGT	M55169	CCDS9502.1	13q32-q33	2008-02-05			ENSG00000134900	ENSG00000134900	3.4.14.10		12016	protein-coding gene	gene with protein product		190470				1670990	Standard	NM_003291		Approved		uc001vpi.4	P29144	OTTHUMG00000017305	ENST00000376065.4:c.590G>T	13.37:g.103271166G>T	ENSP00000365233:p.Cys197Phe	Somatic	117	2		WXS	Illumina HiSeq	Phase_I	74	30	NM_003291	0	0	0	0	0	Q5VZU8	Missense_Mutation	SNP	ENST00000376065.4	37	CCDS9502.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.592962	0.86953	.	.	ENSG00000134900	ENST00000376065;ENST00000376052	.	.	.	5.69	5.69	0.88448	Peptidase S8/S53, subtilisin/kexin/sedolisin (2);	0.000000	0.85682	D	0.000000	D	0.84120	0.5402	M	0.83483	2.645	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	D	0.85728	0.1329	9	0.87932	D	0	.	19.8131	0.96556	0.0:0.0:1.0:0.0	.	197	P29144	TPP2_HUMAN	F	197	.	ENSP00000365220:C197F	C	+	2	0	TPP2	102069167	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.476000	0.97823	2.682000	0.91365	0.585000	0.79938	TGC	.		0.358	TPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045683.2		
TTC5	91875	broad.mit.edu;ucsc.edu	37	14	20774052	20774052	+	Silent	SNP	T	T	C			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr14:20774052T>C	ENST00000258821.3	-	1	101	c.45A>G	c.(43-45)aaA>aaG	p.K15K	CTD-2292M16.7_ENST00000553419.1_RNA	NM_138376.2	NP_612385.2	Q8N0Z6	TTC5_HUMAN	tetratricopeptide repeat domain 5	15					DNA repair (GO:0006281)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	15	all_cancers(95;0.00092)		Epithelial(56;1.1e-06)|all cancers(55;8.07e-06)	GBM - Glioblastoma multiforme(265;0.0106)		CCACCTGCAATTTCTGCAAGA	0.502											OREG0022552	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.K15K													.	TTC5-91	0			c.A45G						.						135.0	118.0	124.0					14																	20774052		2203	4300	6503	SO:0001819	synonymous_variant	91875	exon1			CTGCAATTTCTGC	BC008647	CCDS9546.1	14q11.2	2013-01-11			ENSG00000136319	ENSG00000136319		"""Tetratricopeptide (TTC) repeat domain containing"""	19274	protein-coding gene	gene with protein product						11511361	Standard	NM_138376		Approved	Strap	uc001vwt.3	Q8N0Z6	OTTHUMG00000029506	ENST00000258821.3:c.45A>G	14.37:g.20774052T>C		Somatic	74	1	743	WXS	Illumina HiSeq	Phase_I	73	10	NM_138376	0	0	0	0	0	A8MQ18|Q96HF9	Silent	SNP	ENST00000258821.3	37	CCDS9546.1	.	.	.	.	.	.	.	.	.	.	T	16.42	3.117697	0.56505	.	.	ENSG00000136319	ENST00000423949	.	.	.	4.95	3.72	0.42706	.	.	.	.	.	T	0.57489	0.2057	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54636	-0.8264	4	.	.	.	.	8.3016	0.32017	0.0:0.0:0.2007:0.7993	.	.	.	.	V	15	.	.	I	-	1	0	TTC5	19843892	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.381000	0.34362	2.201000	0.70794	0.533000	0.62120	ATT	.		0.502	TTC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073529.4	NM_138376	
SNX6	58533	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	35062293	35062293	+	Missense_Mutation	SNP	C	C	A			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr14:35062293C>A	ENST00000362031.4	-	8	742	c.712G>T	c.(712-714)Gat>Tat	p.D238Y	SNX6_ENST00000355110.5_Missense_Mutation_p.D114Y|SNX6_ENST00000396534.3_Missense_Mutation_p.D110Y|SNX6_ENST00000396526.3_Missense_Mutation_p.D110Y	NM_152233.2	NP_689419.2	Q9UNH7	SNX6_HUMAN	sorting nexin 6	226					intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|intracellular (GO:0005622)|nucleus (GO:0005634)	phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)			endometrium(4)|lung(1)|ovary(1)	6	Breast(36;0.0473)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00199)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.0245)		GCAGATGCATCCTTAACTCGG	0.299																																					p.D238Y		.											.	SNX6-226	0			c.G712T						.						75.0	74.0	74.0					14																	35062293		2202	4298	6500	SO:0001583	missense	58533	exon8			ATGCATCCTTAAC	AF121856	CCDS9648.1, CCDS41942.1	14q13	2010-08-05			ENSG00000129515	ENSG00000129515		"""Sorting nexins"""	14970	protein-coding gene	gene with protein product		606098				11279102	Standard	XM_006720224		Approved		uc001wsf.1	Q9UNH7	OTTHUMG00000140213	ENST00000362031.4:c.712G>T	14.37:g.35062293C>A	ENSP00000355217:p.Asp238Tyr	Somatic	269	0		WXS	Illumina HiSeq	Phase_I	127	31	NM_152233	0	0	4	9	5	C0H5W9|Q9Y449	Missense_Mutation	SNP	ENST00000362031.4	37	CCDS41942.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.345615	0.82022	.	.	ENSG00000129515	ENST00000396526;ENST00000396534;ENST00000362031;ENST00000355110;ENST00000557265	T;T;T;T;T	0.54071	1.5;1.5;1.5;1.5;0.59	4.69	4.69	0.59074	Vps5 C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.75317	0.3833	M	0.82630	2.6	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.80360	-0.1415	10	0.87932	D	0	-17.283	17.6053	0.88036	0.0:1.0:0.0:0.0	.	114;226	B4DJS7;Q9UNH7	.;SNX6_HUMAN	Y	110;110;238;114;201	ENSP00000379779:D110Y;ENSP00000379785:D110Y;ENSP00000355217:D238Y;ENSP00000347230:D114Y;ENSP00000452577:D201Y	ENSP00000347230:D114Y	D	-	1	0	SNX6	34132044	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.993000	0.76245	2.340000	0.79590	0.561000	0.74099	GAT	.		0.299	SNX6-002	KNOWN	downstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276642.3		
LTBP2	4053	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	75019017	75019017	+	Silent	SNP	C	C	G			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr14:75019017C>G	ENST00000261978.4	-	6	1658	c.1272G>C	c.(1270-1272)ggG>ggC	p.G424G	LTBP2_ENST00000556690.1_Silent_p.G424G|LTBP2_ENST00000557425.1_Intron|CTD-2207P18.1_ENST00000554552.1_lincRNA	NM_000428.2	NP_000419.1	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding protein 2	424	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein secretion (GO:0009306)|protein targeting (GO:0006605)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|liver(1)|lung(29)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		GGCAGAACTTCCCGGTGGAGT	0.652																																					p.G424G		.											.	LTBP2-92	0			c.G1272C						.						39.0	41.0	40.0					14																	75019017		2203	4300	6503	SO:0001819	synonymous_variant	4053	exon6			GAACTTCCCGGTG		CCDS9831.1	14q24.3	2011-10-20	2001-12-04			ENSG00000119681		"""Latent transforming growth factor, beta binding proteins"""	6715	protein-coding gene	gene with protein product		602091	"""chromosome 14 open reading frame 141"""	LTBP3, C14orf141		7798248	Standard	NM_000428		Approved		uc001xqa.3	Q14767		ENST00000261978.4:c.1272G>C	14.37:g.75019017C>G		Somatic	67	0		WXS	Illumina HiSeq	Phase_I	83	26	NM_000428	0	0	0	0	0	Q99907|Q9NS51	Silent	SNP	ENST00000261978.4	37	CCDS9831.1																																																																																			.		0.652	LTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413595.1	NM_000428	
IRF2BPL	64207	broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	77492877	77492877	+	Missense_Mutation	SNP	A	A	G			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr14:77492877A>G	ENST00000238647.3	-	1	2157	c.1259T>C	c.(1258-1260)tTc>tCc	p.F420S		NM_024496.3	NP_078772.1	Q9H1B7	I2BPL_HUMAN	interferon regulatory factor 2 binding protein-like	420					development of secondary female sexual characteristics (GO:0046543)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	extracellular space (GO:0005615)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	11						GTACTCAATGAACAGCTTCAA	0.592																																					p.F420S													.	IRF2BPL-90	0			c.T1259C						.						46.0	39.0	42.0					14																	77492877		2203	4300	6503	SO:0001583	missense	64207	exon1			TCAATGAACAGCT	AJ277365	CCDS9854.1	14q24.3	2011-02-23	2011-02-23	2011-02-23	ENSG00000119669	ENSG00000119669			14282	protein-coding gene	gene with protein product	"""enhanced at puberty 1"""	611720	"""chromosome 14 open reading frame 4"""	C14orf4		11095982, 17627301	Standard	NM_024496		Approved	EAP1, KIAA1865	uc001xsy.4	Q9H1B7		ENST00000238647.3:c.1259T>C	14.37:g.77492877A>G	ENSP00000238647:p.Phe420Ser	Somatic	93	1		WXS	Illumina HiSeq	Phase_I	100	31	NM_024496	1	0	9	13	3	Q8NDQ2|Q96JG2|Q9H3I7	Missense_Mutation	SNP	ENST00000238647.3	37	CCDS9854.1	.	.	.	.	.	.	.	.	.	.	A	28.5	4.924484	0.92319	.	.	ENSG00000119669	ENST00000238647	T	0.17691	2.26	3.92	3.92	0.45320	.	0.000000	0.64402	U	0.000002	T	0.30916	0.0780	L	0.52573	1.65	0.53005	D	0.99996	D	0.71674	0.998	P	0.61874	0.895	T	0.03840	-1.0999	10	0.72032	D	0.01	0.109	11.7465	0.51823	1.0:0.0:0.0:0.0	.	420	Q9H1B7	I2BPL_HUMAN	S	420	ENSP00000238647:F420S	ENSP00000238647:F420S	F	-	2	0	IRF2BPL	76562630	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.290000	0.89925	1.638000	0.50547	0.379000	0.24179	TTC	.		0.592	IRF2BPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414298.1	NM_024496	
TJP1	7082	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	30019082	30019082	+	Silent	SNP	T	T	G			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr15:30019082T>G	ENST00000346128.6	-	17	2688	c.2214A>C	c.(2212-2214)acA>acC	p.T738T	TJP1_ENST00000400011.2_Silent_p.T742T|RP11-680F8.4_ENST00000560740.1_RNA|TJP1_ENST00000545208.2_Silent_p.T738T|TJP1_ENST00000356107.6_Silent_p.T738T	NM_003257.3|NM_175610.2	NP_003248.3|NP_783297.2	Q07157	ZO1_HUMAN	tight junction protein 1	738	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				apoptotic process (GO:0006915)|blastocyst formation (GO:0001825)|cell-cell junction assembly (GO:0007043)|cell-cell signaling involved in cell-cell junction organization (GO:1901350)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to glucose stimulus (GO:0071333)|hippo signaling (GO:0035329)|membrane organization (GO:0061024)|negative regulation of vascular permeability (GO:0043116)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to magnetism (GO:0071000)|sensory perception of sound (GO:0007605)	apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gap junction (GO:0005921)|intercalated disc (GO:0014704)|intercellular canaliculus (GO:0046581)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(4)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(1)	68		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		TCATTCTCATTGTTTTTACTC	0.363																																					p.T738T	Melanoma(77;681 1843 6309 6570)	.											.	TJP1-95	0			c.A2214C						.						161.0	147.0	151.0					15																	30019082		1861	4096	5957	SO:0001819	synonymous_variant	7082	exon17			TCTCATTGTTTTT		CCDS42007.1, CCDS45199.1, CCDS73702.1	15q13	2012-07-12	2012-07-12		ENSG00000104067	ENSG00000104067			11827	protein-coding gene	gene with protein product	"""zona occludens 1"", ""tight junction protein ZO-1"""	601009				8825647	Standard	XM_005254616		Approved	ZO-1, MGC133289, DKFZp686M05161	uc001zcr.3	Q07157	OTTHUMG00000137397	ENST00000346128.6:c.2214A>C	15.37:g.30019082T>G		Somatic	131	0		WXS	Illumina HiSeq	Phase_I	110	26	NM_175610	0	0	0	0	0	B4E3K1|Q2NKP3|Q4ZGJ6	Silent	SNP	ENST00000346128.6	37	CCDS42007.1																																																																																			.		0.363	TJP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268237.3	NM_003257	
TP53BP1	7158	ucsc.edu;bcgsc.ca	37	15	43748739	43748739	+	Missense_Mutation	SNP	C	C	T			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr15:43748739C>T	ENST00000263801.3	-	12	2304	c.2052G>A	c.(2050-2052)atG>atA	p.M684I	TP53BP1_ENST00000382044.4_Missense_Mutation_p.M689I|TP53BP1_ENST00000450115.2_Missense_Mutation_p.M689I|TP53BP1_ENST00000382039.3_Missense_Mutation_p.M689I|TP53BP1_ENST00000605155.1_5'Flank	NM_005657.2	NP_005648.1	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1	684					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	damaged DNA binding (GO:0003684)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription cofactor activity (GO:0001104)|telomeric DNA binding (GO:0042162)			breast(4)|endometrium(5)|kidney(7)|large_intestine(22)|lung(13)|ovary(4)|pancreas(2)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(3)	72		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		GAACACTCTCCATATTTTCTT	0.453								Other conserved DNA damage response genes																													p.M689I													.	TP53BP1-294	0			c.G2067A						.						103.0	107.0	106.0					15																	43748739		2201	4298	6499	SO:0001583	missense	7158	exon12			ACTCTCCATATTT	U09477	CCDS10096.1, CCDS45250.1, CCDS45251.1	15q15-q21	2007-08-02	2007-08-02		ENSG00000067369	ENSG00000067369			11999	protein-coding gene	gene with protein product		605230	"""tumor protein p53-binding protein, 1"""			8016121, 9748285	Standard	NM_005657		Approved	53BP1, p202	uc001zrr.4	Q12888	OTTHUMG00000059757	ENST00000263801.3:c.2052G>A	15.37:g.43748739C>T	ENSP00000263801:p.Met684Ile	Somatic	130	2		WXS	Illumina HiSeq		93	30	NM_001141980	0	0	0	0	0	F8VY86|Q2M1Z7|Q4LE46|Q5FWZ3|Q7Z3U4	Missense_Mutation	SNP	ENST00000263801.3	37	CCDS10096.1	.	.	.	.	.	.	.	.	.	.	C	4.757	0.140854	0.09083	.	.	ENSG00000067369	ENST00000263801;ENST00000382044;ENST00000382039;ENST00000450115;ENST00000413546	T;T;T;T;T	0.54071	0.59;0.59;0.59;0.59;0.59	4.94	4.02	0.46733	.	0.617223	0.16860	N	0.196566	T	0.34890	0.0913	N	0.19112	0.55	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.17077	-1.0381	10	0.35671	T	0.21	-1.1578	8.3535	0.32316	0.0:0.7608:0.1558:0.0834	.	689;684;689;689	B7Z3E7;Q12888;Q12888-2;F8VY86	.;TP53B_HUMAN;.;.	I	684;689;689;689;689	ENSP00000263801:M684I;ENSP00000371475:M689I;ENSP00000371470:M689I;ENSP00000393497:M689I;ENSP00000388028:M689I	ENSP00000263801:M684I	M	-	3	0	TP53BP1	41536031	0.024000	0.19004	0.838000	0.33150	0.330000	0.28571	1.028000	0.30128	1.203000	0.43233	0.563000	0.77884	ATG	.		0.453	TP53BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132897.3		
HMG20A	10363	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	77750833	77750833	+	Silent	SNP	C	C	G			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr15:77750833C>G	ENST00000381714.3	+	3	512	c.84C>G	c.(82-84)acC>acG	p.T28T	HMG20A_ENST00000336216.4_Silent_p.T28T	NM_018200.2	NP_060670.1	Q9NP66	HM20A_HUMAN	high mobility group 20A	28					chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18						ATCTGGCTACCACTGGGTAAG	0.453																																					p.T28T		.											.	HMG20A-228	0			c.C84G						.						92.0	88.0	89.0					15																	77750833		2196	4294	6490	SO:0001819	synonymous_variant	10363	exon3			GGCTACCACTGGG	AF146222	CCDS10295.1	15q24	2011-07-01	2011-04-05		ENSG00000140382	ENSG00000140382		"""High mobility group / Non-canonical"""	5001	protein-coding gene	gene with protein product	"""HMG box domain containing 1"""	605534	"""high-mobility group 20A"""			10773667	Standard	NM_018200		Approved	HMGX1, FLJ10739, HMGXB1	uc002bcr.3	Q9NP66	OTTHUMG00000143729	ENST00000381714.3:c.84C>G	15.37:g.77750833C>G		Somatic	64	0		WXS	Illumina HiSeq	Phase_I	45	15	NM_018200	0	0	0	0	0	A6NHY3|D3DW78|Q53G31|Q9NSF6	Silent	SNP	ENST00000381714.3	37	CCDS10295.1																																																																																			.		0.453	HMG20A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419512.2	NM_018200	
IREB2	3658	broad.mit.edu	37	15	78758793	78758793	+	Silent	SNP	A	A	T			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr15:78758793A>T	ENST00000258886.8	+	5	740	c.591A>T	c.(589-591)acA>acT	p.T197T	IREB2_ENST00000560440.1_Silent_p.T197T|IREB2_ENST00000559427.1_3'UTR	NM_004136.2	NP_004127	P48200	IREB2_HUMAN	iron-responsive element binding protein 2	197					aging (GO:0007568)|cellular iron ion homeostasis (GO:0006879)|cellular response to hypoxia (GO:0071456)|erythrocyte homeostasis (GO:0034101)|intestinal absorption (GO:0050892)|iron ion transport (GO:0006826)|osteoclast differentiation (GO:0030316)|post-embryonic development (GO:0009791)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to iron(II) ion (GO:0010040)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|iron-responsive element binding (GO:0030350)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|translation repressor activity (GO:0030371)			central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	41				UCEC - Uterine corpus endometrioid carcinoma (272;0.232)		TTGAGAATACACCCATCCTGT	0.413																																					p.T197T	NSCLC(200;764 2208 35157 49871 50830)												.	IREB2-90	0			c.A591T						.						129.0	125.0	126.0					15																	78758793		2196	4293	6489	SO:0001819	synonymous_variant	3658	exon5			GAATACACCCATC	M58511	CCDS10302.1	15q25.1	2013-09-20			ENSG00000136381	ENSG00000136381			6115	protein-coding gene	gene with protein product		147582				2172968	Standard	NM_004136		Approved	IRP2	uc002bdr.2	P48200	OTTHUMG00000143861	ENST00000258886.8:c.591A>T	15.37:g.78758793A>T		Somatic	143	0		WXS	Illumina HiSeq	Phase_I	91	4	NM_004136	0	0	0	0	0	A8KAC7|E1CJT9|H0YKU0|Q13095|Q1HE21|Q59FQ7|Q8WVK6|Q9UF17	Silent	SNP	ENST00000258886.8	37	CCDS10302.1																																																																																			.		0.413	IREB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000290109.3	NM_004136	
APOBR	55911	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	28509637	28509637	+	Missense_Mutation	SNP	C	C	G			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr16:28509637C>G	ENST00000431282.1	+	4	3174	c.3164C>G	c.(3163-3165)cCg>cGg	p.P1055R	APOBR_ENST00000564831.1_Missense_Mutation_p.P1064R|CLN3_ENST00000569430.1_5'Flank|CLN3_ENST00000567160.1_5'Flank|APOBR_ENST00000328423.5_Intron			Q0VD83	APOBR_HUMAN	apolipoprotein B receptor	1055					cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|triglyceride metabolic process (GO:0006641)	chylomicron (GO:0042627)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|skin(2)|stomach(1)	29						GATGGGACCCCGGTGCCAGCC	0.672																																					p.P1064R		.											.	APOBR-90	0			c.C3191G						.						16.0	21.0	19.0					16																	28509637		1941	4148	6089	SO:0001583	missense	55911	exon3			GGACCCCGGTGCC	AK025123	CCDS58442.1	16p11.2	2011-02-14			ENSG00000184730	ENSG00000184730			24087	protein-coding gene	gene with protein product	"""apolipoprotein B48 receptor"", ""apolipoprotein B100 receptor"""	605220				10852956	Standard	NM_018690		Approved	APOB48R, APOB100R	uc002dqb.2	Q0VD83		ENST00000431282.1:c.3164C>G	16.37:g.28509637C>G	ENSP00000416094:p.Pro1055Arg	Somatic	55	0		WXS	Illumina HiSeq	Phase_I	93	10	NM_018690	0	0	43	43	0	H3BU97|Q0VD81|Q8NC15|Q9NPJ9	Missense_Mutation	SNP	ENST00000431282.1	37		.	.	.	.	.	.	.	.	.	.	C	13.49	2.251925	0.39797	.	.	ENSG00000184730	ENST00000431282	T	0.61742	0.08	4.84	4.84	0.62591	.	.	.	.	.	T	0.62962	0.2471	L	0.34521	1.04	0.34997	D	0.755616	D;D	0.71674	0.998;0.998	D;D	0.64687	0.928;0.928	T	0.69026	-0.5254	8	.	.	.	-4.4525	13.4548	0.61193	0.0:1.0:0.0:0.0	.	1055;1055	Q0VD83;Q9NS13	APOBR_HUMAN;.	R	1055	ENSP00000416094:P1055R	.	P	+	2	0	APOBR	28417138	0.950000	0.32346	0.996000	0.52242	0.736000	0.42039	2.535000	0.45685	2.236000	0.73375	0.457000	0.33378	CCG	.		0.672	APOBR-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_182804	
SF3B3	23450	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	70605581	70605581	+	Silent	SNP	G	G	A			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr16:70605581G>A	ENST00000302516.5	+	26	3730	c.3519G>A	c.(3517-3519)gtG>gtA	p.V1173V		NM_012426.4	NP_036558.3	Q15393	SF3B3_HUMAN	splicing factor 3b, subunit 3, 130kDa	1173					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|protein complex assembly (GO:0006461)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	nucleic acid binding (GO:0003676)			breast(2)|endometrium(8)|kidney(2)|large_intestine(8)|liver(3)|lung(21)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	53		Ovarian(137;0.0694)				CTTAGAATGTGATTGATGGAG	0.428																																					p.V1173V		.											.	SF3B3-91	0			c.G3519A						.						51.0	48.0	49.0					16																	70605581		2198	4300	6498	SO:0001819	synonymous_variant	23450	exon26			GAATGTGATTGAT	AJ001443	CCDS10894.1	16q22	2008-08-01	2002-08-29		ENSG00000189091	ENSG00000189091			10770	protein-coding gene	gene with protein product		605592	"""splicing factor 3b, subunit 3, 130kD"""			10490618	Standard	NM_012426		Approved	SAP130, SF3b130, RSE1, KIAA0017	uc002ezf.3	Q15393	OTTHUMG00000137582	ENST00000302516.5:c.3519G>A	16.37:g.70605581G>A		Somatic	73	0		WXS	Illumina HiSeq	Phase_I	93	24	NM_012426	0	0	0	0	0	Q6NTI8|Q96GC0|Q9BPY2|Q9UFX7|Q9UJ29	Silent	SNP	ENST00000302516.5	37	CCDS10894.1																																																																																			.		0.428	SF3B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268972.1	NM_012426	
TRPV3	162514	broad.mit.edu	37	17	3438998	3438998	+	Missense_Mutation	SNP	G	G	T			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr17:3438998G>T	ENST00000576742.1	-	7	974	c.653C>A	c.(652-654)gCg>gAg	p.A218E	TRPV3_ENST00000301365.4_Missense_Mutation_p.A218E|TRPV3_ENST00000572519.1_Missense_Mutation_p.A218E	NM_001258205.1|NM_145068.3	NP_001245134.1|NP_659505.1	Q8NET8	TRPV3_HUMAN	transient receptor potential cation channel, subfamily V, member 3	218					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|negative regulation of hair cycle (GO:0042636)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium channel activity (GO:0005262)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(12)|ovary(5)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	35					Menthol(DB00825)	GATGTTCAGCGCCGTCTGCCC	0.736																																					p.A218E													.	TRPV3-94	0			c.C653A						.						8.0	9.0	9.0					17																	3438998		2163	4231	6394	SO:0001583	missense	162514	exon7			TTCAGCGCCGTCT	AF514998	CCDS11029.1, CCDS58500.1	17p13.3	2013-01-10			ENSG00000167723	ENSG00000167723		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18084	protein-coding gene	gene with protein product		607066				12016205, 12077606, 16382100	Standard	NM_001258205		Approved	VRL3	uc002fvr.3	Q8NET8	OTTHUMG00000090695	ENST00000576742.1:c.653C>A	17.37:g.3438998G>T	ENSP00000461518:p.Ala218Glu	Somatic	77	1		WXS	Illumina HiSeq	Phase_I	26	4	NM_001258205	0	0	0	0	0	Q8NDW7|Q8NET9|Q8NFH2	Missense_Mutation	SNP	ENST00000576742.1	37	CCDS11029.1	.	.	.	.	.	.	.	.	.	.	G	36	5.688246	0.96784	.	.	ENSG00000167723	ENST00000381913;ENST00000301365;ENST00000430263	T	0.71341	-0.56	5.03	5.03	0.67393	Ankyrin repeat-containing domain (4);	0.000000	0.64402	D	0.000001	D	0.89491	0.6730	H	0.96111	3.77	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.998;0.999;0.997;0.999;1.0;1.0;0.997	D;D;D;D;D;D;P	0.91635	0.979;0.993;0.933;0.993;0.999;0.999;0.89	D	0.92506	0.6012	10	0.87932	D	0	-11.7793	18.2979	0.90153	0.0:0.0:1.0:0.0	.	202;202;218;202;218;218;218	E7EV24;B7ZKP9;Q2M3L1;B7ZKP6;Q8NET8-3;Q8NET8;Q8NET8-2	.;.;.;.;.;TRPV3_HUMAN;.	E	218;218;202	ENSP00000301365:A218E	ENSP00000301365:A218E	A	-	2	0	TRPV3	3385748	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.422000	0.97458	2.741000	0.93983	0.555000	0.69702	GCG	.		0.736	TRPV3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000207379.2	NM_145068	
GID4	79018	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	17962263	17962263	+	Missense_Mutation	SNP	T	T	A			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr17:17962263T>A	ENST00000268719.4	+	4	861	c.688T>A	c.(688-690)Tac>Aac	p.Y230N		NM_024052.4	NP_076957.3	Q8IVV7	GID4_HUMAN	GID complex subunit 4	230																	GAATGGAGACTACGTCTTCAT	0.458																																					p.Y230N		.											.	.	0			c.T688A						.						75.0	68.0	71.0					17																	17962263		2203	4300	6503	SO:0001583	missense	79018	exon4			GGAGACTACGTCT	AK127580	CCDS11190.1	17p11.2	2013-07-31	2013-07-31	2012-07-20	ENSG00000141034	ENSG00000141034			28453	protein-coding gene	gene with protein product	"""vacuolar import and degradation 24"""		"""chromosome 17 open reading frame 39"", ""GID complex subunit 4, VID24 homolog (S. cerevisiae)"""	C17orf39		11997338	Standard	NM_024052		Approved	VID24	uc002gsg.1	Q8IVV7	OTTHUMG00000059398	ENST00000268719.4:c.688T>A	17.37:g.17962263T>A	ENSP00000268719:p.Tyr230Asn	Somatic	111	0		WXS	Illumina HiSeq	Phase_I	125	33	NM_024052	0	0	6	10	4	Q8TEB5|Q9BW50	Missense_Mutation	SNP	ENST00000268719.4	37	CCDS11190.1	.	.	.	.	.	.	.	.	.	.	T	15.99	2.995621	0.54147	.	.	ENSG00000141034	ENST00000268719	.	.	.	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.55862	0.1947	L	0.48642	1.525	0.80722	D	1	B	0.24317	0.101	B	0.20184	0.028	T	0.51387	-0.8712	9	0.23302	T	0.38	-15.1166	16.1549	0.81657	0.0:0.0:0.0:1.0	.	230	Q8IVV7	CQ039_HUMAN	N	230	.	ENSP00000268719:Y230N	Y	+	1	0	C17orf39	17902988	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	7.797000	0.85911	2.209000	0.71365	0.533000	0.62120	TAC	.		0.458	GID4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132071.2	NM_024052	
CORO6	84940	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	27948314	27948314	+	Silent	SNP	G	G	A			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr17:27948314G>A	ENST00000445145.2	-	1	127	c.126C>T	c.(124-126)gtC>gtT	p.V42V	CORO6_ENST00000580212.1_Silent_p.V42V|CORO6_ENST00000345068.5_Silent_p.V42V|RP11-68I3.10_ENST00000582367.1_RNA|RP11-68I3.2_ENST00000581474.1_RNA|CORO6_ENST00000577909.1_Intron|CORO6_ENST00000584969.1_Silent_p.V42V|CORO6_ENST00000388767.3_Silent_p.V42V			Q6QEF8	CORO6_HUMAN	coronin 6	42					actin cytoskeleton organization (GO:0030036)	actin cytoskeleton (GO:0015629)	actin filament binding (GO:0051015)			breast(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(4)|prostate(1)|urinary_tract(2)	14						ATTTGGGGTTGACGGCACAGA	0.592																																					p.V42V													.	CORO6-90	0			c.C126T						.						75.0	80.0	78.0					17																	27948314		2187	4295	6482	SO:0001819	synonymous_variant	84940	exon1			GGGGTTGACGGCA	AF193039	CCDS11252.2	17q11.2	2013-01-10			ENSG00000167549	ENSG00000167549		"""Coronins"", ""WD repeat domain containing"""	21356	protein-coding gene	gene with protein product							Standard	NM_032854		Approved	FLJ14871	uc002hel.2	Q6QEF8	OTTHUMG00000132732	ENST00000445145.2:c.126C>T	17.37:g.27948314G>A		Somatic	83	1		WXS	Illumina HiSeq	Phase_I	119	48	NM_032854	0	0	0	0	0	B3KU26|Q71MF3|Q8WYH7|Q96K02	Silent	SNP	ENST00000445145.2	37																																																																																				.		0.592	CORO6-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000447831.1	NM_032854	
KRTAP3-2	83897	bcgsc.ca	37	17	39155883	39155883	+	Missense_Mutation	SNP	G	G	C			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr17:39155883G>C	ENST00000391587.1	-	1	255	c.223C>G	c.(223-225)Ccg>Gcg	p.P75A		NM_031959.2	NP_114165.1	Q9BYR7	KRA32_HUMAN	keratin associated protein 3-2	75						keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			endometrium(1)|large_intestine(1)|lung(1)	3		Breast(137;0.00043)				TCCAGGCCCGGAGTTGGCTGG	0.622																																					p.P75A													.	.	0			c.C223G						.						61.0	79.0	73.0					17																	39155883		2201	4296	6497	SO:0001583	missense	83897	exon1			GGCCCGGAGTTGG	AJ406932	CCDS32644.1	17q21.2	2013-06-25			ENSG00000212900	ENSG00000212900		"""Keratin associated proteins"""	16779	protein-coding gene	gene with protein product						11279113	Standard	NM_031959		Approved	KAP3.2	uc002hvs.3	Q9BYR7	OTTHUMG00000133581	ENST00000391587.1:c.223C>G	17.37:g.39155883G>C	ENSP00000375429:p.Pro75Ala	Somatic	107	3		WXS	Illumina HiSeq	Phase_1	153	90	NM_031959	0	0	0	0	0		Missense_Mutation	SNP	ENST00000391587.1	37	CCDS32644.1	.	.	.	.	.	.	.	.	.	.	G	11.70	1.718303	0.30503	.	.	ENSG00000212900	ENST00000391587	T	0.34472	1.36	5.76	5.76	0.90799	.	0.000000	0.56097	D	0.000025	T	0.47154	0.1430	.	.	.	0.38317	D	0.943408	P	0.45348	0.856	P	0.48454	0.578	T	0.53222	-0.8469	9	0.72032	D	0.01	.	15.5326	0.75977	0.0:0.0:1.0:0.0	.	75	Q9BYR7	KRA32_HUMAN	A	75	ENSP00000375429:P75A	ENSP00000375429:P75A	P	-	1	0	KRTAP3-2	36409409	1.000000	0.71417	0.922000	0.36590	0.095000	0.18619	4.486000	0.60286	2.732000	0.93576	0.558000	0.71614	CCG	.		0.622	KRTAP3-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257685.1		
ACOX1	51	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	73953542	73953542	+	Missense_Mutation	SNP	C	C	G			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr17:73953542C>G	ENST00000301608.4	-	4	596	c.536G>C	c.(535-537)gGg>gCg	p.G179A	ACOX1_ENST00000293217.5_Missense_Mutation_p.G179A|ACOX1_ENST00000591857.1_5'UTR|ACOX1_ENST00000537812.1_Missense_Mutation_p.G141A	NM_007292.5	NP_009223.2	Q15067	ACOX1_HUMAN	acyl-CoA oxidase 1, palmitoyl	179					alpha-linolenic acid metabolic process (GO:0036109)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|fatty acid oxidation (GO:0019395)|generation of precursor metabolites and energy (GO:0006091)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|peroxisome fission (GO:0016559)|positive regulation of cholesterol homeostasis (GO:2000189)|prostaglandin metabolic process (GO:0006693)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid metabolic process (GO:0000038)	membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	acyl-CoA dehydrogenase activity (GO:0003995)|acyl-CoA oxidase activity (GO:0003997)|FAD binding (GO:0071949)|fatty acid binding (GO:0005504)|flavin adenine dinucleotide binding (GO:0050660)|palmitoyl-CoA oxidase activity (GO:0016401)|PDZ domain binding (GO:0030165)|protein N-terminus binding (GO:0047485)|receptor binding (GO:0005102)			large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(1)	14					Flavin adenine dinucleotide(DB03147)	TCACTTACGCCCACCAGGCCA	0.443																																					p.G179A													.	ACOX1-91	0			c.G536C						.						112.0	106.0	108.0					17																	73953542		2203	4300	6503	SO:0001583	missense	51	exon4			TTACGCCCACCAG	U03254	CCDS11734.1, CCDS11735.1	17q25.1	2012-10-04	2010-04-30		ENSG00000161533	ENSG00000161533	1.3.3.6		119	protein-coding gene	gene with protein product		609751	"""acyl-Coenzyme A oxidase 1, palmitoyl"""			8159712	Standard	NM_007292		Approved	PALMCOX	uc002jqe.3	Q15067	OTTHUMG00000180027	ENST00000301608.4:c.536G>C	17.37:g.73953542C>G	ENSP00000301608:p.Gly179Ala	Somatic	148	2		WXS	Illumina HiSeq	Phase_I	149	73	NM_007292	0	0	0	0	0	A8K6X8|A8KAA0|B4DK61|F5GYQ8|Q12863|Q15068|Q15101|Q16131|Q7Z3W5|Q9UD31	Missense_Mutation	SNP	ENST00000301608.4	37	CCDS11735.1	.	.	.	.	.	.	.	.	.	.	C	16.05	3.012128	0.54468	.	.	ENSG00000161533	ENST00000301608;ENST00000293217;ENST00000537812;ENST00000539791;ENST00000538781	T;T;T	0.69685	-0.42;-0.42;-0.42	5.64	5.64	0.86602	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA oxidase/dehydrogenase, central domain (2);	0.096704	0.64402	D	0.000001	T	0.69593	0.3128	L	0.60845	1.875	0.80722	D	1	P;P;B;B	0.35481	0.504;0.504;0.329;0.446	B;B;B;B	0.40285	0.117;0.232;0.325;0.107	T	0.67260	-0.5715	10	0.37606	T	0.19	-20.1018	19.7014	0.96054	0.0:1.0:0.0:0.0	.	111;141;179;179	F5H0M0;F5GYQ8;Q15067;Q15067-2	.;.;ACOX1_HUMAN;.	A	179;179;141;179;111	ENSP00000301608:G179A;ENSP00000293217:G179A;ENSP00000441257:G141A	ENSP00000293217:G179A	G	-	2	0	ACOX1	71465137	1.000000	0.71417	0.988000	0.46212	0.923000	0.55619	7.480000	0.81109	2.657000	0.90304	0.637000	0.83480	GGG	.		0.443	ACOX1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439503.1		
FASN	2194	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	80047603	80047603	+	Splice_Site	SNP	C	C	G			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr17:80047603C>G	ENST00000306749.2	-	12	2089		c.e12-1			NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase						acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	CAGGACAAGCCTATGGCAGAG	0.652																																					.	Colon(59;314 1043 11189 28578 32273)	.											.	FASN-90	0			c.1871-1G>C						.						16.0	15.0	16.0					17																	80047603		2171	4272	6443	SO:0001630	splice_region_variant	2194	exon13			ACAAGCCTATGGC	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.1871-1G>C	17.37:g.80047603C>G		Somatic	84	0		WXS	Illumina HiSeq	Phase_I	92	15	NM_004104	0	0	0	0	0	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Splice_Site	SNP	ENST00000306749.2	37	CCDS11801.1	.	.	.	.	.	.	.	.	.	.	C	15.55	2.865470	0.51588	.	.	ENSG00000169710	ENST00000306749	.	.	.	4.4	4.4	0.53042	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.9623	0.86275	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	FASN	77640892	1.000000	0.71417	0.168000	0.22838	0.067000	0.16453	5.505000	0.66981	1.997000	0.58415	0.561000	0.74099	.	.		0.652	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1	NM_004104	Intron
ANKRD29	147463	bcgsc.ca	37	18	21214114	21214114	+	Splice_Site	SNP	C	C	T			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr18:21214114C>T	ENST00000592179.1	-	5	485		c.e5-1		ANKRD29_ENST00000284207.7_Splice_Site|ANKRD29_ENST00000322980.9_Splice_Site	NM_173505.2	NP_775776.2	Q8N6D5	ANR29_HUMAN	ankyrin repeat domain 29											breast(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(3)|prostate(1)|skin(1)	13	all_cancers(21;5.07e-05)|all_epithelial(16;2.49e-07)|Lung NSC(20;0.00211)|all_lung(20;0.00676)|Colorectal(14;0.0202)|Ovarian(20;0.127)					TGCCCCCGTCCTATGGACATG	0.502																																					.													.	ANKRD29-156	0			c.331-1G>A						.						72.0	58.0	63.0					18																	21214114		2203	4300	6503	SO:0001630	splice_region_variant	147463	exon6			CCCGTCCTATGGA	AK057782	CCDS11879.1	18q11.2	2013-01-10			ENSG00000154065	ENSG00000154065		"""Ankyrin repeat domain containing"""	27110	protein-coding gene	gene with protein product							Standard	NM_173505		Approved	FLJ25053	uc002kun.3	Q8N6D5	OTTHUMG00000131875	ENST00000592179.1:c.331-1G>A	18.37:g.21214114C>T		Somatic	53	1		WXS	Illumina HiSeq	Phase_1	56	18	NM_173505	0	0	0	0	0	B2R972|Q6ZWE8|Q96LU9	Splice_Site	SNP	ENST00000592179.1	37	CCDS11879.1	.	.	.	.	.	.	.	.	.	.	C	13.64	2.298068	0.40694	.	.	ENSG00000154065	ENST00000322980;ENST00000284207	.	.	.	5.66	5.66	0.87406	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.8957	0.92423	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ANKRD29	19468112	1.000000	0.71417	0.986000	0.45419	0.061000	0.15899	6.746000	0.74866	2.832000	0.97577	0.655000	0.94253	.	.		0.502	ANKRD29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254825.1	NM_173505	Intron
MUC16	94025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	9057871	9057871	+	Missense_Mutation	SNP	G	G	A			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr19:9057871G>A	ENST00000397910.4	-	3	29778	c.29575C>T	c.(29575-29577)Cct>Tct	p.P9859S		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9861	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GAGAAGGCAGGATTTGATGTG	0.478																																					p.P9859S		.											.	MUC16-566	0			c.C29575T						.						147.0	138.0	141.0					19																	9057871		1987	4169	6156	SO:0001583	missense	94025	exon3			AGGCAGGATTTGA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.29575C>T	19.37:g.9057871G>A	ENSP00000381008:p.Pro9859Ser	Somatic	140	0		WXS	Illumina HiSeq	Phase_I	123	36	NM_024690	0	0	0	0	0	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	3.787	-0.044427	0.07452	.	.	ENSG00000181143	ENST00000397910	T	0.26223	1.75	2.62	0.396	0.16309	.	.	.	.	.	T	0.23330	0.0564	N	0.14661	0.345	.	.	.	D	0.54207	0.965	P	0.59703	0.862	T	0.26503	-1.0101	8	0.87932	D	0	.	3.8274	0.08859	0.1494:0.2545:0.5961:0.0	.	9859	B5ME49	.	S	9859	ENSP00000381008:P9859S	ENSP00000381008:P9859S	P	-	1	0	MUC16	8918871	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-1.124000	0.03260	0.181000	0.19994	-1.109000	0.02080	CCT	.		0.478	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
CARM1	10498	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	11019856	11019856	+	Silent	SNP	G	G	A			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr19:11019856G>A	ENST00000327064.4	+	4	721	c.531G>A	c.(529-531)ctG>ctA	p.L177L	CARM1_ENST00000344150.4_Silent_p.L177L	NM_199141.1	NP_954592.1	Q86X55	CARM1_HUMAN	coactivator-associated arginine methyltransferase 1	177	SAM-dependent MTase PRMT-type. {ECO:0000255|PROSITE-ProRule:PRU01015}.				cellular lipid metabolic process (GO:0044255)|endochondral bone morphogenesis (GO:0060350)|histone H3-R17 methylation (GO:0034971)|histone H3-R2 methylation (GO:0034970)|histone methylation (GO:0016571)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of protein binding (GO:0032091)|pathogenesis (GO:0009405)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|regulation of growth plate cartilage chondrocyte proliferation (GO:0003420)|regulation of intracellular estrogen receptor signaling pathway (GO:0033146)|regulation of transcription, DNA-templated (GO:0006355)|response to cAMP (GO:0051591)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	beta-catenin binding (GO:0008013)|histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H3-R17 specific) (GO:0035642)|histone-arginine N-methyltransferase activity (GO:0008469)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|lysine-acetylated histone binding (GO:0070577)|protein methyltransferase activity (GO:0008276)|protein-arginine N-methyltransferase activity (GO:0016274)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|urinary_tract(1)	13						GCGCCATCCTGCAAAACCACA	0.517																																					p.L177L													.	CARM1-90	0			c.G531A						.						102.0	77.0	86.0					19																	11019856		2203	4300	6503	SO:0001819	synonymous_variant	10498	exon4			CATCCTGCAAAAC	AF055027	CCDS12250.1	19p13.2	2010-10-11			ENSG00000142453	ENSG00000142453		"""Protein arginine methyltransferases"""	23393	protein-coding gene	gene with protein product		603934				10381882, 11724789	Standard	NM_199141		Approved	PRMT4	uc002mpz.3	Q86X55		ENST00000327064.4:c.531G>A	19.37:g.11019856G>A		Somatic	73	1		WXS	Illumina HiSeq	Phase_I	60	20	NM_199141	0	0	5	13	8	A6NN38	Silent	SNP	ENST00000327064.4	37	CCDS12250.1																																																																																			.		0.517	CARM1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452625.1	XM_032719	
ZNF45	7596	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	44419046	44419046	+	Missense_Mutation	SNP	A	A	C			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr19:44419046A>C	ENST00000269973.5	-	10	1632	c.542T>G	c.(541-543)aTt>aGt	p.I181S	RP11-15A1.2_ENST00000586247.1_RNA|ZNF45_ENST00000589703.1_Missense_Mutation_p.I181S	NM_003425.3	NP_003416.1	Q02386	ZNF45_HUMAN	zinc finger protein 45	181					gene expression (GO:0010467)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	17						CCTTTGGTTAATTTGAAGATG	0.443																																					p.I181S		.											.	ZNF45-91	0			c.T542G						.						126.0	128.0	127.0					19																	44419046		2203	4300	6503	SO:0001583	missense	7596	exon10			TGGTTAATTTGAA	M67509	CCDS12632.1	19q13.2	2013-01-08	2005-01-11			ENSG00000124459		"""Zinc fingers, C2H2-type"", ""-"""	13111	protein-coding gene	gene with protein product		194554	"""zinc finger protein 45 (a Kruppel-associated box (KRAB) domain polypeptide)"", ""zinc finger protein 13"""	ZNF13		9067431	Standard	NM_003425		Approved		uc002oxw.2	Q02386		ENST00000269973.5:c.542T>G	19.37:g.44419046A>C	ENSP00000269973:p.Ile181Ser	Somatic	86	0		WXS	Illumina HiSeq	Phase_I	74	25	NM_003425	0	0	0	1	1	P17016|P78472|Q9P1U9	Missense_Mutation	SNP	ENST00000269973.5	37	CCDS12632.1	.	.	.	.	.	.	.	.	.	.	A	6.279	0.419509	0.11928	.	.	ENSG00000124459	ENST00000269973;ENST00000328762	T	0.15139	2.45	3.91	-3.04	0.05412	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	2.004110	0.02863	N	0.130523	T	0.07279	0.0184	N	0.13299	0.325	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.18178	-1.0345	10	0.08179	T	0.78	0.9799	0.481	0.00547	0.3318:0.133:0.2741:0.2611	.	181	Q02386	ZNF45_HUMAN	S	181	ENSP00000269973:I181S	ENSP00000269973:I181S	I	-	2	0	ZNF45	49110886	0.000000	0.05858	0.000000	0.03702	0.251000	0.25915	-5.448000	0.00121	-0.856000	0.04120	0.260000	0.18958	ATT	.		0.443	ZNF45-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459919.1	NM_003425	
ZNF534	147658	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	52941044	52941044	+	Missense_Mutation	SNP	T	T	A			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr19:52941044T>A	ENST00000332323.6	+	4	431	c.370T>A	c.(370-372)Tta>Ata	p.L124I	ZNF534_ENST00000433050.1_Missense_Mutation_p.L111I|ZNF534_ENST00000432303.2_Intron|ZNF534_ENST00000301085.4_Intron	NM_001143939.1	NP_001137411.1	Q76KX8	ZN534_HUMAN	zinc finger protein 534	124					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|lung(1)|prostate(1)|skin(1)	4						TCAACATGGATTAACTCTTCA	0.353																																					p.L124I		.											.	ZNF534-68	0			c.T370A						.						71.0	60.0	63.0					19																	52941044		1568	3582	5150	SO:0001583	missense	147658	exon4			CATGGATTAACTC	AK058073	CCDS46165.1, CCDS46166.1	19q13.41	2013-01-08	2004-02-06	2004-02-11	ENSG00000198633	ENSG00000198633		"""Zinc fingers, C2H2-type"", ""-"""	26337	protein-coding gene	gene with protein product			"""KRAB domain only 3"""	KRBO3			Standard	NM_001143938		Approved	FLJ25344	uc002pzk.3	Q76KX8	OTTHUMG00000156493	ENST00000332323.6:c.370T>A	19.37:g.52941044T>A	ENSP00000327538:p.Leu124Ile	Somatic	455	0		WXS	Illumina HiSeq	Phase_I	257	82	NM_001143939	0	0	0	0	0	Q76KX9	Missense_Mutation	SNP	ENST00000332323.6	37	CCDS46165.1	.	.	.	.	.	.	.	.	.	.	T	9.193	1.026520	0.19512	.	.	ENSG00000198633	ENST00000332323;ENST00000433050;ENST00000391790	T;T	0.07444	3.19;3.23	1.69	1.69	0.24217	.	.	.	.	.	T	0.11750	0.0286	M	0.62723	1.935	0.09310	N	1	P;P	0.44344	0.833;0.524	P;B	0.45276	0.475;0.095	T	0.14309	-1.0477	9	0.45353	T	0.12	.	6.6481	0.22947	0.0:0.0:0.0:1.0	.	111;124	Q76KX8-2;Q76KX8	.;ZN534_HUMAN	I	124;111;123	ENSP00000327538:L124I;ENSP00000391358:L111I	ENSP00000327538:L124I	L	+	1	2	ZNF534	57632856	0.001000	0.12720	0.012000	0.15200	0.302000	0.27658	-0.032000	0.12266	0.751000	0.32900	0.172000	0.16884	TTA	.		0.353	ZNF534-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460877.1	NM_182512	
FAM228A	653140	ucsc.edu;bcgsc.ca	37	2	24413283	24413283	+	Missense_Mutation	SNP	C	C	T			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr2:24413283C>T	ENST00000295150.3	+	6	490	c.404C>T	c.(403-405)cCt>cTt	p.P135L	RP11-507M3.1_ENST00000584973.1_3'UTR	NM_001040710.1	NP_001035800.1	Q86W67	F228A_HUMAN	family with sequence similarity 228, member A	135																	CTTCACAGTCCTGAAAAGCTC	0.403																																					p.P135L													.	.	0			c.C404T						.						27.0	27.0	27.0					2																	24413283		1863	4086	5949	SO:0001583	missense	653140	exon6			ACAGTCCTGAAAA		CCDS42659.1	2p23.3	2012-07-04	2012-07-04	2012-07-04	ENSG00000186453	ENSG00000186453			34418	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 84"""	C2orf84			Standard	NM_001040710		Approved	FLJ30851	uc002rfc.3	Q86W67	OTTHUMG00000151903	ENST00000295150.3:c.404C>T	2.37:g.24413283C>T	ENSP00000295150:p.Pro135Leu	Somatic	290	3		WXS	Illumina HiSeq		234	62	NM_001040710	0	0	0	0	0		Missense_Mutation	SNP	ENST00000295150.3	37	CCDS42659.1	.	.	.	.	.	.	.	.	.	.	C	15.53	2.859698	0.51376	.	.	ENSG00000186453	ENST00000295150;ENST00000415196	T;T	0.49432	0.79;0.78	3.64	2.77	0.32553	.	0.665350	0.13290	N	0.399077	T	0.31167	0.0788	N	0.19112	0.55	0.19300	N	0.99998	B	0.22683	0.073	B	0.25884	0.064	T	0.20638	-1.0269	10	0.46703	T	0.11	1.0E-4	7.0592	0.25115	0.0:0.8788:0.0:0.1212	.	135	Q86W67	CB084_HUMAN	L	135;36	ENSP00000295150:P135L;ENSP00000416595:P36L	ENSP00000295150:P135L	P	+	2	0	C2orf84	24266787	0.562000	0.26586	0.120000	0.21714	0.061000	0.15899	0.376000	0.20535	1.121000	0.41925	0.650000	0.86243	CCT	.		0.403	FAM228A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324342.1	NM_001040710	
SOS1	6654	bcgsc.ca	37	2	39284009	39284009	+	Splice_Site	SNP	T	T	C			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr2:39284009T>C	ENST00000426016.1	-	5	432		c.e5-2		SOS1_ENST00000395038.2_Splice_Site|SOS1_ENST00000402219.2_Splice_Site|SOS1_ENST00000428721.2_Splice_Site			Q07889	SOS1_HUMAN	son of sevenless homolog 1 (Drosophila)						apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|Ras protein signal transduction (GO:0007265)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	DNA binding (GO:0003677)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(29)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	75		all_hematologic(82;0.21)				TAGGACCTCCTGCAAAATTAA	0.299									Noonan syndrome																												.													.	SOS1-851	0			c.346-2A>G						.						101.0	117.0	111.0					2																	39284009		2198	4295	6493	SO:0001630	splice_region_variant	6654	exon5	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	ACCTCCTGCAAAA	L13857	CCDS1802.1	2p21	2014-09-17	2002-11-05		ENSG00000115904	ENSG00000115904		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11187	protein-coding gene	gene with protein product		182530	"""gingival fibromatosis, hereditary, 1"""	GINGF		8276400, 10995566	Standard	NM_005633		Approved	HGF, GF1	uc002rrk.4	Q07889	OTTHUMG00000102109	ENST00000426016.1:c.346-2A>G	2.37:g.39284009T>C		Somatic	117	4		WXS	Illumina HiSeq	Phase_1	43	21	NM_005633	0	0	0	0	0	A8K2G3|B4DXG2	Splice_Site	SNP	ENST00000426016.1	37	CCDS1802.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.361515	0.82353	.	.	ENSG00000115904	ENST00000426016;ENST00000402219;ENST00000395038;ENST00000263879;ENST00000428721;ENST00000451331	.	.	.	5.57	5.57	0.84162	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7191	0.77694	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	SOS1	39137513	1.000000	0.71417	0.998000	0.56505	0.968000	0.65278	7.904000	0.87408	2.118000	0.64928	0.377000	0.23210	.	.		0.299	SOS1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219948.3	NM_005633	Intron
GMCL1	64395	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	70096993	70096993	+	Missense_Mutation	SNP	T	T	G			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr2:70096993T>G	ENST00000282570.3	+	12	1612	c.1361T>G	c.(1360-1362)tTt>tGt	p.F454C		NM_178439.3	NP_848526.1	Q96IK5	GMCL1_HUMAN	germ cell-less, spermatogenesis associated 1	454					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)	nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)				endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	15						AGCATAGCATTTAGGTAGGAT	0.398																																					p.F454C		.											.	GMCL1-93	0			c.T1361G						.						138.0	118.0	125.0					2																	70096993		2203	4300	6503	SO:0001583	missense	64395	exon12			TAGCATTTAGGTA	AK023119	CCDS1895.1	2p13.3	2013-01-09	2012-08-20		ENSG00000087338	ENSG00000087338		"""BTB/POZ domain containing"""	23843	protein-coding gene	gene with protein product	"""spermatogenesis associated 29"""		"""germ cell-less homolog 1 (Drosophila)"""				Standard	NM_178439		Approved	FLJ13057, BTBD13, GCL1, SPATA29	uc002sfu.3	Q96IK5	OTTHUMG00000129643	ENST00000282570.3:c.1361T>G	2.37:g.70096993T>G	ENSP00000282570:p.Phe454Cys	Somatic	63	0		WXS	Illumina HiSeq	Phase_I	56	20	NM_178439	0	0	0	0	0	Q9H826|Q9H8V7|Q9H927	Missense_Mutation	SNP	ENST00000282570.3	37	CCDS1895.1	.	.	.	.	.	.	.	.	.	.	T	15.07	2.723230	0.48728	.	.	ENSG00000087338	ENST00000282570	T	0.56103	0.48	5.22	5.22	0.72569	.	0.108148	0.64402	D	0.000004	T	0.63534	0.2519	L	0.44542	1.39	0.46113	D	0.99887	D	0.76494	0.999	D	0.70227	0.968	T	0.64478	-0.6398	10	0.51188	T	0.08	-38.9046	13.3387	0.60533	0.0:0.0:0.0:1.0	.	454	Q96IK5	GMCL1_HUMAN	C	454	ENSP00000282570:F454C	ENSP00000282570:F454C	F	+	2	0	GMCL1	69950497	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	3.799000	0.55529	2.090000	0.63153	0.533000	0.62120	TTT	.		0.398	GMCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251841.2	NM_178439	
CFAP221	200373	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	120362785	120362785	+	Missense_Mutation	SNP	A	A	C			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr2:120362785A>C	ENST00000413369.3	+	11	1140	c.1053A>C	c.(1051-1053)aaA>aaC	p.K351N	PCDP1_ENST00000597189.1_3'UTR|PCDP1_ENST00000602047.1_Missense_Mutation_p.K65N	NM_001271049.1	NP_001257978																Colorectal(110;0.196)					AAATTTCAAAAACGAGACAGA	0.383																																					p.K351N		.											.	.	0			c.A1053C						.						67.0	70.0	69.0					2																	120362785		2203	4300	6503	SO:0001583	missense	0	exon11			TTCAAAAACGAGA																												ENST00000413369.3:c.1053A>C	2.37:g.120362785A>C	ENSP00000393222:p.Lys351Asn	Somatic	419	0		WXS	Illumina HiSeq	Phase_I	280	80	NM_001271049	0	0	2	4	2		Missense_Mutation	SNP	ENST00000413369.3	37	CCDS33282.2	.	.	.	.	.	.	.	.	.	.	A	14.44	2.535164	0.45176	.	.	ENSG00000163075	ENST00000295220;ENST00000413369	T	0.19938	2.11	5.22	2.87	0.33458	.	0.239906	0.36338	N	0.002660	T	0.12433	0.0302	L	0.34521	1.04	0.80722	D	1	P;B	0.35011	0.48;0.291	B;B	0.27715	0.082;0.082	T	0.13872	-1.0493	10	0.27082	T	0.32	-25.951	8.4885	0.33086	0.8403:0.0:0.1597:0.0	.	195;351	Q4G0U5-3;Q4G0U5	.;PCDP1_HUMAN	N	65;351	ENSP00000393222:K351N	ENSP00000295220:K65N	K	+	3	2	AC069154.2	120079255	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	1.660000	0.37397	0.460000	0.27045	0.533000	0.62120	AAA	.		0.383	PCDP1-006	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464236.1		
NIFK	84365	bcgsc.ca	37	2	122494414	122494414	+	Missense_Mutation	SNP	A	A	G			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr2:122494414A>G	ENST00000285814.4	-	1	85	c.13T>C	c.(13-15)Tct>Cct	p.S5P		NM_032390.4	NP_115766.3	Q9BYG3	MK67I_HUMAN		5					negative regulation of phosphatase activity (GO:0010923)|protein complex assembly (GO:0006461)|rRNA metabolic process (GO:0016072)|rRNA transcription (GO:0009303)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|pancreas(1)|urinary_tract(1)	12						GCCGGGCCAGAAAAAGTCGCC	0.627																																					p.S5P													.	MKI67IP-90	0			c.T13C						.						28.0	28.0	28.0					2																	122494414		2203	4300	6503	SO:0001583	missense	84365	exon1			GGCCAGAAAAAGT																												ENST00000285814.4:c.13T>C	2.37:g.122494414A>G	ENSP00000285814:p.Ser5Pro	Somatic	146	3		WXS	Illumina HiSeq	Phase_1	156	53	NM_032390	0	0	4	9	5	A8K788|Q8TB66|Q96ED4	Missense_Mutation	SNP	ENST00000285814.4	37	CCDS2135.1	.	.	.	.	.	.	.	.	.	.	A	10.34	1.324189	0.24080	.	.	ENSG00000155438	ENST00000285814;ENST00000409201;ENST00000451734	T;T	0.35973	2.19;1.28	3.13	-6.26	0.02033	.	2.322460	0.01768	N	0.030964	T	0.24509	0.0594	L	0.33485	1.01	0.09310	N	1	B;P	0.49961	0.013;0.93	B;B	0.41571	0.01;0.36	T	0.40869	-0.9540	10	0.49607	T	0.09	6.4386	3.9147	0.09217	0.2927:0.5044:0.0971:0.1058	.	5;5	B4DSM4;Q9BYG3	.;MK67I_HUMAN	P	5	ENSP00000285814:S5P;ENSP00000398116:S5P	ENSP00000285814:S5P	S	-	1	0	MKI67IP	122210884	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.354000	0.02614	-2.375000	0.00598	-0.489000	0.04712	TCT	.		0.627	MKI67IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254239.2		
SCN1A	6323	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	166908235	166908235	+	Missense_Mutation	SNP	C	C	A			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr2:166908235C>A	ENST00000303395.4	-	6	957	c.958G>T	c.(958-960)Gat>Tat	p.D320Y	AC010127.3_ENST00000595647.1_RNA|SCN1A_ENST00000409050.1_Missense_Mutation_p.D320Y|SCN1A_ENST00000423058.2_Missense_Mutation_p.D320Y|AC010127.3_ENST00000599041.1_RNA|AC010127.3_ENST00000595268.1_RNA|SCN1A_ENST00000375405.3_Missense_Mutation_p.D320Y			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	320					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)			NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TTACTTGAATCTTGAATATAT	0.299																																					p.D320Y													.	SCN1A-147	0			c.G958T						.						39.0	40.0	40.0					2																	166908235		2201	4295	6496	SO:0001583	missense	6323	exon6			TTGAATCTTGAAT	AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.958G>T	2.37:g.166908235C>A	ENSP00000303540:p.Asp320Tyr	Somatic	199	1		WXS	Illumina HiSeq	Phase_I	105	38	NM_001165964	0	0	0	0	0	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Missense_Mutation	SNP	ENST00000303395.4	37	CCDS54413.1	.	.	.	.	.	.	.	.	.	.	C	19.61	3.860340	0.71834	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	D;D;D;D	0.96554	-4.05;-4.05;-4.01;-3.98	5.41	5.41	0.78517	Ion transport (1);	0.161043	0.43919	D	0.000516	D	0.97845	0.9292	M	0.67953	2.075	0.54753	D	0.999989	P;D;D	0.89917	0.841;0.998;1.0	P;D;D	0.87578	0.552;0.974;0.998	D	0.98223	1.0479	10	0.62326	D	0.03	.	19.5538	0.95333	0.0:1.0:0.0:0.0	.	320;320;320	P35498-2;E9PG49;P35498	.;.;SCN1A_HUMAN	Y	320	ENSP00000407030:D320Y;ENSP00000303540:D320Y;ENSP00000364554:D320Y;ENSP00000386312:D320Y	ENSP00000303540:D320Y	D	-	1	0	SCN1A	166616481	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.926000	0.48892	2.688000	0.91661	0.655000	0.94253	GAT	.		0.299	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1	NM_006920	
IHH	3549	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	219920296	219920296	+	Missense_Mutation	SNP	A	A	G			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr2:219920296A>G	ENST00000295731.6	-	3	868	c.869T>C	c.(868-870)tTc>tCc	p.F290S		NM_002181.3	NP_002172.2	Q14623	IHH_HUMAN	indian hedgehog	290					bone resorption (GO:0045453)|camera-type eye photoreceptor cell fate commitment (GO:0060220)|cartilage development (GO:0051216)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-cell signaling (GO:0007267)|chondrocyte proliferation (GO:0035988)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic pattern specification (GO:0009880)|embryonic skeletal joint development (GO:0072498)|epithelial cell morphogenesis (GO:0003382)|epithelial cell-cell adhesion (GO:0090136)|head morphogenesis (GO:0060323)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|intein-mediated protein splicing (GO:0016539)|maternal process involved in female pregnancy (GO:0060135)|multicellular organism growth (GO:0035264)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of eye pigmentation (GO:0048074)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|negative regulation of signal transduction (GO:0009968)|negative regulation of T cell differentiation in thymus (GO:0033085)|neuron development (GO:0048666)|osteoblast differentiation (GO:0001649)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of T cell differentiation in thymus (GO:0033089)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proteoglycan metabolic process (GO:0006029)|regulation of growth (GO:0040008)|response to estradiol (GO:0032355)|retinal pigment epithelium development (GO:0003406)|skeletal system development (GO:0001501)|smooth muscle tissue development (GO:0048745)|smoothened signaling pathway (GO:0007224)|somite development (GO:0061053)|vitelline membrane formation (GO:0030704)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|patched binding (GO:0005113)|peptidase activity (GO:0008233)			breast(1)|endometrium(2)|large_intestine(1)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	14		Renal(207;0.0915)		Epithelial(149;1.13e-06)|all cancers(144;0.000188)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGTGGCCCGGAAGCGGGCTGC	0.667																																					p.F290S													.	IHH-710	0			c.T869C						.						24.0	28.0	26.0					2																	219920296		2202	4299	6501	SO:0001583	missense	3549	exon3			GCCCGGAAGCGGG	L38517	CCDS33380.1	2q33-q35	2013-02-15	2013-02-15		ENSG00000163501	ENSG00000163501			5956	protein-coding gene	gene with protein product		600726	"""Indian hedgehog (Drosophila) homolog"", ""Indian hedgehog homolog (Drosophila)"""			7590746, 14770182	Standard	NM_002181		Approved	HHG2, BDA1	uc002vjo.2	Q14623	OTTHUMG00000154631	ENST00000295731.6:c.869T>C	2.37:g.219920296A>G	ENSP00000295731:p.Phe290Ser	Somatic	67	1		WXS	Illumina HiSeq	Phase_I	60	17	NM_002181	0	0	2	3	1	B9EGM5|O43322|Q8N4B9	Missense_Mutation	SNP	ENST00000295731.6	37	CCDS33380.1	.	.	.	.	.	.	.	.	.	.	A	17.61	3.431635	0.62844	.	.	ENSG00000163501	ENST00000295731	D	0.98792	-5.14	5.16	5.16	0.70880	Hedgehog/intein hint, N-terminal (1);Peptidase C46, hedgehog protein, hint region (1);	0.051418	0.85682	D	0.000000	D	0.97626	0.9222	L	0.57536	1.79	0.45662	D	0.998585	P	0.49185	0.92	P	0.47744	0.556	D	0.97010	0.9735	10	0.20519	T	0.43	-0.671	13.8287	0.63366	1.0:0.0:0.0:0.0	.	290	Q14623	IHH_HUMAN	S	290	ENSP00000295731:F290S	ENSP00000295731:F290S	F	-	2	0	IHH	219628540	0.991000	0.36638	0.999000	0.59377	0.936000	0.57629	1.540000	0.36115	1.929000	0.55896	0.459000	0.35465	TTC	.		0.667	IHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336408.2	NM_002181	
PER2	8864	broad.mit.edu	37	2	239186362	239186362	+	Silent	SNP	C	C	T	rs561050117		TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr2:239186362C>T	ENST00000254657.3	-	2	495	c.216G>A	c.(214-216)ccG>ccA	p.P72P	PER2_ENST00000254658.3_Silent_p.P72P|PER2_ENST00000440245.1_Silent_p.P72P|PER2_ENST00000355768.2_Silent_p.P72P	NM_022817.2	NP_073728.1	O15055	PER2_HUMAN	period circadian clock 2	72					circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|fatty acid metabolic process (GO:0006631)|gluconeogenesis (GO:0006094)|glycogen biosynthetic process (GO:0005978)|histone H3 deacetylation (GO:0070932)|lactate biosynthetic process (GO:0019249)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of DNA-templated transcription, termination (GO:0060567)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of glutamate uptake involved in transmission of nerve impulse (GO:0051946)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of vasoconstriction (GO:0019229)|response to ischemia (GO:0002931)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	pre-mRNA binding (GO:0036002)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|ubiquitin binding (GO:0043130)			NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)		GGCGGGCATCCGGTGGCTCCA	0.577													C|||	1	0.000199681	0.0	0.0	5008	,	,		16985	0.0		0.0	False		,,,				2504	0.001				p.P72P													.	PER2-154	0			c.G216A						.						47.0	48.0	48.0					2																	239186362		2203	4300	6503	SO:0001819	synonymous_variant	8864	exon2			GGCATCCGGTGGC	AB002345	CCDS2528.1	2q37.3	2012-12-13	2012-12-13		ENSG00000132326	ENSG00000132326			8846	protein-coding gene	gene with protein product		603426	"""period (Drosophila) homolog 2"", ""period homolog 2 (Drosophila)"""			9427249, 17218255	Standard	NM_022817		Approved	KIAA0347	uc002vyc.3	O15055	OTTHUMG00000152884	ENST00000254657.3:c.216G>A	2.37:g.239186362C>T		Somatic	30	0		WXS	Illumina HiSeq	Phase_I	27	4	NM_022817	0	0	0	0	0	A2I2P7|Q4ZG49|Q6DT41|Q9UQ45	Silent	SNP	ENST00000254657.3	37	CCDS2528.1																																																																																			.		0.577	PER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257167.1	NM_022817	
CRNKL1	51340	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	20033152	20033152	+	Silent	SNP	G	G	A	rs140622884		TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr20:20033152G>A	ENST00000377340.2	-	2	349	c.318C>T	c.(316-318)gcC>gcT	p.A106A	C20orf26_ENST00000377309.2_5'Flank|C20orf26_ENST00000377306.1_5'Flank|C20orf26_ENST00000245957.5_5'Flank|CRNKL1_ENST00000377327.4_Silent_p.A94A|CRNKL1_ENST00000536226.1_5'Flank|C20orf26_ENST00000389656.3_5'Flank	NM_001278628.1|NM_016652.4	NP_001265557.1|NP_057736.4	Q9BZJ0	CRNL1_HUMAN	crooked neck pre-mRNA splicing factor 1	106					mRNA splicing, via spliceosome (GO:0000398)|spliceosomal complex assembly (GO:0000245)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|cervix(2)|endometrium(7)|large_intestine(11)|lung(12)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(6)	45						CCGTGACGGAGGCGGCACCGT	0.607																																					p.A106A		.											.	CRNKL1-137	0			c.C318T						.	G		1,4405	2.1+/-5.4	0,1,2202	74.0	70.0	71.0		318	-9.0	0.0	20	dbSNP_134	71	0,8600		0,0,4300	no	coding-synonymous	CRNKL1	NM_016652.4		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		106/849	20033152	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	51340	exon2			GACGGAGGCGGCA	AF255443	CCDS33446.1, CCDS63238.1, CCDS63239.1	20p11.2	2013-10-03	2013-10-03		ENSG00000101343	ENSG00000101343			15762	protein-coding gene	gene with protein product	"""SYF3 pre-mRNA-splicing factor"""	610952	"""crooked neck (Drosophila Crn homolog)-like 1"", ""Crn, crooked neck-like 1 (Drosophila)"", ""crooked neck pre-mRNA splicing factor-like 1 (Drosophila)"""				Standard	NM_016652		Approved	CRN, CLF, SYF3, Clf1	uc002wrs.3	Q9BZJ0	OTTHUMG00000032000	ENST00000377340.2:c.318C>T	20.37:g.20033152G>A		Somatic	86	0		WXS	Illumina HiSeq	Phase_I	131	38	NM_016652	0	0	0	0	0	A8K9T4|Q5JY64|Q8WYI5|Q9BZI9|Q9BZJ1|Q9BZJ2|Q9GZW7|Q9H8F8|Q9NQH5|Q9NYD8	Silent	SNP	ENST00000377340.2	37	CCDS33446.1																																																																																			G|1.000;A|0.000		0.607	CRNKL1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000127787.1		
FRG1B	284802	bcgsc.ca	37	20	29623215	29623215	+	Silent	SNP	G	G	A	rs77485836	byFrequency	TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr20:29623215G>A	ENST00000278882.3	+	3	407	c.27G>A	c.(25-27)tcG>tcA	p.S9S	FRG1B_ENST00000358464.4_Silent_p.S9S|FRG1B_ENST00000439954.2_Missense_Mutation_p.D11N			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	9										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						ACATGCACTCGACAATGGTCT	0.393													.|||	138	0.0275559	0.0106	0.0576	5008	,	,		49196	0.0238		0.0268	False		,,,				2504	0.0337				.													.	FRG1B-22	0			.						.																																			SO:0001819	synonymous_variant	284802	.			GCACTCGACAATG			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.27G>A	20.37:g.29623215G>A		Somatic	988	36		WXS	Illumina HiSeq	Phase_1	598	46	.	0	0	38	39	1	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	g	10.79	1.450717	0.26074	.	.	ENSG00000149531	ENST00000439954	T	0.63913	-0.07	1.93	1.93	0.25924	.	.	.	.	.	T	0.67135	0.2861	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.68945	-0.5275	6	0.54805	T	0.06	.	9.8943	0.41309	0.0:0.0:1.0:0.0	.	.	.	.	N	11	ENSP00000408863:D11N	ENSP00000408863:D11N	D	+	1	0	FRG1B	28236876	1.000000	0.71417	0.999000	0.59377	0.081000	0.17604	8.270000	0.89880	1.399000	0.46721	0.423000	0.28283	GAC	G|0.500;A|0.500		0.393	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
TM9SF4	9777	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	30730877	30730877	+	Silent	SNP	C	C	T			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr20:30730877C>T	ENST00000398022.2	+	6	856	c.621C>T	c.(619-621)ttC>ttT	p.F207F	TM9SF4_ENST00000217315.5_Silent_p.F190F	NM_014742.3	NP_055557.2	Q92544	TM9S4_HUMAN	transmembrane 9 superfamily protein member 4	207						integral component of membrane (GO:0016021)				central_nervous_system(2)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			TCGTCCGCTTCGAGGTGATTC	0.597																																					p.F207F		.											.	TM9SF4-514	0			c.C621T						.						151.0	107.0	122.0					20																	30730877		2203	4300	6503	SO:0001819	synonymous_variant	9777	exon6			CCGCTTCGAGGTG	BC021107	CCDS13196.2	20q11.21	2004-04-19			ENSG00000101337	ENSG00000101337			30797	protein-coding gene	gene with protein product						9039502	Standard	NM_014742		Approved	KIAA0255, dJ836N17.2	uc002wxj.2	Q92544	OTTHUMG00000032206	ENST00000398022.2:c.621C>T	20.37:g.30730877C>T		Somatic	97	0		WXS	Illumina HiSeq	Phase_I	69	17	NM_014742	0	0	8	8	0	B0QYT7|Q9NUA3	Silent	SNP	ENST00000398022.2	37	CCDS13196.2																																																																																			.		0.597	TM9SF4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323568.1	NM_014742	
CDH4	1002	broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	60427908	60427908	+	Missense_Mutation	SNP	C	C	A			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr20:60427908C>A	ENST00000360469.5	+	6	919	c.831C>A	c.(829-831)ttC>ttA	p.F277L	CDH4_ENST00000543233.1_Missense_Mutation_p.F203L	NM_001794.3	NP_001785.2	P55283	CADH4_HUMAN	cadherin 4, type 1, R-cadherin (retinal)	277	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(2)|lung(25)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			GCCCTGAGTTCATCAACCAGG	0.582																																					p.F277L													.	CDH4-282	0			c.C831A						.						219.0	174.0	189.0					20																	60427908		2203	4300	6503	SO:0001583	missense	1002	exon6			TGAGTTCATCAAC	L34059	CCDS13488.1, CCDS58784.1	20q13.3	2010-01-26			ENSG00000179242	ENSG00000179242		"""Cadherins / Major cadherins"""	1763	protein-coding gene	gene with protein product	"""R-Cadherin"""	603006				10191097, 10516427	Standard	NM_001794		Approved		uc002ybn.2	P55283	OTTHUMG00000032890	ENST00000360469.5:c.831C>A	20.37:g.60427908C>A	ENSP00000353656:p.Phe277Leu	Somatic	82	1		WXS	Illumina HiSeq	Phase_I	100	34	NM_001794	0	0	0	0	0	B3KWB8|G3V1P8|Q2M208|Q5VZ44|Q9BZ05	Missense_Mutation	SNP	ENST00000360469.5	37	CCDS13488.1	.	.	.	.	.	.	.	.	.	.	C	15.29	2.789775	0.50102	.	.	ENSG00000179242	ENST00000360469;ENST00000536643;ENST00000543233	T;T	0.78707	-1.2;-1.2	4.76	3.7	0.42460	Cadherin (3);Cadherin-like (1);	0.110955	0.64402	D	0.000008	T	0.80204	0.4580	M	0.92880	3.355	0.58432	D	0.999995	B	0.25609	0.13	B	0.17433	0.018	T	0.80190	-0.1485	9	.	.	.	.	11.0665	0.47979	0.0:0.8229:0.0:0.1771	.	277	P55283	CADH4_HUMAN	L	277;185;203	ENSP00000353656:F277L;ENSP00000443301:F203L	.	F	+	3	2	CDH4	59861303	0.662000	0.27439	0.994000	0.49952	0.873000	0.50193	1.182000	0.32029	2.202000	0.70862	0.561000	0.74099	TTC	.		0.582	CDH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079965.2	NM_001794	
PRODH	5625	broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	18909899	18909899	+	Missense_Mutation	SNP	C	C	A			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr22:18909899C>A	ENST00000357068.6	-	7	1133	c.868G>T	c.(868-870)Ggc>Tgc	p.G290C	PRODH_ENST00000420436.1_Missense_Mutation_p.G182C|PRODH_ENST00000334029.2_Missense_Mutation_p.G182C	NM_016335.4	NP_057419	O43272	PROD_HUMAN	proline dehydrogenase (oxidase) 1	290					4-hydroxyproline catabolic process (GO:0019470)|cellular nitrogen compound metabolic process (GO:0034641)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|proline catabolic process (GO:0006562)|proline catabolic process to glutamate (GO:0010133)|proline metabolic process (GO:0006560)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)	FAD binding (GO:0071949)|proline dehydrogenase activity (GO:0004657)			breast(1)|endometrium(3)|lung(4)|upper_aerodigestive_tract(1)	9					L-Proline(DB00172)	GATGCGATGCCCAACTTTGCG	0.562																																					p.G290C													.	PRODH-289	0			c.G868T						.						92.0	78.0	83.0					22																	18909899		2203	4300	6503	SO:0001583	missense	5625	exon8			CGATGCCCAACTT	AF010310	CCDS13754.1, CCDS56223.1	22q11.2	2014-07-10	2001-12-05		ENSG00000100033	ENSG00000100033	1.5.5.2		9453	protein-coding gene	gene with protein product		606810	"""proline dehydrogenase (proline oxidase )"""			9385373, 10192398	Standard	NM_001195226		Approved	HSPOX2, PRODH1, PIG6, PRODH2, TP53I6	uc002zok.4	O43272	OTTHUMG00000150163	ENST00000357068.6:c.868G>T	22.37:g.18909899C>A	ENSP00000349577:p.Gly290Cys	Somatic	125	2		WXS	Illumina HiSeq	Phase_I	148	52	NM_016335	0	0	0	8	8	A6NF53|O14680|Q0P507|Q147W8|Q504W1|Q59FI8|Q6NV86|Q9UF13	Missense_Mutation	SNP	ENST00000357068.6	37	CCDS13754.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	21.2|21.2	4.109058|4.109058	0.77096|0.77096	.|.	.|.	ENSG00000100033|ENSG00000100033	ENST00000357068;ENST00000399694;ENST00000450579|ENST00000438924	T;T|.	0.64803|.	-0.12;0.61|.	4.63|4.63	4.63|4.63	0.57726|0.57726	Proline dehydrogenase (1);|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.80210|0.80210	0.4581|0.4581	M|M	0.88105|0.88105	2.93|2.93	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	1.0;1.0;1.0|.	D|D	0.83981|0.83981	0.0332|0.0332	10|6	0.87932|.	D|.	0|.	-23.324|-23.324	15.5145|15.5145	0.75812|0.75812	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	206;290;182|.	O43272-1;O43272;E7EQL6|.	.;PROD_HUMAN;.|.	C|V	290;83;131|150	ENSP00000349577:G290C;ENSP00000396806:G131C|.	ENSP00000334726:G182C|.	G|G	-|-	1|2	0|0	PRODH|PRODH	17289899|17289899	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.860000|0.860000	0.49131|0.49131	6.925000|6.925000	0.75829|0.75829	2.316000|2.316000	0.78162|0.78162	0.638000|0.638000	0.83543|0.83543	GGC|GGG	.		0.562	PRODH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316637.2	NM_016335	
PTPN23	25930	hgsc.bcm.edu;bcgsc.ca	37	3	47452317	47452317	+	Missense_Mutation	SNP	C	C	G			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr3:47452317C>G	ENST00000265562.4	+	20	3106	c.3029C>G	c.(3028-3030)cCg>cGg	p.P1010R	PTPN23_ENST00000431726.1_Missense_Mutation_p.P884R	NM_015466.2	NP_056281.1	Q9H3S7	PTN23_HUMAN	protein tyrosine phosphatase, non-receptor type 23	1010	His.|Pro-rich.				cilium morphogenesis (GO:0060271)|negative regulation of epithelial cell migration (GO:0010633)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of adherens junction organization (GO:1903393)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of homophilic cell adhesion (GO:1903387)|protein transport (GO:0015031)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|central_nervous_system(1)|large_intestine(5)|lung(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	23				BRCA - Breast invasive adenocarcinoma(193;0.000271)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CTGGGGCAGCCGCCACCCCCC	0.687																																					p.P1010R		.											.	PTPN23-227	0			c.C3029G						.						15.0	20.0	18.0					3																	47452317		2139	4247	6386	SO:0001583	missense	25930	exon20			GGCAGCCGCCACC	AB025194	CCDS2754.1	3p21.3	2011-06-09			ENSG00000076201	ENSG00000076201		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	14406	protein-coding gene	gene with protein product		606584				11095967	Standard	NM_015466		Approved	DKFZP564F0923, KIAA1471, HD-PTP	uc003crf.1	Q9H3S7	OTTHUMG00000133520	ENST00000265562.4:c.3029C>G	3.37:g.47452317C>G	ENSP00000265562:p.Pro1010Arg	Somatic	108	0		WXS	Illumina HiSeq	Phase_I	130	35	NM_015466	0	0	3	7	4	A8K0D7|Q7KZF8|Q8N6Z5|Q9BSR5|Q9P257|Q9UG03|Q9UMZ4	Missense_Mutation	SNP	ENST00000265562.4	37	CCDS2754.1	.	.	.	.	.	.	.	.	.	.	C	12.39	1.923200	0.33908	.	.	ENSG00000076201	ENST00000265562	T	0.02763	4.17	4.29	3.18	0.36537	.	0.362779	0.25154	N	0.032736	T	0.02342	0.0072	N	0.19112	0.55	0.41800	D	0.989917	P;P	0.37824	0.609;0.609	B;B	0.39738	0.308;0.308	T	0.62310	-0.6881	10	0.37606	T	0.19	-4.7843	6.2976	0.21095	0.0:0.6978:0.0:0.3022	.	884;1010	B4DST5;Q9H3S7	.;PTN23_HUMAN	R	1010	ENSP00000265562:P1010R	ENSP00000265562:P1010R	P	+	2	0	PTPN23	47427321	0.000000	0.05858	0.892000	0.35008	0.632000	0.37999	0.244000	0.18124	0.976000	0.38417	0.557000	0.71058	CCG	.		0.687	PTPN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257492.2	NM_015466	
RNF123	63891	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	49737921	49737921	+	Missense_Mutation	SNP	A	A	G			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr3:49737921A>G	ENST00000327697.6	+	14	1271	c.1127A>G	c.(1126-1128)gAt>gGt	p.D376G	RNF123_ENST00000432042.1_Missense_Mutation_p.D230G	NM_022064.3	NP_071347.2	Q5XPI4	RN123_HUMAN	ring finger protein 123	376					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		GAGGTACAAGATTGCCTCAAG	0.572																																					p.D376G													.	RNF123-584	0			c.A1127G						.						103.0	93.0	97.0					3																	49737921		2203	4300	6503	SO:0001583	missense	63891	exon14			TACAAGATTGCCT	AK022627	CCDS33758.1	3p24.3	2008-02-05			ENSG00000164068	ENSG00000164068		"""RING-type (C3HC4) zinc fingers"""	21148	protein-coding gene	gene with protein product		614472					Standard	NM_022064		Approved	FLJ12565	uc003cxh.4	Q5XPI4	OTTHUMG00000156891	ENST00000327697.6:c.1127A>G	3.37:g.49737921A>G	ENSP00000328287:p.Asp376Gly	Somatic	104	1		WXS	Illumina HiSeq	Phase_I	105	40	NM_022064	0	0	1	4	3	A1L4Q3|A6NLS5|Q5I022|Q6PFW4|Q71RH0|Q8IW18|Q9H0M8|Q9H5L8|Q9H9T2	Missense_Mutation	SNP	ENST00000327697.6	37	CCDS33758.1	.	.	.	.	.	.	.	.	.	.	A	16.23	3.064583	0.55432	.	.	ENSG00000164068	ENST00000327697;ENST00000389066;ENST00000432042	T;T	0.75589	-0.66;-0.95	5.15	5.15	0.70609	.	0.285942	0.32935	N	0.005472	T	0.55784	0.1942	N	0.08118	0	0.80722	D	1	B;P	0.34522	0.255;0.455	B;B	0.32465	0.031;0.146	T	0.61637	-0.7022	10	0.48119	T	0.1	-16.8059	14.1621	0.65452	1.0:0.0:0.0:0.0	.	230;376	C9J266;Q5XPI4	.;RN123_HUMAN	G	376;376;230	ENSP00000328287:D376G;ENSP00000392443:D230G	ENSP00000328287:D376G	D	+	2	0	RNF123	49712925	1.000000	0.71417	0.996000	0.52242	0.936000	0.57629	6.802000	0.75175	1.953000	0.56701	0.533000	0.62120	GAT	.		0.572	RNF123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346475.2	NM_022064	
IL17RD	54756	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	57136553	57136553	+	Silent	SNP	C	C	T			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr3:57136553C>T	ENST00000296318.7	-	10	1021	c.933G>A	c.(931-933)tcG>tcA	p.S311S	IL17RD_ENST00000463523.1_Silent_p.S167S|IL17RD_ENST00000320057.5_Silent_p.S167S|IL17RD_ENST00000427856.2_Silent_p.S287S	NM_017563.3	NP_060033.3	Q8NFM7	I17RD_HUMAN	interleukin 17 receptor D	311					signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(1)|ovary(1)|pancreas(1)	16				KIRC - Kidney renal clear cell carcinoma(284;0.0173)|Kidney(284;0.0204)		TCGCGAATGCCGATATGACTA	0.547																																					p.S311S		.											.	IL17RD-500	0			c.G933A						.						70.0	69.0	69.0					3																	57136553		2203	4300	6503	SO:0001819	synonymous_variant	54756	exon10			GAATGCCGATATG	AF494208	CCDS2880.2	3p21.1	2008-02-05			ENSG00000144730	ENSG00000144730		"""Interleukins and interleukin receptors"""	17616	protein-coding gene	gene with protein product		606807				11802164, 12604616	Standard	NM_017563		Approved	SEF, IL17RLM, FLJ35755, IL-17RD	uc003dil.3	Q8NFM7	OTTHUMG00000150171	ENST00000296318.7:c.933G>A	3.37:g.57136553C>T		Somatic	145	0		WXS	Illumina HiSeq	Phase_I	138	37	NM_017563	0	0	0	0	0	Q2NKP7|Q58EZ7|Q6RVF4|Q6UWI5|Q8N113|Q8NFS0|Q9UFA0	Silent	SNP	ENST00000296318.7	37	CCDS2880.2																																																																																			.		0.547	IL17RD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316680.1	NM_017563	
HSPBAP1	79663	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	122471457	122471457	+	Missense_Mutation	SNP	A	A	G			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr3:122471457A>G	ENST00000306103.2	-	6	949	c.806T>C	c.(805-807)aTa>aCa	p.I269T	snoU13_ENST00000459192.1_RNA|HSPBAP1_ENST00000383659.1_3'UTR|HSPBAP1_ENST00000465044.1_5'Flank	NM_024610.5	NP_078886.2	Q96EW2	HBAP1_HUMAN	HSPB (heat shock 27kDa) associated protein 1	269	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.					cytoplasm (GO:0005737)				breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|urinary_tract(1)	16				GBM - Glioblastoma multiforme(114;0.0531)		CCATGAGTTTATACTGACAGT	0.348																																					p.I269T													.	HSPBAP1-227	0			c.T806C						.						94.0	87.0	89.0					3																	122471457		2203	4300	6503	SO:0001583	missense	79663	exon6			GAGTTTATACTGA	AF400663	CCDS3017.1	3q21.1	2008-07-18	2002-08-29		ENSG00000169087	ENSG00000169087			16389	protein-coding gene	gene with protein product		608263	"""HSPB (heat shock 27kD) associated protein 1"""			11978969	Standard	NM_024610		Approved	FLJ22623, PASS1	uc003efu.2	Q96EW2	OTTHUMG00000159550	ENST00000306103.2:c.806T>C	3.37:g.122471457A>G	ENSP00000302562:p.Ile269Thr	Somatic	293	1		WXS	Illumina HiSeq	Phase_I	169	46	NM_024610	0	0	5	6	1	Q6P476|Q8N8J4|Q8NHH6|Q8WWF0	Missense_Mutation	SNP	ENST00000306103.2	37	CCDS3017.1	.	.	.	.	.	.	.	.	.	.	A	23.0	4.359468	0.82353	.	.	ENSG00000169087	ENST00000306103	T	0.13196	2.61	5.3	5.3	0.74995	Cupin, JmjC-type (1);Transcription factor jumonji/aspartyl beta-hydroxylase (2);	0.153054	0.56097	D	0.000021	T	0.31358	0.0794	M	0.74467	2.265	0.80722	D	1	D	0.56035	0.974	P	0.55303	0.773	T	0.04708	-1.0932	10	0.66056	D	0.02	.	14.5845	0.68315	1.0:0.0:0.0:0.0	.	269	Q96EW2	HBAP1_HUMAN	T	269	ENSP00000302562:I269T	ENSP00000302562:I269T	I	-	2	0	HSPBAP1	123954147	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.442000	0.90317	2.232000	0.73038	0.528000	0.53228	ATA	.		0.348	HSPBAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356161.1	NM_024610	
DNAJC13	23317	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	132207851	132207851	+	Missense_Mutation	SNP	T	T	C			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr3:132207851T>C	ENST00000260818.6	+	31	3702	c.3454T>C	c.(3454-3456)Ttc>Ctc	p.F1152L		NM_015268.3	NP_056083.3	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	1152					osteoblast differentiation (GO:0001649)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)				breast(4)|endometrium(2)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|urinary_tract(1)	34						CAAACAGGCTTTCAAGTCAGA	0.333																																					p.F1152L		.											.	DNAJC13-272	0			c.T3454C						.						64.0	65.0	64.0					3																	132207851		2203	4300	6503	SO:0001583	missense	23317	exon31			CAGGCTTTCAAGT	AB014578	CCDS33857.1	3q22.1	2011-09-02			ENSG00000138246	ENSG00000138246		"""Heat shock proteins / DNAJ (HSP40)"""	30343	protein-coding gene	gene with protein product		614334				12438707	Standard	NM_015268		Approved	RME8, KIAA0678	uc003eor.3	O75165	OTTHUMG00000159674	ENST00000260818.6:c.3454T>C	3.37:g.132207851T>C	ENSP00000260818:p.Phe1152Leu	Somatic	106	0		WXS	Illumina HiSeq	Phase_I	44	13	NM_015268	0	0	0	0	0	Q3L0T1|Q6PI82|Q6UJ77|Q6ZSW1|Q6ZUT5|Q86XG3|Q96DC1|Q9BWK9	Missense_Mutation	SNP	ENST00000260818.6	37	CCDS33857.1	.	.	.	.	.	.	.	.	.	.	T	25.6	4.653771	0.88056	.	.	ENSG00000138246	ENST00000260818	T	0.18174	2.23	5.57	5.57	0.84162	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.16171	0.0389	L	0.47716	1.5	0.80722	D	1	P	0.52463	0.953	B	0.39217	0.294	T	0.04708	-1.0932	10	0.25106	T	0.35	.	15.7007	0.77538	0.0:0.0:0.0:1.0	.	1152	O75165	DJC13_HUMAN	L	1152	ENSP00000260818:F1152L	ENSP00000260818:F1152L	F	+	1	0	DNAJC13	133690541	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.807000	0.75201	2.236000	0.73375	0.528000	0.53228	TTC	.		0.333	DNAJC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356807.2	NM_015268	
WHSC1	7468	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	1977074	1977074	+	Missense_Mutation	SNP	G	G	C			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr4:1977074G>C	ENST00000382895.3	+	22	3999	c.3568G>C	c.(3568-3570)Gtc>Ctc	p.V1190L	WHSC1_ENST00000508803.1_Missense_Mutation_p.V1190L|SCARNA22_ENST00000503991.1_RNA|WHSC1_ENST00000382888.3_Missense_Mutation_p.V538L|WHSC1_ENST00000382891.5_Missense_Mutation_p.V1190L|WHSC1_ENST00000482415.2_3'UTR|WHSC1_ENST00000382892.2_Missense_Mutation_p.V1190L	NM_133330.2	NP_579877.1	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1	1190	Post-SET. {ECO:0000255|PROSITE- ProRule:PRU00155}.				anatomical structure morphogenesis (GO:0009653)|atrial septum primum morphogenesis (GO:0003289)|atrial septum secundum morphogenesis (GO:0003290)|bone development (GO:0060348)|membranous septum morphogenesis (GO:0003149)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	48		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		TGAAAAAACGGTCTGCCGGTG	0.532			T	IGH@	MM																																p.V1190L		.		Dom	yes		4	4p16.3	7468	Wolf-Hirschhorn syndrome candidate 1(MMSET)		L	.	WHSC1-664	0			c.G3568C						.						101.0	93.0	96.0					4																	1977074		2203	4300	6503	SO:0001583	missense	7468	exon20			AAAACGGTCTGCC	AF083386	CCDS3356.1, CCDS33940.1, CCDS46999.1	4p16.3	2013-05-20			ENSG00000109685	ENSG00000109685		"""Zinc fingers, PHD-type"""	12766	protein-coding gene	gene with protein product		602952				9618163, 9787135	Standard	NM_133334		Approved	MMSET, NSD2	uc003gdz.4	O96028	OTTHUMG00000121147	ENST00000382895.3:c.3568G>C	4.37:g.1977074G>C	ENSP00000372351:p.Val1190Leu	Somatic	99	0		WXS	Illumina HiSeq	Phase_I	111	24	NM_133335	0	0	1	3	2	A2A2T2|A2A2T3|A2A2T4|A7MCZ1|D3DVQ2|O96031|Q4VBY8|Q672J1|Q6IS00|Q86V01|Q9BZB4|Q9UI92|Q9UPR2	Missense_Mutation	SNP	ENST00000382895.3	37	CCDS33940.1	.	.	.	.	.	.	.	.	.	.	G	14.75	2.627438	0.46944	.	.	ENSG00000109685	ENST00000508803;ENST00000382891;ENST00000382892;ENST00000382895;ENST00000382888	D;D;D;D;D	0.97066	-3.61;-3.61;-3.61;-3.61;-4.23	4.91	4.91	0.64330	Post-SET domain (2);	0.000000	0.49916	D	0.000140	D	0.93523	0.7933	L	0.42008	1.315	0.80722	D	1	B;B	0.30361	0.009;0.277	B;B	0.21151	0.012;0.033	D	0.91080	0.4899	10	0.30854	T	0.27	.	12.0537	0.53522	0.0793:0.0:0.9207:0.0	.	538;1190	A2A2T2;O96028	.;NSD2_HUMAN	L	1190;1190;1190;1190;538	ENSP00000423972:V1190L;ENSP00000372347:V1190L;ENSP00000372348:V1190L;ENSP00000372351:V1190L;ENSP00000372344:V538L	ENSP00000372344:V538L	V	+	1	0	WHSC1	1946872	1.000000	0.71417	0.974000	0.42286	0.874000	0.50279	5.102000	0.64572	2.719000	0.93026	0.655000	0.94253	GTC	.		0.532	WHSC1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366269.2	NM_133330	
WDR19	57728	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	39205336	39205336	+	Missense_Mutation	SNP	A	A	C			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr4:39205336A>C	ENST00000399820.3	+	7	751	c.597A>C	c.(595-597)gaA>gaC	p.E199D	WDR19_ENST00000288634.7_Missense_Mutation_p.E39D|WDR19_ENST00000506503.1_Missense_Mutation_p.E199D	NM_025132.3	NP_079408.3	Q8NEZ3	WDR19_HUMAN	WD repeat domain 19	199					ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|cilium assembly (GO:0042384)|digestive system development (GO:0055123)|ear morphogenesis (GO:0042471)|embryonic camera-type eye development (GO:0031076)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic limb morphogenesis (GO:0030326)|in utero embryonic development (GO:0001701)|intraciliary retrograde transport (GO:0035721)|myotome development (GO:0061055)|neurological system process (GO:0050877)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intraciliary transport particle A (GO:0030991)|motile cilium (GO:0031514)|nonmotile primary cilium (GO:0031513)|photoreceptor connecting cilium (GO:0032391)				large_intestine(1)	1						CTGCTGCTGAAAGCATGGTAA	0.353																																					p.E199D		.											.	WDR19-67	0			c.A597C						.						92.0	83.0	86.0					4																	39205336		1872	4111	5983	SO:0001583	missense	57728	exon7			TGCTGAAAGCATG	AB046858, AY029257	CCDS47042.1	4p14	2014-02-21			ENSG00000157796	ENSG00000157796		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	18340	protein-coding gene	gene with protein product	"""intraflagellar transport 144 homolog (Chlamydomonas)"""	608151				12906858, 22019273	Standard	XM_005262658		Approved	Pwdmp, KIAA1638, FLJ23127, ORF26, DYF-2, Oseg6, IFT144, NPHP13	uc003gtv.3	Q8NEZ3	OTTHUMG00000160466	ENST00000399820.3:c.597A>C	4.37:g.39205336A>C	ENSP00000382717:p.Glu199Asp	Somatic	133	0		WXS	Illumina HiSeq	Phase_I	66	21	NM_025132	0	0	0	0	0	B5MEF2|Q8N5B4|Q9H5S0|Q9HCD4	Missense_Mutation	SNP	ENST00000399820.3	37	CCDS47042.1	.	.	.	.	.	.	.	.	.	.	A	14.28	2.488399	0.44249	.	.	ENSG00000157796	ENST00000399820;ENST00000509560;ENST00000512112;ENST00000288634;ENST00000506503;ENST00000399836	T;T;T;T	0.66099	3.42;2.2;-0.19;3.42	5.64	1.62	0.23740	WD40 repeat-like-containing domain (1);	0.134922	0.64402	D	0.000003	T	0.51941	0.1704	M	0.64080	1.96	0.38720	D	0.953425	B;B	0.19445	0.002;0.036	B;B	0.20767	0.007;0.031	T	0.38714	-0.9648	10	0.23891	T	0.37	-17.3314	6.2227	0.20691	0.6749:0.1242:0.2008:0.0	.	199;199	Q8NEZ3;D6R9P6	WDR19_HUMAN;.	D	199;140;39;39;199;198	ENSP00000382717:E199D;ENSP00000426918:E140D;ENSP00000288634:E39D;ENSP00000423491:E199D	ENSP00000288634:E39D	E	+	3	2	WDR19	38881731	1.000000	0.71417	0.974000	0.42286	0.955000	0.61496	0.886000	0.28241	0.111000	0.17947	0.455000	0.32223	GAA	.		0.353	WDR19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360689.1		
EXOC1	55763	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	56737307	56737307	+	Missense_Mutation	SNP	A	A	C			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr4:56737307A>C	ENST00000381295.2	+	7	1220	c.872A>C	c.(871-873)cAg>cCg	p.Q291P	EXOC1_ENST00000349598.6_Missense_Mutation_p.Q291P|EXOC1_ENST00000346134.7_Missense_Mutation_p.Q291P	NM_001024924.1	NP_001020095.1	Q9NV70	EXOC1_HUMAN	exocyst complex component 1	291					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	exocyst (GO:0000145)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	35	Glioma(25;0.08)|all_neural(26;0.101)					AAGGCCCTTCAGGAAGGAGAT	0.453																																					p.Q291P		.											.	EXOC1-950	0			c.A872C						.						95.0	83.0	87.0					4																	56737307		2203	4300	6503	SO:0001583	missense	55763	exon7			CCCTTCAGGAAGG	AK027047	CCDS3502.1, CCDS3503.1	4q12	2013-01-22	2005-11-01	2005-11-01	ENSG00000090989	ENSG00000090989			30380	protein-coding gene	gene with protein product		607879	"""SEC3-like 1 (S. cerevisiae)"""	SEC3L1		11042152, 11406615	Standard	XM_005265747		Approved	SEC3, FLJ10893, BM-102, Sec3p	uc003hbf.1	Q9NV70	OTTHUMG00000102165	ENST00000381295.2:c.872A>C	4.37:g.56737307A>C	ENSP00000370695:p.Gln291Pro	Somatic	98	0		WXS	Illumina HiSeq	Phase_I	53	18	NM_018261	0	0	0	0	0	Q504V4|Q8WUE7|Q96T15|Q9NZE4	Missense_Mutation	SNP	ENST00000381295.2	37	CCDS3502.1	.	.	.	.	.	.	.	.	.	.	A	14.67	2.604708	0.46423	.	.	ENSG00000090989	ENST00000381295;ENST00000346134;ENST00000349598	.	.	.	5.97	4.77	0.60923	.	0.224009	0.46758	D	0.000269	T	0.57489	0.2057	L	0.53249	1.67	0.54753	D	0.999985	P;P	0.47191	0.891;0.626	P;P	0.46885	0.466;0.53	T	0.54200	-0.8329	9	0.30854	T	0.27	.	12.5014	0.55957	0.8746:0.0:0.0:0.1254	.	291;291	Q9NV70-2;Q9NV70	.;EXOC1_HUMAN	P	291	.	ENSP00000326514:Q291P	Q	+	2	0	EXOC1	56432064	1.000000	0.71417	1.000000	0.80357	0.819000	0.46315	5.837000	0.69381	1.053000	0.40415	-0.480000	0.04831	CAG	.		0.453	EXOC1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361799.1	NM_018261	
DSPP	1834	bcgsc.ca	37	4	88536142	88536142	+	Silent	SNP	T	T	C			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr4:88536142T>C	ENST00000282478.7	+	4	2361	c.2328T>C	c.(2326-2328)agT>agC	p.S776S	DSPP_ENST00000399271.1_Silent_p.S776S|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	776	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gcagtgatagtagtgacagca	0.507																																					p.S776S													.	DSPP-90	0			c.T2328C						.						85.0	96.0	92.0					4																	88536142		1664	2989	4653	SO:0001819	synonymous_variant	1834	exon5			TGATAGTAGTGAC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.2328T>C	4.37:g.88536142T>C		Somatic	342	7		WXS	Illumina HiSeq	Phase_1	312	27	NM_014208	0	0	0	0	0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.507	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
PABPC4L	132430	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	135121148	135121148	+	Nonsense_Mutation	SNP	C	C	A			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr4:135121148C>A	ENST00000421491.3	-	2	1283	c.1027G>T	c.(1027-1029)Gag>Tag	p.E343*	PABPC4L_ENST00000529122.2_Nonsense_Mutation_p.E401*			P0CB38	PAB4L_HUMAN	poly(A) binding protein, cytoplasmic 4-like	343	RRM 4. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|endometrium(2)	3						GTAGCATCCTCAGGAGAGGAG	0.458																																					p.E401X		.											.	.	0			c.G1201T						.						113.0	94.0	100.0					4																	135121148		692	1591	2283	SO:0001587	stop_gained	132430	exon2			CATCCTCAGGAGA	AY672099		4q28.3	2013-02-12				ENSG00000254535		"""RNA binding motif (RRM) containing"""	31955	protein-coding gene	gene with protein product							Standard	NM_001114734		Approved		uc010ioe.3	P0CB38		ENST00000421491.3:c.1027G>T	4.37:g.135121148C>A	ENSP00000463233:p.Glu343*	Somatic	146	0		WXS	Illumina HiSeq	Phase_I	105	29	NM_001114734	0	0	0	0	0		Nonsense_Mutation	SNP	ENST00000421491.3	37																																																																																				.		0.458	PABPC4L-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000364399.2	NM_001114734	
SMARCA5	8467	broad.mit.edu	37	4	144445524	144445524	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr4:144445524C>T	ENST00000283131.3	+	4	886	c.424C>T	c.(424-426)Cga>Tga	p.R142*		NM_003601.3	NP_003592.3	O60264	SMCA5_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5	142					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|CENP-A containing nucleosome assembly (GO:0034080)|chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA-templated transcription, initiation (GO:0006352)|double-strand break repair (GO:0006302)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromatin silencing complex (GO:0005677)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NURF complex (GO:0016589)|RSF complex (GO:0031213)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)		EWSR1/SMARCA5(2)	endometrium(2)|kidney(2)|large_intestine(9)|lung(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_hematologic(180;0.158)					TAACAGTTACCGACACCGTAG	0.383																																					p.R142X													.	SMARCA5-227	0			c.C424T						.						88.0	87.0	87.0					4																	144445524		2203	4300	6503	SO:0001587	stop_gained	8467	exon4			AGTTACCGACACC	AB010882	CCDS3761.1	4q31.1-q31.2	2011-04-20			ENSG00000153147	ENSG00000153147			11101	protein-coding gene	gene with protein product		603375				9730600	Standard	NM_003601		Approved	hSNF2H, hISWI, ISWI	uc003ijg.3	O60264	OTTHUMG00000161474	ENST00000283131.3:c.424C>T	4.37:g.144445524C>T	ENSP00000283131:p.Arg142*	Somatic	506	1		WXS	Illumina HiSeq	Phase_I	294	4	NM_003601	0	0	0	0	0		Nonsense_Mutation	SNP	ENST00000283131.3	37	CCDS3761.1	.	.	.	.	.	.	.	.	.	.	C	40	8.410910	0.98799	.	.	ENSG00000153147	ENST00000283131;ENST00000536484;ENST00000535006	.	.	.	5.75	3.81	0.43845	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.783	16.3196	0.82941	0.2523:0.7477:0.0:0.0	.	.	.	.	X	142;85;85	.	ENSP00000283131:R142X	R	+	1	2	SMARCA5	144664974	0.991000	0.36638	1.000000	0.80357	0.749000	0.42624	2.926000	0.48892	1.395000	0.46643	0.591000	0.81541	CGA	.		0.383	SMARCA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365077.3		
DDX60L	91351	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	169315621	169315621	+	Missense_Mutation	SNP	T	T	A			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr4:169315621T>A	ENST00000511577.1	-	28	4052	c.3805A>T	c.(3805-3807)Att>Ttt	p.I1269F	DDX60L_ENST00000505890.1_Missense_Mutation_p.I1270F|DDX60L_ENST00000260184.7_Missense_Mutation_p.I1269F			Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like	1269	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.						ATP binding (GO:0005524)|helicase activity (GO:0004386)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		CCTACCCTAATAAGCCCTTTT	0.323																																					p.I1269F		.											.	DDX60L-69	0			c.A3805T						.						67.0	62.0	63.0					4																	169315621		1803	4068	5871	SO:0001583	missense	91351	exon28			CCCTAATAAGCCC	AK092461	CCDS47161.1	4q32.3	2008-01-08				ENSG00000181381			26429	protein-coding gene	gene with protein product							Standard	XM_005263341		Approved	FLJ31033	uc003irq.4	Q5H9U9		ENST00000511577.1:c.3805A>T	4.37:g.169315621T>A	ENSP00000422423:p.Ile1269Phe	Somatic	95	0		WXS	Illumina HiSeq	Phase_I	46	12	NM_001012967	0	0	0	0	0	Q96ND6	Missense_Mutation	SNP	ENST00000511577.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.62|13.62	2.293047|2.293047	0.40594|0.40594	.|.	.|.	ENSG00000181381|ENSG00000181381	ENST00000260184;ENST00000511577;ENST00000505890|ENST00000514580	T;T;T|.	0.59224|.	0.28;0.28;0.28|.	3.16|3.16	1.95|1.95	0.26073|0.26073	Helicase, C-terminal (3);|.	0.000000|.	0.36591|.	U|.	0.002501|.	T|T	0.60183|0.60183	0.2249|0.2249	M|M	0.87682|0.87682	2.9|2.9	0.09310|0.09310	N|N	0.999999|0.999999	D;D|.	0.71674|.	0.994;0.998|.	D;D|.	0.65773|.	0.922;0.938|.	T|T	0.52961|0.52961	-0.8505|-0.8505	10|5	0.66056|.	D|.	0.02|.	.|.	7.0872|7.0872	0.25264|0.25264	0.0:0.118:0.0:0.882|0.0:0.118:0.0:0.882	.|.	1270;1269|.	D6R906;Q5H9U9|.	.;DDX6L_HUMAN|.	F|F	1269;1269;1270|156	ENSP00000260184:I1269F;ENSP00000422423:I1269F;ENSP00000422202:I1270F|.	ENSP00000260184:I1269F|.	I|Y	-|-	1|2	0|0	DDX60L|DDX60L	169552196|169552196	0.721000|0.721000	0.28007|0.28007	0.002000|0.002000	0.10522|0.10522	0.093000|0.093000	0.18481|0.18481	1.244000|1.244000	0.32778|0.32778	0.248000|0.248000	0.21435|0.21435	0.383000|0.383000	0.25322|0.25322	ATT|TAT	.		0.323	DDX60L-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000364839.1	NM_001012967	
SSBP2	23635	ucsc.edu	37	5	80724477	80724477	+	Missense_Mutation	SNP	C	C	T			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr5:80724477C>T	ENST00000320672.4	-	16	1193	c.983G>A	c.(982-984)aGt>aAt	p.S328N	SSBP2_ENST00000509053.1_Intron|SSBP2_ENST00000505980.1_Missense_Mutation_p.S308N|SSBP2_ENST00000510060.1_5'UTR|SSBP2_ENST00000514493.1_Missense_Mutation_p.S298N|SSBP2_ENST00000515395.1_Missense_Mutation_p.S306N	NM_001256732.1|NM_001256733.1|NM_012446.3	NP_001243661.1|NP_001243662.1|NP_036578.2	P81877	SSBP2_HUMAN	single-stranded DNA binding protein 2	328					regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	single-stranded DNA binding (GO:0003697)		SSBP2/JAK2(4)	central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	10		Lung NSC(167;0.00154)|all_lung(232;0.00179)|Ovarian(174;0.0338)		OV - Ovarian serous cystadenocarcinoma(54;1.07e-41)|Epithelial(54;2.79e-35)|all cancers(79;1.18e-29)		CGGTTGATTACTCAGGCTCAT	0.368																																					p.S336N													.	SSBP2-223	0			c.G1007A						.						78.0	79.0	79.0					5																	80724477		2203	4299	6502	SO:0001583	missense	23635	exon16			TGATTACTCAGGC	AF077048	CCDS4056.1, CCDS58960.1, CCDS58961.1, CCDS58962.1, CCDS58963.1, CCDS75268.1	5q14.1	2012-05-25	2001-11-28		ENSG00000145687	ENSG00000145687			15831	protein-coding gene	gene with protein product		607389	"""single-stranded DNA-binding protein 2"""			11230166, 11042152	Standard	NM_001256732		Approved	HSPC116	uc003khp.4	P81877	OTTHUMG00000119039	ENST00000320672.4:c.983G>A	5.37:g.80724477C>T	ENSP00000322977:p.Ser328Asn	Somatic	56	0		WXS	Illumina HiSeq		31	4	NM_001256732	0	0	12	12	0	B2R5W1|B7Z1J2|B7Z2L9|B7Z665|D6RH18|E9PB74|E9PDA8|Q8N2Q2|Q9BWW6|Q9Y4T7	Missense_Mutation	SNP	ENST00000320672.4	37	CCDS4056.1	.	.	.	.	.	.	.	.	.	.	C	15.31	2.795107	0.50208	.	.	ENSG00000145687	ENST00000320672;ENST00000514493;ENST00000380182;ENST00000504985;ENST00000512923;ENST00000505980;ENST00000515395	.	.	.	5.65	5.65	0.86999	.	0.076218	0.85682	D	0.000000	T	0.39091	0.1065	N	0.05574	-0.02	0.42256	D	0.991994	B;B;B;B;B	0.20164	0.009;0.005;0.003;0.017;0.042	B;B;B;B;B	0.22880	0.032;0.042;0.014;0.018;0.026	T	0.33059	-0.9883	9	0.08179	T	0.78	-14.1851	20.096	0.97843	0.0:1.0:0.0:0.0	.	306;308;281;306;328	E9PB74;B7Z1J2;A6ND70;B7Z665;P81877	.;.;.;.;SSBP2_HUMAN	N	328;298;281;242;231;308;306	.	ENSP00000322977:S328N	S	-	2	0	SSBP2	80760233	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.017000	0.49615	2.819000	0.97034	0.650000	0.86243	AGT	.		0.368	SSBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239249.1	NM_012446	
DMXL1	1657	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	118479556	118479556	+	Silent	SNP	T	T	C			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr5:118479556T>C	ENST00000311085.8	+	14	2477	c.2397T>C	c.(2395-2397)ttT>ttC	p.F799F	DMXL1_ENST00000539542.1_Silent_p.F799F	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	799										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		GTGAAGTCTTTAACATCGTCA	0.299																																					p.F799F		.											.	DMXL1-92	0			c.T2397C						.						110.0	116.0	114.0					5																	118479556		2201	4299	6500	SO:0001819	synonymous_variant	1657	exon14			AGTCTTTAACATC	AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.2397T>C	5.37:g.118479556T>C		Somatic	601	1		WXS	Illumina HiSeq	Phase_I	303	97	NM_005509	0	0	0	0	0		Silent	SNP	ENST00000311085.8	37	CCDS4125.1																																																																																			.		0.299	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250862.1	NM_005509	
MEGF10	84466	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	126705695	126705695	+	Splice_Site	SNP	G	G	T			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr5:126705695G>T	ENST00000274473.6	+	6	679		c.e6+1		MEGF10_ENST00000508365.1_Splice_Site|MEGF10_ENST00000503335.2_Splice_Site|MEGF10_ENST00000418761.2_Splice_Site	NM_032446.2	NP_115822.1	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10						homotypic cell-cell adhesion (GO:0034109)|muscle cell development (GO:0055001)|recognition of apoptotic cell (GO:0043654)|regulation of muscle cell differentiation (GO:0051147)|regulation of skeletal muscle tissue development (GO:0048641)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell differentiation (GO:0014816)|skeletal muscle satellite cell proliferation (GO:0014841)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(28)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	68		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		TGCTCCAGTGGTAAGTTTCCA	0.537																																					.		.											.	MEGF10-94	0			c.412+1G>T						.						176.0	140.0	152.0					5																	126705695		2203	4300	6503	SO:0001630	splice_region_variant	84466	exon5			CCAGTGGTAAGTT	AK021631	CCDS4142.1	5q33	2008-02-05			ENSG00000145794	ENSG00000145794			29634	protein-coding gene	gene with protein product		612453				11347906	Standard	NM_032446		Approved	KIAA1780	uc003kui.4	Q96KG7	OTTHUMG00000128984	ENST00000274473.6:c.412+1G>T	5.37:g.126705695G>T		Somatic	33	0		WXS	Illumina HiSeq	Phase_I	42	13	NM_001256545	0	0	0	0	0	Q68DE5|Q8WUL3	Splice_Site	SNP	ENST00000274473.6	37	CCDS4142.1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.749510	0.89753	.	.	ENSG00000145794	ENST00000503335;ENST00000508365;ENST00000418761;ENST00000274473	.	.	.	5.34	5.34	0.76211	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1131	0.93326	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MEGF10	126733594	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.844000	0.99494	2.506000	0.84524	0.558000	0.71614	.	.		0.537	MEGF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250973.2	NM_032446	Intron
HFE	3077	broad.mit.edu;bcgsc.ca	37	6	26091332	26091332	+	Splice_Site	SNP	G	G	C			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr6:26091332G>C	ENST00000357618.5	+	2	462	c.340G>C	c.(340-342)Gag>Cag	p.E114Q	HFE_ENST00000488199.1_Intron|HFE_ENST00000470149.1_Splice_Site_p.E114Q|HFE_ENST00000336625.8_Splice_Site_p.V114L|HFE_ENST00000309234.6_Splice_Site_p.E114Q|HFE_ENST00000349999.4_Intron|HFE_ENST00000397022.3_Splice_Site_p.E91Q|HFE_ENST00000353147.5_Intron|HFE_ENST00000317896.7_Splice_Site_p.V114L|HFE_ENST00000461397.1_Splice_Site_p.E114Q|HFE_ENST00000352392.4_Intron	NM_000410.3|NM_139006.2	NP_000401.1|NP_620575.1	Q30201	HFE_HUMAN	hemochromatosis	114	Alpha-1.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular iron ion homeostasis (GO:0006879)|cellular response to iron ion starvation (GO:0010106)|female pregnancy (GO:0007565)|hormone biosynthetic process (GO:0042446)|immune response (GO:0006955)|iron ion import into cell (GO:0097459)|multicellular organismal iron ion homeostasis (GO:0060586)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protein complex assembly (GO:0006461)	apical part of cell (GO:0045177)|basal part of cell (GO:0045178)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|integral component of plasma membrane (GO:0005887)|MHC class I protein complex (GO:0042612)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	peptide antigen binding (GO:0042605)|receptor binding (GO:0005102)			endometrium(3)|large_intestine(3)|liver(2)|lung(7)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						CCACAGCAAGGGTATGTGGAG	0.488									Hemochromatosis																												p.E114Q													.	HFE-90	0			c.G340C						.						104.0	106.0	105.0					6																	26091332		2203	4300	6503	SO:0001630	splice_region_variant	3077	exon2	Familial Cancer Database		AGCAAGGGTATGT		CCDS4578.1, CCDS4579.1, CCDS4580.1, CCDS4581.1, CCDS4582.1, CCDS47386.1, CCDS47387.1, CCDS54974.1, CCDS54975.1, CCDS75412.1	6p21.3	2014-09-17			ENSG00000010704	ENSG00000010704		"""Immunoglobulin superfamily / C1-set domain containing"""	4886	protein-coding gene	gene with protein product	"""high Fe"""	613609				3460331	Standard	XR_241893		Approved	HLA-H	uc003nfx.1	Q30201	OTTHUMG00000016348	ENST00000357618.5:c.340+1G>C	6.37:g.26091332G>C		Somatic	73	1		WXS	Illumina HiSeq	Phase_I	69	24	NM_139006	0	0	1	1	0	B2CKL0|O75929|O75930|O75931|Q17RT0|Q96KU5|Q96KU6|Q96KU7|Q96KU8|Q9HC64|Q9HC68|Q9HC70|Q9HC83	Missense_Mutation	SNP	ENST00000357618.5	37	CCDS4578.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.68|13.68	2.309910|2.309910	0.40895|0.40895	.|.	.|.	ENSG00000010704|ENSG00000010704	ENST00000397022;ENST00000535098;ENST00000539147;ENST00000357618;ENST00000470149;ENST00000461397;ENST00000309234|ENST00000317896;ENST00000336625	D;D;D;D;D|T;T	0.89617|0.02737	-2.54;-2.54;-2.54;-2.54;-2.54|4.57;4.18	4.98|4.98	4.1|4.1	0.47936|0.47936	MHC class I, alpha chain, alpha1/alpha2 (2);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);|.	0.860579|.	0.09959|.	N|.	0.733694|.	T|T	0.02047|0.02047	0.0064|0.0064	M|M	0.68317|0.68317	2.08|2.08	0.80722|0.80722	D|D	1|1	B;B;B;B|B;B	0.19817|0.27559	0.039;0.031;0.006;0.011|0.181;0.115	B;B;B;B|B;B	0.17979|0.30943	0.02;0.007;0.011;0.013|0.051;0.122	T|T	0.29027|0.29027	-1.0025|-1.0025	10|9	0.87932|0.54805	D|T	0|0.06	.|.	9.3734|9.3734	0.38268|0.38268	0.0977:0.0:0.9023:0.0|0.0977:0.0:0.9023:0.0	.|.	114;114;91;114|114;114	Q6B0J5;Q30201-3;Q30201-5;Q30201|Q30201-7;Q30201-10	.;.;.;HFE_HUMAN|.;.	Q|L	91;114;9;114;114;114;114|114	ENSP00000380217:E91Q;ENSP00000417404:E114Q;ENSP00000419725:E114Q;ENSP00000420802:E114Q;ENSP00000311698:E114Q|ENSP00000313776:V114L;ENSP00000337819:V114L	ENSP00000311698:E114Q|ENSP00000313776:V114L	E|V	+|+	1|1	0|0	HFE|HFE	26199311|26199311	0.978000|0.978000	0.34361|0.34361	0.984000|0.984000	0.44739|0.44739	0.976000|0.976000	0.68499|0.68499	0.989000|0.989000	0.29629|0.29629	1.308000|1.308000	0.44962|0.44962	0.655000|0.655000	0.94253|0.94253	GAG|GTG	.		0.488	HFE-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356133.1		Missense_Mutation
ORC3	23595	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	88362905	88362905	+	Missense_Mutation	SNP	A	A	T			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr6:88362905A>T	ENST00000392844.3	+	14	1502	c.1454A>T	c.(1453-1455)aAc>aTc	p.N485I	ORC3_ENST00000257789.4_Missense_Mutation_p.N485I|ORC3_ENST00000417380.2_3'UTR|ORC3_ENST00000546266.1_Missense_Mutation_p.N342I	NM_012381.3|NM_181837.2	NP_036513.2|NP_862820.1	Q9UBD5	ORC3_HUMAN	origin recognition complex, subunit 3	485					DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|neural precursor cell proliferation (GO:0061351)	nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|origin recognition complex (GO:0000808)	DNA replication origin binding (GO:0003688)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	28						TATTGTGAAAACCACCTTGGC	0.418																																					p.N485I													.	ORC3-206	0			c.A1454T						.						102.0	101.0	101.0					6																	88362905		2203	4300	6503	SO:0001583	missense	23595	exon14			GTGAAAACCACCT	AF093535	CCDS5012.1, CCDS43486.1, CCDS56440.1	6q	2010-10-12	2010-10-12	2010-10-12	ENSG00000135336	ENSG00000135336			8489	protein-coding gene	gene with protein product		604972	"""origin recognition complex, subunit 3 (yeast homolog)-like"", ""origin recognition complex, subunit 3-like (yeast)"", ""origin recognition complex, subunit 3 honolog (yeast)"""	ORC3L		9829972, 10402192	Standard	NM_181837		Approved	IMAGE50150, LATHEO	uc003pmg.3	Q9UBD5	OTTHUMG00000015179	ENST00000392844.3:c.1454A>T	6.37:g.88362905A>T	ENSP00000376586:p.Asn485Ile	Somatic	126	1		WXS	Illumina HiSeq	Phase_I	79	23	NM_181837	0	0	6	11	5	A2A2T5|B4E025|Q13565|Q53GY6|Q5T159|Q6IUY7|Q86TN5|Q9UG44|Q9UNT6	Missense_Mutation	SNP	ENST00000392844.3	37	CCDS43486.1	.	.	.	.	.	.	.	.	.	.	A	16.29	3.081722	0.55861	.	.	ENSG00000135336	ENST00000392844;ENST00000257789;ENST00000546266	T;T;T	0.12147	3.07;3.07;2.71	5.71	5.71	0.89125	.	0.141687	0.64402	D	0.000009	T	0.03390	0.0098	N	0.14661	0.345	0.24464	N	0.994423	B;B;B;B;B	0.31290	0.009;0.318;0.009;0.004;0.029	B;B;B;B;B	0.28849	0.014;0.095;0.005;0.005;0.088	T	0.30851	-0.9964	10	0.36615	T	0.2	-12.2882	13.939	0.64043	1.0:0.0:0.0:0.0	.	485;485;423;485;485	B7ZAI3;B7Z8A5;B4E014;Q9UBD5;Q9UBD5-2	.;.;.;ORC3_HUMAN;.	I	485;485;342	ENSP00000376586:N485I;ENSP00000257789:N485I;ENSP00000444695:N342I	ENSP00000257789:N485I	N	+	2	0	ORC3	88419624	1.000000	0.71417	0.995000	0.50966	0.903000	0.53119	4.074000	0.57577	2.171000	0.68590	0.533000	0.62120	AAC	.		0.418	ORC3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041452.2		
PLEKHG1	57480	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	151161158	151161158	+	Missense_Mutation	SNP	C	C	T			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr6:151161158C>T	ENST00000358517.2	+	16	3495	c.3284C>T	c.(3283-3285)gCa>gTa	p.A1095V	PLEKHG1_ENST00000367328.1_Missense_Mutation_p.A1095V			Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 1	1095							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(19)|ovary(5)|prostate(4)|stomach(1)|urinary_tract(3)	53			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		GGAGAGTTAGCAGATTTCTGT	0.488																																					p.A1095V													.	PLEKHG1-92	0			c.C3284T						.						63.0	63.0	63.0					6																	151161158		2203	4300	6503	SO:0001583	missense	57480	exon17			AGTTAGCAGATTT	AB033035	CCDS34552.1	6q25.1	2013-01-11			ENSG00000120278	ENSG00000120278		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20884	protein-coding gene	gene with protein product						10574462	Standard	XM_005267064		Approved	KIAA1209, ARHGEF41	uc003qny.1	Q9ULL1	OTTHUMG00000015824	ENST00000358517.2:c.3284C>T	6.37:g.151161158C>T	ENSP00000351318:p.Ala1095Val	Somatic	117	1		WXS	Illumina HiSeq	Phase_I	152	49	NM_001029884	0	0	0	0	0	Q5T1F2	Missense_Mutation	SNP	ENST00000358517.2	37	CCDS34552.1	.	.	.	.	.	.	.	.	.	.	C	15.34	2.803848	0.50315	.	.	ENSG00000120278	ENST00000367328;ENST00000358517	T;T	0.67345	-0.26;-0.26	5.81	4.91	0.64330	.	0.092382	0.85682	N	0.000000	T	0.44393	0.1291	L	0.41236	1.265	0.45541	D	0.998498	B;B	0.20052	0.041;0.041	B;B	0.17722	0.019;0.019	T	0.48570	-0.9024	10	0.52906	T	0.07	.	14.0507	0.64734	0.0:0.925:0.0:0.075	.	902;1095	Q5EBL9;Q9ULL1	.;PKHG1_HUMAN	V	1095	ENSP00000356297:A1095V;ENSP00000351318:A1095V	ENSP00000351318:A1095V	A	+	2	0	PLEKHG1	151202851	0.925000	0.31364	0.994000	0.49952	0.938000	0.57974	1.969000	0.40510	1.392000	0.46585	0.655000	0.94253	GCA	.		0.488	PLEKHG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042691.1		
HEATR2	54919	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	769345	769345	+	Missense_Mutation	SNP	A	A	C			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr7:769345A>C	ENST00000297440.6	+	2	661	c.641A>C	c.(640-642)cAg>cCg	p.Q214P	PRKAR1B_ENST00000403562.1_5'Flank|PRKAR1B_ENST00000488474.1_5'Flank|HEATR2_ENST00000438961.1_3'UTR|PRKAR1B_ENST00000537384.1_5'Flank|HEATR2_ENST00000313147.5_Missense_Mutation_p.Q214P	NM_017802.3	NP_060272.3	Q86Y56	HEAT2_HUMAN	HEAT repeat containing 2	214						cytoplasm (GO:0005737)				breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|prostate(4)|skin(1)	22		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0182)|Epithelial(4;5.48e-17)|OV - Ovarian serous cystadenocarcinoma(56;1.95e-16)|all cancers(6;2.98e-14)		CCCCTGATGCAGACCATCTCC	0.622																																					p.Q214P													.	HEATR2-69	0			c.A641C						.						79.0	63.0	69.0					7																	769345		2203	4300	6503	SO:0001583	missense	54919	exon2			TGATGCAGACCAT	AL832914, AK000404, NM_017802, AK056233	CCDS34580.1	7p22.3	2014-05-06	2006-05-19		ENSG00000164818	ENSG00000164818			26013	protein-coding gene	gene with protein product		614864				23040496	Standard	NM_017802		Approved	FLJ20397, FLJ31671, FLJ39381, FLJ25564, CILD18	uc010krz.1	Q86Y56	OTTHUMG00000151416	ENST00000297440.6:c.641A>C	7.37:g.769345A>C	ENSP00000297440:p.Gln214Pro	Somatic	70	1		WXS	Illumina HiSeq	Phase_I	98	23	NM_017802	0	0	4	4	0	Q69YL1|Q96FI9|Q9NX75	Missense_Mutation	SNP	ENST00000297440.6	37	CCDS34580.1	.	.	.	.	.	.	.	.	.	.	A	16.52	3.146749	0.57151	.	.	ENSG00000164818	ENST00000297440;ENST00000313147	T;T	0.18502	2.21;2.21	5.06	5.06	0.68205	Armadillo-like helical (1);Armadillo-type fold (1);	0.285236	0.28114	N	0.016547	T	0.18045	0.0433	L	0.45137	1.4	0.52501	D	0.99995	D	0.57899	0.981	B	0.44044	0.439	T	0.02774	-1.1112	10	0.27082	T	0.32	-19.4779	14.8182	0.70050	1.0:0.0:0.0:0.0	.	214	Q86Y56	HEAT2_HUMAN	P	214	ENSP00000297440:Q214P;ENSP00000321451:Q214P	ENSP00000297440:Q214P	Q	+	2	0	HEATR2	735871	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.233000	0.65337	1.904000	0.55121	0.460000	0.39030	CAG	.		0.622	HEATR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322542.1	NM_017802	
SDK1	221935	broad.mit.edu;bcgsc.ca	37	7	4056809	4056809	+	Silent	SNP	C	C	T			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr7:4056809C>T	ENST00000404826.2	+	17	2566	c.2427C>T	c.(2425-2427)cgC>cgT	p.R809R	SDK1_ENST00000389531.3_Silent_p.R809R	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	809	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		GCAGGTACCGCCTGGCTGGCC	0.567																																					p.R809R													.	SDK1-138	0			c.C2427T						.						54.0	47.0	49.0					7																	4056809		2203	4300	6503	SO:0001819	synonymous_variant	221935	exon17			GTACCGCCTGGCT	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.2427C>T	7.37:g.4056809C>T		Somatic	97	2		WXS	Illumina HiSeq	Phase_I	114	62	NM_152744	0	0	0	0	0	Q8TEN9|Q8TEP5|Q96N44	Silent	SNP	ENST00000404826.2	37	CCDS34590.1																																																																																			.		0.567	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744	
CDK13	8621	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	40134339	40134339	+	Silent	SNP	T	T	C			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr7:40134339T>C	ENST00000181839.4	+	14	4904	c.4299T>C	c.(4297-4299)ccT>ccC	p.P1433P	CDK13_ENST00000340829.5_Silent_p.P1373P	NM_003718.4|NM_031267.3	NP_003709.3|NP_112557.2	Q14004	CDK13_HUMAN	cyclin-dependent kinase 13	1433					alternative mRNA splicing, via spliceosome (GO:0000380)|hemopoiesis (GO:0030097)|multicellular organismal development (GO:0007275)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|positive regulation of cell proliferation (GO:0008284)|regulation of mitosis (GO:0007088)|viral process (GO:0016032)	cyclin K-CDK13 complex (GO:0002945)|extracellular space (GO:0005615)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(1)|pancreas(2)|prostate(2)|skin(5)|stomach(2)|urinary_tract(1)	49						GCCATGGTCCTATTGCAGTCC	0.463																																					p.P1433P													.	CDK13-548	0			c.T4299C						.						125.0	110.0	115.0					7																	40134339		2203	4300	6503	SO:0001819	synonymous_variant	8621	exon14			TGGTCCTATTGCA	M80629	CCDS5461.1, CCDS5462.1	7p14.1	2011-11-08	2009-12-16	2009-12-16	ENSG00000065883	ENSG00000065883		"""Cyclin-dependent kinases"""	1733	protein-coding gene	gene with protein product	"""cholinesterase-related cell division controller"""	603309	"""cell division cycle 2-like 5 (cholinesterase-related cell division controller)"""	CDC2L5		1731328, 19884882	Standard	NM_003718		Approved	CHED, CDC2L, KIAA1791	uc003thh.4	Q14004	OTTHUMG00000023726	ENST00000181839.4:c.4299T>C	7.37:g.40134339T>C		Somatic	107	2		WXS	Illumina HiSeq	Phase_I	147	35	NM_003718	0	0	1	2	1	Q53G78|Q6DKQ9|Q75MH4|Q75MH5|Q96JN4|Q9H4A0|Q9H4A1|Q9UDR4	Silent	SNP	ENST00000181839.4	37	CCDS5461.1																																																																																			.		0.463	CDK13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250726.2	NM_003718	
ENTPD4	9583	broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	23294705	23294705	+	Silent	SNP	G	G	A			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr8:23294705G>A	ENST00000358689.4	-	10	1351	c.1116C>T	c.(1114-1116)gaC>gaT	p.D372D	ENTPD4_ENST00000417069.2_Silent_p.D364D|ENTPD4_ENST00000521321.1_5'Flank|ENTPD4_ENST00000356206.6_Silent_p.D364D	NM_001128930.2|NM_004901.4	NP_001122402.1|NP_004892.1	Q9Y227	ENTP4_HUMAN	ectonucleoside triphosphate diphosphohydrolase 4	372					UDP catabolic process (GO:0006256)	cytoplasmic vesicle (GO:0031410)|integral component of Golgi membrane (GO:0030173)|intracellular membrane-bounded organelle (GO:0043231)	uridine-diphosphatase activity (GO:0045134)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	25		Prostate(55;0.114)		Colorectal(74;0.0161)|COAD - Colon adenocarcinoma(73;0.0649)		CATCTTTAATGTCTAGGGGTA	0.458																																					p.D372D													.	ENTPD4-92	0			c.C1116T						.						128.0	102.0	111.0					8																	23294705		2203	4300	6503	SO:0001819	synonymous_variant	9583	exon10			TTTAATGTCTAGG	AJ131358	CCDS6041.1, CCDS47827.1	8p21.3	2014-05-16	2004-09-22	2004-09-22	ENSG00000197217	ENSG00000197217			14573	protein-coding gene	gene with protein product		607577	"""lysosomal apyrase-like 1"""	LYSAL1		10393803, 9205841	Standard	NM_001128930		Approved	LALP70, LAP70, KIAA0392, NTPDase-4, UDPase	uc003xdl.3	Q9Y227	OTTHUMG00000097852	ENST00000358689.4:c.1116C>T	8.37:g.23294705G>A		Somatic	155	1		WXS	Illumina HiSeq	Phase_I	140	37	NM_004901	0	0	2	4	2	D3DSS3|O15092	Silent	SNP	ENST00000358689.4	37	CCDS6041.1																																																																																			.		0.458	ENTPD4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000215142.1	NM_004901	
RAB11FIP1	80223	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	37729061	37729061	+	Missense_Mutation	SNP	G	G	C			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr8:37729061G>C	ENST00000330843.4	-	4	3271	c.3259C>G	c.(3259-3261)Cct>Gct	p.P1087A	RAB11FIP1_ENST00000524118.1_Intron|RAB11FIP1_ENST00000523182.1_5'UTR|RAB11FIP1_ENST00000522727.1_Intron|RAB11FIP1_ENST00000287263.4_Intron	NM_001002814.2	NP_001002814.2	Q6WKZ4	RFIP1_HUMAN	RAB11 family interacting protein 1 (class I)	1087					protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(4)|endometrium(3)|large_intestine(6)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	49		Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;3.62e-11)			GATGTGCCAGGAGGCGGGCTT	0.552											OREG0018713	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P1087A		.											.	RAB11FIP1-92	0			c.C3259G						.						190.0	202.0	198.0					8																	37729061		2203	4300	6503	SO:0001583	missense	80223	exon4			TGCCAGGAGGCGG	AK092296	CCDS34881.1, CCDS34882.1	8p11.22	2005-10-04			ENSG00000156675	ENSG00000156675			30265	protein-coding gene	gene with protein product		608737				11786538, 11495908	Standard	NM_001002814		Approved	RCP, FLJ22622, FLJ22524, Rab11-FIP1	uc003xkm.2	Q6WKZ4	OTTHUMG00000164026	ENST00000330843.4:c.3259C>G	8.37:g.37729061G>C	ENSP00000331342:p.Pro1087Ala	Somatic	45	0	872	WXS	Illumina HiSeq	Phase_I	69	30	NM_001002814	0	0	0	0	0	J3KNP0|Q307T1|Q6AZK4|Q6WKZ2|Q6WKZ6|Q86YV4|Q8TDL1|Q9H642	Missense_Mutation	SNP	ENST00000330843.4	37	CCDS34882.1	.	.	.	.	.	.	.	.	.	.	G	10.50	1.368051	0.24771	.	.	ENSG00000156675	ENST00000330843	T	0.11712	2.75	5.24	0.717	0.18196	.	0.271342	0.26499	N	0.024035	T	0.05823	0.0152	L	0.36672	1.1	0.09310	N	0.999994	P;B	0.37101	0.582;0.057	B;B	0.33392	0.163;0.02	T	0.32481	-0.9905	10	0.19590	T	0.45	-8.4888	3.2151	0.06696	0.4377:0.2192:0.3431:0.0	.	416;1087	Q67C35;Q6WKZ4	.;RFIP1_HUMAN	A	1087	ENSP00000331342:P1087A	ENSP00000331342:P1087A	P	-	1	0	RAB11FIP1	37848219	0.746000	0.28272	0.013000	0.15412	0.003000	0.03518	1.420000	0.34804	0.206000	0.20587	-0.136000	0.14681	CCT	.		0.552	RAB11FIP1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376816.1	NM_025151	
EFCAB1	79645	broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	49647695	49647695	+	Silent	SNP	G	G	A			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr8:49647695G>A	ENST00000262103.3	-	1	96	c.16C>T	c.(16-18)Ctg>Ttg	p.L6L	EFCAB1_ENST00000433756.1_Silent_p.L6L|EFCAB1_ENST00000523092.1_Silent_p.L6L|EFCAB1_ENST00000521002.1_5'UTR	NM_024593.3	NP_078869.1	Q9HAE3	EFCB1_HUMAN	EF-hand calcium binding domain 1	6							calcium ion binding (GO:0005509)			endometrium(1)|large_intestine(3)|lung(6)|pancreas(1)|prostate(1)|urinary_tract(2)	14		all_epithelial(80;0.0134)|Lung NSC(129;0.0207)|all_lung(136;0.0464)				AGCTTCTGCAGTTTCTTGCGG	0.627																																					p.L6L													.	EFCAB1-90	0			c.C16T						.						171.0	157.0	162.0					8																	49647695		2203	4300	6503	SO:0001819	synonymous_variant	79645	exon1			TCTGCAGTTTCTT		CCDS6145.1, CCDS47853.1	8q11.21	2013-01-10			ENSG00000034239	ENSG00000034239		"""EF-hand domain containing"""	25678	protein-coding gene	gene with protein product						12477932	Standard	NM_024593		Approved	FLJ11767	uc003xqo.2	Q9HAE3	OTTHUMG00000164203	ENST00000262103.3:c.16C>T	8.37:g.49647695G>A		Somatic	70	1		WXS	Illumina HiSeq	Phase_I	60	22	NM_024593	0	0	0	0	0	B4DSB4|E7EVN7	Silent	SNP	ENST00000262103.3	37	CCDS6145.1																																																																																			.		0.627	EFCAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377778.1	NM_024593	
RUNX1T1	862	ucsc.edu;bcgsc.ca	37	8	93088202	93088202	+	Missense_Mutation	SNP	A	A	G			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr8:93088202A>G	ENST00000523629.1	-	2	533	c.79T>C	c.(79-81)Tat>Cat	p.Y27H	RUNX1T1_ENST00000265814.3_Missense_Mutation_p.Y27H|RUNX1T1_ENST00000520724.1_Intron|RUNX1T1_ENST00000518844.1_5'UTR|RUNX1T1_ENST00000522163.1_5'UTR|RUNX1T1_ENST00000436581.2_Intron|RUNX1T1_ENST00000360348.2_Intron	NM_001198626.1|NM_001198630.1|NM_001198633.1|NM_175634.2	NP_001185555.1|NP_001185559.1|NP_001185562.1|NP_783552.1	Q06455	MTG8_HUMAN	runt-related transcription factor 1; translocated to, 1 (cyclin D-related)	27					fat cell differentiation (GO:0045444)|generation of precursor metabolites and energy (GO:0006091)|regulation of DNA binding (GO:0051101)|transcription, DNA-templated (GO:0006351)	nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(54)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	86			BRCA - Breast invasive adenocarcinoma(11;0.0141)			CCTTGACAATATTCAAAGTTC	0.323																																					p.Y27H													.	RUNX1T1-1196	0			c.T79C						.						148.0	143.0	145.0					8																	93088202		2203	4300	6503	SO:0001583	missense	862	exon2			GACAATATTCAAA	D43638	CCDS6256.1, CCDS6257.1, CCDS47891.1, CCDS56544.1, CCDS75766.1, CCDS75767.1	8q22	2007-01-29	2005-01-20	2005-01-22	ENSG00000079102	ENSG00000079102		"""Zinc fingers, MYND-type"""	1535	protein-coding gene	gene with protein product		133435	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 1; cyclin D-related"""	AML1T1, CBFA2T1		1391946, 9790752	Standard	NM_004349		Approved	CDR, ETO, MTG8, ZMYND2	uc011lgi.2	Q06455	OTTHUMG00000164066	ENST00000523629.1:c.79T>C	8.37:g.93088202A>G	ENSP00000428543:p.Tyr27His	Somatic	66	1		WXS	Illumina HiSeq		43	12	NM_001198628	0	0	0	0	0	B7Z4P4|E7EPN4|O14784|Q06456|Q14873|Q16239|Q16346|Q16347|Q6IBL1|Q6NXH1|Q7Z4J5|Q92479|Q9BRZ0	Missense_Mutation	SNP	ENST00000523629.1	37	CCDS6256.1	.	.	.	.	.	.	.	.	.	.	A	13.29	2.192939	0.38707	.	.	ENSG00000079102	ENST00000523629;ENST00000265814;ENST00000518992;ENST00000519847;ENST00000522467;ENST00000517919;ENST00000520583;ENST00000523168;ENST00000521375;ENST00000520974;ENST00000518954;ENST00000520428;ENST00000518449	T;T;T	0.48201	1.46;1.46;0.82	5.48	5.48	0.80851	.	.	.	.	.	T	0.36524	0.0970	L	0.29908	0.895	0.33916	D	0.640263	B	0.30664	0.289	B	0.26094	0.066	T	0.50101	-0.8867	9	0.35671	T	0.21	33.7713	14.4227	0.67196	1.0:0.0:0.0:0.0	.	27	Q06455	MTG8_HUMAN	H	27	ENSP00000428543:Y27H;ENSP00000265814:Y27H;ENSP00000431094:Y27H	ENSP00000265814:Y27H	Y	-	1	0	RUNX1T1	93157378	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.070000	0.57548	2.210000	0.71456	0.460000	0.39030	TAT	.		0.323	RUNX1T1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377045.3	NM_004349, NM_175635	
GRINA	2907	broad.mit.edu	37	8	145065567	145065567	+	Missense_Mutation	SNP	A	A	C			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr8:145065567A>C	ENST00000313269.5	+	2	454	c.176A>C	c.(175-177)cAt>cCt	p.H59P	GRINA_ENST00000395068.4_Missense_Mutation_p.H59P	NM_000837.1	NP_000828.1	Q7Z429	LFG1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding)	59	Pro-rich.					integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(1)|stomach(1)	9	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.31e-40)|Epithelial(56;1.16e-39)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GGGTACCCCCATGGCCCCAGC	0.701																																					p.H59P													.	GRINA-90	0			c.A176C						.						5.0	6.0	6.0					8																	145065567		2054	4104	6158	SO:0001583	missense	2907	exon2			ACCCCCATGGCCC	NM_001009184	CCDS34961.1	8q24.3	2010-03-18	2008-04-01						4589	protein-coding gene	gene with protein product	"""transmembrane BAX inhibitor motif containing 3"""	138251		NMDARA1		1719427, 8406459	Standard	XM_005250899		Approved	HNRGW, TMBIM3, LFG1	uc003zao.1	Q7Z429		ENST00000313269.5:c.176A>C	8.37:g.145065567A>C	ENSP00000314380:p.His59Pro	Somatic	154	6		WXS	Illumina HiSeq	Phase_I	155	14	NM_001009184	0	0	36	36	0	B3KXM7|O43836|Q8IVW7	Missense_Mutation	SNP	ENST00000313269.5	37	CCDS34961.1	.	.	.	.	.	.	.	.	.	.	A	9.808	1.182408	0.21870	.	.	ENSG00000178719	ENST00000313269;ENST00000529301;ENST00000395068;ENST00000530898;ENST00000537637	T;T;T	0.23552	1.92;1.9;1.92	4.86	4.86	0.63082	.	0.419238	0.23836	N	0.044091	T	0.12347	0.0300	N	0.03608	-0.345	0.27083	N	0.963048	B	0.02656	0.0	B	0.01281	0.0	T	0.13899	-1.0492	10	0.34782	T	0.22	-2.4157	12.7237	0.57156	1.0:0.0:0.0:0.0	.	59	Q7Z429	GRINA_HUMAN	P	59;59;59;59;40	ENSP00000314380:H59P;ENSP00000432706:H59P;ENSP00000378507:H59P	ENSP00000314380:H59P	H	+	2	0	GRINA	145137555	0.998000	0.40836	0.947000	0.38551	0.731000	0.41821	3.380000	0.52448	1.961000	0.56991	0.462000	0.41574	CAT	.		0.701	GRINA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384048.1	NM_001009184	
DOCK8	81704	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	441958	441958	+	Silent	SNP	C	C	T			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr9:441958C>T	ENST00000453981.1	+	42	5551	c.5439C>T	c.(5437-5439)gtC>gtT	p.V1813V	DOCK8_ENST00000469391.1_Silent_p.V1713V|DOCK8_ENST00000382329.1_Silent_p.V1280V|DOCK8_ENST00000432829.2_Silent_p.V1745V			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	1813	DHR-2.				blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		AGGAGTTTGTCTACAAAGAGC	0.403																																					p.V1813V		.											.	DOCK8-517	0			c.C5439T						.						111.0	106.0	108.0					9																	441958		2203	4300	6503	SO:0001819	synonymous_variant	81704	exon42			GTTTGTCTACAAA	AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.5439C>T	9.37:g.441958C>T		Somatic	141	0		WXS	Illumina HiSeq	Phase_I	83	35	NM_203447	0	0	4	4	0	A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Silent	SNP	ENST00000453981.1	37	CCDS6440.2																																																																																			.		0.403	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171792.5	XM_036307	
TAF1L	138474	ucsc.edu;bcgsc.ca	37	9	32632528	32632528	+	Missense_Mutation	SNP	A	A	G			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr9:32632528A>G	ENST00000242310.4	-	1	3139	c.3050T>C	c.(3049-3051)cTt>cCt	p.L1017P	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	1017					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		TTTCAGGGAAAGGCGACGAAG	0.453																																					p.L1017P													.	TAF1L-870	0			c.T3050C						.						258.0	244.0	248.0					9																	32632528		2203	4298	6501	SO:0001583	missense	138474	exon1			AGGGAAAGGCGAC	AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.3050T>C	9.37:g.32632528A>G	ENSP00000418379:p.Leu1017Pro	Somatic	256	2		WXS	Illumina HiSeq		287	90	NM_153809	0	0	0	0	0	Q0VG57	Missense_Mutation	SNP	ENST00000242310.4	37	CCDS35003.1	.	.	.	.	.	.	.	.	.	.	A	17.71	3.456647	0.63401	.	.	ENSG00000122728	ENST00000242310	T	0.16457	2.34	0.479	0.479	0.16796	Transcription initiation factor TFIID subunit 1, domain of unknown function (1);	0.117031	0.64402	D	0.000013	T	0.42877	0.1222	M	0.92268	3.29	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.34675	-0.9819	10	0.87932	D	0	.	5.1959	0.15236	0.9999:0.0:1.0E-4:0.0	.	1017	Q8IZX4	TAF1L_HUMAN	P	1017	ENSP00000418379:L1017P	ENSP00000418379:L1017P	L	-	2	0	TAF1L	32622528	1.000000	0.71417	0.965000	0.40720	0.794000	0.44872	5.776000	0.68924	0.426000	0.26116	0.164000	0.16699	CTT	.		0.453	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052012.2		
SHB	6461	broad.mit.edu	37	9	37956019	37956019	+	Missense_Mutation	SNP	A	A	G			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr9:37956019A>G	ENST00000377707.3	-	4	1652	c.1087T>C	c.(1087-1089)Tcc>Ccc	p.S363P	RP11-613M10.9_ENST00000540557.1_3'UTR	NM_003028.2	NP_003019.2	Q15464	SHB_HUMAN	Src homology 2 domain containing adaptor protein B	363	Mediates interaction with LAT, PTK2/FAK1, JAK1 and JAK3.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(2)|endometrium(4)|lung(1)|prostate(1)|skin(1)|soft_tissue(1)|stomach(1)	11		all_epithelial(88;0.122)		GBM - Glioblastoma multiforme(29;3.27e-05)|Lung(182;0.0658)		GGTGAGGGGGATGACTGCCGC	0.602																																					p.S363P													.	SHB-92	0			c.T1087C						.						39.0	33.0	35.0					9																	37956019		1990	4146	6136	SO:0001583	missense	6461	exon4			AGGGGGATGACTG		CCDS43806.1	9p13.2	2013-09-23	2005-05-24		ENSG00000107338	ENSG00000107338		"""SH2 domain containing"""	10838	protein-coding gene	gene with protein product		600314	"""SHB adaptor protein (a Src homology 2 protein)"", ""SHB (Src homology 2 domain containing) adaptor protein B"""			7713524	Standard	NM_003028		Approved		uc004aax.3	Q15464	OTTHUMG00000019936	ENST00000377707.3:c.1087T>C	9.37:g.37956019A>G	ENSP00000366936:p.Ser363Pro	Somatic	105	0		WXS	Illumina HiSeq	Phase_I	86	4	NM_003028	0	0	69	69	0	B9EGM0|D3DRQ5|Q504U5|Q5VUM8	Missense_Mutation	SNP	ENST00000377707.3	37	CCDS43806.1	.	.	.	.	.	.	.	.	.	.	A	15.42	2.827960	0.50845	.	.	ENSG00000107338	ENST00000377707	T	0.36520	1.25	5.68	5.68	0.88126	.	0.117982	0.39341	N	0.001400	T	0.33760	0.0874	N	0.12182	0.205	0.80722	D	1	D	0.61697	0.99	P	0.53649	0.731	T	0.24297	-1.0164	10	0.52906	T	0.07	-16.6295	13.8702	0.63615	1.0:0.0:0.0:0.0	.	363	Q15464	SHB_HUMAN	P	363	ENSP00000366936:S363P	ENSP00000366936:S363P	S	-	1	0	SHB	37946019	1.000000	0.71417	0.999000	0.59377	0.957000	0.61999	6.114000	0.71560	2.161000	0.67846	0.460000	0.39030	TCC	.		0.602	SHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052490.1		
PRKACG	5568	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	71628289	71628289	+	Silent	SNP	G	G	A	rs140133619		TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr9:71628289G>A	ENST00000377276.2	-	1	750	c.720C>T	c.(718-720)taC>taT	p.Y240Y		NM_002732.3	NP_002723.2	P22612	KAPCG_HUMAN	protein kinase, cAMP-dependent, catalytic, gamma	240	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|carbohydrate metabolic process (GO:0005975)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|male gonad development (GO:0008584)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)|triglyceride catabolic process (GO:0019433)|water transport (GO:0006833)	cytosol (GO:0005829)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)	p.Y240Y(1)		central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22						GCTGGTCGGCGTAGAAGGGTG	0.602																																					p.Y240Y	Esophageal Squamous(110;2236 2623 32146)	.											.	PRKACG-1061	1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)	c.C720T						.						70.0	68.0	68.0					9																	71628289		2203	4300	6503	SO:0001819	synonymous_variant	5568	exon1			GTCGGCGTAGAAG	M34182	CCDS6625.1	9q13	2012-10-02			ENSG00000165059	ENSG00000165059	2.7.11.1		9382	protein-coding gene	gene with protein product		176893				2342480, 9598317	Standard	NM_002732		Approved	PKACg	uc004agy.3	P22612	OTTHUMG00000019974	ENST00000377276.2:c.720C>T	9.37:g.71628289G>A		Somatic	90	0		WXS	Illumina HiSeq	Phase_I	91	28	NM_002732	0	0	0	0	0	O60850|Q5VZ02|Q86YI1	Silent	SNP	ENST00000377276.2	37	CCDS6625.1																																																																																			G|1.000;C|0.000		0.602	PRKACG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052559.1		
GDA	9615	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	74838062	74838062	+	Silent	SNP	A	A	G			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr9:74838062A>G	ENST00000358399.3	+	7	726	c.633A>G	c.(631-633)acA>acG	p.T211T	GDA_ENST00000545168.1_Silent_p.T137T|GDA_ENST00000238018.4_Silent_p.T211T|GDA_ENST00000376986.1_Intron|GDA_ENST00000477618.1_3'UTR|GDA_ENST00000376989.3_Intron	NM_001242505.2|NM_001242506.2|NM_004293.4	NP_001229434.1|NP_001229435.1|NP_004284.1	Q9Y2T3	GUAD_HUMAN	guanine deaminase	211					guanine catabolic process (GO:0006147)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	guanine deaminase activity (GO:0008892)|zinc ion binding (GO:0008270)			central_nervous_system(4)|endometrium(1)|kidney(1)|large_intestine(1)|lung(20)|ovary(2)|skin(2)|urinary_tract(1)	32		Myeloproliferative disorder(762;0.0122)		Lung(182;0.0583)		CCATAGTGACACCACGTTTTT	0.388																																					p.T211T													.	GDA-230	0			c.A633G						.						187.0	173.0	177.0					9																	74838062		2203	4300	6503	SO:0001819	synonymous_variant	9615	exon7			AGTGACACCACGT	AF095286	CCDS6641.1, CCDS56576.1, CCDS56577.1	9q21.13	2008-05-14			ENSG00000119125	ENSG00000119125			4212	protein-coding gene	gene with protein product		139260				10075721, 3966794	Standard	NM_001242507		Approved		uc004air.3	Q9Y2T3	OTTHUMG00000020005	ENST00000358399.3:c.633A>G	9.37:g.74838062A>G		Somatic	146	1		WXS	Illumina HiSeq	Phase_I	88	19	NM_004293	0	0	7	16	9	B4DTY5|Q5SZC7|Q9H335|Q9ULG2	Silent	SNP	ENST00000358399.3	37	CCDS6641.1																																																																																			.		0.388	GDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052633.1		
ZNF462	58499	ucsc.edu;bcgsc.ca	37	9	109688639	109688639	+	Missense_Mutation	SNP	G	G	A			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr9:109688639G>A	ENST00000277225.5	+	3	2735	c.2446G>A	c.(2446-2448)Gct>Act	p.A816T	ZNF462_ENST00000441147.2_5'Flank|ZNF462_ENST00000457913.1_Missense_Mutation_p.A816T			Q96JM2	ZN462_HUMAN	zinc finger protein 462	816					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						TTCCAATACTGCTCTGCTGAA	0.433																																					p.A816T													.	ZNF462-95	0			c.G2446A						.						81.0	79.0	80.0					9																	109688639		2203	4300	6503	SO:0001583	missense	58499	exon3			AATACTGCTCTGC	AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.2446G>A	9.37:g.109688639G>A	ENSP00000277225:p.Ala816Thr	Somatic	126	2		WXS	Illumina HiSeq		117	30	NM_021224	0	0	0	0	0	Q5T0T4|Q8N408	Missense_Mutation	SNP	ENST00000277225.5	37	CCDS35096.1	.	.	.	.	.	.	.	.	.	.	G	10.29	1.310351	0.23821	.	.	ENSG00000148143	ENST00000277225;ENST00000457913	T;T	0.05996	3.36;3.81	5.87	3.01	0.34805	.	0.369247	0.28016	N	0.016934	T	0.03827	0.0108	N	0.19112	0.55	0.80722	D	1	B;B	0.20052	0.041;0.037	B;B	0.21360	0.016;0.034	T	0.48080	-0.9066	9	.	.	.	.	6.0149	0.19596	0.1469:0.0:0.4517:0.4014	.	816;816	Q96JM2-3;Q96JM2	.;ZN462_HUMAN	T	816	ENSP00000277225:A816T;ENSP00000414570:A816T	.	A	+	1	0	ZNF462	108728460	0.183000	0.23186	0.395000	0.26283	0.986000	0.74619	0.537000	0.23144	0.377000	0.24735	0.650000	0.86243	GCT	.		0.433	ZNF462-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053532.2	NM_021224	
DNM1	1759	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	130982346	130982346	+	Silent	SNP	G	G	A			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr9:130982346G>A	ENST00000372923.3	+	5	761	c.669G>A	c.(667-669)aaG>aaA	p.K223K	DNM1_ENST00000486160.1_Silent_p.K223K|DNM1_ENST00000393594.3_Silent_p.K223K|DNM1_ENST00000341179.7_Silent_p.K223K|DNM1_ENST00000475805.1_Silent_p.K223K	NM_004408.2	NP_004399.2	Q05193	DYN1_HUMAN	dynamin 1	223	Dynamin-type G.				endocytosis (GO:0006897)|endosome organization (GO:0007032)|GTP catabolic process (GO:0006184)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)	extracellular vesicular exosome (GO:0070062)|membrane coat (GO:0030117)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(15)|lung(6)|ovary(2)|urinary_tract(2)	32						TGGAGAACAAGCTGCTCCCCC	0.647																																					.	GBM(113;146 1575 2722 28670 29921)												.	DNM1-228	0			.						.						95.0	77.0	83.0					9																	130982346		2203	4300	6503	SO:0001819	synonymous_variant	1759	.			GAACAAGCTGCTC	L07807	CCDS6895.1, CCDS43882.1, CCDS75911.1, CCDS75912.1	9q34	2013-01-10			ENSG00000106976	ENSG00000106976		"""Pleckstrin homology (PH) domain containing"""	2972	protein-coding gene	gene with protein product		602377		DNM		2144893, 9143509	Standard	XM_005251763		Approved		uc022bob.1	Q05193	OTTHUMG00000020733	ENST00000372923.3:c.669G>A	9.37:g.130982346G>A		Somatic	154	0		WXS	Illumina HiSeq	Phase_I	153	46	.	0	0	0	4	4	A6NLM6|Q5SYX0|Q5SYX2|Q6P3T6|Q86VD2	Silent	SNP	ENST00000372923.3	37	CCDS6895.1																																																																																			.		0.647	DNM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054367.1	NM_004408	
URM1	81605	broad.mit.edu	37	9	131151640	131151640	+	Missense_Mutation	SNP	G	G	T			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr9:131151640G>T	ENST00000452446.1	+	4	351	c.289G>T	c.(289-291)Gtg>Ttg	p.V97L	URM1_ENST00000372850.1_3'UTR|URM1_ENST00000483206.1_3'UTR|URM1_ENST00000372853.4_Intron|RP11-339B21.11_ENST00000609303.1_lincRNA	NM_001135947.2	NP_001129419.1			ubiquitin related modifier 1											cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)	5						TGCTGCTTCAGTGGGAAAGCG	0.617																																					p.V97L													.	URM1-90	0			c.G289T						.						51.0	48.0	49.0					9																	131151640		1327	2309	3636	SO:0001583	missense	81605	exon4			GCTTCAGTGGGAA	AK097029	CCDS6900.1, CCDS48035.1, CCDS59148.1	9q34.13	2010-06-24	2010-06-24	2006-11-28	ENSG00000167118	ENSG00000167118			28378	protein-coding gene	gene with protein product		612693	"""chromosome 9 open reading frame 74"", ""ubiquitin related modifier 1 homolog (S. cerevisiae)"""	C9orf74		16046629, 16864801	Standard	NM_030914		Approved	MGC2668	uc011may.2	Q9BTM9	OTTHUMG00000020742	ENST00000452446.1:c.289G>T	9.37:g.131151640G>T	ENSP00000412922:p.Val97Leu	Somatic	72	0		WXS	Illumina HiSeq	Phase_I	95	4	NM_001135947	0	0	0	0	0		Missense_Mutation	SNP	ENST00000452446.1	37	CCDS48035.1	.	.	.	.	.	.	.	.	.	.	G	12.42	1.932635	0.34096	.	.	ENSG00000167118	ENST00000452446	.	.	.	3.84	0.924	0.19418	.	.	.	.	.	T	0.23451	0.0567	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.22626	-1.0211	6	.	.	.	.	6.151	0.20313	0.107:0.3997:0.4933:0.0	.	97	Q9BTM9-2	.	L	97	.	.	V	+	1	0	URM1	130191461	0.029000	0.19370	0.002000	0.10522	0.123000	0.20343	0.709000	0.25734	0.202000	0.20498	-0.947000	0.02670	GTG	.		0.617	URM1-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_030914	
MAMDC4	158056	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	139748712	139748712	+	Silent	SNP	C	C	T			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr9:139748712C>T	ENST00000317446.2	+	7	770	c.720C>T	c.(718-720)gtC>gtT	p.V240V	MAMDC4_ENST00000445819.1_Silent_p.V240V|MAMDC4_ENST00000485732.1_3'UTR	NM_206920.2	NP_996803.2			MAM domain containing 4											breast(4)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	19	all_cancers(76;0.0763)|all_epithelial(76;0.198)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.52e-05)|Epithelial(140;0.000171)		AGAACAAGGTCTGCGTGGAGC	0.667																																					p.V240V		.											.	MAMDC4-156	0			c.C720T						.						25.0	27.0	26.0					9																	139748712		2193	4296	6489	SO:0001819	synonymous_variant	158056	exon7			CAAGGTCTGCGTG	AL834531	CCDS7010.1	9q34.3	2013-10-21			ENSG00000177943	ENSG00000177943			24083	protein-coding gene	gene with protein product	"""apical early endosomal glycoprotein precursor"", ""endotubin"""					7829488	Standard	NM_206920		Approved	AEGP, DKFZp434M1411	uc004cjs.3	Q6UXC1	OTTHUMG00000020951	ENST00000317446.2:c.720C>T	9.37:g.139748712C>T		Somatic	106	0		WXS	Illumina HiSeq	Phase_I	130	38	NM_206920	0	0	0	0	0		Silent	SNP	ENST00000317446.2	37	CCDS7010.1																																																																																			.		0.667	MAMDC4-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254642.3	NM_206920	
ATP7A	538	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	77268391	77268391	+	Missense_Mutation	SNP	T	T	A			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chrX:77268391T>A	ENST00000341514.6	+	10	2343	c.2188T>A	c.(2188-2190)Tac>Aac	p.Y730N	ATP7A_ENST00000350425.4_Intron|ATP7A_ENST00000343533.5_Intron	NM_000052.5	NP_000043.4	Q04656	ATP7A_HUMAN	ATPase, Cu++ transporting, alpha polypeptide	730					blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|cartilage development (GO:0051216)|catecholamine metabolic process (GO:0006584)|cellular copper ion homeostasis (GO:0006878)|central nervous system neuron development (GO:0021954)|cerebellar Purkinje cell differentiation (GO:0021702)|collagen fibril organization (GO:0030199)|copper ion export (GO:0060003)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|dendrite morphogenesis (GO:0048813)|detoxification of copper ion (GO:0010273)|dopamine metabolic process (GO:0042417)|elastic fiber assembly (GO:0048251)|elastin biosynthetic process (GO:0051542)|epinephrine metabolic process (GO:0042414)|extracellular matrix organization (GO:0030198)|hair follicle morphogenesis (GO:0031069)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotory behavior (GO:0007626)|lung alveolus development (GO:0048286)|mitochondrion organization (GO:0007005)|negative regulation of metalloenzyme activity (GO:0048553)|negative regulation of neuron apoptotic process (GO:0043524)|neuron projection morphogenesis (GO:0048812)|norepinephrine biosynthetic process (GO:0042421)|norepinephrine metabolic process (GO:0042415)|peptidyl-lysine modification (GO:0018205)|pigmentation (GO:0043473)|positive regulation of catalytic activity (GO:0043085)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of oxidoreductase activity (GO:0051353)|pyramidal neuron development (GO:0021860)|regulation of gene expression (GO:0010468)|regulation of oxidative phosphorylation (GO:0002082)|release of cytochrome c from mitochondria (GO:0001836)|removal of superoxide radicals (GO:0019430)|response to iron(III) ion (GO:0010041)|response to zinc ion (GO:0010043)|serotonin metabolic process (GO:0042428)|skin development (GO:0043588)|T-helper cell differentiation (GO:0042093)|transmembrane transport (GO:0055085)|tryptophan metabolic process (GO:0006568)|tyrosine metabolic process (GO:0006570)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|trans-Golgi network (GO:0005802)|trans-Golgi network transport vesicle (GO:0030140)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper ion transmembrane transporter activity (GO:0005375)|copper-dependent protein binding (GO:0032767)|copper-exporting ATPase activity (GO:0004008)|superoxide dismutase copper chaperone activity (GO:0016532)			breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(26)|pancreas(1)|prostate(1)|urinary_tract(1)	53					Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	CGGAGGCTGGTACTTCTACAT	0.343																																					p.Y730N		.											.	ATP7A-130	0			c.T2188A						.						139.0	122.0	127.0					X																	77268391		2203	4296	6499	SO:0001583	missense	538	exon10			GGCTGGTACTTCT	L06133	CCDS35339.1, CCDS75997.1	Xq21.1	2012-10-22	2008-07-31		ENSG00000165240	ENSG00000165240	3.6.3.4	"""ATPases / P-type"""	869	protein-coding gene	gene with protein product	"""copper pump 1"", ""copper-transporting ATPase 1"""	300011	"""Menkes syndrome"""	MNK		10079817	Standard	NM_000052		Approved		uc004ecx.4	Q04656	OTTHUMG00000021885	ENST00000341514.6:c.2188T>A	X.37:g.77268391T>A	ENSP00000345728:p.Tyr730Asn	Somatic	48	0		WXS	Illumina HiSeq	Phase_I	38	22	NM_000052	0	0	0	0	0	B1AT72|O00227|O00745|Q9BYY8	Missense_Mutation	SNP	ENST00000341514.6	37	CCDS35339.1	.	.	.	.	.	.	.	.	.	.	T	17.13	3.309564	0.60414	.	.	ENSG00000165240	ENST00000341514	T	0.75938	-0.98	5.64	-1.38	0.09027	.	0.505078	0.21943	N	0.066860	T	0.73345	0.3575	L	0.51422	1.61	0.80722	D	1	P	0.38729	0.644	P	0.48654	0.585	T	0.71629	-0.4535	10	0.59425	D	0.04	-15.6701	11.7399	0.51786	0.0:0.5586:0.0:0.4414	.	730	Q04656	ATP7A_HUMAN	N	730	ENSP00000345728:Y730N	ENSP00000345728:Y730N	Y	+	1	0	ATP7A	77155047	1.000000	0.71417	0.995000	0.50966	0.993000	0.82548	0.785000	0.26830	-0.249000	0.09569	0.381000	0.24937	TAC	.		0.343	ATP7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057306.1	NM_000052	
FAM45B	55855	ucsc.edu	37	X	129629790	129629790	+	lincRNA	SNP	A	A	G			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chrX:129629790A>G	ENST00000458525.1	-	0	1015				FAM45B_ENST00000592932.1_RNA																							CGTGCACCTCAACGCCGATGA	0.552																																					.													.	FAM45B-63	0			.						.						136.0	107.0	117.0					X																	129629790		2203	4300	6503			55855	.			CACCTCAACGCCG																													X.37:g.129629790A>G		Somatic	144	0		WXS	Illumina HiSeq		130	2	.	0	0	4	8	4		RNA	SNP	ENST00000458525.1	37																																																																																				.		0.552	RP1-274L7.1-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000058271.1		
CFAP57	149465	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	43675436	43675439	+	Frame_Shift_Del	DEL	TTGA	TTGA	-			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	TTGA	TTGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr1:43675436_43675439delTTGA	ENST00000372492.4	+	11	2102_2105	c.1778_1781delTTGA	c.(1777-1782)tttgatfs	p.FD593fs	WDR65_ENST00000528956.1_Frame_Shift_Del_p.FD593fs	NM_001195831.2	NP_001182760.2	Q96MR6	WDR65_HUMAN		593										NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				ATATCGGCGTTTGATGTCACCTAC	0.574																																					p.593_594del		.											.	WDR65-91	0			c.1778_1781del						.																																			SO:0001589	frameshift_variant	149465	exon11			.																												ENST00000372492.4:c.1778_1781delTTGA	1.37:g.43675436_43675439delTTGA	ENSP00000361570:p.Phe593fs	Somatic	59	0		WXS	Illumina HiSeq	Phase_I	67	19	NM_152498	0	0	0	0	0	A6NKQ3|Q17RI9|Q5TAI0	Frame_Shift_Del	DEL	ENST00000372492.4	37																																																																																				.		0.574	WDR65-002	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000384325.1		
ELTD1	64123	hgsc.bcm.edu;bcgsc.ca	37	1	79470814	79470814	+	Frame_Shift_Del	DEL	C	C	-			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr1:79470814delC	ENST00000370742.3	-	2	176	c.113delG	c.(112-114)ggafs	p.G38fs		NM_022159.3	NP_071442.2	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain containing 1	38	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.G38E(1)		NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(45)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	69				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		GGCTTCAATTCCATTGCGTAT	0.348																																					p.G38fs		.											.	ELTD1-24	1	Substitution - Missense(1)	endometrium(1)	c.113delG						.						140.0	127.0	131.0					1																	79470814		1864	4103	5967	SO:0001589	frameshift_variant	64123	exon2			.	AF192403	CCDS41352.1	1p33-p32	2014-08-08			ENSG00000162618	ENSG00000162618		"""-"", ""GPCR / Class B : Orphans"""	20822	protein-coding gene	gene with protein product						11050079	Standard	NM_022159		Approved	ETL	uc001diq.4	Q9HBW9	OTTHUMG00000009738	ENST00000370742.3:c.113delG	1.37:g.79470814delC	ENSP00000359778:p.Gly38fs	Somatic	175	0		WXS	Illumina HiSeq	Phase_I	82	20	NM_022159	0	0	0	0	0	B1AR71|Q5KU34	Frame_Shift_Del	DEL	ENST00000370742.3	37	CCDS41352.1																																																																																			.		0.348	ELTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026859.1	NM_022159	
SETDB1	9869	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	150900339	150900347	+	In_Frame_Del	DEL	AGATGGATT	AGATGGATT	-	rs201917860|rs200122173		TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	AGATGGATT	AGATGGATT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr1:150900339_150900347delAGATGGATT	ENST00000271640.5	+	2	339_347	c.149_157delAGATGGATT	c.(148-159)aagatggattgt>agt	p.50_53KMDC>S	SETDB1_ENST00000368962.2_In_Frame_Del_p.50_53KMDC>S|SETDB1_ENST00000368969.4_In_Frame_Del_p.50_53KMDC>S|SETDB1_ENST00000368963.1_In_Frame_Del_p.50_53KMDC>S|SETDB1_ENST00000459773.1_3'UTR	NM_001145415.1|NM_012432.3	NP_001138887.1|NP_036564.3	Q15047	SETB1_HUMAN	SET domain, bifurcated 1	50					bone development (GO:0060348)|histone H3-K9 trimethylation (GO:0036124)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)			GAACTGGAGAAGATGGATTGTGTACAGCA	0.474																																					p.50_53del		.											.	SETDB1-228	0			c.149_157del						.																																			SO:0001651	inframe_deletion	9869	exon2			.	D31891	CCDS972.1, CCDS44217.1, CCDS58026.1	1q21	2013-01-23			ENSG00000143379	ENSG00000143379		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Tudor domain containing"""	10761	protein-coding gene	gene with protein product	"""tudor domain containing 21"""	604396				10343109	Standard	NM_001145415		Approved	KG1T, KIAA0067, ESET, KMT1E, TDRD21	uc001evu.2	Q15047	OTTHUMG00000035003	ENST00000271640.5:c.149_157delAGATGGATT	1.37:g.150900339_150900347delAGATGGATT	ENSP00000271640:p.Lys50_Cys53delinsSer	Somatic	261	0		WXS	Illumina HiSeq	Phase_I	219	59	NM_012432	0	0	0	0	0	A6NEW2|Q5SZD8|Q5SZD9|Q5SZE0|Q5SZE7|Q96GM9	In_Frame_Del	DEL	ENST00000271640.5	37	CCDS44217.1																																																																																			.		0.474	SETDB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000084717.2		
DNAH14	127602	hgsc.bcm.edu;bcgsc.ca	37	1	225512004	225512005	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	CT	CT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr1:225512004_225512005delCT	ENST00000445597.2	+	43	7338_7339	c.7338_7339delCT	c.(7336-7341)tgctccfs	p.S2447fs	DNAH14_ENST00000430092.1_Frame_Shift_Del_p.S3100fs|DNAH14_ENST00000439375.2_Frame_Shift_Del_p.S3100fs			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14	2447					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						TTGCTTGTTGCTCCCTGTGCCA	0.396																																					p.3099_3100del		.											.	DNAH14-23	0			c.9297_9298del						.																																			SO:0001589	frameshift_variant	127602	exon61			.	U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.7338_7339delCT	1.37:g.225512004_225512005delCT	ENSP00000409472:p.Ser2447fs	Somatic	175	0		WXS	Illumina HiSeq	Phase_I	127	29	NM_001373	0	0	0	0	0	A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Frame_Shift_Del	DEL	ENST00000445597.2	37																																																																																				.		0.396	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000331217.3	XM_059166	
DCHS1	8642	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	6652589	6652589	+	Frame_Shift_Del	DEL	T	T	-			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr11:6652589delT	ENST00000299441.3	-	8	4136	c.3725delA	c.(3724-3726)aagfs	p.K1242fs	RP11-732A19.6_ENST00000526633.1_RNA	NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	1242	Cadherin 12. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ATCTGGATCCTTCGCCTGCAG	0.552																																					p.K1242fs		.											.	DCHS1-73	0			c.3725delA						.						206.0	169.0	181.0					11																	6652589		2201	4296	6497	SO:0001589	frameshift_variant	8642	exon8			.	AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.3725delA	11.37:g.6652589delT	ENSP00000299441:p.Lys1242fs	Somatic	78	0		WXS	Illumina HiSeq	Phase_I	77	21	NM_003737	0	0	0	0	0	O15098	Frame_Shift_Del	DEL	ENST00000299441.3	37	CCDS7771.1																																																																																			.		0.552	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1	NM_003737	
MON2	23041	bcgsc.ca	37	12	62931886	62931886	+	Frame_Shift_Del	DEL	G	G	-			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr12:62931886delG	ENST00000393632.2	+	17	2520	c.2129delG	c.(2128-2130)tggfs	p.W710fs	MON2_ENST00000546600.1_Frame_Shift_Del_p.W710fs|MON2_ENST00000552115.1_Frame_Shift_Del_p.W710fs|MON2_ENST00000393630.3_Frame_Shift_Del_p.W710fs|MON2_ENST00000552738.1_Frame_Shift_Del_p.W687fs|MON2_ENST00000393629.2_Frame_Shift_Del_p.W710fs|MON2_ENST00000280379.6_Frame_Shift_Del_p.W710fs	NM_015026.2	NP_055841.2	Q7Z3U7	MON2_HUMAN	MON2 homolog (S. cerevisiae)	710					actin cytoskeleton organization (GO:0030036)|Golgi to endosome transport (GO:0006895)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(15)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	57			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		CATCTTGTGTGGATTCTGGGA	0.353																																					p.W710X													.	MON2-514	0			c.2129delG						.						43.0	49.0	47.0					12																	62931886		2202	4300	6502	SO:0001589	frameshift_variant	23041	exon17			TTGTGTGGATTCT		CCDS31849.1, CCDS61175.1, CCDS61177.1, CCDS61178.1	12q14.1	2014-08-12	2006-04-04		ENSG00000061987	ENSG00000061987			29177	protein-coding gene	gene with protein product			"""MON2 homolog (yeast)"""			16301316, 24285343	Standard	NM_015026		Approved	KIAA1040	uc001sre.3	Q7Z3U7	OTTHUMG00000169992	ENST00000393632.2:c.2129delG	12.37:g.62931886delG	ENSP00000377252:p.Trp710fs	Somatic	161	1		WXS	Illumina HiSeq	Phase_1	89	24	NM_015026	0	0	0	0	0	A5D8U7|A7E2Y0|B9EGP5|F8VWA6|F8W1Z6|Q86TA2|Q8N3I5|Q8NAI0|Q8NHE2|Q9UPW1	Nonsense_Mutation	DEL	ENST00000393632.2	37	CCDS31849.1																																																																																			.		0.353	MON2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406767.3	NM_015026	
MEFV	4210	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	3304171	3304171	+	Frame_Shift_Del	DEL	T	T	-			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr16:3304171delT	ENST00000219596.1	-	2	936	c.897delA	c.(895-897)gaafs	p.E299fs	MEFV_ENST00000536379.1_Intron|MEFV_ENST00000541159.1_Intron|MEFV_ENST00000339854.4_Intron	NM_000243.2	NP_000234.1	O15553	MEFV_HUMAN	Mediterranean fever	299					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of macrophage inflammatory protein 1 alpha production (GO:0071641)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)			NS(2)|biliary_tract(1)|breast(5)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(3)|prostate(1)|skin(6)	50						tgacCGAATGTTCTGGATTTC	0.562																																					p.E299fs		.											.	MEFV-228	0			c.897delA						.						53.0	56.0	55.0					16																	3304171		2197	4300	6497	SO:0001589	frameshift_variant	4210	exon2			.	AF018080	CCDS10498.1, CCDS55981.1	16p13.3	2014-09-17			ENSG00000103313	ENSG00000103313		"""Tripartite motif containing / Tripartite motif containing"""	6998	protein-coding gene	gene with protein product	"""pyrin"""	608107		MEF		9288094	Standard	NM_000243		Approved	FMF, TRIM20	uc002cun.1	O15553	OTTHUMG00000129324	ENST00000219596.1:c.897delA	16.37:g.3304171delT	ENSP00000219596:p.Glu299fs	Somatic	53	0		WXS	Illumina HiSeq	Phase_I	62	14	NM_000243	0	0	0	0	0	D3DUC0|F5H0Q3|Q3MJ84|Q96PN4|Q96PN5	Frame_Shift_Del	DEL	ENST00000219596.1	37	CCDS10498.1																																																																																			.		0.562	MEFV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251464.1	NM_000243	
CHD3	1107	broad.mit.edu	37	17	7801857	7801859	+	In_Frame_Del	DEL	AAG	AAG	-			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	AAG	AAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr17:7801857_7801859delAAG	ENST00000330494.7	+	13	2245_2247	c.2095_2097delAAG	c.(2095-2097)aagdel	p.K703del	CHD3_ENST00000358181.4_In_Frame_Del_p.K703del|CHD3_ENST00000380358.4_In_Frame_Del_p.K762del	NM_001005273.2	NP_001005273.1	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3	703	Poly-Lys.				centrosome organization (GO:0051297)|chromatin assembly or disassembly (GO:0006333)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|spindle organization (GO:0007051)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(11)|kidney(6)|large_intestine(13)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	65		Prostate(122;0.202)				CCGCAAGTATAAGAAGAAGAAGA	0.488																																					p.758_758del													.	CHD3-228	0			c.2272_2274del						.		,,	1,4263		0,1,2131					,,	-0.1	1.0			78	5,8249		0,5,4122	no	coding,coding,coding	CHD3	NM_005852.3,NM_001005273.2,NM_001005271.2	,,	0,6,6253	A1A1,A1R,RR		0.0606,0.0235,0.0479	,,	,,		6,12512				SO:0001651	inframe_deletion	1107	exon13			AAGTATAAGAAGA	U08379	CCDS32553.2, CCDS32554.1, CCDS32555.1	17p13	2013-01-28			ENSG00000170004	ENSG00000170004		"""Zinc fingers, PHD-type"""	1918	protein-coding gene	gene with protein product		602120				9326634, 7560064	Standard	NM_001005271		Approved	Mi-2a, ZFH, Mi2-ALPHA	uc002gjd.2	Q12873	OTTHUMG00000150427	ENST00000330494.7:c.2095_2097delAAG	17.37:g.7801866_7801868delAAG	ENSP00000332628:p.Lys703del	Somatic	163	0		WXS	Illumina HiSeq	Phase_I	196	8	NM_001005271	0	0	0	0	0	D3DTQ9|E9PG89|Q9Y4I0	In_Frame_Del	DEL	ENST00000330494.7	37	CCDS32554.1																																																																																			.		0.488	CHD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318050.1	NM_001005273	
TEX14	56155	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	56676917	56676918	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	GA	GA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr17:56676917_56676918delGA	ENST00000240361.8	-	14	1891_1892	c.1806_1807delTC	c.(1804-1809)gctcctfs	p.P603fs	TEX14_ENST00000349033.5_Frame_Shift_Del_p.P597fs|TEX14_ENST00000389934.3_Frame_Shift_Del_p.P597fs			Q8IWB6	TEX14_HUMAN	testis expressed 14	603					attachment of spindle microtubules to kinetochore (GO:0008608)|intercellular bridge organization (GO:0043063)|male meiosis (GO:0007140)|mitotic sister chromatid separation (GO:0051306)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of cytokinesis (GO:0032466)|negative regulation of protein binding (GO:0032091)	cell (GO:0005623)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|kinetochore (GO:0000776)|midbody (GO:0030496)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)			breast(6)|endometrium(5)|kidney(3)|large_intestine(22)|liver(1)|lung(24)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	81	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GCAGGGCAAGGAGCATCTTGAT	0.53																																					p.602_603del		.											.	TEX14-810	0			c.1806_1807del						.																																			SO:0001589	frameshift_variant	56155	exon14			.	AF285601	CCDS32692.1, CCDS32693.1, CCDS56042.1	17q22	2013-09-20	2007-03-13		ENSG00000121101	ENSG00000121101			11737	protein-coding gene	gene with protein product	"""cancer/testis antigen 113"""	605792	"""testis expressed sequence 14"""			11279525, 12711554	Standard	NM_031272		Approved	CT113	uc010dcz.2	Q8IWB6	OTTHUMG00000179245	ENST00000240361.8:c.1806_1807delTC	17.37:g.56676917_56676918delGA	ENSP00000240361:p.Pro603fs	Somatic	62	0		WXS	Illumina HiSeq	Phase_I	81	35	NM_001201457	0	0	0	0	0	A6NH19|Q7RTP3|Q8ND97|Q9BXT9	Frame_Shift_Del	DEL	ENST00000240361.8	37	CCDS56042.1																																																																																			.		0.530	TEX14-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445446.1		
ANKRD29	147463	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	21214112	21214112	+	Splice_Site	DEL	T	T	-			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr18:21214112delT	ENST00000592179.1	-	5	486	c.332delA	c.(331-333)gac>gc	p.D111fs	ANKRD29_ENST00000284207.7_Splice_Site_p.D111fs|ANKRD29_ENST00000322980.9_Splice_Site_p.D111fs	NM_173505.2	NP_775776.2	Q8N6D5	ANR29_HUMAN	ankyrin repeat domain 29	111										breast(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(3)|prostate(1)|skin(1)	13	all_cancers(21;5.07e-05)|all_epithelial(16;2.49e-07)|Lung NSC(20;0.00211)|all_lung(20;0.00676)|Colorectal(14;0.0202)|Ovarian(20;0.127)					GGTGCCCCCGTCCTATGGACA	0.498																																					p.D111fs		.											.	ANKRD29-156	0			c.332delA						.						74.0	59.0	64.0					18																	21214112		2203	4300	6503	SO:0001630	splice_region_variant	147463	exon5			.	AK057782	CCDS11879.1	18q11.2	2013-01-10			ENSG00000154065	ENSG00000154065		"""Ankyrin repeat domain containing"""	27110	protein-coding gene	gene with protein product							Standard	NM_173505		Approved	FLJ25053	uc002kun.3	Q8N6D5	OTTHUMG00000131875	ENST00000592179.1:c.331-1A>-	18.37:g.21214112delT		Somatic	55	0		WXS	Illumina HiSeq	Phase_I	53	16	NM_173505	0	0	0	0	0	B2R972|Q6ZWE8|Q96LU9	Frame_Shift_Del	DEL	ENST00000592179.1	37	CCDS11879.1																																																																																			.		0.498	ANKRD29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254825.1	NM_173505	Frame_Shift_Del
FCGBP	8857	broad.mit.edu	37	19	40366441	40366444	+	Frame_Shift_Del	DEL	CGCA	CGCA	-	rs145808007	byFrequency	TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	CGCA	CGCA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr19:40366441_40366444delCGCA	ENST00000221347.6	-	30	13797_13800	c.13790_13793delTGCG	c.(13789-13794)gtgcgcfs	p.VR4597fs		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	4597	VWFD 11. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CACGCGCAGGCGCACGAAGCTGTC	0.672																																					p.4597_4598del													.	FCGBP-98	0			c.13790_13793del						.																																			SO:0001589	frameshift_variant	8857	exon30			CGCAGGCGCACGA	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.13790_13793delTGCG	19.37:g.40366441_40366444delCGCA	ENSP00000221347:p.Val4597fs	Somatic	129	0		WXS	Illumina HiSeq	Phase_I	98	8	NM_003890	0	0	0	0	0	O95784	Frame_Shift_Del	DEL	ENST00000221347.6	37	CCDS12546.1																																																																																			.		0.672	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
NACAD	23148	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	45125173	45125173	+	Frame_Shift_Del	DEL	A	A	-			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr7:45125173delA	ENST00000490531.2	-	2	625	c.606delT	c.(604-606)gctfs	p.A202fs		NM_001146334.1	NP_001139806.1	O15069	NACAD_HUMAN	NAC alpha domain containing	202					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(2)|skin(2)	5						CCCGCAGCTCAGCCTCTGAGT	0.667																																					p.A202fs		.											.	.	0			c.606delT						.						15.0	20.0	19.0					7																	45125173		692	1590	2282	SO:0001589	frameshift_variant	23148	exon2			.	AB002361	CCDS47582.1	7p13	2010-07-14			ENSG00000136274	ENSG00000136274			22196	protein-coding gene	gene with protein product							Standard	NM_001146334		Approved	KIAA0363	uc003tmt.3	O15069	OTTHUMG00000159170	ENST00000490531.2:c.606delT	7.37:g.45125173delA	ENSP00000420477:p.Ala202fs	Somatic	89	0		WXS	Illumina HiSeq	Phase_I	107	25	NM_001146334	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000490531.2	37	CCDS47582.1																																																																																			.		0.667	NACAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353652.2	NM_001146334	
PIK3CG	5294	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	106508582	106508582	+	Frame_Shift_Del	DEL	C	C	-	rs377396894		TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr7:106508582delC	ENST00000359195.3	+	2	886	c.576delC	c.(574-576)gacfs	p.D192fs	PIK3CG_ENST00000440650.2_Frame_Shift_Del_p.D192fs|PIK3CG_ENST00000496166.1_Frame_Shift_Del_p.D192fs	NM_001282427.1|NM_002649.2	NP_001269356.1|NP_002640.2	P48736	PK3CG_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma	192					adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cytokine production (GO:0001816)|dendritic cell chemotaxis (GO:0002407)|endocytosis (GO:0006897)|G-protein coupled receptor signaling pathway (GO:0007186)|hepatocyte apoptotic process (GO:0097284)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|mast cell degranulation (GO:0043303)|natural killer cell chemotaxis (GO:0035747)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of triglyceride catabolic process (GO:0010897)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion mediated by integrin (GO:0033628)|respiratory burst involved in defense response (GO:0002679)|secretory granule localization (GO:0032252)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|T cell chemotaxis (GO:0010818)|T cell proliferation (GO:0042098)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|ephrin receptor binding (GO:0046875)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(7)|central_nervous_system(9)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(16)|liver(4)|lung(59)|ovary(4)|pancreas(4)|prostate(3)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	132						CCAGCCGCGACCCCAAGCTCT	0.617																																					p.D192fs		.											.	PIK3CG-1316	0			c.576delC						.						70.0	74.0	73.0					7																	106508582		2203	4300	6503	SO:0001589	frameshift_variant	5294	exon2			.		CCDS5739.1	7q22	2012-07-13	2012-07-13		ENSG00000105851	ENSG00000105851	2.7.1.153		8978	protein-coding gene	gene with protein product		601232	"""phosphoinositide-3-kinase, catalytic, gamma polypeptide"""				Standard	XM_005250443		Approved		uc003vdw.3	P48736	OTTHUMG00000157641	ENST00000359195.3:c.576delC	7.37:g.106508582delC	ENSP00000352121:p.Asp192fs	Somatic	49	0		WXS	Illumina HiSeq	Phase_I	82	22	NM_002649	0	0	0	0	0	A4D0Q6|Q8IV23|Q9BZC8	Frame_Shift_Del	DEL	ENST00000359195.3	37	CCDS5739.1																																																																																			.		0.617	PIK3CG-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349294.1		
KDM6A	7403	hgsc.bcm.edu;bcgsc.ca	37	X	44918293	44918293	+	Frame_Shift_Del	DEL	T	T	-			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chrX:44918293delT	ENST00000377967.4	+	11	959	c.918delT	c.(916-918)tctfs	p.S306fs	KDM6A_ENST00000543216.1_Frame_Shift_Del_p.S306fs|KDM6A_ENST00000382899.4_Frame_Shift_Del_p.S306fs|KDM6A_ENST00000536777.1_Frame_Shift_Del_p.S306fs	NM_021140.2	NP_066963.2	O15550	KDM6A_HUMAN	lysine (K)-specific demethylase 6A	306	Interaction with SUPT6H. {ECO:0000250}.				canonical Wnt signaling pathway (GO:0060070)|heart morphogenesis (GO:0003007)|histone H3-K4 methylation (GO:0051568)|in utero embryonic development (GO:0001701)|mesodermal cell differentiation (GO:0048333)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|regulation of gene expression (GO:0010468)|respiratory system process (GO:0003016)|somite rostral/caudal axis specification (GO:0032525)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)	p.0?(6)|p.0(2)		NS(1)|breast(7)|central_nervous_system(27)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(24)|kidney(24)|large_intestine(9)|liver(1)|lung(21)|oesophagus(11)|pancreas(2)|prostate(5)|skin(1)|soft_tissue(1)|urinary_tract(29)	170						CCTTTATATCTTACAGGCAGT	0.318			"""D, N, F, S"""		"""renal, oesophageal SCC, MM"""																																p.S306fs	Colon(129;1273 1667 15230 27352 52914)	.		Rec	yes		X	Xp11.2	7403	"""lysine (K)-specific demethylase 6A, UTX"""		"""E, L"""	.	KDM6A-2748	8	Whole gene deletion(6)|No detectable mRNA/protein(2)	haematopoietic_and_lymphoid_tissue(2)|oesophagus(2)|breast(2)|pancreas(2)	c.918delT						.						88.0	79.0	82.0					X																	44918293		2203	4300	6503	SO:0001589	frameshift_variant	7403	exon11			.	AF000992	CCDS14265.1	Xp11.2	2014-09-17	2009-04-17	2009-04-17	ENSG00000147050	ENSG00000147050		"""Chromatin-modifying enzymes / K-demethylases"", ""Tetratricopeptide (TTC) repeat domain containing"""	12637	protein-coding gene	gene with protein product		300128	"""ubiquitously transcribed tetratricopeptide repeat, X chromosome"""	UTX		9499428, 9381176	Standard	XM_005272655		Approved		uc004dge.4	O15550	OTTHUMG00000021402	ENST00000377967.4:c.918delT	X.37:g.44918293delT	ENSP00000367203:p.Ser306fs	Somatic	295	0		WXS	Illumina HiSeq	Phase_I	163	50	NM_021140	0	0	0	0	0	Q52LL9|Q5JVQ7	Frame_Shift_Del	DEL	ENST00000377967.4	37	CCDS14265.1																																																																																			.		0.318	KDM6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056324.1	NM_021140	
CHD1L	9557	hgsc.bcm.edu	37	1	146747129	146747130	+	Frame_Shift_Ins	INS	-	-	A			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr1:146747129_146747130insA	ENST00000369258.4	+	13	1403_1404	c.1383_1384insA	c.(1384-1386)aagfs	p.K462fs	CHD1L_ENST00000369259.3_Frame_Shift_Ins_p.K258fs|CHD1L_ENST00000431239.1_Frame_Shift_Ins_p.K368fs|CHD1L_ENST00000361293.5_Frame_Shift_Ins_p.K181fs|CHD1L_ENST00000467213.1_3'UTR	NM_001256336.1|NM_004284.4|NM_024568.2	NP_001243265.1|NP_004275.4|NP_078844.2	Q86WJ1	CHD1L_HUMAN	chromodomain helicase DNA binding protein 1-like	462	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|nucleotide binding (GO:0000166)			breast(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(923;0.0487)					TTGGCCAAAACAAGTAAGTGAT	0.45																																					p.N461fs		.											.	CHD1L-231	0			c.1383_1384insA						.																																			SO:0001589	frameshift_variant	9557	exon13			.	AF054177	CCDS927.1, CCDS58021.1, CCDS58022.1, CCDS72882.1	1q21.1	2008-02-05			ENSG00000131778	ENSG00000131778			1916	protein-coding gene	gene with protein product		613039				9653160	Standard	NM_004284		Approved	ALC1	uc001epm.5	Q86WJ1	OTTHUMG00000150271	ENST00000369258.4:c.1385dupA	1.37:g.146747131_146747131dupA	ENSP00000358262:p.Lys462fs	Somatic	110	0		WXS	Illumina HiSeq	Phase_I	86	15	NM_004284	0	0	0	0	0	A5YM64|B4DDE1|B5MDZ7|Q53EZ3|Q5VXX7|Q6DD94|Q6PK83|Q86XH3|Q96HF7|Q96SP3|Q9BVJ1|Q9NVV8	Frame_Shift_Ins	INS	ENST00000369258.4	37	CCDS927.1																																																																																			.		0.450	CHD1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040377.1	NM_004284	
TOP2A	7153	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	38562843	38562844	+	Frame_Shift_Ins	INS	-	-	T			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr17:38562843_38562844insT	ENST00000423485.1	-	15	1993_1994	c.1835_1836insA	c.(1834-1836)tatfs	p.Y612fs		NM_001067.3	NP_001058.2	P11388	TOP2A_HUMAN	topoisomerase (DNA) II alpha 170kDa	612					apoptotic chromosome condensation (GO:0030263)|ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromosome segregation (GO:0007059)|DNA ligation (GO:0006266)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|embryonic cleavage (GO:0040016)|hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cell cycle (GO:0000278)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|positive regulation of apoptotic process (GO:0043065)|positive regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral genome replication (GO:0045070)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|DNA-dependent ATPase activity (GO:0008094)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|magnesium ion binding (GO:0000287)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|ubiquitin binding (GO:0043130)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(9)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	39		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00183)		Amsacrine(DB00276)|Ciprofloxacin(DB00537)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Doxorubicin(DB00997)|Enoxacin(DB00467)|Epirubicin(DB00445)|Etoposide(DB00773)|Fleroxacin(DB04576)|Idarubicin(DB01177)|Levofloxacin(DB01137)|Lomefloxacin(DB00978)|Lucanthone(DB04967)|Mitoxantrone(DB01204)|Moxifloxacin(DB00218)|Norfloxacin(DB01059)|Ofloxacin(DB01165)|Pefloxacin(DB00487)|Podofilox(DB01179)|Sparfloxacin(DB01208)|Teniposide(DB00444)|Trovafloxacin(DB00685)|Valrubicin(DB00385)	AACCTTTGTAATATTTGACTTT	0.317																																					p.Y612_Y613delinsX		.											.	TOP2A-655	0			c.1836_1837insA						.																																			SO:0001589	frameshift_variant	7153	exon15			.		CCDS45672.1	17q21-q22	2008-08-06	2002-08-29		ENSG00000131747	ENSG00000131747	5.99.1.2		11989	protein-coding gene	gene with protein product		126430	"""topoisomerase (DNA) II alpha (170kD)"""	TOP2			Standard	NM_001067		Approved		uc002huq.3	P11388	OTTHUMG00000155008	ENST00000423485.1:c.1836dupA	17.37:g.38562844_38562844dupT	ENSP00000411532:p.Tyr612fs	Somatic	103	0		WXS	Illumina HiSeq	Phase_I	70	31	NM_001067	0	0	0	0	0	B2RTS1|Q71UN1|Q71UQ5|Q9HB24|Q9HB25|Q9HB26|Q9UP44|Q9UQP9	Nonsense_Mutation	INS	ENST00000423485.1	37	CCDS45672.1																																																																																			.		0.317	TOP2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338035.1		
SULT6B1	391365	hgsc.bcm.edu;bcgsc.ca	37	2	37414574	37414575	+	Frame_Shift_Ins	INS	-	-	T			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr2:37414574_37414575insT	ENST00000535679.1	-	2	234_235	c.235_236insA	c.(235-237)atafs	p.I79fs	SULT6B1_ENST00000407963.1_Frame_Shift_Ins_p.I41fs|SULT6B1_ENST00000379149.2_Frame_Shift_Ins_p.I79fs|SULT6B1_ENST00000260637.3_Frame_Shift_Ins_p.I41fs			Q6IMI4	ST6B1_HUMAN	sulfotransferase family, cytosolic, 6B, member 1	79						cytoplasm (GO:0005737)	sulfotransferase activity (GO:0008146)			NS(1)|breast(1)|central_nervous_system(1)|large_intestine(3)|lung(5)|ovary(1)	12		all_hematologic(82;0.248)				AACAGCATATATTAATTCACTG	0.327																																					p.I41fs		.											.	SULT6B1-91	0			c.122_123insA						.																																			SO:0001589	frameshift_variant	391365	exon2			.	AY289770, AY289774	CCDS33182.1	2p22.2	2007-07-26			ENSG00000138068	ENSG00000138068		"""Sulfotransferases, cytosolic"""	33433	protein-coding gene	gene with protein product						14676822	Standard	XM_005264307		Approved		uc002rpu.3	Q6IMI4	OTTHUMG00000152160	ENST00000535679.1:c.236dupA	2.37:g.37414576_37414576dupT	ENSP00000444081:p.Ile79fs	Somatic	166	0		WXS	Illumina HiSeq	Phase_I	104	30	NM_001032377	0	0	0	0	0	B2RTS7	Frame_Shift_Ins	INS	ENST00000535679.1	37																																																																																				.		0.327	SULT6B1-203	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001032377	
ABHD13	84945	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	108882148	108882149	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-IZ-A6M8-01A-11D-A31X-10	TCGA-IZ-A6M8-10A-01D-A31X-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4dfdbda6-c66f-4c67-8b66-e44364185d82	63f41eeb-2753-4768-a87a-f24b16256074	g.chr13:108882148_108882149GG>TT	ENST00000375898.3	+	2	883_884	c.582_583GG>TT	c.(580-585)ttGGgt>ttTTgt	p.194_195LG>FC		NM_032859.2	NP_116248.2	Q7L211	ABHDD_HUMAN	abhydrolase domain containing 13	194						integral component of membrane (GO:0016021)|membrane (GO:0016020)	hydrolase activity (GO:0016787)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	17	all_lung(23;0.000238)|all_neural(89;0.00256)|Lung NSC(43;0.0056)|Medulloblastoma(90;0.00596)|Lung SC(71;0.104)					GCCGTTCCTTGGGTGGAGCAGT	0.406																																					p.LG194FC	Pancreas(22;506 789 38166 45896 51596)	.											.	ABHD13-93	0			c.G583T						.																																			SO:0001583	missense	84945	exon2			TCCTTGGGTGGAG	AK027812	CCDS32007.1	13q33.2	2007-04-03	2006-03-10	2006-03-10	ENSG00000139826	ENSG00000139826		"""Abhydrolase domain containing"""	20293	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 6"""	C13orf6			Standard	NM_032859		Approved	bA153I24.2, FLJ14906, BEM46L1	uc001vqq.3	Q7L211	OTTHUMG00000017330	Exception_encountered	13.37:g.108882148_108882149delinsTT	ENSP00000365063:p.L194_G195delinsFC	Somatic	129.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	25.0	NM_032859	0	0	0	0	0	B3KWE7|Q8NBW1|Q96JX9	Missense_Mutation	DNP	ENST00000375898.3	37	CCDS32007.1																																																																																			.		0.406	ABHD13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045743.1	NM_032859	
