#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CLSTN1	22883	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	9809529	9809529	+	Silent	SNP	G	G	A			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr1:9809529G>A	ENST00000377298.4	-	7	1767	c.975C>T	c.(973-975)caC>caT	p.H325H	CLSTN1_ENST00000361311.4_Silent_p.H315H|CLSTN1_ENST00000377288.3_Silent_p.H325H	NM_001009566.1	NP_001009566.1	O94985	CSTN1_HUMAN	calsyntenin 1	325					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	cell junction (GO:0030054)|cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	beta-amyloid binding (GO:0001540)|calcium ion binding (GO:0005509)|kinesin binding (GO:0019894)|X11-like protein binding (GO:0042988)			breast(1)|endometrium(5)|kidney(2)|large_intestine(7)|liver(1)|lung(9)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	36	all_lung(157;0.222)	all_lung(284;4.03e-05)|Lung NSC(185;6.93e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;8.36e-08)|COAD - Colon adenocarcinoma(227;1.93e-05)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(304;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|STAD - Stomach adenocarcinoma(132;0.00644)|READ - Rectum adenocarcinoma(331;0.0419)		CACAGAGCCGGTGGAGGGACT	0.557																																					p.H325H		.											.	CLSTN1-523	0			c.C975T						.						100.0	102.0	101.0					1																	9809529		2203	4300	6503	SO:0001819	synonymous_variant	22883	exon7			GAGCCGGTGGAGG	AB020718	CCDS105.1, CCDS30580.1	1p36.22	2011-07-01			ENSG00000171603	ENSG00000171603		"""Cadherins / Cadherin-related"""	17447	protein-coding gene	gene with protein product	"""cadherin-related family member 12"""	611321				10048485	Standard	XM_005263432		Approved	CSTN1, KIAA0911, CDHR12	uc001aqh.3	O94985	OTTHUMG00000001451	ENST00000377298.4:c.975C>T	1.37:g.9809529G>A		Somatic	89	0		WXS	Illumina HiSeq	Phase_I	74	32	NM_001009566	0	0	0	0	0	A8K183|Q5SR52|Q5UE58|Q71MN0|Q8N4K9	Silent	SNP	ENST00000377298.4	37	CCDS30580.1																																																																																			.		0.557	CLSTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000004239.1		
PRDM2	7799	bcgsc.ca	37	1	14105124	14105124	+	Missense_Mutation	SNP	A	A	T	rs556843220	byFrequency	TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr1:14105124A>T	ENST00000235372.7	+	8	1690	c.834A>T	c.(832-834)gaA>gaT	p.E278D	PRDM2_ENST00000413440.1_Missense_Mutation_p.E77D|PRDM2_ENST00000505823.1_Intron|PRDM2_ENST00000343137.4_Missense_Mutation_p.E77D|PRDM2_ENST00000376048.5_Intron|PRDM2_ENST00000503842.1_Intron|PRDM2_ENST00000311066.5_Missense_Mutation_p.E278D	NM_012231.4	NP_036363.2	Q13029	PRDM2_HUMAN	PR domain containing 2, with ZNF domain	278	Asp/Glu-rich (acidic).			EDEEEEEDDDDDELEDEG -> VGGGGGVVVVVSWKARGE (in Ref. 6; AAA87023). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(16)|lung(20)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	55	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		aggaggatgaagaagaagaag	0.498													A|||	3	0.000599042	0.0	0.0	5008	,	,		19571	0.0		0.001	False		,,,				2504	0.002				p.E278D													.	PRDM2-116	0			c.A834T						.						56.0	57.0	57.0					1																	14105124		2203	4300	6503	SO:0001583	missense	7799	exon8			GGATGAAGAAGAA	U17838	CCDS150.1, CCDS151.1, CCDS30603.1, CCDS44061.1	1p36	2011-07-01			ENSG00000116731	ENSG00000116731		"""Chromatin-modifying enzymes / K-methyltransferases"""	9347	protein-coding gene	gene with protein product	"""retinoblastoma protein-binding zinc finger protein"", ""retinoblastoma protein-interacting zinc finger protein"", ""MTE-binding protein"", ""zinc-finger DNA-binding protein"", ""GATA-3 binding protein G3B"""	601196				7538672	Standard	NM_012231		Approved	RIZ, RIZ1, RIZ2, KMT8, MTB-ZF, HUMHOXY1	uc001avi.3	Q13029	OTTHUMG00000007917	ENST00000235372.7:c.834A>T	1.37:g.14105124A>T	ENSP00000235372:p.Glu278Asp	Somatic	85	0		WXS	Illumina HiSeq	Phase_1	103	5	NM_015866	0	0	0	0	0	B1AJZ4|B5MC68|Q13149|Q14550|Q5THJ1|Q5VUL9	Missense_Mutation	SNP	ENST00000235372.7	37	CCDS150.1	.	.	.	.	.	.	.	.	.	.	A	0.001	-2.900977	0.00058	.	.	ENSG00000116731	ENST00000235372;ENST00000311066;ENST00000400800;ENST00000413440;ENST00000343137;ENST00000407521	T;T;T;T	0.01871	4.73;4.59;4.69;4.69	1.23	-2.46	0.06461	.	0.178267	0.19455	U	0.113847	T	0.00845	0.0028	N	0.08118	0	0.19775	N	0.999955	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.0;0.0;0.0;0.001	T	0.43702	-0.9375	10	0.07325	T	0.83	.	0.0761	0.00027	0.3091:0.2376:0.2157:0.2375	.	278;136;278;278	A8MW16;Q5THJ0;Q13029;Q13029-2	.;.;PRDM2_HUMAN;.	D	278;278;278;77;77;77	ENSP00000235372:E278D;ENSP00000312352:E278D;ENSP00000411103:E77D;ENSP00000341621:E77D	ENSP00000235372:E278D	E	+	3	2	PRDM2	13977711	0.979000	0.34478	0.186000	0.23195	0.093000	0.18481	-0.759000	0.04761	-1.632000	0.01541	-1.785000	0.00643	GAA	.		0.498	PRDM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021792.2	NM_012231	
IFFO2	126917	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	19282228	19282228	+	Missense_Mutation	SNP	G	G	A			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr1:19282228G>A	ENST00000455833.2	-	1	952	c.599C>T	c.(598-600)cCg>cTg	p.P200L		NM_001136265.1	NP_001129737.1	Q5TF58	IFFO2_HUMAN	intermediate filament family orphan 2	200						intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)	2						GCGGATCTCCGGCGTGATGGT	0.736																																					p.P200L		.											.	.	0			c.C599T						.						6.0	8.0	7.0					1																	19282228		672	1561	2233	SO:0001583	missense	126917	exon1			ATCTCCGGCGTGA	AK024480, AL080251	CCDS44076.1	1p36.13	2013-10-11			ENSG00000169991	ENSG00000169991		"""Intermediate filament family orphans"""	27006	protein-coding gene	gene with protein product						14702039	Standard	NM_001136265		Approved		uc001bbd.2	Q5TF58	OTTHUMG00000002499	ENST00000455833.2:c.599C>T	1.37:g.19282228G>A	ENSP00000387941:p.Pro200Leu	Somatic	43	0		WXS	Illumina HiSeq	Phase_I	34	8	NM_001136265	0	0	0	0	0	Q9H7K0	Missense_Mutation	SNP	ENST00000455833.2	37	CCDS44076.1	.	.	.	.	.	.	.	.	.	.	G	33	5.256100	0.95336	.	.	ENSG00000169991	ENST00000304963;ENST00000455833	T	0.70164	-0.46	4.4	4.4	0.53042	.	0.203730	0.42420	D	0.000711	T	0.78880	0.4353	L	0.57536	1.79	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.81536	-0.0888	10	0.72032	D	0.01	.	15.899	0.79359	0.0:0.0:1.0:0.0	.	200	Q5TF58	IFFO2_HUMAN	L	191;200	ENSP00000387941:P200L	ENSP00000305144:P191L	P	-	2	0	IFFO2	19154815	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.480000	0.73604	2.180000	0.69256	0.313000	0.20887	CCG	.		0.736	IFFO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007099.2	NM_001136265	
CSDE1	7812	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	115277116	115277116	+	Missense_Mutation	SNP	T	T	A	rs200868850		TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr1:115277116T>A	ENST00000358528.4	-	7	955	c.529A>T	c.(529-531)Atg>Ttg	p.M177L	CSDE1_ENST00000438362.2_Missense_Mutation_p.M223L|CSDE1_ENST00000261443.5_Missense_Mutation_p.M146L|CSDE1_ENST00000530886.1_Missense_Mutation_p.M47L|CSDE1_ENST00000369530.1_Missense_Mutation_p.M192L|CSDE1_ENST00000534699.1_Missense_Mutation_p.M177L|CSDE1_ENST00000339438.6_Missense_Mutation_p.M146L	NM_001007553.2	NP_001007554.1	O75534	CSDE1_HUMAN	cold shock domain containing E1, RNA-binding	177	CSD 2; truncated.				male gonad development (GO:0008584)|nuclear-transcribed mRNA catabolic process, no-go decay (GO:0070966)|regulation of transcription, DNA-templated (GO:0006355)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(4)|endometrium(11)|kidney(2)|large_intestine(12)|lung(17)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	51	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;2.21e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TTCAACAGCATAATGTTGCGA	0.388																																					p.M223L		.											.	CSDE1-227	0			c.A667T						.						80.0	80.0	80.0					1																	115277116		2203	4300	6503	SO:0001583	missense	7812	exon8			ACAGCATAATGTT		CCDS30811.1, CCDS30812.1, CCDS44197.1, CCDS55626.1	1p13.2	2011-11-02			ENSG00000009307	ENSG00000009307			29905	protein-coding gene	gene with protein product	"""upstream of NRAS"""	191510				2204029, 10048485	Standard	NM_007158		Approved	D1S155E, UNR	uc001efi.3	O75534	OTTHUMG00000012060	ENST00000358528.4:c.529A>T	1.37:g.115277116T>A	ENSP00000351329:p.Met177Leu	Somatic	389	0		WXS	Illumina HiSeq	Phase_I	295	34	NM_001242891	0	1	3	4	0	A8K281|E9PGZ0|G5E9Q2|O94961|Q5TF04|Q5TF05|Q68DF1|Q68DI9|Q9Y2S4	Missense_Mutation	SNP	ENST00000358528.4	37	CCDS30812.1	.	.	.	.	.	.	.	.	.	.	T	15.16	2.752407	0.49362	.	.	ENSG00000009307	ENST00000339438;ENST00000438362;ENST00000358528;ENST00000261443;ENST00000530886;ENST00000369530;ENST00000534699;ENST00000529046	.	.	.	5.82	4.67	0.58626	Nucleic acid-binding, OB-fold-like (1);	0.141721	0.64402	D	0.000006	T	0.42337	0.1198	L	0.29908	0.895	0.36744	D	0.882387	B;B;B	0.29805	0.04;0.0;0.257	B;B;P	0.44623	0.008;0.0;0.455	T	0.48198	-0.9056	9	0.42905	T	0.14	-0.4958	13.0463	0.58928	0.0:0.0:0.1344:0.8656	.	192;177;223	E9PGZ0;O75534;G5E9Q2	.;CSDE1_HUMAN;.	L	146;223;177;146;47;192;177;47	.	ENSP00000261443:M146L	M	-	1	0	CSDE1	115078639	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.781000	0.55394	0.999000	0.39023	0.460000	0.39030	ATG	.		0.388	CSDE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033397.1	NM_007158	
POLR3C	10623	broad.mit.edu	37	1	145608259	145608259	+	Missense_Mutation	SNP	G	G	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr1:145608259G>T	ENST00000334163.3	-	4	598	c.438C>A	c.(436-438)aaC>aaA	p.N146K	POLR3C_ENST00000369294.1_Missense_Mutation_p.N146K|RNF115_ENST00000369291.5_5'Flank|POLR3C_ENST00000471254.1_5'UTR	NM_006468.6	NP_006459.3	Q9BUI4	RPC3_HUMAN	polymerase (RNA) III (DNA directed) polypeptide C (62kD)	146					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			breast(2)|endometrium(4)|kidney(1)|large_intestine(3)|liver(1)|lung(8)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)		Epithelial(2;7.55e-13)			GCACAAATGTGTTTGATACTT	0.517																																					p.N146K													.	POLR3C-91	0			c.C438A						.						186.0	166.0	173.0					1																	145608259		2203	4300	6503	SO:0001583	missense	10623	exon4			AAATGTGTTTGAT	AJ238234	CCDS72864.1	1q21	2013-01-21			ENSG00000186141	ENSG00000186141		"""RNA polymerase subunits"""	30076	protein-coding gene	gene with protein product						9171375, 12391170	Standard	NM_006468		Approved	RPC62, RPC3	uc001eoh.3	Q9BUI4	OTTHUMG00000013753	ENST00000334163.3:c.438C>A	1.37:g.145608259G>T	ENSP00000334564:p.Asn146Lys	Somatic	102	0		WXS	Illumina HiSeq	Phase_I	89	4	NM_006468	0	0	4	4	0	O15317|Q9Y3R6	Missense_Mutation	SNP	ENST00000334163.3	37	CCDS921.1	.	.	.	.	.	.	.	.	.	.	G	5.188	0.220179	0.09863	.	.	ENSG00000186141	ENST00000334163;ENST00000369294	T;T	0.39229	1.09;1.09	5.41	3.53	0.40419	RNA polymerase III Rpc82, C -terminal (1);	0.652107	0.17151	N	0.185056	T	0.09468	0.0233	N	0.20986	0.625	0.40998	D	0.984907	B;B;B	0.11235	0.003;0.002;0.004	B;B;B	0.12156	0.002;0.002;0.007	T	0.16424	-1.0403	10	0.06236	T	0.91	-13.0953	9.1782	0.37125	0.1803:0.0:0.8197:0.0	.	146;146;146	E9PHH9;Q9BUI4;Q53F76	.;RPC3_HUMAN;.	K	146	ENSP00000334564:N146K;ENSP00000358300:N146K	ENSP00000334564:N146K	N	-	3	2	POLR3C	144319616	0.975000	0.34042	0.976000	0.42696	0.395000	0.30598	1.682000	0.37628	0.640000	0.30582	0.655000	0.94253	AAC	.		0.517	POLR3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038542.1	NM_006468	
ACP6	51205	broad.mit.edu	37	1	147142085	147142085	+	Missense_Mutation	SNP	A	A	C	rs201678741		TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr1:147142085A>C	ENST00000369238.6	-	1	533	c.86T>G	c.(85-87)gTg>gGg	p.V29G	ACP6_ENST00000392988.2_Missense_Mutation_p.V29G	NM_016361.3	NP_057445.4	Q9NPH0	PPA6_HUMAN	acid phosphatase 6, lysophosphatidic	29					dephosphorylation (GO:0016311)|lysobisphosphatidic acid metabolic process (GO:2001311)|phospholipid metabolic process (GO:0006644)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	acid phosphatase activity (GO:0003993)|lysophosphatidic acid phosphatase activity (GO:0052642)			breast(1)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(4)|prostate(1)	16	all_hematologic(923;0.0276)					GGCCAGGGCCACCCGCCGCTG	0.657																																					p.V29G													.	ACP6-94	0			c.T86G						.						12.0	10.0	11.0					1																	147142085		2053	4027	6080	SO:0001583	missense	51205	exon1			AGGGCCACCCGCC	BC009965	CCDS928.1	1q21	2008-02-05			ENSG00000162836	ENSG00000162836			29609	protein-coding gene	gene with protein product		611471				12010880, 10506173	Standard	NM_016361		Approved	LPAP, ACPL1	uc001epr.2	Q9NPH0	OTTHUMG00000014019	ENST00000369238.6:c.86T>G	1.37:g.147142085A>C	ENSP00000358241:p.Val29Gly	Somatic	82	22		WXS	Illumina HiSeq	Phase_I	58	24	NM_016361	0	0	4	4	0	Q59G61|Q5T490|Q6IAQ3|Q7LG81|Q9UIG6	Missense_Mutation	SNP	ENST00000369238.6	37	CCDS928.1	.	.	.	.	.	.	.	.	.	.	A	13.14	2.149393	0.37923	.	.	ENSG00000162836	ENST00000369238;ENST00000392988	T;T	0.48522	2.65;0.81	5.28	-5.16	0.02857	.	0.609019	0.16327	N	0.219309	T	0.09555	0.0235	L	0.34521	1.04	0.43385	D	0.99549	B;B	0.06786	0.001;0.0	B;B	0.09377	0.004;0.001	T	0.22730	-1.0208	10	0.19147	T	0.46	.	1.0577	0.01593	0.2021:0.3491:0.2212:0.2275	.	29;29	Q9NPH0-2;Q9NPH0	.;PPA6_HUMAN	G	29	ENSP00000358241:V29G;ENSP00000376714:V29G	ENSP00000358241:V29G	V	-	2	0	ACP6	145608709	0.001000	0.12720	0.927000	0.36925	0.947000	0.59692	-0.635000	0.05471	-0.919000	0.03803	-0.460000	0.05396	GTG	.		0.657	ACP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039420.2	NM_016361	
RPRD2	23248	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	150443766	150443766	+	Missense_Mutation	SNP	A	A	C			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr1:150443766A>C	ENST00000369068.4	+	11	2346	c.2342A>C	c.(2341-2343)gAg>gCg	p.E781A	RPRD2_ENST00000539519.1_Missense_Mutation_p.E755A|RPRD2_ENST00000492220.1_3'UTR|RPRD2_ENST00000401000.4_Missense_Mutation_p.E755A	NM_015203.3	NP_056018.2	Q5VT52	RPRD2_HUMAN	regulation of nuclear pre-mRNA domain containing 2	781	Ser-rich.					DNA-directed RNA polymerase II, holoenzyme (GO:0016591)				central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(20)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						TACCCCCGAGAGCTCTCCAAT	0.498																																					p.E781A		.											.	RPRD2-23	0			c.A2342C						.						84.0	79.0	81.0					1																	150443766		1895	4111	6006	SO:0001583	missense	23248	exon11			CCCGAGAGCTCTC	BX641025	CCDS44216.1, CCDS72907.1	1q21.2	2012-02-09	2008-08-15	2008-07-28	ENSG00000163125	ENSG00000163125			29039	protein-coding gene	gene with protein product		614695	"""KIAA0460"""	KIAA0460		22231121	Standard	XM_005245033		Approved	FLJ32145, HSPC099	uc009wlr.3	Q5VT52	OTTHUMG00000012808	ENST00000369068.4:c.2342A>C	1.37:g.150443766A>C	ENSP00000358064:p.Glu781Ala	Somatic	127	0		WXS	Illumina HiSeq	Phase_I	109	43	NM_015203	0	0	0	0	0	A8K6N8|B3KPT1|B4E2Q6|O75048|Q5VT51|Q5VT53|Q6MZL4|Q86XD2|Q9P0D7	Missense_Mutation	SNP	ENST00000369068.4	37	CCDS44216.1	.	.	.	.	.	.	.	.	.	.	A	18.04	3.534839	0.64972	.	.	ENSG00000163125	ENST00000401000;ENST00000539519;ENST00000369068	T;T;T	0.53206	0.63;0.63;0.63	5.21	5.21	0.72293	.	0.000000	0.64402	D	0.000001	T	0.22781	0.0550	N	0.24115	0.695	0.32162	N	0.582853	B;P;P	0.46784	0.319;0.816;0.884	B;B;B	0.40477	0.048;0.177;0.33	T	0.14035	-1.0487	10	0.59425	D	0.04	-7.9453	15.2872	0.73835	1.0:0.0:0.0:0.0	.	755;781;755	B4E2Q6;Q5VT52;Q5VT52-3	.;RPRD2_HUMAN;.	A	755;755;781	ENSP00000383785:E755A;ENSP00000445482:E755A;ENSP00000358064:E781A	ENSP00000358064:E781A	E	+	2	0	RPRD2	148710390	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.543000	0.73874	2.194000	0.70268	0.529000	0.55759	GAG	.		0.498	RPRD2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000035844.1	NM_015203	
RPTN	126638	broad.mit.edu	37	1	152128054	152128054	+	Silent	SNP	T	T	C			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr1:152128054T>C	ENST00000316073.3	-	3	1585	c.1521A>G	c.(1519-1521)caA>caG	p.Q507Q		NM_001122965.1	NP_001116437.1	Q6XPR3	RPTN_HUMAN	repetin	507	Gln-rich.					cornified envelope (GO:0001533)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)	p.Q507Q(1)		breast(2)|central_nervous_system(1)|endometrium(14)|kidney(2)|large_intestine(1)|lung(32)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	59						AGTGGGAACTTTGGCCTTGTC	0.498																																					p.Q507Q													.	RPTN-68	1	Substitution - coding silent(1)	central_nervous_system(1)	c.A1521G						.						824.0	714.0	748.0					1																	152128054		1568	3582	5150	SO:0001819	synonymous_variant	126638	exon3			GGAACTTTGGCCT	AK096436	CCDS41397.1	1q21.3	2013-01-10			ENSG00000215853	ENSG00000215853		"""EF-hand domain containing"""	26809	protein-coding gene	gene with protein product		613259				15854042	Standard	NM_001122965		Approved	FLJ39117	uc001ezs.1	Q6XPR3	OTTHUMG00000154095	ENST00000316073.3:c.1521A>G	1.37:g.152128054T>C		Somatic	141	2		WXS	Illumina HiSeq	Phase_I	113	4	NM_001122965	0	0	0	0	0	B7ZBZ3	Silent	SNP	ENST00000316073.3	37	CCDS41397.1																																																																																			.		0.498	RPTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333867.1	XM_371312	
KDM5B	10765	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	202701002	202701002	+	Nonsense_Mutation	SNP	A	A	C			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr1:202701002A>C	ENST00000367265.3	-	24	5139	c.3975T>G	c.(3973-3975)taT>taG	p.Y1325*	KDM5B_ENST00000367264.2_Nonsense_Mutation_p.Y1361*	NM_006618.3	NP_006609.3	Q9UGL1	KDM5B_HUMAN	lysine (K)-specific demethylase 5B	1325					histone H3-K4 demethylation (GO:0034720)|histone H3-K4 demethylation, trimethyl-H3-K4-specific (GO:0034721)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-trimethyl-K4 specific) (GO:0034647)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(2)|ovary(2)|skin(1)|urinary_tract(1)	6						GGGAGTGCAAATATGAGGTTC	0.408																																					p.Y1325X		.											.	KDM5B-273	0			c.T3975G						.						111.0	106.0	108.0					1																	202701002		2203	4300	6503	SO:0001587	stop_gained	10765	exon24			GTGCAAATATGAG	AJ243706	CCDS30974.1	1q32.1	2014-06-12	2009-04-06	2009-04-06	ENSG00000117139	ENSG00000117139		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	18039	protein-coding gene	gene with protein product	"""cancer/testis antigen 31"", ""protein phosphatase 1, regulatory subunit 98"""	605393	"""Jumonji, AT rich interactive domain 1B (RBP2-like)"", ""jumonji, AT rich interactive domain 1B"""	JARID1B		11483573, 11478881	Standard	NM_006618		Approved	RBBP2H1A, PLU-1, CT31, PPP1R98	uc001gyf.3	Q9UGL1	OTTHUMG00000041401	ENST00000367265.3:c.3975T>G	1.37:g.202701002A>C	ENSP00000356234:p.Tyr1325*	Somatic	61	0		WXS	Illumina HiSeq	Phase_I	70	21	NM_006618	0	0	4	4	0	O95811|Q15752|Q9Y3Q5	Nonsense_Mutation	SNP	ENST00000367265.3	37	CCDS30974.1	.	.	.	.	.	.	.	.	.	.	A	47	13.303743	0.99733	.	.	ENSG00000117139	ENST00000367265;ENST00000538292;ENST00000367264;ENST00000235790	.	.	.	5.78	3.41	0.39046	.	0.229878	0.47093	D	0.000247	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.4004	7.269	0.26246	0.7476:0.1297:0.1226:0.0	.	.	.	.	X	1325;1167;1361;1167	.	ENSP00000235790:Y1167X	Y	-	3	2	KDM5B	200967625	0.999000	0.42202	0.375000	0.26029	0.998000	0.95712	1.112000	0.31172	1.096000	0.41439	0.533000	0.62120	TAT	.		0.408	KDM5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099184.2	NM_006618	
PLXNA2	5362	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	208234136	208234136	+	Missense_Mutation	SNP	A	A	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr1:208234136A>T	ENST00000367033.3	-	13	3390	c.2633T>A	c.(2632-2634)aTc>aAc	p.I878N		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	878	IPT/TIG 1.				axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		CACGCCATGGATGGTCACTCG	0.582																																					p.I878N		.											.	PLXNA2-92	0			c.T2633A						.						64.0	59.0	60.0					1																	208234136		2203	4300	6503	SO:0001583	missense	5362	exon13			CCATGGATGGTCA	X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.2633T>A	1.37:g.208234136A>T	ENSP00000356000:p.Ile878Asn	Somatic	128	0		WXS	Illumina HiSeq	Phase_I	89	39	NM_025179	0	0	0	0	0	A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Missense_Mutation	SNP	ENST00000367033.3	37	CCDS31013.1	.	.	.	.	.	.	.	.	.	.	A	26.6	4.751914	0.89753	.	.	ENSG00000076356	ENST00000367033	T	0.70869	-0.52	4.75	4.75	0.60458	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.87744	0.6254	H	0.94847	3.59	0.80722	D	1	D	0.76494	0.999	D	0.75020	0.985	D	0.91215	0.5002	10	0.87932	D	0	.	14.2819	0.66219	1.0:0.0:0.0:0.0	.	878	O75051	PLXA2_HUMAN	N	878	ENSP00000356000:I878N	ENSP00000356000:I878N	I	-	2	0	PLXNA2	206300759	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.956000	0.93066	1.787000	0.52448	0.533000	0.62120	ATC	.		0.582	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088932.6	NM_025179	
PLXNA2	5362	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	208234142	208234142	+	Missense_Mutation	SNP	A	A	G			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr1:208234142A>G	ENST00000367033.3	-	13	3384	c.2627T>C	c.(2626-2628)gTg>gCg	p.V876A		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	876	IPT/TIG 1.				axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		ATGGATGGTCACTCGCGTCCC	0.587																																					p.V876A		.											.	PLXNA2-92	0			c.T2627C						.						62.0	57.0	59.0					1																	208234142		2203	4300	6503	SO:0001583	missense	5362	exon13			ATGGTCACTCGCG	X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.2627T>C	1.37:g.208234142A>G	ENSP00000356000:p.Val876Ala	Somatic	121	0		WXS	Illumina HiSeq	Phase_I	84	38	NM_025179	0	0	0	0	0	A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Missense_Mutation	SNP	ENST00000367033.3	37	CCDS31013.1	.	.	.	.	.	.	.	.	.	.	A	29.5	5.008254	0.93346	.	.	ENSG00000076356	ENST00000367033	T	0.66815	-0.23	4.75	4.75	0.60458	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.81917	0.4924	M	0.91920	3.255	0.80722	D	1	D	0.54397	0.966	P	0.55824	0.785	D	0.86680	0.1916	10	0.87932	D	0	.	14.2819	0.66219	1.0:0.0:0.0:0.0	.	876	O75051	PLXA2_HUMAN	A	876	ENSP00000356000:V876A	ENSP00000356000:V876A	V	-	2	0	PLXNA2	206300765	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.956000	0.93066	1.787000	0.52448	0.533000	0.62120	GTG	.		0.587	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088932.6	NM_025179	
PTPN14	5784	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	214557537	214557537	+	Missense_Mutation	SNP	C	C	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr1:214557537C>T	ENST00000366956.5	-	13	1855	c.1661G>A	c.(1660-1662)aGc>aAc	p.S554N	PTPN14_ENST00000543945.1_3'UTR	NM_005401.4	NP_005392.2	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type 14	554					lymphangiogenesis (GO:0001946)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of protein export from nucleus (GO:0046825)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)			NS(2)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(9)|liver(3)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	58				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		GTGGGCCGTGCTGTAGTTATG	0.632																																					p.S554N	Colon(92;557 1424 24372 34121 40073)	.											.	PTPN14-290	0			c.G1661A						.						67.0	69.0	68.0					1																	214557537		2203	4300	6503	SO:0001583	missense	5784	exon13			GCCGTGCTGTAGT	X82676	CCDS1514.1	1q32.2	2011-06-09			ENSG00000152104	ENSG00000152104		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9647	protein-coding gene	gene with protein product		603155				7733990	Standard	NM_005401		Approved	PEZ	uc001hkk.2	Q15678	OTTHUMG00000037039	ENST00000366956.5:c.1661G>A	1.37:g.214557537C>T	ENSP00000355923:p.Ser554Asn	Somatic	61	0		WXS	Illumina HiSeq	Phase_I	50	20	NM_005401	0	0	0	0	0	Q5VSI0	Missense_Mutation	SNP	ENST00000366956.5	37	CCDS1514.1	.	.	.	.	.	.	.	.	.	.	C	5.545	0.285458	0.10513	.	.	ENSG00000152104	ENST00000366956	T	0.67523	-0.27	5.51	-1.94	0.07571	.	0.544215	0.22141	N	0.064056	T	0.36635	0.0974	N	0.11560	0.145	0.28282	N	0.923954	B	0.02656	0.0	B	0.01281	0.0	T	0.21759	-1.0236	10	0.14252	T	0.57	.	6.8274	0.23891	0.113:0.4191:0.0:0.468	.	554	Q15678	PTN14_HUMAN	N	554	ENSP00000355923:S554N	ENSP00000355923:S554N	S	-	2	0	PTPN14	212624160	0.001000	0.12720	0.056000	0.19401	0.764000	0.43329	-0.747000	0.04823	-0.259000	0.09432	0.650000	0.86243	AGC	.		0.632	PTPN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089918.2	NM_005401	
GDI2	2665	hgsc.bcm.edu;bcgsc.ca	37	10	5855180	5855180	+	Silent	SNP	C	C	A			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr10:5855180C>A	ENST00000380191.4	-	1	332	c.42G>T	c.(40-42)ctG>ctT	p.L14L	RP11-318E3.9_ENST00000608273.1_lincRNA|GDI2_ENST00000380132.4_5'UTR|GDI2_ENST00000380181.3_Silent_p.L14L	NM_001115156.1|NM_001494.3	NP_001108628.1|NP_001485.2	P50395	GDIB_HUMAN	GDP dissociation inhibitor 2	14					protein transport (GO:0015031)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|Rab GDP-dissociation inhibitor activity (GO:0005093)|Rab GTPase activator activity (GO:0005097)			NS(1)|breast(1)|large_intestine(1)|lung(6)|urinary_tract(1)	10						CGCCCACCGTCAGGCCGGTGC	0.751																																					p.L14L		.											.	GDI2-90	0			c.G42T						.						8.0	9.0	9.0					10																	5855180		2144	4238	6382	SO:0001819	synonymous_variant	2665	exon1			CACCGTCAGGCCG	D13988	CCDS7071.1, CCDS44352.1	10p15	2010-03-16			ENSG00000057608	ENSG00000057608			4227	protein-coding gene	gene with protein product	"""rab GDP-dissociation"""	600767				9434952	Standard	NM_001494		Approved	RABGDIB	uc001iil.4	P50395	OTTHUMG00000017607	ENST00000380191.4:c.42G>T	10.37:g.5855180C>A		Somatic	66	0		WXS	Illumina HiSeq	Phase_I	50	24	NM_001115156	0	0	0	0	0	O43928|Q5SX88|Q9UQM6	Silent	SNP	ENST00000380191.4	37	CCDS7071.1																																																																																			.		0.751	GDI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046580.1	NM_001494	
ZNF33B	7582	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	43088707	43088707	+	Missense_Mutation	SNP	T	T	C			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr10:43088707T>C	ENST00000359467.3	-	5	1805	c.1691A>G	c.(1690-1692)cAt>cGt	p.H564R	ZNF33B_ENST00000486187.1_RNA	NM_006955.1	NP_008886.1	Q06732	ZN33B_HUMAN	zinc finger protein 33B	564					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(15)|skin(1)|stomach(1)	29						GGTTGACTTATGGCTAAAGAA	0.413																																					p.H564R	Melanoma(137;1247 1767 16772 25727 43810)												.	ZNF33B-90	0			c.A1691G						.						120.0	120.0	120.0					10																	43088707		2203	4300	6503	SO:0001583	missense	7582	exon5			GACTTATGGCTAA	X68688, AJ491697	CCDS7198.1	10q11.2	2013-01-08	2005-03-18		ENSG00000196693	ENSG00000196693		"""Zinc fingers, C2H2-type"", ""-"""	13097	protein-coding gene	gene with protein product		194522	"""zinc finger protein 33b (KOX 31)"", ""zinc finger protein 11B"""	ZNF11B		2014798	Standard	NM_006955		Approved	KOX31, KOX2	uc001jaf.1	Q06732	OTTHUMG00000018014	ENST00000359467.3:c.1691A>G	10.37:g.43088707T>C	ENSP00000352444:p.His564Arg	Somatic	117	1		WXS	Illumina HiSeq	Phase_I	75	37	NM_006955	0	0	4	6	2	Q06731|Q32MA2|Q86XY8|Q8NDW3	Missense_Mutation	SNP	ENST00000359467.3	37	CCDS7198.1	.	.	.	.	.	.	.	.	.	.	T	10.35	1.326415	0.24080	.	.	ENSG00000196693	ENST00000359467;ENST00000395836	T	0.17691	2.26	2.58	2.58	0.30949	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.37219	N	0.002197	T	0.05868	0.0153	N	0.01529	-0.815	0.27560	N	0.950226	P	0.40834	0.73	B	0.40782	0.34	T	0.27938	-1.0059	10	0.19590	T	0.45	.	9.0257	0.36227	0.0:0.0:0.0:1.0	.	564	Q06732	ZN33B_HUMAN	R	564;530	ENSP00000352444:H564R	ENSP00000352444:H564R	H	-	2	0	ZNF33B	42408713	0.000000	0.05858	1.000000	0.80357	0.980000	0.70556	-0.095000	0.11077	1.449000	0.47699	0.341000	0.21757	CAT	.		0.413	ZNF33B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_006955	
WDFY4	57705	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	49986698	49986698	+	Missense_Mutation	SNP	C	C	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr10:49986698C>T	ENST00000325239.5	+	17	3245	c.3218C>T	c.(3217-3219)tCc>tTc	p.S1073F	WDFY4_ENST00000413659.2_Intron	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	1073						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						CTGACCTTCTCCTGCTGGTTC	0.627																																					p.S1073F		.											.	WDFY4-22	0			c.C3218T						.						39.0	46.0	44.0					10																	49986698		692	1591	2283	SO:0001583	missense	57705	exon18			CCTTCTCCTGCTG	AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.3218C>T	10.37:g.49986698C>T	ENSP00000320563:p.Ser1073Phe	Somatic	25	0		WXS	Illumina HiSeq	Phase_I	26	9	NM_020945	0	0	0	0	0	B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Missense_Mutation	SNP	ENST00000325239.5	37	CCDS44385.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.999280	0.74818	.	.	ENSG00000128815	ENST00000426033;ENST00000325239	T	0.55760	0.5	5.23	5.23	0.72850	.	.	.	.	.	T	0.72128	0.3422	M	0.72353	2.195	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.72561	-0.4256	8	.	.	.	.	17.7936	0.88562	0.0:1.0:0.0:0.0	.	1073	Q6ZS81	WDFY4_HUMAN	F	1073	ENSP00000320563:S1073F	.	S	+	2	0	WDFY4	49656704	1.000000	0.71417	1.000000	0.80357	0.431000	0.31685	5.681000	0.68175	2.417000	0.82017	0.563000	0.77884	TCC	.		0.627	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_033379	
COL17A1	1308	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	105795252	105795252	+	Missense_Mutation	SNP	T	T	G			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr10:105795252T>G	ENST00000353479.5	-	49	3778	c.3488A>C	c.(3487-3489)gAg>gCg	p.E1163A	COL17A1_ENST00000369733.3_Missense_Mutation_p.E1118A	NM_000494.3	NP_000485.3	Q9UMD9	COHA1_HUMAN	collagen, type XVII, alpha 1	1163	Triple-helical region.				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|hemidesmosome (GO:0030056)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				NS(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|liver(1)|lung(22)|ovary(5)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	62		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		GGAGAGGAGCTCCTCATAGGA	0.627																																					p.E1163A		.											.	COL17A1-95	0			c.A3488C						.						29.0	33.0	32.0					10																	105795252		2203	4300	6503	SO:0001583	missense	1308	exon49			AGGAGCTCCTCAT	M91669	CCDS7554.1	10q24.3	2013-01-16			ENSG00000065618	ENSG00000065618		"""Collagens"""	2194	protein-coding gene	gene with protein product		113811		BPAG2		7916703	Standard	NM_000494		Approved	BP180	uc001kxr.3	Q9UMD9	OTTHUMG00000018998	ENST00000353479.5:c.3488A>C	10.37:g.105795252T>G	ENSP00000340937:p.Glu1163Ala	Somatic	116	0		WXS	Illumina HiSeq	Phase_I	105	16	NM_000494	0	0	10	10	0	Q02802|Q5JV36|Q99018|Q9NQK9|Q9UC14	Missense_Mutation	SNP	ENST00000353479.5	37	CCDS7554.1	.	.	.	.	.	.	.	.	.	.	T	10.22	1.290516	0.23478	.	.	ENSG00000065618	ENST00000353479;ENST00000369733	D;D	0.91740	-2.9;-2.8	4.83	3.68	0.42216	.	0.150217	0.30329	N	0.009864	D	0.84633	0.5515	L	0.34521	1.04	0.80722	D	1	B	0.30406	0.278	B	0.30179	0.112	T	0.76542	-0.2921	10	0.10902	T	0.67	-20.9225	9.6783	0.40054	0.1549:0.0:0.0:0.8451	.	1163	Q9UMD9	COHA1_HUMAN	A	1163;1118	ENSP00000340937:E1163A;ENSP00000358748:E1118A	ENSP00000340937:E1163A	E	-	2	0	COL17A1	105785242	1.000000	0.71417	1.000000	0.80357	0.007000	0.05969	2.356000	0.44116	0.845000	0.35118	-0.695000	0.03696	GAG	.		0.627	COL17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050181.1	NM_130778, NM_000494	
MUC2	4583	broad.mit.edu	37	11	1092630	1092630	+	Silent	SNP	T	T	C			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr11:1092630T>C	ENST00000441003.2	+	30	4476	c.4449T>C	c.(4447-4449)acT>acC	p.T1483T	MUC2_ENST00000359061.5_Silent_p.T1484T|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	4218	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	caaccaccactcccaGCCCTC	0.632																																					p.T1483T													.	MUC2-90	0			c.T4449C						.						242.0	368.0	324.0					11																	1092630		1607	3000	4607	SO:0001819	synonymous_variant	4583	exon30			CACCACTCCCAGC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4449T>C	11.37:g.1092630T>C		Somatic	157	17		WXS	Illumina HiSeq	Phase_I	134	29	NM_002457	0	0	0	0	0	Q14878	Silent	SNP	ENST00000441003.2	37																																																																																				.		0.632	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
SMPD1	6609	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	6412728	6412728	+	Missense_Mutation	SNP	G	G	A			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr11:6412728G>A	ENST00000342245.4	+	2	601	c.433G>A	c.(433-435)Gtg>Atg	p.V145M	SMPD1_ENST00000356761.2_Missense_Mutation_p.V145M|SMPD1_ENST00000533196.1_Intron|SMPD1_ENST00000299397.3_Missense_Mutation_p.V145M|SMPD1_ENST00000527275.1_Missense_Mutation_p.V144M	NM_000543.4|NM_001007593.2	NP_000534.3|NP_001007594.2	P17405	ASM_HUMAN	sphingomyelin phosphodiesterase 1, acid lysosomal	143	Saposin B-type. {ECO:0000255|PROSITE- ProRule:PRU00415}.				cell death (GO:0008219)|ceramide biosynthetic process (GO:0046513)|glycosphingolipid metabolic process (GO:0006687)|negative regulation of MAP kinase activity (GO:0043407)|nervous system development (GO:0007399)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein dephosphorylation (GO:0035307)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)|sphingomyelin metabolic process (GO:0006684)|termination of signal transduction (GO:0023021)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lamellar body (GO:0042599)|lysosomal lumen (GO:0043202)	hydrolase activity, acting on glycosyl bonds (GO:0016798)|sphingomyelin phosphodiesterase activity (GO:0004767)			breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(3)	23		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;4.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)	Amlodipine(DB00381)|Chlorpromazine(DB00477)|Desipramine(DB01151)	GGATGACATGGTGGAGGTGTG	0.582																																					p.V145M		.											.	SMPD1-90	0			c.G433A						.						76.0	63.0	68.0					11																	6412728		2201	4296	6497	SO:0001583	missense	6609	exon2			GACATGGTGGAGG	AB209775	CCDS31409.1, CCDS44531.1, CCDS31409.2	11p15.4-p15.1	2010-04-28	2008-02-04		ENSG00000166311	ENSG00000166311	3.1.4.12		11120	protein-coding gene	gene with protein product	"""acid sphingomyelinase"""	607608				1711683	Standard	NM_000543		Approved	ASM	uc001mcw.3	P17405	OTTHUMG00000165453	ENST00000342245.4:c.433G>A	11.37:g.6412728G>A	ENSP00000340409:p.Val145Met	Somatic	55	0		WXS	Illumina HiSeq	Phase_I	52	19	NM_000543	0	0	10	15	5	A8K8M3|E9PKS3|P17406|Q13811|Q16837|Q16841	Missense_Mutation	SNP	ENST00000342245.4	37	CCDS44531.1	.	.	.	.	.	.	.	.	.	.	G	18.12	3.553731	0.65425	.	.	ENSG00000166311	ENST00000299397;ENST00000356761;ENST00000342245;ENST00000527275	D;D;D;D	0.97731	-4.51;-4.51;-4.51;-4.51	5.11	5.11	0.69529	Saposin-like (2);Saposin B (2);	0.178891	0.37857	N	0.001919	D	0.96892	0.8985	L	0.54323	1.7	0.42449	D	0.99274	P;P;P	0.46706	0.818;0.883;0.579	B;P;P	0.51516	0.366;0.672;0.472	D	0.96137	0.9097	10	0.49607	T	0.09	-7.0221	9.6331	0.39791	0.0956:0.0:0.9044:0.0	.	144;145;143	E9PKS3;G3XAB5;P17405	.;.;ASM_HUMAN	M	145;145;145;144	ENSP00000299397:V145M;ENSP00000349203:V145M;ENSP00000340409:V145M;ENSP00000435350:V144M	ENSP00000299397:V145M	V	+	1	0	SMPD1	6369304	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.869000	0.48444	2.382000	0.81193	0.650000	0.86243	GTG	.		0.582	SMPD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384205.1	NM_000543	
PEX16	9409	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	45936221	45936221	+	Missense_Mutation	SNP	G	G	A			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr11:45936221G>A	ENST00000378750.5	-	6	718	c.475C>T	c.(475-477)Cct>Tct	p.P159S	PEX16_ENST00000532681.1_Missense_Mutation_p.P64S|PEX16_ENST00000241041.3_Missense_Mutation_p.P159S|PEX16_ENST00000532554.1_5'UTR			Q9Y5Y5	PEX16_HUMAN	peroxisomal biogenesis factor 16	159					ER-dependent peroxisome organization (GO:0032581)|peroxisome membrane biogenesis (GO:0016557)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome membrane (GO:0045046)|protein localization to endoplasmic reticulum (GO:0070972)|protein targeting to peroxisome (GO:0006625)|protein to membrane docking (GO:0022615)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	protein C-terminus binding (GO:0008022)	p.P159T(1)		large_intestine(2)|lung(2)|ovary(2)|skin(1)	7				GBM - Glioblastoma multiforme(35;0.223)		TGGTTGCCAGGGCTGTGGTCA	0.582																																					p.P159S		.											.	PEX16-93	1	Substitution - Missense(1)	large_intestine(1)	c.C475T						.						154.0	129.0	137.0					11																	45936221		2203	4299	6502	SO:0001583	missense	9409	exon6			TGCCAGGGCTGTG	AF118240	CCDS7917.1, CCDS31472.1	11p	2007-12-14			ENSG00000121680	ENSG00000121680			8857	protein-coding gene	gene with protein product		603360				9922452	Standard	NM_057174		Approved		uc001nbt.3	Q9Y5Y5	OTTHUMG00000167005	ENST00000378750.5:c.475C>T	11.37:g.45936221G>A	ENSP00000368024:p.Pro159Ser	Somatic	51	0		WXS	Illumina HiSeq	Phase_I	59	21	NM_004813	0	0	63	115	52	Q9BWB9	Missense_Mutation	SNP	ENST00000378750.5	37	CCDS31472.1	.	.	.	.	.	.	.	.	.	.	G	0.052	-1.248308	0.01469	.	.	ENSG00000121680	ENST00000241041;ENST00000378750;ENST00000532681;ENST00000533151;ENST00000525192	T;T;T;T;T	0.19250	2.16;2.16;2.16;2.16;2.16	6.04	-5.2	0.02823	.	1.274680	0.04746	N	0.423709	T	0.05868	0.0153	N	0.03608	-0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.28744	-1.0034	10	0.06236	T	0.91	2.692	1.5964	0.02665	0.2746:0.3442:0.2067:0.1744	.	159;159	Q9Y5Y5;Q9Y5Y5-2	PEX16_HUMAN;.	S	159;159;64;55;64	ENSP00000241041:P159S;ENSP00000368024:P159S;ENSP00000434654:P64S;ENSP00000433045:P55S;ENSP00000431309:P64S	ENSP00000241041:P159S	P	-	1	0	PEX16	45892797	0.000000	0.05858	0.001000	0.08648	0.474000	0.32979	-1.251000	0.02882	-0.602000	0.05775	0.561000	0.74099	CCT	.		0.582	PEX16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392398.1	NM_057174	
OR5J2	282775	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	55944703	55944703	+	Missense_Mutation	SNP	G	G	A	rs143728764	byFrequency	TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr11:55944703G>A	ENST00000312298.1	+	1	610	c.610G>A	c.(610-612)Gga>Aga	p.G204R		NM_001005492.1	NP_001005492.1	Q8NH18	OR5J2_HUMAN	olfactory receptor, family 5, subfamily J, member 2	204						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(30)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	44	Esophageal squamous(21;0.00693)					AACCTTCTCCGGAGTCATTGC	0.468													.|||	2	0.000399361	0.0	0.0	5008	,	,		23855	0.0		0.002	False		,,,				2504	0.0				p.G204R		.											.	OR5J2-115	0			c.G610A						.	A	ARG/GLY	1,4401	2.1+/-5.4	0,1,2200	168.0	129.0	142.0		610	1.6	0.0	11	dbSNP_134	142	2,8590	3.0+/-9.4	0,2,4294	yes	missense	OR5J2	NM_001005492.1	125	0,3,6494	AA,AG,GG		0.0233,0.0227,0.0231	probably-damaging	204/313	55944703	3,12991	2201	4296	6497	SO:0001583	missense	282775	exon1			TTCTCCGGAGTCA	AB065595	CCDS31522.1	11q11	2012-08-09			ENSG00000174957	ENSG00000174957		"""GPCR / Class A : Olfactory receptors"""	19612	protein-coding gene	gene with protein product							Standard	NM_001005492		Approved		uc010rjb.2	Q8NH18	OTTHUMG00000166835	ENST00000312298.1:c.610G>A	11.37:g.55944703G>A	ENSP00000310788:p.Gly204Arg	Somatic	79	0		WXS	Illumina HiSeq	Phase_I	66	8	NM_001005492	0	0	0	0	0	Q6IEU5	Missense_Mutation	SNP	ENST00000312298.1	37	CCDS31522.1	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	g	9.690	1.151524	0.21371	2.27E-4	2.33E-4	ENSG00000174957	ENST00000312298	T	0.38401	1.14	4.55	1.59	0.23543	GPCR, rhodopsin-like superfamily (1);	0.240868	0.29059	N	0.013277	T	0.47710	0.1460	M	0.90977	3.165	0.09310	N	1	P	0.45569	0.861	P	0.45037	0.467	T	0.48811	-0.9002	10	0.72032	D	0.01	.	7.9468	0.29991	0.334:0.0:0.666:0.0	.	204	Q8NH18	OR5J2_HUMAN	R	204	ENSP00000310788:G204R	ENSP00000310788:G204R	G	+	1	0	OR5J2	55701279	0.000000	0.05858	0.034000	0.17996	0.001000	0.01503	0.042000	0.13949	0.497000	0.27926	-0.185000	0.12909	GGA	G|1.000;A|0.000		0.468	OR5J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391544.1	NM_001005492	
ITPR2	3709	broad.mit.edu	37	12	26714818	26714818	+	Missense_Mutation	SNP	G	G	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr12:26714818G>T	ENST00000381340.3	-	35	5114	c.4698C>A	c.(4696-4698)agC>agA	p.S1566R		NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	1566					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	TATTTGAATGGCTCTTCATGA	0.433																																					p.S1566R													.	ITPR2-542	0			c.C4698A						.						58.0	58.0	58.0					12																	26714818		1879	4118	5997	SO:0001583	missense	3709	exon35			TGAATGGCTCTTC	D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.4698C>A	12.37:g.26714818G>T	ENSP00000370744:p.Ser1566Arg	Somatic	158	0		WXS	Illumina HiSeq	Phase_I	106	3	NM_002223	0	0	0	0	0	O94773	Missense_Mutation	SNP	ENST00000381340.3	37	CCDS41764.1	.	.	.	.	.	.	.	.	.	.	G	14.88	2.667994	0.47677	.	.	ENSG00000123104	ENST00000381340	T	0.68331	-0.32	4.59	0.0451	0.14228	.	0.401114	0.31233	N	0.008004	T	0.52451	0.1735	L	0.46819	1.47	0.80722	D	1	B	0.28933	0.228	B	0.29267	0.1	T	0.44498	-0.9324	10	0.72032	D	0.01	.	4.8656	0.13607	0.416:0.0:0.4445:0.1395	.	1566	Q14571	ITPR2_HUMAN	R	1566	ENSP00000370744:S1566R	ENSP00000370744:S1566R	S	-	3	2	ITPR2	26606085	1.000000	0.71417	0.992000	0.48379	0.998000	0.95712	1.059000	0.30517	0.105000	0.17753	0.655000	0.94253	AGC	.		0.433	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402732.1	NM_002223	
DNAJC22	79962	bcgsc.ca	37	12	49745201	49745201	+	Missense_Mutation	SNP	G	G	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr12:49745201G>T	ENST00000549441.2	+	4	2146	c.942G>T	c.(940-942)gaG>gaT	p.E314D	DNAJC22_ENST00000395069.3_Missense_Mutation_p.E314D			Q8N4W6	DJC22_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 22	314	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.					integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|liver(2)|lung(1)|ovary(1)|pancreas(1)	10						ACCAGACAGAGGAGGCACAGA	0.547																																					p.E314D													.	DNAJC22-159	0			c.G942T						.						59.0	59.0	59.0					12																	49745201		2203	4300	6503	SO:0001583	missense	79962	exon3			GACAGAGGAGGCA	AK055747	CCDS8785.1	12q13.12	2011-09-02		2008-07-08	ENSG00000178401	ENSG00000178401		"""Heat shock proteins / DNAJ (HSP40)"""	25802	protein-coding gene	gene with protein product	"""wurst homolog (Drosophila)"""					17558392	Standard	NM_024902		Approved	wus, FLJ13236	uc001rua.3	Q8N4W6		ENST00000549441.2:c.942G>T	12.37:g.49745201G>T	ENSP00000446830:p.Glu314Asp	Somatic	132	0		WXS	Illumina HiSeq	Phase_1	120	5	NM_024902	0	0	16	16	0	B3KP54	Missense_Mutation	SNP	ENST00000549441.2	37	CCDS8785.1	.	.	.	.	.	.	.	.	.	.	G	18.17	3.564963	0.65651	.	.	ENSG00000178401	ENST00000549441;ENST00000395069	T;T	0.33438	1.41;1.41	5.5	3.53	0.40419	Heat shock protein DnaJ, N-terminal (5);	0.154813	0.56097	D	0.000021	T	0.18882	0.0453	N	0.20357	0.565	0.47511	D	0.999446	P	0.36354	0.549	B	0.40038	0.317	T	0.05517	-1.0880	10	0.37606	T	0.19	-7.4243	4.2702	0.10783	0.1957:0.0:0.6268:0.1776	.	314	Q8N4W6	DJC22_HUMAN	D	314	ENSP00000446830:E314D;ENSP00000378508:E314D	ENSP00000378508:E314D	E	+	3	2	DNAJC22	48031468	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	0.731000	0.26058	0.748000	0.32831	0.555000	0.69702	GAG	.		0.547	DNAJC22-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404302.2	NM_024902	
R3HDM2	22864	broad.mit.edu	37	12	57663626	57663626	+	Missense_Mutation	SNP	G	G	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr12:57663626G>T	ENST00000347140.3	-	15	1844	c.1454C>A	c.(1453-1455)cCc>cAc	p.P485H	R3HDM2_ENST00000546843.1_5'Flank|R3HDM2_ENST00000403821.2_Missense_Mutation_p.P519H|RP11-123K3.4_ENST00000548184.1_3'UTR|R3HDM2_ENST00000402412.1_Missense_Mutation_p.P499H|R3HDM2_ENST00000358907.2_Missense_Mutation_p.P485H|R3HDM2_ENST00000413953.2_Missense_Mutation_p.P212H|R3HDM2_ENST00000441731.2_Missense_Mutation_p.P180H			Q9Y2K5	R3HD2_HUMAN	R3H domain containing 2	485	Gln-rich.					nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	22						AGTGGGGAGGGGCTGACCCGT	0.572																																					p.P485H													.	R3HDM2-92	0			c.C1454A						.						120.0	106.0	111.0					12																	57663626		2203	4300	6503	SO:0001583	missense	22864	exon13			GGGAGGGGCTGAC	AB023219	CCDS8937.2	12q13.3	2012-11-19			ENSG00000179912	ENSG00000179912			29167	protein-coding gene	gene with protein product							Standard	NM_014925		Approved	KIAA1002	uc009zpm.1	Q9Y2K5	OTTHUMG00000171568	ENST00000347140.3:c.1454C>A	12.37:g.57663626G>T	ENSP00000317903:p.Pro485His	Somatic	76	1		WXS	Illumina HiSeq	Phase_I	81	5	NM_014925	0	0	0	0	0	Q2M1T9|Q3ZCT5	Missense_Mutation	SNP	ENST00000347140.3	37	CCDS8937.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.3|25.3	4.627176|4.627176	0.87560|0.87560	.|.	.|.	ENSG00000179912|ENSG00000179912	ENST00000413953;ENST00000393811;ENST00000347140;ENST00000402412;ENST00000358907;ENST00000441731;ENST00000429355;ENST00000403821|ENST00000466401	T;T;T;T;T;T;T;T|.	0.41400|.	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0|.	5.21|5.21	5.21|5.21	0.72293|0.72293	.|.	0.058617|0.058617	0.64402|0.64402	D|D	0.000001|0.000001	T|T	0.69305|0.69305	0.3096|0.3096	L|L	0.42245|0.42245	1.32|1.32	0.54753|0.54753	D|D	0.999983|0.999983	D;D;D;D;D|.	0.76494|.	0.999;0.997;0.997;0.997;0.999|.	D;P;P;P;D|.	0.65874|.	0.939;0.817;0.817;0.817;0.939|.	T|T	0.70360|0.70360	-0.4893|-0.4893	10|7	0.87932|0.66056	D|D	0|0.02	-11.5485|-11.5485	18.0786|18.0786	0.89436|0.89436	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	212;519;499;485;212|.	B4DDZ2;B5MCG9;B5MCU0;Q9Y2K5;E9PAL1|.	.;.;.;R3HD2_HUMAN;.|.	H|T	212;212;485;499;485;180;250;519|83	ENSP00000409146:P212H;ENSP00000377400:P212H;ENSP00000317903:P485H;ENSP00000385839:P499H;ENSP00000351784:P485H;ENSP00000408536:P180H;ENSP00000394676:P250H;ENSP00000385169:P519H|.	ENSP00000317903:P485H|ENSP00000449326:P83T	P|P	-|-	2|1	0|0	R3HDM2|R3HDM2	55949893|55949893	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	8.841000|8.841000	0.92131|0.92131	2.890000|2.890000	0.99128|0.99128	0.650000|0.650000	0.86243|0.86243	CCC|CCC	.		0.572	R3HDM2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326570.2	NM_014925	
DACH1	1602	broad.mit.edu	37	13	72440446	72440446	+	Silent	SNP	G	G	A			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr13:72440446G>A	ENST00000359684.2	-	1	461	c.462C>T	c.(460-462)agC>agT	p.S154S	DACH1_ENST00000313174.7_Silent_p.S154S|DACH1_ENST00000354591.4_Silent_p.S154S|DACH1_ENST00000305425.4_Silent_p.S154S			Q9UI36	DACH1_HUMAN	dachshund family transcription factor 1	154	Poly-Ser.				cell proliferation (GO:0008283)|development of primary female sexual characteristics (GO:0046545)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription by competitive promoter binding (GO:0010944)|respiratory gaseous exchange (GO:0007585)|suckling behavior (GO:0001967)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity involved in preinitiation complex assembly (GO:0001075)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(23)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	41		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)		GBM - Glioblastoma multiforme(99;0.00032)		tgctactactgctgctgctgc	0.662																																					p.S154S													.	DACH1-135	0			c.C462T						.						3.0	4.0	4.0					13																	72440446		1701	3505	5206	SO:0001819	synonymous_variant	1602	exon1			ACTACTGCTGCTG	AJ005670	CCDS41899.1, CCDS53874.1, CCDS53873.1	13q22	2014-02-03	2014-02-03	2004-04-02	ENSG00000165659	ENSG00000276644			2663	protein-coding gene	gene with protein product		603803	"""dachshund homolog (Drosophila)"", ""dachshund homolog 1 (Drosophila)"""	DACH		9933575, 10395809, 15057823	Standard	NM_004392		Approved		uc021rkj.1	Q9UI36	OTTHUMG00000017063	ENST00000359684.2:c.462C>T	13.37:g.72440446G>A		Somatic	23	0		WXS	Illumina HiSeq	Phase_I	17	3	NM_080759	0	0	0	0	0	D0FY35|D0FY36|O75523|O75687|Q5VYY3|Q5VYY4|Q96SG3|Q96SG4|Q9H524|Q9UMH4	Silent	SNP	ENST00000359684.2	37																																																																																				.		0.662	DACH1-002	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000045240.1	NM_004392	
TMTC4	84899	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	101287091	101287091	+	Missense_Mutation	SNP	T	T	G			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr13:101287091T>G	ENST00000376234.3	-	11	1606	c.1417A>C	c.(1417-1419)Agt>Cgt	p.S473R	TMTC4_ENST00000342624.5_Missense_Mutation_p.S492R|TMTC4_ENST00000328767.5_Missense_Mutation_p.S362R|TMTC4_ENST00000462211.1_5'UTR	NM_001079669.1	NP_001073137.1	Q5T4D3	TMTC4_HUMAN	transmembrane and tetratricopeptide repeat containing 4	473						integral component of membrane (GO:0016021)				breast(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					GACAGAGCACTTCTGAAAAGC	0.493																																					p.S492R		.											.	TMTC4-155	0			c.A1474C						.						135.0	140.0	139.0					13																	101287091		2203	4300	6503	SO:0001583	missense	84899	exon12			GAGCACTTCTGAA		CCDS9497.2, CCDS41904.1, CCDS66575.1	13q32.3	2013-01-10	2006-01-06		ENSG00000125247	ENSG00000125247		"""Tetratricopeptide (TTC) repeat domain containing"""	25904	protein-coding gene	gene with protein product							Standard	XM_005254082		Approved	FLJ14624, FLJ22153	uc001vot.3	Q5T4D3	OTTHUMG00000017289	ENST00000376234.3:c.1417A>C	13.37:g.101287091T>G	ENSP00000365408:p.Ser473Arg	Somatic	95	0		WXS	Illumina HiSeq	Phase_I	62	21	NM_032813	0	0	1	1	0	A6NLI7|B7Z666|Q5T4D4|Q5T4D5|Q5T4D6|Q8WV63|Q96SU8	Missense_Mutation	SNP	ENST00000376234.3	37	CCDS41904.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.428259	0.83667	.	.	ENSG00000125247	ENST00000376234;ENST00000342624;ENST00000328767	T;T;T	0.52526	0.66;0.66;0.66	5.55	5.55	0.83447	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.75406	0.3845	M	0.91663	3.23	0.80722	D	1	D;D;D;P	0.89917	1.0;0.999;1.0;0.737	D;D;D;P	0.97110	0.997;0.994;1.0;0.565	T	0.81901	-0.0720	10	0.87932	D	0	.	15.7439	0.77922	0.0:0.0:0.0:1.0	.	362;473;473;492	B7Z666;Q5T4D3-2;Q5T4D3;Q5T4D3-3	.;.;TMTC4_HUMAN;.	R	473;492;362	ENSP00000365408:S473R;ENSP00000343871:S492R;ENSP00000365409:S362R	ENSP00000365409:S362R	S	-	1	0	TMTC4	100085092	1.000000	0.71417	0.954000	0.39281	0.652000	0.38707	7.590000	0.82653	2.134000	0.65973	0.456000	0.33151	AGT	.		0.493	TMTC4-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045649.2	NM_032813	
FBXO34	55030	broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	55817793	55817793	+	Missense_Mutation	SNP	T	T	A			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr14:55817793T>A	ENST00000313833.4	+	2	930	c.685T>A	c.(685-687)Tgc>Agc	p.C229S	FBXO34_ENST00000440021.1_Missense_Mutation_p.C229S	NM_017943.3	NP_060413.2	Q9NWN3	FBX34_HUMAN	F-box protein 34	229										breast(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|pancreas(1)|skin(2)|stomach(3)	22						TTCAAAAAACTGCACAAACTC	0.512																																					p.C229S													.	FBXO34-228	0			c.T685A						.						83.0	76.0	79.0					14																	55817793		2203	4300	6503	SO:0001583	missense	55030	exon2			AAAAACTGCACAA	AK000732	CCDS32086.1	14q22.1	2004-08-24	2004-06-15			ENSG00000178974		"""F-boxes /  ""other"""""	20201	protein-coding gene	gene with protein product		609104	"""F-box only protein 34"""				Standard	NM_017943		Approved	FLJ20725, Fbx34	uc010aoo.3	Q9NWN3		ENST00000313833.4:c.685T>A	14.37:g.55817793T>A	ENSP00000313159:p.Cys229Ser	Somatic	79	1		WXS	Illumina HiSeq	Phase_I	74	29	NM_017943	0	0	1	1	0	Q2VPB5|Q4VBP5|Q86TY4	Missense_Mutation	SNP	ENST00000313833.4	37	CCDS32086.1	.	.	.	.	.	.	.	.	.	.	T	6.831	0.522583	0.13066	.	.	ENSG00000178974	ENST00000313833;ENST00000440021	T;T	0.46819	0.86;0.86	5.08	5.08	0.68730	.	0.167805	0.40818	N	0.001006	T	0.45836	0.1362	M	0.63428	1.95	0.47511	D	0.999442	B	0.12630	0.006	B	0.17722	0.019	T	0.37430	-0.9706	10	0.21014	T	0.42	-14.1611	15.0107	0.71547	0.0:0.0:0.0:1.0	.	229	Q9NWN3	FBX34_HUMAN	S	229	ENSP00000313159:C229S;ENSP00000394117:C229S	ENSP00000313159:C229S	C	+	1	0	FBXO34	54887546	1.000000	0.71417	0.967000	0.41034	0.171000	0.22731	4.380000	0.59581	2.136000	0.66102	0.528000	0.53228	TGC	.		0.512	FBXO34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411322.1		
ACOT4	122970	broad.mit.edu	37	14	74060593	74060593	+	Missense_Mutation	SNP	G	G	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr14:74060593G>T	ENST00000326303.4	+	2	899	c.645G>T	c.(643-645)atG>atT	p.M215I		NM_152331.3	NP_689544.3	Q8N9L9	ACOT4_HUMAN	acyl-CoA thioesterase 4	215					acyl-CoA metabolic process (GO:0006637)|dicarboxylic acid catabolic process (GO:0043649)|dicarboxylic acid metabolic process (GO:0043648)|long-chain fatty acid metabolic process (GO:0001676)|saturated monocarboxylic acid metabolic process (GO:0032788)|short-chain fatty acid metabolic process (GO:0046459)|succinyl-CoA metabolic process (GO:0006104)|unsaturated monocarboxylic acid metabolic process (GO:0032789)|very long-chain fatty acid metabolic process (GO:0000038)	peroxisome (GO:0005777)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)|succinyl-CoA hydrolase activity (GO:0004778)			endometrium(1)|large_intestine(3)|lung(4)	8				BRCA - Breast invasive adenocarcinoma(234;0.00331)		TATGCTACATGCTTCAACATC	0.423																																					p.M215I													.	ACOT4-90	0			c.G645T						.						150.0	147.0	148.0					14																	74060593		2203	4300	6503	SO:0001583	missense	122970	exon2			CTACATGCTTCAA	BC031799	CCDS9817.1	14q24.1	2011-02-16			ENSG00000177465	ENSG00000177465		"""Acyl CoA thioesterases"""	19748	protein-coding gene	gene with protein product		614314				16103133, 16940157	Standard	NM_152331		Approved	FLJ31235, PTE-Ib, PTE2B	uc001xoo.3	Q8N9L9	OTTHUMG00000169485	ENST00000326303.4:c.645G>T	14.37:g.74060593G>T	ENSP00000323071:p.Met215Ile	Somatic	93	0		WXS	Illumina HiSeq	Phase_I	66	3	NM_152331	0	0	1	1	0	Q17RF4|Q5BKT6|Q86TX0|Q86TX1|Q96N88	Missense_Mutation	SNP	ENST00000326303.4	37	CCDS9817.1	.	.	.	.	.	.	.	.	.	.	G	16.92	3.254564	0.59212	.	.	ENSG00000177465	ENST00000326303	T	0.28069	1.63	5.39	4.47	0.54385	BAAT/Acyl-CoA thioester hydrolase C-terminal (1);	0.301034	0.37437	N	0.002098	T	0.37705	0.1013	M	0.65975	2.015	0.47183	D	0.999347	P	0.41313	0.745	B	0.42555	0.391	T	0.34551	-0.9824	10	0.72032	D	0.01	-12.828	13.8627	0.63571	0.0:0.153:0.847:0.0	.	215	Q8N9L9	ACOT4_HUMAN	I	215	ENSP00000323071:M215I	ENSP00000323071:M215I	M	+	3	0	ACOT4	73130346	0.997000	0.39634	0.990000	0.47175	0.742000	0.42306	2.664000	0.46783	1.215000	0.43411	0.561000	0.74099	ATG	.		0.423	ACOT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404298.2	NM_152331	
UNC79	57578	broad.mit.edu	37	14	94088804	94088804	+	Missense_Mutation	SNP	C	C	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr14:94088804C>T	ENST00000393151.2	+	30	5225	c.5225C>T	c.(5224-5226)aCg>aTg	p.T1742M	UNC79_ENST00000555664.1_Missense_Mutation_p.T1742M|UNC79_ENST00000256339.4_Missense_Mutation_p.T1565M|UNC79_ENST00000553484.1_Missense_Mutation_p.T1764M			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	1742					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						AGCCCACTGACGCTGAAGCAA	0.582																																					p.T1565M													.	.	0			c.C4694T						.						67.0	71.0	70.0					14																	94088804		2203	4300	6503	SO:0001583	missense	57578	exon30			CACTGACGCTGAA	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.5225C>T	14.37:g.94088804C>T	ENSP00000376858:p.Thr1742Met	Somatic	100	0		WXS	Illumina HiSeq	Phase_I	85	4	NM_020818	0	0	0	0	0	B5MDL6|Q6ZUT7	Missense_Mutation	SNP	ENST00000393151.2	37		.	.	.	.	.	.	.	.	.	.	C	15.99	2.995180	0.54147	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.27104	1.75;1.69;1.76;1.75	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.43100	0.1232	L	0.32530	0.975	0.52501	D	0.999953	D	0.89917	1.0	D	0.87578	0.998	T	0.39683	-0.9602	10	0.87932	D	0	-15.2232	18.72	0.91689	0.0:1.0:0.0:0.0	.	1764	C9JQL1	.	M	1565;1742;1764;1742;1764	ENSP00000256339:T1565M;ENSP00000450868:T1742M;ENSP00000451360:T1764M;ENSP00000376858:T1742M	ENSP00000256339:T1565M	T	+	2	0	KIAA1409	93158557	1.000000	0.71417	0.553000	0.28255	0.624000	0.37722	7.294000	0.78760	2.433000	0.82419	0.305000	0.20034	ACG	.		0.582	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395	
SPTBN5	51332	broad.mit.edu	37	15	42143073	42143073	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr15:42143073G>A	ENST00000320955.6	-	66	11127	c.10900C>T	c.(10900-10902)Cga>Tga	p.R3634*	RNA5SP393_ENST00000363423.1_RNA	NM_016642.2	NP_057726.4	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	3634	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi organization (GO:0007030)|lysosomal transport (GO:0007041)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|spectrin (GO:0008091)	actin binding (GO:0003779)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|kinesin binding (GO:0019894)|myosin tail binding (GO:0032029)|protein self-association (GO:0043621)|spectrin binding (GO:0030507)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(6)|lung(18)|ovary(5)|prostate(8)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	62		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		CCCAGGGCTCGCCACCAGCTC	0.647																																					p.R3599X													.	SPTBN5-91	0			c.C10795T						.						19.0	24.0	22.0					15																	42143073		2149	4252	6401	SO:0001587	stop_gained	51332	exon66			GGGCTCGCCACCA	AF233523	CCDS61599.1	15q21	2010-08-17			ENSG00000137877	ENSG00000137877			15680	protein-coding gene	gene with protein product	"""beta V spectrin"""	605916				10764729	Standard	NM_016642		Approved	HUSPECV, BSPECV, HUBSPECV	uc001zos.4	Q9NRC6		ENST00000320955.6:c.10900C>T	15.37:g.42143073G>A	ENSP00000317790:p.Arg3634*	Somatic	69	1		WXS	Illumina HiSeq	Phase_I	48	3	NM_016642	0	1	25	26	0		Nonsense_Mutation	SNP	ENST00000320955.6	37		.	.	.	.	.	.	.	.	.	.	.	52	18.710897	0.99909	.	.	ENSG00000137877	ENST00000320955	.	.	.	3.79	1.91	0.25777	.	1.938660	0.03085	N	0.158980	.	.	.	.	.	.	0.44055	A	0.996793	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.1913	0.25826	0.0981:0.1862:0.7158:0.0	.	.	.	.	X	3634	.	ENSP00000317790:R3634X	R	-	1	2	SPTBN5	39930365	0.000000	0.05858	0.000000	0.03702	0.050000	0.14768	0.503000	0.22610	0.582000	0.29556	-0.119000	0.15052	CGA	.		0.647	SPTBN5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000420237.1	NM_016642	
MEGF11	84465	broad.mit.edu	37	15	66250030	66250030	+	Missense_Mutation	SNP	C	C	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr15:66250030C>T	ENST00000409699.2	-	10	1314	c.1142G>A	c.(1141-1143)tGc>tAc	p.C381Y	MEGF11_ENST00000288745.3_Missense_Mutation_p.C306Y|MEGF11_ENST00000422354.1_Missense_Mutation_p.C381Y|MEGF11_ENST00000395614.1_5'UTR|MEGF11_ENST00000395625.2_Missense_Mutation_p.C306Y|MEGF11_ENST00000360698.4_Missense_Mutation_p.C381Y			A6BM72	MEG11_HUMAN	multiple EGF-like-domains 11	381					homotypic cell-cell adhesion (GO:0034109)|retina layer formation (GO:0010842)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	19						GCCTGGCTGGCAGGTACAAGC	0.587																																					p.C381Y													.	MEGF11-69	0			c.G1142A						.						49.0	44.0	45.0					15																	66250030		2201	4298	6499	SO:0001583	missense	84465	exon10			GGCTGGCAGGTAC	AB058677	CCDS10213.2	15q22.31	2006-03-31			ENSG00000157890	ENSG00000157890			29635	protein-coding gene	gene with protein product		612454				11347906	Standard	NM_032445		Approved	KIAA1781, DKFZp434L121	uc002apm.2	A6BM72	OTTHUMG00000133175	ENST00000409699.2:c.1142G>A	15.37:g.66250030C>T	ENSP00000386908:p.Cys381Tyr	Somatic	97	0		WXS	Illumina HiSeq	Phase_I	95	4	NM_032445	0	0	0	0	0	Q17R86|Q6UXS5|Q8ND91|Q96KG6	Missense_Mutation	SNP	ENST00000409699.2	37	CCDS10213.2	.	.	.	.	.	.	.	.	.	.	C	23.0	4.356687	0.82243	.	.	ENSG00000157890	ENST00000409699;ENST00000288745;ENST00000422354;ENST00000395625;ENST00000360698;ENST00000455812	D;D;D;D;D;D	0.94330	-3.4;-3.4;-3.4;-3.4;-3.4;-3.4	4.87	4.87	0.63330	EGF-like, laminin (3);EGF-like region, conserved site (2);	0.000000	0.46442	U	0.000299	D	0.98582	0.9526	H	0.99894	4.905	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	0.992;1.0	D	0.99544	1.0964	10	0.87932	D	0	.	17.3629	0.87356	0.0:1.0:0.0:0.0	.	381;306	A6BM72;A6BM72-2	MEG11_HUMAN;.	Y	381;306;381;306;381;85	ENSP00000386908:C381Y;ENSP00000288745:C306Y;ENSP00000414475:C381Y;ENSP00000378987:C306Y;ENSP00000353919:C381Y;ENSP00000401400:C85Y	ENSP00000288745:C306Y	C	-	2	0	MEGF11	64037084	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	7.684000	0.84104	2.420000	0.82092	0.561000	0.74099	TGC	.		0.587	MEGF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329307.2	NM_032445	
WDR90	197335	broad.mit.edu	37	16	707223	707223	+	Splice_Site	SNP	T	T	G	rs78538490		TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr16:707223T>G	ENST00000293879.4	+	20	2473		c.e20+2		LA16c-349E10.1_ENST00000573609.1_RNA|WDR90_ENST00000549091.1_Splice_Site			Q96KV7	WDR90_HUMAN	WD repeat domain 90											endometrium(4)|kidney(3)|large_intestine(2)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	37		Hepatocellular(780;0.0218)				GAGTGGCAGGTTGGGCCCCCT	0.692																																					.													.	WDR90-92	0			c.2473+2T>G						.						4.0	5.0	5.0					16																	707223		1769	3825	5594	SO:0001630	splice_region_variant	197335	exon20			GGCAGGTTGGGCC	AB067511	CCDS42092.1	16p13.3	2013-01-09			ENSG00000161996	ENSG00000161996		"""WD repeat domain containing"""	26960	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 17"", ""chromosome 16 open reading frame 15"", ""chromosome 16 open reading frame 16"", ""chromosome 16 open reading frame 19"", ""chromosome 16 open reading frame 18"""	C16orf17, C16orf15, C16orf16, C16orf19, C16orf18		11572484, 11157797	Standard	XM_005255160		Approved	FLJ36483, KIAA1924	uc002cii.1	Q96KV7	OTTHUMG00000048040	ENST00000293879.4:c.2473+2T>G	16.37:g.707223T>G		Somatic	77	6		WXS	Illumina HiSeq	Phase_I	92	8	NM_145294	0	0	2	2	0	Q0VA87|Q0VA88|Q6P048|Q6ZMS1|Q6ZTH1|Q8N202|Q8N221|Q8NBB8|Q96PW4|Q96S18	Splice_Site	SNP	ENST00000293879.4	37	CCDS42092.1	.	.	.	.	.	.	.	.	.	.	T	14.78	2.637594	0.47049	.	.	ENSG00000161996	ENST00000549091;ENST00000293879	.	.	.	4.41	4.41	0.53225	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.127	0.59360	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	WDR90	647224	0.999000	0.42202	0.986000	0.45419	0.177000	0.22998	3.227000	0.51262	1.761000	0.52028	0.402000	0.26972	.	.		0.692	WDR90-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404335.1	NM_145294	Intron
APOBR	55911	hgsc.bcm.edu	37	16	28507452	28507452	+	Missense_Mutation	SNP	G	G	T	rs370148393		TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr16:28507452G>T	ENST00000431282.1	+	3	1073	c.1063G>T	c.(1063-1065)Ggg>Tgg	p.G355W	CLN3_ENST00000567160.1_5'Flank|APOBR_ENST00000564831.1_Missense_Mutation_p.G364W|CLN3_ENST00000569430.1_5'Flank|APOBR_ENST00000328423.5_Missense_Mutation_p.G355W			Q0VD83	APOBR_HUMAN	apolipoprotein B receptor	355	Glu-rich.				cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|triglyceride metabolic process (GO:0006641)	chylomicron (GO:0042627)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|skin(2)|stomach(1)	29						GGAGGAGGCCGGGACAGCCTC	0.672																																					p.G364W		.											.	APOBR-90	0			c.G1090T						.						14.0	17.0	16.0					16																	28507452		1944	4097	6041	SO:0001583	missense	55911	exon2			GAGGCCGGGACAG	AK025123	CCDS58442.1	16p11.2	2011-02-14			ENSG00000184730	ENSG00000184730			24087	protein-coding gene	gene with protein product	"""apolipoprotein B48 receptor"", ""apolipoprotein B100 receptor"""	605220				10852956	Standard	NM_018690		Approved	APOB48R, APOB100R	uc002dqb.2	Q0VD83		ENST00000431282.1:c.1063G>T	16.37:g.28507452G>T	ENSP00000416094:p.Gly355Trp	Somatic	15	0		WXS	Illumina HiSeq	Phase_I	29	6	NM_018690	0	0	0	0	0	H3BU97|Q0VD81|Q8NC15|Q9NPJ9	Missense_Mutation	SNP	ENST00000431282.1	37		.	.	.	.	.	.	.	.	.	.	G	11.71	1.718826	0.30503	.	.	ENSG00000184730	ENST00000328423;ENST00000431282	T;T	0.60548	0.18;0.18	3.86	-2.49	0.06403	.	.	.	.	.	T	0.33059	0.0850	N	0.19112	0.55	0.09310	N	1	B	0.33777	0.425	B	0.27715	0.082	T	0.13980	-1.0489	9	0.72032	D	0.01	.	3.7884	0.08710	0.5999:0.0:0.2159:0.1841	.	355	Q9NS13	.	W	355	ENSP00000327669:G355W;ENSP00000416094:G355W	ENSP00000327669:G355W	G	+	1	0	APOBR	28414953	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.825000	0.04433	-0.783000	0.04534	-0.487000	0.04747	GGG	.		0.672	APOBR-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_182804	
ZNF689	115509	broad.mit.edu	37	16	30616114	30616114	+	Missense_Mutation	SNP	C	C	T	rs374687630		TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr16:30616114C>T	ENST00000287461.3	-	3	1311	c.974G>A	c.(973-975)cGc>cAc	p.R325H	RP11-146F11.5_ENST00000563540.1_RNA|ZNF689_ENST00000566673.1_5'UTR	NM_138447.1	NP_612456.1	Q96CS4	ZN689_HUMAN	zinc finger protein 689	325					regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|prostate(1)|urinary_tract(1)	14			Colorectal(24;0.198)			GGAGGAGAAGCGCCGCTCGCA	0.697																																					p.R325H													.	ZNF689-68	0			c.G974A						.	C	HIS/ARG	1,4393	2.1+/-5.4	0,1,2196	37.0	31.0	33.0		974	5.2	1.0	16		33	0,8600		0,0,4300	no	missense	ZNF689	NM_138447.1	29	0,1,6496	TT,TC,CC		0.0,0.0228,0.0077	probably-damaging	325/501	30616114	1,12993	2197	4300	6497	SO:0001583	missense	115509	exon3			GAGAAGCGCCGCT	BC014000	CCDS10686.1	16p11.2	2013-01-08			ENSG00000156853	ENSG00000156853		"""Zinc fingers, C2H2-type"", ""-"""	25173	protein-coding gene	gene with protein product							Standard	NM_138447		Approved	FLJ90415	uc031qvq.1	Q96CS4	OTTHUMG00000132415	ENST00000287461.3:c.974G>A	16.37:g.30616114C>T	ENSP00000287461:p.Arg325His	Somatic	45	0		WXS	Illumina HiSeq	Phase_I	45	3	NM_138447	0	0	0	0	0	Q658J5	Missense_Mutation	SNP	ENST00000287461.3	37	CCDS10686.1	.	.	.	.	.	.	.	.	.	.	c	18.99	3.740643	0.69304	2.28E-4	0.0	ENSG00000156853	ENST00000287461;ENST00000443190	T	0.53640	0.61	5.18	5.18	0.71444	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.49916	D	0.000133	T	0.61286	0.2335	L	0.43757	1.38	0.34736	D	0.730231	D	0.89917	1.0	D	0.71414	0.973	T	0.69691	-0.5077	10	0.72032	D	0.01	-21.8329	16.5866	0.84728	0.0:1.0:0.0:0.0	.	325	Q96CS4	ZN689_HUMAN	H	325	ENSP00000287461:R325H	ENSP00000287461:R325H	R	-	2	0	ZNF689	30523615	0.001000	0.12720	0.977000	0.42913	0.544000	0.35116	1.554000	0.36266	2.868000	0.98415	0.555000	0.69702	CGC	.		0.697	ZNF689-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255552.1	NM_138447	
EDC4	23644	broad.mit.edu;bcgsc.ca	37	16	67913803	67913803	+	Silent	SNP	C	C	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr16:67913803C>T	ENST00000358933.5	+	16	2111	c.1872C>T	c.(1870-1872)agC>agT	p.S624S	CTC-479C5.10_ENST00000572067.1_lincRNA|AC040162.1_ENST00000408599.1_RNA	NM_014329.4	NP_055144.3	Q6P2E9	EDC4_HUMAN	enhancer of mRNA decapping 4	624	Ser-rich.				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(4)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	41		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)		gcagcagcagcagtagcagca	0.602																																					p.S624S													.	EDC4-92	0			c.C1872T						.						36.0	33.0	34.0					16																	67913803		2193	4282	6475	SO:0001819	synonymous_variant	23644	exon16			CAGCAGCAGTAGC	U17474	CCDS10849.1	16q22.1	2008-02-05			ENSG00000038358	ENSG00000038358			17157	protein-coding gene	gene with protein product		606030				9067524	Standard	NM_014329		Approved	RCD-8, Ge-1, HEDLS	uc002eur.3	Q6P2E9	OTTHUMG00000137543	ENST00000358933.5:c.1872C>T	16.37:g.67913803C>T		Somatic	46	0		WXS	Illumina HiSeq	Phase_I	47	5	NM_014329	0	0	1	1	0	A6NGM1|A8K4T4|Q13025|Q13826|Q6ZR12|Q7Z6H7	Silent	SNP	ENST00000358933.5	37	CCDS10849.1																																																																																			.		0.602	EDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268874.2	NM_014329	
PDPR	55066	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	70163023	70163023	+	Missense_Mutation	SNP	A	A	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr16:70163023A>T	ENST00000288050.4	+	6	1562	c.605A>T	c.(604-606)aAt>aTt	p.N202I	PDPR_ENST00000568530.1_Missense_Mutation_p.N202I|PDPR_ENST00000398122.3_Missense_Mutation_p.N102I	NM_017990.3	NP_060460.4	Q8NCN5	PDPR_HUMAN	pyruvate dehydrogenase phosphatase regulatory subunit	202					cellular metabolic process (GO:0044237)|glycine catabolic process (GO:0006546)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)	aminomethyltransferase activity (GO:0004047)|oxidoreductase activity (GO:0016491)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|skin(2)|stomach(3)	33				BRCA - Breast invasive adenocarcinoma(221;0.124)		GCCTCCCAAAATGGTGAGCAG	0.512																																					p.N202I		.											.	PDPR-135	0			c.A605T						.						111.0	104.0	106.0					16																	70163023		1953	4159	6112	SO:0001583	missense	55066	exon6			CCCAAAATGGTGA		CCDS45520.1	16q22.1	2010-08-24			ENSG00000090857	ENSG00000090857			30264	protein-coding gene	gene with protein product						9395502	Standard	NM_017990		Approved	PDP3	uc002eyf.1	Q8NCN5		ENST00000288050.4:c.605A>T	16.37:g.70163023A>T	ENSP00000288050:p.Asn202Ile	Somatic	379	0		WXS	Illumina HiSeq	Phase_I	473	124	NM_017990	0	0	1	2	1	A7E298|A8K8Y7|B3KSE1|Q6AI20|Q6AWC9	Missense_Mutation	SNP	ENST00000288050.4	37	CCDS45520.1	.	.	.	.	.	.	.	.	.	.	A	13.30	2.196035	0.38806	.	.	ENSG00000090857	ENST00000288050;ENST00000398122	D;D	0.82167	-1.58;-1.58	4.5	3.4	0.38934	FAD dependent oxidoreductase (1);	0.236187	0.40385	N	0.001112	T	0.77765	0.4179	L	0.55213	1.73	0.80722	D	1	B	0.23806	0.091	B	0.28784	0.094	T	0.69224	-0.5201	10	0.31617	T	0.26	.	9.0915	0.36614	0.9111:0.0:0.0889:0.0	.	202	Q8NCN5	PDPR_HUMAN	I	202;102	ENSP00000288050:N202I;ENSP00000381190:N102I	ENSP00000288050:N202I	N	+	2	0	PDPR	68720524	1.000000	0.71417	0.967000	0.41034	0.965000	0.64279	5.368000	0.66133	0.581000	0.29539	0.455000	0.32223	AAT	.		0.512	PDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434502.1	NM_017990	
KARS	3735	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	16	75678300	75678300	+	Intron	SNP	A	A	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr16:75678300A>T	ENST00000302445.3	-	2	102				KARS_ENST00000319410.5_Silent_p.L9L|KARS_ENST00000568378.1_Silent_p.L9L	NM_005548.2	NP_005539.1	Q15046	SYK_HUMAN	lysyl-tRNA synthetase						cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|lysyl-tRNA aminoacylation (GO:0006430)|tRNA aminoacylation for protein translation (GO:0006418)|tRNA processing (GO:0008033)|viral process (GO:0016032)	aminoacyl-tRNA synthetase multienzyme complex (GO:0017101)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|microtubule cytoskeleton (GO:0015630)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	amino acid binding (GO:0016597)|ATP binding (GO:0005524)|lysine-tRNA ligase activity (GO:0004824)|metal ion binding (GO:0046872)|tRNA binding (GO:0000049)			kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	18					L-Lysine(DB00123)	ACCCCCTAACAAGCCTTACAG	0.552																																					p.L9L		.											.	KARS-92	0			c.T27A						.						50.0	47.0	48.0					16																	75678300		1568	3582	5150	SO:0001627	intron_variant	3735	exon2			CCTAACAAGCCTT	AF285758	CCDS10923.1, CCDS45532.1	16q23.1	2014-09-17			ENSG00000065427	ENSG00000065427	6.1.1.6	"""Aminoacyl tRNA synthetases / Class II"""	6215	protein-coding gene	gene with protein product	"""lysine tRNA ligase"""	601421	"""deafness, autosomal recessive 89"""	DFNB89		8812440, 9278442, 23768514	Standard	NM_005548		Approved	KARS2, KARS1	uc002fer.3	Q15046	OTTHUMG00000137609	ENST00000302445.3:c.63-2679T>A	16.37:g.75678300A>T		Somatic	87	0		WXS	Illumina HiSeq	Phase_I	96	54	NM_001130089	0	0	1	1	0	A8MSK1|D3DUK4|O14946|Q96J25|Q9HB23	Silent	SNP	ENST00000302445.3	37	CCDS10923.1																																																																																			.		0.552	KARS-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000269023.1	NM_005548	
ANKRD11	29123	broad.mit.edu	37	16	89345819	89345819	+	Silent	SNP	G	G	A			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr16:89345819G>A	ENST00000301030.4	-	9	7591	c.7131C>T	c.(7129-7131)gaC>gaT	p.D2377D	ANKRD11_ENST00000378330.2_Silent_p.D2377D	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	2377					bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.D2377D(1)		breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		CCTGGGCGTCGTCGTCCTCGG	0.716																																					p.D2377D													.	ANKRD11-139	1	Substitution - coding silent(1)	large_intestine(1)	c.C7131T						.						2.0	2.0	2.0					16																	89345819		1332	2736	4068	SO:0001819	synonymous_variant	29123	exon9			GGCGTCGTCGTCC	AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.7131C>T	16.37:g.89345819G>A		Somatic	23	0		WXS	Illumina HiSeq	Phase_I	31	3	NM_001256183	0	0	6	6	0	Q6NTG1|Q6QMF8	Silent	SNP	ENST00000301030.4	37	CCDS32513.1																																																																																			.		0.716	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430462.3	NM_013275	
TSR1	55720	broad.mit.edu	37	17	2237906	2237906	+	Missense_Mutation	SNP	G	G	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr17:2237906G>T	ENST00000301364.5	-	5	1920	c.841C>A	c.(841-843)Cag>Aag	p.Q281K	TSR1_ENST00000576112.2_Missense_Mutation_p.Q265K|SGSM2_ENST00000426855.2_5'Flank|SGSM2_ENST00000268989.3_5'Flank	NM_018128.4	NP_060598.3	Q2NL82	TSR1_HUMAN	TSR1, 20S rRNA accumulation, homolog (S. cerevisiae)	281					ribosome assembly (GO:0042255)	nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	20						TTCAGAGTCTGCCCTCGAACA	0.458																																					p.Q281K													.	TSR1-91	0			c.C841A						.						126.0	125.0	125.0					17																	2237906		2203	4300	6503	SO:0001583	missense	55720	exon5			GAGTCTGCCCTCG	AK026565	CCDS32525.1	17p13.3	2006-04-20	2006-04-20			ENSG00000167721			25542	protein-coding gene	gene with protein product		611214	"""TSR1, 20S rRNA accumulation, homolog (yeast)"""			10718198	Standard	NM_018128		Approved	FLJ10534	uc002fuj.3	Q2NL82		ENST00000301364.5:c.841C>A	17.37:g.2237906G>T	ENSP00000301364:p.Gln281Lys	Somatic	106	0		WXS	Illumina HiSeq	Phase_I	142	4	NM_018128	0	0	0	0	0	Q8WUY5|Q9NVT0|Q9P2E6	Missense_Mutation	SNP	ENST00000301364.5	37	CCDS32525.1	.	.	.	.	.	.	.	.	.	.	G	12.73	2.026899	0.35797	.	.	ENSG00000167721	ENST00000301364	T	0.40225	1.04	5.4	4.4	0.53042	AARP2CN (2);	0.317953	0.36374	N	0.002639	T	0.27731	0.0682	L	0.27053	0.805	0.38853	D	0.956327	B	0.13594	0.008	B	0.19666	0.026	T	0.11299	-1.0593	10	0.05525	T	0.97	-1.3011	14.1036	0.65072	0.0:0.0:0.8438:0.1562	.	281	Q2NL82	TSR1_HUMAN	K	281	ENSP00000301364:Q281K	ENSP00000301364:Q281K	Q	-	1	0	TSR1	2184656	0.996000	0.38824	0.778000	0.31720	0.919000	0.55068	4.100000	0.57762	1.207000	0.43291	0.655000	0.94253	CAG	.		0.458	TSR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438180.2	NM_018128	
BCL6B	255877	broad.mit.edu	37	17	6927003	6927003	+	Missense_Mutation	SNP	G	G	T	rs578215266		TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr17:6927003G>T	ENST00000293805.5	+	2	105	c.13G>T	c.(13-15)Gcc>Tcc	p.A5S	BCL6B_ENST00000572216.1_3'UTR	NM_181844.3	NP_862827	Q8N143	BCL6B_HUMAN	B-cell CLL/lymphoma 6, member B	5					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			skin(1)	1						GGGTTCCCCCGCCGCCCCGGA	0.647																																					p.A5S													.	BCL6B-227	0			c.G13T						.						17.0	19.0	19.0					17																	6927003		1982	4123	6105	SO:0001583	missense	255877	exon2			TCCCCCGCCGCCC	AI672318	CCDS42248.1	17p13.1	2014-06-10	2010-04-14		ENSG00000161940	ENSG00000161940		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	1002	protein-coding gene	gene with protein product		608992	"""zinc finger protein 62"", ""B-cell CLL/lymphoma 6, member B (zinc finger protein)"""	ZNF62		9632807	Standard	NM_181844		Approved	ZBTB28, BAZF	uc010clt.1	Q8N143	OTTHUMG00000177882	ENST00000293805.5:c.13G>T	17.37:g.6927003G>T	ENSP00000293805:p.Ala5Ser	Somatic	58	0		WXS	Illumina HiSeq	Phase_I	72	3	NM_181844	0	0	0	0	0	Q6PCB4	Missense_Mutation	SNP	ENST00000293805.5	37	CCDS42248.1	.	.	.	.	.	.	.	.	.	.	G	29.6	5.016817	0.93404	.	.	ENSG00000161940	ENST00000293805	T	0.07567	3.18	5.78	3.81	0.43845	.	0.802457	0.11693	N	0.538677	T	0.09862	0.0242	L	0.46157	1.445	0.09310	N	1	B	0.23591	0.088	B	0.25506	0.061	T	0.25745	-1.0123	10	0.87932	D	0	.	8.4482	0.32856	0.1756:0.0:0.8244:0.0	.	5	Q8N143	BCL6B_HUMAN	S	5	ENSP00000293805:A5S	ENSP00000293805:A5S	A	+	1	0	BCL6B	6867727	0.119000	0.22226	0.002000	0.10522	0.548000	0.35241	2.746000	0.47467	0.803000	0.34113	0.655000	0.94253	GCC	.		0.647	BCL6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439455.2	NM_181844	
PHF23	79142	broad.mit.edu	37	17	7139965	7139965	+	Missense_Mutation	SNP	G	G	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr17:7139965G>T	ENST00000320316.3	-	4	507	c.281C>A	c.(280-282)gCa>gAa	p.A94E	DVL2_ENST00000005340.5_5'Flank|PHF23_ENST00000571362.1_Intron|PHF23_ENST00000454255.2_Missense_Mutation_p.A90E|PHF23_ENST00000576955.1_5'UTR|DVL2_ENST00000575458.1_5'Flank|PHF23_ENST00000570753.1_5'UTR	NM_001284518.1|NM_024297.2	NP_001271447.1|NP_077273.2	Q9BUL5	PHF23_HUMAN	PHD finger protein 23	94							zinc ion binding (GO:0008270)			breast(4)|kidney(2)|large_intestine(6)|lung(3)	15						GGATGACTTTGCTTTCTTAAC	0.587																																					p.A94E													.	PHF23-90	0			c.C281A						.						100.0	110.0	106.0					17																	7139965		1945	4139	6084	SO:0001583	missense	79142	exon4			GACTTTGCTTTCT	AK122791	CCDS42250.1, CCDS67143.1, CCDS67144.1	17p13.1	2014-08-13			ENSG00000040633	ENSG00000040633		"""Zinc fingers, PHD-type"""	28428	protein-coding gene	gene with protein product		612910					Standard	NM_024297		Approved	MGC2941, FLJ16355	uc002gfa.3	Q9BUL5	OTTHUMG00000177972	ENST00000320316.3:c.281C>A	17.37:g.7139965G>T	ENSP00000322579:p.Ala94Glu	Somatic	51	0		WXS	Illumina HiSeq	Phase_I	66	3	NM_024297	0	0	6	6	0	A1DZ74|B3KVH8|B4DLK6|D3DTN4|Q8IZK0|Q96HG7|Q9H5X0	Missense_Mutation	SNP	ENST00000320316.3	37	CCDS42250.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.225605	0.79576	.	.	ENSG00000040633	ENST00000320316;ENST00000454255;ENST00000043410	T;T	0.35789	1.29;1.34	4.8	4.8	0.61643	.	0.000000	0.85682	D	0.000000	T	0.51041	0.1651	L	0.39898	1.24	0.58432	D	0.999998	D	0.89917	1.0	D	0.80764	0.994	T	0.52170	-0.8611	10	0.66056	D	0.02	-11.0369	15.399	0.74823	0.0:0.0:1.0:0.0	.	94	Q9BUL5	PHF23_HUMAN	E	94;90;94	ENSP00000322579:A94E;ENSP00000414607:A90E	ENSP00000043410:A94E	A	-	2	0	PHF23	7080689	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.954000	0.87848	2.488000	0.83962	0.557000	0.71058	GCA	.		0.587	PHF23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440047.1	NM_024297	
MYH4	4622	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	10358389	10358389	+	Missense_Mutation	SNP	G	G	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr17:10358389G>T	ENST00000255381.2	-	21	2414	c.2304C>A	c.(2302-2304)ttC>ttA	p.F768L	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	768	Actin-binding. {ECO:0000250}.|Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						CAGCTTTGAAGAAAACCTTAT	0.403																																					p.F768L		.											.	MYH4-102	0			c.C2304A						.						169.0	108.0	129.0					17																	10358389		2203	4300	6503	SO:0001583	missense	4622	exon21			TTTGAAGAAAACC		CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.2304C>A	17.37:g.10358389G>T	ENSP00000255381:p.Phe768Leu	Somatic	104	0		WXS	Illumina HiSeq	Phase_I	115	31	NM_017533	0	0	0	0	0		Missense_Mutation	SNP	ENST00000255381.2	37	CCDS11154.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.962237	0.74016	.	.	ENSG00000141048	ENST00000255381	D	0.94280	-3.39	5.04	5.04	0.67666	Myosin head, motor domain (2);	0.000000	0.39475	U	0.001344	D	0.97340	0.9130	H	0.96691	3.865	0.58432	D	0.999998	P	0.40794	0.729	P	0.51229	0.663	D	0.98383	1.0559	10	0.62326	D	0.03	.	18.7298	0.91731	0.0:0.0:1.0:0.0	.	768	Q9Y623	MYH4_HUMAN	L	768	ENSP00000255381:F768L	ENSP00000255381:F768L	F	-	3	2	MYH4	10299114	1.000000	0.71417	1.000000	0.80357	0.820000	0.46376	3.989000	0.56958	2.497000	0.84241	0.313000	0.20887	TTC	.		0.403	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252731.1	NM_017533	
ADPRM	56985	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	10608594	10608594	+	Missense_Mutation	SNP	T	T	G			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr17:10608594T>G	ENST00000379774.4	+	2	442	c.351T>G	c.(349-351)agT>agG	p.S117R	ADPRM_ENST00000609540.1_Missense_Mutation_p.S117R	NM_020233.4	NP_064618.3	Q3LIE5	ADPRM_HUMAN	ADP-ribose/CDP-alcohol diphosphatase, manganese-dependent	117							ADP-ribose diphosphatase activity (GO:0047631)|CDP-glycerol diphosphatase activity (GO:0047734)|metal ion binding (GO:0046872)										ATAACTTCAGTAGAGAGTATT	0.358																																					p.S117R		.											.	.	0			c.T351G						.						83.0	78.0	80.0					17																	10608594		2203	4300	6503	SO:0001583	missense	56985	exon2			CTTCAGTAGAGAG	BC070155	CCDS11159.2	17p13.1	2012-07-20	2012-07-20	2012-07-20	ENSG00000170222	ENSG00000170222	3.6.1.13, 3.6.1.16, 3.6.1.53		30925	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 48"""	C17orf48		18352857	Standard	XM_005256738		Approved	MDS006	uc002gmt.3	Q3LIE5	OTTHUMG00000130366	ENST00000379774.4:c.351T>G	17.37:g.10608594T>G	ENSP00000369099:p.Ser117Arg	Somatic	113	0		WXS	Illumina HiSeq	Phase_I	149	81	NM_020233	0	0	2	6	4	A8K9B4|D3DTS4|Q9BVD4|Q9NRU8	Missense_Mutation	SNP	ENST00000379774.4	37	CCDS11159.2	.	.	.	.	.	.	.	.	.	.	T	13.35	2.211314	0.39102	.	.	ENSG00000170222	ENST00000379774	D	0.84800	-1.9	5.64	-3.05	0.05396	Metallophosphoesterase domain (1);	0.000000	0.85682	D	0.000000	T	0.80919	0.4716	M	0.65498	2.005	0.80722	D	1	B	0.22080	0.064	B	0.27380	0.079	T	0.67264	-0.5714	10	0.21014	T	0.42	-25.0558	14.2725	0.66159	0.0:0.7691:0.1179:0.113	.	117	Q3LIE5	ADPRM_HUMAN	R	117	ENSP00000369099:S117R	ENSP00000369099:S117R	S	+	3	2	C17orf48	10549319	0.999000	0.42202	0.983000	0.44433	0.902000	0.53008	0.629000	0.24538	-0.424000	0.07382	-0.299000	0.09455	AGT	.		0.358	ADPRM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252732.2	NM_020233	
CCDC144A	9720	ucsc.edu;bcgsc.ca	37	17	16612498	16612498	+	Missense_Mutation	SNP	A	A	G			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr17:16612498A>G	ENST00000360524.8	+	5	1203	c.1127A>G	c.(1126-1128)tAc>tGc	p.Y376C	CCDC144A_ENST00000340621.5_Missense_Mutation_p.Y375C|CCDC144A_ENST00000399273.1_Missense_Mutation_p.Y376C|CCDC144A_ENST00000456009.1_Intron|RP11-219A15.1_ENST00000448331.3_Missense_Mutation_p.Y376C|CCDC144A_ENST00000443444.2_Missense_Mutation_p.Y376C|RN7SL620P_ENST00000580704.1_RNA	NM_014695.1	NP_055510.1	A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A	376																	ATCCATCCATACTATCATCCA	0.378																																					p.Y376C													.	.	0			c.A1127G						.						107.0	100.0	102.0					17																	16612498		1830	4077	5907	SO:0001583	missense	9720	exon5			ATCCATACTATCA	BC133019	CCDS45621.1	17p11.2	2008-10-23			ENSG00000170160	ENSG00000170160			29072	protein-coding gene	gene with protein product						9628581, 11997339	Standard	NM_014695		Approved	KIAA0565, FLJ43983	uc002gqk.1	A2RUR9	OTTHUMG00000059178	ENST00000360524.8:c.1127A>G	17.37:g.16612498A>G	ENSP00000353717:p.Tyr376Cys	Somatic	783	4		WXS	Illumina HiSeq		869	213	NM_014695	0	0	0	0	0	O60311|Q6ZU57	Missense_Mutation	SNP	ENST00000360524.8	37	CCDS45621.1	.	.	.	.	.	.	.	.	.	.	.	9.422	1.083342	0.20309	.	.	ENSG00000170160	ENST00000340621;ENST00000399273;ENST00000443444;ENST00000448331;ENST00000360524;ENST00000360495	T;T;T;T;T;T	0.20463	2.07;2.07;2.07;2.07;2.07;2.07	1.26	-2.52	0.06346	.	.	.	.	.	T	0.12390	0.0301	N	0.14661	0.345	0.09310	N	1	D	0.62365	0.991	P	0.49477	0.612	T	0.08534	-1.0717	8	.	.	.	.	2.6285	0.04937	0.4796:0.3278:0.0:0.1927	.	376	A2RUR9	C144A_HUMAN	C	375;376;376;376;376;376	ENSP00000344740:Y375C;ENSP00000382215:Y376C;ENSP00000439262:Y376C;ENSP00000440655:Y376C;ENSP00000353717:Y376C;ENSP00000353685:Y376C	.	Y	+	2	0	CCDC144A	16553223	0.024000	0.19004	0.000000	0.03702	0.076000	0.17211	0.184000	0.16939	-1.073000	0.03137	0.147000	0.16070	TAC	.		0.378	CCDC144A-013	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000444093.1		
SUPT6H	6830	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	27014486	27014486	+	Silent	SNP	G	G	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr17:27014486G>T	ENST00000314616.6	+	23	3286	c.3003G>T	c.(3001-3003)ctG>ctT	p.L1001L	SUPT6H_ENST00000347486.4_Silent_p.L1001L	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	1001	Interaction with KDM6A. {ECO:0000250}.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					CCCACCTCCTGAAGGTAGGAT	0.458																																					p.L1001L		.											.	SUPT6H-93	0			c.G3003T						.						46.0	41.0	43.0					17																	27014486		2203	4300	6503	SO:0001819	synonymous_variant	6830	exon23			CCTCCTGAAGGTA	U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.3003G>T	17.37:g.27014486G>T		Somatic	45	0		WXS	Illumina HiSeq	Phase_I	44	10	NM_003170	0	0	0	0	0	A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Silent	SNP	ENST00000314616.6	37	CCDS32596.1																																																																																			.		0.458	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446422.2	NM_003170	
CACNB1	782	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	37341119	37341119	+	Splice_Site	SNP	T	T	A			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr17:37341119T>A	ENST00000394303.3	-	8	856		c.e8-2		CACNB1_ENST00000344140.5_Splice_Site|CACNB1_ENST00000394310.3_Splice_Site|CACNB1_ENST00000582877.1_5'Flank	NM_000723.4	NP_000714.3	Q02641	CACB1_HUMAN	calcium channel, voltage-dependent, beta 1 subunit						axon guidance (GO:0007411)|protein targeting to membrane (GO:0006612)|transport (GO:0006810)	sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	16					Dronedarone(DB04855)|Ibutilide(DB00308)|Magnesium Sulfate(DB00653)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	ATGCTCTGTCTGGGGGGGGAA	0.627																																					.	Esophageal Squamous(5;100 366 38393 41452 45827)	.											.	CACNB1-154	0			c.649-2A>T						.						33.0	30.0	31.0					17																	37341119		2203	4300	6503	SO:0001630	splice_region_variant	782	exon9			TCTGTCTGGGGGG		CCDS11334.1, CCDS42311.1, CCDS45665.1	17q21-q22	2013-03-20			ENSG00000067191	ENSG00000067191		"""Calcium channel subunits"""	1401	protein-coding gene	gene with protein product		114207		CACNLB1		8381767, 8395940	Standard	NM_000723		Approved		uc002hrm.2	Q02641	OTTHUMG00000133217	ENST00000394303.3:c.649-2A>T	17.37:g.37341119T>A		Somatic	102	0		WXS	Illumina HiSeq	Phase_I	83	50	NM_000723	0	0	0	0	0	A8K114|O15331|Q02639|Q02640|Q8N3X9|Q9C085|Q9UD79	Splice_Site	SNP	ENST00000394303.3	37	CCDS42311.1	.	.	.	.	.	.	.	.	.	.	T	18.41	3.618558	0.66787	.	.	ENSG00000067191	ENST00000539338;ENST00000394303;ENST00000344140;ENST00000394310;ENST00000536613	.	.	.	5.28	5.28	0.74379	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.1992	0.65690	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	CACNB1	34594645	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	7.867000	0.87062	1.992000	0.58205	0.454000	0.30748	.	.		0.627	CACNB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256945.3		Intron
ERBB2	2064	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	37883597	37883597	+	Missense_Mutation	SNP	C	C	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr17:37883597C>T	ENST00000269571.5	+	26	3368	c.3209C>T	c.(3208-3210)gCc>gTc	p.A1070V	MIEN1_ENST00000474210.1_5'Flank|ERBB2_ENST00000584450.1_Intron|ERBB2_ENST00000541774.1_Missense_Mutation_p.A1055V|ERBB2_ENST00000445658.2_Missense_Mutation_p.A794V|MIR4728_ENST00000580969.1_RNA|ERBB2_ENST00000406381.2_Missense_Mutation_p.A1040V|ERBB2_ENST00000540147.1_Missense_Mutation_p.A1040V|ERBB2_ENST00000584601.1_Missense_Mutation_p.A1040V			P04626	ERBB2_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2	1070					axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|enzyme linked receptor protein signaling pathway (GO:0007167)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of angiogenesis (GO:0045765)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of microtubule-based process (GO:0032886)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|ErbB-3 class receptor binding (GO:0043125)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|RNA polymerase I core binding (GO:0001042)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(16)|central_nervous_system(17)|endometrium(6)|haematopoietic_and_lymphoid_tissue(8)|kidney(4)|large_intestine(16)|liver(3)|lung(125)|ovary(18)|pancreas(1)|prostate(4)|skin(1)|stomach(14)|upper_aerodigestive_tract(9)|urinary_tract(4)	247	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Lapatinib(DB01259)|Pertuzumab(DB06366)|Trastuzumab(DB00072)	GAAGAGGAGGCCCCCAGGTCT	0.617		1	"""A, Mis, O"""		"""breast, ovarian, other tumour types, NSCLC, gastric"""					TCGA GBM(5;<1E-08)																											p.A1070V		.		Dom	yes		17	17q21.1	2064	"""v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)"""		E	.	ERBB2-9959	0			c.C3209T						.						35.0	39.0	38.0					17																	37883597		2203	4300	6503	SO:0001583	missense	2064	exon26			AGGAGGCCCCCAG	X03363	CCDS32642.1, CCDS45667.1, CCDS74052.1	17q11.2-q12	2014-09-17	2013-07-09			ENSG00000141736		"""CD molecules"""	3430	protein-coding gene	gene with protein product	"""neuro/glioblastoma derived oncogene homolog"""	164870	"""v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2 (neuro/glioblastoma derived oncogene homolog)"""	NGL			Standard	XM_005257140		Approved	NEU, HER-2, CD340, HER2	uc002hso.3	P04626		ENST00000269571.5:c.3209C>T	17.37:g.37883597C>T	ENSP00000269571:p.Ala1070Val	Somatic	73	0		WXS	Illumina HiSeq	Phase_I	74	21	NM_004448	0	0	99	134	35	B2RZG3|B4DHN3|Q14256|Q6LDV1|Q9UMK4|X5D2V5	Missense_Mutation	SNP	ENST00000269571.5	37	CCDS32642.1	.	.	.	.	.	.	.	.	.	.	C	12.57	1.978099	0.34942	.	.	ENSG00000141736	ENST00000406381;ENST00000541774;ENST00000445658;ENST00000269571;ENST00000540147	T;T;T;T;T	0.75704	-0.95;-0.95;-0.93;-0.96;-0.95	5.41	5.41	0.78517	.	.	.	.	.	T	0.63260	0.2496	L	0.29908	0.895	0.58432	D	0.99999	B;B;B	0.19817	0.017;0.019;0.039	B;B;B	0.18561	0.01;0.022;0.01	T	0.57854	-0.7739	9	0.17369	T	0.5	.	15.9084	0.79447	0.0:1.0:0.0:0.0	.	794;1055;1070	B4DTR1;P04626-4;P04626	.;.;ERBB2_HUMAN	V	1040;1055;794;1070;1040	ENSP00000385185:A1040V;ENSP00000446466:A1055V;ENSP00000404047:A794V;ENSP00000269571:A1070V;ENSP00000443562:A1040V	ENSP00000269571:A1070V	A	+	2	0	ERBB2	35137123	0.667000	0.27484	0.997000	0.53966	0.976000	0.68499	2.804000	0.47931	2.515000	0.84797	0.561000	0.74099	GCC	.		0.617	ERBB2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445621.2		
C17orf77	146723	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	72588562	72588562	+	Missense_Mutation	SNP	G	G	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr17:72588562G>T	ENST00000392620.1	+	3	739	c.377G>T	c.(376-378)tGc>tTc	p.C126F	CD300LD_ENST00000375352.1_5'Flank|C17orf77_ENST00000328023.2_Missense_Mutation_p.C126F	NM_152460.2	NP_689673.2	Q96MU5	CQ077_HUMAN	chromosome 17 open reading frame 77	126	Cys-rich.					extracellular region (GO:0005576)				breast(2)|large_intestine(2)|lung(5)|prostate(1)|stomach(1)	11						TGCAAGGTGTGCCCAAACTTT	0.458																																					p.C126F		.											.	C17orf77-90	0			c.G377T						.						151.0	143.0	145.0					17																	72588562		2203	4300	6503	SO:0001583	missense	146723	exon3			AGGTGTGCCCAAA		CCDS32721.1	17q25.1	2006-01-16			ENSG00000182352	ENSG00000182352			26480	protein-coding gene	gene with protein product							Standard	NM_152460		Approved	FLJ31882	uc002jla.1	Q96MU5	OTTHUMG00000067611	ENST00000392620.1:c.377G>T	17.37:g.72588562G>T	ENSP00000376396:p.Cys126Phe	Somatic	70	0		WXS	Illumina HiSeq	Phase_I	65	18	NM_152460	0	0	0	0	0		Missense_Mutation	SNP	ENST00000392620.1	37	CCDS32721.1	.	.	.	.	.	.	.	.	.	.	G	2.196	-0.384056	0.04966	.	.	ENSG00000182352	ENST00000392620;ENST00000328023	T;T	0.55760	0.5;0.5	2.64	1.62	0.23740	.	.	.	.	.	T	0.39436	0.1078	N	0.08118	0	0.09310	N	1	D	0.59767	0.986	P	0.53861	0.736	T	0.18650	-1.0330	8	.	.	.	.	7.2654	0.26227	0.0:0.2771:0.7229:0.0	.	126	Q96MU5	CQ077_HUMAN	F	126	ENSP00000376396:C126F;ENSP00000329353:C126F	.	C	+	2	0	C17orf77	70100157	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.150000	0.16263	0.651000	0.30788	0.609000	0.83330	TGC	.		0.458	C17orf77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000145090.2	NM_152460	
ZNF407	55628	broad.mit.edu	37	18	72775888	72775888	+	Missense_Mutation	SNP	C	C	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr18:72775888C>T	ENST00000299687.5	+	8	6211	c.6211C>T	c.(6211-6213)Cgg>Tgg	p.R2071W		NM_017757.2	NP_060227.2	Q9C0G0	ZN407_HUMAN	zinc finger protein 407	2071					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(21)|lung(23)|ovary(4)|prostate(3)|upper_aerodigestive_tract(2)	67		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		CTCTCAGGAGCGGGCACAGGT	0.662																																					p.R2071W													.	ZNF407-92	0			c.C6211T						.						38.0	46.0	43.0					18																	72775888		2106	4222	6328	SO:0001583	missense	55628	exon8			CAGGAGCGGGCAC	AB051490	CCDS45885.1, CCDS54191.1, CCDS58634.1	18q23	2013-01-08			ENSG00000215421	ENSG00000215421		"""Zinc fingers, C2H2-type"""	19904	protein-coding gene	gene with protein product		615894				11214970	Standard	NM_017757		Approved	FLJ20307, FLJ13839, KIAA1703	uc002llw.2	Q9C0G0		ENST00000299687.5:c.6211C>T	18.37:g.72775888C>T	ENSP00000299687:p.Arg2071Trp	Somatic	93	0		WXS	Illumina HiSeq	Phase_I	42	3	NM_017757	0	0	0	0	0	B5MD54|Q96MY0|Q9H8A1|Q9NXD4|Q9NXD7	Missense_Mutation	SNP	ENST00000299687.5	37	CCDS45885.1	.	.	.	.	.	.	.	.	.	.	C	13.05	2.122778	0.37436	.	.	ENSG00000215421	ENST00000299687	T	0.15372	2.43	4.42	2.43	0.29744	.	.	.	.	.	T	0.34019	0.0883	M	0.67953	2.075	0.80722	D	1	D	0.71674	0.998	P	0.61592	0.891	T	0.16600	-1.0397	9	0.87932	D	0	.	11.8945	0.52650	0.4417:0.5583:0.0:0.0	.	2071	Q9C0G0	ZN407_HUMAN	W	2071	ENSP00000299687:R2071W	ENSP00000299687:R2071W	R	+	1	2	ZNF407	70904876	0.715000	0.27946	0.648000	0.29521	0.838000	0.47535	1.314000	0.33597	0.866000	0.35629	-0.448000	0.05591	CGG	.		0.662	ZNF407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444903.1	NM_017757	
TMPRSS9	360200	broad.mit.edu	37	19	2410353	2410353	+	Silent	SNP	G	G	A			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr19:2410353G>A	ENST00000332578.3	+	8	1113	c.1113G>A	c.(1111-1113)gtG>gtA	p.V371V		NM_182973.1	NP_892018.1	Q7Z410	TMPS9_HUMAN	transmembrane protease, serine 9	371	Peptidase S1 1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				plasminogen activation (GO:0031639)	integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACAGGATGGTGTGCGCTGGCT	0.577																																					p.V371V													.	TMPRSS9-91	0			c.G1113A						.						90.0	76.0	81.0					19																	2410353		2203	4300	6503	SO:0001819	synonymous_variant	360200	exon8			GATGGTGTGCGCT	AJ488946	CCDS12088.1	19p13.3	2010-04-13						"""Serine peptidases / Transmembrane"""	30079	protein-coding gene	gene with protein product	"""polyserase 1"""	610477				12886014	Standard	NM_182973		Approved		uc010xgx.2	Q7Z410		ENST00000332578.3:c.1113G>A	19.37:g.2410353G>A		Somatic	70	0		WXS	Illumina HiSeq	Phase_I	72	3	NM_182973	0	0	0	0	0	Q6ZND6|Q7Z411	Silent	SNP	ENST00000332578.3	37	CCDS12088.1																																																																																			.		0.577	TMPRSS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451330.3	NM_182973	
XAB2	56949	broad.mit.edu	37	19	7684501	7684501	+	Missense_Mutation	SNP	C	C	T	rs538580383		TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr19:7684501C>T	ENST00000358368.4	-	19	2576	c.2539G>A	c.(2539-2541)Gca>Aca	p.A847T	XAB2_ENST00000534844.1_Missense_Mutation_p.A844T	NM_020196.2	NP_064581.2	Q9HCS7	SYF1_HUMAN	XPA binding protein 2	847					blastocyst development (GO:0001824)|DNA repair (GO:0006281)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|transcription, DNA-templated (GO:0006351)|transcription-coupled nucleotide-excision repair (GO:0006283)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	26						CCAAACACTGCGGCTGGCACG	0.647								Direct reversal of damage;Nucleotide excision repair (NER)					c|||	1	0.000199681	0.0	0.0014	5008	,	,		8461	0.0		0.0	False		,,,				2504	0.0				p.A847T													.	XAB2-272	0			c.G2539A						.						25.0	24.0	24.0					19																	7684501		2201	4297	6498	SO:0001583	missense	56949	exon19			ACACTGCGGCTGG	AB026111	CCDS32892.1	19p13.3	2013-08-21				ENSG00000076924			14089	protein-coding gene	gene with protein product	"""SYF1 homolog, RNA splicing factor (S. cerevisiae)"", ""SYF1 pre-mRNA-splicing factor"""	610850				10944529	Standard	NM_020196		Approved	HCNP, HCRN, SYF1, NTC90	uc002mgx.3	Q9HCS7		ENST00000358368.4:c.2539G>A	19.37:g.7684501C>T	ENSP00000351137:p.Ala847Thr	Somatic	104	0		WXS	Illumina HiSeq	Phase_I	61	3	NM_020196	0	1	173	174	0	Q8TET6|Q96HB0|Q96IW0|Q9NRG6|Q9ULP3	Missense_Mutation	SNP	ENST00000358368.4	37	CCDS32892.1	.	.	.	.	.	.	.	.	.	.	c	12.83	2.055385	0.36277	.	.	ENSG00000076924	ENST00000358368;ENST00000534844	T;T	0.23552	1.9;1.9	4.94	3.67	0.42095	.	0.076238	0.50627	U	0.000101	T	0.14056	0.0340	L	0.41415	1.275	0.24814	N	0.992626	P	0.45827	0.867	B	0.27796	0.083	T	0.29701	-1.0003	10	0.48119	T	0.1	-17.4672	8.1134	0.30928	0.1619:0.7401:0.0:0.098	.	847	Q9HCS7	SYF1_HUMAN	T	847;844	ENSP00000351137:A847T;ENSP00000438225:A844T	ENSP00000351137:A847T	A	-	1	0	XAB2	7590501	0.953000	0.32496	0.089000	0.20774	0.506000	0.33950	2.124000	0.42006	2.315000	0.78130	0.479000	0.44913	GCA	.		0.647	XAB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000461021.1	NM_020196	
MARCH2	51257	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	8503277	8503277	+	Silent	SNP	C	C	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr19:8503277C>T	ENST00000602117.1	+	5	1043	c.588C>T	c.(586-588)tcC>tcT	p.S196S	MARCH2_ENST00000601283.1_Intron|MARCH2_ENST00000215555.2_Silent_p.S196S|MARCH2_ENST00000381035.4_Silent_p.S126S|MARCH2_ENST00000393944.1_Silent_p.S196S			Q9P0N8	MARH2_HUMAN	membrane-associated ring finger (C3HC4) 2, E3 ubiquitin protein ligase	196					endocytosis (GO:0006897)|protein ubiquitination (GO:0016567)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(1)|lung(3)|ovary(3)|skin(1)|urinary_tract(1)	10						CACAGGTCTCCTTCCGCTACC	0.637																																					p.S196S		.											.	MARCH2-70	0			c.C588T						.						54.0	54.0	54.0					19																	8503277		2203	4300	6503	SO:0001819	synonymous_variant	51257	exon5			GGTCTCCTTCCGC	AF151074	CCDS12202.1, CCDS32894.1	19p13.2	2013-01-09	2012-02-23			ENSG00000099785		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	28038	protein-coding gene	gene with protein product		613332	"""membrane-associated ring finger (C3HC4) 2"""			11042152, 14722266	Standard	NM_016496		Approved	HSPC240, MARCH-II, RNF172	uc002mjw.3	Q9P0N8		ENST00000602117.1:c.588C>T	19.37:g.8503277C>T		Somatic	87	0		WXS	Illumina HiSeq	Phase_I	62	22	NM_001005415	0	0	1	5	4	A6NP10|Q5H785|Q8N5A3|Q96B78	Silent	SNP	ENST00000602117.1	37	CCDS12202.1																																																																																			.		0.637	MARCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460361.2	NM_016496	
FBL	2091	broad.mit.edu	37	19	40331279	40331279	+	Silent	SNP	G	G	A			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr19:40331279G>A	ENST00000221801.3	-	2	272	c.159C>T	c.(157-159)ggC>ggT	p.G53G	FBL_ENST00000593503.1_5'Flank	NM_001436.3	NP_001427.2	P22087	FBRL_HUMAN	fibrillarin	53	DMA/Gly-rich.				histone glutamine methylation (GO:1990258)|osteoblast differentiation (GO:0001649)|rRNA processing (GO:0006364)|snoRNA metabolic process (GO:0016074)|tRNA processing (GO:0008033)	box C/D snoRNP complex (GO:0031428)|Cajal body (GO:0015030)|extracellular vesicular exosome (GO:0070062)|granular component (GO:0001652)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone-glutamine methyltransferase activity (GO:1990259)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(1)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)	9	all_cancers(60;5.79e-06)|all_lung(34;5.2e-08)|Lung NSC(34;6.14e-08)|Ovarian(47;0.06)	Renal(1328;0.000518)|Hepatocellular(1079;0.0893)	Epithelial(26;5.74e-25)|OV - Ovarian serous cystadenocarcinoma(5;3.13e-24)|all cancers(26;8.59e-23)	GBM - Glioblastoma multiforme(1328;0.000826)|STAD - Stomach adenocarcinoma(1328;0.138)		ctcctccaccgccgccgccgc	0.657																																					p.G53G													.	FBL-91	0			c.C159T						.						18.0	21.0	20.0					19																	40331279		2201	4299	6500	SO:0001819	synonymous_variant	2091	exon2			TCCACCGCCGCCG	AC005393	CCDS12545.1	19q13.1	2010-02-17			ENSG00000105202	ENSG00000105202			3599	protein-coding gene	gene with protein product		134795				1846968, 2026646	Standard	NM_001436		Approved	RNU3IP1, FLRN, FIB	uc002omn.3	P22087		ENST00000221801.3:c.159C>T	19.37:g.40331279G>A		Somatic	107	1		WXS	Illumina HiSeq	Phase_I	80	3	NM_001436	0	0	0	0	0	B5BUE8|O75259|Q6IAT5|Q9UPI6	Silent	SNP	ENST00000221801.3	37	CCDS12545.1																																																																																			.		0.657	FBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462509.4	NM_001436	
DNAJC5G	285126	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	27500675	27500675	+	Missense_Mutation	SNP	T	T	A			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr2:27500675T>A	ENST00000296097.3	+	4	585	c.167T>A	c.(166-168)cTg>cAg	p.L56Q	DNAJC5G_ENST00000404433.1_Missense_Mutation_p.L40Q|DNAJC5G_ENST00000402462.1_Missense_Mutation_p.L56Q|SLC30A3_ENST00000447008.2_5'Flank|DNAJC5G_ENST00000406962.1_Intron	NM_173650.1	NP_775921.1	Q8N7S2	DNJ5G_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 5 gamma	56	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.					membrane (GO:0016020)				cervix(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGTAGGAAACTGGCCTTGCGG	0.488																																					p.L56Q		.											.	DNAJC5G-226	0			c.T167A						.						107.0	102.0	104.0					2																	27500675		2203	4300	6503	SO:0001583	missense	285126	exon4			GGAAACTGGCCTT	AF368277	CCDS1744.1	2p23	2011-09-02			ENSG00000163793	ENSG00000163793		"""Heat shock proteins / DNAJ (HSP40)"""	24844	protein-coding gene	gene with protein product		613946					Standard	NM_173650		Approved	FLJ40417, CSP-gamma	uc002rjl.1	Q8N7S2	OTTHUMG00000097079	ENST00000296097.3:c.167T>A	2.37:g.27500675T>A	ENSP00000296097:p.Leu56Gln	Somatic	108	0		WXS	Illumina HiSeq	Phase_I	79	21	NM_173650	0	0	0	0	0	B4DY29|Q53SY5|Q8IYQ4|Q96RJ8	Missense_Mutation	SNP	ENST00000296097.3	37	CCDS1744.1	.	.	.	.	.	.	.	.	.	.	T	17.86	3.492169	0.64074	.	.	ENSG00000163793	ENST00000296097;ENST00000402462;ENST00000404433	T;T;T	0.46819	0.86;0.86;0.86	5.09	5.09	0.68999	Heat shock protein DnaJ, N-terminal (5);	0.000000	0.40554	N	0.001066	T	0.65780	0.2724	M	0.69248	2.105	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.69247	-0.5195	10	0.72032	D	0.01	.	12.8356	0.57771	0.0:0.0:0.0:1.0	.	56	Q8N7S2	DNJ5G_HUMAN	Q	56;56;40	ENSP00000296097:L56Q;ENSP00000384305:L56Q;ENSP00000385829:L40Q	ENSP00000296097:L56Q	L	+	2	0	DNAJC5G	27354179	1.000000	0.71417	1.000000	0.80357	0.243000	0.25628	7.834000	0.86773	1.926000	0.55796	0.455000	0.32223	CTG	.		0.488	DNAJC5G-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000214200.1	NM_173650	
RFX8	731220	bcgsc.ca	37	2	102018937	102018937	+	Missense_Mutation	SNP	C	C	A			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr2:102018937C>A	ENST00000376826.2	-	14	1544	c.1545G>T	c.(1543-1545)agG>agT	p.R515S	RFX8_ENST00000428343.1_Missense_Mutation_p.R402S			Q6ZV50	RFX8_HUMAN	RFX family member 8, lacking RFX DNA binding domain	515					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|kidney(1)|stomach(1)	3						AGCCCAGGATCCTGAGGACCA	0.612																																					p.R402S													.	.	0			c.G1206T						.						43.0	42.0	43.0					2																	102018937		692	1591	2283	SO:0001583	missense	731220	exon11			CAGGATCCTGAGG	AK124976	CCDS46376.1	2q11.2	2012-11-15	2012-11-15		ENSG00000196460	ENSG00000196460			37253	protein-coding gene	gene with protein product			"""regulatory factor X, 8"", ""RFX gene family member 8, lacking RFX DNA binding domain"""				Standard	NM_001145664		Approved	FLJ42986	uc010yvx.1	Q6ZV50	OTTHUMG00000130693	ENST00000376826.2:c.1545G>T	2.37:g.102018937C>A	ENSP00000366022:p.Arg515Ser	Somatic	110	0		WXS	Illumina HiSeq	Phase_1	91	39	NM_001145664	0	0	0	0	0	B4DQ32	Missense_Mutation	SNP	ENST00000376826.2	37		.	.	.	.	.	.	.	.	.	.	C	13.04	2.117635	0.37339	.	.	ENSG00000196460	ENST00000376826;ENST00000428343	T;T	0.77358	-1.09;0.9	5.23	-0.241	0.13043	.	0.429341	0.22488	N	0.059414	T	0.58380	0.2118	L	0.27053	0.805	0.22571	N	0.998976	B;B	0.13145	0.007;0.004	B;B	0.12156	0.007;0.006	T	0.43261	-0.9402	10	0.39692	T	0.17	-3.4896	4.3392	0.11101	0.4543:0.3723:0.0:0.1734	.	402;515	Q6ZV50-3;Q6ZV50	.;RFX8_HUMAN	S	515;402	ENSP00000366022:R515S;ENSP00000401536:R402S	ENSP00000366022:R515S	R	-	3	2	RFX8	101385369	0.905000	0.30787	0.987000	0.45799	0.700000	0.40528	0.026000	0.13599	0.020000	0.15106	0.407000	0.27541	AGG	.		0.612	RFX8-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001145664	
GPR39	2863	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	133403162	133403162	+	Missense_Mutation	SNP	C	C	A			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr2:133403162C>A	ENST00000329321.3	+	2	1814	c.1345C>A	c.(1345-1347)Cag>Aag	p.Q449K	LYPD1_ENST00000397463.2_3'UTR|GPR39_ENST00000470071.1_3'UTR	NM_001508.2	NP_001499.1	O43194	GPR39_HUMAN	G protein-coupled receptor 39	449					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						GAATGGTTTTCAGGAGCATGA	0.532																																					p.Q449K		.											.	GPR39-226	0			c.C1345A						.						54.0	58.0	57.0					2																	133403162		2203	4300	6503	SO:0001583	missense	2863	exon2			GGTTTTCAGGAGC	AF034633	CCDS2170.1	2q21-q22	2012-08-21			ENSG00000183840	ENSG00000183840		"""GPCR / Class A : Orphans"""	4496	protein-coding gene	gene with protein product		602886				9441746	Standard	NM_001508		Approved		uc002ttl.3	O43194	OTTHUMG00000131679	ENST00000329321.3:c.1345C>A	2.37:g.133403162C>A	ENSP00000327417:p.Gln449Lys	Somatic	58	0		WXS	Illumina HiSeq	Phase_I	64	30	NM_001508	0	0	0	1	1	B2RC12|B6V9G4|Q08AS2|Q53R01	Missense_Mutation	SNP	ENST00000329321.3	37	CCDS2170.1	.	.	.	.	.	.	.	.	.	.	C	0.009	-1.834578	0.00579	.	.	ENSG00000183840	ENST00000329321	T	0.65178	-0.14	5.15	3.18	0.36537	.	3.248910	0.01165	N	0.006739	T	0.56992	0.2023	L	0.57536	1.79	0.37755	D	0.926099	B	0.02656	0.0	B	0.01281	0.0	T	0.51741	-0.8667	10	0.16896	T	0.51	.	4.3592	0.11194	0.4322:0.446:0.0:0.1219	.	449	O43194	GPR39_HUMAN	K	449	ENSP00000327417:Q449K	ENSP00000327417:Q449K	Q	+	1	0	GPR39	133119632	0.326000	0.24669	0.628000	0.29241	0.050000	0.14768	0.714000	0.25808	1.393000	0.46605	-0.188000	0.12872	CAG	.		0.532	GPR39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254582.1		
NEB	4703	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	152382499	152382499	+	Silent	SNP	G	G	A			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr2:152382499G>A	ENST00000172853.10	-	122	17178	c.17031C>T	c.(17029-17031)gtC>gtT	p.V5677V	NEB_ENST00000397345.3_Silent_p.V7378V|NEB_ENST00000409198.1_Silent_p.V5677V|NEB_ENST00000604864.1_Silent_p.V7378V|NEB_ENST00000603639.1_Silent_p.V7378V|NEB_ENST00000427231.2_Silent_p.V7378V			P20929	NEBU_HUMAN	nebulin	5677					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)	p.V5677V(1)|p.V7378V(1)		NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TCACTTCCTTGACGTGAACAG	0.483																																					p.V7413V		.											.	NEB-145	2	Substitution - coding silent(2)	lung(2)	c.C22239T						.						300.0	294.0	296.0					2																	152382499		2038	4201	6239	SO:0001819	synonymous_variant	4703	exon151			TTCCTTGACGTGA	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.17031C>T	2.37:g.152382499G>A		Somatic	126	0		WXS	Illumina HiSeq	Phase_I	102	25	NM_001271208	0	0	0	0	0	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Silent	SNP	ENST00000172853.10	37		.	.	.	.	.	.	.	.	.	.	G	10.46	1.355381	0.24512	.	.	ENSG00000183091	ENST00000434685	.	.	.	6.07	5.2	0.72013	.	.	.	.	.	T	0.63885	0.2549	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62756	-0.6787	4	.	.	.	.	12.0778	0.53653	0.0656:0.1214:0.813:0.0	.	.	.	.	L	1	.	.	S	-	2	0	NEB	152090745	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.792000	0.62467	1.582000	0.49881	0.655000	0.94253	TCA	.		0.483	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
AGPS	8540	broad.mit.edu;bcgsc.ca	37	2	178301756	178301756	+	Missense_Mutation	SNP	G	G	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr2:178301756G>T	ENST00000264167.4	+	5	757	c.611G>T	c.(610-612)cGa>cTa	p.R204L	AGPS_ENST00000409888.1_Intron	NM_003659.3	NP_003650.1	O00116	ADAS_HUMAN	alkylglycerone phosphate synthase	204	FAD-binding PCMH-type. {ECO:0000255|PROSITE-ProRule:PRU00718}.				cellular lipid metabolic process (GO:0044255)|ether lipid biosynthetic process (GO:0008611)|lipid biosynthetic process (GO:0008610)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	alkylglycerone-phosphate synthase activity (GO:0008609)|FAD binding (GO:0071949)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)	p.R204Q(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0018)|Epithelial(96;0.00919)|all cancers(119;0.0358)			ATGTTTGAGCGAATTCCTGAT	0.303																																					p.R204L													.	AGPS-92	1	Substitution - Missense(1)	large_intestine(1)	c.G611T						.						125.0	132.0	130.0					2																	178301756		2203	4300	6503	SO:0001583	missense	8540	exon5			TTGAGCGAATTCC	Y09443	CCDS2275.1	2q	2008-02-05			ENSG00000018510	ENSG00000018510	2.5.1.26		327	protein-coding gene	gene with protein product		603051				9187299, 9553082	Standard	NM_003659		Approved	ADHAPS, ADAS, ALDHPSY, ADPS, ADAP-S	uc002ull.2	O00116	OTTHUMG00000132530	ENST00000264167.4:c.611G>T	2.37:g.178301756G>T	ENSP00000264167:p.Arg204Leu	Somatic	152	0		WXS	Illumina HiSeq	Phase_I	115	5	NM_003659	0	0	1	1	0	A5D8U9|Q2TU35	Missense_Mutation	SNP	ENST00000264167.4	37	CCDS2275.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.541251	0.85917	.	.	ENSG00000018510	ENST00000264167;ENST00000536686	D	0.81739	-1.53	5.52	4.64	0.57946	FAD-binding, type 2, subdomain 1 (1);FAD-binding, type 2 (2);	0.000000	0.85682	D	0.000000	D	0.89760	0.6808	M	0.83852	2.665	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	D	0.91173	0.4970	10	0.87932	D	0	.	14.2952	0.66308	0.0719:0.0:0.9281:0.0	.	204	O00116	ADAS_HUMAN	L	204;74	ENSP00000264167:R204L	ENSP00000264167:R204L	R	+	2	0	AGPS	178010002	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.468000	0.90393	1.315000	0.45114	0.655000	0.94253	CGA	.		0.303	AGPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255730.2		
COL3A1	1281	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	189867767	189867767	+	Silent	SNP	C	C	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr2:189867767C>T	ENST00000304636.3	+	36	2702	c.2532C>T	c.(2530-2532)ccC>ccT	p.P844P	COL3A1_ENST00000317840.5_Intron	NM_000090.3	NP_000081	P02461	CO3A1_HUMAN	collagen, type III, alpha 1	844	Triple-helical region.				aging (GO:0007568)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell-matrix adhesion (GO:0007160)|cellular response to amino acid stimulus (GO:0071230)|cerebral cortex development (GO:0021987)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|digestive tract development (GO:0048565)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of immune response (GO:0050777)|negative regulation of neuron migration (GO:2001223)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|positive regulation of Rho protein signal transduction (GO:0035025)|response to cytokine (GO:0034097)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	collagen type III trimer (GO:0005586)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(2)|breast(1)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(60)|ovary(4)|pancreas(1)|prostate(5)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	126			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)	TTGCAGGACCCCCTGGAGGTT	0.493																																					p.P844P		.											.	COL3A1-581	0			c.C2532T						.						51.0	61.0	58.0					2																	189867767		2068	4020	6088	SO:0001819	synonymous_variant	1281	exon36			AGGACCCCCTGGA	X15332	CCDS2297.1	2q32.2	2014-09-17	2008-06-23		ENSG00000168542	ENSG00000168542		"""Collagens"""	2201	protein-coding gene	gene with protein product		120180	"""Ehlers-Danlos syndrome type IV, autosomal dominant"""	EDS4A		2780304, 2834369	Standard	NM_000090		Approved		uc002uqj.1	P02461	OTTHUMG00000132648	ENST00000304636.3:c.2532C>T	2.37:g.189867767C>T		Somatic	103	0		WXS	Illumina HiSeq	Phase_I	79	26	NM_000090	0	0	0	0	0	D2JYH5|D3DPH4|P78429|Q15112|Q16403|Q53S91|Q541P8|Q6LDB3|Q6LDJ2|Q6LDJ3|Q7KZ56|Q8N6U4|Q9UC88|Q9UC89|Q9UC90|Q9UC91|R4N3C5|V9GZI1	Silent	SNP	ENST00000304636.3	37	CCDS2297.1																																																																																			.		0.493	COL3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255899.3	NM_000090	
NBEAL1	65065	ucsc.edu;bcgsc.ca	37	2	204045155	204045155	+	Missense_Mutation	SNP	C	C	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr2:204045155C>T	ENST00000449802.1	+	42	6761	c.6428C>T	c.(6427-6429)gCt>gTt	p.A2143V		NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1	2143	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.									NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						ACCTGGCAAGCTCTTATGGAT	0.328																																					p.A2143V													.	NBEAL1-92	0			c.C6428T						.						121.0	114.0	116.0					2																	204045155		1833	4088	5921	SO:0001583	missense	65065	exon42			GGCAAGCTCTTAT	AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.6428C>T	2.37:g.204045155C>T	ENSP00000399903:p.Ala2143Val	Somatic	107	2		WXS	Illumina HiSeq		62	27	NM_001114132	0	0	0	0	0	A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	Missense_Mutation	SNP	ENST00000449802.1	37	CCDS46495.1	.	.	.	.	.	.	.	.	.	.	C	34	5.404068	0.96051	.	.	ENSG00000144426	ENST00000449802;ENST00000340268;ENST00000414576	T;T	0.80033	-1.33;-1.33	5.85	5.85	0.93711	BEACH domain (4);	0.266934	0.43260	D	0.000585	D	0.86426	0.5930	M	0.72479	2.2	0.58432	D	0.999998	P;P	0.52692	0.907;0.955	P;P	0.51974	0.686;0.673	D	0.86616	0.1876	10	0.56958	D	0.05	.	19.7681	0.96350	0.0:1.0:0.0:0.0	.	2143;2132	Q6ZS30;C9JGK5	NBEL1_HUMAN;.	V	2143;2143;158	ENSP00000399903:A2143V;ENSP00000388466:A158V	ENSP00000344985:A2143V	A	+	2	0	NBEAL1	203753400	1.000000	0.71417	0.997000	0.53966	0.967000	0.64934	7.624000	0.83124	2.768000	0.95171	0.655000	0.94253	GCT	.		0.328	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333982.4		
NOP56	10528	ucsc.edu;bcgsc.ca	37	20	2635760	2635760	+	Intron	SNP	G	G	A			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr20:2635760G>A	ENST00000329276.5	+	5	1085				MIR1292_ENST00000408135.1_RNA|SNORD110_ENST00000408189.1_RNA|SNORD57_ENST00000448188.1_RNA|SNORD86_ENST00000391196.1_RNA|SNORA51_ENST00000606420.1_RNA|SNORD56_ENST00000413522.1_RNA	NM_006392.3	NP_006383.2	O00567	NOP56_HUMAN	NOP56 ribonucleoprotein						cell death (GO:0008219)|rRNA processing (GO:0006364)	box C/D snoRNP complex (GO:0031428)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|pre-snoRNP complex (GO:0070761)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|snoRNA binding (GO:0030515)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	25						TGACTGTATAGAAAGAGGAGG	0.512																																					.													.	.	0			.						.						94.0	90.0	91.0					20																	2635760		876	1991	2867	SO:0001627	intron_variant	677831	.			TGTATAGAAAGAG	Y12065	CCDS13030.1	20p13	2012-12-10	2012-12-10	2009-01-13	ENSG00000101361	ENSG00000101361			15911	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 36"""	614154	"""nucleolar protein 5A (56kD with KKE/D repeat)"", ""nucleolar protein 5A (56kDa with KKE/D repeat)"", ""NOP56 ribonucleoprotein homolog (yeast)"""	NOL5A		9372940, 21683323	Standard	NR_027700		Approved	SCA36	uc002wgh.3	O00567	OTTHUMG00000031703	ENST00000329276.5:c.569+167G>A	20.37:g.2635760G>A		Somatic	22	0		WXS	Illumina HiSeq		22	9	.	0	0	0	0	0	Q2M3T6|Q9NQ05	RNA	SNP	ENST00000329276.5	37	CCDS13030.1																																																																																			.		0.512	NOP56-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077631.2	NM_006392	
ZNF335	63925	bcgsc.ca	37	20	44592465	44592465	+	Missense_Mutation	SNP	C	C	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr20:44592465C>T	ENST00000322927.2	-	8	1367	c.1267G>A	c.(1267-1269)Gca>Aca	p.A423T	ZNF335_ENST00000426788.1_Missense_Mutation_p.A268T	NM_022095.3	NP_071378.1	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	423					brain development (GO:0007420)|brain morphogenesis (GO:0048854)|cerebral cortex neuron differentiation (GO:0021895)|histone H3-K4 trimethylation (GO:0080182)|in utero embryonic development (GO:0001701)|neuron projection morphogenesis (GO:0048812)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of neurogenesis (GO:0050769)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(13)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	51		Myeloproliferative disorder(115;0.0122)				GAGGGGGCTGCGTTCTCTGCA	0.637																																					p.A423T													.	ZNF335-94	0			c.G1267A						.						80.0	78.0	79.0					20																	44592465		2203	4300	6503	SO:0001583	missense	63925	exon8			GGGCTGCGTTCTC	AK026157	CCDS13389.1	20q13.12	2011-09-12			ENSG00000198026	ENSG00000198026		"""Zinc fingers, C2H2-type"""	15807	protein-coding gene	gene with protein product	"""NRC-interacting factor 1"""	610827				12215545, 19131338	Standard	NM_022095		Approved	bA465L10.2, NIF-1	uc002xqw.3	Q9H4Z2	OTTHUMG00000032637	ENST00000322927.2:c.1267G>A	20.37:g.44592465C>T	ENSP00000325326:p.Ala423Thr	Somatic	88	0		WXS	Illumina HiSeq	Phase_1	75	5	NM_022095	0	0	1	1	0	B4DLG7|Q548D0|Q9H684	Missense_Mutation	SNP	ENST00000322927.2	37	CCDS13389.1	.	.	.	.	.	.	.	.	.	.	C	12.82	2.051468	0.36181	.	.	ENSG00000198026	ENST00000322927;ENST00000243961;ENST00000426788	T;T	0.08102	3.24;3.13	4.81	1.61	0.23674	.	0.186864	0.45606	N	0.000356	T	0.03608	0.0103	N	0.12182	0.205	0.26398	N	0.976472	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.43163	-0.9408	10	0.17369	T	0.5	-4.5635	5.2985	0.15766	0.0:0.4872:0.0:0.5128	.	268;423	Q9H4Z2-2;Q9H4Z2	.;ZN335_HUMAN	T	423;200;268	ENSP00000325326:A423T;ENSP00000397098:A268T	ENSP00000243961:A200T	A	-	1	0	ZNF335	44025872	0.210000	0.23517	0.028000	0.17463	0.687000	0.40016	0.545000	0.23268	0.633000	0.30452	0.555000	0.69702	GCA	.		0.637	ZNF335-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079553.1	NM_022095	
SYCP2	10388	bcgsc.ca	37	20	58475248	58475248	+	Missense_Mutation	SNP	G	G	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr20:58475248G>T	ENST00000357552.3	-	18	1574	c.1349C>A	c.(1348-1350)cCt>cAt	p.P450H	SYCP2_ENST00000371001.2_Missense_Mutation_p.P450H			Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	450					female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)			NS(4)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			ATATTTTGAAGGTTTAGCAAA	0.363																																					p.P450H													.	SYCP2-525	0			c.C1349A						.						136.0	123.0	127.0					20																	58475248		2202	4299	6501	SO:0001583	missense	10388	exon17			TTTGAAGGTTTAG	Y08982	CCDS13482.1	20q13.33	2007-07-02			ENSG00000196074	ENSG00000196074			11490	protein-coding gene	gene with protein product		604105				10341103, 9592139	Standard	NM_014258		Approved	SCP2	uc002yaz.3	Q9BX26	OTTHUMG00000032872	ENST00000357552.3:c.1349C>A	20.37:g.58475248G>T	ENSP00000350162:p.Pro450His	Somatic	109	0		WXS	Illumina HiSeq	Phase_1	88	5	NM_014258	0	0	0	0	0	A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	Missense_Mutation	SNP	ENST00000357552.3	37	CCDS13482.1	.	.	.	.	.	.	.	.	.	.	G	11.05	1.525062	0.27299	.	.	ENSG00000196074	ENST00000371001;ENST00000357552;ENST00000446834	T;T;T	0.18502	2.46;2.46;2.21	5.37	2.19	0.27852	.	0.750306	0.11861	N	0.522405	T	0.28896	0.0717	M	0.62723	1.935	0.09310	N	1	D;P	0.58620	0.983;0.895	P;P	0.59825	0.864;0.606	T	0.08638	-1.0712	10	0.52906	T	0.07	-2.3323	4.4928	0.11822	0.0912:0.1516:0.6019:0.1552	.	450;450	A2A341;Q9BX26	.;SYCP2_HUMAN	H	450	ENSP00000360040:P450H;ENSP00000350162:P450H;ENSP00000402456:P450H	ENSP00000350162:P450H	P	-	2	0	SYCP2	57908643	0.019000	0.18553	0.057000	0.19452	0.155000	0.21991	1.388000	0.34442	1.258000	0.44101	0.650000	0.86243	CCT	.		0.363	SYCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079930.3	NM_014258	
KRTAP10-6	386674	broad.mit.edu	37	21	46011400	46011400	+	Silent	SNP	G	G	A	rs371252868		TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr21:46011400G>A	ENST00000400368.1	-	1	986	c.966C>T	c.(964-966)tcC>tcT	p.S322S	TSPEAR_ENST00000323084.4_Intron	NM_198688.2	NP_941961.2	P60371	KR106_HUMAN	keratin associated protein 10-6	322	29 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)		p.S322S(5)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(6)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	23						AGGCACCACAGGAGGGGACGG	0.692																																					p.S322S													.	KRTAP10-6-90	5	Substitution - coding silent(5)	endometrium(3)|urinary_tract(1)|prostate(1)	c.C966T						.						66.0	81.0	76.0					21																	46011400		2201	4300	6501	SO:0001819	synonymous_variant	386674	exon1			ACCACAGGAGGGG	AB076353	CCDS42959.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000188155	ENSG00000188155		"""Keratin associated proteins"""	20523	protein-coding gene	gene with protein product			"""keratin associated protein 18-6"""	KRTAP18-6			Standard	NM_198688		Approved	KRTAP18.6, KAP18.6, KAP10.6	uc002zfm.3	P60371	OTTHUMG00000057634	ENST00000400368.1:c.966C>T	21.37:g.46011400G>A		Somatic	145	2		WXS	Illumina HiSeq	Phase_I	137	7	NM_198688	0	0	0	0	0		Silent	SNP	ENST00000400368.1	37	CCDS42959.1																																																																																			.		0.692	KRTAP10-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128037.1	NM_198688	
CLTCL1	8218	broad.mit.edu	37	22	19213138	19213138	+	Missense_Mutation	SNP	C	C	A			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr22:19213138C>A	ENST00000263200.10	-	13	2038	c.1966G>T	c.(1966-1968)Ggc>Tgc	p.G656C	CLTCL1_ENST00000353891.5_Missense_Mutation_p.G656C|CLTCL1_ENST00000427926.1_Missense_Mutation_p.G656C	NM_007098.3	NP_009029.3	P53675	CLH2_HUMAN	clathrin, heavy chain-like 1	656	Heavy chain arm.|Proximal segment.				anatomical structure morphogenesis (GO:0009653)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|positive regulation of glucose import (GO:0046326)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|spindle (GO:0005819)|trans-Golgi network (GO:0005802)	signal transducer activity (GO:0004871)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	Colorectal(54;0.0993)					GATAAGGAGCCAAAGAAATTG	0.473			T	?	ALCL																																p.G656C				Dom	yes		22	22q11.21	8218	"""clathrin, heavy polypeptide-like 1"""		L	.	CLTCL1-230	0			c.G1966T						.																																			SO:0001583	missense	8218	exon13			AGGAGCCAAAGAA		CCDS46662.1, CCDS54497.1, CCDS46662.2, CCDS54497.2	22q11.2	2008-06-10	2006-09-29		ENSG00000070371	ENSG00000070371			2093	protein-coding gene	gene with protein product		601273	"""clathrin, heavy polypeptide-like 1"""	CLTCL		8844170, 15133132	Standard	NM_007098		Approved	CLTD, CLH22, CHC22	uc021wle.1	P53675	OTTHUMG00000150109	ENST00000263200.10:c.1966G>T	22.37:g.19213138C>A	ENSP00000445677:p.Gly656Cys	Somatic	47	12		WXS	Illumina HiSeq	Phase_I	55	9	NM_001835	0	0	0	0	0	B7Z7U5|Q14017|Q15808|Q15809	Missense_Mutation	SNP	ENST00000263200.10	37	CCDS46662.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.027241	0.75390	.	.	ENSG00000070371	ENST00000353891;ENST00000263200;ENST00000427926	T;T;T	0.53857	0.6;0.6;0.6	4.0	4.0	0.46444	Tetratricopeptide-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.78755	0.4333	M	0.92738	3.34	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.85440	0.1154	10	0.87932	D	0	-20.3922	16.6486	0.85183	0.0:1.0:0.0:0.0	.	656;656	P53675-2;P53675	.;CLH2_HUMAN	C	656	ENSP00000439662:G656C;ENSP00000445677:G656C;ENSP00000441158:G656C	ENSP00000445677:G656C	G	-	1	0	CLTCL1	17593138	1.000000	0.71417	1.000000	0.80357	0.721000	0.41392	5.229000	0.65316	2.220000	0.72140	0.655000	0.94253	GGC	.		0.473	CLTCL1-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316397.5	NM_007098	
MORC2	22880	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	31345772	31345772	+	Missense_Mutation	SNP	T	T	G			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr22:31345772T>G	ENST00000397641.3	-	5	691	c.283A>C	c.(283-285)Act>Cct	p.T95P	MORC2_ENST00000215862.4_Missense_Mutation_p.T33P			Q9Y6X9	MORC2_HUMAN	MORC family CW-type zinc finger 2	95						cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	21						CCAATCTGAGTAGACTCAGGT	0.463																																					p.T33P		.											.	MORC2-92	0			c.A97C						.						139.0	127.0	131.0					22																	31345772		2203	4300	6503	SO:0001583	missense	22880	exon6			TCTGAGTAGACTC	AB020659	CCDS33636.1	22q12.2	2005-06-15	2005-06-15	2005-06-15	ENSG00000133422	ENSG00000133422			23573	protein-coding gene	gene with protein product			"""zinc finger, CW-type with coiled-coil domain 1"", ""zinc finger, CW type with coiled-coil domain 1"""	ZCWCC1		14607086	Standard	XM_005261391		Approved	ZCW3, KIAA0852, AC004542.C22.1	uc003aje.1	Q9Y6X9	OTTHUMG00000151193	ENST00000397641.3:c.283A>C	22.37:g.31345772T>G	ENSP00000380763:p.Thr95Pro	Somatic	82	0		WXS	Illumina HiSeq	Phase_I	59	23	NM_014941	0	0	1	1	0	B2RNB1|Q9UF28|Q9Y6V2	Missense_Mutation	SNP	ENST00000397641.3	37		.	.	.	.	.	.	.	.	.	.	T	26.9	4.777606	0.90195	.	.	ENSG00000133422	ENST00000397641;ENST00000215862	D;D	0.95205	-3.64;-3.64	5.62	5.62	0.85841	ATPase-like, ATP-binding domain (4);	0.050861	0.85682	D	0.000000	D	0.94968	0.8372	L	0.35341	1.055	0.80722	D	1	D	0.89917	1.0	D	0.70487	0.969	D	0.94117	0.7376	10	0.30854	T	0.27	.	15.8169	0.78608	0.0:0.0:0.0:1.0	.	95	Q9Y6X9	MORC2_HUMAN	P	95;33	ENSP00000380763:T95P;ENSP00000215862:T33P	ENSP00000215862:T33P	T	-	1	0	MORC2	29675772	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.698000	0.84413	2.151000	0.67156	0.482000	0.46254	ACT	.		0.463	MORC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000321710.2	NM_014941	
RRP7A	27341	broad.mit.edu;bcgsc.ca	37	22	42910736	42910736	+	Silent	SNP	C	C	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr22:42910736C>T	ENST00000323013.6	-	5	525	c.510G>A	c.(508-510)agG>agA	p.R170R	SERHL_ENST00000359906.2_RNA	NM_015703.4	NP_056518.2	Q9Y3A4	RRP7A_HUMAN	ribosomal RNA processing 7 homolog A (S. cerevisiae)	170							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|liver(2)|lung(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	10						CCACTTCCACCCTCAGGGCCT	0.637																																					p.R170R													.	RRP7A-91	0			c.G510A						.						35.0	36.0	36.0					22																	42910736		2202	4297	6499	SO:0001819	synonymous_variant	27341	exon5			TTCCACCCTCAGG	BC035992	CCDS14036.1	22q13.2	2008-08-08			ENSG00000189306	ENSG00000189306			24286	protein-coding gene	gene with protein product						10810093, 12087473	Standard	NM_015703		Approved	CGI-96	uc003bcq.3	Q9Y3A4	OTTHUMG00000150891	ENST00000323013.6:c.510G>A	22.37:g.42910736C>T		Somatic	191	0		WXS	Illumina HiSeq	Phase_I	141	14	NM_015703	1	0	86	89	2	A4FTX2|B2RBG4|Q0VAD0|Q5JZ94|Q6P4B5|Q8IVR9|Q8IVY0|Q8N5Q3|Q8NEY6|Q9Y3H5	Silent	SNP	ENST00000323013.6	37	CCDS14036.1																																																																																			.		0.637	RRP7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320451.1	NM_015703	
PRKAR2A	5576	broad.mit.edu	37	3	48884918	48884918	+	Missense_Mutation	SNP	T	T	G			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr3:48884918T>G	ENST00000265563.8	-	1	361	c.112A>C	c.(112-114)Acc>Ccc	p.T38P	PRKAR2A-AS1_ENST00000435419.1_RNA|PRKAR2A-AS1_ENST00000431705.1_RNA|PRKAR2A-AS1_ENST00000416209.2_RNA|PRKAR2A_ENST00000296446.8_Missense_Mutation_p.T38P|PRKAR2A_ENST00000454963.1_Missense_Mutation_p.T38P|PRKAR2A-AS1_ENST00000412171.2_RNA	NM_004157.2	NP_004148.1	P13861	KAP2_HUMAN	protein kinase, cAMP-dependent, regulatory, type II, alpha	38	Dimerization and phosphorylation.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	AMP-activated protein kinase complex (GO:0031588)|cAMP-dependent protein kinase complex (GO:0005952)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|protein kinase A catalytic subunit binding (GO:0034236)|ubiquitin protein ligase binding (GO:0031625)		SLC26A6/PRKAR2A(2)	breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(1)|ovary(1)	6				BRCA - Breast invasive adenocarcinoma(193;0.000176)|Kidney(197;0.00246)|KIRC - Kidney renal clear cell carcinoma(197;0.00261)		CGCAGGCGGGTGAAGTACTCC	0.731																																					p.T38P													.	PRKAR2A-1108	0			c.A112C						.																																			SO:0001583	missense	5576	exon1			GGCGGGTGAAGTA		CCDS2778.1	3p21.3-p21.2	2009-07-10			ENSG00000114302	ENSG00000114302	2.7.11.1		9391	protein-coding gene	gene with protein product		176910		PRKAR2		9676433	Standard	NM_004157		Approved		uc003cux.1	P13861	OTTHUMG00000133540	ENST00000265563.8:c.112A>C	3.37:g.48884918T>G	ENSP00000265563:p.Thr38Pro	Somatic	99	16		WXS	Illumina HiSeq	Phase_I	84	22	NM_004157	0	0	0	0	0	Q16823|Q9BUB1	Missense_Mutation	SNP	ENST00000265563.8	37	CCDS2778.1	.	.	.	.	.	.	.	.	.	.	T	17.06	3.292833	0.60086	.	.	ENSG00000114302	ENST00000265563;ENST00000454963;ENST00000296446;ENST00000419216	T;T;T;T	0.77877	-1.13;-1.13;-1.13;-1.13	3.86	3.86	0.44501	cAMP-dependent protein kinase, regulatory subunit, type I/II alpha/beta (3);	0.000000	0.56097	D	0.000034	D	0.87325	0.6149	M	0.88031	2.925	0.80722	D	1	D;D	0.61080	0.989;0.989	D;D	0.71656	0.974;0.974	D	0.86994	0.2112	10	0.45353	T	0.12	-0.0721	8.6605	0.34091	0.0:0.0973:0.0:0.9027	.	38;38	Q9BUB1;P13861	.;KAP2_HUMAN	P	38	ENSP00000265563:T38P;ENSP00000394041:T38P;ENSP00000296446:T38P;ENSP00000411432:T38P	ENSP00000265563:T38P	T	-	1	0	PRKAR2A	48859922	1.000000	0.71417	1.000000	0.80357	0.292000	0.27327	3.137000	0.50562	1.521000	0.48983	0.377000	0.23210	ACC	.		0.731	PRKAR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257518.1		
GLT8D1	55830	bcgsc.ca	37	3	52731772	52731772	+	Nonsense_Mutation	SNP	G	G	T	rs370367748		TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr3:52731772G>T	ENST00000407584.3	-	5	1144	c.294C>A	c.(292-294)taC>taA	p.Y98*	GLT8D1_ENST00000266014.5_Nonsense_Mutation_p.Y98*|GLT8D1_ENST00000394783.3_Nonsense_Mutation_p.Y98*|GLT8D1_ENST00000478968.2_Nonsense_Mutation_p.Y98*|GLT8D1_ENST00000463827.1_5'Flank|GLT8D1_ENST00000491606.1_Nonsense_Mutation_p.Y98*	NM_001010983.1|NM_001278280.1	NP_001010983.1|NP_001265209.1	Q68CQ7	GL8D1_HUMAN	glycosyltransferase 8 domain containing 1	98						integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|endometrium(1)|kidney(3)|large_intestine(3)	8				BRCA - Breast invasive adenocarcinoma(193;6.78e-05)|Kidney(197;0.000618)|KIRC - Kidney renal clear cell carcinoma(197;0.000779)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		GAGTAACAATGTAGAAAATCA	0.483																																					p.Y98X													.	GLT8D1-90	0			c.C294A						.						139.0	128.0	132.0					3																	52731772		2203	4300	6503	SO:0001587	stop_gained	55830	exon4			AACAATGTAGAAA	AY358579	CCDS2862.1	3p21.1	2013-02-22			ENSG00000016864	ENSG00000016864		"""Glycosyltransferase family 8 domain containing"""	24870	protein-coding gene	gene with protein product						12975309	Standard	NM_152932		Approved	AD-017, FLJ14611	uc003dfi.4	Q68CQ7	OTTHUMG00000158759	ENST00000407584.3:c.294C>A	3.37:g.52731772G>T	ENSP00000385730:p.Tyr98*	Somatic	90	2		WXS	Illumina HiSeq	Phase_1	62	51	NM_152932	0	0	1	4	3	Q7Z4D1|Q8N2J6|Q9P0I5	Nonsense_Mutation	SNP	ENST00000407584.3	37	CCDS2862.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.388865	0.82902	.	.	ENSG00000016864	ENST00000478968;ENST00000394783;ENST00000407584;ENST00000266014;ENST00000491606;ENST00000479553;ENST00000489119	.	.	.	5.89	5.89	0.94794	.	0.173276	0.51477	D	0.000086	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.19147	T	0.46	-11.4738	9.9543	0.41657	0.1851:0.0:0.8149:0.0	.	.	.	.	X	98	.	ENSP00000266014:Y98X	Y	-	3	2	GLT8D1	52706812	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.845000	0.48254	2.793000	0.96121	0.655000	0.94253	TAC	.		0.483	GLT8D1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352065.3	NM_152932	
MAGI1	9223	broad.mit.edu	37	3	66023695	66023695	+	Missense_Mutation	SNP	C	C	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr3:66023695C>T	ENST00000497477.2	-	1	288	c.289G>A	c.(289-291)Gtc>Atc	p.V97I	MAGI1_ENST00000483466.1_Missense_Mutation_p.V97I|MAGI1_ENST00000402939.2_Missense_Mutation_p.V97I|MAGI1_ENST00000330909.8_Missense_Mutation_p.V97I			Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 1	97	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.|PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|neuron death (GO:0070997)|protein complex assembly (GO:0006461)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	alpha-actinin binding (GO:0051393)|ATP binding (GO:0005524)|protein C-terminus binding (GO:0008022)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|liver(1)|lung(21)|pancreas(1)|skin(5)	51		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		TTGAAGGTGACGGCCTCCTTG	0.652																																					p.V97I													.	MAGI1-661	0			c.G289A						.						65.0	76.0	72.0					3																	66023695		2197	4295	6492	SO:0001583	missense	9223	exon1			AGGTGACGGCCTC	AB010894	CCDS33780.1, CCDS33781.1, CCDS2904.1	3p14.1	2009-10-06	2005-05-10	2005-05-10	ENSG00000151276	ENSG00000151276			946	protein-coding gene	gene with protein product		602625	"""BAI1-associated protein 1"""	BAIAP1		9647739, 9225980	Standard	XM_005265563		Approved	BAP1, MAGI-1, TNRC19, AIP3, WWP3	uc003dmn.3	Q96QZ7	OTTHUMG00000157554	ENST00000497477.2:c.289G>A	3.37:g.66023695C>T	ENSP00000424369:p.Val97Ile	Somatic	192	0		WXS	Illumina HiSeq	Phase_I	166	5	NM_001033057	0	0	0	0	0	A8K188|O00309|O43863|O75085|Q96QZ8|Q96QZ9	Missense_Mutation	SNP	ENST00000497477.2	37		.	.	.	.	.	.	.	.	.	.	C	9.397	1.077120	0.20227	.	.	ENSG00000151276	ENST00000402939;ENST00000330909;ENST00000483466;ENST00000497477	T;T;T;T	0.21932	2.54;2.12;2.12;1.98	5.77	5.77	0.91146	PDZ/DHR/GLGF (3);Guanylate kinase (1);	0.144117	0.46145	D	0.000305	T	0.09423	0.0232	N	0.16478	0.41	0.33586	D	0.600553	B;B;B;B;B	0.32526	0.066;0.015;0.015;0.374;0.042	B;B;B;B;B	0.20955	0.006;0.006;0.006;0.028;0.032	T	0.10177	-1.0641	10	0.02654	T	1	-14.5033	10.9889	0.47539	0.0:0.887:0.0:0.113	.	97;97;97;97;97	Q96QZ7;Q96QZ7-4;Q96QZ7-3;Q96QZ7-2;Q96QZ7-5	MAGI1_HUMAN;.;.;.;.	I	97	ENSP00000385450:V97I;ENSP00000331157:V97I;ENSP00000420323:V97I;ENSP00000424369:V97I	ENSP00000331157:V97I	V	-	1	0	MAGI1	65998735	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.773000	0.47686	2.724000	0.93272	0.655000	0.94253	GTC	.		0.652	MAGI1-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000349132.2	NM_004742	
LRIG1	26018	broad.mit.edu	37	3	66433543	66433543	+	Missense_Mutation	SNP	C	C	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr3:66433543C>T	ENST00000273261.3	-	15	2878	c.2354G>A	c.(2353-2355)gGc>gAc	p.G785D	LRIG1_ENST00000496559.2_5'UTR|SLC25A26_ENST00000536651.1_Intron|LRIG1_ENST00000383703.3_Missense_Mutation_p.G762D	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	785					innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		CTTCCTGCAGCCTGCTGCGGG	0.607																																					p.G785D													.	LRIG1-230	0			c.G2354A						.						134.0	128.0	130.0					3																	66433543		2203	4300	6503	SO:0001583	missense	26018	exon15			CTGCAGCCTGCTG	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.2354G>A	3.37:g.66433543C>T	ENSP00000273261:p.Gly785Asp	Somatic	64	0		WXS	Illumina HiSeq	Phase_I	79	3	NM_015541	0	0	1	1	0	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	.	.	.	.	.	.	.	.	.	.	C	11.61	1.689783	0.29962	.	.	ENSG00000144749	ENST00000273261;ENST00000383703;ENST00000383702	T;T	0.67345	-0.23;-0.26	5.88	5.88	0.94601	.	0.102414	0.64402	D	0.000002	T	0.62405	0.2425	L	0.50333	1.59	0.40098	D	0.976331	B;B;B	0.19445	0.036;0.004;0.021	B;B;B	0.25405	0.032;0.025;0.06	T	0.57608	-0.7782	10	0.33141	T	0.24	.	14.3978	0.67022	0.0:0.9299:0.0:0.0701	.	762;785;785	Q96JA1-2;Q5XWD3;Q96JA1	.;.;LRIG1_HUMAN	D	785;762;688	ENSP00000273261:G785D;ENSP00000373208:G762D	ENSP00000273261:G785D	G	-	2	0	LRIG1	66516233	0.997000	0.39634	0.995000	0.50966	0.199000	0.23934	1.418000	0.34782	2.782000	0.95742	0.655000	0.94253	GGC	.		0.607	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
FBXO40	51725	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	121345735	121345735	+	Missense_Mutation	SNP	C	C	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr3:121345735C>T	ENST00000338040.4	+	4	2522	c.2108C>T	c.(2107-2109)cCa>cTa	p.P703L		NM_016298.3	NP_057382.2	Q9UH90	FBX40_HUMAN	F-box protein 40	703					muscle cell differentiation (GO:0042692)	cytoplasm (GO:0005737)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(11)|lung(19)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	46				GBM - Glioblastoma multiforme(114;0.189)		AGAATCAGACCACGAGGAAGA	0.478																																					p.P703L													.	FBXO40-273	0			c.C2108T						.						77.0	77.0	77.0					3																	121345735		2203	4300	6503	SO:0001583	missense	51725	exon4			TCAGACCACGAGG	AF204674	CCDS33835.1	3q21.1	2004-08-24			ENSG00000163833	ENSG00000163833		"""F-boxes /  ""other"""""	29816	protein-coding gene	gene with protein product		609107				10574462	Standard	NM_016298		Approved	KIAA1195, Fbx40	uc003eeg.2	Q9UH90	OTTHUMG00000159410	ENST00000338040.4:c.2108C>T	3.37:g.121345735C>T	ENSP00000337510:p.Pro703Leu	Somatic	90	1		WXS	Illumina HiSeq	Phase_I	57	48	NM_016298	0	0	0	0	0	B2RAX7|Q32M70|Q9ULM5	Missense_Mutation	SNP	ENST00000338040.4	37	CCDS33835.1	.	.	.	.	.	.	.	.	.	.	C	10.86	1.468980	0.26335	.	.	ENSG00000163833	ENST00000338040	T	0.30448	1.53	6.17	4.36	0.52297	.	0.734910	0.13029	N	0.419516	T	0.27663	0.0680	L	0.44542	1.39	0.25676	N	0.985842	B	0.06786	0.001	B	0.08055	0.003	T	0.20907	-1.0261	10	0.66056	D	0.02	0.0962	9.7888	0.40692	0.1392:0.7879:0.0:0.0728	.	703	Q9UH90	FBX40_HUMAN	L	703	ENSP00000337510:P703L	ENSP00000337510:P703L	P	+	2	0	FBXO40	122828425	0.002000	0.14202	0.072000	0.20136	0.410000	0.31052	0.687000	0.25407	0.907000	0.36646	0.655000	0.94253	CCA	.		0.478	FBXO40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355158.1	NM_016298	
FAIM	55179	broad.mit.edu	37	3	138341182	138341182	+	Missense_Mutation	SNP	G	G	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr3:138341182G>T	ENST00000393035.2	+	3	373	c.264G>T	c.(262-264)aaG>aaT	p.K88N	FAIM_ENST00000393034.2_Missense_Mutation_p.K88N|FAIM_ENST00000464668.1_Missense_Mutation_p.K88N|FAIM_ENST00000338446.4_Missense_Mutation_p.K122N|FAIM_ENST00000360570.3_Missense_Mutation_p.K110N	NM_001033032.1	NP_001028204.1	Q9NVQ4	FAIM1_HUMAN	Fas apoptotic inhibitory molecule	88					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)	cytoplasm (GO:0005737)				kidney(1)|upper_aerodigestive_tract(1)	2						GTCTCAAGAAGTATATGGAGG	0.378																																					p.K122N													.	FAIM-227	0			c.G366T						.						111.0	112.0	112.0					3																	138341182		2203	4300	6503	SO:0001583	missense	55179	exon4			CAAGAAGTATATG	AK001444	CCDS3103.1, CCDS33864.1, CCDS33865.1	3q23	2008-07-18			ENSG00000158234	ENSG00000158234			18703	protein-coding gene	gene with protein product						10075978	Standard	NM_018147		Approved	FLJ10582, FAIM1	uc003esq.3	Q9NVQ4	OTTHUMG00000159885	ENST00000393035.2:c.264G>T	3.37:g.138341182G>T	ENSP00000376755:p.Lys88Asn	Somatic	153	0		WXS	Illumina HiSeq	Phase_I	104	4	NM_001033030	0	0	65	65	0	Q6IAN2	Missense_Mutation	SNP	ENST00000393035.2	37	CCDS3103.1	.	.	.	.	.	.	.	.	.	.	G	18.62	3.663788	0.67700	.	.	ENSG00000158234	ENST00000338446;ENST00000360570;ENST00000393035;ENST00000393034;ENST00000464668;ENST00000479848	T;T;T;T;T;T	0.35973	1.28;1.28;1.28;1.28;1.28;1.28	5.82	1.5	0.22942	.	0.045770	0.85682	N	0.000000	T	0.56978	0.2022	M	0.85945	2.785	0.80722	D	1	D;D;D;P	0.59767	0.986;0.985;0.985;0.934	D;P;D;P	0.64237	0.911;0.897;0.923;0.82	T	0.59579	-0.7428	10	0.52906	T	0.07	-9.3449	10.4652	0.44602	0.3213:0.0:0.6787:0.0	.	88;110;122;88	Q9NVQ4;Q9NVQ4-3;Q9NVQ4-2;C9JDZ2	FAIM1_HUMAN;.;.;.	N	122;110;88;88;88;88	ENSP00000342805:K122N;ENSP00000353775:K110N;ENSP00000376755:K88N;ENSP00000376754:K88N;ENSP00000417642:K88N;ENSP00000420543:K88N	ENSP00000342805:K122N	K	+	3	2	FAIM	139823872	1.000000	0.71417	0.999000	0.59377	0.974000	0.67602	1.529000	0.35996	0.370000	0.24538	0.650000	0.86243	AAG	.		0.378	FAIM-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357979.1	NM_001033032	
IQCJ-SCHIP1	100505385	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	159606614	159606614	+	Silent	SNP	A	A	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr3:159606614A>T	ENST00000460298.1	+	6	1321	c.1080A>T	c.(1078-1080)ccA>ccT	p.P360P	IQCJ-SCHIP1_ENST00000476809.1_Silent_p.P449P|IQCJ-SCHIP1_ENST00000337808.6_Silent_p.P400P|SCHIP1_ENST00000482804.1_Silent_p.P173P|SCHIP1_ENST00000445224.2_Silent_p.P157P|IQCJ-SCHIP1_ENST00000412423.2_Silent_p.P387P|IQCJ-SCHIP1_ENST00000527095.1_Silent_p.P168P|IQCJ-SCHIP1_ENST00000485419.1_Silent_p.P476P					IQCJ-SCHIP1 readthrough											central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(7)	12						TTCAGCTGCCACACATGCCTC	0.433																																					p.P476P		.											.	.	0			c.A1428T						.						138.0	130.0	132.0					3																	159606614		2203	4300	6503	SO:0001819	synonymous_variant	100505385	exon9			GCTGCCACACATG		CCDS56289.1, CCDS56291.1	3q25.33	2011-03-24			ENSG00000250588	ENSG00000250588			38842	other	readthrough							Standard	NM_001197113		Approved		uc003fcq.2		OTTHUMG00000162426	ENST00000460298.1:c.1080A>T	3.37:g.159606614A>T		Somatic	92	0		WXS	Illumina HiSeq	Phase_I	81	63	NM_001197113	0	0	0	0	0		Silent	SNP	ENST00000460298.1	37																																																																																				.		0.433	IQCJ-SCHIP1-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000352558.2	NM_001197113	
FGFRL1	53834	broad.mit.edu;bcgsc.ca	37	4	1018104	1018104	+	Missense_Mutation	SNP	A	A	C			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr4:1018104A>C	ENST00000398484.2	+	7	1304	c.724A>C	c.(724-726)Acc>Ccc	p.T242P	FGFRL1_ENST00000510644.1_Missense_Mutation_p.T242P|FGFRL1_ENST00000264748.6_Missense_Mutation_p.T242P|FGFRL1_ENST00000504138.1_Missense_Mutation_p.T242P			Q8N441	FGRL1_HUMAN	fibroblast growth factor receptor-like 1	242					diaphragm development (GO:0060539)|heart valve morphogenesis (GO:0003179)|negative regulation of cell proliferation (GO:0008285)|skeletal system development (GO:0001501)|ventricular septum morphogenesis (GO:0060412)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)			endometrium(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	13			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			CACAGAGCGGACCCGTTCCAA	0.706																																					p.T242P													.	FGFRL1-90	0			c.A724C						.						39.0	37.0	38.0					4																	1018104		2199	4275	6474	SO:0001583	missense	53834	exon6			GAGCGGACCCGTT		CCDS3344.1	4p16	2013-01-11			ENSG00000127418	ENSG00000127418		"""Immunoglobulin superfamily / I-set domain containing"""	3693	protein-coding gene	gene with protein product		605830					Standard	NM_021923		Approved		uc003gcg.3	Q8N441	OTTHUMG00000118998	ENST00000398484.2:c.724A>C	4.37:g.1018104A>C	ENSP00000381498:p.Thr242Pro	Somatic	55	1		WXS	Illumina HiSeq	Phase_I	42	27	NM_001004356	0	0	0	0	0	B2RAU9|Q6PJN1|Q9BXN7|Q9H4D7	Missense_Mutation	SNP	ENST00000398484.2	37	CCDS3344.1	.	.	.	.	.	.	.	.	.	.	a	19.31	3.802814	0.70682	.	.	ENSG00000127418	ENST00000398484;ENST00000542622;ENST00000510644;ENST00000504138;ENST00000264748	T;T;T;T	0.71934	-0.61;-0.61;-0.61;-0.61	5.24	4.03	0.46877	.	0.049213	0.85682	N	0.000000	T	0.79730	0.4496	M	0.64260	1.97	0.80722	D	1	D	0.71674	0.998	D	0.67103	0.949	T	0.79990	-0.1570	10	0.66056	D	0.02	-28.2282	11.4565	0.50185	0.8487:0.1513:0.0:0.0	.	242	Q8N441	FGRL1_HUMAN	P	242;212;242;242;242	ENSP00000381498:T242P;ENSP00000425025:T242P;ENSP00000423091:T242P;ENSP00000264748:T242P	ENSP00000264748:T242P	T	+	1	0	FGFRL1	1008104	0.997000	0.39634	0.913000	0.36048	0.638000	0.38207	3.318000	0.51975	0.810000	0.34279	0.463000	0.42550	ACC	.		0.706	FGFRL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239195.2	NM_021923	
FAM193A	8603	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	2632748	2632748	+	Missense_Mutation	SNP	T	T	A			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr4:2632748T>A	ENST00000324666.5	+	3	368	c.17T>A	c.(16-18)cTc>cAc	p.L6H	FAM193A_ENST00000545951.1_Missense_Mutation_p.L6H|FAM193A_ENST00000505311.1_Missense_Mutation_p.L6H|FAM193A_ENST00000382839.3_Missense_Mutation_p.L6H|FAM193A_ENST00000502458.1_Missense_Mutation_p.L6H	NM_001256666.1	NP_001243595.1	P78312	F193A_HUMAN	family with sequence similarity 193, member A	6										NS(2)|breast(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(12)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	40						GTCCGCCTGCTCCGGCAGCTG	0.632																																					p.L6H		.											.	FAM193A-93	0			c.T17A						.						42.0	45.0	44.0					4																	2632748		2202	4300	6502	SO:0001583	missense	8603	exon3			GCCTGCTCCGGCA	AB000459	CCDS33943.1, CCDS58874.1, CCDS58875.1, CCDS58876.1	4p16.3	2009-09-04	2009-09-04	2009-09-04					16822	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 8"""	C4orf8		9734812	Standard	NR_046335		Approved	RES4-22	uc010ick.3	P78312		ENST00000324666.5:c.17T>A	4.37:g.2632748T>A	ENSP00000324587:p.Leu6His	Somatic	76	0		WXS	Illumina HiSeq	Phase_I	60	18	NM_003704	0	0	0	0	0	B7ZM85|B9EGR0|E9PFA1|O43607|P78311|P78313|Q9UEG8	Missense_Mutation	SNP	ENST00000324666.5	37	CCDS58875.1	.	.	.	.	.	.	.	.	.	.	T	28.0	4.881897	0.91740	.	.	ENSG00000125386	ENST00000509050;ENST00000382839;ENST00000324666;ENST00000545951;ENST00000502458	T;T;T;T	0.53640	0.63;1.02;0.61;0.67	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.65460	0.2693	L	0.59436	1.845	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.999;0.996;0.999	T	0.68534	-0.5383	10	0.87932	D	0	-27.2496	14.8927	0.70620	0.0:0.0:0.0:1.0	.	6;6;6;6;6	B9EGR0;E9PFA1;P78312;B7ZM85;P78312-2	.;.;F193A_HUMAN;.;.	H	6	ENSP00000372290:L6H;ENSP00000324587:L6H;ENSP00000443617:L6H;ENSP00000427505:L6H	ENSP00000324587:L6H	L	+	2	0	FAM193A	2602546	1.000000	0.71417	0.996000	0.52242	0.879000	0.50718	7.680000	0.84062	2.108000	0.64289	0.533000	0.62120	CTC	.		0.632	FAM193A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000360903.1	NM_003704	
LNX1	84708	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	54343069	54343069	+	Silent	SNP	T	T	C	rs151307935		TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr4:54343069T>C	ENST00000263925.7	-	9	2057	c.1743A>G	c.(1741-1743)acA>acG	p.T581T	LNX1_ENST00000306888.2_Silent_p.T485T|FIP1L1_ENST00000507166.1_Intron	NM_001126328.2	NP_001119800.1	Q8TBB1	LNX1_HUMAN	ligand of numb-protein X 1, E3 ubiquitin protein ligase	581	PDZ 3. {ECO:0000255|PROSITE- ProRule:PRU00143}.				protein homooligomerization (GO:0051260)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|endometrium(3)|large_intestine(11)|lung(6)|ovary(3)|urinary_tract(4)	32	all_neural(26;0.153)		GBM - Glioblastoma multiforme(3;8.2e-46)|LUSC - Lung squamous cell carcinoma(32;0.0134)			TCGAGGATGATGTTCTTTTCA	0.512																																					p.T581T		.											.	LNX1-229	0			c.A1743G						.						180.0	180.0	180.0					4																	54343069		2203	4300	6503	SO:0001819	synonymous_variant	84708	exon9			GGATGATGTTCTT	AF237782	CCDS3492.1, CCDS47057.1	4q12	2013-01-09	2012-02-23	2005-11-04	ENSG00000072201	ENSG00000072201		"""RING-type (C3HC4) zinc fingers"""	6657	protein-coding gene	gene with protein product		609732	"""ligand of numb-protein X"", ""ligand of numb-protein X 1"""	LNX		11521506, 11782429	Standard	NM_032622		Approved	MPDZ, PDZRN2	uc003hag.5	Q8TBB1	OTTHUMG00000102099	ENST00000263925.7:c.1743A>G	4.37:g.54343069T>C		Somatic	69	0		WXS	Illumina HiSeq	Phase_I	46	21	NM_001126328	0	0	1	3	2	Q4W5K7|Q8N4C2|Q96MJ7|Q9BY20	Silent	SNP	ENST00000263925.7	37	CCDS47057.1																																																																																			T|1.000;G|0.000		0.512	LNX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219934.2		
CEP135	9662	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	56876035	56876035	+	Missense_Mutation	SNP	A	A	G	rs148279836		TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr4:56876035A>G	ENST00000257287.4	+	19	2595	c.2471A>G	c.(2470-2472)cAa>cGa	p.Q824R		NM_025009.4	NP_079285.2	Q66GS9	CP135_HUMAN	centrosomal protein 135kDa	824					centriole replication (GO:0007099)|centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)	protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(26)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	50	Glioma(25;0.08)|all_neural(26;0.101)					AGAAGACTGCAAGATGACCTG	0.388																																					p.Q824R		.											.	CEP135-94	0			c.A2471G						.	A	ARG/GLN	1,4405	2.1+/-5.4	0,1,2202	83.0	82.0	82.0		2471	5.5	1.0	4	dbSNP_134	82	0,8600		0,0,4300	no	missense	CEP135	NM_025009.3	43	0,1,6502	GG,GA,AA		0.0,0.0227,0.0077	probably-damaging	824/1141	56876035	1,13005	2203	4300	6503	SO:0001583	missense	9662	exon19			GACTGCAAGATGA	AB014535	CCDS33986.1	4q12	2014-02-20	2005-12-02	2005-12-02	ENSG00000174799	ENSG00000174799			29086	protein-coding gene	gene with protein product		611423	"""KIAA0635"", ""centrosomal protein 4"""	KIAA0635, CEP4		9734811, 14654843	Standard	NM_025009		Approved	FLJ13621	uc003hbi.4	Q66GS9	OTTHUMG00000160748	ENST00000257287.4:c.2471A>G	4.37:g.56876035A>G	ENSP00000257287:p.Gln824Arg	Somatic	251	0		WXS	Illumina HiSeq	Phase_I	144	45	NM_025009	0	0	0	0	0	B2RMY0|O75130|Q58F25|Q9H8H7	Missense_Mutation	SNP	ENST00000257287.4	37	CCDS33986.1	.	.	.	.	.	.	.	.	.	.	A	23.1	4.375961	0.82682	2.27E-4	0.0	ENSG00000174799	ENST00000257287	T	0.09911	2.93	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.30854	0.0778	M	0.66939	2.045	0.58432	D	0.999998	D	0.89917	1.0	D	0.85130	0.997	T	0.01508	-1.1337	10	0.28530	T	0.3	.	15.8895	0.79286	1.0:0.0:0.0:0.0	.	824	Q66GS9	CP135_HUMAN	R	824	ENSP00000257287:Q824R	ENSP00000257287:Q824R	Q	+	2	0	CEP135	56570792	1.000000	0.71417	0.999000	0.59377	0.951000	0.60555	8.565000	0.90730	2.207000	0.71202	0.533000	0.62120	CAA	A|1.000;G|0.000		0.388	CEP135-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362092.2	NM_025009	
CEP135	9662	broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	56885619	56885619	+	Missense_Mutation	SNP	C	C	T	rs370534878		TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr4:56885619C>T	ENST00000257287.4	+	23	3237	c.3113C>T	c.(3112-3114)gCt>gTt	p.A1038V		NM_025009.4	NP_079285.2	Q66GS9	CP135_HUMAN	centrosomal protein 135kDa	1038					centriole replication (GO:0007099)|centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)	protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(26)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	50	Glioma(25;0.08)|all_neural(26;0.101)					TCATTGTTGGCTACAAACAGA	0.363																																					p.A1038V													.	CEP135-94	0			c.C3113T						.						82.0	77.0	79.0					4																	56885619		2203	4300	6503	SO:0001583	missense	9662	exon23			TGTTGGCTACAAA	AB014535	CCDS33986.1	4q12	2014-02-20	2005-12-02	2005-12-02	ENSG00000174799	ENSG00000174799			29086	protein-coding gene	gene with protein product		611423	"""KIAA0635"", ""centrosomal protein 4"""	KIAA0635, CEP4		9734811, 14654843	Standard	NM_025009		Approved	FLJ13621	uc003hbi.4	Q66GS9	OTTHUMG00000160748	ENST00000257287.4:c.3113C>T	4.37:g.56885619C>T	ENSP00000257287:p.Ala1038Val	Somatic	232	1		WXS	Illumina HiSeq	Phase_I	139	53	NM_025009	0	0	1	2	1	B2RMY0|O75130|Q58F25|Q9H8H7	Missense_Mutation	SNP	ENST00000257287.4	37	CCDS33986.1	.	.	.	.	.	.	.	.	.	.	C	12.63	1.995763	0.35226	.	.	ENSG00000174799	ENST00000257287	T	0.14022	2.54	4.96	4.12	0.48240	.	0.118380	0.56097	D	0.000024	T	0.17152	0.0412	L	0.43757	1.38	0.34364	D	0.69129	P	0.34864	0.473	B	0.42653	0.394	T	0.21655	-1.0239	10	0.29301	T	0.29	.	13.6448	0.62275	0.0:0.9246:0.0:0.0754	.	1038	Q66GS9	CP135_HUMAN	V	1038	ENSP00000257287:A1038V	ENSP00000257287:A1038V	A	+	2	0	CEP135	56580376	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.087000	0.57671	1.235000	0.43724	0.650000	0.86243	GCT	.		0.363	CEP135-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362092.2	NM_025009	
LRRC14B	389257	broad.mit.edu;bcgsc.ca	37	5	194906	194906	+	Missense_Mutation	SNP	C	C	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr5:194906C>T	ENST00000328278.3	+	2	1011	c.983C>T	c.(982-984)gCc>gTc	p.A328V	CTD-2083E4.7_ENST00000563761.1_RNA	NM_001080478.1	NP_001073947.1	A6NHZ5	LR14B_HUMAN	leucine rich repeat containing 14B	328										endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)|upper_aerodigestive_tract(2)	10						GCAGACTGTGCCCACGCTGCC	0.647																																					p.A328V													.	LRRC14B-69	0			c.C983T						.						34.0	40.0	38.0					5																	194906		2151	4252	6403	SO:0001583	missense	389257	exon2			ACTGTGCCCACGC		CCDS47184.1	5p15.33	2010-02-17			ENSG00000185028	ENSG00000185028			37268	protein-coding gene	gene with protein product							Standard	NM_001080478		Approved		uc003jal.1	A6NHZ5	OTTHUMG00000161578	ENST00000328278.3:c.983C>T	5.37:g.194906C>T	ENSP00000327675:p.Ala328Val	Somatic	133	0		WXS	Illumina HiSeq	Phase_I	69	5	NM_001080478	0	0	0	0	0		Missense_Mutation	SNP	ENST00000328278.3	37	CCDS47184.1	.	.	.	.	.	.	.	.	.	.	C	0.018	-1.469465	0.01044	.	.	ENSG00000185028	ENST00000328278	T	0.08193	3.12	5.82	-3.37	0.04898	.	1.007700	0.07960	N	0.982296	T	0.04907	0.0132	N	0.20986	0.625	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.47275	-0.9130	10	0.15952	T	0.53	.	7.6661	0.28432	0.1368:0.1683:0.0:0.6948	.	328	A6NHZ5	LR14B_HUMAN	V	328	ENSP00000327675:A328V	ENSP00000327675:A328V	A	+	2	0	LRRC14B	247906	0.013000	0.17824	0.001000	0.08648	0.145000	0.21501	0.399000	0.20916	-0.483000	0.06772	-0.367000	0.07326	GCC	.		0.647	LRRC14B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000365393.2	NM_001080478	
ANKHD1	54882	broad.mit.edu	37	5	139781730	139781730	+	Missense_Mutation	SNP	G	G	A			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr5:139781730G>A	ENST00000360839.2	+	1	332	c.178G>A	c.(178-180)Ggc>Agc	p.G60S	ANKHD1_ENST00000394723.3_Missense_Mutation_p.G60S|ANKHD1_ENST00000394722.3_Missense_Mutation_p.G60S|CTC-329D1.2_ENST00000507521.1_RNA|ANKHD1_ENST00000297183.6_Missense_Mutation_p.G60S|ANKHD1-EIF4EBP3_ENST00000532219.1_Missense_Mutation_p.G60S	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	60	Gly-rich.					cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			cggcagcagcggcggcggcgg	0.756																																					p.G60S													.	ANKHD1-185	0			c.G178A						.																																			SO:0001583	missense	54882	exon1			AGCAGCGGCGGCG	AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.178G>A	5.37:g.139781730G>A	ENSP00000354085:p.Gly60Ser	Somatic	69	1		WXS	Illumina HiSeq	Phase_I	60	3	NM_017978	0	0	0	0	0	A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Missense_Mutation	SNP	ENST00000360839.2	37	CCDS4225.1	.	.	.	.	.	.	.	.	.	.	G	14.87	2.663652	0.47572	.	.	ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000254996	ENST00000360839;ENST00000422011;ENST00000297183;ENST00000253810;ENST00000421134;ENST00000394723;ENST00000511151;ENST00000394722;ENST00000532219	T;T;T;T;T;T;T	0.66815	-0.12;-0.17;-0.14;-0.1;-0.23;-0.01;-0.17	4.8	1.98	0.26296	.	0.127893	0.34555	N	0.003870	T	0.61451	0.2348	N	0.24115	0.695	0.22366	N	0.999162	D;D;D;D;P	0.71674	0.998;0.996;0.996;0.998;0.836	D;P;P;D;B	0.65443	0.935;0.862;0.862;0.935;0.038	T	0.52586	-0.8556	10	0.17369	T	0.5	.	6.4517	0.21908	0.4177:0.0:0.5823:0.0	.	60;60;60;60;60	Q8IWZ3-5;Q8IWZ2;Q8IWZ3;Q8IWZ3-3;Q8IWZ3-2	.;.;ANKH1_HUMAN;.;.	S	60;74;60;60;60;60;60;60;60	ENSP00000354085:G60S;ENSP00000297183:G60S;ENSP00000394489:G60S;ENSP00000378212:G60S;ENSP00000421069:G60S;ENSP00000378211:G60S;ENSP00000432016:G60S	ENSP00000432016:G60S	G	+	1	0	ANKHD1-EIF4EBP3;ANKHD1	139761914	0.926000	0.31397	0.971000	0.41717	0.367000	0.29736	0.608000	0.24223	0.224000	0.20940	0.505000	0.49811	GGC	.		0.756	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000251672.1	NM_017747	
ECI2	10455	bcgsc.ca	37	6	4133832	4133832	+	Missense_Mutation	SNP	T	T	C			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr6:4133832T>C	ENST00000380118.3	-	2	200	c.164A>G	c.(163-165)aAg>aGg	p.K55R	ECI2_ENST00000361538.2_Missense_Mutation_p.K25R|RP3-400B16.1_ENST00000427049.2_lincRNA|RP3-400B16.4_ENST00000527831.1_RNA|ECI2_ENST00000380125.2_Missense_Mutation_p.K25R|ECI2_ENST00000465828.1_Missense_Mutation_p.K25R|ECI2_ENST00000413766.2_5'UTR			O75521	ECI2_HUMAN	enoyl-CoA delta isomerase 2	55	ACB. {ECO:0000255|PROSITE- ProRule:PRU00573}.				fatty acid catabolic process (GO:0009062)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	dodecenoyl-CoA delta-isomerase activity (GO:0004165)|fatty-acyl-CoA binding (GO:0000062)|receptor binding (GO:0005102)			endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	11						TCCTGGATCCTTTTTCAAGAG	0.398																																					p.K55R													.	ECI2-90	0			c.A164G						.						217.0	201.0	206.0					6																	4133832		2203	4300	6503	SO:0001583	missense	10455	exon2			GGATCCTTTTTCA	AF069301	CCDS4490.1, CCDS43420.1, CCDS43420.2	6p24.3	2011-03-15	2011-03-15	2011-03-15	ENSG00000198721	ENSG00000198721			14601	protein-coding gene	gene with protein product	"""acyl-Coenzyme A binding domain containing 2"", "" Hepatocellular carcinoma-associated antigen 88"""	608024	"""peroxisomal D3,D2-enoyl-CoA isomerase"""	PECI		10419495	Standard	NM_206836		Approved	ACBD2, DRS1, HCA88	uc003mwf.3	O75521	OTTHUMG00000014158	ENST00000380118.3:c.164A>G	6.37:g.4133832T>C	ENSP00000369461:p.Lys55Arg	Somatic	164	1		WXS	Illumina HiSeq	Phase_1	129	5	NM_206836	0	0	5	5	0	Q5JYK5|Q5JYK7|Q7L124|Q8N0X0|Q9BUE9|Q9H0T9|Q9NQH1|Q9NYH7|Q9UN55	Missense_Mutation	SNP	ENST00000380118.3	37	CCDS43420.2	.	.	.	.	.	.	.	.	.	.	T	21.7	4.191753	0.78902	.	.	ENSG00000198721	ENST00000380118;ENST00000380125;ENST00000361538;ENST00000465828;ENST00000495548	T;T;T;T;T	0.24908	1.83;1.83;1.83;1.83;1.83	5.98	5.98	0.97165	FERM/acyl-CoA-binding protein, 3-helical bundle (1);Acyl-CoA-binding protein, ACBP (4);	21.516500	0.00166	N	0.000000	T	0.31796	0.0808	M	0.78223	2.4	0.80722	D	1	B	0.20988	0.05	B	0.35899	0.213	T	0.34850	-0.9812	10	0.54805	T	0.06	.	14.4143	0.67139	0.0:0.0:0.0:1.0	.	55	O75521	ECI2_HUMAN	R	55;25;25;25;102	ENSP00000369461:K55R;ENSP00000369468:K25R;ENSP00000354737:K25R;ENSP00000420309:K25R;ENSP00000417459:K102R	ENSP00000354737:K25R	K	-	2	0	ECI2	4078831	0.659000	0.27411	0.999000	0.59377	0.997000	0.91878	3.003000	0.49505	2.289000	0.77006	0.533000	0.62120	AAG	.		0.398	ECI2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039716.4	NM_006117	
DNAH8	1769	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	38825504	38825504	+	Missense_Mutation	SNP	A	A	G			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr6:38825504A>G	ENST00000359357.3	+	40	5547	c.5293A>G	c.(5293-5295)Att>Gtt	p.I1765V	DNAH8_ENST00000449981.2_Missense_Mutation_p.I1982V|DNAH8_ENST00000441566.1_Missense_Mutation_p.I1765V			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	1765					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						TCAGAGAGATATTTTTGATGA	0.308																																					p.I1982V		.											.	DNAH8-615	0			c.A5944G						.						110.0	106.0	107.0					6																	38825504		2203	4300	6503	SO:0001583	missense	1769	exon42			AGAGATATTTTTG	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.5293A>G	6.37:g.38825504A>G	ENSP00000352312:p.Ile1765Val	Somatic	130	0		WXS	Illumina HiSeq	Phase_I	111	53	NM_001206927	0	0	0	0	0	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	37		.	.	.	.	.	.	.	.	.	.	A	21.7	4.181365	0.78677	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.20332	2.09;2.09;2.08	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.21590	0.0520	L	0.46670	1.46	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.06862	-1.0803	10	0.02654	T	1	.	16.0707	0.80928	1.0:0.0:0.0:0.0	.	1765	Q96JB1	DYH8_HUMAN	V	1970;1970;1765;1765	ENSP00000333363:I1970V;ENSP00000352312:I1765V;ENSP00000402294:I1765V	ENSP00000333363:I1970V	I	+	1	0	DNAH8	38933482	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.271000	0.95698	2.194000	0.70268	0.533000	0.62120	ATT	.		0.308	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
FBXO5	26271	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	153293427	153293427	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr6:153293427G>A	ENST00000229758.3	-	4	1130	c.1072C>T	c.(1072-1074)Cga>Tga	p.R358*	FBXO5_ENST00000367241.3_Nonsense_Mutation_p.R312*|FBXO5_ENST00000477822.1_5'UTR	NM_012177.3	NP_036309.1	Q9UKT4	FBX5_HUMAN	F-box protein 5	358					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|G1/S transition of mitotic cell cycle (GO:0000082)|inhibition of mitotic anaphase-promoting complex activity (GO:0060565)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|microtubule polymerization (GO:0046785)|mitotic cell cycle (GO:0000278)|negative regulation of meiosis (GO:0045835)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|oocyte maturation (GO:0001556)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|spindle assembly involved in female meiosis I (GO:0007057)|vesicle organization (GO:0016050)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)	15		Ovarian(120;0.125)		OV - Ovarian serous cystadenocarcinoma(155;4.38e-10)|BRCA - Breast invasive adenocarcinoma(81;0.0893)		TCATTGTGTCGACTATAAGTA	0.333																																					p.R358X	NSCLC(121;372 1757 17721 17977 29669)												.	FBXO5-658	0			c.C1072T						.						100.0	97.0	98.0					6																	153293427		2203	4300	6503	SO:0001587	stop_gained	26271	exon4			TGTGTCGACTATA	AF129535	CCDS5242.1, CCDS47501.1	6q25-q26	2008-02-05	2004-06-15		ENSG00000112029	ENSG00000112029		"""F-boxes /  ""other"""""	13584	protein-coding gene	gene with protein product		606013	"""F-box only protein 5"""			10531035, 10531037	Standard	NM_012177		Approved	FBX5, Fbxo31, EMI1	uc003qpg.3	Q9UKT4	OTTHUMG00000015854	ENST00000229758.3:c.1072C>T	6.37:g.153293427G>A	ENSP00000229758:p.Arg358*	Somatic	135	2		WXS	Illumina HiSeq	Phase_I	86	32	NM_012177	0	0	1	1	0	B3KNX5|Q5TF47|Q8WV29|Q9UGC8	Nonsense_Mutation	SNP	ENST00000229758.3	37	CCDS5242.1	.	.	.	.	.	.	.	.	.	.	G	37	6.362282	0.97507	.	.	ENSG00000112029	ENST00000229758;ENST00000367241	.	.	.	5.75	5.75	0.90469	.	0.614218	0.15057	N	0.282948	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.7102	13.8697	0.63610	0.0:0.0:0.7458:0.2542	.	.	.	.	X	358;312	.	ENSP00000229758:R358X	R	-	1	2	FBXO5	153335120	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.898000	0.48672	2.696000	0.92011	0.655000	0.94253	CGA	.		0.333	FBXO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042757.1		
EZR	7430	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	159188095	159188095	+	Missense_Mutation	SNP	G	G	C	rs367907031		TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr6:159188095G>C	ENST00000367075.3	-	14	1780	c.1612C>G	c.(1612-1614)Ctg>Gtg	p.L538V	EZR_ENST00000337147.7_Missense_Mutation_p.L538V|EZR_ENST00000392177.4_Missense_Mutation_p.L506V|MIR3918_ENST00000581555.1_RNA	NM_001111077.1	NP_001104547.1	P15311	EZRI_HUMAN	ezrin	538	Interaction with SCYL3.				actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of endothelial barrier (GO:0061028)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|filopodium assembly (GO:0046847)|leukocyte cell-cell adhesion (GO:0007159)|membrane to membrane docking (GO:0022614)|positive regulation of gene expression (GO:0010628)|receptor internalization (GO:0031623)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|astrocyte projection (GO:0097449)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell tip (GO:0051286)|ciliary basal body (GO:0036064)|cortical cytoskeleton (GO:0030863)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|microspike (GO:0044393)|microvillus (GO:0005902)|microvillus membrane (GO:0031528)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|Schwann cell microvillus (GO:0097454)|T-tubule (GO:0030315)|uropod (GO:0001931)|vesicle (GO:0031982)	actin filament binding (GO:0051015)|cell adhesion molecule binding (GO:0050839)|poly(A) RNA binding (GO:0044822)		EZR/ROS1(4)	breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)	15		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-17)|BRCA - Breast invasive adenocarcinoma(81;6.58e-06)		GCCTGGGACAGCTCGCTGCTC	0.562			T	ROS1	NSCLC																																p.L538V		.		Dom	yes		6	6q25.3	7430	ezrin		E	.	EZR-70	0			c.C1612G						.						180.0	157.0	165.0					6																	159188095		2203	4300	6503	SO:0001583	missense	7430	exon13			GGGACAGCTCGCT	AF187552	CCDS5258.1	6q25.3	2010-12-10	2007-11-29	2007-11-29	ENSG00000092820	ENSG00000092820		"""A-kinase anchor proteins"""	12691	protein-coding gene	gene with protein product	"""cytovillin 2"""	123900	"""villin 2 (ezrin)"""	VIL2			Standard	NM_003379		Approved		uc003qrt.4	P15311	OTTHUMG00000015917	ENST00000367075.3:c.1612C>G	6.37:g.159188095G>C	ENSP00000356042:p.Leu538Val	Somatic	89	0		WXS	Illumina HiSeq	Phase_I	95	32	NM_003379	0	0	203	377	174	E1P5A8|P23714|Q4VX75|Q96CU8|Q9NSJ4	Missense_Mutation	SNP	ENST00000367075.3	37	CCDS5258.1	.	.	.	.	.	.	.	.	.	.	G	19.03	3.747324	0.69533	.	.	ENSG00000092820	ENST00000337147;ENST00000367075;ENST00000392177	D;D;D	0.88586	-2.4;-2.4;-2.4	5.37	0.447	0.16608	Moesin (1);Ezrin/radixin/moesin, C-terminal (1);	0.067471	0.64402	D	0.000011	D	0.92074	0.7488	M	0.87617	2.895	0.58432	D	0.999996	D;D	0.71674	0.998;0.989	D;D	0.75484	0.986;0.976	D	0.91442	0.5174	10	0.87932	D	0	.	9.9553	0.41663	0.3142:0.0:0.6858:0.0	.	506;538	E7EQR4;P15311	.;EZRI_HUMAN	V	538;538;506	ENSP00000338934:L538V;ENSP00000356042:L538V;ENSP00000376016:L506V	ENSP00000338934:L538V	L	-	1	2	EZR	159108083	1.000000	0.71417	0.995000	0.50966	0.980000	0.70556	3.249000	0.51437	0.007000	0.14760	0.561000	0.74099	CTG	.		0.562	EZR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042878.1	NM_003379	
TBP	6908	hgsc.bcm.edu	37	6	170871004	170871004	+	Silent	SNP	G	G	A			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr6:170871004G>A	ENST00000392092.2	+	3	459	c.180G>A	c.(178-180)caG>caA	p.Q60Q	TBP_ENST00000540980.1_Silent_p.Q40Q|TBP_ENST00000230354.6_Silent_p.Q60Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	60	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		Ggcagcagcagcaacaacaac	0.542																																					p.Q60Q		.											.	TBP-91	0			c.G180A						.						43.0	45.0	44.0					6																	170871004		2203	4300	6503	SO:0001819	synonymous_variant	6908	exon3			GCAGCAGCAACAA	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.180G>A	6.37:g.170871004G>A		Somatic	47	0		WXS	Illumina HiSeq	Phase_I	41	5	NM_003194	0	0	3	3	0	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	ENST00000392092.2	37	CCDS5315.1																																																																																			.		0.542	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194	
DNAH11	8701	broad.mit.edu	37	7	21788203	21788203	+	Missense_Mutation	SNP	G	G	A			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr7:21788203G>A	ENST00000409508.3	+	52	8547	c.8516G>A	c.(8515-8517)cGc>cAc	p.R2839H	DNAH11_ENST00000328843.6_Missense_Mutation_p.R2846H	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2846	AAA 4. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						CTCAGGTGTCGCATCAGCCGG	0.493									Kartagener syndrome																												.													.	DNAH11-146	0			.						.						50.0	50.0	50.0					7																	21788203		1924	4134	6058	SO:0001583	missense	8701	.	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	GGTGTCGCATCAG	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.8516G>A	7.37:g.21788203G>A	ENSP00000475939:p.Arg2839His	Somatic	99	1		WXS	Illumina HiSeq	Phase_I	69	3	.	0	0	0	0	0	Q9UJ82	Missense_Mutation	SNP	ENST00000409508.3	37		.	.	.	.	.	.	.	.	.	.	G	16.53	3.147816	0.57151	.	.	ENSG00000105877	ENST00000328843	T	0.48836	0.8	5.7	5.7	0.88788	Dynein heavy chain, P-loop containing D4 domain (1);	0.000000	0.64402	D	0.000016	T	0.69314	0.3097	.	.	.	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.71056	-0.4703	9	0.56958	D	0.05	.	15.0327	0.71720	0.0699:0.0:0.9301:0.0	.	2846	Q96DT5	DYH11_HUMAN	H	2846	ENSP00000330671:R2846H	ENSP00000330671:R2846H	R	+	2	0	DNAH11	21754728	1.000000	0.71417	0.863000	0.33907	0.063000	0.16089	6.315000	0.72853	2.705000	0.92388	0.650000	0.86243	CGC	.		0.493	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	NM_003777	
ZNF273	10793	bcgsc.ca	37	7	64389216	64389216	+	Missense_Mutation	SNP	C	C	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr7:64389216C>T	ENST00000476120.1	+	4	1581	c.1510C>T	c.(1510-1512)Cat>Tat	p.H504Y	ZNF273_ENST00000527278.1_3'UTR|ZNF273_ENST00000319636.5_Missense_Mutation_p.H439Y	NM_021148.2	NP_066971.2	Q14593	ZN273_HUMAN	zinc finger protein 273	504					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Lung NSC(55;0.0295)|all_lung(88;0.0691)				TCTTACTAAACATAAGAGAAT	0.383																																					p.H504Y	Ovarian(154;605 895 6696 7659 15316 19321 21716 23848 32322 36932)												.	ZNF273-90	0			c.C1510T						.						48.0	50.0	49.0					7																	64389216		2203	4297	6500	SO:0001583	missense	10793	exon4			ACTAAACATAAGA	X78932	CCDS5528.2	7q11.21	2013-01-08				ENSG00000198039		"""Zinc fingers, C2H2-type"", ""-"""	13067	protein-coding gene	gene with protein product		604756				7865130	Standard	NR_003099		Approved	HZF9	uc003tto.3	Q14593		ENST00000476120.1:c.1510C>T	7.37:g.64389216C>T	ENSP00000418719:p.His504Tyr	Somatic	79	0		WXS	Illumina HiSeq	Phase_1	69	10	NM_021148	0	0	5	5	0	B3KQZ5|Q6P3V4	Missense_Mutation	SNP	ENST00000476120.1	37	CCDS5528.2	.	.	.	.	.	.	.	.	.	.	.	19.11	3.764673	0.69878	.	.	ENSG00000198039	ENST00000476120;ENST00000319636	D;D	0.86769	-2.17;-2.17	1.16	1.16	0.20824	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.94301	0.8169	H	0.95328	3.655	0.26486	N	0.975022	D	0.89917	1.0	D	0.87578	0.998	D	0.85433	0.1150	9	0.72032	D	0.01	.	7.3527	0.26700	0.0:1.0:0.0:0.0	.	504	Q14593	ZN273_HUMAN	Y	504;439	ENSP00000418719:H504Y;ENSP00000324518:H439Y	ENSP00000324518:H439Y	H	+	1	0	ZNF273	64026651	0.997000	0.39634	0.806000	0.32338	0.805000	0.45488	5.366000	0.66122	0.202000	0.20498	0.205000	0.17691	CAT	.		0.383	ZNF273-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313502.1		
AUTS2	26053	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	70255844	70255844	+	Silent	SNP	A	A	G			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr7:70255844A>G	ENST00000342771.4	+	19	3963	c.3642A>G	c.(3640-3642)acA>acG	p.T1214T	AUTS2_ENST00000406775.2_Silent_p.T1190T	NM_015570.2	NP_056385.1	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2	1214										breast(2)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	50		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		CCCCTCCGACAGCAGCGCTGA	0.672																																					p.T1214T		.											.	AUTS2-92	0			c.A3642G						.						41.0	45.0	43.0					7																	70255844		2203	4299	6502	SO:0001819	synonymous_variant	26053	exon19			TCCGACAGCAGCG	AF326917	CCDS5539.1, CCDS47601.1, CCDS47602.1	7q11.22	2014-01-06			ENSG00000158321	ENSG00000158321			14262	protein-coding gene	gene with protein product		607270				12160723	Standard	XM_005250257		Approved	KIAA0442, FBRSL2	uc003tvw.4	Q8WXX7	OTTHUMG00000023865	ENST00000342771.4:c.3642A>G	7.37:g.70255844A>G		Somatic	80	0		WXS	Illumina HiSeq	Phase_I	106	30	NM_015570	0	0	0	0	0	A4D1Y9|L7QET3|L7QF75|Q5D049|Q6PJU5|Q9Y4F2	Silent	SNP	ENST00000342771.4	37	CCDS5539.1																																																																																			.		0.672	AUTS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251971.2		
GTF2IRD2	84163	broad.mit.edu	37	7	74211898	74211898	+	Missense_Mutation	SNP	G	G	C			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr7:74211898G>C	ENST00000405086.2	-	16	2142	c.1953C>G	c.(1951-1953)atC>atG	p.I651M	GTF2IRD2_ENST00000451013.2_Missense_Mutation_p.I198M	NM_173537.2	NP_775808	Q86UP8	GTD2A_HUMAN	GTF2I repeat domain containing 2	651					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(3)|large_intestine(2)|lung(2)|ovary(2)|skin(1)	11						ttatacaacagatggacttca	0.532																																					p.I651M	NSCLC(40;560 1096 7501 40315 49546)												.	GTF2IRD2-23	0			c.C1953G						.						4.0	5.0	5.0					7																	74211898		1559	3279	4838	SO:0001583	missense	84163	exon16			ACAACAGATGGAC	BC047706	CCDS5576.1, CCDS64682.1	7q11.23	2014-05-06			ENSG00000196275	ENSG00000196275			30775	protein-coding gene	gene with protein product	"""transcription factor GTF2IRD2"""	608899				15243160	Standard	NM_173537		Approved	FLJ37938, GTF2IRD2A	uc003ubd.1	Q86UP8	OTTHUMG00000181527	ENST00000405086.2:c.1953C>G	7.37:g.74211898G>C	ENSP00000385491:p.Ile651Met	Somatic	365	0		WXS	Illumina HiSeq	Phase_I	434	85	NM_173537	0	1	13	16	2	A8K5W6|B3KUZ2|Q69G40|Q6EKI8|Q6EKI9|Q6NVW2|Q6P7N8|Q86WX4|Q8ND85|Q8NDE5	Missense_Mutation	SNP	ENST00000405086.2	37	CCDS5576.1	.	.	.	.	.	.	.	.	.	.	G	0.013	-1.616433	0.00828	.	.	ENSG00000196275	ENST00000405086;ENST00000451013	T;T	0.28255	1.62;1.62	1.74	-2.06	0.07298	Ribonuclease H-like (1);	.	.	.	.	T	0.20861	0.0502	L	0.35542	1.07	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.22800	-1.0206	9	0.33940	T	0.23	-2.7586	9.9695	0.41745	0.0:0.2899:0.7101:0.0	.	651	Q86UP8	GTD2A_HUMAN	M	651;198	ENSP00000385491:I651M;ENSP00000406723:I198M	ENSP00000385491:I651M	I	-	3	3	GTF2IRD2	73849834	0.000000	0.05858	0.005000	0.12908	0.021000	0.10359	-3.493000	0.00452	-0.542000	0.06249	-0.580000	0.04137	ATC	.		0.532	GTF2IRD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252712.3	NM_173537	
NCF1C	654817	broad.mit.edu	37	7	74573095	74573095	+	IGR	SNP	G	G	A			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr7:74573095G>A								GTF2IRD2B (7472 upstream) : Y_RNA (139751 downstream)																							GGCCGCGCCTGGCGGCGTCGC	0.716																																					.													.	.	0			.						.																																			SO:0001628	intergenic_variant	654817	.			GCGCCTGGCGGCG																													7.37:g.74573095G>A		Somatic	89	0		WXS	Illumina HiSeq	Phase_I	81	19	.	0	0	61	61	0		RNA	SNP		37																																																																																				.	0	0.716								
NUP205	23165	broad.mit.edu	37	7	135307641	135307641	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr7:135307641C>T	ENST00000285968.6	+	31	4473	c.4447C>T	c.(4447-4449)Cga>Tga	p.R1483*		NM_015135.2	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	1483					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)	p.R1483*(1)		breast(4)|central_nervous_system(2)|endometrium(9)|kidney(7)|large_intestine(17)|liver(4)|lung(36)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	93						AGTGGTCTGTCGAGATGCTTG	0.383																																					p.R1483X													.	NUP205-207	1	Substitution - Nonsense(1)	lung(1)	c.C4447T						.						98.0	95.0	96.0					7																	135307641		2203	4300	6503	SO:0001587	stop_gained	23165	exon31			GTCTGTCGAGATG	D86978	CCDS34759.1	7q31.32	2007-03-26	2004-01-06	2004-01-07	ENSG00000155561	ENSG00000155561			18658	protein-coding gene	gene with protein product		614352	"""chromosome 7 open reading frame 14"""	C7orf14		9039502, 9348540	Standard	NM_015135		Approved	KIAA0225	uc003vsw.3	Q92621	OTTHUMG00000155497	ENST00000285968.6:c.4447C>T	7.37:g.135307641C>T	ENSP00000285968:p.Arg1483*	Somatic	143	0		WXS	Illumina HiSeq	Phase_I	152	6	NM_015135	0	0	4	4	0	A6H8X3|Q86YC1	Nonsense_Mutation	SNP	ENST00000285968.6	37	CCDS34759.1	.	.	.	.	.	.	.	.	.	.	C	44	10.870996	0.99481	.	.	ENSG00000155561	ENST00000285968	.	.	.	4.83	3.93	0.45458	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-33.0615	14.5921	0.68373	0.1474:0.8526:0.0:0.0	.	.	.	.	X	1483	.	ENSP00000285968:R1483X	R	+	1	2	NUP205	134958181	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.263000	0.43293	1.129000	0.42072	-0.293000	0.09583	CGA	.		0.383	NUP205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340358.1		
RP1L1	94137	broad.mit.edu	37	8	10470455	10470455	+	Missense_Mutation	SNP	G	G	A			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr8:10470455G>A	ENST00000382483.3	-	4	1376	c.1153C>T	c.(1153-1155)Cgg>Tgg	p.R385W		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	385					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		CTGCAGGGCCGGGGTCCCCAC	0.657																																					p.R385W													.	RP1L1-139	0			c.C1153T						.						43.0	49.0	47.0					8																	10470455		1876	4098	5974	SO:0001583	missense	94137	exon4			AGGGCCGGGGTCC	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.1153C>T	8.37:g.10470455G>A	ENSP00000371923:p.Arg385Trp	Somatic	65	0		WXS	Illumina HiSeq	Phase_I	43	3	NM_178857	0	0	0	0	0	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	CCDS43708.1	.	.	.	.	.	.	.	.	.	.	G	15.20	2.762894	0.49574	.	.	ENSG00000183638	ENST00000382483	T	0.04275	3.66	4.78	-0.522	0.11928	.	0.688275	0.11554	U	0.552455	T	0.07413	0.0187	N	0.22421	0.69	0.09310	N	1	D	0.89917	1.0	P	0.61328	0.887	T	0.35847	-0.9772	10	0.62326	D	0.03	-5.29	5.6606	0.17667	0.0:0.1827:0.5552:0.2621	.	385	A6NKC6	.	W	385	ENSP00000371923:R385W	ENSP00000371923:R385W	R	-	1	2	RP1L1	10507865	0.000000	0.05858	0.000000	0.03702	0.038000	0.13279	0.052000	0.14163	0.116000	0.18110	-0.479000	0.04858	CGG	.		0.657	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1		
MTFR1	9650	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	66617127	66617127	+	Missense_Mutation	SNP	A	A	C			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr8:66617127A>C	ENST00000262146.4	+	5	606	c.480A>C	c.(478-480)aaA>aaC	p.K160N	MTFR1_ENST00000517944.1_3'UTR|MTFR1_ENST00000458689.2_Missense_Mutation_p.K127N	NM_014637.3	NP_055452.3	Q15390	MTFR1_HUMAN	mitochondrial fission regulator 1	160					aerobic respiration (GO:0009060)|mitochondrial fission (GO:0000266)|mitochondrion organization (GO:0007005)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(1)|pancreas(1)|urinary_tract(1)	11			Epithelial(68;0.0526)|BRCA - Breast invasive adenocarcinoma(89;0.156)|all cancers(69;0.171)|OV - Ovarian serous cystadenocarcinoma(28;0.194)			AGATTGCCAAAATTGTGACCC	0.458																																					p.K160N		.											.	MTFR1-91	0			c.A480C						.						27.0	28.0	27.0					8																	66617127		2203	4300	6503	SO:0001583	missense	9650	exon5			TGCCAAAATTGTG		CCDS6182.1, CCDS55240.1	8q13.1	2012-11-30							29510	protein-coding gene	gene with protein product	"""likely ortholog of chicken chondrocyte protein with a poly proline region"""					7584026, 7584028, 15389597	Standard	NM_014637		Approved	CHPPR, KIAA0009, FAM54A2	uc003xvn.2	Q15390		ENST00000262146.4:c.480A>C	8.37:g.66617127A>C	ENSP00000262146:p.Lys160Asn	Somatic	122	0		WXS	Illumina HiSeq	Phase_I	127	51	NM_014637	0	0	0	0	0	E7EP84|Q6IB94|Q7Z669|Q86XH5|Q8IVD7	Missense_Mutation	SNP	ENST00000262146.4	37	CCDS6182.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.72|19.72	3.879273|3.879273	0.72294|0.72294	.|.	.|.	ENSG00000066855|ENSG00000066855	ENST00000518609;ENST00000262146;ENST00000458689|ENST00000518800	T;T|T	0.50813|0.49432	0.73;0.73|0.78	5.24|5.24	1.59|1.59	0.23543|0.23543	.|.	0.095465|0.095465	0.64402|0.64402	D|D	0.000001|0.000001	T|T	0.59932|0.59932	0.2230|0.2230	M|M	0.84683|0.84683	2.71|2.71	0.44789|0.44789	D|D	0.997793|0.997793	P;D;D;D|.	0.76494|.	0.947;0.992;0.998;0.999|.	P;D;D;D|.	0.74674|.	0.905;0.954;0.94;0.984|.	T|T	0.56044|0.56044	-0.8044|-0.8044	10|8	0.42905|0.41790	T|T	0.14|0.15	-28.337|-28.337	7.9704|7.9704	0.30124|0.30124	0.6814:0.0:0.3186:0.0|0.6814:0.0:0.3186:0.0	.|.	160;144;127;160|.	B4E3G8;E5RJS5;E7EP84;Q15390|.	.;.;.;MTFR1_HUMAN|.	N|T	144;160;127|118	ENSP00000262146:K160N;ENSP00000391502:K127N|ENSP00000430621:K118T	ENSP00000262146:K160N|ENSP00000430621:K118T	K|K	+|+	3|2	2|0	MTFR1|MTFR1	66779681|66779681	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.987000|0.987000	0.75469|0.75469	1.601000|1.601000	0.36773|0.36773	0.035000|0.035000	0.15519|0.15519	0.460000|0.460000	0.39030|0.39030	AAA|AAA	.		0.458	MTFR1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378894.1	NM_014637	
SULF1	23213	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	70488224	70488224	+	Missense_Mutation	SNP	C	C	G			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr8:70488224C>G	ENST00000260128.4	+	6	909	c.192C>G	c.(190-192)aaC>aaG	p.N64K	SULF1_ENST00000419716.3_Missense_Mutation_p.N64K|SULF1_ENST00000458141.2_Missense_Mutation_p.N64K|SULF1_ENST00000402687.4_Missense_Mutation_p.N64K	NM_015170.2	NP_055985.2	Q8IWU6	SULF1_HUMAN	sulfatase 1	64					apoptotic process (GO:0006915)|bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of prostatic bud formation (GO:0060686)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|central_nervous_system(3)|endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			AAGTCATGAACAAAACGAGAA	0.522																																					p.N64K		.											.	SULF1-518	0			c.C192G						.						80.0	67.0	71.0					8																	70488224		2203	4300	6503	SO:0001583	missense	23213	exon6			CATGAACAAAACG	AB029000	CCDS6204.1	8q13.2	2014-09-11			ENSG00000137573	ENSG00000137573			20391	protein-coding gene	gene with protein product		610012				12368295	Standard	NM_015170		Approved	KIAA1077, SULF-1	uc003xyd.2	Q8IWU6	OTTHUMG00000164466	ENST00000260128.4:c.192C>G	8.37:g.70488224C>G	ENSP00000260128:p.Asn64Lys	Somatic	91	0		WXS	Illumina HiSeq	Phase_I	89	33	NM_001128205	0	0	0	0	0	Q86YV8|Q8NCA2|Q9UPS5	Missense_Mutation	SNP	ENST00000260128.4	37	CCDS6204.1	.	.	.	.	.	.	.	.	.	.	C	11.47	1.648999	0.29336	.	.	ENSG00000137573	ENST00000458141;ENST00000260128;ENST00000529134;ENST00000402687;ENST00000419716;ENST00000528783;ENST00000525999	D;D;D;D;D;T;D	0.96265	-3.96;-3.96;-3.23;-3.96;-3.96;0.86;-3.96	5.23	2.96	0.34315	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.93861	0.8036	M	0.67397	2.05	0.53688	D	0.999974	B	0.06786	0.001	B	0.10450	0.005	D	0.89996	0.4111	10	0.22109	T	0.4	.	10.5049	0.44828	0.0:0.7019:0.0:0.2981	.	64	Q8IWU6	SULF1_HUMAN	K	64	ENSP00000403040:N64K;ENSP00000260128:N64K;ENSP00000432178:N64K;ENSP00000385704:N64K;ENSP00000390315:N64K;ENSP00000436949:N64K;ENSP00000431753:N64K	ENSP00000260128:N64K	N	+	3	2	SULF1	70650778	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.135000	0.31454	1.123000	0.41961	0.650000	0.86243	AAC	.		0.522	SULF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378885.2	NM_015170	
CSMD3	114788	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	114326898	114326898	+	Missense_Mutation	SNP	A	A	C			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr8:114326898A>C	ENST00000297405.5	-	2	547	c.303T>G	c.(301-303)aaT>aaG	p.N101K	CSMD3_ENST00000455883.2_Missense_Mutation_p.N101K|CSMD3_ENST00000343508.3_Missense_Mutation_p.N61K|CSMD3_ENST00000352409.3_Missense_Mutation_p.N101K	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	101	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.N101N(1)|p.N61N(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TTTGTATTCTATTTCGTTCTT	0.353										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.N101K		.											.	CSMD3-1132	2	Substitution - coding silent(2)	lung(2)	c.T303G						.						171.0	162.0	165.0					8																	114326898		2203	4300	6503	SO:0001583	missense	114788	exon2			TATTCTATTTCGT	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.303T>G	8.37:g.114326898A>C	ENSP00000297405:p.Asn101Lys	Somatic	136	0		WXS	Illumina HiSeq	Phase_I	131	52	NM_052900	0	0	0	0	0	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	A	14.73	2.621352	0.46736	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000455883;ENST00000352409	T;T;T;T	0.27256	1.68;1.68;1.68;1.68	5.72	3.38	0.38709	CUB (5);	0.077066	0.47455	D	0.000223	T	0.24699	0.0599	L	0.28740	0.885	0.28547	N	0.911799	P;P;D;P;B	0.69078	0.827;0.93;0.997;0.77;0.395	B;P;P;B;B	0.61132	0.275;0.526;0.884;0.253;0.341	T	0.09796	-1.0658	10	0.09338	T	0.73	.	4.6113	0.12404	0.5913:0.0:0.4087:0.0	.	101;101;101;101;61	Q7Z407-3;Q7Z407-4;Q7Z407-5;Q7Z407;Q7Z407-2	.;.;.;CSMD3_HUMAN;.	K	61;101;101;101	ENSP00000345799:N61K;ENSP00000297405:N101K;ENSP00000412263:N101K;ENSP00000343124:N101K	ENSP00000297405:N101K	N	-	3	2	CSMD3	114396074	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.778000	0.55371	0.998000	0.38996	0.455000	0.32223	AAT	.		0.353	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
MLLT3	4300	broad.mit.edu	37	9	20414280	20414280	+	Silent	SNP	G	G	A			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr9:20414280G>A	ENST00000380338.4	-	5	850	c.564C>T	c.(562-564)agC>agT	p.S188S	MLLT3_ENST00000429426.2_Silent_p.S185S|MLLT3_ENST00000475957.1_5'UTR|MLLT3_ENST00000355930.6_5'UTR	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	188	Poly-Ser.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)		p.S188S(1)		central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		TGGTActactgctgctgctgc	0.502			T	MLL	ALL																																p.S188S				Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	.	MLLT3-660	1	Substitution - coding silent(1)	large_intestine(1)	c.C564T						.						77.0	84.0	82.0					9																	20414280		2203	4300	6503	SO:0001819	synonymous_variant	4300	exon5			ACTACTGCTGCTG	L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.564C>T	9.37:g.20414280G>A		Somatic	109	1		WXS	Illumina HiSeq	Phase_I	101	5	NM_004529	0	0	0	0	0	B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Silent	SNP	ENST00000380338.4	37	CCDS6494.1																																																																																			.		0.502	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051872.1	NM_004529	
SIGMAR1	10280	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	34637563	34637563	+	Missense_Mutation	SNP	C	C	G			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr9:34637563C>G	ENST00000277010.4	-	1	205	c.132G>C	c.(130-132)caG>caC	p.Q44H	SIGMAR1_ENST00000477726.1_Missense_Mutation_p.Q44H|SIGMAR1_ENST00000461426.1_5'UTR|SIGMAR1_ENST00000378892.1_5'UTR	NM_001282208.1|NM_005866.2	NP_001269137.1|NP_005857.1	Q99720	SGMR1_HUMAN	sigma non-opioid intracellular receptor 1	44					cell death (GO:0008219)|lipid transport (GO:0006869)|nervous system development (GO:0007399)|regulation of neuron apoptotic process (GO:0043523)	cell junction (GO:0030054)|cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lipid particle (GO:0005811)|nuclear envelope (GO:0005635)	drug binding (GO:0008144)|opioid receptor activity (GO:0004985)			large_intestine(1)|lung(1)	2					Amitriptyline(DB00321)|Dextromethorphan(DB00514)|Nortriptyline(DB00540)|Pentazocine(DB00652)|Remoxipride(DB00409)	GCCGCGCCAACTGCGCTATCT	0.701																																					p.Q44H		.											.	SIGMAR1-90	0			c.G132C						.						15.0	18.0	17.0					9																	34637563		2195	4292	6487	SO:0001583	missense	10280	exon1			CGCCAACTGCGCT	BC004899	CCDS6562.1, CCDS6563.1	9p13.3	2008-12-18	2008-12-18	2008-12-18	ENSG00000147955	ENSG00000147955			8157	protein-coding gene	gene with protein product		601978	"""opioid receptor, sigma 1"""	OPRS1		8954936, 9453537	Standard	NM_005866		Approved	SR-BP1	uc003zvb.3	Q99720	OTTHUMG00000019829	ENST00000277010.4:c.132G>C	9.37:g.34637563C>G	ENSP00000277010:p.Gln44His	Somatic	37	0		WXS	Illumina HiSeq	Phase_I	33	7	NM_005866	0	0	4	4	0	D3DRM7|O00673|O00725|Q0Z9W6|Q153Z1|Q2TSD1|Q53GN2|Q7Z653|Q8N7H3|Q9NYX0	Missense_Mutation	SNP	ENST00000277010.4	37	CCDS6562.1	.	.	.	.	.	.	.	.	.	.	C	14.79	2.641021	0.47153	.	.	ENSG00000147955	ENST00000277010;ENST00000477726	T;T	0.64618	-0.11;-0.11	4.7	3.8	0.43715	.	0.332724	0.31519	N	0.007517	T	0.63757	0.2538	L	0.52011	1.625	0.29794	N	0.832985	D;D;P	0.59357	0.958;0.985;0.879	P;P;P	0.52598	0.574;0.703;0.559	T	0.63897	-0.6533	10	0.56958	D	0.05	-7.6325	9.982	0.41819	0.3691:0.6309:0.0:0.0	.	44;44;44	B4DR71;A2A3U5;Q99720	.;.;SGMR1_HUMAN	H	44	ENSP00000277010:Q44H;ENSP00000420022:Q44H	ENSP00000277010:Q44H	Q	-	3	2	SIGMAR1	34627563	0.996000	0.38824	1.000000	0.80357	0.969000	0.65631	1.763000	0.38461	1.194000	0.43101	0.561000	0.74099	CAG	.		0.701	SIGMAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052204.1	NM_005866	
TMOD1	7111	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	100286582	100286582	+	Missense_Mutation	SNP	G	G	A			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr9:100286582G>A	ENST00000259365.4	+	2	325	c.112G>A	c.(112-114)Gac>Aac	p.D38N	TMOD1_ENST00000395211.2_Missense_Mutation_p.D38N	NM_003275.3	NP_003266.1	P28289	TMOD1_HUMAN	tropomodulin 1	38					adult locomotory behavior (GO:0008344)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)	cortical cytoskeleton (GO:0030863)|cytosol (GO:0005829)|membrane (GO:0016020)|myofibril (GO:0030016)		p.D38N(1)		breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(3)|lung(2)|urinary_tract(1)	11		Acute lymphoblastic leukemia(62;0.154)		STAD - Stomach adenocarcinoma(157;0.105)		GGATGAGCTGGACCCTGATGT	0.512																																					p.D38N		.											.	TMOD1-90	1	Substitution - Missense(1)	kidney(1)	c.G112A						.						138.0	112.0	121.0					9																	100286582		2203	4300	6503	SO:0001583	missense	7111	exon2			GAGCTGGACCCTG		CCDS6726.1	9q22	2008-07-21		2003-03-21	ENSG00000136842	ENSG00000136842			11871	protein-coding gene	gene with protein product		190930		D9S57E, TMOD		1370827, 8661028	Standard	NM_003275		Approved	ETMOD	uc004axl.2	P28289	OTTHUMG00000020325	ENST00000259365.4:c.112G>A	9.37:g.100286582G>A	ENSP00000259365:p.Asp38Asn	Somatic	101	0		WXS	Illumina HiSeq	Phase_I	77	30	NM_001166116	0	0	0	0	0	B2RB77|Q5T7W3|Q9BUF1	Missense_Mutation	SNP	ENST00000259365.4	37	CCDS6726.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.821210	0.90873	.	.	ENSG00000136842	ENST00000395211;ENST00000259365	T;T	0.54279	0.58;0.58	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	T	0.76814	0.4040	M	0.87097	2.86	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.81468	-0.0919	10	0.87932	D	0	-31.3023	17.3565	0.87337	0.0:0.0:1.0:0.0	.	38	P28289	TMOD1_HUMAN	N	38	ENSP00000378637:D38N;ENSP00000259365:D38N	ENSP00000259365:D38N	D	+	1	0	TMOD1	99326403	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.283000	0.78640	2.534000	0.85438	0.585000	0.79938	GAC	.		0.512	TMOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053320.2	NM_003275	
CTNNAL1	8727	broad.mit.edu	37	9	111775718	111775718	+	Missense_Mutation	SNP	G	G	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr9:111775718G>T	ENST00000325551.4	-	1	91	c.5C>A	c.(4-6)gCc>gAc	p.A2D	CTNNAL1_ENST00000325580.6_Missense_Mutation_p.A2D|CTNNAL1_ENST00000374593.4_Missense_Mutation_p.A2D|CTNNAL1_ENST00000374595.4_Missense_Mutation_p.A2D	NM_003798.2	NP_003789.1	Q9UBT7	CTNL1_HUMAN	catenin (cadherin-associated protein), alpha-like 1	2					cell adhesion (GO:0007155)|Rho protein signal transduction (GO:0007266)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(4)|urinary_tract(2)	25				STAD - Stomach adenocarcinoma(157;0.0768)		GGGAGAGGCGGCCATGGCCCT	0.746																																					p.A2D													.	CTNNAL1-228	0			c.C5A						.						3.0	4.0	4.0					9																	111775718		1652	3413	5065	SO:0001583	missense	8727	exon1			GAGGCGGCCATGG	AF030233	CCDS6775.1, CCDS69638.1	9q31.2	2008-07-21			ENSG00000119326	ENSG00000119326			2512	protein-coding gene	gene with protein product	"""alpha-catulin"", ""alpha2-catulin"""	604785				9806841	Standard	XM_005252291		Approved	CLLP, alpha-CATU	uc004bdo.1	Q9UBT7	OTTHUMG00000020466	ENST00000325551.4:c.5C>A	9.37:g.111775718G>T	ENSP00000320434:p.Ala2Asp	Somatic	47	2		WXS	Illumina HiSeq	Phase_I	55	7	NM_003798	0	0	0	0	0	B5BU47|O76084|Q53FQ2|Q5JTQ7|Q5JTQ8|Q9Y401	Missense_Mutation	SNP	ENST00000325551.4	37	CCDS6775.1	.	.	.	.	.	.	.	.	.	.	G	14.12	2.439682	0.43326	.	.	ENSG00000119326	ENST00000374595;ENST00000325551;ENST00000325580;ENST00000374593	T;T;T;T	0.68765	1.53;1.64;1.52;-0.35	3.82	3.82	0.43975	.	0.000000	0.40144	N	0.001171	T	0.45677	0.1354	N	0.08118	0	0.37305	D	0.908868	B;B;B	0.23058	0.048;0.079;0.048	B;B;B	0.21546	0.015;0.035;0.015	T	0.54682	-0.8257	10	0.87932	D	0	-4.838	11.0862	0.48089	0.0:0.0:1.0:0.0	.	2;2;2	B2RBI4;Q9UBT7-2;Q9UBT7	.;.;CTNL1_HUMAN	D	2	ENSP00000363723:A2D;ENSP00000320434:A2D;ENSP00000323351:A2D;ENSP00000363721:A2D	ENSP00000320434:A2D	A	-	2	0	CTNNAL1	110815539	1.000000	0.71417	0.994000	0.49952	0.107000	0.19398	1.855000	0.39378	1.942000	0.56320	0.561000	0.74099	GCC	.		0.746	CTNNAL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053577.1	NM_003798	
PKN3	29941	broad.mit.edu	37	9	131469297	131469297	+	Missense_Mutation	SNP	G	G	A			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr9:131469297G>A	ENST00000291906.4	+	5	1039	c.646G>A	c.(646-648)Gct>Act	p.A216T	RN7SL560P_ENST00000577943.1_RNA	NM_013355.3	NP_037487.2	Q6P5Z2	PKN3_HUMAN	protein kinase N3	216					epithelial cell migration (GO:0010631)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(9)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24						CAAGGCACTGGCTGAGGTCAG	0.612																																					p.A216T													.	PKN3-521	0			c.G646A						.						82.0	80.0	80.0					9																	131469297		2203	4300	6503	SO:0001583	missense	29941	exon5			GCACTGGCTGAGG	AB019692	CCDS6908.1	9q34.13	2008-02-05			ENSG00000160447	ENSG00000160447			17999	protein-coding gene	gene with protein product		610714				10441506	Standard	NM_013355		Approved	PKNbeta	uc004bvw.3	Q6P5Z2	OTTHUMG00000020757	ENST00000291906.4:c.646G>A	9.37:g.131469297G>A	ENSP00000291906:p.Ala216Thr	Somatic	58	0		WXS	Illumina HiSeq	Phase_I	58	3	NM_013355	0	0	0	0	0	Q9UM03	Missense_Mutation	SNP	ENST00000291906.4	37	CCDS6908.1	.	.	.	.	.	.	.	.	.	.	G	15.68	2.905684	0.52333	.	.	ENSG00000160447	ENST00000291906	T	0.20069	2.1	5.05	4.11	0.48088	.	.	.	.	.	T	0.31451	0.0797	M	0.66939	2.045	0.54753	D	0.99998	P;P	0.44380	0.834;0.645	P;B	0.48189	0.57;0.371	T	0.04855	-1.0922	9	0.48119	T	0.1	.	12.6655	0.56840	0.0:0.0:0.835:0.165	.	216;216	Q05BU1;Q6P5Z2	.;PKN3_HUMAN	T	216	ENSP00000291906:A216T	ENSP00000291906:A216T	A	+	1	0	PKN3	130509118	1.000000	0.71417	0.096000	0.21009	0.046000	0.14306	4.414000	0.59802	2.345000	0.79718	0.555000	0.69702	GCT	.		0.612	PKN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054487.1	NM_013355	
PRDM12	59335	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	133556745	133556745	+	Missense_Mutation	SNP	C	C	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr9:133556745C>T	ENST00000253008.2	+	5	853	c.793C>T	c.(793-795)Cac>Tac	p.H265Y		NM_021619.2	NP_067632.2	Q9H4Q4	PRD12_HUMAN	PR domain containing 12	265					neurogenesis (GO:0022008)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			kidney(2)|large_intestine(3)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	11		all_hematologic(13;0.0433)|Acute lymphoblastic leukemia(5;0.0534)		OV - Ovarian serous cystadenocarcinoma(145;0.000344)		CATGCGCATCCACACGCTGGA	0.711																																					p.H265Y		.											.	PRDM12-90	0			c.C793T						.						11.0	13.0	12.0					9																	133556745		2188	4269	6457	SO:0001583	missense	59335	exon5			CGCATCCACACGC	AY004252	CCDS6934.1	9q33-q34	2013-01-08			ENSG00000130711	ENSG00000130711		"""Zinc fingers, C2H2-type"""	13997	protein-coding gene	gene with protein product	"""PR-domain containing protein 12"", ""PR-domain zinc finger protein 12"""					14523459	Standard	NM_021619		Approved		uc004bzt.1	Q9H4Q4	OTTHUMG00000020808	ENST00000253008.2:c.793C>T	9.37:g.133556745C>T	ENSP00000253008:p.His265Tyr	Somatic	77	0		WXS	Illumina HiSeq	Phase_I	73	29	NM_021619	0	0	0	0	0	A3KFK9	Missense_Mutation	SNP	ENST00000253008.2	37	CCDS6934.1	.	.	.	.	.	.	.	.	.	.	C	35	5.424499	0.96111	.	.	ENSG00000130711	ENST00000253008	T	0.67523	-0.27	4.31	4.31	0.51392	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.84120	0.5402	M	0.89353	3.025	0.54753	D	0.999986	D	0.76494	0.999	D	0.87578	0.998	D	0.88039	0.2780	10	0.87932	D	0	-38.3997	15.763	0.78101	0.0:1.0:0.0:0.0	.	265	Q9H4Q4	PRD12_HUMAN	Y	265	ENSP00000253008:H265Y	ENSP00000253008:H265Y	H	+	1	0	PRDM12	132546566	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.432000	0.80349	1.954000	0.56735	0.561000	0.74099	CAC	.		0.711	PRDM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054664.1	NM_021619	
MAGED2	10916	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	54841947	54841947	+	Silent	SNP	C	C	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chrX:54841947C>T	ENST00000375068.1	+	12	1886	c.1653C>T	c.(1651-1653)gcC>gcT	p.A551A	MAGED2_ENST00000375053.2_Silent_p.A551A|SNORA11_ENST00000408789.1_RNA|MAGED2_ENST00000375058.1_Silent_p.A551A|MAGED2_ENST00000218439.4_Silent_p.A551A|MAGED2_ENST00000375062.4_Silent_p.A466A|MAGED2_ENST00000396224.1_Silent_p.A551A|MAGED2_ENST00000347546.4_Silent_p.A533A|MAGED2_ENST00000375060.1_Silent_p.A466A			Q9UNF1	MAGD2_HUMAN	melanoma antigen family D, 2	551						membrane (GO:0016020)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	26						gcactggtgccagtaccagta	0.602																																					p.A551A		.											.	MAGED2-195	0			c.C1653T						.						35.0	28.0	30.0					X																	54841947		2197	4291	6488	SO:0001819	synonymous_variant	10916	exon12			TGGTGCCAGTACC	AF128527	CCDS14362.1	Xp11.2	2008-08-01			ENSG00000102316	ENSG00000102316			16353	protein-coding gene	gene with protein product	"""hepatocellular carcinoma associated protein"", ""breast cancer associated gene 1"", ""melanoma-associated antigen D2"", ""hepatocellular carcinoma-associated protein HCA10"""	300470					Standard	NM_014599		Approved	JCL-1, BCG1, 11B6, MAGE-D2, HCA10, MAGED, MGC8386	uc004dtk.1	Q9UNF1	OTTHUMG00000021638	ENST00000375068.1:c.1653C>T	X.37:g.54841947C>T		Somatic	48	0		WXS	Illumina HiSeq	Phase_I	47	4	NM_201222	0	0	359	386	27	A6NMX0|O76058|Q5BJF3|Q8NAL6|Q9H218|Q9P0U9|Q9UM52	Silent	SNP	ENST00000375068.1	37	CCDS14362.1																																																																																			.		0.602	MAGED2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056821.2	NM_014599	
TCEAL4	79921	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	102841929	102841929	+	Missense_Mutation	SNP	A	A	T			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chrX:102841929A>T	ENST00000472745.1	+	3	878	c.326A>T	c.(325-327)gAa>gTa	p.E109V	TCEAL4_ENST00000472484.1_Missense_Mutation_p.E109V|TCEAL4_ENST00000372629.4_Missense_Mutation_p.E252V|TCEAL4_ENST00000494801.1_Missense_Mutation_p.E109V|TCEAL4_ENST00000415568.2_Missense_Mutation_p.E109V|TCEAL4_ENST00000468024.1_Missense_Mutation_p.E109V			Q96EI5	TCAL4_HUMAN	transcription elongation factor A (SII)-like 4	109	Glu-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(2)|skin(2)	6						CCAGGGAGTGAAACAAGGGCT	0.507																																					p.E109V		.											.	TCEAL4-130	0			c.A326T						.						67.0	67.0	67.0					X																	102841929		2203	4300	6503	SO:0001583	missense	79921	exon3			GGAGTGAAACAAG	AF314542	CCDS14510.2, CCDS76004.1	Xq22.2	2014-03-21			ENSG00000133142	ENSG00000133142			26121	protein-coding gene	gene with protein product						14702039, 16221301	Standard	XM_005262192		Approved	FLJ21174, WEX7	uc004ekn.3	Q96EI5	OTTHUMG00000022103	ENST00000472745.1:c.326A>T	X.37:g.102841929A>T	ENSP00000424314:p.Glu109Val	Somatic	153	1		WXS	Illumina HiSeq	Phase_I	126	104	NM_001006935	0	0	10	150	140	Q8WY12|Q9H2H1|Q9H775	Missense_Mutation	SNP	ENST00000472745.1	37	CCDS14510.2	.	.	.	.	.	.	.	.	.	.	A	10.28	1.307826	0.23821	.	.	ENSG00000133142	ENST00000372629;ENST00000468024;ENST00000472484;ENST00000415568;ENST00000414064;ENST00000472745;ENST00000494801;ENST00000469586	T;T;T;T;T;T;T	0.35973	1.32;1.28;1.28;1.28;1.28;1.28;1.44	3.99	1.55	0.23275	.	0.216564	0.23312	N	0.049559	T	0.38214	0.1032	M	0.63843	1.955	0.09310	N	1	P	0.38250	0.624	P	0.45577	0.486	T	0.25187	-1.0139	10	0.56958	D	0.05	.	5.2758	0.15649	0.7556:0.0:0.2444:0.0	.	109	Q96EI5	TCAL4_HUMAN	V	252;109;109;109;80;109;109;109	ENSP00000361712:E252V;ENSP00000421857:E109V;ENSP00000421156:E109V;ENSP00000415564:E109V;ENSP00000424314:E109V;ENSP00000427494:E109V;ENSP00000427053:E109V	ENSP00000361712:E252V	E	+	2	0	TCEAL4	102728585	0.003000	0.15002	0.001000	0.08648	0.387000	0.30353	1.156000	0.31712	0.221000	0.20879	-0.681000	0.03757	GAA	.		0.507	TCEAL4-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252339.2	NM_024863	
DOCK11	139818	ucsc.edu;bcgsc.ca	37	X	117786022	117786022	+	Silent	SNP	T	T	C			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chrX:117786022T>C	ENST00000276202.7	+	42	4740	c.4677T>C	c.(4675-4677)aaT>aaC	p.N1559N	DOCK11_ENST00000276204.6_Silent_p.N1559N	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	1559					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						ATTTTGCAAATAGTGACAGAC	0.348																																					p.N1559N													.	DOCK11-93	0			c.T4677C						.						71.0	70.0	70.0					X																	117786022		2203	4295	6498	SO:0001819	synonymous_variant	139818	exon42			TGCAAATAGTGAC	AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.4677T>C	X.37:g.117786022T>C		Somatic	219	2		WXS	Illumina HiSeq		148	111	NM_144658	0	0	0	0	0	A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Silent	SNP	ENST00000276202.7	37	CCDS35373.1																																																																																			.		0.348	DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000356002.1	NM_144658	
SLC25A5	292	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	118603720	118603720	+	Missense_Mutation	SNP	T	T	G			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chrX:118603720T>G	ENST00000317881.8	+	2	324	c.208T>G	c.(208-210)Ttc>Gtc	p.F70V	SLC25A5-AS1_ENST00000446986.1_RNA|SLC25A5_ENST00000460013.1_3'UTR	NM_001152.4	NP_001143.2	P05141	ADT2_HUMAN	solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5	70					adenine transport (GO:0015853)|chromosome segregation (GO:0007059)|energy reserve metabolic process (GO:0006112)|negative regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901029)|positive regulation of cell proliferation (GO:0008284)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|MMXD complex (GO:0071817)|nucleus (GO:0005634)	adenine transmembrane transporter activity (GO:0015207)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|stomach(2)	12					Clodronate(DB00720)	AGTTCTGTCCTTCTGGCGCGG	0.498																																					p.F70V		.											.	SLC25A5-131	0			c.T208G						.						166.0	157.0	160.0					X																	118603720		2203	4300	6503	SO:0001583	missense	292	exon2			CTGTCCTTCTGGC	BC068199	CCDS14578.1	Xq24	2013-08-09			ENSG00000005022	ENSG00000005022		"""Solute carriers"""	10991	protein-coding gene	gene with protein product		300150		ANT2		2168878, 2829183	Standard	NM_001152		Approved	T2, 2F1, T3	uc004erh.4	P05141	OTTHUMG00000022715	ENST00000317881.8:c.208T>G	X.37:g.118603720T>G	ENSP00000360671:p.Phe70Val	Somatic	40	0		WXS	Illumina HiSeq	Phase_I	63	45	NM_001152	0	0	14	109	95	B2RCV1|O43350	Missense_Mutation	SNP	ENST00000317881.8	37	CCDS14578.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.010876	0.75046	.	.	ENSG00000005022	ENST00000317881	T	0.80214	-1.35	4.18	4.18	0.49190	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.90290	0.6963	M	0.90198	3.095	0.58432	D	0.999999	D	0.63880	0.993	D	0.69824	0.966	D	0.91908	0.5537	10	0.87932	D	0	.	12.1849	0.54231	0.0:0.0:0.0:1.0	.	70	P05141	ADT2_HUMAN	V	70	ENSP00000360671:F70V	ENSP00000360671:F70V	F	+	1	0	SLC25A5	118487748	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.575000	0.82447	1.622000	0.50330	0.430000	0.28490	TTC	.		0.498	SLC25A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058952.2	NM_001152	
KIAA1614	57710	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	180885446	180885457	+	In_Frame_Del	DEL	TCCCAGGGTATG	TCCCAGGGTATG	-	rs377550267		TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	TCCCAGGGTATG	TCCCAGGGTATG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr1:180885446_180885457delTCCCAGGGTATG	ENST00000367588.4	+	2	262_273	c.207_218delTCCCAGGGTATG	c.(205-219)cctcccagggtatgg>ccg	p.PRVW70del		NM_020950.1	NP_066001.1	Q5VZ46	K1614_HUMAN	KIAA1614	70										NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(12)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	33						CCCCCCAGCCTCCCAGGGTATGGGGAGTACAG	0.599																																					p.69_73del		.											.	KIAA1614-26	0			c.207_218del						.																																			SO:0001651	inframe_deletion	57710	exon2			.	AB046834	CCDS41442.1	1q25.3	2008-02-05			ENSG00000135835	ENSG00000135835			29327	protein-coding gene	gene with protein product							Standard	NM_020950		Approved		uc001gok.2	Q5VZ46	OTTHUMG00000035183	ENST00000367588.4:c.207_218delTCCCAGGGTATG	1.37:g.180885446_180885457delTCCCAGGGTATG	ENSP00000356560:p.Pro70_Trp73del	Somatic	67	0		WXS	Illumina HiSeq	Phase_I	53	17	NM_020950	0	0	0	0	0	Q5VZ45|Q9HCF8	In_Frame_Del	DEL	ENST00000367588.4	37	CCDS41442.1																																																																																			.		0.599	KIAA1614-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085151.1	XM_046531	
CFAP46	54777	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	134738376	134738376	+	Frame_Shift_Del	DEL	G	G	-			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr10:134738376delG	ENST00000368586.5	-	11	1180	c.1080delC	c.(1078-1080)atcfs	p.I361fs	TTC40_ENST00000368582.2_Frame_Shift_Del_p.I361fs	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						GCCTCTGTATGATATCCAGCT	0.687																																					p.I360fs		.											.	.	0			c.1080delC						.																																			SO:0001589	frameshift_variant	54777	exon11			.																												ENST00000368586.5:c.1080delC	10.37:g.134738376delG	ENSP00000357575:p.Ile361fs	Somatic	129	0		WXS	Illumina HiSeq	Phase_I	82	39	NM_001200049	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000368586.5	37	CCDS58101.1																																																																																			.		0.687	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051095.3		
C11orf57	55216	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	111953315	111953315	+	Frame_Shift_Del	DEL	C	C	-			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr11:111953315delC	ENST00000280352.9	+	6	1134	c.498delC	c.(496-498)cacfs	p.H166fs	C11orf57_ENST00000420986.2_Frame_Shift_Del_p.H166fs|C11orf57_ENST00000393047.3_Frame_Shift_Del_p.H167fs|TIMM8B_ENST00000507614.1_5'Flank|C11orf57_ENST00000532163.1_Frame_Shift_Del_p.H138fs	NM_001082970.1|NM_018195.3	NP_001076439.1|NP_060665.3	Q6ZUT1	CK057_HUMAN	chromosome 11 open reading frame 57	166	Lys-rich.									autonomic_ganglia(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|prostate(1)	12		all_cancers(61;9.8e-15)|all_epithelial(67;6.57e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;3.6e-07)|BRCA - Breast invasive adenocarcinoma(274;6.17e-07)|all cancers(92;7.01e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0521)		AAAGGTCACACAAAAAACAGA	0.413																																					p.H167fs		.											.	C11orf57-155	0			c.501delC						.						99.0	105.0	103.0					11																	111953315		2201	4297	6498	SO:0001589	frameshift_variant	55216	exon6			.	BX538107	CCDS8356.2, CCDS41715.1, CCDS73383.1	11q23.1	2006-03-09			ENSG00000150776	ENSG00000150776			25569	protein-coding gene	gene with protein product						12477932	Standard	NM_001082970		Approved	FLJ10726	uc001pmw.4	Q6ZUT1	OTTHUMG00000150213	ENST00000280352.9:c.498delC	11.37:g.111953315delC	ENSP00000339076:p.His166fs	Somatic	256	0		WXS	Illumina HiSeq	Phase_I	209	79	NM_001082969	0	0	0	0	0	Q5RL41|Q6IN53|Q7Z357|Q8N2T3	Frame_Shift_Del	DEL	ENST00000280352.9	37	CCDS41715.1																																																																																			.		0.413	C11orf57-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000316852.1	NM_018195	
VPS11	55823	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	118952015	118952015	+	Frame_Shift_Del	DEL	C	C	-			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr11:118952015delC	ENST00000300793.6	+	16	2691	c.2649delC	c.(2647-2649)ttcfs	p.F883fs	VPS11_ENST00000527798.1_3'UTR	NM_021729.4	NP_068375.3	Q9H270	VPS11_HUMAN	vacuolar protein sorting 11 homolog (S. cerevisiae)	884					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	endocytic vesicle (GO:0030139)|endosome (GO:0005768)|HOPS complex (GO:0030897)|lysosomal membrane (GO:0005765)	nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|skin(2)|urinary_tract(2)	29	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.88e-05)		ATGATCAATTCCAGCATCAGG	0.532																																					.		.											.	VPS11-25	0			.						.						50.0	52.0	51.0					11																	118952015		1948	4151	6099	SO:0001589	frameshift_variant	55823	.			.	AB027508	CCDS73404.1	11q23	2008-02-05	2006-12-19			ENSG00000160695		"""RING-type (C3HC4) zinc fingers"""	14583	protein-coding gene	gene with protein product		608549	"""vacuolar protein sorting 11 (yeast homolog)"""				Standard	NM_021729		Approved	RNF108, PEP5	uc010ryx.2	Q9H270		ENST00000300793.6:c.2649delC	11.37:g.118952015delC	ENSP00000475301:p.Phe883fs	Somatic	71	0		WXS	Illumina HiSeq	Phase_I	55	25	.	0	0	0	0	0	Q8WY89|Q96EP8|Q9H6D9|Q9HCS6	Targeted_Region	DEL	ENST00000300793.6	37																																																																																				.		0.532	VPS11-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_021729	
ABCB9	23457	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	123465766	123465770	+	5'UTR	DEL	AGAGC	AGAGC	-			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	AGAGC	AGAGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr12:123465766_123465770delAGAGC	ENST00000542678.1	-	0	426_430				ARL6IP4_ENST00000412505.2_Frame_Shift_Del_p.KS27fs|RP11-197N18.2_ENST00000540866.2_RNA|ARL6IP4_ENST00000453766.2_Frame_Shift_Del_p.KS150fs|ARL6IP4_ENST00000315580.5_Frame_Shift_Del_p.KS150fs|ARL6IP4_ENST00000357866.4_Frame_Shift_Del_p.KS27fs|ARL6IP4_ENST00000426960.2_Frame_Shift_Del_p.KS27fs|ARL6IP4_ENST00000454885.2_Frame_Shift_Del_p.KS27fs|ARL6IP4_ENST00000439686.2_Frame_Shift_Del_p.KS27fs|ARL6IP4_ENST00000392435.2_Frame_Shift_Del_p.KS150fs|ARL6IP4_ENST00000543566.1_Frame_Shift_Del_p.KS150fs			Q9NP78	ABCB9_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 9						peptide transport (GO:0015833)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)	integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)	ATP binding (GO:0005524)|peptide-transporting ATPase activity (GO:0015440)|protein homodimerization activity (GO:0042803)|substrate-specific transmembrane transporter activity (GO:0022891)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(1)|skin(1)	18	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.84e-05)|Epithelial(86;0.000152)|BRCA - Breast invasive adenocarcinoma(302;0.111)		AGAAAGAAGAAGAGCAGGAAAGACA	0.683																																					p.150_151del	Ovarian(49;786 1333 9175 38236)	.											.	ARL6IP4-90	0			c.449_453del						.																																			SO:0001623	5_prime_UTR_variant	51329	exon2			.	U66676	CCDS9241.1, CCDS58286.1, CCDS58287.1, CCDS58288.1	12q24	2012-03-14			ENSG00000150967	ENSG00000150967		"""ATP binding cassette transporters / subfamily B"""	50	protein-coding gene	gene with protein product		605453				8894702	Standard	NM_019625		Approved	EST122234	uc001udm.4	Q9NP78		ENST00000542678.1:c.-2413GCTCT>-	12.37:g.123465766_123465770delAGAGC		Somatic	155	0		WXS	Illumina HiSeq	Phase_I	144	31	NM_018694	0	0	0	0	0	B4E2J0|Q5W9G7|Q769F3|Q769F4|Q96AB1|Q9P208	Frame_Shift_Del	DEL	ENST00000542678.1	37	CCDS9241.1																																																																																			.		0.683	ABCB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400956.1	NM_019624	
NUFIP1	26747	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	13	45563329	45563329	+	Frame_Shift_Del	DEL	G	G	-			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr13:45563329delG	ENST00000379161.4	-	1	289	c.243delC	c.(241-243)ttcfs	p.F81fs	RP11-321C24.1_ENST00000437748.2_lincRNA|GPALPP1_ENST00000361121.2_5'Flank|GPALPP1_ENST00000379151.4_5'Flank	NM_012345.2	NP_036477.2	Q9UHK0	NUFP1_HUMAN	nuclear fragile X mental retardation protein interacting protein 1	81	Pro-rich.				box C/D snoRNP assembly (GO:0000492)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|RNA processing (GO:0006396)	cytosolic ribosome (GO:0022626)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|pre-snoRNP complex (GO:0070761)|presynaptic active zone (GO:0048786)|transcription elongation factor complex (GO:0008023)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)|RNA binding (GO:0003723)			breast(2)|cervix(1)|endometrium(2)|large_intestine(2)|lung(4)|prostate(4)|skin(3)	18		Lung NSC(96;8.23e-05)|Breast(139;0.00378)|Prostate(109;0.0107)|all_hematologic(4;0.014)|Lung SC(185;0.0262)|Hepatocellular(98;0.0524)|Acute lymphoblastic leukemia(4;0.143)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000306)|BRCA - Breast invasive adenocarcinoma(63;0.125)		TCTGGGCGTCGAAGGGGGGCG	0.657																																					p.F81fs		.											.	NUFIP1-90	0			c.243delC						.						14.0	17.0	16.0					13																	45563329		2189	4285	6474	SO:0001589	frameshift_variant	26747	exon1			.	AF159548	CCDS9393.1	13q14	2008-02-05			ENSG00000083635	ENSG00000083635			8057	protein-coding gene	gene with protein product		604354				10556305, 10894927	Standard	NM_012345		Approved	NUFIP	uc001uzp.2	Q9UHK0	OTTHUMG00000016842	ENST00000379161.4:c.243delC	13.37:g.45563329delG	ENSP00000368459:p.Phe81fs	Somatic	130	0		WXS	Illumina HiSeq	Phase_I	113	22	NM_012345	0	0	0	0	0	Q8WVM5|Q96SG1	Frame_Shift_Del	DEL	ENST00000379161.4	37	CCDS9393.1																																																																																			.		0.657	NUFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044755.2	NM_012345	
LMO7	4008	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	13	76395479	76395497	+	Frame_Shift_Del	DEL	AAAGAAGATTCTACCACTT	AAAGAAGATTCTACCACTT	-	rs200351536|rs532984694|rs149099643	byFrequency	TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	AAAGAAGATTCTACCACTT	AAAGAAGATTCTACCACTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr13:76395479_76395497delAAAGAAGATTCTACCACTT	ENST00000321797.8	+	12	2396_2414	c.1675_1693delAAAGAAGATTCTACCACTT	c.(1675-1695)aaagaagattctaccacttttfs	p.KEDSTTF559fs	LMO7_ENST00000341547.4_Frame_Shift_Del_p.KEDSTTF510fs|LMO7_ENST00000526202.1_Frame_Shift_Del_p.KEDSTTF409fs|LMO7_ENST00000357063.3_Frame_Shift_Del_p.KEDSTTF844fs|LMO7_ENST00000465261.2_Frame_Shift_Del_p.KEDSTTF559fs|LMO7_ENST00000377534.3_Frame_Shift_Del_p.KEDSTTF844fs			Q8WWI1	LMO7_HUMAN	LIM domain 7	844					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(20)|lung(15)|ovary(2)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		AGAAATTCCCAAAGAAGATTCTACCACTTTTGCAAAAAG	0.457																																					p.559_565del		.											.	LMO7-586	0			c.1675_1693del						.																																			SO:0001589	frameshift_variant	4008	exon11			.	AF092557	CCDS9454.1, CCDS53876.1	13q22.2	2008-02-05	2004-06-15		ENSG00000136153	ENSG00000136153			6646	protein-coding gene	gene with protein product	"""F-box only protein 20"""	604362	"""LIM domain only 7"""	FBXO20		9826547, 10531035	Standard	NM_005358		Approved	FBX20, KIAA0858	uc021rkq.1	Q8WWI1	OTTHUMG00000017093	ENST00000321797.8:c.1675_1693delAAAGAAGATTCTACCACTT	13.37:g.76395479_76395497delAAAGAAGATTCTACCACTT	ENSP00000317802:p.Lys559fs	Somatic	161	0		WXS	Illumina HiSeq	Phase_I	104	28	NM_015842	0	0	0	0	0	E9PLH4|O15462|O95346|Q5TBK6|Q9UKC1|Q9UQM5|Q9Y6A7	Frame_Shift_Del	DEL	ENST00000321797.8	37																																																																																				.		0.457	LMO7-005	PUTATIVE	alternative_5_UTR|not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000045301.3	NM_005358	
CNOT1	23019	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	58592566	58592570	+	Frame_Shift_Del	DEL	CAAGA	CAAGA	-			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	CAAGA	CAAGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr16:58592566_58592570delCAAGA	ENST00000317147.5	-	18	2471_2475	c.2139_2143delTCTTG	c.(2137-2145)cctcttgctfs	p.LA714fs	CNOT1_ENST00000569732.1_5'Flank|SNORA50_ENST00000384225.2_RNA|CNOT1_ENST00000569240.1_Frame_Shift_Del_p.LA714fs|CNOT1_ENST00000441024.2_Frame_Shift_Del_p.LA714fs	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	714					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		GTCATTCCAGCAAGAGGGTCAATCT	0.4																																					p.713_715del		.											.	CNOT1-95	0			c.2139_2143del						.																																			SO:0001589	frameshift_variant	23019	exon18			.	AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.2139_2143delTCTTG	16.37:g.58592566_58592570delCAAGA	ENSP00000320949:p.Leu714fs	Somatic	102	0		WXS	Illumina HiSeq	Phase_I	97	46	NM_206999	0	0	0	0	0	Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Frame_Shift_Del	DEL	ENST00000317147.5	37	CCDS10799.1																																																																																			.		0.400	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257385.3	NM_016284	
RFX8	731220	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	102018936	102018936	+	Frame_Shift_Del	DEL	T	T	-			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr2:102018936delT	ENST00000376826.2	-	14	1545	c.1546delA	c.(1546-1548)atcfs	p.I516fs	RFX8_ENST00000428343.1_Frame_Shift_Del_p.I403fs			Q6ZV50	RFX8_HUMAN	RFX family member 8, lacking RFX DNA binding domain	516					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|kidney(1)|stomach(1)	3						AAGCCCAGGATCCTGAGGACC	0.607																																					p.I403fs		.											.	.	0			c.1207delA						.						44.0	43.0	43.0					2																	102018936		692	1591	2283	SO:0001589	frameshift_variant	731220	exon11			.	AK124976	CCDS46376.1	2q11.2	2012-11-15	2012-11-15		ENSG00000196460	ENSG00000196460			37253	protein-coding gene	gene with protein product			"""regulatory factor X, 8"", ""RFX gene family member 8, lacking RFX DNA binding domain"""				Standard	NM_001145664		Approved	FLJ42986	uc010yvx.1	Q6ZV50	OTTHUMG00000130693	ENST00000376826.2:c.1546delA	2.37:g.102018936delT	ENSP00000366022:p.Ile516fs	Somatic	107	0		WXS	Illumina HiSeq	Phase_I	89	38	NM_001145664	0	0	0	0	0	B4DQ32	Frame_Shift_Del	DEL	ENST00000376826.2	37																																																																																				.		0.607	RFX8-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001145664	
RFX8	731220	hgsc.bcm.edu	37	2	102018936	102018937	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	TC	TC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr2:102018936_102018937delTC	ENST00000376826.2	-	14	1544_1545	c.1545_1546delGA	c.(1543-1548)aggatcfs	p.RI515fs	RFX8_ENST00000428343.1_Frame_Shift_Del_p.RI402fs			Q6ZV50	RFX8_HUMAN	RFX family member 8, lacking RFX DNA binding domain	515					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|kidney(1)|stomach(1)	3						AAGCCCAGGATCCTGAGGACCA	0.609																																					p.402_403del		.											.	.	0			c.1206_1207del						.																																			SO:0001589	frameshift_variant	731220	exon11			.	AK124976	CCDS46376.1	2q11.2	2012-11-15	2012-11-15		ENSG00000196460	ENSG00000196460			37253	protein-coding gene	gene with protein product			"""regulatory factor X, 8"", ""RFX gene family member 8, lacking RFX DNA binding domain"""				Standard	NM_001145664		Approved	FLJ42986	uc010yvx.1	Q6ZV50	OTTHUMG00000130693	ENST00000376826.2:c.1545_1546delGA	2.37:g.102018936_102018937delTC	ENSP00000366022:p.Arg515fs	Somatic	109	0		WXS	Illumina HiSeq	Phase_I	90	27	NM_001145664	0	0	0	0	0	B4DQ32	Frame_Shift_Del	DEL	ENST00000376826.2	37																																																																																				.		0.609	RFX8-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001145664	
EPB41L1	2036	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	34765954	34765956	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	CTT	CTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr20:34765954_34765956delCTT	ENST00000338074.2	+	4	584_586	c.423_425delCTT	c.(421-426)accttc>acc	p.F142del	EPB41L1_ENST00000373946.3_In_Frame_Del_p.F111del|EPB41L1_ENST00000202028.5_In_Frame_Del_p.F80del|EPB41L1_ENST00000441639.1_In_Frame_Del_p.F80del|EPB41L1_ENST00000373941.1_In_Frame_Del_p.F142del|EPB41L1_ENST00000373950.2_Intron	NM_001258329.1|NM_012156.2	NP_001245258.1|NP_036288.2	Q9H4G0	E41L1_HUMAN	erythrocyte membrane protein band 4.1-like 1	142	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cortical actin cytoskeleton organization (GO:0030866)|synaptic transmission (GO:0007268)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(10)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	37	Breast(12;0.0239)					TCGGCCTGACCTTCTGTGATGCT	0.576																																					p.141_142del		.											.	EPB41L1-93	0			c.423_425del						.																																			SO:0001651	inframe_deletion	2036	exon5			.	AB002336	CCDS13271.1, CCDS13272.1, CCDS58771.1	20q11.2-q12	2003-03-17			ENSG00000088367	ENSG00000088367			3378	protein-coding gene	gene with protein product		602879				9570967, 9828140	Standard	NM_012156		Approved	KIAA0338	uc002xfb.3	Q9H4G0	OTTHUMG00000032378	ENST00000338074.2:c.423_425delCTT	20.37:g.34765954_34765956delCTT	ENSP00000337168:p.Phe142del	Somatic	64	0		WXS	Illumina HiSeq	Phase_I	50	20	NM_001258329	0	0	0	0	0	O15046|Q4VXM6|Q4VXM7|Q4VXM8|Q4VXN4|Q6ZT61|Q8IUU7|Q96CV5|Q96L65	In_Frame_Del	DEL	ENST00000338074.2	37	CCDS13271.1																																																																																			.		0.576	EPB41L1-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078978.3	NM_012156	
NEFH	4744	hgsc.bcm.edu	37	22	29885581	29885604	+	In_Frame_Del	DEL	AGGCCAAGTCCCCAGAGAAGGAAG	AGGCCAAGTCCCCAGAGAAGGAAG	-	rs267607534|rs373980795|rs267607533|rs149571560|rs79235463|rs200984527|rs370803228	byFrequency	TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	AGGCCAAGTCCCCAGAGAAGGAAG	AGGCCAAGTCCCCAGAGAAGGAAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr22:29885581_29885604delAGGCCAAGTCCCCAGAGAAGGAAG	ENST00000310624.6	+	4	1985_2008	c.1952_1975delAGGCCAAGTCCCCAGAGAAGGAAG	c.(1951-1977)aaggccaagtccccagagaaggaagag>aag	p.AKSPEKEE652del		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	658	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.			Missing (in Ref. 1; CAA33366 and 5; AC000035). {ECO:0000305}.	axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						TCCCCTGAGAAGGCCAAGTCCCCAGAGAAGGAAGAGGCCAAGTC	0.562																																					p.651_659del		.											.	NEFH-90	0			c.1952_1975del						.																																			SO:0001651	inframe_deletion	4744	exon4			.		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1952_1975delAGGCCAAGTCCCCAGAGAAGGAAG	22.37:g.29885581_29885604delAGGCCAAGTCCCCAGAGAAGGAAG	ENSP00000311997:p.Ala652_Glu659del	Somatic	245	0		WXS	Illumina HiSeq	Phase_I	260	58	NM_021076	0	0	0	0	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Del	DEL	ENST00000310624.6	37	CCDS13858.1																																																																																			.		0.562	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
EIF4G1	1981	broad.mit.edu	37	3	184039744	184039746	+	In_Frame_Del	DEL	GAA	GAA	-	rs530167757	byFrequency	TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	GAA	GAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr3:184039744_184039746delGAA	ENST00000346169.2	+	10	1643_1645	c.1372_1374delGAA	c.(1372-1374)gaadel	p.E465del	EIF4G1_ENST00000411531.1_In_Frame_Del_p.E425del|EIF4G1_ENST00000424196.1_In_Frame_Del_p.E472del|EIF2B5_ENST00000444495.1_Intron|EIF4G1_ENST00000392537.2_In_Frame_Del_p.E378del|EIF4G1_ENST00000342981.4_In_Frame_Del_p.E465del|EIF4G1_ENST00000441154.1_In_Frame_Del_p.E301del|EIF4G1_ENST00000414031.1_In_Frame_Del_p.E425del|EIF4G1_ENST00000352767.3_In_Frame_Del_p.E472del|EIF4G1_ENST00000319274.6_In_Frame_Del_p.E465del|EIF4G1_ENST00000434061.2_In_Frame_Del_p.E269del|EIF4G1_ENST00000427845.1_In_Frame_Del_p.E378del|EIF4G1_ENST00000435046.2_In_Frame_Del_p.E269del|EIF4G1_ENST00000350481.5_In_Frame_Del_p.E301del|EIF4G1_ENST00000382330.3_In_Frame_Del_p.E472del	NM_198241.2	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4 gamma, 1	465	Poly-Glu.				cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|lung development (GO:0030324)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|response to ethanol (GO:0045471)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(5)|large_intestine(14)|lung(41)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	75	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GGAGGAAATGgaagaagaagaag	0.562																																					p.465_465del													.	EIF4G1-344	0			c.1393_1395del						.																																			SO:0001651	inframe_deletion	1981	exon11			GAAATGGAAGAAG	D12686	CCDS3259.1, CCDS3260.1, CCDS3261.1, CCDS46970.1, CCDS46970.2, CCDS54687.1, CCDS54688.1	3q27.1	2013-09-19			ENSG00000114867	ENSG00000114867		"""Parkinson disease"""	3296	protein-coding gene	gene with protein product		600495		EIF4G, EIF4F		1429670, 9372926, 21907011	Standard	NM_182917		Approved	p220, PARK18	uc010hxy.3	Q04637	OTTHUMG00000156784	ENST00000346169.2:c.1372_1374delGAA	3.37:g.184039753_184039755delGAA	ENSP00000316879:p.Glu465del	Somatic	104	0		WXS	Illumina HiSeq	Phase_I	118	10	NM_001194946	0	0	0	0	0	D3DNT2|D3DNT4|D3DNT5|E9PFM1|G5E9S1|O43177|O95066|Q5HYG0|Q6ZN21|Q8N102	In_Frame_Del	DEL	ENST00000346169.2	37	CCDS3259.1																																																																																			.		0.562	EIF4G1-007	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000345733.1	NM_182917	
ZNF273	10793	broad.mit.edu;bcgsc.ca	37	7	64389208	64389214	+	Frame_Shift_Del	DEL	TTACTAA	TTACTAA	-	rs555033749		TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	TTACTAA	TTACTAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr7:64389208_64389214delTTACTAA	ENST00000476120.1	+	4	1573_1579	c.1502_1508delTTACTAA	c.(1501-1509)cttactaaafs	p.LTK501fs	ZNF273_ENST00000527278.1_3'UTR|ZNF273_ENST00000319636.5_Frame_Shift_Del_p.LTK436fs	NM_021148.2	NP_066971.2	Q14593	ZN273_HUMAN	zinc finger protein 273	501					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Lung NSC(55;0.0295)|all_lung(88;0.0691)				TCCTCAACTCTTACTAAACATAAGAGA	0.386																																					p.501_503del	Ovarian(154;605 895 6696 7659 15316 19321 21716 23848 32322 36932)												.	ZNF273-90	0			c.1502_1508del						.																																			SO:0001589	frameshift_variant	10793	exon4			CAACTCTTACTAA	X78932	CCDS5528.2	7q11.21	2013-01-08				ENSG00000198039		"""Zinc fingers, C2H2-type"", ""-"""	13067	protein-coding gene	gene with protein product		604756				7865130	Standard	NR_003099		Approved	HZF9	uc003tto.3	Q14593		ENST00000476120.1:c.1502_1508delTTACTAA	7.37:g.64389208_64389214delTTACTAA	ENSP00000418719:p.Leu501fs	Somatic	74	0		WXS	Illumina HiSeq	Phase_I	70	9	NM_021148	0	0	0	0	0	B3KQZ5|Q6P3V4	Frame_Shift_Del	DEL	ENST00000476120.1	37	CCDS5528.2																																																																																			.		0.386	ZNF273-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313502.1		
DPYS	1807	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	105393497	105393499	+	In_Frame_Del	DEL	CTT	CTT	-	rs148864394	byFrequency	TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	CTT	CTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr8:105393497_105393499delCTT	ENST00000351513.2	-	9	1619_1621	c.1487_1489delAAG	c.(1486-1491)gaagtc>gtc	p.E496del	DPYS_ENST00000521601.1_5'UTR	NM_001385.2	NP_001376.1	Q14117	DPYS_HUMAN	dihydropyrimidinase	496					beta-alanine metabolic process (GO:0019482)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein homotetramerization (GO:0051289)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymine catabolic process (GO:0006210)|uracil catabolic process (GO:0006212)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|dihydropyrimidinase activity (GO:0004157)|thymine binding (GO:0002059)|uracil binding (GO:0002058)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)			AGTGTGGCGACTTCTCCCTTATA	0.483																																					p.496_497del		.											.	DPYS-229	0			c.1487_1489del						.																																			SO:0001651	inframe_deletion	1807	exon9			.	D78011	CCDS6302.1	8q22	2004-01-22			ENSG00000147647	ENSG00000147647			3013	protein-coding gene	gene with protein product		613326				8973361	Standard	NM_001385		Approved	DHPase	uc003yly.4	Q14117	OTTHUMG00000164891	ENST00000351513.2:c.1487_1489delAAG	8.37:g.105393497_105393499delCTT	ENSP00000276651:p.Glu496del	Somatic	69	0		WXS	Illumina HiSeq	Phase_I	55	26	NM_001385	0	0	0	0	0		In_Frame_Del	DEL	ENST00000351513.2	37	CCDS6302.1																																																																																			.		0.483	DPYS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380814.1	NM_001385	
HRCT1	646962	broad.mit.edu	37	9	35906599	35906601	+	In_Frame_Del	DEL	CCC	CCC	-	rs565823201|rs112212538		TCGA-IZ-A6M9-01A-11D-A31X-10	TCGA-IZ-A6M9-10A-01D-A31X-10	CCC	CCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0541b2e4-13f8-4845-a6ba-6dfde158bc09	558c1803-c4c2-42cb-82cb-f3e277bf9beb	g.chr9:35906599_35906601delCCC	ENST00000354323.2	+	1	411_413	c.315_317delCCC	c.(313-318)cacccc>cac	p.P106del	LINC00961_ENST00000443779.1_lincRNA	NM_001039792.1	NP_001034881.1	Q6UXD1	HRCT1_HUMAN	histidine rich carboxyl terminus 1	106	His-rich.					integral component of membrane (GO:0016021)				NS(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|prostate(1)	4						accaccaccacccccaccgccac	0.67																																					p.105_106del													.	HRCT1-22	0			c.315_317del						.																																			SO:0001651	inframe_deletion	646962	exon1			CCACCACCCCCAC		CCDS35012.1	9p13.3	2008-09-30			ENSG00000196196	ENSG00000196196			33872	protein-coding gene	gene with protein product						12975309	Standard	NM_001039792		Approved	LGLL338, PRO537, UNQ338	uc003zyr.1	Q6UXD1	OTTHUMG00000154146	ENST00000354323.2:c.315_317delCCC	9.37:g.35906599_35906601delCCC	ENSP00000346283:p.Pro106del	Somatic	9	0		WXS	Illumina HiSeq	Phase_I	12	5	NM_001039792	0	0	0	0	0	B7ZBJ1	In_Frame_Del	DEL	ENST00000354323.2	37	CCDS35012.1																																																																																			.		0.670	HRCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334099.1	NM_001039792	
