#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
KIAA1377	57562	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	11	101793446	101793446	+	Missense_Mutation	SNP	G	G	A	rs142032267	byFrequency	TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr11:101793446G>A	ENST00000263468.8	+	2	473	c.203G>A	c.(202-204)cGa>cAa	p.R68Q		NM_020802.2	NP_065853.2	Q9P2H0	K1377_HUMAN	KIAA1377	68								p.R68L(1)		breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(18)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	53	all_epithelial(12;0.0104)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00931)		BRCA - Breast invasive adenocarcinoma(274;0.038)		AAAATATGTCGAAATCGAGCA	0.303																																						.											1	Substitution - Missense(1)	lung(1)						G	GLN/ARG	0,4406		0,0,2203	67.0	70.0	69.0		203	5.8	1.0	11	dbSNP_134	69	1,8597	1.2+/-3.3	0,1,4298	no	missense	KIAA1377	NM_020802.2	43	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	68/1118	101793446	1,13003	2203	4299	6502	SO:0001583	missense	57562			AK095004	CCDS31658.1	11q22.2	2006-02-03			ENSG00000110318	ENSG00000110318			29264	protein-coding gene	gene with protein product		614634				10718198	Standard	XM_005271627		Approved		uc001pgm.3	Q9P2H0	OTTHUMG00000167319	ENST00000263468.8:c.203G>A	11.37:g.101793446G>A	ENSP00000263468:p.Arg68Gln	Somatic		WXS	Illumina HiSeq	Phase_I	Q4G0U6	Missense_Mutation	SNP	ENST00000263468.8	37	CCDS31658.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.945729	0.92593	0.0	1.16E-4	ENSG00000110318	ENST00000263468	T	0.12361	2.69	5.84	5.84	0.93424	.	0.000000	0.53938	D	0.000056	T	0.38241	0.1033	M	0.67953	2.075	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.03728	-1.1009	10	0.87932	D	0	-11.1498	17.6233	0.88088	0.0:0.0:1.0:0.0	.	68	Q9P2H0	K1377_HUMAN	Q	68	ENSP00000263468:R68Q	ENSP00000263468:R68Q	R	+	2	0	KIAA1377	101298656	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	5.645000	0.67909	2.758000	0.94735	0.591000	0.81541	CGA		0.303	KIAA1377-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394140.1	NM_020802	
FBXO21	23014	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	12	117624289	117624289	+	Nonsense_Mutation	SNP	C	C	A			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr12:117624289C>A	ENST00000330622.5	-	3	462	c.463G>T	c.(463-465)Gaa>Taa	p.E155*	FBXO21_ENST00000427718.2_Nonsense_Mutation_p.E155*|FBXO21_ENST00000549689.1_5'UTR			O94952	FBX21_HUMAN	F-box protein 21	155					protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	ubiquitin ligase complex (GO:0000151)	DNA binding (GO:0003677)|ubiquitin-protein transferase activity (GO:0004842)			breast(4)|endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|pancreas(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	29	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0291)		TACCTTCCTTCCATATTTAGG	0.388																																					GBM(168;452 2038 13535 17701 43680)	.											0													91.0	88.0	89.0					12																	117624289		2203	4300	6503	SO:0001587	stop_gained	23014			AB020682	CCDS9184.1, CCDS44989.1	12q24.23	2004-06-15	2004-06-15					"""F-boxes /  ""other"""""	13592	protein-coding gene	gene with protein product		609095	"""F-box only protein 21"""			10048485, 10531035	Standard	NM_033624		Approved	FBX21, KIAA0875	uc001twk.3	O94952	OTTHUMG00000169495	ENST00000330622.5:c.463G>T	12.37:g.117624289C>A	ENSP00000328187:p.Glu155*	Somatic		WXS	Illumina HiSeq	Phase_I	B3KMF0|Q5BJG0|Q9H087	Nonsense_Mutation	SNP	ENST00000330622.5	37	CCDS9184.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.0|24.0	4.478785|4.478785	0.84747|0.84747	.|.	.|.	ENSG00000135108|ENSG00000135108	ENST00000427718;ENST00000257563;ENST00000535590;ENST00000330622|ENST00000550180	.|.	.|.	.|.	5.67|5.67	5.67|5.67	0.87782|0.87782	.|.	0.058331|.	0.64402|.	D|.	0.000002|.	.|T	.|0.76506	.|0.3997	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.74680	.|-0.3584	.|3	0.14252|.	T|.	0.57|.	-14.5205|-14.5205	19.3563|19.3563	0.94416|0.94416	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|V	155;71;71;155|98	.|.	ENSP00000257563:E71X|.	E|G	-|-	1|2	0|0	FBXO21|FBXO21	116108672|116108672	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	4.803000|4.803000	0.62546|0.62546	2.670000|2.670000	0.90874|0.90874	0.655000|0.655000	0.94253|0.94253	GAA|GGA		0.388	FBXO21-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000404409.1	NM_033624	
RPTOR	57521	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	17	78866565	78866565	+	Missense_Mutation	SNP	G	G	T			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr17:78866565G>T	ENST00000306801.3	+	19	2500	c.2138G>T	c.(2137-2139)tGc>tTc	p.C713F	RPTOR_ENST00000575542.1_3'UTR|RPTOR_ENST00000544334.2_Missense_Mutation_p.C555F	NM_020761.2	NP_065812.1	Q8N122	RPTOR_HUMAN	regulatory associated protein of MTOR, complex 1	713					cell cycle arrest (GO:0007050)|cell growth (GO:0016049)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nutrient levels (GO:0031669)|insulin receptor signaling pathway (GO:0008286)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|regulation of cell size (GO:0008361)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|TORC1 complex (GO:0031931)	14-3-3 protein binding (GO:0071889)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	44						GACAGCCCGTGCACCCCCAGA	0.542																																						.											0													130.0	133.0	132.0					17																	78866565		2203	4300	6503	SO:0001583	missense	57521				CCDS11773.1, CCDS54175.1	17q25.3	2013-01-10				ENSG00000141564		"""WD repeat domain containing"""	30287	protein-coding gene	gene with protein product	"""regulatory associated protein of mTOR"""	607130				10718198, 12150926	Standard	NM_001163034		Approved	KOG1, Mip1, KIAA1303, raptor	uc002jyt.1	Q8N122		ENST00000306801.3:c.2138G>T	17.37:g.78866565G>T	ENSP00000307272:p.Cys713Phe	Somatic		WXS	Illumina HiSeq	Phase_I	B2RN36|C6KEF2|F5H7J5|Q8N4V9|Q8TB32|Q9P2P3	Missense_Mutation	SNP	ENST00000306801.3	37	CCDS11773.1	.	.	.	.	.	.	.	.	.	.	G	13.09	2.133093	0.37630	.	.	ENSG00000141564	ENST00000306801;ENST00000544334	T;T	0.42131	1.03;0.98	4.66	4.66	0.58398	Armadillo-like helical (1);Armadillo-type fold (1);	0.158118	0.42053	D	0.000768	T	0.25938	0.0632	N	0.08118	0	0.80722	D	1	P;B	0.36249	0.545;0.001	B;B	0.34931	0.192;0.004	T	0.11891	-1.0569	10	0.33940	T	0.23	.	17.5562	0.87890	0.0:0.0:1.0:0.0	.	555;713	F5H7J5;Q8N122	.;RPTOR_HUMAN	F	713;555	ENSP00000307272:C713F;ENSP00000442479:C555F	ENSP00000307272:C713F	C	+	2	0	RPTOR	76481160	1.000000	0.71417	0.998000	0.56505	0.386000	0.30323	6.441000	0.73439	2.143000	0.66587	0.655000	0.94253	TGC		0.542	RPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438125.1	NM_020761	
FAM71E2	284418	hgsc.bcm.edu	37	19	55869902	55869902	+	Silent	SNP	C	C	T	rs386811061|rs67988285|rs67168196	byFrequency	TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr19:55869902C>T	ENST00000424985.3	-	9	2527	c.2334G>A	c.(2332-2334)caG>caA	p.Q778Q	CTD-2105E13.6_ENST00000591954.3_Missense_Mutation_p.S328N	NM_001145402.1	NP_001138874.1	Q8N5Q1	F71E2_HUMAN	family with sequence similarity 71, member E2	778			Missing (in dbSNP:rs35996821). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:17974005}.							NS(1)|breast(3)|endometrium(2)|kidney(1)|skin(1)	8						CGCCCCATGGCTGCTCCTTCA	0.632																																						.											0													14.0	15.0	15.0					19																	55869902		682	1552	2234	SO:0001819	synonymous_variant	284418			AL834316		19q13.42	2014-04-02	2007-11-20	2007-11-20	ENSG00000180043	ENSG00000180043			25278	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 16"""	C19orf16			Standard	NM_001145402		Approved	DKFZp434G1729	uc002qkr.2	Q8N5Q1	OTTHUMG00000170357	ENST00000424985.3:c.2334G>A	19.37:g.55869902C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q8ND99	Silent	SNP	ENST00000424985.3	37																																																																																					0.632	FAM71E2-010	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000409063.4	NM_001145402	
EEF1A2	1917	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	20	62121830	62121830	+	Splice_Site	SNP	A	A	C			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr20:62121830A>C	ENST00000298049.7	-	5	1100		c.e5+1		EEF1A2_ENST00000217182.3_Splice_Site			Q05639	EF1A2_HUMAN	eukaryotic translation elongation factor 1 alpha 2						positive regulation of apoptotic process (GO:0043065)|response to inorganic substance (GO:0010035)	eukaryotic translation elongation factor 1 complex (GO:0005853)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|translation elongation factor activity (GO:0003746)|translation factor activity, nucleic acid binding (GO:0008135)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(14)|stomach(1)	20	all_cancers(38;9.45e-12)		BRCA - Breast invasive adenocarcinoma(10;1.22e-05)			GCAGCCCCCCACCTGGGAGGT	0.667																																						.											0													31.0	32.0	32.0					20																	62121830		2191	4286	6477	SO:0001630	splice_region_variant	1917			AF163763	CCDS13522.1	20q13.3	2010-06-03			ENSG00000101210	ENSG00000101210			3192	protein-coding gene	gene with protein product		602959	"""statin-like"", ""statin"""	STNL, STN		8354261, 8812466	Standard	NM_001958		Approved	EEF1AL, HS1	uc002yfe.2	Q05639	OTTHUMG00000033076	ENST00000298049.7:c.1029+1T>G	20.37:g.62121830A>C		Somatic		WXS	Illumina HiSeq	Phase_I	B5BUF3|E1P5J1|P54266|Q0VGC7	Splice_Site	SNP	ENST00000298049.7	37	CCDS13522.1	.	.	.	.	.	.	.	.	.	.	A	13.15	2.151031	0.38021	.	.	ENSG00000101210	ENST00000298049;ENST00000217182	.	.	.	3.73	3.73	0.42828	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.718	0.57125	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	EEF1A2	61592274	1.000000	0.71417	0.805000	0.32314	0.308000	0.27856	9.102000	0.94226	1.467000	0.48044	0.398000	0.26397	.		0.667	EEF1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080495.1	NM_001958	Intron
LIMS3	96626	hgsc.bcm.edu	37	2	110661397	110661398	+	Intron	INS	-	-	A			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr2:110661397_110661398insA	ENST00000437679.2	+	2	643				LIMS3_ENST00000553749.1_Intron|LIMS3_ENST00000487150.1_Intron	NM_033514.4	NP_277049.1	P0CW19	LIMS3_HUMAN	LIM and senescent cell antigen-like domains 3							cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)										GGACCTGCTCTAAAGGAGAGCG	0.525																																						.											0																																										SO:0001627	intron_variant	0			AF288404	CCDS2084.1	2q13	2013-09-24			ENSG00000256977	ENSG00000256977			30047	protein-coding gene	gene with protein product	"""pinch 2"""						Standard	NM_033514		Approved		uc002tff.3	P0CW19	OTTHUMG00000131197	ENST00000437679.2:c.342+408->A	2.37:g.110661400_110661400dupA		Somatic		WXS	Illumina HiSeq	Phase_I	B4DPH6|Q9HB10	RNA	INS	ENST00000437679.2	37	CCDS2084.1																																																																																				0.525	LIMS3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253922.2	NM_033514	
ARHGAP24	83478	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	4	86863259	86863259	+	Missense_Mutation	SNP	G	G	T			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr4:86863259G>T	ENST00000395184.1	+	5	898	c.432G>T	c.(430-432)gaG>gaT	p.E144D	ARHGAP24_ENST00000503995.1_Missense_Mutation_p.E144D|ARHGAP24_ENST00000395183.2_Missense_Mutation_p.E49D|ARHGAP24_ENST00000264343.4_Missense_Mutation_p.E51D	NM_001025616.2	NP_001020787.2	Q8N264	RHG24_HUMAN	Rho GTPase activating protein 24	144	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of ruffle assembly (GO:1900028)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|wound healing, spreading of epidermal cells (GO:0035313)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)	Rac GTPase activator activity (GO:0030675)			breast(3)|cervix(1)|endometrium(3)|large_intestine(4)|lung(10)|skin(1)|stomach(1)|urinary_tract(1)	24		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000571)		TTCGTTATGAGAAGAGATATG	0.448																																						.											0													86.0	84.0	85.0					4																	86863259		2203	4300	6503	SO:0001583	missense	83478			AK091196	CCDS3611.1, CCDS34025.1, CCDS43246.1	4q22.1	2013-01-10			ENSG00000138639	ENSG00000138639		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	25361	protein-coding gene	gene with protein product		610586				11230166, 15254788	Standard	NM_001042669		Approved	DKFZP564B1162, FLJ33877, FilGAP	uc003hpk.3	Q8N264	OTTHUMG00000130427	ENST00000395184.1:c.432G>T	4.37:g.86863259G>T	ENSP00000378611:p.Glu144Asp	Somatic		WXS	Illumina HiSeq	Phase_I	Q4KMG1|Q6ZNV3|Q86TI5|Q86WE4|Q9H0T6	Missense_Mutation	SNP	ENST00000395184.1	37	CCDS34025.1	.	.	.	.	.	.	.	.	.	.	G	16.82	3.229271	0.58777	.	.	ENSG00000138639	ENST00000395184;ENST00000503995;ENST00000512201;ENST00000395183;ENST00000509300;ENST00000514229;ENST00000264343	T;T;T;T;T;T;T	0.43294	0.95;0.95;0.95;0.95;0.95;0.95;0.95	5.98	4.24	0.50183	Rho GTPase-activating protein domain (2);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.54902	0.1887	L	0.51853	1.615	0.54753	D	0.999982	D;P;P;P	0.69078	0.997;0.931;0.849;0.694	D;P;B;P	0.66497	0.944;0.857;0.271;0.683	T	0.51639	-0.8680	10	0.41790	T	0.15	.	12.9494	0.58391	0.1326:0.0:0.8674:0.0	.	49;51;144;144	Q8N264-3;Q8N264-2;Q8N264;Q8N264-4	.;.;RHG24_HUMAN;.	D	144;144;49;49;18;59;51	ENSP00000378611:E144D;ENSP00000423206:E144D;ENSP00000426105:E49D;ENSP00000378610:E49D;ENSP00000424256:E18D;ENSP00000425589:E59D;ENSP00000264343:E51D	ENSP00000264343:E51D	E	+	3	2	ARHGAP24	87082283	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	1.880000	0.39628	0.841000	0.35020	0.650000	0.86243	GAG		0.448	ARHGAP24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252815.2	NM_031305	
AFF1	4299	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	4	87967367	87967367	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr4:87967367C>T	ENST00000307808.6	+	2	487	c.67C>T	c.(67-69)Cgc>Tgc	p.R23C	AFF1_ENST00000544085.1_Intron|AFF1_ENST00000395146.4_Missense_Mutation_p.R30C	NM_005935.2	NP_005926.1	P51825	AFF1_HUMAN	AF4/FMR2 family, member 1	23					positive regulation of transcription, DNA-templated (GO:0045893)	transcription elongation factor complex (GO:0008023)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|large_intestine(2)	3		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000233)		GAAGGAAAGACGCAACCAGGA	0.403																																						.											0													110.0	109.0	109.0					4																	87967367		2203	4300	6503	SO:0001583	missense	4299			L22179	CCDS3616.1, CCDS54775.1	4q21.3	2009-08-04	2005-06-27	2005-06-27	ENSG00000172493	ENSG00000172493			7135	protein-coding gene	gene with protein product		159557	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 2"", ""pre-B-cell monocytic leukemia partner 1"""	PBM1, MLLT2		7689231, 1423625, 8353274	Standard	NM_005935		Approved	AF-4, AF4	uc011ccz.2	P51825	OTTHUMG00000130603	ENST00000307808.6:c.67C>T	4.37:g.87967367C>T	ENSP00000305689:p.Arg23Cys	Somatic		WXS	Illumina HiSeq	Phase_I	B4DTU1|E9PBM3	Missense_Mutation	SNP	ENST00000307808.6	37	CCDS3616.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.984267	0.74474	.	.	ENSG00000172493	ENST00000395146;ENST00000395142;ENST00000507468;ENST00000503477;ENST00000307808	T;T;T;T	0.78816	-1.21;-1.21;-1.21;-1.21	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	D	0.89072	0.6611	M	0.84683	2.71	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.999;0.999;0.999	D	0.90059	0.4155	10	0.87932	D	0	-27.6095	15.5699	0.76326	0.2016:0.7984:0.0:0.0	.	30;30;23;23;30	E9PBM3;B4DXZ8;Q14C88;P51825;B4DTU1	.;.;.;AFF1_HUMAN;.	C	30;30;30;30;23	ENSP00000378578:R30C;ENSP00000427593:R30C;ENSP00000424483:R30C;ENSP00000305689:R23C	ENSP00000305689:R23C	R	+	1	0	AFF1	88186391	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	1.919000	0.40015	2.854000	0.98071	0.655000	0.94253	CGC		0.403	AFF1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253053.3	NM_005935	
GLP1R	2740	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	6	39040661	39040661	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr6:39040661A>G	ENST00000373256.4	+	6	576	c.533A>G	c.(532-534)tAc>tGc	p.Y178C		NM_002062.3	NP_002053.3	P43220	GLP1R_HUMAN	glucagon-like peptide 1 receptor	178					activation of adenylate cyclase activity (GO:0007190)|cAMP-mediated signaling (GO:0019933)|energy reserve metabolic process (GO:0006112)|learning or memory (GO:0007611)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of heart contraction (GO:0008016)|regulation of insulin secretion (GO:0050796)|response to stress (GO:0006950)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glucagon receptor activity (GO:0004967)|transmembrane signaling receptor activity (GO:0004888)			breast(5)|endometrium(3)|kidney(1)|large_intestine(8)|lung(9)|pancreas(1)|prostate(1)|skin(1)|stomach(2)	31					Exenatide(DB01276)|Glucagon recombinant(DB00040)|Liraglutide(DB06655)	ACCAGGAACTACATCCACCTG	0.557																																						.											0													210.0	167.0	181.0					6																	39040661		2203	4300	6503	SO:0001583	missense	2740				CCDS4839.1	6p21	2012-08-10			ENSG00000112164	ENSG00000112164		"""GPCR / Class B : Glucagon receptors"""	4324	protein-coding gene	gene with protein product		138032					Standard	NM_002062		Approved		uc003ooj.4	P43220	OTTHUMG00000014638	ENST00000373256.4:c.533A>G	6.37:g.39040661A>G	ENSP00000362353:p.Tyr178Cys	Somatic		WXS	Illumina HiSeq	Phase_I	Q2M229|Q99669	Missense_Mutation	SNP	ENST00000373256.4	37	CCDS4839.1	.	.	.	.	.	.	.	.	.	.	A	19.32	3.804534	0.70682	.	.	ENSG00000112164	ENST00000373256	T	0.39406	1.08	5.56	3.08	0.35506	GPCR, family 2-like (1);	0.000000	0.56097	D	0.000024	T	0.58481	0.2125	M	0.91717	3.235	0.52099	D	0.999945	D	0.89917	1.0	D	0.91635	0.999	T	0.64360	-0.6426	10	0.72032	D	0.01	.	8.7911	0.34852	0.7396:0.1333:0.0:0.127	.	178	P43220	GLP1R_HUMAN	C	178	ENSP00000362353:Y178C	ENSP00000362353:Y178C	Y	+	2	0	GLP1R	39148639	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.310000	0.96267	0.363000	0.24346	-0.333000	0.08304	TAC		0.557	GLP1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040443.1		
ARFGEF1	10565	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	8	68152453	68152453	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr8:68152453G>A	ENST00000262215.3	-	20	3312	c.2923C>T	c.(2923-2925)Ctt>Ttt	p.L975F	ARFGEF1_ENST00000518230.1_5'Flank|ARFGEF1_ENST00000520381.1_Missense_Mutation_p.L429F	NM_006421.4	NP_006412.2	Q9Y6D6	BIG1_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)	975					endomembrane system organization (GO:0010256)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein glycosylation in Golgi (GO:0090284)|positive regulation of wound healing (GO:0090303)|protein transport (GO:0015031)|regulation of ARF protein signal transduction (GO:0032012)|regulation of establishment of cell polarity (GO:2000114)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|small nuclear ribonucleoprotein complex (GO:0030532)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|guanyl-nucleotide exchange factor activity (GO:0005085)|myosin binding (GO:0017022)|protein kinase A regulatory subunit binding (GO:0034237)			breast(1)|endometrium(14)|kidney(4)|large_intestine(17)|lung(20)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			TCCAGGCAAAGAGAGGCTACT	0.368																																						.											0													119.0	109.0	112.0					8																	68152453		2203	4300	6503	SO:0001583	missense	10565			AF084520	CCDS6199.1	8q13	2011-08-18	2011-08-18		ENSG00000066777	ENSG00000066777			15772	protein-coding gene	gene with protein product		604141				10212200, 8917509	Standard	NM_006421		Approved	DKFZP434L057, BIG1, ARFGEP1, p200	uc003xxo.2	Q9Y6D6	OTTHUMG00000164626	ENST00000262215.3:c.2923C>T	8.37:g.68152453G>A	ENSP00000262215:p.Leu975Phe	Somatic		WXS	Illumina HiSeq	Phase_I	Q9NV46|Q9UFV2|Q9UNL0	Missense_Mutation	SNP	ENST00000262215.3	37	CCDS6199.1	.	.	.	.	.	.	.	.	.	.	G	34	5.302469	0.95601	.	.	ENSG00000066777	ENST00000520381;ENST00000262215	T;T	0.52754	0.65;0.65	5.84	5.84	0.93424	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.76659	0.4018	M	0.89968	3.075	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.87578	0.998;0.964	T	0.80520	-0.1346	10	0.87932	D	0	.	20.1466	0.98079	0.0:0.0:1.0:0.0	.	975;429	Q9Y6D6;E5RIF2	BIG1_HUMAN;.	F	429;975	ENSP00000428429:L429F;ENSP00000262215:L975F	ENSP00000262215:L975F	L	-	1	0	ARFGEF1	68315007	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.734000	0.74801	2.779000	0.95612	0.591000	0.81541	CTT		0.368	ARFGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379441.4	NM_006421	
RPL11	6135	hgsc.bcm.edu	37	1	24021261	24021261	+	Frame_Shift_Del	DEL	T	T	-			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr1:24021261delT	ENST00000374550.3	+	4	421	c.376delT	c.(376-378)tacfs	p.Y126fs	RPL11_ENST00000482370.1_3'UTR	NM_000975.3|NM_001199802.1	NP_000966.2|NP_001186731.1	P62913	RL11_HUMAN	ribosomal protein L11	126					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|protein localization to nucleus (GO:0034504)|protein targeting (GO:0006605)|ribosomal large subunit biogenesis (GO:0042273)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(2)	6		Colorectal(325;3.46e-05)|Lung NSC(340;0.000112)|all_lung(284;0.00016)|Renal(390;0.000219)|Breast(348;0.0044)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;2.13e-24)|Colorectal(126;5.06e-08)|COAD - Colon adenocarcinoma(152;2.92e-06)|GBM - Glioblastoma multiforme(114;4.4e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000954)|KIRC - Kidney renal clear cell carcinoma(1967;0.00322)|STAD - Stomach adenocarcinoma(196;0.0124)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0837)|LUSC - Lung squamous cell carcinoma(448;0.185)		CATTGGTATCTACGGCCTGGA	0.408																																						.											0													151.0	144.0	147.0					1																	24021261		2203	4300	6503	SO:0001589	frameshift_variant	6135			L05092	CCDS238.1	1p36.1-p35	2011-04-06			ENSG00000142676	ENSG00000142676		"""L ribosomal proteins"""	10301	protein-coding gene	gene with protein product		604175				9582194, 10343117	Standard	NM_000975		Approved	L11	uc001bhk.3	P62913	OTTHUMG00000002926	ENST00000374550.3:c.376delT	1.37:g.24021261delT	ENSP00000363676:p.Tyr126fs	Somatic		WXS	Illumina HiSeq	Phase_I	P25121|P39026|Q8TDH2|Q9Y674	Frame_Shift_Del	DEL	ENST00000374550.3	37	CCDS238.1																																																																																				0.408	RPL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008168.1	NM_000975	
DNAJC17	55192	hgsc.bcm.edu	37	15	41060179	41060179	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr15:41060179C>T	ENST00000220496.4	-	11	904	c.874G>A	c.(874-876)Gca>Aca	p.A292T	DNAJC17_ENST00000558727.1_5'UTR|C15orf62_ENST00000344320.6_5'Flank	NM_018163.2	NP_060633.1	Q9NVM6	DJC17_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 17	292					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)		nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(1)|kidney(1)|large_intestine(2)|pancreas(1)|skin(1)	6		all_cancers(109;4.16e-14)|all_epithelial(112;9.68e-12)|Lung NSC(122;3.19e-09)|all_lung(180;6.45e-08)|Melanoma(134;0.091)|Colorectal(260;0.175)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;2.91e-05)|COAD - Colon adenocarcinoma(120;0.153)|BRCA - Breast invasive adenocarcinoma(123;0.166)		TGCATCCGTGCGATCAGCTGT	0.607																																						.											0													76.0	68.0	70.0					15																	41060179		2203	4300	6503	SO:0001583	missense	55192			AK001496	CCDS10065.1	15q15.1	2014-02-12			ENSG00000104129	ENSG00000104129		"""Heat shock proteins / DNAJ (HSP40)"", ""RNA binding motif (RRM) containing"""	25556	protein-coding gene	gene with protein product						12477932	Standard	NM_018163		Approved	FLJ10634	uc001zms.2	Q9NVM6	OTTHUMG00000130065	ENST00000220496.4:c.874G>A	15.37:g.41060179C>T	ENSP00000220496:p.Ala292Thr	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000220496.4	37	CCDS10065.1	.	.	.	.	.	.	.	.	.	.	C	14.18	2.457642	0.43634	.	.	ENSG00000104129	ENST00000220496	T	0.17691	2.26	5.74	3.87	0.44632	.	0.103900	0.64402	D	0.000004	T	0.18425	0.0442	L	0.60455	1.87	0.36819	D	0.886305	B	0.10296	0.003	B	0.09377	0.004	T	0.06197	-1.0840	10	0.54805	T	0.06	.	10.9764	0.47469	0.0:0.8536:0.0:0.1464	.	292	Q9NVM6	DJC17_HUMAN	T	292	ENSP00000220496:A292T	ENSP00000220496:A292T	A	-	1	0	DNAJC17	38847471	0.919000	0.31177	0.767000	0.31495	0.282000	0.26991	1.831000	0.39141	0.900000	0.36469	0.561000	0.74099	GCA		0.607	DNAJC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252356.2	NM_018163	
MAPK3	5595	hgsc.bcm.edu	37	16	30128095	30128095	+	Missense_Mutation	SNP	G	G	T			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr16:30128095G>T	ENST00000263025.4	-	8	1118	c.1034C>A	c.(1033-1035)cCc>cAc	p.P345H	MAPK3_ENST00000484663.1_Missense_Mutation_p.P231H|MAPK3_ENST00000395202.1_Missense_Mutation_p.P301H|MAPK3_ENST00000322266.5_Missense_Mutation_p.P301H|MAPK3_ENST00000403394.1_3'UTR|MAPK3_ENST00000494643.1_5'Flank|GDPD3_ENST00000406256.3_5'Flank|MAPK3_ENST00000395200.1_Missense_Mutation_p.P277H	NM_002746.2	NP_002737.2	P27361	MK03_HUMAN	mitogen-activated protein kinase 3	345					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|caveolin-mediated endocytosis (GO:0072584)|cell cycle (GO:0007049)|cellular response to mechanical stimulus (GO:0071260)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage induced protein phosphorylation (GO:0006975)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|interleukin-1-mediated signaling pathway (GO:0070498)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MAPK cascade (GO:0000165)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apolipoprotein binding (GO:2000657)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|peptidyl-tyrosine autophosphorylation (GO:0038083)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone phosphorylation (GO:0033129)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of cytoskeleton organization (GO:0051493)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of Golgi inheritance (GO:0090170)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of stress-activated MAPK cascade (GO:0032872)|response to epidermal growth factor (GO:0070849)|response to exogenous dsRNA (GO:0043330)|sensory perception of pain (GO:0019233)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	caveola (GO:0005901)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pseudopodium (GO:0031143)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|phosphatase binding (GO:0019902)									Arsenic trioxide(DB01169)|Sulindac(DB00605)	GAAGGTGAAGGGCTCCTCGGC	0.662																																						.											0													43.0	46.0	45.0					16																	30128095		2197	4300	6497	SO:0001583	missense	5595			M84490	CCDS10672.1, CCDS42148.1, CCDS42149.1	16p11.2	2011-06-10			ENSG00000102882	ENSG00000102882	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6877	protein-coding gene	gene with protein product		601795		PRKM3		9628824	Standard	NM_001109891		Approved	ERK1, p44mapk, p44erk1	uc002dws.3	P27361	OTTHUMG00000132149	ENST00000263025.4:c.1034C>A	16.37:g.30128095G>T	ENSP00000263025:p.Pro345His	Somatic		WXS	Illumina HiSeq	Phase_I	A8CZ58|B0LPG3|Q8NHX1	Missense_Mutation	SNP	ENST00000263025.4	37	CCDS10672.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.498895	0.85069	.	.	ENSG00000102882	ENST00000263025;ENST00000484663;ENST00000322266;ENST00000395200;ENST00000395202;ENST00000478356	T;T;T;T;T;T	0.77489	-1.1;-1.01;-1.07;0.61;-1.07;2.77	5.79	5.79	0.91817	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	D	0.90875	0.7133	M	0.92507	3.315	0.80722	D	1	D;B	0.76494	0.999;0.268	D;B	0.69479	0.964;0.067	D	0.92267	0.5822	10	0.66056	D	0.02	-0.0145	18.7978	0.92003	0.0:0.0:1.0:0.0	.	301;345	P27361-2;P27361	.;MK03_HUMAN	H	345;231;301;277;301;108	ENSP00000263025:P345H;ENSP00000432742:P231H;ENSP00000327293:P301H;ENSP00000378626:P277H;ENSP00000378628:P301H;ENSP00000432292:P108H	ENSP00000263025:P345H	P	-	2	0	MAPK3	30035596	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	9.635000	0.98437	2.735000	0.93741	0.655000	0.94253	CCC		0.662	MAPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255196.2		
CHD3	1107	broad.mit.edu;hgsc.bcm.edu	37	17	7793910	7793910	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr17:7793910T>C	ENST00000330494.7	+	3	385	c.235T>C	c.(235-237)Tct>Cct	p.S79P	CHD3_ENST00000380358.4_Missense_Mutation_p.S138P|CHD3_ENST00000570758.1_3'UTR|CHD3_ENST00000358181.4_Missense_Mutation_p.S79P	NM_001005273.2	NP_001005273.1	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3	79					centrosome organization (GO:0051297)|chromatin assembly or disassembly (GO:0006333)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|spindle organization (GO:0007051)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(11)|kidney(6)|large_intestine(13)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	65		Prostate(122;0.202)				GGAATTTGGTTCTGAGCGAGA	0.448																																						.											0													39.0	42.0	41.0					17																	7793910		2203	4300	6503	SO:0001583	missense	1107			U08379	CCDS32553.2, CCDS32554.1, CCDS32555.1	17p13	2013-01-28			ENSG00000170004	ENSG00000170004		"""Zinc fingers, PHD-type"""	1918	protein-coding gene	gene with protein product		602120				9326634, 7560064	Standard	NM_001005271		Approved	Mi-2a, ZFH, Mi2-ALPHA	uc002gjd.2	Q12873	OTTHUMG00000150427	ENST00000330494.7:c.235T>C	17.37:g.7793910T>C	ENSP00000332628:p.Ser79Pro	Somatic		WXS	Illumina HiSeq	Phase_I	D3DTQ9|E9PG89|Q9Y4I0	Missense_Mutation	SNP	ENST00000330494.7	37	CCDS32554.1	.	.	.	.	.	.	.	.	.	.	T	14.64	2.596618	0.46318	.	.	ENSG00000170004	ENST00000380358;ENST00000358181;ENST00000330494	T;D;D	0.90261	1.47;-2.64;-2.64	4.76	4.76	0.60689	.	0.000000	0.38605	N	0.001630	D	0.92704	0.7681	L	0.43152	1.355	0.52501	D	0.999958	D;D;D	0.69078	0.997;0.995;0.995	D;D;D	0.75484	0.986;0.969;0.979	D	0.92477	0.5990	10	0.44086	T	0.13	-10.0278	14.2672	0.66126	0.0:0.0:0.0:1.0	.	79;79;138	Q12873-2;Q12873;E9PG89	.;CHD3_HUMAN;.	P	138;79;79	ENSP00000369716:S138P;ENSP00000350907:S79P;ENSP00000332628:S79P	ENSP00000332628:S79P	S	+	1	0	CHD3	7734635	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.390000	0.79816	1.765000	0.52091	0.383000	0.25322	TCT		0.448	CHD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318050.1	NM_001005273	
MUC16	94025	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	19	9058813	9058813	+	Missense_Mutation	SNP	C	C	G			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr19:9058813C>G	ENST00000397910.4	-	3	28836	c.28633G>C	c.(28633-28635)Gtg>Ctg	p.V9545L		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9547	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GGAGATATCACTTTTGTTGGC	0.453																																						.											0													104.0	100.0	101.0					19																	9058813		1917	4133	6050	SO:0001583	missense	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.28633G>C	19.37:g.9058813C>G	ENSP00000381008:p.Val9545Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	c	5.100	0.204117	0.09704	.	.	ENSG00000181143	ENST00000397910	T	0.23147	1.92	2.27	-0.0985	0.13628	.	.	.	.	.	T	0.14960	0.0361	N	0.24115	0.695	.	.	.	B	0.19817	0.039	B	0.23574	0.047	T	0.25467	-1.0131	8	0.87932	D	0	.	3.2643	0.06859	0.0:0.5449:0.2801:0.175	.	9545	B5ME49	.	L	9545	ENSP00000381008:V9545L	ENSP00000381008:V9545L	V	-	1	0	MUC16	8919813	0.000000	0.05858	0.000000	0.03702	0.026000	0.11368	-0.943000	0.03917	0.051000	0.15978	0.305000	0.20034	GTG		0.453	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
GJA10	84694	hgsc.bcm.edu;bcgsc.ca	37	6	90605153	90605153	+	Missense_Mutation	SNP	G	G	T			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr6:90605153G>T	ENST00000369352.1	+	1	966	c.966G>T	c.(964-966)tgG>tgT	p.W322C	Y_RNA_ENST00000517082.1_RNA	NM_032602.1	NP_115991.1	P57773	CXA9_HUMAN	gap junction protein, alpha 10, 62kDa	4					cell communication (GO:0007154)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)				breast(2)|endometrium(2)|kidney(1)|large_intestine(10)|lung(17)|ovary(1)|skin(3)|urinary_tract(1)	37		all_cancers(76;5.71e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00527)		BRCA - Breast invasive adenocarcinoma(108;0.0915)		AAAAGGACTGGTCTGAGAAGG	0.507																																						.											0													76.0	72.0	74.0					6																	90605153		2203	4300	6503	SO:0001583	missense	84694			AF296766	CCDS5025.1	6q15-q16	2008-02-05			ENSG00000135355	ENSG00000135355		"""Ion channels / Gap junction proteins (connexins)"""	16995	protein-coding gene	gene with protein product	"""connexin 62"""	611924					Standard	NM_032602		Approved	CX62	uc011eaa.2	Q969M2	OTTHUMG00000015210	ENST00000369352.1:c.966G>T	6.37:g.90605153G>T	ENSP00000358358:p.Trp322Cys	Somatic		WXS	Illumina HiSeq	Phase_I	B2R722|B3KVQ2|Q5TA63|Q96KG0	Missense_Mutation	SNP	ENST00000369352.1	37	CCDS5025.1	.	.	.	.	.	.	.	.	.	.	G	3.006	-0.205059	0.06180	.	.	ENSG00000135355	ENST00000369352	D	0.98901	-5.22	5.6	1.7	0.24286	.	0.962270	0.08562	N	0.927439	D	0.93706	0.7989	M	0.63843	1.955	0.19775	N	0.999951	B	0.15719	0.014	B	0.12156	0.007	D	0.87229	0.2259	10	0.37606	T	0.19	.	2.2376	0.04012	0.1489:0.1316:0.4486:0.2708	.	322	Q969M2	CXA10_HUMAN	C	322	ENSP00000358358:W322C	ENSP00000358358:W322C	W	+	3	0	GJA10	90661874	0.002000	0.14202	0.015000	0.15790	0.237000	0.25408	0.550000	0.23345	0.276000	0.22118	0.563000	0.77884	TGG		0.507	GJA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041505.1	NM_032602	
HRNR	388697	broad.mit.edu	37	1	152186038	152186038	+	Frame_Shift_Del	DEL	A	A	-			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr1:152186038delA	ENST00000368801.2	-	3	8142	c.8067delT	c.(8065-8067)ggtfs	p.G2689fs	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	2689					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CAGAAGAGTGACCCAAGCGAG	0.577																																						.											0													29.0	26.0	27.0					1																	152186038		1971	3911	5882	SO:0001589	frameshift_variant	388697			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.8067delT	1.37:g.152186038delA	ENSP00000357791:p.Gly2689fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q5DT20|Q5U1F4	Frame_Shift_Del	DEL	ENST00000368801.2	37	CCDS30859.1																																																																																				0.577	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868	
HRNR	388697	broad.mit.edu	37	1	152186047	152186047	+	Frame_Shift_Del	DEL	A	A	-			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr1:152186047delA	ENST00000368801.2	-	3	8133	c.8058delT	c.(8056-8058)tctfs	p.S2686fs	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	2686					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GACCCAAGCGAGACTCATATG	0.587																																						.											0													27.0	24.0	25.0					1																	152186047		1883	3790	5673	SO:0001589	frameshift_variant	388697			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.8058delT	1.37:g.152186047delA	ENSP00000357791:p.Ser2686fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q5DT20|Q5U1F4	Frame_Shift_Del	DEL	ENST00000368801.2	37	CCDS30859.1																																																																																				0.587	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868	
FAM149B1	317662	broad.mit.edu	37	10	74952370	74952370	+	Silent	SNP	A	A	G			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr10:74952370A>G	ENST00000242505.6	+	4	513	c.339A>G	c.(337-339)gaA>gaG	p.E113E	Y_RNA_ENST00000362331.1_RNA	NM_173348.1	NP_775483.1	Q96BN6	F149B_HUMAN	family with sequence similarity 149, member B1	113										breast(2)|endometrium(1)|kidney(1)|stomach(3)	7						CCATTGATGAACTCTTGTATG	0.438																																						.											0													97.0	85.0	89.0					10																	74952370		692	1591	2283	SO:0001819	synonymous_variant	317662			AB023191	CCDS44435.1	10q22.2	2008-10-27	2007-11-14	2007-11-14	ENSG00000138286	ENSG00000138286			29162	protein-coding gene	gene with protein product			"""KIAA0974"""	KIAA0974		10231032	Standard	NM_173348		Approved		uc009xqz.3	Q96BN6	OTTHUMG00000067794	ENST00000242505.6:c.339A>G	10.37:g.74952370A>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q9Y2I0	Silent	SNP	ENST00000242505.6	37	CCDS44435.1	.	.	.	.	.	.	.	.	.	.	A	9.263	1.043654	0.19748	.	.	ENSG00000138286	ENST00000372955	.	.	.	5.5	1.52	0.23074	.	.	.	.	.	T	0.55353	0.1915	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46303	-0.9201	4	.	.	.	-9.544	8.0104	0.30351	0.4344:0.0:0.5656:0.0	.	.	.	.	S	54	.	.	N	+	2	0	FAM149B1	74622376	0.741000	0.28217	1.000000	0.80357	0.985000	0.73830	-0.343000	0.07791	0.271000	0.22005	-0.468000	0.05107	AAC		0.438	FAM149B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000145438.1	NM_173348	
ABCC8	6833	broad.mit.edu	37	11	17483365	17483365	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr11:17483365A>G	ENST00000389817.3	-	5	655	c.587T>C	c.(586-588)aTc>aCc	p.I196T	ABCC8_ENST00000302539.4_Missense_Mutation_p.I196T			Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 8	196					carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium ion transmembrane transporter activity (GO:0015079)|sulfonylurea receptor activity (GO:0008281)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(38)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	67				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Chlorpropamide(DB00672)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Gliquidone(DB01251)|Glyburide(DB01016)|Glycodiazine(DB01382)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolbutamide(DB01124)	CTTGAAGAAGATGTATCTCTG	0.572																																						.											0													58.0	55.0	56.0					11																	17483365		2200	4293	6493	SO:0001583	missense	6833			L78207	CCDS31437.1, CCDS73264.1	11p15.1	2014-09-17			ENSG00000006071	ENSG00000006071		"""ATP binding cassette transporters / subfamily C"""	59	protein-coding gene	gene with protein product	"""sulfonylurea receptor (hyperinsulinemia)"""	600509		SUR, HRINS		7920639, 7716548	Standard	NM_000352		Approved	HI, PHHI, SUR1, MRP8, ABC36, HHF1, TNDM2	uc001mnc.3	Q09428	OTTHUMG00000166316	ENST00000389817.3:c.587T>C	11.37:g.17483365A>G	ENSP00000374467:p.Ile196Thr	Somatic		WXS	Illumina HiSeq	Phase_I	A6NMX8|E3UYX6|O75948|Q16583	Missense_Mutation	SNP	ENST00000389817.3	37	CCDS31437.1	.	.	.	.	.	.	.	.	.	.	A	16.31	3.087067	0.55861	.	.	ENSG00000006071	ENST00000389817;ENST00000302539;ENST00000379493	D;D	0.91180	-2.8;-2.8	5.49	5.49	0.81192	.	0.230857	0.36034	N	0.002829	D	0.83806	0.5334	N	0.14661	0.345	0.44439	D	0.997363	B;B	0.18968	0.032;0.009	B;B	0.19946	0.017;0.027	T	0.80056	-0.1542	10	0.51188	T	0.08	.	15.8929	0.79315	1.0:0.0:0.0:0.0	.	196;196	B7Z4N0;Q09428	.;ABCC8_HUMAN	T	196;196;210	ENSP00000374467:I196T;ENSP00000303960:I196T	ENSP00000303960:I196T	I	-	2	0	ABCC8	17439941	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.057000	0.93889	2.205000	0.71048	0.528000	0.53228	ATC		0.572	ABCC8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000389093.1	NM_000352	
C2CD3	26005	broad.mit.edu	37	11	73820090	73820090	+	Missense_Mutation	SNP	G	G	T			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr11:73820090G>T	ENST00000334126.7	-	12	2177	c.1951C>A	c.(1951-1953)Cca>Aca	p.P651T	C2CD3_ENST00000313663.7_Missense_Mutation_p.P651T			Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	651					brain development (GO:0007420)|centriole elongation (GO:0061511)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|neural plate axis specification (GO:0021997)|neural tube development (GO:0021915)|nonmotile primary cilium assembly (GO:0035058)|protein localization to centrosome (GO:0071539)|protein processing (GO:0016485)|regulation of proteolysis (GO:0030162)|regulation of smoothened signaling pathway (GO:0008589)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)				NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(26)|ovary(4)|pancreas(2)|prostate(1)|skin(3)	64	Breast(11;4.16e-06)					TTTTTCTGTGGAGTTTTCTTT	0.398																																						.											0													112.0	110.0	111.0					11																	73820090		2200	4293	6493	SO:0001583	missense	26005			BC035599	CCDS31636.1, CCDS66167.1	11q13.4	2014-02-12	2007-10-17		ENSG00000168014	ENSG00000168014			24564	protein-coding gene	gene with protein product		615944					Standard	XM_005273897		Approved	DKFZP586P0123	uc001ouu.2	Q4AC94	OTTHUMG00000168110	ENST00000334126.7:c.1951C>A	11.37:g.73820090G>T	ENSP00000334379:p.Pro651Thr	Somatic		WXS	Illumina HiSeq	Phase_I	C9JR55|E2QRD1|Q2NLE1|Q3C1U9|Q6ZU92|Q8IYM4|Q8NB87|Q8NDH7|Q9Y4M2	Missense_Mutation	SNP	ENST00000334126.7	37		.	.	.	.	.	.	.	.	.	.	G	0.210	-1.037313	0.02013	.	.	ENSG00000168014	ENST00000334126;ENST00000313663;ENST00000313681	T;T	0.08546	3.08;3.08	5.46	2.38	0.29361	.	0.291255	0.34223	N	0.004144	T	0.04543	0.0124	L	0.36672	1.1	0.25691	N	0.985688	B	0.28350	0.208	B	0.22152	0.038	T	0.35276	-0.9795	10	0.09084	T	0.74	-1.4511	3.0945	0.06304	0.0926:0.1185:0.4536:0.3353	.	651	Q4AC94-1	.	T	651	ENSP00000334379:P651T;ENSP00000323339:P651T	ENSP00000323339:P651T	P	-	1	0	C2CD3	73497738	0.979000	0.34478	0.885000	0.34714	0.593000	0.36681	1.535000	0.36061	1.310000	0.45006	0.650000	0.86243	CCA		0.398	C2CD3-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015531	
ITGA5	3678	broad.mit.edu	37	12	54812840	54812840	+	Missense_Mutation	SNP	G	G	T			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr12:54812840G>T	ENST00000293379.4	-	1	404	c.143C>A	c.(142-144)gCc>gAc	p.A48D	RP11-753H16.5_ENST00000552785.1_RNA|RP11-753H16.3_ENST00000550474.1_RNA|RP11-753H16.3_ENST00000552053.1_RNA	NM_002205.2	NP_002196.2	P08648	ITA5_HUMAN	integrin, alpha 5 (fibronectin receptor, alpha polypeptide)	48					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|memory (GO:0007613)|negative regulation of anoikis (GO:2000811)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|viral process (GO:0016032)|wound healing, spreading of epidermal cells (GO:0035313)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	metal ion binding (GO:0046872)|platelet-derived growth factor receptor binding (GO:0005161)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	34						TACTGCTGGGGCCTCCGCGTC	0.706																																						.											0													13.0	19.0	17.0					12																	54812840		2110	4214	6324	SO:0001583	missense	3678				CCDS8880.1	12q11-q13	2010-03-23				ENSG00000161638		"""CD molecules"", ""Integrins"""	6141	protein-coding gene	gene with protein product		135620		FNRA		2454952	Standard	NM_002205		Approved	CD49e	uc001sga.3	P08648	OTTHUMG00000169841	ENST00000293379.4:c.143C>A	12.37:g.54812840G>T	ENSP00000293379:p.Ala48Asp	Somatic		WXS	Illumina HiSeq	Phase_I	Q96HA5	Missense_Mutation	SNP	ENST00000293379.4	37	CCDS8880.1	.	.	.	.	.	.	.	.	.	.	G	11.64	1.699146	0.30142	.	.	ENSG00000161638	ENST00000293379	T	0.69685	-0.42	4.54	3.64	0.41730	.	0.339088	0.30959	N	0.008525	T	0.50411	0.1614	L	0.28400	0.85	0.38871	D	0.956695	B	0.32781	0.384	B	0.28305	0.088	T	0.53078	-0.8489	10	0.39692	T	0.17	.	10.6553	0.45671	0.0:0.1943:0.8057:0.0	.	48	P08648	ITA5_HUMAN	D	48	ENSP00000293379:A48D	ENSP00000293379:A48D	A	-	2	0	ITGA5	53099107	1.000000	0.71417	1.000000	0.80357	0.778000	0.44026	2.524000	0.45589	1.254000	0.44035	0.462000	0.41574	GCC		0.706	ITGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406174.1		
WHAMMP3	339005	broad.mit.edu	37	15	23191911	23191911	+	RNA	SNP	C	C	T	rs147199465		TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr15:23191911C>T	ENST00000400153.2	-	0	1785					NR_003521.1		Q1A5X7	WHAL1_HUMAN	WAS protein homolog associated with actin, golgi membranes and microtubules pseudogene 3																		TGATTTTCTTCGCACTGATCC	0.408																																						.											0																																												339005			BC048987		15q11.2	2014-03-20	2011-06-24	2011-06-24	ENSG00000187667	ENSG00000276141			27892	pseudogene	pseudogene			"""WAS protein homology region 2 domain containing 1-like 1"", ""WAS protein homolog associated with actin, golgi membranes and microtubules-like 1"", ""WAS protein homolog associated with actin, golgi membranes and microtubules-like 1 (pseudogene)"""	WHDC1L1, WHAMML1		18226259	Standard	NR_003521		Approved		uc001yvg.3	Q1A5X7	OTTHUMG00000171921		15.37:g.23191911C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q1A5X8|Q52M16|Q52M18	RNA	SNP	ENST00000400153.2	37																																																																																					0.408	WHAMMP3-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000415907.1	NR_003521	
CEP152	22995	broad.mit.edu;mdanderson.org;bcgsc.ca	37	15	49081131	49081131	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr15:49081131T>C	ENST00000380950.2	-	9	1227	c.1040A>G	c.(1039-1041)cAt>cGt	p.H347R	CEP152_ENST00000325747.5_Missense_Mutation_p.H254R|CEP152_ENST00000399334.3_Missense_Mutation_p.H347R	NM_001194998.1|NM_014985.3	NP_001181927.1|NP_055800.2	O94986	CE152_HUMAN	centrosomal protein 152kDa	347					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)			breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(16)|lung(30)|ovary(1)|prostate(2)|skin(2)	63		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		TTCAGAATGATGAAGGTCCAC	0.408																																						.											0													175.0	160.0	165.0					15																	49081131		1938	4147	6085	SO:0001583	missense	22995			AB020719	CCDS42033.1, CCDS58361.1	15q21.1	2014-02-20							29298	protein-coding gene	gene with protein product	"""asterless"""	613529	"""microcephaly, primary autosomal recessive 4"""	MCPH4		14654843, 21131973	Standard	NM_014985		Approved	KIAA0912, SCKL5	uc001zwz.3	O94986		ENST00000380950.2:c.1040A>G	15.37:g.49081131T>C	ENSP00000370337:p.His347Arg	Somatic		WXS	Illumina HiSeq	Phase_I	E7ER66|Q17RV1|Q6NTA0	Missense_Mutation	SNP	ENST00000380950.2	37	CCDS58361.1	.	.	.	.	.	.	.	.	.	.	T	2.260	-0.369551	0.05069	.	.	ENSG00000103995	ENST00000380950;ENST00000325747;ENST00000399334;ENST00000541880	T;T;T	0.75589	-0.95;-0.95;-0.95	5.79	-3.12	0.05282	.	0.430803	0.27932	N	0.017275	T	0.43722	0.1260	N	0.10664	0.02	0.09310	N	1	B;B;B	0.11235	0.004;0.0;0.0	B;B;B	0.11329	0.006;0.001;0.002	T	0.42344	-0.9457	10	0.06625	T	0.88	-4.476	9.3157	0.37932	0.0:0.4731:0.1117:0.4153	.	254;347;347	O94986-1;E7ER66;O94986	.;.;CE152_HUMAN	R	347;254;347;347	ENSP00000370337:H347R;ENSP00000321000:H254R;ENSP00000382271:H347R	ENSP00000321000:H254R	H	-	2	0	CEP152	46868423	0.768000	0.28519	0.180000	0.23079	0.984000	0.73092	0.432000	0.21461	-0.336000	0.08438	0.533000	0.62120	CAT		0.408	CEP152-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417365.1	NM_014985	
ACAN	176	broad.mit.edu;mdanderson.org;bcgsc.ca	37	15	89383275	89383275	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr15:89383275C>T	ENST00000561243.1	+	3	487	c.487C>T	c.(487-489)Cgc>Tgc	p.R163C	ACAN_ENST00000352105.7_Missense_Mutation_p.R163C|ACAN_ENST00000558207.1_Missense_Mutation_p.R163C|ACAN_ENST00000439576.2_Missense_Mutation_p.R163C|ACAN_ENST00000559004.1_Missense_Mutation_p.R163C			P16112	PGCA_HUMAN	aggrecan	163	G1-B.|Link 1. {ECO:0000255|PROSITE- ProRule:PRU00323}.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			CATCTCTACACGCTACACCCT	0.597																																						.											0													47.0	43.0	44.0					15																	89383275		2126	4231	6357	SO:0001583	missense	176			M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.487C>T	15.37:g.89383275C>T	ENSP00000453342:p.Arg163Cys	Somatic		WXS	Illumina HiSeq	Phase_I	Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Missense_Mutation	SNP	ENST00000561243.1	37	CCDS53970.1	.	.	.	.	.	.	.	.	.	.	C	17.21	3.331458	0.60853	.	.	ENSG00000157766	ENST00000439576;ENST00000352105;ENST00000268134	T;T	0.15372	2.43;2.43	5.79	5.79	0.91817	.	0.000000	0.33075	N	0.005313	T	0.51550	0.1681	M	0.93854	3.465	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.61926	-0.6962	10	0.87932	D	0	-18.174	12.6082	0.56535	0.2601:0.7399:0.0:0.0	.	163;163;163	E7ENV9;E7EX88;Q6PID9	.;.;.	C	163	ENSP00000387356:R163C;ENSP00000341615:R163C	ENSP00000268134:R163C	R	+	1	0	ACAN	87184279	1.000000	0.71417	0.982000	0.44146	0.756000	0.42949	4.786000	0.62425	2.733000	0.93635	0.655000	0.94253	CGC		0.597	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416267.2	NM_001135	
CRAMP1L	57585	broad.mit.edu	37	16	1705979	1705979	+	Silent	SNP	A	A	G			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr16:1705979A>G	ENST00000397412.3	+	10	1320	c.1221A>G	c.(1219-1221)acA>acG	p.T407T	LA16c-431H6.6_ENST00000454337.1_Intron|CRAMP1L_ENST00000262317.4_Intron|CRAMP1L_ENST00000436138.3_Silent_p.T404T|CRAMP1L_ENST00000293925.5_Silent_p.T407T			Q96RY5	CRML_HUMAN	Crm, cramped-like (Drosophila)	407						nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(6)|pancreas(1)	22						GTACACTGACACCGCTGCCGG	0.647																																						.											0													33.0	38.0	36.0					16																	1705979		2172	4272	6444	SO:0001819	synonymous_variant	57585			AB037847	CCDS10440.2	16p13.3	2008-07-30	2001-11-28		ENSG00000007545	ENSG00000007545			14122	protein-coding gene	gene with protein product			"""Crm (Cramped Drosophila)-like"""				Standard	NM_020825		Approved	KIAA1426	uc010uvh.2	Q96RY5	OTTHUMG00000074087	ENST00000397412.3:c.1221A>G	16.37:g.1705979A>G		Somatic		WXS	Illumina HiSeq	Phase_I	A8MZL1|B1AJY1|Q8NDN1|Q9P2C1	Silent	SNP	ENST00000397412.3	37	CCDS10440.2																																																																																				0.647	CRAMP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157297.4		
SHISA6	388336	broad.mit.edu	37	17	11461116	11461116	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr17:11461116C>T	ENST00000409168.3	+	4	998	c.998C>T	c.(997-999)cCc>cTc	p.P333L	SHISA6_ENST00000432116.3_Missense_Mutation_p.P365L|SHISA6_ENST00000441885.3_Missense_Mutation_p.P384L	NM_001173461.1	NP_001166932.1	Q6ZSJ9	SHSA6_HUMAN	shisa family member 6	333						alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)				breast(1)|endometrium(4)	5						CGGCACCTGCCCGACCTGGCT	0.647																																						.											0													15.0	18.0	17.0					17																	11461116		692	1591	2283	SO:0001583	missense	388336			AK127379, AK128003	CCDS45615.1, CCDS54089.1, CCDS54090.1	17p13.1-p12	2013-07-31	2013-07-31		ENSG00000188803	ENSG00000188803		"""Shisa homologs"""	34491	protein-coding gene	gene with protein product			"""shisa homolog 6 (Xenopus laevis)"""				Standard	NM_207386		Approved	FLJ45455	uc002gnc.2	Q6ZSJ9	OTTHUMG00000154121	ENST00000409168.3:c.998C>T	17.37:g.11461116C>T	ENSP00000387157:p.Pro333Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B3KXV5|Q4PL63	Missense_Mutation	SNP	ENST00000409168.3	37	CCDS54090.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.102339	0.76983	.	.	ENSG00000188803	ENST00000441885;ENST00000432116;ENST00000409168;ENST00000343478	.	.	.	4.9	4.9	0.64082	.	0.063059	0.64402	D	0.000005	T	0.73289	0.3568	L	0.48642	1.525	0.80722	D	1	D;D	0.76494	0.999;0.994	D;P	0.71414	0.973;0.808	T	0.74763	-0.3555	9	0.56958	D	0.05	.	16.8108	0.85718	0.0:1.0:0.0:0.0	.	384;333	Q6ZSJ9-3;Q6ZSJ9	.;SHSA6_HUMAN	L	384;365;333;231	.	ENSP00000340821:P231L	P	+	2	0	SHISA6	11401841	1.000000	0.71417	0.975000	0.42487	0.504000	0.33889	5.421000	0.66447	2.551000	0.86045	0.305000	0.20034	CCC		0.647	SHISA6-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000333970.2	NM_207386	
NLRP9	338321	broad.mit.edu	37	19	56243852	56243852	+	Nonsense_Mutation	SNP	G	G	A			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr19:56243852G>A	ENST00000332836.2	-	2	1372	c.1345C>T	c.(1345-1347)Caa>Taa	p.Q449*		NM_176820.2	NP_789790.2	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	449	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.					cytoplasm (GO:0005737)	ATP binding (GO:0005524)	p.Q449K(1)		NS(2)|breast(5)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(15)|lung(21)|ovary(2)|prostate(3)|skin(7)|urinary_tract(3)	74		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		CAAAACTCTTGGATACACAGA	0.502																																						.											1	Substitution - Missense(1)	large_intestine(1)											121.0	121.0	121.0					19																	56243852		2203	4300	6503	SO:0001587	stop_gained	338321			AY154464	CCDS12934.1	19q13.43	2006-12-08	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22941	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 9"""	609663	"""NACHT, leucine rich repeat and PYD containing 9"""	NALP9		12563287	Standard	NM_176820		Approved	NOD6, PAN12, CLR19.1	uc002qly.3	Q7RTR0		ENST00000332836.2:c.1345C>T	19.37:g.56243852G>A	ENSP00000331857:p.Gln449*	Somatic		WXS	Illumina HiSeq	Phase_I	B2RN12|Q86W27	Nonsense_Mutation	SNP	ENST00000332836.2	37	CCDS12934.1	.	.	.	.	.	.	.	.	.	.	G	28.8	4.950445	0.92660	.	.	ENSG00000185792	ENST00000332836;ENST00000333452	.	.	.	2.56	2.56	0.30785	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	11.3626	0.49653	0.0:0.0:1.0:0.0	.	.	.	.	X	449	.	ENSP00000331857:Q449X	Q	-	1	0	NLRP9	60935664	1.000000	0.71417	0.029000	0.17559	0.107000	0.19398	5.908000	0.69916	1.792000	0.52537	0.644000	0.83932	CAA		0.502	NLRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453653.1	NM_176820	
PSD4	23550	broad.mit.edu	37	2	113940985	113940985	+	Missense_Mutation	SNP	C	C	T	rs148062987	byFrequency	TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr2:113940985C>T	ENST00000245796.6	+	2	1147	c.952C>T	c.(952-954)Cct>Tct	p.P318S	PSD4_ENST00000441564.3_Missense_Mutation_p.P318S	NM_012455.2	NP_036587.2	Q8NDX1	PSD4_HUMAN	pleckstrin and Sec7 domain containing 4	318					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			cervix(1)|endometrium(2)|large_intestine(4)|lung(13)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						GCATTGTACCCCTCCATTCCC	0.617																																						.											0													61.0	52.0	55.0					2																	113940985		2203	4300	6503	SO:0001583	missense	23550			U63127	CCDS33276.1	2q13	2013-01-10			ENSG00000125637	ENSG00000125637		"""Pleckstrin homology (PH) domain containing"""	19096	protein-coding gene	gene with protein product		614442				12082148	Standard	XM_005263634		Approved	TIC, EFA6B	uc002tjc.3	Q8NDX1	OTTHUMG00000153339	ENST00000245796.6:c.952C>T	2.37:g.113940985C>T	ENSP00000245796:p.Pro318Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A6NEG7|A8K1Y0|O95621|Q4ZG34|Q6GPH8|Q8IYP4	Missense_Mutation	SNP	ENST00000245796.6	37	CCDS33276.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.488476	0.84854	.	.	ENSG00000125637	ENST00000245796;ENST00000441564	T;T	0.12465	2.78;2.68	5.83	5.83	0.93111	.	0.655300	0.14825	N	0.296217	T	0.27765	0.0683	L	0.32530	0.975	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76575	0.988;0.984	T	0.00373	-1.1781	9	.	.	.	.	15.6209	0.76805	0.0:1.0:0.0:0.0	.	318;318	Q8NDX1-2;Q8NDX1	.;PSD4_HUMAN	S	318	ENSP00000245796:P318S;ENSP00000413997:P318S	.	P	+	1	0	PSD4	113657456	0.253000	0.23982	0.287000	0.24848	0.340000	0.28889	2.065000	0.41442	2.758000	0.94735	0.655000	0.94253	CCT		0.617	PSD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330789.1	NM_012455	
CDC45	8318	broad.mit.edu	37	22	19496202	19496202	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr22:19496202A>G	ENST00000407835.1	+	14	1461	c.1205A>G	c.(1204-1206)gAc>gGc	p.D402G	CDC45_ENST00000263201.1_Missense_Mutation_p.D402G|CDC45_ENST00000404724.3_Missense_Mutation_p.D356G|CDC45_ENST00000437685.2_Missense_Mutation_p.D434G			O75419	CDC45_HUMAN	cell division cycle 45	402					DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|prostate(2)|skin(1)	19						CAGGCTCTGGACAGCCTCTCC	0.602																																						.											0													75.0	61.0	66.0					22																	19496202		2203	4300	6503	SO:0001583	missense	8318			AF053074	CCDS13762.1, CCDS54499.1, CCDS54500.1	22q11.21	2013-01-17	2013-01-17	2010-03-24	ENSG00000093009	ENSG00000093009			1739	protein-coding gene	gene with protein product	"""human CDC45"""	603465	"""CDC45 (cell division cycle 45, S.cerevisiae, homolog)-like"", ""CDC45 cell division cycle 45-like (S. cerevisiae)"", ""cell division cycle 45 homolog (S. cerevisiae)"""	CDC45L2, CDC45L		9660782, 9724329, 17608804	Standard	NM_001178010		Approved		uc011aha.2	O75419	OTTHUMG00000150386	ENST00000407835.1:c.1205A>G	22.37:g.19496202A>G	ENSP00000385240:p.Asp402Gly	Somatic		WXS	Illumina HiSeq	Phase_I	B4DDB4|B4DDU3|E9PDH7|O60856|Q20WK8|Q6UW54|Q9UP68	Missense_Mutation	SNP	ENST00000407835.1	37	CCDS13762.1	.	.	.	.	.	.	.	.	.	.	A	27.3	4.815394	0.90790	.	.	ENSG00000093009	ENST00000407835;ENST00000437685;ENST00000263201;ENST00000404724	T;T;T;T	0.29655	1.56;1.56;1.56;1.56	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.63367	0.2505	M	0.89287	3.02	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.996;0.999;0.996;0.996;0.996	T	0.70988	-0.4722	10	0.87932	D	0	-29.6376	16.3009	0.82811	1.0:0.0:0.0:0.0	.	434;397;356;434;402	E9PDH7;B4E092;B4DDB4;B4DDU3;O75419	.;.;.;.;CDC45_HUMAN	G	402;434;402;356	ENSP00000385240:D402G;ENSP00000405726:D434G;ENSP00000263201:D402G;ENSP00000384978:D356G	ENSP00000263201:D402G	D	+	2	0	CDC45	17876202	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	8.850000	0.92190	2.246000	0.74042	0.533000	0.62120	GAC		0.602	CDC45-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000317903.1	NM_003504	
CABIN1	23523	broad.mit.edu	37	22	24573681	24573681	+	Frame_Shift_Del	DEL	T	T	-			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr22:24573681delT	ENST00000398319.2	+	36	6800	c.6415delT	c.(6415-6417)tccfs	p.S2139fs	CABIN1_ENST00000405822.2_Frame_Shift_Del_p.S2060fs|CABIN1_ENST00000263119.5_Frame_Shift_Del_p.S2139fs|CABIN1_ENST00000337989.7_Frame_Shift_Del_p.S509fs	NM_001199281.1	NP_001186210.1	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	2139	Required for interaction with calcineurin. {ECO:0000250}.				cell surface receptor signaling pathway (GO:0007166)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of catalytic activity (GO:0043086)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(13)|liver(1)|lung(18)|ovary(5)|pancreas(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						GGTCATCCCCTCCGCCGCCAC	0.662																																						.											0													72.0	59.0	63.0					22																	24573681		2203	4300	6503	SO:0001589	frameshift_variant	23523			AF072441	CCDS13823.1, CCDS74830.1	22q11.23	2008-09-16			ENSG00000099991	ENSG00000099991			24187	protein-coding gene	gene with protein product		604251				9655484, 9205841	Standard	NM_001199281		Approved	KIAA0330, PPP3IN	uc002zzi.1	Q9Y6J0	OTTHUMG00000150797	ENST00000398319.2:c.6415delT	22.37:g.24573681delT	ENSP00000381364:p.Ser2139fs	Somatic		WXS	Illumina HiSeq	Phase_I	G5E9F3|Q6PHY0|Q9Y460	Frame_Shift_Del	DEL	ENST00000398319.2	37	CCDS13823.1																																																																																				0.662	CABIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320161.2	NM_012295	
DOCK3	1795	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	3	51251628	51251628	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr3:51251628G>A	ENST00000266037.9	+	14	1225	c.1202G>A	c.(1201-1203)aGg>aAg	p.R401K		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	401					small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		ATATTTAATAGGGGATTGGCA	0.413																																						.											0													80.0	77.0	78.0					3																	51251628		1864	4117	5981	SO:0001583	missense	1795			AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.1202G>A	3.37:g.51251628G>A	ENSP00000266037:p.Arg401Lys	Somatic		WXS	Illumina HiSeq	Phase_I	O15017	Missense_Mutation	SNP	ENST00000266037.9	37	CCDS46835.1	.	.	.	.	.	.	.	.	.	.	G	18.48	3.633166	0.67015	.	.	ENSG00000088538	ENST00000266037	T	0.05382	3.45	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.08268	0.0206	L	0.47716	1.5	0.58432	D	0.999999	B	0.06786	0.001	B	0.08055	0.003	T	0.29366	-1.0014	10	0.11485	T	0.65	.	19.4352	0.94788	0.0:0.0:1.0:0.0	.	401	Q8IZD9	DOCK3_HUMAN	K	401	ENSP00000266037:R401K	ENSP00000266037:R401K	R	+	2	0	DOCK3	51226668	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.382000	0.79729	2.668000	0.90789	0.655000	0.94253	AGG		0.413	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346478.5	NM_004947	
CNTN3	5067	broad.mit.edu	37	3	74570232	74570232	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr3:74570232A>G	ENST00000263665.6	-	1	59	c.32T>C	c.(31-33)cTt>cCt	p.L11P		NM_020872.1	NP_065923.1	Q9P232	CNTN3_HUMAN	contactin 3 (plasmacytoma associated)	11					cell adhesion (GO:0007155)|nervous system development (GO:0007399)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(39)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	83		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		AATGAATGAAAGCAGGATCAA	0.343																																						.											0													82.0	82.0	82.0					3																	74570232		2203	4299	6502	SO:0001583	missense	5067			AB040929	CCDS33790.1	3p12.3	2013-02-11			ENSG00000113805	ENSG00000113805		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2173	protein-coding gene	gene with protein product		601325		PANG		8661054, 8586965	Standard	XM_005264757		Approved	BIG-1	uc003dpm.1	Q9P232	OTTHUMG00000158813	ENST00000263665.6:c.32T>C	3.37:g.74570232A>G	ENSP00000263665:p.Leu11Pro	Somatic		WXS	Illumina HiSeq	Phase_I	B9EK50|Q9H039	Missense_Mutation	SNP	ENST00000263665.6	37	CCDS33790.1	.	.	.	.	.	.	.	.	.	.	A	8.229	0.804189	0.16467	.	.	ENSG00000113805	ENST00000263665	T	0.61859	0.07	5.2	5.2	0.72013	.	0.000000	0.56097	D	0.000021	T	0.55000	0.1893	M	0.68317	2.08	0.50632	D	0.999886	B	0.22480	0.07	B	0.18871	0.023	T	0.56238	-0.8012	10	0.52906	T	0.07	.	11.4879	0.50365	1.0:0.0:0.0:0.0	.	11	Q9P232	CNTN3_HUMAN	P	11	ENSP00000263665:L11P	ENSP00000263665:L11P	L	-	2	0	CNTN3	74652922	1.000000	0.71417	0.963000	0.40424	0.310000	0.27922	5.285000	0.65633	1.969000	0.57287	0.477000	0.44152	CTT		0.343	CNTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352306.1	NM_020872	
ZBTB20	26137	broad.mit.edu	37	3	114070436	114070436	+	Silent	SNP	T	T	C			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr3:114070436T>C	ENST00000474710.1	-	4	667	c.489A>G	c.(487-489)ctA>ctG	p.L163L	ZBTB20_ENST00000481632.1_Silent_p.L90L|ZBTB20_ENST00000357258.3_Silent_p.L90L|ZBTB20_ENST00000393785.2_Silent_p.L90L|ZBTB20_ENST00000471418.1_Silent_p.L90L|ZBTB20_ENST00000464560.1_Silent_p.L90L|ZBTB20-AS1_ENST00000467304.1_RNA|ZBTB20-AS1_ENST00000475939.1_RNA|ZBTB20-AS1_ENST00000496219.1_RNA|ZBTB20_ENST00000462705.1_Silent_p.L90L	NM_001164342.1	NP_001157814.1	Q9HC78	ZBT20_HUMAN	zinc finger and BTB domain containing 20	163	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.					nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	48				LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)		GCGAGACCCGTAGCACGCCGC	0.567																																					NSCLC(69;748 1344 9802 11203 30933)	.											0													81.0	69.0	73.0					3																	114070436		2203	4300	6503	SO:0001819	synonymous_variant	26137			AF139460	CCDS2981.1, CCDS54626.1	3q13.2	2013-01-08	2004-07-16	2004-07-16	ENSG00000181722	ENSG00000181722		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13503	protein-coding gene	gene with protein product		606025	"""zinc finger protein 288"""	ZNF288		10965110, 11352661	Standard	XM_005247339		Approved	ODA-8S, DKFZp566F123, DPZF	uc003ebi.3	Q9HC78	OTTHUMG00000159366	ENST00000474710.1:c.489A>G	3.37:g.114070436T>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q63HP6|Q8N6R5|Q9Y410	Silent	SNP	ENST00000474710.1	37	CCDS54626.1																																																																																				0.567	ZBTB20-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354951.1	NM_015642	
IRF2	3660	broad.mit.edu	37	4	185339717	185339717	+	Missense_Mutation	SNP	C	C	A			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr4:185339717C>A	ENST00000393593.3	-	4	540	c.333G>T	c.(331-333)atG>atT	p.M111I	IRF2_ENST00000512020.1_5'UTR	NM_002199.3	NP_002190.2	P14316	IRF2_HUMAN	interferon regulatory factor 2	111					blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(2)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	22		all_lung(41;7.86e-14)|Lung NSC(41;1.87e-13)|Colorectal(36;0.00146)|Hepatocellular(41;0.00826)|Renal(120;0.00992)|Prostate(90;0.0115)|all_neural(102;0.0573)|all_hematologic(60;0.0592)		all cancers(43;3.94e-27)|Epithelial(43;5.3e-24)|OV - Ovarian serous cystadenocarcinoma(60;1.06e-10)|Colorectal(24;7.98e-07)|STAD - Stomach adenocarcinoma(60;3.95e-05)|GBM - Glioblastoma multiforme(59;8.3e-05)|COAD - Colon adenocarcinoma(29;0.000106)|BRCA - Breast invasive adenocarcinoma(30;0.000311)|LUSC - Lung squamous cell carcinoma(40;0.0128)|READ - Rectum adenocarcinoma(43;0.0419)		ATAGGGGCAGCATTCGGTAGA	0.403																																						.											0													152.0	145.0	148.0					4																	185339717		2203	4300	6503	SO:0001583	missense	3660				CCDS3835.1	4q34.1-q35.1	2008-07-29				ENSG00000168310			6117	protein-coding gene	gene with protein product		147576				2475256	Standard	NM_002199		Approved		uc003iwf.4	P14316		ENST00000393593.3:c.333G>T	4.37:g.185339717C>A	ENSP00000377218:p.Met111Ile	Somatic		WXS	Illumina HiSeq	Phase_I	D6RCK5|H0Y8S3|Q6IAS7|Q96B99	Missense_Mutation	SNP	ENST00000393593.3	37	CCDS3835.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.1|23.1	4.378734|4.378734	0.82682|0.82682	.|.	.|.	ENSG00000168310|ENSG00000168310	ENST00000505067|ENST00000393593;ENST00000502750;ENST00000507523;ENST00000510814;ENST00000506230;ENST00000505316	.|D;D;D;D;D	.|0.97404	.|-4.37;-1.52;-4.37;-4.37;-4.37	4.98|4.98	4.98|4.98	0.66077|0.66077	.|Winged helix-turn-helix transcription repressor DNA-binding (1);Interferon regulatory factor DNA-binding domain (3);	.|0.073994	.|0.85682	.|D	.|0.000000	D|D	0.97096|0.97096	0.9051|0.9051	L|L	0.31207|0.31207	0.915|0.915	0.80722|0.80722	D|D	1|1	.|D	.|0.62365	.|0.991	.|D	.|0.70487	.|0.969	D|D	0.97237|0.97237	0.9888|0.9888	5|10	.|0.48119	.|T	.|0.1	-13.3126|-13.3126	18.7969|18.7969	0.91997|0.91997	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|111	.|P14316	.|IRF2_HUMAN	S|I	10|111;23;111;111;111;111	.|ENSP00000377218:M111I;ENSP00000423074:M23I;ENSP00000427204:M111I;ENSP00000424552:M111I;ENSP00000422860:M111I	.|ENSP00000377218:M111I	A|M	-|-	1|3	0|0	IRF2|IRF2	185576711|185576711	1.000000|1.000000	0.71417|0.71417	0.972000|0.972000	0.41901|0.41901	0.692000|0.692000	0.40212|0.40212	7.600000|7.600000	0.82769|0.82769	2.750000|2.750000	0.94351|0.94351	0.655000|0.655000	0.94253|0.94253	GCT|ATG		0.403	IRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361393.1		
ADAMTS12	81792	broad.mit.edu	37	5	33881393	33881393	+	Missense_Mutation	SNP	G	G	A	rs201373627		TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr5:33881393G>A	ENST00000504830.1	-	2	655	c.320C>T	c.(319-321)aCg>aTg	p.T107M	ADAMTS12_ENST00000352040.3_Missense_Mutation_p.T107M|ADAMTS12_ENST00000515401.1_Missense_Mutation_p.T107M	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	107					cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						TTGATTGACCGTCAAGTTAAA	0.478										HNSCC(64;0.19)			G|||	1	0.000199681	0.0	0.0	5008	,	,		20736	0.001		0.0	False		,,,				2504	0.0					.											0								G	MET/THR	0,4406		0,0,2203	125.0	120.0	121.0		320	5.7	1.0	5		121	1,8599	1.2+/-3.3	0,1,4299	no	missense	ADAMTS12	NM_030955.2	81	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	107/1595	33881393	1,13005	2203	4300	6503	SO:0001583	missense	81792			AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.320C>T	5.37:g.33881393G>A	ENSP00000422554:p.Thr107Met	Somatic		WXS	Illumina HiSeq	Phase_I	A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	ENST00000504830.1	37	CCDS34140.1	.	.	.	.	.	.	.	.	.	.	G	18.14	3.556990	0.65425	0.0	1.16E-4	ENSG00000151388	ENST00000504830;ENST00000352040;ENST00000515401	T;T;T	0.06608	3.28;3.28;3.28	5.65	5.65	0.86999	Peptidase M12B, propeptide (1);	0.059724	0.64402	D	0.000004	T	0.27967	0.0689	M	0.73598	2.24	0.35388	D	0.79053	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.78314	0.963;0.991;0.982	T	0.11060	-1.0603	10	0.87932	D	0	.	19.734	0.96193	0.0:0.0:1.0:0.0	.	107;107;107	P58397-3;D6REX0;P58397	.;.;ATS12_HUMAN	M	107	ENSP00000422554:T107M;ENSP00000344847:T107M;ENSP00000421638:T107M	ENSP00000344847:T107M	T	-	2	0	ADAMTS12	33917150	1.000000	0.71417	0.952000	0.39060	0.737000	0.42083	5.157000	0.64911	2.670000	0.90874	0.467000	0.42956	ACG		0.478	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	NM_030955	
ZNF391	346157	broad.mit.edu	37	6	27368216	27368216	+	Nonsense_Mutation	SNP	C	C	T			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr6:27368216C>T	ENST00000244576.4	+	3	612	c.67C>T	c.(67-69)Caa>Taa	p.Q23*		NM_001076781.1	NP_001070249.1	Q9UJN7	ZN391_HUMAN	zinc finger protein 391	23					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(6)|lung(7)|pancreas(2)|skin(3)|upper_aerodigestive_tract(1)	21						AAACGAAGGCCAATTATCAAG	0.413																																						.											0													110.0	101.0	104.0					6																	27368216		1852	4099	5951	SO:0001587	stop_gained	346157			BC132797	CCDS43429.1	6p21	2013-01-08			ENSG00000124613	ENSG00000124613		"""Zinc fingers, C2H2-type"""	18779	protein-coding gene	gene with protein product							Standard	NM_001076781		Approved	dJ153G14.3	uc003njf.1	Q9UJN7	OTTHUMG00000014477	ENST00000244576.4:c.67C>T	6.37:g.27368216C>T	ENSP00000244576:p.Gln23*	Somatic		WXS	Illumina HiSeq	Phase_I	B4DH77	Nonsense_Mutation	SNP	ENST00000244576.4	37	CCDS43429.1	.	.	.	.	.	.	.	.	.	.	C	12.28	1.889974	0.33348	.	.	ENSG00000124613	ENST00000244576;ENST00000461521	.	.	.	3.74	0.479	0.16796	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06365	T	0.9	.	5.7265	0.18017	0.3487:0.5442:0.0:0.1071	.	.	.	.	X	23	.	ENSP00000244576:Q23X	Q	+	1	0	ZNF391	27476195	0.165000	0.22948	0.002000	0.10522	0.010000	0.07245	0.746000	0.26275	0.246000	0.21394	0.655000	0.94253	CAA		0.413	ZNF391-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040145.2	NM_001076781	
CDC40	51362	broad.mit.edu	37	6	110528751	110528751	+	Missense_Mutation	SNP	C	C	A			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr6:110528751C>A	ENST00000368932.1	+	5	550	c.449C>A	c.(448-450)gCt>gAt	p.A150D	CDC40_ENST00000368930.1_Missense_Mutation_p.A150D|CDC40_ENST00000307731.1_Missense_Mutation_p.A150D			O60508	PRP17_HUMAN	cell division cycle 40	150					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)	p.A150D(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)	18		all_cancers(87;6.23e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		Epithelial(106;0.0221)|all cancers(137;0.0314)|OV - Ovarian serous cystadenocarcinoma(136;0.034)		CAAGTGTCTGCTAAATATATT	0.269																																						.											1	Substitution - Missense(1)	kidney(1)											94.0	106.0	102.0					6																	110528751		2201	4290	6491	SO:0001583	missense	51362			AF015044	CCDS5081.1	6q22.1	2013-01-17	2013-01-17		ENSG00000168438	ENSG00000168438		"""WD repeat domain containing"""	17350	protein-coding gene	gene with protein product		605585	"""cell division cycle 40 homolog (yeast)"", ""cell division cycle 40 homolog (S. cerevisiae)"""			9769104, 9830021	Standard	NM_015891		Approved	PRP17, EHB3, PRPF17, FLJ10564	uc003pua.3	O60508	OTTHUMG00000015358	ENST00000368932.1:c.449C>A	6.37:g.110528751C>A	ENSP00000357928:p.Ala150Asp	Somatic		WXS	Illumina HiSeq	Phase_I	B2RBC5|O75471|Q5SRN0|Q9UPG1	Missense_Mutation	SNP	ENST00000368932.1	37	CCDS5081.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.60|12.60	1.987752|1.987752	0.35036|0.35036	.|.	.|.	ENSG00000168438|ENSG00000168438	ENST00000368932;ENST00000368933;ENST00000368930;ENST00000307731;ENST00000439165;ENST00000453107|ENST00000431461	T;T;T;T|.	0.60920|.	0.28;0.15;0.15;0.28|.	5.86|5.86	5.86|5.86	0.93980|0.93980	.|.	0.360512|.	0.35349|.	N|.	0.003280|.	T|.	0.30230|.	0.0758|.	N|N	0.03608|0.03608	-0.345|-0.345	0.45046|0.45046	D|D	0.998061|0.998061	B|.	0.02656|.	0.0|.	B|.	0.04013|.	0.001|.	T|.	0.35475|.	-0.9787|.	10|.	0.10636|.	T|.	0.68|.	-15.4556|-15.4556	20.1739|20.1739	0.98173|0.98173	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	150|.	O60508|.	PRP17_HUMAN|.	D|X	150;150;150;150;150;47|42	ENSP00000357928:A150D;ENSP00000357929:A150D;ENSP00000357926:A150D;ENSP00000304370:A150D|.	ENSP00000304370:A150D|.	A|C	+|+	2|3	0|2	CDC40|CDC40	110635444|110635444	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	5.478000|5.478000	0.66806|0.66806	2.774000|2.774000	0.95407|0.95407	0.585000|0.585000	0.79938|0.79938	GCT|TGC		0.269	CDC40-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041791.1	NM_015891	
FAM184A	79632	broad.mit.edu	37	6	119281278	119281278	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr6:119281278A>G	ENST00000338891.7	-	18	3856	c.3413T>C	c.(3412-3414)tTc>tCc	p.F1138S	RP11-351A11.1_ENST00000518570.1_RNA|FAM184A_ENST00000521531.1_Missense_Mutation_p.F1054S|FAM184A_ENST00000352896.5_Missense_Mutation_p.F969S|FAM184A_ENST00000368475.4_Missense_Mutation_p.F934S	NM_024581.4	NP_078857.5	Q8NB25	F184A_HUMAN	family with sequence similarity 184, member A	1138						extracellular space (GO:0005615)				breast(2)|central_nervous_system(2)|endometrium(2)|kidney(5)|large_intestine(19)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(5)	52						TCAGAATGTGAAGTACCGGGC	0.428																																						.											0													61.0	64.0	63.0					6																	119281278		1879	4089	5968	SO:0001583	missense	79632			BC009055	CCDS43499.1, CCDS43500.1, CCDS75508.1	6q22.31	2008-08-14	2008-08-14	2008-08-14	ENSG00000111879	ENSG00000111879			20991	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 60"""	C6orf60		11230166	Standard	NM_024581		Approved	FLJ13942	uc003pyj.3	Q8NB25	OTTHUMG00000015471	ENST00000338891.7:c.3413T>C	6.37:g.119281278A>G	ENSP00000342604:p.Phe1138Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B9DI75|F8W8D6|Q5TBS9|Q7Z323|Q96GY8|Q9H0J8|Q9H851	Missense_Mutation	SNP	ENST00000338891.7	37	CCDS43499.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	22.3|22.3	4.275019|4.275019	0.80580|0.80580	.|.	.|.	ENSG00000111879|ENSG00000111879	ENST00000521043;ENST00000338891;ENST00000352896;ENST00000368475;ENST00000368472;ENST00000521531|ENST00000481884	T;T;T;T;T|.	0.70164|.	0.23;0.32;-0.08;-0.46;-0.34|.	5.39|5.39	4.24|4.24	0.50183|0.50183	.|.	0.062472|.	0.64402|.	N|.	0.000003|.	T|T	0.60143|0.60143	0.2246|0.2246	M|M	0.70275|0.70275	2.135|2.135	0.80722|0.80722	D|D	1|1	D;D;D|.	0.76494|.	0.999;0.999;0.999|.	D;D;D|.	0.83275|.	0.994;0.994;0.996|.	T|T	0.61715|0.61715	-0.7006|-0.7006	10|5	0.87932|.	D|.	0|.	-8.2841|-8.2841	11.3459|11.3459	0.49561|0.49561	0.9286:0.0:0.0714:0.0|0.9286:0.0:0.0714:0.0	.|.	1054;969;1138|.	Q8NB25-2;F8W8D6;Q8NB25|.	.;.;F184A_HUMAN|.	S|P	266;1138;969;934;163;1054|72	ENSP00000342604:F1138S;ENSP00000326608:F969S;ENSP00000357460:F934S;ENSP00000357457:F163S;ENSP00000430442:F1054S|.	ENSP00000342604:F1138S|.	F|S	-|-	2|1	0|0	FAM184A|FAM184A	119322977|119322977	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.941000|0.941000	0.58515|0.58515	9.029000|9.029000	0.93718|0.93718	0.989000|0.989000	0.38761|0.38761	0.455000|0.455000	0.32223|0.32223	TTC|TCA		0.428	FAM184A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042009.3	NM_024581	
TRRAP	8295	broad.mit.edu	37	7	98522828	98522828	+	Missense_Mutation	SNP	G	G	T			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr7:98522828G>T	ENST00000359863.4	+	22	3126	c.2917G>T	c.(2917-2919)Gcc>Tcc	p.A973S	TRRAP_ENST00000446306.3_Missense_Mutation_p.A972S|TRRAP_ENST00000355540.3_Missense_Mutation_p.A973S	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	973					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)	p.A973S(2)		NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			CTTCCTGGTGGCCATGATGAG	0.562																																						.											2	Substitution - Missense(2)	endometrium(2)											173.0	138.0	149.0					7																	98522828		2203	4300	6503	SO:0001583	missense	8295			AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.2917G>T	7.37:g.98522828G>T	ENSP00000352925:p.Ala973Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	ENST00000359863.4	37	CCDS59066.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.1|22.1	4.250101|4.250101	0.80024|0.80024	.|.	.|.	ENSG00000196367|ENSG00000196367	ENST00000359863;ENST00000355540;ENST00000446306|ENST00000456197	T;T|.	0.02812|.	4.15;4.15|.	6.17|6.17	6.17|6.17	0.99709|0.99709	Armadillo-like helical (1);Armadillo-type fold (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.53578|0.53578	0.1805|0.1805	N|N	0.16066|0.16066	0.365|0.365	0.80722|0.80722	D|D	1|1	P;B;P|.	0.46784|.	0.884;0.297;0.461|.	B;B;B|.	0.43155|.	0.41;0.077;0.134|.	T|T	0.44143|0.44143	-0.9347|-0.9347	10|5	0.10377|.	T|.	0.69|.	.|.	20.8794|20.8794	0.99867|0.99867	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	973;687;973|.	Q9Y4A5-2;Q59FH1;Q9Y4A5|.	.;.;TRRAP_HUMAN|.	S|C	973;973;971|687	ENSP00000352925:A973S;ENSP00000347733:A973S|.	ENSP00000347733:A973S|.	A|W	+|+	1|3	0|0	TRRAP|TRRAP	98360764|98360764	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	9.728000|9.728000	0.98792|0.98792	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GCC|TGG		0.562	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317978.1	NM_003496	
BAI1	575	broad.mit.edu	37	8	143562971	143562971	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr8:143562971A>G	ENST00000517894.1	+	11	2923	c.2029A>G	c.(2029-2031)Acc>Gcc	p.T677A	BAI1_ENST00000323289.5_Missense_Mutation_p.T677A			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	677					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					TCAGGACGGGACCAGCTACAG	0.627																																						.											0													41.0	48.0	46.0					8																	143562971		2060	4186	6246	SO:0001583	missense	575			AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.2029A>G	8.37:g.143562971A>G	ENSP00000430945:p.Thr677Ala	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000517894.1	37		.	.	.	.	.	.	.	.	.	.	A	11.04	1.521645	0.27211	.	.	ENSG00000181790	ENST00000517894;ENST00000323289	T;T	0.09817	2.94;2.94	4.7	-0.423	0.12325	.	0.147583	0.44097	U	0.000497	T	0.06142	0.0159	N	0.21097	0.63	0.37769	D	0.926627	B	0.16802	0.019	B	0.24269	0.052	T	0.27806	-1.0063	10	0.44086	T	0.13	.	4.5373	0.12040	0.4542:0.0:0.3914:0.1544	.	677	E9PBK0	.	A	677	ENSP00000430945:T677A;ENSP00000313046:T677A	ENSP00000313046:T677A	T	+	1	0	BAI1	143559973	1.000000	0.71417	0.964000	0.40570	0.542000	0.35054	2.485000	0.45250	-0.064000	0.13043	0.260000	0.18958	ACC		0.627	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000379963.3	NM_001702	
GTF3C5	9328	broad.mit.edu	37	9	135929828	135929828	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr9:135929828A>G	ENST00000372097.5	+	7	1345	c.1022A>G	c.(1021-1023)aAg>aGg	p.K341R	GTF3C5_ENST00000372108.5_Missense_Mutation_p.K341R|GTF3C5_ENST00000372099.6_Missense_Mutation_p.K332R|GTF3C5_ENST00000342018.8_Missense_Mutation_p.K272R|GTF3C5_ENST00000372095.5_Missense_Mutation_p.K216R	NM_012087.3	NP_036219.2	Q9Y5Q8	TF3C5_HUMAN	general transcription factor IIIC, polypeptide 5, 63kDa	341					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			endometrium(5)|kidney(1)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)	21				OV - Ovarian serous cystadenocarcinoma(145;4.01e-06)|Epithelial(140;4e-05)		GTCAAAGCAAAGCGCAGCACC	0.602																																						.											0													105.0	89.0	95.0					9																	135929828		2203	4300	6503	SO:0001583	missense	9328			AF133124	CCDS6958.1, CCDS48050.1, CCDS75927.1	9q34.13	2010-03-23	2002-08-29		ENSG00000148308	ENSG00000148308		"""General transcription factors"""	4668	protein-coding gene	gene with protein product	"""transcription factor IIIC, 63 kD"""	604890	"""general transcription factor IIIC, polypeptide 5 (63kD)"""			10373544	Standard	NM_012087		Approved	TFiiiC2-63, TFIIIC63, TFIIICepsilon	uc004ccj.4	Q9Y5Q8	OTTHUMG00000020856	ENST00000372097.5:c.1022A>G	9.37:g.135929828A>G	ENSP00000361169:p.Lys341Arg	Somatic		WXS	Illumina HiSeq	Phase_I	A6NI44|A6NJB9|Q5T7U2|Q5T7U3|Q8N2U7|Q8N857|Q96GD9|Q9H4P2	Missense_Mutation	SNP	ENST00000372097.5	37	CCDS6958.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	34|34	5.402263|5.402263	0.96030|0.96030	.|.	.|.	ENSG00000148308|ENSG00000148308	ENST00000372097;ENST00000372099;ENST00000372095;ENST00000372089;ENST00000372108;ENST00000342018;ENST00000439697|ENST00000434175;ENST00000435745	T;T;T;T;T;T|.	0.49432|.	0.78;0.78;0.78;0.78;0.78;0.78|.	5.65|5.65	5.65|5.65	0.86999|0.86999	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.76877|0.76877	0.4049|0.4049	M|M	0.81942|0.81942	2.565|2.565	0.58432|0.58432	D|D	0.99999|0.99999	D;D;D|.	0.89917|.	1.0;0.998;1.0|.	D;D;D|.	0.87578|.	0.998;0.955;0.998|.	T|T	0.78605|0.78605	-0.2139|-0.2139	10|5	0.13108|.	T|.	0.6|.	-10.4115|-10.4115	15.072|15.072	0.72046|0.72046	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	216;341;341|.	B7Z1V3;Q9Y5Q8-3;Q9Y5Q8|.	.;.;TF3C5_HUMAN|.	R|G	341;332;216;191;341;272;216|113;20	ENSP00000361169:K341R;ENSP00000361171:K332R;ENSP00000361167:K216R;ENSP00000361180:K341R;ENSP00000339530:K272R;ENSP00000393207:K216R|.	ENSP00000339530:K272R|.	K|S	+|+	2|1	0|0	GTF3C5|GTF3C5	134919649|134919649	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.981000|0.981000	0.71138|0.71138	8.913000|8.913000	0.92730|0.92730	2.146000|2.146000	0.66826|0.66826	0.533000|0.533000	0.62120|0.62120	AAG|AGC		0.602	GTF3C5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054826.1	NM_001122823	
PCDH11Y	83259	broad.mit.edu	37	Y	4967267	4967267	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chrY:4967267C>T	ENST00000333703.4	+	5	2128	c.1615C>T	c.(1615-1617)Cgt>Tgt	p.R539C	PCDH11Y_ENST00000362095.5_Missense_Mutation_p.R550C|PCDH11Y_ENST00000215473.6_Missense_Mutation_p.R550C	NM_001278619.1|NM_032971.2	NP_001265548.1|NP_116753.1	Q9BZA8	PC11Y_HUMAN	protocadherin 11 Y-linked	550	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|kidney(2)|large_intestine(7)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						CCTGGATCGTCGTACAGGCAT	0.438																																						.											0																																										SO:0001583	missense	83259			AF332217	CCDS14776.1, CCDS14777.1, CCDS76066.1	Yp11.2	2010-01-26	2002-05-22	2002-05-24	ENSG00000099715	ENSG00000099715		"""Cadherins / Protocadherins : Non-clustered"""	15813	protein-coding gene	gene with protein product		400022	"""protocadherin 22"""	PCDH22		10644456, 11003707	Standard	NM_032971		Approved	PCDHY	uc004fqo.3	Q9BZA8	OTTHUMG00000035105	ENST00000333703.4:c.1615C>T	Y.37:g.4967267C>T	ENSP00000330552:p.Arg539Cys	Somatic		WXS	Illumina HiSeq	Phase_I	Q70LR6|Q70LR8|Q70LS0|Q70LS1|Q70LS2|Q70LS3|Q70LS4|Q70LS5|Q8WY34|Q9BZA9|Q9H4E1	Missense_Mutation	SNP	ENST00000333703.4	37	CCDS14776.1																																																																																				0.438	PCDH11Y-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084979.2	NM_032973	
HRNR	388697	broad.mit.edu	37	1	152186041	152186042	+	Frame_Shift_Ins	INS	-	-	GG	rs12751022|rs555234935	byFrequency	TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr1:152186041_152186042insGG	ENST00000368801.2	-	3	8138_8139	c.8063_8064insCC	c.(8062-8064)ttgfs	p.L2688fs	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	2688				L -> S (in Ref. 1; BAC57496). {ECO:0000305}.	establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.L2688S(1)|p.L2688F(1)		autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AAGAGTGACCCAAGCGAGACTC	0.584																																						.											2	Substitution - Missense(2)	prostate(1)|lung(1)																																								SO:0001589	frameshift_variant	388697			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.8063_8064insCC	1.37:g.152186041_152186042insGG	ENSP00000357791:p.Leu2688fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q5DT20|Q5U1F4	Frame_Shift_Ins	INS	ENST00000368801.2	37	CCDS30859.1																																																																																				0.584	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868	
PLEKHG3	26030	broad.mit.edu	37	14	65209023	65209024	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr14:65209023_65209024insC	ENST00000394691.1	+	16	2935_2936	c.2788_2789insC	c.(2788-2790)gccfs	p.A930fs	PLEKHG3_ENST00000247226.7_Frame_Shift_Ins_p.A874fs|PLEKHG3_ENST00000471182.2_Frame_Shift_Ins_p.A463fs|PLEKHG3_ENST00000484731.2_Frame_Shift_Ins_p.A435fs|PLEKHG3_ENST00000492928.1_Intron			A1L390	PKHG3_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 3	930							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(5)|kidney(2)|large_intestine(1)|lung(14)|prostate(2)|skin(3)|urinary_tract(2)	29				all cancers(60;0.00802)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)|BRCA - Breast invasive adenocarcinoma(234;0.0485)		CTACCAGCTGGCCCGCCAGTAC	0.644																																						.											0																																										SO:0001589	frameshift_variant	26030			AB011171	CCDS32098.1	14q23.3	2013-01-10	2004-12-01	2004-12-01	ENSG00000126822	ENSG00000126822		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20364	protein-coding gene	gene with protein product			"""KIAA0599"""	KIAA0599			Standard	XM_005267511		Approved	ARHGEF43	uc001xhp.2	A1L390	OTTHUMG00000029671	ENST00000394691.1:c.2791dupC	14.37:g.65209026_65209026dupC	ENSP00000378183:p.Ala930fs	Somatic		WXS	Illumina HiSeq	Phase_I	A1L389|B5MEC9|O60339|Q6GMS3|Q6P4B1|Q7L3S3|Q86SW7|Q8TEF5|Q96EW6|Q9BT82	Frame_Shift_Ins	INS	ENST00000394691.1	37																																																																																					0.644	PLEKHG3-010	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000412028.1	NM_015549	
MYH14	79784	broad.mit.edu	37	19	50805044	50805045	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr19:50805044_50805045insC	ENST00000596571.1	+	37	5473_5474	c.5473_5474insC	c.(5473-5475)gccfs	p.A1825fs	MYH14_ENST00000425460.1_Frame_Shift_Ins_p.A1833fs|MYH14_ENST00000262269.8_Frame_Shift_Ins_p.A1866fs|MYH14_ENST00000440075.2_Frame_Shift_Ins_p.A1866fs|MYH14_ENST00000376970.2_Frame_Shift_Ins_p.A1858fs|MYH14_ENST00000601313.1_Frame_Shift_Ins_p.A1866fs|MYH14_ENST00000598205.1_Frame_Shift_Ins_p.A1833fs			Q7Z406	MYH14_HUMAN	myosin, heavy chain 14, non-muscle	1825					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|mitochondrion morphogenesis (GO:0070584)|neuronal action potential (GO:0019228)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue development (GO:0007519)|vocalization behavior (GO:0071625)	actomyosin (GO:0042641)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|stress fiber (GO:0001725)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	46		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		GGATGCTGGGGCCCGTGCCCGC	0.639																																						.											0																																										SO:0001589	frameshift_variant	79784			AY165122	CCDS46151.1, CCDS54295.1, CCDS59411.1	19q13.33	2011-09-27	2009-11-19			ENSG00000105357		"""Myosins / Myosin superfamily : Class II"""	23212	protein-coding gene	gene with protein product		608568	"""myosin, heavy polypeptide 14"", ""myosin, heavy chain 14"""	DFNA4		12909352, 15015131, 17940200	Standard	NM_024729		Approved	FLJ13881, KIAA2034, MHC16, MYH17	uc010enu.1	Q7Z406		ENST00000596571.1:c.5476dupC	19.37:g.50805047_50805047dupC	ENSP00000472819:p.Ala1825fs	Somatic		WXS	Illumina HiSeq	Phase_I	B0I1S2|C3TTN4|Q5CZ75|Q6XYE4|Q76B62|Q8WV23|Q96I22|Q9BT27|Q9BW35|Q9H882	Frame_Shift_Ins	INS	ENST00000596571.1	37	CCDS59411.1																																																																																				0.639	MYH14-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464710.2	NM_024729	
URGCP	55665	broad.mit.edu	37	7	43917145	43917146	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr7:43917145_43917146insC	ENST00000453200.1	-	6	2409_2410	c.1916_1917insG	c.(1915-1917)ggcfs	p.G639fs	URGCP-MRPS24_ENST00000603700.1_Intron|URGCP_ENST00000402306.3_Frame_Shift_Ins_p.G630fs|URGCP_ENST00000447717.3_Frame_Shift_Ins_p.G596fs|URGCP_ENST00000223341.7_Frame_Shift_Ins_p.G596fs|URGCP_ENST00000336086.6_Frame_Shift_Ins_p.G596fs|URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000443736.1_Frame_Shift_Ins_p.G596fs			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	639					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						AACGCCTCTGGCCTGCCGGCAG	0.629																																						.											0																																										SO:0001589	frameshift_variant	55665				CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.1917dupG	7.37:g.43917147_43917147dupC	ENSP00000396918:p.Gly639fs	Somatic		WXS	Illumina HiSeq	Phase_I	E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Frame_Shift_Ins	INS	ENST00000453200.1	37	CCDS47578.1																																																																																				0.629	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338995.1	NM_001077664	
CLCN1	1180	broad.mit.edu	37	7	143047474	143047475	+	Frame_Shift_Ins	INS	-	-	G			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr7:143047474_143047475insG	ENST00000343257.2	+	21	2500_2501	c.2413_2414insG	c.(2413-2415)tggfs	p.W805fs		NM_000083.2	NP_000074	P35523	CLCN1_HUMAN	chloride channel, voltage-sensitive 1	805					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|neuronal action potential propagation (GO:0019227)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	adenyl nucleotide binding (GO:0030554)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(4)|central_nervous_system(1)|endometrium(1)|large_intestine(11)|lung(26)|ovary(3)|prostate(2)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	58	Melanoma(164;0.205)					GATTGAGGCCTGGGAGCAGGAG	0.554																																						.											0																																										SO:0001589	frameshift_variant	1180			Z25884	CCDS5881.1	7q12	2012-09-26	2012-02-23		ENSG00000188037	ENSG00000188037		"""Ion channels / Chloride channels : Voltage-sensitive"""	2019	protein-coding gene	gene with protein product	"""Thomsen disease, autosomal dominant"""	118425	"""chloride channel 1, skeletal muscle"""			1379744	Standard	NM_000083		Approved	CLC1, ClC-1	uc003wcr.1	P35523	OTTHUMG00000152695	ENST00000343257.2:c.2416dupG	7.37:g.143047477_143047477dupG	ENSP00000339867:p.Trp805fs	Somatic		WXS	Illumina HiSeq	Phase_I	A4D2H5|Q2M202	Frame_Shift_Ins	INS	ENST00000343257.2	37	CCDS5881.1																																																																																				0.554	CLCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327420.1	NM_000083	
NOTCH1	4851	broad.mit.edu	37	9	139417353	139417354	+	Frame_Shift_Ins	INS	-	-	GA			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr9:139417353_139417354insGA	ENST00000277541.6	-	4	765_766	c.690_691insTC	c.(688-693)gggggcfs	p.G231fs	NOTCH1_ENST00000491649.1_5'UTR	NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	231	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.				anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		CGGCAGGTGCCCCCGTTCTGGC	0.748			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																												.		Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	0										3,3549		1,1,1774						4.8	1.0			8	11,7377		2,7,3685	no	frameshift	NOTCH1	NM_017617.3		3,8,5459	A1A1,A1R,RR		0.1489,0.0845,0.128				14,10926				SO:0001589	frameshift_variant	4851			AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.690_691insTC	9.37:g.139417353_139417354insGA	ENSP00000277541:p.Gly231fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q59ED8|Q5SXM3	Frame_Shift_Ins	INS	ENST00000277541.6	37	CCDS43905.1																																																																																				0.748	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055087.1	NM_017617	
NOTCH1	4851	broad.mit.edu	37	9	139417355	139417356	+	Frame_Shift_Ins	INS	-	-	T			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr9:139417355_139417356insT	ENST00000277541.6	-	4	763_764	c.688_689insA	c.(688-690)gggfs	p.G230fs	NOTCH1_ENST00000491649.1_5'UTR	NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	230	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.				anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		GCAGGTGCCCCCGTTCTGGCAG	0.748			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																												.		Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	0																																										SO:0001589	frameshift_variant	4851			AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.688_689insA	9.37:g.139417355_139417356insT	ENSP00000277541:p.Gly230fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q59ED8|Q5SXM3	Frame_Shift_Ins	INS	ENST00000277541.6	37	CCDS43905.1																																																																																				0.748	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055087.1	NM_017617	
PHF3	23469	ucsc.edu;bcgsc.ca	37	6	64419126	64419126	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr6:64419126C>T	ENST00000262043.3	+	14	4131	c.3791C>T	c.(3790-3792)tCa>tTa	p.S1264L	PHF3_ENST00000393387.1_Missense_Mutation_p.S1264L			Q92576	PHF3_HUMAN	PHD finger protein 3	1264					multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(7)|cervix(2)|endometrium(8)|kidney(7)|large_intestine(18)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(6)	75	all_cancers(3;0.0241)|all_epithelial(2;0.00306)|Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(74;0.0644)|Lung(124;0.148)			ATAAAAGCATCAGGAACCAAG	0.358																																					GBM(135;136 1820 29512 34071 46235)	.											0													155.0	165.0	162.0					6																	64419126		2203	4300	6503	SO:0001583	missense	23469			AF091622	CCDS4966.1	6q12	2013-09-24			ENSG00000118482	ENSG00000118482		"""Zinc fingers, PHD-type"""	8921	protein-coding gene	gene with protein product		607789				11856869	Standard	XM_005248701		Approved		uc003pep.1	Q92576	OTTHUMG00000014952	ENST00000262043.3:c.3791C>T	6.37:g.64419126C>T	ENSP00000262043:p.Ser1264Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A3KFI8|Q14CR5|Q5CZI1|Q5T1T6|Q9NQ16|Q9UI45	Missense_Mutation	SNP	ENST00000262043.3	37	CCDS4966.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	35|35	5.528384|5.528384	0.96446|0.96446	.|.	.|.	ENSG00000118482|ENSG00000118482	ENST00000505138|ENST00000515594;ENST00000262043;ENST00000393387	.|T;T;T	.|0.56103	.|0.48;1.79;1.79	6.02|6.02	6.02|6.02	0.97574|0.97574	.|Spen paralogue and orthologue SPOC, C-terminal (1);	.|0.000000	.|0.32608	.|N	.|0.005877	.|T	.|0.70011	.|0.3175	M|M	0.74467|0.74467	2.265|2.265	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.91635	.|0.999	.|T	.|0.66822	.|-0.5826	.|9	.|.	.|.	.|.	-14.8658|-14.8658	20.547|20.547	0.99278|0.99278	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1264	.|Q92576	.|PHF3_HUMAN	X|L	53|533;1264;1264	.|ENSP00000425338:S533L;ENSP00000262043:S1264L;ENSP00000377048:S1264L	.|.	Q|S	+|+	1|2	0|0	PHF3|PHF3	64477085|64477085	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	7.493000|7.493000	0.81493|0.81493	2.850000|2.850000	0.98022|0.98022	0.650000|0.650000	0.86243|0.86243	CAG|TCA		0.358	PHF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041086.2		
ANKRD30BL	554226	mdanderson.org	37	2	132914561	132914561	+	Silent	SNP	G	G	A	rs79828184		TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr2:132914561G>A	ENST00000409867.1	-	3	741	c.492C>T	c.(490-492)atC>atT	p.I164I	ANKRD30BL_ENST00000470729.1_5'UTR			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like	164										endometrium(1)|kidney(3)	4						TCTTCACTTCGATGTCTGCAC	0.328																																						.											0																																										SO:0001819	synonymous_variant	554226					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.492C>T	2.37:g.132914561G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B8ZZL7	RNA	SNP	ENST00000409867.1	37																																																																																					0.328	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331353.2	NR_027019	
CEACAM1	634	mdanderson.org	37	19	43031318	43031318	+	Missense_Mutation	SNP	G	G	A	rs199627333		TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr19:43031318G>A	ENST00000161559.6	-	2	433	c.299C>T	c.(298-300)aCa>aTa	p.T100I	LIPE-AS1_ENST00000594624.2_RNA|CEACAM1_ENST00000403461.1_Missense_Mutation_p.T100I|CEACAM1_ENST00000403444.3_Missense_Mutation_p.T100I|CEACAM1_ENST00000599389.1_Missense_Mutation_p.T100I|CEACAM1_ENST00000351134.3_Missense_Mutation_p.T100I|CEACAM1_ENST00000308072.4_Missense_Mutation_p.T60I|LIPE-AS1_ENST00000457234.2_RNA|LIPE-AS1_ENST00000594688.1_RNA|CEACAM1_ENST00000358394.3_Missense_Mutation_p.T100I|CEACAM1_ENST00000352591.5_Missense_Mutation_p.T100I	NM_001712.4	NP_001703.2	P13688	CEAM1_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein)	100	Ig-like V-type.				angiogenesis (GO:0001525)|cell migration (GO:0016477)|homophilic cell adhesion (GO:0007156)|integrin-mediated signaling pathway (GO:0007229)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	17		Prostate(69;0.00682)		GBM - Glioblastoma multiforme(486;0.00148)	Arcitumomab(DB00113)	GGGGTATATTGTCTCTCGACC	0.473																																						.											0													358.0	304.0	322.0					19																	43031318		2203	4300	6503	SO:0001583	missense	634			M72238	CCDS12609.1, CCDS46089.1, CCDS54272.1, CCDS54273.1, CCDS54274.1	19q13.2	2014-05-16			ENSG00000079385	ENSG00000079385		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1814	protein-coding gene	gene with protein product		109770		BGP		2457922, 2025273	Standard	NM_001712		Approved	BGP1, CD66a	uc002otv.3	P13688	OTTHUMG00000151078	ENST00000161559.6:c.299C>T	19.37:g.43031318G>A	ENSP00000161559:p.Thr100Ile	Somatic		WXS	Illumina HiSeq	Phase_I	A6NE38|A8MY49|O60430|Q069I7|Q13854|Q13857|Q13858|Q13859|Q13860|Q15600|Q15601|Q16170|Q5UB49|Q7KYP5|Q96CA7|Q9UQV9	Missense_Mutation	SNP	ENST00000161559.6	37	CCDS12609.1	.	.	.	.	.	.	.	.	.	.	g	8.472	0.857824	0.17178	.	.	ENSG00000079385	ENST00000161559;ENST00000358394;ENST00000351134;ENST00000446434;ENST00000378065;ENST00000352591;ENST00000403444;ENST00000403461;ENST00000308072;ENST00000377806;ENST00000344391;ENST00000403136	T;T;T;T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33;-0.33;-0.33;-0.33	4.41	-0.431	0.12295	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.46737	0.1408	L	0.33485	1.01	0.09310	N	1	B;B;B;B;B;B;B;B;B;B	0.31989	0.35;0.005;0.001;0.003;0.001;0.005;0.197;0.012;0.022;0.054	B;B;B;B;B;B;B;B;B;B	0.30495	0.103;0.005;0.003;0.006;0.002;0.01;0.116;0.007;0.051;0.026	T	0.26710	-1.0095	9	0.24483	T	0.36	.	3.4213	0.07395	0.1214:0.1385:0.5979:0.1422	.	100;100;100;100;100;100;100;100;100;100	P13688-7;P13688-10;P13688-3;P13688-4;P13688-2;P13688-11;P13688-6;P13688-5;P13688-8;P13688	.;.;.;.;.;.;.;.;.;CEAM1_HUMAN	I	100;100;100;127;60;100;100;100;60;100;100;100	ENSP00000161559:T100I;ENSP00000351165:T100I;ENSP00000325946:T100I;ENSP00000244291:T100I;ENSP00000384709:T100I;ENSP00000384083:T100I;ENSP00000312184:T60I	ENSP00000161559:T100I	T	-	2	0	CEACAM1	47723158	0.000000	0.05858	0.003000	0.11579	0.001000	0.01503	-1.426000	0.02443	-0.044000	0.13491	-2.357000	0.00240	ACA		0.473	CEACAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321190.2	NM_001712	
EBI3	10148	mdanderson.org	37	19	4237067	4237067	+	Silent	SNP	A	A	G	rs4905	byFrequency	TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr19:4237067A>G	ENST00000221847.5	+	5	725	c.672A>G	c.(670-672)acA>acG	p.T224T		NM_005755.2	NP_005746.2	Q14213	IL27B_HUMAN	Epstein-Barr virus induced 3	224	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cytokine-mediated signaling pathway (GO:0019221)|humoral immune response (GO:0006959)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|T-helper 1 type immune response (GO:0042088)	extracellular space (GO:0005615)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)			large_intestine(1)|lung(2)|ovary(1)|urinary_tract(1)	5		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0336)|STAD - Stomach adenocarcinoma(1328;0.18)		CCACTGCCACAATGAGCCTGG	0.657													G|||	2308	0.460863	0.6679	0.2767	5008	,	,		15560	0.4435		0.3052	False		,,,				2504	0.4898					.											0								G		2725,1681	481.7+/-359.2	844,1037,322	40.0	40.0	40.0		672	-7.3	0.0	19	dbSNP_52	40	2457,6143	665.9+/-402.3	372,1713,2215	no	coding-synonymous	EBI3	NM_005755.2		1216,2750,2537	GG,GA,AA		28.5698,38.1525,39.8431		224/230	4237067	5182,7824	2203	4300	6503	SO:0001819	synonymous_variant	10148			L08187	CCDS12123.1	19p13	2013-02-11	2008-09-12		ENSG00000105246	ENSG00000105246		"""Fibronectin type III domain containing"""	3129	protein-coding gene	gene with protein product	"""IL27 subunit"", ""IL35 subunit"""	605816				8551575	Standard	NM_005755		Approved		uc002lzu.3	Q14213		ENST00000221847.5:c.672A>G	19.37:g.4237067A>G		Somatic		WXS	Illumina HiSeq	Phase_I	A0N0N2|O75269	Silent	SNP	ENST00000221847.5	37	CCDS12123.1																																																																																				0.657	EBI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458005.1		
CEACAM1	634	mdanderson.org	37	19	43031329	43031329	+	Silent	SNP	G	G	A	rs143477834		TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr19:43031329G>A	ENST00000161559.6	-	2	422	c.288C>T	c.(286-288)agC>agT	p.S96S	LIPE-AS1_ENST00000594624.2_RNA|CEACAM1_ENST00000403461.1_Silent_p.S96S|CEACAM1_ENST00000403444.3_Silent_p.S96S|CEACAM1_ENST00000599389.1_Silent_p.S96S|CEACAM1_ENST00000351134.3_Silent_p.S96S|CEACAM1_ENST00000308072.4_Silent_p.S56S|LIPE-AS1_ENST00000457234.2_RNA|LIPE-AS1_ENST00000594688.1_RNA|CEACAM1_ENST00000358394.3_Silent_p.S96S|CEACAM1_ENST00000352591.5_Silent_p.S96S	NM_001712.4	NP_001703.2	P13688	CEAM1_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein)	96	Ig-like V-type.				angiogenesis (GO:0001525)|cell migration (GO:0016477)|homophilic cell adhesion (GO:0007156)|integrin-mediated signaling pathway (GO:0007229)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	17		Prostate(69;0.00682)		GBM - Glioblastoma multiforme(486;0.00148)	Arcitumomab(DB00113)	TCTCTCGACCGCTGTTTGCGG	0.488																																						.											0													338.0	284.0	303.0					19																	43031329		2203	4300	6503	SO:0001819	synonymous_variant	634			M72238	CCDS12609.1, CCDS46089.1, CCDS54272.1, CCDS54273.1, CCDS54274.1	19q13.2	2014-05-16			ENSG00000079385	ENSG00000079385		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1814	protein-coding gene	gene with protein product		109770		BGP		2457922, 2025273	Standard	NM_001712		Approved	BGP1, CD66a	uc002otv.3	P13688	OTTHUMG00000151078	ENST00000161559.6:c.288C>T	19.37:g.43031329G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A6NE38|A8MY49|O60430|Q069I7|Q13854|Q13857|Q13858|Q13859|Q13860|Q15600|Q15601|Q16170|Q5UB49|Q7KYP5|Q96CA7|Q9UQV9	Silent	SNP	ENST00000161559.6	37	CCDS12609.1																																																																																				0.488	CEACAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321190.2	NM_001712	
EPPK1	83481	mdanderson.org;bcgsc.ca	37	8	144940290	144940290	+	Missense_Mutation	SNP	C	C	G	rs201976887		TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr8:144940290C>G	ENST00000525985.1	-	2	7203	c.7132G>C	c.(7132-7134)Gac>Cac	p.D2378H				P58107	EPIPL_HUMAN	epiplakin 1	2378						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TCGCTGGGGTCGGCCAGGACG	0.682																																						.											0								C	HIS/ASP	51,4341	20.2+/-43.8	0,51,2145	315.0	292.0	300.0		7132	3.6	0.8	8		300	22,8530	7.1+/-27.0	0,22,4254	no	missense	EPPK1	NM_031308.1	81	0,73,6399	GG,GC,CC		0.2572,1.1612,0.564	probably-damaging	2378/2420	144940290	73,12871	2196	4276	6472	SO:0001583	missense	83481			AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.7132G>C	8.37:g.144940290C>G	ENSP00000436337:p.Asp2378His	Somatic		WXS	Illumina HiSeq	Phase_I	Q76E58|Q9NSU9	Missense_Mutation	SNP	ENST00000525985.1	37		.	.	.	.	.	.	.	.	.	.	C	22.4	4.279155	0.80692	0.011612	0.002572	ENSG00000227184	ENST00000525985	T	0.74737	-0.87	4.43	3.56	0.40772	.	.	.	.	.	D	0.83133	0.5188	M	0.89785	3.06	0.42176	D	0.991666	D	0.89917	1.0	D	0.91635	0.999	D	0.86316	0.1689	9	0.62326	D	0.03	.	10.4012	0.44231	0.0:0.9038:0.0:0.0962	.	2378	E9PPU0	.	H	2378	ENSP00000436337:D2378H	ENSP00000436337:D2378H	D	-	1	0	EPPK1	145012278	1.000000	0.71417	0.773000	0.31616	0.942000	0.58702	7.555000	0.82223	1.223000	0.43536	0.591000	0.81541	GAC		0.682	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308	
FRG1B	284802	mdanderson.org	37	20	29624052	29624052	+	Missense_Mutation	SNP	C	C	G			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr20:29624052C>G	ENST00000278882.3	+	4	456	c.76C>G	c.(76-78)Cct>Gct	p.P26A	FRG1B_ENST00000358464.4_Missense_Mutation_p.P26A|FRG1B_ENST00000439954.2_Missense_Mutation_p.P31A			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	26										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						GGGCCCTAGTCCTCCAGAGCA	0.279																																						.											0																																										SO:0001583	missense	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.76C>G	20.37:g.29624052C>G	ENSP00000278882:p.Pro26Ala	Somatic		WXS	Illumina HiSeq	Phase_I	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	c	11.20	1.569321	0.28003	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.51817	0.69	1.91	1.91	0.25777	.	0.054688	0.85682	D	0.000000	T	0.51176	0.1659	.	.	.	0.53688	D	0.999971	.	.	.	.	.	.	T	0.50825	-0.8782	7	0.40728	T	0.16	.	9.8627	0.41125	0.0:1.0:0.0:0.0	.	.	.	.	A	26;31;26	ENSP00000408863:P31A	ENSP00000278882:P26A	P	+	1	0	FRG1B	28237713	1.000000	0.71417	1.000000	0.80357	0.408000	0.30992	6.195000	0.72088	1.383000	0.46405	0.184000	0.17185	CCT		0.279	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
FRG1B	284802	mdanderson.org	37	20	29628282	29628282	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr20:29628282G>A	ENST00000278882.3	+	6	664	c.284G>A	c.(283-285)gGg>gAg	p.G95E	FRG1B_ENST00000358464.4_Missense_Mutation_p.G95E|FRG1B_ENST00000439954.2_Missense_Mutation_p.G100E			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	95										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						AATGAAGCAGGGGACATAGAA	0.373																																						.											0																																										SO:0001583	missense	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.284G>A	20.37:g.29628282G>A	ENSP00000278882:p.Gly95Glu	Somatic		WXS	Illumina HiSeq	Phase_I	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	g	18.02	3.529440	0.64860	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.56103	0.48	2.08	2.08	0.27032	Actin cross-linking (1);	0.051750	0.85682	D	0.000000	T	0.52092	0.1713	.	.	.	0.58432	D	0.999996	B;P	0.39940	0.309;0.696	P;P	0.46543	0.492;0.52	T	0.54221	-0.8326	9	0.45353	T	0.12	.	10.2211	0.43198	0.0:0.0:1.0:0.0	.	100;95	F5H5R5;Q9BZ01	.;FRG1B_HUMAN	E	95;100;95	ENSP00000408863:G100E	ENSP00000278882:G95E	G	+	2	0	FRG1B	28241943	1.000000	0.71417	0.998000	0.56505	0.945000	0.59286	8.494000	0.90477	1.475000	0.48197	0.423000	0.28283	GGG		0.373	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
FRG1B	284802	mdanderson.org	37	20	29631557	29631557	+	Missense_Mutation	SNP	A	A	G	rs11525721		TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr20:29631557A>G	ENST00000278882.3	+	7	733	c.353A>G	c.(352-354)aAa>aGa	p.K118R	FRG1B_ENST00000358464.4_Missense_Mutation_p.K118R			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	118								p.K118R(2)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TGTGCTGAAAAAGAAACCAAG	0.333																																						.											2	Substitution - Missense(2)	endometrium(2)																																								SO:0001583	missense	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.353A>G	20.37:g.29631557A>G	ENSP00000278882:p.Lys118Arg	Somatic		WXS	Illumina HiSeq	Phase_I	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	a	0.014	-1.602257	0.00849	.	.	ENSG00000149531	ENST00000278882;ENST00000358464	.	.	.	2.03	1.07	0.20283	.	0.100689	0.64402	N	0.000003	T	0.12475	0.0303	.	.	.	0.22378	N	0.999156	B	0.02656	0.0	B	0.01281	0.0	T	0.34079	-0.9843	8	0.02654	T	1	.	7.0418	0.25025	0.1556:0.0:0.8444:0.0	rs11525721	118	Q9BZ01	FRG1B_HUMAN	R	118	.	ENSP00000278882:K118R	K	+	2	0	FRG1B	28245218	1.000000	0.71417	0.998000	0.56505	0.630000	0.37929	4.500000	0.60387	0.419000	0.25927	-0.343000	0.07986	AAA		0.333	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
HLA-A	3105	mdanderson.org	37	6	29912333	29912333	+	Missense_Mutation	SNP	C	C	T	rs3179982	byFrequency	TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr6:29912333C>T	ENST00000396634.1	+	7	1293	c.952C>T	c.(952-954)Ctt>Ttt	p.L318F	HLA-A_ENST00000376802.2_Intron|HLA-A_ENST00000376809.5_Missense_Mutation_p.L318F|HLA-A_ENST00000376806.5_Missense_Mutation_p.L318F			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	318					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						CCTGGTTCTCCTTGGAGCTGT	0.592									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)			c|||	2681	0.535343	0.6044	0.6023	5008	,	,		19739	0.4881		0.5229	False		,,,				2504	0.456					.											0								C	PHE/LEU	1582,1436		428,726,355	109.0	103.0	105.0		952	-1.0	0.0	6	dbSNP_105	105	2518,2900		666,1186,857	no	missense	HLA-A	NM_002116.7	22	1094,1912,1212	TT,TC,CC		46.4747,47.5812,48.6012	probably-damaging	318/366	29912333	4100,4336	1509	2709	4218	SO:0001583	missense	3105	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.952C>T	6.37:g.29912333C>T	ENSP00000379873:p.Leu318Phe	Somatic		WXS	Illumina HiSeq	Phase_I	O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Missense_Mutation	SNP	ENST00000396634.1	37	CCDS34373.1	1165	0.5334249084249084	307	0.6239837398373984	196	0.5414364640883977	273	0.4772727272727273	389	0.5131926121372031	.	3.888	-0.024559	0.07589	0.524188	0.464747	ENSG00000206503	ENST00000396634;ENST00000376806;ENST00000376809	T;T;T	0.00995	5.49;5.46;5.49	3.13	-0.987	0.10249	.	0.308416	0.17061	U	0.188566	T	0.01353	0.0044	.	.	.	0.80722	P	0.0	B;B;D;B;B	0.71674	0.0;0.0;0.998;0.0;0.0	B;B;D;B;B	0.81914	0.001;0.004;0.995;0.004;0.001	T	0.47222	-0.9134	8	0.87932	D	0	.	6.4125	0.21698	0.0:0.4707:0.0:0.5293	rs3179982;rs3205680;rs17405339;rs17851725;rs41552629	197;318;318;318;318	B4DVB9;P16188;Q5SRN5;P30455;P04439	.;1A30_HUMAN;.;1A36_HUMAN;1A03_HUMAN	F	318	ENSP00000379873:L318F;ENSP00000366002:L318F;ENSP00000366005:L318F	ENSP00000366002:L318F	L	+	1	0	HLA-A	30020312	0.000000	0.05858	0.001000	0.08648	0.016000	0.09150	-2.297000	0.01141	-0.224000	0.09928	-0.330000	0.08379	CTT		0.592	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252909.1	NM_002116	
HLA-B	3106	mdanderson.org	37	6	31323175	31323175	+	Missense_Mutation	SNP	C	C	T	rs41558116		TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr6:31323175C>T	ENST00000412585.2	-	4	842	c.814G>A	c.(814-816)Gtg>Atg	p.V272M		NM_005514.6	NP_005505.2	P30486	1B48_HUMAN	major histocompatibility complex, class I, B	272	Alpha-3.|Ig-like C1-type.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|viral process (GO:0016032)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	peptide antigen binding (GO:0042605)			endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(2)	27						GAAGGCACCACCACAGCTGCC	0.587									Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of																													.											0													89.0	74.0	79.0					6																	31323175		2203	4300	6503	SO:0001583	missense	3106	Familial Cancer Database	;Lichen Sclerosis, Familial	M15470	CCDS34394.1	6p21.3	2013-01-11			ENSG00000234745	ENSG00000234745		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4932	protein-coding gene	gene with protein product		142830	"""ankylosing spondylitis"""	AS		3459708	Standard	NM_005514		Approved		uc011imz.2	P01889	OTTHUMG00000031153	ENST00000412585.2:c.814G>A	6.37:g.31323175C>T	ENSP00000399168:p.Val272Met	Somatic		WXS	Illumina HiSeq	Phase_I	Q29764	Missense_Mutation	SNP	ENST00000412585.2	37	CCDS34394.1	.	.	.	.	.	.	.	.	.	.	N	10.68	1.418256	0.25552	.	.	ENSG00000234745	ENST00000412585;ENST00000428231;ENST00000452596	T	0.02837	4.14	3.16	1.27	0.21489	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	1.046770	0.07693	U	0.939030	T	0.02455	0.0075	M	0.68593	2.085	0.24952	N	0.99179	P	0.50710	0.938	P	0.49012	0.598	T	0.42616	-0.9441	10	0.87932	D	0	.	6.0204	0.19626	0.0:0.6896:0.1938:0.1165	rs41558116	272	P01889	1B07_HUMAN	M	272;151;151	ENSP00000399168:V272M	ENSP00000399168:V272M	V	-	1	0	HLA-B	31431154	0.004000	0.15560	0.919000	0.36401	0.660000	0.38997	0.286000	0.18902	0.182000	0.20032	0.442000	0.29010	GTG		0.587	HLA-B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076280.4	NM_005514	
HLA-B	3106	mdanderson.org	37	6	31323254	31323254	+	Silent	SNP	G	G	C	rs61759952	byFrequency	TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr6:31323254G>C	ENST00000412585.2	-	4	763	c.735C>G	c.(733-735)ggC>ggG	p.G245G		NM_005514.6	NP_005505.2	P30486	1B48_HUMAN	major histocompatibility complex, class I, B	245	Alpha-3.|Ig-like C1-type.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|viral process (GO:0016032)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	peptide antigen binding (GO:0042605)			endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(2)	27						TTTGGTCCTCGCCATCCCGCT	0.602									Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of				G|||	309	0.0617013	0.0507	0.0591	5008	,	,		21808	0.119		0.0487	False		,,,				2504	0.0327					.											0													105.0	93.0	97.0					6																	31323254		2203	4300	6503	SO:0001819	synonymous_variant	3106	Familial Cancer Database	;Lichen Sclerosis, Familial	M15470	CCDS34394.1	6p21.3	2013-01-11			ENSG00000234745	ENSG00000234745		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4932	protein-coding gene	gene with protein product		142830	"""ankylosing spondylitis"""	AS		3459708	Standard	NM_005514		Approved		uc011imz.2	P01889	OTTHUMG00000031153	ENST00000412585.2:c.735C>G	6.37:g.31323254G>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q29764	Silent	SNP	ENST00000412585.2	37	CCDS34394.1																																																																																				0.602	HLA-B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076280.4	NM_005514	
HLA-B	3106	mdanderson.org	37	6	31323262	31323262	+	Missense_Mutation	SNP	G	G	A	rs77665001	byFrequency	TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr6:31323262G>A	ENST00000412585.2	-	4	755	c.727C>T	c.(727-729)Cgg>Tgg	p.R243W		NM_005514.6	NP_005505.2	P30486	1B48_HUMAN	major histocompatibility complex, class I, B	243	Alpha-3.|Ig-like C1-type.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|viral process (GO:0016032)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	peptide antigen binding (GO:0042605)			endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(2)	27						TCGCCATCCCGCTGCCAGGTC	0.597									Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of																													.											0													95.0	88.0	90.0					6																	31323262		2203	4300	6503	SO:0001583	missense	3106	Familial Cancer Database	;Lichen Sclerosis, Familial	M15470	CCDS34394.1	6p21.3	2013-01-11			ENSG00000234745	ENSG00000234745		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4932	protein-coding gene	gene with protein product		142830	"""ankylosing spondylitis"""	AS		3459708	Standard	NM_005514		Approved		uc011imz.2	P01889	OTTHUMG00000031153	ENST00000412585.2:c.727C>T	6.37:g.31323262G>A	ENSP00000399168:p.Arg243Trp	Somatic		WXS	Illumina HiSeq	Phase_I	Q29764	Missense_Mutation	SNP	ENST00000412585.2	37	CCDS34394.1	133	0.060897435897435896	29	0.05894308943089431	17	0.04696132596685083	44	0.07692307692307693	43	0.05672823218997362	N	11.80	1.747791	0.30955	.	.	ENSG00000234745	ENST00000412585;ENST00000428231;ENST00000452596	T	0.03181	4.02	3.16	-0.095	0.13643	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	0.232653	0.21556	U	0.072641	T	0.01661	0.0053	M	0.80183	2.485	0.22989	N	0.998462	B	0.23540	0.087	B	0.14023	0.01	T	0.36504	-0.9745	10	0.72032	D	0.01	.	2.5362	0.04715	0.2793:0.0:0.3821:0.3386	.	243	P01889	1B07_HUMAN	W	243;122;122	ENSP00000399168:R243W	ENSP00000399168:R243W	R	-	1	2	HLA-B	31431241	0.022000	0.18835	0.712000	0.30502	0.703000	0.40648	0.052000	0.14163	0.183000	0.20059	0.442000	0.29010	CGG		0.597	HLA-B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076280.4	NM_005514	
IFT122	55764	mdanderson.org	37	3	129214369	129214369	+	Silent	SNP	C	C	T	rs73204231		TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr3:129214369C>T	ENST00000348417.2	+	18	2204	c.2127C>T	c.(2125-2127)gcC>gcT	p.A709A	IFT122_ENST00000349441.2_Silent_p.A598A|IFT122_ENST00000504021.1_Silent_p.A585A|IFT122_ENST00000507564.1_Silent_p.A701A|IFT122_ENST00000440957.2_Silent_p.A500A|IFT122_ENST00000347300.2_Silent_p.A650A|IFT122_ENST00000513932.1_3'UTR|IFT122_ENST00000296266.3_Silent_p.A760A|IFT122_ENST00000431818.2_Silent_p.A559A	NM_052989.1	NP_443715.1	Q9HBG6	IF122_HUMAN	intraflagellar transport 122	709					camera-type eye morphogenesis (GO:0048593)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|cilium morphogenesis (GO:0060271)|embryonic body morphogenesis (GO:0010172)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic heart tube left/right pattern formation (GO:0060971)|establishment of protein localization to organelle (GO:0072594)|intraciliary anterograde transport (GO:0035720)|intraciliary retrograde transport (GO:0035721)|limb development (GO:0060173)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|neural tube closure (GO:0001843)|protein localization to cilium (GO:0061512)|signal transduction downstream of smoothened (GO:0007227)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|intraciliary transport particle A (GO:0030991)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|primary cilium (GO:0072372)				breast(3)|cervix(1)|endometrium(9)|large_intestine(10)|lung(21)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	52						TCCATGAGGCCGCCAAACTGT	0.507																																						.											0													109.0	94.0	99.0					3																	129214369		2203	4300	6503	SO:0001819	synonymous_variant	55764			AF244930	CCDS3059.1, CCDS3060.1, CCDS3061.1, CCDS3062.1, CCDS63770.1, CCDS63772.1, CCDS63773.1	3q21	2014-07-03	2014-07-03	2005-11-02	ENSG00000163913	ENSG00000163913		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	13556	protein-coding gene	gene with protein product		606045	"""WD repeat domain 10"", ""intraflagellar transport 122 homolog (Chlamydomonas)"""	WDR10		11242542	Standard	NM_052985		Approved	WDR140, WDR10p, SPG	uc003emm.3	Q9HBG6	OTTHUMG00000159516	ENST00000348417.2:c.2127C>T	3.37:g.129214369C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B3KW53|B4DEY9|B4DPW7|E7EQF4|E9PDG2|E9PDX2|G3XAB1|H7C3C0|Q53G36|Q8TC06|Q9BTB9|Q9BTY4|Q9HAT9|Q9HBG5|Q9NV68|Q9UF80	Silent	SNP	ENST00000348417.2	37	CCDS3061.1																																																																																				0.507	IFT122-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355852.1	NM_018262	
KRTAP4-11	653240	mdanderson.org	37	17	39274291	39274291	+	Missense_Mutation	SNP	T	T	C	rs200214744|rs565505867	byFrequency	TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr17:39274291T>C	ENST00000391413.2	-	1	315	c.277A>G	c.(277-279)Atg>Gtg	p.M93V		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	93	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament (GO:0045095)		p.M93V(4)		endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			TGGCAGCACATAGACTGGCAG	0.662																																						.											4	Substitution - Missense(4)	endometrium(3)|kidney(1)											6.0	10.0	8.0					17																	39274291		651	1556	2207	SO:0001583	missense	653240			AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.277A>G	17.37:g.39274291T>C	ENSP00000375232:p.Met93Val	Somatic		WXS	Illumina HiSeq	Phase_I	A0AUY2	Missense_Mutation	SNP	ENST00000391413.2	37	CCDS45675.1	.	.	.	.	.	.	.	.	.	.	.	0.073	-1.199029	0.01581	.	.	ENSG00000212721	ENST00000391413	T	0.00580	6.43	4.25	-4.9	0.03094	.	.	.	.	.	T	0.00109	0.0003	N	0.00040	-2.49	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43097	-0.9412	9	0.02654	T	1	.	0.4739	0.00536	0.3479:0.2455:0.1203:0.2863	.	93	Q9BYQ6	KR411_HUMAN	V	93	ENSP00000375232:M93V	ENSP00000375232:M93V	M	-	1	0	KRTAP4-11	36527817	.	.	0.012000	0.15200	0.010000	0.07245	.	.	-1.319000	0.02286	-1.132000	0.01976	ATG		0.662	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257690.1		
MLLT3	4300	mdanderson.org	37	9	20414340	20414340	+	Silent	SNP	G	G	A			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr9:20414340G>A	ENST00000380338.4	-	5	790	c.504C>T	c.(502-504)agC>agT	p.S168S	MLLT3_ENST00000475957.1_5'UTR|MLLT3_ENST00000429426.2_Silent_p.S165S|MLLT3_ENST00000355930.6_5'UTR	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	168	Poly-Ser.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)		p.S168S(5)		central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		tgctgctgctgctactgctgc	0.537			T	MLL	ALL																																	.		Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	5	Substitution - coding silent(5)	lung(2)|urinary_tract(1)|endometrium(1)|kidney(1)											9.0	16.0	13.0					9																	20414340		1646	3412	5058	SO:0001819	synonymous_variant	4300			L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.504C>T	9.37:g.20414340G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Silent	SNP	ENST00000380338.4	37	CCDS6494.1																																																																																				0.537	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051872.1	NM_004529	
MUC16	94025	mdanderson.org	37	19	8999445	8999445	+	Missense_Mutation	SNP	C	C	T	rs112439001	byFrequency	TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr19:8999445C>T	ENST00000397910.4	-	56	40933	c.40730G>A	c.(40729-40731)aGc>aAc	p.S13577N	MUC16_ENST00000380951.5_Missense_Mutation_p.S218N	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	13579	SEA 10. {ECO:0000255|PROSITE- ProRule:PRU00188}.			Missing (in Ref. 3; AAK74120). {ECO:0000305}.	cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CTCAGTGATGCTGTGGGTCAG	0.572													C|||	228	0.0455272	0.025	0.062	5008	,	,		20165	0.1012		0.0	False		,,,				2504	0.0511					.											0													231.0	193.0	206.0					19																	8999445		2056	4204	6260	SO:0001583	missense	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.40730G>A	19.37:g.8999445C>T	ENSP00000381008:p.Ser13577Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	3.899|3.899	-0.022418|-0.022418	0.07634|0.07634	.|.	.|.	ENSG00000181143|ENSG00000181143	ENST00000542240|ENST00000397910;ENST00000380951	.|T;T	.|0.29142	.|1.58;1.58	2.95|2.95	1.9|1.9	0.25705|0.25705	.|SEA (2);	.|.	.|.	.|.	.|.	T|T	0.42653|0.42653	0.1212|0.1212	.|.	.|.	.|.	.|.	.|.	.|.	.|B;P	.|0.44281	.|0.0;0.831	.|B;P	.|0.60541	.|0.003;0.876	T|T	0.49781|0.49781	-0.8903|-0.8903	3|7	.|0.41790	.|T	.|0.15	.|.	5.174|5.174	0.15126|0.15126	0.0:0.8277:0.0:0.1723|0.0:0.8277:0.0:0.1723	.|.	.|21222;13577	.|Q8WXI7;B5ME49	.|MUC16_HUMAN;.	T|N	417|13577;218	.|ENSP00000381008:S13577N;ENSP00000370338:S218N	.|ENSP00000370338:S218N	A|S	-|-	1|2	0|0	MUC16|MUC16	8860445|8860445	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.016000|0.016000	0.09150|0.09150	0.554000|0.554000	0.23407|0.23407	0.786000|0.786000	0.33708|0.33708	0.555000|0.555000	0.69702|0.69702	GCA|AGC		0.572	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MUC16	94025	mdanderson.org	37	19	9012858	9012858	+	Silent	SNP	G	G	A	rs111669353		TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr19:9012858G>A	ENST00000397910.4	-	34	38789	c.38586C>T	c.(38584-38586)acC>acT	p.T12862T		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	12864	SEA 6. {ECO:0000255|PROSITE- ProRule:PRU00188}.			Missing (in Ref. 3; AAK74120). {ECO:0000305}.	cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GGTTGGTGATGGTGAAGTTGA	0.537																																						.											0													255.0	217.0	229.0					19																	9012858		2027	4189	6216	SO:0001819	synonymous_variant	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.38586C>T	19.37:g.9012858G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	CCDS54212.1																																																																																				0.537	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MUC2	4583	mdanderson.org;bcgsc.ca	37	11	1092910	1092910	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr11:1092910G>A	ENST00000441003.2	+	30	4756	c.4729G>A	c.(4729-4731)Ggc>Agc	p.G1577S	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000359061.5_Missense_Mutation_p.G1578S	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.G1577S(1)|p.G1578S(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	aacacccaccggcacacagac	0.637																																						.											2	Substitution - Missense(2)	prostate(2)											85.0	125.0	111.0					11																	1092910		1937	3603	5540	SO:0001583	missense	4583			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4729G>A	11.37:g.1092910G>A	ENSP00000415183:p.Gly1577Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	g	2.787	-0.252217	0.05829	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.11169	2.8;2.9	1.49	-2.97	0.05530	.	1.221530	0.07178	U	0.853623	T	0.04092	0.0114	.	.	.	0.09310	N	1	B	0.24882	0.113	B	0.11329	0.006	T	0.37798	-0.9690	9	0.07175	T	0.84	.	4.8921	0.13731	0.6336:0.1684:0.198:0.0	.	1577	E7EUV1	.	S	1577;1578	ENSP00000415183:G1577S;ENSP00000351956:G1578S	ENSP00000351956:G1578S	G	+	1	0	MUC2	1082910	0.000000	0.05858	0.000000	0.03702	0.067000	0.16453	-1.266000	0.02842	-2.620000	0.00440	-1.713000	0.00713	GGC		0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC2	4583	mdanderson.org	37	11	1093412	1093412	+	Missense_Mutation	SNP	C	C	T	rs113330607		TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr11:1093412C>T	ENST00000441003.2	+	30	5258	c.5231C>T	c.(5230-5232)aCg>aTg	p.T1744M	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_Missense_Mutation_p.T32M|MUC2_ENST00000359061.5_Missense_Mutation_p.T1711M	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.T1711M(1)|p.T1744M(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	accccaaccacgacacccatc	0.642																																						.											2	Substitution - Missense(2)	haematopoietic_and_lymphoid_tissue(2)											214.0	246.0	236.0					11																	1093412		2029	3941	5970	SO:0001583	missense	4583			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5231C>T	11.37:g.1093412C>T	ENSP00000415183:p.Thr1744Met	Somatic		WXS	Illumina HiSeq	Phase_I	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	8.377	0.836553	0.16891	.	.	ENSG00000198788	ENST00000441003;ENST00000359061;ENST00000333592	T;T;T	0.12147	2.78;2.71;2.78	1.64	0.621	0.17643	.	2.578920	0.03359	U	0.197396	T	0.07863	0.0197	.	.	.	0.09310	N	1	P	0.46457	0.878	B	0.24006	0.05	T	0.39418	-0.9615	9	0.49607	T	0.09	.	7.4201	0.27067	0.0:0.7261:0.2739:0.0	.	1744	E7EUV1	.	M	1744;1711;32	ENSP00000415183:T1744M;ENSP00000351956:T1711M;ENSP00000331373:T32M	ENSP00000331373:T32M	T	+	2	0	MUC2	1083412	0.002000	0.14202	0.000000	0.03702	0.003000	0.03518	-0.157000	0.10085	0.023000	0.15187	0.195000	0.17529	ACG		0.642	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
NUDT10	170685	mdanderson.org	37	X	51075901	51075901	+	Silent	SNP	G	G	A	rs2801627		TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chrX:51075901G>A	ENST00000376006.3	+	2	304	c.84G>A	c.(82-84)gaG>gaA	p.E28E	NUDT10_ENST00000356450.2_Silent_p.E28E	NM_153183.2	NP_694853.1	Q9BW91	NUDT9_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 10	0					ADP catabolic process (GO:0046032)|IDP catabolic process (GO:0046709)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrial matrix (GO:0005759)	adenosine-diphosphatase activity (GO:0043262)|ADP-ribose diphosphatase activity (GO:0047631)|ADP-sugar diphosphatase activity (GO:0019144)	p.E28E(2)		cervix(1)|endometrium(8)|kidney(1)|large_intestine(1)|lung(1)|prostate(3)|upper_aerodigestive_tract(1)	16	Ovarian(276;0.236)					TCCGGAGCGAGCGCGAGGACG	0.687																																					NSCLC(90;1817 2035 37909 38249)	.											2	Substitution - coding silent(2)	upper_aerodigestive_tract(1)|prostate(1)											41.0	35.0	37.0					X																	51075901		2203	4300	6503	SO:0001819	synonymous_variant	170685			AF469196	CCDS35278.1	Xp11.22-p11.1	2014-05-20			ENSG00000122824	ENSG00000122824		"""Nudix motif containing"""	17621	protein-coding gene	gene with protein product		300527				12105228	Standard	NM_153183		Approved	DIPP3a, hDIPP3alpha	uc004dph.3	Q8NFP7	OTTHUMG00000021530	ENST00000376006.3:c.84G>A	X.37:g.51075901G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q8NBN1|Q8NCB9|Q8NG25	Silent	SNP	ENST00000376006.3	37	CCDS35278.1																																																																																				0.687	NUDT10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056578.1	NM_153183	
OR10A5	144124	mdanderson.org	37	11	6867462	6867462	+	Silent	SNP	G	G	A	rs543931840		TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr11:6867462G>A	ENST00000299454.4	+	1	580	c.549G>A	c.(547-549)ccG>ccA	p.P183P	OR10A5_ENST00000379831.2_Silent_p.P187P			Q9H207	O10A5_HUMAN	olfactory receptor, family 10, subfamily A, member 5	183					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P183P(2)		endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|ovary(1)|skin(2)|urinary_tract(2)	21		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.68e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		GTGACAGCCCGCCTGTGCTGA	0.527													A|||	1	0.000199681	0.0	0.0	5008	,	,		23000	0.001		0.0	False		,,,				2504	0.0				Pancreas(44;21 1072 25662 28041 45559)	.											2	Substitution - coding silent(2)	kidney(2)											180.0	152.0	161.0					11																	6867462		2201	4296	6497	SO:0001819	synonymous_variant	144124			AF324499	CCDS7773.1	11p15.4	2012-08-09			ENSG00000166363	ENSG00000166363		"""GPCR / Class A : Olfactory receptors"""	15131	protein-coding gene	gene with protein product		608493		OR10A1			Standard	NM_178168		Approved	OR11-403, JCG6	uc001met.1	Q9H207	OTTHUMG00000165738	ENST00000299454.4:c.549G>A	11.37:g.6867462G>A		Somatic		WXS	Illumina HiSeq	Phase_I	O95223|Q52M66|Q96R21|Q96R22	Silent	SNP	ENST00000299454.4	37	CCDS7773.1																																																																																				0.527	OR10A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385983.1	NM_178168	
OR10A5	144124	mdanderson.org	37	11	6867588	6867588	+	Silent	SNP	T	T	C			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr11:6867588T>C	ENST00000299454.4	+	1	706	c.675T>C	c.(673-675)gcT>gcC	p.A225A	OR10A5_ENST00000379831.2_Silent_p.A229A			Q9H207	O10A5_HUMAN	olfactory receptor, family 10, subfamily A, member 5	225					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|ovary(1)|skin(2)|urinary_tract(2)	21		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.68e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		TTGCTGCTGCTATCCTCAAGA	0.473																																					Pancreas(44;21 1072 25662 28041 45559)	.											0													286.0	234.0	252.0					11																	6867588		2201	4296	6497	SO:0001819	synonymous_variant	144124			AF324499	CCDS7773.1	11p15.4	2012-08-09			ENSG00000166363	ENSG00000166363		"""GPCR / Class A : Olfactory receptors"""	15131	protein-coding gene	gene with protein product		608493		OR10A1			Standard	NM_178168		Approved	OR11-403, JCG6	uc001met.1	Q9H207	OTTHUMG00000165738	ENST00000299454.4:c.675T>C	11.37:g.6867588T>C		Somatic		WXS	Illumina HiSeq	Phase_I	O95223|Q52M66|Q96R21|Q96R22	Silent	SNP	ENST00000299454.4	37	CCDS7773.1																																																																																				0.473	OR10A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385983.1	NM_178168	
OR8U1	219417	mdanderson.org	37	11	56143717	56143717	+	Missense_Mutation	SNP	G	G	A	rs10896310|rs386753762		TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr11:56143717G>A	ENST00000302270.1	+	1	618	c.618G>A	c.(616-618)atG>atA	p.M206I		NM_001005204.1	NP_001005204.1	Q8NH10	OR8U1_HUMAN	olfactory receptor, family 8, subfamily U, member 1	206			M -> I (in dbSNP:rs10896310).|M -> T (in dbSNP:rs10896309).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(23)|ovary(4)|skin(1)|stomach(1)	39	Esophageal squamous(21;0.00448)					CTGGTATCATGTTCATTTCCT	0.458																																						.											0																																										SO:0001583	missense	219417			AB065603	CCDS41647.1	11q11	2012-08-09			ENSG00000172199	ENSG00000172199		"""GPCR / Class A : Olfactory receptors"""	19611	protein-coding gene	gene with protein product							Standard	NM_001005204		Approved			Q8NH10	OTTHUMG00000166860	ENST00000302270.1:c.618G>A	11.37:g.56143717G>A	ENSP00000304188:p.Met206Ile	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000302270.1	37	CCDS41647.1	.	.	.	.	.	.	.	.	.	.	g	3.388	-0.124883	0.06795	.	.	ENSG00000172199	ENST00000302270	T	0.00048	8.82	5.78	-8.74	0.00838	GPCR, rhodopsin-like superfamily (1);	0.571004	0.16107	N	0.229286	T	0.00039	0.0001	N	0.01618	-0.8	0.09310	N	1	B	0.19935	0.04	B	0.25759	0.063	T	0.43212	-0.9405	10	0.49607	T	0.09	.	2.9203	0.05766	0.5031:0.0848:0.1561:0.256	rs10896310;rs52836552;rs10896310	206	Q8NH10	OR8U1_HUMAN	I	206	ENSP00000304188:M206I	ENSP00000304188:M206I	M	+	3	0	OR8U1	55900293	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-5.475000	0.00119	-1.582000	0.01640	-1.926000	0.00513	ATG		0.458	OR8U1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391607.1	NM_001005204	
PCMTD1	115294	mdanderson.org	37	8	52732959	52732959	+	Silent	SNP	G	G	A			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr8:52732959G>A	ENST00000360540.5	-	7	1432	c.1026C>T	c.(1024-1026)ccC>ccT	p.P342P	PCMTD1_ENST00000519559.1_5'UTR|PCMTD1_ENST00000544451.1_Silent_p.P266P|PCMTD1_ENST00000522514.1_Silent_p.P342P	NM_052937.2	NP_443169.2	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1	342						cytoplasm (GO:0005737)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)			NS(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(17)|prostate(2)|skin(8)|soft_tissue(1)	37		Lung NSC(129;0.0795)|all_lung(136;0.144)				ATTCAGGGAGGGGCAGCTTCA	0.353																																						.											0													69.0	67.0	68.0					8																	52732959		2203	4300	6503	SO:0001819	synonymous_variant	115294				CCDS6148.1, CCDS69480.1	8q11.23	2010-08-05			ENSG00000168300	ENSG00000168300			30483	protein-coding gene	gene with protein product							Standard	XM_005251146		Approved	FLJ10883	uc003xqx.4	Q96MG8	OTTHUMG00000164246	ENST00000360540.5:c.1026C>T	8.37:g.52732959G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q96FK9	Silent	SNP	ENST00000360540.5	37	CCDS6148.1																																																																																				0.353	PCMTD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377909.2	NM_052937	
PCMTD1	115294	mdanderson.org	37	8	52732961	52732961	+	Missense_Mutation	SNP	G	G	T	rs150537425		TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr8:52732961G>T	ENST00000360540.5	-	7	1430	c.1024C>A	c.(1024-1026)Ccc>Acc	p.P342T	PCMTD1_ENST00000519559.1_5'UTR|PCMTD1_ENST00000544451.1_Missense_Mutation_p.P266T|PCMTD1_ENST00000522514.1_Missense_Mutation_p.P342T	NM_052937.2	NP_443169.2	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1	342						cytoplasm (GO:0005737)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)			NS(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(17)|prostate(2)|skin(8)|soft_tissue(1)	37		Lung NSC(129;0.0795)|all_lung(136;0.144)				TCAGGGAGGGGCAGCTTCATG	0.358																																						.											0													71.0	69.0	70.0					8																	52732961		2203	4300	6503	SO:0001583	missense	115294				CCDS6148.1, CCDS69480.1	8q11.23	2010-08-05			ENSG00000168300	ENSG00000168300			30483	protein-coding gene	gene with protein product							Standard	XM_005251146		Approved	FLJ10883	uc003xqx.4	Q96MG8	OTTHUMG00000164246	ENST00000360540.5:c.1024C>A	8.37:g.52732961G>T	ENSP00000353739:p.Pro342Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q96FK9	Missense_Mutation	SNP	ENST00000360540.5	37	CCDS6148.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.365461	0.82463	.	.	ENSG00000168300	ENST00000360540;ENST00000544451;ENST00000522514	T;T;T	0.71461	0.25;-0.57;0.25	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	D	0.84835	0.5560	M	0.71036	2.16	0.80722	D	1	D;D;D	0.89917	0.995;1.0;0.999	P;D;D	0.91635	0.82;0.999;0.972	D	0.84761	0.0762	10	0.87932	D	0	-0.0352	20.6593	0.99626	0.0:0.0:1.0:0.0	.	212;266;342	B4E2B4;F5H1M8;Q96MG8	.;.;PCMD1_HUMAN	T	342;266;342	ENSP00000353739:P342T;ENSP00000444026:P266T;ENSP00000428099:P342T	ENSP00000353739:P342T	P	-	1	0	PCMTD1	52895514	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.903000	0.92573	2.885000	0.99019	0.655000	0.94253	CCC		0.358	PCMTD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377909.2	NM_052937	
PCMTD1	115294	mdanderson.org	37	8	52732981	52732981	+	Missense_Mutation	SNP	C	C	G	rs201786115		TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr8:52732981C>G	ENST00000360540.5	-	7	1410	c.1004G>C	c.(1003-1005)aGa>aCa	p.R335T	PCMTD1_ENST00000519559.1_5'UTR|PCMTD1_ENST00000544451.1_Missense_Mutation_p.R259T|PCMTD1_ENST00000522514.1_Missense_Mutation_p.R335T	NM_052937.2	NP_443169.2	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1	335						cytoplasm (GO:0005737)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)			NS(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(17)|prostate(2)|skin(8)|soft_tissue(1)	37		Lung NSC(129;0.0795)|all_lung(136;0.144)				GATTTTTTCTCTCAGTAAATT	0.363																																						.											0													81.0	76.0	78.0					8																	52732981		2203	4300	6503	SO:0001583	missense	115294				CCDS6148.1, CCDS69480.1	8q11.23	2010-08-05			ENSG00000168300	ENSG00000168300			30483	protein-coding gene	gene with protein product							Standard	XM_005251146		Approved	FLJ10883	uc003xqx.4	Q96MG8	OTTHUMG00000164246	ENST00000360540.5:c.1004G>C	8.37:g.52732981C>G	ENSP00000353739:p.Arg335Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q96FK9	Missense_Mutation	SNP	ENST00000360540.5	37	CCDS6148.1	.	.	.	.	.	.	.	.	.	.	C	16.08	3.021524	0.54576	.	.	ENSG00000168300	ENST00000360540;ENST00000544451;ENST00000522514	T;T;T	0.58060	1.08;0.36;1.08	5.97	5.1	0.69264	.	0.000000	0.85682	D	0.000000	T	0.66694	0.2815	M	0.71036	2.16	0.58432	D	0.999997	P;D;P	0.56746	0.473;0.977;0.853	B;P;P	0.55923	0.056;0.787;0.504	T	0.71839	-0.4471	10	0.87932	D	0	-19.9202	15.3016	0.73955	0.0:0.9329:0.0:0.0671	.	205;259;335	B4E2B4;F5H1M8;Q96MG8	.;.;PCMD1_HUMAN	T	335;259;335	ENSP00000353739:R335T;ENSP00000444026:R259T;ENSP00000428099:R335T	ENSP00000353739:R335T	R	-	2	0	PCMTD1	52895534	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	7.046000	0.76592	1.532000	0.49169	0.655000	0.94253	AGA		0.363	PCMTD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377909.2	NM_052937	
PABPC1	26986	mdanderson.org	37	8	101721899	101721899	+	Nonsense_Mutation	SNP	C	C	A	rs142985461	byFrequency	TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr8:101721899C>A	ENST00000318607.5	-	8	2161	c.1033G>T	c.(1033-1035)Gaa>Taa	p.E345*	PABPC1_ENST00000519596.1_5'UTR|PABPC1_ENST00000519004.1_Nonsense_Mutation_p.E300*|PABPC1_ENST00000522387.1_Nonsense_Mutation_p.E313*|AP001205.1_ENST00000579868.1_RNA	NM_002568.3	NP_002559.2	P11940	PABP1_HUMAN	poly(A) binding protein, cytoplasmic 1	345	RRM 4. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|mRNA stabilization (GO:0048255)|negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|translation activator activity (GO:0008494)			breast(2)|endometrium(4)|kidney(15)|large_intestine(4)|lung(13)|prostate(1)|skin(1)	40	all_cancers(14;6.8e-05)|all_epithelial(15;3.16e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;6.37e-11)|all cancers(13;1.11e-08)|OV - Ovarian serous cystadenocarcinoma(57;3.91e-05)|STAD - Stomach adenocarcinoma(118;0.206)			TTAGTGGCTTCTTCTGGGGAG	0.423																																						.											0													74.0	69.0	71.0					8																	101721899		2203	4298	6501	SO:0001587	stop_gained	26986			Y00345	CCDS6289.1	8q22.2-q23	2013-02-12	2004-04-20		ENSG00000070756	ENSG00000070756		"""RNA binding motif (RRM) containing"""	8554	protein-coding gene	gene with protein product		604679	"""poly(A)-binding protein, cytoplasmic 2"""	PAB1, PABPC2		2885805	Standard	XM_005250861		Approved	PABP1, PABPL1	uc003yjs.1	P11940	OTTHUMG00000164779	ENST00000318607.5:c.1033G>T	8.37:g.101721899C>A	ENSP00000313007:p.Glu345*	Somatic		WXS	Illumina HiSeq	Phase_I	Q15097|Q93004	Nonsense_Mutation	SNP	ENST00000318607.5	37	CCDS6289.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	41|41|41	8.575894|8.575894|8.575894	0.98870|0.98870|0.98870	.|.|.	.|.|.	ENSG00000070756|ENSG00000070756|ENSG00000070756	ENST00000318607;ENST00000347137;ENST00000519004;ENST00000522387|ENST00000519100|ENST00000519596	.|.|.	.|.|.	.|.|.	4.92|4.92|4.92	4.92|4.92|4.92	0.64577|0.64577|0.64577	.|.|.	0.000000|.|.	0.64402|.|.	D|.|.	0.000008|.|.	.|T|T	.|0.74412|0.74412	.|0.3713|0.3713	.|.|.	.|.|.	.|.|.	0.80722|0.80722|0.80722	A|A|A	1|1|1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|T|T	.|0.73987|0.73987	.|-0.3809|-0.3809	.|3|3	0.87932|.|.	D|.|.	0|.|.	.|.|.	18.4911|18.4911|18.4911	0.90848|0.90848|0.90848	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.|.	.|.|.	.|.|.	.|.|.	X|N|I	345;345;300;313|213|177	.|.|.	ENSP00000313007:E345X|.|.	E|K|R	-|-|-	1|3|2	0|2|0	PABPC1|PABPC1|PABPC1	101791075|101791075|101791075	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.998000|0.998000|0.998000	0.95712|0.95712|0.95712	7.748000|7.748000|7.748000	0.85085|0.85085|0.85085	2.426000|2.426000|2.426000	0.82243|0.82243|0.82243	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	GAA|AAG|AGA		0.423	PABPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380217.1	NM_002568	
SIRPA	140885	mdanderson.org	37	20	1895950	1895951	+	Missense_Mutation	DNP	CC	CC	GT	rs138283486|rs149634649|rs386811661	byFrequency	TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	CC	CC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr20:1895950_1895951CC>GT	ENST00000358771.4	+	2	437_438	c.285_286CC>GT	c.(283-288)gaCCtc>gaGTtc	p.95_96DL>EF	SIRPA_ENST00000400068.3_Missense_Mutation_p.95_96DL>EF|SIRPA_ENST00000356025.3_Missense_Mutation_p.95_96DL>EF	NM_001040023.1	NP_001035112.1	P78324	SHPS1_HUMAN	signal-regulatory protein alpha	95	Ig-like V-type.		D -> E. {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:9062191, ECO:0000269|PubMed:9070220}.|L -> S. {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:9062191, ECO:0000269|PubMed:9070220}.		blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(13)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	21				Colorectal(46;0.018)|READ - Rectum adenocarcinoma(1;0.0556)		CTGTTTCAGACCTCACAAAGAG	0.53																																					GBM(155;1668 1920 5945 42733 48121)	.											0																																										SO:0001583	missense	140885			D86043	CCDS13022.1	20p13	2013-01-11	2006-03-29	2006-03-29	ENSG00000198053	ENSG00000198053		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	9662	protein-coding gene	gene with protein product		602461	"""protein tyrosine phosphatase, non-receptor type substrate 1"""	PTPNS1		9070220, 9062191, 16339511	Standard	XM_005260669		Approved	SHPS1, SIRP, MYD-1, BIT, P84, SHPS-1, SIRPalpha, CD172a, SIRPalpha2, MFR, SIRP-ALPHA-1	uc002wfr.3	P78324	OTTHUMG00000031682	Exception_encountered	20.37:g.1895950_1895951delinsGT	ENSP00000351621:p.D95_L96delinsEF	Somatic		WXS	Illumina HiSeq	Phase_I	A2A2E1|A8K411|B2R6C3|O00683|O43799|Q8N517|Q8TAL8|Q9H0Z2|Q9UDX2|Q9UIJ6|Q9Y4U9	Missense_Mutation	DNP	ENST00000358771.4	37	CCDS13022.1																																																																																				0.530	SIRPA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077568.2	NM_080792	
SLC25A5	292	mdanderson.org	37	X	118603729	118603729	+	Missense_Mutation	SNP	G	G	A	rs143413528		TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chrX:118603729G>A	ENST00000317881.8	+	2	333	c.217G>A	c.(217-219)Ggt>Agt	p.G73S	SLC25A5-AS1_ENST00000446986.1_RNA|SLC25A5_ENST00000460013.1_3'UTR	NM_001152.4	NP_001143.2	P05141	ADT2_HUMAN	solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5	73					adenine transport (GO:0015853)|chromosome segregation (GO:0007059)|energy reserve metabolic process (GO:0006112)|negative regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901029)|positive regulation of cell proliferation (GO:0008284)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|MMXD complex (GO:0071817)|nucleus (GO:0005634)	adenine transmembrane transporter activity (GO:0015207)|poly(A) RNA binding (GO:0044822)	p.G73S(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|stomach(2)	12					Clodronate(DB00720)	CTTCTGGCGCGGTAACCTGGC	0.502																																						.											1	Substitution - Missense(1)	breast(1)											150.0	142.0	145.0					X																	118603729		2203	4300	6503	SO:0001583	missense	292			BC068199	CCDS14578.1	Xq24	2013-08-09			ENSG00000005022	ENSG00000005022		"""Solute carriers"""	10991	protein-coding gene	gene with protein product		300150		ANT2		2168878, 2829183	Standard	NM_001152		Approved	T2, 2F1, T3	uc004erh.4	P05141	OTTHUMG00000022715	ENST00000317881.8:c.217G>A	X.37:g.118603729G>A	ENSP00000360671:p.Gly73Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B2RCV1|O43350	Missense_Mutation	SNP	ENST00000317881.8	37	CCDS14578.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.569470	0.86439	.	.	ENSG00000005022	ENST00000317881	D	0.98164	-4.76	4.18	4.18	0.49190	Mitochondrial carrier domain (2);	0.048889	0.85682	D	0.000000	D	0.99471	0.9812	H	0.99732	4.735	0.09310	P	0.999999126608	D	0.76494	0.999	D	0.74674	0.984	D	0.97692	1.0179	9	0.87932	D	0	.	15.4079	0.74893	0.0:0.0:1.0:0.0	.	73	P05141	ADT2_HUMAN	S	73	ENSP00000360671:G73S	ENSP00000360671:G73S	G	+	1	0	SLC25A5	118487757	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.307000	0.96226	2.019000	0.59389	0.529000	0.55759	GGT		0.502	SLC25A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058952.2	NM_001152	
SLC35G5	83650	mdanderson.org	37	8	11189125	11189125	+	Silent	SNP	C	C	A			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr8:11189125C>A	ENST00000382435.4	+	1	729	c.510C>A	c.(508-510)atC>atA	p.I170I		NM_001282300.1|NM_054028.1	NP_001269229.1|NP_473369.1	Q96KT7	S35G5_HUMAN	solute carrier family 35, member G5	170	EamA 1.					integral component of membrane (GO:0016021)											TAGGACTAATCATCATTCTGG	0.597																																						.											0													180.0	173.0	176.0					8																	11189125		2203	4300	6503	SO:0001819	synonymous_variant	83650			AJ291677	CCDS5980.1	8p23.1	2013-05-22	2011-08-03	2011-08-03	ENSG00000177710	ENSG00000177710		"""Solute carriers"""	15546	protein-coding gene	gene with protein product		615199	"""acyl-malonyl condensing enzyme 1-like 2"""	AMAC, AMAC1L2			Standard	NM_054028		Approved		uc003wtp.1	Q96KT7	OTTHUMG00000090653	ENST00000382435.4:c.510C>A	8.37:g.11189125C>A		Somatic		WXS	Illumina HiSeq	Phase_I	A2RRL6	Silent	SNP	ENST00000382435.4	37	CCDS5980.1																																																																																				0.597	SLC35G5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207313.2	NM_054028	
SLC35G5	83650	mdanderson.org	37	8	11189132	11189132	+	Missense_Mutation	SNP	C	C	G	rs149105667		TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr8:11189132C>G	ENST00000382435.4	+	1	736	c.517C>G	c.(517-519)Ctg>Gtg	p.L173V		NM_001282300.1|NM_054028.1	NP_001269229.1|NP_473369.1	Q96KT7	S35G5_HUMAN	solute carrier family 35, member G5	173	EamA 1.					integral component of membrane (GO:0016021)											AATCATCATTCTGGGACCTGG	0.607																																						.											0													177.0	171.0	173.0					8																	11189132		2203	4300	6503	SO:0001583	missense	83650			AJ291677	CCDS5980.1	8p23.1	2013-05-22	2011-08-03	2011-08-03	ENSG00000177710	ENSG00000177710		"""Solute carriers"""	15546	protein-coding gene	gene with protein product		615199	"""acyl-malonyl condensing enzyme 1-like 2"""	AMAC, AMAC1L2			Standard	NM_054028		Approved		uc003wtp.1	Q96KT7	OTTHUMG00000090653	ENST00000382435.4:c.517C>G	8.37:g.11189132C>G	ENSP00000371872:p.Leu173Val	Somatic		WXS	Illumina HiSeq	Phase_I	A2RRL6	Missense_Mutation	SNP	ENST00000382435.4	37	CCDS5980.1	.	.	.	.	.	.	.	.	.	.	G	0.003	-2.426350	0.00186	.	.	ENSG00000177710	ENST00000382435	T	0.53857	0.6	0.34	0.34	0.15985	.	0.000000	0.42964	N	0.000622	T	0.14700	0.0355	N	0.01576	-0.805	0.09310	N	0.999996	B	0.02656	0.0	B	0.04013	0.001	T	0.21793	-1.0235	9	0.02654	T	1	-1.8868	.	.	.	.	173	Q96KT7	S35G5_HUMAN	V	173	ENSP00000371872:L173V	ENSP00000371872:L173V	L	+	1	2	SLC35G5	11226542	0.961000	0.32948	0.861000	0.33841	0.133000	0.20885	-0.006000	0.12833	-1.354000	0.02188	-1.964000	0.00472	CTG		0.607	SLC35G5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207313.2	NM_054028	
TCP10L2	401285	mdanderson.org	37	6	167592571	167592571	+	Missense_Mutation	SNP	G	G	A	rs28690444	byFrequency	TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr6:167592571G>A	ENST00000366832.2	+	6	861	c.730G>A	c.(730-732)Gcc>Acc	p.A244T		NM_001145121.1	NP_001138593.1	B9ZVM9	TCP2L_HUMAN	t-complex 10-like 2	244										endometrium(1)|kidney(2)|lung(3)	6						TTCCCAGGCCGCCACGCTGCA	0.592																																						.											0													23.0	28.0	27.0					6																	167592571		692	1591	2283	SO:0001583	missense	401285				CCDS47514.1	6q27	2012-09-20	2012-09-20		ENSG00000166984	ENSG00000166984			21254	protein-coding gene	gene with protein product			"""t-complex 10-like 2 (mouse)"""				Standard	NM_001145121		Approved	bA517H2.3	uc010kkp.3	B9ZVM9	OTTHUMG00000016014	ENST00000366832.2:c.730G>A	6.37:g.167592571G>A	ENSP00000355797:p.Ala244Thr	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000366832.2	37	CCDS47514.1	87	0.03983516483516483	17	0.034552845528455285	12	0.03314917127071823	14	0.024475524475524476	44	0.05804749340369393	c	8.486	0.860926	0.17178	.	.	ENSG00000166984	ENST00000366832	T	0.13901	2.55	1.87	-1.19	0.09585	.	.	.	.	.	T	0.00906	0.0030	N	0.11560	0.145	0.09310	N	1	B	0.32968	0.392	B	0.17433	0.018	T	0.43718	-0.9374	9	0.02654	T	1	.	2.6095	0.04887	0.3443:0.2689:0.3868:0.0	rs28690444	244	B9ZVM9	TCP2L_HUMAN	T	244	ENSP00000355797:A244T	ENSP00000283507:A244T	A	+	1	0	TCP10L2	167512561	0.000000	0.05858	0.000000	0.03702	0.115000	0.19883	-0.863000	0.04259	-0.321000	0.08627	-1.962000	0.00476	GCC		0.592	TCP10L2-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043112.5	XR_040749	
TCP10L2	401285	mdanderson.org	37	6	167592601	167592601	+	Missense_Mutation	SNP	G	G	A	rs200019718	byFrequency	TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr6:167592601G>A	ENST00000366832.2	+	6	891	c.760G>A	c.(760-762)Gga>Aga	p.G254R		NM_001145121.1	NP_001138593.1	B9ZVM9	TCP2L_HUMAN	t-complex 10-like 2	254										endometrium(1)|kidney(2)|lung(3)	6						GGCAGCAGCCGGAGTTGCTGG	0.577																																						.											0																																										SO:0001583	missense	401285				CCDS47514.1	6q27	2012-09-20	2012-09-20		ENSG00000166984	ENSG00000166984			21254	protein-coding gene	gene with protein product			"""t-complex 10-like 2 (mouse)"""				Standard	NM_001145121		Approved	bA517H2.3	uc010kkp.3	B9ZVM9	OTTHUMG00000016014	ENST00000366832.2:c.760G>A	6.37:g.167592601G>A	ENSP00000355797:p.Gly254Arg	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000366832.2	37	CCDS47514.1	.	.	.	.	.	.	.	.	.	.	g	7.547	0.661865	0.14645	.	.	ENSG00000166984	ENST00000366832	T	0.41065	1.01	.	.	.	.	.	.	.	.	T	0.20981	0.0505	N	0.24115	0.695	0.09310	N	1	D	0.89917	1.0	D	0.83275	0.996	T	0.13522	-1.0506	7	0.06891	T	0.86	.	.	.	.	.	254	B9ZVM9	TCP2L_HUMAN	R	254	ENSP00000355797:G254R	ENSP00000283507:G254R	G	+	1	0	TCP10L2	167512591	0.001000	0.12720	0.002000	0.10522	0.027000	0.11550	0.333000	0.19768	0.159000	0.19401	0.162000	0.16502	GGA		0.577	TCP10L2-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043112.5	XR_040749	
TCP10L2	401285	mdanderson.org	37	6	167592606	167592606	+	Silent	SNP	T	T	A	rs201866116	byFrequency	TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr6:167592606T>A	ENST00000366832.2	+	6	896	c.765T>A	c.(763-765)gtT>gtA	p.V255V		NM_001145121.1	NP_001138593.1	B9ZVM9	TCP2L_HUMAN	t-complex 10-like 2	255										endometrium(1)|kidney(2)|lung(3)	6						CAGCCGGAGTTGCTGGTGAGC	0.577																																						.											0																																										SO:0001819	synonymous_variant	401285				CCDS47514.1	6q27	2012-09-20	2012-09-20		ENSG00000166984	ENSG00000166984			21254	protein-coding gene	gene with protein product			"""t-complex 10-like 2 (mouse)"""				Standard	NM_001145121		Approved	bA517H2.3	uc010kkp.3	B9ZVM9	OTTHUMG00000016014	ENST00000366832.2:c.765T>A	6.37:g.167592606T>A		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000366832.2	37	CCDS47514.1																																																																																				0.577	TCP10L2-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043112.5	XR_040749	
TMEM30B	161291	mdanderson.org	37	14	61747644	61747644	+	Silent	SNP	A	A	G	rs3196765	byFrequency	TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr14:61747644A>G	ENST00000555868.1	-	1	914	c.222T>C	c.(220-222)ggT>ggC	p.G74G	TMEM30B_ENST00000355702.2_Silent_p.G74G|TMEM30B_ENST00000557163.1_5'UTR	NM_001017970.2	NP_001017970.1	Q3MIR4	CC50B_HUMAN	transmembrane protein 30B	74					lipid transport (GO:0006869)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|large_intestine(1)|lung(1)|prostate(1)|stomach(1)	6				OV - Ovarian serous cystadenocarcinoma(108;0.107)|BRCA - Breast invasive adenocarcinoma(234;0.181)		CCGAGCAGTTACCGGTGCCCG	0.706													G|||	3905	0.779752	0.6528	0.7392	5008	,	,		11768	0.8591		0.8638	False		,,,				2504	0.8119					.											0								G		2664,1138		957,750,194	6.0	5.0	6.0		222	4.3	1.0	14	dbSNP_105	6	6522,954		2863,796,79	no	coding-synonymous	TMEM30B	NM_001017970.2		3820,1546,273	GG,GA,AA		12.7608,29.9316,18.5494		74/352	61747644	9186,2092	1901	3738	5639	SO:0001819	synonymous_variant	161291			AK091169	CCDS32093.1	14q23.1	2006-09-20				ENSG00000182107			27254	protein-coding gene	gene with protein product		611029				15375526	Standard	NM_001017970		Approved	CDC50B	uc001xfl.3	Q3MIR4		ENST00000555868.1:c.222T>C	14.37:g.61747644A>G		Somatic		WXS	Illumina HiSeq	Phase_I	B3KR84|Q14D00	Silent	SNP	ENST00000555868.1	37	CCDS32093.1																																																																																				0.706	TMEM30B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413358.1	XM_090844	
RPL11	6135	bcgsc.ca	37	1	24021262	24021262	+	Frame_Shift_Del	DEL	T	T	-			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr1:24021262delT	ENST00000374550.3	+	4	422	c.377delT	c.(376-378)ttcfs	p.F126fs	RPL11_ENST00000482370.1_3'UTR	NM_000975.3|NM_001199802.1	NP_000966.2|NP_001186731.1	P62913	RL11_HUMAN	ribosomal protein L11	126					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|protein localization to nucleus (GO:0034504)|protein targeting (GO:0006605)|ribosomal large subunit biogenesis (GO:0042273)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(2)	6		Colorectal(325;3.46e-05)|Lung NSC(340;0.000112)|all_lung(284;0.00016)|Renal(390;0.000219)|Breast(348;0.0044)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;2.13e-24)|Colorectal(126;5.06e-08)|COAD - Colon adenocarcinoma(152;2.92e-06)|GBM - Glioblastoma multiforme(114;4.4e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000954)|KIRC - Kidney renal clear cell carcinoma(1967;0.00322)|STAD - Stomach adenocarcinoma(196;0.0124)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0837)|LUSC - Lung squamous cell carcinoma(448;0.185)		ATTGGTATCTACGGCCTGGAC	0.408																																						.											0													149.0	142.0	145.0					1																	24021262		2203	4300	6503	SO:0001589	frameshift_variant	6135			L05092	CCDS238.1	1p36.1-p35	2011-04-06			ENSG00000142676	ENSG00000142676		"""L ribosomal proteins"""	10301	protein-coding gene	gene with protein product		604175				9582194, 10343117	Standard	NM_000975		Approved	L11	uc001bhk.3	P62913	OTTHUMG00000002926	ENST00000374550.3:c.377delT	1.37:g.24021262delT	ENSP00000363676:p.Phe126fs	Somatic		WXS	Illumina HiSeq	Phase_I	P25121|P39026|Q8TDH2|Q9Y674	Frame_Shift_Del	DEL	ENST00000374550.3	37	CCDS238.1																																																																																				0.408	RPL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008168.1	NM_000975	
TGFB2	7042	bcgsc.ca	37	1	218520179	218520179	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr1:218520179A>G	ENST00000366930.4	+	1	603	c.136A>G	c.(136-138)Agc>Ggc	p.S46G	TGFB2_ENST00000366929.4_Missense_Mutation_p.S46G|RP11-224O19.2_ENST00000414452.1_RNA	NM_003238.3	NP_003229.1	P61812	TGFB2_HUMAN	transforming growth factor, beta 2	46					activation of protein kinase activity (GO:0032147)|angiogenesis (GO:0001525)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac muscle cell proliferation (GO:0060038)|cardioblast differentiation (GO:0010002)|cartilage condensation (GO:0001502)|catagen (GO:0042637)|cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|collagen fibril organization (GO:0030199)|dopamine biosynthetic process (GO:0042416)|embryo development (GO:0009790)|embryonic digestive tract development (GO:0048566)|epithelial to mesenchymal transition (GO:0001837)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway (GO:0097191)|eye development (GO:0001654)|face morphogenesis (GO:0060325)|generation of neurons (GO:0048699)|glial cell migration (GO:0008347)|hair follicle development (GO:0001942)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|hemopoiesis (GO:0030097)|menstrual cycle phase (GO:0022601)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of immune response (GO:0050777)|negative regulation of macrophage cytokine production (GO:0010936)|neuron development (GO:0048666)|neuron fate commitment (GO:0048663)|neutrophil chemotaxis (GO:0030593)|odontogenesis (GO:0042476)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of activation-induced cell death of T cells (GO:0070237)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of catagen (GO:0051795)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell division (GO:0051781)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of gene expression (GO:0010628)|positive regulation of heart contraction (GO:0045823)|positive regulation of immune response (GO:0050778)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of ossification (GO:0045778)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein secretion (GO:0050714)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein phosphorylation (GO:0006468)|regulation of transforming growth factor beta2 production (GO:0032909)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to progesterone (GO:0032570)|response to wounding (GO:0009611)|salivary gland morphogenesis (GO:0007435)|signal transduction by phosphorylation (GO:0023014)|SMAD protein import into nucleus (GO:0007184)|somatic stem cell division (GO:0048103)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	axon (GO:0030424)|endosome (GO:0005768)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|platelet alpha granule lumen (GO:0031093)	beta-amyloid binding (GO:0001540)|cytokine activity (GO:0005125)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta receptor binding (GO:0005160)|type II transforming growth factor beta receptor binding (GO:0005114)			breast(1)|endometrium(1)|large_intestine(11)|lung(15)|upper_aerodigestive_tract(2)|urinary_tract(1)	31				all cancers(67;0.0459)|OV - Ovarian serous cystadenocarcinoma(81;0.049)|GBM - Glioblastoma multiforme(131;0.0776)		GCAGATCCTGAGCAAGCTGAA	0.592																																						.											0													79.0	81.0	80.0					1																	218520179		2203	4300	6503	SO:0001583	missense	7042			M19154	CCDS1521.1, CCDS44318.1	1q41	2014-01-30			ENSG00000092969	ENSG00000092969		"""Endogenous ligands"""	11768	protein-coding gene	gene with protein product	"""prepro-transforming growth factor beta-2"""	190220					Standard	NM_003238		Approved		uc001hln.3	P61812	OTTHUMG00000039521	ENST00000366930.4:c.136A>G	1.37:g.218520179A>G	ENSP00000355897:p.Ser46Gly	Somatic		WXS	Illumina HiSeq	Phase_I	B4DKC5|P08112|Q15579|Q15581|Q4VAV9	Missense_Mutation	SNP	ENST00000366930.4	37	CCDS1521.1	.	.	.	.	.	.	.	.	.	.	A	32	5.138115	0.94560	.	.	ENSG00000092969	ENST00000366930;ENST00000366929	T;T	0.69806	-0.43;-0.43	5.98	5.98	0.97165	Transforming growth factor-beta, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.83778	0.5328	M	0.86268	2.805	0.80722	D	1	D;D;D	0.89917	0.991;0.999;1.0	D;D;D	0.79108	0.951;0.986;0.992	D	0.86378	0.1727	10	0.87932	D	0	.	16.4578	0.84025	1.0:0.0:0.0:0.0	.	46;46;47	P61812-2;P61812;Q59EG9	.;TGFB2_HUMAN;.	G	46	ENSP00000355897:S46G;ENSP00000355896:S46G	ENSP00000355896:S46G	S	+	1	0	TGFB2	216586802	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.305000	0.96197	2.288000	0.76882	0.482000	0.46254	AGC		0.592	TGFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095359.2	NM_003238	
BAG5	9529	bcgsc.ca	37	14	104026390	104026390	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr14:104026390T>C	ENST00000445922.2	-	2	1358	c.1112A>G	c.(1111-1113)aAc>aGc	p.N371S	APOPT1_ENST00000409074.2_5'Flank|APOPT1_ENST00000556253.2_5'Flank|RP11-73M18.2_ENST00000472726.2_5'Flank|BAG5_ENST00000299204.4_Missense_Mutation_p.N371S|BAG5_ENST00000337322.4_Missense_Mutation_p.N412S|RP11-894P9.2_ENST00000556332.1_RNA|APOPT1_ENST00000247618.4_5'Flank	NM_004873.3	NP_004864.1	Q9UL15	BAG5_HUMAN	BCL2-associated athanogene 5	371	BAG 5. {ECO:0000255|PROSITE- ProRule:PRU00369}.				negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of protein refolding (GO:0061084)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|neuron death (GO:0070997)|protein folding (GO:0006457)|regulation of inclusion body assembly (GO:0090083)	inclusion body (GO:0016234)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	chaperone binding (GO:0051087)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)			endometrium(5)|large_intestine(4)|lung(7)|ovary(2)|prostate(2)|skin(2)|urinary_tract(2)	24		Melanoma(154;0.155)	Epithelial(46;0.144)			TCCAAGGACGTTCCAGACGGC	0.468																																					NSCLC(171;1832 2055 18950 31566 41632)	.											0													108.0	118.0	114.0					14																	104026390		2203	4300	6503	SO:0001583	missense	9529			AF095195	CCDS9982.1, CCDS41995.1	14q32	2008-08-01				ENSG00000166170			941	protein-coding gene	gene with protein product		603885				9873016, 15603737	Standard	NM_001015048		Approved		uc001ynh.2	Q9UL15		ENST00000445922.2:c.1112A>G	14.37:g.104026390T>C	ENSP00000391713:p.Asn371Ser	Somatic		WXS	Illumina HiSeq	Phase_I	O94950|Q86W59	Missense_Mutation	SNP	ENST00000445922.2	37	CCDS9982.1	.	.	.	.	.	.	.	.	.	.	T	0.016	-1.534118	0.00951	.	.	ENSG00000166170	ENST00000299204;ENST00000445922;ENST00000337322	D;D;D	0.88124	-2.34;-2.34;-2.34	5.76	-4.14	0.03892	BAG domain (3);	1.814820	0.02770	N	0.119546	T	0.69735	0.3144	N	0.03608	-0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.62220	-0.6900	10	0.13108	T	0.6	-0.4667	9.606	0.39634	0.0:0.3661:0.3681:0.2658	.	371;412	Q9UL15;Q9UL15-2	BAG5_HUMAN;.	S	371;371;412	ENSP00000299204:N371S;ENSP00000391713:N371S;ENSP00000338814:N412S	ENSP00000299204:N371S	N	-	2	0	BAG5	103096143	0.000000	0.05858	0.000000	0.03702	0.076000	0.17211	-1.686000	0.01929	-0.743000	0.04784	0.533000	0.62120	AAC		0.468	BAG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414990.1		
RAP1GAP2	23108	bcgsc.ca	37	17	2901629	2901629	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr17:2901629G>A	ENST00000254695.8	+	14	1249	c.1159G>A	c.(1159-1161)Gtg>Atg	p.V387M	RAP1GAP2_ENST00000366401.4_Missense_Mutation_p.V372M|RAP1GAP2_ENST00000540393.2_Missense_Mutation_p.V368M|RAP1GAP2_ENST00000542807.1_Missense_Mutation_p.V387M	NM_015085.4	NP_055900.4	Q684P5	RPGP2_HUMAN	RAP1 GTPase activating protein 2	387	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				negative regulation of neuron projection development (GO:0010977)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|neuron projection (GO:0043005)|nuclear membrane (GO:0031965)	Rap GTPase activator activity (GO:0046582)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	11						CTACATCGTCGTGCAGGTCGA	0.532																																						.											0													99.0	99.0	99.0					17																	2901629		2055	4186	6241	SO:0001583	missense	23108			AB028962	CCDS45573.1, CCDS45574.1	17p13.3	2009-09-14	2009-09-14	2009-09-14		ENSG00000132359			29176	protein-coding gene	gene with protein product			"""GTPase activating RANGAP domain-like 4"", ""GTPase activating Rap/RanGAP domain-like 4"""	GARNL4		15632203	Standard	NM_015085		Approved	KIAA1039	uc010ckd.3	Q684P5		ENST00000254695.8:c.1159G>A	17.37:g.2901629G>A	ENSP00000254695:p.Val387Met	Somatic		WXS	Illumina HiSeq	Phase_I	B2RTY5|Q684P4|Q6AI00|Q6ZVF0|Q9UPW2	Missense_Mutation	SNP	ENST00000254695.8	37	CCDS45573.1	.	.	.	.	.	.	.	.	.	.	G	19.04	3.749844	0.69533	.	.	ENSG00000132359	ENST00000254695;ENST00000366401;ENST00000540393;ENST00000542807	D;D;D;D	0.96745	-4.11;-4.11;-4.11;-4.11	5.66	5.66	0.87406	Rap/ran-GAP (2);	0.112822	0.64402	D	0.000010	D	0.98915	0.9632	H	0.98027	4.13	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.66979	0.92;0.948	D	0.99414	1.0931	10	0.87932	D	0	-1.3817	18.7291	0.91728	0.0:0.0:1.0:0.0	.	372;387	Q684P5-2;Q684P5	.;RPGP2_HUMAN	M	387;372;368;387	ENSP00000254695:V387M;ENSP00000389824:V372M;ENSP00000439688:V368M;ENSP00000444890:V387M	ENSP00000254695:V387M	V	+	1	0	RAP1GAP2	2848379	1.000000	0.71417	0.945000	0.38365	0.122000	0.20287	9.869000	0.99810	2.670000	0.90874	0.561000	0.74099	GTG		0.532	RAP1GAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000438208.2		
ABCC3	8714	bcgsc.ca	37	17	48744970	48744970	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr17:48744970A>G	ENST00000285238.8	+	12	1567	c.1487A>G	c.(1486-1488)aAc>aGc	p.N496S	ABCC3_ENST00000427699.1_Missense_Mutation_p.N496S	NM_003786.3	NP_003777.2	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 3	496	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Doxorubicin(DB00997)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indomethacin(DB00328)|Lamivudine(DB00709)|Leucovorin(DB00650)|Methotrexate(DB00563)|Metyrapone(DB01011)|Nifedipine(DB01115)|Omeprazole(DB00338)|Phenobarbital(DB01174)|Probenecid(DB01032)|Rifampicin(DB01045)|Sulfinpyrazone(DB01138)|Verapamil(DB00661)|Vincristine(DB00541)	GAGATCCTGAACGGCATCAAG	0.592																																						.											0													85.0	71.0	75.0					17																	48744970		2203	4300	6503	SO:0001583	missense	8714			Y17151	CCDS32681.1, CCDS45739.1	17q21	2012-03-14			ENSG00000108846	ENSG00000108846		"""ATP binding cassette transporters / subfamily C"""	54	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter 2"""	604323				8894702, 9827529	Standard	NM_003786		Approved	MRP3, cMOAT2, EST90757, MLP2, MOAT-D	uc002isl.3	O15438	OTTHUMG00000162245	ENST00000285238.8:c.1487A>G	17.37:g.48744970A>G	ENSP00000285238:p.Asn496Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B2RPA9|D3DTX9|O60265|O60922|O75621|O95078|O95289|O95290|Q86X85|Q9UN52	Missense_Mutation	SNP	ENST00000285238.8	37	CCDS32681.1	.	.	.	.	.	.	.	.	.	.	A	1.000	-0.691101	0.03303	.	.	ENSG00000108846	ENST00000427699;ENST00000285238	D;D	0.88431	-2.38;-2.38	3.92	0.653	0.17828	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.715086	0.13639	N	0.373093	T	0.76499	0.3996	N	0.21142	0.635	0.32001	N	0.603402	B;B	0.24823	0.008;0.112	B;B	0.30855	0.026;0.121	T	0.64947	-0.6287	10	0.07175	T	0.84	-0.0616	4.479	0.11757	0.2791:0.1635:0.5574:0.0	.	496;496	O15438;O15438-5	MRP3_HUMAN;.	S	496	ENSP00000395160:N496S;ENSP00000285238:N496S	ENSP00000285238:N496S	N	+	2	0	ABCC3	46099969	0.631000	0.27164	0.520000	0.27837	0.765000	0.43378	1.047000	0.30367	0.075000	0.16796	-0.427000	0.05922	AAC		0.592	ABCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368083.2	NM_020038	
SLC39A3	29985	bcgsc.ca	37	19	2732787	2732787	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr19:2732787A>G	ENST00000269740.4	-	3	1236	c.907T>C	c.(907-909)Tac>Cac	p.Y303H	SLC39A3_ENST00000545664.1_Missense_Mutation_p.Y303H|AC006538.4_ENST00000586572.1_Intron	NM_144564.4	NP_653165.2	Q9BRY0	S39A3_HUMAN	solute carrier family 39 (zinc transporter), member 3	303					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	zinc ion transmembrane transporter activity (GO:0005385)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	10		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGGACGGTGTAGCCCAGCACC	0.672																																						.											0													48.0	38.0	41.0					19																	2732787		2203	4299	6502	SO:0001583	missense	29985			AF052125	CCDS12093.1, CCDS45909.1	19p13.3	2013-05-22			ENSG00000141873	ENSG00000141873		"""Solute carriers"""	17128	protein-coding gene	gene with protein product		612168				10681536	Standard	NM_144564		Approved	ZIP3	uc002lwg.3	Q9BRY0		ENST00000269740.4:c.907T>C	19.37:g.2732787A>G	ENSP00000269740:p.Tyr303His	Somatic		WXS	Illumina HiSeq	Phase_I	B3KMJ3|Q8WUG1	Missense_Mutation	SNP	ENST00000269740.4	37	CCDS12093.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.949013	0.73787	.	.	ENSG00000141873	ENST00000545664;ENST00000269740	T;T	0.48201	0.82;0.82	4.6	4.6	0.57074	.	0.000000	0.85682	D	0.000000	T	0.64125	0.2570	M	0.64997	1.995	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.75020	0.971;0.985	T	0.67956	-0.5536	10	0.87932	D	0	-19.2825	12.7846	0.57498	1.0:0.0:0.0:0.0	.	303;303	F5H385;Q9BRY0	.;S39A3_HUMAN	H	303	ENSP00000445345:Y303H;ENSP00000269740:Y303H	ENSP00000269740:Y303H	Y	-	1	0	SLC39A3	2683787	1.000000	0.71417	0.958000	0.39756	0.788000	0.44548	8.720000	0.91442	1.698000	0.51180	0.374000	0.22700	TAC		0.672	SLC39A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451354.2		
PLB1	151056	bcgsc.ca	37	2	28812354	28812354	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr2:28812354A>G	ENST00000327757.5	+	27	1897	c.1853A>G	c.(1852-1854)gAc>gGc	p.D618G	PLB1_ENST00000422425.2_Missense_Mutation_p.D607G|PLB1_ENST00000329020.6_Missense_Mutation_p.D306G	NM_153021.4	NP_694566.4	Q6P1J6	PLB1_HUMAN	phospholipase B1	618	4 X 308-326 AA approximate repeats.				glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phospholipid metabolic process (GO:0006644)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(31)|ovary(6)|prostate(1)|skin(7)|stomach(2)	69	Acute lymphoblastic leukemia(172;0.155)					GGGCGATATGACACAAGGGAA	0.478																																						.											0													132.0	116.0	122.0					2																	28812354		2203	4300	6503	SO:0001583	missense	151056				CCDS33168.1, CCDS54340.1	2p23.3	2014-03-14			ENSG00000163803	ENSG00000163803	3.1.1.4, 3.1.1.5		30041	protein-coding gene	gene with protein product		610179				12150957	Standard	NM_153021		Approved	PLB, FLJ30866	uc002rmb.2	Q6P1J6	OTTHUMG00000152014	ENST00000327757.5:c.1853A>G	2.37:g.28812354A>G	ENSP00000330442:p.Asp618Gly	Somatic		WXS	Illumina HiSeq	Phase_I	A8KAX2|Q53S03|Q8IUP7|Q96DP9	Missense_Mutation	SNP	ENST00000327757.5	37	CCDS33168.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.33|17.33	3.363343|3.363343	0.61513|0.61513	.|.	.|.	ENSG00000163803|ENSG00000163803	ENST00000327757;ENST00000422425;ENST00000436544;ENST00000329020|ENST00000404858	T;T;T;T|.	0.55930|.	0.49;0.49;0.49;0.49|.	5.99|5.99	5.99|5.99	0.97316|0.97316	Esterase, SGNH hydrolase-type (1);Esterase, SGNH hydrolase-type, subgroup (1);Lipase, GDSL (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.78521|0.78521	0.4296|0.4296	M|M	0.85197|0.85197	2.74|2.74	0.80722|0.80722	D|D	1|1	D;D;D;P|.	0.89917|.	0.997;1.0;0.963;0.745|.	D;D;P;P|.	0.91635|.	0.98;0.999;0.779;0.74|.	T|T	0.80881|0.80881	-0.1184|-0.1184	10|5	0.33141|.	T|.	0.24|.	-35.3349|-35.3349	14.0175|14.0175	0.64533|0.64533	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	607;618;306;618|.	Q6P1J6-3;Q6P1J6-4;Q6P1J6-2;Q6P1J6|.	.;.;.;PLB1_HUMAN|.	G|A	618;607;328;306|606	ENSP00000330442:D618G;ENSP00000416440:D607G;ENSP00000392493:D328G;ENSP00000330729:D306G|.	ENSP00000330442:D618G|.	D|T	+|+	2|1	0|0	PLB1|PLB1	28665858|28665858	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.075000|0.075000	0.17131|0.17131	7.863000|7.863000	0.87023|0.87023	2.291000|2.291000	0.77112|0.77112	0.533000|0.533000	0.62120|0.62120	GAC|ACA		0.478	PLB1-012	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353348.2		
SLC16A14	151473	bcgsc.ca	37	2	230911292	230911292	+	Missense_Mutation	SNP	C	C	A	rs62191755	byFrequency	TCGA-KN-8425-01A-11D-2310-10	TCGA-KN-8425-11A-01D-2310-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	81bb13fc-f082-4c0b-8066-1729f11ef617	d0260f96-f7bd-41b1-b929-9451954cb3b4	g.chr2:230911292C>A	ENST00000295190.4	-	4	1008	c.550G>T	c.(550-552)Gca>Tca	p.A184S		NM_152527.4	NP_689740.2	Q7RTX9	MOT14_HUMAN	solute carrier family 16, member 14	184						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			NS(1)|cervix(1)|endometrium(7)|large_intestine(7)|lung(3)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.149)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;7.31e-13)|all cancers(144;5.1e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00948)		CCGTACTCTGCGCACAGGTAC	0.572													C|||	45	0.00898562	0.003	0.0144	5008	,	,		19289	0.0		0.0258	False		,,,				2504	0.0051					.											0								C	SER/ALA	17,4389	24.3+/-50.5	0,17,2186	92.0	90.0	91.0		550	0.5	0.3	2	dbSNP_129	91	200,8400	87.1+/-149.5	1,198,4101	yes	missense	SLC16A14	NM_152527.4	99	1,215,6287	AA,AC,CC		2.3256,0.3858,1.6685	benign	184/511	230911292	217,12789	2203	4300	6503	SO:0001583	missense	151473			BN000146	CCDS2473.1	2q37.1	2013-07-18	2013-07-18		ENSG00000163053	ENSG00000163053		"""Solute carriers"""	26417	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 14"""		"""solute carrier family 16 (monocarboxylic acid transporters), member 14"""				Standard	NM_152527		Approved	FLJ30794, MCT14	uc002vqd.2	Q7RTX9	OTTHUMG00000133205	ENST00000295190.4:c.550G>T	2.37:g.230911292C>A	ENSP00000295190:p.Ala184Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A8KA08|Q53R92|Q96NI7	Missense_Mutation	SNP	ENST00000295190.4	37	CCDS2473.1	29	0.013278388278388278	4	0.008130081300813009	5	0.013812154696132596	0	0.0	20	0.026385224274406333	C	5.596	0.294816	0.10567	0.003858	0.023256	ENSG00000163053	ENST00000295190;ENST00000457406;ENST00000412034	T;T;T	0.55930	0.49;0.49;0.49	4.94	0.515	0.17013	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.712084	0.13251	N	0.402103	T	0.09730	0.0239	N	0.12422	0.21	0.09310	N	1	B;B	0.18310	0.027;0.027	B;B	0.24394	0.026;0.053	T	0.09751	-1.0660	10	0.23891	T	0.37	.	0.7198	0.00938	0.4247:0.2031:0.1266:0.2456	rs62191755	184;184	E7EMG7;Q7RTX9	.;MOT14_HUMAN	S	184	ENSP00000295190:A184S;ENSP00000400352:A184S;ENSP00000395775:A184S	ENSP00000295190:A184S	A	-	1	0	SLC16A14	230619536	0.007000	0.16637	0.290000	0.24890	0.940000	0.58332	0.271000	0.18626	0.229000	0.21039	0.655000	0.94253	GCA		0.572	SLC16A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256918.2	NM_152527	
