#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CUL2	8453	hgsc.bcm.edu;bcgsc.ca	37	10	35320289	35320289	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr10:35320289C>T	ENST00000374748.1	-	15	1638	c.1325G>A	c.(1324-1326)cGt>cAt	p.R442H	CUL2_ENST00000374751.3_Missense_Mutation_p.R442H|CUL2_ENST00000374742.1_Missense_Mutation_p.R442H|CUL2_ENST00000537177.1_Missense_Mutation_p.R461H|CUL2_ENST00000374746.1_Missense_Mutation_p.R442H|CUL2_ENST00000374749.3_Missense_Mutation_p.R442H|CUL2_ENST00000602371.1_Missense_Mutation_p.R385H			Q13617	CUL2_HUMAN	cullin 2	442					cell cycle arrest (GO:0007050)|cellular response to hypoxia (GO:0071456)|G1/S transition of mitotic cell cycle (GO:0000082)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of cell proliferation (GO:0008285)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	Cul2-RING ubiquitin ligase complex (GO:0031462)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|VCB complex (GO:0030891)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|prostate(2)|skin(1)|urinary_tract(2)	31						ATGAATTAAACGTTTTGCCAG	0.303																																						.											0													84.0	83.0	83.0					10																	35320289		2203	4300	6503	SO:0001583	missense	8453			U83410	CCDS7179.1, CCDS73086.1	10p11.2	2011-05-24			ENSG00000108094	ENSG00000108094			2552	protein-coding gene	gene with protein product		603135				8681378	Standard	NM_003591		Approved		uc021ppa.1	Q13617	OTTHUMG00000017950	ENST00000374748.1:c.1325G>A	10.37:g.35320289C>T	ENSP00000363880:p.Arg442His	Somatic		WXS	Illumina HiSeq	Phase_I	B3KT95|B7Z6K8|D3DRY6|G3V1S2|O00200|Q5T2B6|Q9UNF9	Missense_Mutation	SNP	ENST00000374748.1	37	CCDS7179.1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.914130	0.92178	.	.	ENSG00000108094	ENST00000374751;ENST00000374748;ENST00000374746;ENST00000374749;ENST00000374754;ENST00000374742;ENST00000537177	D;D;D;D;D;D	0.89939	-2.59;-2.59;-2.59;-2.59;-2.59;-2.59	5.87	4.97	0.65823	Cullin, N-terminal (1);Cullin homology (3);	0.000000	0.85682	D	0.000000	D	0.95335	0.8486	M	0.90198	3.095	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.96153	0.9109	10	0.87932	D	0	-18.5811	15.1993	0.73122	0.0:0.9322:0.0:0.0678	.	442;461;442	Q5T2B5;G3V1S2;Q13617	.;.;CUL2_HUMAN	H	442;442;442;442;385;442;461	ENSP00000363883:R442H;ENSP00000363880:R442H;ENSP00000363878:R442H;ENSP00000363881:R442H;ENSP00000363874:R442H;ENSP00000444856:R461H	ENSP00000363874:R442H	R	-	2	0	CUL2	35360295	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.814000	0.86154	1.477000	0.48234	0.591000	0.81541	CGT		0.303	CUL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047538.1	NM_003591	
RPH3A	22895	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	12	113333605	113333605	+	Missense_Mutation	SNP	C	C	G			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr12:113333605C>G	ENST00000389385.4	+	21	2378	c.1881C>G	c.(1879-1881)caC>caG	p.H627Q	RPH3A_ENST00000543106.2_Missense_Mutation_p.H627Q|RPH3A_ENST00000551052.1_Missense_Mutation_p.H623Q|RPH3A_ENST00000415485.3_Missense_Mutation_p.H627Q|RPH3A_ENST00000548866.1_Missense_Mutation_p.H578Q|RPH3A_ENST00000447659.2_Missense_Mutation_p.H578Q|RPH3A_ENST00000420983.2_Missense_Mutation_p.H627Q|RPH3A_ENST00000549913.2_3'UTR	NM_001143854.1|NM_014954.3	NP_001137326.1|NP_055769.2	Q9Y2J0	RP3A_HUMAN	rabphilin 3A	627	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				intracellular protein transport (GO:0006886)	cell junction (GO:0030054)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylinositol phosphate binding (GO:1901981)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)|ovary(3)|prostate(4)|skin(6)|urinary_tract(1)	47				BRCA - Breast invasive adenocarcinoma(302;0.00453)		ACATCAAACACAGTGACCTGG	0.468																																						.											0													97.0	79.0	85.0					12																	113333605		2203	4300	6503	SO:0001583	missense	22895			AB023202	CCDS31904.1, CCDS44979.1	12q24.13	2014-07-02	2014-07-02		ENSG00000089169	ENSG00000089169		"""Synaptotagmins"""	17056	protein-coding gene	gene with protein product		612159	"""rabphilin 3A homolog (mouse)"""			10231032, 7822236	Standard	NM_014954		Approved	KIAA0985, rabphilin, exophilin-1	uc001ttz.3	Q9Y2J0	OTTHUMG00000169713	ENST00000389385.4:c.1881C>G	12.37:g.113333605C>G	ENSP00000374036:p.His627Gln	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z3C3|Q96AE0	Missense_Mutation	SNP	ENST00000389385.4	37	CCDS44979.1	.	.	.	.	.	.	.	.	.	.	C	17.75	3.466660	0.63625	.	.	ENSG00000089169	ENST00000543106;ENST00000389385;ENST00000447659;ENST00000551052;ENST00000415485;ENST00000548866;ENST00000420983;ENST00000549913	T;T;T;T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33;-0.33;-0.33;-0.33	5.42	-1.8	0.07907	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);Synaptotagmin (1);	0.000000	0.64402	D	0.000007	T	0.65903	0.2736	N	0.25789	0.76	0.52099	D	0.999943	D;P;D	0.89917	1.0;0.794;0.999	D;P;D	0.74348	0.983;0.53;0.969	T	0.61574	-0.7035	10	0.29301	T	0.29	.	13.0375	0.58881	0.0:0.6808:0.0:0.3192	.	578;627;623	F8VP47;Q9Y2J0;Q9Y2J0-2	.;RP3A_HUMAN;.	Q	627;627;578;623;627;578;627;279	ENSP00000440384:H627Q;ENSP00000374036:H627Q;ENSP00000413254:H578Q;ENSP00000448297:H623Q;ENSP00000405357:H627Q;ENSP00000450347:H578Q;ENSP00000408889:H627Q	ENSP00000374036:H627Q	H	+	3	2	RPH3A	111817988	0.990000	0.36364	0.969000	0.41365	0.996000	0.88848	0.331000	0.19733	-0.114000	0.11936	-0.137000	0.14449	CAC		0.468	RPH3A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405561.1	NM_014954	
LINC00283	100874057	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	13	103393537	103393537	+	RNA	SNP	C	C	A			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr13:103393537C>A	ENST00000430111.1	+	0	0									long intergenic non-protein coding RNA 283																		TTGAAAAGTCCATTTTCTGTC	0.294																																						.											0													44.0	35.0	38.0					13																	103393537		692	1588	2280			643677					13q33.1	2012-10-12	2011-08-10	2011-08-10	ENSG00000231633	ENSG00000231633		"""Long non-coding RNAs"""	38809	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 283"""	NCRNA00283			Standard			Approved				OTTHUMG00000017311		13.37:g.103393537C>A		Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000430111.1	37																																																																																					0.294	LINC00283-001	KNOWN	not_organism_supported|basic	antisense	antisense	OTTHUMT00000045714.1		
RASGRF1	5923	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	15	79324635	79324635	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr15:79324635G>A	ENST00000419573.3	-	7	1256	c.982C>T	c.(982-984)Ccc>Tcc	p.P328S	RASGRF1_ENST00000560334.1_5'UTR|RASGRF1_ENST00000558480.2_Missense_Mutation_p.P328S	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	328	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						TTGAGCATGGGCAGCAGGATG	0.587																																						.											0													159.0	98.0	118.0					15																	79324635		2196	4293	6489	SO:0001583	missense	5923			M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.982C>T	15.37:g.79324635G>A	ENSP00000405963:p.Pro328Ser	Somatic		WXS	Illumina HiSeq	Phase_I	F8VPA5|H0YKF2|J3KQP9|Q16027	Missense_Mutation	SNP	ENST00000419573.3	37	CCDS10309.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.538020	0.85917	.	.	ENSG00000058335	ENST00000419573;ENST00000394741	T	0.62232	0.04	4.35	4.35	0.52113	Dbl homology (DH) domain (5);	0.000000	0.85682	D	0.000000	T	0.72795	0.3505	L	0.46157	1.445	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.75752	-0.3207	10	0.72032	D	0.01	.	14.4226	0.67193	0.0:0.0:1.0:0.0	.	328;328;328;328	A8K270;Q8IUU5;Q13972;F8VPA5	.;.;RGRF1_HUMAN;.	S	328	ENSP00000405963:P328S	ENSP00000378224:P328S	P	-	1	0	RASGRF1	77111690	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.418000	0.97395	2.258000	0.74832	0.491000	0.48974	CCC		0.587	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000291371.3	NM_002891	
CLEC19A	728276	hgsc.bcm.edu;mdanderson.org	37	16	19318972	19318972	+	Intron	SNP	G	G	A	rs202158142		TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr16:19318972G>A	ENST00000493231.1	+	2	367				AC003003.5_ENST00000468219.1_RNA			Q6UXS0	CL19A_HUMAN	C-type lectin domain family 19, member A							extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)										AGAGGACTGCGTGCAGATATG	0.592																																						.											0																																										SO:0001627	intron_variant	728276					16p12.3	2013-01-07			ENSG00000261210	ENSG00000261210		"""C-type lectin domain containing"""	34522	protein-coding gene	gene with protein product							Standard	NM_001256720		Approved		uc031qvg.1	Q6UXS0	OTTHUMG00000177218	ENST00000493231.1:c.254+8812G>A	16.37:g.19318972G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q0VF32	Missense_Mutation	SNP	ENST00000493231.1	37																																																																																					0.592	CLEC19A-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000438114.1	NM_00125672	
CRHR1	1394	hgsc.bcm.edu	37	17	43910515	43910515	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr17:43910515G>A	ENST00000398285.3	+	10	869	c.869G>A	c.(868-870)gGc>gAc	p.G290D	CRHR1_ENST00000339069.5_Missense_Mutation_p.G160D|CRHR1_ENST00000352855.5_Missense_Mutation_p.G221D|CRHR1_ENST00000293493.7_Missense_Mutation_p.G86D|CRHR1_ENST00000577353.1_Missense_Mutation_p.G261D|CRHR1_ENST00000314537.5_Missense_Mutation_p.G261D	NM_001145146.1	NP_001138618.1	P34998	CRFR1_HUMAN	corticotropin releasing hormone receptor 1	290					activation of adenylate cyclase activity (GO:0007190)|adrenal gland development (GO:0030325)|behavioral response to cocaine (GO:0048148)|behavioral response to ethanol (GO:0048149)|behavioral response to pain (GO:0048266)|cellular response to corticotropin-releasing hormone stimulus (GO:0071376)|corticotropin secretion (GO:0051458)|epithelial cell differentiation (GO:0030855)|fear response (GO:0042596)|female pregnancy (GO:0007565)|general adaptation syndrome, behavioral process (GO:0051867)|hypothalamus development (GO:0021854)|immune response (GO:0006955)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of feeding behavior (GO:2000252)|negative regulation of neuron death (GO:1901215)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|neuropeptide signaling pathway (GO:0007218)|parturition (GO:0007567)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mast cell degranulation (GO:0043306)|regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010578)|regulation of corticosterone secretion (GO:2000852)|response to hypoxia (GO:0001666)|response to immobilization stress (GO:0035902)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|vesicle (GO:0031982)	corticotrophin-releasing factor receptor activity (GO:0015056)|corticotropin-releasing hormone binding (GO:0051424)|corticotropin-releasing hormone receptor activity (GO:0043404)			NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(15)|pancreas(1)|skin(1)	24	Colorectal(2;0.0416)			BRCA - Breast invasive adenocarcinoma(366;0.161)		TGCTGGTTTGGCAAAAGGCCT	0.607																																					Ovarian(110;57 1568 10207 38216 49865)	.											0													124.0	130.0	128.0					17																	43910515		1993	4160	6153	SO:0001583	missense	1394			L23332	CCDS42350.1, CCDS45712.1, CCDS45713.1, CCDS45714.1	17q12-q22	2012-08-14			ENSG00000120088	ENSG00000120088		"""GPCR / Class B : Corticotropin-releasing factor receptors"""	2357	protein-coding gene	gene with protein product	"""corticotropin-releasing factor receptor"""	122561		CRHR		7590738	Standard	NM_004382		Approved	CRF-R, CRF1	uc010dap.3	P34998		ENST00000398285.3:c.869G>A	17.37:g.43910515G>A	ENSP00000381333:p.Gly290Asp	Somatic		WXS	Illumina HiSeq	Phase_I	B4DIE9|Q13008|Q4QRJ1|Q9UK64	Missense_Mutation	SNP	ENST00000398285.3	37	CCDS45712.1	.	.	.	.	.	.	.	.	.	.	G	16.46	3.130090	0.56721	.	.	ENSG00000120088	ENST00000293493;ENST00000339069;ENST00000398285;ENST00000314537;ENST00000347197;ENST00000352855	T;T;T;T;T	0.42131	0.98;0.98;0.98;0.98;0.98	5.2	5.2	0.72013	GPCR, family 2-like (1);	0.000000	0.85682	D	0.000000	T	0.36331	0.0963	N	0.14661	0.345	0.80722	D	1	P;B;P;P;P;P	0.47034	0.889;0.333;0.536;0.877;0.48;0.819	P;P;B;P;B;B	0.51742	0.618;0.449;0.306;0.678;0.276;0.398	T	0.06899	-1.0801	10	0.11182	T	0.66	.	16.2316	0.82347	0.0:0.0:1.0:0.0	.	261;290;160;160;221;261	P34998-4;P34998;B3TIK8;B4DMR5;P34998-3;P34998-2	.;CRFR1_HUMAN;.;.;.;.	D	86;160;290;261;261;221	ENSP00000293493:G86D;ENSP00000340522:G160D;ENSP00000381333:G290D;ENSP00000326060:G261D;ENSP00000344068:G221D	ENSP00000293493:G86D	G	+	2	0	CRHR1	41266296	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.869000	0.99810	2.427000	0.82271	0.561000	0.74099	GGC		0.607	CRHR1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000441241.3		
MN1	4330	hgsc.bcm.edu	37	22	28194900	28194900	+	Silent	SNP	T	T	C	rs202212250|rs530519178	byFrequency	TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr22:28194900T>C	ENST00000302326.4	-	1	2586	c.1632A>G	c.(1630-1632)caA>caG	p.Q544Q		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	544	Poly-Gln.				intramembranous ossification (GO:0001957)					NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						gctgctgctgttgctgttgct	0.647			T	ETV6	"""AML, meningioma"""								C|||	5	0.000998403	0.0023	0.0	5008	,	,		12597	0.0		0.0	False		,,,				2504	0.002					.		Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	0																																										SO:0001819	synonymous_variant	4330			X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.1632A>G	22.37:g.28194900T>C		Somatic		WXS	Illumina HiSeq	Phase_I	A9Z1V9	Silent	SNP	ENST00000302326.4	37	CCDS42998.1																																																																																				0.647	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320737.1	NM_002430	
HDAC11	79885	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	3	13544436	13544436	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr3:13544436A>G	ENST00000295757.3	+	8	788	c.605A>G	c.(604-606)gAt>gGt	p.D202G	HDAC11_ENST00000433119.1_Missense_Mutation_p.M160V|HDAC11_ENST00000402271.1_Missense_Mutation_p.D123G|HDAC11_ENST00000522202.1_Missense_Mutation_p.D151G|HDAC11_ENST00000405025.1_Intron|HDAC11_ENST00000402259.1_Intron|HDAC11_ENST00000404040.1_Missense_Mutation_p.D102G|HDAC11_ENST00000404548.1_Intron|HDAC11_ENST00000437379.2_Missense_Mutation_p.D174G|HDAC11_ENST00000495099.2_3'UTR|HDAC11_ENST00000446613.2_Missense_Mutation_p.D10G	NM_024827.3	NP_079103.2	Q96DB2	HDA11_HUMAN	histone deacetylase 11	202	Histone deacetylase.				chromatin modification (GO:0016568)|histone deacetylation (GO:0016575)|oligodendrocyte development (GO:0014003)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone deacetylase activity (GO:0004407)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|transcription factor binding (GO:0008134)			breast(1)|endometrium(2)|large_intestine(1)|lung(2)|ovary(4)|prostate(3)	13						TACATCATGGATGTCTACAAC	0.582																																						.											0													195.0	181.0	186.0					3																	13544436		2203	4300	6503	SO:0001583	missense	79885			AK025426	CCDS2615.1, CCDS46760.1	3p25.1	2008-07-18			ENSG00000163517	ENSG00000163517	3.5.1.98		19086	protein-coding gene	gene with protein product		607226				11948178	Standard	NM_001136041		Approved		uc003bxy.3	Q96DB2	OTTHUMG00000129800	ENST00000295757.3:c.605A>G	3.37:g.13544436A>G	ENSP00000295757:p.Asp202Gly	Somatic		WXS	Illumina HiSeq	Phase_I	B4DDK1|Q9H6I7|Q9H6X3|Q9NTC9	Missense_Mutation	SNP	ENST00000295757.3	37	CCDS2615.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	26.9|26.9	4.784923|4.784923	0.90282|0.90282	.|.	.|.	ENSG00000163517|ENSG00000163517	ENST00000295757;ENST00000402271;ENST00000446613;ENST00000404040;ENST00000405478;ENST00000522202;ENST00000437379|ENST00000433119;ENST00000434848	T;T;T;T;T;T;T|.	0.70986|.	-0.53;-0.53;-0.53;-0.53;-0.53;-0.53;-0.53|.	4.94|4.94	4.94|4.94	0.65067|0.65067	Histone deacetylase domain (2);|.	0.117295|.	0.53938|.	D|.	0.000041|.	T|T	0.73837|0.73837	0.3638|0.3638	M|M	0.92833|0.92833	3.35|3.35	0.80722|0.80722	D|D	1|1	D;D|B	0.89917|0.14012	1.0;1.0|0.009	D;D|B	0.97110|0.11329	1.0;0.999|0.006	T|T	0.75852|0.75852	-0.3171|-0.3171	10|8	0.87932|0.87932	D|D	0|0	-10.674|-10.674	12.5707|12.5707	0.56334|0.56334	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	151;202|160	B4DDK1;Q96DB2|Q658J9	.;HDA11_HUMAN|.	G|V	202;123;10;102;174;151;174|160;168	ENSP00000295757:D202G;ENSP00000384123:D123G;ENSP00000401487:D10G;ENSP00000385475:D102G;ENSP00000385252:D174G;ENSP00000429794:D151G;ENSP00000395188:D174G|.	ENSP00000295757:D202G|ENSP00000412514:M160V	D|M	+|+	2|1	0|0	HDAC11|HDAC11	13519436|13519436	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.986000|0.986000	0.74619|0.74619	7.983000|7.983000	0.88140|0.88140	1.867000|1.867000	0.54127|0.54127	0.402000|0.402000	0.26972|0.26972	GAT|ATG		0.582	HDAC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252028.5	NM_024827	
LRRIQ4	344657	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	3	169540071	169540071	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr3:169540071G>A	ENST00000340806.6	+	1	362	c.362G>A	c.(361-363)cGc>cAc	p.R121H		NM_001080460.1	NP_001073929.1	A6NIV6	LRIQ4_HUMAN	leucine-rich repeats and IQ motif containing 4	121										breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	30						CACGCCCTGCGCGAGCTCCGG	0.607																																						.											0													53.0	59.0	57.0					3																	169540071		2072	4209	6281	SO:0001583	missense	344657				CCDS46951.1	3q26.2	2008-08-08	2008-06-12	2008-06-12	ENSG00000188306	ENSG00000188306			34298	protein-coding gene	gene with protein product	"""leucine rich repeat containing 64"""						Standard	NM_001080460		Approved	LRRC64	uc003fgb.3	A6NIV6	OTTHUMG00000164420	ENST00000340806.6:c.362G>A	3.37:g.169540071G>A	ENSP00000342188:p.Arg121His	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000340806.6	37	CCDS46951.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.565378	0.86439	.	.	ENSG00000188306	ENST00000340806	T	0.59772	0.24	5.56	5.56	0.83823	.	0.082415	0.51477	D	0.000088	T	0.61009	0.2313	M	0.77820	2.39	0.41284	D	0.986936	P	0.52316	0.952	B	0.43225	0.412	T	0.67280	-0.5710	10	0.49607	T	0.09	.	13.7965	0.63175	0.0754:0.0:0.9246:0.0	.	121	A6NIV6	LRIQ4_HUMAN	H	121	ENSP00000342188:R121H	ENSP00000342188:R121H	R	+	2	0	LRRIQ4	171022765	0.280000	0.24249	0.844000	0.33320	0.588000	0.36517	2.749000	0.47492	2.631000	0.89168	0.462000	0.41574	CGC		0.607	LRRIQ4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378698.1	NM_001080460	
LGI2	55203	hgsc.bcm.edu;ucsc.edu	37	4	25005583	25005583	+	Silent	SNP	C	C	T			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr4:25005583C>T	ENST00000382114.4	-	8	1313	c.1128G>A	c.(1126-1128)gcG>gcA	p.A376A		NM_018176.3	NP_060646.2	Q8N0V4	LGI2_HUMAN	leucine-rich repeat LGI family, member 2	376						extracellular region (GO:0005576)				breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(15)|prostate(1)|skin(3)|stomach(2)	33		Breast(46;0.173)				CAACAAACTCCGCATCCGTGT	0.483																																						.											0													117.0	121.0	120.0					4																	25005583		2203	4300	6503	SO:0001819	synonymous_variant	55203			AJ487516	CCDS3431.1	4p15.31	2008-07-28			ENSG00000153012	ENSG00000153012			18710	protein-coding gene	gene with protein product		608301				12023020, 16014869	Standard	NM_018176		Approved	KIAA1916, FLJ10675	uc003grf.2	Q8N0V4	OTTHUMG00000097749	ENST00000382114.4:c.1128G>A	4.37:g.25005583C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q3MIN2|Q8NDW6|Q96PX2|Q9NVK4	Silent	SNP	ENST00000382114.4	37	CCDS3431.1																																																																																				0.483	LGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214978.1		
ABCA1	19	hgsc.bcm.edu	37	9	107556793	107556794	+	Splice_Site	INS	-	-	A	rs397938228|rs77663187|rs377469216		TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr9:107556793_107556794insA	ENST00000374736.3	-	40	5777		c.e40-2			NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1						apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)	p.?(2)		NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	ATTCAGCTTCTAAAAAAAAAAA	0.406																																						.											2	Unknown(2)	lung(1)|kidney(1)																																								SO:0001630	splice_region_variant	19			AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.5383-2->T	9.37:g.107556804_107556804dupA		Somatic		WXS	Illumina HiSeq	Phase_I	Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Splice_Site	INS	ENST00000374736.3	37	CCDS6762.1																																																																																				0.406	ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053491.1	NM_005502	Intron
ATP8B2	57198	broad.mit.edu;hgsc.bcm.edu;mdanderson.org	37	1	154315638	154315638	+	Silent	SNP	C	C	T			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr1:154315638C>T	ENST00000368489.3	+	16	1602	c.1602C>T	c.(1600-1602)acC>acT	p.T534T		NM_020452.3	NP_065185.1	P98198	AT8B2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 2	520					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)		IL6R/ATP8B2(2)	breast(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	51	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			CCCTGGTCACCGCAGCCAGGA	0.567																																						.											0													72.0	58.0	63.0					1																	154315638		2203	4300	6503	SO:0001819	synonymous_variant	57198			AB032963	CCDS1066.1, CCDS41405.1	1q21.3	2012-03-09	2012-03-09		ENSG00000143515	ENSG00000143515		"""ATPases / P-type"""	13534	protein-coding gene	gene with protein product		605867	"""ATPase, class I, type 8B, member 2"""			10574461, 11015572	Standard	NM_020452		Approved	ATPID, KIAA1137	uc001fex.3	P98198	OTTHUMG00000035979	ENST00000368489.3:c.1602C>T	1.37:g.154315638C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B4E3P4|Q6NT69|Q7Z486|Q96I43|Q96NQ7	Silent	SNP	ENST00000368489.3	37	CCDS1066.1																																																																																				0.567	ATP8B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087658.2	NM_020452	
OR5D18	219438	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	11	55587779	55587779	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr11:55587779C>T	ENST00000333976.4	+	1	694	c.674C>T	c.(673-675)aCc>aTc	p.T225I		NM_001001952.1	NP_001001952.1	Q8NGL1	OR5DI_HUMAN	olfactory receptor, family 5, subfamily D, member 18	225						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(3)|large_intestine(6)|lung(33)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		all_epithelial(135;0.208)				ATTGTTGTAACCATCCTCAAG	0.488																																						.											0													171.0	141.0	151.0					11																	55587779		2200	4296	6496	SO:0001583	missense	219438			AB065781	CCDS31510.1	11q11	2012-08-09			ENSG00000186119	ENSG00000186119		"""GPCR / Class A : Olfactory receptors"""	15285	protein-coding gene	gene with protein product							Standard	NM_001001952		Approved		uc010rin.2	Q8NGL1	OTTHUMG00000166811	ENST00000333976.4:c.674C>T	11.37:g.55587779C>T	ENSP00000335025:p.Thr225Ile	Somatic		WXS	Illumina HiSeq	Phase_I	Q6IF67|Q6IFD3|Q96RB3	Missense_Mutation	SNP	ENST00000333976.4	37	CCDS31510.1	.	.	.	.	.	.	.	.	.	.	.	5.664	0.307208	0.10733	.	.	ENSG00000186119	ENST00000333976	T	0.00193	8.58	4.73	4.73	0.59995	GPCR, rhodopsin-like superfamily (1);	0.000000	0.40640	N	0.001058	T	0.00384	0.0012	M	0.85859	2.78	0.09310	N	1	P	0.37330	0.59	B	0.43575	0.424	T	0.18903	-1.0322	10	0.72032	D	0.01	-52.0107	12.7851	0.57500	0.1644:0.8356:0.0:0.0	.	225	Q8NGL1	OR5DI_HUMAN	I	225	ENSP00000335025:T225I	ENSP00000335025:T225I	T	+	2	0	OR5D18	55344355	0.005000	0.15991	0.123000	0.21794	0.068000	0.16541	2.037000	0.41174	2.402000	0.81655	0.567000	0.79289	ACC		0.488	OR5D18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391515.1	NM_001001952	
KIAA1731	85459	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	11	93462806	93462806	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr11:93462806C>T	ENST00000325212.6	+	27	7588	c.7426C>T	c.(7426-7428)Cca>Tca	p.P2476S	KIAA1731_ENST00000531700.1_Missense_Mutation_p.P656S|SNORA8_ENST00000384574.1_RNA|SNORA25_ENST00000384384.1_RNA|KIAA1731_ENST00000344196.4_Missense_Mutation_p.P656S|KIAA1731_ENST00000411936.1_Missense_Mutation_p.P2477S|SNORA1_ENST00000384107.1_RNA|SNORA32_ENST00000384072.1_RNA|TAF1D_ENST00000546088.1_5'Flank|SNORD6_ENST00000365444.1_RNA			Q9C0D2	K1731_HUMAN	KIAA1731	2476						centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)	11		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				TACACCTGTACCAGGGAGCTT	0.413																																						.											0													30.0	26.0	27.0					11																	93462806		692	1591	2283	SO:0001583	missense	85459			AB051518	CCDS44708.1	11q21	2014-03-11			ENSG00000166004	ENSG00000166004			29366	protein-coding gene	gene with protein product						20844083	Standard	NM_033395		Approved		uc009ywb.1	Q9C0D2	OTTHUMG00000167449	ENST00000325212.6:c.7426C>T	11.37:g.93462806C>T	ENSP00000316681:p.Pro2476Ser	Somatic		WXS	Illumina HiSeq	Phase_I	C9J5H9|C9JQY8|Q8N7L4|Q8N919|Q8N9B0|Q96LT8	Missense_Mutation	SNP	ENST00000325212.6	37	CCDS44708.1	.	.	.	.	.	.	.	.	.	.	c	8.332	0.826659	0.16749	.	.	ENSG00000166004	ENST00000325212;ENST00000411936;ENST00000344196;ENST00000531700;ENST00000531404	T;T	0.12465	2.68;2.68	3.61	-3.45	0.04781	.	.	.	.	.	T	0.05502	0.0145	N	0.14661	0.345	0.09310	N	1	B;B;B	0.22746	0.019;0.074;0.019	B;B;B	0.20955	0.009;0.032;0.013	T	0.40059	-0.9583	9	0.24483	T	0.36	.	1.4227	0.02315	0.2403:0.4141:0.1174:0.2282	.	2476;2477;656	Q9C0D2;Q9C0D2-3;Q9C0D2-2	K1731_HUMAN;.;.	S	2476;2477;656;656;489	ENSP00000316681:P2476S;ENSP00000406505:P2477S	ENSP00000316681:P2476S	P	+	1	0	KIAA1731	93102454	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.145000	0.10265	-0.755000	0.04709	-1.411000	0.01122	CCA		0.413	KIAA1731-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000394640.1	NM_033395	
ATP6V0A4	50617	broad.mit.edu;hgsc.bcm.edu;mdanderson.org	37	7	138437565	138437566	+	Missense_Mutation	DNP	CT	CT	GA			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	CT	CT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr7:138437565_138437566CT>GA	ENST00000310018.2	-	11	1115_1116	c.833_834AG>TC	c.(832-834)gAG>gTC	p.E278V	ATP6V0A4_ENST00000393054.1_Missense_Mutation_p.E278V|ATP6V0A4_ENST00000353492.4_Missense_Mutation_p.E278V	NM_020632.2|NM_130840.2	NP_065683.2|NP_570855.2	Q9HBG4	VPP4_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a4	278					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|excretion (GO:0007588)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|ossification (GO:0001503)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|regulation of pH (GO:0006885)|sensory perception of sound (GO:0007605)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	ATPase binding (GO:0051117)|hydrogen ion transmembrane transporter activity (GO:0015078)			NS(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(15)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36						GGCGGTGAGACTCTGTTTGTGT	0.495																																						.											0																																										SO:0001583	missense	50617			AF245517	CCDS5849.1	7q34	2011-06-09	2006-01-20	2002-05-10	ENSG00000105929	ENSG00000105929		"""ATPases / V-type"""	866	protein-coding gene	gene with protein product		605239	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) non-catalytic accessory protein 1B"", ""ATPase, H+ transporting, lysosomal V0 subunit a isoform 4"", ""ATPase, H+ transporting, lysosomal V0 subunit A4"""	ATP6N1B, ATP6N2, RTA1C		10577919, 10973252	Standard	XM_005250393		Approved	RDRTA2, VPP2, RTADR, a4, Vph1, Stv1	uc003vuf.3	Q9HBG4	OTTHUMG00000157122	ENST00000310018.2:c.833_834delinsGA	7.37:g.138437565_138437566delinsGA	ENSP00000308122:p.Glu278Val	Somatic		WXS	Illumina HiSeq	Phase_I	A4D1R4|A8KA80|Q32M47	Missense_Mutation	DNP	ENST00000310018.2	37	CCDS5849.1																																																																																				0.495	ATP6V0A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347514.1	NM_020632	
MNX1	3110	hgsc.bcm.edu;bcgsc.ca	37	7	156799223	156799223	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr7:156799223G>A	ENST00000252971.6	-	2	1102	c.802C>T	c.(802-804)Cgg>Tgg	p.R268W	MNX1-AS2_ENST00000429228.1_RNA|MNX1_ENST00000469500.1_Intron|MNX1_ENST00000543409.1_Missense_Mutation_p.R56W	NM_005515.3	NP_005506.3	P50219	MNX1_HUMAN	motor neuron and pancreas homeobox 1	268					anatomical structure morphogenesis (GO:0009653)|diaphragm development (GO:0060539)|dorsal/ventral neural tube patterning (GO:0021904)|endocrine pancreas development (GO:0031018)|humoral immune response (GO:0006959)|motor neuron axon guidance (GO:0008045)|nerve development (GO:0021675)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spinal cord motor neuron cell fate specification (GO:0021520)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(1)|lung(4)|skin(1)	7	Ovarian(565;0.218)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00301)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CGCTTGGGCCGCGACAGGTAC	0.697																																						.											0													44.0	43.0	43.0					7																	156799223		2202	4300	6502	SO:0001583	missense	3110			AF107457	CCDS34788.1, CCDS55187.1	7q36	2012-03-09	2007-08-09	2007-08-09	ENSG00000130675	ENSG00000130675		"""Homeoboxes / ANTP class : HOXL subclass"""	4979	protein-coding gene	gene with protein product		142994	"""homeo box HB9"", ""homeobox HB9"""	HLXB9		9843207	Standard	NM_001165255		Approved	HB9, HOXHB9, SCRA1	uc003wmz.4	P50219	OTTHUMG00000157181	ENST00000252971.6:c.802C>T	7.37:g.156799223G>A	ENSP00000252971:p.Arg268Trp	Somatic		WXS	Illumina HiSeq	Phase_I	F5H401|Q9Y648	Missense_Mutation	SNP	ENST00000252971.6	37	CCDS34788.1	.	.	.	.	.	.	.	.	.	.	G	19.42	3.824984	0.71143	.	.	ENSG00000130675	ENST00000252971;ENST00000543409;ENST00000542972;ENST00000428439	D;D;D	0.96459	-4.02;-4.02;-4.02	3.96	0.905	0.19307	Homeobox, eukaryotic (1);Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.36972	U	0.002313	D	0.98479	0.9493	H	0.95850	3.73	0.42035	D	0.991044	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.998;0.995	D	0.98607	1.0661	10	0.87932	D	0	-27.5498	12.5851	0.56412	0.0:0.0:0.4215:0.5785	.	104;268;56	Q9UDY3;P50219;F5H401	.;MNX1_HUMAN;.	W	268;56;98;56	ENSP00000252971:R268W;ENSP00000438552:R56W;ENSP00000401158:R56W	ENSP00000252971:R268W	R	-	1	2	MNX1	156491984	0.467000	0.25831	0.845000	0.33349	0.985000	0.73830	0.680000	0.25306	-0.054000	0.13266	-0.276000	0.10085	CGG		0.697	MNX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347796.3		
AGRN	375790	broad.mit.edu	37	1	983491	983493	+	In_Frame_Del	DEL	TGA	TGA	-			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	TGA	TGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr1:983491_983493delTGA	ENST00000379370.2	+	23	3901_3903	c.3851_3853delTGA	c.(3850-3855)gtgacc>gcc	p.1284_1285VT>A		NM_198576.3	NP_940978.2	O00468	AGRIN_HUMAN	agrin	1284	Ser/Thr-rich.				axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|clustering of voltage-gated sodium channels (GO:0045162)|extracellular matrix organization (GO:0030198)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|neuromuscular junction development (GO:0007528)|neurotransmitter receptor metabolic process (GO:0045213)|phototransduction, visible light (GO:0007603)|plasma membrane organization (GO:0007009)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of synaptic growth at neuromuscular junction (GO:0045887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor clustering (GO:0043113)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synapse organization (GO:0050808)	basal lamina (GO:0005605)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|synapse (GO:0045202)	acetylcholine receptor regulator activity (GO:0030548)|calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|dystroglycan binding (GO:0002162)|heparan sulfate proteoglycan binding (GO:0043395)|laminin binding (GO:0043236)|sialic acid binding (GO:0033691)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(2)|lung(20)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	42	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)		TCCTCTGCTGTGACCCCTCGGGC	0.695																																						.											0																																										SO:0001651	inframe_deletion	375790			XM_372195	CCDS30551.1	1p36.33	2014-09-17		2007-02-16	ENSG00000188157	ENSG00000188157		"""Proteoglycans / Extracellular Matrix : Other"""	329	protein-coding gene	gene with protein product	"""agrin proteoglycan"""	103320				1851019, 12270958	Standard	NM_198576		Approved	AGRIN	uc001ack.2	O00468	OTTHUMG00000040778	ENST00000379370.2:c.3851_3853delTGA	1.37:g.983491_983493delTGA	ENSP00000368678:p.Val1284_Thr1285delinsAla	Somatic		WXS	Illumina HiSeq	Phase_I	Q5SVA1|Q5SVA2|Q60FE1|Q7KYS8|Q8N4J5|Q96IC1|Q9BTD4	In_Frame_Del	DEL	ENST00000379370.2	37	CCDS30551.1																																																																																				0.695	AGRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097990.2	NM_198576	
CLCC1	23155	broad.mit.edu	37	1	109486125	109486125	+	Missense_Mutation	SNP	A	A	C			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr1:109486125A>C	ENST00000369971.2	-	6	803	c.674T>G	c.(673-675)tTg>tGg	p.L225W	CLCC1_ENST00000348264.2_Intron|CLCC1_ENST00000369970.3_Missense_Mutation_p.L175W|CLCC1_ENST00000415331.1_Missense_Mutation_p.L175W|CLCC1_ENST00000369968.2_Intron|CLCC1_ENST00000302500.4_Intron|CLCC1_ENST00000356970.2_Missense_Mutation_p.L225W|CLCC1_ENST00000369976.1_Intron|CLCC1_ENST00000369969.2_Intron|AKNAD1_ENST00000357393.4_Intron|CLCC1_ENST00000482889.1_5'UTR	NM_001048210.1	NP_001041675.1	Q96S66	CLCC1_HUMAN	chloride channel CLIC-like 1	225						chloride channel complex (GO:0034707)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	chloride channel activity (GO:0005254)			autonomic_ganglia(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|liver(1)|skin(1)	14		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)		Colorectal(144;0.0314)|Lung(183;0.0924)|COAD - Colon adenocarcinoma(174;0.119)|Epithelial(280;0.231)		ATTCCATCCCAAACTGAACAG	0.368																																						.											0													94.0	105.0	101.0					1																	109486125		2203	4300	6503	SO:0001583	missense	23155			AB018304	CCDS793.1, CCDS41362.1, CCDS60214.1, CCDS60215.1	1p13.3	2008-02-05			ENSG00000121940	ENSG00000121940			29675	protein-coding gene	gene with protein product	"""Mid1-related chloride channel (yeast)"""					9872452, 11279057	Standard	NM_001048210		Approved	MCLC	uc001dwf.2	Q96S66	OTTHUMG00000011732	ENST00000369971.2:c.674T>G	1.37:g.109486125A>C	ENSP00000358988:p.Leu225Trp	Somatic		WXS	Illumina HiSeq	Phase_I	O94861|Q8WYP8|Q8WYP9|Q9BU25	Missense_Mutation	SNP	ENST00000369971.2	37	CCDS41362.1	.	.	.	.	.	.	.	.	.	.	A	19.54	3.847298	0.71603	.	.	ENSG00000121940	ENST00000356970;ENST00000369971;ENST00000415331;ENST00000369970	T;T;T;T	0.55588	0.51;0.51;0.51;0.51	5.26	5.26	0.73747	.	0.241386	0.42420	D	0.000720	T	0.61565	0.2357	M	0.72118	2.19	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.68943	0.919;0.961	T	0.67546	-0.5643	10	0.72032	D	0.01	-0.3509	11.4695	0.50259	0.927:0.0:0.073:0.0	.	175;225	Q96S66-2;Q96S66	.;CLCC1_HUMAN	W	225;225;175;175	ENSP00000349456:L225W;ENSP00000358988:L225W;ENSP00000411591:L175W;ENSP00000358987:L175W	ENSP00000349456:L225W	L	-	2	0	CLCC1	109287648	0.996000	0.38824	0.948000	0.38648	0.811000	0.45836	3.750000	0.55157	2.114000	0.64651	0.482000	0.46254	TTG		0.368	CLCC1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032405.1	NM_015127	
TDRD1	56165	broad.mit.edu	37	10	115973824	115973824	+	Silent	SNP	T	T	C			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr10:115973824T>C	ENST00000369280.1	+	16	2623	c.2163T>C	c.(2161-2163)tgT>tgC	p.C721C	TDRD1_ENST00000422662.1_Silent_p.C325C|TDRD1_ENST00000251864.2_Silent_p.C721C|TDRD1_ENST00000369281.2_Silent_p.C664C|TDRD1_ENST00000369282.1_Silent_p.C721C			Q9BXT4	TDRD1_HUMAN	tudor domain containing 1	721					DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|germ cell development (GO:0007281)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|P granule (GO:0043186)|pi-body (GO:0071546)	metal ion binding (GO:0046872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(5)	48		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)		TTGTGGTCTGTGTGATATATA	0.373																																						.											0													281.0	261.0	268.0					10																	115973824		2203	4300	6503	SO:0001819	synonymous_variant	56165			AF285606	CCDS7588.1	10q26.11	2013-01-23			ENSG00000095627	ENSG00000095627		"""Tudor domain containing"""	11712	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.1"""	605796				11279525	Standard	NM_198795		Approved	CT41.1	uc001lbg.1	Q9BXT4	OTTHUMG00000019083	ENST00000369280.1:c.2163T>C	10.37:g.115973824T>C		Somatic		WXS	Illumina HiSeq	Phase_I	A6NEN3|A6NMN2|B3KVI4|B4E2L5|D3DRC2|Q4G0Y8|Q6P518|Q9H7B3	Silent	SNP	ENST00000369280.1	37																																																																																					0.373	TDRD1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000050457.2		
ANO9	338440	broad.mit.edu	37	11	421030	421030	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr11:421030C>T	ENST00000332826.6	-	17	1489	c.1405G>A	c.(1405-1407)Ggc>Agc	p.G469S		NM_001012302.2	NP_001012302	A1A5B4	ANO9_HUMAN	anoctamin 9	469					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|negative regulation of intracellular calcium activated chloride channel activity (GO:1902939)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)			central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|lung(5)|ovary(1)|prostate(4)|skin(4)	21						ATCATGCAGCCGCTGGCGTGG	0.657																																						.											0													25.0	27.0	27.0					11																	421030		2201	4293	6494	SO:0001583	missense	338440			U33271	CCDS31326.1	11p15.5	2014-04-09	2008-08-28	2008-08-28	ENSG00000185101	ENSG00000185101		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	20679	protein-coding gene	gene with protein product			"""tumor protein p53 inducible protein 5"", ""transmembrane protein 16J"""	TP53I5, TMEM16J		9305847, 24692353	Standard	NM_001012302		Approved	PIG5	uc001lpi.2	A1A5B4	OTTHUMG00000165446	ENST00000332826.6:c.1405G>A	11.37:g.421030C>T	ENSP00000332788:p.Gly469Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B3KUC4|B4E134|Q8TEN4	Missense_Mutation	SNP	ENST00000332826.6	37	CCDS31326.1	.	.	.	.	.	.	.	.	.	.	C	34	5.335785	0.95758	.	.	ENSG00000185101	ENST00000332826	T	0.71579	-0.58	3.99	3.99	0.46301	.	0.217963	0.38548	N	0.001644	D	0.85279	0.5660	M	0.85299	2.745	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.88270	0.2929	10	0.62326	D	0.03	.	16.4677	0.84087	0.0:1.0:0.0:0.0	.	170;469	A1A5B4-2;A1A5B4	.;ANO9_HUMAN	S	469	ENSP00000332788:G469S	ENSP00000332788:G469S	G	-	1	0	ANO9	411030	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	4.818000	0.62657	1.946000	0.56461	0.306000	0.20318	GGC		0.657	ANO9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384116.1	NM_001012302	
MLNR	2862	broad.mit.edu	37	13	49794805	49794805	+	Frame_Shift_Del	DEL	G	G	-			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr13:49794805delG	ENST00000218721.1	+	1	332	c.332delG	c.(331-333)tgcfs	p.C111fs	MLNR_ENST00000398307.1_Frame_Shift_Del_p.C111fs	NM_001507.1	NP_001498.1	O43193	MTLR_HUMAN	motilin receptor	111					digestion (GO:0007586)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|growth hormone-releasing hormone receptor activity (GO:0016520)			endometrium(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)	14		all_lung(13;8.31e-06)|Lung NSC(96;0.000251)|Breast(56;0.0008)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;6.1e-09)		CCGCTGCTCTGCCGCCTGTCC	0.706																																						.											0													20.0	18.0	19.0					13																	49794805		2199	4298	6497	SO:0001589	frameshift_variant	2862			AF034632	CCDS9414.1	13q14-q21	2012-08-08	2004-05-27	2004-05-28	ENSG00000102539	ENSG00000102539		"""GPCR / Class A : Motilin receptors"""	4495	protein-coding gene	gene with protein product		602885	"""G protein-coupled receptor 38"""	GPR38		9441746	Standard	NM_001507		Approved		uc010tgj.2	O43193	OTTHUMG00000016909	ENST00000218721.1:c.332delG	13.37:g.49794805delG	ENSP00000218721:p.Cys111fs	Somatic		WXS	Illumina HiSeq	Phase_I		Frame_Shift_Del	DEL	ENST00000218721.1	37	CCDS9414.1																																																																																				0.706	MLNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044897.1	NM_001507	
ENTPD5	957	broad.mit.edu	37	14	74443082	74443082	+	Missense_Mutation	SNP	C	C	T	rs375628237		TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr14:74443082C>T	ENST00000334696.6	-	9	906	c.587G>A	c.(586-588)gGg>gAg	p.G196E	ENTPD5_ENST00000557325.1_Missense_Mutation_p.G196E	NM_001249.2	NP_001240.1	O75356	ENTP5_HUMAN	ectonucleoside triphosphate diphosphohydrolase 5	196					'de novo' posttranslational protein folding (GO:0051084)|ATP metabolic process (GO:0046034)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|positive regulation of glycolytic process (GO:0045821)|protein N-linked glycosylation (GO:0006487)|regulation of phosphatidylinositol 3-kinase signaling (GO:0014066)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	guanosine-diphosphatase activity (GO:0004382)|uridine-diphosphatase activity (GO:0045134)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	10				BRCA - Breast invasive adenocarcinoma(234;0.00394)		GTCCAAGGTCCCCACAGTCTC	0.542																																						.											0								C	GLU/GLY	2,4404	4.2+/-10.8	0,2,2201	102.0	87.0	92.0		587	5.5	1.0	14		92	0,8600		0,0,4300	no	missense	ENTPD5	NM_001249.2	98	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	probably-damaging	196/429	74443082	2,13004	2203	4300	6503	SO:0001583	missense	957			AF039918	CCDS9825.1	14q24	2003-10-03	2003-10-03			ENSG00000187097			3367	protein-coding gene	gene with protein product		603162	"""proto-oncogene CPH"""	CD39L4, PCPH		9271669, 9676430	Standard	NM_001249		Approved	NTPDase-5	uc010tuo.2	O75356		ENST00000334696.6:c.587G>A	14.37:g.74443082C>T	ENSP00000335246:p.Gly196Glu	Somatic		WXS	Illumina HiSeq	Phase_I	A1L4C5|Q96RX0	Missense_Mutation	SNP	ENST00000334696.6	37	CCDS9825.1	.	.	.	.	.	.	.	.	.	.	C	35	5.438026	0.96168	4.54E-4	0.0	ENSG00000187097	ENST00000557325;ENST00000334696;ENST00000553284	T;T;T	0.23552	1.9;1.9;1.9	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.66982	0.2845	H	0.96175	3.78	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.77392	-0.2605	10	0.87932	D	0	-3.7302	19.6556	0.95837	0.0:1.0:0.0:0.0	.	196;196	O75356;G3V4I0	ENTP5_HUMAN;.	E	196	ENSP00000451810:G196E;ENSP00000335246:G196E;ENSP00000451591:G196E	ENSP00000335246:G196E	G	-	2	0	ENTPD5	73512835	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.687000	0.74552	2.882000	0.98803	0.655000	0.94253	GGG		0.542	ENTPD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412637.1	NM_001249	
UNC79	57578	broad.mit.edu;mdanderson.org;bcgsc.ca	37	14	93963546	93963546	+	Missense_Mutation	SNP	C	C	A			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr14:93963546C>A	ENST00000393151.2	+	7	812	c.812C>A	c.(811-813)cCt>cAt	p.P271H	UNC79_ENST00000553484.1_Missense_Mutation_p.P271H|UNC79_ENST00000256339.4_Missense_Mutation_p.P94H|UNC79_ENST00000555664.1_Missense_Mutation_p.P271H			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	271					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						CAAGTGAAGCCTCCAGCTGTG	0.438																																						.											0													98.0	91.0	93.0					14																	93963546		2203	4300	6503	SO:0001583	missense	57578			AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.812C>A	14.37:g.93963546C>A	ENSP00000376858:p.Pro271His	Somatic		WXS	Illumina HiSeq	Phase_I	B5MDL6|Q6ZUT7	Missense_Mutation	SNP	ENST00000393151.2	37		.	.	.	.	.	.	.	.	.	.	C	20.2	3.944488	0.73672	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.18016	2.25;2.24;2.24;2.24	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.34687	0.0906	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.01824	-1.1266	10	0.44086	T	0.13	-14.0484	19.3549	0.94408	0.0:1.0:0.0:0.0	.	271	C9JQL1	.	H	94;271;271;271;271	ENSP00000256339:P94H;ENSP00000450868:P271H;ENSP00000451360:P271H;ENSP00000376858:P271H	ENSP00000256339:P94H	P	+	2	0	KIAA1409	93033299	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.569000	0.86673	0.563000	0.77884	CCT		0.438	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395	
EPB42	2038	broad.mit.edu	37	15	43499534	43499534	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr15:43499534A>G	ENST00000441366.2	-	9	1406	c.1181T>C	c.(1180-1182)gTg>gCg	p.V394A	EPB42_ENST00000563128.1_5'Flank|EPB42_ENST00000300215.3_Missense_Mutation_p.V424A|EPB42_ENST00000540029.1_Missense_Mutation_p.V316A	NM_000119.2|NM_001114134.1	NP_000110.2|NP_001107606.1	P16452	EPB42_HUMAN	erythrocyte membrane protein band 4.2	394					cell morphogenesis (GO:0000902)|erythrocyte maturation (GO:0043249)|hemoglobin metabolic process (GO:0020027)|iron ion homeostasis (GO:0055072)|peptide cross-linking (GO:0018149)|regulation of cell shape (GO:0008360)|spleen development (GO:0048536)	cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)|structural constituent of cytoskeleton (GO:0005200)			endometrium(3)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.7e-07)		CTTCCAGACCACACATGAGGC	0.562																																						.											0													111.0	79.0	90.0					15																	43499534		2203	4299	6502	SO:0001583	missense	2038			M60298	CCDS10093.1, CCDS45249.1	15q15-q21	2013-05-02			ENSG00000166947	ENSG00000166947		"""Transglutaminases"""	3381	protein-coding gene	gene with protein product	"""Erythrocyte surface protein band 4.2"""	177070				1284644	Standard	NM_000119		Approved	PA, MGC116735, MGC116737	uc001zrb.4	P16452	OTTHUMG00000130701	ENST00000441366.2:c.1181T>C	15.37:g.43499534A>G	ENSP00000396616:p.Val394Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q4KKX0|Q4VB97	Missense_Mutation	SNP	ENST00000441366.2	37	CCDS45249.1	.	.	.	.	.	.	.	.	.	.	A	9.956	1.221440	0.22457	.	.	ENSG00000166947	ENST00000300215;ENST00000540029;ENST00000441366	T;T;T	0.54279	0.58;0.58;0.58	6.02	3.62	0.41486	.	0.538253	0.21503	N	0.073494	T	0.45337	0.1337	M	0.63208	1.945	0.28107	N	0.93115	B;B;B;B	0.20052	0.041;0.007;0.023;0.007	B;B;B;B	0.19946	0.027;0.005;0.011;0.005	T	0.39272	-0.9622	10	0.46703	T	0.11	-14.4242	5.6677	0.17704	0.7642:0.0:0.0833:0.1525	.	316;394;424;394	F5H563;B7Z4C3;P16452-2;P16452	.;.;.;EPB42_HUMAN	A	424;316;394	ENSP00000300215:V424A;ENSP00000444699:V316A;ENSP00000396616:V394A	ENSP00000300215:V424A	V	-	2	0	EPB42	41286826	0.084000	0.21492	0.995000	0.50966	0.008000	0.06430	1.606000	0.36826	2.299000	0.77371	0.528000	0.53228	GTG		0.562	EPB42-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432219.1	NM_000119	
DHX8	1659	broad.mit.edu	37	17	41585844	41585844	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr17:41585844A>G	ENST00000262415.3	+	16	2530	c.2458A>G	c.(2458-2460)Atg>Gtg	p.M820V	DHX8_ENST00000540306.1_Missense_Mutation_p.M820V	NM_004941.1	NP_004932.1	Q14562	DHX8_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 8	820	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	42		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.08)		TCCCAGTGAGATGCAGACCCG	0.478																																					NSCLC(56;1548 1661 49258 49987)	.											0													115.0	105.0	109.0					17																	41585844		2203	4300	6503	SO:0001583	missense	1659			D50487	CCDS11464.1	17q21.31	2005-08-19	2003-06-13	2003-06-20		ENSG00000067596		"""DEAH-boxes"""	2749	protein-coding gene	gene with protein product		600396	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 8 (RNA helicase)"""	DDX8		7935475	Standard	NM_004941		Approved	HRH1, PRP22, PRPF22	uc002idu.1	Q14562		ENST00000262415.3:c.2458A>G	17.37:g.41585844A>G	ENSP00000262415:p.Met820Val	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000262415.3	37	CCDS11464.1	.	.	.	.	.	.	.	.	.	.	A	15.56	2.868390	0.51588	.	.	ENSG00000067596	ENST00000540306;ENST00000262415	T;T	0.74737	-0.87;-0.87	5.68	5.68	0.88126	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.63721	0.2535	N	0.12611	0.24	0.80722	D	1	P;B	0.34629	0.46;0.091	B;B	0.40329	0.279;0.326	T	0.66296	-0.5959	10	0.42905	T	0.14	.	15.0989	0.72256	1.0:0.0:0.0:0.0	.	820;820	F5H658;Q14562	.;DHX8_HUMAN	V	820	ENSP00000437886:M820V;ENSP00000262415:M820V	ENSP00000262415:M820V	M	+	1	0	DHX8	38941370	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.237000	0.95368	2.162000	0.67917	0.459000	0.35465	ATG		0.478	DHX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453485.1		
ANKRD30B	374860	broad.mit.edu	37	18	14837637	14837637	+	Frame_Shift_Del	DEL	G	G	-			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr18:14837637delG	ENST00000358984.4	+	30	2773	c.2593delG	c.(2593-2595)ggafs	p.G865fs		NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	865										breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						ATCAGAATTAGGAAGAAAAGA	0.264																																						.											0													19.0	24.0	23.0					18																	14837637		690	1579	2269	SO:0001589	frameshift_variant	374860			BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.2593delG	18.37:g.14837637delG	ENSP00000351875:p.Gly865fs	Somatic		WXS	Illumina HiSeq	Phase_I	B4DGP1|F8WAG3|Q4G175	Frame_Shift_Del	DEL	ENST00000358984.4	37	CCDS54182.1																																																																																				0.264	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443557.1	NM_001145029	
ZNF653	115950	broad.mit.edu;ucsc.edu	37	19	11598244	11598244	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr19:11598244A>G	ENST00000293771.5	-	4	1170	c.1034T>C	c.(1033-1035)gTc>gCc	p.V345A	CTC-398G3.6_ENST00000585656.1_Intron	NM_138783.3	NP_620138.2	Q96CK0	ZN653_HUMAN	zinc finger protein 653	345					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|large_intestine(2)|lung(8)|prostate(1)|skin(1)	17						ACTGCCGGGGACACCGCTGCC	0.652																																					Pancreas(83;980 1446 4542 6441 43352)	.											0													65.0	55.0	58.0					19																	11598244		2203	4300	6503	SO:0001583	missense	115950			AY072704	CCDS12261.1	19p13.2	2013-01-08						"""Zinc fingers, C2H2-type"""	25196	protein-coding gene	gene with protein product		611371				12477932	Standard	NM_138783		Approved	Zip67	uc002mrz.2	Q96CK0		ENST00000293771.5:c.1034T>C	19.37:g.11598244A>G	ENSP00000293771:p.Val345Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q96AS7	Missense_Mutation	SNP	ENST00000293771.5	37	CCDS12261.1	.	.	.	.	.	.	.	.	.	.	G	0.005	-2.176622	0.00312	.	.	ENSG00000161914	ENST00000293771	T	0.10005	2.92	2.93	2.93	0.34026	.	0.686095	0.11916	N	0.517184	T	0.04227	0.0117	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43426	-0.9392	10	0.02654	T	1	-7.9695	6.1699	0.20410	0.1428:0.0:0.8572:0.0	.	345	Q96CK0	ZN653_HUMAN	A	345	ENSP00000293771:V345A	ENSP00000293771:V345A	V	-	2	0	ZNF653	11459244	0.617000	0.27043	0.586000	0.28679	0.056000	0.15407	1.002000	0.29796	0.805000	0.34159	-0.642000	0.03964	GTC		0.652	ZNF653-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458836.2	NM_138783	
TMEM91	641649	broad.mit.edu	37	19	41884219	41884219	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr19:41884219A>G	ENST00000392002.2	+	2	665	c.5A>G	c.(4-6)gAc>gGc	p.D2G	CTC-435M10.3_ENST00000540732.1_Missense_Mutation_p.D2G|CTC-435M10.3_ENST00000604424.1_Intron|TMEM91_ENST00000604123.1_Missense_Mutation_p.D59G|BCKDHA_ENST00000595085.1_Missense_Mutation_p.D2G|TMEM91_ENST00000542945.1_Missense_Mutation_p.D2G|TMEM91_ENST00000544232.1_Missense_Mutation_p.D2G|TMEM91_ENST00000539627.1_Missense_Mutation_p.D2G|TMEM91_ENST00000436170.2_Missense_Mutation_p.D2G|TMEM91_ENST00000413014.2_Missense_Mutation_p.D2G|TMEM91_ENST00000356385.4_Missense_Mutation_p.D2G|TMEM91_ENST00000447302.2_Missense_Mutation_p.D2G	NM_001098821.1	NP_001092291.1	Q6ZNR0	TMM91_HUMAN	transmembrane protein 91	2					hematopoietic progenitor cell differentiation (GO:0002244)|response to biotic stimulus (GO:0009607)	integral component of membrane (GO:0016021)				lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	5						AAAGCCATGGACAGCCCTAGT	0.557																																						.											0													66.0	64.0	65.0					19																	41884219		1881	4112	5993	SO:0001583	missense	641649			AK130820, BC063705	CCDS42571.1, CCDS42572.1, CCDS46082.1, CCDS46083.1, CCDS46084.1	19q13.2	2009-10-16							32393	protein-coding gene	gene with protein product	"""interferon induced transmembrane protein domain containing 6"""					12477932	Standard	NM_001098824		Approved	FLJ27310, IFITMD6		Q6ZNR0		ENST00000392002.2:c.5A>G	19.37:g.41884219A>G	ENSP00000375859:p.Asp2Gly	Somatic		WXS	Illumina HiSeq	Phase_I	C9J9D1|C9JZ62|C9K046|Q6P434	Missense_Mutation	SNP	ENST00000392002.2	37	CCDS42571.1	.	.	.	.	.	.	.	.	.	.	A	14.53	2.563594	0.45694	.	.	ENSG00000142046;ENSG00000142046;ENSG00000142046;ENSG00000142046;ENSG00000142046;ENSG00000142046;ENSG00000142046;ENSG00000142046;ENSG00000142046;ENSG00000142046;ENSG00000255730	ENST00000539627;ENST00000413014;ENST00000392002;ENST00000436170;ENST00000447302;ENST00000544232;ENST00000542945;ENST00000537354;ENST00000342187;ENST00000356385;ENST00000540732	D;D	0.99226	-4.46;-5.59	4.44	4.44	0.53790	.	0.000000	0.41605	D	0.000858	D	0.98557	0.9518	L	0.27053	0.805	0.33346	D	0.570468	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.996;1.0;1.0	D;D;D;D;D;D;D	0.83275	0.992;0.992;0.992;0.992;0.981;0.992;0.996	D	0.99780	1.1027	10	0.87932	D	0	.	10.2932	0.43608	1.0:0.0:0.0:0.0	.	2;2;2;2;2;2;2	C9J9D1;C9JZ62;C9K046;Q6P434;F5H5P2;Q6ZNR0;F5GWC9	.;.;.;.;.;TMM91_HUMAN;.	G	2	ENSP00000375859:D2G;ENSP00000443246:D2G	ENSP00000443246:D2G	D	+	2	0	CTC-435M10.3;TMEM91	46576059	0.998000	0.40836	0.986000	0.45419	0.165000	0.22458	3.619000	0.54196	2.013000	0.59113	0.459000	0.35465	GAC		0.557	TMEM91-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398302.2		
TP63	8626	broad.mit.edu;mdanderson.org;bcgsc.ca	37	3	189526226	189526226	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr3:189526226G>A	ENST00000264731.3	+	4	579	c.490G>A	c.(490-492)Gcc>Acc	p.A164T	TP63_ENST00000392463.2_Missense_Mutation_p.A70T|TP63_ENST00000437221.1_Missense_Mutation_p.A70T|TP63_ENST00000392460.3_Missense_Mutation_p.A164T|TP63_ENST00000392461.3_Missense_Mutation_p.A70T|TP63_ENST00000320472.5_Missense_Mutation_p.A164T|TP63_ENST00000449992.1_Intron|TP63_ENST00000418709.2_Missense_Mutation_p.A164T|TP63_ENST00000440651.2_Missense_Mutation_p.A164T|TP63_ENST00000456148.1_Missense_Mutation_p.A70T|TP63_ENST00000354600.5_Missense_Mutation_p.A70T|TP63_ENST00000382063.4_Intron	NM_001114978.1|NM_003722.4	NP_001108450.1|NP_003713.3	Q9H3D4	P63_HUMAN	tumor protein p63	164					apoptotic process (GO:0006915)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|cloacal septation (GO:0060197)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|ectoderm and mesoderm interaction (GO:0007499)|embryonic limb morphogenesis (GO:0030326)|epidermal cell division (GO:0010481)|epithelial cell development (GO:0002064)|establishment of planar polarity (GO:0001736)|establishment of skin barrier (GO:0061436)|female genitalia morphogenesis (GO:0048807)|hair follicle morphogenesis (GO:0031069)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organismal aging (GO:0010259)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular senescence (GO:2000773)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of mesoderm development (GO:2000381)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|polarized epithelial cell differentiation (GO:0030859)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell cycle G1/S phase transition (GO:1902808)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-anal tail morphogenesis (GO:0036342)|prostatic bud formation (GO:0060513)|protein homotetramerization (GO:0051289)|proximal/distal pattern formation (GO:0009954)|regulation of epidermal cell division (GO:0010482)|regulation of neuron apoptotic process (GO:0043523)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|skeletal system development (GO:0001501)|smooth muscle tissue development (GO:0048745)|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development (GO:0060529)|sympathetic nervous system development (GO:0048485)|urinary bladder development (GO:0060157)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region DNA binding (GO:0044212)|WW domain binding (GO:0050699)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(5)|large_intestine(12)|lung(15)|ovary(2)|skin(9)|upper_aerodigestive_tract(6)	61	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)		TCCATCACCCGCCATCCCCTC	0.637										HNSCC(45;0.13)																												.											0													171.0	124.0	140.0					3																	189526226		2203	4300	6503	SO:0001583	missense	8626			AB010153	CCDS3293.1, CCDS46976.1, CCDS46977.1, CCDS46978.1, CCDS46979.1, CCDS46980.1	3q27-q29	2014-09-17			ENSG00000073282	ENSG00000073282			15979	protein-coding gene	gene with protein product		603273	"""tumor protein p73-like"", ""tumor protein p53-like"", ""tumor protein p53-competing protein"""	TP73L, TP53L, TP53CP		9774969, 9662378, 11181441, 11181451	Standard	NM_003722		Approved	p51, SHFM4, EEC3, p63, p73L, OFC8, KET, p73H, NBP, p53CP	uc003fry.2	Q9H3D4	OTTHUMG00000156313	ENST00000264731.3:c.490G>A	3.37:g.189526226G>A	ENSP00000264731:p.Ala164Thr	Somatic		WXS	Illumina HiSeq	Phase_I	O75080|O75195|O75922|O76078|Q6VEG2|Q6VEG3|Q6VEG4|Q6VFJ1|Q6VFJ2|Q6VFJ3|Q6VH20|Q7LDI3|Q7LDI4|Q7LDI5|Q96KR0|Q9H3D2|Q9H3D3|Q9H3P8|Q9NPH7|Q9P1B4|Q9P1B5|Q9P1B6|Q9P1B7|Q9UBV9|Q9UE10|Q9UP26|Q9UP27|Q9UP28|Q9UP74	Missense_Mutation	SNP	ENST00000264731.3	37	CCDS3293.1	.	.	.	.	.	.	.	.	.	.	G	9.717	1.158763	0.21454	.	.	ENSG00000073282	ENST00000264731;ENST00000418709;ENST00000320472;ENST00000392460;ENST00000440651;ENST00000354600;ENST00000434928;ENST00000437221;ENST00000392463;ENST00000392461;ENST00000456148	D;D;D;D;D;D;D;D;D;D;D	0.99732	-6.57;-6.57;-6.57;-6.57;-6.57;-6.57;-6.57;-6.57;-6.57;-6.57;-6.57	5.83	4.96	0.65561	p53, DNA-binding domain (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.106561	0.64402	D	0.000004	D	0.97269	0.9107	N	0.01705	-0.755	0.58432	D	0.999998	P;P;B;B;B;B;P;P;P	0.41643	0.758;0.758;0.347;0.347;0.187;0.223;0.758;0.677;0.758	B;B;B;B;B;B;B;B;B	0.41917	0.254;0.254;0.154;0.127;0.08;0.044;0.254;0.37;0.254	D	0.99222	1.0879	9	.	.	.	-7.0778	14.0633	0.64812	0.0719:0.0:0.9281:0.0	.	164;164;70;70;70;70;164;164;164	Q9H3D4-7;Q9H3D4-11;Q9H3D4-4;Q9H3D4-2;Q9H3D4-6;C9D7C9;Q9H3D4-3;Q9H3D4;Q9H3D4-5	.;.;.;.;.;.;.;P63_HUMAN;.	T	164;164;164;164;164;70;70;70;70;70;70	ENSP00000264731:A164T;ENSP00000407144:A164T;ENSP00000317510:A164T;ENSP00000376253:A164T;ENSP00000394337:A164T;ENSP00000346614:A70T;ENSP00000401661:A70T;ENSP00000392488:A70T;ENSP00000376256:A70T;ENSP00000376254:A70T;ENSP00000389485:A70T	.	A	+	1	0	TP63	191008920	1.000000	0.71417	0.888000	0.34837	0.136000	0.21042	7.863000	0.87023	1.485000	0.48380	-0.140000	0.14226	GCC		0.637	TP63-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000343865.1	NM_003722	
MUC4	4585	broad.mit.edu	37	3	195509691	195509691	+	Silent	SNP	T	T	A			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr3:195509691T>A	ENST00000463781.3	-	2	9219	c.8760A>T	c.(8758-8760)tcA>tcT	p.S2920S	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Silent_p.S2920S|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CTGTGGATGCTGAGGAAGTGT	0.577																																						.											0													14.0	9.0	11.0					3																	195509691		675	1546	2221	SO:0001819	synonymous_variant	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8760A>T	3.37:g.195509691T>A		Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																				0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
LOC220729	220729	broad.mit.edu	37	3	197348716	197348716	+	RNA	SNP	A	A	C			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr3:197348716A>C	ENST00000418868.1	-	0	543					NR_003266.2																						CAGTTCTGCTAAACGGCATGC	0.433																																						.											0																																												0																															3.37:g.197348716A>C		Somatic		WXS	Illumina HiSeq	Phase_I		RNA	SNP	ENST00000418868.1	37																																																																																					0.433	AC024560.3-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000340283.1		
ADAMTS3	9508	broad.mit.edu;mdanderson.org	37	4	73205262	73205262	+	Silent	SNP	A	A	G			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr4:73205262A>G	ENST00000286657.4	-	5	846	c.810T>C	c.(808-810)cgT>cgC	p.R270R		NM_014243.2	NP_055058.2	O15072	ATS3_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 3	270	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix organization (GO:0030198)|positive regulation of vascular endothelial growth factor signaling pathway (GO:1900748)|protein processing (GO:0016485)|vascular endothelial growth factor production (GO:0010573)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(33)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	76			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TGCCATGGAAACGGACCACAG	0.453																																					NSCLC(168;1941 2048 2918 13048 43078)	.											0													322.0	324.0	324.0					4																	73205262		2203	4300	6503	SO:0001819	synonymous_variant	9508			AB002364	CCDS3553.1	4q21	2008-07-29	2005-08-19		ENSG00000156140	ENSG00000156140	3.4.24.-	"""ADAM metallopeptidases with thrombospondin type 1 motif"""	219	protein-coding gene	gene with protein product		605011	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 3"""			10094461	Standard	NM_014243		Approved	KIAA0366, ADAMTS-4	uc003hgk.2	O15072	OTTHUMG00000129912	ENST00000286657.4:c.810T>C	4.37:g.73205262A>G		Somatic		WXS	Illumina HiSeq	Phase_I	A1L3U9|Q9BXZ8	Silent	SNP	ENST00000286657.4	37	CCDS3553.1																																																																																				0.453	ADAMTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252164.2		
C4orf17	84103	broad.mit.edu;mdanderson.org	37	4	100460404	100460404	+	Missense_Mutation	SNP	A	A	C			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr4:100460404A>C	ENST00000326581.4	+	7	1075	c.713A>C	c.(712-714)gAa>gCa	p.E238A	C4orf17_ENST00000514652.1_Missense_Mutation_p.E238A	NM_032149.2	NP_115525.2	Q53FE4	CD017_HUMAN	chromosome 4 open reading frame 17	238										central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|prostate(1)|urinary_tract(3)	18				OV - Ovarian serous cystadenocarcinoma(123;2.08e-08)		ACCTCAATGGAACCAGCAGCA	0.428																																						.											0													133.0	137.0	136.0					4																	100460404		2203	4300	6503	SO:0001583	missense	84103			AL136838	CCDS3649.1	4q23	2008-02-05			ENSG00000138813	ENSG00000138813			25274	protein-coding gene	gene with protein product						11230166	Standard	NM_032149		Approved	DKFZP434G072	uc003huw.3	Q53FE4	OTTHUMG00000131027	ENST00000326581.4:c.713A>C	4.37:g.100460404A>C	ENSP00000322582:p.Glu238Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q6FI84|Q6IS77|Q8NA78|Q9H0D9	Missense_Mutation	SNP	ENST00000326581.4	37	CCDS3649.1	.	.	.	.	.	.	.	.	.	.	A	13.98	2.400323	0.42613	.	.	ENSG00000138813	ENST00000326581;ENST00000514652	T;T	0.18960	2.18;2.18	5.09	3.92	0.45320	.	0.143577	0.33477	N	0.004867	T	0.33673	0.0871	M	0.69823	2.125	0.09310	N	1	D	0.60160	0.987	P	0.56751	0.805	T	0.11867	-1.0570	10	0.34782	T	0.22	-18.0611	7.0975	0.25317	0.9013:0.0:0.0987:0.0	.	238	Q53FE4	CD017_HUMAN	A	238	ENSP00000322582:E238A;ENSP00000427663:E238A	ENSP00000322582:E238A	E	+	2	0	C4orf17	100679427	0.272000	0.24172	0.066000	0.19879	0.050000	0.14768	1.885000	0.39678	0.987000	0.38709	0.533000	0.62120	GAA		0.428	C4orf17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253670.2	NM_032149	
TBCK	93627	broad.mit.edu	37	4	107154198	107154198	+	Silent	SNP	A	A	G	rs149535149		TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr4:107154198A>G	ENST00000273980.5	-	18	1983	c.1536T>C	c.(1534-1536)tgT>tgC	p.C512C	TBCK_ENST00000361687.4_Silent_p.C449C|TBCK_ENST00000394706.3_Silent_p.C473C|TBCK_ENST00000394708.2_Silent_p.C512C|TBCK_ENST00000432496.2_Silent_p.C512C					TBC1 domain containing kinase											NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)	25						CGTACTGATGACAGCGAGGAA	0.363																																						.											0								A	,,,	0,4406		0,0,2203	122.0	116.0	118.0		1536,1536,1419,1347	1.5	1.0	4	dbSNP_134	118	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	TBCK	NM_001163435.1,NM_001163436.1,NM_001163437.1,NM_033115.3	,,,	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	,,,	512/894,512/894,473/855,449/831	107154198	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	93627				CCDS3673.1, CCDS54788.1, CCDS54789.1	4q24	2014-09-17			ENSG00000145348	ENSG00000145348			28261	protein-coding gene	gene with protein product						12471243	Standard	XR_427553		Approved	MGC16169, HSPC302	uc010ilv.2	Q8TEA7	OTTHUMG00000131214	ENST00000273980.5:c.1536T>C	4.37:g.107154198A>G		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000273980.5	37	CCDS54788.1																																																																																				0.363	TBCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253953.4	NM_033115	
TERT	7015	broad.mit.edu	37	5	1294102	1294102	+	Frame_Shift_Del	DEL	C	C	-			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr5:1294102delC	ENST00000310581.5	-	2	956	c.899delG	c.(898-900)ggcfs	p.G300fs	TERT_ENST00000296820.5_Frame_Shift_Del_p.G300fs|TERT_ENST00000508104.2_Frame_Shift_Del_p.G300fs|TERT_ENST00000522877.1_5'Flank|TERT_ENST00000334602.6_Frame_Shift_Del_p.G300fs	NM_001193376.1|NM_198253.2	NP_001180305.1|NP_937983.2	O14746	TERT_HUMAN	telomerase reverse transcriptase	300	Linker.				DNA strand elongation (GO:0022616)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|replicative senescence (GO:0090399)|telomere formation via telomerase (GO:0032203)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|telomerase holoenzyme complex (GO:0005697)	metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|telomerase activity (GO:0003720)|telomeric DNA binding (GO:0042162)|telomeric RNA binding (GO:0070034)|telomeric template RNA reverse transcriptase activity (GO:0003721)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|kidney(4)|large_intestine(3)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	41	all_cancers(3;3.17e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.87e-10)		Epithelial(17;0.00105)|all cancers(22;0.00178)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)		Zidovudine(DB00495)	GTGCTGGCGGCCCACGGATGG	0.677									TERT Mutation-Associated Haematological Disorders;Pulmonary Fibrosis, Idiopathic;Congenital Dyskeratosis																													.											0													18.0	17.0	17.0					5																	1294102		2161	4254	6415	SO:0001589	frameshift_variant	7015	Familial Cancer Database	;Hamman-Rich syndrome, Fibrocystic Pulmonary Dysplasia;Zinsser-Engman-Cole syndrome, Dyskeratosis Congenita	AF015950	CCDS3861.2, CCDS54831.1	5p15.33	2014-09-17			ENSG00000164362	ENSG00000164362			11730	protein-coding gene	gene with protein product		187270				9252327	Standard	NM_198253		Approved	TRT, TP2, TCS1, hEST2, EST2	uc003jcb.1	O14746	OTTHUMG00000090357	ENST00000310581.5:c.899delG	5.37:g.1294102delC	ENSP00000309572:p.Gly300fs	Somatic		WXS	Illumina HiSeq	Phase_I	O14783|Q2XS35|Q8N6C3|Q8NG38|Q8NG46	Frame_Shift_Del	DEL	ENST00000310581.5	37	CCDS3861.2																																																																																				0.677	TERT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206729.2		
ELMO1	9844	broad.mit.edu	37	7	37136306	37136306	+	Silent	SNP	T	T	C			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr7:37136306T>C	ENST00000310758.4	-	15	1865	c.1218A>G	c.(1216-1218)gaA>gaG	p.E406E	ELMO1_ENST00000442504.1_Silent_p.E406E|ELMO1_ENST00000341056.3_Silent_p.E108E|ELMO1_ENST00000448602.1_Silent_p.E406E	NM_001206480.1|NM_014800.10	NP_001193409.1|NP_055615.8	Q92556	ELMO1_HUMAN	engulfment and cell motility 1	406	ELMO. {ECO:0000255|PROSITE- ProRule:PRU00664}.				actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|phagocytosis, engulfment (GO:0006911)|Rac protein signal transduction (GO:0016601)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	SH3 domain binding (GO:0017124)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(28)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	58						CATGCTTGTCTTCTCGACTAC	0.408																																						.											0													177.0	142.0	154.0					7																	37136306		2203	4300	6503	SO:0001819	synonymous_variant	9844			AF398885	CCDS5449.1, CCDS5450.1	7p14.1	2012-07-10	2006-01-20		ENSG00000155849	ENSG00000155849		"""Engulfment and cell motility proteins"""	16286	protein-coding gene	gene with protein product		606420	"""engulfment and cell motility 1 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_001039459		Approved	KIAA0281, CED12, ELMO-1, CED-12	uc003tfk.2	Q92556	OTTHUMG00000023701	ENST00000310758.4:c.1218A>G	7.37:g.37136306T>C		Somatic		WXS	Illumina HiSeq	Phase_I	A4D1X6|Q29R79|Q6ZTJ0|Q96PB0|Q9H0I1	Silent	SNP	ENST00000310758.4	37	CCDS5449.1	.	.	.	.	.	.	.	.	.	.	T	9.607	1.130145	0.21041	.	.	ENSG00000155849	ENST00000433246	.	.	.	4.96	4.96	0.65561	.	.	.	.	.	T	0.70762	0.3261	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.70510	-0.4852	4	.	.	.	.	14.9674	0.71204	0.0:0.0:0.0:1.0	.	.	.	.	R	186	.	.	K	-	2	0	ELMO1	37102831	0.999000	0.42202	1.000000	0.80357	0.988000	0.76386	0.469000	0.22067	1.998000	0.58463	0.460000	0.39030	AAG		0.408	ELMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219830.4	NM_130442	
LINC00957	255031	broad.mit.edu	37	7	44081007	44081007	+	lincRNA	DEL	G	G	-	rs71011964		TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr7:44081007delG	ENST00000441052.1	+	0	1692				RASA4CP_ENST00000446874.1_RNA					long intergenic non-protein coding RNA 957																		ACATTCTTTTGGGGGGGGGGG	0.547																																						.											0																																												0			BC014556		7p13	2013-06-04			ENSG00000235314	ENSG00000235314		"""Long non-coding RNAs"""	22332	non-coding RNA	RNA, long non-coding							Standard	NR_015401		Approved				OTTHUMG00000155351		7.37:g.44081007delG		Somatic		WXS	Illumina HiSeq	Phase_I		RNA	DEL	ENST00000441052.1	37																																																																																					0.547	LINC00957-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000339589.1		
PPP1R3B	79660	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	8	8998708	8998708	+	Nonsense_Mutation	SNP	G	G	A			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr8:8998708G>A	ENST00000310455.3	-	2	604	c.454C>T	c.(454-456)Cag>Tag	p.Q152*	RP11-10A14.3_ENST00000522057.1_RNA|RP11-10A14.3_ENST00000520017.1_RNA|PPP1R3B_ENST00000519699.1_Nonsense_Mutation_p.Q152*	NM_001201329.1|NM_024607.3	NP_001188258.1|NP_078883.2	Q86XI6	PPR3B_HUMAN	protein phosphatase 1, regulatory subunit 3B	152	CBM21. {ECO:0000255|PROSITE- ProRule:PRU00491}.				glycogen metabolic process (GO:0005977)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of glycogen catabolic process (GO:0005981)	glycogen granule (GO:0042587)|intracellular membrane-bounded organelle (GO:0043231)|protein phosphatase type 1 complex (GO:0000164)	protein phosphatase regulator activity (GO:0019888)			endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	12				COAD - Colon adenocarcinoma(149;0.0717)|READ - Rectum adenocarcinoma(644;0.241)		GCGAGGTTCTGAACCTTCACA	0.478																																						.											0													188.0	161.0	170.0					8																	8998708		2203	4300	6503	SO:0001587	stop_gained	79660			AK024067	CCDS5973.1	8p23.1	2012-04-17	2011-10-04		ENSG00000173281	ENSG00000173281		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14942	protein-coding gene	gene with protein product	"""PP1 subunit R4"", ""hepatic glycogen-targeting subunit, G(L)"""	610541	"""protein phosphatase 1, regulatory (inhibitor) subunit 3B"""			11948623, 17555403	Standard	NM_024607		Approved	GL, FLJ14005, PPP1R4	uc003wsn.4	Q86XI6	OTTHUMG00000129329	ENST00000310455.3:c.454C>T	8.37:g.8998708G>A	ENSP00000308318:p.Gln152*	Somatic		WXS	Illumina HiSeq	Phase_I	B3KTV3|Q9H812	Nonsense_Mutation	SNP	ENST00000310455.3	37	CCDS5973.1	.	.	.	.	.	.	.	.	.	.	G	38	7.007912	0.97998	.	.	ENSG00000173281	ENST00000310455;ENST00000519699	.	.	.	5.87	5.87	0.94306	.	0.098174	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-24.5559	12.7339	0.57212	0.0:0.0:0.7426:0.2574	.	.	.	.	X	152	.	ENSP00000308318:Q152X	Q	-	1	0	PPP1R3B	9036118	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	5.830000	0.69324	2.780000	0.95670	0.561000	0.74099	CAG		0.478	PPP1R3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251472.1	NM_024607	
FBXO16	157574	broad.mit.edu	37	8	28321189	28321189	+	Missense_Mutation	SNP	C	C	A			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr8:28321189C>A	ENST00000380254.2	-	4	430	c.282G>T	c.(280-282)agG>agT	p.R94S	FBXO16_ENST00000518734.1_Missense_Mutation_p.R82S|FBXO16_ENST00000517436.1_5'UTR|FBXO16_ENST00000346498.2_Missense_Mutation_p.R82S	NM_001258211.1|NM_172366.3	NP_001245140.1|NP_758954.1	Q8IX29	FBX16_HUMAN	F-box protein 16	94	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.									large_intestine(2)|ovary(1)	3		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.121)|Kidney(114;0.144)|Colorectal(74;0.249)		AAGATAACACCCTTGGAAGCT	0.483																																						.											0													72.0	70.0	70.0					8																	28321189		2203	4300	6503	SO:0001583	missense	157574			AF453435	CCDS6068.1, CCDS59099.1	8p21.1	2008-02-05	2004-06-15		ENSG00000214050	ENSG00000214050		"""F-boxes /  ""other"""""	13618	protein-coding gene	gene with protein product		608519	"""F-box only protein 16"""			12243353	Standard	NM_172366		Approved	FBX16	uc003xgu.4	Q8IX29	OTTHUMG00000102147	ENST00000380254.2:c.282G>T	8.37:g.28321189C>A	ENSP00000369604:p.Arg94Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q3T1B2|Q3T1B3|Q3T1B4	Missense_Mutation	SNP	ENST00000380254.2	37	CCDS6068.1	.	.	.	.	.	.	.	.	.	.	C	18.47	3.630403	0.67015	.	.	ENSG00000214050	ENST00000380254;ENST00000346498;ENST00000518734;ENST00000517673	T;T;T;T	0.53857	1.04;1.04;1.04;0.6	5.63	1.67	0.24075	F-box domain, cyclin-like (2);F-box domain, Skp2-like (1);	0.000000	0.85682	U	0.000000	T	0.48660	0.1512	L	0.35542	1.07	0.80722	D	1	P;P;P	0.50156	0.832;0.932;0.932	P;P;P	0.54965	0.669;0.765;0.765	T	0.44636	-0.9315	10	0.87932	D	0	-46.5598	4.7587	0.13097	0.0:0.4167:0.2818:0.3015	.	82;82;94	Q3T1B3;Q3T1B2;Q8IX29	.;.;FBX16_HUMAN	S	94;82;82;94	ENSP00000369604:R94S;ENSP00000341416:R82S;ENSP00000429687:R82S;ENSP00000429390:R94S	ENSP00000341416:R82S	R	-	3	2	FBXO16	28377108	0.831000	0.29352	0.877000	0.34402	0.977000	0.68977	-0.041000	0.12084	0.088000	0.17205	-0.218000	0.12543	AGG		0.483	FBXO16-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219988.2	NM_172366	
AGRN	375790	broad.mit.edu	37	1	983488	983489	+	In_Frame_Ins	INS	-	-	CCA			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr1:983488_983489insCCA	ENST00000379370.2	+	23	3898_3899	c.3848_3849insCCA	c.(3847-3852)gctgtg>gcCCAtgtg	p.1283_1284AV>AHV		NM_198576.3	NP_940978.2	O00468	AGRIN_HUMAN	agrin	1283	Ser/Thr-rich.				axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|clustering of voltage-gated sodium channels (GO:0045162)|extracellular matrix organization (GO:0030198)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|neuromuscular junction development (GO:0007528)|neurotransmitter receptor metabolic process (GO:0045213)|phototransduction, visible light (GO:0007603)|plasma membrane organization (GO:0007009)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of synaptic growth at neuromuscular junction (GO:0045887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor clustering (GO:0043113)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synapse organization (GO:0050808)	basal lamina (GO:0005605)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|synapse (GO:0045202)	acetylcholine receptor regulator activity (GO:0030548)|calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|dystroglycan binding (GO:0002162)|heparan sulfate proteoglycan binding (GO:0043395)|laminin binding (GO:0043236)|sialic acid binding (GO:0033691)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(2)|lung(20)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	42	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)		CCGTCCTCTGCTGTGACCCCTC	0.698																																						.											0																																										SO:0001652	inframe_insertion	375790			XM_372195	CCDS30551.1	1p36.33	2014-09-17		2007-02-16	ENSG00000188157	ENSG00000188157		"""Proteoglycans / Extracellular Matrix : Other"""	329	protein-coding gene	gene with protein product	"""agrin proteoglycan"""	103320				1851019, 12270958	Standard	NM_198576		Approved	AGRIN	uc001ack.2	O00468	OTTHUMG00000040778	Exception_encountered	1.37:g.983488_983489insCCA	ENSP00000368678:p.Ala1283_Val1284insHis	Somatic		WXS	Illumina HiSeq	Phase_I	Q5SVA1|Q5SVA2|Q60FE1|Q7KYS8|Q8N4J5|Q96IC1|Q9BTD4	In_Frame_Ins	INS	ENST00000379370.2	37	CCDS30551.1																																																																																				0.698	AGRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097990.2	NM_198576	
MUC6	4588	broad.mit.edu	37	11	1018550	1018551	+	Frame_Shift_Ins	INS	-	-	G			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr11:1018550_1018551insG	ENST00000421673.2	-	31	4300_4301	c.4250_4251insC	c.(4249-4251)cctfs	p.P1417fs		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1417	Pro-rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GACCTGTGGAAGGGACGGGACT	0.559																																						.											0																																										SO:0001589	frameshift_variant	4588			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.4251dupC	11.37:g.1018553_1018553dupG	ENSP00000406861:p.Pro1417fs	Somatic		WXS	Illumina HiSeq	Phase_I	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Frame_Shift_Ins	INS	ENST00000421673.2	37	CCDS44513.1																																																																																				0.559	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
ATP6V0A4	50617	ucsc.edu;bcgsc.ca	37	7	138437565	138437565	+	Missense_Mutation	SNP	C	C	G			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr7:138437565C>G	ENST00000310018.2	-	11	1116	c.834G>C	c.(832-834)gaG>gaC	p.E278D	ATP6V0A4_ENST00000393054.1_Missense_Mutation_p.E278D|ATP6V0A4_ENST00000353492.4_Missense_Mutation_p.E278D	NM_020632.2|NM_130840.2	NP_065683.2|NP_570855.2	Q9HBG4	VPP4_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a4	278					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|excretion (GO:0007588)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|ossification (GO:0001503)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|regulation of pH (GO:0006885)|sensory perception of sound (GO:0007605)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	ATPase binding (GO:0051117)|hydrogen ion transmembrane transporter activity (GO:0015078)			NS(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(15)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36						GGCGGTGAGACTCTGTTTGTG	0.498																																						.											0													62.0	58.0	59.0					7																	138437565		2203	4300	6503	SO:0001583	missense	50617			AF245517	CCDS5849.1	7q34	2011-06-09	2006-01-20	2002-05-10	ENSG00000105929	ENSG00000105929		"""ATPases / V-type"""	866	protein-coding gene	gene with protein product		605239	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) non-catalytic accessory protein 1B"", ""ATPase, H+ transporting, lysosomal V0 subunit a isoform 4"", ""ATPase, H+ transporting, lysosomal V0 subunit A4"""	ATP6N1B, ATP6N2, RTA1C		10577919, 10973252	Standard	XM_005250393		Approved	RDRTA2, VPP2, RTADR, a4, Vph1, Stv1	uc003vuf.3	Q9HBG4	OTTHUMG00000157122	ENST00000310018.2:c.834G>C	7.37:g.138437565C>G	ENSP00000308122:p.Glu278Asp	Somatic		WXS	Illumina HiSeq	Phase_I	A4D1R4|A8KA80|Q32M47	Missense_Mutation	SNP	ENST00000310018.2	37	CCDS5849.1	.	.	.	.	.	.	.	.	.	.	C	18.84	3.708910	0.68615	.	.	ENSG00000105929	ENST00000310018;ENST00000393054;ENST00000353492	D;D;D	0.87029	-2.2;-2.2;-2.2	5.49	0.522	0.17053	.	0.152547	0.47455	D	0.000235	D	0.90421	0.7001	M	0.62266	1.93	0.40025	D	0.97545	D	0.89917	1.0	D	0.91635	0.999	D	0.88346	0.2978	10	0.51188	T	0.08	-28.8362	10.5346	0.44996	0.0:0.5315:0.0:0.4685	.	278	Q9HBG4	VPP4_HUMAN	D	278	ENSP00000308122:E278D;ENSP00000376774:E278D;ENSP00000253856:E278D	ENSP00000308122:E278D	E	-	3	2	ATP6V0A4	138088105	0.960000	0.32886	0.972000	0.41901	0.983000	0.72400	0.144000	0.16135	0.097000	0.17492	0.655000	0.94253	GAG		0.498	ATP6V0A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347514.1	NM_020632	
FGF6	2251	ucsc.edu	37	12	4554715	4554715	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr12:4554715A>G	ENST00000228837.2	-	1	65	c.22T>C	c.(22-24)Ttc>Ctc	p.F8L		NM_020996.1	NP_066276.2	P10767	FGF6_HUMAN	fibroblast growth factor 6	8					angiogenesis (GO:0001525)|cartilage condensation (GO:0001502)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|myoblast differentiation (GO:0045445)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|sarcolemma (GO:0042383)	growth factor activity (GO:0008083)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)			ATAGTGATGAACAGTTTCTGT	0.582																																						.											0													49.0	56.0	54.0					12																	4554715		2203	4300	6503	SO:0001583	missense	2251			X63454	CCDS8527.1	12p13	2014-01-30				ENSG00000111241		"""Endogenous ligands"""	3684	protein-coding gene	gene with protein product		134921				16597617	Standard	NM_020996		Approved		uc001qmr.1	P10767		ENST00000228837.2:c.22T>C	12.37:g.4554715A>G	ENSP00000228837:p.Phe8Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q0VAE1	Missense_Mutation	SNP	ENST00000228837.2	37	CCDS8527.1	.	.	.	.	.	.	.	.	.	.	A	6.186	0.402488	0.11696	.	.	ENSG00000111241	ENST00000228837	T	0.32753	1.44	5.0	1.03	0.20045	.	0.165360	0.56097	N	0.000034	T	0.08313	0.0207	N	0.01729	-0.75	0.31700	N	0.640804	B	0.02656	0.0	B	0.01281	0.0	T	0.40059	-0.9583	10	0.02654	T	1	.	7.2764	0.26288	0.3464:0.0:0.6536:0.0	.	8	P10767	FGF6_HUMAN	L	8	ENSP00000228837:F8L	ENSP00000228837:F8L	F	-	1	0	FGF6	4424976	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.502000	0.53332	0.365000	0.24400	0.459000	0.35465	TTC		0.582	FGF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398939.1	NM_020996	
PRRT4	401399	ucsc.edu	37	7	127991184	127991184	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr7:127991184A>G	ENST00000446477.2	-	6	2739	c.2426T>C	c.(2425-2427)cTc>cCc	p.L809P	PRRT4_ENST00000489835.2_3'UTR|PRRT4_ENST00000435512.1_Missense_Mutation_p.L603P|PRRT4_ENST00000535159.1_Missense_Mutation_p.L809P	NM_001174164.1	NP_001167635.1	C9JH25	PRRT4_HUMAN	proline-rich transmembrane protein 4	809	Ser-rich.					integral component of membrane (GO:0016021)				endometrium(4)|prostate(1)	5						GTCCCGCGAGAGTCCGCAGAA	0.721																																						.											0													2.0	4.0	3.0					7																	127991184		592	1466	2058	SO:0001583	missense	401399			BC063892	CCDS47698.1, CCDS47698.2, CCDS55160.1	7q32.1	2011-10-10			ENSG00000224940	ENSG00000224940		"""Proline-rich transmembrane proteins"""	37280	protein-coding gene	gene with protein product							Standard	NM_001114726		Approved		uc022aky.1	C9JH25	OTTHUMG00000157714	ENST00000446477.2:c.2426T>C	7.37:g.127991184A>G	ENSP00000415026:p.Leu809Pro	Somatic		WXS	Illumina HiSeq	Phase_I	A4D0Z9|C9JVW7	Missense_Mutation	SNP	ENST00000446477.2	37	CCDS55160.1	.	.	.	.	.	.	.	.	.	.	A	11.97	1.798044	0.31777	.	.	ENSG00000224940	ENST00000446477;ENST00000480290;ENST00000535159;ENST00000435512	.	.	.	4.24	4.24	0.50183	.	.	.	.	.	T	0.54415	0.1857	N	0.22421	0.69	0.47476	D	0.999431	D	0.71674	0.998	P	0.62491	0.903	T	0.59445	-0.7453	8	0.87932	D	0	-14.5421	11.6244	0.51136	1.0:0.0:0.0:0.0	.	809	C9JH25	PRRT4_HUMAN	P	809;338;809;603	.	ENSP00000410779:L603P	L	-	2	0	PRRT4	127778420	0.993000	0.37304	0.919000	0.36401	0.384000	0.30261	1.883000	0.39658	1.914000	0.55421	0.379000	0.24179	CTC		0.721	PRRT4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001114726	
TEKT4	150483	ucsc.edu	37	2	95542418	95542419	+	Missense_Mutation	DNP	TG	TG	CA	rs199648585|rs75603622	byFrequency	TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	TG	TG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr2:95542418_95542419TG>CA	ENST00000295201.4	+	6	1349_1350	c.1212_1213TG>CA	c.(1210-1215)atTGcc>atCAcc	p.A405T	AC097374.2_ENST00000568768.1_RNA	NM_144705.2	NP_653306.1	Q8WW24	TEKT4_HUMAN	tektin 4	405					cell projection organization (GO:0030030)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|motile cilium (GO:0031514)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	28						AGAAGGACATTGCCGCCATGAC	0.584																																						.											0																																										SO:0001583	missense	150483			AK097438	CCDS2005.1	2q11.2	2008-02-05			ENSG00000163060	ENSG00000163060			31012	protein-coding gene	gene with protein product							Standard	XM_005263876		Approved	MGC27019	uc002stw.1	Q8WW24	OTTHUMG00000130396	Exception_encountered	2.37:g.95542418_95542419delinsCA	ENSP00000295201:p.Ala405Thr	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	DNP	ENST00000295201.4	37	CCDS2005.1																																																																																				0.584	TEKT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252777.1	NM_144705	
ADCYAP1	116	mdanderson.org	37	18	907675	907675	+	Silent	SNP	G	G	A	rs8192597	byFrequency	TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr18:907675G>A	ENST00000579794.1	+	2	404	c.126G>A	c.(124-126)gcG>gcA	p.A42A	RP11-672L10.2_ENST00000581719.2_RNA|RP11-672L10.2_ENST00000580612.1_RNA|ADCYAP1_ENST00000450565.3_Silent_p.A42A|RP11-672L10.3_ENST00000582554.1_RNA|RP11-672L10.2_ENST00000577358.1_RNA	NM_001117.3	NP_001108.2	P18509	PACA_HUMAN	adenylate cyclase activating polypeptide 1 (pituitary)	42					activation of adenylate cyclase activity (GO:0007190)|ATP metabolic process (GO:0046034)|behavioral fear response (GO:0001662)|cAMP-mediated signaling (GO:0019933)|cell-cell signaling (GO:0007267)|cellular response to glucocorticoid stimulus (GO:0071385)|female pregnancy (GO:0007565)|histamine secretion (GO:0001821)|negative regulation of acute inflammatory response to antigenic stimulus (GO:0002865)|negative regulation of acute inflammatory response to non-antigenic stimulus (GO:0002878)|negative regulation of cell cycle (GO:0045786)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of Rho GTPase activity (GO:0034259)|neuron projection development (GO:0031175)|neuropeptide signaling pathway (GO:0007218)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|pituitary gland development (GO:0021983)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of somatostatin secretion (GO:0090274)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasodilation (GO:0045909)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)|regulation of postsynaptic membrane potential (GO:0060078)|regulation of protein localization (GO:0032880)|response to ethanol (GO:0045471)|response to starvation (GO:0042594)|sensory perception of pain (GO:0019233)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|terminal bouton (GO:0043195)	neuropeptide hormone activity (GO:0005184)|peptide hormone receptor binding (GO:0051428)|pituitary adenylate cyclase activating polypeptide activity (GO:0016521)|receptor binding (GO:0005102)|receptor signaling protein activity (GO:0005057)			endometrium(1)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)	12						AGGAAGAGGCGTACGGCGAGG	0.726													G|||	3516	0.702077	0.5061	0.7622	5008	,	,		8604	0.8492		0.6889	False		,,,				2504	0.7863					.											0								G	,	2350,1996		679,992,502	9.0	11.0	11.0		126,126	-3.4	1.0	18	dbSNP_117	11	6028,2476		2167,1694,391	no	coding-synonymous,coding-synonymous	ADCYAP1	NM_001099733.1,NM_001117.3	,	2846,2686,893	AA,AG,GG		29.1157,45.9273,34.8016	,	42/177,42/177	907675	8378,4472	2173	4252	6425	SO:0001819	synonymous_variant	116			S83513	CCDS11825.1	18p11	2013-02-28			ENSG00000141433	ENSG00000141433		"""Endogenous ligands"""	241	protein-coding gene	gene with protein product	"""prepro-PACAP"""	102980				1730060	Standard	NM_001099733		Approved	PACAP	uc010dkh.4	P18509	OTTHUMG00000131479	ENST00000579794.1:c.126G>A	18.37:g.907675G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B2R7N4|Q52LQ0	Silent	SNP	ENST00000579794.1	37	CCDS11825.1																																																																																				0.726	ADCYAP1-003	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440765.3	NM_001117	
ANO3	63982	mdanderson.org	37	11	26569053	26569053	+	Silent	SNP	C	C	T	rs201539223		TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr11:26569053C>T	ENST00000256737.3	+	12	2097	c.1245C>T	c.(1243-1245)tgC>tgT	p.C415C	ANO3_ENST00000529242.1_3'UTR|ANO3_ENST00000525139.1_Silent_p.C399C|ANO3_ENST00000537978.1_Silent_p.C399C|ANO3_ENST00000531568.1_Silent_p.C269C	NM_031418.2	NP_113606.2	Q9BYT9	ANO3_HUMAN	anoctamin 3	415					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	phospholipid scramblase activity (GO:0017128)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68						TTGGTTTGTGCGTTTTCTTCT	0.368													C|||	1	0.000199681	0.0	0.0014	5008	,	,		17646	0.0		0.0	False		,,,				2504	0.0					.											0													320.0	287.0	298.0					11																	26569053		2203	4300	6503	SO:0001819	synonymous_variant	63982			AJ300461	CCDS31447.1	11p14.2	2014-04-09	2008-08-28	2008-08-28	ENSG00000134343	ENSG00000134343		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	14004	protein-coding gene	gene with protein product	"""transmembrane protein 16C (eight membrane-spanning domains)"""	610110	"""chromosome 11 open reading frame 25"", ""transmembrane protein 16C"""	C11orf25, TMEM16C		12739008, 15067359, 23200863, 24692353	Standard	NM_031418		Approved	GENX-3947, DYT23	uc001mqt.4	Q9BYT9	OTTHUMG00000166096	ENST00000256737.3:c.1245C>T	11.37:g.26569053C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B7Z3F5	Silent	SNP	ENST00000256737.3	37	CCDS31447.1																																																																																				0.368	ANO3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387806.1	NM_031418	
CD5L	922	mdanderson.org;bcgsc.ca	37	1	157805692	157805692	+	Missense_Mutation	SNP	C	C	G			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr1:157805692C>G	ENST00000368174.4	-	3	405	c.309G>C	c.(307-309)ttG>ttC	p.L103F	CD5L_ENST00000484609.1_5'Flank	NM_005894.2	NP_005885.1	O43866	CD5L_HUMAN	CD5 molecule-like	103	SRCR 1. {ECO:0000255|PROSITE- ProRule:PRU00196}.				apoptotic process (GO:0006915)|cellular defense response (GO:0006968)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	scavenger receptor activity (GO:0005044)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	52	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			CACACTGAGCCAATGTATCTT	0.488																																						.											0													213.0	217.0	216.0					1																	157805692		2203	4300	6503	SO:0001583	missense	922			U82812	CCDS1171.1	1q21-q23	2008-02-05	2006-03-28		ENSG00000073754	ENSG00000073754			1690	protein-coding gene	gene with protein product		602592	"""apoptosis inhibitor 6"", ""CD5 antigen-like (scavenger receptor cysteine rich family)"""	API6		9045627	Standard	NM_005894		Approved	Spalpha	uc001frk.4	O43866	OTTHUMG00000022440	ENST00000368174.4:c.309G>C	1.37:g.157805692C>G	ENSP00000357156:p.Leu103Phe	Somatic		WXS	Illumina HiSeq	Phase_I	A8K7M5|Q6UX63	Missense_Mutation	SNP	ENST00000368174.4	37	CCDS1171.1	.	.	.	.	.	.	.	.	.	.	C	14.22	2.471904	0.43942	.	.	ENSG00000073754	ENST00000368174	T	0.57907	0.37	4.68	4.68	0.58851	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.000000	0.35291	N	0.003305	T	0.65491	0.2696	M	0.90759	3.145	0.09310	N	1	D	0.71674	0.998	D	0.68353	0.957	T	0.62296	-0.6884	10	0.87932	D	0	.	8.6725	0.34159	0.0:0.8993:0.0:0.1007	.	103	O43866	CD5L_HUMAN	F	103	ENSP00000357156:L103F	ENSP00000357156:L103F	L	-	3	2	CD5L	156072316	0.000000	0.05858	0.194000	0.23346	0.023000	0.10783	-1.013000	0.03645	2.419000	0.82065	0.563000	0.77884	TTG		0.488	CD5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058346.1	NM_005894	
CNTNAP3B	728577	mdanderson.org	37	9	43816760	43816760	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr9:43816760A>G	ENST00000377564.3	+	6	1259	c.866A>G	c.(865-867)gAc>gGc	p.D289G	CNTNAP3B_ENST00000276974.6_Missense_Mutation_p.D289G	NM_001201380.1	NP_001188309.1	Q96NU0	CNT3B_HUMAN	contactin associated protein-like 3B	289	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|lung(3)|pancreas(1)|prostate(3)	10						TTCACCGTGGACAAACACACT	0.448																																						.											0																																										SO:0001583	missense	728577			BX538190	CCDS75836.1	9p12	2007-12-14			ENSG00000154529	ENSG00000154529			32035	protein-coding gene	gene with protein product						15820314	Standard	XM_006716853		Approved		uc004abr.1	Q96NU0	OTTHUMG00000013174	ENST00000377564.3:c.866A>G	9.37:g.43816760A>G	ENSP00000366787:p.Asp289Gly	Somatic		WXS	Illumina HiSeq	Phase_I	B1B0V7|B1B0V8|B1B0V9|B1B0W0|B1B0X8|B1B162|Q4VXF0|Q9H7W3	Missense_Mutation	SNP	ENST00000377564.3	37	CCDS55312.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.57|15.57	2.872866|2.872866	0.51695|0.51695	.|.	.|.	ENSG00000154529|ENSG00000154529	ENST00000377564;ENST00000276974;ENST00000341990;ENST00000403166|ENST00000377561	D;D|.	0.88354|.	-2.37;-2.37|.	2.77|2.77	2.77|2.77	0.32553|0.32553	.|.	.|.	.|.	.|.	.|.	T|T	0.78629|0.78629	0.4313|0.4313	M|M	0.92026|0.92026	3.265|3.265	0.37380|0.37380	D|D	0.911984|0.911984	.|.	.|.	.|.	.|.	.|.	.|.	D|D	0.83842|0.83842	0.0258|0.0258	7|5	0.87932|.	D|.	0|.	.|.	10.0867|10.0867	0.42423|0.42423	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|.	.|.	.|.	G|A	289|338	ENSP00000366787:D289G;ENSP00000276974:D289G|.	ENSP00000276974:D289G|.	D|T	+|+	2|1	0|0	CNTNAP3B|CNTNAP3B	43756756|43756756	1.000000|1.000000	0.71417|0.71417	0.522000|0.522000	0.27862|0.27862	0.507000|0.507000	0.33981|0.33981	7.686000|7.686000	0.84128|0.84128	1.289000|1.289000	0.44618|0.44618	0.338000|0.338000	0.21704|0.21704	GAC|ACA		0.448	CNTNAP3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036930.3		
DACT1	51339	mdanderson.org	37	14	59112179	59112179	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr14:59112179A>G	ENST00000335867.4	+	4	862	c.838A>G	c.(838-840)Agc>Ggc	p.S280G	DACT1_ENST00000556859.1_5'UTR|DACT1_ENST00000555845.1_3'UTR|DACT1_ENST00000541264.2_5'UTR|DACT1_ENST00000395153.3_Missense_Mutation_p.S243G			Q9NYF0	DACT1_HUMAN	dishevelled-binding antagonist of beta-catenin 1	280					dendrite morphogenesis (GO:0048813)|embryonic hindgut morphogenesis (GO:0048619)|gastrulation with mouth forming second (GO:0001702)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of catenin import into nucleus (GO:0035412)|regulation of protein stability (GO:0031647)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|synapse organization (GO:0050808)|Wnt signaling pathway (GO:0016055)	beta-catenin destruction complex (GO:0030877)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|synapse (GO:0045202)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|protein kinase A binding (GO:0051018)|protein kinase C binding (GO:0005080)			endometrium(7)|kidney(3)|large_intestine(11)|lung(27)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	53						GGCTGTGCAGAGCCCAATGTT	0.502																																						.											0													144.0	132.0	136.0					14																	59112179		2203	4300	6503	SO:0001583	missense	51339			AF251079	CCDS9736.1, CCDS41961.1	14q22.3	2013-05-15	2013-05-15		ENSG00000165617	ENSG00000165617			17748	protein-coding gene	gene with protein product		607861	"""dapper homolog 1, antagonist of beta-catenin (xenopus)"", ""dapper, antagonist of beta-catenin, homolog 1 (Xenopus laevis)"""			11970895	Standard	NM_001079520		Approved	DAPPER1, THYEX3, HDPR1, DAPPER, FRODO	uc001xdw.3	Q9NYF0	OTTHUMG00000140324	ENST00000335867.4:c.838A>G	14.37:g.59112179A>G	ENSP00000337439:p.Ser280Gly	Somatic		WXS	Illumina HiSeq	Phase_I	A8MYJ2|Q86TY0	Missense_Mutation	SNP	ENST00000335867.4	37	CCDS9736.1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.289521	0.80914	.	.	ENSG00000165617	ENST00000395153;ENST00000335867	T;T	0.69306	-0.39;-0.39	5.71	5.71	0.89125	.	0.101407	0.64402	D	0.000001	D	0.83184	0.5199	M	0.83603	2.65	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.85130	0.997;0.996	D	0.85748	0.1341	10	0.72032	D	0.01	-21.4663	15.979	0.80091	1.0:0.0:0.0:0.0	.	243;280	A8MYJ2;Q9NYF0	.;DACT1_HUMAN	G	243;280	ENSP00000378582:S243G;ENSP00000337439:S280G	ENSP00000337439:S280G	S	+	1	0	DACT1	58181932	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	7.122000	0.77169	2.182000	0.69389	0.460000	0.39030	AGC		0.502	DACT1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325515.1	NM_016651	
DDX12P	440081	mdanderson.org	37	12	9573215	9573215	+	IGR	SNP	A	A	G			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr12:9573215A>G								RP13-735L24.1 (23002 upstream) : SNORA75 (24438 downstream)														p.S700P(3)									ACCCCTCCAGAAACCACACCG	0.617																																						.											3	Substitution - Missense(3)	endometrium(3)											148.0	147.0	147.0					12																	9573215		692	1591	2283	SO:0001628	intergenic_variant	440081																															12.37:g.9573215A>G		Somatic		WXS	Illumina HiSeq	Phase_I		RNA	SNP		37																																																																																				0	0.617								
DDX11	1663	mdanderson.org	37	12	31242416	31242416	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr12:31242416G>A	ENST00000407793.2	+	8	1123	c.872G>A	c.(871-873)aGc>aAc	p.S291N	DDX11_ENST00000545668.1_Missense_Mutation_p.S291N|DDX11_ENST00000542838.1_Missense_Mutation_p.S291N|DDX11_ENST00000228264.6_Missense_Mutation_p.S265N|DDX11_ENST00000350437.4_Missense_Mutation_p.S291N|DDX11_ENST00000251758.5_3'UTR	NM_030653.3|NM_152438.1	NP_085911.2|NP_689651.1	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11	291	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(11)|large_intestine(5)|lung(23)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	57	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					ATGCAGAGAAGCAGGCACGGT	0.512										Multiple Myeloma(12;0.14)																												.											0													36.0	44.0	42.0					12																	31242416		2203	4300	6503	SO:0001583	missense	1663			U75969	CCDS8721.1, CCDS41767.1, CCDS44856.1, CCDS58224.1	12p11.21	2012-02-23	2012-02-23		ENSG00000013573	ENSG00000013573		"""DEAD-boxes"""	2736	protein-coding gene	gene with protein product	"""CHL1-like helicase homolog (S. cerevisiae)"""	601150	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (S.cerevisiae CHL1-like helicase)"", ""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11"""				Standard	NM_030653		Approved	CHLR1, KRG2, CHL1, ChlR1, WABS	uc001rjv.2	Q96FC9	OTTHUMG00000168435	ENST00000407793.2:c.872G>A	12.37:g.31242416G>A	ENSP00000384703:p.Ser291Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	ENST00000407793.2	37	CCDS44856.1	.	.	.	.	.	.	.	.	.	.	G	0.033	-1.321428	0.01320	.	.	ENSG00000013573	ENST00000542838;ENST00000407793;ENST00000228264;ENST00000438391;ENST00000545668;ENST00000350437	T;T;T;T;T;T	0.71579	-0.58;-0.58;-0.58;-0.58;-0.58;-0.58	3.45	0.218	0.15270	DEAD2 (1);Helicase-like, DEXD box c2 type (1);Helicase, superfamily 1/2, ATP-binding domain, DinG/Rad3-type (1);	0.418647	0.29424	N	0.012196	T	0.35508	0.0934	N	0.02357	-0.585	0.80722	D	1	B;B;B	0.12013	0.005;0.001;0.001	B;B;B	0.14023	0.01;0.003;0.004	T	0.04165	-1.0972	10	0.12103	T	0.63	.	5.4846	0.16743	0.5522:0.0:0.4478:0.0	.	291;291;291	Q96FC9;Q96FC9-4;Q96FC9-2	DDX11_HUMAN;.;.	N	291;291;265;262;291;291	ENSP00000443426:S291N;ENSP00000384703:S291N;ENSP00000228264:S265N;ENSP00000407646:S262N;ENSP00000440402:S291N;ENSP00000309965:S291N	ENSP00000228264:S265N	S	+	2	0	DDX11	31133683	1.000000	0.71417	0.242000	0.24170	0.022000	0.10575	3.115000	0.50391	0.180000	0.19960	0.505000	0.49811	AGC		0.512	DDX11-202	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000399728.1	NM_030653	
LINS	55180	mdanderson.org	37	15	101110265	101110265	+	Silent	SNP	T	T	A	rs2411836	byFrequency	TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr15:101110265T>A	ENST00000314742.8	-	7	1674	c.1452A>T	c.(1450-1452)acA>acT	p.T484T	LINS_ENST00000559149.1_5'Flank	NM_001040616.2	NP_001035706	Q8NG48	LINES_HUMAN	lines homolog (Drosophila)	484								p.T484T(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|prostate(1)|skin(1)|stomach(4)	21						CATTTTCATGTGTGTGATGGT	0.353													T|||	1560	0.311502	0.2375	0.2493	5008	,	,		17495	0.246		0.4513	False		,,,				2504	0.3793					.											1	Substitution - coding silent(1)	stomach(1)						T		1242,3164	413.7+/-336.6	157,928,1118	56.0	55.0	55.0		1452	-0.9	0.8	15	dbSNP_100	55	4032,4566	526.5+/-381.0	961,2110,1228	no	coding-synonymous	LINS	NM_001040616.2		1118,3038,2346	AA,AT,TT		46.8946,28.1888,40.5568		484/758	101110265	5274,7730	2203	4299	6502	SO:0001819	synonymous_variant	55180			AK095448	CCDS10385.1	15q26.3	2010-09-08	2010-09-08	2010-09-08	ENSG00000140471	ENSG00000140471			30922	protein-coding gene	gene with protein product		610350	"""lines homolog 1 (Drosophila)"""	LINS1		12119551, 8889548	Standard	NM_001040616		Approved	WINS1	uc002bwg.3	Q8NG48	OTTHUMG00000149865	ENST00000314742.8:c.1452A>T	15.37:g.101110265T>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q96FW2|Q9NVQ3	Silent	SNP	ENST00000314742.8	37	CCDS10385.1																																																																																				0.353	LINS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313592.1	NM_018148	
MIR494	574452	mdanderson.org	37	14	101493161	101493161	+	RNA	SNP	A	A	T			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr14:101493161A>T	ENST00000349529.2	+	0	0				MIR323A_ENST00000362199.1_RNA|MIR1197_ENST00000408818.1_RNA|MIR299_ENST00000385016.2_RNA|MIR380_ENST00000362112.2_RNA|MIR758_ENST00000390227.1_RNA|MIR329-1_ENST00000385028.1_RNA|MIR329-2_ENST00000385029.1_RNA	NR_030174.1				microRNA 494																		TGTTTCTTTAATGAGGACGAA	0.468																																						.											0													250.0	208.0	221.0					14																	101493161		1568	3582	5150			574408					14q32.31	2011-09-12		2008-12-18	ENSG00000194717	ENSG00000194717		"""ncRNAs / Micro RNAs"""	32084	non-coding RNA	RNA, micro				MIRN494			Standard	NR_030174		Approved	hsa-mir-494	uc010txm.2				14.37:g.101493161A>T		Somatic		WXS	Illumina HiSeq	Phase_I		RNA	SNP	ENST00000349529.2	37																																																																																					0.468	MIR494-201	KNOWN	basic	miRNA	miRNA		NR_030174	
MLLT3	4300	mdanderson.org	37	9	20414346	20414346	+	Silent	SNP	G	G	A			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr9:20414346G>A	ENST00000380338.4	-	5	784	c.498C>T	c.(496-498)agC>agT	p.S166S	MLLT3_ENST00000429426.2_Silent_p.S163S|MLLT3_ENST00000355930.6_5'UTR|MLLT3_ENST00000475957.1_5'UTR	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	166	Poly-Ser.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)		p.S166S(4)		central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		tgctgctactgctgctgctgc	0.527			T	MLL	ALL																																	.		Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	4	Substitution - coding silent(4)	urinary_tract(2)|lung(1)|prostate(1)											8.0	15.0	13.0					9																	20414346		1434	3114	4548	SO:0001819	synonymous_variant	4300			L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.498C>T	9.37:g.20414346G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Silent	SNP	ENST00000380338.4	37	CCDS6494.1																																																																																				0.527	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051872.1	NM_004529	
MN1	4330	mdanderson.org	37	22	28194912	28194912	+	Silent	SNP	T	T	C			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr22:28194912T>C	ENST00000302326.4	-	1	2574	c.1620A>G	c.(1618-1620)caA>caG	p.Q540Q		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	540	Poly-Gln.				intramembranous ossification (GO:0001957)					NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						gctgttgctgttgctgctgct	0.657			T	ETV6	"""AML, meningioma"""																																	.		Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	0													4.0	5.0	5.0					22																	28194912		1941	3935	5876	SO:0001819	synonymous_variant	4330			X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.1620A>G	22.37:g.28194912T>C		Somatic		WXS	Illumina HiSeq	Phase_I	A9Z1V9	Silent	SNP	ENST00000302326.4	37	CCDS42998.1																																																																																				0.657	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320737.1	NM_002430	
MN1	4330	mdanderson.org	37	22	28194927	28194927	+	Silent	SNP	C	C	T	rs570740760	byFrequency	TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr22:28194927C>T	ENST00000302326.4	-	1	2559	c.1605G>A	c.(1603-1605)caG>caA	p.Q535Q		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	535	Poly-Gln.				intramembranous ossification (GO:0001957)					NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						gctgctgctgctgctgttgct	0.647			T	ETV6	"""AML, meningioma"""								C|||	8	0.00159744	0.0008	0.0043	5008	,	,		12376	0.001		0.002	False		,,,				2504	0.001					.		Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	0																																										SO:0001819	synonymous_variant	4330			X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.1605G>A	22.37:g.28194927C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A9Z1V9	Silent	SNP	ENST00000302326.4	37	CCDS42998.1																																																																																				0.647	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320737.1	NM_002430	
RNF123	63891	mdanderson.org	37	3	49724172	49724172	+	5'Flank	SNP	C	C	T	rs41291698		TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr3:49724172C>T	ENST00000327697.6	+	0	0				MST1_ENST00000449682.2_Nonsense_Mutation_p.W264*|AC099668.5_ENST00000563780.1_RNA|RNF123_ENST00000432042.1_5'Flank|MST1_ENST00000383728.3_Nonsense_Mutation_p.W189*|MST1_ENST00000494828.2_5'Flank|MST1_ENST00000545762.1_3'UTR	NM_022064.3	NP_071347.2	Q5XPI4	RN123_HUMAN	ring finger protein 123						protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.W250*(1)		NS(1)|breast(4)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		TAGTGTAGCACCATGGCCGCT	0.642																																						.											1	Substitution - Nonsense(1)	endometrium(1)											6.0	7.0	7.0					3																	49724172		2129	4208	6337	SO:0001631	upstream_gene_variant	4485			AK022627	CCDS33758.1	3p24.3	2008-02-05			ENSG00000164068	ENSG00000164068		"""RING-type (C3HC4) zinc fingers"""	21148	protein-coding gene	gene with protein product		614472					Standard	NM_022064		Approved	FLJ12565	uc003cxh.4	Q5XPI4	OTTHUMG00000156891		3.37:g.49724172C>T	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_I	A1L4Q3|A6NLS5|Q5I022|Q6PFW4|Q71RH0|Q8IW18|Q9H0M8|Q9H5L8|Q9H9T2	Nonsense_Mutation	SNP	ENST00000327697.6	37	CCDS33758.1	.	.	.	.	.	.	.	.	.	.	C	39	7.839035	0.98519	.	.	ENSG00000173531	ENST00000449682;ENST00000383728	.	.	.	5.75	5.75	0.90469	.	0.265808	0.20896	N	0.083726	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.9522	0.97203	0.0:1.0:0.0:0.0	rs41291698	.	.	.	X	264;189	.	ENSP00000373234:W189X	W	-	3	0	MST1	49699176	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	7.550000	0.82173	2.725000	0.93324	0.655000	0.94253	TGG		0.642	RNF123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346475.2	NM_022064	
MUC16	94025	mdanderson.org	37	19	9025604	9025604	+	Silent	SNP	A	A	G	rs200791776		TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr19:9025604A>G	ENST00000397910.4	-	15	37053	c.36850T>C	c.(36850-36852)Ttg>Ctg	p.L12284L		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	12286	SEA 2. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGCAAGGTCAATCTGCAGCCA	0.522																																						.											0													115.0	104.0	108.0					19																	9025604		1962	4161	6123	SO:0001819	synonymous_variant	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.36850T>C	19.37:g.9025604A>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	CCDS54212.1																																																																																				0.522	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MUC4	4585	mdanderson.org	37	3	195508997	195508997	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr3:195508997G>A	ENST00000463781.3	-	2	9913	c.9454C>T	c.(9454-9456)Cct>Tct	p.P3152S	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.P3152S|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACAGGAAGAGGGGTGGTGTCA	0.592																																						.											0													7.0	5.0	5.0					3																	195508997		606	1448	2054	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9454C>T	3.37:g.195508997G>A	ENSP00000417498:p.Pro3152Ser	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	7.243	0.601604	0.13939	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.27402	1.68;1.67	.	.	.	.	.	.	.	.	T	0.15176	0.0366	N	0.19112	0.55	0.09310	N	1	P	0.47604	0.898	B	0.37550	0.253	T	0.15150	-1.0447	7	.	.	.	.	6.8901	0.24224	1.0E-4:0.0:0.9999:0.0	.	3024	E7ESK3	.	S	3152	ENSP00000417498:P3152S;ENSP00000420243:P3152S	.	P	-	1	0	MUC4	196993776	0.000000	0.05858	0.057000	0.19452	0.057000	0.15508	-1.730000	0.01855	0.073000	0.16731	0.074000	0.15403	CCT		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195510121	195510121	+	Missense_Mutation	SNP	A	A	G	rs444825	byFrequency	TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr3:195510121A>G	ENST00000463781.3	-	2	8789	c.8330T>C	c.(8329-8331)gTa>gCa	p.V2777A	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.V2777A|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACCTGTGGATACTGAGGAAGT	0.582													.|||	247	0.0493211	0.0923	0.013	5008	,	,		5929	0.0427		0.0258	False		,,,				2504	0.0481					.											0													45.0	27.0	33.0					3																	195510121		684	1545	2229	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8330T>C	3.37:g.195510121A>G	ENSP00000417498:p.Val2777Ala	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	0.635	-0.815532	0.02776	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.33654	1.4;1.4	1.02	-2.03	0.07365	.	.	.	.	.	T	0.13500	0.0327	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.24941	-1.0146	8	.	.	.	.	2.031	0.03529	0.4943:0.0:0.2439:0.2618	.	2649	E7ESK3	.	A	2777	ENSP00000417498:V2777A;ENSP00000420243:V2777A	.	V	-	2	0	MUC4	196994900	.	.	0.007000	0.13788	0.026000	0.11368	.	.	-0.419000	0.07439	0.063000	0.15292	GTA		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195510133	195510133	+	Missense_Mutation	SNP	T	T	C	rs371587475		TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr3:195510133T>C	ENST00000463781.3	-	2	8777	c.8318A>G	c.(8317-8319)aAc>aGc	p.N2773S	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.N2773S|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.N2773S(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGAGGAAGTGTTGGTGACAGG	0.582																																						.											1	Substitution - Missense(1)	kidney(1)											42.0	25.0	30.0					3																	195510133		688	1543	2231	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8318A>G	3.37:g.195510133T>C	ENSP00000417498:p.Asn2773Ser	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	0.344	-0.948616	0.02304	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.32753	1.5;1.44	1.02	-1.52	0.08637	.	.	.	.	.	T	0.10465	0.0256	N	0.03608	-0.345	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.32929	-0.9888	8	.	.	.	.	4.3758	0.11270	0.0:0.4779:0.0:0.5221	.	2645	E7ESK3	.	S	2773	ENSP00000417498:N2773S;ENSP00000420243:N2773S	.	N	-	2	0	MUC4	196994912	0.000000	0.05858	0.002000	0.10522	0.016000	0.09150	-4.761000	0.00189	-0.419000	0.07439	0.063000	0.15292	AAC		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195510146	195510146	+	Missense_Mutation	SNP	G	G	C	rs199750921		TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr3:195510146G>C	ENST00000463781.3	-	2	8764	c.8305C>G	c.(8305-8307)Ctt>Gtt	p.L2769V	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.L2769V|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.L2769V(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTGACAGGAAGAGGGGTGGCG	0.577																																						.											1	Substitution - Missense(1)	kidney(1)											35.0	21.0	25.0					3																	195510146		686	1538	2224	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8305C>G	3.37:g.195510146G>C	ENSP00000417498:p.Leu2769Val	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	2.836	-0.241610	0.05906	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.38722	1.12;1.16	1.02	-1.7	0.08159	.	.	.	.	.	T	0.20007	0.0481	N	0.19112	0.55	0.09310	N	1	B	0.24426	0.103	B	0.20384	0.029	T	0.19160	-1.0314	8	.	.	.	.	1.6641	0.02798	0.4545:0.0:0.2536:0.2919	.	2641	E7ESK3	.	V	2769	ENSP00000417498:L2769V;ENSP00000420243:L2769V	.	L	-	1	0	MUC4	196994925	0.000000	0.05858	0.002000	0.10522	0.103000	0.19146	-1.498000	0.02287	-0.413000	0.07507	0.074000	0.15403	CTT		0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195511093	195511093	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr3:195511093C>T	ENST00000463781.3	-	2	7817	c.7358G>A	c.(7357-7359)aGc>aAc	p.S2453N	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.S2453N|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGAGGAAGTGCTGGTGACAGG	0.587																																						.											0																																										SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.7358G>A	3.37:g.195511093C>T	ENSP00000417498:p.Ser2453Asn	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	T	8.058	0.767416	0.15983	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.30448	1.54;1.53	1.04	-1.45	0.08828	.	.	.	.	.	T	0.08537	0.0212	N	0.08118	0	0.09310	N	1	P	0.42993	0.797	B	0.25759	0.063	T	0.23013	-1.0200	8	.	.	.	.	2.8143	0.05451	0.3013:0.3987:0.3:0.0	.	2453	E7ESK3	.	N	2453	ENSP00000417498:S2453N;ENSP00000420243:S2453N	.	S	-	2	0	MUC4	196995488	.	.	0.028000	0.17463	0.000000	0.00434	.	.	0.614000	0.30107	0.000000	0.15137	AGC		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195511283	195511283	+	Missense_Mutation	SNP	C	C	G			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr3:195511283C>G	ENST00000463781.3	-	2	7627	c.7168G>C	c.(7168-7170)Gct>Cct	p.A2390P	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.A2390P|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.A2390T(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GCTGAGGAAGCGTCGGTGACA	0.592																																						.											2	Substitution - Missense(2)	kidney(2)											28.0	31.0	30.0					3																	195511283		681	1586	2267	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.7168G>C	3.37:g.195511283C>G	ENSP00000417498:p.Ala2390Pro	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	C	4.430	0.079589	0.08533	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.33438	1.47;1.41	.	.	.	.	.	.	.	.	T	0.11537	0.0281	N	0.08118	0	0.09310	N	1	B	0.31581	0.329	B	0.28784	0.094	T	0.26677	-1.0096	7	.	.	.	.	4.7077	0.12858	0.3536:0.6463:0.0:1.0E-4	.	2390	E7ESK3	.	P	2390	ENSP00000417498:A2390P;ENSP00000420243:A2390P	.	A	-	1	0	MUC4	196995678	0.000000	0.05858	0.001000	0.08648	0.060000	0.15804	-3.000000	0.00653	-0.833000	0.04245	0.064000	0.15345	GCT		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
NBPF1	55672	mdanderson.org	37	1	16907914	16907914	+	Splice_Site	SNP	C	C	T			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr1:16907914C>T	ENST00000430580.2	-	15	2267		c.e15+1		NBPF1_ENST00000432949.1_5'Flank	NM_017940.3	NP_060410.2	Q3BBV0	NBPF1_HUMAN	neuroblastoma breakpoint family, member 1							cytoplasm (GO:0005737)									UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		TTCAGTGTTACCTGGGGGCAG	0.438																																						.											0													255.0	285.0	274.0					1																	16907914		1493	2696	4189	SO:0001630	splice_region_variant	55672			AB051480		1p36.13	2013-01-30			ENSG00000219481	ENSG00000219481		"""neuroblastoma breakpoint family"""	26088	protein-coding gene	gene with protein product		610501				11214970, 16079250	Standard	NM_017940		Approved	FLJ20719, KIAA1693	uc001ayw.4	Q3BBV0	OTTHUMG00000002487	ENST00000430580.2:c.1379+1G>A	1.37:g.16907914C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q8N4E8|Q9C0H0	Splice_Site	SNP	ENST00000430580.2	37																																																																																					0.438	NBPF1-005	NOVEL	upstream_uORF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000106436.3	NM_017940	Intron
NUP50	10762	mdanderson.org	37	22	45574426	45574426	+	Silent	SNP	A	A	G	rs199713755	byFrequency	TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr22:45574426A>G	ENST00000347635.4	+	5	1114	c.648A>G	c.(646-648)gcA>gcG	p.A216A	NUP50_ENST00000425733.2_5'UTR|CTA-268H5.12_ENST00000610217.1_RNA|NUP50_ENST00000407019.2_Silent_p.A188A|NUP50_ENST00000396096.2_Silent_p.A188A	NM_007172.3	NP_009103.2	Q9UKX7	NUP50_HUMAN	nucleoporin 50kDa	216	5 X 2 AA repeats of F-G.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|intracellular transport (GO:0046907)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	9		Ovarian(80;0.00965)|all_neural(38;0.0244)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)		ACAAAGTGGCAGCTGAAACAC	0.388																																						.											0													51.0	52.0	51.0					22																	45574426		2202	4300	6502	SO:0001819	synonymous_variant	10762			AF107840	CCDS14062.1, CCDS14063.1	22q13.3	2007-01-22	2002-08-29		ENSG00000093000	ENSG00000093000			8065	protein-coding gene	gene with protein product		604646	"""nucleoporin 50kD"""	NPAP60L		10449902	Standard	XM_005261312		Approved		uc003bfr.3	Q9UKX7	OTTHUMG00000151265	ENST00000347635.4:c.648A>G	22.37:g.45574426A>G		Somatic		WXS	Illumina HiSeq	Phase_I	B1AHA4|B2RB15|O75644|Q8N6V5|Q9NPM9|Q9NPR6|Q9P1K5	Silent	SNP	ENST00000347635.4	37	CCDS14062.1																																																																																				0.388	NUP50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321993.2		
OR10H2	26538	mdanderson.org	37	19	15839047	15839047	+	Missense_Mutation	SNP	T	T	C	rs201424847	byFrequency	TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr19:15839047T>C	ENST00000305899.3	+	1	214	c.194T>C	c.(193-195)gTc>gCc	p.V65A		NM_013939.2	NP_039227.1	O60403	O10H2_HUMAN	olfactory receptor, family 10, subfamily H, member 2	65						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|skin(3)|stomach(1)	27	all_hematologic(1;0.0517)|Acute lymphoblastic leukemia(2;0.074)					TTCCTGTGCGTCCTCTCAGTC	0.637																																						.											0													234.0	188.0	204.0					19																	15839047		2203	4300	6503	SO:0001583	missense	26538			AC004597	CCDS12333.1	19p13.1	2012-08-09				ENSG00000171942		"""GPCR / Class A : Olfactory receptors"""	8173	protein-coding gene	gene with protein product							Standard	NM_013939		Approved		uc002nbm.2	O60403		ENST00000305899.3:c.194T>C	19.37:g.15839047T>C	ENSP00000306095:p.Val65Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q6IFQ1|Q96R58	Missense_Mutation	SNP	ENST00000305899.3	37	CCDS12333.1	.	.	.	.	.	.	.	.	.	.	.	0.151	-1.091346	0.01858	.	.	ENSG00000171942	ENST00000305899	T	0.02890	4.12	3.4	2.24	0.28232	GPCR, rhodopsin-like superfamily (1);	0.275578	0.25848	N	0.027919	T	0.01695	0.0054	N	0.17474	0.49	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.49062	-0.8978	10	0.15499	T	0.54	.	5.1985	0.15250	0.2013:0.6781:0.0:0.1206	.	65	O60403	O10H2_HUMAN	A	65	ENSP00000306095:V65A	ENSP00000306095:V65A	V	+	2	0	OR10H2	15700047	0.000000	0.05858	0.937000	0.37676	0.644000	0.38419	0.494000	0.22467	0.427000	0.26145	-0.254000	0.11334	GTC		0.637	OR10H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460917.1		
OR52M1	119772	mdanderson.org	37	11	4566711	4566711	+	Silent	SNP	C	C	T	rs2709182	byFrequency	TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr11:4566711C>T	ENST00000360213.1	+	1	291	c.291C>T	c.(289-291)gaC>gaT	p.D97D		NM_001004137.1	NP_001004137.1	Q8NGK5	O52M1_HUMAN	olfactory receptor, family 52, subfamily M, member 1	97						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(2)|lung(9)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	18		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;8.45e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		TTGGCCTGGACGCCTGCTTGG	0.512													T|||	2190	0.4373	0.5174	0.3444	5008	,	,		21627	0.2639		0.492	False		,,,				2504	0.5174					.											0								T		2223,2179	585.3+/-386.2	556,1111,534	164.0	148.0	153.0		291	4.7	1.0	11	dbSNP_100	153	4454,4142	565.0+/-388.4	1154,2146,998	no	coding-synonymous	OR52M1	NM_001004137.1		1710,3257,1532	TT,TC,CC		48.1852,49.5002,48.6306		97/318	4566711	6677,6321	2201	4298	6499	SO:0001819	synonymous_variant	119772			AB065789	CCDS31353.1	11p15.4	2012-08-09	2002-11-13	2002-11-15	ENSG00000197790	ENSG00000197790		"""GPCR / Class A : Olfactory receptors"""	15225	protein-coding gene	gene with protein product			"""olfactory receptor, family 52, subfamily M, member 1 pseudogene"""	OR52M1P			Standard	NM_001004137		Approved		uc010qyf.2	Q8NGK5	OTTHUMG00000165706	ENST00000360213.1:c.291C>T	11.37:g.4566711C>T		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000360213.1	37	CCDS31353.1																																																																																				0.512	OR52M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385847.1	NM_001004137	
PASK	23178	mdanderson.org	37	2	242080064	242080064	+	Missense_Mutation	SNP	G	G	T			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr2:242080064G>T	ENST00000405260.1	-	3	999	c.301C>A	c.(301-303)Ccg>Acg	p.P101T	PASK_ENST00000539818.1_Intron|PASK_ENST00000234040.4_Missense_Mutation_p.P101T|PASK_ENST00000403638.3_Missense_Mutation_p.P101T|PASK_ENST00000358649.4_Missense_Mutation_p.P101T|PASK_ENST00000544142.1_Intron	NM_001252120.1	NP_001239049.1	Q96RG2	PASK_HUMAN	PAS domain containing serine/threonine kinase	101					negative regulation of glycogen biosynthetic process (GO:0045719)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of energy homeostasis (GO:2000505)|regulation of glucagon secretion (GO:0070092)|regulation of respiratory gaseous exchange (GO:0043576)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(20)|ovary(4)|prostate(4)|skin(1)|stomach(1)|urinary_tract(2)	53		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.34e-31)|all cancers(36;1e-28)|OV - Ovarian serous cystadenocarcinoma(60;3.53e-14)|Kidney(56;4.31e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.35e-08)|BRCA - Breast invasive adenocarcinoma(100;5.64e-06)|Lung(119;0.000596)|LUSC - Lung squamous cell carcinoma(224;0.00481)|Colorectal(34;0.014)|COAD - Colon adenocarcinoma(134;0.0968)		CTGCCCCGCGGTTCGGACGGG	0.597																																						.											0													74.0	71.0	72.0					2																	242080064		2203	4300	6503	SO:0001583	missense	23178			U79240	CCDS2545.1, CCDS58758.1, CCDS58759.1	2q37.3	2008-05-23			ENSG00000115687	ENSG00000115687			17270	protein-coding gene	gene with protein product		607505				11688972, 11459942, 15148392	Standard	NM_001252119		Approved	PASKIN, KIAA0135, STK37	uc010fzl.2	Q96RG2	OTTHUMG00000133392	ENST00000405260.1:c.301C>A	2.37:g.242080064G>T	ENSP00000384016:p.Pro101Thr	Somatic		WXS	Illumina HiSeq	Phase_I	G5E9F1|Q05BE4|Q68DY3|Q6GSJ5|Q86XH6|Q99763|Q9UFR7	Missense_Mutation	SNP	ENST00000405260.1	37	CCDS2545.1	.	.	.	.	.	.	.	.	.	.	G	0.841	-0.741927	0.03088	.	.	ENSG00000115687	ENST00000234040;ENST00000405260;ENST00000358649;ENST00000403638;ENST00000452907	T;T;T;T	0.66995	-0.24;-0.24;-0.19;0.76	4.67	-0.193	0.13244	.	0.522234	0.17487	N	0.172473	T	0.45155	0.1328	L	0.40543	1.245	0.18873	N	0.999988	B;B;P;B	0.38078	0.146;0.228;0.617;0.146	B;B;B;B	0.30855	0.057;0.083;0.121;0.057	T	0.43048	-0.9415	10	0.07325	T	0.83	.	9.3561	0.38168	0.8464:0.0:0.1536:0.0	.	101;101;101;101	B7Z7R6;Q96RG2-2;G5E9F1;Q96RG2	.;.;.;PASK_HUMAN	T	101	ENSP00000234040:P101T;ENSP00000384016:P101T;ENSP00000351475:P101T;ENSP00000384438:P101T	ENSP00000234040:P101T	P	-	1	0	PASK	241728737	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.569000	0.23638	-0.212000	0.10109	-0.258000	0.10820	CCG		0.597	PASK-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000323753.1	NM_015148	
BCRP4	616	mdanderson.org	37	22	22977582	22977582	+	IGR	SNP	T	T	C	rs4050718	byFrequency	TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr22:22977582T>C								IGLV3-32 (40081 upstream) : POM121L1P (4065 downstream)																							GACTCTAGCATGGCACAGCCC	0.607													.|||	1067	0.213059	0.2905	0.2651	5008	,	,		7284	0.1369		0.1004	False		,,,				2504	0.2658					.											0																																										SO:0001628	intergenic_variant	25812																															22.37:g.22977582T>C		Somatic		WXS	Illumina HiSeq	Phase_I		RNA	SNP		37																																																																																				0	0.607								
POTEF	728378	mdanderson.org	37	2	130872871	130872871	+	Silent	SNP	C	C	T	rs199770435		TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr2:130872871C>T	ENST00000409914.2	-	4	951	c.552G>A	c.(550-552)ggG>ggA	p.G184G	POTEF_ENST00000357462.5_Silent_p.G184G|POTEF_ENST00000361163.4_Silent_p.G184G|POTEF_ENST00000360967.5_Silent_p.G184G	NM_001099771.2	NP_001093241.1	A5A3E0	POTEF_HUMAN	POTE ankyrin domain family, member F	184					retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.G184G(2)		breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(28)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	53						CTTCTGAATTCCCATTGGCAG	0.423																																						.											2	Substitution - coding silent(2)	prostate(2)											45.0	53.0	50.0					2																	130872871		2105	4041	6146	SO:0001819	synonymous_variant	728378			EF523384	CCDS46409.1	2q21.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000196604	ENSG00000196604		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33905	protein-coding gene	gene with protein product			"""ANKRD26-like family C, member 1B"""	A26C1B		17101985	Standard	NM_001099771		Approved	POTEACTIN, POTE2alpha	uc010fmh.2	A5A3E0	OTTHUMG00000153628	ENST00000409914.2:c.552G>A	2.37:g.130872871C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A6NC34	Silent	SNP	ENST00000409914.2	37	CCDS46409.1																																																																																				0.423	POTEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331889.2	NM_001099771	
RBMXL1	494115	mdanderson.org	37	1	89449237	89449237	+	Missense_Mutation	SNP	T	T	A	rs200727134		TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr1:89449237T>A	ENST00000321792.5	-	2	700	c.273A>T	c.(271-273)agA>agT	p.R91S	CCBL2_ENST00000260508.4_Intron|CCBL2_ENST00000446900.2_Intron|CCBL2_ENST00000370491.3_Intron|CCBL2_ENST00000370485.2_Intron|RBMXL1_ENST00000399794.2_Missense_Mutation_p.R91S|RBMXL1_ENST00000413769.1_5'UTR	NM_019610.5	NP_062556.2	Q96E39	RMXL1_HUMAN	RNA binding motif protein, X-linked-like 1	91					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)										CATGTCTACCTCTTTCAAATG	0.522											OREG0013593	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										.											0													103.0	106.0	105.0					1																	89449237		2203	4300	6503	SO:0001583	missense	494115			BC012942	CCDS716.1	1p22.2	2013-02-12	2007-01-04	2007-01-04	ENSG00000213516	ENSG00000213516		"""RNA binding motif (RRM) containing"""	25073	protein-coding gene	gene with protein product	"""kynurenine aminotransferase III"""					10441733	Standard	NM_019610		Approved	KAT3	uc001dms.3	Q96E39	OTTHUMG00000010661	ENST00000321792.5:c.273A>T	1.37:g.89449237T>A	ENSP00000318415:p.Arg91Ser	Somatic	1267	WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000321792.5	37	CCDS716.1	.	.	.	.	.	.	.	.	.	.	T	0.418	-0.909529	0.02434	.	.	ENSG00000213516	ENST00000321792;ENST00000399794	T;T	0.74315	-0.83;-0.83	1.59	-1.88	0.07713	Nucleotide-binding, alpha-beta plait (1);	0.103071	0.64402	N	0.000004	T	0.12518	0.0304	N	0.02412	-0.56	0.24373	N	0.994823	B	0.02656	0.0	B	0.01281	0.0	T	0.33394	-0.9870	10	0.02654	T	1	-5.4219	1.5207	0.02515	0.4483:0.0:0.2296:0.322	.	91	Q96E39	RBMXL_HUMAN	S	91	ENSP00000318415:R91S;ENSP00000446099:R91S	ENSP00000318415:R91S	R	-	3	2	RBMXL1	89221825	0.996000	0.38824	0.677000	0.29947	0.326000	0.28443	0.395000	0.20850	-0.106000	0.12110	-1.038000	0.02383	AGA		0.522	RBMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029403.3	NM_019610	
SF1	7536	mdanderson.org	37	11	64533401	64533401	+	Silent	SNP	A	A	C			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr11:64533401A>C	ENST00000377390.3	-	13	2146	c.1809T>G	c.(1807-1809)ccT>ccG	p.P603P	SF1_ENST00000433274.2_Silent_p.P577P|SF1_ENST00000422298.2_Intron|SF1_ENST00000489544.1_5'Flank|SF1_ENST00000227503.9_Intron|SF1_ENST00000377394.3_Intron|SF1_ENST00000334944.5_Intron|SF1_ENST00000377387.1_Intron	NM_004630.3	NP_004621.2	Q15637	SF01_HUMAN	splicing factor 1	603	Pro-rich.				Leydig cell differentiation (GO:0033327)|male sex determination (GO:0030238)|mRNA 3'-splice site recognition (GO:0000389)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of smooth muscle cell proliferation (GO:0048662)|regulation of steroid biosynthetic process (GO:0050810)|regulation of transcription, DNA-templated (GO:0006355)|spliceosomal complex assembly (GO:0000245)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|ribosome (GO:0005840)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(12)|ovary(2)|skin(2)	31						TGGGAGGCGGAGGAGGAGGGG	0.726																																						.											0													8.0	8.0	8.0					11																	64533401		2124	4172	6296	SO:0001819	synonymous_variant	7536			D26120	CCDS8080.1, CCDS8081.1, CCDS31599.1, CCDS44642.1, CCDS44642.2, CCDS53660.1, CCDS53661.1	11q13	2014-09-17	2001-12-19	2002-01-11	ENSG00000168066	ENSG00000168066		"""Zinc fingers, CCHC domain containing"""	12950	protein-coding gene	gene with protein product		601516	"""zinc finger protein 162"""	ZNF162		7912130, 9573336	Standard	NM_201997		Approved	ZFM1, ZCCHC25	uc001oaz.2	Q15637	OTTHUMG00000066833	ENST00000377390.3:c.1809T>G	11.37:g.64533401A>C		Somatic		WXS	Illumina HiSeq	Phase_I	B7Z1Q1|C9JJE2|Q14818|Q14819|Q15913|Q8IY00|Q92744|Q92745|Q969H7|Q9BW01|Q9UEI0	Silent	SNP	ENST00000377390.3	37	CCDS31599.1	.	.	.	.	.	.	.	.	.	.	A	7.114	0.576643	0.13686	.	.	ENSG00000168066	ENST00000413725	.	.	.	4.73	0.919	0.19392	.	.	.	.	.	T	0.42607	0.1210	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.20107	-1.0285	4	.	.	.	.	1.9493	0.03363	0.4292:0.3236:0.0907:0.1565	.	.	.	.	R	173	.	.	L	-	2	0	SF1	64289977	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	1.067000	0.30616	-0.091000	0.12440	0.454000	0.30748	CTC		0.726	SF1-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000143242.1	NM_004630	
THSD4	79875	mdanderson.org	37	15	72040774	72040774	+	Silent	SNP	C	C	T	rs1872056	byFrequency	TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr15:72040774C>T	ENST00000355327.3	+	14	2390	c.2256C>T	c.(2254-2256)tgC>tgT	p.C752C	THSD4_ENST00000357769.4_Silent_p.C392C|THSD4_ENST00000567838.1_3'UTR|THSD4_ENST00000261862.6_Silent_p.C752C			Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4	752	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				elastic fiber assembly (GO:0048251)	extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)	metalloendopeptidase activity (GO:0004222)			breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(20)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						CGGTGCCCTGCGGCGTGGGAC	0.562													C|||	998	0.199281	0.3086	0.147	5008	,	,		19695	0.0823		0.2644	False		,,,				2504	0.1421					.											0								C		1281,3079		190,901,1089	121.0	135.0	130.0		2256	-8.4	0.6	15	dbSNP_92	130	2145,6401		312,1521,2440	no	coding-synonymous	THSD4	NM_024817.2		502,2422,3529	TT,TC,CC		25.0995,29.3807,26.5458		752/1019	72040774	3426,9480	2180	4273	6453	SO:0001819	synonymous_variant	79875			AK023772	CCDS10238.2, CCDS66817.1	15q23	2009-11-09			ENSG00000187720	ENSG00000187720			25835	protein-coding gene	gene with protein product		614476				19734141	Standard	NM_001286429		Approved	FVSY9334, PRO34005, FLJ13710, ADAMTSL6	uc002atb.1	Q6ZMP0	OTTHUMG00000133389	ENST00000355327.3:c.2256C>T	15.37:g.72040774C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B2RTY3|B4DR13|Q6MZI3|Q6UXZ8|Q9H8E4	Silent	SNP	ENST00000355327.3	37	CCDS10238.2																																																																																				0.562	THSD4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257253.2	NM_024817	
TUBA3C	7278	mdanderson.org	37	13	19751292	19751292	+	Silent	SNP	T	T	C	rs147482964	byFrequency	TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr13:19751292T>C	ENST00000400113.3	-	4	935	c.831A>G	c.(829-831)tcA>tcG	p.S277S		NM_006001.2	NP_005992.1	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	277					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(4)|prostate(7)|skin(7)|urinary_tract(1)	72		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		CCTTCTCGGCTGAGATGACCG	0.612																																						.											0													131.0	119.0	123.0					13																	19751292		2203	4300	6503	SO:0001819	synonymous_variant	7278			AF005392	CCDS9284.1	13q12.11	2007-06-20	2007-02-12	2007-02-12	ENSG00000198033	ENSG00000198033		"""Tubulins"""	12408	protein-coding gene	gene with protein product		602528	"""tubulin, alpha 2"""	TUBA2		9465305	Standard	NM_006001		Approved	bA408E5.3	uc009zzj.3	Q13748	OTTHUMG00000016481	ENST00000400113.3:c.831A>G	13.37:g.19751292T>C		Somatic		WXS	Illumina HiSeq	Phase_I	A6NJQ0|Q5W099|Q6PEY3|Q96F18	Silent	SNP	ENST00000400113.3	37	CCDS9284.1																																																																																				0.612	TUBA3C-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044007.2	NM_006001	
TUBA3C	7278	mdanderson.org	37	13	19751301	19751301	+	Silent	SNP	C	C	T	rs140548354		TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr13:19751301C>T	ENST00000400113.3	-	4	926	c.822G>A	c.(820-822)ccG>ccA	p.P274P		NM_006001.2	NP_005992.1	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	274					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(4)|prostate(7)|skin(7)|urinary_tract(1)	72		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		CTGAGATGACCGGGGCGTAGG	0.607																																						.											0													123.0	114.0	117.0					13																	19751301		2203	4300	6503	SO:0001819	synonymous_variant	7278			AF005392	CCDS9284.1	13q12.11	2007-06-20	2007-02-12	2007-02-12	ENSG00000198033	ENSG00000198033		"""Tubulins"""	12408	protein-coding gene	gene with protein product		602528	"""tubulin, alpha 2"""	TUBA2		9465305	Standard	NM_006001		Approved	bA408E5.3	uc009zzj.3	Q13748	OTTHUMG00000016481	ENST00000400113.3:c.822G>A	13.37:g.19751301C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A6NJQ0|Q5W099|Q6PEY3|Q96F18	Silent	SNP	ENST00000400113.3	37	CCDS9284.1																																																																																				0.607	TUBA3C-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044007.2	NM_006001	
USP32	84669	mdanderson.org	37	17	58292024	58292024	+	Missense_Mutation	SNP	C	C	T	rs571048538	byFrequency	TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr17:58292024C>T	ENST00000300896.4	-	17	2173	c.1979G>A	c.(1978-1980)cGc>cAc	p.R660H	USP32_ENST00000592339.1_Missense_Mutation_p.R330H	NM_032582.3	NP_115971.2	Q8NFA0	UBP32_HUMAN	ubiquitin specific peptidase 32	660					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			NS(3)|breast(5)|endometrium(5)|kidney(4)|large_intestine(12)|liver(1)|lung(24)|pancreas(1)|prostate(3)|skin(3)|urinary_tract(1)	62	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;2.02e-11)|all cancers(12;5.23e-10)|Colorectal(3;0.198)			CTCTTTAATGCGCAGCCTTTG	0.408													C|||	3	0.000599042	0.0023	0.0	5008	,	,		19451	0.0		0.0	False		,,,				2504	0.0					.											0													41.0	38.0	39.0					17																	58292024		2201	4295	6496	SO:0001583	missense	84669			AF533230	CCDS32697.1	17q23.3	2013-01-10	2005-08-08		ENSG00000170832	ENSG00000170832		"""Ubiquitin-specific peptidases"", ""EF-hand domain containing"""	19143	protein-coding gene	gene with protein product		607740	"""ubiquitin specific protease 32"""			12838346	Standard	NM_032582		Approved	NY-REN-60, USP10	uc002iyo.1	Q8NFA0		ENST00000300896.4:c.1979G>A	17.37:g.58292024C>T	ENSP00000300896:p.Arg660His	Somatic		WXS	Illumina HiSeq	Phase_I	Q7Z5T3|Q9BX85|Q9Y591	Missense_Mutation	SNP	ENST00000300896.4	37	CCDS32697.1	.	.	.	.	.	.	.	.	.	.	C	35	5.530108	0.96446	.	.	ENSG00000170832	ENST00000300896	T	0.50001	0.76	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.46073	0.1374	L	0.48642	1.525	0.80722	D	1	P	0.50617	0.937	B	0.41440	0.357	T	0.49113	-0.8973	10	0.49607	T	0.09	.	19.155	0.93506	0.0:1.0:0.0:0.0	.	660	Q8NFA0	UBP32_HUMAN	H	660	ENSP00000300896:R660H	ENSP00000300896:R660H	R	-	2	0	USP32	55646806	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.717000	0.84732	2.539000	0.85634	0.650000	0.86243	CGC		0.408	USP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449235.2	NM_032582	
YBX1	4904	mdanderson.org	37	1	43166630	43166630	+	Missense_Mutation	SNP	G	G	A	rs200741644		TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr1:43166630G>A	ENST00000321358.7	+	7	1058	c.919G>A	c.(919-921)Gat>Aat	p.D307N		NM_004559.3	NP_004550.2	P67809	YBOX1_HUMAN	Y box binding protein 1	307					CRD-mediated mRNA stabilization (GO:0070934)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of striated muscle cell differentiation (GO:0051154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell division (GO:0051781)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|histone pre-mRNA 3'end processing complex (GO:0071204)|intracellular membrane-bounded organelle (GO:0043231)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|U12-type spliceosomal complex (GO:0005689)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)	p.D307N(1)		large_intestine(2)|lung(4)|ovary(4)|prostate(4)|upper_aerodigestive_tract(2)	16	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				AAAAGCAGCCGATCCACCAGC	0.562																																						.											1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											56.0	58.0	57.0					1																	43166630		2203	4299	6502	SO:0001583	missense	4904			BC013838	CCDS470.1	1p34	2008-02-05	2005-08-11	2005-08-11	ENSG00000065978	ENSG00000065978			8014	protein-coding gene	gene with protein product		154030	"""nuclease sensitive element binding protein 1"""	NSEP1		1891370, 3174636	Standard	NM_004559		Approved	YB-1, YB1, DBPB, NSEP-1, MDR-NF1, BP-8, CSDB, CSDA2	uc001chs.3	P67809	OTTHUMG00000007523	ENST00000321358.7:c.919G>A	1.37:g.43166630G>A	ENSP00000361626:p.Asp307Asn	Somatic		WXS	Illumina HiSeq	Phase_I	P16990|P16991|Q14972|Q15325|Q5FVF0	Missense_Mutation	SNP	ENST00000321358.7	37	CCDS470.1	.	.	.	.	.	.	.	.	.	.	G	18.97	3.735579	0.69189	.	.	ENSG00000065978	ENST00000321358;ENST00000318612	T	0.31510	1.49	5.39	5.39	0.77823	.	0.236880	0.49916	N	0.000136	T	0.22044	0.0531	N	0.17379	0.485	0.54753	D	0.999989	B	0.25312	0.123	B	0.15052	0.012	T	0.04078	-1.0979	10	0.62326	D	0.03	-3.4519	16.6483	0.85182	0.0:0.0:1.0:0.0	.	307	P67809	YBOX1_HUMAN	N	307;297	ENSP00000361626:D307N	ENSP00000361621:D297N	D	+	1	0	YBX1	42939217	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.018000	0.93657	2.505000	0.84491	0.557000	0.71058	GAT		0.562	YBX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019786.2	NM_004559	
ZNF418	147686	mdanderson.org	37	19	58439306	58439306	+	Silent	SNP	G	G	A	rs7253514	byFrequency	TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr19:58439306G>A	ENST00000396147.1	-	4	534	c.243C>T	c.(241-243)gcC>gcT	p.A81A	ZNF418_ENST00000599086.1_5'Flank|ZNF418_ENST00000600989.1_Intron|ZNF418_ENST00000595830.1_Silent_p.A81A|ZNF418_ENST00000599852.1_5'UTR|ZNF418_ENST00000425570.3_Silent_p.A102A	NM_133460.1	NP_597717.1	Q8TF45	ZN418_HUMAN	zinc finger protein 418	81	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	31		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0158)		CACAAGAGTGGGCCTTCTTGG	0.507													G|||	1448	0.289137	0.2595	0.3573	5008	,	,		18775	0.4048		0.2545	False		,,,				2504	0.1973					.											0								G		1066,3340		131,804,1268	62.0	66.0	64.0		243	-1.5	0.0	19	dbSNP_116	64	2219,6381		293,1633,2374	no	coding-synonymous	ZNF418	NM_133460.1		424,2437,3642	AA,AG,GG		25.8023,24.1943,25.2576		81/677	58439306	3285,9721	2203	4300	6503	SO:0001819	synonymous_variant	147686			AB075836, AY695825	CCDS42642.1	19q13.43	2013-01-08				ENSG00000196724		"""Zinc fingers, C2H2-type"", ""-"""	20647	protein-coding gene	gene with protein product						11853319	Standard	NM_133460		Approved	KIAA1956, FLJ31551	uc002qqs.1	Q8TF45		ENST00000396147.1:c.243C>T	19.37:g.58439306G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q2M1S2|Q670L5|Q96N18	Silent	SNP	ENST00000396147.1	37	CCDS42642.1																																																																																				0.507	ZNF418-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466693.1	NM_133460	
OVGP1	5016	bcgsc.ca	37	1	111957517	111957517	+	Missense_Mutation	SNP	T	T	C	rs3767609|rs201350653|rs549398942	byFrequency	TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr1:111957517T>C	ENST00000369732.3	-	11	1661	c.1606A>G	c.(1606-1608)Agt>Ggt	p.S536G		NM_002557.3	NP_002548.3	Q12889	OVGP1_HUMAN	oviductal glycoprotein 1, 120kDa	536			S -> G (in dbSNP:rs3767609).		binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|chitin catabolic process (GO:0006032)|female pregnancy (GO:0007565)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|single fertilization (GO:0007338)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|egg coat (GO:0035805)|perivitelline space (GO:0098595)	chitinase activity (GO:0004568)	p.T597_V604delTPVSHQSV(2)|p.T533_V540delTPVSHQSV(2)		NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	39		all_cancers(81;8.18e-06)|all_epithelial(167;5.64e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000302)		Lung(183;0.0253)|Colorectal(144;0.033)|all cancers(265;0.0552)|Epithelial(280;0.0802)|COAD - Colon adenocarcinoma(174;0.123)|LUSC - Lung squamous cell carcinoma(189;0.14)		GACTGATGACTCACAGGGGTC	0.547													T|||	1503	0.30012	0.4092	0.2291	5008	,	,		16183	0.2044		0.2972	False		,,,				2504	0.3047					.											4	Deletion - In frame(4)	haematopoietic_and_lymphoid_tissue(2)|stomach(2)						T	GLY/SER	1138,3170		242,654,1258	58.0	69.0	66.0		1606	-4.5	0.0	1	dbSNP_107	66	2424,6110		368,1688,2211	yes	missense	OVGP1	NM_002557.3	56	610,2342,3469	CC,CT,TT		28.404,26.416,27.7371	benign	536/679	111957517	3562,9280	2154	4267	6421	SO:0001583	missense	5016			U09550	CCDS834.1	1p13.2	2008-07-31	2008-07-31		ENSG00000085465	ENSG00000085465		"""Mucins"""	8524	protein-coding gene	gene with protein product	"""oviductin"""	603578	"""mucin 9"""	MUC9		7819450, 9341614	Standard	NM_002557		Approved	CHIT5	uc001eba.3	Q12889	OTTHUMG00000011746	ENST00000369732.3:c.1606A>G	1.37:g.111957517T>C	ENSP00000358747:p.Ser536Gly	Somatic		WXS	Illumina HiSeq	Phase_I	A0AV19|B9EGE1|Q15841	Missense_Mutation	SNP	ENST00000369732.3	37	CCDS834.1	.	.	.	.	.	.	.	.	.	.	T	6.657	0.489649	0.12702	0.26416	0.28404	ENSG00000085465	ENST00000369732;ENST00000369728;ENST00000434331	T	0.02787	4.16	2.23	-4.46	0.03536	.	.	.	.	.	T	0.00524	0.0017	N	0.19112	0.55	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.44982	-0.9292	8	0.31617	T	0.26	0.2049	3.9657	0.09431	0.0:0.2687:0.3546:0.3767	rs3767609;rs3767609	536;600	Q12889;Q59HH5	OVGP1_HUMAN;.	G	536;600;344	ENSP00000358747:S536G	ENSP00000358743:S600G	S	-	1	0	OVGP1	111759040	0.017000	0.18338	0.000000	0.03702	0.168000	0.22595	0.634000	0.24614	-1.729000	0.01364	0.254000	0.18369	AGT		0.547	OVGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032461.1	NM_002557	
CGN	57530	bcgsc.ca	37	1	151497210	151497210	+	Nonsense_Mutation	SNP	G	G	T			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr1:151497210G>T	ENST00000271636.7	+	8	1595	c.1462G>T	c.(1462-1464)Gag>Tag	p.E488*		NM_020770.2	NP_065821.1	Q9P2M7	CING_HUMAN	cingulin	482	Glu-rich.				transforming growth factor beta receptor signaling pathway (GO:0007179)	cell junction (GO:0030054)|myosin complex (GO:0016459)|tight junction (GO:0005923)	actin binding (GO:0003779)|motor activity (GO:0003774)			NS(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			GCGAGTAGAGGAGCAGCTGAG	0.572																																						.											0													27.0	28.0	27.0					1																	151497210		2203	4300	6503	SO:0001587	stop_gained	57530			AB037740	CCDS999.1	1q21	2008-02-05			ENSG00000143375	ENSG00000143375			17429	protein-coding gene	gene with protein product		609473				11042084, 12529927	Standard	NM_020770		Approved	KIAA1319	uc009wmw.3	Q9P2M7	OTTHUMG00000012497	ENST00000271636.7:c.1462G>T	1.37:g.151497210G>T	ENSP00000271636:p.Glu488*	Somatic		WXS	Illumina HiSeq	Phase_I	A6H8L3|A7MD22|Q5T386|Q9NR25	Nonsense_Mutation	SNP	ENST00000271636.7	37	CCDS999.1	.	.	.	.	.	.	.	.	.	.	G	39	7.894441	0.98548	.	.	ENSG00000143375	ENST00000271636	.	.	.	4.86	4.86	0.63082	.	0.255650	0.40222	N	0.001153	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	-27.7576	15.5281	0.75928	0.0:0.0:1.0:0.0	.	.	.	.	X	488	.	ENSP00000271636:E488X	E	+	1	0	CGN	149763834	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.226000	0.78060	2.522000	0.85027	0.655000	0.94253	GAG		0.572	CGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034900.3	NM_020770	
IGFN1	91156	bcgsc.ca	37	1	201181673	201181673	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr1:201181673G>A	ENST00000335211.4	+	12	7782	c.7652G>A	c.(7651-7653)cGg>cAg	p.R2551Q	IGFN1_ENST00000295591.8_5'UTR|IGFN1_ENST00000451870.2_Intron	NM_001164586.1	NP_001158058.1	Q86VF2	IGFN1_HUMAN	immunoglobulin-like and fibronectin type III domain containing 1	0						nucleus (GO:0005634)|Z disc (GO:0030018)				autonomic_ganglia(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						GGATATGAACGGGACATCTGG	0.587																																						.											0													25.0	27.0	27.0					1																	201181673		692	1591	2283	SO:0001583	missense	91156			AY245430	CCDS53455.1	1q32.1	2013-02-11			ENSG00000163395	ENSG00000163395		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	24607	protein-coding gene	gene with protein product							Standard	NM_001164586		Approved	DKFZp434B1231, EEF1A2BP1	uc001gwc.3	Q86VF2	OTTHUMG00000035728	ENST00000335211.4:c.7652G>A	1.37:g.201181673G>A	ENSP00000334714:p.Arg2551Gln	Somatic		WXS	Illumina HiSeq	Phase_I	F8WAI1|Q9NT72	Missense_Mutation	SNP	ENST00000335211.4	37	CCDS53455.1	.	.	.	.	.	.	.	.	.	.	g	10.75	1.439042	0.25900	.	.	ENSG00000163395	ENST00000335211	T	0.51574	0.7	3.53	-7.07	0.01563	.	.	.	.	.	T	0.20251	0.0487	N	0.08118	0	0.09310	N	0.999997	.	.	.	.	.	.	T	0.22871	-1.0204	6	.	.	.	.	7.8001	0.29170	0.326:0.0:0.5404:0.1336	.	.	.	.	Q	2551	ENSP00000334714:R2551Q	.	R	+	2	0	IGFN1	199448296	0.000000	0.05858	0.000000	0.03702	0.078000	0.17371	-3.048000	0.00629	-2.294000	0.00663	-0.778000	0.03378	CGG		0.587	IGFN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_178275	
IL1R2	7850	bcgsc.ca	37	2	102626112	102626112	+	Missense_Mutation	SNP	G	G	T			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr2:102626112G>T	ENST00000332549.3	+	3	385	c.156G>T	c.(154-156)caG>caT	p.Q52H	IL1R2_ENST00000393414.2_Missense_Mutation_p.Q52H|IL1R2_ENST00000441002.1_Missense_Mutation_p.Q52H	NM_004633.3	NP_004624.1	P27930	IL1R2_HUMAN	interleukin 1 receptor, type II	52	Ig-like C2-type 1.				cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type II, blocking receptor activity (GO:0004910)			breast(3)|endometrium(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|skin(1)	28						GGTGCCCCCAGGTGCCCTACT	0.597																																					Pancreas(106;189 1628 2302 5133 12295)	.											0													133.0	140.0	138.0					2																	102626112		2203	4300	6503	SO:0001583	missense	7850			X59770	CCDS2054.1, CCDS58719.1	2q12	2013-01-11			ENSG00000115590	ENSG00000115590		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5994	protein-coding gene	gene with protein product		147811		IL1RB		10191101, 1833184	Standard	NM_004633		Approved	CD121b	uc002tbm.3	P27930	OTTHUMG00000130695	ENST00000332549.3:c.156G>T	2.37:g.102626112G>T	ENSP00000330959:p.Gln52His	Somatic		WXS	Illumina HiSeq	Phase_I	D3DVJ5|Q6LCE6|Q9UE68	Missense_Mutation	SNP	ENST00000332549.3	37	CCDS2054.1	.	.	.	.	.	.	.	.	.	.	G	10.41	1.342180	0.24339	.	.	ENSG00000115590	ENST00000332549;ENST00000393414;ENST00000457817;ENST00000441002	T;T;T;T	0.76968	-1.06;-1.06;-1.06;-1.06	5.8	0.212	0.15240	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.844176	0.10659	N	0.648915	T	0.70211	0.3198	L	0.54323	1.7	0.09310	N	1	D	0.56521	0.976	P	0.49502	0.613	T	0.58544	-0.7618	10	0.15499	T	0.54	.	1.1662	0.01816	0.1664:0.2397:0.3437:0.2502	.	52	P27930	IL1R2_HUMAN	H	52	ENSP00000330959:Q52H;ENSP00000377066:Q52H;ENSP00000408415:Q52H;ENSP00000414611:Q52H	ENSP00000330959:Q52H	Q	+	3	2	IL1R2	101992544	0.116000	0.22171	0.348000	0.25681	0.571000	0.35966	0.556000	0.23438	0.389000	0.25086	0.561000	0.74099	CAG		0.597	IL1R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253191.1	NM_004633	
ANKRD30BL	554226	bcgsc.ca	37	2	132905741	132905741	+	Missense_Mutation	SNP	G	G	A	rs111770980		TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr2:132905741G>A	ENST00000409867.1	-	6	989	c.740C>T	c.(739-741)aCg>aTg	p.T247M	ANKRD30BL_ENST00000470729.1_5'UTR			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like	247										endometrium(1)|kidney(3)	4						GCTTTCAGCCGTGTCAGGTGT	0.438																																						.											0																																										SO:0001583	missense	554226					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.740C>T	2.37:g.132905741G>A	ENSP00000386398:p.Thr247Met	Somatic		WXS	Illumina HiSeq	Phase_I	B8ZZL7	RNA	SNP	ENST00000409867.1	37		.	.	.	.	.	.	.	.	.	.	.	0.003	-2.579831	0.00129	.	.	ENSG00000163046	ENST00000409867	T	0.40225	1.04	0.109	-0.218	0.13142	.	.	.	.	.	T	0.25158	0.0611	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.20306	-1.0279	5	0.36615	T	0.2	.	.	.	.	.	.	.	.	M	247	ENSP00000386398:T247M	ENSP00000386398:T247M	T	-	2	0	ANKRD30BL	132622211	0.000000	0.05858	0.004000	0.12327	0.004000	0.04260	-2.520000	0.00951	-2.990000	0.00280	-3.030000	0.00073	ACG		0.438	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331353.2	NR_027019	
ERAP2	64167	bcgsc.ca	37	5	96232568	96232568	+	Splice_Site	SNP	G	G	A	rs75364820		TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr5:96232568G>A	ENST00000437043.3	+	9	2214		c.e9+1		CTD-2260A17.2_ENST00000501338.1_Intron|ERAP2_ENST00000515095.1_Splice_Site|ERAP2_ENST00000379904.4_Splice_Site	NM_001130140.1|NM_022350.3	NP_001123612.1|NP_071745.1	Q6P179	ERAP2_HUMAN	endoplasmic reticulum aminopeptidase 2						antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|regulation of blood pressure (GO:0008217)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	24		all_cancers(142;0.000311)|all_epithelial(76;1.54e-06)|all_lung(232;0.0131)|Lung NSC(167;0.0161)|Colorectal(57;0.0596)|Ovarian(225;0.105)		COAD - Colon adenocarcinoma(37;0.0703)		TCTGTCAAATGTAAGTCATAT	0.323																																						.											0													106.0	115.0	112.0					5																	96232568		2203	4298	6501	SO:0001630	splice_region_variant	64167			AF191545	CCDS4086.1	5q15	2007-11-21			ENSG00000164308	ENSG00000164308			29499	protein-coding gene	gene with protein product	"""leukocyte-derived arginine aminopeptidase"""	609497				12799365, 15908954	Standard	NM_022350		Approved	L-RAP, LRAP	uc003kmt.3	Q6P179	OTTHUMG00000128718	ENST00000437043.3:c.1503+1G>A	5.37:g.96232568G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q7Z5K1|Q8TD32|Q8WVJ4|Q9HBX2	Splice_Site	SNP	ENST00000437043.3	37	CCDS4086.1	.	.	.	.	.	.	.	.	.	.	G	11.61	1.690341	0.29962	.	.	ENSG00000164308	ENST00000437043;ENST00000510373;ENST00000513084;ENST00000379904	.	.	.	5.01	3.23	0.37069	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.6132	0.45434	0.1496:0.0:0.8504:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ERAP2	96258324	1.000000	0.71417	0.243000	0.24186	0.446000	0.32137	6.798000	0.75155	0.630000	0.30394	0.563000	0.77884	.		0.323	ERAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250623.2	NM_022350	Intron
RNF145	153830	bcgsc.ca	37	5	158630640	158630640	+	5'UTR	SNP	T	T	C	rs368977591		TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr5:158630640T>C	ENST00000424310.2	-	0	345				RNF145_ENST00000520638.1_Missense_Mutation_p.K10E|RNF145_ENST00000521606.2_Missense_Mutation_p.K13E|RNF145_ENST00000518802.1_Missense_Mutation_p.K26E|RNF145_ENST00000274542.2_Missense_Mutation_p.K24E|RNF145_ENST00000519865.1_5'UTR	NM_001199383.1	NP_001186312.1	Q96MT1	RN145_HUMAN	ring finger protein 145							integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(7)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	30	Renal(175;0.00196)	Medulloblastoma(196;0.0523)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			tttttttttttcttttttttt	0.368																																						.											0													33.0	36.0	35.0					5																	158630640		2203	4300	6503	SO:0001623	5_prime_UTR_variant	153830			BC042684	CCDS4344.1, CCDS56390.1, CCDS56391.1, CCDS56392.1, CCDS56393.1	5q33.3	2013-01-09			ENSG00000145860	ENSG00000145860		"""RING-type (C3HC4) zinc fingers"""	20853	protein-coding gene	gene with protein product							Standard	NM_001199380		Approved	FLJ31951	uc003lxo.2	Q96MT1	OTTHUMG00000130306	ENST00000424310.2:c.-15A>G	5.37:g.158630640T>C		Somatic		WXS	Illumina HiSeq	Phase_I	B7Z903|B7Z949|E7EVI7|Q8IVP7	Missense_Mutation	SNP	ENST00000424310.2	37	CCDS56390.1	.	.	.	.	.	.	.	.	.	.	T	0.006	-2.071233	0.00379	.	.	ENSG00000145860	ENST00000274542;ENST00000521606;ENST00000413445;ENST00000518802;ENST00000520638	T;T;T;T;T	0.77489	-1.09;-1.07;-1.07;-1.1;-1.06	1.66	0.33	0.15929	.	4.233800	0.00610	N	0.000418	T	0.52581	0.1743	N	0.08118	0	0.09310	N	0.999996	P;P;P;P;P	0.42584	0.784;0.544;0.544;0.544;0.673	B;B;B;B;B	0.28638	0.092;0.032;0.032;0.032;0.071	T	0.53711	-0.8400	10	0.41790	T	0.15	18.6048	3.7362	0.08511	0.0:0.2254:0.0:0.7746	.	12;13;10;26;24	E7EW26;B7Z949;B7Z903;E7EVI7;Q96MT1-2	.;.;.;.;.	E	24;12;13;26;10	ENSP00000274542:K24E;ENSP00000430753:K12E;ENSP00000445115:K13E;ENSP00000430955:K26E;ENSP00000429071:K10E	ENSP00000274542:K24E	K	-	1	0	RNF145	158563218	0.030000	0.19436	0.002000	0.10522	0.002000	0.02628	0.517000	0.22832	-0.074000	0.12820	-1.322000	0.01289	AAA		0.368	RNF145-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374048.1	NM_144726	
ATP6V0A4	50617	bcgsc.ca	37	7	138437566	138437566	+	Missense_Mutation	SNP	T	T	A			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr7:138437566T>A	ENST00000310018.2	-	11	1115	c.833A>T	c.(832-834)gAg>gTg	p.E278V	ATP6V0A4_ENST00000393054.1_Missense_Mutation_p.E278V|ATP6V0A4_ENST00000353492.4_Missense_Mutation_p.E278V	NM_020632.2|NM_130840.2	NP_065683.2|NP_570855.2	Q9HBG4	VPP4_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a4	278					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|excretion (GO:0007588)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|ossification (GO:0001503)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|regulation of pH (GO:0006885)|sensory perception of sound (GO:0007605)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	ATPase binding (GO:0051117)|hydrogen ion transmembrane transporter activity (GO:0015078)			NS(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(15)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36						GCGGTGAGACTCTGTTTGTGT	0.498																																						.											0													61.0	57.0	59.0					7																	138437566		2203	4300	6503	SO:0001583	missense	50617			AF245517	CCDS5849.1	7q34	2011-06-09	2006-01-20	2002-05-10	ENSG00000105929	ENSG00000105929		"""ATPases / V-type"""	866	protein-coding gene	gene with protein product		605239	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) non-catalytic accessory protein 1B"", ""ATPase, H+ transporting, lysosomal V0 subunit a isoform 4"", ""ATPase, H+ transporting, lysosomal V0 subunit A4"""	ATP6N1B, ATP6N2, RTA1C		10577919, 10973252	Standard	XM_005250393		Approved	RDRTA2, VPP2, RTADR, a4, Vph1, Stv1	uc003vuf.3	Q9HBG4	OTTHUMG00000157122	ENST00000310018.2:c.833A>T	7.37:g.138437566T>A	ENSP00000308122:p.Glu278Val	Somatic		WXS	Illumina HiSeq	Phase_I	A4D1R4|A8KA80|Q32M47	Missense_Mutation	SNP	ENST00000310018.2	37	CCDS5849.1	.	.	.	.	.	.	.	.	.	.	T	26.9	4.777405	0.90195	.	.	ENSG00000105929	ENST00000310018;ENST00000393054;ENST00000353492	D;D;D	0.87256	-2.23;-2.23;-2.23	5.49	5.49	0.81192	.	0.152547	0.47455	D	0.000235	D	0.93966	0.8068	M	0.85859	2.78	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.94767	0.7941	10	0.72032	D	0.01	-28.8362	15.8766	0.79170	0.0:0.0:0.0:1.0	.	278	Q9HBG4	VPP4_HUMAN	V	278	ENSP00000308122:E278V;ENSP00000376774:E278V;ENSP00000253856:E278V	ENSP00000308122:E278V	E	-	2	0	ATP6V0A4	138088106	1.000000	0.71417	0.972000	0.41901	0.977000	0.68977	6.134000	0.71689	2.208000	0.71279	0.533000	0.62120	GAG		0.498	ATP6V0A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347514.1	NM_020632	
DOCK5	80005	bcgsc.ca	37	8	25178551	25178551	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chr8:25178551A>G	ENST00000276440.7	+	16	1642	c.1598A>G	c.(1597-1599)cAc>cGc	p.H533R		NM_024940.6	NP_079216.4	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	533	DHR-1.				positive regulation of GTPase activity (GO:0043547)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(9)|large_intestine(13)|lung(20)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		ACCTTCCGACACAGGTCATCT	0.373																																					Pancreas(145;34 1887 3271 10937 30165)	.											0													76.0	68.0	71.0					8																	25178551		2203	4300	6503	SO:0001583	missense	80005				CCDS6047.1	8p21.2	2009-04-17			ENSG00000147459	ENSG00000147459			23476	protein-coding gene	gene with protein product						12432077	Standard	NM_024940		Approved	FLJ21034	uc003xeg.3	Q9H7D0	OTTHUMG00000131991	ENST00000276440.7:c.1598A>G	8.37:g.25178551A>G	ENSP00000276440:p.His533Arg	Somatic		WXS	Illumina HiSeq	Phase_I	B2RNY0|Q5XKD5|Q6AI11|Q6PJS6|Q6ZTS6	Missense_Mutation	SNP	ENST00000276440.7	37	CCDS6047.1	.	.	.	.	.	.	.	.	.	.	A	24.5	4.536956	0.85812	.	.	ENSG00000147459	ENST00000276440	T	0.17691	2.26	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.54532	0.1864	M	0.93375	3.41	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	T	0.66448	-0.5921	10	0.72032	D	0.01	.	16.8061	0.85666	1.0:0.0:0.0:0.0	.	523;308;533	D3DSS6;Q68DL4;Q9H7D0	.;.;DOCK5_HUMAN	R	533	ENSP00000276440:H533R	ENSP00000276440:H533R	H	+	2	0	DOCK5	25234468	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.692000	0.91284	2.367000	0.80283	0.528000	0.53228	CAC		0.373	DOCK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254955.2	NM_024940	
PLXNB3	5365	bcgsc.ca	37	X	153035378	153035378	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8429-01A-11D-2310-10	TCGA-KN-8429-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	58c7e9c3-1345-48c0-a758-0887358b8696	8a9aade0-01c0-49a8-9a47-1498341edff7	g.chrX:153035378G>A	ENST00000361971.5	+	7	1727	c.1613G>A	c.(1612-1614)cGc>cAc	p.R538H	PLXNB3_ENST00000538776.1_Missense_Mutation_p.R191H|PLXNB3_ENST00000538966.1_Missense_Mutation_p.R561H|PLXNB3_ENST00000538543.1_Missense_Mutation_p.R88H|PLXNB3_ENST00000538282.1_Missense_Mutation_p.R148H	NM_005393.2	NP_005384.2	Q9ULL4	PLXB3_HUMAN	plexin B3	538					axon guidance (GO:0007411)|cell chemotaxis (GO:0060326)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|negative regulation of GTPase activity (GO:0034260)|negative regulation of lamellipodium assembly (GO:0010593)|positive chemotaxis (GO:0050918)|positive regulation of endothelial cell proliferation (GO:0001938)|semaphorin-plexin signaling pathway (GO:0071526)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)			central_nervous_system(1)|endometrium(7)|large_intestine(2)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					CACCACCCCCGCCAGGAGCAG	0.687																																						.											0													17.0	19.0	18.0					X																	153035378		2188	4287	6475	SO:0001583	missense	5365			AF149019	CCDS14729.1, CCDS55536.1	Xq28	2008-02-05			ENSG00000198753	ENSG00000198753		"""Plexins"""	9105	protein-coding gene	gene with protein product		300214		PLXN6		10520995	Standard	NM_005393		Approved	PLEXR, PLEXB3	uc010nuk.2	Q9ULL4	OTTHUMG00000024217	ENST00000361971.5:c.1613G>A	X.37:g.153035378G>A	ENSP00000355378:p.Arg538His	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z3E6|F5H773|Q9HDA4	Missense_Mutation	SNP	ENST00000361971.5	37	CCDS14729.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.395171	0.83011	.	.	ENSG00000198753	ENST00000538966;ENST00000361971;ENST00000538776;ENST00000538543;ENST00000538282	T;T;T;T;T	0.69926	5.11;5.08;4.53;1.71;-0.44	4.71	4.71	0.59529	.	0.000000	0.85682	D	0.000000	T	0.81692	0.4876	M	0.87381	2.88	0.36655	D	0.87762	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.83275	0.991;0.991;0.967;0.996;0.991	D	0.83398	0.0021	10	0.15066	T	0.55	.	14.1448	0.65344	0.0:0.0:1.0:0.0	.	191;220;88;561;538	B7Z3H9;B7Z9A5;F5GZZ4;F5H773;Q9ULL4	.;.;.;.;PLXB3_HUMAN	H	561;538;191;88;148	ENSP00000442736:R561H;ENSP00000355378:R538H;ENSP00000445569:R191H;ENSP00000444086:R88H;ENSP00000441919:R148H	ENSP00000355378:R538H	R	+	2	0	PLXNB3	152688572	1.000000	0.71417	1.000000	0.80357	0.816000	0.46133	3.241000	0.51376	1.910000	0.55303	0.600000	0.82982	CGC		0.687	PLXNB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061063.1		
