#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CDC42BPG	55561	hgsc.bcm.edu;ucsc.edu	37	11	64600192	64600192	+	Silent	SNP	C	C	A			TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr11:64600192C>A	ENST00000342711.5	-	26	2888	c.2889G>T	c.(2887-2889)cgG>cgT	p.R963R	CDC42BPG_ENST00000491280.1_5'Flank	NM_017525.2	NP_059995.2			CDC42 binding protein kinase gamma (DMPK-like)											central_nervous_system(1)|lung(3)	4						GCCAGCCCCGCCGGACACCTG	0.711																																						.											0													17.0	21.0	20.0					11																	64600192		2196	4291	6487	SO:0001819	synonymous_variant	55561			AY648038	CCDS31601.1	11q13	2013-01-10			ENSG00000171219	ENSG00000171219		"""Pleckstrin homology (PH) domain containing"""	29829	protein-coding gene	gene with protein product		613991				9341881, 15194684	Standard	NM_017525		Approved	HSMDPKIN, MRCKgamma, DMPK2, kappa-200	uc001obs.4	Q6DT37	OTTHUMG00000045365	ENST00000342711.5:c.2889G>T	11.37:g.64600192C>A		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000342711.5	37	CCDS31601.1																																																																																				0.711	CDC42BPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105352.4	XM_290516	
SIPA1	6494	hgsc.bcm.edu	37	11	65414344	65414344	+	Missense_Mutation	SNP	C	C	G	rs201341786		TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr11:65414344C>G	ENST00000394224.3	+	8	2135	c.1839C>G	c.(1837-1839)atC>atG	p.I613M	SIPA1_ENST00000527525.1_Intron|SIPA1_ENST00000394227.3_Intron|MIR4489_ENST00000578869.1_RNA|SIPA1_ENST00000534313.1_Missense_Mutation_p.I613M	NM_153253.29	NP_694985.29	Q96FS4	SIPA1_HUMAN	signal-induced proliferation-associated 1	613					cell proliferation (GO:0008283)|cellular response to water deprivation (GO:0042631)|cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rap GTPase activity (GO:0032854)|signal transduction (GO:0007165)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|protein complex (GO:0043234)|transport vesicle (GO:0030133)	GTPase activator activity (GO:0005096)|Rap GTPase activator activity (GO:0046582)			cervix(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	10						TGCTGGGCATCTCGGCCGAGG	0.746																																						.											0								C	MET/ILE,MET/ILE	0,3598		0,0,1799	6.0	7.0	6.0		1839,1839	1.5	1.0	11		6	17,6795		0,17,3389	no	missense,missense	SIPA1	NM_006747.3,NM_153253.29	10,10	0,17,5188	GG,GC,CC		0.2496,0.0,0.1633	benign,benign	613/1043,613/1043	65414344	17,10393	1799	3406	5205	SO:0001583	missense	6494			AH006363, BC010492, BM677738	CCDS8108.1	11q13.3	2008-09-12	2008-09-12		ENSG00000213445	ENSG00000213445			10885	protein-coding gene	gene with protein product		602180				9027487	Standard	NM_006747		Approved	SPA1	uc001ofb.2	Q96FS4	OTTHUMG00000166541	ENST00000394224.3:c.1839C>G	11.37:g.65414344C>G	ENSP00000377771:p.Ile613Met	Somatic		WXS	Illumina HiSeq	Phase_I	O14518|O60484|O60618|Q2YD83	Missense_Mutation	SNP	ENST00000394224.3	37	CCDS8108.1	.	.	.	.	.	.	.	.	.	.	C	14.19	2.462676	0.43736	0.0	0.002496	ENSG00000213445	ENST00000534313;ENST00000394224	T;T	0.51574	0.7;0.7	3.42	1.52	0.23074	.	0.271361	0.23764	U	0.044793	T	0.39332	0.1074	L	0.49571	1.57	0.80722	D	1	B	0.32968	0.392	B	0.34991	0.193	T	0.26052	-1.0114	10	0.87932	D	0	-15.0648	7.2625	0.26212	0.0:0.7707:0.0:0.2293	.	613	Q96FS4	SIPA1_HUMAN	M	613	ENSP00000436269:I613M;ENSP00000377771:I613M	ENSP00000377771:I613M	I	+	3	3	SIPA1	65170920	0.989000	0.36119	0.990000	0.47175	0.919000	0.55068	0.278000	0.18753	0.280000	0.22209	0.297000	0.19635	ATC		0.746	SIPA1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390356.1	NM_006747	
ABCG4	64137	broad.mit.edu;hgsc.bcm.edu;mdanderson.org	37	11	119024755	119024755	+	Silent	SNP	G	G	A			TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr11:119024755G>A	ENST00000449422.2	+	3	446	c.258G>A	c.(256-258)aaG>aaA	p.K86K	ABCG4_ENST00000531739.1_Silent_p.K86K|ABCG4_ENST00000307417.3_Silent_p.K86K	NM_001142505.1	NP_001135977.1	Q9H172	ABCG4_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 4	86	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cholesterol efflux (GO:0033344)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|cholesterol transporter activity (GO:0017127)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(28)|ovary(2)|prostate(1)|skin(1)	44	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		CCCTTCTCAAGTGCCTCTCAG	0.522																																						.											0													105.0	113.0	110.0					11																	119024755		2200	4295	6495	SO:0001819	synonymous_variant	64137			AJ300465	CCDS8415.1	11q23	2012-03-14			ENSG00000172350	ENSG00000172350		"""ATP binding cassette transporters / subfamily G"""	13884	protein-coding gene	gene with protein product	"""putative ABC transporter"", ""ATP-binding cassette, subfamily G, member 4"""	607784				11435397	Standard	NM_022169		Approved	WHITE2	uc001pvs.3	Q9H172	OTTHUMG00000166169	ENST00000449422.2:c.258G>A	11.37:g.119024755G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A8K1B5|Q8WWH0|Q8WWH1|Q8WWH2	Silent	SNP	ENST00000449422.2	37	CCDS8415.1																																																																																				0.522	ABCG4-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388215.1	NM_022169	
SHBG	6462	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	17	7534020	7534020	+	Nonsense_Mutation	SNP	C	C	T			TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr17:7534020C>T	ENST00000380450.4	+	3	257	c.226C>T	c.(226-228)Cga>Tga	p.R76*	SAT2_ENST00000269298.5_5'Flank|SHBG_ENST00000576728.1_Nonsense_Mutation_p.R18*|SHBG_ENST00000572182.1_Nonsense_Mutation_p.R18*|SHBG_ENST00000575903.1_Nonsense_Mutation_p.R76*|SHBG_ENST00000572262.1_Nonsense_Mutation_p.R18*|SHBG_ENST00000575314.1_Nonsense_Mutation_p.R18*|SHBG_ENST00000574539.1_Nonsense_Mutation_p.R18*|SHBG_ENST00000570547.1_Nonsense_Mutation_p.R18*|SHBG_ENST00000416273.3_Nonsense_Mutation_p.R76*|SHBG_ENST00000576478.1_Nonsense_Mutation_p.R18*|SAT2_ENST00000380466.2_5'Flank|SHBG_ENST00000441599.2_Nonsense_Mutation_p.R76*|SHBG_ENST00000340624.5_Nonsense_Mutation_p.R18*|SAT2_ENST00000573566.1_5'Flank	NM_001040.3	NP_001031.2	P04278	SHBG_HUMAN	sex hormone-binding globulin	76	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				primary spermatocyte growth (GO:0007285)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	androgen binding (GO:0005497)	p.?(1)		cervix(1)|endometrium(2)|large_intestine(4)|lung(2)|skin(1)	10		all_cancers(10;0.0867)		READ - Rectum adenocarcinoma(115;0.168)	Danazol(DB01406)|Drostanolone(DB00858)|Estradiol(DB00783)|Estropipate(DB04574)|Fluoxymesterone(DB01185)|Hydrocortisone(DB00741)|Methyltestosterone(DB06710)|Mitotane(DB00648)|Norethindrone(DB00717)|Spironolactone(DB00421)|Testosterone(DB00624)|transdermal testosterone gel(DB05275)	CTTTGAGGTTCGAACCTGGGA	0.502																																						.											1	Unknown(1)	haematopoietic_and_lymphoid_tissue(1)											65.0	62.0	63.0					17																	7534020		2203	4300	6503	SO:0001587	stop_gained	6462				CCDS11117.1, CCDS54082.1, CCDS54083.1, CCDS58513.1, CCDS73961.1, CCDS73962.1	17p13.1	2013-09-19			ENSG00000129214	ENSG00000129214			10839	protein-coding gene	gene with protein product	"""androgen binding protein"""	182205				2587256	Standard	NM_001146279		Approved	ABP, TEBG, MGC126834, MGC138391	uc002gie.2	P04278	OTTHUMG00000108153	ENST00000380450.4:c.226C>T	17.37:g.7534020C>T	ENSP00000369816:p.Arg76*	Somatic		WXS	Illumina HiSeq	Phase_I	B0FWH4|E9PGW1|F5H5Z8|I3L1N7|P14689|Q16616|Q3MIL0|Q6ISD2	Nonsense_Mutation	SNP	ENST00000380450.4	37	CCDS11117.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.755742	0.89843	.	.	ENSG00000129214	ENST00000340624;ENST00000441599;ENST00000416273;ENST00000441313;ENST00000452698;ENST00000380450	.	.	.	5.04	2.98	0.34508	.	0.392041	0.26112	N	0.026270	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.5936	8.3525	0.32310	0.0:0.755:0.1569:0.0881	.	.	.	.	X	18;76;76;76;76;76	.	ENSP00000345675:R18X	R	+	1	2	SHBG	7474745	0.795000	0.28851	0.009000	0.14445	0.979000	0.70002	2.218000	0.42889	0.493000	0.27837	0.561000	0.74099	CGA		0.502	SHBG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000226957.2	NM_001040	
TP53	7157	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	17	7578507	7578507	+	Missense_Mutation	SNP	G	G	C			TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr17:7578507G>C	ENST00000269305.4	-	5	612	c.423C>G	c.(421-423)tgC>tgG	p.C141W	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.C141W|TP53_ENST00000420246.2_Missense_Mutation_p.C141W|TP53_ENST00000413465.2_Missense_Mutation_p.C141W|TP53_ENST00000359597.4_Missense_Mutation_p.C141W|TP53_ENST00000455263.2_Missense_Mutation_p.C141W	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	141	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		C -> A (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|C -> F (in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C141W(13)|p.C141*(11)|p.0?(8)|p.A138_P142delAKTCP(4)|p.C141C(4)|p.N131fs*27(2)|p.P142fs*7(1)|p.L137_W146del10(1)|p.C141A(1)|p.C9W(1)|p.A6_P10delAKTCP(1)|p.K139fs*4(1)|p.A45_P49delAKTCP(1)|p.T140fs*28(1)|p.A138_V143delAKTCPV(1)|p.C141fs*5(1)|p.P142del(1)|p.C48W(1)|p.C141_P142insXX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCTGCACAGGGCAGGTCTTGG	0.577		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	55	Substitution - Missense(16)|Substitution - Nonsense(11)|Deletion - In frame(9)|Whole gene deletion(8)|Deletion - Frameshift(5)|Substitution - coding silent(4)|Insertion - Frameshift(1)|Insertion - In frame(1)	ovary(13)|lung(9)|breast(6)|oesophagus(5)|large_intestine(4)|bone(4)|stomach(3)|central_nervous_system(3)|upper_aerodigestive_tract(2)|haematopoietic_and_lymphoid_tissue(2)|liver(2)|kidney(1)|urinary_tract(1)											57.0	56.0	56.0					17																	7578507		2203	4300	6503	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.423C>G	17.37:g.7578507G>C	ENSP00000269305:p.Cys141Trp	Somatic		WXS	Illumina HiSeq	Phase_I	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	12.43	1.936103	0.34189	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99824	-6.96;-6.96;-6.96;-6.96;-6.96;-6.96;-6.96;-6.96;-6.96	5.48	2.07	0.26955	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.046412	0.85682	D	0.000000	D	0.99775	0.9907	M	0.90309	3.105	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;0.998;1.0;1.0;1.0;1.0	D	0.98853	1.0759	10	0.87932	D	0	-26.1094	8.3736	0.32430	0.2952:0.0:0.7048:0.0	.	102;141;141;48;141;141;141	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	W	141;141;141;141;141;141;130;48;9;48;9;141	ENSP00000410739:C141W;ENSP00000352610:C141W;ENSP00000269305:C141W;ENSP00000398846:C141W;ENSP00000391127:C141W;ENSP00000391478:C141W;ENSP00000425104:C9W;ENSP00000423862:C48W;ENSP00000424104:C141W	ENSP00000269305:C141W	C	-	3	2	TP53	7519232	1.000000	0.71417	0.987000	0.45799	0.022000	0.10575	1.115000	0.31209	0.236000	0.21180	0.655000	0.94253	TGC		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
KRTAP4-11	653240	hgsc.bcm.edu	37	17	39274432	39274432	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr17:39274432C>T	ENST00000391413.2	-	1	174	c.136G>A	c.(136-138)Gtg>Atg	p.V46M		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	46	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].		Missing (in allele KAP4.14). {ECO:0000269|PubMed:15955084}.			keratin filament (GO:0045095)				endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			CAGCTGGACACACAGCAGCTG	0.677																																						.											0													14.0	18.0	17.0					17																	39274432		690	1591	2281	SO:0001583	missense	653240			AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.136G>A	17.37:g.39274432C>T	ENSP00000375232:p.Val46Met	Somatic		WXS	Illumina HiSeq	Phase_I	A0AUY2	Missense_Mutation	SNP	ENST00000391413.2	37	CCDS45675.1	.	.	.	.	.	.	.	.	.	.	.	10.56	1.385842	0.25031	.	.	ENSG00000212721	ENST00000391413	T	0.01430	4.9	3.76	-6.69	0.01772	.	0.911881	0.08829	U	0.887602	T	0.03739	0.0106	M	0.84948	2.725	0.09310	N	1	P	0.40266	0.71	P	0.46585	0.521	T	0.02144	-1.1206	10	0.54805	T	0.06	.	8.7851	0.34816	0.0:0.3102:0.5247:0.1651	.	46	Q9BYQ6	KR411_HUMAN	M	46	ENSP00000375232:V46M	ENSP00000375232:V46M	V	-	1	0	KRTAP4-11	36527958	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-2.396000	0.01052	-0.895000	0.03920	-1.166000	0.01754	GTG		0.677	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257690.1		
LPIN2	9663	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	18	2937725	2937725	+	Missense_Mutation	SNP	G	G	A	rs146067222		TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr18:2937725G>A	ENST00000261596.4	-	7	1371	c.1133C>T	c.(1132-1134)cCg>cTg	p.P378L		NM_014646.2	NP_055461.1	Q92539	LPIN2_HUMAN	lipin 2	378					cellular lipid metabolic process (GO:0044255)|dephosphorylation (GO:0016311)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)|transcription coactivator activity (GO:0003713)			autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	29				READ - Rectum adenocarcinoma(2;0.0419)|Colorectal(6;0.156)		TTTAGCTGCCGGTTTGGATTC	0.453													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16946	0.0		0.0	False		,,,				2504	0.0					.											0								G	LEU/PRO	3,4403	6.2+/-15.9	0,3,2200	59.0	61.0	61.0		1133	5.7	0.9	18	dbSNP_134	61	1,8599	1.2+/-3.3	0,1,4299	yes	missense	LPIN2	NM_014646.2	98	0,4,6499	AA,AG,GG		0.0116,0.0681,0.0308	benign	378/897	2937725	4,13002	2203	4300	6503	SO:0001583	missense	9663			D87436	CCDS11829.1	18p	2014-09-17			ENSG00000101577	ENSG00000101577			14450	protein-coding gene	gene with protein product		605519				11138012, 9039502	Standard	NM_014646		Approved	KIAA0249	uc002klo.3	Q92539	OTTHUMG00000131508	ENST00000261596.4:c.1133C>T	18.37:g.2937725G>A	ENSP00000261596:p.Pro378Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A7MD25|D3DUH3	Missense_Mutation	SNP	ENST00000261596.4	37	CCDS11829.1	.	.	.	.	.	.	.	.	.	.	G	13.11	2.140207	0.37825	6.81E-4	1.16E-4	ENSG00000101577	ENST00000261596	T	0.80304	-1.36	5.74	5.74	0.90152	.	1.049380	0.07337	N	0.880142	D	0.83543	0.5277	M	0.78637	2.42	0.58432	D	0.999999	B	0.14438	0.01	B	0.08055	0.003	T	0.69146	-0.5222	10	0.29301	T	0.29	.	18.1163	0.89556	0.0:0.0:1.0:0.0	.	378	Q92539	LPIN2_HUMAN	L	378	ENSP00000261596:P378L	ENSP00000261596:P378L	P	-	2	0	LPIN2	2927725	1.000000	0.71417	0.910000	0.35882	0.895000	0.52256	4.088000	0.57678	2.715000	0.92844	0.655000	0.94253	CCG		0.453	LPIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254363.2	NM_014646	
SBNO2	22904	hgsc.bcm.edu;mdanderson.org	37	19	1108866	1108866	+	Silent	SNP	G	G	A	rs374174588		TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr19:1108866G>A	ENST00000361757.3	-	31	3765	c.3528C>T	c.(3526-3528)ggC>ggT	p.G1176G	SBNO2_ENST00000587024.1_Silent_p.G1166G|SBNO2_ENST00000438103.2_Silent_p.G1119G	NM_014963.2	NP_055778.2	Q9Y2G9	SBNO2_HUMAN	strawberry notch homolog 2 (Drosophila)	1176					bone mineralization (GO:0030282)|bone trabecula morphogenesis (GO:0061430)|macrophage activation involved in immune response (GO:0002281)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoclast fusion (GO:0072675)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of inflammatory response (GO:0050727)|transcription, DNA-templated (GO:0006351)					NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGGCGATGCGGCCCCACACGC	0.687																																						.											0									,	1,3983		0,1,1991	8.0	9.0	9.0		3357,3528	4.3	1.0	19		9	4,8284		0,4,4140	no	coding-synonymous,coding-synonymous	SBNO2	NM_001100122.1,NM_014963.2	,	0,5,6131	AA,AG,GG		0.0483,0.0251,0.0407	,	1119/1310,1176/1367	1108866	5,12267	1992	4144	6136	SO:0001819	synonymous_variant	22904			AK074102	CCDS45894.1, CCDS45895.1	19p13.3	2008-02-05	2006-10-06	2006-10-06		ENSG00000064932			29158	protein-coding gene	gene with protein product		615729	"""KIAA0963"""	KIAA0963		10231032	Standard	NM_014963		Approved	FLJ00173, Stno, Sno	uc002lrk.4	Q9Y2G9		ENST00000361757.3:c.3528C>T	19.37:g.1108866G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A8K8P2|B3KWJ1|O75257|Q3KQX0|Q8TEM0	Silent	SNP	ENST00000361757.3	37	CCDS45894.1																																																																																				0.687	SBNO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458065.2	NM_014963	
CC2D1A	54862	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	19	14024412	14024412	+	Missense_Mutation	SNP	G	G	C			TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr19:14024412G>C	ENST00000318003.7	+	6	950	c.709G>C	c.(709-711)Gcc>Ccc	p.A237P	CC2D1A_ENST00000589606.1_Missense_Mutation_p.A237P	NM_017721.4	NP_060191.3	Q6P1N0	C2D1A_HUMAN	coiled-coil and C2 domain containing 1A	237	Pro-rich.				positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(12)|prostate(2)|skin(2)	27			OV - Ovarian serous cystadenocarcinoma(19;3.49e-23)			CACCGCCCCAGCCTCATCTCC	0.672																																						.											0													21.0	25.0	24.0					19																	14024412		1936	4116	6052	SO:0001583	missense	54862			AF536205	CCDS42512.1	19p13.12	2007-01-08				ENSG00000132024			30237	protein-coding gene	gene with protein product	"""mental retardation, nonsyndromic, autosomal recessive, 3"""	610055				12761501, 16033914	Standard	NM_017721		Approved	FLJ20241, MRT3	uc002mxo.2	Q6P1N0		ENST00000318003.7:c.709G>C	19.37:g.14024412G>C	ENSP00000313601:p.Ala237Pro	Somatic		WXS	Illumina HiSeq	Phase_I	Q7Z435|Q86XV0|Q8NF89|Q9H603|Q9NXI1	Missense_Mutation	SNP	ENST00000318003.7	37	CCDS42512.1	.	.	.	.	.	.	.	.	.	.	G	9.613	1.131834	0.21041	.	.	ENSG00000132024	ENST00000318003;ENST00000254346;ENST00000389233	T	0.21191	2.02	4.58	-1.52	0.08637	.	0.960608	0.08628	N	0.917415	T	0.14056	0.0340	L	0.40543	1.245	0.09310	N	1	P;B	0.40875	0.731;0.001	B;B	0.38616	0.277;0.003	T	0.24870	-1.0148	10	0.23891	T	0.37	-6.2937	4.6872	0.12764	0.3443:0.0:0.5119:0.1438	.	237;237	Q6P1N0-2;Q6P1N0	.;C2D1A_HUMAN	P	237;75;212	ENSP00000313601:A237P	ENSP00000254346:A75P	A	+	1	0	CC2D1A	13885412	0.000000	0.05858	0.000000	0.03702	0.084000	0.17831	-0.237000	0.08990	-0.243000	0.09653	0.462000	0.41574	GCC		0.672	CC2D1A-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457954.1	NM_017721	
TBC1D5	9779	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	3	17413592	17413592	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr3:17413592C>T	ENST00000253692.7	-	13	2634	c.970G>A	c.(970-972)Gaa>Aaa	p.E324K	TBC1D5_ENST00000446818.2_Missense_Mutation_p.E324K|TBC1D5_ENST00000414318.2_Intron|TBC1D5_ENST00000429924.2_Missense_Mutation_p.E276K|TBC1D5_ENST00000429383.4_Missense_Mutation_p.E324K	NM_014744.2	NP_055559.1	Q92609	TBCD5_HUMAN	TBC1 domain family, member 5	324	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.					retromer complex (GO:0030904)	Rab GTPase activator activity (GO:0005097)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	36						GGTGCAATTTCTAGTCTGTTC	0.373																																						.											0													134.0	130.0	132.0					3																	17413592		2203	4300	6503	SO:0001583	missense	9779			D86965	CCDS33714.1, CCDS46770.1	3p24.3	2013-07-09			ENSG00000131374	ENSG00000131374			19166	protein-coding gene	gene with protein product		615740				19531583	Standard	NM_014744		Approved	KIAA0210	uc003cbe.3	Q92609	OTTHUMG00000155488	ENST00000253692.7:c.970G>A	3.37:g.17413592C>T	ENSP00000253692:p.Glu324Lys	Somatic		WXS	Illumina HiSeq	Phase_I	A6NP25|C9JP52	Missense_Mutation	SNP	ENST00000253692.7	37	CCDS33714.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.811923	0.90707	.	.	ENSG00000131374	ENST00000253692;ENST00000429383;ENST00000446818;ENST00000429924	T;T;T;T	0.22539	1.95;1.95;1.95;1.95	5.79	5.79	0.91817	Rab-GAP/TBC domain (4);	0.000000	0.85682	D	0.000000	T	0.35480	0.0933	N	0.26092	0.79	0.80722	D	1	B;D;D	0.56521	0.096;0.974;0.976	B;P;D	0.67900	0.262;0.906;0.954	T	0.02625	-1.1132	10	0.44086	T	0.13	-15.2812	20.0332	0.97547	0.0:1.0:0.0:0.0	.	276;324;324	C9J3F6;C9JP52;Q92609	.;.;TBCD5_HUMAN	K	324;324;324;276	ENSP00000253692:E324K;ENSP00000398127:E324K;ENSP00000402935:E324K;ENSP00000411925:E276K	ENSP00000253692:E324K	E	-	1	0	TBC1D5	17388596	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.786000	0.85741	2.749000	0.94314	0.491000	0.48974	GAA		0.373	TBC1D5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340301.3	NM_014744	
SENP5	205564	broad.mit.edu;hgsc.bcm.edu	37	3	196613140	196613142	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	CTC	CTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr3:196613140_196613142delCTC	ENST00000323460.5	+	2	1337_1339	c.1088_1090delCTC	c.(1087-1092)tctcct>tct	p.P364del	SENP5_ENST00000419026.1_Intron|SENP5_ENST00000445299.2_In_Frame_Del_p.P364del	NM_152699.4	NP_689912.2	Q96HI0	SENP5_HUMAN	SUMO1/sentrin specific peptidase 5	364					cell cycle (GO:0007049)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein sumoylation (GO:0016925)	intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)			NS(1)|breast(2)|endometrium(2)|kidney(3)|large_intestine(9)|lung(14)|skin(1)	32	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;3.14e-24)|all cancers(36;2.1e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.004)		TCCTGTTCTTCTCCTAAGTGGGA	0.453																																					Ovarian(47;891 1095 11174 13858 51271)	.											0																																										SO:0001651	inframe_deletion	205564			BC030705	CCDS3322.1	3q29	2005-08-17	2005-08-17		ENSG00000119231	ENSG00000119231			28407	protein-coding gene	gene with protein product		612845	"""SUMO1/sentrin specific protease 5"""			12477932	Standard	NM_152699		Approved	MGC27076	uc003fwz.4	Q96HI0	OTTHUMG00000155527	ENST00000323460.5:c.1088_1090delCTC	3.37:g.196613140_196613142delCTC	ENSP00000327197:p.Pro364del	Somatic		WXS	Illumina HiSeq	Phase_I	B4DY82|Q96SA5	In_Frame_Del	DEL	ENST00000323460.5	37	CCDS3322.1																																																																																				0.453	SENP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340524.1	NM_152699	
FOXI1	2299	hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	5	169533097	169533097	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr5:169533097C>T	ENST00000306268.6	+	1	197	c.136C>T	c.(136-138)Cgg>Tgg	p.R46W	FOXI1_ENST00000449804.2_Missense_Mutation_p.R46W			Q12951	FOXI1_HUMAN	forkhead box I1	46	Pro-rich.				embryo development (GO:0009790)|inner ear morphogenesis (GO:0042472)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.R46W(1)		breast(3)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	Renal(175;0.000159)|Lung NSC(126;0.0267)|all_lung(126;0.04)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CAGCCCTCAGCGGCCCTCCTT	0.687									Pendred syndrome																													.											1	Substitution - Missense(1)	lung(1)											20.0	22.0	21.0					5																	169533097		2201	4298	6499	SO:0001583	missense	2299	Familial Cancer Database	Goiter-Deafness syndrome	BC029778	CCDS4372.1, CCDS47337.1	5q34	2008-02-05			ENSG00000168269	ENSG00000168269		"""Forkhead boxes"""	3815	protein-coding gene	gene with protein product		601093		FKHL10		7957066, 8825632	Standard	NM_144769		Approved	FREAC6	uc003mai.4	Q12951	OTTHUMG00000130436	ENST00000306268.6:c.136C>T	5.37:g.169533097C>T	ENSP00000304286:p.Arg46Trp	Somatic		WXS	Illumina HiSeq	Phase_I	Q14518|Q66SR7|Q8N6L8	Missense_Mutation	SNP	ENST00000306268.6	37	CCDS4372.1	.	.	.	.	.	.	.	.	.	.	C	17.84	3.488446	0.64074	.	.	ENSG00000168269	ENST00000306268;ENST00000449804	D;D	0.94897	-3.47;-3.55	4.5	3.63	0.41609	.	0.068553	0.64402	D	0.000010	D	0.96892	0.8985	M	0.83384	2.64	0.49299	D	0.999779	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.992	D	0.96308	0.9226	10	0.49607	T	0.09	.	12.5348	0.56137	0.3021:0.6979:0.0:0.0	.	46;46	Q12951-2;Q12951	.;FOXI1_HUMAN	W	46	ENSP00000304286:R46W;ENSP00000415483:R46W	ENSP00000304286:R46W	R	+	1	2	FOXI1	169465675	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	1.119000	0.31258	0.882000	0.36016	-0.448000	0.05591	CGG		0.687	FOXI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252827.2	NM_144769, NM_012188	
AUTS2	26053	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	7	70231281	70231281	+	Silent	SNP	C	C	T	rs374492620		TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr7:70231281C>T	ENST00000342771.4	+	9	1971	c.1650C>T	c.(1648-1650)atC>atT	p.I550I	AUTS2_ENST00000406775.2_Silent_p.I550I	NM_015570.2	NP_056385.1	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2	550										breast(2)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	50		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		CCCACGCCATCCCACCCACCG	0.612																																						.											0								C	,	0,4406		0,0,2203	247.0	225.0	233.0		1650,1650	3.8	1.0	7		233	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	AUTS2	NM_001127231.1,NM_015570.2	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	550/1236,550/1260	70231281	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	26053			AF326917	CCDS5539.1, CCDS47601.1, CCDS47602.1	7q11.22	2014-01-06			ENSG00000158321	ENSG00000158321			14262	protein-coding gene	gene with protein product		607270				12160723	Standard	XM_005250257		Approved	KIAA0442, FBRSL2	uc003tvw.4	Q8WXX7	OTTHUMG00000023865	ENST00000342771.4:c.1650C>T	7.37:g.70231281C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A4D1Y9|L7QET3|L7QF75|Q5D049|Q6PJU5|Q9Y4F2	Silent	SNP	ENST00000342771.4	37	CCDS5539.1	.	.	.	.	.	.	.	.	.	.	C	10.49	1.364219	0.24684	0.0	1.16E-4	ENSG00000158321	ENST00000443672	.	.	.	5.56	3.76	0.43208	.	.	.	.	.	T	0.61924	0.2386	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57843	-0.7741	4	.	.	.	-15.7907	11.2114	0.48802	0.0:0.8031:0.1282:0.0686	.	.	.	.	F	92	.	.	S	+	2	0	AUTS2	69869217	1.000000	0.71417	0.995000	0.50966	0.992000	0.81027	4.034000	0.57289	0.715000	0.32103	0.561000	0.74099	TCC		0.612	AUTS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251971.2		
PCLO	27445	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	7	82544701	82544701	+	Missense_Mutation	SNP	A	A	T			TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr7:82544701A>T	ENST00000333891.9	-	7	12938	c.12601T>A	c.(12601-12603)Tca>Aca	p.S4201T	PCLO_ENST00000423517.2_Missense_Mutation_p.S4201T|PCLO_ENST00000437081.1_Missense_Mutation_p.S921T	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						GAAAATTTTGACATTTTAGGG	0.378																																						.											0													74.0	65.0	68.0					7																	82544701		1857	4093	5950	SO:0001583	missense	27445			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.12601T>A	7.37:g.82544701A>T	ENSP00000334319:p.Ser4201Thr	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000333891.9	37	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	A	8.038	0.763172	0.15914	.	.	ENSG00000186472	ENST00000333891;ENST00000423517;ENST00000437081	T;T	0.27557	1.66;1.67	5.79	5.79	0.91817	.	.	.	.	.	T	0.24431	0.0592	L	0.31926	0.97	0.29450	N	0.8585	B;B;B	0.24258	0.003;0.1;0.1	B;B;B	0.23574	0.004;0.047;0.047	T	0.15809	-1.0424	9	0.87932	D	0	.	7.9552	0.30038	0.7289:0.1302:0.0:0.1408	.	4132;4201;4201	Q9Y6V0;Q9Y6V0-5;Q9Y6V0-6	PCLO_HUMAN;.;.	T	4201;4201;921	ENSP00000334319:S4201T;ENSP00000388393:S4201T	ENSP00000334319:S4201T	S	-	1	0	PCLO	82382637	0.475000	0.25894	1.000000	0.80357	0.991000	0.79684	1.033000	0.30191	2.216000	0.71823	0.377000	0.23210	TCA		0.378	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
ZYX	7791	hgsc.bcm.edu	37	7	143078856	143078856	+	Silent	SNP	C	C	T	rs371579974		TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr7:143078856C>T	ENST00000322764.5	+	2	537	c.192C>T	c.(190-192)ccC>ccT	p.P64P	ZYX_ENST00000392910.2_5'Flank|ZYX_ENST00000449423.2_Silent_p.P8P|AC093673.5_ENST00000429630.1_RNA	NM_001010972.1|NM_003461.4	NP_001010972.1|NP_003452.1	Q15942	ZYX_HUMAN	zyxin	64	Pro-rich.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|integrin-mediated signaling pathway (GO:0007229)|regulation of inflammatory response (GO:0050727)|signal transduction (GO:0007165)|stress fiber assembly (GO:0043149)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)	17	Melanoma(164;0.205)					GCGAGATTCCCCCGCCGCCCC	0.706																																						.											0								C	,	0,3432		0,0,1716	3.0	4.0	3.0		192,192	0.4	1.0	7		3	4,7292		0,4,3644	no	coding-synonymous,coding-synonymous	ZYX	NM_001010972.1,NM_003461.4	,	0,4,5360	TT,TC,CC		0.0548,0.0,0.0373	,	64/573,64/573	143078856	4,10724	1716	3648	5364	SO:0001819	synonymous_variant	7791			X95735	CCDS5883.1	7q32	2010-02-26			ENSG00000159840	ENSG00000159840			13200	protein-coding gene	gene with protein product		602002				8917469, 8940160	Standard	XM_005250052		Approved		uc003wcx.3	Q15942	OTTHUMG00000023822	ENST00000322764.5:c.192C>T	7.37:g.143078856C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A4D2G6|Q6I9S4	Silent	SNP	ENST00000322764.5	37	CCDS5883.1																																																																																				0.706	ZYX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000156296.2	NM_003461	
C9orf131	138724	hgsc.bcm.edu;ucsc.edu	37	9	35044753	35044753	+	Silent	SNP	G	G	A			TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr9:35044753G>A	ENST00000312292.5	+	2	2174	c.2127G>A	c.(2125-2127)gtG>gtA	p.V709V	C9orf131_ENST00000354479.5_Silent_p.V636V|FLJ00273_ENST00000595331.1_5'Flank|C9orf131_ENST00000421362.2_Silent_p.V661V	NM_001040410.1|NM_203299.2	NP_001035500.1|NP_976044.2	Q5VYM1	CI131_HUMAN	chromosome 9 open reading frame 131	709										cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(23)|prostate(2)|skin(2)|stomach(1)	39	all_epithelial(49;0.22)		LUSC - Lung squamous cell carcinoma(32;0.00117)|Lung(28;0.00309)			GGAGAAATGTGCAACAAAGAG	0.552																																						.											0													62.0	60.0	61.0					9																	35044753		2203	4300	6503	SO:0001819	synonymous_variant	138724			BC045643	CCDS6572.2, CCDS47961.1, CCDS47962.1	9p13.3	2008-02-05			ENSG00000174038	ENSG00000174038			31418	protein-coding gene	gene with protein product							Standard	NM_001287391		Approved	MGC41945	uc003zvw.3	Q5VYM1	OTTHUMG00000019853	ENST00000312292.5:c.2127G>A	9.37:g.35044753G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A6NLE6|E9PB26|Q86XC6|Q9UF74	Silent	SNP	ENST00000312292.5	37	CCDS6572.2																																																																																				0.552	C9orf131-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052283.5	NM_203299	
TBC1D25	4943	broad.mit.edu;hgsc.bcm.edu;mdanderson.org	37	X	48418349	48418349	+	Silent	SNP	C	C	A			TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chrX:48418349C>A	ENST00000376771.4	+	6	1394	c.1053C>A	c.(1051-1053)gcC>gcA	p.A351A	snoU13_ENST00000459609.1_RNA|TBC1D25_ENST00000537536.1_Silent_p.A97A	NM_002536.2	NP_002527.1	Q3MII6	TBC25_HUMAN	TBC1 domain family, member 25	351	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				autophagy (GO:0006914)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of autophagic vacuole maturation (GO:1901096)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)	Rab GTPase activator activity (GO:0005097)			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4						AGGGCCATGCCTTTGTTTGCT	0.582																																						.											0													48.0	32.0	38.0					X																	48418349		2203	4300	6503	SO:0001819	synonymous_variant	4943			L08240	CCDS35242.1	Xp11.23	2014-01-28	2007-01-12	2007-01-12	ENSG00000068354	ENSG00000068354			8092	protein-coding gene	gene with protein product		311240	"""ornithine aminotransferase-like 1"""	OATL1		21383079	Standard	NM_002536		Approved		uc004dka.1	Q3MII6	OTTHUMG00000024123	ENST00000376771.4:c.1053C>A	X.37:g.48418349C>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q08AN9|Q3MII4|Q8TAR9	Silent	SNP	ENST00000376771.4	37	CCDS35242.1																																																																																				0.582	TBC1D25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060764.2	NM_002536	
IGSF1	3547	hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	X	130409464	130409464	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chrX:130409464G>A	ENST00000361420.3	-	16	3251	c.3172C>T	c.(3172-3174)Ctc>Ttc	p.L1058F	IGSF1_ENST00000370903.3_Missense_Mutation_p.L1063F|IGSF1_ENST00000467244.1_5'Flank|IGSF1_ENST00000370910.1_Missense_Mutation_p.L1049F|IGSF1_ENST00000370904.1_Missense_Mutation_p.L1049F			Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1	1058	Ig-like C2-type 10.				regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	coreceptor activity (GO:0015026)|inhibin binding (GO:0034711)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|liver(1)|lung(37)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)	78						GTGACTAGGAGTTCCAGGGTG	0.493																																						.											0													142.0	122.0	129.0					X																	130409464		2203	4300	6503	SO:0001583	missense	3547			AF034198	CCDS14629.1, CCDS14630.1, CCDS55490.1, CCDS55491.1	Xq25	2013-01-11			ENSG00000147255	ENSG00000147255		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5948	protein-coding gene	gene with protein product		300137				9521868, 9729118	Standard	NM_001555		Approved	KIAA0364, IGDC1, IGCD1, INHBP, MGC75490, PGSF2	uc004ewe.4	Q8N6C5	OTTHUMG00000022406	ENST00000361420.3:c.3172C>T	X.37:g.130409464G>A	ENSP00000355010:p.Leu1058Phe	Somatic		WXS	Illumina HiSeq	Phase_I	B5MEG2|H9KV64|O15070|Q9NTC8	Missense_Mutation	SNP	ENST00000361420.3	37	CCDS14629.1	.	.	.	.	.	.	.	.	.	.	G	15.95	2.984986	0.53934	.	.	ENSG00000147255	ENST00000370910;ENST00000361420;ENST00000370904;ENST00000370903	T;T;T;T	0.01745	4.66;4.66;4.66;4.66	5.32	5.32	0.75619	Immunoglobulin-like fold (1);	0.107595	0.42172	D	0.000759	T	0.13798	0.0334	M	0.90922	3.16	0.30618	N	0.758828	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.87578	0.996;0.998;0.996	T	0.02813	-1.1107	10	0.72032	D	0.01	.	13.7707	0.63023	0.0:0.0:1.0:0.0	.	1049;502;1058	Q8N6C5-2;C9JP68;Q8N6C5	.;.;IGSF1_HUMAN	F	1049;1058;1049;1063	ENSP00000359947:L1049F;ENSP00000355010:L1058F;ENSP00000359941:L1049F;ENSP00000359940:L1063F	ENSP00000355010:L1058F	L	-	1	0	IGSF1	130237145	1.000000	0.71417	1.000000	0.80357	0.690000	0.40134	4.727000	0.61993	2.562000	0.86427	0.600000	0.82982	CTC		0.493	IGSF1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058288.1		
PPP1R1A	5502	hgsc.bcm.edu	37	12	54982196	54982196	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr12:54982196G>A	ENST00000257905.8	-	1	247	c.77C>T	c.(76-78)gCg>gTg	p.A26V	PPP1R1A_ENST00000547431.1_Missense_Mutation_p.A26V	NM_006741.3	NP_006732	Q13522	PPR1A_HUMAN	protein phosphatase 1, regulatory (inhibitor) subunit 1A	26					glycogen metabolic process (GO:0005977)|negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	protein serine/threonine phosphatase inhibitor activity (GO:0004865)			lung(2)	2						CACCTGCTCCGCCGCCTCGGG	0.721																																						.											0													5.0	7.0	6.0					12																	54982196		1704	3661	5365	SO:0001583	missense	5502			U48707	CCDS44912.1	12q13.2	2012-04-17			ENSG00000135447	ENSG00000135447	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9286	protein-coding gene	gene with protein product		613246				8611507	Standard	NM_006741		Approved		uc001sgg.2	Q13522	OTTHUMG00000169934	ENST00000257905.8:c.77C>T	12.37:g.54982196G>A	ENSP00000257905:p.Ala26Val	Somatic		WXS	Illumina HiSeq	Phase_I	Q6IB01|Q8TBJ2|Q8WWV2	Missense_Mutation	SNP	ENST00000257905.8	37	CCDS44912.1	.	.	.	.	.	.	.	.	.	.	g	21.8	4.206739	0.79127	.	.	ENSG00000135447	ENST00000379690;ENST00000257905	T	0.29142	1.58	3.73	2.73	0.32206	.	0.174694	0.33772	N	0.004572	T	0.28400	0.0702	L	0.38531	1.155	0.25462	N	0.987909	P	0.51791	0.948	P	0.50934	0.654	T	0.05435	-1.0885	10	0.25751	T	0.34	.	8.5449	0.33415	0.0:0.2389:0.7611:0.0	.	26	Q13522	PPR1A_HUMAN	V	26	ENSP00000257905:A26V	ENSP00000257905:A26V	A	-	2	0	PPP1R1A	53268463	0.944000	0.32072	1.000000	0.80357	0.980000	0.70556	3.933000	0.56545	1.817000	0.53016	0.306000	0.20318	GCG		0.721	PPP1R1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406604.1	NM_006741	
PKD1	5310	hgsc.bcm.edu	37	16	2139968	2139968	+	Silent	SNP	G	G	A			TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr16:2139968G>A	ENST00000262304.4	-	46	12880	c.12672C>T	c.(12670-12672)acC>acT	p.T4224T	MIR1225_ENST00000408729.1_RNA|RP11-304L19.1_ENST00000570072.1_RNA|PKD1_ENST00000423118.1_Silent_p.T4223T	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	4224					anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						GGTCAAACTGGGTGAGCAGGG	0.687																																						.											0													32.0	31.0	31.0					16																	2139968		2193	4293	6486	SO:0001819	synonymous_variant	5310			L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.12672C>T	16.37:g.2139968G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q15140|Q15141	Silent	SNP	ENST00000262304.4	37	CCDS32369.1																																																																																				0.687	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1		
DST	667	hgsc.bcm.edu	37	6	56335065	56335065	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr6:56335065C>T	ENST00000361203.3	-	91	21384	c.21377G>A	c.(21376-21378)cGc>cAc	p.R7126H	DST_ENST00000312431.6_3'UTR|DST_ENST00000421834.2_Missense_Mutation_p.R5122H|DST_ENST00000370769.4_Missense_Mutation_p.R7237H|DST_ENST00000370788.2_Missense_Mutation_p.R5040H|DST_ENST00000370754.5_Missense_Mutation_p.R7415H|DST_ENST00000446842.2_Missense_Mutation_p.R6911H|DST_ENST00000244364.6_Missense_Mutation_p.R4823H			Q03001	DYST_HUMAN	dystonin	7235					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CATCTCCAAGCGACTGGTTGG	0.388																																						.											0													53.0	48.0	49.0					6																	56335065		1867	4109	5976	SO:0001583	missense	667			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.21377G>A	6.37:g.56335065C>T	ENSP00000354508:p.Arg7126His	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000361203.3	37		.	.	.	.	.	.	.	.	.	.	C	19.34	3.809386	0.70797	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	T;T;T;T;T;T;T	0.72505	-0.66;-0.66;-0.66;-0.66;-0.66;-0.66;-0.66	5.26	5.26	0.73747	EF-hand-like domain (1);	0.000000	0.46758	D	0.000265	T	0.79370	0.4434	L	0.53249	1.67	0.33897	D	0.638007	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.998;1.0;0.999;0.984;0.983	T	0.80603	-0.1309	9	0.72032	D	0.01	.	19.2223	0.93803	0.0:1.0:0.0:0.0	.	5122;7237;7415;7235;4823	Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8	.;.;.;DYST_HUMAN;.	H	4823;7415;7237;5122;6911;5040;7126	ENSP00000244364:R4823H;ENSP00000359790:R7415H;ENSP00000359805:R7237H;ENSP00000400883:R5122H;ENSP00000393645:R6911H;ENSP00000359824:R5040H;ENSP00000354508:R7126H	ENSP00000244364:R4823H	R	-	2	0	DST	56443024	1.000000	0.71417	0.996000	0.52242	0.995000	0.86356	7.750000	0.85110	2.620000	0.88729	0.655000	0.94253	CGC		0.388	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
GATA1	2623	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	X	48652278	48652278	+	Missense_Mutation	SNP	C	C	G			TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chrX:48652278C>G	ENST00000376670.3	+	6	1060	c.949C>G	c.(949-951)Cgg>Ggg	p.R317G	GATA1_ENST00000376665.3_Intron	NM_002049.3	NP_002040.1	P15976	GATA1_HUMAN	GATA binding protein 1 (globin transcription factor 1)	317					basophil differentiation (GO:0030221)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cellular response to thyroid hormone stimulus (GO:0097067)|dendritic cell differentiation (GO:0097028)|embryonic hemopoiesis (GO:0035162)|eosinophil differentiation (GO:0030222)|eosinophil fate commitment (GO:0035854)|erythrocyte development (GO:0048821)|erythrocyte differentiation (GO:0030218)|in utero embryonic development (GO:0001701)|male gonad development (GO:0008584)|megakaryocyte differentiation (GO:0030219)|negative regulation of apoptotic process (GO:0043066)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cell proliferation (GO:0008285)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of definitive erythrocyte differentiation (GO:0010724)|regulation of glycoprotein biosynthetic process (GO:0010559)|transcription from RNA polymerase II promoter (GO:0006366)|transcriptional activation by promoter-enhancer looping (GO:0071733)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	C2H2 zinc finger domain binding (GO:0070742)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|enhancer sequence-specific DNA binding (GO:0001158)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(259)|large_intestine(8)|lung(9)|prostate(1)	283						GAAAAAGAAACGGGGCTCCAG	0.602			"""Mis, F"""		megakaryoblastic leukemia of Downs Syndrome																																Pancreas(9;429 505 11287 29617)	.		Dom	yes		X	Xp11.23	2623	GATA binding protein 1 (globin transcription factor 1)		L	0													34.0	31.0	32.0					X																	48652278		2203	4300	6503	SO:0001583	missense	2623			X17254	CCDS14305.1	Xp11.23	2014-09-17	2001-11-28		ENSG00000102145	ENSG00000102145		"""GATA zinc finger domain containing"""	4170	protein-coding gene	gene with protein product	"""nuclear factor, erythroid 1"""	305371	"""GATA-binding protein 1 (globin transcription factor 1)"""	GF1		1999341	Standard	NM_002049		Approved	ERYF1, NFE1, GATA-1, NF-E1	uc004dkq.4	P15976	OTTHUMG00000021504	ENST00000376670.3:c.949C>G	X.37:g.48652278C>G	ENSP00000365858:p.Arg317Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q96GB8	Missense_Mutation	SNP	ENST00000376670.3	37	CCDS14305.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	9.621|9.621	1.133764|1.133764	0.21123|0.21123	.|.	.|.	ENSG00000102145|ENSG00000102145	ENST00000447551|ENST00000376670	.|D	.|0.97620	.|-4.46	3.08|3.08	1.12|1.12	0.20585|0.20585	.|.	.|0.150111	.|0.42420	.|U	.|0.000713	D|D	0.91112|0.91112	0.7202|0.7202	N|N	0.20685|0.20685	0.6|0.6	0.09310|0.09310	N|N	1|1	.|B	.|0.14012	.|0.009	.|B	.|0.12156	.|0.007	T|T	0.82426|0.82426	-0.0463|-0.0463	5|10	.|0.34782	.|T	.|0.22	-2.7506|-2.7506	6.8314|6.8314	0.23913|0.23913	0.5023:0.4977:0.0:0.0|0.5023:0.4977:0.0:0.0	.|.	.|317	.|P15976	.|GATA1_HUMAN	K|G	81|317	.|ENSP00000365858:R317G	.|ENSP00000365858:R317G	N|R	+|+	3|1	2|2	GATA1|GATA1	48537222|48537222	0.956000|0.956000	0.32656|0.32656	0.059000|0.059000	0.19551|0.19551	0.776000|0.776000	0.43924|0.43924	-0.001000|-0.001000	0.12947|0.12947	0.159000|0.159000	0.19401|0.19401	0.365000|0.365000	0.22127|0.22127	AAC|CGG		0.602	GATA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056517.1	NM_002049	
RBMXL3	139804	hgsc.bcm.edu	37	X	114425181	114425181	+	Missense_Mutation	SNP	A	A	G	rs55659078|rs66891148		TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chrX:114425181A>G	ENST00000424776.3	+	1	1219	c.1177A>G	c.(1177-1179)Aga>Gga	p.R393G	LRCH2_ENST00000317135.8_Intron|LRCH2_ENST00000538422.1_Intron	NM_001145346.1	NP_001138818.1	Q8N7X1	RMXL3_HUMAN	RNA binding motif protein, X-linked-like 3	393	Gly-rich.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(13)|kidney(2)|skin(1)	16						CGAGGAGTACAGAGGCCGCTC	0.622																																						.											0													14.0	15.0	15.0					X																	114425181		689	1585	2274	SO:0001583	missense	139804			AK097568	CCDS55478.1	Xq23	2013-02-12	2009-03-24	2009-03-24	ENSG00000175718	ENSG00000175718		"""RNA binding motif (RRM) containing"""	26859	protein-coding gene	gene with protein product			"""chromosome X open reading frame 55"""	CXorf55			Standard	NM_001145346		Approved	FLJ40249	uc011mte.1	Q8N7X1	OTTHUMG00000022230	ENST00000424776.3:c.1177A>G	X.37:g.114425181A>G	ENSP00000417451:p.Arg393Gly	Somatic		WXS	Illumina HiSeq	Phase_I	B4DXC0	Missense_Mutation	SNP	ENST00000424776.3	37	CCDS55478.1	.	.	.	.	.	.	.	.	.	.	A	8.693	0.907954	0.17833	.	.	ENSG00000175718	ENST00000424776	T	0.05855	3.38	0.341	0.341	0.15991	.	.	.	.	.	T	0.03263	0.0095	N	0.08118	0	0.19775	N	0.999956	B	0.10296	0.003	B	0.01281	0.0	T	0.41448	-0.9508	9	0.87932	D	0	.	5.0049	0.14282	0.9998:0.0:2.0E-4:0.0	.	393	Q8N7X1	RMXL3_HUMAN	G	393	ENSP00000417451:R393G	ENSP00000417451:R393G	R	+	1	2	RBMXL3	114331437	0.014000	0.17966	0.074000	0.20217	0.114000	0.19823	-0.464000	0.06688	0.353000	0.24079	0.104000	0.15600	AGA		0.622	RBMXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057968.3	NM_001145346	
MUC6	4588	broad.mit.edu	37	11	1018714	1018714	+	Missense_Mutation	SNP	G	G	A	rs371302246		TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr11:1018714G>A	ENST00000421673.2	-	31	4137	c.4087C>T	c.(4087-4089)Cgt>Tgt	p.R1363C		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1363	Pro-rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGGGTTGGACGTGGGCCTGTC	0.542																																						.											0									CYS/ARG	0,4370		0,0,2185	191.0	207.0	201.0		4087	1.4	0.0	11		201	1,8557		0,1,4278	no	missense	MUC6	NM_005961.2	180	0,1,6463	AA,AG,GG		0.0117,0.0,0.0077	probably-damaging	1363/2440	1018714	1,12927	2185	4279	6464	SO:0001583	missense	4588			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.4087C>T	11.37:g.1018714G>A	ENSP00000406861:p.Arg1363Cys	Somatic		WXS	Illumina HiSeq	Phase_I	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	g	8.824	0.938199	0.18206	0.0	1.17E-4	ENSG00000184956	ENST00000421673	T	0.20069	2.1	1.39	1.39	0.22231	.	.	.	.	.	T	0.06554	0.0168	N	0.08118	0	0.09310	N	1	P	0.43477	0.808	B	0.20955	0.032	T	0.21109	-1.0255	9	0.52906	T	0.07	.	4.8411	0.13491	0.0:0.0:0.639:0.361	.	1363	Q6W4X9	MUC6_HUMAN	C	1363	ENSP00000406861:R1363C	ENSP00000406861:R1363C	R	-	1	0	MUC6	1008714	0.000000	0.05858	0.006000	0.13384	0.187000	0.23431	-3.997000	0.00317	1.103000	0.41568	0.298000	0.19748	CGT		0.542	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
DOCK9	23348	broad.mit.edu	37	13	99476685	99476685	+	Silent	SNP	T	T	C			TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr13:99476685T>C	ENST00000376460.1	-	46	5177	c.5097A>G	c.(5095-5097)gaA>gaG	p.E1699E	DOCK9_ENST00000448493.2_3'UTR|DOCK9_ENST00000339416.2_Silent_p.E1700E	NM_001130048.1|NM_015296.2	NP_001123520.1|NP_056111.1	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9	1700	DHR-2.				blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(18)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					TCCCCACGTCTTCCATCATGG	0.542																																						.											0													166.0	162.0	163.0					13																	99476685		2025	4165	6190	SO:0001819	synonymous_variant	23348			AF527605	CCDS45062.1	13q32.3	2013-01-10			ENSG00000088387	ENSG00000088387		"""Pleckstrin homology (PH) domain containing"""	14132	protein-coding gene	gene with protein product	"""zizimin1"""	607325				12172552, 12432077	Standard	NM_015296		Approved	KIAA1058, ZIZ1	uc001vnt.2	Q9BZ29	OTTHUMG00000017260	ENST00000376460.1:c.5097A>G	13.37:g.99476685T>C		Somatic		WXS	Illumina HiSeq	Phase_I	B3KX25|E9PFM9|Q5JUD4|Q5JUD6|Q5T2Q1|Q5TAN8|Q9BZ25|Q9BZ26|Q9BZ27|Q9BZ28|Q9UPU4	Silent	SNP	ENST00000376460.1	37	CCDS45062.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	10.19|10.19	1.281689|1.281689	0.23392|0.23392	.|.	.|.	ENSG00000088387|ENSG00000088387	ENST00000419908|ENST00000400228	.|.	.|.	.|.	5.43|5.43	3.0|3.0	0.34707|0.34707	.|.	.|.	.|.	.|.	.|.	T|T	0.58264|0.58264	0.2110|0.2110	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.50996|0.50996	-0.8761|-0.8761	4|4	.|.	.|.	.|.	.|.	8.8472|8.8472	0.35177|0.35177	0.0:0.2321:0.0:0.7679|0.0:0.2321:0.0:0.7679	.|.	.|.	.|.	.|.	R|G	117|264	.|.	.|.	K|R	-|-	2|1	0|2	DOCK9|DOCK9	98274686|98274686	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.997000|0.997000	0.91878|0.91878	1.521000|1.521000	0.35910|0.35910	0.371000|0.371000	0.24564|0.24564	0.533000|0.533000	0.62120|0.62120	AAG|AGA		0.542	DOCK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045566.1	NM_015296	
KCNH5	27133	broad.mit.edu	37	14	63316516	63316516	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr14:63316516T>C	ENST00000322893.7	-	8	1692	c.1424A>G	c.(1423-1425)tAt>tGt	p.Y475C	KCNH5_ENST00000420622.2_Missense_Mutation_p.Y475C|KCNH5_ENST00000394968.1_Missense_Mutation_p.Y417C	NM_139318.3	NP_647479.2	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 5	475					potassium ion transmembrane transport (GO:0071805)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(33)|ovary(5)|prostate(2)|skin(17)|upper_aerodigestive_tract(4)|urinary_tract(2)	99				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		GGTGTTGGCATACATTTGCTG	0.358																																						.											0													145.0	127.0	133.0					14																	63316516		2203	4299	6502	SO:0001583	missense	27133			U69185	CCDS9756.1, CCDS45122.1	14q23.1	2012-07-05			ENSG00000140015	ENSG00000140015		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6254	protein-coding gene	gene with protein product		605716				9738473, 16382104	Standard	NM_139318		Approved	Kv10.2, H-EAG2, eag2	uc001xfx.3	Q8NCM2	OTTHUMG00000029041	ENST00000322893.7:c.1424A>G	14.37:g.63316516T>C	ENSP00000321427:p.Tyr475Cys	Somatic		WXS	Illumina HiSeq	Phase_I	C9JP98	Missense_Mutation	SNP	ENST00000322893.7	37	CCDS9756.1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.135686	0.77662	.	.	ENSG00000140015	ENST00000322893;ENST00000420622;ENST00000394968	D;D;D	0.99080	-5.4;-5.18;-5.2	5.36	5.36	0.76844	Cyclic nucleotide-binding-like (1);	0.000000	0.85682	D	0.000000	D	0.99293	0.9753	M	0.87971	2.92	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.74674	0.967;0.959;0.984	D	0.99075	1.0835	10	0.87932	D	0	.	14.8119	0.70003	0.0:0.0:0.0:1.0	.	417;475;475	Q8NCM2-3;Q8NCM2-2;Q8NCM2	.;.;KCNH5_HUMAN	C	475;475;417	ENSP00000321427:Y475C;ENSP00000395439:Y475C;ENSP00000378419:Y417C	ENSP00000321427:Y475C	Y	-	2	0	KCNH5	62386269	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.997000	0.88414	2.147000	0.66899	0.528000	0.53228	TAT		0.358	KCNH5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411747.1	NM_139318	
ARMC5	79798	broad.mit.edu	37	16	31471187	31471189	+	In_Frame_Del	DEL	GTC	GTC	-	rs199693319|rs184376263|rs538649451	byFrequency	TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	GTC	GTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr16:31471187_31471189delGTC	ENST00000563544.1	+	2	888_890	c.342_344delGTC	c.(340-345)gtgtcg>gtg	p.S118del	ARMC5_ENST00000538189.1_In_Frame_Del_p.S150del|ARMC5_ENST00000408912.3_In_Frame_Del_p.S213del|RP11-452L6.5_ENST00000564629.1_RNA|ARMC5_ENST00000412665.2_5'Flank|ARMC5_ENST00000457010.2_In_Frame_Del_p.S118del|ARMC5_ENST00000268314.4_In_Frame_Del_p.S118del			Q96C12	ARMC5_HUMAN	armadillo repeat containing 5	118										central_nervous_system(1)|endometrium(4)|large_intestine(3)|liver(2)|lung(12)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28						ccTCCGCTGTGTCGTCGTCTAGT	0.734														2	0.000399361	0.0	0.0	5008	,	,		10839	0.001		0.0	False		,,,				2504	0.001					.											0									,	2,3402		1,0,1701					,	-4.4	0.0			11	12,7356		5,2,3677	no	coding,coding	ARMC5	NM_024742.2,NM_001105247.1	,	6,2,5378	A1A1,A1R,RR		0.1629,0.0588,0.13	,	,		14,10758				SO:0001651	inframe_deletion	79798			AY217348	CCDS42155.1, CCDS45472.1, CCDS73874.1	16p11	2013-02-14			ENSG00000140691	ENSG00000140691		"""Armadillo repeat containing"""	25781	protein-coding gene	gene with protein product		615549					Standard	NM_024742		Approved	FLJ13063	uc002ecc.3	Q96C12	OTTHUMG00000176618	ENST00000563544.1:c.342_344delGTC	16.37:g.31471193_31471195delGTC	ENSP00000456877:p.Ser118del	Somatic		WXS	Illumina HiSeq	Phase_I	Q86WM9|Q9H7P8|Q9H925	In_Frame_Del	DEL	ENST00000563544.1	37	CCDS45472.1																																																																																				0.734	ARMC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432847.1	NM_024742	
POLR2A	5430	broad.mit.edu	37	17	7404959	7404959	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr17:7404959T>C	ENST00000322644.6	+	14	2659	c.2260T>C	c.(2260-2262)Tcc>Ccc	p.S754P		NM_000937.4	NP_000928	P24928	RPB1_HUMAN	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	754					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA-directed RNA polymerase activity (GO:0003968)|ubiquitin protein ligase binding (GO:0031625)			breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(17)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	50		Prostate(122;0.173)				CAAGACTGGCTCCTCTGCTCA	0.502																																						.											0													83.0	78.0	80.0					17																	7404959		2203	4300	6503	SO:0001583	missense	5430					17p13.1	2013-01-21	2002-08-29		ENSG00000181222	ENSG00000181222	2.7.7.6	"""RNA polymerase subunits"""	9187	protein-coding gene	gene with protein product	"""DNA-directed RNA polymerase II largest subunit, RNA polymerase II 220 kd subunit"", ""RNA polymerase II subunit B1"""	180660	"""polymerase (RNA) II (DNA directed) polypeptide A (220kD)"""	POLR2			Standard	NM_000937		Approved	POLRA, RPB1	uc002ghf.4	P24928	OTTHUMG00000177594	ENST00000322644.6:c.2260T>C	17.37:g.7404959T>C	ENSP00000314949:p.Ser754Pro	Somatic		WXS	Illumina HiSeq	Phase_I	A6NN93|B9EH88|Q6NX41	Missense_Mutation	SNP	ENST00000322644.6	37	CCDS32548.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.613984	0.87359	.	.	ENSG00000181222	ENST00000535204;ENST00000322644	T	0.66815	-0.23	6.07	6.07	0.98685	RNA polymerase Rpb1, domain 4 (1);	0.000000	0.85682	D	0.000000	T	0.73853	0.3640	M	0.62723	1.935	0.80722	D	1	P	0.42039	0.769	P	0.49451	0.611	T	0.76468	-0.2948	10	0.87932	D	0	-16.3469	15.6114	0.76721	0.0:0.0:0.0:1.0	.	754	P24928	RPB1_HUMAN	P	710;754	ENSP00000314949:S754P	ENSP00000314949:S754P	S	+	1	0	SLC35G6	7345683	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.861000	0.87004	2.326000	0.78906	0.533000	0.62120	TCC		0.502	POLR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437967.1	NM_000937	
MN1	4330	broad.mit.edu	37	22	28193289	28193289	+	Silent	SNP	C	C	T			TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr22:28193289C>T	ENST00000302326.4	-	1	4197	c.3243G>A	c.(3241-3243)tcG>tcA	p.S1081S		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	1081					intramembranous ossification (GO:0001957)					NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						GGAGTTTGGGCGAGCCGGTCA	0.662			T	ETV6	"""AML, meningioma"""																																	.		Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	0													20.0	23.0	22.0					22																	28193289		1957	4130	6087	SO:0001819	synonymous_variant	4330			X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.3243G>A	22.37:g.28193289C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A9Z1V9	Silent	SNP	ENST00000302326.4	37	CCDS42998.1																																																																																				0.662	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320737.1	NM_002430	
SLC26A6	65010	broad.mit.edu;ucsc.edu;mdanderson.org	37	3	48669762	48669762	+	Silent	SNP	G	G	A	rs146756914	byFrequency	TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr3:48669762G>A	ENST00000395550.2	-	5	548	c.501C>T	c.(499-501)aaC>aaT	p.N167N	SLC26A6_ENST00000358747.6_Silent_p.N146N|SLC26A6_ENST00000455886.2_Intron|SLC26A6_ENST00000383733.3_Silent_p.N167N|SLC26A6_ENST00000420764.2_Silent_p.N167N|SLC26A6_ENST00000337000.8_Intron|SLC26A6_ENST00000482282.1_5'UTR			Q9BXS9	S26A6_HUMAN	solute carrier family 26 (anion exchanger), member 6	167					angiotensin-activated signaling pathway (GO:0038166)|anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|cellular response to cAMP (GO:0071320)|cellular response to fructose stimulus (GO:0071332)|cellular response to interferon-gamma (GO:0071346)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|epithelial fluid transport (GO:0042045)|formate transport (GO:0015724)|intestinal absorption (GO:0050892)|intracellular pH elevation (GO:0051454)|ion transport (GO:0006811)|mannitol transport (GO:0015797)|oxalate transport (GO:0019532)|oxalic acid secretion (GO:0046724)|positive regulation of dipeptide transmembrane transport (GO:2001150)|protein kinase C signaling (GO:0070528)|regulation of intracellular pH (GO:0051453)|sperm capacitation (GO:0048240)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transepithelial chloride transport (GO:0030321)|transepithelial transport (GO:0070633)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|chloride channel complex (GO:0034707)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane-bounded vesicle (GO:0031988)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)|vesicle membrane (GO:0012506)	anion:anion antiporter activity (GO:0015301)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride channel activity (GO:0005254)|chloride transmembrane transporter activity (GO:0015108)|efflux transmembrane transporter activity (GO:0015562)|formate efflux transmembrane transporter activity (GO:0015660)|formate transmembrane transporter activity (GO:0015499)|formate uptake transmembrane transporter activity (GO:0015659)|oxalate transmembrane transporter activity (GO:0019531)|PDZ domain binding (GO:0030165)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)		SLC26A6/PRKAR2A(2)	NS(1)|breast(1)|cervix(1)|endometrium(3)|large_intestine(1)|lung(11)|ovary(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00609)		TCATGGAGTCGTTCAAGGCCT	0.592													G|||	6	0.00119808	0.0045	0.0	5008	,	,		20479	0.0		0.0	False		,,,				2504	0.0				NSCLC(13;369 479 28271 30152 44026)	.											0								G	,,,	1,4289		0,1,2144	56.0	62.0	60.0		438,501,501,501	-0.4	0.0	3	dbSNP_134	60	0,8476		0,0,4238	yes	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	SLC26A6	NM_001040454.1,NM_022911.2,NM_134263.2,NM_134426.2	,,,	0,1,6382	AA,AG,GG		0.0,0.0233,0.0078	,,,	146/739,167/760,167/759,167/741	48669762	1,12765	2145	4238	6383	SO:0001819	synonymous_variant	65010			AF279265	CCDS43087.1, CCDS46824.1, CCDS46825.1, CCDS46826.1, CCDS63627.1, CCDS63628.1	3p21.31	2013-08-05	2013-07-18		ENSG00000225697	ENSG00000225697		"""Solute carriers"""	14472	protein-coding gene	gene with protein product	"""pendrin-like protein 1"", ""pendrin L1"", ""sulfate anion transporter"", ""anion transporter 1"""	610068	"""solute carrier family 26, member 6"""			11087667, 11247665	Standard	NM_022911		Approved	DKFZp586E1422		Q9BXS9	OTTHUMG00000186381	ENST00000395550.2:c.501C>T	3.37:g.48669762G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B4DMZ1|Q548A7|Q96Q90|Q9NQU1	Silent	SNP	ENST00000395550.2	37	CCDS43087.1																																																																																				0.592	SLC26A6-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345040.1	NM_022911	
DDX60	55601	broad.mit.edu	37	4	169196590	169196590	+	Missense_Mutation	SNP	C	C	T	rs574811561		TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr4:169196590C>T	ENST00000393743.3	-	16	2501	c.2210G>A	c.(2209-2211)cGg>cAg	p.R737Q		NM_017631.5	NP_060101.3	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	737					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)	p.R737Q(2)		breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|urinary_tract(4)	63		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		CAGTTGGAACCGAGCTGGCCC	0.393													C|||	1	0.000199681	0.0008	0.0	5008	,	,		15607	0.0		0.0	False		,,,				2504	0.0					.											2	Substitution - Missense(2)	endometrium(2)											101.0	98.0	99.0					4																	169196590		2203	4300	6503	SO:0001583	missense	55601			AK001649	CCDS34097.1	4q32.3	2010-02-17			ENSG00000137628	ENSG00000137628			25942	protein-coding gene	gene with protein product		613974				12477932	Standard	NM_017631		Approved	FLJ20035	uc003irp.3	Q8IY21	OTTHUMG00000161350	ENST00000393743.3:c.2210G>A	4.37:g.169196590C>T	ENSP00000377344:p.Arg737Gln	Somatic		WXS	Illumina HiSeq	Phase_I	Q6PK35|Q9NVE3	Missense_Mutation	SNP	ENST00000393743.3	37	CCDS34097.1	.	.	.	.	.	.	.	.	.	.	C	18.88	3.717358	0.68844	.	.	ENSG00000137628	ENST00000393743	T	0.18174	2.23	5.37	3.65	0.41850	.	0.102711	0.43110	N	0.000614	T	0.28665	0.0710	L	0.32530	0.975	0.29601	N	0.847719	D	0.89917	1.0	D	0.87578	0.998	T	0.06303	-1.0834	10	0.40728	T	0.16	.	12.3977	0.55395	0.0:0.8661:0.0:0.1339	.	737	Q8IY21	DDX60_HUMAN	Q	737	ENSP00000377344:R737Q	ENSP00000377344:R737Q	R	-	2	0	DDX60	169433165	0.980000	0.34600	0.431000	0.26735	0.718000	0.41266	2.491000	0.45303	0.748000	0.32831	0.563000	0.77884	CGG		0.393	DDX60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364622.1	NM_017631	
TENM3	55714	broad.mit.edu;mdanderson.org;bcgsc.ca	37	4	183594221	183594221	+	Missense_Mutation	SNP	G	G	A	rs544403548		TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr4:183594221G>A	ENST00000511685.1	+	7	1298	c.1175G>A	c.(1174-1176)cGa>cAa	p.R392Q	TENM3_ENST00000406950.2_Missense_Mutation_p.R392Q			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	392					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										GATATTGGCCGAAGAGCAATT	0.388													G|||	1	0.000199681	0.0	0.0	5008	,	,		15262	0.001		0.0	False		,,,				2504	0.0					.											0													42.0	40.0	40.0					4																	183594221		1809	4078	5887	SO:0001583	missense	55714			AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.1175G>A	4.37:g.183594221G>A	ENSP00000424226:p.Arg392Gln	Somatic		WXS	Illumina HiSeq	Phase_I	Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Missense_Mutation	SNP	ENST00000511685.1	37	CCDS47165.1	.	.	.	.	.	.	.	.	.	.	G	15.39	2.819612	0.50633	.	.	ENSG00000218336	ENST00000511685;ENST00000406950	T;T	0.19806	2.12;2.12	5.04	5.04	0.67666	.	.	.	.	.	T	0.11067	0.0270	N	0.20574	0.59	0.47214	D	0.999354	P	0.43352	0.804	B	0.25614	0.062	T	0.21793	-1.0235	9	0.12103	T	0.63	.	19.0138	0.92886	0.0:0.0:1.0:0.0	.	392	Q9P273	TEN3_HUMAN	Q	392	ENSP00000424226:R392Q;ENSP00000385276:R392Q	ENSP00000385276:R392Q	R	+	2	0	ODZ3	183831215	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.250000	0.78287	2.789000	0.95967	0.650000	0.86243	CGA		0.388	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361734.1		
SPINK5	11005	broad.mit.edu	37	5	147499644	147499644	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr5:147499644C>T	ENST00000256084.7	+	25	2428	c.2386C>T	c.(2386-2388)Cgg>Tgg	p.R796W	SPINK5_ENST00000398454.1_Missense_Mutation_p.R796W|SPINK5_ENST00000359874.3_Missense_Mutation_p.R796W	NM_006846.3	NP_006837.2	Q9NQ38	ISK5_HUMAN	serine peptidase inhibitor, Kazal type 5	796	Kazal-like 12. {ECO:0000255|PROSITE- ProRule:PRU00798}.				anagen (GO:0042640)|epidermal cell differentiation (GO:0009913)|epithelial cell differentiation (GO:0030855)|extracellular matrix organization (GO:0030198)|hair cell differentiation (GO:0035315)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of immune response (GO:0050777)|negative regulation of proteolysis (GO:0045861)|negative regulation of serine-type peptidase activity (GO:1902572)|regulation of cell adhesion (GO:0030155)|regulation of T cell differentiation (GO:0045580)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|epidermal lamellar body (GO:0097209)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(8)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGACCCTGTCCGGGGTCCAGA	0.388																																						.											0													88.0	78.0	81.0					5																	147499644		1850	4100	5950	SO:0001583	missense	11005			AJ228139	CCDS43382.1, CCDS47300.1, CCDS47301.1	5q31-q32	2014-09-17	2005-08-17		ENSG00000133710	ENSG00000133710		"""Serine peptidase inhibitors, Kazal type"""	15464	protein-coding gene	gene with protein product	"""lymphoepithelial Kazal-type-related inhibitor"""	605010	"""serine protease inhibitor, Kazal type 5"""			10419450	Standard	NM_001127698		Approved	VAKTI, LEKTI, LETKI, NETS, NS, FLJ21544, FLJ97536, FLJ97596, FLJ99794, DKFZp686K19184	uc003loy.2	Q9NQ38	OTTHUMG00000134305	ENST00000256084.7:c.2386C>T	5.37:g.147499644C>T	ENSP00000256084:p.Arg796Trp	Somatic		WXS	Illumina HiSeq	Phase_I	A8MYE8|B7WPB7|D6REN5|O75770|Q3LX95|Q3LX96|Q3LX97|Q96PP2|Q96PP3	Missense_Mutation	SNP	ENST00000256084.7	37	CCDS43382.1	.	.	.	.	.	.	.	.	.	.	C	19.77	3.889670	0.72524	.	.	ENSG00000133710	ENST00000398454;ENST00000359874;ENST00000508733;ENST00000256084	T;T;T;T	0.04706	3.57;3.57;3.57;3.57	5.56	4.67	0.58626	Proteinase inhibitor I1, Kazal (1);Protease inhibitor, Kazal-type (1);	0.155191	0.30473	N	0.009556	T	0.20455	0.0492	M	0.77616	2.38	0.30017	N	0.814676	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.998;1.0;1.0;1.0	T	0.03483	-1.1032	10	0.62326	D	0.03	-6.0089	12.0016	0.53235	0.1729:0.8271:0.0:0.0	.	777;796;796;796	B4DWS3;Q9NQ38-3;Q9NQ38;Q9NQ38-2	.;.;ISK5_HUMAN;.	W	796;796;777;796	ENSP00000381472:R796W;ENSP00000352936:R796W;ENSP00000421519:R777W;ENSP00000256084:R796W	ENSP00000256084:R796W	R	+	1	2	SPINK5	147479837	0.002000	0.14202	0.943000	0.38184	0.986000	0.74619	0.698000	0.25571	1.455000	0.47813	0.557000	0.71058	CGG		0.388	SPINK5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000259215.2	NM_001127698	
CHRM2	1129	broad.mit.edu	37	7	136699614	136699614	+	Start_Codon_SNP	SNP	T	T	A			TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr7:136699614T>A	ENST00000445907.2	+	3	530	c.2T>A	c.(1-3)aTg>aAg	p.M1K	hsa-mir-490_ENST00000586239.1_RNA|CHRM2_ENST00000320658.5_Start_Codon_SNP_p.M1K|hsa-mir-490_ENST00000593789.1_RNA|CHRM2_ENST00000401861.1_Start_Codon_SNP_p.M1K|CHRM2_ENST00000402486.3_Start_Codon_SNP_p.M1K|CHRM2_ENST00000397608.3_Start_Codon_SNP_p.M1K|hsa-mir-490_ENST00000597642.1_RNA|hsa-mir-490_ENST00000592183.1_RNA|hsa-mir-490_ENST00000439694.1_RNA|hsa-mir-490_ENST00000598184.1_RNA|hsa-mir-490_ENST00000425981.2_RNA|CHRM2_ENST00000453373.1_Start_Codon_SNP_p.M1K	NM_001006627.1|NM_001006629.1	NP_001006628.1|NP_001006630.1	P08172	ACM2_HUMAN	cholinergic receptor, muscarinic 2	1					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|nervous system development (GO:0007399)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|regulation of heart contraction (GO:0008016)|response to virus (GO:0009615)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled acetylcholine receptor activity (GO:0016907)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(13)|liver(1)|lung(29)|ovary(4)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	68					Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Bethanechol(DB01019)|Brompheniramine(DB00835)|Carbachol(DB00411)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cocaine(DB00907)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Dicyclomine(DB00804)|Dimetindene(DB08801)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxacurium chloride(DB01135)|Doxepin(DB01142)|Ethopropazine(DB00392)|Fesoterodine(DB06702)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Rocuronium(DB00728)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	GAACGCAAAATGAATAACTCA	0.338																																						.											0													83.0	81.0	82.0					7																	136699614		2203	4300	6503	SO:0001582	initiator_codon_variant	1129				CCDS5843.1	7q35-q36	2014-09-17			ENSG00000181072	ENSG00000181072		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1951	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 2"""	118493					Standard	NM_000739		Approved		uc003vtl.1	P08172	OTTHUMG00000155658	ENST00000445907.2:c.2T>A	7.37:g.136699614T>A	ENSP00000399745:p.Met1Lys	Somatic		WXS	Illumina HiSeq	Phase_I	Q4VBK6|Q9P1X9	Missense_Mutation	SNP	ENST00000445907.2	37	CCDS5843.1	.	.	.	.	.	.	.	.	.	.	T	14.64	2.596948	0.46318	.	.	ENSG00000181072	ENST00000445907;ENST00000453373;ENST00000320658;ENST00000397608;ENST00000402486;ENST00000401861	T;T;T;T;T;T	0.61859	0.07;0.07;0.07;0.07;0.07;0.07	5.33	5.33	0.75918	.	.	.	.	.	T	0.72732	0.3497	.	.	.	0.80722	D	1	P	0.50156	0.932	P	0.58520	0.84	T	0.76653	-0.2880	8	0.72032	D	0.01	-13.8252	15.3404	0.74290	0.0:0.0:0.0:1.0	.	1	P08172	ACM2_HUMAN	K	1	ENSP00000399745:M1K;ENSP00000415386:M1K;ENSP00000319984:M1K;ENSP00000380733:M1K;ENSP00000384937:M1K;ENSP00000384401:M1K	ENSP00000319984:M1K	M	+	2	0	CHRM2	136350154	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.909000	0.75735	2.024000	0.59613	0.477000	0.44152	ATG		0.338	CHRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341010.1		Missense_Mutation
PRUNE2	158471	broad.mit.edu	37	9	79320843	79320843	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr9:79320843T>C	ENST00000376718.3	-	8	6470	c.6347A>G	c.(6346-6348)gAg>gGg	p.E2116G	PRUNE2_ENST00000428286.1_Missense_Mutation_p.E1757G	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	2116					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						CTTCTCAGTCTCTTGCTTTGC	0.483																																						.											0													175.0	161.0	165.0					9																	79320843		1568	3582	5150	SO:0001583	missense	158471			BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.6347A>G	9.37:g.79320843T>C	ENSP00000365908:p.Glu2116Gly	Somatic		WXS	Illumina HiSeq	Phase_I	B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Missense_Mutation	SNP	ENST00000376718.3	37	CCDS47982.1	.	.	.	.	.	.	.	.	.	.	T	7.829	0.719415	0.15372	.	.	ENSG00000106772	ENST00000376718;ENST00000428286;ENST00000422033	T;T	0.50813	0.73;0.73	6.03	4.86	0.63082	.	0.622455	0.15290	N	0.270184	T	0.47021	0.1423	L	0.59436	1.845	0.25993	N	0.982217	B	0.21821	0.061	B	0.23275	0.045	T	0.45116	-0.9283	10	0.66056	D	0.02	-1.7704	12.6433	0.56721	0.0:0.0:0.4297:0.5703	.	2116	Q8WUY3	PRUN2_HUMAN	G	2116;1757;2115	ENSP00000365908:E2116G;ENSP00000397425:E1757G	ENSP00000365908:E2116G	E	-	2	0	PRUNE2	78510663	0.957000	0.32711	0.389000	0.26208	0.007000	0.05969	2.009000	0.40903	1.047000	0.40274	0.533000	0.62120	GAG		0.483	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	NM_138818	
TBC1D13	54662	broad.mit.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	9	131565713	131565713	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr9:131565713C>T	ENST00000372648.5	+	8	878	c.728C>T	c.(727-729)gCc>gTc	p.A243V	TBC1D13_ENST00000223865.8_Intron|TBC1D13_ENST00000466056.1_3'UTR|TBC1D13_ENST00000539497.1_Missense_Mutation_p.A62V	NM_018201.3	NP_060671.3	Q9NVG8	TBC13_HUMAN	TBC1 domain family, member 13	243	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)	6						TACACCTTTGCCACCGACCCC	0.567																																						.											0													95.0	77.0	83.0					9																	131565713		2203	4300	6503	SO:0001583	missense	54662			AK001605	CCDS6911.1, CCDS69677.1	9q34.13	2013-07-09			ENSG00000107021	ENSG00000107021			25571	protein-coding gene	gene with protein product						22762500	Standard	XM_005252060		Approved	FLJ10743	uc010myj.3	Q9NVG8	OTTHUMG00000020760	ENST00000372648.5:c.728C>T	9.37:g.131565713C>T	ENSP00000361731:p.Ala243Val	Somatic		WXS	Illumina HiSeq	Phase_I	A7E2E7|B3KW04|B9EGJ8|Q5T270|Q5T271	Missense_Mutation	SNP	ENST00000372648.5	37	CCDS6911.1	.	.	.	.	.	.	.	.	.	.	C	34	5.348749	0.95807	.	.	ENSG00000107021	ENST00000372648;ENST00000539497	T;T	0.11821	2.74;2.74	5.66	5.66	0.87406	Rab-GAP/TBC domain (4);	0.112447	0.64402	N	0.000012	T	0.39886	0.1095	M	0.78049	2.395	0.80722	D	1	D	0.71674	0.998	D	0.65573	0.936	T	0.13764	-1.0497	10	0.59425	D	0.04	-24.402	18.7486	0.91804	0.0:1.0:0.0:0.0	.	243	Q9NVG8	TBC13_HUMAN	V	243;62	ENSP00000361731:A243V;ENSP00000437751:A62V	ENSP00000361731:A243V	A	+	2	0	TBC1D13	130605534	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.870000	0.69620	2.675000	0.91044	0.655000	0.94253	GCC		0.567	TBC1D13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054496.1	NM_018201	
DMD	1756	broad.mit.edu	37	X	31645807	31645807	+	Missense_Mutation	SNP	G	G	T			TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chrX:31645807G>T	ENST00000357033.4	-	55	8406	c.8200C>A	c.(8200-8202)Ctg>Atg	p.L2734M	DMD_ENST00000343523.2_Missense_Mutation_p.L274M|DMD_ENST00000378677.2_Missense_Mutation_p.L2730M|DMD_ENST00000541735.1_Missense_Mutation_p.L274M|DMD_ENST00000378707.3_Missense_Mutation_p.L274M|DMD_ENST00000359836.1_Missense_Mutation_p.L274M|DMD_ENST00000474231.1_Missense_Mutation_p.L274M	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	2734					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TGTTTCATCAGCTCTTTTACT	0.448																																						.											0													102.0	87.0	92.0					X																	31645807		2202	4300	6502	SO:0001583	missense	1756			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.8200C>A	X.37:g.31645807G>T	ENSP00000354923:p.Leu2734Met	Somatic		WXS	Illumina HiSeq	Phase_I	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	37	CCDS14233.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.24|16.24	3.066465|3.066465	0.55539|0.55539	.|.	.|.	ENSG00000198947|ENSG00000198947	ENST00000465285|ENST00000534884;ENST00000378682;ENST00000378684;ENST00000358062;ENST00000378677;ENST00000357033;ENST00000359836;ENST00000343523;ENST00000542849;ENST00000535280;ENST00000378707;ENST00000541735;ENST00000474231	.|T;T;T;T;T;T;T;T	.|0.61392	.|0.11;0.11;0.11;0.11;0.11;0.11;0.11;0.11	5.81|5.81	4.95|4.95	0.65309|0.65309	.|.	.|0.000000	.|0.30547	.|U	.|0.009394	T|T	0.76004|0.76004	0.3927|0.3927	M|M	0.77820|0.77820	2.39|2.39	0.41503|0.41503	D|D	0.988296|0.988296	.|P;P;P;D;D;P;D;D;D;D	.|0.89917	.|0.826;0.946;0.946;1.0;1.0;0.753;0.999;0.999;1.0;1.0	.|B;P;P;D;D;B;D;D;D;D	.|0.91635	.|0.43;0.864;0.864;0.999;0.999;0.406;0.992;0.986;0.999;0.998	T|T	0.76523|0.76523	-0.2928|-0.2928	5|10	.|0.35671	.|T	.|0.21	.|.	16.1681|16.1681	0.81785|0.81785	0.0:0.1296:0.8703:0.0|0.0:0.1296:0.8703:0.0	.|.	.|2726;2734;2730;1393;1390;274;274;274;274;274	.|P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6;F8VX32;E7ESB2;E7EQS5;E7EQR9;F5GZY3	.|.;DMD_HUMAN;.;.;.;.;.;.;.;.	D|M	462|2726;1393;1390;430;2730;2734;274;274;2734;2611;274;274;274	.|ENSP00000350765:L430M;ENSP00000367948:L2730M;ENSP00000354923:L2734M;ENSP00000352894:L274M;ENSP00000340057:L274M;ENSP00000367979:L274M;ENSP00000444119:L274M;ENSP00000417123:L274M	.|ENSP00000340057:L274M	A|L	-|-	2|1	0|2	DMD|DMD	31555728|31555728	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.972000|0.972000	0.66771|0.66771	1.728000|1.728000	0.38105|0.38105	1.220000|1.220000	0.43490|0.43490	0.508000|0.508000	0.49915|0.49915	GCT|CTG		0.448	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
RBCK1	10616	broad.mit.edu	37	20	400073	400074	+	Frame_Shift_Ins	INS	-	-	G	rs377036635		TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr20:400073_400074insG	ENST00000356286.5	+	5	1248_1249	c.543_544insG	c.(544-546)ggafs	p.G182fs	RBCK1_ENST00000353660.3_Frame_Shift_Ins_p.G140fs|RBCK1_ENST00000382181.2_Frame_Shift_Ins_p.D66fs	NM_031229.2	NP_112506.2	Q9BYM8	HOIL1_HUMAN	RanBP-type and C3HC4-type zinc finger containing 1	182	Interaction with IRF3.|Interaction with TAB2.				negative regulation of necroptotic process (GO:0060546)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein linear polyubiquitination (GO:0097039)|protein polyubiquitination (GO:0000209)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	LUBAC complex (GO:0071797)	ligase activity (GO:0016874)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			kidney(1)|lung(4)	5		all_epithelial(17;0.172)|Lung NSC(37;0.191)|Breast(17;0.231)				CCCAGGAACCCGGACGGGGGCA	0.668																																						.											0																																										SO:0001589	frameshift_variant	10616			U67322	CCDS12998.1, CCDS13000.2	20p13	2014-09-17	2006-06-28	2006-06-28	ENSG00000125826	ENSG00000125826		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, RAN-binding domain containing"""	15864	protein-coding gene	gene with protein product	"""heme-oxidized IRP2 ubiquitin ligase 1"""	610924	"""chromosome 20 open reading frame 18"""	C20orf18			Standard	NM_031229		Approved	RBCK2, XAP4, RNF54, ZRANB4, UBCE7IP3, HOIL1	uc002wdp.4	Q9BYM8	OTTHUMG00000031634	ENST00000356286.5:c.545dupG	20.37:g.400075_400075dupG	ENSP00000348632:p.Gly182fs	Somatic		WXS	Illumina HiSeq	Phase_I	O95623|Q86SL2|Q96BS3|Q9BYM9	Frame_Shift_Ins	INS	ENST00000356286.5	37	CCDS13000.2																																																																																				0.668	RBCK1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077461.3	NM_031229	
RHBDD3	25807	broad.mit.edu	37	22	29661514	29661515	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr22:29661514_29661515insC	ENST00000216085.7	-	3	525_526	c.101_102insG	c.(100-102)ggcfs	p.G34fs	EWSR1_ENST00000332035.6_5'Flank|EWSR1_ENST00000397938.2_5'Flank|EWSR1_ENST00000414183.2_5'Flank|EWSR1_ENST00000331029.7_5'Flank|EWSR1_ENST00000406548.1_5'Flank|EWSR1_ENST00000332050.6_5'Flank|EWSR1_ENST00000333395.6_5'Flank	NM_012265.1	NP_036397.1	Q9Y3P4	RHBD3_HUMAN	rhomboid domain containing 3	34					liver development (GO:0001889)|MAPK cascade (GO:0000165)|negative regulation of natural killer cell activation (GO:0032815)|positive regulation of protein catabolic process (GO:0045732)|regulation of acute inflammatory response (GO:0002673)|regulation of protein secretion (GO:0050708)|response to xenobiotic stimulus (GO:0009410)	integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)			lung(1)|ovary(1)	2						CCAGGCCGGGGCCGGCCCCCAC	0.683																																						.											0																																										SO:0001589	frameshift_variant	25807			AL050346	CCDS13850.1	22q12.2	2006-02-22	2006-02-22	2006-02-22	ENSG00000100263	ENSG00000100263			1308	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 3"""	C22orf3		10591208, 15105437	Standard	NM_012265		Approved	PTAG	uc003aeq.1	Q9Y3P4	OTTHUMG00000151032	ENST00000216085.7:c.102dupG	22.37:g.29661516_29661516dupC	ENSP00000216085:p.Gly34fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q6I9X3|Q9UGQ7	Frame_Shift_Ins	INS	ENST00000216085.7	37	CCDS13850.1																																																																																				0.683	RHBDD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321085.1	NM_012265	
MASP1	5648	broad.mit.edu	37	3	186978580	186978581	+	Frame_Shift_Ins	INS	-	-	G			TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr3:186978580_186978581insG	ENST00000337774.5	-	4	884_885	c.495_496insC	c.(493-498)tactgcfs	p.C166fs	MASP1_ENST00000495249.1_Intron|MASP1_ENST00000296280.6_Frame_Shift_Ins_p.C166fs|MASP1_ENST00000169293.6_Frame_Shift_Ins_p.C166fs|MASP1_ENST00000392470.2_Frame_Shift_Ins_p.C140fs|MASP1_ENST00000392472.2_Frame_Shift_Ins_p.C53fs	NM_001879.5	NP_001870.3	P48740	MASP1_HUMAN	mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)	166	EGF-like; calcium-binding.|Homodimerization. {ECO:0000250}.|Interaction with FCN2.|Interaction with MBL2.				complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|negative regulation of complement activation (GO:0045916)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(27)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	60	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		CGGCAGGAGCAGTAGTAGCCGC	0.554																																						.											0																																										SO:0001589	frameshift_variant	5648			D28593	CCDS33907.1, CCDS33908.1, CCDS33909.1	3q27-q28	2014-09-17	2005-08-17		ENSG00000127241	ENSG00000127241		"""Serine peptidases / Serine peptidases"""	6901	protein-coding gene	gene with protein product		600521	"""mannan-binding lectin serine protease 1 (C4/C2 activating component of Ra-reactive factor)"""	CRARF, PRSS5		8018603, 8240317	Standard	NR_033519		Approved	MASP	uc003fri.3	P48740	OTTHUMG00000156461	ENST00000337774.5:c.496dupC	3.37:g.186978581_186978581dupG	ENSP00000336792:p.Cys166fs	Somatic		WXS	Illumina HiSeq	Phase_I	A8K542|A8K6M1|B4E2L7|O95570|Q68D21|Q8IUV8|Q96RS4|Q9UF09	Frame_Shift_Ins	INS	ENST00000337774.5	37	CCDS33907.1																																																																																				0.554	MASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344262.1	NM_001879	
ADORA3	140	ucsc.edu;mdanderson.org;bcgsc.ca	37	1	112029261	112029261	+	Missense_Mutation	SNP	G	G	T			TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr1:112029261G>T	ENST00000369716.4	-	4	952	c.819C>A	c.(817-819)aaC>aaA	p.N273K	ADORA3_ENST00000369717.4_Missense_Mutation_p.N192K	NM_020683.6	NP_065734.5	P33765	AA3R_HUMAN	adenosine A3 receptor	0					activation of adenylate cyclase activity (GO:0007190)|histamine secretion by mast cell (GO:0002553)|inflammatory response (GO:0006954)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of mucus secretion (GO:0070257)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of heart contraction (GO:0008016)|response to wounding (GO:0009611)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	G-protein coupled adenosine receptor activity (GO:0001609)			NS(1)|breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)|skin(1)	12		all_cancers(81;1.63e-06)|all_epithelial(167;5.01e-06)|all_lung(203;8.02e-05)|Lung NSC(277;0.000156)		all cancers(265;0.0185)|Colorectal(144;0.0186)|Lung(183;0.0238)|COAD - Colon adenocarcinoma(174;0.0644)|Epithelial(280;0.0872)|LUSC - Lung squamous cell carcinoma(189;0.134)	Adenosine(DB00640)|Aminophylline(DB01223)|Enprofylline(DB00824)	TTCTGGTTTTGTTGCCTGATA	0.557																																						.											0													99.0	91.0	94.0					1																	112029261		2203	4300	6503	SO:0001583	missense	140			BC029831	CCDS838.1, CCDS839.1, CCDS41369.1	1p13.2	2014-09-17			ENSG00000121933	ENSG00000121933		"""GPCR / Class A : Adenosine receptors"", ""Immunoglobulin superfamily / V-set domain containing"""	268	protein-coding gene	gene with protein product		600445				7607699	Standard	NM_020683		Approved	AD026	uc001ebf.3	P33765	OTTHUMG00000011957	ENST00000369716.4:c.819C>A	1.37:g.112029261G>T	ENSP00000358730:p.Asn273Lys	Somatic		WXS	Illumina HiSeq	Phase_I	A2A3P4|Q6UWU0|Q9BYZ1	Missense_Mutation	SNP	ENST00000369716.4	37	CCDS838.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.98|10.98	1.505141|1.505141	0.26949|0.26949	.|.	.|.	ENSG00000121933|ENSG00000121933	ENST00000369717;ENST00000369716;ENST00000355437;ENST00000443498|ENST00000414219;ENST00000442484	T;T|.	0.54071|.	2.41;0.59|.	4.61|4.61	-1.37|-1.37	0.09056|0.09056	.|.	0.361223|.	0.23975|.	N|.	0.042737|.	T|T	0.11024|0.11024	0.0269|0.0269	L|L	0.42245|0.42245	1.32|1.32	0.09310|0.09310	N|N	1|1	B;B|.	0.24368|.	0.102;0.017|.	B;B|.	0.21151|.	0.033;0.009|.	T|T	0.33497|0.33497	-0.9866|-0.9866	10|5	0.72032|.	D|.	0.01|.	-9.9979|-9.9979	1.6911|1.6911	0.02852|0.02852	0.1896:0.3201:0.3425:0.1478|0.1896:0.3201:0.3425:0.1478	.|.	192;273|.	Q5QNY7;P33765-2|.	.;.|.	K|K	192;273;104;98|133;86	ENSP00000358731:N192K;ENSP00000358730:N273K|.	ENSP00000347612:N104K|.	N|T	-|-	3|2	2|0	ADORA3|ADORA3	111830784|111830784	0.003000|0.003000	0.15002|0.15002	0.004000|0.004000	0.12327|0.12327	0.381000|0.381000	0.30169|0.30169	0.086000|0.086000	0.14935|0.14935	-0.084000|-0.084000	0.12595|0.12595	0.561000|0.561000	0.74099|0.74099	AAC|ACA		0.557	ADORA3-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000157679.1	NM_000677, NM_020683	
DNAH9	1770	ucsc.edu	37	17	11865498	11865498	+	Silent	SNP	A	A	G			TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr17:11865498A>G	ENST00000262442.4	+	68	13226	c.13158A>G	c.(13156-13158)gaA>gaG	p.E4386E	DNAH9_ENST00000396001.2_3'UTR|DNAH9_ENST00000608377.1_Silent_p.E698E|RP11-1096G20.5_ENST00000580270.1_RNA|DNAH9_ENST00000454412.2_Silent_p.E4310E	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	4386					cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		AGAACAGAGAAGAGTTTAGGA	0.542																																						.											0													76.0	77.0	77.0					17																	11865498		2203	4300	6503	SO:0001819	synonymous_variant	1770			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.13158A>G	17.37:g.11865498A>G		Somatic		WXS	Illumina HiSeq	Phase_I	A2VCQ8|O15064|O95494|Q9NQ28	Silent	SNP	ENST00000262442.4	37	CCDS11160.1																																																																																				0.542	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	
GABRA1	2554	ucsc.edu	37	5	161324123	161324123	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr5:161324123A>G	ENST00000428797.2	+	11	1421	c.1066A>G	c.(1066-1068)Aaa>Gaa	p.K356E	GABRA1_ENST00000437025.2_Missense_Mutation_p.K356E|GABRA1_ENST00000393943.4_Missense_Mutation_p.K356E|GABRA1_ENST00000420560.1_Missense_Mutation_p.K356E|GABRA1_ENST00000444819.1_Missense_Mutation_p.K356E|GABRA1_ENST00000023897.6_Missense_Mutation_p.K356E	NM_001127643.1	NP_001121115.1	P14867	GBRA1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 1	356					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|drug binding (GO:0008144)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|endometrium(2)|kidney(3)|large_intestine(4)|liver(1)|lung(22)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(1)	42	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zaleplon(DB00962)|Zolpidem(DB00425)|Zopiclone(DB01198)	ACAGCCAAAGAAAGTAAAGGA	0.433																																						.											0													79.0	91.0	87.0					5																	161324123		2203	4300	6503	SO:0001583	missense	2554				CCDS4357.1	5q34	2012-06-22			ENSG00000022355	ENSG00000022355		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4075	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 1"""	137160				1330891	Standard	NM_000806		Approved	EJM5	uc003lyx.4	P14867	OTTHUMG00000163586	ENST00000428797.2:c.1066A>G	5.37:g.161324123A>G	ENSP00000393097:p.Lys356Glu	Somatic		WXS	Illumina HiSeq	Phase_I	D3DQK6|Q8N629	Missense_Mutation	SNP	ENST00000428797.2	37	CCDS4357.1	.	.	.	.	.	.	.	.	.	.	A	17.15	3.316873	0.60524	.	.	ENSG00000022355	ENST00000023897;ENST00000428797;ENST00000393943;ENST00000437025;ENST00000420560;ENST00000444819	D;D;D;D;D;D	0.81908	-1.55;-1.55;-1.55;-1.55;-1.55;-1.55	5.32	5.32	0.75619	Neurotransmitter-gated ion-channel transmembrane domain (1);	0.000000	0.85682	D	0.000000	T	0.81922	0.4925	L	0.42744	1.35	0.80722	D	1	P	0.40000	0.698	P	0.46510	0.519	T	0.78981	-0.1989	10	0.22706	T	0.39	.	15.5691	0.76320	1.0:0.0:0.0:0.0	.	356	P14867	GBRA1_HUMAN	E	356	ENSP00000023897:K356E;ENSP00000393097:K356E;ENSP00000377517:K356E;ENSP00000415441:K356E;ENSP00000408041:K356E;ENSP00000414232:K356E	ENSP00000023897:K356E	K	+	1	0	GABRA1	161256701	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.850000	0.92190	2.134000	0.65973	0.460000	0.39030	AAA		0.433	GABRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252702.2	NM_000806.5	
HINT3	135114	ucsc.edu	37	6	126288134	126288134	+	Silent	SNP	A	A	G			TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr6:126288134A>G	ENST00000229633.5	+	2	500	c.303A>G	c.(301-303)aaA>aaG	p.K101K		NM_138571.4	NP_612638.3	Q9NQE9	HINT3_HUMAN	histidine triad nucleotide binding protein 3	101	HIT. {ECO:0000255|PROSITE- ProRule:PRU00464}.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)	hydrolase activity (GO:0016787)|nucleotide binding (GO:0000166)			endometrium(1)|large_intestine(1)|lung(1)|stomach(1)	4				UCEC - Uterine corpus endometrioid carcinoma (4;0.153)|GBM - Glioblastoma multiforme(226;0.0321)		CTCTAAGGAAAGATCAAGTAG	0.363																																						.											0													129.0	120.0	123.0					6																	126288134		2203	4300	6503	SO:0001819	synonymous_variant	135114			AK057688	CCDS5133.1	6q22.33	2007-12-04			ENSG00000111911	ENSG00000111911			18468	protein-coding gene	gene with protein product		609998				11805111	Standard	NM_138571		Approved	FLJ33126	uc003qal.4	Q9NQE9	OTTHUMG00000015514	ENST00000229633.5:c.303A>G	6.37:g.126288134A>G		Somatic		WXS	Illumina HiSeq	Phase_I	B3KQ91|Q8N0Y9	Silent	SNP	ENST00000229633.5	37	CCDS5133.1																																																																																				0.363	HINT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042090.1	NM_138571	
PEX10	5192	ucsc.edu	37	1	2341848	2341848	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr1:2341848A>G	ENST00000447513.2	-	2	223	c.155T>C	c.(154-156)cTc>cCc	p.L52P	PEX10_ENST00000507596.1_Missense_Mutation_p.L52P|PEX10_ENST00000515760.1_5'Flank|PEX10_ENST00000288774.3_Missense_Mutation_p.L52P	NM_002617.3	NP_002608.1	O60683	PEX10_HUMAN	peroxisomal biogenesis factor 10	52					peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)	integral component of peroxisomal membrane (GO:0005779)|intracellular (GO:0005622)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	protein C-terminus binding (GO:0008022)|zinc ion binding (GO:0008270)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|skin(2)	7	all_cancers(77;0.000247)|all_epithelial(69;9.96e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;5.35e-20)|all_lung(118;2.78e-08)|Lung NSC(185;2.69e-06)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;1.1e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.02e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00102)|BRCA - Breast invasive adenocarcinoma(365;0.00435)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0169)|Lung(427;0.199)		CACATCTGAGAGCAGCTCAAC	0.592																																					GBM(12;9 508 1649 13619)	.											0													115.0	96.0	103.0					1																	2341848		2203	4300	6503	SO:0001583	missense	5192			AF060502	CCDS41.1, CCDS44045.1	1p36.32	2013-01-09	2008-08-26		ENSG00000157911	ENSG00000157911		"""RING-type (C3HC4) zinc fingers"""	8851	protein-coding gene	gene with protein product		602859	"""peroxisome biogenesis factor 10"""			9683594	Standard	NM_002617		Approved	RNF69	uc001ajg.3	O60683	OTTHUMG00000001637	ENST00000447513.2:c.155T>C	1.37:g.2341848A>G	ENSP00000407922:p.Leu52Pro	Somatic		WXS	Illumina HiSeq	Phase_I	B3KWD8|Q5T095|Q9BW90	Missense_Mutation	SNP	ENST00000447513.2	37	CCDS44045.1	.	.	.	.	.	.	.	.	.	.	A	18.80	3.700056	0.68501	.	.	ENSG00000157911	ENST00000288774;ENST00000447513;ENST00000507596	D;D;D	0.86366	-2.11;-2.11;-2.11	4.73	4.73	0.59995	Pex, N-terminal (1);	0.222000	0.39615	N	0.001309	D	0.93575	0.7949	M	0.88377	2.95	0.80722	D	1	D;P	0.71674	0.998;0.938	D;P	0.66716	0.946;0.876	D	0.94192	0.7442	10	0.54805	T	0.06	-0.1355	13.4134	0.60956	1.0:0.0:0.0:0.0	.	52;52	O60683;O60683-2	PEX10_HUMAN;.	P	52	ENSP00000288774:L52P;ENSP00000407922:L52P;ENSP00000424291:L52P	ENSP00000288774:L52P	L	-	2	0	PEX10	2331708	1.000000	0.71417	0.943000	0.38184	0.962000	0.63368	8.505000	0.90515	1.768000	0.52137	0.379000	0.24179	CTC		0.592	PEX10-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367454.1	NM_153818	
RIPK4	54101	ucsc.edu	37	21	43187089	43187089	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr21:43187089T>C	ENST00000352483.2	-	1	177	c.113A>G	c.(112-114)aAg>aGg	p.K38R	RIPK4_ENST00000542057.1_5'Flank|RIPK4_ENST00000544709.1_5'Flank|RIPK4_ENST00000332512.3_Missense_Mutation_p.K38R			P57078	RIPK4_HUMAN	receptor-interacting serine-threonine kinase 4	38	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				morphogenesis of an epithelium (GO:0002009)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						ATGGCGCACCTTGTACACCTG	0.726																																						.											0													34.0	30.0	32.0					21																	43187089		2201	4299	6500	SO:0001583	missense	54101			AJ278016	CCDS13675.1	21q22.3	2013-01-10	2004-07-06	2004-07-06	ENSG00000183421	ENSG00000183421		"""Ankyrin repeat domain containing"""	496	protein-coding gene	gene with protein product	"""protein kinase C-associated kinase"", ""PKC-delta-interacting protein kinase"""	605706	"""ankyrin repeat domain 3"""	ANKRD3		10830953	Standard	NM_020639		Approved	DIK, ANKK2, RIP4, PKK	uc002yzn.1	P57078	OTTHUMG00000086770	ENST00000352483.2:c.113A>G	21.37:g.43187089T>C	ENSP00000330161:p.Lys38Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q96KH0	Missense_Mutation	SNP	ENST00000352483.2	37		.	.	.	.	.	.	.	.	.	.	T	18.63	3.666244	0.67814	.	.	ENSG00000183421	ENST00000332512;ENST00000352483	T;T	0.70164	-0.46;-0.46	3.5	3.5	0.40072	.	0.000000	0.56097	U	0.000027	T	0.68302	0.2986	N	0.21324	0.655	0.80722	D	1	D	0.71674	0.998	D	0.78314	0.991	T	0.68884	-0.5291	10	0.48119	T	0.1	-27.0112	11.2166	0.48830	0.0:0.0:0.0:1.0	.	38	P57078-2	.	R	38	ENSP00000332454:K38R;ENSP00000330161:K38R	ENSP00000332454:K38R	K	-	2	0	RIPK4	42060158	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	6.694000	0.74587	1.231000	0.43661	0.254000	0.18369	AAG		0.726	RIPK4-201	KNOWN	basic	protein_coding	protein_coding		NM_020639	
VENTX	27287	ucsc.edu;mdanderson.org;bcgsc.ca	37	10	135051543	135051543	+	Missense_Mutation	SNP	T	T	C	rs2240892	byFrequency	TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr10:135051543T>C	ENST00000325980.9	+	1	636	c.125T>C	c.(124-126)cTg>cCg	p.L42P		NM_014468.3	NP_055283.1	O95231	VENTX_HUMAN	VENT homeobox	42			L -> P (in dbSNP:rs2240892). {ECO:0000269|PubMed:15489334}.		multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			NS(1)|endometrium(1)|large_intestine(1)|lung(9)|soft_tissue(1)|upper_aerodigestive_tract(1)	14		all_cancers(35;4.15e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;7.8e-06)|Epithelial(32;9.31e-06)|all cancers(32;1.19e-05)		GACTTCTCCCTGGGGAGCCTC	0.716													T|||	1221	0.24381	0.2943	0.1859	5008	,	,		12549	0.376		0.1123	False		,,,				2504	0.2157					.											0								T	PRO/LEU	737,3379		49,639,1370	5.0	7.0	6.0		125	-2.4	0.0	10	dbSNP_98	6	776,7542		42,692,3425	no	missense	VENTX	NM_014468.2	98	91,1331,4795	CC,CT,TT		9.3292,17.9057,12.1682	benign	42/259	135051543	1513,10921	2058	4159	6217	SO:0001583	missense	27287			AF068006	CCDS7675.1	10q26.3	2011-06-20	2011-06-01	2005-09-27	ENSG00000151650	ENSG00000151650		"""Homeoboxes / ANTP class : NKL subclass"""	13639	protein-coding gene	gene with protein product		607158	"""VENT-like homeobox 2"", ""VENT homeobox homolog (Xenopus laevis)"""	VENTX2		10790436	Standard	NM_014468		Approved	HPX42B	uc010quy.1	O95231	OTTHUMG00000019307	ENST00000325980.9:c.125T>C	10.37:g.135051543T>C	ENSP00000357556:p.Leu42Pro	Somatic		WXS	Illumina HiSeq	Phase_I	Q32MZ3	Missense_Mutation	SNP	ENST00000325980.9	37	CCDS7675.1	489	0.2239010989010989	143	0.29065040650406504	71	0.19613259668508287	190	0.3321678321678322	85	0.11213720316622691	T	2.856	-0.237276	0.05944	0.179057	0.093292	ENSG00000151650	ENST00000325980	T	0.43294	0.95	1.78	-2.36	0.06663	.	1.462090	0.04704	N	0.416452	T	0.00012	0.0000	N	0.03608	-0.345	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.32079	-0.9920	9	0.33940	T	0.23	.	0.8221	0.01113	0.1484:0.1943:0.2644:0.393	rs2240892;rs60200993;rs2240892	42	O95231	VENTX_HUMAN	P	42	ENSP00000357556:L42P	ENSP00000357556:L42P	L	+	2	0	VENTX	134901533	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.183000	0.09712	-0.933000	0.03737	-1.572000	0.00871	CTG		0.716	VENTX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051116.4	NM_014468	
XYLT1	64131	ucsc.edu;mdanderson.org;bcgsc.ca	37	16	17235168	17235168	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr16:17235168G>A	ENST00000261381.6	-	7	1513	c.1429C>T	c.(1429-1431)Cgc>Tgc	p.R477C	CTD-2576D5.4_ENST00000567344.1_RNA	NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	477					cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						TCTCCCAGGCGCCACATGTGA	0.597																																						.											0													74.0	75.0	75.0					16																	17235168		2197	4300	6497	SO:0001583	missense	64131			AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.1429C>T	16.37:g.17235168G>A	ENSP00000261381:p.Arg477Cys	Somatic		WXS	Illumina HiSeq	Phase_I	Q9H1B6	Missense_Mutation	SNP	ENST00000261381.6	37	CCDS10569.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.676602	0.88445	.	.	ENSG00000103489	ENST00000261381	T	0.06608	3.28	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.33847	0.0877	M	0.88241	2.94	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.11324	-1.0592	10	0.87932	D	0	-41.8453	19.2966	0.94124	0.0:0.0:1.0:0.0	.	477	Q86Y38	XYLT1_HUMAN	C	477	ENSP00000261381:R477C	ENSP00000261381:R477C	R	-	1	0	XYLT1	17142669	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.392000	0.66272	2.797000	0.96272	0.555000	0.69702	CGC		0.597	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252241.2	NM_022166	
ZBTB18	10472	ucsc.edu;bcgsc.ca	37	1	244218131	244218131	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr1:244218131A>G	ENST00000358704.4	+	2	1204	c.1055A>G	c.(1054-1056)gAg>gGg	p.E352G		NM_001278196.1|NM_006352.4|NM_205768.2	NP_001265125.1|NP_006343.2|NP_991331.1	Q99592	ZBT18_HUMAN	zinc finger and BTB domain containing 18	343	Interaction with DNMT3A.				cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|hippocampus development (GO:0021766)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron development (GO:0048666)|regulation of cell division (GO:0051302)|skeletal muscle tissue development (GO:0007519)|transcription, DNA-templated (GO:0006351)	intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)										CCAGAGAGCGAGCGTGTCCAG	0.632																																						.											0													73.0	65.0	68.0					1																	244218131		2203	4300	6503	SO:0001583	missense	10472			U38896	CCDS1622.1	1q44	2013-09-19	2013-01-09	2013-01-09	ENSG00000179456	ENSG00000179456		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13030	protein-coding gene	gene with protein product		608433	"""zinc finger protein 238"""	ZNF238		9568537, 9013868	Standard	NM_205768		Approved	C2H2-171, TAZ-1, RP58	uc031psv.1	Q99592	OTTHUMG00000040013	ENST00000358704.4:c.1055A>G	1.37:g.244218131A>G	ENSP00000351539:p.Glu352Gly	Somatic		WXS	Illumina HiSeq	Phase_I	A8K5U3|Q13397|Q5VU40|Q8N463|Q9UD99	Missense_Mutation	SNP	ENST00000358704.4	37	CCDS1622.1	.	.	.	.	.	.	.	.	.	.	A	13.17	2.158698	0.38119	.	.	ENSG00000179456	ENST00000366538;ENST00000358704	T	0.14391	2.51	5.73	5.73	0.89815	.	0.053977	0.64402	D	0.000001	T	0.10380	0.0254	N	0.24115	0.695	0.80722	D	1	B;P	0.34934	0.345;0.476	B;B	0.36186	0.109;0.219	T	0.12091	-1.0561	10	0.07990	T	0.79	.	16.0181	0.80457	1.0:0.0:0.0:0.0	.	343;352	Q99592;Q99592-2	ZN238_HUMAN;.	G	352	ENSP00000351539:E352G	ENSP00000351539:E352G	E	+	2	0	ZNF238	242284754	1.000000	0.71417	0.997000	0.53966	0.956000	0.61745	7.508000	0.81686	2.195000	0.70347	0.528000	0.53228	GAG		0.632	ZBTB18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096513.2	NM_205768	
ARHGAP5	394	mdanderson.org	37	14	32561296	32561296	+	Missense_Mutation	SNP	T	T	C	rs200111638		TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr14:32561296T>C	ENST00000345122.3	+	2	1736	c.1421T>C	c.(1420-1422)gTa>gCa	p.V474A	ARHGAP5_ENST00000432921.1_Missense_Mutation_p.V474A|ARHGAP5_ENST00000433497.1_Intron|ARHGAP5_ENST00000396582.2_Intron|ARHGAP5_ENST00000539826.2_Missense_Mutation_p.V474A|ARHGAP5_ENST00000556611.1_Missense_Mutation_p.V474A	NM_001030055.1	NP_001025226.1	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5	474	FF 3.				cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|mammary gland development (GO:0030879)|positive regulation of cell migration (GO:0030335)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell size (GO:0008361)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(10)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(12)|ovary(4)|skin(1)|stomach(1)|urinary_tract(4)	55	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		AGCAAAGAGGTATATGGTAGG	0.368																																					NSCLC(9;77 350 3443 29227 41353)	.											0													74.0	77.0	76.0					14																	32561296		2203	4297	6500	SO:0001583	missense	394			U17032	CCDS32062.1, CCDS45095.1	14q12	2010-02-05						"""Rho GTPase activating proteins"""	675	protein-coding gene	gene with protein product		602680	"""growth factor independent 2"""	GFI2		8537347	Standard	XM_005267635		Approved	RhoGAP5, p190-B, p190BRhoGAP	uc001wrn.3	Q13017		ENST00000345122.3:c.1421T>C	14.37:g.32561296T>C	ENSP00000371897:p.Val474Ala	Somatic		WXS	Illumina HiSeq	Phase_I	A1L375|A1L376|A8KAA1|D3DS89|D3DS90|Q05BE8|Q05BU8|Q59ER0|Q6DHZ3	Missense_Mutation	SNP	ENST00000345122.3	37	CCDS32062.1	.	.	.	.	.	.	.	.	.	.	T	17.13	3.311365	0.60414	.	.	ENSG00000100852	ENST00000556611;ENST00000539826;ENST00000345122;ENST00000432921	T;T;T;T	0.12039	2.72;2.72;2.72;2.72	6.02	6.02	0.97574	FF domain (1);	0.000000	0.85682	D	0.000000	T	0.25457	0.0619	L	0.40543	1.245	0.80722	D	1	P;P	0.49961	0.93;0.885	P;P	0.56042	0.79;0.622	T	0.00254	-1.1874	10	0.56958	D	0.05	.	16.5494	0.84464	0.0:0.0:0.0:1.0	.	474;474	Q13017-2;Q13017	.;RHG05_HUMAN	A	474	ENSP00000452222:V474A;ENSP00000441692:V474A;ENSP00000371897:V474A;ENSP00000393307:V474A	ENSP00000371897:V474A	V	+	2	0	ARHGAP5	31631047	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	8.040000	0.89188	2.299000	0.77371	0.528000	0.53228	GTA		0.368	ARHGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409735.1	NM_001030055	
BIRC6	57448	mdanderson.org	37	2	32641045	32641045	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr2:32641045G>A	ENST00000421745.2	+	10	2820	c.2686G>A	c.(2686-2688)Gac>Aac	p.D896N		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	896					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					AAAAACGTCTGACATTTCTAC	0.403																																					Pancreas(94;175 1509 16028 18060 45422)	.											0													70.0	72.0	71.0					2																	32641045		2203	4300	6503	SO:0001583	missense	57448			AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.2686G>A	2.37:g.32641045G>A	ENSP00000393596:p.Asp896Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q9ULD1	Missense_Mutation	SNP	ENST00000421745.2	37	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	G	14.32	2.498920	0.44455	.	.	ENSG00000115760	ENST00000421745	T	0.63417	-0.04	5.76	4.83	0.62350	.	0.115184	0.56097	D	0.000021	T	0.51601	0.1684	L	0.29908	0.895	0.42755	D	0.99378	B	0.23058	0.079	B	0.18263	0.021	T	0.51076	-0.8751	10	0.49607	T	0.09	.	16.2927	0.82758	0.0:0.1322:0.8678:0.0	.	896	Q9NR09	BIRC6_HUMAN	N	896	ENSP00000393596:D896N	ENSP00000393596:D896N	D	+	1	0	BIRC6	32494549	1.000000	0.71417	0.996000	0.52242	0.866000	0.49608	4.791000	0.62460	2.726000	0.93360	0.655000	0.94253	GAC		0.403	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252	
CCT8	10694	mdanderson.org	37	21	30439985	30439985	+	Silent	SNP	A	A	G			TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr21:30439985A>G	ENST00000286788.4	-	4	479	c.273T>C	c.(271-273)caT>caC	p.H91H	CCT8_ENST00000470450.1_5'UTR|CCT8_ENST00000540844.1_Silent_p.H18H|CCT8_ENST00000542732.1_Silent_p.H72H	NM_006585.2	NP_006576.2	P50990	TCPQ_HUMAN	chaperonin containing TCP1, subunit 8 (theta)	91					'de novo' posttranslational protein folding (GO:0051084)|ATP catabolic process (GO:0006200)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	aggresome (GO:0016235)|cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|microtubule (GO:0005874)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)	p.H91H(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(1)|prostate(3)	14						GCTCTTGCATATGAGAAGCCA	0.393																																						.											1	Substitution - coding silent(1)	prostate(1)											88.0	83.0	84.0					21																	30439985		2203	4300	6503	SO:0001819	synonymous_variant	10694			Z37163	CCDS33528.1, CCDS68180.1	21q21.3	2011-09-02			ENSG00000156261	ENSG00000156261		"""Heat Shock Proteins / Chaperonins"""	1623	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 112"""	C21orf112		7890169	Standard	NM_006585		Approved	Cctq, PRED71	uc002ynb.3	P50990	OTTHUMG00000044595	ENST00000286788.4:c.273T>C	21.37:g.30439985A>G		Somatic		WXS	Illumina HiSeq	Phase_I	A6NN54|B4DEM7|B4DQH4|Q4VBP8	Silent	SNP	ENST00000286788.4	37	CCDS33528.1	.	.	.	.	.	.	.	.	.	.	A	9.791	1.177925	0.21787	.	.	ENSG00000156261	ENST00000431234	.	.	.	5.55	0.164	0.14990	.	.	.	.	.	T	0.56775	0.2008	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49021	-0.8982	4	.	.	.	-12.6863	9.4089	0.38480	0.3761:0.0:0.6239:0.0	.	.	.	.	T	83	.	.	I	-	2	0	CCT8	29361856	1.000000	0.71417	0.994000	0.49952	0.995000	0.86356	1.323000	0.33701	-0.193000	0.10415	-0.242000	0.12053	ATA		0.393	CCT8-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171822.1		
CLN5	1203	mdanderson.org	37	13	77566090	77566090	+	Missense_Mutation	SNP	C	C	T	rs77416795	byFrequency	TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr13:77566090C>T	ENST00000377453.3	+	1	1296	c.4C>T	c.(4-6)Cgc>Tgc	p.R2C		NM_006493.2	NP_006484.1	O75503	CLN5_HUMAN	ceroid-lipofuscinosis, neuronal 5	0					brain development (GO:0007420)|cell death (GO:0008219)|glycosylation (GO:0070085)|lysosomal lumen acidification (GO:0007042)|neurogenesis (GO:0022008)|neuron maturation (GO:0042551)|protein catabolic process (GO:0030163)|signal peptide processing (GO:0006465)|visual perception (GO:0007601)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|perinuclear region of cytoplasm (GO:0048471)|vacuolar lumen (GO:0005775)	mannose binding (GO:0005537)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|urinary_tract(1)	16		Acute lymphoblastic leukemia(28;0.205)		GBM - Glioblastoma multiforme(99;0.0503)		AGGTGTCATGCGCCGGAACCT	0.706													C|||	698	0.139377	0.1293	0.2608	5008	,	,		12735	0.1071		0.0994	False		,,,				2504	0.1411					.											0								C	CYS/ARG	400,3146		17,366,1390	3.0	4.0	3.0		4	2.1	0.0	13	dbSNP_131	3	731,6513		40,651,2931	yes	missense	CLN5	NM_006493.2	180	57,1017,4321	TT,TC,CC		10.0911,11.2803,10.4819		2/408	77566090	1131,9659	1773	3622	5395	SO:0001583	missense	1203				CCDS9456.1	13q21.2-q32	2014-09-17			ENSG00000102805	ENSG00000102805			2076	protein-coding gene	gene with protein product		608102				7942847, 8661106	Standard	NM_006493		Approved		uc001vkc.3	O75503	OTTHUMG00000017100	ENST00000377453.3:c.4C>T	13.37:g.77566090C>T	ENSP00000366673:p.Arg2Cys	Somatic		WXS	Illumina HiSeq	Phase_I	B3KQK7	Missense_Mutation	SNP	ENST00000377453.3	37	CCDS9456.1	275	0.1259157509157509	67	0.13617886178861788	74	0.20441988950276244	58	0.10139860139860139	76	0.10026385224274406	C	14.02	2.409456	0.42715	0.112803	0.100911	ENSG00000102805	ENST00000377453	T	0.35605	1.3	3.0	2.13	0.27403	.	.	.	.	.	T	0.00039	0.0001	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.13845	-1.0494	5	0.87932	D	0	.	3.9634	0.09421	0.2315:0.6377:0.0:0.1308	.	.	.	.	C	2	ENSP00000366673:R2C	ENSP00000366673:R2C	R	+	1	0	CLN5	76464091	0.002000	0.14202	0.006000	0.13384	0.017000	0.09413	0.035000	0.13797	0.794000	0.33899	0.462000	0.41574	CGC		0.706	CLN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045318.1	NM_006493	
CS	1431	mdanderson.org	37	12	56676279	56676279	+	Silent	SNP	A	A	G	rs528162217	byFrequency	TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr12:56676279A>G	ENST00000351328.3	-	6	703	c.513T>C	c.(511-513)gcT>gcC	p.A171A	CS_ENST00000542324.2_Silent_p.A158A|CS_ENST00000548567.1_Silent_p.A105A	NM_004077.2	NP_004068.2	O75390	CISY_HUMAN	citrate synthase	171					carbohydrate metabolic process (GO:0005975)|cellular carbohydrate metabolic process (GO:0044262)|cellular metabolic process (GO:0044237)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	citrate (Si)-synthase activity (GO:0004108)|poly(A) RNA binding (GO:0044822)	p.A171A(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	17		Myeloproliferative disorder(1001;0.000374)		BRCA - Breast invasive adenocarcinoma(357;6.17e-07)		GGGCTGTAACAGCTGCACTGA	0.527													A|||	44	0.00878594	0.0272	0.0014	5008	,	,		18707	0.003		0.003	False		,,,				2504	0.001					.											1	Substitution - coding silent(1)	central_nervous_system(1)																																								SO:0001819	synonymous_variant	1431				CCDS8913.1	12q13.2	2012-10-02				ENSG00000062485	2.3.3.1		2422	protein-coding gene	gene with protein product		118950					Standard	NM_004077		Approved		uc001sks.1	O75390	OTTHUMG00000170344	ENST00000351328.3:c.513T>C	12.37:g.56676279A>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q71UT9|Q7KZH0|Q96FZ8|Q9BWN8	Silent	SNP	ENST00000351328.3	37	CCDS8913.1																																																																																				0.527	CS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408588.2	NM_004077	
DOT1L	84444	mdanderson.org	37	19	2226676	2226676	+	Missense_Mutation	SNP	G	G	A	rs3815308	byFrequency	TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr19:2226676G>A	ENST00000398665.3	+	27	4192	c.4156G>A	c.(4156-4158)Ggc>Agc	p.G1386S		NM_032482.2	NP_115871.1	Q8TEK3	DOT1L_HUMAN	DOT1-like histone H3K79 methyltransferase	1386			G -> S (in dbSNP:rs3815308).		histone lysine methylation (GO:0034968)|regulation of JAK-STAT cascade (GO:0046425)|regulation of transcription regulatory region DNA binding (GO:2000677)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(9)	42		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGCAGCCGCGGCAAGGAGGC	0.726													G|||	1130	0.225639	0.0356	0.3069	5008	,	,		10935	0.1825		0.4692	False		,,,				2504	0.2188					.											0								G	SER/GLY	373,3611		37,299,1656	6.0	9.0	8.0		4156	0.4	0.0	19	dbSNP_107	8	3524,4624		845,1834,1395	no	missense	DOT1L	NM_032482.2	56	882,2133,3051	AA,AG,GG		43.2499,9.3624,32.1217	benign	1386/1538	2226676	3897,8235	1992	4074	6066	SO:0001583	missense	84444			AF509504	CCDS42460.1	19p13.3	2013-05-21	2013-05-21		ENSG00000104885	ENSG00000104885	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"""	24948	protein-coding gene	gene with protein product	"""histone methyltransferase DOT1L"""	607375	"""DOT1-like, histone H3 methyltransferase (S. cerevisiae)"""			11347906, 12123582	Standard	NM_032482		Approved	KIAA1814, DOT1, KMT4	uc002lvb.4	Q8TEK3	OTTHUMG00000150431	ENST00000398665.3:c.4156G>A	19.37:g.2226676G>A	ENSP00000381657:p.Gly1386Ser	Somatic		WXS	Illumina HiSeq	Phase_I	O60379|Q96JL1	Missense_Mutation	SNP	ENST00000398665.3	37	CCDS42460.1	602	0.27564102564102566	19	0.03861788617886179	123	0.3397790055248619	113	0.19755244755244755	347	0.4577836411609499	G	0.015	-1.555274	0.00918	0.093624	0.432499	ENSG00000104885	ENST00000398665;ENST00000221482;ENST00000457590	T;T	0.28454	2.06;1.61	4.28	0.43	0.16515	.	0.858235	0.09817	N	0.751980	T	0.00012	0.0000	N	0.19112	0.55	0.80722	P	0.0	B;B	0.24533	0.105;0.012	B;B	0.12837	0.003;0.008	T	0.46303	-0.9201	9	0.87932	D	0	-4.2319	10.6441	0.45610	0.3992:0.0:0.6008:0.0	rs3815308;rs56900395	1386;1386	Q8TEK3;Q8TEK3-2	DOT1L_HUMAN;.	S	1386;1386;266	ENSP00000381657:G1386S;ENSP00000407411:G266S	ENSP00000221482:G1386S	G	+	1	0	DOT1L	2177676	0.363000	0.24989	0.007000	0.13788	0.002000	0.02628	1.858000	0.39408	-0.020000	0.14032	-1.134000	0.01955	GGC		0.726	DOT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318066.1	NM_032482	
GLTSCR1	29998	mdanderson.org	37	19	48183114	48183114	+	Silent	SNP	A	A	G	rs2914438	byFrequency	TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr19:48183114A>G	ENST00000396720.3	+	6	881	c.687A>G	c.(685-687)acA>acG	p.T229T	CTD-2571L23.8_ENST00000599924.1_lincRNA	NM_015711.3	NP_056526.3	Q9NZM4	GSCR1_HUMAN	glioma tumor suppressor candidate region gene 1	229										breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|pancreas(3)|prostate(4)|skin(2)	20		all_cancers(25;1.8e-07)|all_lung(116;5.73e-06)|Lung NSC(112;9.69e-06)|all_epithelial(76;2.42e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000358)|OV - Ovarian serous cystadenocarcinoma(262;0.000576)|Epithelial(262;0.0212)|GBM - Glioblastoma multiforme(486;0.0355)		CGGCGGCCACACTGGGCCTGG	0.711													G|||	4089	0.816494	0.798	0.7954	5008	,	,		11827	0.9593		0.7227	False		,,,				2504	0.8057					.											0								G		2219,413		932,355,29	3.0	4.0	4.0		687	-9.6	0.0	19	dbSNP_101	4	4284,1130		1704,876,127	no	coding-synonymous	GLTSCR1	NM_015711.3		2636,1231,156	GG,GA,AA		20.8718,15.6915,19.1772		229/1561	48183114	6503,1543	1316	2707	4023	SO:0001819	synonymous_variant	29998			AF182077	CCDS46134.1	19q13.3	2012-11-29			ENSG00000063169	ENSG00000063169			4332	protein-coding gene	gene with protein product		605690				10708517	Standard	NM_015711		Approved		uc002phh.4	Q9NZM4		ENST00000396720.3:c.687A>G	19.37:g.48183114A>G		Somatic		WXS	Illumina HiSeq	Phase_I	A8MW01	Silent	SNP	ENST00000396720.3	37	CCDS46134.1																																																																																				0.711	GLTSCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465846.1	NM_015711	
GSTM5	2949	mdanderson.org	37	1	110256127	110256127	+	Missense_Mutation	SNP	G	G	A	rs17854972	byFrequency	TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr1:110256127G>A	ENST00000256593.3	+	4	257	c.199G>A	c.(199-201)Gct>Act	p.A67T	GSTM5_ENST00000369813.1_Missense_Mutation_p.A26T|GSTM5_ENST00000369812.5_Missense_Mutation_p.A86T	NM_000851.3	NP_000842.2	P46439	GSTM5_HUMAN	glutathione S-transferase mu 5	67	GST N-terminal.		A -> T (in dbSNP:rs17854972). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	glutathione transferase activity (GO:0004364)			NS(1)|central_nervous_system(6)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(2)|urinary_tract(2)	21		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Colorectal(144;0.0131)|all cancers(265;0.0252)|Epithelial(280;0.0265)|Lung(183;0.0425)|COAD - Colon adenocarcinoma(174;0.0474)|LUSC - Lung squamous cell carcinoma(189;0.228)	Glutathione(DB00143)	GATTGATGGGGCTCACAAGAT	0.592													G|||	201	0.0401358	0.0129	0.0548	5008	,	,		18809	0.0		0.0964	False		,,,				2504	0.0501					.											0								G	THR/ALA	113,4293	86.8+/-125.4	2,109,2092	298.0	231.0	254.0		199	-8.7	0.0	1	dbSNP_123	254	958,7642	209.0+/-250.3	54,850,3396	no	missense	GSTM5	NM_000851.3	58	56,959,5488	AA,AG,GG		11.1395,2.5647,8.2347	benign	67/219	110256127	1071,11935	2203	4300	6503	SO:0001583	missense	2949			L02321	CCDS811.1	1p13.3	2012-06-21	2008-11-26		ENSG00000134201	ENSG00000134201	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4637	protein-coding gene	gene with protein product		138385	"""glutathione S-transferase M5"""			8473333	Standard	NM_000851		Approved		uc001dyn.3	P46439	OTTHUMG00000011644	ENST00000256593.3:c.199G>A	1.37:g.110256127G>A	ENSP00000256593:p.Ala67Thr	Somatic		WXS	Illumina HiSeq	Phase_I	A8K0V8|Q6PD78	Missense_Mutation	SNP	ENST00000256593.3	37	CCDS811.1	108	0.04945054945054945	7	0.014227642276422764	24	0.06629834254143646	0	0.0	77	0.10158311345646438	G	2.990	-0.208371	0.06180	0.025647	0.111395	ENSG00000134201	ENST00000256593;ENST00000369813;ENST00000369812	T;T;T	0.41758	0.99;3.33;0.99	4.33	-8.66	0.00866	Glutathione S-transferase, N-terminal (2);Thioredoxin-like fold (2);	0.314056	0.27080	N	0.021026	T	0.03434	0.0099	N	0.03608	-0.345	0.09310	N	1	B;B	0.12630	0.006;0.0	B;B	0.12156	0.007;0.0	T	0.15492	-1.0435	10	0.37606	T	0.19	.	2.4536	0.04524	0.3627:0.2675:0.2738:0.096	rs17854972	26;67	Q5T8Q9;P46439	.;GSTM5_HUMAN	T	67;26;86	ENSP00000256593:A67T;ENSP00000358828:A26T;ENSP00000358827:A86T	ENSP00000256593:A67T	A	+	1	0	GSTM5	110057650	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.869000	0.04232	-2.436000	0.00553	-2.830000	0.00107	GCT		0.592	GSTM5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000032200.1	NM_000851	
H2AFV	94239	mdanderson.org	37	7	44874131	44874131	+	Missense_Mutation	SNP	A	A	G	rs114398265		TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr7:44874131A>G	ENST00000308153.4	-	5	447	c.356T>C	c.(355-357)aTt>aCt	p.I119T	H2AFV_ENST00000521529.1_3'UTR|H2AFV_ENST00000381124.5_3'UTR|H2AFV_ENST00000222690.6_Intron|H2AFV_ENST00000437072.1_Intron|H2AFV_ENST00000349299.3_Missense_Mutation_p.I81T|H2AFV_ENST00000350771.3_Missense_Mutation_p.I93T	NM_012412.4	NP_036544.1	Q71UI9	H2AV_HUMAN	H2A histone family, member V	119						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.I119T(1)		endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|urinary_tract(1)	9						CTTCTTTCCAATCAGAGATTT	0.368																																						.											1	Substitution - Missense(1)	prostate(1)											88.0	76.0	80.0					7																	44874131		2203	4300	6503	SO:0001583	missense	94239			AF081192	CCDS5495.1, CCDS5496.1, CCDS5497.1, CCDS5498.1, CCDS47581.1	7p13	2011-01-27		2004-03-26	ENSG00000105968	ENSG00000105968		"""Histones / Replication-independent"""	20664	protein-coding gene	gene with protein product				H2AV			Standard	NM_012412		Approved	MGC10170, MGC10831, MGC1947	uc003tma.2	Q71UI9	OTTHUMG00000129217	ENST00000308153.4:c.356T>C	7.37:g.44874131A>G	ENSP00000308405:p.Ile119Thr	Somatic		WXS	Illumina HiSeq	Phase_I	A6NFA8|A6NKY0|A6NN01|A8MQC5|Q59GV8|Q6PK98	Missense_Mutation	SNP	ENST00000308153.4	37	CCDS5496.1	.	.	.	.	.	.	.	.	.	.	A	15.33	2.801702	0.50315	.	.	ENSG00000105968	ENST00000349299;ENST00000308153;ENST00000350771	T;D;T	0.83163	0.93;-1.69;0.89	5.61	5.61	0.85477	Histone-fold (1);Histone H2A (2);	.	.	.	.	D	0.82444	0.5038	M	0.69523	2.12	0.80722	D	1	B;B;B	0.17852	0.001;0.024;0.0	B;B;B	0.18871	0.005;0.023;0.001	T	0.80027	-0.1554	9	0.62326	D	0.03	-10.9595	14.0456	0.64704	1.0:0.0:0.0:0.0	.	93;81;119	A6NKY0;A6NFA8;Q71UI9	.;.;H2AV_HUMAN	T	81;119;93	ENSP00000342714:I81T;ENSP00000308405:I119T;ENSP00000340708:I93T	ENSP00000308405:I119T	I	-	2	0	H2AFV	44840656	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.631000	0.90991	2.261000	0.74972	0.533000	0.62120	ATT		0.368	H2AFV-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251305.1	NM_012412	
DDX53	168400	mdanderson.org	37	X	23020661	23020661	+	IGR	SNP	C	C	T	rs77968596		TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chrX:23020661C>T	ENST00000327968.5	+	0	2118				RP11-40F8.2_ENST00000455399.1_lincRNA	NM_182699.3	NP_874358.2	Q86TM3	DDX53_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 53							nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|RNA binding (GO:0003723)			breast(2)|endometrium(5)|kidney(4)|large_intestine(3)|lung(15)|ovary(1)|prostate(1)|skin(2)|urinary_tract(2)	35						GTAAATGTTACGTGTTGGTTA	0.318																																						.											0																																										SO:0001628	intergenic_variant	0			AY039237	CCDS35214.1	Xp22.13	2009-03-25			ENSG00000184735	ENSG00000184735		"""DEAD-boxes"""	20083	protein-coding gene	gene with protein product	"""cancer associated gene"", ""cancer/testis antigen 26"""						Standard	NM_182699		Approved	CAGE, CT26	uc004daj.3	Q86TM3	OTTHUMG00000021248		X.37:g.23020661C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q0D2N2|Q6NVV4	RNA	SNP	ENST00000327968.5	37	CCDS35214.1																																																																																				0.318	DDX53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056043.1	NM_182699	
MESDC1	59274	mdanderson.org	37	15	81294774	81294774	+	Silent	SNP	G	G	C	rs11541231	byFrequency	TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr15:81294774G>C	ENST00000267984.2	+	1	1480	c.162G>C	c.(160-162)tcG>tcC	p.S54S		NM_022566.2	NP_072088.1	Q9H1K6	MESD1_HUMAN	mesoderm development candidate 1	54										endometrium(1)|lung(2)	3						TGCTGCTGTCGAGCGAGGCGC	0.701													G|||	137	0.0273562	0.003	0.0951	5008	,	,		9514	0.0		0.0457	False		,,,				2504	0.0215					.											0								G		48,3752		2,44,1854	11.0	9.0	10.0		162	-8.7	0.9	15	dbSNP_120	10	281,7351		5,271,3540	no	coding-synonymous	MESDC1	NM_022566.2		7,315,5394	CC,CG,GG		3.6819,1.2632,2.8779		54/363	81294774	329,11103	1900	3816	5716	SO:0001819	synonymous_variant	59274			AY007810	CCDS10316.1	15q13	2008-07-18			ENSG00000140406	ENSG00000140406			13519	protein-coding gene	gene with protein product		615466				11247670	Standard	NM_022566		Approved	MGC99595	uc002bfz.3	Q9H1K6	OTTHUMG00000144185	ENST00000267984.2:c.162G>C	15.37:g.81294774G>C		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000267984.2	37	CCDS10316.1																																																																																				0.701	MESDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291390.1	NM_022566	
MIR363	574031	mdanderson.org	37	X	133303450	133303450	+	RNA	SNP	C	C	A			TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chrX:133303450C>A	ENST00000384840.1	-	0	32				MIR106A_ENST00000384870.1_RNA|MIR18B_ENST00000454574.2_RNA|MIR92A2_ENST00000385299.1_RNA|MIR20B_ENST00000384977.1_RNA|MIR19B2_ENST00000385077.2_RNA	NR_029852.1				microRNA 363																		CTATGATACTCATCAAAATTG	0.378																																						.											0													91.0	76.0	80.0					X																	133303450		1568	3582	5150			574031					Xq26.2	2012-03-12		2008-12-18	ENSG00000207572	ENSG00000207572		"""ncRNAs / Micro RNAs"""	32023	non-coding RNA	RNA, micro				MIRN363			Standard	NR_029852		Approved	hsa-mir-363, MIR-363	uc022ceb.1				X.37:g.133303450C>A		Somatic		WXS	Illumina HiSeq	Phase_I		RNA	SNP	ENST00000384840.1	37																																																																																					0.378	MIR363-201	KNOWN	basic	miRNA	miRNA		NR_029852	
MUC2	4583	mdanderson.org	37	11	1093286	1093286	+	Missense_Mutation	SNP	C	C	G	rs201333212		TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr11:1093286C>G	ENST00000441003.2	+	30	5132	c.5105C>G	c.(5104-5106)aCc>aGc	p.T1702S	MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000359061.5_Missense_Mutation_p.T1669S|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.T1669S(1)|p.T1702S(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	acacccatcaccaccaccact	0.632																																						.											2	Substitution - Missense(2)	haematopoietic_and_lymphoid_tissue(2)											116.0	161.0	145.0					11																	1093286		1870	3438	5308	SO:0001583	missense	4583			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5105C>G	11.37:g.1093286C>G	ENSP00000415183:p.Thr1702Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	1.291	-0.607547	0.03717	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.12361	2.84;2.69	1.6	-3.2	0.05156	.	194.215000	0.04190	U	0.328173	T	0.04998	0.0134	.	.	.	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.28202	-1.0051	9	0.10111	T	0.7	.	0.5419	0.00647	0.3852:0.249:0.1961:0.1696	.	1702	E7EUV1	.	S	1702;1669	ENSP00000415183:T1702S;ENSP00000351956:T1669S	ENSP00000351956:T1669S	T	+	2	0	MUC2	1083286	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.007000	0.03667	-1.356000	0.02183	0.184000	0.17185	ACC		0.632	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MRGPRE	116534	mdanderson.org	37	11	3249552	3249552	+	Missense_Mutation	SNP	C	C	T	rs4391795	byFrequency	TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr11:3249552C>T	ENST00000389832.5	-	2	784	c.478G>A	c.(478-480)Ggc>Agc	p.G160S	MRGPRE_ENST00000436689.2_Missense_Mutation_p.G159S|AC109309.4_ENST00000418995.2_RNA			Q86SM8	MRGRE_HUMAN	MAS-related GPR, member E	160			G -> S (in dbSNP:rs4391795).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(6)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	19		Medulloblastoma(188;0.00106)|all_epithelial(84;0.00111)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00529)|LUSC - Lung squamous cell carcinoma(625;0.19)		GTGCAGGCGCCGCTGAGCAGC	0.692													C|||	1467	0.292931	0.0953	0.2392	5008	,	,		13177	0.378		0.4523	False		,,,				2504	0.3466					.											0								C	SER/GLY	481,3647		34,413,1617	5.0	9.0	8.0		475	0.8	0.0	11	dbSNP_111	8	3172,5086		621,1930,1578	yes	missense	MRGPRE	NM_001039165.2	56	655,2343,3195	TT,TC,CC		38.4112,11.6521,29.493	probably-damaging	159/312	3249552	3653,8733	2064	4129	6193	SO:0001583	missense	116534			AY255572	CCDS41603.1, CCDS41603.2	11p15.5	2012-08-21	2004-03-25		ENSG00000184350	ENSG00000184350		"""GPCR / Class A : Orphans"""	30694	protein-coding gene	gene with protein product		607232	"""G protein-coupled receptor 167"""	GPR167		11551509	Standard	NM_001039165		Approved	mrgE	uc001lxq.5	Q86SM8	OTTHUMG00000011708	ENST00000389832.5:c.478G>A	11.37:g.3249552C>T	ENSP00000374482:p.Gly160Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q2M1V7	Missense_Mutation	SNP	ENST00000389832.5	37		712	0.326007326007326	37	0.07520325203252033	100	0.27624309392265195	229	0.40034965034965037	346	0.45646437994722955	c	7.476	0.647610	0.14516	0.116521	0.384112	ENSG00000184350	ENST00000436689;ENST00000389832	.	.	.	3.75	0.817	0.18773	GPCR, rhodopsin-like superfamily (1);	0.506640	0.14301	U	0.328254	T	0.00012	0.0000	L	0.39397	1.21	0.80722	P	0.0	D	0.61080	0.989	P	0.55455	0.776	T	0.44697	-0.9311	8	0.24483	T	0.36	-11.0184	5.6296	0.17504	0.0:0.6298:0.0:0.3702	rs4391795;rs4990224	159	Q86SM8	MRGRE_HUMAN	S	160;159	.	ENSP00000374482:G159S	G	-	1	0	MRGPRE	3206128	0.000000	0.05858	0.001000	0.08648	0.014000	0.08584	0.733000	0.26087	-0.017000	0.14103	-0.229000	0.12294	GGC		0.692	MRGPRE-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000032346.5	XM_171536	
MUC4	4585	mdanderson.org	37	3	195513203	195513203	+	Missense_Mutation	SNP	C	C	T	rs77879173		TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr3:195513203C>T	ENST00000463781.3	-	2	5707	c.5248G>A	c.(5248-5250)Gct>Act	p.A1750T	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.A1750T|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GCTGAGGAAGCGTCAGTGACA	0.587																																						.											0													40.0	37.0	38.0					3																	195513203		692	1590	2282	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.5248G>A	3.37:g.195513203C>T	ENSP00000417498:p.Ala1750Thr	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	9.516	1.107067	0.20714	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.33438	1.48;1.41	0.844	0.844	0.18943	.	0.442567	0.10986	U	0.612157	T	0.15522	0.0374	N	0.08118	0	0.09310	N	0.999995	P	0.52463	0.953	B	0.43386	0.418	T	0.14671	-1.0464	9	.	.	.	.	7.477	0.27382	0.0:0.9999:0.0:1.0E-4	.	1750	E7ESK3	.	T	1750	ENSP00000417498:A1750T;ENSP00000420243:A1750T	.	A	-	1	0	MUC4	196997598	0.000000	0.05858	0.011000	0.14972	0.011000	0.07611	-1.799000	0.01746	0.088000	0.17205	0.089000	0.15464	GCT		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195515017	195515017	+	Missense_Mutation	SNP	A	A	G	rs199883835		TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr3:195515017A>G	ENST00000463781.3	-	2	3893	c.3434T>C	c.(3433-3435)gTa>gCa	p.V1145A	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.V1145A|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	619					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.V1145A(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACCTGTGGATACTGAGGAAGT	0.562																																						.											2	Substitution - Missense(2)	stomach(2)											12.0	7.0	8.0					3																	195515017		680	1501	2181	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.3434T>C	3.37:g.195515017A>G	ENSP00000417498:p.Val1145Ala	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	1.557	-0.537621	0.04082	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.32272	1.47;1.46	0.814	-1.63	0.08345	.	.	.	.	.	T	0.14527	0.0351	N	0.19112	0.55	0.80722	P	0.0	B	0.06786	0.001	B	0.01281	0.0	T	0.29941	-0.9995	7	.	.	.	.	3.4865	0.07622	0.2163:0.2632:0.5205:0.0	.	1145	E7ESK3	.	A	1145	ENSP00000417498:V1145A;ENSP00000420243:V1145A	.	V	-	2	0	MUC4	196999412	0.000000	0.05858	0.000000	0.03702	0.120000	0.20174	-1.901000	0.01597	-0.707000	0.05022	0.055000	0.15244	GTA		0.562	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
NAP1L5	266812	mdanderson.org	37	4	89618837	89618837	+	Silent	SNP	T	T	C	rs710834	byFrequency	TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr4:89618837T>C	ENST00000323061.5	-	1	549	c.69A>G	c.(67-69)gcA>gcG	p.A23A	HERC3_ENST00000543130.1_Intron|HERC3_ENST00000264345.3_Intron|HERC3_ENST00000402738.1_Intron	NM_153757.2	NP_715638.1	Q96NT1	NP1L5_HUMAN	nucleosome assembly protein 1-like 5	23	Poly-Ala.				nucleosome assembly (GO:0006334)	nucleus (GO:0005634)				endometrium(2)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	7				OV - Ovarian serous cystadenocarcinoma(123;0.000181)		ttacctcctctgccgctgcct	0.682													C|||	2787	0.55651	0.7292	0.3588	5008	,	,		11493	0.5516		0.3678	False		,,,				2504	0.6626					.											0								C	,	2661,1617		892,877,370	13.0	17.0	16.0		,69	-1.3	0.0	4	dbSNP_86	16	2912,5504		568,1776,1864	no	intron,coding-synonymous	HERC3,NAP1L5	NM_014606.1,NM_153757.2	,	1460,2653,2234	CC,CT,TT		34.6008,37.798,43.9026	,	,23/183	89618837	5573,7121	2139	4208	6347	SO:0001819	synonymous_variant	266812			NM_153757	CCDS3632.1	4q21-q22	2006-04-12			ENSG00000177432	ENSG00000177432			19968	protein-coding gene	gene with protein product		612203				12383514	Standard	NM_153757		Approved	DRLM	uc003hrx.3	Q96NT1	OTTHUMG00000130950	ENST00000323061.5:c.69A>G	4.37:g.89618837T>C		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000323061.5	37	CCDS3632.1																																																																																				0.682	NAP1L5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253551.1	NM_153757	
NLE1	54475	mdanderson.org	37	17	33469279	33469279	+	Missense_Mutation	SNP	G	G	C	rs1471615	byFrequency	TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr17:33469279G>C	ENST00000442241.4	-	1	55	c.16C>G	c.(16-18)Ccg>Gcg	p.P6A	NLE1_ENST00000586869.1_5'UTR|NLE1_ENST00000360831.5_Missense_Mutation_p.P6A|NLE1_ENST00000593176.1_5'Flank	NM_001014445.1|NM_018096.3	NP_001014445.1|NP_060566.2	Q9NVX2	NLE1_HUMAN	notchless homolog 1 (Drosophila)	6			P -> A (in dbSNP:rs1471615). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:19413330, ECO:0000269|PubMed:22223895, ECO:0000269|PubMed:22814378, ECO:0000269|Ref.5}.		hematopoietic stem cell homeostasis (GO:0061484)|inner cell mass cell differentiation (GO:0001826)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:2001268)|negative regulation of mitotic cell cycle (GO:0045930)|Notch signaling pathway (GO:0007219)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|ribosomal large subunit biogenesis (GO:0042273)	nucleolus (GO:0005730)|nucleus (GO:0005634)				NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)	22		Ovarian(249;0.17)				ACACCCACCGGCACTGCTGCC	0.756													C|||	4975	0.993411	0.9985	0.9957	5008	,	,		10691	1.0		0.9742	False		,,,				2504	0.998					.											0								C	,ALA/PRO	3575,19		1778,19,0	3.0	4.0	4.0		,16	3.4	0.0	17	dbSNP_88	4	7070,124		3473,124,0	no	utr-5,missense	NLE1	NM_001014445.1,NM_018096.3	,27	5251,143,0	CC,CG,GG		1.7237,0.5287,1.3255	,benign	,6/486	33469279	10645,143	1797	3597	5394	SO:0001583	missense	54475				CCDS11291.1, CCDS45647.1	17q12	2013-01-10		2005-08-09	ENSG00000073536	ENSG00000073536		"""WD repeat domain containing"""	19889	protein-coding gene	gene with protein product	"""Notchless gene homolog, (Drosophila)"""						Standard	XM_005257989		Approved	FLJ10458	uc002hiy.1	Q9NVX2	OTTHUMG00000132928	ENST00000442241.4:c.16C>G	17.37:g.33469279G>C	ENSP00000413572:p.Pro6Ala	Somatic		WXS	Illumina HiSeq	Phase_I	O60868|Q59GJ8|Q9BU54	Missense_Mutation	SNP	ENST00000442241.4	37	CCDS11291.1	2147	0.983058608058608	488	0.991869918699187	357	0.9861878453038674	572	1.0	730	0.9630606860158312	C	12.94	2.088081	0.36855	0.994713	0.982763	ENSG00000073536	ENST00000442241;ENST00000537697	T	0.55588	0.51	4.34	3.37	0.38596	.	.	.	.	.	T	0.00012	0.0000	N	0.11560	0.145	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.34153	-0.9840	8	0.18710	T	0.47	15.9119	5.5414	0.17039	0.0:0.6863:0.2052:0.1085	rs1471615;rs52800602;rs59359892;rs1471615	6	Q9NVX2	NLE1_HUMAN	A	6	ENSP00000413572:P6A	ENSP00000413572:P6A	P	-	1	0	NLE1	30493392	0.001000	0.12720	0.010000	0.14722	0.119000	0.20118	0.511000	0.22739	1.193000	0.43086	-0.187000	0.12897	CCG		0.756	NLE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256441.2	NM_018096	
PABPC3	5042	mdanderson.org	37	13	25670851	25670851	+	Missense_Mutation	SNP	A	A	G	rs75475407	byFrequency	TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr13:25670851A>G	ENST00000281589.3	+	1	552	c.515A>G	c.(514-516)cAa>cGa	p.Q172R		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	172	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		TTTGTTGGACAATTTAAGTCT	0.393													g|||	253	0.0505192	0.0719	0.0576	5008	,	,		22064	0.0268		0.0318	False		,,,				2504	0.0603					.											0													110.0	104.0	106.0					13																	25670851		2203	4300	6503	SO:0001583	missense	5042			AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.515A>G	13.37:g.25670851A>G	ENSP00000281589:p.Gln172Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q8NHV0|Q9H086	Missense_Mutation	SNP	ENST00000281589.3	37	CCDS9311.1	.	.	.	.	.	.	.	.	.	.	A	0.065	-1.215282	0.01542	.	.	ENSG00000151846	ENST00000281589	T	0.75704	-0.96	0.828	-0.101	0.13618	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (1);	0.358703	0.18389	N	0.142734	T	0.42877	0.1222	N	0.10664	0.02	0.21841	N	0.99951	B	0.02656	0.0	B	0.01281	0.0	T	0.34079	-0.9843	10	0.02654	T	1	.	5.2926	0.15735	0.2365:0.0:0.7635:0.0	.	172	Q9H361	PABP3_HUMAN	R	172	ENSP00000281589:Q172R	ENSP00000281589:Q172R	Q	+	2	0	PABPC3	24568851	1.000000	0.71417	0.921000	0.36526	0.168000	0.22595	4.799000	0.62517	-0.074000	0.12820	-0.769000	0.03391	CAA		0.393	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044220.2	NM_030979	
RAET1G	353091	mdanderson.org	37	6	150240697	150240697	+	Missense_Mutation	SNP	A	A	G	rs571396556	byFrequency	TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr6:150240697A>G	ENST00000367360.2	-	2	408	c.341T>C	c.(340-342)aTa>aCa	p.I114T	RAET1G_ENST00000479265.1_Missense_Mutation_p.I114T|RP11-244K5.8_ENST00000606915.1_RNA|RAET1E-AS1_ENST00000605899.1_RNA|RAET1E-AS1_ENST00000446954.2_RNA	NM_001001788.2	NP_001001788.2			retinoic acid early transcript 1G											NS(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(4)|urinary_tract(1)	13		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.73e-12)		ACCCTTGGGTATGTAATTCTC	0.448													N|||	2	0.000399361	0.0	0.0	5008	,	,		23706	0.0		0.0	False		,,,				2504	0.002					.											0													235.0	228.0	231.0					6																	150240697		2203	4300	6503	SO:0001583	missense	353091			AY172579	CCDS43514.1	6q24.1-25.1	2009-04-29	2004-11-22		ENSG00000203722	ENSG00000203722			16795	protein-coding gene	gene with protein product		609244	"""retinoic acid early transcript 1G pseudogene"""			11827464, 15240696	Standard	NM_001001788		Approved	ULBP5	uc010kii.1	Q6H3X3	OTTHUMG00000015802	ENST00000367360.2:c.341T>C	6.37:g.150240697A>G	ENSP00000356329:p.Ile114Thr	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000367360.2	37	CCDS43514.1	.	.	.	.	.	.	.	.	.	.	A	0.003	-2.500490	0.00157	.	.	ENSG00000203722	ENST00000367360;ENST00000479265	T;T	0.00662	5.93;5.93	2.4	-2.21	0.06973	MHC class I, alpha chain, alpha1/alpha2 (1);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	.	.	.	.	T	0.00109	0.0003	N	0.05574	-0.02	0.09310	N	1	B	0.11235	0.004	B	0.15052	0.012	T	0.28902	-1.0029	9	0.13470	T	0.59	.	0.432	0.00472	0.2687:0.1947:0.3388:0.1979	.	114	Q6H3X3	RET1G_HUMAN	T	114	ENSP00000356329:I114T;ENSP00000417503:I114T	ENSP00000356329:I114T	I	-	2	0	RAET1G	150282390	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.381000	0.02549	-0.582000	0.05929	-0.343000	0.07986	ATA		0.448	RAET1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042668.2		
RAVER1	125950	mdanderson.org	37	19	10431799	10431799	+	Silent	SNP	G	G	T	rs281425	byFrequency	TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr19:10431799G>T	ENST00000293677.6	-	8	1530	c.1449C>A	c.(1447-1449)ccC>ccA	p.P483P	CTD-2369P2.12_ENST00000586529.1_5'Flank	NM_133452.2	NP_597709.2	Q8IY67	RAVR1_HUMAN	ribonucleoprotein, PTB-binding 1	466						cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|large_intestine(1)|lung(8)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	18			OV - Ovarian serous cystadenocarcinoma(20;1.81e-09)|Epithelial(33;3.65e-06)|all cancers(31;8.35e-06)			CCACAGGGGCGGGGGGAGGAG	0.736													G|||	1073	0.214257	0.3086	0.1801	5008	,	,		12960	0.1012		0.2256	False		,,,				2504	0.2157					.											0								G		462,2062		41,380,841	2.0	2.0	2.0		1449	-7.2	0.3	19	dbSNP_79	2	1100,4946		110,880,2033	no	coding-synonymous	RAVER1	NM_133452.2		151,1260,2874	TT,TG,GG		18.1938,18.3043,18.2264		483/757	10431799	1562,7008	1262	3023	4285	SO:0001819	synonymous_variant	125950				CCDS45960.1	19p13.2	2013-02-12				ENSG00000161847		"""RNA binding motif (RRM) containing"""	30296	protein-coding gene	gene with protein product		609950				11853319, 11724819	Standard	NM_133452		Approved	KIAA1978	uc002moa.3	Q8IY67		ENST00000293677.6:c.1449C>A	19.37:g.10431799G>T		Somatic		WXS	Illumina HiSeq	Phase_I	A6NMU4|Q8IY60|Q8TF24	Silent	SNP	ENST00000293677.6	37	CCDS45960.1																																																																																				0.736	RAVER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451227.1	NM_133452	
RHPN2	85415	mdanderson.org	37	19	33490500	33490500	+	Missense_Mutation	SNP	C	C	T	rs201438314		TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr19:33490500C>T	ENST00000254260.3	-	10	1252	c.1217G>A	c.(1216-1218)cGa>cAa	p.R406Q	RHPN2_ENST00000400226.4_Missense_Mutation_p.R255Q	NM_033103.4	NP_149094.3	Q8IUC4	RHPN2_HUMAN	rhophilin, Rho GTPase binding protein 2	406	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)		p.R406Q(1)		NS(1)|breast(3)|central_nervous_system(5)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(3)|urinary_tract(1)	44	Esophageal squamous(110;0.137)					ACCCAGCTGTCGGCGCTGCTG	0.637																																						.											1	Substitution - Missense(1)	skin(1)											46.0	40.0	42.0					19																	33490500		2203	4300	6503	SO:0001583	missense	85415			AF268032	CCDS12427.1	19q13.12	2008-02-05				ENSG00000131941			19974	protein-coding gene	gene with protein product						12221077	Standard	NM_033103		Approved		uc002nuf.3	Q8IUC4		ENST00000254260.3:c.1217G>A	19.37:g.33490500C>T	ENSP00000254260:p.Arg406Gln	Somatic		WXS	Illumina HiSeq	Phase_I	B2RCG8|B3KUY8|B4DUS7|Q8N3T7|Q8N9D6|Q8NE33|Q96RU1	Missense_Mutation	SNP	ENST00000254260.3	37	CCDS12427.1	.	.	.	.	.	.	.	.	.	.	C	18.46	3.628137	0.66901	.	.	ENSG00000131941	ENST00000254260;ENST00000544458;ENST00000400226	T;T	0.44482	1.92;0.92	4.72	-6.97	0.01616	BRO1 domain (3);	1.251570	0.05432	N	0.546131	T	0.27098	0.0664	L	0.43923	1.385	0.09310	N	1	B	0.20550	0.046	B	0.14578	0.011	T	0.14309	-1.0477	10	0.30854	T	0.27	0.7441	3.3955	0.07304	0.1977:0.0875:0.0954:0.6194	.	406	Q8IUC4	RHPN2_HUMAN	Q	406;136;255	ENSP00000254260:R406Q;ENSP00000402244:R255Q	ENSP00000254260:R406Q	R	-	2	0	RHPN2	38182340	0.000000	0.05858	0.018000	0.16275	0.900000	0.52787	-0.317000	0.08060	-1.575000	0.01655	0.484000	0.47621	CGA		0.637	RHPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450828.2	NM_033103	
RIN1	9610	mdanderson.org	37	11	66102088	66102088	+	Silent	SNP	G	G	A	rs3814740	byFrequency	TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr11:66102088G>A	ENST00000311320.4	-	6	1308	c.1182C>T	c.(1180-1182)ccC>ccT	p.P394P	RIN1_ENST00000530056.1_Silent_p.P289P|RP11-867G23.12_ENST00000526655.1_RNA|RIN1_ENST00000424433.2_Silent_p.P289P|RIN1_ENST00000524804.1_5'Flank	NM_004292.2	NP_004283.2	Q13671	RIN1_HUMAN	Ras and Rab interactor 1	394	Ras and 14-3-3 protein binding region.			AGPE -> DGQR (in Ref. 1, 2 and 3). {ECO:0000305}.	associative learning (GO:0008306)|endocytosis (GO:0006897)|memory (GO:0007613)|negative regulation of synaptic plasticity (GO:0031914)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(1)|lung(8)|ovary(1)	14						CCTGGGGCTCGGGCCCAGCCC	0.721													G|||	740	0.147764	0.3026	0.0836	5008	,	,		11802	0.1399		0.0885	False		,,,				2504	0.0532					.											0								G		1109,3245		154,801,1222	10.0	11.0	11.0		1182	-8.5	0.0	11	dbSNP_107	11	652,7874		43,566,3654	no	coding-synonymous	RIN1	NM_004292.2		197,1367,4876	AA,AG,GG		7.6472,25.4708,13.6724		394/784	66102088	1761,11119	2177	4263	6440	SO:0001819	synonymous_variant	9610			L36463	CCDS31614.1	11q13.2	2005-09-18				ENSG00000174791			18749	protein-coding gene	gene with protein product		605965				9144171, 1849280	Standard	NM_004292		Approved		uc001ohn.1	Q13671		ENST00000311320.4:c.1182C>T	11.37:g.66102088G>A		Somatic		WXS	Illumina HiSeq	Phase_I	O15010|Q00427|Q96CC8	Silent	SNP	ENST00000311320.4	37	CCDS31614.1																																																																																				0.721	RIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392980.2	NM_004292	
SDHA	6389	mdanderson.org	37	5	236653	236653	+	Silent	SNP	C	C	A	rs75091805	byFrequency	TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr5:236653C>A	ENST00000264932.6	+	10	1486	c.1371C>A	c.(1369-1371)ctC>ctA	p.L457L	SDHA_ENST00000504309.1_Silent_p.L457L|SDHA_ENST00000510361.1_Silent_p.L409L	NM_004168.2	NP_004159.2	P31040	SDHA_HUMAN	succinate dehydrogenase complex, subunit A, flavoprotein (Fp)	457					cellular metabolic process (GO:0044237)|nervous system development (GO:0007399)|oxidation-reduction process (GO:0055114)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|tricarboxylic acid cycle (GO:0006099)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|succinate dehydrogenase (ubiquinone) activity (GO:0008177)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|liver(2)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	40			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	CAAACTCGCTCTTGGACCTGG	0.587									Familial Paragangliomas																													.											0													91.0	82.0	85.0					5																	236653		2203	4300	6503	SO:0001819	synonymous_variant	6389	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss	BC001380	CCDS3853.1	5p15	2014-09-17			ENSG00000073578	ENSG00000073578		"""Mitochondrial respiratory chain complex / Complex II"""	10680	protein-coding gene	gene with protein product		600857		SDH2		7798181	Standard	XM_005248329		Approved	FP, SDHF	uc003jao.4	P31040	OTTHUMG00000090275	ENST00000264932.6:c.1371C>A	5.37:g.236653C>A		Somatic		WXS	Illumina HiSeq	Phase_I	A8K5J6|B4DJ60|E9PBJ5|Q16395|Q59GW8|Q8IW48|Q9UMY5	Silent	SNP	ENST00000264932.6	37	CCDS3853.1	222	0.10164835164835165	47	0.09552845528455285	42	0.11602209944751381	74	0.12937062937062938	59	0.07783641160949868	g	4.415	0.076790	0.08485	.	.	ENSG00000073578	ENST00000515815	.	.	.	5.01	-1.79	0.07932	.	.	.	.	.	T	0.00724	0.0024	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.03043	-1.1079	4	.	.	.	.	7.9398	0.29952	0.0:0.2923:0.4778:0.2299	.	.	.	.	Y	9	.	.	S	+	2	0	SDHA	289653	0.041000	0.20044	0.041000	0.18516	0.432000	0.31715	-0.842000	0.04354	-0.318000	0.08665	0.650000	0.86243	TCT		0.587	SDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206599.1	NM_004168	
SPCS1	28972	mdanderson.org	37	3	52740182	52740182	+	5'UTR	SNP	C	C	G	rs6617	byFrequency	TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr3:52740182C>G	ENST00000602728.1	+	0	89				GLT8D1_ENST00000478968.2_5'Flank|GLT8D1_ENST00000407584.3_5'Flank|SPCS1_ENST00000233025.7_Missense_Mutation_p.P41A|GLT8D1_ENST00000266014.5_5'Flank|GLT8D1_ENST00000394783.3_5'Flank|SPCS1_ENST00000423431.1_Intron|GLT8D1_ENST00000491606.1_5'Flank			Q9Y6A9	SPCS1_HUMAN	signal peptidase complex subunit 1 homolog (S. cerevisiae)						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|proteolysis (GO:0006508)|regulation of insulin secretion (GO:0050796)|signal peptide processing (GO:0006465)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|signal peptidase complex (GO:0005787)	peptidase activity (GO:0008233)			kidney(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)	6				BRCA - Breast invasive adenocarcinoma(193;6.51e-05)|Kidney(197;0.000583)|KIRC - Kidney renal clear cell carcinoma(197;0.000751)|OV - Ovarian serous cystadenocarcinoma(275;0.0469)		CCAGACCTTACCCCTCACGGT	0.697													G|||	2230	0.445288	0.5575	0.5144	5008	,	,		13167	0.4286		0.4304	False		,,,				2504	0.2771					.											0													10.0	15.0	14.0					3																	52740182		687	1590	2277	SO:0001623	5_prime_UTR_variant	28972			AF092138	CCDS33769.2	3p21.31	2005-01-05			ENSG00000114902	ENSG00000114902			23401	protein-coding gene	gene with protein product		610358				8632014	Standard	NM_014041		Approved	SPC12, HSPC033, YJR010C-A, SPC1	uc011bei.2	Q9Y6A9	OTTHUMG00000154930	ENST00000602728.1:c.-81C>G	3.37:g.52740182C>G		Somatic		WXS	Illumina HiSeq	Phase_I	B3KNF8|Q9BVW1	Missense_Mutation	SNP	ENST00000602728.1	37		1074	0.49175824175824173	273	0.5548780487804879	192	0.5303867403314917	280	0.48951048951048953	329	0.4340369393139842	G	1.062	-0.672572	0.03403	.	.	ENSG00000114902	ENST00000233025	.	.	.	3.96	-4.39	0.03611	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.41716	-0.9493	7	0.02654	T	1	.	3.0659	0.06214	0.2759:0.4525:0.1602:0.1114	rs6617;rs1139798;rs3184127;rs17548630;rs6617	41	Q9Y6A9	SPCS1_HUMAN	A	41	.	ENSP00000233025:P41A	P	+	1	0	SPCS1	52715222	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.407000	0.02488	-1.177000	0.02744	-0.127000	0.14921	CCC		0.697	SPCS1-006	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000467759.1	NM_014041	
TAS2R43	259289	mdanderson.org	37	12	11244603	11244603	+	Missense_Mutation	SNP	T	T	A	rs200999522	byFrequency	TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr12:11244603T>A	ENST00000531678.1	-	1	309	c.226A>T	c.(226-228)Aat>Tat	p.N76Y	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176884.2	NP_795365.2	P59537	T2R43_HUMAN	taste receptor, type 2, member 43	76					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			endometrium(1)|ovary(1)|prostate(2)|urinary_tract(1)	5			OV - Ovarian serous cystadenocarcinoma(49;0.0344)	BRCA - Breast invasive adenocarcinoma(232;0.196)		TCTACACTATTAAAAGCTGGA	0.398																																						.											0													50.0	43.0	46.0					12																	11244603		1915	3971	5886	SO:0001583	missense	259289			AF494237	CCDS53749.1	12p13.2	2012-08-22				ENSG00000255374		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18875	protein-coding gene	gene with protein product		612668				12379855	Standard	NM_176884		Approved	T2R52	uc001qzq.1	P59537		ENST00000531678.1:c.226A>T	12.37:g.11244603T>A	ENSP00000431719:p.Asn76Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	P59546|Q645X4	Missense_Mutation	SNP	ENST00000531678.1	37	CCDS53749.1	.	.	.	.	.	.	.	.	.	.	-	0	-2.676482	0.00102	.	.	ENSG00000255374	ENST00000531678	T	0.35789	1.29	1.97	-3.32	0.04973	.	.	.	.	.	T	0.03136	0.0092	N	0.00007	-3.165	0.80722	P	0.0	B	0.02656	0.0	B	0.04013	0.001	T	0.34976	-0.9807	8	0.02654	T	1	.	2.2701	0.04088	0.4334:0.0:0.3302:0.2364	.	76	P59537	T2R43_HUMAN	Y	76	ENSP00000431719:N76Y	ENSP00000431719:N76Y	N	-	1	0	TAS2R43	11135870	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.204000	0.09425	-0.948000	0.03668	-1.812000	0.00611	AAT		0.398	TAS2R43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383561.1	NM_176884	
TUSC1	286319	mdanderson.org	37	9	25677698	25677698	+	Missense_Mutation	SNP	A	A	C	rs72631815	byFrequency	TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr9:25677698A>C	ENST00000358022.3	-	1	1158	c.622T>G	c.(622-624)Tct>Gct	p.S208A		NM_001004125.2	NP_001004125.1	Q2TAM9	TUSC1_HUMAN	tumor suppressor candidate 1	208										kidney(1)	1	all_hematologic(1;0.197)	all_neural(3;5.42e-18)|Glioma(3;5.54e-17)		GBM - Glioblastoma multiforme(1;1.51e-108)|Lung(42;2.88e-14)|LUSC - Lung squamous cell carcinoma(38;3.16e-11)		CAGGGCCCAGAGGGCTCCGAG	0.736													A|||	833	0.166334	0.034	0.1744	5008	,	,		11360	0.1577		0.326	False		,,,				2504	0.184				Pancreas(19;648 672 25630 30820 31331)	.											0								A	ALA/SER	228,3728		13,202,1763	6.0	6.0	6.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	622	-1.1	0.0	9	dbSNP_130	6	2027,5715		281,1465,2125	no	missense	TUSC1	NM_001004125.2	99	294,1667,3888	CC,CA,AA		26.1819,5.7634,19.2768	benign	208/213	25677698	2255,9443	1978	3871	5849	SO:0001583	missense	286319			AY168647	CCDS34999.1	9p21.2	2014-05-22			ENSG00000198680	ENSG00000198680			31010	protein-coding gene	gene with protein product		610529				15208665	Standard	NM_001004125		Approved	TSG-9	uc003zpx.3	Q2TAM9	OTTHUMG00000159591	ENST00000358022.3:c.622T>G	9.37:g.25677698A>C	ENSP00000350716:p.Ser208Ala	Somatic		WXS	Illumina HiSeq	Phase_I	A0PJ78|Q67GI3|Q86SS1|Q8TAH8	Missense_Mutation	SNP	ENST00000358022.3	37	CCDS34999.1	446	0.2042124542124542	35	0.07113821138211382	74	0.20441988950276244	96	0.16783216783216784	241	0.3179419525065963	A	3.000	-0.206320	0.06180	0.057634	0.261819	ENSG00000198680	ENST00000358022	T	0.48201	0.82	3.71	-1.1	0.09872	.	0.850927	0.09559	U	0.785795	T	0.00012	0.0000	L	0.44542	1.39	0.80722	P	0.0	B	0.14012	0.009	B	0.08055	0.003	T	0.34279	-0.9835	9	0.06757	T	0.87	0.0163	4.2113	0.10512	0.3572:0.3245:0.3183:0.0	.	208	Q2TAM9	TUSC1_HUMAN	A	208	ENSP00000350716:S208A	ENSP00000350716:S208A	S	-	1	0	TUSC1	25667698	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.236000	0.09003	-0.521000	0.06426	0.379000	0.24179	TCT		0.736	TUSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356351.1	NM_001004125	
TMEFF1	8577	mdanderson.org	37	9	103235853	103235853	+	Silent	SNP	G	G	T	rs77849433	byFrequency	TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr9:103235853G>T	ENST00000374879.4	+	1	459	c.27G>T	c.(25-27)ccG>ccT	p.P9P	TMEFF1_ENST00000334943.6_Intron|MSANTD3-TMEFF1_ENST00000502978.1_Intron	NM_003692.4	NP_003683.2	Q8IYR6	TEFF1_HUMAN	transmembrane protein with EGF-like and two follistatin-like domains 1	9					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|kidney(1)|large_intestine(7)|lung(9)|stomach(1)	19		Acute lymphoblastic leukemia(62;0.0452)				CTGAGGCGCCGCTCCGGCTGC	0.751													G|||	400	0.0798722	0.0877	0.1138	5008	,	,		7642	0.001		0.1292	False		,,,				2504	0.0757					.											0								G	,	360,3810		24,312,1749	5.0	6.0	5.0		,27	3.1	1.0	9	dbSNP_131	5	1088,7026		89,910,3058	no	intron,coding-synonymous	TMEFF1,C9orf30-TMEFF1	NM_001198812.1,NM_003692.4	,	113,1222,4807	TT,TG,GG		13.4089,8.6331,11.7877	,	,9/381	103235853	1448,10836	2085	4057	6142	SO:0001819	synonymous_variant	8577			U19878	CCDS6750.1	9q31	2010-05-04			ENSG00000241697	ENSG00000241697			11866	protein-coding gene	gene with protein product	"""tomoregulin-1"", ""cancer/testis antigen family 120, member 1"""	603421		C9orf2		9730596	Standard	NM_003692		Approved	H7365, CT120.1		Q8IYR6	OTTHUMG00000020367	ENST00000374879.4:c.27G>T	9.37:g.103235853G>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q13086|Q8N3T8	Silent	SNP	ENST00000374879.4	37	CCDS6750.1																																																																																				0.751	TMEFF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053418.1	NM_003692	
PER3	8863	bcgsc.ca	37	1	7890053	7890053	+	Missense_Mutation	SNP	G	G	A	rs1776342	byFrequency	TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr1:7890053G>A	ENST00000361923.2	+	18	3194	c.3019G>A	c.(3019-3021)Gct>Act	p.A1007T	PER3_ENST00000377532.3_Missense_Mutation_p.A1016T|RP3-467L1.4_ENST00000451646.1_RNA	NM_016831.1	NP_058515.1	P56645	PER3_HUMAN	period circadian clock 3	1007	5 X 18 AA tandem repeats of S-[HP]-[AP]- T-[AT]-[GST]-[ATV]-L-S-[MT]-G-[LS]-P-P- [MRS]-[EKR]-[NST]-P.|Ser-rich.		A -> T (in dbSNP:rs1776342).|Missing (associated with eveningness and better cognitive performance during sleep deprivation exepriments; dbSNP:rs57875989).		circadian regulation of gene expression (GO:0032922)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)	p.A1007T(1)		breast(4)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	39	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)		TACTGCCAGCGCTCTGTCCAC	0.587																																						.											1	Substitution - Missense(1)	kidney(1)											87.0	69.0	75.0					1																	7890053		1995	3902	5897	SO:0001583	missense	8863			BC026102	CCDS89.1, CCDS72695.1	1p36.23	2012-12-13	2012-12-13		ENSG00000049246	ENSG00000049246			8847	protein-coding gene	gene with protein product		603427	"""period (Drosophila) homolog 3"", ""period homolog 3 (Drosophila)"""			9427249	Standard	XM_005263520		Approved		uc001aoo.3	P56645	OTTHUMG00000001216	ENST00000361923.2:c.3019G>A	1.37:g.7890053G>A	ENSP00000355031:p.Ala1007Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q5H8X4|Q5H8X5|Q969K6|Q96S77|Q96S78|Q9C0J3|Q9NSP9|Q9UGU8	Missense_Mutation	SNP	ENST00000361923.2	37	CCDS89.1	.	.	.	.	.	.	.	.	.	.	g	0.668	-0.803078	0.02841	.	.	ENSG00000049246	ENST00000377532;ENST00000361923	T;T	0.14391	2.51;2.51	0.119	0.119	0.14685	Period circadian-like, C-terminal (1);	9.368370	0.00166	N	0.000019	T	0.09158	0.0226	N	0.20685	0.6	0.09310	N	1	B;B;B;B;B	0.25048	0.025;0.007;0.066;0.117;0.007	B;B;B;B;B	0.23018	0.002;0.004;0.004;0.043;0.004	T	0.25676	-1.0125	9	0.18710	T	0.47	.	.	.	.	rs1776342	56;1007;1016;1016;1007	B4DR65;A2I2N5;A6H8X0;P56645-2;P56645	.;.;.;.;PER3_HUMAN	T	1016;1007	ENSP00000366755:A1016T;ENSP00000355031:A1007T	ENSP00000355031:A1007T	A	+	1	0	PER3	7812640	0.000000	0.05858	0.068000	0.19968	0.074000	0.17049	-0.849000	0.04322	0.275000	0.22094	0.280000	0.19369	GCT		0.587	PER3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000003607.1	NM_016831	
NTN3	4917	bcgsc.ca	37	16	2523296	2523296	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr16:2523296A>G	ENST00000293973.1	+	4	1498	c.1295A>G	c.(1294-1296)gAc>gGc	p.D432G	TBC1D24_ENST00000567020.1_5'Flank|TBC1D24_ENST00000293970.5_5'Flank	NM_006181.2	NP_006172.1	O00634	NET3_HUMAN	netrin 3	432					axon guidance (GO:0007411)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)	Golgi apparatus (GO:0005794)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|central_nervous_system(2)|lung(3)|prostate(1)	7						CCCACTGAGGACAGCAGCCCT	0.647																																						.											0													92.0	109.0	103.0					16																	2523296		2198	4298	6496	SO:0001583	missense	4917			U86759	CCDS10469.1	16p13.3	2013-03-01	2008-10-29	2008-10-29	ENSG00000162068	ENSG00000162068		"""Netrins"""	8030	protein-coding gene	gene with protein product	"""Netrin-3"""	602349	"""netrin 2 (chicken)-like"", ""netrin 2-like (chicken)"""	NTN2L		9143507, 10366627	Standard	NM_006181		Approved		uc002cqj.3	O00634	OTTHUMG00000128867	ENST00000293973.1:c.1295A>G	16.37:g.2523296A>G	ENSP00000293973:p.Asp432Gly	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000293973.1	37	CCDS10469.1	.	.	.	.	.	.	.	.	.	.	A	2.177	-0.388519	0.04932	.	.	ENSG00000162068	ENST00000293973	T	0.35789	1.29	3.8	1.25	0.21368	.	0.345781	0.25154	N	0.032739	T	0.13243	0.0321	N	0.08118	0	0.09310	N	1	B	0.16166	0.016	B	0.14023	0.01	T	0.10200	-1.0640	10	0.21540	T	0.41	.	2.0831	0.03640	0.4809:0.0:0.2595:0.2596	.	432	O00634	NET3_HUMAN	G	432	ENSP00000293973:D432G	ENSP00000293973:D432G	D	+	2	0	NTN3	2463297	0.712000	0.27916	0.956000	0.39512	0.886000	0.51366	1.231000	0.32624	1.372000	0.46190	0.260000	0.18958	GAC		0.647	NTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250812.1	NM_006181	
FXR2	9513	bcgsc.ca	37	17	7506235	7506235	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr17:7506235A>G	ENST00000250113.7	-	6	869	c.535T>C	c.(535-537)Ttc>Ctc	p.F179L		NM_004860.3	NP_004851.2	P51116	FXR2_HUMAN	fragile X mental retardation, autosomal homolog 2	179						cytoplasm (GO:0005737)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.?(1)		NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(8)|prostate(1)	26				READ - Rectum adenocarcinoma(115;0.17)		ACCAGAATGAAGAGCTCACTG	0.393																																						.											1	Unknown(1)	haematopoietic_and_lymphoid_tissue(1)											101.0	97.0	98.0					17																	7506235		1855	4101	5956	SO:0001583	missense	9513			U31501	CCDS45604.1	17p13.3	2014-09-17				ENSG00000129245			4024	protein-coding gene	gene with protein product		605339		FMR1L2		7489725, 9259278	Standard	NM_004860		Approved		uc002gia.2	P51116		ENST00000250113.7:c.535T>C	17.37:g.7506235A>G	ENSP00000250113:p.Phe179Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B2R9M2|D3DTQ1|Q86V09|Q8WUM2	Missense_Mutation	SNP	ENST00000250113.7	37	CCDS45604.1	.	.	.	.	.	.	.	.	.	.	A	11.35	1.611895	0.28712	.	.	ENSG00000129245	ENST00000250113	T	0.32515	1.45	6.03	6.03	0.97812	.	0.104089	0.64402	D	0.000003	T	0.11965	0.0291	N	0.01576	-0.805	0.32738	N	0.508139	B;B	0.10296	0.003;0.003	B;B	0.12837	0.008;0.003	T	0.13282	-1.0515	10	0.30078	T	0.28	0.1318	9.7513	0.40477	0.8461:0.0:0.0:0.1539	.	179;179	Q86V09;P51116	.;FXR2_HUMAN	L	179	ENSP00000250113:F179L	ENSP00000250113:F179L	F	-	1	0	FXR2	7446960	0.997000	0.39634	1.000000	0.80357	0.760000	0.43138	1.591000	0.36665	2.308000	0.77769	0.533000	0.62120	TTC		0.393	FXR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441084.1		
ANKRD30BL	554226	bcgsc.ca	37	2	132905706	132905706	+	Nonstop_Mutation	SNP	A	A	G	rs142209162		TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr2:132905706A>G	ENST00000409867.1	-	6	1024	c.775T>C	c.(775-777)Tag>Cag	p.*259Q	ANKRD30BL_ENST00000470729.1_5'UTR			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like	0										endometrium(1)|kidney(3)	4						ACTGTATCCTATTCATCAGGT	0.438																																						.											0																																										SO:0001578	stop_lost	554226					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.775T>C	2.37:g.132905706A>G	ENSP00000386398:p.*259Gluext*29	Somatic		WXS	Illumina HiSeq	Phase_I	B8ZZL7	RNA	SNP	ENST00000409867.1	37		.	.	.	.	.	.	.	.	.	.	.	0.034	-1.317389	0.01331	.	.	ENSG00000163046	ENST00000409867	.	.	.	0.109	0.109	0.14578	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	Q	259	.	.	X	-	1	0	ANKRD30BL	132622176	0.072000	0.21174	0.103000	0.21229	0.104000	0.19210	0.225000	0.17757	0.156000	0.19299	0.155000	0.16302	TAG		0.438	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331353.2	NR_027019	
ANKRD30BL	554226	bcgsc.ca	37	2	132905741	132905741	+	Missense_Mutation	SNP	G	G	A	rs111770980		TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr2:132905741G>A	ENST00000409867.1	-	6	989	c.740C>T	c.(739-741)aCg>aTg	p.T247M	ANKRD30BL_ENST00000470729.1_5'UTR			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like	247										endometrium(1)|kidney(3)	4						GCTTTCAGCCGTGTCAGGTGT	0.438																																						.											0																																										SO:0001583	missense	554226					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.740C>T	2.37:g.132905741G>A	ENSP00000386398:p.Thr247Met	Somatic		WXS	Illumina HiSeq	Phase_I	B8ZZL7	RNA	SNP	ENST00000409867.1	37		.	.	.	.	.	.	.	.	.	.	.	0.003	-2.579831	0.00129	.	.	ENSG00000163046	ENST00000409867	T	0.40225	1.04	0.109	-0.218	0.13142	.	.	.	.	.	T	0.25158	0.0611	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.20306	-1.0279	5	0.36615	T	0.2	.	.	.	.	.	.	.	.	M	247	ENSP00000386398:T247M	ENSP00000386398:T247M	T	-	2	0	ANKRD30BL	132622211	0.000000	0.05858	0.004000	0.12327	0.004000	0.04260	-2.520000	0.00951	-2.990000	0.00280	-3.030000	0.00073	ACG		0.438	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331353.2	NR_027019	
FRG1B	284802	bcgsc.ca	37	20	29625971	29625971	+	Missense_Mutation	SNP	C	C	A	rs145033899		TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr20:29625971C>A	ENST00000278882.3	+	5	595	c.215C>A	c.(214-216)cCa>cAa	p.P72Q	FRG1B_ENST00000439954.2_Missense_Mutation_p.P77Q|FRG1B_ENST00000358464.4_Missense_Mutation_p.P72Q			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	72										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						CAATGGGAACCAGTCTTTCAA	0.328																																						.											0																																										SO:0001583	missense	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.215C>A	20.37:g.29625971C>A	ENSP00000278882:p.Pro72Gln	Somatic		WXS	Illumina HiSeq	Phase_I	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	c	12.14	1.847531	0.32606	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.49720	0.77	1.68	1.68	0.24146	.	0.112402	0.64402	D	0.000009	T	0.63271	0.2497	.	.	.	0.49483	D	0.999795	D	0.63046	0.992	D	0.79784	0.993	T	0.65948	-0.6044	9	0.66056	D	0.02	.	9.3557	0.38164	0.0:1.0:0.0:0.0	.	77	F5H5R5	.	Q	72;77;72	ENSP00000408863:P77Q	ENSP00000278882:P72Q	P	+	2	0	FRG1B	28239632	1.000000	0.71417	1.000000	0.80357	0.229000	0.25112	6.442000	0.73443	1.250000	0.43966	0.184000	0.17185	CCA		0.328	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
SENP5	205564	bcgsc.ca	37	3	196613141	196613143	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	CTC	CTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr3:196613141_196613143delCTC	ENST00000323460.5	+	2	1338_1340	c.1089_1091delCTC	c.(1087-1092)tcctct>tct	p.363_364SS>S	SENP5_ENST00000419026.1_Intron|SENP5_ENST00000445299.2_In_Frame_Del_p.363_364SS>S	NM_152699.4	NP_689912.2	Q96HI0	SENP5_HUMAN	SUMO1/sentrin specific peptidase 5	363					cell cycle (GO:0007049)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein sumoylation (GO:0016925)	intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)			NS(1)|breast(2)|endometrium(2)|kidney(3)|large_intestine(9)|lung(14)|skin(1)	32	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;3.14e-24)|all cancers(36;2.1e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.004)		CCTGTTCTTCTCCTAAGTGGGAG	0.453																																					Ovarian(47;891 1095 11174 13858 51271)	.											0																																										SO:0001651	inframe_deletion	205564			BC030705	CCDS3322.1	3q29	2005-08-17	2005-08-17		ENSG00000119231	ENSG00000119231			28407	protein-coding gene	gene with protein product		612845	"""SUMO1/sentrin specific protease 5"""			12477932	Standard	NM_152699		Approved	MGC27076	uc003fwz.4	Q96HI0	OTTHUMG00000155527	ENST00000323460.5:c.1089_1091delCTC	3.37:g.196613141_196613143delCTC	ENSP00000327197:p.Ser363del	Somatic		WXS	Illumina HiSeq	Phase_I	B4DY82|Q96SA5	In_Frame_Del	DEL	ENST00000323460.5	37	CCDS3322.1																																																																																				0.453	SENP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340524.1	NM_152699	
SLC26A5	375611	bcgsc.ca	37	7	103038430	103038430	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chr7:103038430A>G	ENST00000306312.3	-	9	1181	c.920T>C	c.(919-921)tTt>tCt	p.F307S	SLC26A5_ENST00000393727.1_Missense_Mutation_p.F307S|SLC26A5_ENST00000356767.4_Missense_Mutation_p.F307S|SLC26A5_ENST00000393730.1_Missense_Mutation_p.F307S|SLC26A5_ENST00000393729.1_Missense_Mutation_p.F270S|SLC26A5_ENST00000354356.4_5'UTR|SLC26A5_ENST00000432958.2_Missense_Mutation_p.F307S|SLC26A5_ENST00000339444.6_Missense_Mutation_p.F307S|SLC26A5_ENST00000393735.2_Missense_Mutation_p.F307S|SLC26A5_ENST00000393723.1_Missense_Mutation_p.F307S	NM_198999.2	NP_945350.1	P58743	S26A5_HUMAN	solute carrier family 26 (anion exchanger), member 5	307					regulation of cell shape (GO:0008360)|regulation of membrane potential (GO:0042391)|sensory perception of sound (GO:0007605)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)	secondary active sulfate transmembrane transporter activity (GO:0008271)			endometrium(5)|kidney(2)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)	43						TTTCAAGTTAAACCCAGCTGA	0.373																																						.											0													152.0	135.0	141.0					7																	103038430		2203	4300	6503	SO:0001583	missense	375611			AC005064	CCDS5733.1, CCDS43630.1, CCDS55150.1, CCDS5732.1, CCDS43629.1	7q22	2013-07-18	2013-07-18	2005-09-13	ENSG00000170615	ENSG00000170615		"""Solute carriers"""	9359	protein-coding gene	gene with protein product	"""deafness, neurosensory, autosomal recessive, 61"""	604943	"""prestin (motor protein)"""	PRES		10821263	Standard	NM_206883		Approved	DFNB61	uc003vbz.3	P58743	OTTHUMG00000149911	ENST00000306312.3:c.920T>C	7.37:g.103038430A>G	ENSP00000304783:p.Phe307Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q496J2|Q7Z7F3|Q86UF8|Q86UF9|Q86UG0	Missense_Mutation	SNP	ENST00000306312.3	37	CCDS5733.1	.	.	.	.	.	.	.	.	.	.	A	15.27	2.785153	0.49997	.	.	ENSG00000170615	ENST00000339444;ENST00000356767;ENST00000393735;ENST00000306312;ENST00000393730;ENST00000432958;ENST00000393729;ENST00000393727;ENST00000393723	D;D;D;D;D;D;D;D;D	0.93426	-3.22;-3.22;-3.22;-3.22;-3.22;-3.22;-3.22;-3.22;-3.22	5.87	4.72	0.59763	Sulphate transporter (1);	0.303544	0.37715	N	0.001965	D	0.89451	0.6719	L	0.31371	0.925	0.80722	D	1	B;P;B;P;P	0.47106	0.063;0.85;0.101;0.813;0.89	B;P;B;B;B	0.45276	0.145;0.475;0.089;0.262;0.262	D	0.87374	0.2352	10	0.34782	T	0.22	.	11.8608	0.52465	0.9312:0.0:0.0688:0.0	.	307;307;307;307;307	P58743;Q496J2;P58743-4;P58743-3;P58743-2	S26A5_HUMAN;.;.;.;.	S	307;307;307;307;307;307;270;307;307	ENSP00000342396:F307S;ENSP00000349210:F307S;ENSP00000377336:F307S;ENSP00000304783:F307S;ENSP00000377331:F307S;ENSP00000389733:F307S;ENSP00000377330:F270S;ENSP00000377328:F307S;ENSP00000377324:F307S	ENSP00000304783:F307S	F	-	2	0	SLC26A5	102825666	1.000000	0.71417	0.999000	0.59377	0.843000	0.47879	7.257000	0.78362	1.156000	0.42514	-0.256000	0.11100	TTT		0.373	SLC26A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313860.1	NM_198999	
MT-ND1	4535	bcgsc.ca	37	M	3922	3922	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chrM:3922G>A	ENST00000361390.2	+	1	616	c.616G>A	c.(616-618)Gaa>Aaa	p.E206K	MT-TA_ENST00000387392.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-ND2_ENST00000361453.3_5'Flank|MT-TM_ENST00000387377.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-CO1_ENST00000361624.2_5'Flank|MT-TC_ENST00000387405.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA			P03886	NU1M_HUMAN	mitochondrially encoded NADH dehydrogenase 1	206					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(13)|kidney(17)|lung(2)|prostate(1)	34					Desflurane(DB01189)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	AAGGGGAGTCCGAACTAGTCT	0.483																																						.											0																																										SO:0001583	missense	10625					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198888	ENSG00000198888	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7455	protein-coding gene	gene with protein product	"""complex I ND1 subunit"", ""NADH-ubiquinone oxidoreductase chain 1"""	516000	"""NADH dehydrogenase 1"""	MTND1			Standard			Approved	ND1, NAD1		P03886		ENST00000361390.2:c.616G>A	M.37:g.3922G>A	ENSP00000354687:p.Glu206Lys	Somatic		WXS	Illumina HiSeq	Phase_I	C0JKH6|Q37523	Missense_Mutation	SNP	ENST00000361390.2	37																																																																																					0.483	MT-ND1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024026	
MT-CO3	4514	bcgsc.ca	37	M	9651	9651	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8434-01A-11D-2310-10	TCGA-KN-8434-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	24f887e1-ce82-40f3-9674-11102bd076c0	2ba9cc49-f11b-48e0-8af9-90bad2c7cc92	g.chrM:9651C>T	ENST00000362079.2	+	1	445	c.445C>T	c.(445-447)Cat>Tat	p.H149Y	MT-TH_ENST00000387441.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-ND4L_ENST00000361335.1_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-TK_ENST00000387421.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-TG_ENST00000387429.1_RNA			P00414	COX3_HUMAN	mitochondrially encoded cytochrome c oxidase III	149					aerobic electron transport chain (GO:0019646)|cellular metabolic process (GO:0044237)|respiratory chain complex IV assembly (GO:0008535)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)			breast(1)|endometrium(10)|kidney(14)|lung(1)|urinary_tract(1)	27						CCTGAGCTCACCATAGTCTAA	0.443																																						.											0																																										SO:0001583	missense	5742					mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198938	ENSG00000198938		"""Mitochondrial respiratory chain complex / Complex IV"""	7422	protein-coding gene	gene with protein product		516050	"""cytochrome c oxidase III"""	MTCO3			Standard			Approved	COX3, COIII, CO3		P00414		ENST00000362079.2:c.445C>T	M.37:g.9651C>T	ENSP00000354982:p.His149Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	Q14Y83	Missense_Mutation	SNP	ENST00000362079.2	37																																																																																					0.443	MT-CO3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024032	
