#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
JAKMIP3	282973	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	10	133955457	133955457	+	Missense_Mutation	SNP	C	C	T	rs374251347		TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr10:133955457C>T	ENST00000298622.4	+	10	1645	c.1507C>T	c.(1507-1509)Cgg>Tgg	p.R503W		NM_001105521.2	NP_001098991.1	Q5VZ66	JKIP3_HUMAN	Janus kinase and microtubule interacting protein 3	503						Golgi apparatus (GO:0005794)				breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	31		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)		GCTGAGGTTCCGGCAGCTGAC	0.607																																						.											0								C	TRP/ARG	0,4398		0,0,2199	97.0	64.0	75.0		1507	1.9	1.0	10		75	1,8587		0,1,4293	no	missense	JAKMIP3	NM_001105521.2	101	0,1,6492	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	503/845	133955457	1,12985	2199	4294	6493	SO:0001583	missense	282973			AL832756	CCDS44494.1	10q26.3	2009-04-23	2009-04-23	2008-01-28	ENSG00000188385	ENSG00000188385			23523	protein-coding gene	gene with protein product	"""neuroendocrine long coiled-coil 2"""	611198	"""chromosome 10 open reading frame 39"", ""chromosome 10 open reading frame 14"""	C10orf39, C10orf14		15277531, 17572408	Standard	NM_001105521		Approved	FLJ37857, NECC2, KIAA4091, bA140A10.5	uc001lkx.4	Q5VZ66	OTTHUMG00000150167	ENST00000298622.4:c.1507C>T	10.37:g.133955457C>T	ENSP00000298622:p.Arg503Trp	Somatic		WXS	Illumina HiSeq	Phase_I	A6PW00|Q69YM6|Q6ZT29	Missense_Mutation	SNP	ENST00000298622.4	37	CCDS44494.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.407340	0.83230	0.0	1.16E-4	ENSG00000188385	ENST00000298622	T	0.26810	1.71	3.87	1.94	0.25998	.	0.244823	0.33092	N	0.005282	T	0.42720	0.1215	M	0.64404	1.975	0.51012	D	0.999909	D	0.89917	1.0	D	0.91635	0.999	T	0.21793	-1.0235	10	0.72032	D	0.01	-22.0753	8.153	0.31152	0.1571:0.7586:0.0:0.0844	.	503	Q5VZ66	JKIP3_HUMAN	W	503	ENSP00000298622:R503W	ENSP00000298622:R503W	R	+	1	2	JAKMIP3	133805447	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.309000	0.59135	0.405000	0.25532	0.561000	0.74099	CGG		0.607	JAKMIP3-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051049.3	NM_194303	
ATM	472	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	11	108126988	108126988	+	Missense_Mutation	SNP	G	G	T			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr11:108126988G>T	ENST00000452508.2	+	15	2360	c.2171G>T	c.(2170-2172)gGt>gTt	p.G724V	ATM_ENST00000278616.4_Missense_Mutation_p.G724V			Q13315	ATM_HUMAN	ATM serine/threonine kinase	724					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	CTTTTGGTGGGTGTCCTTGGC	0.328			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																												.	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	0													101.0	98.0	99.0					11																	108126988		2201	4298	6499	SO:0001583	missense	472	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.2171G>T	11.37:g.108126988G>T	ENSP00000388058:p.Gly724Val	Somatic		WXS	Illumina HiSeq	Phase_I	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	ENST00000452508.2	37	CCDS31669.1	.	.	.	.	.	.	.	.	.	.	G	19.88	3.908296	0.72868	.	.	ENSG00000149311	ENST00000527805;ENST00000278616;ENST00000452508	T;T;T	0.77358	-1.09;-1.09;-1.09	5.45	4.54	0.55810	Armadillo-type fold (1);	0.053429	0.85682	D	0.000000	D	0.85643	0.5744	M	0.69823	2.125	0.58432	D	0.999999	D	0.69078	0.997	D	0.64687	0.928	D	0.86131	0.1575	10	0.46703	T	0.11	.	14.6376	0.68702	0.0705:0.0:0.9295:0.0	.	724	Q13315	ATM_HUMAN	V	724	ENSP00000435747:G724V;ENSP00000278616:G724V;ENSP00000388058:G724V	ENSP00000278616:G724V	G	+	2	0	ATM	107632198	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.760000	0.68793	1.432000	0.47375	0.557000	0.71058	GGT		0.328	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051	
RBM15	64783	broad.mit.edu;hgsc.bcm.edu	37	1	110882695	110882713	+	Frame_Shift_Del	DEL	GGCGGCCAGAGGACGCGCG	GGCGGCCAGAGGACGCGCG	-			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	GGCGGCCAGAGGACGCGCG	GGCGGCCAGAGGACGCGCG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr1:110882695_110882713delGGCGGCCAGAGGACGCGCG	ENST00000369784.3	+	1	1568_1586	c.668_686delGGCGGCCAGAGGACGCGCG	c.(667-687)cggcggccagaggacgcgcggfs	p.RRPEDAR223fs	RBM15_ENST00000487146.2_Frame_Shift_Del_p.RRPEDAR223fs|RP5-1074L1.1_ENST00000449169.1_RNA|RBM15_ENST00000602849.1_Frame_Shift_Del_p.RRPEDAR223fs	NM_022768.4	NP_073605.4	Q96T37	RBM15_HUMAN	RNA binding motif protein 15	223	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				negative regulation of myeloid cell differentiation (GO:0045638)|patterning of blood vessels (GO:0001569)|placenta blood vessel development (GO:0060674)|positive regulation of transcription of Notch receptor target (GO:0007221)|spleen development (GO:0048536)|ventricular septum morphogenesis (GO:0060412)|viral process (GO:0016032)	membrane (GO:0016020)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			ovary(3)	3		all_cancers(81;2.89e-06)|all_epithelial(167;2.96e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Breast(1374;0.0634)		BRCA - Breast invasive adenocarcinoma(282;0.000224)|Epithelial(280;0.000476)|Kidney(133;0.000539)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|all cancers(265;0.00144)|Lung(183;0.0238)|Colorectal(144;0.103)|LUSC - Lung squamous cell carcinoma(189;0.135)		GTGAACTTCCGGCGGCCAGAGGACGCGCGGGCGGCCAAG	0.594			T	MKL1	acute megakaryocytic leukemia						OREG0013656	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										.		Dom	yes		1	1p13	64783	RNA binding motif protein 15		L	0																																										SO:0001589	frameshift_variant	64783			AF368063	CCDS822.1, CCDS59198.1	1p13	2013-02-12			ENSG00000162775	ENSG00000162775		"""RNA binding motif (RRM) containing"""	14959	protein-coding gene	gene with protein product	"""one twenty-two"""	606077				11431691, 11344311	Standard	NM_001201545		Approved	OTT, OTT1	uc001dzl.1	Q96T37	OTTHUMG00000011284	ENST00000369784.3:c.668_686delGGCGGCCAGAGGACGCGCG	1.37:g.110882695_110882713delGGCGGCCAGAGGACGCGCG	ENSP00000358799:p.Arg223fs	Somatic	1430	WXS	Illumina HiSeq	Phase_I	A1A693|Q3ZB86|Q4V760|Q5D058|Q5T613|Q86VW9|Q96PE4|Q96SC5|Q96SC6|Q96SC9|Q96SD0|Q96T38|Q9BRA5|Q9H6R8|Q9H9Y0	Frame_Shift_Del	DEL	ENST00000369784.3	37	CCDS822.1																																																																																				0.594	RBM15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000031114.2	NM_022768	
FCRLA	84824	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	161677131	161677131	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr1:161677131T>C	ENST00000236938.6	+	1	370	c.128T>C	c.(127-129)cTg>cCg	p.L43P	FCRLA_ENST00000294796.4_Missense_Mutation_p.L26P|FCRLA_ENST00000309691.6_Missense_Mutation_p.L26P|FCRLA_ENST00000540521.1_Missense_Mutation_p.L43P|FCRLA_ENST00000367959.2_Missense_Mutation_p.L43P|FCRLA_ENST00000367949.2_Missense_Mutation_p.L43P|FCRLA_ENST00000367950.1_Missense_Mutation_p.L3P|FCRLA_ENST00000367957.2_Missense_Mutation_p.L43P|FCRLA_ENST00000546024.1_Missense_Mutation_p.L43P|FCRLA_ENST00000367953.3_Missense_Mutation_p.L26P|FCRLA_ENST00000350710.3_Missense_Mutation_p.L43P|FCRLA_ENST00000540926.1_Missense_Mutation_p.L26P|FCRLA_ENST00000349527.4_Missense_Mutation_p.L26P	NM_032738.3	NP_116127.3	Q7L513	FCRLA_HUMAN	Fc receptor-like A	26					cell differentiation (GO:0030154)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)				breast(1)|kidney(12)|large_intestine(4)|lung(13)|prostate(1)|skin(2)|stomach(1)	34	all_cancers(52;2.55e-15)|all_hematologic(112;0.0359)		BRCA - Breast invasive adenocarcinoma(70;0.00301)			CAGATGCTACTGGGTAAGTAA	0.507																																						.											0													95.0	86.0	89.0					1																	161677131		2203	4300	6503	SO:0001583	missense	84824			AF531423	CCDS30926.1, CCDS53415.1, CCDS53416.1, CCDS53417.1, CCDS53418.1, CCDS53419.1, CCDS53420.1	1q23.3	2014-01-28	2006-09-26	2006-09-26	ENSG00000132185	ENSG00000132185		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18504	protein-coding gene	gene with protein product		606891	"""Fc receptor-like and mucin-like 1"""	FCRLM1		11754007	Standard	NM_001184866		Approved	MGC4595, FCRLc2, FCRLb, FCRLc1, FCRLd, FCRLe, FCRL, FCRLa, FREB, FCRLX	uc001gbe.3	Q7L513	OTTHUMG00000034537	ENST00000236938.6:c.128T>C	1.37:g.161677131T>C	ENSP00000236938:p.Leu43Pro	Somatic		WXS	Illumina HiSeq	Phase_I	A0N0M1|A6NC03|A6NL20|F5H720|F8W743|G3V1J2|Q5VXA1|Q5VXA2|Q5VXA3|Q5VXA4|Q5VXB0|Q5VXB1|Q8NEW4|Q8WXH3|Q96PC6|Q96PJ0|Q96PJ1|Q96PJ2|Q96PJ4|Q9BR57	Missense_Mutation	SNP	ENST00000236938.6	37	CCDS30926.1	.	.	.	.	.	.	.	.	.	.	T	10.17	1.277899	0.23307	.	.	ENSG00000132185	ENST00000236938;ENST00000367959;ENST00000546024;ENST00000540521;ENST00000367949;ENST00000350710;ENST00000540926;ENST00000367957;ENST00000349527;ENST00000309691;ENST00000294796;ENST00000367953;ENST00000367950	T;T;T;T;T;T;T;T;T;T;T;T;T	0.56776	5.52;5.31;4.43;4.29;0.61;0.8;5.04;4.3;3.68;4.47;4.31;5.36;0.44	5.08	1.56	0.23342	.	0.398608	0.18668	N	0.134528	T	0.26846	0.0657	L	0.59436	1.845	0.23533	N	0.997473	B;B;B;P;B;B;B	0.40794	0.087;0.087;0.202;0.729;0.033;0.125;0.197	B;B;B;B;B;B;B	0.38880	0.063;0.063;0.12;0.284;0.027;0.028;0.119	T	0.10222	-1.0639	10	0.87932	D	0	.	6.5753	0.22562	0.0:0.2731:0.0:0.7269	.	43;43;43;43;43;43;43	F8W743;A6NL20;F5H720;Q5VXB1;G3V1J2;A6NC03;Q7L513-9	.;.;.;.;.;.;.	P	43;43;43;43;43;43;26;43;26;26;26;26;3	ENSP00000236938:L43P;ENSP00000356936:L43P;ENSP00000439838:L43P;ENSP00000442870:L43P;ENSP00000356926:L43P;ENSP00000344808:L43P;ENSP00000446380:L26P;ENSP00000356934:L43P;ENSP00000294798:L26P;ENSP00000309596:L26P;ENSP00000294796:L26P;ENSP00000356930:L26P;ENSP00000356927:L3P	ENSP00000236938:L43P	L	+	2	0	FCRLA	159943755	0.104000	0.21937	0.070000	0.20053	0.074000	0.17049	0.355000	0.20163	0.167000	0.19631	0.533000	0.62120	CTG		0.507	FCRLA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083574.1	NM_032738	
OR6A2	8590	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	11	6816462	6816462	+	Missense_Mutation	SNP	T	T	G			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr11:6816462T>G	ENST00000332601.3	-	1	666	c.478A>C	c.(478-480)Atc>Ctc	p.I160L		NM_003696.2	NP_003687.2	O95222	OR6A2_HUMAN	olfactory receptor, family 6, subfamily A, member 2	160					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(4)|pancreas(1)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	29		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		ACCATGGAGATGCCAAAACCT	0.502																																						.											0													91.0	89.0	89.0					11																	6816462		2201	4296	6497	SO:0001583	missense	8590			AB065822	CCDS7772.1	11p15.4	2012-08-09		2004-03-10	ENSG00000184933	ENSG00000184933		"""GPCR / Class A : Olfactory receptors"""	15301	protein-coding gene	gene with protein product		608495		OR6A2P, OR6A1			Standard	NM_003696		Approved	OR11-55	uc001mes.1	O95222	OTTHUMG00000165736	ENST00000332601.3:c.478A>C	11.37:g.6816462T>G	ENSP00000330384:p.Ile160Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q3MJC7|Q6IF35|Q9H206	Missense_Mutation	SNP	ENST00000332601.3	37	CCDS7772.1	.	.	.	.	.	.	.	.	.	.	T	18.05	3.538105	0.65085	.	.	ENSG00000184933	ENST00000332601	T	0.35236	1.32	5.07	2.75	0.32379	GPCR, rhodopsin-like superfamily (1);	0.220980	0.31246	N	0.007994	T	0.28167	0.0695	N	0.21324	0.655	0.27374	N	0.955607	P	0.45569	0.861	P	0.51918	0.684	T	0.11616	-1.0580	10	0.10902	T	0.67	.	6.5696	0.22531	0.0:0.2741:0.0:0.7259	.	160	O95222	OR6A2_HUMAN	L	160	ENSP00000330384:I160L	ENSP00000330384:I160L	I	-	1	0	OR6A2	6773038	0.000000	0.05858	0.973000	0.42090	0.965000	0.64279	-0.619000	0.05572	0.503000	0.28060	0.533000	0.62120	ATC		0.502	OR6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385981.1	NM_003696	
COL2A1	1280	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	12	48379322	48379322	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr12:48379322G>A	ENST00000380518.3	-	26	1893	c.1729C>T	c.(1729-1731)Cct>Tct	p.P577S	COL2A1_ENST00000493991.1_5'UTR|COL2A1_ENST00000337299.6_Missense_Mutation_p.P508S	NM_001844.4|NM_033150.2	NP_001835.3|NP_149162.2	P02458	CO2A1_HUMAN	collagen, type II, alpha 1	577	Triple-helical region.				axon guidance (GO:0007411)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to BMP stimulus (GO:0071773)|central nervous system development (GO:0007417)|chondrocyte differentiation (GO:0002062)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal joint morphogenesis (GO:0060272)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart morphogenesis (GO:0003007)|inner ear morphogenesis (GO:0042472)|limb bud formation (GO:0060174)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|notochord development (GO:0030903)|otic vesicle development (GO:0071599)|palate development (GO:0060021)|proteoglycan metabolic process (GO:0006029)|regulation of gene expression (GO:0010468)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|tissue homeostasis (GO:0001894)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen type II trimer (GO:0005585)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(3)	64		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	CTTACAGAAGGGCCAACTTTG	0.597																																						.											0													116.0	124.0	121.0					12																	48379322		2203	4300	6503	SO:0001583	missense	1280			X16468	CCDS8759.1, CCDS41778.1	12q12-q13.2	2013-11-14	2008-02-04		ENSG00000139219	ENSG00000139219		"""Collagens"""	2200	protein-coding gene	gene with protein product		120140	"""collagen, type II, alpha 1 (primary osteoarthritis, spondyloepiphyseal dysplasia, congenital)"", ""arthroophthalmopathy, progressive (Stickler syndrome)"""	SEDC, AOM		1677770	Standard	NM_033150		Approved	STL1	uc001rqu.3	P02458	OTTHUMG00000149896	ENST00000380518.3:c.1729C>T	12.37:g.48379322G>A	ENSP00000369889:p.Pro577Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A6NGA0|Q12985|Q14009|Q14044|Q14045|Q14046|Q14047|Q14056|Q14058|Q16672|Q1JQ82|Q2V4X7|Q6LBY1|Q6LBY2|Q6LBY3|Q96IT5|Q99227|Q9UE38|Q9UE39|Q9UE40|Q9UE41|Q9UE42|Q9UE43	Missense_Mutation	SNP	ENST00000380518.3	37	CCDS41778.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.280839	0.80692	.	.	ENSG00000139219	ENST00000380518;ENST00000395281;ENST00000337299	D;D	0.96587	-4.06;-4.06	5.05	5.05	0.67936	.	0.065251	0.64402	D	0.000009	D	0.97558	0.9200	L	0.61387	1.9	0.54753	D	0.999984	D;D	0.59357	0.985;0.975	D;P	0.74674	0.984;0.894	D	0.97810	1.0250	10	0.56958	D	0.05	.	17.3421	0.87299	0.0:0.0:1.0:0.0	.	508;577	P02458-1;P02458	.;CO2A1_HUMAN	S	577;508;508	ENSP00000369889:P577S;ENSP00000338213:P508S	ENSP00000338213:P508S	P	-	1	0	COL2A1	46665589	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	3.508000	0.53378	2.629000	0.89072	0.609000	0.83330	CCT		0.597	COL2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313810.2	NM_001844	
EIF5	1983	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	14	103802243	103802243	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr14:103802243T>C	ENST00000216554.3	+	3	722	c.46T>C	c.(46-48)Tac>Cac	p.Y16H	EIF5_ENST00000558506.1_Missense_Mutation_p.Y16H|SNORA28_ENST00000606769.1_RNA|EIF5_ENST00000560200.1_3'UTR|EIF5_ENST00000392715.2_Missense_Mutation_p.Y16H	NM_001969.4	NP_001960.2	P55010	IF5_HUMAN	eukaryotic translation initiation factor 5	16					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|regulation of translational initiation (GO:0006446)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			breast(3)|kidney(2)|large_intestine(3)|lung(5)|pancreas(2)|skin(2)|upper_aerodigestive_tract(1)	18		Melanoma(154;0.155)	Epithelial(46;0.182)			GTTCTATCGCTACAAGATGCC	0.388																																						.											0													152.0	142.0	146.0					14																	103802243		2203	4300	6503	SO:0001583	missense	1983			U49436	CCDS9980.1	14q32.32	2006-05-11				ENSG00000100664			3299	protein-coding gene	gene with protein product		601710				8663286	Standard	NM_001969		Approved		uc001ymq.4	P55010		ENST00000216554.3:c.46T>C	14.37:g.103802243T>C	ENSP00000216554:p.Tyr16His	Somatic		WXS	Illumina HiSeq	Phase_I	Q53XB3|Q9H5N2|Q9UG48	Missense_Mutation	SNP	ENST00000216554.3	37	CCDS9980.1	.	.	.	.	.	.	.	.	.	.	.	27.2	4.806994	0.90623	.	.	ENSG00000100664	ENST00000216554;ENST00000392715	T;T	0.47528	0.84;0.84	5.79	5.79	0.91817	Translation initiation factor IF2/IF5, N-terminal (1);Translation initiation factor IF2/IF5 (2);	0.000000	0.85682	D	0.000000	T	0.78426	0.4281	H	0.95917	3.74	0.80722	D	1	B	0.29136	0.234	P	0.51297	0.665	T	0.81433	-0.0935	10	0.87932	D	0	.	16.1805	0.81895	0.0:0.0:0.0:1.0	.	16	P55010	IF5_HUMAN	H	16	ENSP00000216554:Y16H;ENSP00000376477:Y16H	ENSP00000216554:Y16H	Y	+	1	0	EIF5	102871996	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.831000	0.86748	2.221000	0.72209	0.529000	0.55759	TAC		0.388	EIF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415329.2	NM_001969	
ISLR	3671	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	15	74467546	74467546	+	Missense_Mutation	SNP	G	G	T			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr15:74467546G>T	ENST00000249842.3	+	2	704	c.347G>T	c.(346-348)aGc>aTc	p.S116I	ISLR_ENST00000395118.1_Missense_Mutation_p.S116I|RP11-665J16.1_ENST00000561647.1_RNA	NM_005545.3	NP_005536.1	O14498	ISLR_HUMAN	immunoglobulin superfamily containing leucine-rich repeat	116					cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)				central_nervous_system(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(1)	20						TTTGCCTGGAGCGACCTGCAC	0.617																																						.											0													82.0	79.0	80.0					15																	74467546		2198	4297	6495	SO:0001583	missense	3671			AB003184	CCDS10260.1	15q23-q24	2013-01-11			ENSG00000129009	ENSG00000129009		"""Immunoglobulin superfamily / I-set domain containing"""	6133	protein-coding gene	gene with protein product		602059				9325048	Standard	NM_005545		Approved	HsT17563	uc002axh.1	O14498	OTTHUMG00000137623	ENST00000249842.3:c.347G>T	15.37:g.74467546G>T	ENSP00000249842:p.Ser116Ile	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000249842.3	37	CCDS10260.1	.	.	.	.	.	.	.	.	.	.	G	14.33	2.504498	0.44558	.	.	ENSG00000129009	ENST00000249842;ENST00000395118	T;T	0.55588	0.51;0.51	4.05	1.59	0.23543	.	0.623254	0.13676	U	0.370522	T	0.51329	0.1668	M	0.72118	2.19	0.26664	N	0.971856	P	0.39601	0.68	B	0.41412	0.356	T	0.43376	-0.9395	10	0.42905	T	0.14	.	8.0656	0.30659	0.1519:0.1641:0.684:0.0	.	116	O14498	ISLR_HUMAN	I	116	ENSP00000249842:S116I;ENSP00000378550:S116I	ENSP00000249842:S116I	S	+	2	0	ISLR	72254599	0.991000	0.36638	1.000000	0.80357	0.984000	0.73092	1.728000	0.38105	0.659000	0.30945	0.313000	0.20887	AGC		0.617	ISLR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269044.1	NM_005545	
TMIGD1	388364	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	17	28656457	28656457	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr17:28656457T>C	ENST00000328886.4	-	3	245	c.173A>G	c.(172-174)aAc>aGc	p.N58S	TMIGD1_ENST00000538566.2_Missense_Mutation_p.N58S	NM_206832.1	NP_996663.1	Q6UXZ0	TMIG1_HUMAN	transmembrane and immunoglobulin domain containing 1	58	Ig-like C2-type 1.					integral component of membrane (GO:0016021)				breast(1)|kidney(3)|large_intestine(1)|lung(5)|skin(2)	12						TCTGGTGTGGTTTTGAACAGC	0.448																																						.											0													108.0	98.0	102.0					17																	28656457		2203	4300	6503	SO:0001583	missense	388364			AY358153	CCDS32605.1	17q11.2	2013-01-29	2006-07-05	2006-07-05		ENSG00000182271		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	32431	protein-coding gene	gene with protein product				TMIGD		12975309	Standard	NM_206832		Approved	UNQ9372	uc002hfa.1	Q6UXZ0		ENST00000328886.4:c.173A>G	17.37:g.28656457T>C	ENSP00000332404:p.Asn58Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A8K2K1|Q6ZMC6	Missense_Mutation	SNP	ENST00000328886.4	37	CCDS32605.1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.250385	0.80024	.	.	ENSG00000182271	ENST00000328886;ENST00000538566	T;T	0.13657	2.57;2.57	5.44	5.44	0.79542	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.195565	0.53938	D	0.000050	T	0.37019	0.0988	M	0.71581	2.175	0.44241	D	0.997081	D;D	0.89917	1.0;0.989	D;P	0.85130	0.997;0.9	T	0.10613	-1.0622	10	0.56958	D	0.05	-21.8761	14.6668	0.68915	0.0:0.0:0.0:1.0	.	58;58	Q6UXZ0-2;Q6UXZ0	.;TMIG1_HUMAN	S	58	ENSP00000332404:N58S;ENSP00000446118:N58S	ENSP00000332404:N58S	N	-	2	0	TMIGD1	25680583	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	5.190000	0.65104	2.058000	0.61347	0.472000	0.43445	AAC		0.448	TMIGD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447955.1	NM_206832	
NECAB3	63941	broad.mit.edu;hgsc.bcm.edu	37	20	32258501	32258501	+	Frame_Shift_Del	DEL	C	C	-	rs576975573		TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr20:32258501delC	ENST00000246190.6	-	3	307	c.252delG	c.(250-252)gggfs	p.G84fs	NECAB3_ENST00000375238.4_Frame_Shift_Del_p.G84fs	NM_031232.3	NP_112509.3	Q96P71	NECA3_HUMAN	N-terminal EF-hand calcium binding protein 3	84					protein metabolic process (GO:0019538)|protein secretion (GO:0009306)|regulation of amyloid precursor protein biosynthetic process (GO:0042984)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|Golgi cis cisterna (GO:0000137)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			large_intestine(3)|lung(5)|skin(2)	10						CGGTGAGATGCCCATCAATGC	0.547																																						.											0													61.0	65.0	64.0					20																	32258501		1980	4161	6141	SO:0001589	frameshift_variant	63941			AB039947	CCDS42866.1, CCDS42867.1	20q11.21	2013-01-10	2007-12-06	2007-12-06	ENSG00000125967	ENSG00000125967		"""N-terminal EF-hand calcium binding proteins"", ""EF-hand domain containing"""	15851	protein-coding gene	gene with protein product	"""EF-hand calcium binding protein 3"""	612478	"""amyloid beta (A4) precursor protein-binding, family A, member 2 binding protein"""	SYTIP2, APBA2BP		10833507	Standard	NM_031232		Approved	XB51, dJ63M2.4, NIP1, dJ63M2.5, EFCBP3	uc002wzn.4	Q96P71	OTTHUMG00000032264	ENST00000246190.6:c.252delG	20.37:g.32258501delC	ENSP00000246190:p.Gly84fs	Somatic		WXS	Illumina HiSeq	Phase_I	A8K780|E1P5N2|Q5JWF5|Q5JWF6|Q5JWF7|Q86VV1|Q9H433|Q9H8G8|Q9HBW7|Q9HCQ9	Frame_Shift_Del	DEL	ENST00000246190.6	37	CCDS42866.1																																																																																				0.547	NECAB3-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000078724.2		
PCNA	5111	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	20	5099481	5099481	+	Missense_Mutation	SNP	C	C	G			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr20:5099481C>G	ENST00000379160.3	-	3	495	c.253G>C	c.(253-255)Gaa>Caa	p.E85Q	PCNA_ENST00000379143.5_Missense_Mutation_p.E85Q|SNORA26_ENST00000391215.1_RNA	NM_002592.2	NP_002583.1	P12004	PCNA_HUMAN	proliferating cell nuclear antigen	85	Interaction with NUDT15.				base-excision repair (GO:0006284)|cell proliferation (GO:0008283)|DNA repair (GO:0006281)|DNA strand elongation involved in DNA replication (GO:0006271)|epithelial cell differentiation (GO:0030855)|G1/S transition of mitotic cell cycle (GO:0000082)|heart development (GO:0007507)|leading strand elongation (GO:0006272)|mismatch repair (GO:0006298)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|positive regulation of deoxyribonuclease activity (GO:0032077)|regulation of DNA replication (GO:0006275)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|response to cadmium ion (GO:0046686)|response to lipid (GO:0033993)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)|translesion synthesis (GO:0019985)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|DNA replication factor C complex (GO:0005663)|extracellular vesicular exosome (GO:0070062)|nuclear replication fork (GO:0043596)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCNA complex (GO:0043626)|PCNA-p21 complex (GO:0070557)	dinucleotide insertion or deletion binding (GO:0032139)|DNA polymerase binding (GO:0070182)|DNA polymerase processivity factor activity (GO:0030337)|identical protein binding (GO:0042802)|MutLalpha complex binding (GO:0032405)|purine-specific mismatch base pair DNA N-glycosylase activity (GO:0000701)|receptor tyrosine kinase binding (GO:0030971)			endometrium(2)|kidney(1)|large_intestine(4)|lung(2)	9						ATGATATCTTCATTGCCGGCG	0.448								DNA polymerases (catalytic subunits)																														.											0													210.0	202.0	205.0					20																	5099481		2203	4300	6503	SO:0001583	missense	5111			J04718	CCDS13087.1	20p13-p12.3	2013-09-19			ENSG00000132646	ENSG00000132646			8729	protein-coding gene	gene with protein product		176740				2565339	Standard	NM_002592		Approved		uc002wlp.3	P12004	OTTHUMG00000031798	ENST00000379160.3:c.253G>C	20.37:g.5099481C>G	ENSP00000368458:p.Glu85Gln	Somatic		WXS	Illumina HiSeq	Phase_I	B2R897|D3DW02	Missense_Mutation	SNP	ENST00000379160.3	37	CCDS13087.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.219431	0.79464	.	.	ENSG00000132646	ENST00000379143;ENST00000379160	.	.	.	4.81	4.81	0.61882	Proliferating cell nuclear antigen, PCNA, N-terminal (1);	0.046072	0.85682	D	0.000000	T	0.66356	0.2781	M	0.62723	1.935	0.80722	D	1	P;B	0.38048	0.616;0.162	B;B	0.43194	0.411;0.261	T	0.70927	-0.4739	9	0.62326	D	0.03	-17.6534	16.6123	0.84886	0.0:1.0:0.0:0.0	.	85;85	B4DUA2;P12004	.;PCNA_HUMAN	Q	85	.	ENSP00000368438:E85Q	E	-	1	0	PCNA	5047481	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.322000	0.79097	2.471000	0.83476	0.563000	0.77884	GAA		0.448	PCNA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077852.2		
COL3A1	1281	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	2	189873717	189873717	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr2:189873717G>A	ENST00000304636.3	+	48	3763	c.3593G>A	c.(3592-3594)gGt>gAt	p.G1198D	COL3A1_ENST00000317840.5_Missense_Mutation_p.G895D	NM_000090.3	NP_000081	P02461	CO3A1_HUMAN	collagen, type III, alpha 1	1198	Nonhelical region (C-terminal).				aging (GO:0007568)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell-matrix adhesion (GO:0007160)|cellular response to amino acid stimulus (GO:0071230)|cerebral cortex development (GO:0021987)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|digestive tract development (GO:0048565)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of immune response (GO:0050777)|negative regulation of neuron migration (GO:2001223)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|positive regulation of Rho protein signal transduction (GO:0035025)|response to cytokine (GO:0034097)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	collagen type III trimer (GO:0005586)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(2)|breast(1)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(60)|ovary(4)|pancreas(1)|prostate(5)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	126			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)	CCTTGCTGTGGTGGTGTTGGA	0.542																																						.											0													71.0	79.0	76.0					2																	189873717		2203	4300	6503	SO:0001583	missense	1281			X15332	CCDS2297.1	2q32.2	2014-09-17	2008-06-23		ENSG00000168542	ENSG00000168542		"""Collagens"""	2201	protein-coding gene	gene with protein product		120180	"""Ehlers-Danlos syndrome type IV, autosomal dominant"""	EDS4A		2780304, 2834369	Standard	NM_000090		Approved		uc002uqj.1	P02461	OTTHUMG00000132648	ENST00000304636.3:c.3593G>A	2.37:g.189873717G>A	ENSP00000304408:p.Gly1198Asp	Somatic		WXS	Illumina HiSeq	Phase_I	D2JYH5|D3DPH4|P78429|Q15112|Q16403|Q53S91|Q541P8|Q6LDB3|Q6LDJ2|Q6LDJ3|Q7KZ56|Q8N6U4|Q9UC88|Q9UC89|Q9UC90|Q9UC91|R4N3C5|V9GZI1	Missense_Mutation	SNP	ENST00000304636.3	37	CCDS2297.1	.	.	.	.	.	.	.	.	.	.	G	15.30	2.793993	0.50102	.	.	ENSG00000168542	ENST00000304636;ENST00000317840	D;D	0.90261	-2.52;-2.64	5.54	4.66	0.58398	.	.	.	.	.	T	0.77624	0.4158	N	0.08118	0	0.37055	D	0.897788	B	0.06786	0.001	B	0.04013	0.001	T	0.70898	-0.4747	9	0.09084	T	0.74	.	9.9195	0.41455	0.0729:0.149:0.7781:0.0	.	1198	P02461	CO3A1_HUMAN	D	1198;895	ENSP00000304408:G1198D;ENSP00000315243:G895D	ENSP00000304408:G1198D	G	+	2	0	COL3A1	189581962	1.000000	0.71417	0.997000	0.53966	0.834000	0.47266	8.061000	0.89467	1.310000	0.45006	0.655000	0.94253	GGT		0.542	COL3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255899.3	NM_000090	
CLASP2	23122	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	3	33686372	33686372	+	Missense_Mutation	SNP	A	A	T			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr3:33686372A>T	ENST00000468888.2	-	8	785	c.739T>A	c.(739-741)Tca>Aca	p.S247T	CLASP2_ENST00000539981.1_Missense_Mutation_p.S20T|CLASP2_ENST00000313350.6_Missense_Mutation_p.S20T|CLASP2_ENST00000487200.1_Missense_Mutation_p.S20T|CLASP2_ENST00000461133.3_Missense_Mutation_p.S14T|CLASP2_ENST00000399362.4_Missense_Mutation_p.S247T|CLASP2_ENST00000333778.6_Missense_Mutation_p.S24T|CLASP2_ENST00000480013.1_Missense_Mutation_p.S14T|CLASP2_ENST00000359576.5_Missense_Mutation_p.S247T|CLASP2_ENST00000482896.1_5'UTR|CLASP2_ENST00000307312.7_5'UTR			O75122	CLAP2_HUMAN	cytoplasmic linker associated protein 2	14					axon guidance (GO:0007411)|establishment or maintenance of cell polarity (GO:0007163)|fucosylation (GO:0036065)|microtubule anchoring (GO:0034453)|microtubule nucleation (GO:0007020)|microtubule organizing center organization (GO:0031023)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of microtubule depolymerization (GO:0007026)|regulation of microtubule polymerization or depolymerization (GO:0031110)|regulation of microtubule-based process (GO:0032886)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|trans-Golgi network (GO:0005802)	galactoside 2-alpha-L-fucosyltransferase activity (GO:0008107)|microtubule plus-end binding (GO:0051010)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	48						CCATCCACTGATTCTTCATCA	0.403																																						.											0													84.0	77.0	79.0					3																	33686372		1908	4136	6044	SO:0001583	missense	23122			AB014527		3p24.3	2013-01-18			ENSG00000163539	ENSG00000163539			17078	protein-coding gene	gene with protein product		605853				9734811, 10899121	Standard	NM_015097		Approved	KIAA0627	uc021wvc.1	O75122	OTTHUMG00000156489	ENST00000468888.2:c.739T>A	3.37:g.33686372A>T	ENSP00000419974:p.Ser247Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q7L8F6|Q8N6R6|Q9BQT3|Q9BQT4|Q9H7A3|Q9NSZ2	Missense_Mutation	SNP	ENST00000468888.2	37		.	.	.	.	.	.	.	.	.	.	A	22.9	4.353402	0.82243	.	.	ENSG00000163539	ENST00000468888;ENST00000399362;ENST00000359576;ENST00000539981;ENST00000480013;ENST00000461133;ENST00000313350;ENST00000487200;ENST00000333778;ENST00000485378;ENST00000496954	T;T;T	0.20463	2.07;2.12;2.13	5.83	5.83	0.93111	.	0.260982	0.38164	N	0.001783	T	0.39860	0.1094	L	0.49778	1.585	0.80722	D	1	D;D;D;P	0.69078	0.995;0.995;0.997;0.954	P;P;D;D	0.66351	0.849;0.849;0.928;0.943	T	0.16660	-1.0395	10	0.87932	D	0	-15.3362	14.7605	0.69602	1.0:0.0:0.0:0.0	.	24;20;20;247	E7ENG2;B3KR06;O75122-2;F5H604	.;.;.;.	T	247;247;247;20;14;14;20;20;24;20;14	ENSP00000419974:S247T;ENSP00000382297:S247T;ENSP00000352581:S247T	ENSP00000324364:S20T	S	-	1	0	CLASP2	33661376	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.188000	0.65093	2.222000	0.72286	0.477000	0.44152	TCA		0.403	CLASP2-001	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000344320.4	NM_001207044	
ABHD10	55347	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	3	111710501	111710501	+	Missense_Mutation	SNP	C	C	A			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr3:111710501C>A	ENST00000273359.3	+	5	881	c.854C>A	c.(853-855)gCa>gAa	p.A285E	ABHD10_ENST00000534857.1_Missense_Mutation_p.A128E	NM_018394.2	NP_060864.1	Q9NUJ1	ABHDA_HUMAN	abhydrolase domain containing 10	285					glucuronoside catabolic process (GO:0019391)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			large_intestine(2)|lung(7)|skin(1)	10						AGGGAAAAAGCAGACATTCAA	0.388																																						.											0													110.0	95.0	100.0					3																	111710501		2203	4300	6503	SO:0001583	missense	55347			AL713726	CCDS2963.1, CCDS63718.1	3q13.2	2012-03-26			ENSG00000144827	ENSG00000144827		"""Abhydrolase domain containing"""	25656	protein-coding gene	gene with protein product						22294686	Standard	NM_018394		Approved	FLJ11342	uc003dyk.5	Q9NUJ1	OTTHUMG00000159280	ENST00000273359.3:c.854C>A	3.37:g.111710501C>A	ENSP00000273359:p.Ala285Glu	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z6A8|C9IZX5|D3DN63|Q8TCF9	Missense_Mutation	SNP	ENST00000273359.3	37	CCDS2963.1	.	.	.	.	.	.	.	.	.	.	C	11.17	1.558635	0.27827	.	.	ENSG00000144827	ENST00000534857;ENST00000273359	T;T	0.35605	1.3;1.3	5.83	4.89	0.63831	.	0.162113	0.53938	D	0.000041	T	0.13543	0.0328	N	0.02751	-0.505	0.39385	D	0.966326	B	0.06786	0.001	B	0.10450	0.005	T	0.16394	-1.0404	10	0.02654	T	1	-13.2051	11.1048	0.48197	0.3475:0.6525:0.0:0.0	.	285	Q9NUJ1	ABHDA_HUMAN	E	128;285	ENSP00000442932:A128E;ENSP00000273359:A285E	ENSP00000273359:A285E	A	+	2	0	ABHD10	113193191	1.000000	0.71417	0.965000	0.40720	0.886000	0.51366	4.440000	0.59975	2.771000	0.95319	0.591000	0.81541	GCA		0.388	ABHD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354326.1	NM_018394	
SMARCA5	8467	hgsc.bcm.edu	37	4	144442709	144442710	+	Frame_Shift_Ins	INS	-	-	A			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr4:144442709_144442710insA	ENST00000283131.3	+	3	842_843	c.380_381insA	c.(379-384)ataaaafs	p.IK127fs		NM_003601.3	NP_003592.3	O60264	SMCA5_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5	127					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|CENP-A containing nucleosome assembly (GO:0034080)|chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA-templated transcription, initiation (GO:0006352)|double-strand break repair (GO:0006302)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromatin silencing complex (GO:0005677)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NURF complex (GO:0016589)|RSF complex (GO:0031213)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)		EWSR1/SMARCA5(2)	endometrium(2)|kidney(2)|large_intestine(9)|lung(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_hematologic(180;0.158)					CGCCCACGAATAAAAAAAGATG	0.381																																						.											0																																										SO:0001589	frameshift_variant	8467			AB010882	CCDS3761.1	4q31.1-q31.2	2011-04-20			ENSG00000153147	ENSG00000153147			11101	protein-coding gene	gene with protein product		603375				9730600	Standard	NM_003601		Approved	hSNF2H, hISWI, ISWI	uc003ijg.3	O60264	OTTHUMG00000161474	ENST00000283131.3:c.387dupA	4.37:g.144442716_144442716dupA	ENSP00000283131:p.Ile127fs	Somatic		WXS	Illumina HiSeq	Phase_I		Frame_Shift_Ins	INS	ENST00000283131.3	37	CCDS3761.1																																																																																				0.381	SMARCA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365077.3		
CD109	135228	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	6	74520746	74520746	+	Missense_Mutation	SNP	A	A	C			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr6:74520746A>C	ENST00000287097.5	+	28	3690	c.3578A>C	c.(3577-3579)gAa>gCa	p.E1193A	CD109_ENST00000437994.2_Missense_Mutation_p.E1193A|CD109_ENST00000422508.2_Missense_Mutation_p.E1116A			Q6YHK3	CD109_HUMAN	CD109 molecule	1193					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)|transforming growth factor beta binding (GO:0050431)			NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						GCTCTGTCTGAATTTGCAGCC	0.398																																						.											0													115.0	115.0	115.0					6																	74520746		2203	4300	6503	SO:0001583	missense	135228			AF410459	CCDS4982.1, CCDS55038.1, CCDS55039.1	6q14.1	2008-02-05	2006-03-28		ENSG00000156535	ENSG00000156535		"""CD molecules"""	21685	protein-coding gene	gene with protein product		608859	"""CD109 antigen (Gov platelet alloantigens)"""			11861284, 11861285	Standard	XM_005248659		Approved	FLJ38569, DKFZp762L1111, CPAMD7	uc003php.3	Q6YHK3	OTTHUMG00000015040	ENST00000287097.5:c.3578A>C	6.37:g.74520746A>C	ENSP00000287097:p.Glu1193Ala	Somatic		WXS	Illumina HiSeq	Phase_I	A5YKK4|B2R948|B3KW25|Q0P6K7|Q5SYA8|Q5XUM7|Q5XUM9|Q6MZI7|Q8N3A7|Q8N915|Q8TDJ2|Q8TDJ3	Missense_Mutation	SNP	ENST00000287097.5	37	CCDS4982.1	.	.	.	.	.	.	.	.	.	.	A	9.542	1.113523	0.20795	.	.	ENSG00000156535	ENST00000437994;ENST00000422508;ENST00000287097	T;T;T	0.39592	1.07;1.07;1.07	5.2	4.04	0.47022	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);A-macroglobulin complement component (1);	0.554792	0.20420	N	0.092694	T	0.11410	0.0278	L	0.31578	0.945	0.26257	N	0.978636	B;B;B	0.32350	0.366;0.125;0.022	B;B;B	0.29785	0.107;0.072;0.098	T	0.05257	-1.0896	10	0.23891	T	0.37	.	6.0642	0.19854	0.5255:0.3335:0.0:0.141	.	1116;1193;1193	Q6YHK3-2;Q6YHK3-4;Q6YHK3	.;.;CD109_HUMAN	A	1193;1116;1193	ENSP00000388062:E1193A;ENSP00000404475:E1116A;ENSP00000287097:E1193A	ENSP00000287097:E1193A	E	+	2	0	CD109	74577467	0.107000	0.21998	1.000000	0.80357	0.963000	0.63663	0.782000	0.26788	2.180000	0.69256	0.533000	0.62120	GAA		0.398	CD109-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041230.3	NM_133493	
HOXA9	3205	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	7	27204514	27204514	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr7:27204514T>C	ENST00000343483.6	-	1	635	c.563A>G	c.(562-564)aAg>aGg	p.K188R	HOXA9_ENST00000497089.1_Intron|HOXA9_ENST00000396345.1_3'UTR|RP1-170O19.20_ENST00000470747.4_Missense_Mutation_p.K28R|RP1-170O19.20_ENST00000465941.1_Intron	NM_152739.3	NP_689952.1	P31269	HXA9_HUMAN	homeobox A9	188					endothelial cell activation (GO:0042118)|multicellular organismal development (GO:0007275)|negative regulation of myeloid cell differentiation (GO:0045638)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	enzyme binding (GO:0019899)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|endometrium(1)|lung(5)|prostate(1)	8						GATGGGGGGCTTGTCTCCGCC	0.582			T	"""NUP98, MSI2"""	AML*																																	.		Dom	yes		7	7p15-p14.2	3205	homeo box A9		L	0													49.0	56.0	53.0					7																	27204514		2203	4300	6503	SO:0001583	missense	3205				CCDS5409.1	7p15.2	2011-06-20	2005-12-22		ENSG00000078399	ENSG00000078399		"""Homeoboxes / ANTP class : HOXL subclass"""	5109	protein-coding gene	gene with protein product		142956	"""homeo box A9"""	HOX1G, HOX1		1973146, 1358459	Standard	NM_152739		Approved		uc003syt.3	P31269	OTTHUMG00000023220	ENST00000343483.6:c.563A>G	7.37:g.27204514T>C	ENSP00000343619:p.Lys188Arg	Somatic		WXS	Illumina HiSeq	Phase_I	O43369|O43429|Q99820	Missense_Mutation	SNP	ENST00000343483.6	37	CCDS5409.1	.	.	.	.	.	.	.	.	.	.	T	18.19	3.569468	0.65765	.	.	ENSG00000078399;ENSG00000078399;ENSG00000257184	ENST00000343483;ENST00000242050;ENST00000470747	D;D	0.94576	-3.37;-3.46	5.86	5.86	0.93980	Hox9, N-terminal activation domain (1);Homeodomain-like (1);	0.000000	0.64402	D	0.000005	D	0.95582	0.8564	M	0.89534	3.04	0.80722	D	1	B	0.21520	0.057	B	0.26614	0.071	D	0.93911	0.7197	10	0.72032	D	0.01	.	16.2433	0.82426	0.0:0.0:0.0:1.0	.	188	P31269	HXA9_HUMAN	R	188;179;28	ENSP00000343619:K188R;ENSP00000421799:K28R	ENSP00000242050:K179R	K	-	2	0	RP1-170O19.20;HOXA9	27171039	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.283000	0.78640	2.242000	0.73789	0.459000	0.35465	AAG		0.582	HOXA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358706.2		
WNK2	65268	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	9	95991992	95991992	+	Silent	SNP	C	C	G			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr9:95991992C>G	ENST00000297954.4	+	2	696	c.696C>G	c.(694-696)acC>acG	p.T232T	WNK2_ENST00000427277.2_5'UTR|WNK2_ENST00000395475.2_Silent_p.T218T|WNK2_ENST00000395477.2_Silent_p.T232T|WNK2_ENST00000356055.3_5'UTR|WNK2_ENST00000349097.3_5'UTR	NM_001282394.1	NP_001269323.1	Q9Y3S1	WNK2_HUMAN	WNK lysine deficient protein kinase 2	232	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(11)|kidney(4)|large_intestine(5)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)	54						GGAAGCTCACCAAGCTGGAGC	0.602																																						.											0													41.0	32.0	35.0					9																	95991992		2203	4299	6502	SO:0001819	synonymous_variant	65268			AJ242724	CCDS75858.1	9q22.3	2008-02-05	2003-06-23	2005-01-22	ENSG00000165238	ENSG00000165238			14542	protein-coding gene	gene with protein product		606249	"""serologically defined colon cancer antigen 43"""	SDCCAG43, PRKWNK2		9610721, 11571656	Standard	NM_006648		Approved	NY-CO-43, KIAA1760	uc004atj.3	Q9Y3S1	OTTHUMG00000020247	ENST00000297954.4:c.696C>G	9.37:g.95991992C>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q5VWF1|Q5VWF2|Q8IY36|Q9C0A3|Q9H3P4	Silent	SNP	ENST00000297954.4	37		.	.	.	.	.	.	.	.	.	.	C	8.729	0.916153	0.17907	.	.	ENSG00000165238	ENST00000432730	.	.	.	5.53	3.54	0.40534	.	.	.	.	.	T	0.53222	0.1783	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49670	-0.8915	4	.	.	.	.	5.3031	0.15790	0.1937:0.6167:0.1065:0.0831	.	.	.	.	R	228	.	.	P	+	2	0	WNK2	95031813	0.199000	0.23386	1.000000	0.80357	0.973000	0.67179	-0.382000	0.07408	1.354000	0.45846	-0.126000	0.14955	CCA		0.602	WNK2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000317359.1	NM_006648	
LRRK2	120892	hgsc.bcm.edu	37	12	40707951	40707951	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr12:40707951G>A	ENST00000298910.7	+	32	4772	c.4714G>A	c.(4714-4716)Gca>Aca	p.A1572T	LRRK2_ENST00000481256.1_3'UTR	NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	1572					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)	p.A1572T(2)		NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				GCTTCCTCACGCAGTTCACTT	0.338																																						.											2	Substitution - Missense(2)	ovary(2)											67.0	57.0	60.0					12																	40707951		2203	4299	6502	SO:0001583	missense	120892			AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.4714G>A	12.37:g.40707951G>A	ENSP00000298910:p.Ala1572Thr	Somatic		WXS	Illumina HiSeq	Phase_I	A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	ENST00000298910.7	37	CCDS31774.1	.	.	.	.	.	.	.	.	.	.	G	32	5.146199	0.94603	.	.	ENSG00000188906	ENST00000298910	T	0.79247	-1.25	5.83	5.83	0.93111	.	0.055971	0.64402	D	0.000001	D	0.88614	0.6484	M	0.79123	2.44	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.68943	0.945;0.961	D	0.88885	0.3342	10	0.72032	D	0.01	.	20.1099	0.97909	0.0:0.0:1.0:0.0	.	1572;1572	Q17RV3;Q5S007	.;LRRK2_HUMAN	T	1572	ENSP00000298910:A1572T	ENSP00000298910:A1572T	A	+	1	0	LRRK2	38994218	1.000000	0.71417	0.995000	0.50966	0.818000	0.46254	8.984000	0.93482	2.753000	0.94483	0.585000	0.79938	GCA		0.338	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277179.1	XM_058513	
ZCCHC8	55596	hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	12	122958438	122958438	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr12:122958438G>A	ENST00000336229.4	-	14	1860	c.1730C>T	c.(1729-1731)aCg>aTg	p.T577M	ZCCHC8_ENST00000543897.1_Missense_Mutation_p.T339M|ZCCHC8_ENST00000538116.1_Missense_Mutation_p.T188M|ZCCHC8_ENST00000536306.1_Missense_Mutation_p.T339M	NM_017612.3	NP_060082.2	Q6NZY4	ZCHC8_HUMAN	zinc finger, CCHC domain containing 8	577					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(2)|large_intestine(8)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	23	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.25e-05)|Epithelial(86;0.000113)|BRCA - Breast invasive adenocarcinoma(302;0.202)		CTCATCCAGCGTCTGCTTTTC	0.488																																						.											0													213.0	208.0	210.0					12																	122958438		1953	4156	6109	SO:0001583	missense	55596			BC017704		12q24.31	2014-04-14				ENSG00000033030		"""Zinc fingers, CCHC domain containing"""	25265	protein-coding gene	gene with protein product						12477932	Standard	XM_005253581		Approved	DKFZp434E2220	uc001ucn.3	Q6NZY4		ENST00000336229.4:c.1730C>T	12.37:g.122958438G>A	ENSP00000337313:p.Thr577Met	Somatic		WXS	Illumina HiSeq	Phase_I	Q7L2P6|Q8N2K5|Q96SK7|Q9NSS2|Q9NSS3	Missense_Mutation	SNP	ENST00000336229.4	37		.	.	.	.	.	.	.	.	.	.	G	9.946	1.218896	0.22373	.	.	ENSG00000033030	ENST00000536306;ENST00000543897;ENST00000336229;ENST00000538116	T;T;T;T	0.44482	0.93;0.93;0.93;0.92	5.72	-7.32	0.01436	.	2.565100	0.00904	N	0.002393	T	0.18215	0.0437	N	0.08118	0	0.09310	N	1	B	0.12013	0.005	B	0.06405	0.002	T	0.08166	-1.0735	10	0.36615	T	0.2	2.2068	2.1954	0.03909	0.2269:0.1934:0.373:0.2067	.	577	Q6NZY4	ZCHC8_HUMAN	M	339;339;577;188	ENSP00000441423:T339M;ENSP00000438993:T339M;ENSP00000337313:T577M;ENSP00000440028:T188M	ENSP00000337313:T577M	T	-	2	0	ZCCHC8	121524391	0.000000	0.05858	0.000000	0.03702	0.055000	0.15305	-0.623000	0.05546	-1.273000	0.02424	-0.334000	0.08254	ACG		0.488	ZCCHC8-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_017612	
MED8	112950	broad.mit.edu;hgsc.bcm.edu;bcgsc.ca	37	1	43852260	43852260	+	Splice_Site	SNP	C	C	T			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr1:43852260C>T	ENST00000372457.4	-	5	536	c.493G>A	c.(493-495)Ggt>Agt	p.G165S	MED8_ENST00000372455.4_Splice_Site_p.G76S|RP1-92O14.6_ENST00000436713.1_RNA|MED8_ENST00000290663.6_Splice_Site_p.G165S	NM_001001653.2|NM_201542.3	NP_001001653.1|NP_963836.2	Q96G25	MED8_HUMAN	mediator complex subunit 8	165					gene expression (GO:0010467)|protein ubiquitination (GO:0016567)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)	RNA polymerase II transcription cofactor activity (GO:0001104)			endometrium(2)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)	9	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CCCATCATACCTCCACTCTCT	0.423																																						.											0													178.0	156.0	164.0					1																	43852260		2203	4300	6503	SO:0001630	splice_region_variant	112950			AF521562, BC010543	CCDS486.2, CCDS487.2, CCDS60108.1	1p34.1	2008-02-05	2007-07-30		ENSG00000159479	ENSG00000159479			19971	protein-coding gene	gene with protein product		607956	"""mediator of RNA polymerase II transcription, subunit 8 homolog (S. cerevisiae)"""			12149480, 9671713	Standard	NM_052877		Approved	MGC17544, MGC19641, ARC32	uc001cje.2	Q96G25	OTTHUMG00000007421	ENST00000372457.4:c.493+1G>A	1.37:g.43852260C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A9IZ91|A9IZ92|Q5JUY8|Q96FQ4	Missense_Mutation	SNP	ENST00000372457.4	37	CCDS487.2	.	.	.	.	.	.	.	.	.	.	C	5.816	0.334799	0.11013	.	.	ENSG00000159479	ENST00000290663;ENST00000372457;ENST00000372455	.	.	.	5.89	4.97	0.65823	.	0.204896	0.50627	D	0.000103	T	0.24392	0.0591	N	0.02539	-0.55	0.47819	D	0.999526	B;B	0.26081	0.022;0.141	B;B	0.22753	0.018;0.041	T	0.11299	-1.0593	8	.	.	.	-13.9899	10.4361	0.44437	0.0:0.7956:0.1352:0.0692	.	165;165	Q96G25;Q96G25-2	MED8_HUMAN;.	S	165;165;76	.	.	G	-	1	0	MED8	43624847	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	4.270000	0.58896	1.495000	0.48549	0.555000	0.69702	GGT		0.423	MED8-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318959.1	NM_052877	Missense_Mutation
DAGLB	221955	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	7	6452490	6452490	+	Missense_Mutation	SNP	A	A	T			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr7:6452490A>T	ENST00000297056.6	-	13	1690	c.1521T>A	c.(1519-1521)gaT>gaA	p.D507E	DAGLB_ENST00000436575.1_Missense_Mutation_p.D466E|DAGLB_ENST00000425398.2_Missense_Mutation_p.D378E|DAGLB_ENST00000428902.2_Missense_Mutation_p.S367T	NM_139179.3	NP_631918.3	Q8NCG7	DGLB_HUMAN	diacylglycerol lipase, beta	507					arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|lipid catabolic process (GO:0016042)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|urinary_tract(2)	26		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.102)		TTCTCTTCAGATCTTCCAAGT	0.592																																						.											0													72.0	58.0	62.0					7																	6452490		2202	4297	6499	SO:0001583	missense	221955			AF450090	CCDS5350.1, CCDS47536.1	7p22.1	2008-03-18			ENSG00000164535	ENSG00000164535	3.1.1.-		28923	protein-coding gene	gene with protein product		614016					Standard	NM_139179		Approved	KCCR13L, DAGLBETA	uc003sqa.3	Q8NCG7	OTTHUMG00000125513	ENST00000297056.6:c.1521T>A	7.37:g.6452490A>T	ENSP00000297056:p.Asp507Glu	Somatic		WXS	Illumina HiSeq	Phase_I	A4D2P3|B3KV90|B4DQU0|Q6PIX3|Q8N2N2|Q8N9S1|Q8TED3|Q8WXE6	Missense_Mutation	SNP	ENST00000297056.6	37	CCDS5350.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.54|10.54	1.379977|1.379977	0.24944|0.24944	.|.	.|.	ENSG00000164535|ENSG00000164535	ENST00000297056;ENST00000425398;ENST00000436575|ENST00000428902	T;T;T|.	0.48201|.	0.84;0.82;0.84|.	5.52|5.52	-5.44|-5.44	0.02624|0.02624	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.71178|0.71178	0.3309|0.3309	M|M	0.75447|0.75447	2.3|2.3	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;1.0;0.999;0.999|.	D;D;D;D|.	0.91635|.	0.994;0.999;0.979;0.997|.	T|T	0.75510|0.75510	-0.3292|-0.3292	10|6	0.14656|0.41790	T|T	0.56|0.15	-6.0701|-6.0701	17.3302|17.3302	0.87261|0.87261	0.3927:0.0:0.6073:0.0|0.3927:0.0:0.6073:0.0	.|.	378;321;507;204|.	B4DQU0;B4DQQ6;Q8NCG7;B3KRA0|.	.;.;DGLB_HUMAN;.|.	E|T	507;378;466|367	ENSP00000297056:D507E;ENSP00000391171:D378E;ENSP00000404785:D466E|.	ENSP00000297056:D507E|ENSP00000416046:S367T	D|S	-|-	3|1	2|0	DAGLB|DAGLB	6419015|6419015	0.039000|0.039000	0.19947|0.19947	0.030000|0.030000	0.17652|0.17652	0.718000|0.718000	0.41266|0.41266	-0.352000|-0.352000	0.07701|0.07701	-0.913000|-0.913000	0.03832|0.03832	-0.250000|-0.250000	0.11733|0.11733	GAT|TCT		0.592	DAGLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246840.2	NM_139179	
ZFAND4	93550	broad.mit.edu	37	10	46122460	46122460	+	Missense_Mutation	SNP	C	C	A			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr10:46122460C>A	ENST00000344646.5	-	7	1026	c.811G>T	c.(811-813)Gtc>Ttc	p.V271F	ZFAND4_ENST00000374371.2_Intron|ZFAND4_ENST00000374370.1_5'UTR|ZFAND4_ENST00000374366.3_Missense_Mutation_p.V197F	NM_001128324.2|NM_174890.2	NP_001121796.1|NP_777550.2	Q86XD8	ZFAN4_HUMAN	zinc finger, AN1-type domain 4	271							zinc ion binding (GO:0008270)										TTGGGGAGGACCCTTAACAAT	0.478																																						.											0													90.0	83.0	85.0					10																	46122460		2203	4300	6503	SO:0001583	missense	93550			AF311324	CCDS7214.1, CCDS60520.1	10q11.22	2013-01-09	2011-11-10	2011-11-10	ENSG00000172671	ENSG00000172671		"""Zinc fingers, AN1-type domain containing"""	23504	protein-coding gene	gene with protein product			"""AN1, ubiquitin-like, homolog (Xenopus laevis)"""	ANUBL1			Standard	XM_005271837		Approved	FLJ40185	uc001jcp.4	Q86XD8	OTTHUMG00000018085	ENST00000344646.5:c.811G>T	10.37:g.46122460C>A	ENSP00000339484:p.Val271Phe	Somatic		WXS	Illumina HiSeq	Phase_I	A8K8V4|B2RAX2|Q5VVY5	Missense_Mutation	SNP	ENST00000344646.5	37	CCDS7214.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.293016	0.80914	.	.	ENSG00000172671	ENST00000344646;ENST00000374366;ENST00000374370	T;T	0.26373	1.74;1.75	5.47	5.47	0.80525	.	2.576260	0.02078	N	0.052100	T	0.50394	0.1613	L	0.61218	1.895	0.52099	D	0.999947	D	0.63880	0.993	P	0.55871	0.786	T	0.12528	-1.0544	10	0.44086	T	0.13	-35.2232	16.8259	0.85931	0.0:1.0:0.0:0.0	.	271	Q86XD8	ANUB1_HUMAN	F	271;197;153	ENSP00000339484:V271F;ENSP00000363486:V197F	ENSP00000339484:V271F	V	-	1	0	ANUBL1	45442466	1.000000	0.71417	0.997000	0.53966	0.747000	0.42532	3.284000	0.51708	2.574000	0.86865	0.650000	0.86243	GTC		0.478	ZFAND4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047790.1	NM_174890	
OR1S1	219959	broad.mit.edu;mdanderson.org	37	11	57982414	57982414	+	Silent	SNP	G	G	A	rs386753888|rs111386724	byFrequency	TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr11:57982414G>A	ENST00000309433.6	+	1	198	c.198G>A	c.(196-198)acG>acA	p.T66T		NM_001004458.1	NP_001004458.1	Q8NH92	OR1S1_HUMAN	olfactory receptor, family 1, subfamily S, member 1	66						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T66T(1)		breast(1)|central_nervous_system(1)|endometrium(24)|kidney(1)|large_intestine(1)|liver(1)|lung(10)|prostate(1)|skin(2)|stomach(3)|urinary_tract(3)	48		Breast(21;0.0589)				GCTTGGATACGTACCTTCATA	0.443													G|||	4	0.000798722	0.0008	0.0	5008	,	,		20373	0.0		0.003	False		,,,				2504	0.0					.											1	Substitution - coding silent(1)	endometrium(1)						G		2,4400	4.2+/-10.8	0,2,2199	327.0	300.0	309.0		198	-6.9	0.0	11	dbSNP_132	309	22,8570	16.0+/-53.3	0,22,4274	no	coding-synonymous	OR1S1	NM_001004458.1		0,24,6473	AA,AG,GG		0.2561,0.0454,0.1847		66/326	57982414	24,12970	2201	4296	6497	SO:0001819	synonymous_variant	219959			BK004299	CCDS31546.1	11q12.1	2012-08-09			ENSG00000172774	ENSG00000172774		"""GPCR / Class A : Olfactory receptors"""	8227	protein-coding gene	gene with protein product							Standard	NM_001004458		Approved	OST034	uc010rkc.2	Q8NH92	OTTHUMG00000167463	ENST00000309433.6:c.198G>A	11.37:g.57982414G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q6IFG3	Silent	SNP	ENST00000309433.6	37	CCDS31546.1																																																																																				0.443	OR1S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394705.1	NM_001004458	
PCNXL4	64430	broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	60585201	60585201	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr14:60585201T>C	ENST00000406854.1	+	7	2287	c.1733T>C	c.(1732-1734)gTc>gCc	p.V578A	PCNXL4_ENST00000404681.2_Missense_Mutation_p.V578A|PCNXL4_ENST00000317623.4_Missense_Mutation_p.V344A|PCNXL4_ENST00000406949.1_Missense_Mutation_p.V344A|PCNXL4_ENST00000535349.1_5'UTR			Q63HM2	PCX4_HUMAN	pecanex-like 4 (Drosophila)	578						integral component of membrane (GO:0016021)											TTCGTGTTGGTCATCATAGTT	0.428																																						.											0													128.0	126.0	126.0					14																	60585201		2203	4300	6503	SO:0001583	missense	64430			AK022861		14q23.1	2012-07-18	2012-07-18	2012-07-18	ENSG00000126773	ENSG00000126773			20349	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 135"""	C14orf135			Standard	NM_022495		Approved		uc001xer.4	Q63HM2	OTTHUMG00000150361	ENST00000406854.1:c.1733T>C	14.37:g.60585201T>C	ENSP00000384801:p.Val578Ala	Somatic		WXS	Illumina HiSeq	Phase_I	A8MXM2|Q9BQG8|Q9H9F2	Missense_Mutation	SNP	ENST00000406854.1	37		.	.	.	.	.	.	.	.	.	.	T	4.317	0.058181	0.08339	.	.	ENSG00000126773	ENST00000317623;ENST00000406854;ENST00000406949;ENST00000404681	T;T;T;T	0.20881	2.04;2.06;2.08;2.06	6.0	3.61	0.41365	.	.	.	.	.	T	0.10895	0.0266	N	0.13098	0.295	0.20074	N	0.999932	B;B	0.06786	0.0;0.001	B;B	0.04013	0.001;0.001	T	0.38023	-0.9680	9	0.18276	T	0.48	.	6.4521	0.21910	0.0:0.1295:0.2441:0.6264	.	578;344	Q63HM2;B5MC47	CN135_HUMAN;.	A	344;578;344;578	ENSP00000317396:V344A;ENSP00000384801:V578A;ENSP00000385201:V344A;ENSP00000385713:V578A	ENSP00000317396:V344A	V	+	2	0	C14orf135	59654954	0.089000	0.21612	0.043000	0.18650	0.294000	0.27393	0.458000	0.21892	0.493000	0.27837	-0.263000	0.10527	GTC		0.428	PCNXL4-005	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000317847.1	NM_022495	
WASH3P	374666	broad.mit.edu	37	15	102515298	102515298	+	RNA	SNP	C	C	T	rs530852091	byFrequency	TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr15:102515298C>T	ENST00000557932.1	+	0	1144				DDX11L9_ENST00000562189.1_RNA			C4AMC7	WASH3_HUMAN	WAS protein family homolog 3 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)	p.I373I(1)		central_nervous_system(1)|endometrium(6)|kidney(11)|prostate(5)|stomach(1)|urinary_tract(1)	25						CTGGGGGCATCGGCAAGGCCA	0.652													c|||	4	0.000798722	0.0	0.0	5008	,	,		30507	0.002		0.002	False		,,,				2504	0.0					.											1	Substitution - coding silent(1)	kidney(1)																																										374666					15q26.3	2014-03-20	2008-01-16	2008-01-16	ENSG00000185596	ENSG00000185596		"""WAS protein homologs"""	24362	pseudogene	pseudogene			"""family with sequence similarity 39, member D pseudogene"""	FAM39DP		11701968, 18159949	Standard	NR_003659		Approved	FLJ25222	uc002cdi.3	C4AMC7	OTTHUMG00000172275		15.37:g.102515298C>T		Somatic		WXS	Illumina HiSeq	Phase_I		RNA	SNP	ENST00000557932.1	37																																																																																					0.652	WASH3P-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000417608.1	NM_199163	
WASH3P	374666	broad.mit.edu	37	15	102516466	102516466	+	RNA	SNP	C	C	G	rs373564005		TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr15:102516466C>G	ENST00000557932.1	+	0	1414				DDX11L9_ENST00000562189.1_RNA			C4AMC7	WASH3_HUMAN	WAS protein family homolog 3 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)	p.S463S(2)		central_nervous_system(1)|endometrium(6)|kidney(11)|prostate(5)|stomach(1)|urinary_tract(1)	25						ACTGGGAATCCTAGGGGGCTC	0.642																																						.											2	Substitution - coding silent(2)	endometrium(2)																																										374666					15q26.3	2014-03-20	2008-01-16	2008-01-16	ENSG00000185596	ENSG00000185596		"""WAS protein homologs"""	24362	pseudogene	pseudogene			"""family with sequence similarity 39, member D pseudogene"""	FAM39DP		11701968, 18159949	Standard	NR_003659		Approved	FLJ25222	uc002cdi.3	C4AMC7	OTTHUMG00000172275		15.37:g.102516466C>G		Somatic		WXS	Illumina HiSeq	Phase_I		RNA	SNP	ENST00000557932.1	37																																																																																					0.642	WASH3P-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000417608.1	NM_199163	
VASN	114990	broad.mit.edu	37	16	4431910	4431910	+	Silent	SNP	C	C	T	rs200909451	byFrequency	TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr16:4431910C>T	ENST00000304735.3	+	2	1187	c.1032C>T	c.(1030-1032)taC>taT	p.Y344Y	CORO7_ENST00000251166.4_Intron|CORO7_ENST00000539968.1_Intron|CORO7-PAM16_ENST00000572467.1_Intron|CORO7_ENST00000574025.1_Intron|CORO7_ENST00000423908.2_Intron|CORO7_ENST00000537233.2_Intron	NM_138440.2	NP_612449.2	Q6EMK4	VASN_HUMAN	vasorin	344	LRRCT.				cellular response to hypoxia (GO:0071456)|cellular response to redox state (GO:0071461)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	transforming growth factor beta binding (GO:0050431)			breast(1)|lung(3)|prostate(1)|skin(1)	6						AGCTTGACTACGCCGACTTTG	0.672													C|||	3	0.000599042	0.0	0.0	5008	,	,		13672	0.002		0.001	False		,,,				2504	0.0					.											0													19.0	21.0	20.0					16																	4431910		2186	4290	6476	SO:0001819	synonymous_variant	114990			AY358299	CCDS10514.1	16p13.3	2008-02-05	2006-03-30	2006-03-30	ENSG00000168140	ENSG00000168140			18517	protein-coding gene	gene with protein product		608843	"""slit-like 2 (Drosophila)"""	SLITL2		15247411	Standard	NM_138440		Approved		uc002cwj.1	Q6EMK4	OTTHUMG00000129469	ENST00000304735.3:c.1032C>T	16.37:g.4431910C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q6UXL4|Q6UXL5|Q96CX1	Silent	SNP	ENST00000304735.3	37	CCDS10514.1																																																																																				0.672	VASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251632.1	NM_138440	
BRCA1	672	broad.mit.edu;mdanderson.org	37	17	41244425	41244425	+	Silent	SNP	T	T	C			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr17:41244425T>C	ENST00000357654.3	-	10	3241	c.3123A>G	c.(3121-3123)tcA>tcG	p.S1041S	BRCA1_ENST00000352993.3_Intron|BRCA1_ENST00000471181.2_Silent_p.S1041S|BRCA1_ENST00000491747.2_Intron|BRCA1_ENST00000354071.3_Silent_p.S1041S|BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000586385.1_Intron|BRCA1_ENST00000309486.4_Silent_p.S745S|BRCA1_ENST00000591534.1_Intron|BRCA1_ENST00000493795.1_Silent_p.S994S|BRCA1_ENST00000346315.3_Silent_p.S1041S|BRCA1_ENST00000468300.1_Intron|BRCA1_ENST00000351666.3_Intron	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	1041					androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		TAATATTGCTTGAGCTGGCTT	0.363			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																												.	yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	0													127.0	121.0	123.0					17																	41244425		2203	4300	6503	SO:0001819	synonymous_variant	672	Familial Cancer Database		U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.3123A>G	17.37:g.41244425T>C		Somatic		WXS	Illumina HiSeq	Phase_I	O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Silent	SNP	ENST00000357654.3	37	CCDS11453.1																																																																																				0.363	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348798.2	NM_007294	
HEATR6	63897	broad.mit.edu	37	17	58156293	58156293	+	5'Flank	SNP	G	G	C			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr17:58156293G>C	ENST00000184956.6	-	0	0				HEATR6_ENST00000585712.1_5'Flank|HEATR6_ENST00000585976.1_5'Flank|CTD-2319I12.2_ENST00000589740.1_lincRNA	NM_022070.4	NP_071353.4	Q6AI08	HEAT6_HUMAN	HEAT repeat containing 6								poly(A) RNA binding (GO:0044822)			NS(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	44	all_cancers(5;2.25e-13)|Breast(5;4.84e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		BRCA - Breast invasive adenocarcinoma(1;5.93e-19)|Epithelial(12;7.59e-12)|all cancers(12;1.26e-10)			ACGGGCGGGGGGGGTGGGTGG	0.622																																						.											0													2.0	3.0	3.0					17																	58156293		1507	3097	4604	SO:0001631	upstream_gene_variant	63897			BX640819	CCDS11623.1	17q23.2	2007-05-01				ENSG00000068097			24076	protein-coding gene	gene with protein product	"""amplified in breast cancer 1"""					12755490	Standard	NM_022070		Approved	ABC1, FLJ22087	uc002iyk.1	Q6AI08			17.37:g.58156293G>C	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_I	B3KXP3|Q6MZX1|Q6MZY2|Q8TDM9|Q9H6B3|Q9H6M7	Splice_Site	SNP	ENST00000184956.6	37	CCDS11623.1																																																																																				0.622	HEATR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449165.1	NM_022070	
CPAMD8	27151	broad.mit.edu;ucsc.edu	37	19	17036078	17036078	+	Silent	SNP	A	A	G			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr19:17036078A>G	ENST00000443236.1	-	26	3647	c.3616T>C	c.(3616-3618)Ttg>Ctg	p.L1206L		NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	1159						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						AGATACTTCAAGACAAAGACG	0.542																																						.											0													95.0	99.0	97.0					19																	17036078		1998	4179	6177	SO:0001819	synonymous_variant	27151			AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.3616T>C	19.37:g.17036078A>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q8NC09|Q9ULD7	Silent	SNP	ENST00000443236.1	37	CCDS42519.1																																																																																				0.542	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257531.2	NM_015692	
CILP2	148113	broad.mit.edu	37	19	19649208	19649208	+	Frame_Shift_Del	DEL	T	T	-			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr19:19649208delT	ENST00000291495.5	+	1	135	c.50delT	c.(49-51)ctgfs	p.L17fs	CILP2_ENST00000586018.1_Frame_Shift_Del_p.L17fs	NM_153221.2	NP_694953.2	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	17						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	32						GCTGCGCACCTGGCGGGGGCC	0.761																																						.											0													8.0	11.0	10.0					19																	19649208		2122	4173	6295	SO:0001589	frameshift_variant	148113			AF542080	CCDS12405.1	19p13.11	2013-01-14				ENSG00000160161		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	24213	protein-coding gene	gene with protein product		612419				12477932	Standard	NM_153221		Approved	MGC45771	uc002nmv.4	Q8IUL8		ENST00000291495.5:c.50delT	19.37:g.19649208delT	ENSP00000291495:p.Leu17fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q6NV88|Q8N4A6|Q8WV21	Frame_Shift_Del	DEL	ENST00000291495.5	37	CCDS12405.1																																																																																				0.761	CILP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000459738.3	NM_153221	
RELB	5971	broad.mit.edu;bcgsc.ca	37	19	45537516	45537516	+	Missense_Mutation	SNP	G	G	C			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr19:45537516G>C	ENST00000221452.8	+	10	1372	c.1222G>C	c.(1222-1224)Gac>Cac	p.D408H	RELB_ENST00000505236.1_Missense_Mutation_p.D405H|RELB_ENST00000540120.1_Missense_Mutation_p.D408H	NM_006509.3	NP_006500.2	Q01201	RELB_HUMAN	v-rel avian reticuloendotheliosis viral oncogene homolog B	408	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				antigen processing and presentation (GO:0019882)|circadian regulation of gene expression (GO:0032922)|myeloid dendritic cell differentiation (GO:0043011)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of gene expression (GO:0010628)|T-helper 1 cell differentiation (GO:0045063)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|ovary(3)|skin(1)	12		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00986)		CTACGGCGTGGACAAGAAGCG	0.463																																						.											0													54.0	57.0	56.0					19																	45537516		1940	4138	6078	SO:0001583	missense	5971			M83221	CCDS46110.1	19q13.32	2013-07-09	2013-07-09		ENSG00000104856	ENSG00000104856			9956	protein-coding gene	gene with protein product		604758	"""v-rel avian reticuloendotheliosis viral oncogene homolog B (nuclear factor of kappa light polypeptide gene enhancer in B-cells 3)"""			1531086	Standard	NM_006509		Approved	REL-B	uc021uvp.1	Q01201	OTTHUMG00000162116	ENST00000221452.8:c.1222G>C	19.37:g.45537516G>C	ENSP00000221452:p.Asp408His	Somatic		WXS	Illumina HiSeq	Phase_I	Q6GTX7|Q9UEI7	Missense_Mutation	SNP	ENST00000221452.8	37	CCDS46110.1	.	.	.	.	.	.	.	.	.	.	G	14.41	2.526283	0.44969	.	.	ENSG00000104856	ENST00000221452;ENST00000540120;ENST00000505236	T;T;T	0.44881	0.91;0.91;0.91	5.0	5.0	0.66597	.	0.446106	0.22395	N	0.060623	T	0.24122	0.0584	N	0.14661	0.345	0.40606	D	0.981628	P	0.35272	0.493	B	0.26094	0.066	T	0.10660	-1.0620	10	0.34782	T	0.22	-0.0751	13.6656	0.62393	0.0:0.0:1.0:0.0	.	405	D6R992	.	H	408;408;405	ENSP00000221452:D408H;ENSP00000445542:D408H;ENSP00000423287:D405H	ENSP00000221452:D408H	D	+	1	0	RELB	50229356	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	1.846000	0.39289	2.603000	0.88011	0.563000	0.77884	GAC		0.463	RELB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000367361.2		
SSC5D	284297	broad.mit.edu	37	19	56029435	56029435	+	Missense_Mutation	SNP	A	A	C			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr19:56029435A>C	ENST00000389623.6	+	14	3815	c.3792A>C	c.(3790-3792)caA>caC	p.Q1264H		NM_001144950.1	NP_001138422.1	A1L4H1	SRCRL_HUMAN	scavenger receptor cysteine rich family, 5 domains	1264	Pro-rich.|Thr-rich.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterial lipoprotein (GO:0042494)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|negative regulation of interleukin-8 secretion (GO:2000483)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|intracellular (GO:0005622)|membrane (GO:0016020)	extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|skin(2)	4						caacccctcaacccttcacca	0.627																																						.											0													466.0	543.0	520.0					19																	56029435		692	1591	2283	SO:0001583	missense	284297				CCDS46196.1, CCDS59424.1	19q13.42	2014-07-09	2014-07-09		ENSG00000179954	ENSG00000179954			26641	protein-coding gene	gene with protein product	"""soluble scavenger with 5 domains"""		"""scavenger receptor cysteine rich domain containing (5 domains)"""			19535143	Standard	NM_001144950		Approved	FLJ35258	uc002qlg.4	A1L4H1		ENST00000389623.6:c.3792A>C	19.37:g.56029435A>C	ENSP00000374274:p.Gln1264His	Somatic		WXS	Illumina HiSeq	Phase_I	B5MDQ5|C7S7T9|C7S7U0|K7EP70	Missense_Mutation	SNP	ENST00000389623.6	37	CCDS46196.1	.	.	.	.	.	.	.	.	.	.	-	9.790	1.177611	0.21787	.	.	ENSG00000179954	ENST00000389623	T	0.01203	5.18	2.43	-0.372	0.12520	.	.	.	.	.	T	0.01029	0.0034	L	0.29908	0.895	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45585	-0.9251	9	0.42905	T	0.14	.	4.8355	0.13462	0.2466:0.522:0.2314:0.0	.	1264	A1L4H1	SRCRL_HUMAN	H	1264	ENSP00000374274:Q1264H	ENSP00000374274:Q1264H	Q	+	3	2	SSC5D	60721247	0.000000	0.05858	0.032000	0.17829	0.085000	0.17905	-6.418000	0.00067	-0.143000	0.11334	-1.107000	0.02091	CAA		0.627	SSC5D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453345.2	XM_001718392	
ZNF787	126208	broad.mit.edu	37	19	56599998	56599998	+	Frame_Shift_Del	DEL	C	C	-			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr19:56599998delC	ENST00000270459.3	-	3	661	c.543delG	c.(541-543)ccgfs	p.P181fs		NM_001002836.2	NP_001002836	Q6DD87	ZN787_HUMAN	zinc finger protein 787	181					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|lung(2)|pancreas(1)	5		Colorectal(82;3.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0559)		GGCCGCAGCGCGGGCACACGA	0.731																																						.											0										17,3769		5,7,1881	4.0	5.0	5.0			3.7	1.0	19		5	22,7600		5,12,3794	no	frameshift	ZNF787	NM_001002836.2		10,19,5675	A1A1,A1R,RR		0.2886,0.449,0.3419			56599998	39,11369	1997	4032	6029	SO:0001589	frameshift_variant	126208			BC077728, AF000560	CCDS42634.1	19q13.42	2013-01-08				ENSG00000142409		"""Zinc fingers, C2H2-type"""	26998	protein-coding gene	gene with protein product							Standard	NM_001002836		Approved		uc010eth.1	Q6DD87		ENST00000270459.3:c.543delG	19.37:g.56599998delC	ENSP00000270459:p.Pro181fs	Somatic		WXS	Illumina HiSeq	Phase_I	O00455	Frame_Shift_Del	DEL	ENST00000270459.3	37	CCDS42634.1																																																																																				0.731	ZNF787-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457498.1	NM_001002836	
ANAPC1	64682	broad.mit.edu	37	2	112608394	112608394	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr2:112608394T>C	ENST00000341068.3	-	14	2381	c.1609A>G	c.(1609-1611)Act>Gct	p.T537A		NM_022662.3	NP_073153.1	Q9H1A4	APC1_HUMAN	anaphase promoting complex subunit 1	537					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)		p.T537A(5)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(7)|lung(16)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	49						GGCTTTGGAGTACTAACGCCA	0.433																																						.											5	Substitution - Missense(5)	lung(3)|kidney(1)|endometrium(1)											109.0	106.0	107.0					2																	112608394		2203	4300	6503	SO:0001583	missense	64682			AJ278357	CCDS2093.1	2q12.1	2011-06-15			ENSG00000153107	ENSG00000153107		"""Anaphase promoting complex subunits"""	19988	protein-coding gene	gene with protein product		608473				11179667	Standard	NM_022662		Approved	MCPR, TSG24, APC1	uc002ssh.3	Q9H1A4	OTTHUMG00000131277	ENST00000341068.3:c.1609A>G	2.37:g.112608394T>C	ENSP00000339109:p.Thr537Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q2M3H8|Q9BSE6|Q9H8D0	Missense_Mutation	SNP	ENST00000341068.3	37	CCDS2093.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	4.716|4.716	0.133071|0.133071	0.09032|0.09032	.|.	.|.	ENSG00000153107|ENSG00000153107	ENST00000341068|ENST00000427997	.|.	.|.	.|.	4.57|4.57	3.37|3.37	0.38596|0.38596	.|.	0.273018|.	0.23039|.	U|.	0.052629|.	T|T	0.55305|0.55305	0.1912|0.1912	L|L	0.45352|0.45352	1.415|1.415	0.37887|0.37887	D|D	0.930579|0.930579	B|.	0.14438|.	0.01|.	B|.	0.18263|.	0.021|.	T|T	0.53535|0.53535	-0.8425|-0.8425	9|5	0.08837|.	T|.	0.75|.	-8.0757|-8.0757	10.3103|10.3103	0.43704|0.43704	0.1479:0.0:0.0:0.8521|0.1479:0.0:0.0:0.8521	.|.	537|.	Q9H1A4|.	APC1_HUMAN|.	A|C	537|71	.|.	ENSP00000339109:T537A|.	T|Y	-|-	1|2	0|0	ANAPC1|ANAPC1	112324865|112324865	1.000000|1.000000	0.71417|0.71417	0.138000|0.138000	0.22173|0.22173	0.127000|0.127000	0.20565|0.20565	3.555000|3.555000	0.53727|0.53727	0.570000|0.570000	0.29347|0.29347	0.369000|0.369000	0.22263|0.22263	ACT|TAC		0.433	ANAPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254045.2	NM_022662	
MFNG	4242	broad.mit.edu	37	22	37875491	37875491	+	Silent	SNP	C	C	T			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr22:37875491C>T	ENST00000356998.3	-	4	676	c.453G>A	c.(451-453)gcG>gcA	p.A151A	MFNG_ENST00000416983.3_Silent_p.A137A	NM_002405.3	NP_002396.2	O00587	MFNG_HUMAN	MFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase	151					pattern specification process (GO:0007389)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of protein binding (GO:0032092)	extracellular space (GO:0005615)|integral component of Golgi membrane (GO:0030173)	metal ion binding (GO:0046872)|O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase activity (GO:0033829)			large_intestine(2)|lung(2)|skin(1)	5	Melanoma(58;0.0574)					GCTGCAGCAGCGCCCTTGGGT	0.612																																						.											0													90.0	77.0	81.0					22																	37875491		2203	4300	6503	SO:0001819	synonymous_variant	4242			BC094814	CCDS13947.1, CCDS54525.1	22q13.1	2013-02-19	2006-11-13		ENSG00000100060	ENSG00000100060	2.4.1.222	"""Beta 3-glycosyltransferases"""	7038	protein-coding gene	gene with protein product		602577	"""manic fringe (Drosophila) homolog"", ""manic fringe homolog (Drosophila)"""			9878264, 9187150	Standard	NM_002405		Approved		uc003ass.2	O00587	OTTHUMG00000150560	ENST00000356998.3:c.453G>A	22.37:g.37875491C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B4DLT6|O43730|Q504S9	Silent	SNP	ENST00000356998.3	37	CCDS13947.1																																																																																				0.612	MFNG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318902.1	NM_002405	
BRD1	23774	broad.mit.edu;mdanderson.org	37	22	50216913	50216913	+	Silent	SNP	A	A	G			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr22:50216913A>G	ENST00000216267.8	-	1	1539	c.1053T>C	c.(1051-1053)caT>caC	p.H351H	BRD1_ENST00000404034.1_Silent_p.H351H|BRD1_ENST00000457780.2_Silent_p.H351H|BRD1_ENST00000459821.1_5'UTR|BRD1_ENST00000542442.1_5'UTR|BRD1_ENST00000342989.5_5'Flank|BRD1_ENST00000404760.1_Silent_p.H351H	NM_014577.1	NP_055392.1	O95696	BRD1_HUMAN	bromodomain containing 1	351					histone H3 acetylation (GO:0043966)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleus (GO:0005634)	histone binding (GO:0042393)|zinc ion binding (GO:0008270)			endometrium(6)|kidney(3)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	37		all_cancers(38;6.11e-10)|all_epithelial(38;8.06e-09)|all_lung(38;6.64e-05)|Lung NSC(38;0.0011)|Breast(42;0.00235)|Ovarian(80;0.0139)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0369)|BRCA - Breast invasive adenocarcinoma(115;0.21)		CACACGTCACATGGAATGCTG	0.562																																						.											0													135.0	130.0	132.0					22																	50216913		2203	4300	6503	SO:0001819	synonymous_variant	23774			AF005067	CCDS14080.1	22q13.33	2008-07-01	2002-01-14		ENSG00000100425	ENSG00000100425			1102	protein-coding gene	gene with protein product	"""BR140-like"""	604589	"""bromodomain-containing 1"""			10591208, 10602503	Standard	NM_014577		Approved	BRL, BRPF2	uc003biv.3	O95696	OTTHUMG00000150288	ENST00000216267.8:c.1053T>C	22.37:g.50216913A>G		Somatic		WXS	Illumina HiSeq	Phase_I	A6ZJA4	Silent	SNP	ENST00000216267.8	37	CCDS14080.1																																																																																				0.562	BRD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317402.1	NM_014577	
MON1A	84315	broad.mit.edu	37	3	49967246	49967246	+	Frame_Shift_Del	DEL	G	G	-			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr3:49967246delG	ENST00000296473.3	-	1	332	c.74delC	c.(73-75)gctfs	p.A25fs	MON1A_ENST00000483022.1_5'UTR|MON1A_ENST00000455683.2_Frame_Shift_Del_p.A25fs|MON1A_ENST00000417270.1_5'UTR	NM_032355.3	NP_115731.2	Q86VX9	MON1A_HUMAN	MON1 secretory trafficking family member A	0										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)	13				BRCA - Breast invasive adenocarcinoma(193;4.62e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		CAGGAAGATAGCTTTCGCCGG	0.706																																						.											0													1.0	3.0	2.0					3																	49967246		457	1201	1658	SO:0001589	frameshift_variant	84315			AK074404	CCDS2808.2, CCDS46830.1	3p21.31	2013-08-21	2013-08-21		ENSG00000164077	ENSG00000164077			28207	protein-coding gene	gene with protein product		611464	"""MON1 homolog A (yeast)"""			12477932	Standard	NM_032355		Approved	MGC13272, SAND1	uc003cxz.3	Q86VX9	OTTHUMG00000156737	ENST00000296473.3:c.74delC	3.37:g.49967246delG	ENSP00000296473:p.Ala25fs	Somatic		WXS	Illumina HiSeq	Phase_I	B2RDQ1|G5E9N1|Q8NAV7|Q9BRF3	Frame_Shift_Del	DEL	ENST00000296473.3	37	CCDS2808.2																																																																																				0.706	MON1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345534.2	NM_032355	
NAT8L	339983	broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	2065597	2065597	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr4:2065597C>T	ENST00000423729.2	+	3	652	c.652C>T	c.(652-654)Cgt>Tgt	p.R218C	NAT8L_ENST00000331662.3_Missense_Mutation_p.R50C	NM_178557.3	NP_848652.2	Q8N9F0	NAT8L_HUMAN	N-acetyltransferase 8-like (GCN5-related, putative)	218	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				metabolic process (GO:0008152)|positive regulation of dopamine uptake involved in synaptic transmission (GO:0051586)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)	aspartate N-acetyltransferase activity (GO:0017188)			haematopoietic_and_lymphoid_tissue(1)|lung(1)	2			OV - Ovarian serous cystadenocarcinoma(23;0.0315)			TGTGGACTCACGTTTCCGAGG	0.667																																						.											0													81.0	61.0	67.0					4																	2065597		2202	4300	6502	SO:0001583	missense	339983			AK094797	CCDS3359.1, CCDS3359.2	4p16.3	2011-11-16	2008-09-24		ENSG00000185818	ENSG00000185818			26742	protein-coding gene	gene with protein product		610647	"""N-acetyltransferase 8-like"""			11397015	Standard	NM_178557		Approved	FLJ37478, Hcml3	uc003geq.2	Q8N9F0	OTTHUMG00000121151	ENST00000423729.2:c.652C>T	4.37:g.2065597C>T	ENSP00000413064:p.Arg218Cys	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000423729.2	37	CCDS3359.2	.	.	.	.	.	.	.	.	.	.	C	19.07	3.755264	0.69648	.	.	ENSG00000185818	ENST00000423729;ENST00000331662	T;T	0.23348	1.91;1.91	5.54	4.61	0.57282	GCN5-related N-acetyltransferase (GNAT) domain (2);Acyl-CoA N-acyltransferase (2);	0.475646	0.21667	U	0.070925	T	0.39989	0.1099	L	0.46157	1.445	0.51767	D	0.999932	D	0.76494	0.999	D	0.65987	0.94	T	0.10543	-1.0625	10	0.62326	D	0.03	-20.8764	10.9382	0.47257	0.3955:0.6045:0.0:0.0	.	218	Q8N9F0	NAT8L_HUMAN	C	218;50	ENSP00000413064:R218C;ENSP00000328464:R50C	ENSP00000328464:R50C	R	+	1	0	NAT8L	2035395	0.977000	0.34250	0.986000	0.45419	0.509000	0.34042	3.848000	0.55903	2.604000	0.88044	0.450000	0.29827	CGT		0.667	NAT8L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_178557	
ZSWIM6	57688	broad.mit.edu	37	5	60822215	60822215	+	Frame_Shift_Del	DEL	A	A	-			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr5:60822215delA	ENST00000252744.5	+	7	1829	c.1829delA	c.(1828-1830)caafs	p.Q610fs		NM_020928.1	NP_065979.1	Q9HCJ5	ZSWM6_HUMAN	zinc finger, SWIM-type containing 6	610					neuron projection morphogenesis (GO:0048812)|regulation of neuron migration (GO:2001222)		zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)	8						TTCCGAACCCAAAAAAAAGGT	0.408																																						.											0													144.0	131.0	135.0					5																	60822215		692	1591	2283	SO:0001589	frameshift_variant	57688			BC039438	CCDS47215.1	5q12.1	2011-03-17			ENSG00000130449	ENSG00000130449		"""Zinc fingers, SWIM-type"""	29316	protein-coding gene	gene with protein product		615951				10997877, 16427614	Standard	NM_020928		Approved	KIAA1577	uc003jsr.3	Q9HCJ5	OTTHUMG00000162388	ENST00000252744.5:c.1829delA	5.37:g.60822215delA	ENSP00000252744:p.Gln610fs	Somatic		WXS	Illumina HiSeq	Phase_I		Frame_Shift_Del	DEL	ENST00000252744.5	37	CCDS47215.1																																																																																				0.408	ZSWIM6-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368710.1	NM_020928	
NBPF22P	285622	broad.mit.edu	37	5	85581611	85581611	+	RNA	DEL	A	A	-			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr5:85581611delA	ENST00000590707.1	+	0	631					NR_003719.2				neuroblastoma breakpoint family, member 22, pseudogene																		TCCTGACCTGACTCCCTCCTA	0.488																																						.											0																																												285622			BC050328		5q14.3	2013-01-17	2011-04-15		ENSG00000205449	ENSG00000205449		"""neuroblastoma breakpoint family"""	28731	pseudogene	pseudogene						16079250	Standard	NR_003719		Approved	MGC48637	uc003kiq.3		OTTHUMG00000162585		5.37:g.85581611delA		Somatic		WXS	Illumina HiSeq	Phase_I		RNA	DEL	ENST00000590707.1	37																																																																																					0.488	NBPF22P-004	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000453100.1	XM_208333	
SLC25A46	91137	broad.mit.edu	37	5	110097244	110097244	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr5:110097244G>A	ENST00000355943.3	+	8	1145	c.1019G>A	c.(1018-1020)cGc>cAc	p.R340H	SLC25A46_ENST00000447245.2_Missense_Mutation_p.R259H|SLC25A46_ENST00000509442.2_Missense_Mutation_p.R249H|SLC25A46_ENST00000509432.1_Missense_Mutation_p.R127H|SLC25A46_ENST00000504098.1_Missense_Mutation_p.R194H|SLC25A46_ENST00000513807.1_Missense_Mutation_p.R178H|SLC25A46_ENST00000513706.1_3'UTR	NM_138773.1	NP_620128.1	Q96AG3	S2546_HUMAN	solute carrier family 25, member 46	340					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	10		all_cancers(142;0.00203)|all_epithelial(76;4.52e-05)|Prostate(80;0.0115)|Colorectal(57;0.0676)|Ovarian(225;0.156)		OV - Ovarian serous cystadenocarcinoma(64;2.58e-09)|Epithelial(69;7.29e-08)|all cancers(49;9.35e-06)|COAD - Colon adenocarcinoma(37;0.211)		GTTTTGCACCGCCTTCACATT	0.393																																						.											0													255.0	242.0	246.0					5																	110097244		2202	4300	6502	SO:0001583	missense	91137			BC017169	CCDS4100.1	5q22.1	2013-05-22			ENSG00000164209	ENSG00000164209		"""Solute carriers"""	25198	protein-coding gene	gene with protein product		610826				1651562, 1651563, 16949250	Standard	NM_138773		Approved		uc003koz.3	Q96AG3	OTTHUMG00000128794	ENST00000355943.3:c.1019G>A	5.37:g.110097244G>A	ENSP00000348211:p.Arg340His	Somatic		WXS	Illumina HiSeq	Phase_I	A8K2F2|B3KRE6|B4DTA3|D3DSZ6|D6R9W7|Q04197	Missense_Mutation	SNP	ENST00000355943.3	37	CCDS4100.1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.985424	0.93044	.	.	ENSG00000164209	ENST00000513807;ENST00000509442;ENST00000355943;ENST00000514046;ENST00000447245;ENST00000504098;ENST00000509432	D;D;D;D;D;D	0.83992	-1.79;-1.79;-1.79;-1.79;-1.79;-1.79	5.71	5.71	0.89125	Mitochondrial carrier domain (2);	0.044516	0.85682	D	0.000000	D	0.93657	0.7974	M	0.92880	3.355	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.993;0.997	D	0.94518	0.7724	10	0.87932	D	0	-9.4977	19.8594	0.96778	0.0:0.0:1.0:0.0	.	249;340	B4DY98;Q96AG3	.;S2546_HUMAN	H	178;249;340;194;259;194;127	ENSP00000421134:R178H;ENSP00000424136:R249H;ENSP00000348211:R340H;ENSP00000399717:R259H;ENSP00000425708:R194H;ENSP00000426604:R127H	ENSP00000348211:R340H	R	+	2	0	SLC25A46	110125143	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.897000	0.92532	2.691000	0.91804	0.650000	0.86243	CGC		0.393	SLC25A46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250721.5	NM_138773	
DPCR1	135656	broad.mit.edu	37	6	30917845	30917845	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr6:30917845C>T	ENST00000462446.1	+	2	1632	c.1604C>T	c.(1603-1605)cCa>cTa	p.P535L	DPCR1_ENST00000304311.2_5'UTR|HCG21_ENST00000419481.1_RNA			Q3MIW9	DPCR1_HUMAN	diffuse panbronchiolitis critical region 1	280						integral component of membrane (GO:0016021)				endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|pancreas(1)	10						AACACCACACCATCCCCAGCA	0.512																																						.											0													83.0	92.0	89.0					6																	30917845		692	1591	2283	SO:0001583	missense	135656			AB064272	CCDS4692.1, CCDS4692.2	6p21.32	2008-02-05			ENSG00000168631	ENSG00000168631			21666	protein-coding gene	gene with protein product		613928				12185533, 10677310	Standard	NM_080870		Approved	PBLT, bCX105N19.6	uc003nsg.2	Q3MIW9	OTTHUMG00000031104	ENST00000462446.1:c.1604C>T	6.37:g.30917845C>T	ENSP00000417182:p.Pro535Leu	Somatic		WXS	Illumina HiSeq	Phase_I	C9IZC0|Q658M7|Q8WYN2	Missense_Mutation	SNP	ENST00000462446.1	37	CCDS4692.2	.	.	.	.	.	.	.	.	.	.	-	1.979	-0.434705	0.04669	.	.	ENSG00000168631	ENST00000462446	T	0.46451	0.87	2.42	-3.88	0.04205	.	.	.	.	.	T	0.13286	0.0322	M	0.69823	2.125	0.09310	N	0.999999	B	0.18741	0.03	B	0.17979	0.02	T	0.28267	-1.0049	9	0.30078	T	0.28	.	0.5003	0.00578	0.2318:0.1654:0.3276:0.2752	.	535	E9PEI6	.	L	535	ENSP00000417182:P535L	ENSP00000417182:P535L	P	+	2	0	DPCR1	31025824	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	-0.305000	0.08188	-1.062000	0.03181	0.538000	0.68166	CCA		0.512	DPCR1-001	NOVEL	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076173.3	NM_080870	
CAMSAP1	157922	broad.mit.edu	37	9	138715800	138715800	+	Frame_Shift_Del	DEL	T	T	-			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr9:138715800delT	ENST00000389532.4	-	10	1460	c.1396delA	c.(1396-1398)accfs	p.T466fs	CAMSAP1_ENST00000483991.1_5'UTR|CAMSAP1_ENST00000409386.3_Frame_Shift_Del_p.T477fs|CAMSAP1_ENST00000312405.6_Frame_Shift_Del_p.T188fs	NM_015447.3	NP_056262.3	Q5T5Y3	CAMP1_HUMAN	calmodulin regulated spectrin-associated protein 1	466					cytoskeleton organization (GO:0007010)|neuron projection development (GO:0031175)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|spectrin binding (GO:0030507)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(11)|lung(16)|ovary(3)|pancreas(1)|skin(1)	47				OV - Ovarian serous cystadenocarcinoma(145;1.4e-06)|Epithelial(140;1.11e-05)		ACTCACCTGGTTTTTTTTTCT	0.463																																						.											0										100,44,4118		0,0,100,9,26,1996	52.0	46.0	48.0			-3.4	0.0	9		48	225,85,7928		1,0,223,16,53,3826	no	codingComplex	CAMSAP1	NM_015447.3		1,0,323,25,79,5822	A1A1,A1A2,A1R,A2A2,A2R,RR		3.763,3.3787,3.632			138715800	325,129,12046	2202	4295	6497	SO:0001589	frameshift_variant	157922			AJ519841	CCDS35176.2	9q34.3	2008-02-05			ENSG00000130559	ENSG00000130559			19946	protein-coding gene	gene with protein product		613774				12477932	Standard	NM_015447		Approved	FLJ31228, DKFZp434F195	uc004cgr.4	Q5T5Y3	OTTHUMG00000020918	ENST00000389532.4:c.1396delA	9.37:g.138715800delT	ENSP00000374183:p.Thr466fs	Somatic		WXS	Illumina HiSeq	Phase_I	A1L4L2|B2REB2|B2REB3|Q70W33|Q8NCY0|Q96E80|Q96FM3|Q9UFJ5	Frame_Shift_Del	DEL	ENST00000389532.4	37	CCDS35176.2																																																																																				0.463	CAMSAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055024.2	XM_351857	
STAM	8027	broad.mit.edu	37	10	17756602	17756603	+	In_Frame_Ins	INS	-	-	CCC			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr10:17756602_17756603insCCC	ENST00000377524.3	+	14	1661_1662	c.1446_1447insCCC	c.(1447-1449)cct>CCCcct	p.483_483P>PP	STAM_ENST00000540523.1_In_Frame_Ins_p.372_372P>PP	NM_003473.3	NP_003464.1	Q92783	STAM1_HUMAN	signal transducing adaptor molecule (SH3 domain and ITAM motif) 1	483					endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)	SH3/SH2 adaptor activity (GO:0005070)			breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	26						TATATAGTCCTCCTCCTGCCGC	0.47																																						.											0																																										SO:0001652	inframe_insertion	8027			U43899	CCDS7122.1	10p14-p13	2009-04-29			ENSG00000136738	ENSG00000136738			11357	protein-coding gene	gene with protein product	"""HSE1 homolog (S. cerevisiae)"""	601899				8780729	Standard	NM_003473		Approved	STAM1	uc001ipj.2	Q92783	OTTHUMG00000017749	Exception_encountered	10.37:g.17756602_17756603insCCC	ENSP00000366746:p.Pro484dup	Somatic		WXS	Illumina HiSeq	Phase_I	B0YJ99|D3DRU5|Q8N6D9	In_Frame_Ins	INS	ENST00000377524.3	37	CCDS7122.1																																																																																				0.470	STAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047039.1	NM_003473	
SIK2	23235	broad.mit.edu	37	11	111594331	111594332	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr11:111594331_111594332insC	ENST00000304987.3	+	15	2432_2433	c.2259_2260insC	c.(2260-2262)cccfs	p.P754fs		NM_015191.1	NP_056006.1	Q9H0K1	SIK2_HUMAN	salt-inducible kinase 2	754					insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of insulin receptor signaling pathway (GO:0046626)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	30						AGCTGCCCCTTCCCCGCCAGGA	0.589																																						.											0																																										SO:0001589	frameshift_variant	23235			AB018324	CCDS8347.1	11q23.1	2008-12-23	2008-12-23	2008-12-23	ENSG00000170145	ENSG00000170145			21680	protein-coding gene	gene with protein product		608973	"""SNF1-like kinase 2"""	SNF1LK2		15067358	Standard	NM_015191		Approved	KIAA0781, QIK, DKFZp434K1115, LOH11CR1I	uc001plt.3	Q9H0K1	OTTHUMG00000150644	ENST00000304987.3:c.2263dupC	11.37:g.111594335_111594335dupC	ENSP00000305976:p.Pro754fs	Somatic		WXS	Illumina HiSeq	Phase_I	A8K5B8|B0YJ94|O94878|Q17RV0|Q6AZE2|Q76N03|Q8NCV7|Q96CZ8	Frame_Shift_Ins	INS	ENST00000304987.3	37	CCDS8347.1																																																																																				0.589	SIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319352.3	NM_015191	
RTL1	388015	broad.mit.edu	37	14	101347140	101347141	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr14:101347140_101347141insC	ENST00000534062.1	-	1	4043_4044	c.3985_3986insG	c.(3985-3987)gccfs	p.A1329fs	MIR127_ENST00000384876.1_RNA|MIR433_ENST00000384837.1_RNA|MIR431_ENST00000385266.1_RNA	NM_001134888.2	NP_001128360.1	A6NKG5	RTL1_HUMAN	retrotransposon-like 1	1329					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)				breast(1)|endometrium(5)|kidney(4)|large_intestine(1)|lung(5)|pancreas(1)|prostate(2)|skin(2)	21						GATGGGCAGGGCCCGCCTGTAG	0.649																																						.											0																																										SO:0001589	frameshift_variant	388015				CCDS53910.1	14q32.2	2012-04-18			ENSG00000254656	ENSG00000254656			14665	protein-coding gene	gene with protein product		611896				16155747, 15854907, 12796779	Standard	NM_001134888		Approved	PEG11, MART1, Mar1	uc010txj.1	A6NKG5	OTTHUMG00000167573	ENST00000534062.1:c.3986dupG	14.37:g.101347143_101347143dupC	ENSP00000435342:p.Ala1329fs	Somatic		WXS	Illumina HiSeq	Phase_I	E9PKS8	Frame_Shift_Ins	INS	ENST00000534062.1	37	CCDS53910.1																																																																																				0.649	RTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395127.1	NM_001134888	
SLC28A2	9153	broad.mit.edu	37	15	45556950	45556951	+	Frame_Shift_Ins	INS	-	-	G			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr15:45556950_45556951insG	ENST00000347644.3	+	7	751_752	c.686_687insG	c.(685-690)ctgggafs	p.LG229fs	CTD-2651B20.3_ENST00000561404.1_RNA|CTD-2651B20.3_ENST00000560344.1_RNA	NM_004212.3	NP_004203.2	O43868	S28A2_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 2	229					nucleobase-containing compound metabolic process (GO:0006139)|purine nucleoside transmembrane transport (GO:0015860)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|nucleoside:sodium symporter activity (GO:0005415)|purine nucleoside transmembrane transporter activity (GO:0015211)			NS(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(4)|skin(1)	26		all_cancers(109;8.53e-07)|all_epithelial(112;1.39e-05)|Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;3.77e-16)|GBM - Glioblastoma multiforme(94;2.71e-06)	Mercaptopurine(DB01033)	TTTCAGTGGCTGGGAGAGCAGG	0.446																																					NSCLC(92;493 1501 26361 28917 47116)	.											0																																										SO:0001589	frameshift_variant	9153			U84392	CCDS10121.1	15q15	2013-07-17	2013-07-17		ENSG00000137860	ENSG00000137860		"""Solute carriers"""	11002	protein-coding gene	gene with protein product		606208	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 2"""			9435697	Standard	NM_004212		Approved	CNT2, SPNT1, HCNT2, HsT17153	uc001zva.2	O43868	OTTHUMG00000131426	ENST00000347644.3:c.689dupG	15.37:g.45556953_45556953dupG	ENSP00000315006:p.Leu229fs	Somatic		WXS	Illumina HiSeq	Phase_I	A8K7F9|O43239|Q52LZ0	Frame_Shift_Ins	INS	ENST00000347644.3	37	CCDS10121.1																																																																																				0.446	SLC28A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254219.2	NM_004212	
ZNF548	147694	broad.mit.edu	37	19	57911165	57911166	+	Frame_Shift_Ins	INS	-	-	TT			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr19:57911165_57911166insTT	ENST00000366197.5	+	3	1760_1761	c.1510_1511insTT	c.(1510-1512)cttfs	p.L504fs	AC004076.7_ENST00000597410.1_Intron|AC003002.6_ENST00000596400.1_Intron|AC003002.6_ENST00000600421.1_Intron|ZNF548_ENST00000336128.7_Frame_Shift_Ins_p.L516fs	NM_152909.3	NP_690873.2	Q8NEK5	ZN548_HUMAN	zinc finger protein 548	504					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TGAAGAGAGGCTTGTGTGCTCC	0.416																																						.											0																																										SO:0001589	frameshift_variant	147694			AK057494	CCDS46209.1, CCDS54324.1	19q13.43	2013-01-08				ENSG00000188785		"""Zinc fingers, C2H2-type"", ""-"""	26561	protein-coding gene	gene with protein product						12477932	Standard	NM_152909		Approved	FLJ32932	uc002qon.3	Q8NEK5		ENST00000366197.5:c.1511_1512dupTT	19.37:g.57911166_57911167dupTT	ENSP00000379482:p.Leu504fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q96M05	Frame_Shift_Ins	INS	ENST00000366197.5	37	CCDS46209.1																																																																																				0.416	ZNF548-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000465937.1	NM_152909	
GGT7	2686	broad.mit.edu	37	20	33447370	33447371	+	Frame_Shift_Ins	INS	-	-	G			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr20:33447370_33447371insG	ENST00000336431.5	-	7	933_934	c.889_890insC	c.(889-891)cgcfs	p.R297fs		NM_178026.2	NP_821158.2	Q9UJ14	GGT7_HUMAN	gamma-glutamyltransferase 7	297					glutathione biosynthetic process (GO:0006750)|glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)	anchored component of external side of plasma membrane (GO:0031362)|integral component of membrane (GO:0016021)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)	p.R297H(1)		NS(2)|breast(1)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|skin(2)	20						TAGTGGCGGGCGGCCCGATGGC	0.688																																						.											1	Substitution - Missense(1)	lung(1)																																								SO:0001589	frameshift_variant	2686			AL049709	CCDS13242.2	20q11.22	2008-11-24	2008-03-10	2008-03-10	ENSG00000131067	ENSG00000131067		"""Gamma-glutamyltransferases"""	4259	protein-coding gene	gene with protein product		612342	"""gamma-glutamyltransferase-like 3"""	GGTL5, GGTL3		8104871, 18357469	Standard	NM_178026		Approved	D20S101, dJ18C9.2	uc002xay.3	Q9UJ14	OTTHUMG00000032314	ENST00000336431.5:c.890dupC	20.37:g.33447372_33447372dupG	ENSP00000338964:p.Arg297fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q8N899|Q8NF66|Q9BYP5|Q9BYP6	Frame_Shift_Ins	INS	ENST00000336431.5	37	CCDS13242.2																																																																																				0.688	GGT7-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000078816.2	NM_178026	
SYNGR1	9145	broad.mit.edu	37	22	39777835	39777836	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr22:39777835_39777836insC	ENST00000328933.5	+	4	633_634	c.618_619insC	c.(619-621)cccfs	p.P207fs		NM_004711.4	NP_004702.2	O43759	SNG1_HUMAN	synaptogyrin 1	207					protein targeting (GO:0006605)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle membrane (GO:0030672)				endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|skin(1)	7	Melanoma(58;0.04)					CTGGGCCGGATCCCGCCGGTAT	0.673																																						.											0																																										SO:0001589	frameshift_variant	9145			AJ002303	CCDS13989.1, CCDS13990.1, CCDS13991.1	22q13	2008-06-10			ENSG00000100321	ENSG00000100321			11498	protein-coding gene	gene with protein product		603925				9760194, 10595519	Standard	NM_004711		Approved			O43759	OTTHUMG00000030978	ENST00000328933.5:c.621dupC	22.37:g.39777838_39777838dupC	ENSP00000332287:p.Pro207fs	Somatic		WXS	Illumina HiSeq	Phase_I	A6NP69|A8K0E2|O43757|O43758|Q53Y02|Q96J56|Q9UGZ4	Frame_Shift_Ins	INS	ENST00000328933.5	37	CCDS13989.1																																																																																				0.673	SYNGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075866.2	NM_004711	
ACKR4	51554	broad.mit.edu	37	3	132320028	132320029	+	Frame_Shift_Ins	INS	-	-	G	rs142433574	byFrequency	TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr3:132320028_132320029insG	ENST00000249887.2	+	2	883_884	c.787_788insG	c.(787-789)cgafs	p.R263fs	ACAD11_ENST00000545291.1_Intron|ACAD11_ENST00000264990.6_Intron|ACAD11_ENST00000355458.3_Intron	NM_016557.2|NM_178445.2	NP_057641.1|NP_848540.1	Q9NPB9	ACKR4_HUMAN	atypical chemokine receptor 4	263					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)|scavenger receptor activity (GO:0005044)										CAAGTTCTGCCGAGCCATAGAC	0.446																																						.											0																																										SO:0001589	frameshift_variant	51554			AF110640	CCDS3075.1	3q22	2013-07-17	2013-07-16	2013-07-16	ENSG00000129048	ENSG00000129048		"""GPCR / Class A : Chemokine receptors : Atypical"""	1611	protein-coding gene	gene with protein product		606065	"""chemokine (C-C motif) receptor-like 1"""	CCRL1		10767544, 16148	Standard	NM_016557		Approved	CCR11, CCBP2, VSHK1, CCX-CKR, PPR1	uc003eow.3	Q9NPB9	OTTHUMG00000159768	ENST00000249887.2:c.788dupG	3.37:g.132320029_132320029dupG	ENSP00000249887:p.Arg263fs	Somatic		WXS	Illumina HiSeq	Phase_I	B2R9U7	Frame_Shift_Ins	INS	ENST00000249887.2	37	CCDS3075.1																																																																																				0.446	ACKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357238.2	NM_016557	
RIPPLY2	134701	broad.mit.edu	37	6	84567032	84567033	+	Frame_Shift_Ins	INS	-	-	A			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr6:84567032_84567033insA	ENST00000369689.1	+	4	462_463	c.311_312insA	c.(310-315)ccaattfs	p.I105fs	RIPPLY2_ENST00000369687.1_Frame_Shift_Ins_p.I47fs|CYB5R4_ENST00000369679.4_5'Flank|CYB5R4_ENST00000369681.5_5'Flank	NM_001009994.1	NP_001009994.1	Q5TAB7	RIPP2_HUMAN	ripply transcriptional repressor 2	105	Ripply homology domain. {ECO:0000255}.				bone morphogenesis (GO:0060349)|determination of left/right symmetry (GO:0007368)|Notch signaling pathway (GO:0007219)|ossification (GO:0001503)|post-anal tail morphogenesis (GO:0036342)|regulation of gene expression (GO:0010468)|somite rostral/caudal axis specification (GO:0032525)|somitogenesis (GO:0001756)	nucleus (GO:0005634)				large_intestine(2)|lung(4)|urinary_tract(1)	7						AAAAATTTTCCAATTCAAGCCA	0.297																																						.											0																																										SO:0001589	frameshift_variant	134701			BC130460	CCDS34493.1	6q14.2	2013-07-23	2013-07-23	2008-05-07	ENSG00000203877	ENSG00000203877			21390	protein-coding gene	gene with protein product		609891	"""chromosome 6 open reading frame 159"", ""ripply2 homolog (zebrafish)"""	C6orf159			Standard	NM_001009994		Approved	dJ237I15.1	uc003pke.3	Q5TAB7	OTTHUMG00000015117	ENST00000369689.1:c.313dupA	6.37:g.84567034_84567034dupA	ENSP00000358703:p.Ile105fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q5TAB6	Frame_Shift_Ins	INS	ENST00000369689.1	37	CCDS34493.1																																																																																				0.297	RIPPLY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041360.1	NM_001009994	
CBWD6	644019	broad.mit.edu	37	9	69256826	69256827	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr9:69256826_69256827insC	ENST00000377457.5	-	3	409_410	c.304_305insG	c.(304-306)gaafs	p.E102fs	CBWD6_ENST00000377441.1_Frame_Shift_Ins_p.E102fs|CBWD6_ENST00000377449.1_Frame_Shift_Ins_p.E66fs|CBWD6_ENST00000382399.4_Frame_Shift_Ins_p.E102fs	NM_001085457.1	NP_001078926.1	Q4V339	CBWD6_HUMAN	COBW domain containing 6	102							ATP binding (GO:0005524)			lung(4)	4						GTTTCTAAGTTCCAGCCACTCT	0.376																																						.											0																																										SO:0001589	frameshift_variant	644019				CCDS43827.1	9q13	2006-06-30			ENSG00000204790	ENSG00000204790			31978	protein-coding gene	gene with protein product							Standard	NM_001085457		Approved	OTTHUMG00000066820	uc004afj.4	Q4V339	OTTHUMG00000066820	ENST00000377457.5:c.305dupG	9.37:g.69256828_69256828dupC	ENSP00000366677:p.Glu102fs	Somatic		WXS	Illumina HiSeq	Phase_I		Frame_Shift_Ins	INS	ENST00000377457.5	37	CCDS43827.1																																																																																				0.376	CBWD6-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143172.2	XM_928822	
C17orf98	388381	ucsc.edu	37	17	36997606	36997606	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr17:36997606T>C	ENST00000398575.4	-	1	102	c.37A>G	c.(37-39)Aaa>Gaa	p.K13E		NM_001080465.2	NP_001073934.1	A8MV24	CQ098_HUMAN	chromosome 17 open reading frame 98	13										endometrium(5)|kidney(1)|large_intestine(1)|lung(3)|pancreas(1)|prostate(3)	14						ATAAAGCCTTTCTCCAGTCGC	0.642																																						.											0													39.0	42.0	41.0					17																	36997606		2036	4204	6240	SO:0001583	missense	388381			AC006449, DY654789	CCDS42310.1	17q12	2014-05-06			ENSG00000214556	ENSG00000275489			34492	protein-coding gene	gene with protein product						16625196	Standard	NM_001080465		Approved	LOC388381	uc002hqv.2	A8MV24	OTTHUMG00000188506	ENST00000398575.4:c.37A>G	17.37:g.36997606T>C	ENSP00000381580:p.Lys13Glu	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000398575.4	37	CCDS42310.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.614500	0.87359	.	.	ENSG00000214556	ENST00000398575	T	0.48836	0.8	5.38	5.38	0.77491	.	0.000000	0.40469	U	0.001088	T	0.58264	0.2110	L	0.43152	1.355	0.40513	D	0.980755	D	0.71674	0.998	D	0.63488	0.915	T	0.62343	-0.6874	10	0.72032	D	0.01	-21.4557	13.3941	0.60840	0.0:0.0:0.0:1.0	.	13	A8MV24	CQ098_HUMAN	E	13	ENSP00000381580:K13E	ENSP00000381580:K13E	K	-	1	0	C17orf98	34251132	0.998000	0.40836	0.969000	0.41365	0.909000	0.53808	4.928000	0.63447	2.263000	0.75096	0.379000	0.24179	AAA		0.642	C17orf98-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255469.2	NM_001080465	
CHAT	1103	ucsc.edu	37	10	50827861	50827861	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr10:50827861A>G	ENST00000337653.2	+	3	631	c.478A>G	c.(478-480)Agg>Ggg	p.R160G	CHAT_ENST00000351556.3_Missense_Mutation_p.R42G|CHAT_ENST00000455728.2_Missense_Mutation_p.R42G|CHAT_ENST00000395562.2_Missense_Mutation_p.R78G|CHAT_ENST00000395559.2_Missense_Mutation_p.R42G|CHAT_ENST00000460699.1_3'UTR|CHAT_ENST00000339797.1_Missense_Mutation_p.R42G	NM_001142929.1|NM_020549.4	NP_001136401.1|NP_065574	P28329	CLAT_HUMAN	choline O-acetyltransferase	160					adult walking behavior (GO:0007628)|dendrite development (GO:0016358)|establishment of synaptic specificity at neuromuscular junction (GO:0007529)|glycerophospholipid biosynthetic process (GO:0046474)|muscle organ development (GO:0007517)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|rhythmic behavior (GO:0007622)|rhythmic excitation (GO:0043179)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	choline O-acetyltransferase activity (GO:0004102)			central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(11)|lung(34)|prostate(3)|urinary_tract(1)	56		all_neural(218;0.107)		GBM - Glioblastoma multiforme(2;0.000585)	Choline(DB00122)|Nicotine(DB00184)	GGAGCAGTTCAGGAAGAGCCA	0.632																																						.											0													44.0	40.0	41.0					10																	50827861		2203	4300	6503	SO:0001583	missense	1103			AF305907	CCDS7232.1, CCDS7233.1, CCDS44389.1	10q11.2	2010-05-11	2010-05-11		ENSG00000070748	ENSG00000070748	2.3.1.6		1912	protein-coding gene	gene with protein product		118490	"""choline acetyltransferase"""			1840566	Standard	NM_020984		Approved		uc001jhz.2	P28329	OTTHUMG00000018198	ENST00000337653.2:c.478A>G	10.37:g.50827861A>G	ENSP00000337103:p.Arg160Gly	Somatic		WXS	Illumina HiSeq	Phase_I	A2BDF4|A2BDF5|Q16488|Q9BQ23|Q9BQ35|Q9BQE1	Missense_Mutation	SNP	ENST00000337653.2	37	CCDS7232.1	.	.	.	.	.	.	.	.	.	.	A	8.218	0.801776	0.16397	.	.	ENSG00000070748	ENST00000339797;ENST00000351556;ENST00000395559;ENST00000337653;ENST00000395562;ENST00000455728	D;D;D;D;D;D	0.89746	-2.56;-2.56;-2.56;-2.56;-2.56;-2.56	5.09	-4.98	0.03019	.	0.478897	0.22326	N	0.061530	D	0.82554	0.5062	L	0.39898	1.24	0.25002	N	0.991467	B;B	0.32409	0.016;0.37	B;B	0.29785	0.036;0.107	T	0.65907	-0.6054	10	0.42905	T	0.14	-7.1764	19.9976	0.97389	0.2201:0.7798:0.0:0.0	.	42;160	F8W8I2;P28329	.;CLAT_HUMAN	G	42;42;42;160;78;42	ENSP00000343486:R42G;ENSP00000345878:R42G;ENSP00000378926:R42G;ENSP00000337103:R160G;ENSP00000378929:R78G;ENSP00000390521:R42G	ENSP00000337103:R160G	R	+	1	2	CHAT	50497867	0.001000	0.12720	0.308000	0.25141	0.027000	0.11550	0.124000	0.15728	-0.730000	0.04869	-0.648000	0.03929	AGG		0.632	CHAT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047997.1	NM_020549	
ZBTB48	3104	ucsc.edu;bcgsc.ca	37	1	6641321	6641321	+	Nonsense_Mutation	SNP	G	G	T			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr1:6641321G>T	ENST00000377674.4	+	2	810	c.652G>T	c.(652-654)Gag>Tag	p.E218*		NM_001278647.1|NM_001278648.1|NM_005341.2	NP_001265576.1|NP_001265577.1|NP_005332.1	P10074	ZBT48_HUMAN	zinc finger and BTB domain containing 48	218					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(1)|large_intestine(1)|liver(2)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	11	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;7.39e-28)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;1.35e-07)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(304;0.00109)|STAD - Stomach adenocarcinoma(132;0.017)|READ - Rectum adenocarcinoma(331;0.0642)		AAGGCCCTTAGAGGCTGAAGG	0.572																																					Esophageal Squamous(125;1449 1657 4031 29866 49542)	.											0													26.0	28.0	27.0					1																	6641321		2203	4298	6501	SO:0001587	stop_gained	3104			BC013573	CCDS84.1	1p36.3	2013-01-08	2006-09-20	2006-09-20	ENSG00000204859	ENSG00000204859		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	4930	protein-coding gene	gene with protein product		165270	"""GLI-Kruppel family member HKR3"""	HKR3		2850480, 8661141	Standard	NM_001278647		Approved	ZNF855	uc001anx.3	P10074	OTTHUMG00000001438	ENST00000377674.4:c.652G>T	1.37:g.6641321G>T	ENSP00000366902:p.Glu218*	Somatic		WXS	Illumina HiSeq	Phase_I	Q5SY19	Nonsense_Mutation	SNP	ENST00000377674.4	37	CCDS84.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.586826	0.86851	.	.	ENSG00000204859	ENST00000319084;ENST00000435905;ENST00000377674	.	.	.	5.74	3.54	0.40534	.	0.441142	0.25247	N	0.032043	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	-23.3543	8.1099	0.30909	0.0952:0.1648:0.74:0.0	.	.	.	.	X	218	.	ENSP00000313416:E218X	E	+	1	0	ZBTB48	6563908	0.123000	0.22298	0.922000	0.36590	0.540000	0.34992	0.465000	0.22004	1.423000	0.47198	-0.150000	0.13652	GAG		0.572	ZBTB48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004193.1	NM_005341	
COL11A1	1301	ucsc.edu	37	1	103453264	103453264	+	Silent	SNP	T	T	C			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr1:103453264T>C	ENST00000370096.3	-	30	2739	c.2427A>G	c.(2425-2427)gaA>gaG	p.E809E	COL11A1_ENST00000358392.2_Silent_p.E821E|COL11A1_ENST00000353414.4_Silent_p.E770E|COL11A1_ENST00000512756.1_Silent_p.E693E	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	809	Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		CAGGGCCATCTTCCCCTCTTG	0.453																																						.											0													89.0	85.0	86.0					1																	103453264		2203	4300	6503	SO:0001819	synonymous_variant	1301			J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.2427A>G	1.37:g.103453264T>C		Somatic		WXS	Illumina HiSeq	Phase_I	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Silent	SNP	ENST00000370096.3	37	CCDS778.1	.	.	.	.	.	.	.	.	.	.	T	5.986	0.365772	0.11352	.	.	ENSG00000060718	ENST00000370090	.	.	.	4.4	0.842	0.18927	.	.	.	.	.	T	0.41213	0.1149	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.30090	-0.9990	5	0.31617	T	0.26	.	8.997	0.36059	0.0:0.2321:0.0:0.7679	.	.	.	.	R	24	.	ENSP00000359108:K24R	K	-	2	0	COL11A1	103225852	1.000000	0.71417	1.000000	0.80357	0.623000	0.37688	1.409000	0.34680	0.303000	0.22785	0.383000	0.25322	AAG		0.453	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	
ALG9	79796	mdanderson.org	37	11	111657129	111657129	+	Missense_Mutation	SNP	C	C	T	rs370840671		TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr11:111657129C>T	ENST00000531154.1	-	15	1808	c.1336G>A	c.(1336-1338)Gga>Aga	p.G446R	ALG9_ENST00000527228.1_5'UTR|ALG9_ENST00000524880.1_3'UTR|ALG9_ENST00000398006.2_Missense_Mutation_p.G439R	NM_024740.2	NP_079016.2	Q9H6U8	ALG9_HUMAN	ALG9, alpha-1,2-mannosyltransferase	610					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	dol-P-Man:Man(6)GlcNAc(2)-PP-Dol alpha-1,2-mannosyltransferase activity (GO:0052926)|dol-P-Man:Man(8)GlcNAc(2)-PP-Dol alpha-1,2-mannosyltransferase activity (GO:0052918)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;6.81e-07)|BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|all cancers(92;1.3e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0587)		TGCTAACCTCCACTTTTCTTC	0.468																																						.											0								C	ARG/GLY,ARG/GLY,ARG/GLY,ARG/GLY	0,3976		0,0,1988	277.0	272.0	274.0		1829,1336,1315,1850	3.9	1.0	11		274	1,8321		0,1,4160	no	missense,missense,missense,missense	ALG9	NM_001077690.1,NM_001077691.1,NM_001077692.1,NM_024740.2	125,125,125,125	0,1,6148	TT,TC,CC		0.012,0.0,0.0081	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	610/612,446/448,439/441,617/619	111657129	1,12297	1988	4161	6149	SO:0001583	missense	79796				CCDS41714.1, CCDS53709.1, CCDS73379.1, CCDS73380.1	11q23	2013-02-26	2013-02-26	2004-08-26	ENSG00000086848	ENSG00000086848	2.4.1.259, 2.4.1.261	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	15672	protein-coding gene	gene with protein product	"""dolichyl-P-Man:Man(6)GlcNAc(2)-PP-dolichol alpha-1,2-mannosyltransferase"", ""dolichyl-P-Man:Man(8)GlcNAc(2)-PP-dolichol alpha-1,2-mannosyltransferase"", ""dol-P-Man dependent alpha-1,2-mannosyltransferase"""	606941	"""disrupted in bipolar affective disorder 1"", ""asparagine-linked glycosylation 9 homolog (yeast, alpha 1,2 mannosyltransferase)"", ""asparagine-linked glycosylation 9, alpha- 1,2-mannosyltransferase homolog (S. cerevisiae, alpha- 1,2-mannosyltransferase)"", ""asparagine-linked glycosylation 9, alpha-1,2-mannosyltransferase homolog (S. cerevisiae)"""	DIBD1		12030331, 15148656	Standard	NM_024740		Approved		uc021qql.1	Q9H6U8	OTTHUMG00000166819	ENST00000531154.1:c.1336G>A	11.37:g.111657129C>T	ENSP00000435517:p.Gly446Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q6ZMD5|Q7Z4R4|Q96GS7|Q96PB9|Q9H068	Missense_Mutation	SNP	ENST00000531154.1	37	CCDS41714.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.005992	0.74932	0.0	1.2E-4	ENSG00000086848	ENST00000531154;ENST00000398006;ENST00000428306	T;T	0.14022	2.54;2.54	5.87	3.9	0.45041	.	0.229782	0.45867	N	0.000334	T	0.11367	0.0277	N	0.22421	0.69	0.39048	D	0.960263	P;B	0.48016	0.904;0.005	P;B	0.45829	0.494;0.008	T	0.06110	-1.0845	10	0.72032	D	0.01	-6.6827	8.4076	0.32625	0.1537:0.767:0.0:0.0793	.	617;610	Q9H6U8-3;Q9H6U8	.;ALG9_HUMAN	R	446;439;843	ENSP00000435517:G446R;ENSP00000381090:G439R	ENSP00000381090:G439R	G	-	1	0	ALG9	111162339	0.938000	0.31826	0.987000	0.45799	0.996000	0.88848	2.670000	0.46833	1.633000	0.50488	0.655000	0.94253	GGA		0.468	ALG9-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000391485.1	NM_024740	
AQP12A	375318	mdanderson.org	37	2	241631668	241631668	+	Silent	SNP	T	T	C	rs4343462	byFrequency	TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr2:241631668T>C	ENST00000337801.4	+	2	370	c.301T>C	c.(301-303)Ttg>Ctg	p.L101L	AC011298.2_ENST00000407635.2_lincRNA|AQP12A_ENST00000429564.1_Silent_p.L113L	NM_198998.2	NP_945349.1	Q8IXF9	AQ12A_HUMAN	aquaporin 12A	101						integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			endometrium(2)|kidney(3)|large_intestine(2)|lung(7)	14		all_epithelial(40;7.49e-12)|Breast(86;0.000148)|Renal(207;0.00571)|Ovarian(221;0.104)|all_neural(83;0.107)|all_hematologic(139;0.182)|all_lung(227;0.186)|Melanoma(123;0.238)		Epithelial(32;2.2e-31)|all cancers(36;1.08e-28)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.52e-06)|Lung(119;0.00163)|LUSC - Lung squamous cell carcinoma(224;0.008)|Colorectal(34;0.0124)|COAD - Colon adenocarcinoma(134;0.0757)		TGGCACGCTGTTGAAGCTGGC	0.682													N|||	46	0.0091853	0.0295	0.0058	5008	,	,		13571	0.002		0.001	False		,,,				2504	0.0					.											0										55,4087		4,47,2020	26.0	36.0	33.0		301	1.6	0.8	2	dbSNP_111	33	6,8504		0,6,4249	no	coding-synonymous	AQP12A	NM_198998.1		4,53,6269	CC,CT,TT		0.0705,1.3279,0.4821		101/296	241631668	61,12591	2071	4255	6326	SO:0001819	synonymous_variant	375318			AB040748		2q37.3	2013-06-03	2005-05-26	2005-05-26	ENSG00000184945	ENSG00000184945		"""Ion channels / Aquaporins"""	19941	protein-coding gene	gene with protein product		609789	"""aquaporin 12"""	AQP12			Standard	NM_198998		Approved		uc002vzu.3	Q8IXF9	OTTHUMG00000183906	ENST00000337801.4:c.301T>C	2.37:g.241631668T>C		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000337801.4	37																																																																																					0.682	AQP12A-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000257185.2	NM_198998	
AQP7	364	mdanderson.org	37	9	33385815	33385815	+	Missense_Mutation	SNP	T	T	C	rs62542745		TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr9:33385815T>C	ENST00000537089.1	-	6	617	c.299A>G	c.(298-300)cAg>cGg	p.Q100R	AQP7_ENST00000377425.4_Missense_Mutation_p.Q135R|AQP7_ENST00000539936.1_Missense_Mutation_p.Q192R|AQP7_ENST00000541274.1_Silent_p.P60P			O14520	AQP7_HUMAN	aquaporin 7	192					excretion (GO:0007588)|generation of precursor metabolites and energy (GO:0006091)|glycerol transport (GO:0015793)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glycerol channel activity (GO:0015254)|water channel activity (GO:0015250)			NS(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(4)|skin(2)|stomach(1)	17			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		GTTGTTCTCCTGGTCCGTGAT	0.612																																						.											0													123.0	107.0	113.0					9																	33385815		2203	4300	6503	SO:0001583	missense	364			AB006190	CCDS6541.1	9p13	2008-02-05			ENSG00000165269	ENSG00000165269		"""Ion channels / Aquaporins"""	640	protein-coding gene	gene with protein product		602974		AQP7L		9252401	Standard	NM_001170		Approved	AQP9, AQPap	uc003zst.3	O14520	OTTHUMG00000019773	ENST00000537089.1:c.299A>G	9.37:g.33385815T>C	ENSP00000441619:p.Gln100Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q08E94|Q5T5L9|Q8NHM3	Missense_Mutation	SNP	ENST00000537089.1	37		.	.	.	.	.	.	.	.	.	.	t	2.177	-0.388519	0.04932	.	.	ENSG00000165269	ENST00000537089;ENST00000379507;ENST00000447660;ENST00000297988;ENST00000377425;ENST00000439678;ENST00000379506;ENST00000539936;ENST00000379503	D;D;D;D;D;D;D;D;D	0.85013	-1.93;-1.93;-1.93;-1.93;-1.93;-1.93;-1.93;-1.93;-1.93	5.02	3.85	0.44370	Aquaporin-like (2);	0.260173	0.44483	D	0.000447	T	0.69360	0.3102	N	0.20483	0.58	0.09310	N	1	B;B;B;B	0.14012	0.001;0.001;0.001;0.009	B;B;B;B	0.17098	0.006;0.006;0.01;0.017	T	0.51260	-0.8728	10	0.13853	T	0.58	-14.4887	4.9508	0.14013	0.0:0.0932:0.1892:0.7176	rs62542745	191;192;135;192	Q5T5M0;B7Z4U2;Q6P5T0;O14520	.;.;.;AQP7_HUMAN	R	100;191;60;192;135;100;191;192;128	ENSP00000441619:Q100R;ENSP00000368821:Q191R;ENSP00000412868:Q60R;ENSP00000297988:Q192R;ENSP00000396111:Q135R;ENSP00000410138:Q100R;ENSP00000368820:Q191R;ENSP00000439534:Q192R;ENSP00000368817:Q128R	ENSP00000297988:Q192R	Q	-	2	0	AQP7	33375815	0.007000	0.16637	0.339000	0.25562	0.162000	0.22319	0.341000	0.19909	0.903000	0.36546	0.524000	0.50904	CAG		0.612	AQP7-202	KNOWN	basic	protein_coding	protein_coding		NM_001170	
ATXN1	6310	mdanderson.org	37	6	16327903	16327903	+	Missense_Mutation	SNP	C	C	A	rs3817753		TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr6:16327903C>A	ENST00000244769.4	-	8	1575	c.639G>T	c.(637-639)caG>caT	p.Q213H	ATXN1_ENST00000436367.1_Missense_Mutation_p.Q213H	NM_000332.3	NP_000323.2	P54253	ATX1_HUMAN	ataxin 1	213	Poly-Gln.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|nuclear export (GO:0051168)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear inclusion body (GO:0042405)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|protein self-association (GO:0043621)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|lung(12)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)	44	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				gctgctgctgctgctgatgct	0.667																																						.											0													5.0	8.0	7.0					6																	16327903		1624	3504	5128	SO:0001583	missense	6310			X79204	CCDS34342.1	6p23	2014-09-17	2004-08-12	2004-08-13	ENSG00000124788	ENSG00000124788		"""Ataxins"""	10548	protein-coding gene	gene with protein product		601556	"""spinocerebellar ataxia 1 (olivopontocerebellar ataxia 1, autosomal dominant, ataxin 1)"""	SCA1		1582256	Standard	NM_000332		Approved	D6S504E, ATX1	uc010jpi.3	P54253	OTTHUMG00000014303	ENST00000244769.4:c.639G>T	6.37:g.16327903C>A	ENSP00000244769:p.Gln213His	Somatic		WXS	Illumina HiSeq	Phase_I	Q17S02|Q9UJG2|Q9Y4J1	Missense_Mutation	SNP	ENST00000244769.4	37	CCDS34342.1	221	0.10119047619047619	38	0.07723577235772358	47	0.1298342541436464	89	0.1555944055944056	47	0.06200527704485488	C	4.787	0.146322	0.09134	.	.	ENSG00000124788	ENST00000244769;ENST00000450222;ENST00000436367	T;T	0.62941	-0.01;-0.01	.	.	.	.	.	.	.	.	T	0.18676	0.0448	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.19582	-1.0301	5	0.45353	T	0.12	.	.	.	.	rs3817753	213	P54253	ATX1_HUMAN	H	213	ENSP00000244769:Q213H;ENSP00000416360:Q213H	ENSP00000244769:Q213H	Q	-	3	2	ATXN1	16435882	0.034000	0.19679	0.018000	0.16275	0.072000	0.16883	0.306000	0.19279	0.000000	0.14550	0.000000	0.15137	CAG		0.667	ATXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039943.3	NM_000332	
BDNF	627	mdanderson.org	37	11	27681197	27681197	+	5'UTR	SNP	C	C	T	rs4030470|rs112614050|rs376982344|rs200712840|rs202011320	byFrequency	TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr11:27681197C>T	ENST00000525528.1	-	0	8				BDNF_ENST00000533131.1_Intron|BDNF_ENST00000395983.3_Intron|BDNF_ENST00000532997.1_Intron|BDNF-AS_ENST00000502161.2_RNA|BDNF_ENST00000418212.1_Intron|BDNF-AS_ENST00000530313.1_RNA|BDNF-AS_ENST00000499568.2_RNA|BDNF_ENST00000395978.3_Intron|BDNF_ENST00000530861.1_Intron|BDNF_ENST00000314915.6_Intron|BDNF_ENST00000439476.2_5'UTR|BDNF_ENST00000395980.2_Intron|BDNF-AS_ENST00000500662.2_RNA|BDNF_ENST00000395986.2_Intron|BDNF_ENST00000438929.1_Intron|BDNF-AS_ENST00000530686.1_RNA|BDNF-AS_ENST00000532965.1_RNA|BDNF_ENST00000356660.4_Intron|BDNF_ENST00000533246.1_Intron|BDNF_ENST00000395981.3_Intron|BDNF_ENST00000420794.1_Intron|BDNF-AS_ENST00000501176.2_RNA|BDNF_ENST00000525950.1_Intron|BDNF_ENST00000584049.1_Intron|BDNF-AS_ENST00000499008.3_RNA	NM_170735.5	NP_733931.1	P23560	BDNF_HUMAN	brain-derived neurotrophic factor						axon extension (GO:0048675)|axon guidance (GO:0007411)|axon target recognition (GO:0007412)|behavioral fear response (GO:0001662)|chronic inflammatory response (GO:0002544)|circadian rhythm (GO:0007623)|dendrite development (GO:0016358)|dendrite extension (GO:0097484)|feeding behavior (GO:0007631)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glutamate secretion (GO:0014047)|inner ear development (GO:0048839)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|nerve development (GO:0021675)|nervous system development (GO:0007399)|neuron recognition (GO:0008038)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of synapse assembly (GO:0051965)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of retinal cell programmed cell death (GO:0046668)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|response to anesthetic (GO:0072347)|response to fluoxetine (GO:0014076)|response to hormone (GO:0009725)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to vitamin A (GO:0033189)|taste bud development (GO:0061193)|ureteric bud development (GO:0001657)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	growth factor activity (GO:0008083)			breast(1)|large_intestine(3)|lung(2)	6						tgtgtgtgtgcgcgcgcgcgt	0.438													T|||	2464	0.492013	0.618	0.5303	5008	,	,		15382	0.4772		0.4324	False		,,,				2504	0.3712					.											0																																										SO:0001623	5_prime_UTR_variant	497258			AB038670	CCDS7865.1, CCDS7866.1, CCDS44558.1, CCDS41628.1	11p14.1	2014-01-30			ENSG00000176697	ENSG00000176697		"""Endogenous ligands"""	1033	protein-coding gene	gene with protein product	"""neurotrophin"""	113505				2236018, 1889806, 17942328, 17493809	Standard	NM_170731		Approved		uc009yje.3	P23560	OTTHUMG00000178797	ENST00000525528.1:c.-1086G>A	11.37:g.27681197C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A7LA85|A7LA92|D3DQZ2|Q598Q1|Q6DN19|Q6YNR2|Q6YNR3|Q9BYY7|Q9UC24	RNA	SNP	ENST00000525528.1	37	CCDS7866.1																																																																																				0.438	BDNF-016	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388135.1	NM_170735	
CCDC144NL	339184	mdanderson.org	37	17	20768816	20768816	+	Missense_Mutation	SNP	C	C	T	rs73298040	byFrequency	TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr17:20768816C>T	ENST00000327925.5	-	4	697	c.578G>A	c.(577-579)tGt>tAt	p.C193Y	CCDC144NL_ENST00000539484.1_5'UTR|RP11-344E13.3_ENST00000577537.1_RNA|RP11-344E13.3_ENST00000439794.2_RNA	NM_001004306.1	NP_001004306.1	Q6NUI1	C144L_HUMAN	coiled-coil domain containing 144 family, N-terminal like	193										large_intestine(3)|lung(3)|skin(1)	7						ATGCAGATGACAATACTCTTG	0.363																																						.											0													75.0	69.0	71.0					17																	20768816		2203	4300	6503	SO:0001583	missense	339184				CCDS32591.1	17p11.2	2009-01-15			ENSG00000205212	ENSG00000205212			33735	protein-coding gene	gene with protein product							Standard	NM_001004306		Approved	MGC87631	uc002gyf.3	Q6NUI1	OTTHUMG00000132271	ENST00000327925.5:c.578G>A	17.37:g.20768816C>T	ENSP00000328054:p.Cys193Tyr	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000327925.5	37	CCDS32591.1	.	.	.	.	.	.	.	.	.	.	c	0.024	-1.390208	0.01185	.	.	ENSG00000205212	ENST00000327925	T	0.18502	2.21	.	.	.	.	.	.	.	.	T	0.11879	0.0289	N	0.08118	0	0.09310	N	1	P	0.42518	0.782	P	0.48738	0.588	T	0.23476	-1.0187	7	0.87932	D	0	.	.	.	.	.	193	Q6NUI1	C144L_HUMAN	Y	193	ENSP00000328054:C193Y	ENSP00000328054:C193Y	C	-	2	0	CCDC144NL	20709408	0.181000	0.23161	0.041000	0.18516	0.041000	0.13682	0.076000	0.14712	0.088000	0.17205	0.089000	0.15464	TGT		0.363	CCDC144NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255361.2	NM_001004306	
CDC27	996	mdanderson.org	37	17	45214527	45214527	+	Missense_Mutation	SNP	T	T	C	rs62075618|rs200720095	byFrequency	TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr17:45214527T>C	ENST00000066544.3	-	14	1997	c.1904A>G	c.(1903-1905)tAt>tGt	p.Y635C	CDC27_ENST00000527547.1_Missense_Mutation_p.Y634C|CDC27_ENST00000531206.1_Missense_Mutation_p.Y641C|CDC27_ENST00000446365.2_Missense_Mutation_p.Y574C	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	635					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						CCATGCATTATAATGTCTAGG	0.338																																						.											0													35.0	35.0	35.0					17																	45214527		2203	4300	6503	SO:0001583	missense	996			U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.1904A>G	17.37:g.45214527T>C	ENSP00000066544:p.Tyr635Cys	Somatic		WXS	Illumina HiSeq	Phase_I	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	T	29.4	5.004463	0.93287	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547	T;T;T;T	0.59502	0.26;0.26;0.26;0.26	5.98	5.98	0.97165	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.80798	0.4692	H	0.96943	3.91	0.09310	P	0.999999999633698	D;D;D;D	0.59357	0.985;0.982;0.982;0.969	P;P;P;P	0.56042	0.79;0.753;0.753;0.727	D	0.88807	0.3289	9	0.87932	D	0	-24.5847	14.4087	0.67101	0.0:0.0:0.0:1.0	rs62075618	574;634;641;635	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	C	635;641;574;634	ENSP00000066544:Y635C;ENSP00000434614:Y641C;ENSP00000392802:Y574C;ENSP00000437339:Y634C	ENSP00000066544:Y635C	Y	-	2	0	CDC27	42569526	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.308000	0.72820	2.293000	0.77203	0.477000	0.44152	TAT		0.338	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
DOCK2	1794	mdanderson.org	37	5	169504743	169504743	+	Silent	SNP	T	T	C	rs1045168	byFrequency	TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr5:169504743T>C	ENST00000256935.8	+	48	4976	c.4896T>C	c.(4894-4896)cgT>cgC	p.R1632R	DOCK2_ENST00000540750.1_Silent_p.R693R|DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000520908.1_Silent_p.R1124R	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1632					actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)	p.R1632R(1)		NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GAGTGGGCCGTCCCAGGTCTA	0.577													C|||	1458	0.291134	0.3782	0.2579	5008	,	,		15757	0.1071		0.334	False		,,,				2504	0.3425					.											1	Substitution - coding silent(1)	stomach(1)						C		1660,2746	658.5+/-400.4	303,1054,846	132.0	119.0	124.0		4896	-5.4	0.9	5	dbSNP_86	124	2650,5950	685.7+/-404.1	414,1822,2064	no	coding-synonymous	DOCK2	NM_004946.2		717,2876,2910	CC,CT,TT		30.814,37.6759,33.1386		1632/1831	169504743	4310,8696	2203	4300	6503	SO:0001819	synonymous_variant	1794			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.4896T>C	5.37:g.169504743T>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q2M3I0|Q96AK7	Silent	SNP	ENST00000256935.8	37	CCDS4371.1																																																																																				0.577	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946	
ETFDH	2110	mdanderson.org	37	4	159601752	159601752	+	Silent	SNP	A	A	G			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr4:159601752A>G	ENST00000511912.1	+	2	500	c.168A>G	c.(166-168)agA>agG	p.R56R	ETFDH_ENST00000307738.5_Intron	NM_001281738.1|NM_004453.2	NP_001268667.1|NP_004444.2	Q16134	ETFD_HUMAN	electron-transferring-flavoprotein dehydrogenase	56					cellular metabolic process (GO:0044237)|electron transport chain (GO:0022900)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|respiratory electron transport chain (GO:0022904)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	integral component of mitochondrial inner membrane (GO:0031305)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)	4 iron, 4 sulfur cluster binding (GO:0051539)|electron carrier activity (GO:0009055)|electron-transferring-flavoprotein dehydrogenase activity (GO:0004174)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)|oxidoreductase activity, oxidizing metal ions with flavin as acceptor (GO:0043783)|quinone binding (GO:0048038)|ubiquinone binding (GO:0048039)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(13)|prostate(1)|skin(3)	28	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0172)		AGGACAAGAGATGGGAAGGTA	0.333																																						.											0													102.0	97.0	99.0					4																	159601752		2203	4298	6501	SO:0001819	synonymous_variant	2110			S69232	CCDS3800.1, CCDS64090.1	4q32-q35	2008-08-26			ENSG00000171503	ENSG00000171503			3483	protein-coding gene	gene with protein product		231675					Standard	NM_004453		Approved	ETFQO	uc003iqb.3	Q16134	OTTHUMG00000161684	ENST00000511912.1:c.168A>G	4.37:g.159601752A>G		Somatic		WXS	Illumina HiSeq	Phase_I	B4E3R9|J3KND9|Q7Z347	Silent	SNP	ENST00000511912.1	37	CCDS3800.1	.	.	.	.	.	.	.	.	.	.	A	12.94	2.089012	0.36855	.	.	ENSG00000171503	ENST00000512251	.	.	.	5.54	3.05	0.35203	.	.	.	.	.	T	0.64000	0.2559	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.63296	-0.6669	5	0.87932	D	0	-20.4541	8.1689	0.31243	0.7941:0.1352:0.0707:0.0	.	.	.	.	G	36	.	ENSP00000425661:D36G	D	+	2	0	ETFDH	159821202	1.000000	0.71417	0.998000	0.56505	0.940000	0.58332	3.251000	0.51453	0.456000	0.26937	0.482000	0.46254	GAT		0.333	ETFDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365718.2		
GJA1	2697	mdanderson.org	37	6	121769050	121769050	+	Silent	SNP	T	T	C			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr6:121769050T>C	ENST00000282561.3	+	2	1214	c.1057T>C	c.(1057-1059)Tta>Cta	p.L353L		NM_000165.3	NP_000156.1	P17302	CXA1_HUMAN	gap junction protein, alpha 1, 43kDa	353					adult heart development (GO:0007512)|apoptotic process (GO:0006915)|ATP transport (GO:0015867)|atrial cardiac muscle cell action potential (GO:0086014)|atrial ventricular junction remodeling (GO:0003294)|blood vessel morphogenesis (GO:0048514)|cell communication by chemical coupling (GO:0010643)|cell communication by electrical coupling (GO:0010644)|cell-cell signaling (GO:0007267)|cellular response to mechanical stimulus (GO:0071260)|chronic inflammatory response (GO:0002544)|embryonic digit morphogenesis (GO:0042733)|endothelium development (GO:0003158)|epithelial cell maturation (GO:0002070)|gap junction assembly (GO:0016264)|heart development (GO:0007507)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|lens development in camera-type eye (GO:0002088)|membrane organization (GO:0061024)|milk ejection (GO:0060156)|muscle contraction (GO:0006936)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of gene expression (GO:0010629)|neuron migration (GO:0001764)|neuron projection morphogenesis (GO:0048812)|osteoblast differentiation (GO:0001649)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of cell communication by chemical coupling (GO:0010652)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of gene expression (GO:0010628)|positive regulation of glomerular filtration (GO:0003104)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of striated muscle tissue development (GO:0045844)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein oligomerization (GO:0051259)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of bone mineralization (GO:0030500)|regulation of bone remodeling (GO:0046850)|regulation of calcium ion transport (GO:0051924)|regulation of tight junction assembly (GO:2000810)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to fluid shear stress (GO:0034405)|response to peptide hormone (GO:0043434)|response to pH (GO:0009268)|signal transduction (GO:0007165)|skeletal muscle tissue regeneration (GO:0043403)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vascular transport (GO:0010232)	apical plasma membrane (GO:0016324)|connexon complex (GO:0005922)|contractile fiber (GO:0043292)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|gap junction (GO:0005921)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle membrane (GO:0030660)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial outer membrane (GO:0005741)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)	gap junction channel activity (GO:0005243)|ion transmembrane transporter activity (GO:0015075)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(2)|large_intestine(10)|liver(2)|lung(13)|ovary(2)	33				GBM - Glioblastoma multiforme(226;0.00252)	Carvedilol(DB01136)	TGGACATGAATTACAGCCACT	0.522																																						.											0													54.0	60.0	58.0					6																	121769050		2199	4298	6497	SO:0001819	synonymous_variant	2697			BC026329	CCDS5123.1	6q22.31	2013-05-10	2007-01-16		ENSG00000152661	ENSG00000152661		"""Ion channels / Gap junction proteins (connexins)"""	4274	protein-coding gene	gene with protein product	"""oculodentodigital dysplasia (syndactyly type III)"", ""connexin 43"""	121014	"""gap junction protein, alpha-like"", ""gap junction protein, alpha 1, 43kDa (connexin 43)"""	ODDD, GJAL		10331943, 1646158	Standard	NM_000165		Approved	CX43, ODD, ODOD, SDTY3	uc003pyr.3	P17302	OTTHUMG00000015479	ENST00000282561.3:c.1057T>C	6.37:g.121769050T>C		Somatic		WXS	Illumina HiSeq	Phase_I	B2R5U9|Q6FHU1|Q9Y5I8	Silent	SNP	ENST00000282561.3	37	CCDS5123.1																																																																																				0.522	GJA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042023.1	NM_000165	
GOLGA8F	100132565	mdanderson.org	37	15	28632760	28632760	+	Missense_Mutation	SNP	G	G	A	rs560793621	byFrequency	TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr15:28632760G>A	ENST00000450328.2	+	14	1572	c.674G>A	c.(673-675)gGa>gAa	p.G225E	GOLGA8F_ENST00000337838.7_Intron|GOLGA8F_ENST00000526619.2_Missense_Mutation_p.G229E|GOLGA8F_ENST00000532622.2_Missense_Mutation_p.G443E|AC091304.1_ENST00000408123.1_RNA|RN7SL238P_ENST00000465782.2_RNA			Q08AF8	GOG8F_HUMAN	golgin A8 family, member F	225						Golgi apparatus (GO:0005794)				lung(4)	4						GATGGAGGAGGACATCTGGAC	0.617													g|||	189	0.0377396	0.1051	0.0115	5008	,	,		17562	0.0089		0.007	False		,,,				2504	0.0266					.											0													13.0	19.0	17.0					15																	28632760		609	1570	2179	SO:0001583	missense	100132565					15q13.1	2013-01-17	2010-02-12		ENSG00000153684	ENSG00000153684			32378	other	unknown			"""golgi autoantigen, golgin subfamily a, 8F"""			12477932	Standard	NR_033351		Approved	DKFZp434P162	uc010uag.1	Q08AF8	OTTHUMG00000167129	ENST00000450328.2:c.674G>A	15.37:g.28632760G>A	ENSP00000455253:p.Gly225Glu	Somatic		WXS	Illumina HiSeq	Phase_I	A4FTY1|Q1A5X9|Q8NDK0	RNA	SNP	ENST00000450328.2	37																																																																																					0.617	GOLGA8F-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NR_033351.1	
GPR112	139378	mdanderson.org	37	X	135431236	135431236	+	Missense_Mutation	SNP	T	T	C	rs5930932	byFrequency	TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chrX:135431236T>C	ENST00000394143.1	+	6	5662	c.5371T>C	c.(5371-5373)Ttt>Ctt	p.F1791L	GPR112_ENST00000287534.4_Missense_Mutation_p.F1728L|GPR112_ENST00000394141.1_Missense_Mutation_p.F1586L|GPR112_ENST00000370652.1_Missense_Mutation_p.F1791L|GPR112_ENST00000412101.1_Missense_Mutation_p.F1586L	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	1791			F -> L (in dbSNP:rs5930932).		G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.F1791L(1)		NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					CACCAATTGCTTTTCTTCTAA	0.383													c|||	1834	0.485828	0.4569	0.3617	3775	,	,		15609	0.2778		0.3797	False		,,,				2504	0.3241					.											1	Substitution - Missense(1)	prostate(1)							LEU/PHE	2257,1576		567,784,339,280,232	133.0	133.0	133.0		5371	-1.8	0.0	X	dbSNP_114	133	3229,3499		567,1181,914,680,958	yes	missense	GPR112	NM_153834.3	22	1134,1965,1253,960,1190	CC,CT,C,TT,T		47.9935,41.1166,48.0542	benign	1791/3081	135431236	5486,5075	2202	4300	6502	SO:0001583	missense	139378			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.5371T>C	X.37:g.135431236T>C	ENSP00000377699:p.Phe1791Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	37	CCDS35409.1	786	0.47377938517179025	152	0.4175824175824176	84	0.29577464788732394	112	0.24669603524229075	190	0.3242320819112628	c	0.020	-1.432654	0.01108	0.588834	0.479935	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.20463	2.11;2.11;2.07;2.25;2.07	3.63	-1.78	0.07957	.	.	.	.	.	T	0.00012	0.0000	N	0.01352	-0.895	0.80722	P	0.0	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.37291	-0.9712	8	0.21014	T	0.42	.	5.3382	0.15969	0.0:0.2802:0.1606:0.5593	rs5930932;rs6635265;rs52832481;rs60264923;rs5930932	1728;1586;1791	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	L	1791;1791;1586;1728;1586	ENSP00000377699:F1791L;ENSP00000359686:F1791L;ENSP00000416526:F1586L;ENSP00000287534:F1728L;ENSP00000377697:F1586L	ENSP00000287534:F1728L	F	+	1	0	GPR112	135258902	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.934000	0.03955	-1.013000	0.03383	-1.690000	0.00728	TTT		0.383	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1		
KCNA6	3742	mdanderson.org	37	12	4920387	4920387	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr12:4920387G>A	ENST00000280684.3	+	1	2046	c.1180G>A	c.(1180-1182)Gtc>Atc	p.V394I	RP11-234B24.4_ENST00000542988.1_lincRNA|KCNA6_ENST00000433855.1_Missense_Mutation_p.V394I			P17658	KCNA6_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 6	394					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|endometrium(5)|large_intestine(6)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(5)	49					Dalfampridine(DB06637)	CTCCAGTGCCGTCTACTTCGC	0.582										HNSCC(72;0.22)																												.											0													118.0	100.0	106.0					12																	4920387		2203	4300	6503	SO:0001583	missense	3742			X17622	CCDS8534.1	12p13	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6225	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 96"""	176257				16382104	Standard	NM_002235		Approved	Kv1.6, HBK2, PPP1R96	uc001qng.3	P17658		ENST00000280684.3:c.1180G>A	12.37:g.4920387G>A	ENSP00000280684:p.Val394Ile	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000280684.3	37	CCDS8534.1	.	.	.	.	.	.	.	.	.	.	G	19.48	3.836332	0.71373	.	.	ENSG00000151079	ENST00000433855;ENST00000280684	D;D	0.97303	-4.33;-4.33	5.18	5.18	0.71444	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.94555	0.8246	N	0.20304	0.555	0.58432	D	0.999999	P	0.50443	0.935	P	0.46362	0.514	D	0.94785	0.7957	10	0.48119	T	0.1	.	17.8587	0.88775	0.0:0.0:1.0:0.0	.	394	P17658	KCNA6_HUMAN	I	394	ENSP00000408321:V394I;ENSP00000280684:V394I	ENSP00000280684:V394I	V	+	1	0	KCNA6	4790648	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	9.495000	0.97964	2.688000	0.91661	0.655000	0.94253	GTC		0.582	KCNA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398909.1	NM_002235	
KRTAP4-9	100132386	mdanderson.org	37	17	39262096	39262096	+	Silent	SNP	C	C	T			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr17:39262096C>T	ENST00000391415.1	+	1	513	c.456C>T	c.(454-456)ccC>ccT	p.P152P		NM_001146041.1	NP_001139513.1	Q9BYQ8	KRA49_HUMAN	keratin associated protein 4-9	152	29 X 5 AA repeats of C-C-[RQVHIEK]- [SPTR]-[VSTQCRNP].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|urinary_tract(3)	14						gctgccgccccagctgcagca	0.672																																						.											0													5.0	8.0	7.0					17																	39262096		674	1562	2236	SO:0001819	synonymous_variant	100132386			AJ406941	CCDS54124.1	17q21.2	2013-06-25			ENSG00000212722	ENSG00000212722		"""Keratin associated proteins"""	18910	protein-coding gene	gene with protein product							Standard	NM_001146041		Approved	KAP4.9	uc010wfp.2	Q9BYQ8	OTTHUMG00000133584	ENST00000391415.1:c.456C>T	17.37:g.39262096C>T		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000391415.1	37	CCDS54124.1																																																																																				0.672	KRTAP4-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257688.1	NM_001146041	
KRTAP5-2	440021	mdanderson.org	37	11	1619368	1619368	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr11:1619368C>T	ENST00000412090.1	-	1	156	c.113G>A	c.(112-114)tGt>tAt	p.C38Y	KRTAP5-AS1_ENST00000532922.1_RNA|KRTAP5-AS1_ENST00000424148.1_RNA|KRTAP5-AS1_ENST00000524947.1_RNA|KRTAP5-AS1_ENST00000534077.1_RNA	NM_001004325.1	NP_001004325.1	Q701N4	KRA52_HUMAN	keratin associated protein 5-2	38						keratin filament (GO:0045095)				large_intestine(1)|lung(2)|skin(1)	4		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		GCCAGAGCCACAGCCCCCACG	0.687																																						.											0													31.0	39.0	36.0					11																	1619368		2173	4229	6402	SO:0001583	missense	440021			AB126071	CCDS31331.1	11p15.5	2008-02-05				ENSG00000205867		"""Keratin associated proteins"""	23597	protein-coding gene	gene with protein product						15144888	Standard	NM_001004325		Approved	KRTAP5.2, KRTAP5-8	uc001ltv.3	Q701N4		ENST00000412090.1:c.113G>A	11.37:g.1619368C>T	ENSP00000400041:p.Cys38Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	A9JTZ1	Missense_Mutation	SNP	ENST00000412090.1	37	CCDS31331.1	.	.	.	.	.	.	.	.	.	.	-	11.10	1.540016	0.27563	.	.	ENSG00000205867	ENST00000412090	T	0.01178	5.22	.	.	.	.	.	.	.	.	T	0.01800	0.0057	L	0.46157	1.445	0.21915	N	0.999477	.	.	.	.	.	.	T	0.45585	-0.9251	5	0.87932	D	0	.	.	.	.	.	38	Q701N4	KRA52_HUMAN	Y	38	ENSP00000400041:C38Y	ENSP00000400041:C38Y	C	-	2	0	KRTAP5-2	1575944	0.976000	0.34144	0.670000	0.29842	0.641000	0.38312	3.989000	0.56958	0.000000	0.14550	0.000000	0.15137	TGT		0.687	KRTAP5-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384775.1	NM_001004325	
KRTAP5-4	387267	mdanderson.org	37	11	1643246	1643246	+	Silent	SNP	A	A	G	rs142004120	byFrequency	TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr11:1643246A>G	ENST00000399682.1	-	1	122	c.78T>C	c.(76-78)tcT>tcC	p.S26S		NM_001012709.1	NP_001012727	Q6L8H1	KRA54_HUMAN	keratin associated protein 5-4	0						keratin filament (GO:0045095)				NS(1)|endometrium(9)|kidney(2)|lung(2)|pancreas(1)|prostate(3)|skin(2)	20		all_epithelial(84;0.00819)|Breast(177;0.00832)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ccccacagccagagccacagc	0.682													-|||	374	0.0746805	0.0908	0.0562	5008	,	,		7183	0.0923		0.0596	False		,,,				2504	0.0634					.											0													4.0	8.0	7.0					11																	1643246		639	1494	2133	SO:0001819	synonymous_variant	387267			AB126073		11p15.5	2012-04-19			ENSG00000241598	ENSG00000241598		"""Keratin associated proteins"""	23599	protein-coding gene	gene with protein product						15144888	Standard	NM_001012709		Approved	KRTAP5.4	uc009ycy.1	Q6L8H1	OTTHUMG00000057553	ENST00000399682.1:c.78T>C	11.37:g.1643246A>G		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000399682.1	37																																																																																					0.682	KRTAP5-4-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000127918.1	NM_001012709	
KRTAP5-10	387273	mdanderson.org	37	11	71276876	71276876	+	Silent	SNP	A	A	G	rs12788123		TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr11:71276876A>G	ENST00000398531.1	+	1	268	c.243A>G	c.(241-243)aaA>aaG	p.K81K	KRTAP5-10_ENST00000376536.4_Intron	NM_001012710.1	NP_001012728.1	Q6L8G5	KR510_HUMAN	keratin associated protein 5-10	81	7 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)		p.K81K(1)		endometrium(2)|large_intestine(1)|lung(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	12						GGGGCTCCAAAGGGGGCTGTG	0.682																																						.											1	Substitution - coding silent(1)	endometrium(1)											51.0	72.0	65.0					11																	71276876		2140	4257	6397	SO:0001819	synonymous_variant	387273			AB126079	CCDS41684.1	11q13.4	2008-02-05			ENSG00000204572	ENSG00000204572		"""Keratin associated proteins"""	23605	protein-coding gene	gene with protein product						15144888	Standard	NM_001012710		Approved	KRTAP5.10	uc001oqt.1	Q6L8G5	OTTHUMG00000057585	ENST00000398531.1:c.243A>G	11.37:g.71276876A>G		Somatic		WXS	Illumina HiSeq	Phase_I	B9EHA4	Silent	SNP	ENST00000398531.1	37	CCDS41684.1																																																																																				0.682	KRTAP5-10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000127968.2		
MUC16	94025	mdanderson.org	37	19	9065113	9065113	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr19:9065113T>C	ENST00000397910.4	-	3	22536	c.22333A>G	c.(22333-22335)Acc>Gcc	p.T7445A		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	7447	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GGTGAACTGGTTTCAGGTTCT	0.493																																						.											0													161.0	148.0	152.0					19																	9065113		1980	4172	6152	SO:0001583	missense	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.22333A>G	19.37:g.9065113T>C	ENSP00000381008:p.Thr7445Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	N	6.007	0.369713	0.11352	.	.	ENSG00000181143	ENST00000397910	T	0.27720	1.65	2.98	0.715	0.18186	.	.	.	.	.	T	0.21186	0.0510	L	0.36672	1.1	.	.	.	P	0.45474	0.859	B	0.41236	0.351	T	0.21965	-1.0230	8	0.87932	D	0	.	3.6452	0.08182	0.2221:0.0:0.2298:0.5481	.	7445	B5ME49	.	A	7445	ENSP00000381008:T7445A	ENSP00000381008:T7445A	T	-	1	0	MUC16	8926113	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.156000	0.10100	0.060000	0.16281	0.455000	0.32223	ACC		0.493	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MUC4	4585	mdanderson.org	37	3	195505791	195505791	+	Silent	SNP	A	A	T			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr3:195505791A>T	ENST00000463781.3	-	2	13119	c.12660T>A	c.(12658-12660)ggT>ggA	p.G4220G	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Silent_p.G4220G|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.G4220G(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGGTGGCGTGACCTGTGGATG	0.587																																						.											1	Substitution - coding silent(1)	kidney(1)											24.0	25.0	24.0					3																	195505791		2078	4168	6246	SO:0001819	synonymous_variant	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12660T>A	3.37:g.195505791A>T		Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																				0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195505839	195505839	+	Silent	SNP	A	A	T			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr3:195505839A>T	ENST00000463781.3	-	2	13071	c.12612T>A	c.(12610-12612)ggT>ggA	p.G4204G	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Silent_p.G4204G|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.G4204G(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGGTGGCGTGACCTGTGGATG	0.597																																						.											2	Substitution - coding silent(2)	kidney(2)											16.0	14.0	14.0					3																	195505839		689	1580	2269	SO:0001819	synonymous_variant	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12612T>A	3.37:g.195505839A>T		Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																				0.597	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195505849	195505849	+	Missense_Mutation	SNP	G	G	A			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr3:195505849G>A	ENST00000463781.3	-	2	13061	c.12602C>T	c.(12601-12603)gCa>gTa	p.A4201V	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.A4201V|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACCTGTGGATGCTGAGGAAGT	0.592																																						.											0													18.0	14.0	15.0					3																	195505849		690	1575	2265	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12602C>T	3.37:g.195505849G>A	ENSP00000417498:p.Ala4201Val	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	2.680	-0.275604	0.05679	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.46063	0.88;0.97	.	.	.	.	.	.	.	.	T	0.16599	0.0399	N	0.08118	0	0.09310	N	1	B	0.21606	0.058	B	0.18263	0.021	T	0.18871	-1.0323	7	.	.	.	.	4.6311	0.12502	0.442:0.0:0.558:0.0	.	4073	E7ESK3	.	V	4201	ENSP00000417498:A4201V;ENSP00000420243:A4201V	.	A	-	2	0	MUC4	196990628	0.000000	0.05858	0.003000	0.11579	0.012000	0.07955	-0.859000	0.04277	-1.727000	0.01368	-1.973000	0.00462	GCA		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195509515	195509515	+	Missense_Mutation	SNP	T	T	A	rs28438604	byFrequency	TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr3:195509515T>A	ENST00000463781.3	-	2	9395	c.8936A>T	c.(8935-8937)gAc>gTc	p.D2979V	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.D2979V|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGTGTCGGTGTCAGGAAGAGG	0.587													.|||	227	0.0453275	0.0688	0.0288	5008	,	,		9462	0.0377		0.0408	False		,,,				2504	0.0378					.											0													19.0	10.0	13.0					3																	195509515		656	1549	2205	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8936A>T	3.37:g.195509515T>A	ENSP00000417498:p.Asp2979Val	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	0.069	-1.206801	0.01568	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.30981	1.51;1.51	.	.	.	.	.	.	.	.	T	0.11665	0.0284	N	0.08118	0	0.80722	P	0.0	B	0.09022	0.002	B	0.01281	0.0	T	0.28650	-1.0037	6	.	.	.	.	1.4192	0.02308	0.3252:0.278:0.0:0.3967	.	2851	E7ESK3	.	V	2979	ENSP00000417498:D2979V;ENSP00000420243:D2979V	.	D	-	2	0	MUC4	196994294	.	.	0.003000	0.11579	0.000000	0.00434	.	.	0.402000	0.25451	0.000000	0.15137	GAC		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195509585	195509585	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr3:195509585C>T	ENST00000463781.3	-	2	9325	c.8866G>A	c.(8866-8868)Ggt>Agt	p.G2956S	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.G2956S|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTGGCGTGACCTGTGGATGCT	0.587																																						.											0													9.0	8.0	8.0					3																	195509585		623	1473	2096	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8866G>A	3.37:g.195509585C>T	ENSP00000417498:p.Gly2956Ser	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	c	6.832	0.522622	0.13066	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.32988	1.48;1.43	.	.	.	.	.	.	.	.	T	0.20780	0.0500	N	0.19112	0.55	0.09310	N	1	P	0.50443	0.935	P	0.47402	0.546	T	0.08911	-1.0699	7	.	.	.	.	4.2698	0.10780	0.3913:0.6087:0.0:0.0	.	2828	E7ESK3	.	S	2956	ENSP00000417498:G2956S;ENSP00000420243:G2956S	.	G	-	1	0	MUC4	196994364	0.852000	0.29690	0.004000	0.12327	0.000000	0.00434	2.070000	0.41491	0.482000	0.27582	0.000000	0.15137	GGT		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195515099	195515099	+	Missense_Mutation	SNP	T	T	C	rs71321848		TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr3:195515099T>C	ENST00000463781.3	-	2	3811	c.3352A>G	c.(3352-3354)Acc>Gcc	p.T1118A	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.T1118A|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	557					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGAGGGGTGGTGTGACCTGTG	0.567																																						.											0													14.0	8.0	9.0					3																	195515099		671	1543	2214	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.3352A>G	3.37:g.195515099T>C	ENSP00000417498:p.Thr1118Ala	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	4.711	0.132120	0.08981	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.32988	1.43;1.43	0.814	-0.654	0.11443	.	.	.	.	.	T	0.30355	0.0762	N	0.19112	0.55	0.09310	N	1	D	0.56968	0.978	D	0.65443	0.935	T	0.17471	-1.0368	8	.	.	.	.	4.6508	0.12594	0.0:0.2207:0.0:0.7793	.	1118	E7ESK3	.	A	1118	ENSP00000417498:T1118A;ENSP00000420243:T1118A	.	T	-	1	0	MUC4	196999494	0.000000	0.05858	0.000000	0.03702	0.110000	0.19582	-1.353000	0.02617	-0.216000	0.10048	-2.075000	0.00382	ACC		0.567	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC6	4588	mdanderson.org	37	11	1018314	1018314	+	Missense_Mutation	SNP	G	G	A	rs200089063		TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr11:1018314G>A	ENST00000421673.2	-	31	4537	c.4487C>T	c.(4486-4488)aCc>aTc	p.T1496I		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1496	Pro-rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGCTGTGTGGGTGGACCCTGT	0.572																																						.											0													279.0	289.0	286.0					11																	1018314		2189	4269	6458	SO:0001583	missense	4588			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.4487C>T	11.37:g.1018314G>A	ENSP00000406861:p.Thr1496Ile	Somatic		WXS	Illumina HiSeq	Phase_I	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	G	7.706	0.694199	0.15039	.	.	ENSG00000184956	ENST00000421673	T	0.20738	2.05	2.45	2.45	0.29901	.	.	.	.	.	T	0.26159	0.0638	L	0.59436	1.845	0.09310	N	1	D	0.54964	0.969	P	0.47162	0.54	T	0.08617	-1.0713	9	0.37606	T	0.19	.	11.017	0.47696	0.0:0.0:1.0:0.0	.	1496	Q6W4X9	MUC6_HUMAN	I	1496	ENSP00000406861:T1496I	ENSP00000406861:T1496I	T	-	2	0	MUC6	1008314	0.042000	0.20092	0.002000	0.10522	0.024000	0.10985	0.803000	0.27083	1.326000	0.45319	0.313000	0.20887	ACC		0.572	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
OR7A5	26659	mdanderson.org	37	19	14938184	14938184	+	Silent	SNP	A	A	G	rs200531878		TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr19:14938184A>G	ENST00000322301.3	-	2	957	c.870T>C	c.(868-870)taT>taC	p.Y290Y	OR7A5_ENST00000601611.1_Intron|OR7A5_ENST00000594432.1_Silent_p.Y290Y			Q15622	OR7A5_HUMAN	olfactory receptor, family 7, subfamily A, member 5	290					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Y290Y(2)		breast(1)|central_nervous_system(4)|endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	26						TCCTCAGACTATAGATAAAGG	0.478																																						.											2	Substitution - coding silent(2)	kidney(2)											74.0	72.0	72.0					19																	14938184		2203	4300	6503	SO:0001819	synonymous_variant	26659			X64976	CCDS12318.1	19p13.1	2012-08-09	2003-12-09			ENSG00000188269		"""GPCR / Class A : Olfactory receptors"""	8368	protein-coding gene	gene with protein product			"""olfactory receptor, family 7, subfamily A, member 5 pseudogene"""				Standard	XM_006722722		Approved	HTPCR2	uc002mzw.3	Q15622		ENST00000322301.3:c.870T>C	19.37:g.14938184A>G		Somatic		WXS	Illumina HiSeq	Phase_I	B2R682|Q6IFP1|Q96R96	Silent	SNP	ENST00000322301.3	37	CCDS12318.1																																																																																				0.478	OR7A5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466518.1	NM_017506	
OR7A5	26659	mdanderson.org	37	19	14938248	14938248	+	Missense_Mutation	SNP	T	T	A	rs112284734	byFrequency	TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr19:14938248T>A	ENST00000322301.3	-	2	893	c.806A>T	c.(805-807)cAc>cTc	p.H269L	OR7A5_ENST00000601611.1_Intron|OR7A5_ENST00000594432.1_Missense_Mutation_p.H269L			Q15622	OR7A5_HUMAN	olfactory receptor, family 7, subfamily A, member 5	269					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(4)|endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	26						TGCACTTGAGTGTGAGTTGCG	0.483																																						.											0													94.0	81.0	86.0					19																	14938248		2203	4300	6503	SO:0001583	missense	26659			X64976	CCDS12318.1	19p13.1	2012-08-09	2003-12-09			ENSG00000188269		"""GPCR / Class A : Olfactory receptors"""	8368	protein-coding gene	gene with protein product			"""olfactory receptor, family 7, subfamily A, member 5 pseudogene"""				Standard	XM_006722722		Approved	HTPCR2	uc002mzw.3	Q15622		ENST00000322301.3:c.806A>T	19.37:g.14938248T>A	ENSP00000316955:p.His269Leu	Somatic		WXS	Illumina HiSeq	Phase_I	B2R682|Q6IFP1|Q96R96	Missense_Mutation	SNP	ENST00000322301.3	37	CCDS12318.1	.	.	.	.	.	.	.	.	.	.	t	11.34	1.609869	0.28712	.	.	ENSG00000188269	ENST00000322301	T	0.00069	8.77	3.12	-0.173	0.13322	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00109	0.0003	N	0.20445	0.575	0.09310	N	1	B	0.23990	0.095	B	0.33254	0.16	T	0.04976	-1.0914	9	0.48119	T	0.1	.	6.5609	0.22485	0.0:0.5426:0.0:0.4574	.	269	Q15622	OR7A5_HUMAN	L	269	ENSP00000316955:H269L	ENSP00000316955:H269L	H	-	2	0	OR7A5	14799248	0.000000	0.05858	0.000000	0.03702	0.320000	0.28249	-0.053000	0.11846	0.050000	0.15949	0.102000	0.15555	CAC		0.483	OR7A5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466518.1	NM_017506	
PAK2	5062	mdanderson.org	37	3	196530013	196530013	+	Silent	SNP	A	A	G	rs73205842	byFrequency	TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr3:196530013A>G	ENST00000327134.3	+	4	736	c.414A>G	c.(412-414)aaA>aaG	p.K138K		NM_002577.4	NP_002568.2	Q13177	PAK2_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 2	138					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in execution phase of apoptosis (GO:2001271)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-serine phosphorylation (GO:0018105)|phosphorylation (GO:0016310)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of defense response to virus by virus (GO:0050690)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activator activity (GO:0030296)			breast(1)|cervix(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)	12	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.07e-23)|all cancers(36;6.38e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00405)		TGAAGCAGAAATATCTGAGCT	0.418																																						.											0													92.0	84.0	87.0					3																	196530013		2203	4300	6503	SO:0001819	synonymous_variant	5062			U24153	CCDS3321.1	3q29	2008-06-17	2008-06-17			ENSG00000180370	2.7.11.1		8591	protein-coding gene	gene with protein product	"""S6/H4 kinase"""	605022	"""p21 (CDKN1A)-activated kinase 2"""			7744004, 7618083	Standard	NM_002577		Approved	PAK65, PAKgamma	uc003fwy.4	Q13177		ENST00000327134.3:c.414A>G	3.37:g.196530013A>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q13154|Q6ISC3	Silent	SNP	ENST00000327134.3	37	CCDS3321.1																																																																																				0.418	PAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340548.1	NM_002577	
PCDHA6	56142	mdanderson.org	37	5	140208909	140208909	+	Silent	SNP	T	T	C	rs664837	byFrequency	TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr5:140208909T>C	ENST00000529310.1	+	1	1347	c.1233T>C	c.(1231-1233)agT>agC	p.S411S	PCDHA4_ENST00000530339.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000527624.1_Silent_p.S411S|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000504120.2_Intron	NM_018909.2|NM_031848.2|NM_031849.1	NP_061732.1|NP_114036.1|NP_114037.1	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6	411	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(42)|prostate(8)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	89			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCTGGACAGTGCCCTGGACC	0.622													.|||	3	0.000599042	0.0	0.0043	5008	,	,		20184	0.0		0.0	False		,,,				2504	0.0					.											0													148.0	146.0	147.0					5																	140208909		2203	4300	6503	SO:0001819	synonymous_variant	56142			AF152484	CCDS47281.1, CCDS47282.1	5q31	2010-11-26			ENSG00000081842	ENSG00000081842		"""Cadherins / Protocadherins : Clustered"""	8672	other	complex locus constituent	"""KIAA0345-like 8"""	606312		CNRS2		10380929, 10662547	Standard	NM_018909		Approved	CNR2, CRNR2, PCDH-ALPHA6		Q9UN73	OTTHUMG00000163353	ENST00000529310.1:c.1233T>C	5.37:g.140208909T>C		Somatic		WXS	Illumina HiSeq	Phase_I	O75283|Q9NRT8	Silent	SNP	ENST00000529310.1	37	CCDS47281.1																																																																																				0.622	PCDHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372829.3	NM_018909	
BCRP4	616	mdanderson.org	37	22	22977640	22977640	+	IGR	SNP	G	G	C	rs113599461	byFrequency	TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr22:22977640G>C								IGLV3-32 (40139 upstream) : POM121L1P (4007 downstream)																							CCTCTGCTTCGGTCCTCTACA	0.612													.|||	1294	0.258387	0.2428	0.3012	5008	,	,		8075	0.3978		0.1431	False		,,,				2504	0.2239					.											0																																										SO:0001628	intergenic_variant	25812																															22.37:g.22977640G>C		Somatic		WXS	Illumina HiSeq	Phase_I		RNA	SNP		37																																																																																				0	0.612								
PRAMEF7	441871	mdanderson.org	37	1	12980074	12980074	+	Silent	SNP	T	T	A	rs139206769		TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr1:12980074T>A	ENST00000361079.2	+	4	1349	c.1266T>A	c.(1264-1266)ggT>ggA	p.G422G	RNU6-1072P_ENST00000384703.1_RNA			Q5VXH5	PRAM7_HUMAN	PRAME family member 7	422					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					endometrium(2)|kidney(5)|large_intestine(3)|lung(4)|prostate(2)|upper_aerodigestive_tract(2)	18	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		ACACCCAGGGTGCTCTCTGCT	0.587																																						.											0													36.0	39.0	38.0					1																	12980074		1261	2762	4023	SO:0001819	synonymous_variant	441871				CCDS30593.1	1p36.21	2013-01-17			ENSG00000204510	ENSG00000204510		"""-"""	28415	protein-coding gene	gene with protein product							Standard	NM_001012277		Approved			Q5VXH5	OTTHUMG00000001982	ENST00000361079.2:c.1266T>A	1.37:g.12980074T>A		Somatic		WXS	Illumina HiSeq	Phase_I	B9EIP0	Silent	SNP	ENST00000361079.2	37	CCDS30593.1																																																																																				0.587	PRAMEF7-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001012277	
PRB2	653247	mdanderson.org	37	12	11546634	11546634	+	Silent	SNP	G	G	A			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr12:11546634G>A	ENST00000389362.4	-	3	413	c.378C>T	c.(376-378)ggC>ggT	p.G126G	PRB2_ENST00000545829.1_5'Flank|PRB1_ENST00000546254.1_Intron	NM_006248.3	NP_006239.3	P02812	PRB2_HUMAN	proline-rich protein BstNI subfamily 2	126	15 X 20 AA approximate tandem repeats of P-P-G-K-P-Q-G-P-P-P-Q-G-[GD]-[NKS]-[KSQ]- [PRS]-[QRS] [GPS]-[PSAR]-[PSR].					extracellular region (GO:0005576)				NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(5)|skin(4)|stomach(2)|urinary_tract(1)	37		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			GAGGCTGGTTGCCTCCTTGTG	0.607																																						.											0													301.0	284.0	290.0					12																	11546634		2203	4300	6503	SO:0001819	synonymous_variant	653247			K03208	CCDS41757.2	12p13.2	2012-10-02			ENSG00000121335	ENSG00000121335			9338	protein-coding gene	gene with protein product		168810				8554050	Standard	NM_006248		Approved	PRPPRB1, Ps, cP7	uc010shk.1	P02812	OTTHUMG00000156975	ENST00000389362.4:c.378C>T	12.37:g.11546634G>A		Somatic		WXS	Illumina HiSeq	Phase_I	O00599|P02811|P04281	Silent	SNP	ENST00000389362.4	37	CCDS41757.2																																																																																				0.607	PRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346925.2	NM_006248	
RNF145	153830	mdanderson.org	37	5	158603839	158603839	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr5:158603839A>G	ENST00000424310.2	-	5	781	c.422T>C	c.(421-423)aTg>aCg	p.M141T	RNF145_ENST00000521606.2_Missense_Mutation_p.M158T|RNF145_ENST00000519865.1_Missense_Mutation_p.M141T|RNF145_ENST00000518802.1_Missense_Mutation_p.M171T|RNF145_ENST00000274542.2_Missense_Mutation_p.M169T|RNF145_ENST00000520638.1_Missense_Mutation_p.M155T	NM_001199383.1	NP_001186312.1	Q96MT1	RN145_HUMAN	ring finger protein 145	141						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)	p.M169T(4)		endometrium(7)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	30	Renal(175;0.00196)	Medulloblastoma(196;0.0523)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTTTGTTTTCATGACACAGGA	0.363																																						.											4	Substitution - Missense(4)	endometrium(3)|lung(1)											35.0	33.0	34.0					5																	158603839		2201	4298	6499	SO:0001583	missense	153830			BC042684	CCDS4344.1, CCDS56390.1, CCDS56391.1, CCDS56392.1, CCDS56393.1	5q33.3	2013-01-09			ENSG00000145860	ENSG00000145860		"""RING-type (C3HC4) zinc fingers"""	20853	protein-coding gene	gene with protein product							Standard	NM_001199380		Approved	FLJ31951	uc003lxo.2	Q96MT1	OTTHUMG00000130306	ENST00000424310.2:c.422T>C	5.37:g.158603839A>G	ENSP00000409064:p.Met141Thr	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z903|B7Z949|E7EVI7|Q8IVP7	Missense_Mutation	SNP	ENST00000424310.2	37	CCDS56390.1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.282699	0.80692	.	.	ENSG00000145860	ENST00000274542;ENST00000519865;ENST00000424310;ENST00000521606;ENST00000413445;ENST00000518802;ENST00000535312;ENST00000520638	T;T;T;T;T;T;T	0.77229	-1.08;-1.06;-1.06;-1.07;-1.07;-1.08;-1.07	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.81725	0.4883	L	0.44542	1.39	0.80722	D	1	D;D;D;D;D;D	0.57257	0.979;0.979;0.979;0.979;0.979;0.974	P;P;P;P;P;P	0.57846	0.828;0.828;0.828;0.828;0.76;0.736	D	0.83797	0.0234	10	0.72032	D	0.01	-20.3428	15.6548	0.77124	1.0:0.0:0.0:0.0	.	157;158;155;171;141;169	E7EW26;B7Z949;B7Z903;E7EVI7;Q96MT1;Q96MT1-2	.;.;.;.;RN145_HUMAN;.	T	169;141;141;157;158;171;141;155	ENSP00000274542:M169T;ENSP00000430397:M141T;ENSP00000409064:M141T;ENSP00000430753:M157T;ENSP00000445115:M158T;ENSP00000430955:M171T;ENSP00000429071:M155T	ENSP00000274542:M169T	M	-	2	0	RNF145	158536417	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.339000	0.96797	2.162000	0.67917	0.377000	0.23210	ATG		0.363	RNF145-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374048.1	NM_144726	
TBP	6908	mdanderson.org	37	6	170871052	170871052	+	Silent	SNP	G	G	A	rs112083427|rs369312237	byFrequency	TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr6:170871052G>A	ENST00000392092.2	+	3	507	c.228G>A	c.(226-228)caG>caA	p.Q76Q	TBP_ENST00000230354.6_Silent_p.Q76Q|TBP_ENST00000540980.1_Silent_p.Q56Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	76	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.Q76Q(4)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		agcaacagcagcagcagcagc	0.572																																						.											4	Substitution - coding silent(4)	lung(3)|prostate(1)											14.0	19.0	17.0					6																	170871052		1952	3842	5794	SO:0001819	synonymous_variant	6908			M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.228G>A	6.37:g.170871052G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	ENST00000392092.2	37	CCDS5315.1																																																																																				0.572	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194	
USP11	8237	mdanderson.org	37	X	47092432	47092432	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chrX:47092432A>G	ENST00000218348.3	+	1	119	c.119A>G	c.(118-120)gAa>gGa	p.E40G	USP11_ENST00000377107.2_5'UTR	NM_004651.3	NP_004642.2	P51784	UBP11_HUMAN	ubiquitin specific peptidase 11	40					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(14)|ovary(3)|pancreas(1)|stomach(1)	40						TGTAGAAGAGAACGgacggcg	0.637																																						.											0													24.0	22.0	22.0					X																	47092432		2203	4299	6502	SO:0001583	missense	8237			U44839	CCDS14277.1	Xp11.23	2008-02-05	2005-08-08		ENSG00000102226	ENSG00000102226		"""Ubiquitin-specific peptidases"""	12609	protein-coding gene	gene with protein product		300050	"""ubiquitin specific protease 11"""			12838346	Standard	XM_005272674		Approved	UHX1	uc004dhp.3	P51784	OTTHUMG00000021437	ENST00000218348.3:c.119A>G	X.37:g.47092432A>G	ENSP00000218348:p.Glu40Gly	Somatic		WXS	Illumina HiSeq	Phase_I	B2RTX1|Q8IUG6|Q9BWE1	Missense_Mutation	SNP	ENST00000218348.3	37	CCDS14277.1	.	.	.	.	.	.	.	.	.	.	A	2.393	-0.339424	0.05243	.	.	ENSG00000102226	ENST00000218348	T	0.22336	1.96	4.53	0.72	0.18214	.	.	.	.	.	T	0.08088	0.0202	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.36696	-0.9737	9	0.27785	T	0.31	-1.3885	6.0165	0.19605	0.5144:0.0:0.4856:0.0	.	40	P51784	UBP11_HUMAN	G	40	ENSP00000218348:E40G	ENSP00000218348:E40G	E	+	2	0	USP11	46977376	0.008000	0.16893	0.041000	0.18516	0.014000	0.08584	0.710000	0.25748	0.095000	0.17434	-0.502000	0.04539	GAA		0.637	USP11-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_004651	
TMEM257	9142	mdanderson.org	37	X	144909347	144909347	+	Missense_Mutation	SNP	C	C	T	rs370861051		TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chrX:144909347C>T	ENST00000408967.2	+	1	420	c.152C>T	c.(151-153)tCg>tTg	p.S51L		NM_004709.2	NP_004700.1	O96002	TM257_HUMAN	transmembrane protein 257	51						integral component of membrane (GO:0016021)		p.S51L(1)									CAAGCACTTTCGACCATATTT	0.313																																						.											1	Substitution - Missense(1)	large_intestine(1)						C	LEU/SER	1,3834		0,1,1631,571	87.0	86.0	86.0		152	-4.7	0.0	X		86	1,6725		0,1,2426,1872	no	missense	CXorf1	NM_004709.2	145	0,2,4057,2443	TT,TC,CC,C		0.0149,0.0261,0.0189	benign	51/112	144909347	2,10559	2203	4299	6502	SO:0001583	missense	9142			Y08902	CCDS14681.1	Xq27.3	2012-12-03	2012-12-03	2012-12-03	ENSG00000221870	ENSG00000221870			2562	protein-coding gene	gene with protein product		300565	"""chromosome X open reading frame 1"""	CXorf1		9881668	Standard	NM_004709		Approved		uc004fch.3	O96002	OTTHUMG00000159605	ENST00000408967.2:c.152C>T	X.37:g.144909347C>T	ENSP00000386149:p.Ser51Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q14CW0	Missense_Mutation	SNP	ENST00000408967.2	37	CCDS14681.1	.	.	.	.	.	.	.	.	.	.	C	3.263	-0.150696	0.06585	2.61E-4	1.49E-4	ENSG00000221870	ENST00000408967	T	0.54279	0.58	5.68	-4.68	0.03309	.	.	.	.	.	T	0.21962	0.0529	N	0.08118	0	0.09310	N	1	B	0.32051	0.354	B	0.23150	0.044	T	0.10894	-1.0610	9	0.87932	D	0	.	1.8321	0.03132	0.3277:0.1317:0.3753:0.1653	.	51	O96002	CX001_HUMAN	L	51	ENSP00000386149:S51L	ENSP00000386149:S51L	S	+	2	0	CXorf1	144717039	0.000000	0.05858	0.000000	0.03702	0.074000	0.17049	-0.690000	0.05138	-1.099000	0.03034	0.594000	0.82650	TCG		0.313	TMEM257-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356465.1	NM_004709	
ZHX1	11244	mdanderson.org	37	8	124267138	124267138	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr8:124267138T>C	ENST00000522655.1	-	3	1589	c.1049A>G	c.(1048-1050)gAg>gGg	p.E350G	ZHX1_ENST00000522595.1_5'Flank|ZHX1_ENST00000297857.2_Missense_Mutation_p.E350G|ZHX1-C8ORF76_ENST00000357082.4_Intron|ZHX1_ENST00000395571.3_Missense_Mutation_p.E350G			Q9UKY1	ZHX1_HUMAN	zinc fingers and homeoboxes 1	350	Required for dimerization.|Required for interaction with NFYA.				cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(37;1.25e-09)|Ovarian(258;0.0154)		STAD - Stomach adenocarcinoma(47;0.00527)			CCTTCTTGCCTCCTCTACTTC	0.413																																						.											0													237.0	203.0	215.0					8																	124267138		2203	4300	6503	SO:0001583	missense	11244			AF106862	CCDS6342.1	8q24.13	2012-03-09	2004-01-23		ENSG00000165156	ENSG00000165156		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	12871	protein-coding gene	gene with protein product		604764	"""zinc-fingers and homeoboxes 1"""			10441475	Standard	NM_001017926		Approved		uc003yqe.3	Q9UKY1	OTTHUMG00000165088	ENST00000522655.1:c.1049A>G	8.37:g.124267138T>C	ENSP00000428821:p.Glu350Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q8IWD8	Missense_Mutation	SNP	ENST00000522655.1	37	CCDS6342.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.66|17.66	3.445777|3.445777	0.63178|0.63178	.|.	.|.	ENSG00000165156|ENSG00000165156	ENST00000297857;ENST00000395571;ENST00000522655|ENST00000520474	T;T;T|.	0.31247|.	1.5;1.5;1.5|.	5.8|5.8	5.8|5.8	0.92144|0.92144	Homeodomain-related (1);Homeodomain-like (1);|.	0.154395|.	0.56097|.	D|.	0.000027|.	T|T	0.73048|0.73048	0.3537|0.3537	.|.	.|.	.|.	0.54753|0.54753	D|D	0.999989|0.999989	P|.	0.50710|.	0.938|.	P|.	0.49140|.	0.601|.	T|T	0.72243|0.72243	-0.4350|-0.4350	9|4	0.87932|.	D|.	0|.	-14.3997|-14.3997	16.1404|16.1404	0.81517|0.81517	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	350|.	Q9UKY1|.	ZHX1_HUMAN|.	G|G	350|35	ENSP00000297857:E350G;ENSP00000378938:E350G;ENSP00000428821:E350G|.	ENSP00000297857:E350G|.	E|R	-|-	2|1	0|2	ZHX1|ZHX1	124336319|124336319	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.929000|0.929000	0.56500|0.56500	6.286000|6.286000	0.72665|0.72665	2.210000|2.210000	0.71456|0.71456	0.454000|0.454000	0.30748|0.30748	GAG|AGG		0.413	ZHX1-003	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000381759.1		
ZNF468	90333	mdanderson.org	37	19	53352388	53352388	+	Silent	SNP	A	A	G	rs536376293	byFrequency	TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr19:53352388A>G	ENST00000595646.1	-	3	214	c.94T>C	c.(94-96)Tta>Cta	p.L32L	ZNF28_ENST00000594602.1_Intron|ZNF468_ENST00000243639.4_Silent_p.L32L|ZNF468_ENST00000390651.4_5'UTR|ZNF468_ENST00000396409.4_5'UTR			Q5VIY5	ZN468_HUMAN	zinc finger protein 468	32	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L32L(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|skin(1)|stomach(3)|urinary_tract(1)	23				GBM - Glioblastoma multiforme(134;0.0358)		TCCCTGTATAAAGTCCTCTGA	0.468													-|||	32	0.00638978	0.0129	0.0	5008	,	,		18523	0.001		0.0099	False		,,,				2504	0.0041					.											1	Substitution - coding silent(1)	large_intestine(1)											147.0	149.0	149.0					19																	53352388		2203	4300	6503	SO:0001819	synonymous_variant	90333			AK023558	CCDS33094.1, CCDS62781.1	19q13.41	2013-01-08				ENSG00000204604		"""Zinc fingers, C2H2-type"", ""-"""	33105	protein-coding gene	gene with protein product						16144304	Standard	NM_001277120		Approved		uc002qaf.3	Q5VIY5		ENST00000595646.1:c.94T>C	19.37:g.53352388A>G		Somatic		WXS	Illumina HiSeq	Phase_I	A8MV20|Q5CZB8|Q5VIY4|Q68DI7	Silent	SNP	ENST00000595646.1	37	CCDS33094.1																																																																																				0.468	ZNF468-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463098.1	NM_001008801	
ZNF584	201514	mdanderson.org	37	19	58921398	58921398	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr19:58921398A>G	ENST00000306910.4	+	2	632	c.109A>G	c.(109-111)Acc>Gcc	p.T37A	ZNF584_ENST00000593920.1_5'UTR|ZNF584_ENST00000322834.7_Missense_Mutation_p.T29A|ZNF584_ENST00000596921.1_Intron|ZNF584_ENST00000599238.1_5'UTR|ZNF584_ENST00000596281.1_Intron|CTD-2619J13.14_ENST00000593393.1_lincRNA	NM_173548.1	NP_775819.1	Q8IVC4	ZN584_HUMAN	zinc finger protein 584	37	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(3)|large_intestine(3)|lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	14		all_cancers(17;5.3e-17)|all_epithelial(17;3.71e-12)|Lung NSC(17;8.3e-05)|Colorectal(82;0.000147)|all_lung(17;0.000386)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0271)		CCTTAATGTGACCCAGAAGGG	0.537																																						.											0													178.0	155.0	163.0					19																	58921398		2203	4300	6503	SO:0001583	missense	201514			AK097218	CCDS12979.1	19q13.43	2013-01-08			ENSG00000171574	ENSG00000171574		"""Zinc fingers, C2H2-type"", ""-"""	27318	protein-coding gene	gene with protein product							Standard	NM_173548		Approved	FLJ39899	uc002qsp.3	Q8IVC4		ENST00000306910.4:c.109A>G	19.37:g.58921398A>G	ENSP00000306756:p.Thr37Ala	Somatic		WXS	Illumina HiSeq	Phase_I	A8K203	Missense_Mutation	SNP	ENST00000306910.4	37	CCDS12979.1	.	.	.	.	.	.	.	.	.	.	A	0.472	-0.883756	0.02530	.	.	ENSG00000171574	ENST00000306910;ENST00000322834	T;T	0.01313	5.02;5.02	3.92	-3.28	0.05033	Krueppel-associated box (4);	.	.	.	.	T	0.00524	0.0017	N	0.01761	-0.735	0.09310	N	1	B;B	0.19073	0.033;0.002	B;B	0.18263	0.021;0.007	T	0.46176	-0.9210	9	0.02654	T	1	.	3.6587	0.08230	0.3759:0.0:0.3426:0.2815	.	29;37	F6W0P0;Q8IVC4	.;ZN584_HUMAN	A	37;29	ENSP00000306756:T37A;ENSP00000320731:T29A	ENSP00000306756:T37A	T	+	1	0	ZNF584	63613210	0.000000	0.05858	0.065000	0.19835	0.996000	0.88848	-3.011000	0.00647	-0.263000	0.09378	0.454000	0.30748	ACC		0.537	ZNF584-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467022.1	NM_173548	
SZT2	23334	bcgsc.ca	37	1	43908707	43908707	+	Missense_Mutation	SNP	T	T	C			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr1:43908707T>C	ENST00000562955.1	+	58	8198	c.8198T>C	c.(8197-8199)gTc>gCc	p.V2733A	SZT2_ENST00000372442.1_Missense_Mutation_p.V1891A	NM_015284.3	NP_056099.3	Q5T011	SZT2_HUMAN	seizure threshold 2 homolog (mouse)	2790					central nervous system development (GO:0007417)|corpus callosum morphogenesis (GO:0021540)|embryo development (GO:0009790)|pigmentation (GO:0043473)|post-embryonic development (GO:0009791)|regulation of superoxide dismutase activity (GO:1901668)	extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)				NS(2)|breast(9)|central_nervous_system(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(39)|ovary(4)|pancreas(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	113						CCTGATCCTGTCACCTACCAT	0.592																																						.											0													58.0	59.0	59.0					1																	43908707		2203	4300	6503	SO:0001583	missense	23334			AB007936	CCDS30694.1, CCDS30694.2	1p34.2	2012-11-19	2011-06-10	2011-06-10	ENSG00000198198	ENSG00000198198			29040	protein-coding gene	gene with protein product	"""seizure threshold 2 homolog A (mouse)"", ""seizure threshold 2 homolog B (mouse)"""	615463	"""chromosome 1 open reading frame 84"", ""KIAA0467"""	C1orf84, KIAA0467		9455484	Standard	NM_015284		Approved	FLJ10387, SZT2B, RP11-506B15.1, FLJ34502, SZT2A	uc001cjk.3	Q5T011	OTTHUMG00000007423	ENST00000562955.1:c.8198T>C	1.37:g.43908707T>C	ENSP00000457168:p.Val2733Ala	Somatic		WXS	Illumina HiSeq	Phase_I	A0PJK5|A7E2X4|O75055|Q5JUY7|Q5T012|Q5XKC7|Q6ZNI8|Q6ZT24|Q7Z636|Q8NAY9|Q9H5H7|Q9UFQ8	Missense_Mutation	SNP	ENST00000562955.1	37	CCDS30694.2	.	.	.	.	.	.	.	.	.	.	T	18.16	3.562597	0.65538	.	.	ENSG00000198198	ENST00000372442	.	.	.	5.67	5.67	0.87782	.	0.065649	0.64402	D	0.000011	T	0.44074	0.1276	L	0.48642	1.525	0.32201	N	0.577808	P	0.43231	0.801	B	0.39805	0.31	T	0.61412	-0.7068	9	0.72032	D	0.01	.	14.4754	0.67541	0.0:0.0:0.0:1.0	.	2733	Q5T011-5	.	A	1891	.	ENSP00000361519:V1891A	V	+	2	0	SZT2	43681294	1.000000	0.71417	0.997000	0.53966	0.977000	0.68977	7.423000	0.80229	2.169000	0.68431	0.459000	0.35465	GTC		0.592	SZT2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019517.3	NM_015284	
RBM15	64783	bcgsc.ca	37	1	110882696	110882714	+	Frame_Shift_Del	DEL	GGCGGCCAGAGGACGCGCG	GGCGGCCAGAGGACGCGCG	-			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	GGCGGCCAGAGGACGCGCG	GGCGGCCAGAGGACGCGCG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr1:110882696_110882714delGGCGGCCAGAGGACGCGCG	ENST00000369784.3	+	1	1569_1587	c.669_687delGGCGGCCAGAGGACGCGCG	c.(667-687)cgggcggccagaggacgcgcgfs	p.RAARGRA223fs	RBM15_ENST00000487146.2_Frame_Shift_Del_p.RAARGRA223fs|RP5-1074L1.1_ENST00000449169.1_RNA|RBM15_ENST00000602849.1_Frame_Shift_Del_p.RAARGRA223fs	NM_022768.4	NP_073605.4	Q96T37	RBM15_HUMAN	RNA binding motif protein 15	223	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				negative regulation of myeloid cell differentiation (GO:0045638)|patterning of blood vessels (GO:0001569)|placenta blood vessel development (GO:0060674)|positive regulation of transcription of Notch receptor target (GO:0007221)|spleen development (GO:0048536)|ventricular septum morphogenesis (GO:0060412)|viral process (GO:0016032)	membrane (GO:0016020)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			ovary(3)	3		all_cancers(81;2.89e-06)|all_epithelial(167;2.96e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Breast(1374;0.0634)		BRCA - Breast invasive adenocarcinoma(282;0.000224)|Epithelial(280;0.000476)|Kidney(133;0.000539)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|all cancers(265;0.00144)|Lung(183;0.0238)|Colorectal(144;0.103)|LUSC - Lung squamous cell carcinoma(189;0.135)		TGAACTTCCGGCGGCCAGAGGACGCGCGGGCGGCCAAGC	0.589			T	MKL1	acute megakaryocytic leukemia						OREG0013656	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										.		Dom	yes		1	1p13	64783	RNA binding motif protein 15		L	0																																										SO:0001589	frameshift_variant	64783			AF368063	CCDS822.1, CCDS59198.1	1p13	2013-02-12			ENSG00000162775	ENSG00000162775		"""RNA binding motif (RRM) containing"""	14959	protein-coding gene	gene with protein product	"""one twenty-two"""	606077				11431691, 11344311	Standard	NM_001201545		Approved	OTT, OTT1	uc001dzl.1	Q96T37	OTTHUMG00000011284	ENST00000369784.3:c.669_687delGGCGGCCAGAGGACGCGCG	1.37:g.110882696_110882714delGGCGGCCAGAGGACGCGCG	ENSP00000358799:p.Arg223fs	Somatic	1430	WXS	Illumina HiSeq	Phase_I	A1A693|Q3ZB86|Q4V760|Q5D058|Q5T613|Q86VW9|Q96PE4|Q96SC5|Q96SC6|Q96SC9|Q96SD0|Q96T38|Q9BRA5|Q9H6R8|Q9H9Y0	Frame_Shift_Del	DEL	ENST00000369784.3	37	CCDS822.1																																																																																				0.589	RBM15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000031114.2	NM_022768	
CYP20A1	57404	bcgsc.ca	37	2	204161576	204161576	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr2:204161576A>G	ENST00000356079.4	+	13	1457	c.1334A>G	c.(1333-1335)gAa>gGa	p.E445G	CYP20A1_ENST00000461371.1_3'UTR|CYP20A1_ENST00000429815.2_Missense_Mutation_p.E453G	NM_177538.2	NP_803882.1	Q6UW02	CP20A_HUMAN	cytochrome P450, family 20, subfamily A, polypeptide 1	445						integral component of membrane (GO:0016021)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			cervix(1)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	11						ACAAAGTATGAACTGGTAACA	0.348																																						.											0													107.0	106.0	106.0					2																	204161576		2203	4300	6503	SO:0001583	missense	57404			AK021770	CCDS2357.1	2q33	2008-02-05			ENSG00000119004	ENSG00000119004		"""Cytochrome P450s"""	20576	protein-coding gene	gene with protein product							Standard	NM_177538		Approved	CYP-M	uc002uzv.4	Q6UW02	OTTHUMG00000132854	ENST00000356079.4:c.1334A>G	2.37:g.204161576A>G	ENSP00000348380:p.Glu445Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q4ZG61|Q8N4Q8|Q8WWA9|Q9HC04	Missense_Mutation	SNP	ENST00000356079.4	37	CCDS2357.1	.	.	.	.	.	.	.	.	.	.	A	19.81	3.896548	0.72639	.	.	ENSG00000119004	ENST00000356079;ENST00000421618;ENST00000429815	T;T	0.70282	-0.47;-0.47	5.63	5.63	0.86233	.	0.052405	0.64402	D	0.000001	T	0.61714	0.2369	L	0.31664	0.95	0.80722	D	1	P;B	0.34977	0.478;0.029	B;B	0.37601	0.254;0.036	T	0.59359	-0.7469	10	0.23302	T	0.38	-18.0972	15.8391	0.78831	1.0:0.0:0.0:0.0	.	453;445	E9PHG5;Q6UW02	.;CP20A_HUMAN	G	445;418;453	ENSP00000348380:E445G;ENSP00000407860:E453G	ENSP00000348380:E445G	E	+	2	0	CYP20A1	203869821	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.183000	0.89700	2.134000	0.65973	0.482000	0.46254	GAA		0.348	CYP20A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256328.3	NM_020674	
NECAB3	63941	bcgsc.ca	37	20	32258502	32258502	+	Frame_Shift_Del	DEL	C	C	-			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr20:32258502delC	ENST00000246190.6	-	3	306	c.251delG	c.(250-252)gggfs	p.G84fs	NECAB3_ENST00000375238.4_Frame_Shift_Del_p.G84fs	NM_031232.3	NP_112509.3	Q96P71	NECA3_HUMAN	N-terminal EF-hand calcium binding protein 3	84					protein metabolic process (GO:0019538)|protein secretion (GO:0009306)|regulation of amyloid precursor protein biosynthetic process (GO:0042984)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|Golgi cis cisterna (GO:0000137)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			large_intestine(3)|lung(5)|skin(2)	10						GGTGAGATGCCCATCAATGCC	0.552																																						.											0													62.0	66.0	65.0					20																	32258502		1979	4159	6138	SO:0001589	frameshift_variant	63941			AB039947	CCDS42866.1, CCDS42867.1	20q11.21	2013-01-10	2007-12-06	2007-12-06	ENSG00000125967	ENSG00000125967		"""N-terminal EF-hand calcium binding proteins"", ""EF-hand domain containing"""	15851	protein-coding gene	gene with protein product	"""EF-hand calcium binding protein 3"""	612478	"""amyloid beta (A4) precursor protein-binding, family A, member 2 binding protein"""	SYTIP2, APBA2BP		10833507	Standard	NM_031232		Approved	XB51, dJ63M2.4, NIP1, dJ63M2.5, EFCBP3	uc002wzn.4	Q96P71	OTTHUMG00000032264	ENST00000246190.6:c.251delG	20.37:g.32258502delC	ENSP00000246190:p.Gly84fs	Somatic		WXS	Illumina HiSeq	Phase_I	A8K780|E1P5N2|Q5JWF5|Q5JWF6|Q5JWF7|Q86VV1|Q9H433|Q9H8G8|Q9HBW7|Q9HCQ9	Frame_Shift_Del	DEL	ENST00000246190.6	37	CCDS42866.1																																																																																				0.552	NECAB3-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000078724.2		
C3orf33	285315	bcgsc.ca	37	3	155485327	155485327	+	Missense_Mutation	SNP	C	C	T			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr3:155485327C>T	ENST00000340171.2	-	4	552	c.454G>A	c.(454-456)Gca>Aca	p.A152T	C3orf33_ENST00000534941.1_Missense_Mutation_p.A109T			Q6P1S2	CC033_HUMAN	chromosome 3 open reading frame 33	152					negative regulation of ERK1 and ERK2 cascade (GO:0070373)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)			breast(1)|kidney(1)|large_intestine(3)|lung(3)	8			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			CAAAAGAGTGCTGAATTCTCC	0.358																																						.											0													138.0	105.0	115.0					3																	155485327		1859	4101	5960	SO:0001583	missense	285315			AF115515	CCDS54659.1	3q25.31	2012-10-31			ENSG00000174928	ENSG00000174928			26434	protein-coding gene	gene with protein product						20680465	Standard	NM_173657		Approved	FLJ31139, AC3-33	uc003fal.1	Q6P1S2	OTTHUMG00000158496	ENST00000340171.2:c.454G>A	3.37:g.155485327C>T	ENSP00000342512:p.Ala152Thr	Somatic		WXS	Illumina HiSeq	Phase_I	A8K1H5|Q86YE6|Q8IXA7|Q96NB5	Missense_Mutation	SNP	ENST00000340171.2	37		.	.	.	.	.	.	.	.	.	.	C	10.84	1.463087	0.26248	.	.	ENSG00000174928	ENST00000534941;ENST00000340171;ENST00000537385	T;T	0.28666	1.6;1.6	5.28	-2.47	0.06442	Staphylococcal nuclease (SNase-like) (1);	0.655301	0.15921	N	0.238120	T	0.14485	0.0350	L	0.28192	0.835	0.09310	N	0.999999	B	0.16603	0.018	B	0.10450	0.005	T	0.24261	-1.0165	10	0.17369	T	0.5	-16.3589	4.5596	0.12154	0.2285:0.434:0.0:0.3375	.	152	Q6P1S2	CC033_HUMAN	T	109;152;152	ENSP00000445446:A109T;ENSP00000342512:A152T	ENSP00000342512:A152T	A	-	1	0	C3orf33	156968021	0.227000	0.23707	0.117000	0.21633	0.976000	0.68499	0.700000	0.25601	-0.242000	0.09667	0.591000	0.81541	GCA		0.358	C3orf33-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351167.1	NM_173657	
KIAA1244	57221	bcgsc.ca	37	6	138655499	138655499	+	Missense_Mutation	SNP	A	A	G			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr6:138655499A>G	ENST00000251691.4	+	33	5682	c.5516A>G	c.(5515-5517)aAg>aGg	p.K1839R		NM_020340.4	NP_065073.3			KIAA1244											NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|lung(17)|ovary(2)|skin(2)	44	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		CAAGTGAAGAAGGTCCTTTTT	0.522																																						.											0													40.0	38.0	38.0					6																	138655499		2203	4300	6503	SO:0001583	missense	57221			AB033070	CCDS5189.2	6q23.3	2012-04-17			ENSG00000112379	ENSG00000112379		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 33"""		"""chromosome 6 open reading frame 92"""	C6orf92			Standard	NM_020340		Approved	dJ171N11.1, BIG3, PPP1R33	uc003qhu.3	Q5TH69	OTTHUMG00000015670	ENST00000251691.4:c.5516A>G	6.37:g.138655499A>G	ENSP00000251691:p.Lys1839Arg	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000251691.4	37	CCDS5189.2	.	.	.	.	.	.	.	.	.	.	A	9.628	1.135731	0.21123	.	.	ENSG00000112379	ENST00000251691;ENST00000367706	T	0.19105	2.17	4.99	2.6	0.31112	.	0.644286	0.16619	N	0.206574	T	0.04182	0.0116	N	0.19112	0.55	0.45690	D	0.998602	B	0.02656	0.0	B	0.04013	0.001	T	0.31308	-0.9948	10	0.17832	T	0.49	-23.402	8.9846	0.35986	0.8474:0.0:0.1526:0.0	.	1839	Q5TH69	BIG3_HUMAN	R	1839;4	ENSP00000251691:K1839R	ENSP00000251691:K1839R	K	+	2	0	KIAA1244	138697192	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	2.452000	0.44961	0.273000	0.22049	0.338000	0.21704	AAG		0.522	KIAA1244-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042425.4	NM_020340	
SMARCA5	8467	bcgsc.ca	37	4	144442710	144442711	+	Frame_Shift_Ins	INS	-	-	A			TCGA-KN-8435-01A-11D-2310-10	TCGA-KN-8435-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	715f59dd-a80f-422d-988c-f73f4b987baf	9cf36c04-1d2a-4e2f-902d-857033d208d3	g.chr4:144442710_144442711insA	ENST00000283131.3	+	3	843_844	c.381_382insA	c.(382-384)aaafs	p.K128fs		NM_003601.3	NP_003592.3	O60264	SMCA5_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5	128					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|CENP-A containing nucleosome assembly (GO:0034080)|chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA-templated transcription, initiation (GO:0006352)|double-strand break repair (GO:0006302)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromatin silencing complex (GO:0005677)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NURF complex (GO:0016589)|RSF complex (GO:0031213)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)		EWSR1/SMARCA5(2)	endometrium(2)|kidney(2)|large_intestine(9)|lung(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_hematologic(180;0.158)					GCCCACGAATAAAAAAAGATGA	0.386																																						.											0																																										SO:0001589	frameshift_variant	8467			AB010882	CCDS3761.1	4q31.1-q31.2	2011-04-20			ENSG00000153147	ENSG00000153147			11101	protein-coding gene	gene with protein product		603375				9730600	Standard	NM_003601		Approved	hSNF2H, hISWI, ISWI	uc003ijg.3	O60264	OTTHUMG00000161474	ENST00000283131.3:c.387dupA	4.37:g.144442716_144442716dupA	ENSP00000283131:p.Lys128fs	Somatic		WXS	Illumina HiSeq	Phase_I		Frame_Shift_Ins	INS	ENST00000283131.3	37	CCDS3761.1																																																																																				0.386	SMARCA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365077.3		
