#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MYO7A	4647	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	11	76924024	76924024	+	Missense_Mutation	SNP	A	A	T	rs539755538		TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr11:76924024A>T	ENST00000409709.3	+	47	6654	c.6382A>T	c.(6382-6384)Atc>Ttc	p.I2128F	MYO7A_ENST00000605744.1_3'UTR|MYO7A_ENST00000409619.2_Missense_Mutation_p.I2079F|MYO7A_ENST00000458637.2_Missense_Mutation_p.I2088F	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	2128	FERM 2. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						CTTCCCTGAGATCCTCCTAAT	0.517																																						.											0													86.0	73.0	77.0					11																	76924024		1938	4137	6075	SO:0001583	missense	4647			U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.6382A>T	11.37:g.76924024A>T	ENSP00000386331:p.Ile2128Phe	Somatic		WXS	Illumina HiSeq	Phase_I	B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Missense_Mutation	SNP	ENST00000409709.3	37	CCDS53683.1	.	.	.	.	.	.	.	.	.	.	A	14.67	2.603818	0.46423	.	.	ENSG00000137474	ENST00000409709;ENST00000458637;ENST00000409619;ENST00000545136;ENST00000358342;ENST00000343356;ENST00000341717;ENST00000458169	T;T;T;T	0.75367	-0.93;-0.93;-0.93;-0.93	4.74	3.62	0.41486	FERM domain (1);Pleckstrin homology-type (1);	0.049218	0.85682	D	0.000000	T	0.73713	0.3622	M	0.65975	2.015	0.54753	D	0.999981	P;B	0.40909	0.732;0.413	P;B	0.48598	0.583;0.142	T	0.66999	-0.5781	10	0.17369	T	0.5	.	6.986	0.24729	0.7717:0.1495:0.0788:0.0	.	2088;2128	F8VUN5;Q13402	.;MYO7A_HUMAN	F	2128;2088;2079;1301;2127;2097;2004;1270	ENSP00000386331:I2128F;ENSP00000392185:I2088F;ENSP00000386635:I2079F;ENSP00000417017:I1270F	ENSP00000345075:I2004F	I	+	1	0	MYO7A	76601672	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.068000	0.57534	0.777000	0.33496	0.477000	0.44152	ATC		0.517	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000328133.1	NM_000260	
PRB2	653247	hgsc.bcm.edu	37	12	11546874	11546874	+	Silent	SNP	T	T	C	rs534885201	byFrequency	TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr12:11546874T>C	ENST00000389362.4	-	3	173	c.138A>G	c.(136-138)aaA>aaG	p.K46K	PRB2_ENST00000545829.1_5'Flank|PRB1_ENST00000546254.1_Intron	NM_006248.3	NP_006239.3	P02812	PRB2_HUMAN	proline-rich protein BstNI subfamily 2	46						extracellular region (GO:0005576)		p.K46K(1)|p.?(1)|p.A39_G59delAPPQGGNKPQGPPSPPGKPQG(1)		NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(5)|skin(4)|stomach(2)|urinary_tract(1)	37		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			GACCTTGAGGTTTGTTGCCTC	0.532													C|||	2	0.000399361	0.0	0.0014	5008	,	,		17866	0.001		0.0	False		,,,				2504	0.0					.											3	Unknown(1)|Substitution - coding silent(1)|Deletion - In frame(1)	stomach(3)											126.0	141.0	136.0					12																	11546874		2156	4278	6434	SO:0001819	synonymous_variant	653247			K03208	CCDS41757.2	12p13.2	2012-10-02			ENSG00000121335	ENSG00000121335			9338	protein-coding gene	gene with protein product		168810				8554050	Standard	NM_006248		Approved	PRPPRB1, Ps, cP7	uc010shk.1	P02812	OTTHUMG00000156975	ENST00000389362.4:c.138A>G	12.37:g.11546874T>C		Somatic		WXS	Illumina HiSeq	Phase_I	O00599|P02811|P04281	Silent	SNP	ENST00000389362.4	37	CCDS41757.2																																																																																				0.532	PRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346925.2	NM_006248	
SMG1	23049	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	16	18849726	18849726	+	Missense_Mutation	SNP	G	G	T			TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr16:18849726G>T	ENST00000446231.2	-	44	7559	c.7147C>A	c.(7147-7149)Ctg>Atg	p.L2383M	SMG1_ENST00000389467.3_Missense_Mutation_p.L2383M			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	2383	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						GTTACACCCAGTGCTGTTTCA	0.373																																						.											0													198.0	183.0	188.0					16																	18849726		1884	4122	6006	SO:0001583	missense	23049			AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.7147C>A	16.37:g.18849726G>T	ENSP00000402515:p.Leu2383Met	Somatic		WXS	Illumina HiSeq	Phase_I	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Missense_Mutation	SNP	ENST00000446231.2	37	CCDS45430.1	.	.	.	.	.	.	.	.	.	.	G	16.24	3.068487	0.55539	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	T;T	0.81163	-1.46;-1.46	5.87	2.86	0.33363	Protein kinase-like domain (1);Armadillo-type fold (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);	0.000000	0.53938	D	0.000051	T	0.77572	0.4150	N	0.25031	0.7	0.33860	D	0.633718	P	0.44380	0.834	P	0.55923	0.787	T	0.79055	-0.1960	10	0.32370	T	0.25	.	10.4288	0.44395	0.2602:0.0:0.7398:0.0	.	2383	Q96Q15	SMG1_HUMAN	M	2383	ENSP00000402515:L2383M;ENSP00000374118:L2383M	ENSP00000374118:L2383M	L	-	1	2	SMG1	18757227	1.000000	0.71417	0.997000	0.53966	0.999000	0.98932	2.877000	0.48506	0.485000	0.27652	0.655000	0.94253	CTG		0.373	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391817.1	NM_015092	
CDC27	996	hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	17	45234367	45234367	+	Missense_Mutation	SNP	A	A	T	rs200148949		TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr17:45234367A>T	ENST00000066544.3	-	7	847	c.754T>A	c.(754-756)Tcc>Acc	p.S252T	CDC27_ENST00000527547.1_Missense_Mutation_p.S252T|CDC27_ENST00000531206.1_Missense_Mutation_p.S252T|CDC27_ENST00000528748.1_5'Flank|CDC27_ENST00000446365.2_Missense_Mutation_p.S191T	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	252					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)	p.S252T(3)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						GATAATATGGAAGTTCCTGTT	0.383																																						.											3	Substitution - Missense(3)	prostate(3)											54.0	60.0	58.0					17																	45234367		2197	4295	6492	SO:0001583	missense	996			U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.754T>A	17.37:g.45234367A>T	ENSP00000066544:p.Ser252Thr	Somatic		WXS	Illumina HiSeq	Phase_I	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	A	11.88	1.770710	0.31320	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547;ENST00000526866	T;T;T;T;T	0.68181	-0.31;-0.26;0.01;-0.31;0.83	5.44	2.92	0.33932	.	0.295461	0.32687	N	0.005769	T	0.46425	0.1392	N	0.24115	0.695	0.34835	D	0.740078	B;B;B;B	0.09022	0.002;0.001;0.001;0.0	B;B;B;B	0.08055	0.001;0.003;0.002;0.001	T	0.45702	-0.9243	10	0.19590	T	0.45	-13.824	7.977	0.30161	0.7316:0.1283:0.0:0.1401	.	191;252;252;252	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	T	252;252;191;252;252	ENSP00000066544:S252T;ENSP00000434614:S252T;ENSP00000392802:S191T;ENSP00000437339:S252T;ENSP00000432105:S252T	ENSP00000066544:S252T	S	-	1	0	CDC27	42589366	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	2.784000	0.47774	0.864000	0.35578	0.377000	0.23210	TCC		0.383	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
TP53	7157	broad.mit.edu;hgsc.bcm.edu;bcgsc.ca	37	17	7578212	7578212	+	Nonsense_Mutation	SNP	G	G	A	rs397516436		TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr17:7578212G>A	ENST00000269305.4	-	6	826	c.637C>T	c.(637-639)Cga>Tga	p.R213*	TP53_ENST00000574684.1_Intron|TP53_ENST00000359597.4_Nonsense_Mutation_p.R213*|TP53_ENST00000445888.2_Nonsense_Mutation_p.R213*|TP53_ENST00000455263.2_Nonsense_Mutation_p.R213*|TP53_ENST00000413465.2_Nonsense_Mutation_p.R213*|TP53_ENST00000420246.2_Nonsense_Mutation_p.R213*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	213	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> W (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R213*(250)|p.R81*(21)|p.R120*(21)|p.0?(8)|p.?(5)|p.R213G(5)|p.R213fs*35(3)|p.R213fs*34(3)|p.D208_V216delDRNTFRHSV(1)|p.R120G(1)|p.D207_R213delDDRNTFR(1)|p.T211_S215delTFRHS(1)|p.R81fs*>11(1)|p.D208fs*1(1)|p.R120fs*35(1)|p.R81G(1)|p.R209_R213delRNTFR(1)|p.R213fs*2(1)|p.T211fs*28(1)|p.R213_S215>X(1)|p.D207_V216del10(1)|p.R213R(1)|p.R213fs*32(1)|p.R209fs*6(1)|p.R213W(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ACACTATGTCGAAAAGTGTTT	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	333	Substitution - Nonsense(292)|Deletion - Frameshift(8)|Whole gene deletion(8)|Substitution - Missense(8)|Deletion - In frame(5)|Insertion - Frameshift(5)|Unknown(5)|Complex - deletion inframe(1)|Substitution - coding silent(1)	large_intestine(89)|breast(45)|lung(37)|upper_aerodigestive_tract(30)|central_nervous_system(18)|skin(16)|oesophagus(15)|stomach(14)|ovary(14)|haematopoietic_and_lymphoid_tissue(10)|urinary_tract(9)|biliary_tract(8)|liver(8)|soft_tissue(5)|endometrium(5)|bone(4)|prostate(3)|thyroid(1)|pancreas(1)|autonomic_ganglia(1)	GRCh37	CM951226	TP53	M							132.0	118.0	123.0					17																	7578212		2203	4300	6503	SO:0001587	stop_gained	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.637C>T	17.37:g.7578212G>A	ENSP00000269305:p.Arg213*	Somatic		WXS	Illumina HiSeq	Phase_I	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	37	6.039727	0.97226	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.28	3.25	0.37280	.	0.057335	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.5444	12.7263	0.57173	0.0:0.0:0.701:0.299	.	.	.	.	X	213;213;213;213;213;213;202;120;81;120;81	.	ENSP00000269305:R213X	R	-	1	2	TP53	7518937	0.971000	0.33674	0.123000	0.21794	0.957000	0.61999	1.659000	0.37387	0.702000	0.31825	0.563000	0.77884	CGA		0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
CDC27	996	hgsc.bcm.edu	37	17	45234386	45234386	+	Silent	SNP	G	G	T			TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr17:45234386G>T	ENST00000066544.3	-	7	828	c.735C>A	c.(733-735)gtC>gtA	p.V245V	CDC27_ENST00000527547.1_Silent_p.V245V|CDC27_ENST00000531206.1_Silent_p.V245V|CDC27_ENST00000528748.1_5'Flank|CDC27_ENST00000446365.2_Silent_p.V184V	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	245					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)	p.V245V(9)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						TTCCCAGTGGGACAGTATCAG	0.358																																						.											9	Substitution - coding silent(9)	prostate(9)											48.0	53.0	51.0					17																	45234386		2196	4292	6488	SO:0001819	synonymous_variant	996			U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.735C>A	17.37:g.45234386G>T		Somatic		WXS	Illumina HiSeq	Phase_I	G3V1C4|Q16349|Q96F35	Silent	SNP	ENST00000066544.3	37	CCDS11509.1																																																																																				0.358	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
ZNF521	25925	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	18	22807259	22807259	+	Missense_Mutation	SNP	C	C	T			TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr18:22807259C>T	ENST00000361524.3	-	4	771	c.623G>A	c.(622-624)cGc>cAc	p.R208H	ZNF521_ENST00000538137.2_Missense_Mutation_p.R208H|ZNF521_ENST00000579111.1_5'Flank|ZNF521_ENST00000584787.1_5'UTR	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	208					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					AAACCCACGGCGACAAATGGC	0.493			T	PAX5	ALL																																	.		Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	0													88.0	83.0	85.0					18																	22807259		2203	4300	6503	SO:0001583	missense	25925			AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.623G>A	18.37:g.22807259C>T	ENSP00000354794:p.Arg208His	Somatic		WXS	Illumina HiSeq	Phase_I	A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Missense_Mutation	SNP	ENST00000361524.3	37	CCDS32806.1	.	.	.	.	.	.	.	.	.	.	C	11.57	1.679010	0.29783	.	.	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	T;T	0.14893	2.47;2.47	5.98	5.98	0.97165	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.25232	0.0613	N	0.16307	0.4	0.36028	D	0.839201	D	0.76494	0.999	D	0.66716	0.946	T	0.16630	-1.0396	10	0.87932	D	0	-41.7226	13.6203	0.62134	0.0:0.9294:0.0:0.0706	.	208	Q96K83	ZN521_HUMAN	H	208;242;208	ENSP00000354794:R208H;ENSP00000382352:R208H	ENSP00000354794:R208H	R	-	2	0	ZNF521	21061257	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.743000	0.68655	2.838000	0.97847	0.655000	0.94253	CGC		0.493	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446781.2	NM_015461	
ZNF808	388558	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	19	53057816	53057816	+	Missense_Mutation	SNP	G	G	T			TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr19:53057816G>T	ENST00000359798.4	+	5	1827	c.1647G>T	c.(1645-1647)atG>atT	p.M549I		NM_001039886.3	NP_001034975.2	Q8N4W9	ZN808_HUMAN	zinc finger protein 808	549					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(8)|kidney(3)|lung(12)|urinary_tract(1)	24				OV - Ovarian serous cystadenocarcinoma(262;0.00501)|GBM - Glioblastoma multiforme(134;0.0213)		AGGTTTTCATGCGTAATTCAG	0.398																																						.											0													141.0	152.0	148.0					19																	53057816		2203	4300	6503	SO:0001583	missense	388558			CR749856	CCDS46167.1	19q13.41	2013-01-08			ENSG00000198482	ENSG00000198482		"""Zinc fingers, C2H2-type"", ""-"""	33230	protein-coding gene	gene with protein product							Standard	NM_001039886		Approved		uc010epq.1	Q8N4W9	OTTHUMG00000158230	ENST00000359798.4:c.1647G>T	19.37:g.53057816G>T	ENSP00000352846:p.Met549Ile	Somatic		WXS	Illumina HiSeq	Phase_I	Q68CN7	Missense_Mutation	SNP	ENST00000359798.4	37	CCDS46167.1	.	.	.	.	.	.	.	.	.	.	.	0.142	-1.101126	0.01843	.	.	ENSG00000198482	ENST00000359798	T	0.35048	1.33	1.51	-3.03	0.05429	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.11452	0.0279	N	0.02876	-0.465	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.12708	-1.0537	9	0.30078	T	0.28	.	0.8882	0.01249	0.153:0.2176:0.318:0.3114	.	549	Q8N4W9	ZN808_HUMAN	I	549	ENSP00000352846:M549I	ENSP00000352846:M549I	M	+	3	0	ZNF808	57749628	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-10.447000	0.00006	-1.967000	0.01008	0.205000	0.17691	ATG		0.398	ZNF808-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350447.3	NM_001039886	
SERPINE1	5054	hgsc.bcm.edu;ucsc.edu	37	7	100780310	100780310	+	Silent	SNP	C	C	T	rs550385890		TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr7:100780310C>T	ENST00000223095.4	+	8	1273	c.1116C>T	c.(1114-1116)ccC>ccT	p.P372P	SERPINE1_ENST00000445463.2_Silent_p.P357P	NM_000602.4	NP_000593.1	P05121	PAI1_HUMAN	serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1	372					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular response to lipopolysaccharide (GO:0071222)|chronological cell aging (GO:0001300)|defense response to Gram-negative bacterium (GO:0050829)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|gene expression (GO:0010467)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell migration (GO:0030336)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of plasminogen activation (GO:0010757)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell-matrix adhesion (GO:2000098)|negative regulation of vascular wound healing (GO:0061044)|negative regulation of wound healing (GO:0061045)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of leukotriene production involved in inflammatory response (GO:0035491)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of receptor activity (GO:0010469)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(3)	20	Lung NSC(181;0.136)|all_lung(186;0.182)				Alteplase(DB00009)|Anistreplase(DB00029)|Drotrecogin alfa(DB00055)|Reteplase(DB00015)|Tenecteplase(DB00031)|Urokinase(DB00013)	GCATGGCCCCCGAGGAGATCA	0.582													C|||	1	0.000199681	0.0	0.0	5008	,	,		19048	0.001		0.0	False		,,,				2504	0.0					.											0													134.0	114.0	121.0					7																	100780310		2203	4300	6503	SO:0001819	synonymous_variant	5054			M16006	CCDS5711.1	7q22.1	2014-02-18	2005-08-18		ENSG00000106366	ENSG00000106366		"""Serine (or cysteine) peptidase inhibitors"""	8583	protein-coding gene	gene with protein product	"""plasminogen activator inhibitor, type I"""	173360	"""serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1"""	PLANH1, PAI1		3097076, 2891140, 24172014	Standard	NM_000602		Approved	PAI	uc003uxt.4	P05121	OTTHUMG00000157107	ENST00000223095.4:c.1116C>T	7.37:g.100780310C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B7Z4S0|F8WD53	Silent	SNP	ENST00000223095.4	37	CCDS5711.1																																																																																				0.582	SERPINE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347458.1	NM_000602	
SDR16C5	195814	hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	8	57224802	57224802	+	Missense_Mutation	SNP	C	C	T	rs199932397		TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr8:57224802C>T	ENST00000303749.3	-	3	1016	c.379G>A	c.(379-381)Gga>Aga	p.G127R	SDR16C5_ENST00000522671.1_Missense_Mutation_p.G127R|SDR16C5_ENST00000396721.2_Intron	NM_138969.2	NP_620419.2	Q8N3Y7	RDHE2_HUMAN	short chain dehydrogenase/reductase family 16C, member 5	127					detection of light stimulus involved in visual perception (GO:0050908)|keratinocyte proliferation (GO:0043616)|retinal metabolic process (GO:0042574)|retinol metabolic process (GO:0042572)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	retinol dehydrogenase activity (GO:0004745)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|skin(1)	16						GTTACGATTCCGGCATTGTTG	0.378																																						.											0								C	ARG/GLY	0,4406		0,0,2203	119.0	109.0	112.0		379	4.5	0.5	8		112	2,8598	2.2+/-6.3	0,2,4298	yes	missense	SDR16C5	NM_138969.2	125	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging	127/310	57224802	2,13004	2203	4300	6503	SO:0001583	missense	195814				CCDS6167.1	8q12.1	2011-09-20			ENSG00000170786	ENSG00000170786	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	30311	protein-coding gene	gene with protein product		608989				12372410	Standard	NM_138969		Approved	RDHE2, RDH-E2	uc003xsy.1	Q8N3Y7	OTTHUMG00000164311	ENST00000303749.3:c.379G>A	8.37:g.57224802C>T	ENSP00000307607:p.Gly127Arg	Somatic		WXS	Illumina HiSeq	Phase_I	B4DGK2|Q330K3|Q8TDV9|Q96LX1	Missense_Mutation	SNP	ENST00000303749.3	37	CCDS6167.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.622111	0.87460	0.0	2.33E-4	ENSG00000170786	ENST00000303749;ENST00000522671;ENST00000538514	D;T	0.94758	-3.51;-0.2	5.41	4.53	0.55603	NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.98498	0.9499	H	0.99117	4.435	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	D	0.99056	1.0829	10	0.87932	D	0	.	14.1141	0.65142	0.0:0.9276:0.0:0.0724	.	127;127	G3V145;Q8N3Y7	.;RDHE2_HUMAN	R	127	ENSP00000307607:G127R;ENSP00000431010:G127R	ENSP00000307607:G127R	G	-	1	0	SDR16C5	57387356	1.000000	0.71417	0.454000	0.27019	0.992000	0.81027	5.952000	0.70282	1.291000	0.44653	0.655000	0.94253	GGA		0.378	SDR16C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378235.1	NM_138969	
FAM163A	148753	broad.mit.edu	37	1	179782953	179782953	+	Missense_Mutation	SNP	G	G	A			TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr1:179782953G>A	ENST00000341785.4	+	5	529	c.133G>A	c.(133-135)Gag>Aag	p.E45K	RP11-12M5.3_ENST00000415218.1_RNA|RP11-12M5.3_ENST00000453051.1_RNA	NM_173509.2	NP_775780.1	Q96GL9	F163A_HUMAN	family with sequence similarity 163, member A	45						integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(1)	15						GGTTGCAGACGAGGAGGAGGA	0.642																																						.											0													51.0	46.0	48.0					1																	179782953		2203	4300	6503	SO:0001583	missense	148753			BC009382	CCDS1333.1	1q25.2	2008-06-05	2008-06-05	2008-06-05	ENSG00000143340	ENSG00000143340			28274	protein-coding gene	gene with protein product		611727	"""chromosome 1 open reading frame 76"""	C1orf76		12477932	Standard	NM_173509		Approved	MGC16664	uc001gnj.3	Q96GL9	OTTHUMG00000035262	ENST00000341785.4:c.133G>A	1.37:g.179782953G>A	ENSP00000354891:p.Glu45Lys	Somatic		WXS	Illumina HiSeq	Phase_I	A8K8R7	Missense_Mutation	SNP	ENST00000341785.4	37	CCDS1333.1	.	.	.	.	.	.	.	.	.	.	G	18.58	3.654145	0.67472	.	.	ENSG00000143340	ENST00000341785	.	.	.	4.63	4.63	0.57726	.	0.524877	0.22200	N	0.063250	T	0.43700	0.1259	L	0.36672	1.1	0.47407	D	0.999414	D	0.52996	0.957	B	0.38880	0.284	T	0.52071	-0.8624	9	0.52906	T	0.07	-5.0697	17.4521	0.87595	0.0:0.0:1.0:0.0	.	45	Q96GL9	F163A_HUMAN	K	45	.	ENSP00000354891:E45K	E	+	1	0	FAM163A	178049576	0.999000	0.42202	0.964000	0.40570	0.559000	0.35586	3.571000	0.53841	2.293000	0.77203	0.462000	0.41574	GAG		0.642	FAM163A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085300.1	NM_173509	
OR51T1	401665	broad.mit.edu;mdanderson.org	37	11	4903765	4903765	+	Silent	SNP	C	C	T	rs138268565	byFrequency	TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr11:4903765C>T	ENST00000322049.1	+	1	636	c.636C>T	c.(634-636)gaC>gaT	p.D212D	OR51T1_ENST00000380378.1_Silent_p.D239D|MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron			Q8NGJ9	O51T1_HUMAN	olfactory receptor, family 51, subfamily T, member 1	212						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	34		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		ATGGCACTGACGTATTGTTTA	0.443													c|||	2	0.000399361	0.0	0.0029	5008	,	,		22131	0.0		0.0	False		,,,				2504	0.0					.											0								T		0,4402		0,0,2201	115.0	106.0	109.0		717	-1.6	0.7	11	dbSNP_134	109	2,8594	2.2+/-6.3	0,2,4296	no	coding-synonymous	OR51T1	NM_001004759.1		0,2,6497	TT,TC,CC		0.0233,0.0,0.0154		239/355	4903765	2,12996	2201	4298	6499	SO:0001819	synonymous_variant	401665			BK004283	CCDS31363.1	11p15.4	2012-08-09			ENSG00000176900	ENSG00000176900		"""GPCR / Class A : Olfactory receptors"""	15205	protein-coding gene	gene with protein product							Standard	NM_001004759		Approved		uc010qyp.2	Q8NGJ9	OTTHUMG00000066507	ENST00000322049.1:c.636C>T	11.37:g.4903765C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q6IFH9	Silent	SNP	ENST00000322049.1	37																																																																																					0.443	OR51T1-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000142180.1	NM_001004759	
OR5M9	390162	broad.mit.edu	37	11	56230414	56230414	+	Missense_Mutation	SNP	A	A	G			TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr11:56230414A>G	ENST00000279791.1	-	1	463	c.464T>C	c.(463-465)cTa>cCa	p.L155P		NM_001004743.1	NP_001004743.1	Q8NGP3	OR5M9_HUMAN	olfactory receptor, family 5, subfamily M, member 9	155						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(4)|urinary_tract(2)	36	Esophageal squamous(21;0.00448)					TGTGCATATTAGGCTGACAGA	0.458																																						.											0													94.0	96.0	96.0					11																	56230414		2201	4296	6497	SO:0001583	missense	390162			AB065747	CCDS31531.1	11q11	2012-08-09			ENSG00000150269	ENSG00000150269		"""GPCR / Class A : Olfactory receptors"""	15294	protein-coding gene	gene with protein product							Standard	NM_001004743		Approved		uc010rjj.2	Q8NGP3	OTTHUMG00000166874	ENST00000279791.1:c.464T>C	11.37:g.56230414A>G	ENSP00000279791:p.Leu155Pro	Somatic		WXS	Illumina HiSeq	Phase_I	Q6IEW5|Q96RB9	Missense_Mutation	SNP	ENST00000279791.1	37	CCDS31531.1	.	.	.	.	.	.	.	.	.	.	A	12.97	2.096068	0.36952	.	.	ENSG00000150269	ENST00000279791	T	0.00285	8.3	4.63	4.63	0.57726	GPCR, rhodopsin-like superfamily (1);	0.000000	0.37219	N	0.002191	T	0.00724	0.0024	M	0.92026	3.265	0.25397	N	0.988475	D	0.71674	0.998	D	0.76575	0.988	T	0.28808	-1.0032	10	0.66056	D	0.02	-3.3219	7.1803	0.25768	0.8977:0.0:0.1023:0.0	.	155	Q8NGP3	OR5M9_HUMAN	P	155	ENSP00000279791:L155P	ENSP00000279791:L155P	L	-	2	0	OR5M9	55986990	0.000000	0.05858	0.091000	0.20842	0.438000	0.31896	1.335000	0.33839	1.847000	0.53656	0.443000	0.29094	CTA		0.458	OR5M9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391638.1	NM_001004743	
NCOR2	9612	broad.mit.edu	37	12	124819113	124819113	+	Silent	SNP	T	T	G			TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr12:124819113T>G	ENST00000405201.1	-	41	6462	c.6462A>C	c.(6460-6462)gcA>gcC	p.A2154A	NCOR2_ENST00000429285.2_Silent_p.A2144A|NCOR2_ENST00000404121.2_Silent_p.A1715A|NCOR2_ENST00000356219.3_Silent_p.A2161A|NCOR2_ENST00000404621.1_Silent_p.A2144A|NCOR2_ENST00000397355.1_Silent_p.A2145A			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	2165					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		CGGGCAGGGGTGCGCTGAGCT	0.692																																						.											0													6.0	9.0	8.0					12																	124819113		2041	4111	6152	SO:0001819	synonymous_variant	9612			U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.6462A>C	12.37:g.124819113T>G		Somatic		WXS	Illumina HiSeq	Phase_I	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Silent	SNP	ENST00000405201.1	37	CCDS41858.2	.	.	.	.	.	.	.	.	.	.	t	1.066	-0.671344	0.03403	.	.	ENSG00000196498	ENST00000443451	.	.	.	4.4	-6.49	0.01890	.	.	.	.	.	T	0.34106	0.0886	.	.	.	0.35397	D	0.791261	.	.	.	.	.	.	T	0.39722	-0.9600	4	.	.	.	-0.8161	2.2268	0.03986	0.1512:0.1274:0.3748:0.3466	.	.	.	.	P	27	.	.	H	-	2	0	NCOR2	123385066	0.008000	0.16893	0.012000	0.15200	0.049000	0.14656	-1.776000	0.01781	-1.142000	0.02869	-0.618000	0.04049	CAC		0.692	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318173.2	NM_006312	
MAP3K9	4293	broad.mit.edu	37	14	71206799	71206799	+	Frame_Shift_Del	DEL	A	A	-			TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr14:71206799delA	ENST00000554752.2	-	7	1649	c.1650delT	c.(1648-1650)cctfs	p.P550fs	MAP3K9_ENST00000381250.4_Frame_Shift_Del_p.P550fs|MAP3K9_ENST00000553414.1_Frame_Shift_Del_p.P244fs|MAP3K9_ENST00000555993.2_Frame_Shift_Del_p.P550fs|MAP3K9_ENST00000554146.1_Frame_Shift_Del_p.P287fs	NM_001284230.1	NP_001271159.1	P80192	M3K9_HUMAN	mitogen-activated protein kinase kinase kinase 9	550					activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)		ATP binding (GO:0005524)|JUN kinase kinase kinase activity (GO:0004706)|MAP kinase kinase activity (GO:0004708)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(1)|skin(3)|stomach(2)	46				all cancers(60;0.00779)|BRCA - Breast invasive adenocarcinoma(234;0.00884)|OV - Ovarian serous cystadenocarcinoma(108;0.08)		TGGGGCTTGCAGGAGGACTGG	0.552																																					GBM(114;411 1587 13539 28235 50070)	.											0													149.0	135.0	140.0					14																	71206799		2203	4300	6503	SO:0001589	frameshift_variant	4293			AF251442	CCDS32112.1, CCDS61485.1, CCDS61488.1, CCDS73650.1	14q24.2	2012-10-02			ENSG00000006432	ENSG00000006432		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6861	protein-coding gene	gene with protein product		600136		MLK1			Standard	NM_001284231		Approved	PRKE1, MEKK9	uc001xml.3	P80192	OTTHUMG00000171249	ENST00000554752.2:c.1650delT	14.37:g.71206799delA	ENSP00000451612:p.Pro550fs	Somatic		WXS	Illumina HiSeq	Phase_I	A3KN85|Q0D2G7|Q6EH31|Q9H2N5	Frame_Shift_Del	DEL	ENST00000554752.2	37																																																																																					0.552	MAP3K9-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412550.2		
IRF2BPL	64207	broad.mit.edu	37	14	77493792	77493794	+	In_Frame_Del	DEL	TGT	TGT	-	rs377151545|rs28718623|rs71125518	byFrequency	TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	TGT	TGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr14:77493792_77493794delTGT	ENST00000238647.3	-	1	1240_1242	c.342_344delACA	c.(340-345)caacag>cag	p.114_115QQ>Q		NM_024496.3	NP_078772.1	Q9H1B7	I2BPL_HUMAN	interferon regulatory factor 2 binding protein-like	114	Poly-Gln.				development of secondary female sexual characteristics (GO:0046543)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	extracellular space (GO:0005615)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	11						ctgctgctgctgttgctgctgct	0.7																																						.											0										1119,1147		390,339,404						-1.3	0.0			2	2585,1523		1057,471,526	no	coding	IRF2BPL	NM_024496.2		1447,810,930	A1A1,A1R,RR		37.074,49.3822,41.8889				3704,2670				SO:0001651	inframe_deletion	64207			AJ277365	CCDS9854.1	14q24.3	2011-02-23	2011-02-23	2011-02-23	ENSG00000119669	ENSG00000119669			14282	protein-coding gene	gene with protein product	"""enhanced at puberty 1"""	611720	"""chromosome 14 open reading frame 4"""	C14orf4		11095982, 17627301	Standard	NM_024496		Approved	EAP1, KIAA1865	uc001xsy.4	Q9H1B7		ENST00000238647.3:c.342_344delACA	14.37:g.77493792_77493794delTGT	ENSP00000238647:p.Gln127del	Somatic		WXS	Illumina HiSeq	Phase_I	Q8NDQ2|Q96JG2|Q9H3I7	In_Frame_Del	DEL	ENST00000238647.3	37	CCDS9854.1																																																																																				0.700	IRF2BPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414298.1	NM_024496	
GPR139	124274	broad.mit.edu	37	16	20084858	20084858	+	Frame_Shift_Del	DEL	G	G	-			TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr16:20084858delG	ENST00000570682.1	-	1	381	c.81delC	c.(79-81)ttcfs	p.F27fs		NM_001002911.2	NP_001002911.1	Q6DWJ6	GP139_HUMAN	G protein-coupled receptor 139	27					G-protein coupled receptor signaling pathway (GO:0007186)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	30						CCACGGGCACGAAACCCAAGC	0.682																																						.											0													35.0	35.0	35.0					16																	20084858		2199	4299	6498	SO:0001589	frameshift_variant	124274			AY255545	CCDS32398.1	16p13.11	2012-08-21						"""GPCR / Class A : Orphans"""	19995	protein-coding gene	gene with protein product						12679517	Standard	XM_005255114		Approved	PGR3	uc002dgu.1	Q6DWJ6		ENST00000570682.1:c.81delC	16.37:g.20084858delG	ENSP00000458791:p.Phe27fs	Somatic		WXS	Illumina HiSeq	Phase_I	A8K5R9|Q86SP2|Q8TDU8	Frame_Shift_Del	DEL	ENST00000570682.1	37	CCDS32398.1																																																																																				0.682	GPR139-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438522.1	NM_001002911	
DDX19A	55308	broad.mit.edu	37	16	70405336	70405336	+	Silent	SNP	G	G	A			TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr16:70405336G>A	ENST00000302243.7	+	11	1408	c.1245G>A	c.(1243-1245)ggG>ggA	p.G415G	DDX19A_ENST00000417604.2_Silent_p.G384G|DDX19A_ENST00000443119.2_Silent_p.G325G	NM_018332.3	NP_060802.1	Q9NUU7	DD19A_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 19A	415	C-terminal lobe. {ECO:0000250}.|Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				mRNA transport (GO:0051028)|positive regulation of apoptotic process (GO:0043065)|protein transport (GO:0015031)|response to zinc ion (GO:0010043)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear pore (GO:0005643)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|large_intestine(5)|lung(3)|urinary_tract(1)	11		Ovarian(137;0.221)				ACAAGGACGGGAATCCTGACA	0.557																																						.											0													57.0	52.0	54.0					16																	70405336		2197	4280	6477	SO:0001819	synonymous_variant	55308			AF183422	CCDS10889.1	16q22.1	2012-02-23	2012-02-23	2005-07-13	ENSG00000168872	ENSG00000168872		"""DEAD-boxes"""	25628	protein-coding gene	gene with protein product			"""DEAD (Asp-Glu-Ala-As) box polypeptide 19-like"""	DDX19L		12477932	Standard	NM_018332		Approved	FLJ11126		Q9NUU7	OTTHUMG00000137579	ENST00000302243.7:c.1245G>A	16.37:g.70405336G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B2RPL0|B4DRZ7|Q53FM0	Silent	SNP	ENST00000302243.7	37	CCDS10889.1																																																																																				0.557	DDX19A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268967.2	NM_018332	
COL8A1	1295	broad.mit.edu;mdanderson.org	37	3	99514923	99514923	+	Silent	SNP	G	G	A			TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr3:99514923G>A	ENST00000261037.3	+	5	2558	c.2178G>A	c.(2176-2178)ctG>ctA	p.L726L	COL8A1_ENST00000273342.4_Silent_p.L726L	NM_001850.4	NP_001841.2	P27658	CO8A1_HUMAN	collagen, type VIII, alpha 1	726	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.|Nonhelical region (NC1).				angiogenesis (GO:0001525)|camera-type eye morphogenesis (GO:0048593)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epithelial cell proliferation (GO:0050673)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	collagen type VIII trimer (GO:0005591)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)				breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(15)|skin(5)|upper_aerodigestive_tract(1)	27						CTGCAGGACTGTATGCCGGGC	0.473																																						.											0													35.0	35.0	35.0					3																	99514923		2203	4300	6503	SO:0001819	synonymous_variant	1295			AF170702	CCDS2934.1	3q11.1-q13.2	2013-01-16			ENSG00000144810	ENSG00000144810		"""Collagens"""	2215	protein-coding gene	gene with protein product		120251	"""chromosome 3 open reading frame 7"""	C3orf7		2029894	Standard	NM_001850		Approved	MGC9568	uc003dth.2	P27658	OTTHUMG00000148669	ENST00000261037.3:c.2178G>A	3.37:g.99514923G>A		Somatic		WXS	Illumina HiSeq	Phase_I	D3DN42|Q53XI6|Q96D07	Silent	SNP	ENST00000261037.3	37	CCDS2934.1																																																																																				0.473	COL8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309001.1	NM_001850	
MAP9	79884	broad.mit.edu;ucsc.edu;mdanderson.org	37	4	156294336	156294336	+	Missense_Mutation	SNP	T	T	C			TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr4:156294336T>C	ENST00000311277.4	-	4	696	c.433A>G	c.(433-435)Aaa>Gaa	p.K145E	AC097467.2_ENST00000596165.1_RNA|MAP9_ENST00000379248.2_Missense_Mutation_p.K73E|MAP9_ENST00000515654.1_Missense_Mutation_p.K145E	NM_001039580.1	NP_001034669.1	Q49MG5	MAP9_HUMAN	microtubule-associated protein 9	145					cytokinesis (GO:0000910)|regulation of mitosis (GO:0007088)|spindle assembly involved in mitosis (GO:0090307)	astral microtubule (GO:0000235)|mitotic spindle midzone (GO:1990023)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	26	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.143)		GGTTTCATTTTTATTTTGTCT	0.303																																						.											0													43.0	45.0	44.0					4																	156294336		2202	4300	6502	SO:0001583	missense	79884			AK024812	CCDS35493.1	4q32.1	2008-02-05			ENSG00000164114	ENSG00000164114			26118	protein-coding gene	gene with protein product	"""aster-associated protein"""	610070				16049101	Standard	XM_006714306		Approved	ASAP, FLJ21159	uc003ios.3	Q49MG5	OTTHUMG00000133628	ENST00000311277.4:c.433A>G	4.37:g.156294336T>C	ENSP00000310593:p.Lys145Glu	Somatic		WXS	Illumina HiSeq	Phase_I	Q4W5I7|Q68DU1|Q9H781|Q9H7B6	Missense_Mutation	SNP	ENST00000311277.4	37	CCDS35493.1	.	.	.	.	.	.	.	.	.	.	T	11.89	1.774899	0.31411	.	.	ENSG00000164114	ENST00000311277;ENST00000515654;ENST00000433024;ENST00000393836;ENST00000379248	T;T;T;T	0.35421	2.14;2.15;1.41;1.31	5.84	-1.67	0.08238	.	0.700052	0.14170	N	0.336772	T	0.30262	0.0759	L	0.52364	1.645	0.09310	N	1	B;P;B;B	0.51537	0.001;0.946;0.01;0.01	B;P;B;B	0.45639	0.004;0.488;0.006;0.006	T	0.18808	-1.0325	10	0.66056	D	0.02	-4.9641	4.9297	0.13910	0.0:0.2786:0.2805:0.4409	.	145;73;145;145	B4DVG9;A8MSM7;B9EJB6;Q49MG5	.;.;.;MAP9_HUMAN	E	145;145;145;145;73	ENSP00000310593:K145E;ENSP00000427402:K145E;ENSP00000394048:K145E;ENSP00000368550:K73E	ENSP00000310593:K145E	K	-	1	0	MAP9	156513786	0.000000	0.05858	0.000000	0.03702	0.583000	0.36354	0.003000	0.13083	-0.184000	0.10567	0.455000	0.32223	AAA		0.303	MAP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257771.3	NM_001039580	
HCN1	348980	broad.mit.edu;ucsc.edu;mdanderson.org	37	5	45267264	45267264	+	Silent	SNP	G	G	A	rs141455774	byFrequency	TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr5:45267264G>A	ENST00000303230.4	-	7	1767	c.1710C>T	c.(1708-1710)aaC>aaT	p.N570N		NM_021072.3	NP_066550.2	O60741	HCN1_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 1	570					apical protein localization (GO:0045176)|cellular response to cAMP (GO:0071320)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|retinal cone cell development (GO:0046549)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|intracellular cAMP activated cation channel activity (GO:0005222)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(3)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(21)|liver(1)|lung(98)|ovary(1)|prostate(7)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(5)	156						CCAGGACCTCGTTGAAATTGT	0.428																																						.											0								G		4,4402	8.1+/-20.4	0,4,2199	156.0	143.0	147.0		1710	1.9	1.0	5	dbSNP_134	147	0,8600		0,0,4300	no	coding-synonymous	HCN1	NM_021072.3		0,4,6499	AA,AG,GG		0.0,0.0908,0.0308		570/891	45267264	4,13002	2203	4300	6503	SO:0001819	synonymous_variant	348980			AF064876	CCDS3952.1	5p12	2011-07-05			ENSG00000164588	ENSG00000164588		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4845	protein-coding gene	gene with protein product		602780		BCNG1		9405696, 9630217, 16382102	Standard	NM_021072		Approved	BCNG-1, HAC-2	uc003jok.3	O60741	OTTHUMG00000131155	ENST00000303230.4:c.1710C>T	5.37:g.45267264G>A		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000303230.4	37	CCDS3952.1																																																																																				0.428	HCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253847.1	NM_021072	
VPS13B	157680	broad.mit.edu	37	8	100832274	100832274	+	Missense_Mutation	SNP	A	A	G			TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr8:100832274A>G	ENST00000358544.2	+	49	9104	c.8993A>G	c.(8992-8994)gAc>gGc	p.D2998G	VPS13B_ENST00000357162.2_Missense_Mutation_p.D2973G|VPS13B_ENST00000395996.1_3'UTR	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	2998					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			TCCAAATGGGACCTCTGGCTA	0.393																																					Colon(161;2205 2542 7338 31318)	.											0													124.0	129.0	127.0					8																	100832274		2203	4300	6503	SO:0001583	missense	157680			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.8993A>G	8.37:g.100832274A>G	ENSP00000351346:p.Asp2998Gly	Somatic		WXS	Illumina HiSeq	Phase_I	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	ENST00000358544.2	37	CCDS6280.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.203194	0.79127	.	.	ENSG00000132549	ENST00000357162;ENST00000358544	T;T	0.80480	-1.38;-1.38	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	D	0.83147	0.5191	N	0.19112	0.55	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	D	0.85178	0.1002	10	0.54805	T	0.06	.	16.3526	0.83220	1.0:0.0:0.0:0.0	.	2973;2998	Q7Z7G8-2;Q7Z7G8	.;VP13B_HUMAN	G	2973;2998	ENSP00000349685:D2973G;ENSP00000351346:D2998G	ENSP00000349685:D2973G	D	+	2	0	VPS13B	100901450	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.255000	0.74692	0.533000	0.62120	GAC		0.393	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042	
UBR5	51366	broad.mit.edu;mdanderson.org;bcgsc.ca	37	8	103324629	103324629	+	Missense_Mutation	SNP	C	C	G			TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr8:103324629C>G	ENST00000520539.1	-	17	2698	c.2092G>C	c.(2092-2094)Gat>Cat	p.D698H	UBR5_ENST00000521922.1_Missense_Mutation_p.D692H|UBR5_ENST00000220959.4_Missense_Mutation_p.D698H	NM_001282873.1|NM_015902.5	NP_001269802.1|NP_056986.2	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin 5	698					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of protein import into nucleus, translocation (GO:0033160)|progesterone receptor signaling pathway (GO:0050847)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-ubiquitin ligase activity (GO:0034450)|zinc ion binding (GO:0008270)			NS(1)|breast(13)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(19)|liver(1)|lung(51)|ovary(6)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	124	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			GGGTCAGCATCTGGACCAGAG	0.408																																					Ovarian(131;96 1741 5634 7352 27489)	.											0													103.0	97.0	99.0					8																	103324629		2203	4300	6503	SO:0001583	missense	51366			AF006010	CCDS34933.1, CCDS64946.1	8q22	2008-06-23	2007-06-19	2007-06-19	ENSG00000104517	ENSG00000104517		"""Ubiquitin protein ligase E3 component n-recognins"""	16806	protein-coding gene	gene with protein product		608413	"""E3 ubiquitin protein ligase, HECT domain containing, 1"""	EDD1		10030672, 16055722	Standard	NM_015902		Approved	DD5, HYD, EDD, KIAA0896	uc003ykr.2	O95071	OTTHUMG00000164755	ENST00000520539.1:c.2092G>C	8.37:g.103324629C>G	ENSP00000429084:p.Asp698His	Somatic		WXS	Illumina HiSeq	Phase_I	B2RP24|J3KMW7|O94970|Q9NPL3	Missense_Mutation	SNP	ENST00000520539.1	37	CCDS34933.1	.	.	.	.	.	.	.	.	.	.	C	19.22	3.784670	0.70222	.	.	ENSG00000104517	ENST00000520539;ENST00000220959;ENST00000521922	T;T;T	0.52057	0.68;0.68;0.68	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	T	0.63307	0.2500	L	0.42245	1.32	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.77557	0.99;0.99	T	0.65429	-0.6170	10	0.66056	D	0.02	.	18.7881	0.91963	0.0:1.0:0.0:0.0	.	692;698	E7EMW7;O95071	.;UBR5_HUMAN	H	698;698;692	ENSP00000429084:D698H;ENSP00000220959:D698H;ENSP00000427819:D692H	ENSP00000220959:D698H	D	-	1	0	UBR5	103393805	1.000000	0.71417	0.996000	0.52242	0.967000	0.64934	7.818000	0.86416	2.449000	0.82847	0.591000	0.81541	GAT		0.408	UBR5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380075.2	NM_015902	
FRMPD4	9758	broad.mit.edu	37	X	12735002	12735002	+	Silent	SNP	C	C	T			TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chrX:12735002C>T	ENST00000380682.1	+	15	2930	c.2424C>T	c.(2422-2424)gcC>gcT	p.A808A		NM_014728.3	NP_055543.2	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	808					positive regulation of synapse structural plasticity (GO:0051835)	cytoskeleton (GO:0005856)|dendritic spine (GO:0043197)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			breast(1)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)	22						TGGCCATTGCCGCACCCCCAC	0.547																																						.											0													152.0	114.0	127.0					X																	12735002		2203	4300	6503	SO:0001819	synonymous_variant	9758			AB002314	CCDS35201.1	Xp22.31	2006-02-09	2006-02-09	2006-02-09	ENSG00000169933	ENSG00000169933			29007	protein-coding gene	gene with protein product		300838	"""PDZ domain containing 10"""	PDZK10, PDZD10		9205841	Standard	NM_014728		Approved	KIAA0316	uc004cuz.2	Q14CM0	OTTHUMG00000021138	ENST00000380682.1:c.2424C>T	X.37:g.12735002C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A8K0X9|O15032	Silent	SNP	ENST00000380682.1	37	CCDS35201.1																																																																																				0.547	FRMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055771.1	XM_045712	
BRWD3	254065	broad.mit.edu	37	X	79932729	79932729	+	Silent	SNP	T	T	C			TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chrX:79932729T>C	ENST00000373275.4	-	41	5004	c.4788A>G	c.(4786-4788)aaA>aaG	p.K1596K	BRWD3_ENST00000473691.1_5'Flank	NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	1596			K -> E (in MRX93; may be a rare polymorphism). {ECO:0000269|PubMed:17668385}.		cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)					breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						GAGAtttctcttttgtttctt	0.408																																						.											0													72.0	64.0	66.0					X																	79932729		2203	4300	6503	SO:0001819	synonymous_variant	254065				CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.4788A>G	X.37:g.79932729T>C		Somatic		WXS	Illumina HiSeq	Phase_I	C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Silent	SNP	ENST00000373275.4	37	CCDS14447.1																																																																																				0.408	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057344.1	NM_153252	
SPANXD	64648	broad.mit.edu;mdanderson.org	37	X	140785755	140785755	+	Missense_Mutation	SNP	C	C	T	rs368985448		TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chrX:140785755C>T	ENST00000370515.3	-	2	494	c.161G>A	c.(160-162)cGc>cAc	p.R54H		NM_032417.2|NM_145665.1	NP_115793.1|NP_663698.1	Q9BXN6	SPNXD_HUMAN	SPANX family, member D	54						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.R54H(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	9	Acute lymphoblastic leukemia(192;7.65e-05)					CCTCCTGTAGCGAACCACTAG	0.483																																						.											1	Substitution - Missense(1)	upper_aerodigestive_tract(1)						C	HIS/ARG	0,3834		0,0,1632,570	232.0	175.0	194.0		161		0.0	X		194	1,6715		0,1,2427,1860	no	missense	SPANXD	NM_032417.2	29	0,1,4059,2430	TT,TC,CC,C		0.0149,0.0,0.0095	probably-damaging	54/98	140785755	1,10549	2202	4288	6490	SO:0001583	missense	171489			AJ457791	CCDS14675.1	Xq27.2	2014-06-19			ENSG00000196406	ENSG00000196406			14332	protein-coding gene	gene with protein product	"""cancer/testis antigen family 11, member 4"""	300670, 300671	"""SPANX family, member E"""	SPANXE			Standard	NM_032417		Approved	CT11.4		Q9BXN6	OTTHUMG00000022563	ENST00000370515.3:c.161G>A	X.37:g.140785755C>T	ENSP00000359546:p.Arg54His	Somatic		WXS	Illumina HiSeq	Phase_I	Q5JWI1	Missense_Mutation	SNP	ENST00000370515.3	37	CCDS14675.1	.	.	.	.	.	.	.	.	.	.	N	9.220	1.033247	0.19590	0.0	1.49E-4	ENSG00000196406	ENST00000370515	T	0.06933	3.24	.	.	.	.	.	.	.	.	T	0.11324	0.0276	.	.	.	0.09310	N	1	D	0.67145	0.996	P	0.59703	0.862	T	0.25641	-1.0126	6	0.15952	T	0.53	.	.	.	.	.	54	Q9BXN6	SPNXD_HUMAN	H	54	ENSP00000359546:R54H	ENSP00000359546:R54H	R	-	2	0	SPANXD	140613421	0.006000	0.16342	0.001000	0.08648	0.006000	0.05464	0.064000	0.14437	-0.506000	0.06558	0.068000	0.15388	CGC		0.483	SPANXD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058598.1		
CHID1	66005	broad.mit.edu	37	11	869923	869924	+	Frame_Shift_Ins	INS	-	-	C			TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr11:869923_869924insC	ENST00000449825.1	-	13	1472_1473	c.1116_1117insG	c.(1114-1119)gagctgfs	p.L373fs	CHID1_ENST00000429789.2_Frame_Shift_Ins_p.L342fs|CHID1_ENST00000436108.2_Frame_Shift_Ins_p.L373fs|CHID1_ENST00000336845.5_Frame_Shift_Ins_p.L398fs|CHID1_ENST00000323541.7_Frame_Shift_Ins_p.L403fs|CHID1_ENST00000528581.1_Frame_Shift_Ins_p.L398fs|CHID1_ENST00000323578.8_Frame_Shift_Ins_p.L373fs|CHID1_ENST00000526714.1_5'Flank|CHID1_ENST00000454838.2_Frame_Shift_Ins_p.L398fs	NM_001142675.1	NP_001136147.1	Q9BWS9	CHID1_HUMAN	chitinase domain containing 1	373					carbohydrate metabolic process (GO:0005975)|chitin catabolic process (GO:0006032)|innate immune response (GO:0045087)|negative regulation of cytokine production involved in inflammatory response (GO:1900016)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	chitinase activity (GO:0004568)|oligosaccharide binding (GO:0070492)			endometrium(4)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	13		all_cancers(49;9.46e-06)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;5.48e-25)|Epithelial(43;3.75e-24)|BRCA - Breast invasive adenocarcinoma(625;4.65e-05)|Lung(200;0.0624)|LUSC - Lung squamous cell carcinoma(625;0.0735)		CCAACGCCCAGCTCCCGGGCCA	0.663																																					Pancreas(117;992 2327 5172 41921)	.											0																																										SO:0001589	frameshift_variant	66005			AK124697	CCDS7722.1, CCDS44510.1, CCDS44511.1	11p15.5	2005-10-27			ENSG00000177830	ENSG00000177830			28474	protein-coding gene	gene with protein product		615692					Standard	NM_023947		Approved	MGC3234, FLJ42707	uc001lsm.3	Q9BWS9	OTTHUMG00000133314	ENST00000449825.1:c.1117dupG	11.37:g.869924_869924dupC	ENSP00000391255:p.Leu373fs	Somatic		WXS	Illumina HiSeq	Phase_I	B3KWB0|Q8NBM9|Q96CZ3|Q96S93|Q96SK0|Q9BY52	Frame_Shift_Ins	INS	ENST00000449825.1	37	CCDS7722.1																																																																																				0.663	CHID1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257112.1	NM_023947	
TBC1D32	221322	ucsc.edu	37	6	121436334	121436334	+	Missense_Mutation	SNP	T	T	C	rs201909100		TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr6:121436334T>C	ENST00000398212.2	-	27	3086	c.3037A>G	c.(3037-3039)Att>Gtt	p.I1013V	TBC1D32_ENST00000275159.6_Missense_Mutation_p.I1054V|TBC1D32_ENST00000398197.2_5'UTR	NM_152730.4	NP_689943.4	Q96NH3	BROMI_HUMAN	TBC1 domain family, member 32	1013					cilium morphogenesis (GO:0060271)|embryonic digit morphogenesis (GO:0042733)|lens development in camera-type eye (GO:0002088)|protein localization to cilium (GO:0061512)|retinal pigment epithelium development (GO:0003406)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cilium (GO:0005929)|cytoplasm (GO:0005737)	Rab GTPase activator activity (GO:0005097)										GTCATTTTAATGCCAAGCTGC	0.343													T|||	1	0.000199681	0.0008	0.0	5008	,	,		16598	0.0		0.0	False		,,,				2504	0.0					.											0													104.0	97.0	99.0					6																	121436334		1828	4102	5930	SO:0001583	missense	221322			AK055461	CCDS43501.1	6q22.31	2014-02-20	2013-07-10	2013-07-10	ENSG00000146350	ENSG00000146350			21485	protein-coding gene	gene with protein product	"""broad-minded homolog"""	615867	"""chromosome 6 open reading frame 171"", ""chromosome 6 open reading frame 170"""	C6orf171, C6orf170		20159594, 24285566	Standard	NM_152730		Approved	FLJ30899, dJ310J6.1, FLJ34235, bA57L9.1, BROMI	uc003pyo.1	Q96NH3	OTTHUMG00000015474	ENST00000398212.2:c.3037A>G	6.37:g.121436334T>C	ENSP00000381270:p.Ile1013Val	Somatic		WXS	Illumina HiSeq	Phase_I	Q5SZD6|Q5SZM6|Q6ZMY4|Q6ZUR7|Q8NB47	Missense_Mutation	SNP	ENST00000398212.2	37	CCDS43501.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	T	3.083	-0.188580	0.06299	.	.	ENSG00000146350	ENST00000275159;ENST00000398212	T;T	0.16073	2.37;2.37	5.73	2.05	0.26809	.	0.221573	0.48286	N	0.000192	T	0.02571	0.0078	N	0.13327	0.33	0.27263	N	0.958571	B;B	0.06786	0.0;0.001	B;B	0.09377	0.001;0.004	T	0.46652	-0.9176	10	0.20519	T	0.43	.	9.4136	0.38507	0.0:0.3515:0.0:0.6485	.	1054;1013	Q96NH3-4;Q96NH3	.;BROMI_HUMAN	V	1054;1013	ENSP00000275159:I1054V;ENSP00000381270:I1013V	ENSP00000275159:I1054V	I	-	1	0	C6orf170	121478033	0.828000	0.29307	0.988000	0.46212	0.995000	0.86356	0.119000	0.15626	0.177000	0.19895	0.533000	0.62120	ATT		0.343	TBC1D32-005	PUTATIVE	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380937.2	NM_152730	
EPOR	2057	ucsc.edu	37	19	11488817	11488817	+	Missense_Mutation	SNP	A	A	G			TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr19:11488817A>G	ENST00000222139.6	-	8	1474	c.1370T>C	c.(1369-1371)cTt>cCt	p.L457P	EPOR_ENST00000592375.2_3'UTR	NM_000121.3	NP_000112.1	P19235	EPOR_HUMAN	erythropoietin receptor	457					brain development (GO:0007420)|decidualization (GO:0046697)|erythropoietin-mediated signaling pathway (GO:0038162)|heart development (GO:0007507)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	erythropoietin receptor activity (GO:0004900)|identical protein binding (GO:0042802)			endometrium(1)|lung(2)|ovary(1)|urinary_tract(1)	5					Darbepoetin alfa(DB00012)|Epoetin alfa(DB00016)|Epoetin Zeta(DB08923)|Peginesatide(DB08894)	AGATACCACAAGGTACAGGTA	0.577											OREG0025254	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										.											0													69.0	74.0	72.0					19																	11488817		2203	4300	6503	SO:0001583	missense	2057			M34986	CCDS12260.1	19p13.3-p13.2	2013-02-11				ENSG00000187266		"""Fibronectin type III domain containing"""	3416	protein-coding gene	gene with protein product		133171					Standard	NM_000121		Approved		uc002mrj.2	P19235		ENST00000222139.6:c.1370T>C	19.37:g.11488817A>G	ENSP00000222139:p.Leu457Pro	Somatic	672	WXS	Illumina HiSeq	Phase_I	B2RCG4|Q15443|Q2M205	Missense_Mutation	SNP	ENST00000222139.6	37	CCDS12260.1	.	.	.	.	.	.	.	.	.	.	A	15.93	2.977074	0.53720	.	.	ENSG00000187266	ENST00000222139	T	0.44482	0.92	4.82	4.82	0.62117	.	0.710381	0.13856	N	0.358052	T	0.50086	0.1595	L	0.32530	0.975	0.53688	D	0.999979	D	0.76494	0.999	D	0.70716	0.97	T	0.49113	-0.8973	10	0.87932	D	0	-36.5626	7.9588	0.30060	0.8174:0.0:0.0:0.1826	.	457	P19235	EPOR_HUMAN	P	457	ENSP00000222139:L457P	ENSP00000222139:L457P	L	-	2	0	EPOR	11349817	0.998000	0.40836	0.751000	0.31187	0.801000	0.45260	4.194000	0.58393	1.793000	0.52555	0.454000	0.30748	CTT		0.577	EPOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458791.1		
MYH14	79784	ucsc.edu	37	19	50755954	50755954	+	Missense_Mutation	SNP	T	T	C			TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr19:50755954T>C	ENST00000596571.1	+	14	1865	c.1865T>C	c.(1864-1866)gTc>gCc	p.V622A	MYH14_ENST00000440075.2_Missense_Mutation_p.V630A|MYH14_ENST00000425460.1_Missense_Mutation_p.V630A|MYH14_ENST00000376970.2_Missense_Mutation_p.V622A|MYH14_ENST00000601313.1_Missense_Mutation_p.V630A|MYH14_ENST00000598205.1_Missense_Mutation_p.V630A|MYH14_ENST00000262269.8_Missense_Mutation_p.V630A			Q7Z406	MYH14_HUMAN	myosin, heavy chain 14, non-muscle	622	Myosin motor.				actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|mitochondrion morphogenesis (GO:0070584)|neuronal action potential (GO:0019228)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue development (GO:0007519)|vocalization behavior (GO:0071625)	actomyosin (GO:0042641)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|stress fiber (GO:0001725)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	46		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		AATGACAACGTCGCAGCCTTG	0.587																																						.											0													50.0	51.0	51.0					19																	50755954		2183	4294	6477	SO:0001583	missense	79784			AY165122	CCDS46151.1, CCDS54295.1, CCDS59411.1	19q13.33	2011-09-27	2009-11-19			ENSG00000105357		"""Myosins / Myosin superfamily : Class II"""	23212	protein-coding gene	gene with protein product		608568	"""myosin, heavy polypeptide 14"", ""myosin, heavy chain 14"""	DFNA4		12909352, 15015131, 17940200	Standard	NM_024729		Approved	FLJ13881, KIAA2034, MHC16, MYH17	uc010enu.1	Q7Z406		ENST00000596571.1:c.1865T>C	19.37:g.50755954T>C	ENSP00000472819:p.Val622Ala	Somatic		WXS	Illumina HiSeq	Phase_I	B0I1S2|C3TTN4|Q5CZ75|Q6XYE4|Q76B62|Q8WV23|Q96I22|Q9BT27|Q9BW35|Q9H882	Missense_Mutation	SNP	ENST00000596571.1	37	CCDS59411.1	.	.	.	.	.	.	.	.	.	.	T	18.34	3.601434	0.66445	.	.	ENSG00000105357	ENST00000301415;ENST00000440075;ENST00000376970;ENST00000425460;ENST00000376965;ENST00000262269	D;D;D;D	0.87887	-2.31;-2.31;-2.31;-2.31	4.35	4.35	0.52113	Myosin head, motor domain (2);	.	.	.	.	D	0.92103	0.7497	M	0.76574	2.34	0.80722	D	1	D;D;D	0.71674	0.998;0.998;0.997	D;D;D	0.72075	0.953;0.976;0.959	D	0.92773	0.6234	9	0.87932	D	0	.	11.8047	0.52147	0.0:0.0:0.0:1.0	.	630;622;630	Q7Z406-2;Q7Z406;Q7Z406-6	.;MYH14_HUMAN;.	A	622;630;622;630;622;630	ENSP00000406273:V630A;ENSP00000366169:V622A;ENSP00000407879:V630A;ENSP00000262269:V630A	ENSP00000262269:V630A	V	+	2	0	MYH14	55447766	1.000000	0.71417	0.164000	0.22755	0.365000	0.29674	6.077000	0.71275	1.961000	0.56991	0.379000	0.24179	GTC		0.587	MYH14-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464710.2	NM_024729	
NBPF10	100132406	ucsc.edu	37	1	145302775	145302775	+	Missense_Mutation	SNP	T	T	G	rs376014420		TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr1:145302775T>G	ENST00000369339.3	+	5	653	c.400T>G	c.(400-402)Tat>Gat	p.Y134D	NBPF10_ENST00000342960.5_Missense_Mutation_p.Y405D|NBPF10_ENST00000369338.1_Missense_Mutation_p.Y134D|RP11-458D21.5_ENST00000468030.1_3'UTR			Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	405						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		CCTCACTCCGTATGAGCCGGA	0.577																																						.											0																																										SO:0001583	missense	100132406			BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000369339.3:c.400T>G	1.37:g.145302775T>G	ENSP00000358345:p.Tyr134Asp	Somatic		WXS	Illumina HiSeq	Phase_I	Q5RHC0|Q9NWN6	Missense_Mutation	SNP	ENST00000369339.3	37		.	.	.	.	.	.	.	.	.	.	.	0	-2.664813	0.00107	.	.	ENSG00000163386	ENST00000448873;ENST00000369338;ENST00000369334;ENST00000342960	T;T	0.46063	0.88;4.33	0.712	-0.91	0.10511	.	.	.	.	.	T	0.03390	0.0098	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.33189	-0.9878	7	0.02654	T	1	.	.	.	.	.	134	A8MQ30	.	D	330;134;134;405	ENSP00000358344:Y134D;ENSP00000345684:Y405D	ENSP00000345684:Y405D	Y	+	1	0	NBPF10	144014132	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.464000	0.06688	-1.158000	0.02811	-1.371000	0.01190	TAT		0.577	NBPF10-001	KNOWN	not_best_in_genome_evidence|basic	protein_coding	protein_coding	OTTHUMT00000038550.3	NM_001039703	
AHNAK2	113146	mdanderson.org	37	14	105415691	105415691	+	Missense_Mutation	SNP	T	T	C	rs199921891		TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr14:105415691T>C	ENST00000333244.5	-	7	6216	c.6097A>G	c.(6097-6099)Acc>Gcc	p.T2033A	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2033						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			AGGTCAGTGGTCTTCAGGTCC	0.662																																						.											0													111.0	80.0	90.0					14																	105415691		1929	4059	5988	SO:0001583	missense	113146			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.6097A>G	14.37:g.105415691T>C	ENSP00000353114:p.Thr2033Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	-	4.415	0.076697	0.08485	.	.	ENSG00000185567	ENST00000333244	T	0.02916	4.11	3.87	1.35	0.21983	.	.	.	.	.	T	0.01627	0.0052	N	0.17345	0.48	0.09310	N	1	B	0.15141	0.012	B	0.21360	0.034	T	0.49312	-0.8953	9	0.07990	T	0.79	-38.0818	3.0595	0.06195	0.0:0.2131:0.2467:0.5403	.	2033	Q8IVF2	AHNK2_HUMAN	A	2033	ENSP00000353114:T2033A	ENSP00000353114:T2033A	T	-	1	0	AHNAK2	104486736	0.003000	0.15002	0.349000	0.25694	0.166000	0.22503	0.346000	0.19997	0.370000	0.24538	0.397000	0.26171	ACC		0.662	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
CDC27	996	mdanderson.org;bcgsc.ca	37	17	45234350	45234350	+	Silent	SNP	C	C	T			TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr17:45234350C>T	ENST00000066544.3	-	7	864	c.771G>A	c.(769-771)caG>caA	p.Q257Q	CDC27_ENST00000527547.1_Silent_p.Q257Q|CDC27_ENST00000531206.1_Silent_p.Q257Q|CDC27_ENST00000528748.1_5'Flank|CDC27_ENST00000446365.2_Silent_p.Q196Q	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	257					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)	p.Q257Q(3)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						TATTTTGAACCTGTTTAGATA	0.383																																						.											3	Substitution - coding silent(3)	prostate(3)											57.0	63.0	61.0					17																	45234350		2198	4294	6492	SO:0001819	synonymous_variant	996			U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.771G>A	17.37:g.45234350C>T		Somatic		WXS	Illumina HiSeq	Phase_I	G3V1C4|Q16349|Q96F35	Silent	SNP	ENST00000066544.3	37	CCDS11509.1																																																																																				0.383	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
FOLH1	2346	mdanderson.org	37	11	49186293	49186293	+	Silent	SNP	C	C	T	rs370741711		TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr11:49186293C>T	ENST00000256999.2	-	13	1664	c.1404G>A	c.(1402-1404)ccG>ccA	p.P468P	FOLH1_ENST00000533034.1_Silent_p.P453P|FOLH1_ENST00000340334.7_Silent_p.P453P|FOLH1_ENST00000356696.3_Silent_p.P468P|FOLH1_ENST00000343844.4_Silent_p.P160P|FOLH1_ENST00000525629.1_5'UTR	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	468	NAALADase.				folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	TGTACATCAGCGGTGTACAAT	0.284																																						.											0													41.0	42.0	42.0					11																	49186293		2197	4295	6492	SO:0001819	synonymous_variant	2346			M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.1404G>A	11.37:g.49186293C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Silent	SNP	ENST00000256999.2	37	CCDS7946.1																																																																																				0.284	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390896.1	NM_004476	
FRG1B	284802	mdanderson.org	37	20	29624055	29624055	+	Missense_Mutation	SNP	C	C	A			TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr20:29624055C>A	ENST00000278882.3	+	4	459	c.79C>A	c.(79-81)Cca>Aca	p.P27T	FRG1B_ENST00000358464.4_Missense_Mutation_p.P27T|FRG1B_ENST00000439954.2_Missense_Mutation_p.P32T			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	27										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						CCCTAGTCCTCCAGAGCAGTT	0.279																																						.											0																																										SO:0001583	missense	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.79C>A	20.37:g.29624055C>A	ENSP00000278882:p.Pro27Thr	Somatic		WXS	Illumina HiSeq	Phase_I	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	c	8.757	0.922733	0.18056	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.42513	0.97	1.91	1.91	0.25777	.	0.058688	0.64402	D	0.000001	T	0.36552	0.0971	.	.	.	0.45490	D	0.998458	.	.	.	.	.	.	T	0.06698	-1.0812	7	0.18276	T	0.48	.	9.8627	0.41125	0.0:1.0:0.0:0.0	.	.	.	.	T	27;32;27	ENSP00000408863:P32T	ENSP00000278882:P27T	P	+	1	0	FRG1B	28237716	1.000000	0.71417	1.000000	0.80357	0.356000	0.29392	6.195000	0.72088	1.383000	0.46405	0.184000	0.17185	CCA		0.279	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
FRG1B	284802	mdanderson.org	37	20	29628243	29628243	+	Missense_Mutation	SNP	T	T	C			TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr20:29628243T>C	ENST00000278882.3	+	6	625	c.245T>C	c.(244-246)tTg>tCg	p.L82S	FRG1B_ENST00000358464.4_Missense_Mutation_p.L82S|FRG1B_ENST00000439954.2_Missense_Mutation_p.L87S			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	82								p.L82S(2)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						ATGGCTTTGTTGGCCTCAAAT	0.363																																						.											2	Substitution - Missense(2)	urinary_tract(2)																																								SO:0001583	missense	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.245T>C	20.37:g.29628243T>C	ENSP00000278882:p.Leu82Ser	Somatic		WXS	Illumina HiSeq	Phase_I	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	t	12.14	1.848999	0.32699	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.49139	0.79	2.08	2.08	0.27032	Actin cross-linking (1);	0.147685	0.45361	D	0.000380	T	0.38665	0.1049	.	.	.	0.46185	D	0.99891	B;B	0.27656	0.03;0.184	B;B	0.35813	0.11;0.211	T	0.24548	-1.0157	9	0.38643	T	0.18	.	8.0833	0.30758	0.0:0.0:0.0:1.0	.	87;82	F5H5R5;Q9BZ01	.;FRG1B_HUMAN	S	82;87;82	ENSP00000408863:L87S	ENSP00000278882:L82S	L	+	2	0	FRG1B	28241904	1.000000	0.71417	0.998000	0.56505	0.541000	0.35023	6.955000	0.76007	1.208000	0.43306	0.347000	0.21830	TTG		0.363	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
FRG1B	284802	mdanderson.org	37	20	29628245	29628245	+	Missense_Mutation	SNP	G	G	A			TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr20:29628245G>A	ENST00000278882.3	+	6	627	c.247G>A	c.(247-249)Gcc>Acc	p.A83T	FRG1B_ENST00000358464.4_Missense_Mutation_p.A83T|FRG1B_ENST00000439954.2_Missense_Mutation_p.A88T			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	83								p.A83T(2)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						GGCTTTGTTGGCCTCAAATAG	0.353																																						.											2	Substitution - Missense(2)	urinary_tract(2)																																								SO:0001583	missense	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.247G>A	20.37:g.29628245G>A	ENSP00000278882:p.Ala83Thr	Somatic		WXS	Illumina HiSeq	Phase_I	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	g	18.80	3.700173	0.68501	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.50277	0.75	2.08	2.08	0.27032	Actin cross-linking (1);	0.055129	0.64402	D	0.000001	T	0.40473	0.1118	.	.	.	0.51482	D	0.99992	B;P	0.40875	0.016;0.731	B;P	0.45558	0.085;0.485	T	0.12502	-1.0545	9	0.21540	T	0.41	.	10.2211	0.43198	0.0:0.0:1.0:0.0	.	88;83	F5H5R5;Q9BZ01	.;FRG1B_HUMAN	T	83;88;83	ENSP00000408863:A88T	ENSP00000278882:A83T	A	+	1	0	FRG1B	28241906	1.000000	0.71417	1.000000	0.80357	0.609000	0.37215	8.494000	0.90477	1.475000	0.48197	0.423000	0.28283	GCC		0.353	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
FRG1	2483	mdanderson.org	37	4	190876287	190876287	+	Nonsense_Mutation	SNP	G	G	A	rs113079586		TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr4:190876287G>A	ENST00000226798.4	+	5	635	c.413G>A	c.(412-414)tGg>tAg	p.W138*	FRG1_ENST00000514482.1_3'UTR	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1	138					mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		AGAGAACAATGGGAACCAGTC	0.348																																						.											0													85.0	85.0	85.0					4																	190876287		2203	4300	6503	SO:0001587	stop_gained	2483			L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.413G>A	4.37:g.190876287G>A	ENSP00000226798:p.Trp138*	Somatic		WXS	Illumina HiSeq	Phase_I	A8K775	Nonsense_Mutation	SNP	ENST00000226798.4	37	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	.	37	6.190454	0.97362	.	.	ENSG00000109536	ENST00000226798;ENST00000531991	.	.	.	4.04	4.04	0.47022	.	0.054165	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-23.9237	14.145	0.65344	0.0:0.0:1.0:0.0	.	.	.	.	X	138;75	.	ENSP00000226798:W138X	W	+	2	0	FRG1	191113281	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	6.226000	0.72277	1.964000	0.57103	0.567000	0.79289	TGG		0.348	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	
FRG1	2483	mdanderson.org	37	4	190876307	190876307	+	Splice_Site	SNP	G	G	A	rs200854715		TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr4:190876307G>A	ENST00000226798.4	+	5	654		c.e5+1		FRG1_ENST00000514482.1_Splice_Site	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1						mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		CTTTCAAAATGTAAGTGCTGT	0.328																																						.											0													74.0	74.0	74.0					4																	190876307		2202	4295	6497	SO:0001630	splice_region_variant	2483			L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.432+1G>A	4.37:g.190876307G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A8K775	Splice_Site	SNP	ENST00000226798.4	37	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	N	18.80	3.700931	0.68501	.	.	ENSG00000109536	ENST00000226798;ENST00000531991	.	.	.	3.88	3.88	0.44766	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.7779	0.63066	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FRG1	191113301	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	7.413000	0.80104	1.879000	0.54435	0.567000	0.79289	.		0.328	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	Intron
FRG1	2483	mdanderson.org	37	4	190878604	190878604	+	Missense_Mutation	SNP	G	G	A	rs371189769		TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr4:190878604G>A	ENST00000226798.4	+	6	706	c.484G>A	c.(484-486)Gca>Aca	p.A162T	FRG1_ENST00000514482.1_3'UTR	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1	162					mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		ATGCAATGAAGCAGGGGACAT	0.383																																						.											0													36.0	36.0	36.0					4																	190878604		2184	4280	6464	SO:0001583	missense	2483			L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.484G>A	4.37:g.190878604G>A	ENSP00000226798:p.Ala162Thr	Somatic		WXS	Illumina HiSeq	Phase_I	A8K775	Missense_Mutation	SNP	ENST00000226798.4	37	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	.	11.61	1.689550	0.29962	.	.	ENSG00000109536	ENST00000226798;ENST00000524583;ENST00000531991	T;T	0.42900	1.94;0.96	4.19	4.19	0.49359	Actin cross-linking (1);	0.268853	0.42821	D	0.000657	T	0.36110	0.0955	L	0.47716	1.5	0.31376	N	0.679557	B	0.27951	0.195	B	0.30716	0.119	T	0.35001	-0.9806	10	0.14656	T	0.56	-21.4303	14.4711	0.67517	0.0:0.0:1.0:0.0	.	162	Q14331	FRG1_HUMAN	T	162;34;99	ENSP00000226798:A162T;ENSP00000435943:A99T	ENSP00000226798:A162T	A	+	1	0	FRG1	191115598	1.000000	0.71417	1.000000	0.80357	0.534000	0.34807	4.336000	0.59304	2.063000	0.61619	0.454000	0.30748	GCA		0.383	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	
FRG1	2483	mdanderson.org	37	4	190878625	190878625	+	Missense_Mutation	SNP	A	A	G	rs373840195		TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr4:190878625A>G	ENST00000226798.4	+	6	727	c.505A>G	c.(505-507)Agt>Ggt	p.S169G	FRG1_ENST00000514482.1_3'UTR	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1	169					mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.S169G(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		AGAAGCAAAAAGTAAAACAGC	0.363																																						.											1	Substitution - Missense(1)	lung(1)											49.0	46.0	47.0					4																	190878625		2183	4281	6464	SO:0001583	missense	2483			L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.505A>G	4.37:g.190878625A>G	ENSP00000226798:p.Ser169Gly	Somatic		WXS	Illumina HiSeq	Phase_I	A8K775	Missense_Mutation	SNP	ENST00000226798.4	37	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	.	21.2	4.112843	0.77210	.	.	ENSG00000109536	ENST00000226798;ENST00000524583;ENST00000531991	T;T	0.49139	1.86;0.79	4.19	4.19	0.49359	Actin cross-linking (1);	0.160510	0.64402	D	0.000002	T	0.58750	0.2144	M	0.77103	2.36	0.49915	D	0.999832	D	0.55800	0.973	P	0.53102	0.718	T	0.61426	-0.7065	10	0.39692	T	0.17	0.1847	11.5749	0.50856	1.0:0.0:0.0:0.0	.	169	Q14331	FRG1_HUMAN	G	169;41;106	ENSP00000226798:S169G;ENSP00000435943:S106G	ENSP00000226798:S169G	S	+	1	0	FRG1	191115619	1.000000	0.71417	1.000000	0.80357	0.852000	0.48524	9.044000	0.93805	1.677000	0.50941	0.373000	0.22412	AGT		0.363	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	
FRG1	2483	mdanderson.org	37	4	190878658	190878658	+	Splice_Site	SNP	G	G	A	rs76810924		TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr4:190878658G>A	ENST00000226798.4	+	6	759		c.e6+1		FRG1_ENST00000514482.1_Splice_Site	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1						mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		AATGATCAAGGTAATGATGAC	0.348																																						.											0													47.0	43.0	44.0					4																	190878658		2169	4247	6416	SO:0001630	splice_region_variant	2483			L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.537+1G>A	4.37:g.190878658G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A8K775	Splice_Site	SNP	ENST00000226798.4	37	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	N	15.05	2.718286	0.48622	.	.	ENSG00000109536	ENST00000226798;ENST00000524583	.	.	.	3.8	3.8	0.43715	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.6226	0.62146	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FRG1	191115652	1.000000	0.71417	1.000000	0.80357	0.557000	0.35523	9.554000	0.98121	1.860000	0.53959	0.454000	0.30748	.		0.348	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	Intron
FRG2B	441581	mdanderson.org	37	10	135438891	135438891	+	Silent	SNP	T	T	C	rs370488310		TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr10:135438891T>C	ENST00000425520.1	-	4	601	c.549A>G	c.(547-549)tcA>tcG	p.S183S	FRG2B_ENST00000443774.1_Silent_p.S184S	NM_001080998.1	NP_001074467.1	Q96QU4	FRG2B_HUMAN	FSHD region gene 2 family, member B	183						nucleus (GO:0005634)				endometrium(2)|kidney(2)|lung(14)|ovary(1)|prostate(1)	20		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		AAACAGCCTCTGACATAGCTC	0.582																																						.											0								T		1,4373		0,1,2186	98.0	113.0	108.0		549		0.5	10	dbSNP_134	108	2,8584		0,2,4291	no	coding-synonymous	FRG2B	NM_001080998.1		0,3,6477	CC,CT,TT		0.0233,0.0229,0.0231		183/279	135438891	3,12957	2187	4293	6480	SO:0001819	synonymous_variant	441581			AY744466	CCDS44502.1	10q26.3	2012-10-02			ENSG00000225899	ENSG00000225899			33518	protein-coding gene	gene with protein product						15520407	Standard	NM_001080998		Approved		uc010qvg.2	Q96QU4	OTTHUMG00000019328	ENST00000425520.1:c.549A>G	10.37:g.135438891T>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q5VSQ1	Silent	SNP	ENST00000425520.1	37	CCDS44502.1																																																																																				0.582	FRG2B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000467780.1	NM_001080998	
FRG2B	441581	mdanderson.org	37	10	135438933	135438933	+	Silent	SNP	C	C	T	rs200793608		TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr10:135438933C>T	ENST00000425520.1	-	4	559	c.507G>A	c.(505-507)ccG>ccA	p.P169P	FRG2B_ENST00000443774.1_Silent_p.P170P	NM_001080998.1	NP_001074467.1	Q96QU4	FRG2B_HUMAN	FSHD region gene 2 family, member B	169						nucleus (GO:0005634)				endometrium(2)|kidney(2)|lung(14)|ovary(1)|prostate(1)	20		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		TTCGAATTGACGGTGTTTGGA	0.552																																						.											0													126.0	151.0	143.0					10																	135438933		2193	4291	6484	SO:0001819	synonymous_variant	441581			AY744466	CCDS44502.1	10q26.3	2012-10-02			ENSG00000225899	ENSG00000225899			33518	protein-coding gene	gene with protein product						15520407	Standard	NM_001080998		Approved		uc010qvg.2	Q96QU4	OTTHUMG00000019328	ENST00000425520.1:c.507G>A	10.37:g.135438933C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q5VSQ1	Silent	SNP	ENST00000425520.1	37	CCDS44502.1																																																																																				0.552	FRG2B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000467780.1	NM_001080998	
FRG2B	441581	mdanderson.org	37	10	135438943	135438943	+	Missense_Mutation	SNP	A	A	T	rs200701804		TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr10:135438943A>T	ENST00000425520.1	-	4	549	c.497T>A	c.(496-498)gTc>gAc	p.V166D	FRG2B_ENST00000443774.1_Missense_Mutation_p.V167D	NM_001080998.1	NP_001074467.1	Q96QU4	FRG2B_HUMAN	FSHD region gene 2 family, member B	166						nucleus (GO:0005634)				endometrium(2)|kidney(2)|lung(14)|ovary(1)|prostate(1)	20		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		CGGTGTTTGGACTCCTAGGGC	0.557																																						.											0													125.0	151.0	142.0					10																	135438943		2192	4290	6482	SO:0001583	missense	441581			AY744466	CCDS44502.1	10q26.3	2012-10-02			ENSG00000225899	ENSG00000225899			33518	protein-coding gene	gene with protein product						15520407	Standard	NM_001080998		Approved		uc010qvg.2	Q96QU4	OTTHUMG00000019328	ENST00000425520.1:c.497T>A	10.37:g.135438943A>T	ENSP00000401310:p.Val166Asp	Somatic		WXS	Illumina HiSeq	Phase_I	Q5VSQ1	Missense_Mutation	SNP	ENST00000425520.1	37	CCDS44502.1	.	.	.	.	.	.	.	.	.	.	.	2.998	-0.206630	0.06180	.	.	ENSG00000225899	ENST00000443774;ENST00000425520	T;T	0.39997	1.05;1.05	.	.	.	.	1.677530	0.03603	N	0.233651	T	0.22666	0.0547	N	0.08118	0	0.09310	N	0.999995	B	0.02656	0.0	B	0.04013	0.001	T	0.16748	-1.0392	8	0.34782	T	0.22	-0.1173	.	.	.	.	166	Q96QU4	FRG2B_HUMAN	D	167;166	ENSP00000408343:V167D;ENSP00000401310:V166D	ENSP00000401310:V166D	V	-	2	0	FRG2B	135288933	0.003000	0.15002	0.161000	0.22692	0.163000	0.22366	-0.691000	0.05133	0.103000	0.17682	0.102000	0.15555	GTC		0.557	FRG2B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000467780.1	NM_001080998	
FRG2B	441581	mdanderson.org	37	10	135438961	135438961	+	Missense_Mutation	SNP	C	C	T	rs200048408	byFrequency	TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr10:135438961C>T	ENST00000425520.1	-	4	531	c.479G>A	c.(478-480)aGg>aAg	p.R160K	FRG2B_ENST00000443774.1_Missense_Mutation_p.R161K	NM_001080998.1	NP_001074467.1	Q96QU4	FRG2B_HUMAN	FSHD region gene 2 family, member B	160						nucleus (GO:0005634)				endometrium(2)|kidney(2)|lung(14)|ovary(1)|prostate(1)	20		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		GGCCCGAGACCTATGCCGCTT	0.557																																						.											0													118.0	141.0	133.0					10																	135438961		2195	4299	6494	SO:0001583	missense	441581			AY744466	CCDS44502.1	10q26.3	2012-10-02			ENSG00000225899	ENSG00000225899			33518	protein-coding gene	gene with protein product						15520407	Standard	NM_001080998		Approved		uc010qvg.2	Q96QU4	OTTHUMG00000019328	ENST00000425520.1:c.479G>A	10.37:g.135438961C>T	ENSP00000401310:p.Arg160Lys	Somatic		WXS	Illumina HiSeq	Phase_I	Q5VSQ1	Missense_Mutation	SNP	ENST00000425520.1	37	CCDS44502.1	.	.	.	.	.	.	.	.	.	.	.	7.703	0.693451	0.15039	.	.	ENSG00000225899	ENST00000443774;ENST00000425520	T;T	0.50001	0.76;0.76	.	.	.	.	2.815140	0.01633	N	0.023649	T	0.33235	0.0856	L	0.27053	0.805	0.09310	N	1	B	0.15473	0.013	B	0.16289	0.015	T	0.09684	-1.0663	8	0.21014	T	0.42	-0.5686	.	.	.	.	160	Q96QU4	FRG2B_HUMAN	K	161;160	ENSP00000408343:R161K;ENSP00000401310:R160K	ENSP00000401310:R160K	R	-	2	0	FRG2B	135288951	0.009000	0.17119	0.133000	0.22050	0.135000	0.20990	0.259000	0.18405	0.119000	0.18210	0.121000	0.15741	AGG		0.557	FRG2B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000467780.1	NM_001080998	
GGT1	2678	mdanderson.org	37	22	25016911	25016911	+	Missense_Mutation	SNP	C	C	T	rs199703506	byFrequency	TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr22:25016911C>T	ENST00000400382.1	+	9	1362	c.607C>T	c.(607-609)Cgg>Tgg	p.R203W	GGT1_ENST00000400383.1_Missense_Mutation_p.R203W|GGT1_ENST00000248923.4_Missense_Mutation_p.R203W|GGT1_ENST00000466310.1_Intron|GGT1_ENST00000400380.1_Missense_Mutation_p.R203W|GGT1_ENST00000406383.2_Missense_Mutation_p.R203W			P19440	GGT1_HUMAN	gamma-glutamyltransferase 1	203					arachidonic acid metabolic process (GO:0019369)|cellular amino acid metabolic process (GO:0006520)|cysteine biosynthetic process (GO:0019344)|glutamate metabolic process (GO:0006536)|glutathione biosynthetic process (GO:0006750)|glutathione catabolic process (GO:0006751)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|regulation of immune system process (GO:0002682)|regulation of inflammatory response (GO:0050727)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|xenobiotic metabolic process (GO:0006805)|zymogen activation (GO:0031638)	anchored component of external side of plasma membrane (GO:0031362)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)	p.R203W(1)		breast(1)|endometrium(2)|kidney(14)|large_intestine(2)|lung(6)|pancreas(1)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	40					Glutathione(DB00143)	AAAGGTGCTTCGGGAGGGGGA	0.652																																						.											1	Substitution - Missense(1)	breast(1)											20.0	22.0	21.0					22																	25016911		1981	4142	6123	SO:0001583	missense	2678			M24903	CCDS42992.1	22q11.23	2008-08-15			ENSG00000100031	ENSG00000100031	2.3.2.2	"""CD molecules"", ""Gamma-glutamyltransferases"""	4250	protein-coding gene	gene with protein product		612346		GGT		8104871, 18357469	Standard	NM_001288833		Approved	D22S672, D22S732, CD224	uc003aan.1	P19440	OTTHUMG00000030859	ENST00000400382.1:c.607C>T	22.37:g.25016911C>T	ENSP00000383232:p.Arg203Trp	Somatic		WXS	Illumina HiSeq	Phase_I	Q08247|Q14404|Q8TBS1|Q9UMK1	Missense_Mutation	SNP	ENST00000400382.1	37	CCDS42992.1	.	.	.	.	.	.	.	.	.	.	.	16.88	3.244872	0.59103	.	.	ENSG00000100031	ENST00000248923;ENST00000412658;ENST00000400382;ENST00000400383;ENST00000400380;ENST00000406383	T;T;T;T;T;T	0.08193	3.12;3.12;3.12;3.12;3.12;3.12	3.94	1.51	0.23008	.	0.465560	0.21948	U	0.066770	T	0.18841	0.0452	M	0.62016	1.91	0.29917	N	0.823045	D	0.76494	0.999	P	0.58970	0.849	T	0.03121	-1.1070	10	0.87932	D	0	-23.2527	10.8877	0.46976	0.3395:0.6605:0.0:0.0	.	203	P19440	GGT1_HUMAN	W	203	ENSP00000248923:R203W;ENSP00000393537:R203W;ENSP00000383232:R203W;ENSP00000383233:R203W;ENSP00000383231:R203W;ENSP00000385975:R203W	ENSP00000248923:R203W	R	+	1	2	GGT1	23346911	0.047000	0.20315	0.042000	0.18584	0.549000	0.35272	1.263000	0.33004	0.735000	0.32537	0.555000	0.69702	CGG		0.652	GGT1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250797.1	NM_013430	
GOLGA6D	653643	mdanderson.org	37	15	75586689	75586689	+	Splice_Site	SNP	T	T	A	rs201430576	byFrequency	TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr15:75586689T>A	ENST00000434739.3	+	18	1996	c.1955T>A	c.(1954-1956)gTt>gAt	p.V652D	RN7SL327P_ENST00000488659.2_RNA	NM_001145224.1	NP_001138696.1	P0CG33	GOG6D_HUMAN	golgin A6 family, member D	652						Golgi apparatus (GO:0005794)				kidney(1)|lung(1)	2						CTCTCCGAAGTTTTTTATGAA	0.617													a|||	236	0.0471246	0.1157	0.0548	5008	,	,		15529	0.0298		0.002	False		,,,				2504	0.0133					.											0													8.0	15.0	13.0					15																	75586689		633	1578	2211	SO:0001630	splice_region_variant	653643				CCDS45308.1	15q24.2	2013-05-10	2010-02-12	2009-09-04	ENSG00000140478	ENSG00000140478			32204	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6D"""				Standard	NM_001145224		Approved		uc010uma.2	P0CG33	OTTHUMG00000172672	ENST00000434739.3:c.1955-1T>A	15.37:g.75586689T>A		Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000434739.3	37	CCDS45308.1	.	.	.	.	.	.	.	.	.	.	A	0.005	-2.147222	0.00328	.	.	ENSG00000140478	ENST00000434739	T	0.19669	2.13	1.63	-0.857	0.10693	.	.	.	.	.	T	0.02649	0.0080	N	0.00062	-2.325	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.36648	-0.9739	8	.	.	.	.	2.1621	0.03827	0.3879:0.0:0.3567:0.2555	.	652	P0CG33	GOG6D_HUMAN	D	652	ENSP00000391085:V652D	.	V	+	2	0	GOLGA6D	73373742	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.546000	0.23284	-0.743000	0.04784	-0.937000	0.02696	GTT		0.617	GOLGA6D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419798.1	NM_001145224	Missense_Mutation
GPR78	27201	mdanderson.org	37	4	8583312	8583312	+	Missense_Mutation	SNP	A	A	C	rs17844778	byFrequency	TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr4:8583312A>C	ENST00000382487.4	+	1	1020	c.603A>C	c.(601-603)agA>agC	p.R201S	GPR78_ENST00000509216.1_Intron	NM_080819.4	NP_543009.2	Q96P69	GPR78_HUMAN	G protein-coupled receptor 78	201			R -> S (in dbSNP:rs17844778).		adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(4)|kidney(4)|large_intestine(1)|lung(8)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	26						TGGCACGCAGACACTGCCAGC	0.692													C|||	752	0.15016	0.0295	0.2161	5008	,	,		16947	0.0248		0.3231	False		,,,				2504	0.2178					.											0								C	SER/ARG	308,4022		19,270,1876	8.0	8.0	8.0		603	1.6	0.0	4	dbSNP_123	8	2619,5825		429,1761,2032	yes	missense	GPR78	NM_080819.2	110	448,2031,3908	CC,CA,AA		31.0161,7.1132,22.9137	benign	201/364	8583312	2927,9847	2165	4222	6387	SO:0001583	missense	27201			AF411107	CCDS3403.1	4p16.1	2012-08-21			ENSG00000155269	ENSG00000155269		"""GPCR / Class A : Orphans"""	4528	protein-coding gene	gene with protein product		606921				11574155	Standard	NM_080819		Approved		uc003glk.4	Q96P69	OTTHUMG00000128483	ENST00000382487.4:c.603A>C	4.37:g.8583312A>C	ENSP00000371927:p.Arg201Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q8NGV3	Missense_Mutation	SNP	ENST00000382487.4	37	CCDS3403.1	353	0.16163003663003664	28	0.056910569105691054	91	0.2513812154696133	8	0.013986013986013986	226	0.29815303430079154	C	0.020	-1.434012	0.01108	0.071132	0.310161	ENSG00000155269	ENST00000382487	T	0.40756	1.02	2.53	1.64	0.23874	GPCR, rhodopsin-like superfamily (1);	0.236614	0.34291	N	0.004095	T	0.00012	0.0000	N	0.01048	-1.04	0.58432	P	1.999999999946489E-6	B	0.02656	0.0	B	0.04013	0.001	T	0.44003	-0.9356	9	0.19147	T	0.46	.	9.2648	0.37634	0.3897:0.6103:0.0:0.0	rs17844778	201	Q96P69	GPR78_HUMAN	S	201	ENSP00000371927:R201S	ENSP00000371927:R201S	R	+	3	2	GPR78	8634212	0.998000	0.40836	0.000000	0.03702	0.067000	0.16453	0.463000	0.21972	-0.378000	0.07918	-0.648000	0.03929	AGA		0.692	GPR78-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359201.1		
HLA-DQA2	3118	mdanderson.org	37	6	32714125	32714125	+	Missense_Mutation	SNP	A	A	G	rs200904145	byFrequency	TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr6:32714125A>G	ENST00000374940.3	+	4	824	c.722A>G	c.(721-723)cAa>cGa	p.Q241R		NM_020056.4	NP_064440.1	P01906	DQA2_HUMAN	major histocompatibility complex, class II, DQ alpha 2	241					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)			endometrium(2)|large_intestine(3)|lung(7)|skin(1)	13					"""""""Insulin(DB00071)"""	TTCATCATCCAAGGCCTGCGT	0.522																																						.											0													155.0	152.0	153.0					6																	32714125		1511	2709	4220	SO:0001583	missense	3118				CCDS4753.1	6p21.3	2013-01-11			ENSG00000237541	ENSG00000237541		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4943	protein-coding gene	gene with protein product		613503		HLA-DXA			Standard	NM_020056		Approved		uc003obx.3	P01906	OTTHUMG00000031108	ENST00000374940.3:c.722A>G	6.37:g.32714125A>G	ENSP00000364076:p.Gln241Arg	Somatic		WXS	Illumina HiSeq	Phase_I	A2BF37|B0V0E7|O19789|Q5SQ94|Q5SR04	Missense_Mutation	SNP	ENST00000374940.3	37	CCDS4753.1	.	.	.	.	.	.	.	.	.	.	.	0.001	-3.026763	0.00041	.	.	ENSG00000237541	ENST00000374940	T	0.01705	4.68	3.06	-6.13	0.02118	.	0.616827	0.14885	N	0.292732	T	0.00178	0.0005	N	0.01800	-0.715	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.28235	-1.0050	10	0.07813	T	0.8	.	5.6461	0.17590	0.6481:0.1299:0.222:0.0	.	241	P01906	DQA2_HUMAN	R	241	ENSP00000364076:Q241R	ENSP00000364076:Q241R	Q	+	2	0	HLA-DQA2	32822103	0.051000	0.20477	0.067000	0.19924	0.023000	0.10783	-0.431000	0.06965	-1.761000	0.01310	-1.188000	0.01700	CAA		0.522	HLA-DQA2-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076179.2	NM_020056	
IRF5	3663	mdanderson.org	37	7	128587381	128587381	+	Silent	SNP	T	T	C	rs199508964|rs79724471|rs60344245	byFrequency	TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr7:128587381T>C	ENST00000402030.2	+	6	603	c.531T>C	c.(529-531)ccT>ccC	p.P177P	IRF5_ENST00000473745.1_Silent_p.P177P|IRF5_ENST00000477535.1_Intron|IRF5_ENST00000357234.5_Silent_p.P193P|IRF5_ENST00000249375.4_Silent_p.P177P	NM_001098629.1|NM_001098630.1	NP_001092099.1|NP_001092100.1	Q13568	IRF5_HUMAN	interferon regulatory factor 5	177					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to muramyl dipeptide (GO:0032495)|response to peptidoglycan (GO:0032494)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.?(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(1)|prostate(1)	15						TGCGGCCGCCTACTCTGCAGC	0.657																																						.											1	Unknown(1)	haematopoietic_and_lymphoid_tissue(1)						T	,,,,	881,2925		144,593,1166	5.0	7.0	6.0		531,579,531,,531		0.1	7	dbSNP_131	6	1628,6000		358,912,2544	no	coding-synonymous,coding-synonymous,coding-synonymous,intron,coding-synonymous	IRF5	NM_001098627.2,NM_001098629.1,NM_001098630.1,NM_001242452.1,NM_032643.3	,,,,	502,1505,3710	CC,CT,TT		21.3424,23.1477,21.9433	,,,,	177/499,193/515,177/499,,177/499	128587381	2509,8925	1903	3814	5717	SO:0001819	synonymous_variant	3663				CCDS5808.1, CCDS43645.1, CCDS56512.1	7q32	2008-07-18			ENSG00000128604	ENSG00000128604			6120	protein-coding gene	gene with protein product		607218					Standard	XM_005250317		Approved		uc003vog.3	Q13568	OTTHUMG00000158410	ENST00000402030.2:c.531T>C	7.37:g.128587381T>C		Somatic		WXS	Illumina HiSeq	Phase_I	A4D1J8|A8DUA8|A8DUA9|E7EQ16|E7EW54|Q1A7B4|Q64GA9|Q64GB1|Q64GB2|Q6RCM8|Q9BQF0	Silent	SNP	ENST00000402030.2	37	CCDS5808.1	740	0.33882783882783885	191	0.3882113821138211	85	0.23480662983425415	170	0.2972027972027972	294	0.38786279683377306	T	2.949	-0.217149	0.06101	0.231477	0.213424	ENSG00000128604	ENST00000430204	.	.	.	.	.	.	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.58432	P	2.9999999999752447E-6	.	.	.	.	.	.	T	0.44667	-0.9313	1	.	.	.	.	.	.	.	.	166	E9PC81	.	P	166	.	.	L	+	2	0	IRF5	128374617	0.027000	0.19231	0.110000	0.21437	0.055000	0.15305	0.056000	0.14256	0.056000	0.16144	0.055000	0.15244	CTA		0.657	IRF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350934.1	NM_001098627	
LAMA5	3911	mdanderson.org	37	20	60887581	60887581	+	Missense_Mutation	SNP	G	G	A	rs944895	byFrequency	TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr20:60887581G>A	ENST00000252999.3	-	68	9301	c.9235C>T	c.(9235-9237)Cgg>Tgg	p.R3079W		NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	3079	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.		R -> W (in dbSNP:rs944895). {ECO:0000269|PubMed:11821406, ECO:0000269|PubMed:9271224, ECO:0000269|PubMed:9628581}.		angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			GGGAAGAGCCGTCGCAGGCTG	0.677													.|||	3391	0.677117	0.5666	0.6988	5008	,	,		15366	0.7411		0.6431	False		,,,				2504	0.7802					.											0									TRP/ARG	2500,1886	594.1+/-388.1	703,1094,396	31.0	29.0	30.0		9235	3.4	0.1	20	dbSNP_86	30	5600,2988	634.2+/-398.8	1810,1980,504	yes	missense	LAMA5	NM_005560.3	101	2513,3074,900	AA,AG,GG		34.7927,43.0005,37.5674	probably-damaging	3079/3696	60887581	8100,4874	2193	4294	6487	SO:0001583	missense	3911			AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.9235C>T	20.37:g.60887581G>A	ENSP00000252999:p.Arg3079Trp	Somatic		WXS	Illumina HiSeq	Phase_I	Q8TDF8|Q8WZA7|Q9H1P1	Missense_Mutation	SNP	ENST00000252999.3	37	CCDS33502.1	1458	0.6675824175824175	280	0.5691056910569106	257	0.7099447513812155	425	0.743006993006993	496	0.6543535620052771	g	9.192	1.026390	0.19512	0.569995	0.652073	ENSG00000130702	ENST00000252999	T	0.78481	-1.18	4.36	3.38	0.38709	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	1.920180	0.02454	N	0.085827	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	D	0.58620	0.983	P	0.47376	0.545	T	0.48547	-0.9026	9	0.72032	D	0.01	.	3.2954	0.06964	0.0954:0.1438:0.5475:0.2134	rs944895;rs58677971;rs944895	3079	O15230	LAMA5_HUMAN	W	3079	ENSP00000252999:R3079W	ENSP00000252999:R3079W	R	-	1	2	LAMA5	60320976	0.000000	0.05858	0.064000	0.19789	0.038000	0.13279	-0.605000	0.05661	2.269000	0.75478	0.556000	0.70494	CGG		0.677	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080014.2	NM_005560	
MUC17	140453	mdanderson.org	37	7	100678935	100678935	+	Missense_Mutation	SNP	C	C	T	rs116960680		TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr7:100678935C>T	ENST00000306151.4	+	3	4302	c.4238C>T	c.(4237-4239)gCt>gTt	p.A1413V		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1413	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					AGTTCTGAGGCTAGCACCCTT	0.507																																						.											0													271.0	276.0	274.0					7																	100678935		2203	4300	6503	SO:0001583	missense	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.4238C>T	7.37:g.100678935C>T	ENSP00000302716:p.Ala1413Val	Somatic		WXS	Illumina HiSeq	Phase_I	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	c	2.228	-0.376848	0.05000	.	.	ENSG00000169876	ENST00000306151	T	0.02656	4.21	0.838	-1.68	0.08212	.	.	.	.	.	T	0.01870	0.0059	L	0.29908	0.895	0.09310	N	1	B	0.17038	0.02	B	0.06405	0.002	T	0.49103	-0.8974	9	0.16896	T	0.51	.	2.1924	0.03903	0.0:0.2679:0.3208:0.4112	.	1413	Q685J3	MUC17_HUMAN	V	1413	ENSP00000302716:A1413V	ENSP00000302716:A1413V	A	+	2	0	MUC17	100465655	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	0.179000	0.16840	-0.919000	0.03803	0.134000	0.15878	GCT		0.507	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
MUC4	4585	mdanderson.org	37	3	195505763	195505763	+	Missense_Mutation	SNP	G	G	A	rs534260673	byFrequency	TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr3:195505763G>A	ENST00000463781.3	-	2	13147	c.12688C>T	c.(12688-12690)Ctt>Ttt	p.L4230F	MUC4_ENST00000475231.1_Missense_Mutation_p.L4230F|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	987					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.L4230F(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACTGAGGAAAGGCTGGTGACA	0.582																																						.											2	Substitution - Missense(2)	kidney(2)											42.0	42.0	42.0					3																	195505763		2092	4200	6292	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12688C>T	3.37:g.195505763G>A	ENSP00000417498:p.Leu4230Phe	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	10.21	1.286628	0.23478	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.31769	1.48;1.49	1.78	0.849	0.18972	.	.	.	.	.	T	0.13756	0.0333	N	0.19112	0.55	0.09310	N	1	P	0.35139	0.486	B	0.19946	0.027	T	0.16276	-1.0408	8	.	.	.	.	6.3726	0.21489	0.0:0.3086:0.6914:0.0	.	4102	E7ESK3	.	F	4230	ENSP00000417498:L4230F;ENSP00000420243:L4230F	.	L	-	1	0	MUC4	196990542	0.000000	0.05858	0.002000	0.10522	0.001000	0.01503	-0.092000	0.11129	0.347000	0.23924	-0.229000	0.12294	CTT		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195505859	195505859	+	Missense_Mutation	SNP	T	T	C			TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr3:195505859T>C	ENST00000463781.3	-	2	13051	c.12592A>G	c.(12592-12594)Act>Gct	p.T4198A	MUC4_ENST00000475231.1_Missense_Mutation_p.T4198A|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.T4198A(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GCTGAGGAAGTGTCGGTGACA	0.602																																						.											2	Substitution - Missense(2)	endometrium(1)|kidney(1)											19.0	15.0	16.0					3																	195505859		689	1576	2265	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12592A>G	3.37:g.195505859T>C	ENSP00000417498:p.Thr4198Ala	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	1.310	-0.602470	0.03744	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.35789	1.42;1.29	.	.	.	.	.	.	.	.	T	0.15739	0.0379	N	0.14661	0.345	0.18873	N	0.999989	B	0.14438	0.01	B	0.15870	0.014	T	0.21827	-1.0234	7	.	.	.	.	4.4479	0.11606	0.0:0.2715:0.0:0.7285	.	4070	E7ESK3	.	A	4198	ENSP00000417498:T4198A;ENSP00000420243:T4198A	.	T	-	1	0	MUC4	196990638	0.000000	0.05858	0.008000	0.14137	0.030000	0.12068	-0.602000	0.05680	-1.729000	0.01364	-1.976000	0.00459	ACT		0.602	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195509235	195509235	+	Silent	SNP	C	C	A	rs71291871|rs77084193		TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr3:195509235C>A	ENST00000463781.3	-	2	9675	c.9216G>T	c.(9214-9216)ccG>ccT	p.P3072P	MUC4_ENST00000475231.1_Silent_p.P3072P|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGACAGGAAGCGGGGTGGCGT	0.607																																						.											0													8.0	7.0	8.0					3																	195509235		629	1493	2122	SO:0001819	synonymous_variant	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9216G>T	3.37:g.195509235C>A		Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																				0.607	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195512665	195512665	+	Missense_Mutation	SNP	G	G	A	rs79300100	byFrequency	TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr3:195512665G>A	ENST00000463781.3	-	2	6245	c.5786C>T	c.(5785-5787)gCa>gTa	p.A1929V	MUC4_ENST00000475231.1_Missense_Mutation_p.A1929V|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.A1929V(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACCTGTGGATGCTGAGGAAAG	0.582																																						.											1	Substitution - Missense(1)	kidney(1)											37.0	33.0	34.0					3																	195512665		686	1586	2272	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.5786C>T	3.37:g.195512665G>A	ENSP00000417498:p.Ala1929Val	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	6.513	0.462935	0.12402	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.26810	1.72;1.71	.	.	.	.	.	.	.	.	T	0.15478	0.0373	N	0.19112	0.55	0.09310	N	1	P	0.43392	0.805	P	0.45506	0.483	T	0.09997	-1.0649	7	.	.	.	.	5.4001	0.16291	0.2688:0.0:0.7312:0.0	.	1929	E7ESK3	.	V	1929	ENSP00000417498:A1929V;ENSP00000420243:A1929V	.	A	-	2	0	MUC4	196997060	.	.	0.001000	0.08648	0.008000	0.06430	.	.	-1.752000	0.01325	-2.092000	0.00371	GCA		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
NUDT10	170685	mdanderson.org	37	X	51076024	51076024	+	Silent	SNP	G	G	A	rs143435240		TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chrX:51076024G>A	ENST00000376006.3	+	2	427	c.207G>A	c.(205-207)gaG>gaA	p.E69E	NUDT10_ENST00000356450.2_Silent_p.E69E	NM_153183.2	NP_694853.1	Q9BW91	NUDT9_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 10	234					ADP catabolic process (GO:0046032)|IDP catabolic process (GO:0046709)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrial matrix (GO:0005759)	adenosine-diphosphatase activity (GO:0043262)|ADP-ribose diphosphatase activity (GO:0047631)|ADP-sugar diphosphatase activity (GO:0019144)	p.E69E(8)		cervix(1)|endometrium(8)|kidney(1)|large_intestine(1)|lung(1)|prostate(3)|upper_aerodigestive_tract(1)	16	Ovarian(276;0.236)					TGTACGAAGAGGCGGGAGTCA	0.657																																					NSCLC(90;1817 2035 37909 38249)	.											8	Substitution - coding silent(8)	endometrium(5)|cervix(1)|prostate(1)|lung(1)											52.0	62.0	59.0					X																	51076024		2203	4300	6503	SO:0001819	synonymous_variant	170685			AF469196	CCDS35278.1	Xp11.22-p11.1	2014-05-20			ENSG00000122824	ENSG00000122824		"""Nudix motif containing"""	17621	protein-coding gene	gene with protein product		300527				12105228	Standard	NM_153183		Approved	DIPP3a, hDIPP3alpha	uc004dph.3	Q8NFP7	OTTHUMG00000021530	ENST00000376006.3:c.207G>A	X.37:g.51076024G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q8NBN1|Q8NCB9|Q8NG25	Silent	SNP	ENST00000376006.3	37	CCDS35278.1																																																																																				0.657	NUDT10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056578.1	NM_153183	
OR2T33	391195	mdanderson.org	37	1	248436925	248436925	+	Silent	SNP	A	A	G	rs146015658	byFrequency	TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr1:248436925A>G	ENST00000318021.2	-	1	213	c.192T>C	c.(190-192)ctT>ctC	p.L64L		NM_001004695.1	NP_001004695.1	Q8NG76	O2T33_HUMAN	olfactory receptor, family 2, subfamily T, member 33	64						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(41)|ovary(1)|prostate(1)|skin(4)	67	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			CCATGAGGGAAAGTTGGCTCA	0.552																																						.											0													89.0	81.0	84.0					1																	248436925		2201	4300	6501	SO:0001819	synonymous_variant	391195				CCDS31109.1	1q44	2012-08-09			ENSG00000177212	ENSG00000177212		"""GPCR / Class A : Olfactory receptors"""	31255	protein-coding gene	gene with protein product							Standard	NM_001004695		Approved		uc010pzi.2	Q8NG76	OTTHUMG00000040458	ENST00000318021.2:c.192T>C	1.37:g.248436925A>G		Somatic		WXS	Illumina HiSeq	Phase_I	B2RNN0	Silent	SNP	ENST00000318021.2	37	CCDS31109.1																																																																																				0.552	OR2T33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097354.1	NM_001004695	
PAK2	5062	mdanderson.org	37	3	196509544	196509544	+	Silent	SNP	T	T	C	rs79361419	byFrequency	TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr3:196509544T>C	ENST00000327134.3	+	2	349	c.27T>C	c.(25-27)gaT>gaC	p.D9D	RNU6-42P_ENST00000384165.1_RNA	NM_002577.4	NP_002568.2	Q13177	PAK2_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 2	9					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in execution phase of apoptosis (GO:2001271)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-serine phosphorylation (GO:0018105)|phosphorylation (GO:0016310)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of defense response to virus by virus (GO:0050690)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activator activity (GO:0030296)	p.D9D(2)		breast(1)|cervix(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)	12	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.07e-23)|all cancers(36;6.38e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00405)		AACTGGAAGATAAGCCTCCAG	0.423																																						.											2	Substitution - coding silent(2)	prostate(2)											99.0	104.0	102.0					3																	196509544		2203	4300	6503	SO:0001819	synonymous_variant	5062			U24153	CCDS3321.1	3q29	2008-06-17	2008-06-17			ENSG00000180370	2.7.11.1		8591	protein-coding gene	gene with protein product	"""S6/H4 kinase"""	605022	"""p21 (CDKN1A)-activated kinase 2"""			7744004, 7618083	Standard	NM_002577		Approved	PAK65, PAKgamma	uc003fwy.4	Q13177		ENST00000327134.3:c.27T>C	3.37:g.196509544T>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q13154|Q6ISC3	Silent	SNP	ENST00000327134.3	37	CCDS3321.1																																																																																				0.423	PAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340548.1	NM_002577	
PAK2	5062	mdanderson.org	37	3	196509577	196509577	+	Missense_Mutation	SNP	C	C	G	rs76714248	byFrequency	TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr3:196509577C>G	ENST00000327134.3	+	2	382	c.60C>G	c.(58-60)agC>agG	p.S20R	RNU6-42P_ENST00000384165.1_RNA	NM_002577.4	NP_002568.2	Q13177	PAK2_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 2	20					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in execution phase of apoptosis (GO:2001271)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-serine phosphorylation (GO:0018105)|phosphorylation (GO:0016310)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of defense response to virus by virus (GO:0050690)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activator activity (GO:0030296)			breast(1)|cervix(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)	12	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.07e-23)|all cancers(36;6.38e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00405)		GAATGAGCAGCACCATCTTTA	0.443																																						.											0													123.0	129.0	127.0					3																	196509577		2203	4300	6503	SO:0001583	missense	5062			U24153	CCDS3321.1	3q29	2008-06-17	2008-06-17			ENSG00000180370	2.7.11.1		8591	protein-coding gene	gene with protein product	"""S6/H4 kinase"""	605022	"""p21 (CDKN1A)-activated kinase 2"""			7744004, 7618083	Standard	NM_002577		Approved	PAK65, PAKgamma	uc003fwy.4	Q13177		ENST00000327134.3:c.60C>G	3.37:g.196509577C>G	ENSP00000314067:p.Ser20Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q13154|Q6ISC3	Missense_Mutation	SNP	ENST00000327134.3	37	CCDS3321.1	.	.	.	.	.	.	.	.	.	.	C	19.04	3.749766	0.69533	.	.	ENSG00000180370	ENST00000327134	T	0.74737	-0.87	5.21	-3.63	0.04529	.	0.081384	0.85682	D	0.000000	D	0.83115	0.5184	M	0.78456	2.415	0.58432	D	0.999997	D	0.89917	1.0	D	0.91635	0.999	D	0.83597	0.0126	10	0.87932	D	0	.	14.4339	0.67268	0.0:0.6189:0.0:0.3811	.	20	Q13177	PAK2_HUMAN	R	20	ENSP00000314067:S20R	ENSP00000314067:S20R	S	+	3	2	PAK2	197993974	0.899000	0.30636	0.987000	0.45799	0.994000	0.84299	-0.061000	0.11693	-0.583000	0.05921	-0.290000	0.09829	AGC		0.443	PAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340548.1	NM_002577	
PRR21	643905	mdanderson.org	37	2	240981515	240981515	+	Silent	SNP	A	A	G	rs59139800	byFrequency	TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr2:240981515A>G	ENST00000408934.1	-	1	884	c.885T>C	c.(883-885)caT>caC	p.H295H		NM_001080835.1	NP_001074304.1	Q8WXC7	PRR21_HUMAN	proline rich 21	295	Pro-rich.									NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(5)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)	29						GTGAAGAGGCATGGACGAAGG	0.637													a|||	2084	0.416134	0.4463	0.379	5008	,	,		14987	0.5754		0.334	False		,,,				2504	0.3221					.											0													7.0	5.0	5.0					2																	240981515		1341	2643	3984	SO:0001819	synonymous_variant	643905			AF453950	CCDS33417.1	2q37.3	2009-04-20			ENSG00000221961	ENSG00000221961			33866	protein-coding gene	gene with protein product							Standard	NM_001080835		Approved		uc010zod.2	Q8WXC7	OTTHUMG00000159174	ENST00000408934.1:c.885T>C	2.37:g.240981515A>G		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000408934.1	37	CCDS33417.1																																																																																				0.637	PRR21-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001080835	
TBP	6908	mdanderson.org	37	6	170871040	170871040	+	Silent	SNP	A	A	G	rs71815788|rs55736770	byFrequency	TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr6:170871040A>G	ENST00000392092.2	+	3	495	c.216A>G	c.(214-216)caA>caG	p.Q72Q	TBP_ENST00000540980.1_Silent_p.Q52Q|TBP_ENST00000230354.6_Silent_p.Q72Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	72	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.Q72del(3)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		agcagcagcaacagcaacagc	0.567																																						.											3	Deletion - In frame(3)	ovary(1)|prostate(1)|breast(1)											12.0	14.0	13.0					6																	170871040		1995	3894	5889	SO:0001819	synonymous_variant	6908			M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.216A>G	6.37:g.170871040A>G		Somatic		WXS	Illumina HiSeq	Phase_I	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	ENST00000392092.2	37	CCDS5315.1																																																																																				0.567	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194	
TBP	6908	mdanderson.org	37	6	170871043	170871043	+	Silent	SNP	G	G	A			TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr6:170871043G>A	ENST00000392092.2	+	3	498	c.219G>A	c.(217-219)caG>caA	p.Q73Q	TBP_ENST00000540980.1_Silent_p.Q53Q|TBP_ENST00000230354.6_Silent_p.Q73Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	73	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.Q73Q(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		agcagcaacagcaacagcagc	0.562																																						.											1	Substitution - coding silent(1)	endometrium(1)											17.0	21.0	20.0					6																	170871043		1987	3877	5864	SO:0001819	synonymous_variant	6908			M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.219G>A	6.37:g.170871043G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	ENST00000392092.2	37	CCDS5315.1																																																																																				0.562	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194	
UBALD2	283991	mdanderson.org	37	17	74261677	74261677	+	Silent	SNP	T	T	C	rs2585751	byFrequency	TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr17:74261677T>C	ENST00000327490.6	+	1	395	c.91T>C	c.(91-93)Ttg>Ctg	p.L31L	UBALD2_ENST00000589240.1_5'Flank	NM_182565.3	NP_872371.1	Q8IYN6	UBAD2_HUMAN	UBA-like domain containing 2	31																	GGCGAAGCAGTTGCTGCAGGC	0.766													C|||	3578	0.714457	0.8843	0.6412	5008	,	,		3805	0.7024		0.5547	False		,,,				2504	0.7137					.											0								C		3526,686		1494,538,74	10.0	12.0	11.0		91	2.6	1.0	17	dbSNP_100	11	4861,3485		1480,1901,792	no	coding-synonymous	FAM100B	NM_182565.3		2974,2439,866	CC,CT,TT		41.7565,16.2868,33.2139		31/165	74261677	8387,4171	2106	4173	6279	SO:0001819	synonymous_variant	283991				CCDS11742.1	17q25.1	2012-11-30	2012-11-30	2012-11-30	ENSG00000185262	ENSG00000185262			28438	protein-coding gene	gene with protein product			"""family with sequence similarity 100, member B"""	FAM100B			Standard	NM_182565		Approved	MGC29814	uc010wsy.1	Q8IYN6	OTTHUMG00000132666	ENST00000327490.6:c.91T>C	17.37:g.74261677T>C		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000327490.6	37	CCDS11742.1																																																																																				0.766	UBALD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255920.1	NM_182565	
Unknown	0	mdanderson.org	37	9	14863	14863	+	IGR	SNP	A	A	G	rs71509923	byFrequency	TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr9:14863A>G								None (None upstream) : MIR1302-2 (12793 downstream)																							GGTGGCGGCAAAGGAGGGATG	0.647													.|||	1047	0.209065	0.3124	0.2176	5008	,	,		15478	0.1508		0.1789	False		,,,				2504	0.1544					.											0													9.0	16.0	14.0					9																	14863		1472	3710	5182	SO:0001628	intergenic_variant	100287171																															9.37:g.14863A>G		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP		37																																																																																				0	0.647								
ZNF587	84914	mdanderson.org	37	19	58371202	58371202	+	Silent	SNP	C	C	T			TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr19:58371202C>T	ENST00000339656.5	+	3	1604	c.1422C>T	c.(1420-1422)ggC>ggT	p.G474G	ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000597652.1_5'Flank|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF587_ENST00000423137.1_Silent_p.G473G|ZNF814_ENST00000597342.1_Intron|ZNF587_ENST00000419854.1_Silent_p.G431G	NM_001204817.1|NM_032828.3	NP_001191746.1|NP_116217.1	Q96SQ5	ZN587_HUMAN	zinc finger protein 587	474					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	15		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0264)		AATTATTTGGCAATAAGCACA	0.433																																					Pancreas(59;641 1233 1885 20055 50741)	.											0													154.0	150.0	151.0					19																	58371202		2203	4300	6503	SO:0001819	synonymous_variant	84914			AF294842	CCDS12964.1, CCDS56110.1	19q13.43	2013-01-08				ENSG00000198466		"""Zinc fingers, C2H2-type"", ""-"""	30955	protein-coding gene	gene with protein product						10520746	Standard	NM_032828		Approved	ZF6, FLJ14710, UBF-fl, FLJ20813	uc002qql.3	Q96SQ5	OTTHUMG00000154901	ENST00000339656.5:c.1422C>T	19.37:g.58371202C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A0AV72|G3V0H5|Q6ZMK8	Silent	SNP	ENST00000339656.5	37	CCDS12964.1																																																																																				0.433	ZNF587-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337594.2	NM_032828	
ZNF587	84914	mdanderson.org	37	19	58371209	58371209	+	Missense_Mutation	SNP	C	C	A			TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr19:58371209C>A	ENST00000339656.5	+	3	1611	c.1429C>A	c.(1429-1431)Cac>Aac	p.H477N	ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000597652.1_5'Flank|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF587_ENST00000423137.1_Missense_Mutation_p.H476N|ZNF814_ENST00000597342.1_Intron|ZNF587_ENST00000419854.1_Missense_Mutation_p.H434N	NM_001204817.1|NM_032828.3	NP_001191746.1|NP_116217.1	Q96SQ5	ZN587_HUMAN	zinc finger protein 587	477					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	15		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0264)		TGGCAATAAGCACAGCGTGAC	0.423																																					Pancreas(59;641 1233 1885 20055 50741)	.											0													158.0	150.0	153.0					19																	58371209		2203	4300	6503	SO:0001583	missense	84914			AF294842	CCDS12964.1, CCDS56110.1	19q13.43	2013-01-08				ENSG00000198466		"""Zinc fingers, C2H2-type"", ""-"""	30955	protein-coding gene	gene with protein product						10520746	Standard	NM_032828		Approved	ZF6, FLJ14710, UBF-fl, FLJ20813	uc002qql.3	Q96SQ5	OTTHUMG00000154901	ENST00000339656.5:c.1429C>A	19.37:g.58371209C>A	ENSP00000345479:p.His477Asn	Somatic		WXS	Illumina HiSeq	Phase_I	A0AV72|G3V0H5|Q6ZMK8	Missense_Mutation	SNP	ENST00000339656.5	37	CCDS12964.1	.	.	.	.	.	.	.	.	.	.	.	6.087	0.384262	0.11524	.	.	ENSG00000198466	ENST00000376209;ENST00000423137;ENST00000339656;ENST00000540851;ENST00000419854	T;T;T	0.13196	2.61;2.61;2.61	0.882	-1.59	0.08453	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06554	0.0168	N	0.11106	0.095	0.23496	N	0.99756	B;B	0.15473	0.0;0.013	B;B	0.16289	0.0;0.015	T	0.27673	-1.0067	8	0.56958	D	0.05	.	5.9746	0.19371	0.0:0.4805:0.0:0.5195	.	476;477	G3V0H5;Q96SQ5	.;ZN587_HUMAN	N	434;476;477;477;434	ENSP00000393865:H476N;ENSP00000345479:H477N;ENSP00000406999:H434N	ENSP00000345479:H477N	H	+	1	0	ZNF587	63063021	0.000000	0.05858	0.000000	0.03702	0.370000	0.29829	-1.806000	0.01735	-0.644000	0.05465	0.195000	0.17529	CAC		0.423	ZNF587-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337594.2	NM_032828	
ZNF587	84914	mdanderson.org	37	19	58371212	58371212	+	Missense_Mutation	SNP	A	A	T			TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr19:58371212A>T	ENST00000339656.5	+	3	1614	c.1432A>T	c.(1432-1434)Agc>Tgc	p.S478C	ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000597652.1_5'Flank|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF587_ENST00000423137.1_Missense_Mutation_p.S477C|ZNF814_ENST00000597342.1_Intron|ZNF587_ENST00000419854.1_Missense_Mutation_p.S435C	NM_001204817.1|NM_032828.3	NP_001191746.1|NP_116217.1	Q96SQ5	ZN587_HUMAN	zinc finger protein 587	478					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	15		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0264)		CAATAAGCACAGCGTGACTAT	0.423																																					Pancreas(59;641 1233 1885 20055 50741)	.											0													156.0	149.0	152.0					19																	58371212		2203	4300	6503	SO:0001583	missense	84914			AF294842	CCDS12964.1, CCDS56110.1	19q13.43	2013-01-08				ENSG00000198466		"""Zinc fingers, C2H2-type"", ""-"""	30955	protein-coding gene	gene with protein product						10520746	Standard	NM_032828		Approved	ZF6, FLJ14710, UBF-fl, FLJ20813	uc002qql.3	Q96SQ5	OTTHUMG00000154901	ENST00000339656.5:c.1432A>T	19.37:g.58371212A>T	ENSP00000345479:p.Ser478Cys	Somatic		WXS	Illumina HiSeq	Phase_I	A0AV72|G3V0H5|Q6ZMK8	Missense_Mutation	SNP	ENST00000339656.5	37	CCDS12964.1	.	.	.	.	.	.	.	.	.	.	.	7.068	0.567735	0.13560	.	.	ENSG00000198466	ENST00000376209;ENST00000423137;ENST00000339656;ENST00000540851;ENST00000419854	T;T;T	0.08008	3.14;3.14;3.14	0.882	-0.521	0.11931	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08980	0.0222	M	0.64630	1.985	0.24750	N	0.992985	B;B	0.27140	0.169;0.025	B;B	0.29598	0.104;0.033	T	0.20773	-1.0265	8	0.38643	T	0.18	.	4.8451	0.13510	0.7267:0.0:0.0:0.2733	.	477;478	G3V0H5;Q96SQ5	.;ZN587_HUMAN	C	435;477;478;478;435	ENSP00000393865:S477C;ENSP00000345479:S478C;ENSP00000406999:S435C	ENSP00000345479:S478C	S	+	1	0	ZNF587	63063024	0.000000	0.05858	0.000000	0.03702	0.344000	0.29017	-2.794000	0.00765	-0.256000	0.09473	0.164000	0.16699	AGC		0.423	ZNF587-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337594.2	NM_032828	
SNF8	11267	bcgsc.ca	37	17	47010703	47010703	+	Missense_Mutation	SNP	T	T	C			TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr17:47010703T>C	ENST00000502492.1	-	6	810	c.428A>G	c.(427-429)gAc>gGc	p.D143G	SNF8_ENST00000290330.3_Missense_Mutation_p.D143G|SNF8_ENST00000514089.1_5'UTR|AC091133.1_ENST00000435491.1_RNA			Q96H20	SNF8_HUMAN	SNF8, ESCRT-II complex subunit	143					endosomal transport (GO:0016197)|membrane organization (GO:0061024)|protein transport (GO:0015031)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			breast(1)|endometrium(1)|lung(1)	3						TCTGATCAGGTCATCTCTGAG	0.502																																						.											0													162.0	141.0	148.0					17																	47010703		2203	4300	6503	SO:0001583	missense	11267			AF156102	CCDS11541.1	17q21.32	2013-06-05	2013-06-05		ENSG00000159210	ENSG00000159210			17028	protein-coding gene	gene with protein product		610904	"""SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae)"""			10419521, 15329733	Standard	NM_007241		Approved	EAP30, VPS22, Dot3	uc002ioj.3	Q96H20	OTTHUMG00000160569	ENST00000502492.1:c.428A>G	17.37:g.47010703T>C	ENSP00000421380:p.Asp143Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q8IXY3|Q9UN50	Missense_Mutation	SNP	ENST00000502492.1	37	CCDS11541.1	.	.	.	.	.	.	.	.	.	.	T	16.25	3.071558	0.55646	.	.	ENSG00000159210	ENST00000502492;ENST00000290330	.	.	.	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	D	0.82962	0.5151	M	0.93106	3.38	0.80722	D	1	D;D	0.54397	0.958;0.966	P;P	0.54856	0.649;0.762	D	0.87276	0.2289	9	0.87932	D	0	-32.4767	16.2903	0.82747	0.0:0.0:0.0:1.0	.	143;143	Q96H20-2;Q96H20	.;SNF8_HUMAN	G	143	.	ENSP00000290330:D143G	D	-	2	0	SNF8	44365702	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.794000	0.85869	2.326000	0.78906	0.533000	0.62120	GAC		0.502	SNF8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000361172.1	NM_007241	
SMEK2	57223	bcgsc.ca	37	2	55842601	55842601	+	Missense_Mutation	SNP	A	A	G			TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr2:55842601A>G	ENST00000345102.5	-	2	485	c.184T>C	c.(184-186)Tat>Cat	p.Y62H	SMEK2_ENST00000272313.5_Missense_Mutation_p.Y62H|SMEK2_ENST00000477749.1_5'UTR|SMEK2_ENST00000407823.3_Missense_Mutation_p.Y62H|RP11-554J4.1_ENST00000608113.1_RNA	NM_001122964.1	NP_001116436	Q5MIZ7	P4R3B_HUMAN	SMEK homolog 2, suppressor of mek1 (Dictyostelium)	62	WH1.				positive regulation of gluconeogenesis (GO:0045722)|protein dephosphorylation (GO:0006470)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|protein phosphatase 4 complex (GO:0030289)				kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	16			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			TGTTTCTGATATGCAGTATTT	0.308																																						.											0													92.0	96.0	95.0					2																	55842601		2201	4299	6500	SO:0001583	missense	57223			AB037808	CCDS1855.1, CCDS46289.1, CCDS62913.1	2p16.1	2008-09-15			ENSG00000138041				29267	protein-coding gene	gene with protein product		610352				16085932, 18614045	Standard	NM_001122964		Approved	PSY2, FLFL2, KIAA1387, FLJ31474	uc002rzc.3	Q5MIZ7	OTTHUMG00000129336	ENST00000345102.5:c.184T>C	2.37:g.55842601A>G	ENSP00000339769:p.Tyr62His	Somatic		WXS	Illumina HiSeq	Phase_I	Q6P9B0|Q86XB8|Q9BQJ0|Q9BRK2|Q9H913|Q9P2G0	Missense_Mutation	SNP	ENST00000345102.5	37	CCDS46289.1	.	.	.	.	.	.	.	.	.	.	A	22.7	4.322473	0.81580	.	.	ENSG00000138041	ENST00000272313;ENST00000407823;ENST00000345102	T;T;T	0.46063	0.88;0.88;0.88	5.4	5.4	0.78164	Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	T	0.74854	0.3771	H	0.95114	3.625	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.83441	0.0043	10	0.87932	D	0	-9.6523	15.4274	0.75065	1.0:0.0:0.0:0.0	.	62;62;62	Q5MIZ7-2;Q5MIZ7;Q5MIZ7-3	.;P4R3B_HUMAN;.	H	62	ENSP00000272313:Y62H;ENSP00000385912:Y62H;ENSP00000339769:Y62H	ENSP00000272313:Y62H	Y	-	1	0	SMEK2	55696105	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.507000	0.90522	2.061000	0.61500	0.528000	0.53228	TAT		0.308	SMEK2-002	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251483.1	NM_020463	
ATG9A	79065	bcgsc.ca	37	2	220085850	220085850	+	Missense_Mutation	SNP	T	T	C			TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr2:220085850T>C	ENST00000409618.1	-	14	2759	c.2320A>G	c.(2320-2322)Acc>Gcc	p.T774A	ABCB6_ENST00000439002.2_5'Flank|ATG9A_ENST00000396761.2_Missense_Mutation_p.T774A|ATG9A_ENST00000409422.1_Missense_Mutation_p.T713A|AC068946.1_ENST00000408417.1_RNA|ABCB6_ENST00000265316.3_5'Flank|ATG9A_ENST00000361242.4_Missense_Mutation_p.T774A			Q7Z3C6	ATG9A_HUMAN	autophagy related 9A	774					autophagic vacuole assembly (GO:0000045)|late nucleophagy (GO:0044805)|mitochondrion degradation (GO:0000422)|piecemeal microautophagy of nucleus (GO:0034727)|protein localization to pre-autophagosomal structure (GO:0034497)|protein transport (GO:0015031)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|pre-autophagosomal structure (GO:0000407)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)				endometrium(2)|large_intestine(5)|lung(3)|prostate(1)|skin(1)|stomach(1)	13		Renal(207;0.0474)		Epithelial(149;1.37e-06)|all cancers(144;0.000222)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGGGCAGTGGTCTCAGGAGCT	0.647																																						.											0													21.0	23.0	22.0					2																	220085850		1892	4098	5990	SO:0001583	missense	79065			AK021732	CCDS42820.1	2q35	2014-02-12	2012-06-06	2005-09-11	ENSG00000198925	ENSG00000198925			22408	protein-coding gene	gene with protein product		612204	"""APG9 autophagy 9-like 1 (S. cerevisiae)"", ""ATG9 autophagy related 9 homolog A (S. cerevisiae)"""	APG9L1			Standard	NM_024085		Approved	FLJ22169	uc002vkf.1	Q7Z3C6	OTTHUMG00000154557	ENST00000409618.1:c.2320A>G	2.37:g.220085850T>C	ENSP00000386710:p.Thr774Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q3ZAQ6|Q6P0N7|Q7Z317|Q7Z320|Q8NDK6|Q8WU65|Q9BVL5|Q9H6L1|Q9HAG7	Missense_Mutation	SNP	ENST00000409618.1	37	CCDS42820.1	.	.	.	.	.	.	.	.	.	.	T	15.11	2.735244	0.48939	.	.	ENSG00000198925	ENST00000396761;ENST00000409618;ENST00000361242;ENST00000409422	T;T;T;T	0.71341	-0.56;-0.56;-0.56;-0.56	5.3	5.3	0.74995	.	0.320888	0.33813	N	0.004532	T	0.51907	0.1702	N	0.24115	0.695	0.37355	D	0.91096	B	0.06786	0.001	B	0.06405	0.002	T	0.51403	-0.8710	10	0.10902	T	0.67	-18.9449	9.84	0.40993	0.0:0.076:0.0:0.924	.	774	Q7Z3C6	ATG9A_HUMAN	A	774;774;774;713	ENSP00000379983:T774A;ENSP00000386710:T774A;ENSP00000355173:T774A;ENSP00000386535:T713A	ENSP00000355173:T774A	T	-	1	0	ATG9A	219794094	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	1.652000	0.37313	2.225000	0.72522	0.482000	0.46254	ACC		0.647	ATG9A-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335930.1	NM_024085	
FRG1B	284802	bcgsc.ca	37	20	29625885	29625885	+	Missense_Mutation	SNP	A	A	T			TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr20:29625885A>T	ENST00000278882.3	+	5	509	c.129A>T	c.(127-129)aaA>aaT	p.K43N	FRG1B_ENST00000358464.4_Missense_Mutation_p.K43N|FRG1B_ENST00000439954.2_Missense_Mutation_p.K48N			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	43								p.K43N(2)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TCGCCCTGAAATCTGGCTATG	0.353																																						.											2	Substitution - Missense(2)	prostate(2)																																								SO:0001583	missense	284802					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.129A>T	20.37:g.29625885A>T	ENSP00000278882:p.Lys43Asn	Somatic		WXS	Illumina HiSeq	Phase_I	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	a	10.23	1.292024	0.23564	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.62364	0.03	1.68	1.68	0.24146	.	0.000000	0.85682	D	0.000000	T	0.74145	0.3678	.	.	.	0.48762	D	0.999701	D	0.71674	0.998	D	0.79784	0.993	T	0.74598	-0.3612	9	0.87932	D	0	.	7.3757	0.26827	1.0:0.0:0.0:0.0	.	48	F5H5R5	.	N	43;48;43	ENSP00000408863:K48N	ENSP00000278882:K43N	K	+	3	2	FRG1B	28239546	1.000000	0.71417	1.000000	0.80357	0.064000	0.16182	0.595000	0.24029	1.028000	0.39785	0.155000	0.16302	AAA		0.353	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
UTRN	7402	bcgsc.ca	37	6	145110379	145110379	+	Missense_Mutation	SNP	T	T	C			TCGA-KO-8413-01A-11D-2310-10	TCGA-KO-8413-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a5a92196-b322-4ea4-8446-1844057de50b	9da1b142-030b-472b-861e-25be9ab226f3	g.chr6:145110379T>C	ENST00000367545.3	+	61	8884	c.8884T>C	c.(8884-8886)Tct>Cct	p.S2962P	UTRN_ENST00000367526.4_Missense_Mutation_p.S517P	NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	2962	Interaction with SYNM.				aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		TGGATTAATGTCTCTCTCCAA	0.299																																						.											0													131.0	150.0	143.0					6																	145110379		2203	4299	6502	SO:0001583	missense	7402			AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.8884T>C	6.37:g.145110379T>C	ENSP00000356515:p.Ser2962Pro	Somatic		WXS	Illumina HiSeq	Phase_I	Q5SYY1|Q5SZ57|Q9UJ40	Missense_Mutation	SNP	ENST00000367545.3	37	CCDS34547.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.961973	0.74016	.	.	ENSG00000152818	ENST00000367545;ENST00000367526	T;T	0.64085	-0.08;-0.08	5.96	3.45	0.39498	EF-hand domain, type 1 (1);EF-hand-like domain (1);	0.123946	0.36972	N	0.002309	T	0.59649	0.2209	M	0.83852	2.665	0.34582	D	0.714609	P	0.43231	0.801	P	0.47299	0.543	T	0.64989	-0.6277	10	0.42905	T	0.14	.	13.0868	0.59146	0.0:0.0:0.2518:0.7481	.	2962	P46939	UTRO_HUMAN	P	2962;517	ENSP00000356515:S2962P;ENSP00000356496:S517P	ENSP00000356496:S517P	S	+	1	0	UTRN	145152072	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	4.917000	0.63369	1.051000	0.40369	0.533000	0.62120	TCT		0.299	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042551.1		
