#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
KAT6B	23522	hgsc.bcm.edu	37	10	76790413	76790413	+	Missense_Mutation	SNP	A	A	G	rs143966521		TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr10:76790413A>G	ENST00000287239.4	+	18	6320	c.5831A>G	c.(5830-5832)tAt>tGt	p.Y1944C	KAT6B_ENST00000372725.1_Missense_Mutation_p.Y1652C|KAT6B_ENST00000372724.1_Missense_Mutation_p.Y1652C|KAT6B_ENST00000372711.1_Missense_Mutation_p.Y1761C|KAT6B_ENST00000372714.1_Missense_Mutation_p.Y1652C	NM_001256468.1|NM_012330.3	NP_001243397.1|NP_036462.2	Q8WYB5	KAT6B_HUMAN	K(lysine) acetyltransferase 6B	1944	Interaction with RUNX1 and RUNX2.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.Y1944C(1)									TCACAAATCTATGGGCGCTCC	0.552																																						.											1	Substitution - Missense(1)	lung(1)						A	CYS/TYR	0,4406		0,0,2203	86.0	86.0	86.0		5831	5.7	1.0	10	dbSNP_134	86	1,8599	1.2+/-3.3	0,1,4299	no	missense	KAT6B	NM_012330.2	194	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	probably-damaging	1944/2074	76790413	1,13005	2203	4300	6503	SO:0001583	missense	23522			AF113514	CCDS7345.1, CCDS58084.1, CCDS58085.1	10q22.2	2013-01-28	2011-07-21	2011-07-21	ENSG00000156650	ENSG00000156650		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	17582	protein-coding gene	gene with protein product	"""MOZ-related factor"""	605880	"""MYST histone acetyltransferase (monocytic leukemia) 4"""	MYST4		9205841, 10497217	Standard	NM_012330		Approved	querkopf, qkf, Morf, MOZ2, ZC2HC6B	uc001jwn.2	Q8WYB5	OTTHUMG00000018509	ENST00000287239.4:c.5831A>G	10.37:g.76790413A>G	ENSP00000287239:p.Tyr1944Cys	Somatic		WXS	Illumina HiSeq	Phase_I	O15087|Q86Y05|Q8WU81|Q9UKW2|Q9UKW3|Q9UKX0	Missense_Mutation	SNP	ENST00000287239.4	37	CCDS7345.1	.	.	.	.	.	.	.	.	.	.	A	14.09	2.432460	0.43224	0.0	1.16E-4	ENSG00000156650	ENST00000372725;ENST00000372724;ENST00000287239;ENST00000372714;ENST00000372711	D;D;D;D;D	0.87650	-2.13;-2.13;-2.28;-2.13;-2.14	5.69	5.69	0.88448	.	0.000000	0.45361	D	0.000363	D	0.89822	0.6826	L	0.29908	0.895	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.999;0.998	D	0.91276	0.5048	10	0.87932	D	0	-10.2811	15.9322	0.79672	1.0:0.0:0.0:0.0	.	1761;1652;1944	Q8WYB5-2;Q8WYB5-3;Q8WYB5	.;.;KAT6B_HUMAN	C	1652;1652;1944;1652;1761	ENSP00000361810:Y1652C;ENSP00000361809:Y1652C;ENSP00000287239:Y1944C;ENSP00000361799:Y1652C;ENSP00000361796:Y1761C	ENSP00000287239:Y1944C	Y	+	2	0	KAT6B	76460419	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.962000	0.93254	2.165000	0.68154	0.460000	0.39030	TAT		0.552	KAT6B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048771.1	NM_012330	
OR51I2	390064	hgsc.bcm.edu	37	11	5475431	5475431	+	Missense_Mutation	SNP	T	T	A	rs199654892|rs35301588	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr11:5475431T>A	ENST00000341449.2	+	1	794	c.713T>A	c.(712-714)cTc>cAc	p.L238H	AC104389.28_ENST00000415970.1_RNA|HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380259.2_Intron|HBG2_ENST00000380252.1_Intron	NM_001004754.2	NP_001004754.1	Q9H344	O51I2_HUMAN	olfactory receptor, family 51, subfamily I, member 2	238					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.09e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTCAAAGCTCTCAACACATGT	0.498																																						.											0													282.0	237.0	252.0					11																	5475431		2201	4297	6498	SO:0001583	missense	390064			BK004381	CCDS31383.1	11p15.4	2012-08-09			ENSG00000187918	ENSG00000187918		"""GPCR / Class A : Olfactory receptors"""	15201	protein-coding gene	gene with protein product							Standard	NM_001004754		Approved		uc010qzf.2	Q9H344	OTTHUMG00000066902	ENST00000341449.2:c.713T>A	11.37:g.5475431T>A	ENSP00000341987:p.Leu238His	Somatic		WXS	Illumina HiSeq	Phase_I	Q6IF81	Missense_Mutation	SNP	ENST00000341449.2	37	CCDS31383.1	.	.	.	.	.	.	.	.	.	.	T	14.64	2.594810	0.46318	.	.	ENSG00000187918	ENST00000341449	T	0.00207	8.55	5.58	5.58	0.84498	GPCR, rhodopsin-like superfamily (1);	0.110868	0.40908	D	0.000997	T	0.00875	0.0029	H	0.95574	3.69	0.31649	N	0.647016	D	0.76494	0.999	D	0.66847	0.947	T	0.03325	-1.1048	10	0.87932	D	0	.	14.7227	0.69320	0.0:0.0:0.0:1.0	.	238	Q9H344	O51I2_HUMAN	H	238	ENSP00000341987:L238H	ENSP00000341987:L238H	L	+	2	0	OR51I2	5432007	0.880000	0.30214	1.000000	0.80357	0.415000	0.31203	5.792000	0.69052	2.343000	0.79666	0.533000	0.62120	CTC		0.498	OR51I2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143385.1	NM_001004754	
DAAM1	23002	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	14	59793702	59793702	+	Missense_Mutation	SNP	G	G	T			TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr14:59793702G>T	ENST00000395125.1	+	11	1388	c.1365G>T	c.(1363-1365)atG>atT	p.M455I	DAAM1_ENST00000351081.1_Missense_Mutation_p.M455I|DAAM1_ENST00000360909.3_Missense_Mutation_p.M455I	NM_014992.2	NP_055807.1	Q9Y4D1	DAAM1_HUMAN	dishevelled associated activator of morphogenesis 1	455					actin cytoskeleton organization (GO:0030036)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	identical protein binding (GO:0042802)			breast(3)|cervix(3)|endometrium(5)|kidney(5)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	37				OV - Ovarian serous cystadenocarcinoma(108;0.165)		CGGAAAAAATGAGAAAAGGTA	0.333																																						.											0													160.0	175.0	170.0					14																	59793702		2203	4300	6503	SO:0001583	missense	23002			AB014566	CCDS9737.1, CCDS58323.1	14q22.3	2008-08-11			ENSG00000100592	ENSG00000100592			18142	protein-coding gene	gene with protein product		606626				11779461, 18162551	Standard	NM_014992		Approved	KIAA0666	uc031qou.1	Q9Y4D1	OTTHUMG00000140326	ENST00000395125.1:c.1365G>T	14.37:g.59793702G>T	ENSP00000378557:p.Met455Ile	Somatic		WXS	Illumina HiSeq	Phase_I	Q86U34|Q8N1Z8|Q8TB39	Missense_Mutation	SNP	ENST00000395125.1	37	CCDS9737.1	.	.	.	.	.	.	.	.	.	.	G	19.46	3.831199	0.71258	.	.	ENSG00000100592	ENST00000360909;ENST00000351081;ENST00000358498;ENST00000395125	T;T;T	0.39997	1.05;1.05;1.05	6.01	6.01	0.97437	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.42787	0.1218	M	0.68952	2.095	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.001	T	0.24119	-1.0169	10	0.46703	T	0.11	.	12.7696	0.57412	0.074:0.0:0.926:0.0	.	455;455	Q9Y4D1-2;Q9Y4D1	.;DAAM1_HUMAN	I	455	ENSP00000354162:M455I;ENSP00000247170:M455I;ENSP00000378557:M455I	ENSP00000247170:M455I	M	+	3	0	DAAM1	58863455	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.475000	0.73582	2.861000	0.98227	0.650000	0.86243	ATG		0.333	DAAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276942.2	NM_014992	
YLPM1	56252	broad.mit.edu;hgsc.bcm.edu;bcgsc.ca	37	14	75265325	75265325	+	Nonsense_Mutation	SNP	C	C	T			TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr14:75265325C>T	ENST00000325680.7	+	5	3449	c.3325C>T	c.(3325-3327)Cga>Tga	p.R1109*	YLPM1_ENST00000552421.1_Intron|YLPM1_ENST00000238571.3_Nonsense_Mutation_p.R914*	NM_019589.2	NP_062535.2	P49750	YLPM1_HUMAN	YLP motif containing 1	914	Arg-rich.				regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		AGCTGGCAGCCGAGAAAGGGG	0.627																																						.											0													45.0	54.0	51.0					14																	75265325		1933	4131	6064	SO:0001587	stop_gained	56252			AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000325680.7:c.3325C>T	14.37:g.75265325C>T	ENSP00000324463:p.Arg1109*	Somatic		WXS	Illumina HiSeq	Phase_I	P49752|Q96I64|Q9P1V7	Nonsense_Mutation	SNP	ENST00000325680.7	37	CCDS45135.1	.	.	.	.	.	.	.	.	.	.	C	33	5.253132	0.95336	.	.	ENSG00000119596	ENST00000325680;ENST00000238571;ENST00000423680	.	.	.	5.78	3.91	0.45181	.	0.110829	0.40302	N	0.001127	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.3673	10.8655	0.46853	0.3692:0.5117:0.1192:0.0	.	.	.	.	X	1109;914;822	.	ENSP00000238571:R914X	R	+	1	2	YLPM1	74335078	0.996000	0.38824	0.999000	0.59377	0.972000	0.66771	0.320000	0.19540	0.739000	0.32628	0.643000	0.83706	CGA		0.627	YLPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404451.1	NM_019589	
LIPC	3990	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	58837951	58837951	+	Silent	SNP	C	C	T	rs149322349		TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr15:58837951C>T	ENST00000356113.6	+	7	1200	c.585C>T	c.(583-585)gcC>gcT	p.A195A	LIPC_ENST00000299022.5_Silent_p.A195A|LIPC_ENST00000433326.2_Silent_p.A134A|LIPC_ENST00000414170.3_Silent_p.A195A			P11150	LIPC_HUMAN	lipase, hepatic	195					cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|chylomicron remnant clearance (GO:0034382)|fatty acid biosynthetic process (GO:0006633)|high-density lipoprotein particle remodeling (GO:0034375)|intermediate-density lipoprotein particle remodeling (GO:0034373)|low-density lipoprotein particle remodeling (GO:0034374)|phosphatidylcholine catabolic process (GO:0034638)|reverse cholesterol transport (GO:0043691)|triglyceride catabolic process (GO:0019433)|triglyceride homeostasis (GO:0070328)|very-low-density lipoprotein particle remodeling (GO:0034372)	extracellular space (GO:0005615)|high-density lipoprotein particle (GO:0034364)	apolipoprotein binding (GO:0034185)|heparin binding (GO:0008201)|low-density lipoprotein particle binding (GO:0030169)|phospholipase activity (GO:0004620)|triglyceride lipase activity (GO:0004806)	p.A195A(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		Colorectal(260;0.215)		GBM - Glioblastoma multiforme(80;0.00213)|all cancers(107;0.00548)		GGCTGGATGCCGCGGGACCTT	0.493																																						.											1	Substitution - coding silent(1)	endometrium(1)						C		0,4384		0,0,2192	62.0	59.0	60.0		585	-10.9	0.0	15	dbSNP_134	60	1,8583	1.2+/-3.3	0,1,4291	no	coding-synonymous	LIPC	NM_000236.2		0,1,6483	TT,TC,CC		0.0116,0.0,0.0077		195/500	58837951	1,12967	2192	4292	6484	SO:0001819	synonymous_variant	3990				CCDS10166.1	15q21-q23	2012-10-02			ENSG00000166035	ENSG00000166035	3.1.1.3		6619	protein-coding gene	gene with protein product		151670					Standard	NM_000236		Approved	HL, HTGL	uc002afa.2	P11150	OTTHUMG00000132632	ENST00000356113.6:c.585C>T	15.37:g.58837951C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A2RUB4|A8K9B6|O43571|P78529|Q99465	Silent	SNP	ENST00000356113.6	37	CCDS10166.1																																																																																				0.493	LIPC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416209.1		
CYP1A2	1544	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	15	75042327	75042327	+	Missense_Mutation	SNP	C	C	T	rs138652540		TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr15:75042327C>T	ENST00000343932.4	+	2	311	c.248C>T	c.(247-249)aCg>aTg	p.T83M		NM_000761.3	NP_000752.2	P05177	CP1A2_HUMAN	cytochrome P450, family 1, subfamily A, polypeptide 2	83			T -> M (in allele CYP1A2*9). {ECO:0000269|PubMed:14563787}.		alkaloid metabolic process (GO:0009820)|arachidonic acid metabolic process (GO:0019369)|cellular respiration (GO:0045333)|cellular response to cadmium ion (GO:0071276)|dibenzo-p-dioxin metabolic process (GO:0018894)|drug catabolic process (GO:0042737)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|exogenous drug catabolic process (GO:0042738)|heterocycle metabolic process (GO:0046483)|hydrogen peroxide biosynthetic process (GO:0050665)|lung development (GO:0030324)|methylation (GO:0032259)|monocarboxylic acid metabolic process (GO:0032787)|monoterpenoid metabolic process (GO:0016098)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|oxidative deethylation (GO:0071615)|oxidative demethylation (GO:0070989)|porphyrin-containing compound metabolic process (GO:0006778)|post-embryonic development (GO:0009791)|regulation of gene expression (GO:0010468)|response to estradiol (GO:0032355)|response to lipopolysaccharide (GO:0032496)|small molecule metabolic process (GO:0044281)|steroid catabolic process (GO:0006706)|toxin biosynthetic process (GO:0009403)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	aromatase activity (GO:0070330)|caffeine oxidase activity (GO:0034875)|demethylase activity (GO:0032451)|electron carrier activity (GO:0009055)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)			breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(7)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	33					"""""""Insulin(DB00071)|Acenocoumarol(DB01418)|Acetaminophen(DB00316)|Agomelatine(DB06594)|Albendazole(DB00518)|Alitretinoin(DB00523)|Almotriptan(DB00918)|Alosetron(DB00969)|Aminoglutethimide(DB00357)|Aminophenazone(DB01424)|Aminophylline(DB01223)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Anagrelide(DB00261)|Anastrozole(DB01217)|Antipyrine(DB01435)|Apixaban(DB06605)|Aprepitant(DB00673)|Asenapine(DB06216)|Atropine(DB00572)|Axitinib(DB06626)|Azelastine(DB00972)|Azithromycin(DB00207)|Benzyl alcohol(DB06770)|Betaxolol(DB00195)|Bortezomib(DB00188)|Bromazepam(DB01558)|Bromocriptine(DB01200)|Bupivacaine(DB00297)|Buprenorphine(DB00921)|Bupropion(DB01156)|Caffeine(DB00201)|Carbamazepine(DB00564)|Carmustine(DB00262)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Chlorzoxazone(DB00356)|Cilostazol(DB01166)|Cimetidine(DB00501)|Cinacalcet(DB01012)|Cinnarizine(DB00568)|Ciprofloxacin(DB00537)|Cisapride(DB00604)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clenbuterol(DB01407)|Clevidipine(DB04920)|Clobetasol propionate(DB01013)|Clomifene(DB00882)|Clomipramine(DB01242)|Clonidine(DB00575)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Conjugated Estrogens(DB00286)|Cyclobenzaprine(DB00924)|Dacarbazine(DB00851)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Delavirdine(DB00705)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexfenfluramine(DB01191)|Dexmedetomidine(DB00633)|Diazepam(DB00829)|Diclofenac(DB00586)|Dinoprostone(DB00917)|Diphenhydramine(DB01075)|Domperidone(DB01184)|Dopamine(DB00988)|Doxepin(DB01142)|Duloxetine(DB00476)|Edetic Acid(DB00974)|Efavirenz(DB00625)|Eltrombopag(DB06210)|Enoxacin(DB00467)|Epinephrine(DB00668)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estrone(DB00655)|Estropipate(DB04574)|Ethanol(DB00898)|Etoposide(DB00773)|Etoricoxib(DB01628)|Flunarizine(DB04841)|Flunitrazepam(DB01544)|Fluorouracil(DB00544)|Fluoxetine(DB00472)|Fluphenazine(DB00623)|Flutamide(DB00499)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Frovatriptan(DB00998)|Gemfibrozil(DB01241)|Griseofulvin(DB00400)|Guanabenz(DB00629)|Haloperidol(DB00502)|Hesperetin(DB01094)|Hexobarbital(DB01355)|Iloperidone(DB04946)|Imatinib(DB00619)|Imipramine(DB00458)|Imiquimod(DB00724)|inhaled insulin(DB05278)|Insulin Aspart(DB01306)|Insulin Detemir(DB01307)|Insulin Glargine(DB00047)|Insulin Glulisine(DB01309)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Irbesartan(DB01029)|Isoniazid(DB00951)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Leflunomide(DB01097)|Levobupivacaine(DB01002)|Levofloxacin(DB01137)|Lidocaine(DB00281)|Lomefloxacin(DB00978)|Lopinavir(DB01601)|Lorcaserin(DB04871)|Losartan(DB00678)|Lumiracoxib(DB01283)|Malathion(DB00772)|Maprotiline(DB00934)|Meclizine(DB00737)|Melatonin(DB01065)|Menadione(DB00170)|Methadone(DB00333)|Methimazole(DB00763)|Methotrimeprazine(DB01403)|Methoxsalen(DB00553)|Methoxyflurane(DB01028)|Mexiletine(DB00379)|Mianserin(DB06148)|Miconazole(DB01110)|Mirtazapine(DB00370)|Moclobemide(DB01171)|Modafinil(DB00745)|Nabumetone(DB00461)|Nafcillin(DB00607)|Naproxen(DB00788)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Niclosamide(DB06803)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitric Oxide(DB00435)|Nitroprusside(DB00325)|Norepinephrine(DB00368)|Norfloxacin(DB01059)|Nortriptyline(DB00540)|Ofloxacin(DB01165)|Olanzapine(DB00334)|Omeprazole(DB00338)|Ondansetron(DB00904)|Oxaliplatin(DB00526)|Oxtriphylline(DB01303)|Palonosetron(DB00377)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Pefloxacin(DB00487)|Pentamidine(DB00738)|Pentoxifylline(DB00806)|Perphenazine(DB00850)|Phenobarbital(DB01174)|Phentermine(DB00191)|Phenylephrine(DB00388)|Phenylpropanolamine(DB00397)|Pimozide(DB01100)|Pipotiazine(DB01621)|Pomalidomide(DB08910)|Praziquantel(DB01058)|Primaquine(DB01087)|Primidone(DB00794)|Progesterone(DB00396)|Proguanil(DB01131)|Promazine(DB00420)|Propafenone(DB01182)|Propofol(DB00818)|Propranolol(DB00571)|Pyrazinamide(DB00339)|Quinidine(DB00908)|Quinine(DB00468)|Rabeprazole(DB01129)|Ramelteon(DB00980)|Ranitidine(DB00863)|Rasagiline(DB01367)|Rifabutin(DB00615)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Riluzole(DB00740)|Ritonavir(DB00503)|Rizatriptan(DB00953)|Ropinirole(DB00268)|Ropivacaine(DB00296)|Rosiglitazone(DB00412)|Rotigotine(DB05271)|Roxithromycin(DB00778)|Secobarbital(DB00418)|Selegiline(DB01037)|Sertraline(DB01104)|SIMEPREVIR(DB06290)|Sorafenib(DB00398)|Streptozocin(DB00428)|Sulindac(DB00605)|Tamoxifen(DB00675)|Telithromycin(DB00976)|Tenofovir(DB00300)|Terbinafine(DB00857)|Thalidomide(DB01041)|Theobromine(DB01412)|Theophylline(DB00277)|Thiabendazole(DB00730)|Thioridazine(DB00679)|Thiothixene(DB01623)|Ticlopidine(DB00208)|Tioconazole(DB01007)|Tizanidine(DB00697)|Tocainide(DB01056)|Toremifene(DB00539)|Tranylcypromine(DB00752)|Triamterene(DB00384)|Trifluoperazine(DB00831)|Valproic Acid(DB00313)|Vemurafenib(DB08881)|Verapamil(DB00661)|Warfarin(DB00682)|Zafirlukast(DB00549)|Zileuton(DB00744)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)|Zolpidem(DB00425)"""	ATTGGCTCCACGCCCGTGCTG	0.667													C|||	1	0.000199681	0.0	0.0014	5008	,	,		18734	0.0		0.0	False		,,,				2504	0.0					.											0								C	MET/THR	1,4393	2.1+/-5.4	0,1,2196	51.0	46.0	48.0		248	3.1	0.3	15	dbSNP_134	48	0,8592		0,0,4296	yes	missense	CYP1A2	NM_000761.3	81	0,1,6492	TT,TC,CC		0.0,0.0228,0.0077	probably-damaging	83/517	75042327	1,12985	2197	4296	6493	SO:0001583	missense	1544			AF182274	CCDS32293.1	15q24.1	2013-11-11	2003-01-14		ENSG00000140505	ENSG00000140505	1.14.14.1	"""Cytochrome P450s"""	2596	protein-coding gene	gene with protein product		124060	"""cytochrome P450, subfamily I (aromatic compound-inducible), polypeptide 2"""			15128046	Standard	NM_000761		Approved	P3-450, CP12	uc002ayr.1	P05177	OTTHUMG00000172901	ENST00000343932.4:c.248C>T	15.37:g.75042327C>T	ENSP00000342007:p.Thr83Met	Somatic		WXS	Illumina HiSeq	Phase_I	Q16754|Q6NWU5|Q9BXX7|Q9UK49	Missense_Mutation	SNP	ENST00000343932.4	37	CCDS32293.1	.	.	.	.	.	.	.	.	.	.	c	14.29	2.489965	0.44249	2.28E-4	0.0	ENSG00000140505	ENST00000343932	T	0.70045	-0.45	4.98	3.11	0.35812	.	0.153946	0.52532	D	0.000076	T	0.77075	0.4077	M	0.81341	2.54	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.65689	-0.6107	10	0.52906	T	0.07	.	3.3504	0.07150	0.1313:0.5675:0.1437:0.1575	.	83	P05177-2	.	M	83	ENSP00000342007:T83M	ENSP00000342007:T83M	T	+	2	0	CYP1A2	72829380	0.028000	0.19301	0.338000	0.25549	0.878000	0.50629	1.520000	0.35899	0.704000	0.31869	-0.215000	0.12644	ACG		0.667	CYP1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421263.2	NM_000761	
P4HB	5034	hgsc.bcm.edu	37	17	79801890	79801891	+	Stop_Codon_Del	DEL	AC	AC	-			TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	AC	AC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr17:79801890_79801891delAC	ENST00000331483.4	-	0	1746_1747				RP11-498C9.2_ENST00000576784.1_RNA|P4HB_ENST00000439918.2_Stop_Codon_Del|P4HB_ENST00000472244.1_5'Flank|P4HB_ENST00000576390.1_Intron	NM_000918.3	NP_000909.2	P07237	PDIA1_HUMAN	prolyl 4-hydroxylase, beta polypeptide						cell redox homeostasis (GO:0045454)|cellular response to hypoxia (GO:0071456)|extracellular matrix organization (GO:0030198)|lipoprotein metabolic process (GO:0042157)|peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)|protein folding (GO:0006457)|regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902175)|response to endoplasmic reticulum stress (GO:0034976)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|procollagen-proline 4-dioxygenase complex (GO:0016222)	poly(A) RNA binding (GO:0044822)|procollagen-proline 4-dioxygenase activity (GO:0004656)|protein disulfide isomerase activity (GO:0003756)			NS(1)|breast(1)|large_intestine(2)|lung(17)|urinary_tract(1)	22	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0509)			TTTGCGTATTACAGTTCATCTT	0.609																																					Colon(49;444 983 1296 7887 42561)	.											0																																										SO:0001567	stop_retained_variant	5034			J02783	CCDS11787.1	17q25	2011-10-19	2008-12-09		ENSG00000185624	ENSG00000185624	1.14.11.2, 5.3.4.1	"""Protein disulfide isomerases"""	8548	protein-coding gene	gene with protein product	"""protein disulfide isomerase-associated 1"", ""protein disulfide isomerase family A, member 1"", ""collagen prolyl 4-hydroxylase beta"""	176790	"""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), beta polypeptide (protein disulfide isomerase; thyroid hormone binding protein p55)"", ""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), beta polypeptide (protein disulfide isomerase-associated 1)"", ""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), beta polypeptide"""	PO4DB, ERBA2L		8111381	Standard	NM_000918		Approved	PDIA1, PROHB, DSI, GIT, PDI, PO4HB, P4Hbeta	uc002kbn.1	P07237	OTTHUMG00000150269	Exception_encountered	17.37:g.79801890_79801891delAC	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_I	B2RDQ2|P30037|P32079|Q15205|Q6LDE5	Frame_Shift_Del	DEL	ENST00000331483.4	37	CCDS11787.1																																																																																				0.609	P4HB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317250.3	NM_000918	
MUC16	94025	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	19	8994179	8994179	+	Missense_Mutation	SNP	C	C	T			TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr19:8994179C>T	ENST00000397910.4	-	65	41709	c.41506G>A	c.(41506-41508)Ggc>Agc	p.G13836S	MUC16_ENST00000380951.5_Missense_Mutation_p.G477S	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	13839	SEA 12. {ECO:0000255|PROSITE- ProRule:PRU00188}.			Missing (in Ref. 3; AAK74120). {ECO:0000305}.	cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TACAGAGGGCCAACACTGGTG	0.522																																						.											0													115.0	101.0	106.0					19																	8994179		1999	4173	6172	SO:0001583	missense	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.41506G>A	19.37:g.8994179C>T	ENSP00000381008:p.Gly13836Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	.	15.37	2.812775	0.50527	.	.	ENSG00000181143	ENST00000397910;ENST00000380951	T;T	0.39056	1.1;1.1	3.74	1.56	0.23342	SEA (1);	0.203527	0.24523	N	0.037787	T	0.54013	0.1832	M	0.64997	1.995	.	.	.	P;D	0.71674	0.907;0.998	P;D	0.80764	0.623;0.994	T	0.61559	-0.7038	9	0.56958	D	0.05	.	6.2106	0.20628	0.0:0.7621:0.0:0.2379	.	21481;13836	Q8WXI7;B5ME49	MUC16_HUMAN;.	S	13836;477	ENSP00000381008:G13836S;ENSP00000370338:G477S	ENSP00000370338:G477S	G	-	1	0	MUC16	8855179	0.017000	0.18338	0.001000	0.08648	0.196000	0.23810	1.901000	0.39838	0.387000	0.25024	-0.157000	0.13467	GGC		0.522	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
CEP89	84902	hgsc.bcm.edu	37	19	33444556	33444556	+	Missense_Mutation	SNP	T	T	C	rs73579706	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr19:33444556T>C	ENST00000305768.5	-	4	545	c.457A>G	c.(457-459)Agt>Ggt	p.S153G	CEP89_ENST00000590597.2_Missense_Mutation_p.S153G	NM_032816.3	NP_116205.3	Q96ST8	CEP89_HUMAN	centrosomal protein 89kDa	153					cilium assembly (GO:0042384)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(2)|cervix(1)|endometrium(4)|large_intestine(4)|lung(15)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	35						AGGTCATCACTGTGGCCTCCT	0.483																																						.											0													401.0	426.0	418.0					19																	33444556		2203	4300	6503	SO:0001583	missense	84902			AL832158	CCDS32987.1	19q13.11	2014-02-20	2011-05-06	2011-05-06		ENSG00000121289			25907	protein-coding gene	gene with protein product		615470	"""coiled-coil domain containing 123"""	CCDC123		16395595	Standard	NM_032816		Approved	FLJ14640	uc002nty.3	Q96ST8		ENST00000305768.5:c.457A>G	19.37:g.33444556T>C	ENSP00000306105:p.Ser153Gly	Somatic		WXS	Illumina HiSeq	Phase_I	B9EGA6|Q8N5J8	Missense_Mutation	SNP	ENST00000305768.5	37	CCDS32987.1	.	.	.	.	.	.	.	.	.	.	T	3.578	-0.086165	0.07097	.	.	ENSG00000121289	ENST00000305768	T	0.31510	1.49	5.12	-10.2	0.00374	.	3.796690	0.00695	N	0.000748	T	0.07234	0.0183	N	0.01048	-1.04	0.09310	N	1	B;B;B	0.12013	0.005;0.0;0.0	B;B;B	0.08055	0.003;0.0;0.0	T	0.34725	-0.9817	10	0.22706	T	0.39	7.6155	0.6143	0.00767	0.2371:0.2982:0.1712:0.2935	.	124;153;153	Q8WUL5;Q96ST8-3;Q96ST8	.;.;CEP89_HUMAN	G	153	ENSP00000306105:S153G	ENSP00000306105:S153G	S	-	1	0	CEP89	38136396	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.650000	0.01991	-4.026000	0.00080	-0.951000	0.02657	AGT		0.483	CEP89-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451300.2	NM_032816	
PPDPF	79144	hgsc.bcm.edu	37	20	62152686	62152687	+	Frame_Shift_Ins	INS	-	-	CC	rs138230076		TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr20:62152686_62152687insCC	ENST00000370179.3	+	2	221_222	c.25_26insCC	c.(25-27)tcgfs	p.S9fs	PPDPF_ENST00000370177.1_Frame_Shift_Ins_p.S9fs|PPDPF_ENST00000473620.1_Intron	NM_024299.2	NP_077275.1	Q9H3Y8	PPDPF_HUMAN	pancreatic progenitor cell differentiation and proliferation factor	9					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)					kidney(1)|lung(2)|ovary(1)	4						CTCCAGCGGCTCGCTCGTGGCC	0.698																																						.											0																																										SO:0001589	frameshift_variant	79144			AL121829	CCDS13523.1	20q13.33	2013-07-23	2013-07-23	2009-06-04	ENSG00000125534	ENSG00000125534			16142	protein-coding gene	gene with protein product	"""exocrine differentiation and proliferation factor"""		"""chromosome 20 open reading frame 149"", ""pancreatic progenitor cell differentiation and proliferation factor homolog (zebrafish)"""	C20orf149			Standard	NM_024299		Approved	dJ697K14.9, exdpf	uc002yff.3	Q9H3Y8	OTTHUMG00000032978	Exception_encountered	20.37:g.62152686_62152687insCC	ENSP00000359198:p.Ser9fs	Somatic		WXS	Illumina HiSeq	Phase_I	E1P5J2|Q4VXP1|Q9H3Y7	Frame_Shift_Ins	INS	ENST00000370179.3	37	CCDS13523.1																																																																																				0.698	PPDPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080149.1		
PCDH12	51294	hgsc.bcm.edu	37	5	141324954	141324954	+	Missense_Mutation	SNP	A	A	T	rs200120809		TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr5:141324954A>T	ENST00000231484.3	-	4	4757	c.3547T>A	c.(3547-3549)Tgc>Agc	p.C1183S		NM_016580.2	NP_057664.1	Q9NPG4	PCD12_HUMAN	protocadherin 12	1183					calcium-dependent cell-cell adhesion (GO:0016339)|glycogen metabolic process (GO:0005977)|homophilic cell adhesion (GO:0007156)|labyrinthine layer development (GO:0060711)|neuron recognition (GO:0008038)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(3)|prostate(2)|skin(1)	38		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTTCACAGGCACctgctgctg	0.562																																						.											0													22.0	23.0	23.0					5																	141324954		2201	4290	6491	SO:0001583	missense	51294			AF231025	CCDS4269.1	5q31.3	2010-01-26			ENSG00000113555	ENSG00000113555		"""Cadherins / Protocadherins : Non-clustered"""	8657	protein-coding gene	gene with protein product		605622				10716726, 10380929	Standard	NM_016580		Approved	VE-cadherin-2	uc003llx.3	Q9NPG4	OTTHUMG00000129658	ENST00000231484.3:c.3547T>A	5.37:g.141324954A>T	ENSP00000231484:p.Cys1183Ser	Somatic		WXS	Illumina HiSeq	Phase_I	Q6UXB6|Q96KB8|Q9H7Y6|Q9H8E0	Missense_Mutation	SNP	ENST00000231484.3	37	CCDS4269.1	.	.	.	.	.	.	.	.	.	.	A	2.539	-0.306764	0.05458	.	.	ENSG00000113555	ENST00000231484	T	0.48836	0.8	5.54	3.42	0.39159	.	0.703549	0.13113	N	0.412850	T	0.22666	0.0547	N	0.08118	0	0.09310	N	1	B	0.13594	0.008	B	0.09377	0.004	T	0.19745	-1.0296	10	0.20046	T	0.44	.	3.9309	0.09285	0.3566:0.4726:0.0:0.1708	.	1183	Q9NPG4	PCD12_HUMAN	S	1183	ENSP00000231484:C1183S	ENSP00000231484:C1183S	C	-	1	0	PCDH12	141305138	0.000000	0.05858	0.112000	0.21494	0.305000	0.27757	0.199000	0.17237	0.589000	0.29677	0.533000	0.62120	TGC		0.562	PCDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251858.1	NM_016580	
ADAMTS2	9509	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	5	178580530	178580530	+	Missense_Mutation	SNP	G	G	A			TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr5:178580530G>A	ENST00000251582.7	-	9	1578	c.1477C>T	c.(1477-1479)Cgc>Tgc	p.R493C	ADAMTS2_ENST00000274609.5_Missense_Mutation_p.R493C	NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	493	Disintegrin.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		AAGTCAAAGCGGCATTGCTCG	0.662																																						.											0													76.0	59.0	65.0					5																	178580530		2202	4300	6502	SO:0001583	missense	9509			AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.1477C>T	5.37:g.178580530G>A	ENSP00000251582:p.Arg493Cys	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000251582.7	37	CCDS4444.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.125084	0.77436	.	.	ENSG00000087116	ENST00000251582;ENST00000274609	T;T	0.71103	-0.54;-0.54	4.58	3.69	0.42338	Metallopeptidase, catalytic domain (1);	0.105625	0.42548	D	0.000696	D	0.84857	0.5565	M	0.89095	3.005	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.995;0.998	D	0.86522	0.1816	10	0.87932	D	0	.	11.2801	0.49188	0.0:0.0:0.6691:0.3309	.	493;493	O95450-2;O95450	.;ATS2_HUMAN	C	493	ENSP00000251582:R493C;ENSP00000274609:R493C	ENSP00000251582:R493C	R	-	1	0	ADAMTS2	178513136	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.578000	0.82498	1.000000	0.39049	0.462000	0.41574	CGC		0.662	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253507.1	NM_014244	
PPP1R9A	55607	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org;bcgsc.ca	37	7	94827677	94827677	+	Missense_Mutation	SNP	G	G	A			TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr7:94827677G>A	ENST00000433881.1	+	6	2303	c.1771G>A	c.(1771-1773)Gaa>Aaa	p.E591K	PPP1R9A_ENST00000424654.1_Missense_Mutation_p.E591K|PPP1R9A_ENST00000289495.5_Missense_Mutation_p.E591K|AC002429.5_ENST00000417881.2_RNA|PPP1R9A_ENST00000340694.4_Missense_Mutation_p.E591K|PPP1R9A_ENST00000433360.1_Missense_Mutation_p.E591K|PPP1R9A_ENST00000456331.2_Missense_Mutation_p.E591K			Q9ULJ8	NEB1_HUMAN	protein phosphatase 1, regulatory subunit 9A	591	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				actin filament organization (GO:0007015)|calcium-mediated signaling (GO:0019722)|neuron projection development (GO:0031175)	cell junction (GO:0030054)|cortical actin cytoskeleton (GO:0030864)|dendritic spine (GO:0043197)|filopodium (GO:0030175)|growth cone (GO:0030426)|synapse (GO:0045202)		p.E591*(2)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(11)|liver(2)|lung(22)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(8)|urinary_tract(5)	71	all_cancers(62;9.12e-11)|all_epithelial(64;4.34e-09)		STAD - Stomach adenocarcinoma(171;0.0031)			TATTGGGCGGGAAAAACCAGG	0.448										HNSCC(28;0.073)																												.											2	Substitution - Nonsense(2)	lung(2)											77.0	78.0	78.0					7																	94827677		2203	4300	6503	SO:0001583	missense	55607			AB033048	CCDS34683.1, CCDS55127.1, CCDS55128.1	7q21.3	2013-01-10	2011-10-04		ENSG00000158528	ENSG00000158528		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Sterile alpha motif (SAM) domain containing"""	14946	protein-coding gene	gene with protein product		602468	"""protein phosphatase 1, regulatory (inhibitor) subunit 9A"""			10574462	Standard	NM_001166160		Approved	Neurabin-I, KIAA1222, FLJ20068	uc010lfj.3	Q9ULJ8	OTTHUMG00000155566	ENST00000433881.1:c.1771G>A	7.37:g.94827677G>A	ENSP00000398870:p.Glu591Lys	Somatic		WXS	Illumina HiSeq	Phase_I	A1L494|B2RWQ1|E9PCA0|E9PCK6|E9PDX1|F8W7J9|O76059|Q9NXT2	Missense_Mutation	SNP	ENST00000433881.1	37	CCDS34683.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.048562	0.75846	.	.	ENSG00000158528	ENST00000433360;ENST00000340694;ENST00000424654;ENST00000433881;ENST00000289495;ENST00000456331	T;T;T;T;T;T	0.38401	1.14;1.14;1.14;1.14;1.14;1.14	5.61	5.61	0.85477	PDZ/DHR/GLGF (3);	0.000000	0.85682	D	0.000000	T	0.54854	0.1884	L	0.41632	1.29	0.80722	D	1	D;D;D;D;D	0.89917	0.995;1.0;1.0;0.998;0.998	D;D;D;D;D	0.85130	0.978;0.997;0.997;0.973;0.986	T	0.54536	-0.8279	10	0.87932	D	0	.	20.0173	0.97481	0.0:0.0:1.0:0.0	.	591;591;591;591;591	B7ZLX4;F8W7J9;E9PDX1;E9PCK6;Q9ULJ8	.;.;.;.;NEB1_HUMAN	K	591	ENSP00000405514:E591K;ENSP00000344524:E591K;ENSP00000411342:E591K;ENSP00000398870:E591K;ENSP00000289495:E591K;ENSP00000402893:E591K	ENSP00000289495:E591K	E	+	1	0	PPP1R9A	94665613	1.000000	0.71417	0.998000	0.56505	0.038000	0.13279	9.718000	0.98758	2.814000	0.96858	0.591000	0.81541	GAA		0.448	PPP1R9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340662.1	NM_001166160	
PPP6C	5537	broad.mit.edu;hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	9	127915854	127915854	+	Silent	SNP	G	G	A			TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr9:127915854G>A	ENST00000373547.4	-	6	726	c.627C>T	c.(625-627)ccC>ccT	p.P209P	PPP6C_ENST00000451402.1_Silent_p.P246P|PPP6C_ENST00000373546.3_Silent_p.P62P|PPP6C_ENST00000415905.1_Silent_p.P187P	NM_002721.4	NP_002712.1	O00743	PPP6_HUMAN	protein phosphatase 6, catalytic subunit	209					G1/S transition of mitotic cell cycle (GO:0000082)|protein dephosphorylation (GO:0006470)	cytosol (GO:0005829)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			NS(2)|endometrium(1)|large_intestine(4)|liver(1)|lung(2)|ovary(1)|skin(3)	14						CTGCTCCTCGGGGACTGATAG	0.438																																						.											0													76.0	72.0	74.0					9																	127915854		2203	4300	6503	SO:0001819	synonymous_variant	5537			AF035158	CCDS6861.1, CCDS48018.1, CCDS48019.1	9q33.3	2010-03-17			ENSG00000119414	ENSG00000119414		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9323	protein-coding gene	gene with protein product		612725				9143513	Standard	NM_002721		Approved	PP6	uc004bpg.4	O00743	OTTHUMG00000020671	ENST00000373547.4:c.627C>T	9.37:g.127915854G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B2R5V6|B7Z2W9|B7Z5K9|Q5U0A2|Q9UIC9	Silent	SNP	ENST00000373547.4	37	CCDS6861.1																																																																																				0.438	PPP6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054060.1	NM_016294	
ZBTB43	23099	broad.mit.edu;hgsc.bcm.edu;mdanderson.org;bcgsc.ca	37	9	129595572	129595572	+	Missense_Mutation	SNP	G	G	A			TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr9:129595572G>A	ENST00000373464.4	+	3	1048	c.784G>A	c.(784-786)Gcg>Acg	p.A262T	ZBTB43_ENST00000449886.1_Missense_Mutation_p.A262T|ZBTB43_ENST00000373457.1_Missense_Mutation_p.A262T	NM_014007.3	NP_054726.1	O43298	ZBT43_HUMAN	zinc finger and BTB domain containing 43	262					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14						GGATGTGCACGCGACCTACGA	0.607																																						.											0													59.0	49.0	52.0					9																	129595572		2203	4300	6503	SO:0001583	missense	23099			AF049907	CCDS6867.1	9q33.3	2013-01-09	2006-04-12	2006-04-12	ENSG00000169155	ENSG00000169155		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	17908	protein-coding gene	gene with protein product			"""zinc finger protein 297B"""	ZNF297B			Standard	NM_014007		Approved	KIAA0414, ZNF-X, FLJ22470, ZBTB22B	uc010mxf.3	O43298	OTTHUMG00000020693	ENST00000373464.4:c.784G>A	9.37:g.129595572G>A	ENSP00000362563:p.Ala262Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q5JU96	Missense_Mutation	SNP	ENST00000373464.4	37	CCDS6867.1	.	.	.	.	.	.	.	.	.	.	G	9.187	1.025052	0.19433	.	.	ENSG00000169155	ENST00000449886;ENST00000373464;ENST00000373457	T;T;T	0.10288	2.89;2.89;2.89	5.49	4.6	0.57074	.	0.257564	0.33290	N	0.005072	T	0.05593	0.0147	N	0.19112	0.55	0.09310	N	1	B	0.27679	0.185	B	0.12837	0.008	T	0.39187	-0.9626	10	0.13470	T	0.59	.	7.3486	0.26678	0.1583:0.1397:0.7021:0.0	.	262	O43298	ZBT43_HUMAN	T	262	ENSP00000390344:A262T;ENSP00000362563:A262T;ENSP00000362556:A262T	ENSP00000362556:A262T	A	+	1	0	ZBTB43	128635393	0.011000	0.17503	0.781000	0.31783	0.724000	0.41520	1.177000	0.31969	1.463000	0.47967	-0.448000	0.05591	GCG		0.607	ZBTB43-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054124.1	NM_001135776	
RPS6KA6	27330	broad.mit.edu;hgsc.bcm.edu;mdanderson.org	37	X	83361951	83361951	+	Silent	SNP	A	A	G			TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chrX:83361951A>G	ENST00000262752.2	-	14	1216	c.1209T>C	c.(1207-1209)ccT>ccC	p.P403P	RPS6KA6_ENST00000495332.1_5'Flank|RPS6KA6_ENST00000543399.1_Silent_p.P403P	NM_014496.4	NP_055311.1	Q9UK32	KS6A6_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 6	403					axon guidance (GO:0007411)|central nervous system development (GO:0007417)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|negative regulation of embryonic development (GO:0045992)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of mesoderm development (GO:2000381)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(26)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	46						CACTTGTGATAGGAGTGATTT	0.353																																						.											0													78.0	72.0	74.0					X																	83361951		2202	4300	6502	SO:0001819	synonymous_variant	27330			AF184965	CCDS14451.1	Xq21.1	2011-04-05	2002-08-29		ENSG00000072133	ENSG00000072133			10435	protein-coding gene	gene with protein product		300303	"""ribosomal protein S6 kinase, 90kD, polypeptide 6"""			10644430	Standard	NM_014496		Approved	RSK4	uc004eej.2	Q9UK32	OTTHUMG00000021923	ENST00000262752.2:c.1209T>C	X.37:g.83361951A>G		Somatic		WXS	Illumina HiSeq	Phase_I	B2R854|B7ZL90|Q6FHX2|Q8WX28|Q9H4S6	Silent	SNP	ENST00000262752.2	37	CCDS14451.1																																																																																				0.353	RPS6KA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057372.1	NM_014496	
TDRD1	56165	hgsc.bcm.edu	37	10	115987678	115987678	+	Missense_Mutation	SNP	A	A	G	rs34112549	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr10:115987678A>G	ENST00000369280.1	+	23	3645	c.3185A>G	c.(3184-3186)tAt>tGt	p.Y1062C	TDRD1_ENST00000422662.1_Missense_Mutation_p.Y666C|TDRD1_ENST00000369282.1_Missense_Mutation_p.Y1062C|TDRD1_ENST00000251864.2_Missense_Mutation_p.Y1138C|TDRD1_ENST00000369281.2_Missense_Mutation_p.Y1024C			Q9BXT4	TDRD1_HUMAN	tudor domain containing 1	1061					DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|germ cell development (GO:0007281)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|P granule (GO:0043186)|pi-body (GO:0071546)	metal ion binding (GO:0046872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(5)	48		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)		GAAAAGATGTATAGGATGAAT	0.318													A|||	56	0.0111821	0.0408	0.0014	5008	,	,		18848	0.0		0.001	False		,,,				2504	0.0					.											0								A	CYS/TYR	164,4240	109.1+/-147.4	5,154,2043	114.0	108.0	110.0		3413	-3.2	0.0	10	dbSNP_126	110	4,8596	3.7+/-12.6	0,4,4296	yes	missense	TDRD1	NM_198795.1	194	5,158,6339	GG,GA,AA		0.0465,3.7239,1.2919	benign	1138/1190	115987678	168,12836	2202	4300	6502	SO:0001583	missense	56165			AF285606	CCDS7588.1	10q26.11	2013-01-23			ENSG00000095627	ENSG00000095627		"""Tudor domain containing"""	11712	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.1"""	605796				11279525	Standard	NM_198795		Approved	CT41.1	uc001lbg.1	Q9BXT4	OTTHUMG00000019083	ENST00000369280.1:c.3185A>G	10.37:g.115987678A>G	ENSP00000358286:p.Tyr1062Cys	Somatic		WXS	Illumina HiSeq	Phase_I	A6NEN3|A6NMN2|B3KVI4|B4E2L5|D3DRC2|Q4G0Y8|Q6P518|Q9H7B3	Missense_Mutation	SNP	ENST00000369280.1	37		24	0.01098901098901099	23	0.046747967479674794	0	0.0	0	0.0	1	0.0013192612137203166	A	6.628	0.484402	0.12641	0.037239	4.65E-4	ENSG00000095627	ENST00000369282;ENST00000251864;ENST00000369281;ENST00000422662;ENST00000369280	T;T;T;T;T	0.17370	3.13;3.13;2.28;2.55;3.13	5.3	-3.16	0.05217	.	1.884470	0.02263	N	0.067712	T	0.01353	0.0044	N	0.04508	-0.205	0.09310	N	1	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.04013	0.001;0.0;0.0;0.001;0.001	T	0.30563	-0.9974	10	0.36615	T	0.2	6.9222	13.0699	0.59055	0.3937:0.0:0.6063:0.0	rs34112549	666;1138;1024;1138;1024	Q9BXT4-4;Q9BXT4;B7WPM2;Q9BXT4-3;Q9BXT4-2	.;TDRD1_HUMAN;.;.;.	C	1062;1138;1024;666;1062	ENSP00000358288:Y1062C;ENSP00000251864:Y1138C;ENSP00000358287:Y1024C;ENSP00000402794:Y666C;ENSP00000358286:Y1062C	ENSP00000251864:Y1138C	Y	+	2	0	TDRD1	115977668	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	0.001000	0.13038	-0.599000	0.05798	-0.973000	0.02599	TAT		0.318	TDRD1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000050457.2		
CACYBP	27101	hgsc.bcm.edu	37	1	174975972	174975972	+	Silent	SNP	A	A	G	rs1802325	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr1:174975972A>G	ENST00000367679.2	+	3	775	c.327A>G	c.(325-327)acA>acG	p.T109T	CACYBP_ENST00000405362.1_Silent_p.T66T|CACYBP_ENST00000367681.2_Silent_p.T66T	NM_014412.2	NP_055227.1	Q9HB71	CYBP_HUMAN	calcyclin binding protein	109	CS. {ECO:0000255|PROSITE- ProRule:PRU00547}.|Interaction with SKP1.				aging (GO:0007568)|cardiac muscle cell differentiation (GO:0055007)|cellular response to calcium ion (GO:0071277)|negative regulation of cell death (GO:0060548)|positive regulation of DNA replication (GO:0045740)|response to growth hormone (GO:0060416)	beta-catenin destruction complex (GO:0030877)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|nuclear envelope lumen (GO:0005641)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)			NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(1)|prostate(1)	11						TGCATTTCACAGAGAGGTGAG	0.378													A|||	80	0.0159744	0.0598	0.0014	5008	,	,		19433	0.0		0.0	False		,,,				2504	0.0					.											0								A	,	284,4122	158.5+/-191.2	11,262,1930	92.0	85.0	87.0		198,327	3.6	1.0	1	dbSNP_89	87	4,8596	2.2+/-6.3	0,4,4296	no	coding-synonymous,coding-synonymous	CACYBP	NM_001007214.1,NM_014412.2	,	11,266,6226	GG,GA,AA		0.0465,6.4458,2.2144	,	66/186,109/229	174975972	288,12718	2203	4300	6503	SO:0001819	synonymous_variant	27101			BC022352	CCDS1315.1, CCDS30942.1	1q24-q25	2008-02-05			ENSG00000116161	ENSG00000116161			30423	protein-coding gene	gene with protein product		606186				11389839, 12421809	Standard	XM_005245092		Approved	SIP, S100A6BP	uc001gkj.1	Q9HB71	OTTHUMG00000034941	ENST00000367679.2:c.327A>G	1.37:g.174975972A>G		Somatic		WXS	Illumina HiSeq	Phase_I	B2ZWH2|B3KSF1|O60666|Q5R370|Q5R371	Silent	SNP	ENST00000367679.2	37	CCDS1315.1																																																																																				0.378	CACYBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084583.3	NM_014412	
ZNF469	84627	broad.mit.edu;hgsc.bcm.edu;bcgsc.ca	37	16	88497528	88497528	+	Missense_Mutation	SNP	C	C	T	rs115183769	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr16:88497528C>T	ENST00000437464.1	+	2	3566	c.3566C>T	c.(3565-3567)cCg>cTg	p.P1189L	ZNF469_ENST00000565624.1_Missense_Mutation_p.P1217L	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	1189					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						GAAACCCGCCCGTCGCTGGAC	0.642													C|||	99	0.0197684	0.0711	0.0072	5008	,	,		13208	0.0		0.0	False		,,,				2504	0.0					.											0													15.0	22.0	20.0					16																	88497528		692	1591	2283	SO:0001583	missense	84627			AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.3566C>T	16.37:g.88497528C>T	ENSP00000402343:p.Pro1189Leu	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000437464.1	37	CCDS45544.1	37	0.01694139194139194	36	0.07317073170731707	1	0.0027624309392265192	0	0.0	0	0.0	C	12.00	1.807968	0.31961	.	.	ENSG00000225614	ENST00000437464	T	0.08282	3.11	4.15	3.19	0.36642	.	.	.	.	.	T	0.00300	0.0009	N	0.14661	0.345	0.09310	N	1	P	0.43885	0.82	B	0.26202	0.067	T	0.44251	-0.9340	9	0.26408	T	0.33	.	6.8723	0.24127	0.0:0.8724:0.0:0.1276	.	1189	Q96JG9	ZN469_HUMAN	L	1189	ENSP00000402343:P1189L	ENSP00000402343:P1189L	P	+	2	0	ZNF469	87025029	0.215000	0.23574	0.006000	0.13384	0.004000	0.04260	1.579000	0.36536	1.871000	0.54225	0.313000	0.20887	CCG		0.642	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NG_012236	
TTN	7273	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	2	179613962	179613962	+	Intron	SNP	C	C	T	rs72648903	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr2:179613962C>T	ENST00000591111.1	-	45	10585				TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000342992.6_Intron|TTN_ENST00000360870.5_Missense_Mutation_p.V4389I|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000589042.1_Intron|TTN-AS1_ENST00000590773.1_RNA|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTAATAGTGACATCACTGAAA	0.343													C|||	95	0.0189696	0.0703	0.0029	5008	,	,		19175	0.0		0.0	False		,,,				2504	0.0					.											0								C	,,ILE/VAL,,	221,4179	123.7+/-161.0	6,209,1985	57.0	62.0	60.0		,,13165,,	3.4	0.0	2	dbSNP_130	60	6,8586	3.7+/-12.6	0,6,4290	yes	intron,intron,missense,intron,intron	TTN	NM_003319.4,NM_133378.4,NM_133379.3,NM_133432.3,NM_133437.3	,,29,,	6,215,6275	TT,TC,CC		0.0698,5.0227,1.7472	,,,,	,,4389/5605,,	179613962	227,12765	2200	4296	6496	SO:0001627	intron_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10360+3888G>A	2.37:g.179613962C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		35	0.016025641025641024	34	0.06910569105691057	1	0.0027624309392265192	0	0.0	0	0.0	C	10.23	1.293061	0.23564	0.050227	6.98E-4	ENSG00000155657	ENST00000360870	T	0.60672	0.17	5.23	3.42	0.39159	.	.	.	.	.	T	0.04452	0.0122	N	0.24115	0.695	0.09310	N	0.999999	B	0.06786	0.001	B	0.06405	0.002	T	0.02126	-1.1209	9	0.16420	T	0.52	.	13.5505	0.61730	0.0:0.8613:0.0:0.1387	.	4389	Q8WZ42-6	.	I	4389	ENSP00000354117:V4389I	ENSP00000354117:V4389I	V	-	1	0	TTN	179322207	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	1.120000	0.31271	0.434000	0.26340	-2.010000	0.00438	GTC		0.343	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
COL4A4	1286	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	2	227924228	227924228	+	Missense_Mutation	SNP	G	G	A	rs36121515	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr2:227924228G>A	ENST00000396625.3	-	28	2483	c.2276C>T	c.(2275-2277)cCg>cTg	p.P759L	COL4A4_ENST00000329662.7_Missense_Mutation_p.P759L	NM_000092.4	NP_000083.3	P53420	CO4A4_HUMAN	collagen, type IV, alpha 4	759	Triple-helical region.		P -> L (in dbSNP:rs36121515).		axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(35)|ovary(5)|pancreas(3)|prostate(2)|skin(12)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	98		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		AGGGTCTCCCGGGATTCCTTT	0.612													G|||	132	0.0263578	0.0991	0.0014	5008	,	,		13983	0.0		0.0	False		,,,				2504	0.0					.											0								G	LEU/PRO	308,3354		15,278,1538	78.0	83.0	82.0		2276	5.1	0.0	2	dbSNP_126	82	5,8139		0,5,4067	yes	missense	COL4A4	NM_000092.4	98	15,283,5605	AA,AG,GG		0.0614,8.4107,2.6512	probably-damaging	759/1691	227924228	313,11493	1831	4072	5903	SO:0001583	missense	1286				CCDS42828.1	2q35-q37	2014-09-17			ENSG00000081052	ENSG00000081052		"""Collagens"""	2206	protein-coding gene	gene with protein product	"""collagen of basement membrane, alpha-4 chain"""	120131				1639407	Standard	NM_000092		Approved	CA44	uc021vxs.1	P53420	OTTHUMG00000149892	ENST00000396625.3:c.2276C>T	2.37:g.227924228G>A	ENSP00000379866:p.Pro759Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A8MTZ1|Q53RW9|Q53S42|Q53WR1	Missense_Mutation	SNP	ENST00000396625.3	37	CCDS42828.1	46	0.021062271062271064	45	0.09146341463414634	1	0.0027624309392265192	0	0.0	0	0.0	G	20.4	3.975804	0.74360	0.084107	6.14E-4	ENSG00000081052	ENST00000396625;ENST00000329662	D;D	0.96685	-4.09;-4.09	5.99	5.09	0.68999	.	.	.	.	.	T	0.51227	0.1662	M	0.76838	2.35	0.40369	D	0.979327	P	0.48503	0.911	B	0.33121	0.158	T	0.73379	-0.4001	9	0.49607	T	0.09	.	12.3916	0.55362	0.081:0.0:0.919:0.0	rs36121515;rs61284557	759	P53420	CO4A4_HUMAN	L	759	ENSP00000379866:P759L;ENSP00000328553:P759L	ENSP00000328553:P759L	P	-	2	0	COL4A4	227632472	0.998000	0.40836	0.036000	0.18154	0.993000	0.82548	4.002000	0.57053	1.474000	0.48178	0.655000	0.94253	CCG		0.612	COL4A4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313770.1	NM_000092	
UGT1A9	54600	broad.mit.edu;hgsc.bcm.edu	37	2	234581245	234581245	+	Missense_Mutation	SNP	G	G	A			TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr2:234581245G>A	ENST00000354728.4	+	1	747	c.665G>A	c.(664-666)cGt>cAt	p.R222H	UGT1A10_ENST00000344644.5_Intron|UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A1_ENST00000609637.1_Missense_Mutation_p.R222H			O60656	UD19_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A9	222					cellular glucuronidation (GO:0052695)|cellular lipid metabolic process (GO:0044255)|drug metabolic process (GO:0017144)|flavone metabolic process (GO:0051552)|flavonoid glucuronidation (GO:0052696)|metabolic process (GO:0008152)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cellular glucuronidation (GO:2001030)|negative regulation of fatty acid metabolic process (GO:0045922)|retinoic acid metabolic process (GO:0042573)|small molecule metabolic process (GO:0044281)|xenobiotic glucuronidation (GO:0052697)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)	p.R222H(2)		breast(2)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	37		Breast(86;0.000766)|all_lung(227;0.00269)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0331)|Lung NSC(271;0.0459)|Lung SC(224;0.128)		Epithelial(121;1.26e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000436)|Lung(119;0.00347)|LUSC - Lung squamous cell carcinoma(224;0.00757)	Acetaminophen(DB00316)|Buprenorphine(DB00921)|Canagliflozin(DB08907)|Dabigatran etexilate(DB06695)|Dapagliflozin(DB06292)|Entacapone(DB00494)|Etodolac(DB00749)|Ezogabine(DB04953)|Flurbiprofen(DB00712)|Haloperidol(DB00502)|Human Serum Albumin(DB00062)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ketobemidone(DB06738)|Lumiracoxib(DB01283)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Nateglinide(DB00731)|Niflumic Acid(DB04552)|Oxazepam(DB00842)|Propofol(DB00818)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sulfamethoxazole(DB01015)|Tapentadol(DB06204)|Valproic Acid(DB00313)|Zileuton(DB00744)	TTATGCCACCGTTTTTTCAAA	0.428																																						.											2	Substitution - Missense(2)	upper_aerodigestive_tract(1)|large_intestine(1)											215.0	224.0	221.0					2																	234581245		2203	4300	6503	SO:0001583	missense	54600			AF056188	CCDS2505.1	2q37	2010-03-05	2005-07-20		ENSG00000241119	ENSG00000241119		"""UDP glucuronosyltransferases"""	12541	other	complex locus constituent		606434	"""UDP glycosyltransferase 1 family, polypeptide A9"""			9295054, 1910331	Standard	NM_021027		Approved	HLUGP4, LUGP4, UGT1AI		O60656	OTTHUMG00000059124	ENST00000354728.4:c.665G>A	2.37:g.234581245G>A	ENSP00000346768:p.Arg222His	Somatic		WXS	Illumina HiSeq	Phase_I	B8K285|P36509|Q9HAX0	Missense_Mutation	SNP	ENST00000354728.4	37	CCDS2505.1	.	.	.	.	.	.	.	.	.	.	G	4.521	0.096669	0.08681	.	.	ENSG00000241119	ENST00000354728	T	0.63913	-0.07	3.22	-5.2	0.02823	.	.	.	.	.	T	0.30823	0.0777	N	0.12182	0.205	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.19451	-1.0305	9	0.16420	T	0.52	.	1.2724	0.02024	0.3067:0.2019:0.0882:0.4033	.	222;222	Q5DSZ5;O60656	.;UD19_HUMAN	H	222	ENSP00000346768:R222H	ENSP00000346768:R222H	R	+	2	0	UGT1A9	234245984	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.600000	0.05693	-0.368000	0.08040	-0.760000	0.03462	CGT		0.428	UGT1A9-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000130995.1	NM_021027	
PHF21B	112885	hgsc.bcm.edu	37	22	45283998	45283998	+	Missense_Mutation	SNP	C	C	G			TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr22:45283998C>G	ENST00000313237.5	-	10	1192	c.1042G>C	c.(1042-1044)Gag>Cag	p.E348Q	PHF21B_ENST00000447824.3_Missense_Mutation_p.R286P|PHF21B_ENST00000404079.2_Missense_Mutation_p.E294Q|PHF21B_ENST00000396103.3_Missense_Mutation_p.E306Q|PHF21B_ENST00000403565.1_Missense_Mutation_p.E144Q	NM_138415.4	NP_612424.1	Q96EK2	PF21B_HUMAN	PHD finger protein 21B	348							zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(14)|ovary(2)|prostate(1)|skin(2)	25		all_neural(38;0.00802)|Glioma(61;0.0353)|Ovarian(80;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0203)		TGGGTGATCTCGTTCTGGAAG	0.692																																						.											0													12.0	11.0	12.0					22																	45283998		2109	4127	6236	SO:0001583	missense	112885			AK091480	CCDS14061.1, CCDS56234.1, CCDS63504.1	22q13.31	2013-01-28			ENSG00000056487	ENSG00000056487		"""Zinc fingers, PHD-type"""	25161	protein-coding gene	gene with protein product			"""PHD finger protein 4"""	PHF4		12477932	Standard	NM_138415		Approved	BHC80L, FLJ34161	uc011aql.2	Q96EK2	OTTHUMG00000151199	ENST00000313237.5:c.1042G>C	22.37:g.45283998C>G	ENSP00000324403:p.Glu348Gln	Somatic		WXS	Illumina HiSeq	Phase_I	B0QYW3|B0QYW4|B3KRU4|B7Z4F8|Q5TFL2|Q6ICC0	Missense_Mutation	SNP	ENST00000313237.5	37	CCDS14061.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.68|12.68	2.009195|2.009195	0.35415|0.35415	.|.	.|.	ENSG00000056487|ENSG00000056487	ENST00000403565;ENST00000313237;ENST00000396103;ENST00000404079|ENST00000447824	T;T;T;T|T	0.55413|0.42900	0.52;0.52;0.52;0.52|0.96	4.13|4.13	4.13|4.13	0.48395|0.48395	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, FYVE/PHD-type (1);|.	0.080425|.	0.48286|.	D|.	0.000197|.	T|T	0.39572|0.39572	0.1083|0.1083	L|L	0.45581|0.45581	1.43|1.43	0.35018|0.35018	D|D	0.757597|0.757597	D;D;D;D|B	0.67145|0.09022	0.99;0.964;0.996;0.989|0.002	P;P;P;P|B	0.60949|0.08055	0.869;0.676;0.881;0.794|0.003	T|T	0.50583|0.50583	-0.8811|-0.8811	10|9	0.33141|0.48119	T|T	0.24|0.1	-28.4847|-28.4847	16.5776|16.5776	0.84705|0.84705	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	306;294;348;144|286	Q96EK2-3;B7Z4F8;Q96EK2;B1AHC5|B7Z657	.;.;PF21B_HUMAN;.|.	Q|P	144;348;306;294|286	ENSP00000385053:E144Q;ENSP00000324403:E348Q;ENSP00000379410:E306Q;ENSP00000385105:E294Q|ENSP00000388619:R286P	ENSP00000324403:E348Q|ENSP00000388619:R286P	E|R	-|-	1|2	0|0	PHF21B|PHF21B	43662662|43662662	0.999000|0.999000	0.42202|0.42202	0.884000|0.884000	0.34674|0.34674	0.105000|0.105000	0.19272|0.19272	4.394000|4.394000	0.59671|0.59671	2.106000|2.106000	0.64143|0.64143	0.462000|0.462000	0.41574|0.41574	GAG|CGA		0.692	PHF21B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321731.2	NM_138415	
QRICH1	54870	hgsc.bcm.edu	37	3	49065314	49065314	+	IGR	SNP	G	G	A	rs139765703		TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr3:49065314G>A	ENST00000395443.2	-	0	3549				RP13-131K19.6_ENST00000607245.1_RNA|IMPDH2_ENST00000326739.4_Silent_p.V120V	NM_198880.1	NP_942581.1	Q2TAL8	QRIC1_HUMAN	glutamine-rich 1							nucleus (GO:0005634)				breast(2)|endometrium(5)|large_intestine(8)|lung(8)|ovary(1)|skin(1)	25				BRCA - Breast invasive adenocarcinoma(193;8.88e-05)|Kidney(197;0.00239)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		TGGGGCTGAGGACCACAGGGT	0.537																																						.											0								G		2,4404	4.2+/-10.8	0,2,2201	60.0	54.0	56.0		360	3.2	1.0	3	dbSNP_134	56	0,8600		0,0,4300	no	coding-synonymous	IMPDH2	NM_000884.2		0,2,6501	AA,AG,GG		0.0,0.0454,0.0154		120/515	49065314	2,13004	2203	4300	6503	SO:0001628	intergenic_variant	3615				CCDS2787.1	3p21.31	2011-06-03			ENSG00000198218	ENSG00000198218			24713	protein-coding gene	gene with protein product						12477932	Standard	NM_017730		Approved	FLJ20259	uc003cvv.3	Q2TAL8	OTTHUMG00000156772		3.37:g.49065314G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q4G0F7|Q7L621|Q8TEA5	Silent	SNP	ENST00000395443.2	37	CCDS2787.1	.	.	.	.	.	.	.	.	.	.	G	10.31	1.314174	0.23908	4.54E-4	0.0	ENSG00000178035	ENST00000429182	.	.	.	5.94	3.18	0.36537	.	.	.	.	.	T	0.58864	0.2152	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51926	-0.8643	4	.	.	.	-44.2625	9.3153	0.37930	0.1361:0.4861:0.3778:0.0	.	.	.	.	S	52	.	.	P	-	1	0	IMPDH2	49040318	0.996000	0.38824	1.000000	0.80357	0.968000	0.65278	0.434000	0.21494	0.407000	0.25591	-0.264000	0.10439	CCT		0.537	QRICH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345669.1	NM_017730	
CAPN11	11131	hgsc.bcm.edu;bcgsc.ca	37	6	44137081	44137081	+	Missense_Mutation	SNP	G	G	T			TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr6:44137081G>T	ENST00000398776.1	+	3	190	c.152G>T	c.(151-153)gGc>gTc	p.G51V	CAPN11_ENST00000542245.1_Missense_Mutation_p.G51V	NM_007058.3	NP_008989.2	Q9UMQ6	CAN11_HUMAN	calpain 11	51					proteolysis (GO:0006508)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|peptidase activity (GO:0008233)			breast(3)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)	36	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			AAGGCCAAGGGCGTGGGCCAG	0.507																																						.											0													40.0	42.0	41.0					6																	44137081		1926	4136	6062	SO:0001583	missense	11131			AJ242832	CCDS47436.1	6p12	2013-01-10			ENSG00000137225	ENSG00000137225		"""EF-hand domain containing"""	1478	protein-coding gene	gene with protein product		604822				10409436	Standard	NM_007058		Approved		uc003owt.1	Q9UMQ6	OTTHUMG00000014758	ENST00000398776.1:c.152G>T	6.37:g.44137081G>T	ENSP00000381758:p.Gly51Val	Somatic		WXS	Illumina HiSeq	Phase_I	B2RA64|Q5T3G1|Q8N4R5	Missense_Mutation	SNP	ENST00000398776.1	37	CCDS47436.1	.	.	.	.	.	.	.	.	.	.	G	15.93	2.976740	0.53720	.	.	ENSG00000137225	ENST00000398776;ENST00000542245;ENST00000532171	D;D;T	0.97209	-4.29;-4.29;0.98	4.1	4.1	0.47936	.	0.138591	0.33691	N	0.004649	D	0.97720	0.9252	M	0.63208	1.945	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97601	1.0123	10	0.52906	T	0.07	.	16.5907	0.84764	0.0:0.0:1.0:0.0	.	51	Q9UMQ6	CAN11_HUMAN	V	51;51;81	ENSP00000381758:G51V;ENSP00000441078:G51V;ENSP00000432420:G81V	ENSP00000381758:G51V	G	+	2	0	CAPN11	44245059	1.000000	0.71417	0.540000	0.28089	0.016000	0.09150	7.713000	0.84693	2.574000	0.86865	0.650000	0.86243	GGC		0.507	CAPN11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040714.3		
DEFA6	1671	hgsc.bcm.edu	37	8	6783459	6783459	+	Silent	SNP	A	A	C	rs13439322	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr8:6783459A>C	ENST00000297436.2	-	1	139	c.99T>G	c.(97-99)gcT>gcG	p.A33A	GS1-24F4.3_ENST00000526235.1_RNA	NM_001926.3	NP_001917.1	Q01524	DEF6_HUMAN	defensin, alpha 6, Paneth cell-specific	33					antibacterial humoral response (GO:0019731)|defense response to fungus (GO:0050832)|innate immune response (GO:0045087)|killing of cells of other organism (GO:0031640)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)				lung(4)	4			STAD - Stomach adenocarcinoma(24;0.0322)	COAD - Colon adenocarcinoma(149;0.0572)|READ - Rectum adenocarcinoma(644;0.121)		CAGCCTCATAAGCTTTTGCCT	0.557													a|||	259	0.0517173	0.1899	0.0101	5008	,	,		21955	0.001		0.0	False		,,,				2504	0.0					.											0								A		731,3675		66,599,1538	67.0	54.0	59.0		99	0.6	0.0	8	dbSNP_121	59	5,8595		0,5,4295	no	coding-synonymous	DEFA6	NM_001926.3		66,604,5833	CC,CA,AA		0.0581,16.591,5.6589		33/101	6783459	736,12270	2203	4300	6503	SO:0001819	synonymous_variant	1671			M98331	CCDS5960.1	8p23.1	2007-02-20			ENSG00000164822	ENSG00000164822		"""Defensins, alpha"""	2765	protein-coding gene	gene with protein product		600471				8417977	Standard	NM_001926		Approved	HD-6, DEF6	uc003wqt.3	Q01524	OTTHUMG00000149984	ENST00000297436.2:c.99T>G	8.37:g.6783459A>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q6EZF9	Silent	SNP	ENST00000297436.2	37	CCDS5960.1																																																																																				0.557	DEFA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206739.1	NM_001926	
ERICH5	203111	hgsc.bcm.edu	37	8	99102105	99102105	+	Missense_Mutation	SNP	A	A	G	rs11994440	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr8:99102105A>G	ENST00000318528.3	+	2	1219	c.860A>G	c.(859-861)cAt>cGt	p.H287R	C8orf47_ENST00000545282.1_Intron	NM_173549.2	NP_775820.2	Q6P6B1	ERIC5_HUMAN		287	Glu-rich.		H -> R (in dbSNP:rs11994440).							kidney(1)|large_intestine(5)|lung(4)|prostate(1)|skin(2)	13	Breast(36;2.31e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.214)			GATCCATTCCATAAAACTCCT	0.443													A|||	124	0.0247604	0.0908	0.0058	5008	,	,		22739	0.0		0.0	False		,,,				2504	0.0					.											0								A	,ARG/HIS	390,4016	195.3+/-220.0	26,338,1839	101.0	93.0	96.0		,860	-3.2	0.0	8	dbSNP_120	96	2,8598	2.2+/-6.3	0,2,4298	yes	intron,missense	C8orf47	NM_001170806.1,NM_173549.2	,29	26,340,6137	GG,GA,AA		0.0233,8.8516,3.014	,benign	,287/375	99102105	392,12614	2203	4300	6503	SO:0001583	missense	203111																														ENST00000318528.3:c.860A>G	8.37:g.99102105A>G	ENSP00000315614:p.His287Arg	Somatic		WXS	Illumina HiSeq	Phase_I	G3V1K4|Q8N1L8	Missense_Mutation	SNP	ENST00000318528.3	37	CCDS34929.1	50	0.022893772893772892	48	0.0975609756097561	2	0.0055248618784530384	0	0.0	0	0.0	A	4.333	0.061136	0.08339	0.088516	2.33E-4	ENSG00000177459	ENST00000318528	T	0.22134	1.97	5.13	-3.19	0.05171	.	1.083140	0.07108	N	0.841664	T	0.00468	0.0015	M	0.63428	1.95	0.09310	N	1	B	0.16396	0.017	B	0.12156	0.007	T	0.33497	-0.9866	10	0.21014	T	0.42	-19.7838	5.9982	0.19505	0.2438:0.321:0.4352:0.0	rs11994440;rs52793077;rs57265963;rs11994440	287	Q6P6B1	CH047_HUMAN	R	287	ENSP00000315614:H287R	ENSP00000315614:H287R	H	+	2	0	C8orf47	99171281	0.003000	0.15002	0.000000	0.03702	0.026000	0.11368	0.598000	0.24074	-0.430000	0.07318	-0.250000	0.11733	CAT		0.443	C8orf47-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380465.1		
COL22A1	169044	hgsc.bcm.edu;ucsc.edu	37	8	139606435	139606435	+	Silent	SNP	G	G	A	rs115499018	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr8:139606435G>A	ENST00000303045.6	-	63	4886	c.4440C>T	c.(4438-4440)ctC>ctT	p.L1480L	COL22A1_ENST00000435777.1_Silent_p.L1460L|COL22A1_ENST00000341807.4_5'UTR	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	1480	Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GGAGGTAGGCGAGTCTGGCTG	0.572										HNSCC(7;0.00092)			G|||	54	0.0107827	0.0378	0.0043	5008	,	,		18009	0.0		0.001	False		,,,				2504	0.0					.											0								G		111,4295	76.8+/-115.0	2,107,2094	33.0	36.0	35.0		4440	-11.8	0.6	8	dbSNP_132	35	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	COL22A1	NM_152888.1		2,109,6392	AA,AG,GG		0.0233,2.5193,0.8688		1480/1627	139606435	113,12893	2203	4300	6503	SO:0001819	synonymous_variant	169044			AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.4440C>T	8.37:g.139606435G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B7ZMH0|C9K0G4|Q8IVT9	Silent	SNP	ENST00000303045.6	37	CCDS6376.1																																																																																				0.572	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257	
AJAP1	55966	broad.mit.edu;mdanderson.org;bcgsc.ca	37	1	4772576	4772576	+	Missense_Mutation	SNP	G	G	C			TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr1:4772576G>C	ENST00000378191.4	+	2	1027	c.646G>C	c.(646-648)Gtg>Ctg	p.V216L	AJAP1_ENST00000378190.3_Missense_Mutation_p.V216L	NM_018836.3	NP_061324.1	Q9UKB5	AJAP1_HUMAN	adherens junctions associated protein 1	216	Thr-rich.				cell adhesion (GO:0007155)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|urinary_tract(1)	24	all_cancers(77;0.071)|Ovarian(185;0.0721)	all_cancers(23;1.77e-36)|all_epithelial(116;1.26e-21)|all_lung(118;3.51e-08)|Lung NSC(185;3.47e-06)|all_neural(13;8.84e-06)|all_hematologic(16;7.61e-05)|Breast(487;0.000507)|Renal(390;0.0007)|Colorectal(325;0.00117)|Hepatocellular(190;0.0071)|Glioma(11;0.0155)|Myeloproliferative disorder(586;0.0258)|Ovarian(437;0.0409)|Lung SC(97;0.133)|Medulloblastoma(700;0.215)		Epithelial(90;3.89e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.97e-19)|GBM - Glioblastoma multiforme(42;3.71e-19)|Colorectal(212;4.57e-06)|COAD - Colon adenocarcinoma(227;0.00019)|Kidney(185;0.000969)|BRCA - Breast invasive adenocarcinoma(365;0.00122)|STAD - Stomach adenocarcinoma(132;0.00578)|KIRC - Kidney renal clear cell carcinoma(229;0.0126)|READ - Rectum adenocarcinoma(331;0.0689)		GAAGACAACTGTGGccgccac	0.647																																						.											0													32.0	31.0	31.0					1																	4772576		2203	4299	6502	SO:0001583	missense	55966			AF175409	CCDS54.1	1p36.32	2008-02-05	2008-01-08		ENSG00000196581	ENSG00000196581			30801	protein-coding gene	gene with protein product	"""transmembrane protein SHREW1"""	610972				14595118	Standard	NM_001042478		Approved	SHREW1, SHREW-1, MOT8	uc001aln.3	Q9UKB5	OTTHUMG00000000645	ENST00000378191.4:c.646G>C	1.37:g.4772576G>C	ENSP00000367433:p.Val216Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q9Y229	Missense_Mutation	SNP	ENST00000378191.4	37	CCDS54.1	.	.	.	.	.	.	.	.	.	.	G	11.07	1.530294	0.27387	.	.	ENSG00000196581	ENST00000378190;ENST00000378191	T;T	0.45276	0.9;0.9	5.35	4.42	0.53409	.	0.500610	0.18335	N	0.144364	T	0.28001	0.0690	N	0.17082	0.46	0.28859	N	0.895599	B	0.28291	0.206	B	0.31101	0.124	T	0.16630	-1.0396	10	0.25106	T	0.35	-5.2669	11.9527	0.52964	0.0:0.1754:0.8246:0.0	.	216	Q9UKB5	AJAP1_HUMAN	L	216	ENSP00000367432:V216L;ENSP00000367433:V216L	ENSP00000367432:V216L	V	+	1	0	AJAP1	4672436	0.928000	0.31464	0.027000	0.17364	0.774000	0.43823	1.764000	0.38471	1.218000	0.43458	0.467000	0.42956	GTG		0.647	AJAP1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001542.3	NM_018836	
GJB5	2709	broad.mit.edu	37	1	35223027	35223027	+	Silent	SNP	C	C	T	rs61750010	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr1:35223027C>T	ENST00000338513.1	+	2	269	c.96C>T	c.(94-96)cgC>cgT	p.R32R	GJB4_ENST00000339480.1_5'Flank	NM_005268.3	NP_005259.1	O95377	CXB5_HUMAN	gap junction protein, beta 5, 31.1kDa	32					cell communication (GO:0007154)|epidermis development (GO:0008544)|labyrinthine layer morphogenesis (GO:0060713)|spongiotrophoblast differentiation (GO:0060708)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|stomach(1)	10		Myeloproliferative disorder(586;0.0393)				TCATCTTCCGCGTGCTGGTGT	0.572													C|||	15	0.00299521	0.0106	0.0014	5008	,	,		19499	0.0		0.0	False		,,,				2504	0.0					.											0								C		70,4336	64.1+/-101.4	0,70,2133	115.0	104.0	108.0		96	-11.3	0.1	1	dbSNP_129	108	0,8600		0,0,4300	no	coding-synonymous	GJB5	NM_005268.2		0,70,6433	TT,TC,CC		0.0,1.5887,0.5382		32/274	35223027	70,12936	2203	4300	6503	SO:0001819	synonymous_variant	2709			BC004379	CCDS382.1	1p34.3	2008-05-14	2007-11-06		ENSG00000189280	ENSG00000189280		"""Ion channels / Gap junction proteins (connexins)"""	4287	protein-coding gene	gene with protein product	"""connexin 31.1"""	604493	"""gap junction protein, beta 5 (connexin 31.1)"", ""gap junction protein, beta 5"""			9843209	Standard	NM_005268		Approved	CX31.1	uc001bxu.4	O95377	OTTHUMG00000004053	ENST00000338513.1:c.96C>T	1.37:g.35223027C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q9UPA3	Silent	SNP	ENST00000338513.1	37	CCDS382.1																																																																																				0.572	GJB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011561.1	NM_005268	
FHL3	2275	broad.mit.edu	37	1	38463083	38463083	+	Silent	SNP	C	C	A			TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr1:38463083C>A	ENST00000373016.3	-	6	1005	c.837G>T	c.(835-837)ggG>ggT	p.G279G	FHL3_ENST00000485803.1_5'UTR	NM_001243878.1|NM_004468.4	NP_001230807.1|NP_004459.2	Q13643	FHL3_HUMAN	four and a half LIM domains 3	279					actin cytoskeleton organization (GO:0030036)|muscle organ development (GO:0007517)	focal adhesion (GO:0005925)|nucleus (GO:0005634)|stress fiber (GO:0001725)|Z disc (GO:0030018)	zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(1)|lung(2)	5	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				TGGCTTAGGGCCCTGCCTGGC	0.642																																						.											0													56.0	61.0	59.0					1																	38463083		2203	4300	6503	SO:0001819	synonymous_variant	2275			BC011697	CCDS30678.1	1p34.3	2008-02-05			ENSG00000183386	ENSG00000183386			3704	protein-coding gene	gene with protein product		602790				8753811, 10226657	Standard	NM_004468		Approved	SLIM2	uc001cck.3	Q13643	OTTHUMG00000004434	ENST00000373016.3:c.837G>T	1.37:g.38463083C>A		Somatic		WXS	Illumina HiSeq	Phase_I	D3DPT6|Q6I9T0|Q9BVA2	Silent	SNP	ENST00000373016.3	37	CCDS30678.1																																																																																				0.642	FHL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012958.1	NM_004468	
PROX1	5629	broad.mit.edu;ucsc.edu;mdanderson.org	37	1	214171103	214171103	+	Silent	SNP	C	C	T			TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr1:214171103C>T	ENST00000366958.4	+	2	1833	c.1225C>T	c.(1225-1227)Ctg>Ttg	p.L409L	PROX1_ENST00000435016.1_Silent_p.L409L|PROX1_ENST00000261454.4_Silent_p.L409L|PROX1_ENST00000498508.2_Silent_p.L409L	NM_001270616.1	NP_001257545.1	Q92786	PROX1_HUMAN	prospero homeobox 1	409					aorta smooth muscle tissue morphogenesis (GO:0060414)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|brain development (GO:0007420)|cell fate determination (GO:0001709)|cerebellar granule cell differentiation (GO:0021707)|dentate gyrus development (GO:0021542)|dorsal spinal cord development (GO:0021516)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocardium formation (GO:0060214)|hepatocyte cell migration (GO:0002194)|hepatocyte differentiation (GO:0070365)|hepatocyte proliferation (GO:0072574)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lens fiber cell morphogenesis (GO:0070309)|liver development (GO:0001889)|lung development (GO:0030324)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|negative regulation of bile acid biosynthetic process (GO:0070858)|negative regulation of cell proliferation (GO:0008285)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|olfactory placode formation (GO:0030910)|optic placode formation involved in camera-type eye formation (GO:0046619)|otic placode formation (GO:0043049)|pancreas development (GO:0031016)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell cycle checkpoint (GO:1901978)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of forebrain neuron differentiation (GO:2000979)|positive regulation of heart growth (GO:0060421)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of sarcomere organization (GO:0060298)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of gene expression (GO:0010468)|regulation of transcription involved in lymphatic endothelial cell fate commitment (GO:0060849)|response to nutrient levels (GO:0031667)|retina morphogenesis in camera-type eye (GO:0060042)|skeletal muscle thin filament assembly (GO:0030240)|venous blood vessel morphogenesis (GO:0048845)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular cardiac myofibril assembly (GO:0055005)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DBD domain binding (GO:0050692)|DNA binding (GO:0003677)|LBD domain binding (GO:0050693)|ligand-dependent nuclear receptor binding (GO:0016922)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|prostate(2)|skin(4)	47				OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)		CAACCAGCGCCTGCAGTGCTT	0.582																																						.											0													99.0	101.0	100.0					1																	214171103		2203	4300	6503	SO:0001819	synonymous_variant	5629			U44060	CCDS31021.1	1q41	2011-06-20	2007-06-01		ENSG00000117707	ENSG00000117707		"""Homeoboxes / PROS class"""	9459	protein-coding gene	gene with protein product		601546	"""prospero-related homeobox 1"""			8812486	Standard	NM_002763		Approved		uc001hkg.2	Q92786	OTTHUMG00000036946	ENST00000366958.4:c.1225C>T	1.37:g.214171103C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A6NK29|A8K2B1|Q5SW76|Q8TB91	Silent	SNP	ENST00000366958.4	37	CCDS31021.1																																																																																				0.582	PROX1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089727.6	NM_002763	
NUTF2	10204	broad.mit.edu	37	16	67899046	67899046	+	Missense_Mutation	SNP	C	C	A			TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr16:67899046C>A	ENST00000219169.4	+	2	296	c.13C>A	c.(13-15)Cca>Aca	p.P5T	NUTF2_ENST00000569436.2_Missense_Mutation_p.P5T|NUTF2_ENST00000568396.2_Missense_Mutation_p.P5T	NM_005796.1	NP_005787.1	P61970	NTF2_HUMAN	nuclear transport factor 2	5					protein export from nucleus (GO:0006611)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nuclear pore (GO:0005643)	transporter activity (GO:0005215)	p.P5T(1)		kidney(1)|lung(2)|upper_aerodigestive_tract(1)	4		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00443)|Epithelial(162;0.0199)|all cancers(182;0.129)		GGGAGACAAGCCAATTTGGGA	0.488																																						.											1	Substitution - Missense(1)	kidney(1)											65.0	55.0	59.0					16																	67899046		2198	4300	6498	SO:0001583	missense	10204			U43939	CCDS10848.1	16q22.1	2008-02-05			ENSG00000102898	ENSG00000102898			13722	protein-coding gene	gene with protein product		605813				7744965, 3380696	Standard	NM_005796		Approved	NTF2, PP15	uc002eup.3	P61970	OTTHUMG00000137540	ENST00000219169.4:c.13C>A	16.37:g.67899046C>A	ENSP00000219169:p.Pro5Thr	Somatic		WXS	Illumina HiSeq	Phase_I	B2R4G7|P13662|Q6IB67	Missense_Mutation	SNP	ENST00000219169.4	37	CCDS10848.1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.857640	0.91433	.	.	ENSG00000102898	ENST00000219169	.	.	.	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	D	0.83617	0.5293	M	0.82630	2.6	0.80722	D	1	D;D	0.89917	1.0;0.999	D;P	0.85130	0.997;0.88	D	0.85761	0.1349	9	0.72032	D	0.01	.	18.0088	0.89217	0.0:1.0:0.0:0.0	.	5;5	B4DEQ2;P61970	.;NTF2_HUMAN	T	5	.	ENSP00000219169:P5T	P	+	1	0	NUTF2	66456547	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.137000	0.77295	2.557000	0.86248	0.555000	0.69702	CCA		0.488	NUTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268871.1		
ELAC2	60528	broad.mit.edu	37	17	12898343	12898343	+	Silent	SNP	C	C	T			TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr17:12898343C>T	ENST00000338034.4	-	20	2084	c.1845G>A	c.(1843-1845)gaG>gaA	p.E615E	ELAC2_ENST00000395962.2_Silent_p.E596E|ELAC2_ENST00000426905.3_Silent_p.E575E	NM_018127.6|NM_173717.1	NP_060597.4|NP_776065.1	Q9BQ52	RNZ2_HUMAN	elaC ribonuclease Z 2	615					mitochondrial tRNA 3'-trailer cleavage, endonucleolytic (GO:0072684)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|skin(1)	23						GACTGGAGATCTCAGCCCCTT	0.453																																						.											0													174.0	181.0	179.0					17																	12898343		2203	4300	6503	SO:0001819	synonymous_variant	60528			AF304370	CCDS11164.1, CCDS54093.1	17p11.2	2013-05-24	2013-05-24		ENSG00000006744	ENSG00000006744	3.1.26.11		14198	protein-coding gene	gene with protein product	"""tRNase Z (long form)"""	605367	"""elaC (E. coli) homolog 2"", ""elaC homolog 2 (E. coli)"""			10986046, 16636667, 21559454	Standard	NM_018127		Approved	FLJ10530, HPC2	uc010vvr.2	Q9BQ52	OTTHUMG00000058764	ENST00000338034.4:c.1845G>A	17.37:g.12898343C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B4DPL9|Q6IA94|Q9HAS8|Q9HAS9|Q9NVT1	Silent	SNP	ENST00000338034.4	37	CCDS11164.1																																																																																				0.453	ELAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129934.5		
PSMD12	5718	broad.mit.edu	37	17	65340732	65340732	+	Missense_Mutation	SNP	A	A	G	rs2230680	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr17:65340732A>G	ENST00000356126.3	-	9	1180	c.1073T>C	c.(1072-1074)gTt>gCt	p.V358A	PSMD12_ENST00000357146.4_Missense_Mutation_p.V338A	NM_002816.3	NP_002807.1	O00232	PSD12_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 12	358	PCI.		V -> A (in dbSNP:rs2230680).		anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)				breast(1)|large_intestine(4)|lung(6)|pancreas(1)|urinary_tract(1)	13	all_cancers(12;2.38e-11)|all_epithelial(3;8.27e-13)					ATGTTCAACAACTCTGTTCTT	0.328													A|||	8	0.00159744	0.0061	0.0	5008	,	,		17078	0.0		0.0	False		,,,				2504	0.0					.											0								A	ALA/VAL,ALA/VAL	34,4372	38.4+/-70.7	1,32,2170	83.0	81.0	82.0		1073,1013	5.6	1.0	17	dbSNP_98	82	0,8600		0,0,4300	yes	missense,missense	PSMD12	NM_002816.3,NM_174871.2	64,64	1,32,6470	GG,GA,AA		0.0,0.7717,0.2614	probably-damaging,probably-damaging	358/457,338/437	65340732	34,12972	2203	4300	6503	SO:0001583	missense	5718			AB003103	CCDS11669.1, CCDS11670.1	17q24.3	2008-05-22			ENSG00000197170	ENSG00000197170		"""Proteasome (prosome, macropain) subunits"""	9557	protein-coding gene	gene with protein product		604450				9426256	Standard	NM_002816		Approved	p55, Rpn5	uc002jfy.3	O00232	OTTHUMG00000140376	ENST00000356126.3:c.1073T>C	17.37:g.65340732A>G	ENSP00000348442:p.Val358Ala	Somatic		WXS	Illumina HiSeq	Phase_I	A6NP15|Q53HA2|Q6P053	Missense_Mutation	SNP	ENST00000356126.3	37	CCDS11669.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	A	25.4	4.635451	0.87760	0.007717	0.0	ENSG00000197170	ENST00000356126;ENST00000357146	T;T	0.33654	1.4;1.4	5.59	5.59	0.84812	Winged helix-turn-helix transcription repressor DNA-binding (1);Proteasome component (PCI) domain (2);	0.000000	0.85682	D	0.000000	T	0.62732	0.2452	M	0.93462	3.42	0.80722	D	1	D;D	0.65815	0.995;0.995	D;D	0.72338	0.977;0.977	T	0.76961	-0.2765	10	0.87932	D	0	-21.0461	15.7585	0.78058	1.0:0.0:0.0:0.0	rs2230680;rs35331578;rs2230680	338;358	A6NP15;O00232	.;PSD12_HUMAN	A	358;338	ENSP00000348442:V358A;ENSP00000349667:V338A	ENSP00000348442:V358A	V	-	2	0	PSMD12	62771194	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	5.894000	0.69806	2.121000	0.65114	0.397000	0.26171	GTT		0.328	PSMD12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277103.1	NM_002816, NM_174871	
ZNF180	7733	broad.mit.edu	37	19	44982053	44982053	+	Missense_Mutation	SNP	G	G	T			TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr19:44982053G>T	ENST00000221327.4	-	5	926	c.645C>A	c.(643-645)aaC>aaA	p.N215K	ZNF180_ENST00000586637.1_3'UTR|ZNF180_ENST00000585514.1_5'Flank|ZNF180_ENST00000592529.1_Missense_Mutation_p.N188K|ZNF180_ENST00000391956.4_Missense_Mutation_p.N190K|AC069278.4_ENST00000591684.1_lincRNA	NM_013256.3	NP_037388.2	Q9UJW8	ZN180_HUMAN	zinc finger protein 180	215					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(14)|lung(6)|ovary(2)|urinary_tract(1)	33		Prostate(69;0.0435)				TATGAAAATGGTTTCTTATGG	0.353																																					Esophageal Squamous(180;1353 2003 32862 46574 49854)	.											0													87.0	87.0	87.0					19																	44982053		2203	4300	6503	SO:0001583	missense	7733			AF192913	CCDS12639.1, CCDS62707.1, CCDS62708.1	19q13.2	2013-01-08	2006-08-22			ENSG00000167384		"""Zinc fingers, C2H2-type"", ""-"""	12970	protein-coding gene	gene with protein product		606740	"""zinc finger protein 180 (HHZ168)"""				Standard	NM_001288762		Approved	HHZ168	uc002ozf.4	Q9UJW8		ENST00000221327.4:c.645C>A	19.37:g.44982053G>T	ENSP00000221327:p.Asn215Lys	Somatic		WXS	Illumina HiSeq	Phase_I	B2RCN6|B3KV56|K7EQX9|Q58F03|Q9P1U2	Missense_Mutation	SNP	ENST00000221327.4	37	CCDS12639.1	.	.	.	.	.	.	.	.	.	.	G	0.572	-0.840767	0.02692	.	.	ENSG00000167384	ENST00000221327;ENST00000391956	T;T	0.06528	3.29;3.33	4.89	1.36	0.22044	.	0.296949	0.24386	N	0.038980	T	0.03739	0.0106	L	0.34521	1.04	0.25773	N	0.984811	B;B;B	0.12013	0.005;0.002;0.003	B;B;B	0.13407	0.009;0.004;0.004	T	0.39143	-0.9628	10	0.19147	T	0.46	-18.0554	1.5731	0.02619	0.1888:0.1773:0.4719:0.1619	.	190;214;215	G5E9B8;Q58F03;Q9UJW8	.;.;ZN180_HUMAN	K	215;190	ENSP00000221327:N215K;ENSP00000375818:N190K	ENSP00000221327:N215K	N	-	3	2	ZNF180	49673893	1.000000	0.71417	0.551000	0.28230	0.022000	0.10575	2.874000	0.48483	0.651000	0.30788	0.655000	0.94253	AAC		0.353	ZNF180-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451601.1	NM_013256	
STK25	10494	broad.mit.edu;bcgsc.ca	37	2	242437048	242437048	+	Missense_Mutation	SNP	G	G	A	rs140408761		TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr2:242437048G>A	ENST00000316586.4	-	10	1436	c.1087C>T	c.(1087-1089)Cgg>Tgg	p.R363W	STK25_ENST00000401869.1_Missense_Mutation_p.R363W|STK25_ENST00000478403.1_5'UTR|STK25_ENST00000405883.3_Missense_Mutation_p.R286W|STK25_ENST00000403346.3_Missense_Mutation_p.R363W|STK25_ENST00000535007.1_Missense_Mutation_p.R269W|STK25_ENST00000405585.1_Missense_Mutation_p.R286W|STK25_ENST00000543554.1_Missense_Mutation_p.R269W	NM_001271977.1|NM_001271978.1|NM_001282308.1	NP_001258906.1|NP_001258907.1|NP_001269237.1	O00506	STK25_HUMAN	serine/threonine kinase 25	363					establishment or maintenance of cell polarity (GO:0007163)|Golgi localization (GO:0051645)|positive regulation of axonogenesis (GO:0050772)|response to oxidative stress (GO:0006979)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|kidney(1)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	10		all_cancers(19;2.09e-34)|all_epithelial(40;2.09e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Ovarian(221;0.069)|Lung NSC(271;0.0886)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.2)		Epithelial(32;8.24e-34)|all cancers(36;3.46e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.6e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.1e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0839)		AAGACGGGCCGGACCAGCGTG	0.657																																					NSCLC(99;1100 1566 7679 28647 48345)	.											0								G	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	71.0	72.0	71.0		1087	3.4	1.0	2	dbSNP_134	71	0,8600		0,0,4300	no	missense	STK25	NM_006374.3	101	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging	363/427	242437048	1,13005	2203	4300	6503	SO:0001583	missense	10494			D63780	CCDS2549.1, CCDS63199.1, CCDS63200.1	2q37.3	2010-06-25	2010-06-25		ENSG00000115694	ENSG00000115694			11404	protein-coding gene	gene with protein product		602255	"""serine/threonine kinase 25 (Ste20, yeast homolog)"""			8887545, 9160885, 15037601	Standard	NM_001271977		Approved	SOK1, YSK1	uc002wbp.4	O00506	OTTHUMG00000133408	ENST00000316586.4:c.1087C>T	2.37:g.242437048G>A	ENSP00000325748:p.Arg363Trp	Somatic		WXS	Illumina HiSeq	Phase_I	A8K6Z3|A8K7D2|B7Z9K1|Q15522|Q5BJF1	Missense_Mutation	SNP	ENST00000316586.4	37	CCDS2549.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.86|16.86	3.240112|3.240112	0.58995|0.58995	2.27E-4|2.27E-4	0.0|0.0	ENSG00000115694|ENSG00000115694	ENST00000423004|ENST00000316586;ENST00000403346;ENST00000401869;ENST00000405883;ENST00000545437;ENST00000405585;ENST00000543554;ENST00000535007	.|T;T;T;T;T;T;T	.|0.38077	.|1.16;1.16;1.16;1.16;1.16;1.16;1.16	5.17|5.17	3.37|3.37	0.38596|0.38596	.|.	.|0.318737	.|0.28630	.|N	.|0.014677	T|T	0.23094|0.23094	0.0558|0.0558	N|N	0.08118|0.08118	0|0	0.35762|0.35762	D|D	0.820274|0.820274	.|P;P;B	.|0.40398	.|0.716;0.716;0.41	.|B;P;B	.|0.44860	.|0.39;0.462;0.339	T|T	0.29640|0.29640	-1.0005|-1.0005	5|10	.|0.66056	.|D	.|0.02	.|.	8.2258|8.2258	0.31568|0.31568	0.0716:0.0:0.6497:0.2787|0.0716:0.0:0.6497:0.2787	.|.	.|289;286;363	.|B4DVS7;A8K6Z3;O00506	.|.;.;STK25_HUMAN	L|W	206|363;363;363;286;269;286;269;269	.|ENSP00000325748:R363W;ENSP00000384162:R363W;ENSP00000385687:R363W;ENSP00000384444:R286W;ENSP00000385541:R286W;ENSP00000444886:R269W;ENSP00000446008:R269W	.|ENSP00000325748:R363W	P|R	-|-	2|1	0|2	STK25|STK25	242085721|242085721	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.808000|0.808000	0.45660|0.45660	3.009000|3.009000	0.49552|0.49552	0.692000|0.692000	0.31613|0.31613	-0.152000|-0.152000	0.13540|0.13540	CCG|CGG		0.657	STK25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257265.4	NM_006374	
BBS12	166379	broad.mit.edu;mdanderson.org	37	4	123663688	123663688	+	Missense_Mutation	SNP	G	G	A			TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr4:123663688G>A	ENST00000314218.3	+	2	834	c.641G>A	c.(640-642)cGa>cAa	p.R214Q	BBS12_ENST00000542236.1_Missense_Mutation_p.R214Q	NM_152618.2	NP_689831.2	Q6ZW61	BBS12_HUMAN	Bardet-Biedl syndrome 12	214					cellular protein metabolic process (GO:0044267)|chaperone-mediated protein complex assembly (GO:0051131)|eating behavior (GO:0042755)|intraciliary transport (GO:0042073)|negative regulation of fat cell differentiation (GO:0045599)|photoreceptor cell maintenance (GO:0045494)	cilium (GO:0005929)	ATP binding (GO:0005524)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|prostate(4)	21						AACACATCACGAACTCTGAAA	0.398									Bardet-Biedl syndrome																													.											0													76.0	77.0	77.0					4																	123663688		2203	4300	6503	SO:0001583	missense	166379	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	AK123553	CCDS3728.1	4q27	2014-06-17	2006-12-13	2006-12-13	ENSG00000181004	ENSG00000181004		"""Heat Shock Proteins / Chaperonins"""	26648	protein-coding gene	gene with protein product		610683	"""chromosome 4 open reading frame 24"""	C4orf24		17160889	Standard	NM_001178007		Approved	FLJ35630, FLJ41559	uc003ieu.3	Q6ZW61	OTTHUMG00000133070	ENST00000314218.3:c.641G>A	4.37:g.123663688G>A	ENSP00000319062:p.Arg214Gln	Somatic		WXS	Illumina HiSeq	Phase_I	D3DNX5|Q7Z342|Q7Z482|Q8NAB8	Missense_Mutation	SNP	ENST00000314218.3	37	CCDS3728.1	.	.	.	.	.	.	.	.	.	.	G	0.018	-1.467434	0.01053	.	.	ENSG00000181004	ENST00000314218;ENST00000542236	T;T	0.67171	-0.25;-0.25	4.99	-2.79	0.05841	.	0.380610	0.26911	N	0.021862	T	0.21590	0.0520	N	0.01048	-1.04	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.37244	-0.9714	10	0.02654	T	1	-15.624	2.5248	0.04689	0.4039:0.3436:0.1412:0.1113	.	214	Q6ZW61	BBS12_HUMAN	Q	214	ENSP00000319062:R214Q;ENSP00000438273:R214Q	ENSP00000319062:R214Q	R	+	2	0	BBS12	123883138	0.000000	0.05858	0.000000	0.03702	0.233000	0.25261	0.181000	0.16880	-0.294000	0.08973	-0.451000	0.05528	CGA		0.398	BBS12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256710.1	NM_152618	
HCN1	348980	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	45396746	45396746	+	Missense_Mutation	SNP	C	C	G			TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr5:45396746C>G	ENST00000303230.4	-	4	1135	c.1078G>C	c.(1078-1080)Ggg>Cgg	p.G360R		NM_021072.3	NP_066550.2	O60741	HCN1_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 1	360					apical protein localization (GO:0045176)|cellular response to cAMP (GO:0071320)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|retinal cone cell development (GO:0046549)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|intracellular cAMP activated cation channel activity (GO:0005222)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(3)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(21)|liver(1)|lung(98)|ovary(1)|prostate(7)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(5)	156						GCTCCATACCCAATGCACAGC	0.483																																						.											0													107.0	93.0	98.0					5																	45396746		2203	4300	6503	SO:0001583	missense	348980			AF064876	CCDS3952.1	5p12	2011-07-05			ENSG00000164588	ENSG00000164588		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4845	protein-coding gene	gene with protein product		602780		BCNG1		9405696, 9630217, 16382102	Standard	NM_021072		Approved	BCNG-1, HAC-2	uc003jok.3	O60741	OTTHUMG00000131155	ENST00000303230.4:c.1078G>C	5.37:g.45396746C>G	ENSP00000307342:p.Gly360Arg	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000303230.4	37	CCDS3952.1	.	.	.	.	.	.	.	.	.	.	C	29.0	4.965322	0.92855	.	.	ENSG00000164588	ENST00000303230	D	0.99888	-7.54	5.18	5.18	0.71444	Ion transport (1);	0.186326	0.36101	N	0.002787	D	0.99919	0.9962	H	0.95365	3.66	0.80722	D	1	D	0.67145	0.996	D	0.74674	0.984	D	0.96259	0.9189	10	0.87932	D	0	.	18.8829	0.92364	0.0:1.0:0.0:0.0	.	360	O60741	HCN1_HUMAN	R	360	ENSP00000307342:G360R	ENSP00000307342:G360R	G	-	1	0	HCN1	45432503	1.000000	0.71417	0.995000	0.50966	0.998000	0.95712	7.651000	0.83577	2.705000	0.92388	0.650000	0.86243	GGG		0.483	HCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253847.1	NM_021072	
SOX30	11063	broad.mit.edu	37	5	157078493	157078493	+	Silent	SNP	G	G	A	rs371262922		TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr5:157078493G>A	ENST00000265007.6	-	1	935	c.594C>T	c.(592-594)ggC>ggT	p.G198G	SOX30_ENST00000311371.5_Silent_p.G198G|SOX30_ENST00000519442.1_Intron	NM_178424.1	NP_848511.1	O94993	SOX30_HUMAN	SRY (sex determining region Y)-box 30	198					regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to corticosteroid (GO:0031960)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	23	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TGCCTGCCCCGCCTTGCATCG	0.657																																					Esophageal Squamous(31;525 799 19355 21125 41744)	.											0													64.0	75.0	71.0					5																	157078493		2197	4289	6486	SO:0001819	synonymous_variant	11063			AB022083	CCDS4339.1, CCDS4340.1	5q33	2010-10-21			ENSG00000039600	ENSG00000039600		"""SRY (sex determining region Y)-boxes"""	30635	protein-coding gene	gene with protein product		606698				15019997, 11678506	Standard	NM_178424		Approved		uc003lxb.1	O94993	OTTHUMG00000130247	ENST00000265007.6:c.594C>T	5.37:g.157078493G>A		Somatic		WXS	Illumina HiSeq	Phase_I	O94995|Q8IYX6	Silent	SNP	ENST00000265007.6	37	CCDS4339.1																																																																																				0.657	SOX30-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252571.2	NM_007017	
CLDN23	137075	broad.mit.edu	37	8	8560021	8560021	+	Missense_Mutation	SNP	A	A	C	rs202151198		TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr8:8560021A>C	ENST00000519106.1	+	1	574	c.113A>C	c.(112-114)aAc>aCc	p.N38T		NM_194284.2	NP_919260.2	Q96B33	CLD23_HUMAN	claudin 23	38					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			endometrium(2)	2		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.071)|READ - Rectum adenocarcinoma(644;0.238)		GGCTTCCTGAACCAGCCAGTG	0.687																																						.											0																																										SO:0001583	missense	137075			AK123547	CCDS55195.1	8p23.1	2006-04-12				ENSG00000253958		"""Claudins"""	17591	protein-coding gene	gene with protein product		609203				12736707	Standard	NM_194284		Approved	CLDNL	uc003wsi.3	Q96B33		ENST00000519106.1:c.113A>C	8.37:g.8560021A>C	ENSP00000428780:p.Asn38Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q08AJ3	Missense_Mutation	SNP	ENST00000519106.1	37	CCDS55195.1	.	.	.	.	.	.	.	.	.	.	A	16.25	3.070338	0.55539	.	.	ENSG00000253958	ENST00000519106	T	0.62364	0.03	4.55	4.55	0.56014	.	.	.	.	.	T	0.49695	0.1572	L	0.38175	1.15	0.24529	N	0.994121	B	0.20887	0.049	B	0.24541	0.054	T	0.34502	-0.9826	9	0.23891	T	0.37	.	8.1946	0.31389	0.9091:0.0:0.0909:0.0	.	38	Q96B33	CLD23_HUMAN	T	38	ENSP00000428780:N38T	ENSP00000428780:N38T	N	+	2	0	CLDN23	8597431	0.007000	0.16637	0.908000	0.35775	0.950000	0.60333	1.972000	0.40540	1.825000	0.53177	0.374000	0.22700	AAC		0.687	CLDN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374721.1	NM_194284	
ZNF658	26149	broad.mit.edu;mdanderson.org;bcgsc.ca	37	9	40774999	40774999	+	Missense_Mutation	SNP	T	T	A			TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr9:40774999T>A	ENST00000602553.1	-	5	570	c.276A>T	c.(274-276)gaA>gaT	p.E92D	ZNF658_ENST00000441795.1_Missense_Mutation_p.E90D|ZNF658_ENST00000377626.3_Missense_Mutation_p.E92D			Q5TYW1	ZN658_HUMAN	zinc finger protein 658	92					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	46				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		TTTCTTGTTTTTCCCGGATCC	0.308																																						.											0													11.0	14.0	13.0					9																	40774999		687	1633	2320	SO:0001583	missense	26149			AA482262	CCDS75846.1	9p13.1	2013-01-08			ENSG00000196409	ENSG00000274349		"""Zinc fingers, C2H2-type"", ""-"""	25226	protein-coding gene	gene with protein product							Standard	NM_033160		Approved	MGC35232, DKFZp572C163, FLJ32813	uc004abs.2	Q5TYW1	OTTHUMG00000013392	ENST00000602553.1:c.276A>T	9.37:g.40774999T>A	ENSP00000473484:p.Glu92Asp	Somatic		WXS	Illumina HiSeq	Phase_I	Q6PIP3|Q96M55|Q9H9S6|Q9UG02	Missense_Mutation	SNP	ENST00000602553.1	37	CCDS35023.1	.	.	.	.	.	.	.	.	.	.	t	13.60	2.284284	0.40394	.	.	ENSG00000196409	ENST00000441795;ENST00000377626	T;T	0.08193	3.23;3.12	2.3	0.937	0.19494	.	.	.	.	.	T	0.07369	0.0186	L	0.45581	1.43	0.09310	N	0.99999	P;B	0.40302	0.712;0.092	B;B	0.40375	0.327;0.05	T	0.29305	-1.0016	9	0.14252	T	0.57	.	5.9381	0.19177	0.0:0.0:0.466:0.534	.	92;92	Q5TYW1-2;Q5TYW1	.;ZN658_HUMAN	D	90;92	ENSP00000408462:E90D;ENSP00000366853:E92D	ENSP00000366853:E92D	E	-	3	2	ZNF658	40764999	0.883000	0.30277	0.058000	0.19502	0.013000	0.08279	0.808000	0.27154	1.092000	0.41356	0.321000	0.21382	GAA		0.308	ZNF658-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467800.1	NM_033160	
CXorf22	170063	broad.mit.edu;mdanderson.org;bcgsc.ca	37	X	35969403	35969403	+	Missense_Mutation	SNP	G	G	A			TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chrX:35969403G>A	ENST00000297866.5	+	5	878	c.812G>A	c.(811-813)cGt>cAt	p.R271H		NM_152632.3	NP_689845.2	Q6ZTR5	CX022_HUMAN	chromosome X open reading frame 22	271										breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(3)	44						AAACATGCACGTGTATACAAT	0.413																																						.											0													72.0	63.0	66.0					X																	35969403		2202	4300	6502	SO:0001583	missense	170063			BC027936	CCDS14237.2	Xp21.1	2014-08-07			ENSG00000165164	ENSG00000165164			28546	protein-coding gene	gene with protein product						12477932	Standard	NM_152632		Approved	MGC34831	uc004ddj.3	Q6ZTR5	OTTHUMG00000021350	ENST00000297866.5:c.812G>A	X.37:g.35969403G>A	ENSP00000297866:p.Arg271His	Somatic		WXS	Illumina HiSeq	Phase_I	Q5JRM8|Q8N6X8	Missense_Mutation	SNP	ENST00000297866.5	37	CCDS14237.2	.	.	.	.	.	.	.	.	.	.	G	3.433	-0.115726	0.06881	.	.	ENSG00000165164	ENST00000297866	T	0.13420	2.59	5.76	3.31	0.37934	.	0.993117	0.08188	N	0.984326	T	0.10594	0.0259	L	0.36672	1.1	0.09310	N	1	P	0.52316	0.952	B	0.44044	0.439	T	0.14783	-1.0460	10	0.14252	T	0.57	-20.7771	2.0991	0.03675	0.2631:0.0768:0.1427:0.5173	.	271	Q6ZTR5	CX022_HUMAN	H	271	ENSP00000297866:R271H	ENSP00000297866:R271H	R	+	2	0	CXorf22	35879324	0.006000	0.16342	0.001000	0.08648	0.006000	0.05464	0.902000	0.28459	0.264000	0.21851	-0.490000	0.04691	CGT		0.413	CXorf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056216.2	NM_152632	
PDZD11	51248	broad.mit.edu;mdanderson.org;bcgsc.ca	37	X	69506937	69506937	+	Missense_Mutation	SNP	G	G	T			TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chrX:69506937G>T	ENST00000239666.4	-	7	550	c.418C>A	c.(418-420)Cac>Aac	p.H140N	PDZD11_ENST00000374454.1_Missense_Mutation_p.H140N|KIF4A_ENST00000374388.3_5'Flank|PDZD11_ENST00000473667.1_5'Flank	NM_016484.4	NP_057568.1	Q5EBL8	PDZ11_HUMAN	PDZ domain containing 11	140						basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)	protein C-terminus binding (GO:0008022)			breast(1)|endometrium(2)|large_intestine(3)|lung(3)	9						ACTTTCTAGTGCACAGTCCTC	0.483																																						.											0													58.0	47.0	51.0					X																	69506937		2202	4297	6499	SO:0001583	missense	51248			AF151061	CCDS14400.1	Xq13.1	2008-02-05		2006-01-24	ENSG00000120509	ENSG00000120509			28034	protein-coding gene	gene with protein product		300632		PDZK11		11042152, 12975309	Standard	NM_016484		Approved		uc004dyd.1	Q5EBL8	OTTHUMG00000021771	ENST00000239666.4:c.418C>A	X.37:g.69506937G>T	ENSP00000239666:p.His140Asn	Somatic		WXS	Illumina HiSeq	Phase_I	D3DVU3|Q6UWE1|Q9P0Q1	Missense_Mutation	SNP	ENST00000239666.4	37	CCDS14400.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.170797	0.78452	.	.	ENSG00000120509	ENST00000239666;ENST00000374454	T;T	0.39997	1.05;1.05	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.53562	0.1804	L	0.27053	0.805	0.80722	D	1	D;D	0.67145	0.996;0.981	D;D	0.75484	0.986;0.932	T	0.56902	-0.7902	10	0.87932	D	0	.	17.55	0.87873	0.0:0.0:1.0:0.0	.	171;140	Q5EBL8-2;Q5EBL8	.;PDZ11_HUMAN	N	140	ENSP00000239666:H140N;ENSP00000363578:H140N	ENSP00000239666:H140N	H	-	1	0	PDZD11	69423662	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.142000	0.77339	2.618000	0.88619	0.600000	0.82982	CAC		0.483	PDZD11-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057060.1	NM_016484	
ANKMY2	57037	ucsc.edu	37	7	16642116	16642116	+	Missense_Mutation	SNP	T	T	G			TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr7:16642116T>G	ENST00000306999.2	-	9	1273	c.1030A>C	c.(1030-1032)Acc>Ccc	p.T344P		NM_020319.2	NP_064715.1	Q8IV38	ANKY2_HUMAN	ankyrin repeat and MYND domain containing 2	344						cilium (GO:0005929)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|urinary_tract(1)	23	Lung NSC(10;0.103)|all_lung(11;0.204)			UCEC - Uterine corpus endometrioid carcinoma (126;0.195)		TTCTGGCAGGTTTGATCACAA	0.363																																						.											0													142.0	139.0	140.0					7																	16642116		2201	4300	6501	SO:0001583	missense	57037			AK001740	CCDS5361.1	7p21	2013-01-10			ENSG00000106524	ENSG00000106524		"""Zinc fingers, MYND-type"", ""Ankyrin repeat domain containing"""	25370	protein-coding gene	gene with protein product						12477932	Standard	NM_020319		Approved	DKFZP564O043, ZMYND20	uc003sti.3	Q8IV38	OTTHUMG00000090806	ENST00000306999.2:c.1030A>C	7.37:g.16642116T>G	ENSP00000303570:p.Thr344Pro	Somatic		WXS	Illumina HiSeq	Phase_I	A4D124|Q659G1|Q96BL3	Missense_Mutation	SNP	ENST00000306999.2	37	CCDS5361.1	.	.	.	.	.	.	.	.	.	.	T	9.066	0.995639	0.19043	.	.	ENSG00000106524	ENST00000306999	T	0.71341	-0.56	5.27	2.84	0.33178	Zinc finger, MYND-type (3);	0.409722	0.30930	N	0.008582	T	0.62109	0.2401	L	0.52011	1.625	0.22771	N	0.998754	B	0.34349	0.45	B	0.35278	0.199	T	0.50162	-0.8860	10	0.36615	T	0.2	0.0514	9.3128	0.37915	0.1121:0.066:0.0:0.8219	.	344	Q8IV38	ANKY2_HUMAN	P	344	ENSP00000303570:T344P	ENSP00000303570:T344P	T	-	1	0	ANKMY2	16608641	0.996000	0.38824	0.983000	0.44433	0.849000	0.48306	1.904000	0.39868	0.008000	0.14787	-2.866000	0.00100	ACC		0.363	ANKMY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207600.2	NM_020319	
ANP32E	81611	ucsc.edu;mdanderson.org	37	1	150199042	150199042	+	Missense_Mutation	SNP	C	C	A	rs56692627|rs28594165|rs68136184	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr1:150199042C>A	ENST00000314136.8	-	5	948	c.579G>T	c.(577-579)gaG>gaT	p.E193D	ANP32E_ENST00000369115.2_Missense_Mutation_p.E61D|ANP32E_ENST00000436748.2_Missense_Mutation_p.E152D|ANP32E_ENST00000369114.5_Intron|ANP32E_ENST00000369116.4_Missense_Mutation_p.E61D|ANP32E_ENST00000533654.1_Missense_Mutation_p.R138M|ANP32E_ENST00000369119.3_Missense_Mutation_p.E145D	NM_001136478.2|NM_001280559.1|NM_030920.3	NP_001129950.1|NP_001267488.1|NP_112182.1	Q9BTT0	AN32E_HUMAN	acidic (leucine-rich) nuclear phosphoprotein 32 family, member E	193	Asp/Glu-rich (highly acidic).				histone exchange (GO:0043486)|negative regulation of catalytic activity (GO:0043086)	cytoplasmic membrane-bounded vesicle (GO:0016023)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	histone binding (GO:0042393)|phosphatase inhibitor activity (GO:0019212)			breast(3)|endometrium(3)|lung(7)|skin(1)|urinary_tract(1)	15	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			cctcatcctcctcttcctctt	0.443																																						.											0													236.0	194.0	208.0					1																	150199042		2203	4300	6503	SO:0001583	missense	81611			AK092672	CCDS946.1, CCDS44214.1, CCDS44215.1, CCDS60245.1	1q22	2008-02-05			ENSG00000143401	ENSG00000143401		"""ANP32 acidic nuclear phosphoproteins"""	16673	protein-coding gene	gene with protein product		609611				12438741	Standard	NM_030920		Approved	LANPL, MGC5350, LANP-L	uc001etw.3	Q9BTT0	OTTHUMG00000012547	ENST00000314136.8:c.579G>T	1.37:g.150199042C>A	ENSP00000324074:p.Glu193Asp	Somatic		WXS	Illumina HiSeq	Phase_I	B4E0I6|E9PEA6|Q5TB18|Q5TB20|Q8N1S4|Q8WWW9	Missense_Mutation	SNP	ENST00000314136.8	37	CCDS946.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	0.397|0.397	-0.920493|-0.920493	0.02396|0.02396	.|.	.|.	ENSG00000143401|ENSG00000143401	ENST00000314136;ENST00000369119;ENST00000369116;ENST00000436748;ENST00000534437;ENST00000369115;ENST00000534220|ENST00000533654	T;T;T|T	0.00351|0.00342	7.97;7.97;7.97|8.03	3.62|3.62	-7.24|-7.24	0.01475|0.01475	.|.	.|.	.|.	.|.	.|.	T|T	0.00039|0.00039	0.0001|0.0001	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	1|1	B;B;B|B	0.02656|0.02656	0.0;0.0;0.0|0.0	B;B;B|B	0.04013|0.01281	0.001;0.0;0.0|0.0	T|T	0.45877|0.45877	-0.9231|-0.9231	9|9	0.11485|0.62326	T|D	0.65|0.03	.|.	0.0398|0.0398	0.00008|0.00008	0.2803:0.2244:0.1888:0.3065|0.2803:0.2244:0.1888:0.3065	rs28594165|rs28594165	152;193;145|138	E9PEA6;Q9BTT0;Q5TB20|E9PLC4	.;AN32E_HUMAN;.|.	D|M	193;145;61;152;7;61;71|138	ENSP00000324074:E193D;ENSP00000358115:E145D;ENSP00000393718:E152D|ENSP00000435215:R138M	ENSP00000324074:E193D|ENSP00000435215:R138M	E|R	-|-	3|2	2|0	ANP32E|ANP32E	148465666|148465666	0.087000|0.087000	0.21565|0.21565	0.000000|0.000000	0.03702|0.03702	0.002000|0.002000	0.02628|0.02628	-2.245000|-2.245000	0.01192|0.01192	-3.665000|-3.665000	0.00124|0.00124	-2.619000|-2.619000	0.00157|0.00157	GAG|AGG		0.443	ANP32E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035056.1	NM_030920	
ANP32E	81611	ucsc.edu;mdanderson.org	37	1	150199045	150199045	+	Silent	SNP	T	T	C	rs56692627|rs68136184|rs28460085	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr1:150199045T>C	ENST00000314136.8	-	5	945	c.576A>G	c.(574-576)gaA>gaG	p.E192E	ANP32E_ENST00000369115.2_Silent_p.E60E|ANP32E_ENST00000436748.2_Silent_p.E151E|ANP32E_ENST00000369114.5_Intron|ANP32E_ENST00000369116.4_Silent_p.E60E|ANP32E_ENST00000533654.1_Missense_Mutation_p.K137R|ANP32E_ENST00000369119.3_Silent_p.E144E	NM_001136478.2|NM_001280559.1|NM_030920.3	NP_001129950.1|NP_001267488.1|NP_112182.1	Q9BTT0	AN32E_HUMAN	acidic (leucine-rich) nuclear phosphoprotein 32 family, member E	192	Asp/Glu-rich (highly acidic).				histone exchange (GO:0043486)|negative regulation of catalytic activity (GO:0043086)	cytoplasmic membrane-bounded vesicle (GO:0016023)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	histone binding (GO:0042393)|phosphatase inhibitor activity (GO:0019212)			breast(3)|endometrium(3)|lung(7)|skin(1)|urinary_tract(1)	15	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			catcctcctcttcctcttcct	0.438																																						.											0													225.0	183.0	197.0					1																	150199045		2203	4300	6503	SO:0001819	synonymous_variant	81611			AK092672	CCDS946.1, CCDS44214.1, CCDS44215.1, CCDS60245.1	1q22	2008-02-05			ENSG00000143401	ENSG00000143401		"""ANP32 acidic nuclear phosphoproteins"""	16673	protein-coding gene	gene with protein product		609611				12438741	Standard	NM_030920		Approved	LANPL, MGC5350, LANP-L	uc001etw.3	Q9BTT0	OTTHUMG00000012547	ENST00000314136.8:c.576A>G	1.37:g.150199045T>C		Somatic		WXS	Illumina HiSeq	Phase_I	B4E0I6|E9PEA6|Q5TB18|Q5TB20|Q8N1S4|Q8WWW9	Silent	SNP	ENST00000314136.8	37	CCDS946.1	.	.	.	.	.	.	.	.	.	.	T	4.124	0.021213	0.08006	.	.	ENSG00000143401	ENST00000533654	T	0.00337	8.05	4.98	-1.51	0.08664	.	.	.	.	.	T	0.00039	0.0001	.	.	.	0.24003	N	0.996202	B	0.02656	0.0	B	0.04013	0.001	T	0.15925	-1.0420	8	0.56958	D	0.05	.	4.2912	0.10879	0.3012:0.342:0.0:0.3568	rs28460085	137	E9PLC4	.	R	137	ENSP00000435215:K137R	ENSP00000435215:K137R	K	-	2	0	ANP32E	148465669	0.097000	0.21791	0.054000	0.19295	0.014000	0.08584	-2.180000	0.01258	-0.128000	0.11641	-0.366000	0.07423	AAG		0.438	ANP32E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035056.1	NM_030920	
ANKRD45	339416	ucsc.edu	37	1	173596257	173596257	+	Missense_Mutation	SNP	A	A	T	rs12059066	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr1:173596257A>T	ENST00000333279.2	-	4	598	c.538T>A	c.(538-540)Tta>Ata	p.L180I		NM_198493.2	NP_940895.1	Q5TZF3	ANR45_HUMAN	ankyrin repeat domain 45	196										NS(2)|endometrium(2)|large_intestine(4)|lung(3)|skin(1)	12						GTAACAGCTAAAGAGACTTTT	0.373													A|||	965	0.192692	0.6989	0.0504	5008	,	,		20198	0.0		0.005	False		,,,				2504	0.001					.											0								A	ILE/LEU	2539,1867	632.6+/-395.9	756,1027,420	145.0	150.0	148.0		538	-3.8	0.0	1	dbSNP_120	148	32,8568	19.8+/-62.0	0,32,4268	yes	missense	ANKRD45	NM_198493.2	5	756,1059,4688	TT,TA,AA		0.3721,42.374,19.7678	benign	180/267	173596257	2571,10435	2203	4300	6503	SO:0001583	missense	339416				CCDS1309.1	1q25.1	2013-01-10			ENSG00000183831	ENSG00000183831		"""Ankyrin repeat domain containing"""	24786	protein-coding gene	gene with protein product	"""cancer/testis antigen 117"""						Standard	NM_198493		Approved	FLJ45235, CT117	uc001gja.1	Q5TZF3	OTTHUMG00000040546	ENST00000333279.2:c.538T>A	1.37:g.173596257A>T	ENSP00000331268:p.Leu180Ile	Somatic		WXS	Illumina HiSeq	Phase_I	A1A4G2|Q6ZST1	Missense_Mutation	SNP	ENST00000333279.2	37	CCDS1309.1	377	0.17261904761904762	353	0.717479674796748	20	0.055248618784530384	0	0.0	4	0.005277044854881266	A	11.25	1.583800	0.28268	0.57626	0.003721	ENSG00000183831	ENST00000333279	T	0.13778	2.56	5.35	-3.79	0.04320	.	1.555310	0.03916	N	0.282716	T	0.01870	0.0059	N	0.22421	0.69	0.80722	P	0.0	B	0.27068	0.167	B	0.19148	0.024	T	0.35895	-0.9770	9	0.36615	T	0.2	-17.7491	1.2921	0.02062	0.1379:0.3633:0.2467:0.2521	rs12059066;rs52822128;rs12059066	196	Q5TZF3	ANR45_HUMAN	I	180	ENSP00000331268:L180I	ENSP00000331268:L180I	L	-	1	2	ANKRD45	171862880	0.000000	0.05858	0.000000	0.03702	0.656000	0.38851	-0.559000	0.05971	-1.213000	0.02617	0.455000	0.32223	TTA		0.373	ANKRD45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097580.2	NM_198493	
DENND3	22898	ucsc.edu	37	8	142204326	142204326	+	Silent	SNP	C	C	G	rs1045248	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr8:142204326C>G	ENST00000262585.2	+	23	3869	c.3591C>G	c.(3589-3591)ggC>ggG	p.G1197G	DENND3_ENST00000424248.1_Silent_p.G1145G|DENND3_ENST00000523308.1_Silent_p.G247G|DENND3_ENST00000519811.1_Silent_p.G1277G	NM_014957.2	NP_055772.2	A2RUS2	DEND3_HUMAN	DENN/MADD domain containing 3	1197					cellular protein catabolic process (GO:0044257)|endosome to lysosome transport (GO:0008333)|positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(4)|stomach(2)|urinary_tract(1)	55	all_cancers(97;7.36e-15)|all_epithelial(106;2.33e-13)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.105)			TTTGGAAAGGCGAATAAACGT	0.617													G|||	2563	0.511781	0.4713	0.4625	5008	,	,		19319	0.6627		0.4085	False		,,,				2504	0.5521					.											0								G		2180,2226	582.3+/-385.5	540,1100,563	56.0	50.0	52.0		3591	-5.1	0.0	8	dbSNP_86	52	3283,5315	636.1+/-399.1	642,1999,1658	no	coding-synonymous	DENND3	NM_014957.2		1182,3099,2221	GG,GC,CC		38.1833,49.478,42.0102		1197/1199	142204326	5463,7541	2203	4299	6502	SO:0001819	synonymous_variant	22898			AB020677	CCDS34947.1	8q24.3	2013-01-10				ENSG00000105339		"""DENN/MADD domain containing"", ""WD repeat domain containing"""	29134	protein-coding gene	gene with protein product						10048485	Standard	NM_014957		Approved	KIAA0870	uc003yvy.3	A2RUS2		ENST00000262585.2:c.3591C>G	8.37:g.142204326C>G		Somatic		WXS	Illumina HiSeq	Phase_I	B7ZM28|O94947|Q2TAM7|Q6ZMS6|Q96DK3	Silent	SNP	ENST00000262585.2	37	CCDS34947.1	1101	0.5041208791208791	236	0.4796747967479675	184	0.5082872928176796	386	0.6748251748251748	295	0.3891820580474934	G	0.178	-1.064887	0.01934	0.49478	0.381833	ENSG00000105339	ENST00000518668	.	.	.	5.29	-5.14	0.02875	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.09310	P	1.0	.	.	.	.	.	.	T	0.41963	-0.9479	3	.	.	.	-22.9582	2.163	0.03829	0.147:0.3307:0.2613:0.261	rs1045248;rs3185128;rs3739225;rs1045248	.	.	.	G	1202	.	.	R	+	1	2	DENND3	142273508	0.000000	0.05858	0.013000	0.15412	0.005000	0.04900	-3.114000	0.00598	-1.350000	0.02199	-2.316000	0.00254	CGA		0.617	DENND3-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_014957	
HCRTR1	3061	ucsc.edu;bcgsc.ca	37	1	32084861	32084861	+	Missense_Mutation	SNP	T	T	C	rs11806980	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr1:32084861T>C	ENST00000373706.5	+	1	221	c.68T>C	c.(67-69)gTg>gCg	p.V23A	HCRTR1_ENST00000373705.1_Missense_Mutation_p.V23A|HCRTR1_ENST00000403528.2_Missense_Mutation_p.V23A|HCRTR1_ENST00000468521.1_3'UTR			O43613	OX1R_HUMAN	hypocretin (orexin) receptor 1	23					feeding behavior (GO:0007631)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|orexin receptor activity (GO:0016499)|peptide hormone binding (GO:0017046)			breast(2)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)	7		Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.053)		CCGTCCCCTGTGCCTCCAGAC	0.612													T|||	204	0.0407348	0.1437	0.0187	5008	,	,		19073	0.0		0.001	False		,,,				2504	0.0					.											0								T	ALA/VAL	551,3855	250.9+/-257.8	35,481,1687	98.0	101.0	100.0		68	-2.6	0.1	1	dbSNP_120	100	3,8597	3.0+/-9.4	0,3,4297	yes	missense	HCRTR1	NM_001525.2	64	35,484,5984	CC,CT,TT		0.0349,12.5057,4.2596	benign	23/426	32084861	554,12452	2203	4300	6503	SO:0001583	missense	3061			AF041243	CCDS344.1	1p33	2012-08-08			ENSG00000121764	ENSG00000121764		"""GPCR / Class A : Hypocretin (orexin) receptors"""	4848	protein-coding gene	gene with protein product		602392				9491897	Standard	NM_001525		Approved	OX1R	uc009vtx.2	O43613	OTTHUMG00000003876	ENST00000373706.5:c.68T>C	1.37:g.32084861T>C	ENSP00000362810:p.Val23Ala	Somatic		WXS	Illumina HiSeq	Phase_I	A8K3A6|Q9HBV6	Missense_Mutation	SNP	ENST00000373706.5	37	CCDS344.1	73	0.033424908424908424	67	0.13617886178861788	5	0.013812154696132596	0	0.0	1	0.0013192612137203166	T	0.130	-1.115174	0.01799	0.125057	3.49E-4	ENSG00000121764	ENST00000403528;ENST00000373706;ENST00000373705	T;T;T	0.59638	0.25;0.25;0.47	3.91	-2.64	0.06114	.	1.606490	0.03596	N	0.232667	T	0.00210	0.0006	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.02925	-1.1093	10	0.08837	T	0.75	.	0.8658	0.01203	0.1644:0.3194:0.1983:0.3179	rs11806980	23;23	A6NMV7;O43613	.;OX1R_HUMAN	A	23	ENSP00000384387:V23A;ENSP00000362810:V23A;ENSP00000362809:V23A	ENSP00000362809:V23A	V	+	2	0	HCRTR1	31857448	0.000000	0.05858	0.095000	0.20976	0.693000	0.40251	-0.247000	0.08866	-0.443000	0.07180	0.533000	0.62120	GTG		0.612	HCRTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011042.1	NM_001525	
IRS2	8660	ucsc.edu	37	13	110435914	110435914	+	Silent	SNP	G	G	A	rs12853546	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr13:110435914G>A	ENST00000375856.3	-	1	3001	c.2487C>T	c.(2485-2487)ccC>ccT	p.P829P		NM_003749.2	NP_003740.2	Q9Y4H2	IRS2_HUMAN	insulin receptor substrate 2	829					brain development (GO:0007420)|cell proliferation (GO:0008283)|cellular response to glucose stimulus (GO:0071333)|cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid homeostasis (GO:0055088)|mammary gland development (GO:0030879)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of kinase activity (GO:0033673)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin secretion (GO:0032024)|positive regulation of mesenchymal cell proliferation (GO:0002053)|regulation of lipid metabolic process (GO:0019216)|response to glucose (GO:0009749)|signal transduction (GO:0007165)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)			kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	19	all_cancers(4;7.57e-15)|all_epithelial(4;5.91e-09)|all_lung(23;7.64e-07)|Lung NSC(43;0.000183)|Colorectal(4;0.00159)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0155)	Breast(118;0.159)	all cancers(43;0.00815)|BRCA - Breast invasive adenocarcinoma(86;0.11)|Epithelial(84;0.127)|GBM - Glioblastoma multiforme(44;0.147)			TGCGCCCCACGGGGGAGCTCA	0.731													.|||	1127	0.22504	0.2027	0.1542	5008	,	,		8938	0.2173		0.2565	False		,,,				2504	0.2812				Melanoma(100;613 2409 40847)	.											0								G		757,3251		86,585,1333	4.0	6.0	5.0		2487	-10.3	0.3	13	dbSNP_121	5	1742,6278		224,1294,2492	no	coding-synonymous	IRS2	NM_003749.2		310,1879,3825	AA,AG,GG		21.7207,18.8872,20.7765		829/1339	110435914	2499,9529	2004	4010	6014	SO:0001819	synonymous_variant	8660			AB000732	CCDS9510.1	13q34	2013-01-10			ENSG00000185950	ENSG00000185950		"""Pleckstrin homology (PH) domain containing"""	6126	protein-coding gene	gene with protein product		600797				9312143	Standard	NM_003749		Approved		uc001vqv.3	Q9Y4H2	OTTHUMG00000017338	ENST00000375856.3:c.2487C>T	13.37:g.110435914G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q96RR2|Q9BZG0|Q9Y6I5	Silent	SNP	ENST00000375856.3	37	CCDS9510.1																																																																																				0.731	IRS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045755.1	NM_003749	
LBX2	85474	ucsc.edu;bcgsc.ca	37	2	74725178	74725178	+	Missense_Mutation	SNP	G	G	A	rs17009998	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr2:74725178G>A	ENST00000377566.4	-	2	651	c.473C>T	c.(472-474)tCc>tTc	p.S158F	LBX2_ENST00000341396.2_3'UTR|AC005041.17_ENST00000479098.1_RNA|LBX2_ENST00000460508.3_Missense_Mutation_p.S154F|LBX2_ENST00000550249.1_5'UTR	NM_001282430.1	NP_001269359.1	Q6XYB7	LBX2_HUMAN	ladybird homeobox 2	158			S -> F (in dbSNP:rs17009998).		regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(1)	4						GACTTCCGGGGACAACGCGCG	0.687													G|||	1668	0.333067	0.1399	0.2579	5008	,	,		15440	0.8204		0.1551	False		,,,				2504	0.3282					.											0								G	PHE/SER	662,3744	276.3+/-273.0	54,554,1595	49.0	48.0	48.0		461	3.0	0.2	2	dbSNP_123	48	1139,7459	227.9+/-263.1	77,985,3237	yes	missense	LBX2	NM_001009812.1	155	131,1539,4832	AA,AG,GG		13.2473,15.025,13.8496	probably-damaging	154/195	74725178	1801,11203	2203	4299	6502	SO:0001583	missense	85474			AC005041	CCDS33228.1, CCDS62938.1	2p13.1	2014-05-06	2007-02-15		ENSG00000179528	ENSG00000179528		"""Homeoboxes / ANTP class : NKL subclass"""	15525	protein-coding gene	gene with protein product		607164	"""ladybird homeobox homolog 2 (Drosophila)"""			11386758	Standard	NM_001282430		Approved		uc002slw.3	Q6XYB7	OTTHUMG00000170595	ENST00000377566.4:c.473C>T	2.37:g.74725178G>A	ENSP00000366789:p.Ser158Phe	Somatic		WXS	Illumina HiSeq	Phase_I	Q7Z5Y8	Missense_Mutation	SNP	ENST00000377566.4	37		718	0.32875457875457875	63	0.12804878048780488	72	0.19889502762430938	471	0.8234265734265734	112	0.14775725593667546	G	15.19	2.759678	0.49468	0.15025	0.132473	ENSG00000179528	ENST00000377566;ENST00000460508	D;D	0.91945	-2.82;-2.94	4.76	2.95	0.34219	.	0.647217	0.13712	N	0.367991	T	0.00012	0.0000	L	0.29908	0.895	0.20563	P	0.999885927	B;B	0.12630	0.006;0.002	B;B	0.19148	0.024;0.002	T	0.44174	-0.9345	9	0.66056	D	0.02	.	7.3598	0.26739	0.0893:0.0:0.7431:0.1677	rs17009998;rs60339187;rs17009998	154;158	Q6XYB7-2;Q6XYB7	.;LBX2_HUMAN	F	158;154	ENSP00000366789:S158F;ENSP00000417116:S154F	ENSP00000366789:S158F	S	-	2	0	LBX2	74578686	0.000000	0.05858	0.178000	0.23040	0.034000	0.12701	0.297000	0.19101	0.605000	0.29947	0.561000	0.74099	TCC		0.687	LBX2-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000328490.1	NM_001009812	
NOC2L	26155	ucsc.edu	37	1	880468	880468	+	Silent	SNP	C	C	T	rs368313199|rs372255682	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr1:880468C>T	ENST00000327044.6	-	18	2161	c.2112G>A	c.(2110-2112)gaG>gaA	p.E704E		NM_015658.3	NP_056473	Q9Y3T9	NOC2L_HUMAN	nucleolar complex associated 2 homolog (S. cerevisiae)	704	Asp/Glu-rich (acidic).				apoptotic process (GO:0006915)|cellular response to UV (GO:0034644)|chromatin assembly (GO:0031497)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of histone acetylation (GO:0035067)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleolus to nucleoplasm transport (GO:0032066)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|nucleosome binding (GO:0031491)|poly(A) RNA binding (GO:0044822)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)			endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|skin(2)|urinary_tract(1)	16	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;1.86e-38)|OV - Ovarian serous cystadenocarcinoma(86;6.08e-23)|Colorectal(212;0.000161)|COAD - Colon adenocarcinoma(227;0.000194)|BRCA - Breast invasive adenocarcinoma(365;0.000475)|Kidney(185;0.00231)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0344)|Lung(427;0.2)		cctcgccctcctcctcgtcct	0.622																																						.											0													124.0	115.0	118.0					1																	880468		2203	4300	6503	SO:0001819	synonymous_variant	26155			AL050019	CCDS3.1	1p36.33	2014-06-12			ENSG00000188976	ENSG00000188976			24517	protein-coding gene	gene with protein product	"""novel INHAT repressor"", ""protein phosphatase 1, regulatory subunit 12"""	610770					Standard	NM_015658		Approved	DKFZP564C186, NET7, NET15, NIR, PPP1R112	uc001abz.4	Q9Y3T9	OTTHUMG00000040720	ENST00000327044.6:c.2112G>A	1.37:g.880468C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q5SVA3|Q9BTN6	Silent	SNP	ENST00000327044.6	37	CCDS3.1																																																																																				0.622	NOC2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097869.1	NM_015658	
NOC2L	26155	ucsc.edu	37	1	880475	880475	+	Missense_Mutation	SNP	T	T	C	rs368313199|rs372255682	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr1:880475T>C	ENST00000327044.6	-	18	2154	c.2105A>G	c.(2104-2106)gAc>gGc	p.D702G		NM_015658.3	NP_056473	Q9Y3T9	NOC2L_HUMAN	nucleolar complex associated 2 homolog (S. cerevisiae)	702	Asp/Glu-rich (acidic).				apoptotic process (GO:0006915)|cellular response to UV (GO:0034644)|chromatin assembly (GO:0031497)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of histone acetylation (GO:0035067)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleolus to nucleoplasm transport (GO:0032066)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|nucleosome binding (GO:0031491)|poly(A) RNA binding (GO:0044822)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)			endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|skin(2)|urinary_tract(1)	16	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;1.86e-38)|OV - Ovarian serous cystadenocarcinoma(86;6.08e-23)|Colorectal(212;0.000161)|COAD - Colon adenocarcinoma(227;0.000194)|BRCA - Breast invasive adenocarcinoma(365;0.000475)|Kidney(185;0.00231)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0344)|Lung(427;0.2)		ctcctcctcgtcctcttcatc	0.622																																						.											0																																										SO:0001583	missense	26155			AL050019	CCDS3.1	1p36.33	2014-06-12			ENSG00000188976	ENSG00000188976			24517	protein-coding gene	gene with protein product	"""novel INHAT repressor"", ""protein phosphatase 1, regulatory subunit 12"""	610770					Standard	NM_015658		Approved	DKFZP564C186, NET7, NET15, NIR, PPP1R112	uc001abz.4	Q9Y3T9	OTTHUMG00000040720	ENST00000327044.6:c.2105A>G	1.37:g.880475T>C	ENSP00000317992:p.Asp702Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q5SVA3|Q9BTN6	Missense_Mutation	SNP	ENST00000327044.6	37	CCDS3.1	.	.	.	.	.	.	.	.	.	.	T	10.22	1.289827	0.23478	.	.	ENSG00000188976	ENST00000327044	T	0.26810	1.71	3.68	-0.445	0.12242	Armadillo-type fold (1);	2.008120	0.02105	N	0.054339	T	0.18425	0.0442	L	0.29908	0.895	0.09310	N	1	B;B;B	0.19583	0.037;0.037;0.001	B;B;B	0.20767	0.031;0.031;0.002	T	0.14727	-1.0462	10	0.25751	T	0.34	0.5989	4.3641	0.11216	0.0:0.212:0.1769:0.6111	.	702;702;469	B3KNC3;Q9Y3T9;Q9H9J5	.;NOC2L_HUMAN;.	G	702	ENSP00000317992:D702G	ENSP00000317992:D702G	D	-	2	0	NOC2L	870338	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.335000	0.07873	0.046000	0.15833	-0.796000	0.03273	GAC		0.622	NOC2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097869.1	NM_015658	
PHF21A	51317	ucsc.edu	37	11	46001380	46001380	+	Silent	SNP	T	T	C	rs151038480		TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr11:46001380T>C	ENST00000418153.2	-	6	490	c.291A>G	c.(289-291)caA>caG	p.Q97Q	PHF21A_ENST00000323180.6_Silent_p.Q97Q|PHF21A_ENST00000257821.4_Silent_p.Q97Q			Q96BD5	PF21A_HUMAN	PHD finger protein 21A	97	Gln-rich.				blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|suckling behavior (GO:0001967)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(10)|lung(9)|skin(2)|upper_aerodigestive_tract(2)	29						actgctgctgttgttgtagtt	0.498																																						.											0								T	,	3,4401	6.2+/-15.9	0,3,2199	343.0	268.0	294.0		291,291	-6.8	0.1	11	dbSNP_134	294	0,8598		0,0,4299	no	coding-synonymous,coding-synonymous	PHF21A	NM_001101802.1,NM_016621.3	,	0,3,6498	CC,CT,TT		0.0,0.0681,0.0231	,	97/681,97/635	46001380	3,12999	2202	4299	6501	SO:0001819	synonymous_variant	51317			AL359593	CCDS31474.1, CCDS44578.1	11p11.2	2013-01-28			ENSG00000135365	ENSG00000135365		"""Zinc fingers, PHD-type"""	24156	protein-coding gene	gene with protein product		608325				11214970, 12032298	Standard	NM_001101802		Approved	BHC80, KIAA1696, BM-006	uc001ncc.4	Q96BD5	OTTHUMG00000167038	ENST00000418153.2:c.291A>G	11.37:g.46001380T>C		Somatic		WXS	Illumina HiSeq	Phase_I	D3DQP5|Q6AWA2|Q9C0G7|Q9H8V9|Q9HAK6|Q9NZE9	Silent	SNP	ENST00000418153.2	37	CCDS44578.1																																																																																				0.498	PHF21A-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000392583.1	NM_016621	
PIEZO1	9780	ucsc.edu	37	16	88800398	88800398	+	Missense_Mutation	SNP	G	G	C	rs144777557|rs144269709|rs62639697	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr16:88800398G>C	ENST00000301015.9	-	17	2491	c.2245C>G	c.(2245-2247)Cag>Gag	p.Q749E	RP5-1142A6.2_ENST00000567968.1_RNA|RP5-1142A6.2_ENST00000440406.2_RNA	NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1	749					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)	p.Q749delQ(1)|p.E756_D757insE(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						tcctcctcctgctgctgctgc	0.667																																						.											2	Insertion - In frame(1)|Deletion - In frame(1)	prostate(1)|breast(1)											8.0	10.0	9.0					16																	88800398		685	1572	2257	SO:0001583	missense	9780			D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776	ENST00000301015.9:c.2245C>G	16.37:g.88800398G>C	ENSP00000301015:p.Gln749Glu	Somatic		WXS	Illumina HiSeq	Phase_I	A6NHT9|A7E2B7|Q0KKZ9	Missense_Mutation	SNP	ENST00000301015.9	37	CCDS54058.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.005|0.005	-2.233254|-2.233254	0.00277|0.00277	.|.	.|.	ENSG00000103335|ENSG00000103335	ENST00000451779|ENST00000301015	.|T	.|0.40756	.|1.02	0.844|0.844	0.844|0.844	0.18943|0.18943	.|.	.|3.384400	.|0.02084	.|N	.|0.052613	T|T	0.19604|0.19604	0.0471|0.0471	N|N	0.03608|0.03608	-0.345|-0.345	0.09310|0.09310	N|N	0.999999|0.999999	.|B	.|0.02656	.|0.0	.|B	.|0.01281	.|0.0	T|T	0.38436|0.38436	-0.9661|-0.9661	5|10	.|0.02654	.|T	.|1	.|.	7.2811|7.2811	0.26312|0.26312	0.0:0.4248:0.5752:0.0|0.0:0.4248:0.5752:0.0	rs62639697|rs62639697	.|749	.|Q92508	.|PIEZ1_HUMAN	G|E	694|749	.|ENSP00000301015:Q749E	.|ENSP00000301015:Q749E	A|Q	-|-	2|1	0|0	FAM38A|FAM38A	87327899|87327899	0.000000|0.000000	0.05858|0.05858	0.092000|0.092000	0.20876|0.20876	0.022000|0.022000	0.10575|0.10575	-0.494000|-0.494000	0.06451|0.06451	-1.966000|-1.966000	0.01009|0.01009	-1.954000|-1.954000	0.00483|0.00483	GCA|CAG		0.667	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000345699.4	NM_014745	
ARHGAP5	394	mdanderson.org	37	14	32561316	32561316	+	Nonsense_Mutation	SNP	G	G	T	rs200628183	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr14:32561316G>T	ENST00000345122.3	+	2	1756	c.1441G>T	c.(1441-1443)Gaa>Taa	p.E481*	ARHGAP5_ENST00000433497.1_Intron|ARHGAP5_ENST00000396582.2_Intron|ARHGAP5_ENST00000539826.2_Nonsense_Mutation_p.E481*|ARHGAP5_ENST00000432921.1_Nonsense_Mutation_p.E481*|ARHGAP5_ENST00000556611.1_Nonsense_Mutation_p.E481*	NM_001030055.1	NP_001025226.1	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5	481	FF 3.				cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|mammary gland development (GO:0030879)|positive regulation of cell migration (GO:0030335)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell size (GO:0008361)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(10)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(12)|ovary(4)|skin(1)|stomach(1)|urinary_tract(4)	55	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		GCATCAGCGAGAAATAGTTGA	0.373																																					NSCLC(9;77 350 3443 29227 41353)	.											0													69.0	70.0	70.0					14																	32561316		2203	4297	6500	SO:0001587	stop_gained	394			U17032	CCDS32062.1, CCDS45095.1	14q12	2010-02-05						"""Rho GTPase activating proteins"""	675	protein-coding gene	gene with protein product		602680	"""growth factor independent 2"""	GFI2		8537347	Standard	XM_005267635		Approved	RhoGAP5, p190-B, p190BRhoGAP	uc001wrn.3	Q13017		ENST00000345122.3:c.1441G>T	14.37:g.32561316G>T	ENSP00000371897:p.Glu481*	Somatic		WXS	Illumina HiSeq	Phase_I	A1L375|A1L376|A8KAA1|D3DS89|D3DS90|Q05BE8|Q05BU8|Q59ER0|Q6DHZ3	Nonsense_Mutation	SNP	ENST00000345122.3	37	CCDS32062.1	.	.	.	.	.	.	.	.	.	.	G	40	8.091676	0.98648	.	.	ENSG00000100852	ENST00000556611;ENST00000539826;ENST00000345122;ENST00000432921	.	.	.	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	.	20.547	0.99278	0.0:0.0:1.0:0.0	.	.	.	.	X	481	.	ENSP00000371897:E481X	E	+	1	0	ARHGAP5	31631067	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.850000	0.98022	0.650000	0.86243	GAA		0.373	ARHGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409735.1	NM_001030055	
BAIAP2L2	80115	mdanderson.org	37	22	38483172	38483172	+	Silent	SNP	G	G	T	rs539447143	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr22:38483172G>T	ENST00000381669.3	-	11	1362	c.1218C>A	c.(1216-1218)tcC>tcA	p.S406S	CTA-228A9.3_ENST00000609162.1_lincRNA	NM_025045.4	NP_079321.3	Q6UXY1	BI2L2_HUMAN	BAI1-associated protein 2-like 2	406					filopodium assembly (GO:0046847)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|signal transduction (GO:0007165)	cell-cell contact zone (GO:0044291)|cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	phospholipid binding (GO:0005543)			large_intestine(2)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)	8	Melanoma(58;0.045)					gtgtcatgggggacatggagg	0.662													G|||	30	0.00599042	0.0068	0.0014	5008	,	,		13061	0.0		0.004	False		,,,				2504	0.0164					.											0													31.0	37.0	35.0					22																	38483172		1925	4122	6047	SO:0001819	synonymous_variant	80115			BC015619	CCDS43018.1	22q13.1	2005-02-09			ENSG00000128298	ENSG00000128298			26203	protein-coding gene	gene with protein product							Standard	NM_025045		Approved	FLJ22582	uc003auw.3	Q6UXY1	OTTHUMG00000151197	ENST00000381669.3:c.1218C>A	22.37:g.38483172G>T		Somatic		WXS	Illumina HiSeq	Phase_I	B0QYE2|Q96BG7	Silent	SNP	ENST00000381669.3	37	CCDS43018.1																																																																																				0.662	BAIAP2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321727.1	NM_025045	
BAIAP2L2	80115	mdanderson.org	37	22	38483174	38483174	+	Missense_Mutation	SNP	A	A	T	rs374089121|rs200930717|rs78489217	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr22:38483174A>T	ENST00000381669.3	-	11	1360	c.1216T>A	c.(1216-1218)Tcc>Acc	p.S406T	CTA-228A9.3_ENST00000609162.1_lincRNA	NM_025045.4	NP_079321.3	Q6UXY1	BI2L2_HUMAN	BAI1-associated protein 2-like 2	406					filopodium assembly (GO:0046847)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|signal transduction (GO:0007165)	cell-cell contact zone (GO:0044291)|cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	phospholipid binding (GO:0005543)	p.M405_S406insTSM(1)		large_intestine(2)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)	8	Melanoma(58;0.045)					gtcatgggggacatggaggtc	0.657													A|||	84	0.0167732	0.0076	0.0159	5008	,	,		13137	0.001		0.0278	False		,,,				2504	0.0348					.											1	Insertion - In frame(1)	ovary(1)											32.0	38.0	36.0					22																	38483174		1925	4121	6046	SO:0001583	missense	80115			BC015619	CCDS43018.1	22q13.1	2005-02-09			ENSG00000128298	ENSG00000128298			26203	protein-coding gene	gene with protein product							Standard	NM_025045		Approved	FLJ22582	uc003auw.3	Q6UXY1	OTTHUMG00000151197	ENST00000381669.3:c.1216T>A	22.37:g.38483174A>T	ENSP00000371085:p.Ser406Thr	Somatic		WXS	Illumina HiSeq	Phase_I	B0QYE2|Q96BG7	Missense_Mutation	SNP	ENST00000381669.3	37	CCDS43018.1	254	0.1163003663003663	58	0.11788617886178862	58	0.16022099447513813	32	0.055944055944055944	106	0.13984168865435356	A	0.010	-1.753658	0.00663	.	.	ENSG00000128298	ENST00000381669;ENST00000402500;ENST00000428572	T;T	0.21543	2.0;2.0	0.235	-0.47	0.12131	.	2.310980	0.01612	N	0.022579	T	0.00039	0.0001	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.27434	-1.0074	9	0.18276	T	0.48	.	.	.	.	.	406	Q6UXY1	BI2L2_HUMAN	T	406;406;97	ENSP00000371085:S406T;ENSP00000410074:S97T	ENSP00000371085:S406T	S	-	1	0	BAIAP2L2	36813120	0.121000	0.22262	0.001000	0.08648	0.001000	0.01503	0.410000	0.21098	-2.434000	0.00554	-2.582000	0.00168	TCC		0.657	BAIAP2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321727.1	NM_025045	
BAIAP2L2	80115	mdanderson.org	37	22	38483180	38483180	+	Missense_Mutation	SNP	A	A	G	rs111783779	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr22:38483180A>G	ENST00000381669.3	-	11	1354	c.1210T>C	c.(1210-1212)Tcc>Ccc	p.S404P	CTA-228A9.3_ENST00000609162.1_lincRNA	NM_025045.4	NP_079321.3	Q6UXY1	BI2L2_HUMAN	BAI1-associated protein 2-like 2	404					filopodium assembly (GO:0046847)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|signal transduction (GO:0007165)	cell-cell contact zone (GO:0044291)|cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	phospholipid binding (GO:0005543)			large_intestine(2)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)	8	Melanoma(58;0.045)					ggggacatggaggtcatggag	0.657													A|||	14	0.00279553	0.0061	0.0	5008	,	,		13299	0.0		0.001	False		,,,				2504	0.0051					.											0													34.0	41.0	39.0					22																	38483180		1927	4124	6051	SO:0001583	missense	80115			BC015619	CCDS43018.1	22q13.1	2005-02-09			ENSG00000128298	ENSG00000128298			26203	protein-coding gene	gene with protein product							Standard	NM_025045		Approved	FLJ22582	uc003auw.3	Q6UXY1	OTTHUMG00000151197	ENST00000381669.3:c.1210T>C	22.37:g.38483180A>G	ENSP00000371085:p.Ser404Pro	Somatic		WXS	Illumina HiSeq	Phase_I	B0QYE2|Q96BG7	Missense_Mutation	SNP	ENST00000381669.3	37	CCDS43018.1	.	.	.	.	.	.	.	.	.	.	A	1.092	-0.663862	0.03428	.	.	ENSG00000128298	ENST00000381669;ENST00000402500;ENST00000428572	T;T	0.21031	2.03;2.03	0.208	0.208	0.15221	.	2.204600	0.02525	N	0.093019	T	0.08802	0.0218	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.17992	-1.0351	9	0.05436	T	0.98	.	.	.	.	.	404	Q6UXY1	BI2L2_HUMAN	P	404;404;95	ENSP00000371085:S404P;ENSP00000410074:S95P	ENSP00000371085:S404P	S	-	1	0	BAIAP2L2	36813126	0.009000	0.17119	0.004000	0.12327	0.001000	0.01503	0.089000	0.15002	-0.794000	0.04468	-0.795000	0.03280	TCC		0.657	BAIAP2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321727.1	NM_025045	
BDNF	627	mdanderson.org	37	11	27681197	27681197	+	5'UTR	SNP	C	C	T	rs4030470|rs112614050|rs376982344|rs200712840|rs202011320	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr11:27681197C>T	ENST00000525528.1	-	0	8				BDNF_ENST00000438929.1_Intron|BDNF_ENST00000533131.1_Intron|BDNF_ENST00000439476.2_5'UTR|BDNF_ENST00000395980.2_Intron|BDNF-AS_ENST00000501176.2_RNA|BDNF_ENST00000533246.1_Intron|BDNF_ENST00000356660.4_Intron|BDNF-AS_ENST00000532965.1_RNA|BDNF-AS_ENST00000499008.3_RNA|BDNF_ENST00000395978.3_Intron|BDNF_ENST00000314915.6_Intron|BDNF_ENST00000530861.1_Intron|BDNF_ENST00000395983.3_Intron|BDNF-AS_ENST00000499568.2_RNA|BDNF-AS_ENST00000530313.1_RNA|BDNF-AS_ENST00000500662.2_RNA|BDNF-AS_ENST00000530686.1_RNA|BDNF_ENST00000525950.1_Intron|BDNF_ENST00000532997.1_Intron|BDNF-AS_ENST00000502161.2_RNA|BDNF_ENST00000395981.3_Intron|BDNF_ENST00000584049.1_Intron|BDNF_ENST00000420794.1_Intron|BDNF_ENST00000418212.1_Intron|BDNF_ENST00000395986.2_Intron	NM_170735.5	NP_733931.1	P23560	BDNF_HUMAN	brain-derived neurotrophic factor						axon extension (GO:0048675)|axon guidance (GO:0007411)|axon target recognition (GO:0007412)|behavioral fear response (GO:0001662)|chronic inflammatory response (GO:0002544)|circadian rhythm (GO:0007623)|dendrite development (GO:0016358)|dendrite extension (GO:0097484)|feeding behavior (GO:0007631)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glutamate secretion (GO:0014047)|inner ear development (GO:0048839)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|nerve development (GO:0021675)|nervous system development (GO:0007399)|neuron recognition (GO:0008038)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of synapse assembly (GO:0051965)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of retinal cell programmed cell death (GO:0046668)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|response to anesthetic (GO:0072347)|response to fluoxetine (GO:0014076)|response to hormone (GO:0009725)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to vitamin A (GO:0033189)|taste bud development (GO:0061193)|ureteric bud development (GO:0001657)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	growth factor activity (GO:0008083)			breast(1)|large_intestine(3)|lung(2)	6						tgtgtgtgtgcgcgcgcgcgt	0.438													T|||	2464	0.492013	0.618	0.5303	5008	,	,		15382	0.4772		0.4324	False		,,,				2504	0.3712					.											0																																										SO:0001623	5_prime_UTR_variant	497258			AB038670	CCDS7865.1, CCDS7866.1, CCDS44558.1, CCDS41628.1	11p14.1	2014-01-30			ENSG00000176697	ENSG00000176697		"""Endogenous ligands"""	1033	protein-coding gene	gene with protein product	"""neurotrophin"""	113505				2236018, 1889806, 17942328, 17493809	Standard	NM_170731		Approved		uc009yje.3	P23560	OTTHUMG00000178797	ENST00000525528.1:c.-1086G>A	11.37:g.27681197C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A7LA85|A7LA92|D3DQZ2|Q598Q1|Q6DN19|Q6YNR2|Q6YNR3|Q9BYY7|Q9UC24	RNA	SNP	ENST00000525528.1	37	CCDS7866.1																																																																																				0.438	BDNF-016	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388135.1	NM_170735	
CARD17	440068	mdanderson.org;bcgsc.ca	37	11	104971257	104971257	+	Missense_Mutation	SNP	G	G	A	rs12806837	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr11:104971257G>A	ENST00000375707.1	-	2	273	c.257C>T	c.(256-258)aCg>aTg	p.T86M	CASP1_ENST00000598974.1_Intron|CASP1_ENST00000593315.1_Intron|CASP1_ENST00000594519.1_Intron|CARD16_ENST00000525374.1_Intron|CASP1_ENST00000415981.2_Intron	NM_001007232.1	NP_001007233.1	Q5XLA6	CAR17_HUMAN	caspase recruitment domain family, member 17	86	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				regulation of apoptotic process (GO:0042981)	cytoplasm (GO:0005737)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			breast(1)|large_intestine(1)|lung(2)|ovary(1)|stomach(1)	6						GAGTCCCAGCGTCCCTGCCAG	0.488													.|||	512	0.102236	0.143	0.2233	5008	,	,		20238	0.006		0.0815	False		,,,				2504	0.0818					.											0								G	MET/THR	601,3803		31,539,1632	122.0	106.0	111.0		257	-2.5	0.0	11	dbSNP_121	111	694,7904		29,636,3634	no	missense	CARD17	NM_001007232.1	81	60,1175,5266	AA,AG,GG		8.0716,13.6467,9.96		86/111	104971257	1295,11707	2202	4299	6501	SO:0001583	missense	440068				CCDS31662.1	11q22.3	2009-01-13				ENSG00000255221			33827	protein-coding gene	gene with protein product	"""Inhibitory CARD"""	609490				15383541	Standard	NM_001007232		Approved	INCA	uc001pir.1	Q5XLA6		ENST00000375707.1:c.257C>T	11.37:g.104971257G>A	ENSP00000364859:p.Thr86Met	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000375707.1	37	CCDS31662.1	216	0.0989010989010989	81	0.16463414634146342	75	0.20718232044198895	2	0.0034965034965034965	58	0.07651715039577836	.	6.103	0.387223	0.11581	0.136467	0.080716	ENSG00000255221	ENST00000375707	T	0.20881	2.04	2.69	-2.47	0.06442	DEATH-like (2);Caspase Recruitment (3);	.	.	.	.	T	0.00012	0.0000	M	0.70595	2.14	0.80722	P	0.0	P	0.38617	0.64	B	0.29598	0.104	T	0.12167	-1.0558	8	0.40728	T	0.16	.	2.9218	0.05771	0.4783:0.0:0.2414:0.2803	rs12806837	86	Q5XLA6	CAR17_HUMAN	M	86	ENSP00000364859:T86M	ENSP00000364859:T86M	T	-	2	0	CARD17	104476467	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.712000	0.01885	-0.752000	0.04728	0.511000	0.50034	ACG		0.488	CARD17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388181.1	NM_001007232	
CCNY	219771	mdanderson.org	37	10	35772402	35772402	+	Silent	SNP	G	G	A	rs3802509	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr10:35772402G>A	ENST00000374704.4	+	2	405	c.225G>A	c.(223-225)acG>acA	p.T75T	CCNY_ENST00000339497.5_Intron|CCNY_ENST00000265375.9_Silent_p.T21T|CCNY_ENST00000492478.1_3'UTR|CCNY_ENST00000374706.1_Silent_p.T21T	NM_145012.4	NP_659449.3	Q8ND76	CCNY_HUMAN	cyclin Y	75					cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytoplasmic cyclin-dependent protein kinase holoenzyme complex (GO:0000308)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)			cervix(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	8						AATCTCAGACGGACGGTAGGT	0.343													A|||	2289	0.457069	0.6536	0.4539	5008	,	,		17108	0.4266		0.3241	False		,,,				2504	0.362					.											0								A	,	2720,1686	511.6+/-367.8	849,1022,332	86.0	82.0	83.0		225,63	-11.7	0.0	10	dbSNP_107	83	2772,5828	678.6+/-403.5	433,1906,1961	no	coding-synonymous,coding-synonymous	CCNY	NM_145012.4,NM_181698.2	,	1282,2928,2293	AA,AG,GG		32.2326,38.266,42.2267	,	75/342,21/288	35772402	5492,7514	2203	4300	6503	SO:0001819	synonymous_variant	219771			AF413522, AY504868	CCDS7189.1, CCDS7190.1, CCDS60513.1	10p11.22	2011-01-25	2007-02-09	2007-02-09	ENSG00000108100	ENSG00000108100			23354	protein-coding gene	gene with protein product		612786	"""chromosome 10 open reading frame 9"""	C10orf9		20441050	Standard	XM_005252388		Approved	CFP1, CBCP1	uc001iyw.4	Q8ND76	OTTHUMG00000017955	ENST00000374704.4:c.225G>A	10.37:g.35772402G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B7ZKX9|D3DRY9|Q2M3V4|Q2TU96|Q6NT86|Q7Z4U7|Q8TEX2|Q8TEX3|Q96M99|Q96P45	Silent	SNP	ENST00000374704.4	37	CCDS7189.1																																																																																				0.343	CCNY-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047568.2	NM_181698	
CDC42EP1	11135	mdanderson.org	37	22	37964429	37964429	+	Missense_Mutation	SNP	T	T	C	rs200195385|rs62235034|rs66468174	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr22:37964429T>C	ENST00000249014.4	+	3	1198	c.778T>C	c.(778-780)Tca>Cca	p.S260P		NM_152243.2	NP_689449.1	Q00587	BORG5_HUMAN	CDC42 effector protein (Rho GTPase binding) 1	260	8 X 7 AA tandem repeats of [PT]-[AT]-A- [ENT]-[PT]-[PTS]-[AG].				positive regulation of pseudopodium assembly (GO:0031274)|regulation of cell shape (GO:0008360)|Rho protein signal transduction (GO:0007266)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)		p.N258_A264delNPSAPAA(3)		endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(4)|prostate(5)	15	Melanoma(58;0.0574)					TGCAAACCCCTCAGCACCTGC	0.667																																						.											3	Deletion - In frame(3)	large_intestine(2)|haematopoietic_and_lymphoid_tissue(1)											12.0	10.0	11.0					22																	37964429		2168	3775	5943	SO:0001583	missense	11135			M88338	CCDS13949.1	22q13.1	2008-06-11			ENSG00000128283	ENSG00000128283			17014	protein-coding gene	gene with protein product	"""55 kDa bone marrow stromal/endothelial cell protein"", ""serum constituent protein"""	606084				1629197, 10430899	Standard	NM_152243		Approved	MSE55, CEP1, Borg5	uc003asz.4	Q00587	OTTHUMG00000150591	ENST00000249014.4:c.778T>C	22.37:g.37964429T>C	ENSP00000249014:p.Ser260Pro	Somatic		WXS	Illumina HiSeq	Phase_I	A8K825|Q96GN1	Missense_Mutation	SNP	ENST00000249014.4	37	CCDS13949.1	812	0.3717948717948718	78	0.15853658536585366	183	0.505524861878453	155	0.270979020979021	396	0.5224274406332454	T	0.070	-1.204174	0.01568	.	.	ENSG00000128283	ENST00000249014	T	0.31769	1.48	1.93	-3.86	0.04230	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.45011	-0.9290	8	0.06236	T	0.91	.	1.0989	0.01680	0.1719:0.4066:0.17:0.2515	rs62235034	260	Q00587	BORG5_HUMAN	P	260	ENSP00000249014:S260P	ENSP00000249014:S260P	S	+	1	0	CDC42EP1	36294375	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.184000	0.09698	-1.081000	0.03105	-1.073000	0.02249	TCA		0.667	CDC42EP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318993.1	NM_152243	
CDHR2	54825	mdanderson.org	37	5	175992370	175992370	+	Missense_Mutation	SNP	T	T	C	rs114786529	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr5:175992370T>C	ENST00000510636.1	+	2	291	c.17T>C	c.(16-18)cTg>cCg	p.L6P	CDHR2_ENST00000506348.1_Missense_Mutation_p.L6P|CDHR2_ENST00000261944.5_Missense_Mutation_p.L6P	NM_001171976.1	NP_001165447.1	Q9BYE9	CDHR2_HUMAN	cadherin-related family member 2	6					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|liver(1)|lung(23)|ovary(3)|prostate(5)|skin(4)|urinary_tract(1)	56						CAGCTATGGCTGTCCTGCTTC	0.617													T|||	41	0.0081869	0.0272	0.0072	5008	,	,		20034	0.0		0.0	False		,,,				2504	0.0					.											0								T	PRO/LEU,PRO/LEU	83,4323	72.0+/-110.0	0,83,2120	185.0	141.0	156.0		17,17	4.4	1.0	5	dbSNP_132	156	17,8583	12.6+/-44.7	0,17,4283	yes	missense,missense	CDHR2	NM_001171976.1,NM_017675.4	98,98	0,100,6403	CC,CT,TT		0.1977,1.8838,0.7689	probably-damaging,probably-damaging	6/1311,6/1311	175992370	100,12906	2203	4300	6503	SO:0001583	missense	54825			AB047004	CCDS34297.1	5q35.2	2011-07-01	2010-01-25	2010-01-25		ENSG00000074276		"""Cadherins / Cadherin-related"""	18231	protein-coding gene	gene with protein product	"""protocadherin LKC"""		"""protocadherin 24"""	PCDH24		11082270, 12117771	Standard	NM_001171976		Approved	PC-LKC, FLJ20124, FLJ20383, PCLKC	uc003mem.2	Q9BYE9		ENST00000510636.1:c.17T>C	5.37:g.175992370T>C	ENSP00000424565:p.Leu6Pro	Somatic		WXS	Illumina HiSeq	Phase_I	A1L3U4|A6NC80|Q9NXP8	Missense_Mutation	SNP	ENST00000510636.1	37	CCDS34297.1	22	0.010073260073260074	20	0.04065040650406504	2	0.0055248618784530384	0	0.0	0	0.0	T	12.99	2.102143	0.37048	0.018838	0.001977	ENSG00000074276	ENST00000510636;ENST00000261944;ENST00000506348	T;T;T	0.57436	0.4;0.4;0.4	4.36	4.36	0.52297	.	.	.	.	.	T	0.28001	0.0690	L	0.38838	1.175	0.58432	D	0.999999	D	0.89917	1.0	D	0.85130	0.997	T	0.50550	-0.8815	9	0.62326	D	0.03	-15.2557	10.1165	0.42593	0.0:0.0:0.0:1.0	.	6	Q9BYE9	CDHR2_HUMAN	P	6	ENSP00000424565:L6P;ENSP00000261944:L6P;ENSP00000421078:L6P	ENSP00000261944:L6P	L	+	2	0	CDHR2	175924976	1.000000	0.71417	0.994000	0.49952	0.126000	0.20510	1.468000	0.35332	1.962000	0.57031	0.459000	0.35465	CTG		0.617	CDHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372201.1	NM_017675	
CROCC	9696	mdanderson.org	37	1	17272044	17272044	+	Silent	SNP	A	A	G	rs2761550	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr1:17272044A>G	ENST00000375541.5	+	15	2148	c.2079A>G	c.(2077-2079)acA>acG	p.T693T	CROCC_ENST00000467938.1_3'UTR	NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin									p.T693T(3)		breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		GCCGCGCCACACTGCAACGGG	0.632																																						.											3	Substitution - coding silent(3)	kidney(3)											18.0	16.0	16.0					1																	17272044		2196	4283	6479	SO:0001819	synonymous_variant	9696			AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.2079A>G	1.37:g.17272044A>G		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000375541.5	37	CCDS30616.1																																																																																				0.632	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006249.2	NM_014675	
CLCA4	22802	mdanderson.org	37	1	87045902	87045902	+	Silent	SNP	A	A	T	rs1932809|rs4001061|rs77067122|rs56040873|rs574759485|rs368263974	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr1:87045902A>T	ENST00000370563.3	+	14	2676	c.2634A>T	c.(2632-2634)acA>acT	p.T878T	RP4-651E10.4_ENST00000456587.1_RNA	NM_012128.3	NP_036260.2	Q14CN2	CLCA4_HUMAN	chloride channel accessory 4	878			Missing. {ECO:0000269|PubMed:10437792, ECO:0000269|PubMed:15489334}.		chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|liver(2)|lung(21)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44		Lung NSC(277;0.238)		all cancers(265;0.0202)|Epithelial(280;0.0404)		TTGAtcctacacctactccta	0.348														35	0.00698882	0.0234	0.0014	5008	,	,		16699	0.002		0.001	False		,,,				2504	0.0					.											0								A		815,2361		278,259,1051	73.0	63.0	66.0		2634	-1.3	0.0	1	dbSNP_92	66	2425,4057		1007,411,1823	no	coding-synonymous	CLCA4	NM_012128.3		1285,670,2874	TT,TA,AA		37.4113,25.6612,33.5473		878/920	87045902	3240,6418	1588	3241	4829	SO:0001819	synonymous_variant	22802			AF127035	CCDS41355.1	1p31-p22	2012-02-26	2009-01-29		ENSG00000016602	ENSG00000016602			2018	protein-coding gene	gene with protein product			"""chloride channel, calcium activated, family member 4"", ""chloride channel regulator 4"""			10437792	Standard	NM_012128		Approved	CaCC2	uc009wcs.3	Q14CN2	OTTHUMG00000010260	ENST00000370563.3:c.2634A>T	1.37:g.87045902A>T		Somatic		WXS	Illumina HiSeq	Phase_I	A8MQC9|B7Z1Q5|Q6UX81|Q9UNF7	Silent	SNP	ENST00000370563.3	37	CCDS41355.1																																																																																				0.348	CLCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028292.1	NM_012128	
CEP170	9859	mdanderson.org	37	1	243333027	243333027	+	Silent	SNP	A	A	G	rs200644784		TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr1:243333027A>G	ENST00000366542.1	-	12	1797	c.1746T>C	c.(1744-1746)cgT>cgC	p.R582R	CEP170_ENST00000366544.1_Silent_p.R484R|RP11-261C10.4_ENST00000422938.1_RNA|RP11-261C10.4_ENST00000437499.1_RNA|CEP170_ENST00000366543.1_Silent_p.R484R	NM_014812.2	NP_055627.2	Q5SW79	CE170_HUMAN	centrosomal protein 170kDa	582						centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear membrane (GO:0031965)		p.R582R(3)		NS(1)|breast(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	62	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)			GTGAAACCCAACGTTTGCTTC	0.398																																						.											3	Substitution - coding silent(3)	kidney(3)											103.0	92.0	95.0					1																	243333027		1878	4106	5984	SO:0001819	synonymous_variant	9859			AB022657	CCDS44337.1, CCDS44338.1, CCDS44339.1	1q44	2014-02-20	2006-01-12	2006-01-12	ENSG00000143702	ENSG00000143702			28920	protein-coding gene	gene with protein product	"""KARP 1 binding protein"", ""XRCC5 binding protein"""	613023	"""KIAA0470"""	KIAA0470		15616186	Standard	NM_014812		Approved	KAB, FAM68A	uc021plo.1	Q5SW79	OTTHUMG00000039862	ENST00000366542.1:c.1746T>C	1.37:g.243333027A>G		Somatic		WXS	Illumina HiSeq	Phase_I	O75058|Q5SW77|Q5SW78|Q7LGA9|Q86W31|Q9UQ08|Q9UQ09	Silent	SNP	ENST00000366542.1	37	CCDS44339.1	.	.	.	.	.	.	.	.	.	.	A	9.754	1.168273	0.21621	.	.	ENSG00000143702	ENST00000336415	.	.	.	4.66	-6.75	0.01738	.	.	.	.	.	T	0.46833	0.1413	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51576	-0.8688	4	.	.	.	-8.1159	6.5973	0.22681	0.3246:0.0:0.4436:0.2317	.	.	.	.	A	546	.	.	V	-	2	0	CEP170	241399650	0.846000	0.29590	0.974000	0.42286	0.957000	0.61999	-0.087000	0.11215	-0.781000	0.04548	-0.555000	0.04198	GTT		0.398	CEP170-003	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096178.2	NM_014812	
DCAF4	26094	mdanderson.org	37	14	73422350	73422350	+	Silent	SNP	T	T	G	rs2806034	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr14:73422350T>G	ENST00000358377.2	+	12	1345	c.1125T>G	c.(1123-1125)tcT>tcG	p.S375S	DCAF4_ENST00000553457.1_Silent_p.S275S|DCAF4_ENST00000353777.3_Silent_p.S205S|DCAF4_ENST00000509153.1_Silent_p.S315S|DCAF4_ENST00000555042.1_Silent_p.S369S|DCAF4_ENST00000394234.2_Silent_p.S275S	NM_001163509.1|NM_015604.3	NP_001156981.1|NP_056419.2	Q8WV16	DCAF4_HUMAN	DDB1 and CUL4 associated factor 4	375					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|skin(1)	22						CAGTGACCTCTGTGCGGATCC	0.547													T|||	1046	0.208866	0.1921	0.1527	5008	,	,		19731	0.1518		0.3131	False		,,,				2504	0.2229					.											0								T	,,,,	970,3436	364.9+/-317.2	105,760,1338	215.0	199.0	205.0		1107,1062,1125,825,945	0.5	0.7	14	dbSNP_100	205	2601,5999	420.9+/-353.5	408,1785,2107	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	DCAF4	NM_001163508.1,NM_001163509.1,NM_015604.3,NM_181340.2,NM_181341.2	,,,,	513,2545,3445	GG,GT,TT		30.2442,22.0154,27.4566	,,,,	369/490,354/475,375/496,275/396,315/436	73422350	3571,9435	2203	4300	6503	SO:0001819	synonymous_variant	26094			BC018979	CCDS9809.1, CCDS9810.1, CCDS41968.1, CCDS41968.2, CCDS55926.1	14q24.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000119599		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	20229	protein-coding gene	gene with protein product			"""WD repeat domain 21"", ""WD repeat domain 21A"""	WDR21, WDR21A			Standard	NM_015604		Approved	DKFZp434K114	uc010ttr.2	Q8WV16		ENST00000358377.2:c.1125T>G	14.37:g.73422350T>G		Somatic		WXS	Illumina HiSeq	Phase_I	B4DUT6|G3V522|Q86U31|Q8IV10|Q96K22|Q9Y4P5	Silent	SNP	ENST00000358377.2	37	CCDS9809.1																																																																																				0.547	DCAF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000361058.1	NM_015604	
DISP2	85455	mdanderson.org	37	15	40660192	40660192	+	Silent	SNP	C	C	T	rs8040755	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr15:40660192C>T	ENST00000267889.3	+	8	1966	c.1879C>T	c.(1879-1881)Ctg>Ttg	p.L627L	RP11-64K12.4_ENST00000558421.1_RNA	NM_033510.1	NP_277045.1	A7MBM2	DISP2_HUMAN	dispatched homolog 2 (Drosophila)	627	SSD. {ECO:0000255|PROSITE- ProRule:PRU00199}.				smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(12)|ovary(4)	30		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.39e-06)|Colorectal(105;0.0114)|READ - Rectum adenocarcinoma(2;0.0649)|BRCA - Breast invasive adenocarcinoma(123;0.0798)|Lung(196;0.15)|LUAD - Lung adenocarcinoma(183;0.247)		CACGGCTGTGCTGGTGCACCT	0.746													C|||	218	0.0435304	0.0038	0.1066	5008	,	,		10666	0.0179		0.0984	False		,,,				2504	0.0225					.											0								C		81,4189		0,81,2054	5.0	5.0	5.0		1879	5.6	1.0	15	dbSNP_116	5	887,7489		41,805,3342	no	coding-synonymous	DISP2	NM_033510.1		41,886,5396	TT,TC,CC		10.5898,1.897,7.6546		627/1402	40660192	968,11678	2135	4188	6323	SO:0001819	synonymous_variant	85455			AB051529	CCDS10056.1	15q14	2004-01-15			ENSG00000140323	ENSG00000140323			19712	protein-coding gene	gene with protein product		607503				11214970, 10619433	Standard	NM_033510		Approved	DISPB, KIAA1742, HsT16908	uc001zlk.1	A7MBM2	OTTHUMG00000129983	ENST00000267889.3:c.1879C>T	15.37:g.40660192C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q6AHW3|Q9C0C1	Silent	SNP	ENST00000267889.3	37	CCDS10056.1																																																																																				0.746	DISP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252249.1	NM_033510	
ERG	2078	mdanderson.org	37	21	39795360	39795360	+	Silent	SNP	C	C	T	rs200326224		TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr21:39795360C>T	ENST00000417133.2	-	5	566	c.381G>A	c.(379-381)acG>acA	p.T127T	ERG_ENST00000398897.1_Silent_p.T28T|ERG_ENST00000429727.2_Silent_p.T120T|ERG_ENST00000398919.2_Silent_p.T127T|ERG_ENST00000398907.1_Silent_p.T120T|ERG_ENST00000398910.1_Silent_p.T127T|ERG_ENST00000288319.7_Silent_p.T120T|ERG_ENST00000398905.1_Silent_p.T120T|ERG_ENST00000442448.1_Silent_p.T127T|ERG_ENST00000398911.1_Silent_p.T127T|ERG_ENST00000453032.2_Silent_p.T28T	NM_001136154.1|NM_001243432.1	NP_001129626.1|NP_001230361.1	Q12809	KCNH2_HUMAN	v-ets avian erythroblastosis virus E26 oncogene homolog	145	PAC. {ECO:0000255|PROSITE- ProRule:PRU00141}.				cardiac muscle contraction (GO:0060048)|cellular response to drug (GO:0035690)|membrane depolarization during action potential (GO:0086010)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion export (GO:1902303)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|identical protein binding (GO:0042802)|inward rectifier potassium channel activity (GO:0005242)|phosphorelay sensor kinase activity (GO:0000155)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)		EWSR1/ERG(178)|NDRG1/ERG(5)|TMPRSS2/ERG(3582)|FUS/ERG(167)|SLC45A3/ERG(50)	lung(2)|ovary(1)|skin(1)	4		Prostate(19;3.6e-06)			Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)	TGCGCTCGTTCGTGGTCATGT	0.607			T	"""EWSR1, TMPRSS2, ELF4, FUS, HERPUD1, NDRG1"""	"""Ewing sarcoma, prostate, AML"""								C|||	1	0.000199681	0.0	0.0	5008	,	,		15792	0.0		0.001	False		,,,				2504	0.0				Esophageal Squamous(130;336 1700 3010 3083 40589)	.		Dom	yes		21	21q22.3	2078	v-ets erythroblastosis virus E26 oncogene like (avian)		"""M, E, L"""	0								C	,,,	0,4406		0,0,2203	240.0	155.0	184.0		381,84,381,360	-6.6	0.6	21		184	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	ERG	NM_001136154.1,NM_001136155.1,NM_004449.4,NM_182918.3	,,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,,	127/487,28/388,127/463,120/480	39795360	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	2078				CCDS13657.1, CCDS13658.1, CCDS46648.1, CCDS46649.1, CCDS58789.1	21q22.3	2013-07-09	2013-07-09		ENSG00000157554	ENSG00000157554			3446	protein-coding gene	gene with protein product	"""v-ets avian erythroblastosis virus E26 oncogene related"", ""transcriptional regulator ERG (transforming protein ERG)"", ""v-ets erythroblastosis virus E26 oncogene like"", ""TMPRSS2-ERG prostate cancer specific"""	165080	"""v-ets avian erythroblastosis virus E26 oncogene related"""			3274086	Standard	NM_001136154		Approved	erg-3, p55	uc002yxa.3	P11308	OTTHUMG00000090767	ENST00000417133.2:c.381G>A	21.37:g.39795360C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A5H1P7|C4PFH9|D3DX04|O75418|O75680|Q708S9|Q9BT72|Q9BUT7|Q9H3P0	Silent	SNP	ENST00000417133.2	37	CCDS46648.1																																																																																				0.607	ERG-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207532.2	NM_182918	
GRIN3B	116444	mdanderson.org	37	19	1009585	1009585	+	Missense_Mutation	SNP	C	C	G	rs10401454	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr19:1009585C>G	ENST00000234389.3	+	9	3135	c.3116C>G	c.(3115-3117)cCg>cGg	p.P1039R		NM_138690.1	NP_619635.1	O60391	NMD3B_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3B	1039					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|protein insertion into membrane (GO:0051205)|regulation of calcium ion transport (GO:0051924)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|neurotransmitter receptor activity (GO:0030594)			breast(1)|kidney(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	11		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000226)|all_lung(49;0.000353)|Breast(49;0.00066)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Acamprosate(DB00659)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TCTGGCCGACCGGGGAGCCAG	0.652													-|||	1279	0.255391	0.2859	0.2565	5008	,	,		9642	0.1478		0.3171	False		,,,				2504	0.2607					.											0									ARG/PRO	490,2270		45,400,935	2.0	2.0	2.0		3116	-3.6	0.0	19	dbSNP_119	2	1532,4650		199,1134,1758	yes	missense	GRIN3B	NM_138690.1	103	244,1534,2693	GG,GC,CC		24.7816,17.7536,22.6124	benign	1039/1044	1009585	2022,6920	1380	3091	4471	SO:0001583	missense	116444				CCDS32861.1	19p13.3	2014-05-06			ENSG00000116032	ENSG00000116032		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16768	protein-coding gene	gene with protein product		606651					Standard	XM_003403700		Approved	GluN3B	uc002lqo.1	O60391	OTTHUMG00000181904	ENST00000234389.3:c.3116C>G	19.37:g.1009585C>G	ENSP00000234389:p.Pro1039Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q5EAK7|Q7RTW9	Missense_Mutation	SNP	ENST00000234389.3	37	CCDS32861.1	564	0.25824175824175827	140	0.2845528455284553	104	0.287292817679558	73	0.12762237762237763	247	0.3258575197889182	C	3.647	-0.072382	0.07228	0.177536	0.247816	ENSG00000116032	ENST00000234389	T	0.11063	2.81	3.71	-3.57	0.04612	.	603.621000	0.00817	U	0.001548	T	0.00012	0.0000	N	0.08118	0	0.54753	P	1.6000000000016E-5	B	0.14805	0.011	B	0.04013	0.001	T	0.41787	-0.9489	9	0.07030	T	0.85	.	2.269	0.04086	0.1122:0.3933:0.2254:0.2691	rs10401454;rs58830778	1039	O60391	NMD3B_HUMAN	R	1039	ENSP00000234389:P1039R	ENSP00000234389:P1039R	P	+	2	0	GRIN3B	960585	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.539000	0.00937	-0.787000	0.04510	-2.078000	0.00380	CCG		0.652	GRIN3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103923.2		
HLA-C	3107	mdanderson.org	37	6	31238859	31238859	+	Missense_Mutation	SNP	G	G	C	rs41555616		TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr6:31238859G>C	ENST00000376228.5	-	3	624	c.610C>G	c.(610-612)Cag>Gag	p.Q204E	HLA-C_ENST00000383329.3_Missense_Mutation_p.Q204E	NM_002117.5	NP_002108.4	Q95604	1C17_HUMAN	major histocompatibility complex, class I, C	204	Alpha-2.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	17						CCTGCGCGCTGCAGCGTCTCC	0.657																																						.											0													51.0	44.0	46.0					6																	31238859		2202	4300	6502	SO:0001583	missense	3107			M11886	CCDS34393.1	6p21.3	2014-01-30			ENSG00000204525	ENSG00000204525		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4933	protein-coding gene	gene with protein product		142840	"""psoriasis susceptibility 1"""	HLA-JY3, D6S204, PSORS1		3863816, 16642438	Standard	NM_001243042		Approved		uc003nsy.3	P04222	OTTHUMG00000031154	ENST00000376228.5:c.610C>G	6.37:g.31238859G>C	ENSP00000365402:p.Gln204Glu	Somatic		WXS	Illumina HiSeq	Phase_I	O02864|O02958|Q29643|Q9MY30	Missense_Mutation	SNP	ENST00000376228.5	37	CCDS34393.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	7.911|7.911	0.736528|0.736528	0.15574|0.15574	.|.	.|.	ENSG00000204525|ENSG00000204525	ENST00000415537|ENST00000376228;ENST00000383329;ENST00000396254;ENST00000539307	.|T;T	.|0.00008	.|9.55;9.55	2.55|2.55	1.64|1.64	0.23874|0.23874	.|MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	.|2.663580	.|0.02242	.|U	.|0.065850	T|T	0.00039|0.00039	0.0001|0.0001	L|L	0.50847|0.50847	1.595|1.595	0.24729|0.24729	N|N	0.993107|0.993107	.|B;B;B;B	.|0.02656	.|0.0;0.0;0.0;0.0	.|B;B;B;B	.|0.06405	.|0.001;0.0;0.0;0.002	T|T	0.46428|0.46428	-0.9192|-0.9192	5|10	.|0.72032	.|D	.|0.01	.|.	5.1171|5.1171	0.14840|0.14840	0.0:0.2329:0.529:0.2381|0.0:0.2329:0.529:0.2381	rs41555616|rs41555616	.|204;204;204;204	.|A2AEA4;A6H578;A2AEA2;P10321	.|.;.;.;1C07_HUMAN	G|E	203|204;204;204;241	.|ENSP00000365402:Q204E;ENSP00000372819:Q204E	.|ENSP00000365402:Q204E	A|Q	-|-	2|1	0|0	HLA-C|HLA-C	31346838|31346838	0.867000|0.867000	0.29959|0.29959	0.825000|0.825000	0.32803|0.32803	0.053000|0.053000	0.15095|0.15095	1.230000|1.230000	0.32612|0.32612	0.606000|0.606000	0.29965|0.29965	0.305000|0.305000	0.20034|0.20034	GCA|CAG		0.657	HLA-C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076281.3	NM_002117	
HLA-DRB1	3123	mdanderson.org	37	6	32548534	32548534	+	Missense_Mutation	SNP	C	C	T	rs71547382		TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr6:32548534C>T	ENST00000360004.5	-	4	857	c.752G>A	c.(751-753)aGg>aAg	p.R251K		NM_002124.3	NP_002115.2	Q30167	2B1A_HUMAN	major histocompatibility complex, class II, DR beta 1	251					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)				large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(2)|stomach(1)	10						TTTCTGATTCCTGAAGTAGAT	0.537										Multiple Myeloma(14;0.17)																												.											0																																										SO:0001583	missense	3123			AJ297583	CCDS47409.1	6p21.3	2013-01-11			ENSG00000196126	ENSG00000196126		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4948	protein-coding gene	gene with protein product		142857		HLA-DR1B			Standard	NM_001243965		Approved		uc011eri.2	P01911	OTTHUMG00000031196	ENST00000360004.5:c.752G>A	6.37:g.32548534C>T	ENSP00000353099:p.Arg251Lys	Somatic		WXS	Illumina HiSeq	Phase_I	P01914|Q9MYF5	Missense_Mutation	SNP	ENST00000360004.5	37	CCDS47409.1	.	.	.	.	.	.	.	.	.	.	.	12.57	1.976489	0.34848	.	.	ENSG00000196126	ENST00000360004	T	0.00635	6.06	3.98	1.66	0.24008	.	0.334220	0.32578	N	0.005907	T	0.00241	0.0007	L	0.33710	1.025	0.28819	N	0.897785	B;B;B	0.18166	0.026;0.026;0.0	B;B;B	0.17979	0.02;0.02;0.001	T	0.44757	-0.9307	10	0.38643	T	0.18	.	6.6584	0.23000	0.0:0.6946:0.0:0.3054	.	251;251;251	P04229;Q29974;P01911	2B11_HUMAN;2B1G_HUMAN;2B1F_HUMAN	K	251	ENSP00000353099:R251K	ENSP00000353099:R251K	R	-	2	0	HLA-DRB1	32656512	0.000000	0.05858	0.929000	0.37066	0.845000	0.48019	-0.186000	0.09670	0.802000	0.34089	0.453000	0.30009	AGG		0.537	HLA-DRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076393.3	NM_002124	
MAP1LC3B	81631	mdanderson.org	37	16	87436663	87436663	+	Missense_Mutation	SNP	A	A	G	rs200708875		TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr16:87436663A>G	ENST00000268607.5	+	4	966	c.338A>G	c.(337-339)tAt>tGt	p.Y113C	MAP1LC3B_ENST00000534986.1_Missense_Mutation_p.Y54C|RP11-178L8.3_ENST00000569147.1_RNA	NM_022818.4	NP_073729.1	Q9GZQ8	MLP3B_HUMAN	microtubule-associated protein 1 light chain 3 beta	113					autophagy (GO:0006914)	autophagic vacuole (GO:0005776)|axoneme (GO:0005930)|cytoplasmic vesicle (GO:0031410)|intracellular (GO:0005622)|microtubule (GO:0005874)|organelle membrane (GO:0031090)				endometrium(1)|lung(2)	3				BRCA - Breast invasive adenocarcinoma(80;0.0249)		TACATGGTCTATGCCTCCCAG	0.443																																						.											0													202.0	172.0	182.0					16																	87436663		2198	4300	6498	SO:0001583	missense	81631			AF087871	CCDS10960.1	16q24.2	2014-02-12			ENSG00000140941	ENSG00000140941			13352	protein-coding gene	gene with protein product		609604					Standard	NM_022818		Approved	ATG8F	uc002fjx.3	Q9GZQ8	OTTHUMG00000137654	ENST00000268607.5:c.338A>G	16.37:g.87436663A>G	ENSP00000268607:p.Tyr113Cys	Somatic		WXS	Illumina HiSeq	Phase_I	Q6NW02	Missense_Mutation	SNP	ENST00000268607.5	37	CCDS10960.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.959452	0.74016	.	.	ENSG00000140941	ENST00000268607;ENST00000534986	T;T	0.61274	0.12;0.12	5.47	5.47	0.80525	.	0.000000	0.64402	U	0.000001	T	0.68201	0.2975	M	0.81112	2.525	0.80722	D	1	B	0.30605	0.287	B	0.40329	0.326	T	0.71774	-0.4491	10	0.87932	D	0	.	15.8499	0.78921	1.0:0.0:0.0:0.0	.	113	Q9GZQ8	MLP3B_HUMAN	C	113;54	ENSP00000268607:Y113C;ENSP00000441125:Y54C	ENSP00000268607:Y113C	Y	+	2	0	MAP1LC3B	85994164	1.000000	0.71417	0.114000	0.21550	0.672000	0.39443	9.125000	0.94402	2.199000	0.70637	0.533000	0.62120	TAT		0.443	MAP1LC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269106.1		
MAVS	57506	mdanderson.org;bcgsc.ca	37	20	3838400	3838400	+	Missense_Mutation	SNP	G	G	T	rs11905552|rs34591263	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr20:3838400G>T	ENST00000428216.2	+	3	364	c.236G>T	c.(235-237)tGt>tTt	p.C79F	MAVS_ENST00000416600.2_Intron|MAVS_ENST00000358134.6_Missense_Mutation_p.C79F	NM_020746.4	NP_065797.2	Q7Z434	MAVS_HUMAN	mitochondrial antiviral signaling protein	79			C -> F (in dbSNP:rs11905552).|C -> S (in dbSNP:rs11908032).		activation of innate immune response (GO:0002218)|cellular response to exogenous dsRNA (GO:0071360)|defense response to bacterium (GO:0042742)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|negative regulation of viral genome replication (GO:0045071)|positive regulation of chemokine (C-C motif) ligand 5 production (GO:0071651)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of IP-10 production (GO:0071660)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of peroxisome organization (GO:1900063)|RIG-I signaling pathway (GO:0039529)|signal transduction (GO:0007165)|viral process (GO:0016032)	integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)	CARD domain binding (GO:0050700)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(3)|endometrium(1)|large_intestine(3)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	14						CTGAGGGGCTGTGAGCTAGTT	0.632													G|||	180	0.0359425	0.1301	0.0086	5008	,	,		14916	0.0		0.002	False		,,,				2504	0.0					.											0								G	,PHE/CYS	16,4390		7,2,2194	140.0	112.0	121.0		,236	4.7	1.0	20	dbSNP_120	121	0,8600		0,0,4300	yes	intron,missense	MAVS	NM_001206491.1,NM_020746.4	,205	7,2,6494	TT,TG,GG		0.0,0.3631,0.123	,probably-damaging	,79/541	3838400	16,12990	2203	4300	6503	SO:0001583	missense	57506			DQ174270	CCDS33437.1, CCDS56176.1	20p13	2009-04-02			ENSG00000088888	ENSG00000088888			29233	protein-coding gene	gene with protein product	"""virus-induced signaling adaptor"", ""IFN-B promoter stimulator 1"", ""CARD adaptor inducing IFN-beta"""	609676				16125763, 16153868	Standard	NM_020746		Approved	VISA, KIAA1271, IPS-1, Cardif	uc002wjw.4	Q7Z434	OTTHUMG00000031765	ENST00000428216.2:c.236G>T	20.37:g.3838400G>T	ENSP00000401980:p.Cys79Phe	Somatic		WXS	Illumina HiSeq	Phase_I	A8K6X0|B2BD33|B2BD34|F5H6C8|Q2HWT5|Q3I0Y2|Q5T7I6|Q86VY7|Q9H1H3|Q9H4Y1|Q9H8D3|Q9ULE9	Missense_Mutation	SNP	ENST00000428216.2	37	CCDS33437.1	38	0.0173992673992674	36	0.07317073170731707	2	0.0055248618784530384	0	0.0	0	0.0	G	9.560	1.118096	0.20877	0.003631	0.0	ENSG00000088888	ENST00000428216;ENST00000358134	T;T	0.10960	2.82;2.82	4.67	4.67	0.58626	.	0.000000	0.85682	D	0.000000	T	0.01976	0.0062	L	0.50919	1.6	0.80722	D	1	P;D;D	0.89917	0.617;1.0;1.0	B;D;D	0.91635	0.221;0.999;0.999	T	0.00018	-1.2372	10	0.72032	D	0.01	-14.2787	12.9462	0.58373	0.0:0.0:1.0:0.0	rs11905552;rs11905552	79;79;79	B2BD34;Q7Z434;Q7Z434-2	.;MAVS_HUMAN;.	F	79	ENSP00000401980:C79F;ENSP00000350852:C79F	ENSP00000350852:C79F	C	+	2	0	MAVS	3786400	1.000000	0.71417	0.987000	0.45799	0.051000	0.14879	4.206000	0.58473	2.407000	0.81776	0.609000	0.83330	TGT		0.632	MAVS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077784.3	NM_020746	
FADS1	3992	mdanderson.org	37	11	61582708	61582708	+	5'UTR	SNP	T	T	C	rs174561	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr11:61582708T>C	ENST00000542506.1	-	0	55				FADS2_ENST00000522056.1_5'Flank|FADS2_ENST00000517839.1_5'Flank|FADS1_ENST00000541683.1_5'UTR|FADS1_ENST00000350997.7_Intron|FADS2_ENST00000574708.1_Intron|FADS2_ENST00000257261.6_5'Flank|FADS1_ENST00000433932.1_Intron|MIR1908_ENST00000410394.1_RNA|FADS2_ENST00000522639.1_5'Flank			O60427	FADS1_HUMAN	fatty acid desaturase 1						alpha-linolenic acid metabolic process (GO:0036109)|cell-cell signaling (GO:0007267)|cellular lipid metabolic process (GO:0044255)|cellular response to starvation (GO:0009267)|icosanoid biosynthetic process (GO:0046456)|linoleic acid metabolic process (GO:0043651)|phospholipid biosynthetic process (GO:0008654)|regulation of cell differentiation (GO:0045595)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid biosynthetic process (GO:0006636)|unsaturated fatty acid metabolic process (GO:0033559)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)	C-5 sterol desaturase activity (GO:0000248)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity (GO:0016491)			central_nervous_system(1)|endometrium(1)|lung(1)|urinary_tract(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	GCCGCGGCATTCCCGGCCCCA	0.721													C|||	1400	0.279553	0.0197	0.5677	5008	,	,		14703	0.5466		0.3032	False		,,,				2504	0.1268					.											0													20.0	24.0	23.0					11																	61582708		692	1591	2283	SO:0001623	5_prime_UTR_variant	100302263				CCDS8011.2	11q12-q13.1	2013-01-25			ENSG00000149485	ENSG00000149485	1.14.19.3	"""Fatty acid desaturases"""	3574	protein-coding gene	gene with protein product	"""delta-5 desaturase"""	606148		LLCDL1			Standard	NM_013402		Approved	D5D, FADSD5, TU12, FADS6	uc010rlm.2	O60427	OTTHUMG00000157155	ENST00000542506.1:c.-489A>G	11.37:g.61582708T>C		Somatic		WXS	Illumina HiSeq	Phase_I	A8K0I7|B2RAI0|Q53GM5|Q8N3A6|Q8NCC7|Q8NCG0|Q96I39|Q96SV3|Q96T10|Q9NRP8|Q9NYX1	RNA	SNP	ENST00000542506.1	37																																																																																					0.721	FADS1-012	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000398584.1	NM_013402	
MUC4	4585	mdanderson.org	37	3	195511836	195511836	+	Missense_Mutation	SNP	C	C	G	rs71291865|rs75072939	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr3:195511836C>G	ENST00000463781.3	-	2	7074	c.6615G>C	c.(6613-6615)caG>caC	p.Q2205H	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.Q2205H|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	994					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGGGTGGCCTGACCTGTGG	0.597																																						.											0													30.0	25.0	26.0					3																	195511836		689	1588	2277	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6615G>C	3.37:g.195511836C>G	ENSP00000417498:p.Gln2205His	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	G	2.776	-0.254644	0.05829	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.35973	1.33;1.28	.	.	.	.	.	.	.	.	T	0.13500	0.0327	N	0.08118	0	0.09310	N	0.999999	B	0.14805	0.011	B	0.01281	0.0	T	0.21621	-1.0240	7	.	.	.	.	5.4854	0.16747	1.0E-4:0.3479:0.652:0.0	.	2205	E7ESK3	.	H	2205	ENSP00000417498:Q2205H;ENSP00000420243:Q2205H	.	Q	-	3	2	MUC4	196996231	0.000000	0.05858	0.007000	0.13788	0.003000	0.03518	-1.933000	0.01553	-2.387000	0.00589	-2.332000	0.00249	CAG		0.597	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	mdanderson.org	37	3	195511925	195511925	+	Missense_Mutation	SNP	A	A	G	rs78031084	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr3:195511925A>G	ENST00000463781.3	-	2	6985	c.6526T>C	c.(6526-6528)Tct>Cct	p.S2176P	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.S2176P|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.S2176P(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACAGGAAGAGAGGTGGCGTGA	0.587													.|||	274	0.0547125	0.0189	0.0288	5008	,	,		15474	0.122		0.0805	False		,,,				2504	0.0256					.											1	Substitution - Missense(1)	kidney(1)																																								SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6526T>C	3.37:g.195511925A>G	ENSP00000417498:p.Ser2176Pro	Somatic		WXS	Illumina HiSeq	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	a	3.373	-0.127914	0.06753	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.44881	0.91;0.97	.	.	.	.	.	.	.	.	T	0.12390	0.0301	N	0.02539	-0.55	0.09310	N	0.999998	B	0.19817	0.039	B	0.23018	0.043	T	0.16129	-1.0413	7	.	.	.	.	2.133	0.03754	0.2597:0.0:0.2591:0.4812	.	2176	E7ESK3	.	P	2176	ENSP00000417498:S2176P;ENSP00000420243:S2176P	.	S	-	1	0	MUC4	196996320	0.000000	0.05858	0.001000	0.08648	0.019000	0.09904	-2.972000	0.00667	-2.644000	0.00427	-2.094000	0.00368	TCT		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
NUMBL	9253	mdanderson.org	37	19	41173898	41173898	+	Silent	SNP	T	T	C	rs59088184|rs79747129|rs71173669|rs141662737	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr19:41173898T>C	ENST00000252891.4	-	10	1472	c.1305A>G	c.(1303-1305)caA>caG	p.Q435Q	NUMBL_ENST00000540131.1_Silent_p.Q394Q|NUMBL_ENST00000598779.1_Silent_p.Q394Q	NM_004756.3	NP_004747.1	Q9Y6R0	NUMBL_HUMAN	numb homolog (Drosophila)-like	435	Poly-Gln.				adherens junction organization (GO:0034332)|axonogenesis (GO:0007409)|cytokine-mediated signaling pathway (GO:0019221)|lateral ventricle development (GO:0021670)|nervous system development (GO:0007399)|neuroblast division in subventricular zone (GO:0021849)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of neurogenesis (GO:0050769)|protein metabolic process (GO:0019538)	cytoplasm (GO:0005737)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)	16			Lung(22;0.000393)|LUSC - Lung squamous cell carcinoma(20;0.00105)			gctgctgctgttgctgttgct	0.667																																						.											0													5.0	6.0	6.0					19																	41173898		1943	3908	5851	SO:0001819	synonymous_variant	9253			AF015401	CCDS12561.1	19q13.13-q13.2	2008-07-17	2001-11-28			ENSG00000105245			8061	protein-coding gene	gene with protein product		604018	"""numb (Drosophila) homolog-like"""			9225980, 9303539	Standard	XM_006723471		Approved	NUMB-R, CTG3a, CAG3A, TNRC23, NUMBR, NUMBLIKE	uc002oon.3	Q9Y6R0		ENST00000252891.4:c.1305A>G	19.37:g.41173898T>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q7Z4J9	Silent	SNP	ENST00000252891.4	37	CCDS12561.1																																																																																				0.667	NUMBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462749.2	NM_004756	
PCDHA6	56142	mdanderson.org	37	5	140207965	140207965	+	Missense_Mutation	SNP	G	G	C	rs150162226	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr5:140207965G>C	ENST00000529310.1	+	1	403	c.289G>C	c.(289-291)Ggg>Cgg	p.G97R	PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000527624.1_Missense_Mutation_p.G97R|PCDHA5_ENST00000529859.1_Intron|PCDHA5_ENST00000529619.1_Intron	NM_018909.2|NM_031848.2|NM_031849.1	NP_061732.1|NP_114036.1|NP_114037.1	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6	97	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(42)|prostate(8)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	89			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGAGCTGTGCGGGCGGAGCGC	0.577																																						.											0													111.0	127.0	121.0					5																	140207965		2203	4291	6494	SO:0001583	missense	56142			AF152484	CCDS47281.1, CCDS47282.1	5q31	2010-11-26			ENSG00000081842	ENSG00000081842		"""Cadherins / Protocadherins : Clustered"""	8672	other	complex locus constituent	"""KIAA0345-like 8"""	606312		CNRS2		10380929, 10662547	Standard	NM_018909		Approved	CNR2, CRNR2, PCDH-ALPHA6		Q9UN73	OTTHUMG00000163353	ENST00000529310.1:c.289G>C	5.37:g.140207965G>C	ENSP00000433378:p.Gly97Arg	Somatic		WXS	Illumina HiSeq	Phase_I	O75283|Q9NRT8	Missense_Mutation	SNP	ENST00000529310.1	37	CCDS47281.1	.	.	.	.	.	.	.	.	.	.	G	9.482	1.098477	0.20552	.	.	ENSG00000081842	ENST00000529310;ENST00000527624	T;T	0.30981	1.51;1.51	3.87	3.87	0.44632	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	0.213176	0.22539	U	0.058753	T	0.37945	0.1022	M	0.70595	2.14	0.26008	N	0.98203	D;P;P	0.56287	0.975;0.915;0.791	P;P;P	0.46389	0.515;0.49;0.51	T	0.34625	-0.9821	10	0.51188	T	0.08	.	12.2854	0.54789	0.0:0.1713:0.8287:0.0	.	97;97;97	Q9UN73-3;Q9UN73;Q9UN73-2	.;PCDA6_HUMAN;.	R	97	ENSP00000433378:G97R;ENSP00000434113:G97R	ENSP00000434113:G97R	G	+	1	0	PCDHA6	140188149	0.984000	0.35163	1.000000	0.80357	0.243000	0.25628	5.505000	0.66981	2.139000	0.66308	0.313000	0.20887	GGG		0.577	PCDHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372829.3	NM_018909	
PCMTD1	115294	mdanderson.org	37	8	52733209	52733209	+	Missense_Mutation	SNP	A	A	G	rs202074278		TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr8:52733209A>G	ENST00000360540.5	-	7	1182	c.776T>C	c.(775-777)aTa>aCa	p.I259T	PCMTD1_ENST00000522514.1_Missense_Mutation_p.I259T|PCMTD1_ENST00000544451.1_Missense_Mutation_p.I183T|PCMTD1_ENST00000519559.1_5'UTR	NM_052937.2	NP_443169.2	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1	259						cytoplasm (GO:0005737)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)	p.I259T(1)		NS(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(17)|prostate(2)|skin(8)|soft_tissue(1)	37		Lung NSC(129;0.0795)|all_lung(136;0.144)				CTCATCATTTATGAAATTTCT	0.403																																						.											1	Substitution - Missense(1)	prostate(1)																																								SO:0001583	missense	115294				CCDS6148.1, CCDS69480.1	8q11.23	2010-08-05			ENSG00000168300	ENSG00000168300			30483	protein-coding gene	gene with protein product							Standard	XM_005251146		Approved	FLJ10883	uc003xqx.4	Q96MG8	OTTHUMG00000164246	ENST00000360540.5:c.776T>C	8.37:g.52733209A>G	ENSP00000353739:p.Ile259Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q96FK9	Missense_Mutation	SNP	ENST00000360540.5	37	CCDS6148.1	.	.	.	.	.	.	.	.	.	.	A	14.22	2.469272	0.43839	.	.	ENSG00000168300	ENST00000360540;ENST00000544451;ENST00000522514	T;T;T	0.44881	0.91;0.91;0.91	5.77	5.77	0.91146	.	0.154593	0.64402	D	0.000017	T	0.43055	0.1230	L	0.34521	1.04	0.51482	D	0.999929	B;D;B	0.56287	0.01;0.975;0.009	B;P;B	0.48815	0.005;0.591;0.015	T	0.38628	-0.9652	10	0.59425	D	0.04	-40.7211	16.0858	0.81049	1.0:0.0:0.0:0.0	.	129;183;259	B4E2B4;F5H1M8;Q96MG8	.;.;PCMD1_HUMAN	T	259;183;259	ENSP00000353739:I259T;ENSP00000444026:I183T;ENSP00000428099:I259T	ENSP00000353739:I259T	I	-	2	0	PCMTD1	52895762	1.000000	0.71417	0.991000	0.47740	0.990000	0.78478	6.577000	0.74027	2.198000	0.70561	0.533000	0.62120	ATA		0.403	PCMTD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377909.2	NM_052937	
PCMTD1	115294	mdanderson.org	37	8	52733214	52733214	+	Missense_Mutation	SNP	A	A	C	rs200377849		TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr8:52733214A>C	ENST00000360540.5	-	7	1177	c.771T>G	c.(769-771)aaT>aaG	p.N257K	PCMTD1_ENST00000522514.1_Missense_Mutation_p.N257K|PCMTD1_ENST00000544451.1_Missense_Mutation_p.N181K|PCMTD1_ENST00000519559.1_5'UTR	NM_052937.2	NP_443169.2	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1	257						cytoplasm (GO:0005737)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)	p.N257K(1)		NS(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(17)|prostate(2)|skin(8)|soft_tissue(1)	37		Lung NSC(129;0.0795)|all_lung(136;0.144)				CATTTATGAAATTTCTAAGTG	0.388																																						.											1	Substitution - Missense(1)	skin(1)											78.0	81.0	80.0					8																	52733214		2203	4300	6503	SO:0001583	missense	115294				CCDS6148.1, CCDS69480.1	8q11.23	2010-08-05			ENSG00000168300	ENSG00000168300			30483	protein-coding gene	gene with protein product							Standard	XM_005251146		Approved	FLJ10883	uc003xqx.4	Q96MG8	OTTHUMG00000164246	ENST00000360540.5:c.771T>G	8.37:g.52733214A>C	ENSP00000353739:p.Asn257Lys	Somatic		WXS	Illumina HiSeq	Phase_I	Q96FK9	Missense_Mutation	SNP	ENST00000360540.5	37	CCDS6148.1	.	.	.	.	.	.	.	.	.	.	A	12.61	1.991059	0.35131	.	.	ENSG00000168300	ENST00000360540;ENST00000544451;ENST00000522514	T;T;T	0.47528	0.84;0.84;0.84	5.56	-0.996	0.10218	.	0.046341	0.85682	D	0.000000	T	0.38983	0.1061	N	0.20530	0.585	0.53005	D	0.999961	P;D;B	0.65815	0.651;0.995;0.002	B;P;B	0.60886	0.122;0.88;0.002	T	0.41556	-0.9502	10	0.02654	T	1	-22.28	11.477	0.50304	0.3747:0.0:0.6253:0.0	.	127;181;257	B4E2B4;F5H1M8;Q96MG8	.;.;PCMD1_HUMAN	K	257;181;257	ENSP00000353739:N257K;ENSP00000444026:N181K;ENSP00000428099:N257K	ENSP00000353739:N257K	N	-	3	2	PCMTD1	52895767	1.000000	0.71417	0.997000	0.53966	0.989000	0.77384	3.249000	0.51437	-0.122000	0.11766	-0.250000	0.11733	AAT		0.388	PCMTD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377909.2	NM_052937	
POLN	353497	mdanderson.org	37	4	2175733	2175733	+	Silent	SNP	A	A	G	rs2022302	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr4:2175733A>G	ENST00000511885.2	-	11	1676	c.1323T>C	c.(1321-1323)caT>caC	p.H441H	POLN_ENST00000382865.1_Silent_p.H441H|POLN_ENST00000515357.1_5'UTR			Q7Z5Q5	DPOLN_HUMAN	polymerase (DNA directed) nu	441					double-strand break repair via homologous recombination (GO:0000724)|interstrand cross-link repair (GO:0036297)|translesion synthesis (GO:0019985)	nucleus (GO:0005634)	cyclin binding (GO:0030332)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)			kidney(6)|large_intestine(5)|liver(1)|lung(8)|ovary(2)|skin(4)|urinary_tract(2)	28			OV - Ovarian serous cystadenocarcinoma(23;0.0955)			CCTGAATGGCATGGCTTTCCA	0.418								DNA polymerases (catalytic subunits)					G|||	1612	0.321885	0.5703	0.2435	5008	,	,		24761	0.373		0.1243	False		,,,				2504	0.1922					.											0								G		2221,2185	586.4+/-386.5	581,1059,563	270.0	231.0	244.0		1323	-0.9	0.0	4	dbSNP_94	244	995,7605	773.9+/-407.7	60,875,3365	no	coding-synonymous	POLN	NM_181808.2		641,1934,3928	GG,GA,AA		11.5698,49.5915,24.727		441/901	2175733	3216,9790	2203	4300	6503	SO:0001819	synonymous_variant	353497			AF044578	CCDS3360.1	4p16.3	2012-05-18			ENSG00000130997	ENSG00000130997		"""DNA polymerases"""	18870	protein-coding gene	gene with protein product		610887				12794064	Standard	NM_181808		Approved		uc003ger.2	Q7Z5Q5	OTTHUMG00000090081	ENST00000511885.2:c.1323T>C	4.37:g.2175733A>G		Somatic		WXS	Illumina HiSeq	Phase_I	A2A336|B4E158|Q4TTW4|Q6ZNF4	Silent	SNP	ENST00000511885.2	37	CCDS3360.1	677	0.309981684981685	281	0.5711382113821138	91	0.2513812154696133	210	0.36713286713286714	95	0.12532981530343007	G	0.009	-1.809418	0.00606	0.504085	0.115698	ENSG00000130997	ENST00000511098	.	.	.	4.28	-0.849	0.10723	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.51012	P	9.80000000000425E-5	.	.	.	.	.	.	T	0.46400	-0.9194	3	.	.	.	-3.7462	9.2076	0.37298	0.5601:0.0:0.4399:0.0	rs2022302;rs61574681;rs2022302	.	.	.	T	75	.	.	M	-	2	0	POLN	2145531	0.000000	0.05858	0.007000	0.13788	0.003000	0.03518	-1.618000	0.02049	-0.617000	0.05664	-2.725000	0.00131	ATG		0.418	POLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000205684.2	NM_181808	
POTEC	388468	mdanderson.org	37	18	14542884	14542884	+	Missense_Mutation	SNP	T	T	C	rs201764782		TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr18:14542884T>C	ENST00000358970.5	-	1	261	c.262A>G	c.(262-264)Aac>Gac	p.N88D	POTEC_ENST00000389891.4_5'UTR	NM_001137671.1	NP_001131143.1	B2RU33	POTEC_HUMAN	POTE ankyrin domain family, member C	88										NS(2)|breast(1)|endometrium(9)|kidney(13)|lung(14)|prostate(3)|skin(6)|soft_tissue(1)|urinary_tract(3)	52						ATAAAGGAGTTGTCATGGTCT	0.607																																						.											0													53.0	58.0	56.0					18																	14542884		692	1591	2283	SO:0001583	missense	388468			BX649118	CCDS45835.1	18p11.21	2013-01-10	2008-11-26	2008-11-26	ENSG00000183206	ENSG00000183206		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33894	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 6"""		"""ANKRD26-like family B, member 2"""	A26B2			Standard	NM_001137671		Approved	POTE18, POTE-18, DKFZp686J0529, CT104.6	uc010dln.3	B2RU33	OTTHUMG00000162963	ENST00000358970.5:c.262A>G	18.37:g.14542884T>C	ENSP00000351856:p.Asn88Asp	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000358970.5	37	CCDS45835.1	.	.	.	.	.	.	.	.	.	.	t	0.003	-2.420683	0.00188	.	.	ENSG00000183206	ENST00000358970;ENST00000389891	T	0.22539	1.95	.	.	.	.	.	.	.	.	T	0.03390	0.0098	N	0.00483	-1.445	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.25152	-1.0140	7	0.02654	T	1	.	.	.	.	.	88	B2RU33	POTEC_HUMAN	D	88	ENSP00000351856:N88D	ENSP00000351856:N88D	N	-	1	0	POTEC	14532884	0.000000	0.05858	0.004000	0.12327	0.004000	0.04260	-0.876000	0.04201	-1.345000	0.02214	-1.352000	0.01234	AAC		0.607	POTEC-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371179.1	XM_496269	
PRB1	5542	mdanderson.org	37	12	11508460	11508460	+	Silent	SNP	A	A	G	rs200021729		TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr12:11508460A>G	ENST00000500254.2	-	1	65	c.28T>C	c.(28-30)Ttg>Ctg	p.L10L	PRB1_ENST00000546254.1_Intron|PRB1_ENST00000545626.1_Silent_p.L10L	NM_005039.3|NM_199353.2	NP_005030.2|NP_955385.1	P04280	PRP1_HUMAN	proline-rich protein BstNI subfamily 1	0						extracellular region (GO:0005576)				NS(1)|central_nervous_system(1)|kidney(4)|large_intestine(1)|lung(9)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	20			OV - Ovarian serous cystadenocarcinoma(49;0.185)			AGGGCCAGCAAGGCCACTGAC	0.498																																						.											0													83.0	80.0	81.0					12																	11508460		2177	4276	6453	SO:0001819	synonymous_variant	5542				CCDS8642.1, CCDS55805.1	12p13.2	2012-10-02							9337	protein-coding gene	gene with protein product		180989				8317492	Standard	NM_199353		Approved	PM, PMF, PMS, PRB1M, PRB1L	uc001qzu.1	P04280		ENST00000500254.2:c.28T>C	12.37:g.11508460A>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q08805|Q15186|Q15187|Q15214|Q15215|Q16038	Silent	SNP	ENST00000500254.2	37	CCDS8642.1																																																																																				0.498	PRB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402312.1	NM_005039	
PRB2	653247	mdanderson.org	37	12	11546625	11546625	+	Silent	SNP	A	A	G	rs200564286		TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr12:11546625A>G	ENST00000389362.4	-	3	422	c.387T>C	c.(385-387)ccT>ccC	p.P129P	PRB1_ENST00000546254.1_Intron|PRB2_ENST00000545829.1_5'Flank	NM_006248.3	NP_006239.3	P02812	PRB2_HUMAN	proline-rich protein BstNI subfamily 2	129	15 X 20 AA approximate tandem repeats of P-P-G-K-P-Q-G-P-P-P-Q-G-[GD]-[NKS]-[KSQ]- [PRS]-[QRS] [GPS]-[PSAR]-[PSR].					extracellular region (GO:0005576)				NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(5)|skin(4)|stomach(2)|urinary_tract(1)	37		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			GAGGACCTTGAGGCTGGTTGC	0.602																																						.											0													309.0	287.0	294.0					12																	11546625		2203	4300	6503	SO:0001819	synonymous_variant	653247			K03208	CCDS41757.2	12p13.2	2012-10-02			ENSG00000121335	ENSG00000121335			9338	protein-coding gene	gene with protein product		168810				8554050	Standard	NM_006248		Approved	PRPPRB1, Ps, cP7	uc010shk.1	P02812	OTTHUMG00000156975	ENST00000389362.4:c.387T>C	12.37:g.11546625A>G		Somatic		WXS	Illumina HiSeq	Phase_I	O00599|P02811|P04281	Silent	SNP	ENST00000389362.4	37	CCDS41757.2																																																																																				0.602	PRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346925.2	NM_006248	
PSG4	5672	mdanderson.org	37	19	43709647	43709647	+	Silent	SNP	G	G	A	rs12985206	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr19:43709647G>A	ENST00000405312.3	-	1	279	c.42C>T	c.(40-42)acC>acT	p.T14T	PSG4_ENST00000244295.9_Silent_p.T14T|PSG4_ENST00000433626.2_Silent_p.T14T	NM_002780.3	NP_002771.2	Q00888	PSG4_HUMAN	pregnancy specific beta-1-glycoprotein 4	14					female pregnancy (GO:0007565)	extracellular vesicular exosome (GO:0070062)				central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	24		Prostate(69;0.00682)				CCCCCTTCCAGGTGATGCGCT	0.597													G|||	3276	0.654153	0.6392	0.5274	5008	,	,		13710	0.7966		0.5865	False		,,,				2504	0.6871					.											0													62.0	61.0	61.0					19																	43709647		2186	4271	6457	SO:0001819	synonymous_variant	5672				CCDS33039.1, CCDS46093.1, CCDS62695.1	19q13.2	2013-01-29			ENSG00000243137	ENSG00000243137		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9521	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1-glycoprotein 4"""	176393				2783133	Standard	NM_002780		Approved		uc002ovy.4	Q00888	OTTHUMG00000151544	ENST00000405312.3:c.42C>T	19.37:g.43709647G>A		Somatic		WXS	Illumina HiSeq	Phase_I	E7EX79|Q13047|Q13048|Q15234|Q15240|Q9UQ76	Silent	SNP	ENST00000405312.3	37	CCDS46093.1																																																																																				0.597	PSG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323073.1	NM_213633	
RBBP6	5930	mdanderson.org	37	16	24583715	24583715	+	Silent	SNP	A	A	G	rs148143334	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr16:24583715A>G	ENST00000319715.4	+	18	5760	c.5328A>G	c.(5326-5328)aaA>aaG	p.K1776K	RBBP6_ENST00000381039.3_Silent_p.K936K|RBBP6_ENST00000348022.2_Silent_p.K1742K	NM_006910.4	NP_008841.2	Q7Z6E9	RBBP6_HUMAN	retinoblastoma binding protein 6	1776					embryonic organ development (GO:0048568)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|somite development (GO:0061053)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(1)	46				GBM - Glioblastoma multiforme(48;0.0518)		acaaagataaagagaaggaga	0.318																																						.											0													25.0	24.0	24.0					16																	24583715		1913	3652	5565	SO:0001819	synonymous_variant	5930				CCDS10621.1, CCDS10622.1, CCDS45444.1	16p12.2	2008-08-04	2001-11-28		ENSG00000122257	ENSG00000122257			9889	protein-coding gene	gene with protein product	"""proliferation potential-related protein"""	600938	"""retinoblastoma-binding protein 6"""			8595913, 16396680	Standard	NM_006910		Approved	P2P-R, PACT, SNAMA	uc002dmh.3	Q7Z6E9	OTTHUMG00000096991	ENST00000319715.4:c.5328A>G	16.37:g.24583715A>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q147T5|Q15290|Q6DKH4|Q6P4C2|Q6YNC9|Q7Z6E8|Q8N0V2|Q96PH3|Q9H3I8|Q9H5M5|Q9NPX4	Silent	SNP	ENST00000319715.4	37	CCDS10621.1																																																																																				0.318	RBBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214067.2	NM_006910	
RBMX	27316	mdanderson.org	37	X	135956462	135956462	+	Missense_Mutation	SNP	G	G	C	rs74463481		TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chrX:135956462G>C	ENST00000320676.7	-	9	1169	c.1015C>G	c.(1015-1017)Cgt>Ggt	p.R339G	RBMX_ENST00000565438.1_Missense_Mutation_p.R211G|RBMX_ENST00000562646.1_3'UTR|RBMX_ENST00000496459.2_5'Flank|RBMX_ENST00000431446.3_Intron|RBMX_ENST00000570135.1_Missense_Mutation_p.R204G	NM_002139.3	NP_002130.2	P38159	RBMX_HUMAN	RNA binding motif protein, X-linked	339	Necessary for RNA-binding.				cellular response to interleukin-1 (GO:0071347)|gene expression (GO:0010467)|membrane protein ectodomain proteolysis (GO:0006509)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|osteoblast differentiation (GO:0001649)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homooligomerization (GO:0051260)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|supraspliceosomal complex (GO:0044530)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(2)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|urinary_tract(1)	33	Acute lymphoblastic leukemia(192;0.000127)					ACCCGATCACGACCACTTGAG	0.537																																						.											0																																										SO:0001583	missense	27316				CCDS14661.1, CCDS55510.1	Xq26	2013-05-23	2003-09-12		ENSG00000147274	ENSG00000147274		"""RNA binding motif (RRM) containing"""	9910	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein G"""	300199	"""RNA binding motif protein, X chromosome"""			10391206, 10391207	Standard	NM_002139		Approved	RNMX, hnRNP-G, HNRNPG	uc004fae.2	P38159	OTTHUMG00000022517	ENST00000320676.7:c.1015C>G	X.37:g.135956462G>C	ENSP00000359645:p.Arg339Gly	Somatic		WXS	Illumina HiSeq	Phase_I	B4E3U4|D3DWH0|E9PG86|Q5JQ67|Q8N8Y7|Q969R3	Missense_Mutation	SNP	ENST00000320676.7	37	CCDS14661.1	.	.	.	.	.	.	.	.	.	.	.	12.06	1.824057	0.32237	.	.	ENSG00000147274	ENST00000320676;ENST00000449161	T	0.81247	-1.47	5.4	4.54	0.55810	.	0.000000	0.85682	U	0.000000	T	0.77350	0.4117	L	0.59436	1.845	0.19300	P	0.9999701562	P	0.47034	0.889	B	0.40101	0.319	D	0.84520	0.0627	9	0.72032	D	0.01	.	13.8398	0.63432	0.0758:0.0:0.9242:0.0	.	339	P38159	HNRPG_HUMAN	G	339;326	ENSP00000359645:R339G	ENSP00000359645:R339G	R	-	1	0	RBMX	135784128	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.693000	0.61753	1.168000	0.42723	-0.176000	0.13171	CGT		0.537	RBMX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058507.1	NM_002139	
RBMX	27316	mdanderson.org	37	X	135956467	135956467	+	Missense_Mutation	SNP	C	C	T	rs35899675		TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chrX:135956467C>T	ENST00000320676.7	-	9	1164	c.1010G>A	c.(1009-1011)aGt>aAt	p.S337N	RBMX_ENST00000565438.1_Missense_Mutation_p.S209N|RBMX_ENST00000562646.1_3'UTR|RBMX_ENST00000496459.2_5'Flank|RBMX_ENST00000431446.3_Intron|RBMX_ENST00000570135.1_Missense_Mutation_p.S202N	NM_002139.3	NP_002130.2	P38159	RBMX_HUMAN	RNA binding motif protein, X-linked	337	Necessary for RNA-binding.				cellular response to interleukin-1 (GO:0071347)|gene expression (GO:0010467)|membrane protein ectodomain proteolysis (GO:0006509)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|osteoblast differentiation (GO:0001649)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homooligomerization (GO:0051260)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|supraspliceosomal complex (GO:0044530)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.S337N(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(2)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|urinary_tract(1)	33	Acute lymphoblastic leukemia(192;0.000127)					ATCACGACCACTTGAGTAGAG	0.527																																						.											1	Substitution - Missense(1)	large_intestine(1)											126.0	116.0	119.0					X																	135956467		2203	4300	6503	SO:0001583	missense	27316				CCDS14661.1, CCDS55510.1	Xq26	2013-05-23	2003-09-12		ENSG00000147274	ENSG00000147274		"""RNA binding motif (RRM) containing"""	9910	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein G"""	300199	"""RNA binding motif protein, X chromosome"""			10391206, 10391207	Standard	NM_002139		Approved	RNMX, hnRNP-G, HNRNPG	uc004fae.2	P38159	OTTHUMG00000022517	ENST00000320676.7:c.1010G>A	X.37:g.135956467C>T	ENSP00000359645:p.Ser337Asn	Somatic		WXS	Illumina HiSeq	Phase_I	B4E3U4|D3DWH0|E9PG86|Q5JQ67|Q8N8Y7|Q969R3	Missense_Mutation	SNP	ENST00000320676.7	37	CCDS14661.1	.	.	.	.	.	.	.	.	.	.	.	14.40	2.523817	0.44866	.	.	ENSG00000147274	ENST00000320676;ENST00000449161	T	0.77229	-1.08	5.4	5.4	0.78164	.	0.134440	0.49916	U	0.000121	D	0.83959	0.5367	L	0.43152	1.355	0.23661	P	0.99717437	D	0.57899	0.981	D	0.67900	0.954	D	0.83628	0.0143	9	0.44086	T	0.13	.	18.4308	0.90624	0.0:1.0:0.0:0.0	rs55701431	337	P38159	HNRPG_HUMAN	N	337;324	ENSP00000359645:S337N	ENSP00000359645:S337N	S	-	2	0	RBMX	135784133	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.933000	0.63484	2.380000	0.81148	0.600000	0.82982	AGT		0.527	RBMX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058507.1	NM_002139	
SLC5A10	125206	mdanderson.org	37	17	18918396	18918396	+	Silent	SNP	G	G	C	rs2074279	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr17:18918396G>C	ENST00000395645.3	+	11	1143	c.1125G>C	c.(1123-1125)gcG>gcC	p.A375A	SLC5A10_ENST00000317977.6_Silent_p.A308A|SLC5A10_ENST00000395647.2_Silent_p.A391A|SLC5A10_ENST00000417251.2_Silent_p.A339A|SLC5A10_ENST00000395643.2_Silent_p.A348A|SLC5A10_ENST00000395642.1_Silent_p.A308A	NM_001042450.2	NP_001035915.1	A0PJK1	SC5AA_HUMAN	solute carrier family 5 (sodium/sugar cotransporter), member 10	375					sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(3)|ovary(3)|prostate(3)|skin(3)	24						TGATGCTGGCGGCGCTCATGT	0.677													C|||	997	0.199081	0.3336	0.0663	5008	,	,		12776	0.3413		0.0288	False		,,,				2504	0.1401					.											0								C	,	1209,3197	706.8+/-407.4	151,907,1145	60.0	49.0	53.0		1125,1173	-4.3	0.8	17	dbSNP_96	53	187,8413	810.1+/-407.1	2,183,4115	no	coding-synonymous,coding-synonymous	SLC5A10	NM_001042450.1,NM_152351.3	,	153,1090,5260	CC,CG,GG		2.1744,27.4399,10.7335	,	375/597,391/613	18918396	1396,11610	2203	4300	6503	SO:0001819	synonymous_variant	125206				CCDS11201.2, CCDS42275.1, CCDS59277.1, CCDS59278.1, CCDS74008.1	17p11.2	2013-07-19	2013-07-19		ENSG00000154025	ENSG00000154025		"""Solute carriers"""	23155	protein-coding gene	gene with protein product			"""solute carrier family 5 (sodium/glucose cotransporter), member 10"""				Standard	NM_152351		Approved	SGLT5	uc002gut.2	A0PJK1	OTTHUMG00000178143	ENST00000395645.3:c.1125G>C	17.37:g.18918396G>C		Somatic		WXS	Illumina HiSeq	Phase_I	A8MUC9|B4DPI0|B7WPR4|Q6P5X0|Q8IXM4|Q96LQ1	Silent	SNP	ENST00000395645.3	37	CCDS42275.1																																																																																				0.677	SLC5A10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132129.2	NM_152351	
SLIT2	9353	mdanderson.org	37	4	20535317	20535317	+	Missense_Mutation	SNP	G	G	C			TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr4:20535317G>C	ENST00000504154.1	+	18	2063	c.1811G>C	c.(1810-1812)gGa>gCa	p.G604A	SLIT2_ENST00000503823.1_Missense_Mutation_p.G596A|SLIT2_ENST00000503837.1_Missense_Mutation_p.G600A|SLIT2_ENST00000273739.5_Missense_Mutation_p.G608A	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	604					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)			NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						ATGTTCAAGGGATTGGAAAGC	0.383																																						.											0													159.0	158.0	158.0					4																	20535317		2203	4300	6503	SO:0001583	missense	9353			AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.1811G>C	4.37:g.20535317G>C	ENSP00000422591:p.Gly604Ala	Somatic		WXS	Illumina HiSeq	Phase_I	B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Missense_Mutation	SNP	ENST00000504154.1	37	CCDS3426.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.822940	0.90873	.	.	ENSG00000145147	ENST00000503823;ENST00000504154;ENST00000273739;ENST00000382173;ENST00000503837	T;T;T;T	0.25085	1.82;1.82;1.82;1.82	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	T	0.55146	0.1902	M	0.80982	2.52	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.75020	0.985;0.967	T	0.61912	-0.6965	10	0.87932	D	0	.	18.4759	0.90792	0.0:0.0:1.0:0.0	.	596;604	O94813-3;O94813	.;SLIT2_HUMAN	A	596;604;608;600;600	ENSP00000427548:G596A;ENSP00000422591:G604A;ENSP00000273739:G608A;ENSP00000422261:G600A	ENSP00000273739:G608A	G	+	2	0	SLIT2	20144415	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.745000	0.98856	2.366000	0.80165	0.561000	0.74099	GGA		0.383	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250396.2		
SPAG7	9552	mdanderson.org	37	17	4864114	4864114	+	Silent	SNP	T	T	C	rs61749470	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr17:4864114T>C	ENST00000206020.3	-	2	187	c.120A>G	c.(118-120)caA>caG	p.Q40Q	SPAG7_ENST00000575142.1_Silent_p.Q29Q|SPAG7_ENST00000573366.1_5'UTR	NM_004890.2	NP_004881.2	O75391	SPAG7_HUMAN	sperm associated antigen 7	40						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			central_nervous_system(1)|endometrium(1)|kidney(2)|lung(3)|ovary(2)|urinary_tract(1)	10						GTTGTTTCTCTTGCTCTTGTA	0.478													T|||	103	0.0205671	0.028	0.013	5008	,	,		19443	0.0099		0.0388	False		,,,				2504	0.0082					.											0								T		94,3648		0,94,1777	161.0	155.0	157.0		120	1.7	1.0	17	dbSNP_129	157	279,7943		6,267,3838	no	coding-synonymous	SPAG7	NM_004890.2		6,361,5615	CC,CT,TT		3.3933,2.512,3.1177		40/228	4864114	373,11591	1871	4111	5982	SO:0001819	synonymous_variant	9552			AF047437	CCDS42240.1	17p13.2	2008-07-18				ENSG00000091640			11216	protein-coding gene	gene with protein product		610056				9653160	Standard	NM_004890		Approved	FSA-1, ACRP, MGC20134	uc002gae.3	O75391		ENST00000206020.3:c.120A>G	17.37:g.4864114T>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q96EU5	Silent	SNP	ENST00000206020.3	37	CCDS42240.1																																																																																				0.478	SPAG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438747.1	NM_004890	
TRIM63	84676	mdanderson.org;bcgsc.ca	37	1	26385003	26385003	+	Missense_Mutation	SNP	T	T	C	rs2275950	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr1:26385003T>C	ENST00000374272.3	-	5	847	c.709A>G	c.(709-711)Aaa>Gaa	p.K237E	TRIM63_ENST00000483052.1_5'Flank	NM_032588.3	NP_115977.2	Q969Q1	TRI63_HUMAN	tripartite motif containing 63, E3 ubiquitin protein ligase	237			K -> E (in dbSNP:rs2275950). {ECO:0000269|PubMed:11243782, ECO:0000269|PubMed:15489334}.		cellular response to dexamethasone stimulus (GO:0071549)|muscle contraction (GO:0006936)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of gene expression (GO:0010468)|response to electrical stimulus involved in regulation of muscle adaptation (GO:0014878)|response to interleukin-1 (GO:0070555)|signal transduction (GO:0007165)|skeletal muscle atrophy (GO:0014732)	contractile fiber (GO:0043292)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|titin binding (GO:0031432)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.K237E(1)		kidney(1)|large_intestine(1)|ovary(1)|skin(1)|stomach(1)	5		Colorectal(325;3.46e-05)|Lung NSC(340;0.000154)|all_lung(284;0.00021)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0133)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;9.15e-26)|Colorectal(126;3.16e-08)|COAD - Colon adenocarcinoma(152;1.72e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000767)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)		CTAAGCTTTTTCTCCTGCTCC	0.537													C|||	913	0.182308	0.267	0.1239	5008	,	,		20137	0.1706		0.2187	False		,,,				2504	0.0838					.											1	Substitution - Missense(1)	stomach(1)						C	GLU/LYS	1195,3211	710.2+/-407.8	175,845,1183	177.0	161.0	166.0		709	5.5	1.0	1	dbSNP_100	166	1862,6738	729.6+/-406.7	197,1468,2635	yes	missense	TRIM63	NM_032588.2	56	372,2313,3818	CC,CT,TT		21.6512,27.1221,23.5045	benign	237/354	26385003	3057,9949	2203	4300	6503	SO:0001583	missense	84676			AF353673	CCDS273.1	1p34-p33	2014-09-17	2012-02-23	2004-11-17	ENSG00000158022	ENSG00000158022		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	16007	protein-coding gene	gene with protein product	"""muscle-specific RING finger protein 1"", ""iris ring finger protein"", ""striated muscle RING zinc finger protein"""	606131	"""ring finger protein 28"", ""tripartite motif-containing 63"", ""tripartite motif containing 63"""	RNF28		11243782, 11283016	Standard	NM_032588		Approved	MURF-1, IRF, SMRZ	uc001bli.2	Q969Q1	OTTHUMG00000007510	ENST00000374272.3:c.709A>G	1.37:g.26385003T>C	ENSP00000363390:p.Lys237Glu	Somatic		WXS	Illumina HiSeq	Phase_I	B4DN95|Q5T2I1|Q96BD3|Q96KD9|Q9BYV4	Missense_Mutation	SNP	ENST00000374272.3	37	CCDS273.1	434	0.1987179487179487	127	0.258130081300813	43	0.11878453038674033	100	0.17482517482517482	164	0.21635883905013192	C	7.836	0.720876	0.15372	0.271221	0.216512	ENSG00000158022	ENST00000374272	T	0.40756	1.02	5.5	5.5	0.81552	.	0.198167	0.52532	N	0.000069	T	0.00012	0.0000	N	0.00043	-2.47	0.48830	P	2.889999999999837E-4	B	0.02656	0.0	B	0.01281	0.0	T	0.33954	-0.9848	9	0.02654	T	1	.	14.2207	0.65826	0.0:0.9273:0.0:0.0727	rs2275950;rs52817885;rs60345068;rs2275950	237	Q969Q1	TRI63_HUMAN	E	237	ENSP00000363390:K237E	ENSP00000363390:K237E	K	-	1	0	TRIM63	26257590	0.957000	0.32711	1.000000	0.80357	0.788000	0.44548	2.222000	0.42926	1.336000	0.45506	-0.215000	0.12644	AAA		0.537	TRIM63-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019750.1	NM_032588	
URI1	8725	mdanderson.org	37	19	30500143	30500143	+	Silent	SNP	T	T	C	rs1127493	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr19:30500143T>C	ENST00000542441.2	+	8	1215	c.918T>C	c.(916-918)gaT>gaC	p.D306D	URI1_ENST00000360605.4_Silent_p.D288D|URI1_ENST00000392271.1_Silent_p.D230D|URI1_ENST00000312051.6_Silent_p.D266D			O94763	RMP_HUMAN	URI1, prefoldin-like chaperone	306	Poly-Asp.				cellular response to growth factor stimulus (GO:0071363)|cellular response to steroid hormone stimulus (GO:0071383)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of phosphatase activity (GO:0010923)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein folding (GO:0006457)|regulation of cell growth (GO:0001558)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to virus (GO:0009615)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, core complex (GO:0005665)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|prefoldin complex (GO:0016272)	chromatin binding (GO:0003682)|protein phosphatase inhibitor activity (GO:0004864)|RNA polymerase II transcription corepressor activity (GO:0001106)										atgatgatgatgacgacgacg	0.403													t|||	18	0.00359425	0.0091	0.0014	5008	,	,		19444	0.0		0.005	False		,,,				2504	0.0					.											0													110.0	87.0	95.0					19																	30500143		2203	4300	6503	SO:0001819	synonymous_variant	8725			AF091095	CCDS12420.1, CCDS58658.1	19q12	2012-04-17	2011-11-21	2011-11-21	ENSG00000105176	ENSG00000105176		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	13236	protein-coding gene	gene with protein product	"""unconventional prefoldin RPB5 interactor"", ""RPB5-mediating protein"", ""protein phosphatase 1, regulatory subunit 19"""	603494	"""chromosome 19 open reading frame 2"""	C19orf2		9878255, 9819440	Standard	NM_003796		Approved	RMP, NNX3, FLJ10575, URI, PPP1R19	uc002nsr.3	O94763		ENST00000542441.2:c.918T>C	19.37:g.30500143T>C		Somatic		WXS	Illumina HiSeq	Phase_I	A8K805|H7BY42|Q8TC23|Q9UNU3	Silent	SNP	ENST00000542441.2	37	CCDS12420.1																																																																																				0.403	URI1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439756.1	NM_134447	
S100A7A	338324	bcgsc.ca	37	1	153391729	153391729	+	Missense_Mutation	SNP	G	G	A	rs3006414	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr1:153391729G>A	ENST00000368729.4	+	3	307	c.250G>A	c.(250-252)Gca>Aca	p.A84T	S100A7A_ENST00000368728.2_Missense_Mutation_p.A84T|S100A7A_ENST00000329256.2_Missense_Mutation_p.A84T	NM_176823.3	NP_789793.1	Q86SG5	S1A7A_HUMAN	S100 calcium binding protein A7A	84	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.		A -> T (in dbSNP:rs3006414).			cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|protein self-association (GO:0043621)	p.A84T(1)		cervix(1)|endometrium(3)|kidney(1)|lung(3)|prostate(1)|skin(2)|stomach(1)	12	all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.171)			AGACATAGCCGCAGACTACCA	0.527													a|||	1047	0.209065	0.4766	0.1686	5008	,	,		16030	0.1379		0.0835	False		,,,				2504	0.0787					.											1	Substitution - Missense(1)	stomach(1)						A	THR/ALA	1893,2513		408,1077,718	81.0	76.0	78.0		250	-2.9	0.0	1	dbSNP_101	78	765,7835		32,701,3567	no	missense	S100A7A	NM_176823.3	58	440,1778,4285	AA,AG,GG		8.8953,42.9641,20.4367	benign	84/102	153391729	2658,10348	2203	4300	6503	SO:0001583	missense	338324			AY189118	CCDS30872.1	1q22	2013-01-10	2006-09-11	2006-09-11	ENSG00000184330	ENSG00000184330		"""S100 calcium binding proteins"", ""EF-hand domain containing"""	21657	protein-coding gene	gene with protein product			"""S100 calcium binding protein A15"", ""S100 calcium binding protein A7-like 1"""	S100A15, S100A7L1		11230159	Standard	NM_176823		Approved	S100A7f	uc001fbt.1	Q86SG5	OTTHUMG00000013122	ENST00000368729.4:c.250G>A	1.37:g.153391729G>A	ENSP00000357718:p.Ala84Thr	Somatic		WXS	Illumina HiSeq	Phase_I	D3DV38|Q5SY69	Missense_Mutation	SNP	ENST00000368729.4	37	CCDS30872.1	436	0.19963369963369965	229	0.4654471544715447	55	0.15193370165745856	85	0.1486013986013986	67	0.08839050131926121	.	0.009	-1.820264	0.00595	0.429641	0.088953	ENSG00000184330	ENST00000368729;ENST00000368728;ENST00000329256	T;T;T	0.06142	3.34;3.34;3.34	1.7	-2.9	0.05648	EF-hand-like domain (1);	.	.	.	.	T	0.00328	0.0010	N	0.00289	-1.7	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.37798	-0.9690	8	0.09843	T	0.71	.	3.6925	0.08351	0.2976:0.0:0.4869:0.2155	rs3006414;rs57686181;rs3006414	84	Q86SG5	S1A7A_HUMAN	T	84	ENSP00000357718:A84T;ENSP00000357717:A84T;ENSP00000329008:A84T	ENSP00000329008:A84T	A	+	1	0	S100A7A	151658353	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.964000	0.01512	-1.503000	0.01812	-2.435000	0.00213	GCA		0.527	S100A7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036786.2	NM_176823	
RHBG	57127	bcgsc.ca	37	1	156351699	156351699	+	Missense_Mutation	SNP	G	G	A	rs3748569	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr1:156351699G>A	ENST00000368249.1	+	6	981	c.943G>A	c.(943-945)Ggg>Agg	p.G315R	RHBG_ENST00000537040.1_Missense_Mutation_p.G153R|RHBG_ENST00000255013.3_Missense_Mutation_p.G246R|RHBG_ENST00000368246.2_Missense_Mutation_p.G315R|RHBG_ENST00000451864.2_Intron|RHBG_ENST00000400992.2_Missense_Mutation_p.G283R	NM_001256396.1|NM_020407.4	NP_001243325.1|NP_065140.3	Q9H310	RHBG_HUMAN	Rh family, B glycoprotein (gene/pseudogene)	315			G -> R (in dbSNP:rs3748569). {ECO:0000269|PubMed:15489334}.		ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|transepithelial ammonium transport (GO:0070634)|transmembrane transport (GO:0055085)	anchored component of plasma membrane (GO:0046658)|basolateral plasma membrane (GO:0016323)|cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|spectrin-associated cytoskeleton (GO:0014731)	ammonium transmembrane transporter activity (GO:0008519)|ankyrin binding (GO:0030506)			endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(3)|skin(2)|stomach(1)|urinary_tract(1)	22	Hepatocellular(266;0.158)					CTTCTTGGCTGGGACTGTCTC	0.572													G|||	2728	0.544728	0.5719	0.6037	5008	,	,		18935	0.7014		0.4095	False		,,,				2504	0.4438					.											0								G	ARG/GLY	2175,1959		576,1023,468	95.0	106.0	103.0		943	4.4	1.0	1	dbSNP_107	103	3575,4831		782,2011,1410	yes	missense	RHBG	NM_020407.3	125	1358,3034,1878	AA,AG,GG		42.5291,47.3875,45.8533	probably-damaging	315/459	156351699	5750,6790	2067	4203	6270	SO:0001583	missense	57127			AF193807		1q22	2013-05-22	2009-01-22		ENSG00000132677	ENSG00000132677		"""Solute carriers"""	14572	protein-coding gene	gene with protein product		607079	"""Rhesus blood group, B glycoprotein"""			10852913	Standard	NM_020407		Approved	SLC42A2	uc010pho.3	Q9H310	OTTHUMG00000024057	ENST00000368249.1:c.943G>A	1.37:g.156351699G>A	ENSP00000357232:p.Gly315Arg	Somatic		WXS	Illumina HiSeq	Phase_I	A8K475|Q5SZW4|Q5SZW6|Q5SZW7|Q6P193|Q6YJI2|Q6YJI3	Missense_Mutation	SNP	ENST00000368249.1	37		1209	0.5535714285714286	287	0.5833333333333334	208	0.574585635359116	403	0.7045454545454546	311	0.4102902374670185	G	26.5	4.744673	0.89663	0.526125	0.425291	ENSG00000132677	ENST00000368249;ENST00000368246;ENST00000537040;ENST00000400992;ENST00000255013	T;T;T;T;T	0.38722	1.12;1.12;1.12;1.12;1.12	4.44	4.44	0.53790	Ammonium transporter AmtB-like (3);	0.049574	0.85682	D	0.000000	T	0.67325	0.2881	M	0.93763	3.455	0.09310	P	1.0	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.97110	0.986;0.998;1.0;0.999	T	0.77643	-0.2511	9	0.72032	D	0.01	-1.7511	14.5902	0.68359	0.0:0.0:1.0:0.0	rs3748569;rs17855953;rs52807244;rs58877861;rs3748569	315;153;283;352	Q9H310;F5GWZ4;Q9H310-3;Q5SZW5	RHBG_HUMAN;.;.;.	R	315;315;153;283;246	ENSP00000357232:G315R;ENSP00000357229:G315R;ENSP00000441197:G153R;ENSP00000383777:G283R;ENSP00000255013:G246R	ENSP00000255013:G246R	G	+	1	0	RHBG	154618323	1.000000	0.71417	0.957000	0.39632	0.996000	0.88848	7.438000	0.80431	2.286000	0.76751	0.561000	0.74099	GGG		0.572	RHBG-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000060589.2	NM_001256395	
DNHD1	144132	bcgsc.ca	37	11	6524072	6524072	+	Missense_Mutation	SNP	A	A	C	rs11605196	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr11:6524072A>C	ENST00000527990.2	+	2	836	c.836A>C	c.(835-837)cAg>cCg	p.Q279P	DNHD1_ENST00000354685.3_Missense_Mutation_p.Q279P|DNHD1_ENST00000254579.6_Missense_Mutation_p.Q279P			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	279			Q -> P (in dbSNP:rs11605196).		microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		CTGGATAGCCAGGTGATGACT	0.502													A|||	499	0.0996406	0.0408	0.147	5008	,	,		20522	0.0169		0.1789	False		,,,				2504	0.1493					.											0								A	PRO/GLN,PRO/GLN	277,4125	155.2+/-188.4	10,257,1934	122.0	102.0	109.0		836,836	4.5	0.0	11	dbSNP_120	109	1636,6956	302.2+/-305.8	165,1306,2825	yes	missense,missense	DNHD1	NM_144666.2,NM_173589.3	76,76	175,1563,4759	CC,CA,AA		19.041,6.2926,14.7222	benign,benign	279/4754,279/598	6524072	1913,11081	2201	4296	6497	SO:0001583	missense	144132			AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.836A>C	11.37:g.6524072A>C	ENSP00000436180:p.Gln279Pro	Somatic		WXS	Illumina HiSeq	Phase_I	Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Missense_Mutation	SNP	ENST00000527990.2	37	CCDS44532.1	224	0.10256410256410256	26	0.052845528455284556	46	0.1270718232044199	11	0.019230769230769232	141	0.18601583113456466	A	11.40	1.627054	0.28978	0.062926	0.19041	ENSG00000179532	ENST00000254579;ENST00000354685;ENST00000527990	T;T;T	0.27890	1.64;2.65;1.64	5.64	4.52	0.55395	.	0.540708	0.18166	N	0.149607	T	0.00039	0.0001	L	0.40543	1.245	0.80722	P	0.0	P;B	0.44578	0.838;0.004	B;B	0.41813	0.367;0.004	T	0.18178	-1.0345	9	0.28530	T	0.3	.	8.2343	0.31616	0.9095:0.0:0.0905:0.0	rs11605196;rs52824639;rs11605196	279;279	Q96M86;Q96M86-4	DNHD1_HUMAN;.	P	279	ENSP00000254579:Q279P;ENSP00000346716:Q279P;ENSP00000436180:Q279P	ENSP00000254579:Q279P	Q	+	2	0	DNHD1	6480648	0.000000	0.05858	0.019000	0.16419	0.032000	0.12392	0.115000	0.15540	0.971000	0.38288	0.460000	0.39030	CAG		0.502	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384673.2	NM_144666	
ERH	2079	bcgsc.ca	37	14	69861593	69861593	+	Missense_Mutation	SNP	G	G	T			TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr14:69861593G>T	ENST00000557016.1	-	2	433	c.40C>A	c.(40-42)Cca>Aca	p.P14T	ERH_ENST00000216520.6_Intron|ERH_ENST00000555373.1_Missense_Mutation_p.P14T	NM_004450.2	NP_004441.1	P84090	ERH_HUMAN	enhancer of rudimentary homolog (Drosophila)	14					cell cycle (GO:0007049)|nucleobase-containing compound metabolic process (GO:0006139)|osteoblast differentiation (GO:0001649)|pyrimidine nucleoside metabolic process (GO:0006213)	membrane (GO:0016020)|midbody (GO:0030496)	poly(A) RNA binding (GO:0044822)								all cancers(60;0.00365)|BRCA - Breast invasive adenocarcinoma(234;0.0137)|OV - Ovarian serous cystadenocarcinoma(108;0.0507)		CTGCCTTCTGGCCTCTTGGTA	0.373																																						.											0													102.0	91.0	95.0					14																	69861593		2203	4300	6503	SO:0001583	missense	2079			BC014301	CCDS9794.1	14q24.1	2011-05-18	2001-11-28		ENSG00000100632	ENSG00000100632			3447	protein-coding gene	gene with protein product		601191	"""enhancer of rudimentary (Drosophila) homolog"""			8786099, 9074495	Standard	NM_004450		Approved	DROER	uc001xlc.2	P84090		ENST00000557016.1:c.40C>A	14.37:g.69861593G>T	ENSP00000451080:p.Pro14Thr	Somatic		WXS	Illumina HiSeq	Phase_I	B2R5H2|P70659|Q14259	Missense_Mutation	SNP	ENST00000557016.1	37	CCDS9794.1	.	.	.	.	.	.	.	.	.	.	G	17.75	3.466046	0.63625	.	.	ENSG00000100632	ENST00000557016;ENST00000555373	.	.	.	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.74650	0.3744	M	0.75615	2.305	0.80722	D	1	B	0.27997	0.197	B	0.42319	0.383	T	0.68674	-0.5346	9	0.13108	T	0.6	.	19.6765	0.95936	0.0:0.0:1.0:0.0	.	14	P84090	ERH_HUMAN	T	14	.	ENSP00000216520:P14T	P	-	1	0	ERH	68931346	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	9.768000	0.98965	2.644000	0.89710	0.655000	0.94253	CCA		0.373	ERH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412990.1	NM_004450	
XAF1	54739	bcgsc.ca	37	17	6663894	6663894	+	Missense_Mutation	SNP	G	G	A	rs386794960|rs2271232	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr17:6663894G>A	ENST00000361842.3	+	4	634	c.395G>A	c.(394-396)cGc>cAc	p.R132H	XAF1_ENST00000346752.4_Missense_Mutation_p.R113H|XAF1_ENST00000441631.1_Missense_Mutation_p.R132H|XAF1_ENST00000438512.1_Missense_Mutation_p.R132H	NM_017523.3	NP_059993.2	Q6GPH4	XAF1_HUMAN	XIAP associated factor 1	132			R -> H (in dbSNP:rs2271232).	R -> Q (in Ref. 3; BAF85537). {ECO:0000305}.	apoptotic process (GO:0006915)|cytokine-mediated signaling pathway (GO:0019221)|negative regulation of protein complex assembly (GO:0031333)|response to interferon-beta (GO:0035456)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			large_intestine(2)|lung(2)|prostate(1)|urinary_tract(1)	6						GATGTCTGTCGCAGTGAACAG	0.592													G|||	670	0.133786	0.2481	0.072	5008	,	,		17101	0.1855		0.0398	False		,,,				2504	0.0665					.											0													51.0	50.0	50.0					17																	6663894		2203	4300	6503	SO:0001583	missense	54739			X99699	CCDS11080.1, CCDS11081.1	17p13.2	2010-03-19			ENSG00000132530	ENSG00000132530			30932	protein-coding gene	gene with protein product		606717				12029096, 11175744	Standard	NM_199139		Approved	BIRC4BP, XIAPAF1, HSXIAPAF1	uc002gdn.3	Q6GPH4		ENST00000361842.3:c.395G>A	17.37:g.6663894G>A	ENSP00000354822:p.Arg132His	Somatic		WXS	Illumina HiSeq	Phase_I	A2T931|A2T932|A8K2L1|A8K9Y3|D3DTM6|Q6MZE8|Q8N557|Q99982	Missense_Mutation	SNP	ENST00000361842.3	37	CCDS11080.1	220	0.10073260073260074	98	0.1991869918699187	17	0.04696132596685083	76	0.13286713286713286	29	0.03825857519788918	G	14.62	2.589297	0.46214	.	.	ENSG00000132530	ENST00000361842;ENST00000441631;ENST00000346752;ENST00000438512	T;T;T;T	0.29397	1.57;1.57;1.57;1.57	3.77	-4.73	0.03259	.	1.042900	0.07588	N	0.921505	T	0.00012	0.0000	N	0.14661	0.345	0.80722	P	0.0	D;D;P;D	0.62365	0.991;0.974;0.956;0.963	P;B;B;B	0.47430	0.547;0.4;0.2;0.301	T	0.05099	-1.0906	9	0.38643	T	0.18	-0.2545	5.9149	0.19050	0.297:0.0:0.5538:0.1493	rs2271232	132;113;132;72	C9J7Z8;Q6GPH4-2;Q6GPH4;B3KPW1	.;.;XAF1_HUMAN;.	H	132;132;113;132	ENSP00000354822:R132H;ENSP00000413199:R132H;ENSP00000341029:R113H;ENSP00000406233:R132H	ENSP00000341029:R113H	R	+	2	0	XAF1	6604618	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-1.822000	0.01711	-0.958000	0.03622	0.455000	0.32223	CGC		0.592	XAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439643.5	NM_017523	
MYH4	4622	bcgsc.ca	37	17	10348354	10348354	+	Missense_Mutation	SNP	T	T	C	rs2277649	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr17:10348354T>C	ENST00000255381.2	-	37	5515	c.5405A>G	c.(5404-5406)gAt>gGt	p.D1802G	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	1802			D -> G (in dbSNP:rs2277649). {ECO:0000269|PubMed:10388558}.		actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						CTCAGCCTCATCCAGACGGAG	0.567													T|||	2278	0.454872	0.233	0.4755	5008	,	,		18937	0.8214		0.3181	False		,,,				2504	0.5031					.											0								T	GLY/ASP	1137,3269	405.8+/-333.6	141,855,1207	143.0	140.0	141.0		5405	5.5	0.9	17	dbSNP_100	141	3050,5550	469.9+/-367.7	536,1978,1786	no	missense	MYH4	NM_017533.2	94	677,2833,2993	CC,CT,TT		35.4651,25.8057,32.1928	possibly-damaging	1802/1940	10348354	4187,8819	2203	4300	6503	SO:0001583	missense	4622				CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.5405A>G	17.37:g.10348354T>C	ENSP00000255381:p.Asp1802Gly	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000255381.2	37	CCDS11154.1	979	0.4482600732600733	106	0.21544715447154472	162	0.44751381215469616	473	0.8269230769230769	238	0.31398416886543534	T	19.34	3.809062	0.70797	0.258057	0.354651	ENSG00000141048	ENST00000255381	T	0.78481	-1.18	5.5	5.5	0.81552	Myosin tail (1);	0.000000	0.38605	U	0.001638	T	0.00012	0.0000	H	0.95079	3.62	0.09310	P	0.999999246958	D	0.63880	0.993	D	0.70487	0.969	T	0.47761	-0.9092	9	0.87932	D	0	.	15.8867	0.79255	0.0:0.0:0.0:1.0	rs2277649;rs61532457;rs2277649	1802	Q9Y623	MYH4_HUMAN	G	1802	ENSP00000255381:D1802G	ENSP00000255381:D1802G	D	-	2	0	MYH4	10289079	1.000000	0.71417	0.938000	0.37757	0.170000	0.22686	6.257000	0.72480	2.214000	0.71695	0.482000	0.46254	GAT		0.567	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252731.1	NM_017533	
LRRC48	83450	bcgsc.ca	37	17	17896205	17896205	+	Missense_Mutation	SNP	C	C	T	rs4584886	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr17:17896205C>T	ENST00000399187.1	+	6	789	c.571C>T	c.(571-573)Cgg>Tgg	p.R191W	LRRC48_ENST00000399182.1_Missense_Mutation_p.R191W|LRRC48_ENST00000584166.1_Missense_Mutation_p.R191W|LRRC48_ENST00000411504.2_Missense_Mutation_p.R191W|LRRC48_ENST00000313838.8_Missense_Mutation_p.R191W	NM_031294.3	NP_112584.3	Q9H069	LRC48_HUMAN	leucine rich repeat containing 48	191	LRRCT.		R -> W (in dbSNP:rs4584886). {ECO:0000269|PubMed:15489334}.			cytoplasm (GO:0005737)				breast(1)|large_intestine(2)|lung(2)|pancreas(1)|urinary_tract(1)	7	all_neural(463;0.228)					CCTGGACTACCGGCGCATTGA	0.542													C|||	2915	0.582069	0.4153	0.5187	5008	,	,		20965	0.8641		0.3748	False		,,,				2504	0.7751					.											0								C	TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG	1688,2530		355,978,776	93.0	93.0	93.0		571,571,571,571	3.0	1.0	17	dbSNP_111	93	2759,5693		452,1855,1919	yes	missense,missense,missense,missense	LRRC48	NM_001130090.1,NM_001130091.1,NM_001130092.1,NM_031294.3	101,101,101,101	807,2833,2695	TT,TC,CC		32.6432,40.019,35.0987	probably-damaging,probably-damaging,probably-damaging,probably-damaging	191/524,191/458,191/458,191/524	17896205	4447,8223	2109	4226	6335	SO:0001583	missense	83450			AK093317	CCDS45622.1, CCDS45623.1	17p11.2	2014-07-18			ENSG00000171962	ENSG00000171962			25384	protein-coding gene	gene with protein product						11997338, 23354437	Standard	NM_001130090		Approved	DKFZP586M1120	uc021trk.1	Q9H069	OTTHUMG00000059355	ENST00000399187.1:c.571C>T	17.37:g.17896205C>T	ENSP00000382140:p.Arg191Trp	Somatic		WXS	Illumina HiSeq	Phase_I	A8KAE6|Q86SF9|Q86W73|Q8IWG0	Missense_Mutation	SNP	ENST00000399187.1	37	CCDS45622.1	1170	0.5357142857142857	220	0.44715447154471544	167	0.4613259668508287	503	0.8793706293706294	280	0.36939313984168864	C	18.50	3.637604	0.67130	0.40019	0.326432	ENSG00000171962	ENST00000313838;ENST00000448396;ENST00000411504;ENST00000399184;ENST00000399187;ENST00000399182;ENST00000399185	T;T;T;T	0.55760	0.5;0.5;0.5;0.5	5.22	3.04	0.35103	.	0.200569	0.51477	D	0.000091	T	0.00012	0.0000	M	0.86740	2.835	0.09310	P	0.999999999725949	D;D	0.89917	1.0;1.0	D;D	0.74674	0.964;0.984	T	0.11916	-1.0568	9	0.72032	D	0.01	-17.5	12.1487	0.54038	0.4277:0.5723:0.0:0.0	rs4584886;rs17854522;rs17859520;rs59823215;rs4584886	191;191	Q9H069;Q9H069-2	LRC48_HUMAN;.	W	191	ENSP00000326870:R191W;ENSP00000394020:R191W;ENSP00000382140:R191W;ENSP00000382136:R191W	ENSP00000326870:R191W	R	+	1	2	LRRC48	17836930	1.000000	0.71417	0.986000	0.45419	0.690000	0.40134	3.333000	0.52090	1.156000	0.42514	0.655000	0.94253	CGG		0.542	LRRC48-001	KNOWN	non_canonical_conserved|non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131945.3	NM_031294	
EVPL	2125	bcgsc.ca	37	17	74006474	74006474	+	Nonsense_Mutation	SNP	G	G	A	rs151046085		TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr17:74006474G>A	ENST00000301607.3	-	22	3065	c.2812C>T	c.(2812-2814)Cag>Tag	p.Q938*	EVPL_ENST00000586740.1_Nonsense_Mutation_p.Q960*	NM_001988.2	NP_001979.2	Q92817	EVPL_HUMAN	envoplakin	938	Central fibrous rod domain.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cell junction (GO:0030054)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(4)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	54						TGGCTCCTCTGCGCCTCCAGC	0.662																																						.											0								G	stop/GLN	2,4404	2.1+/-5.4	0,2,2201	39.0	40.0	40.0		2812	4.8	1.0	17	dbSNP_134	40	0,8600		0,0,4300	yes	stop-gained	EVPL	NM_001988.2		0,2,6501	AA,AG,GG		0.0,0.0454,0.0154		938/2034	74006474	2,13004	2203	4300	6503	SO:0001587	stop_gained	2125			U53786	CCDS11737.1	17q25	2008-07-18				ENSG00000167880			3503	protein-coding gene	gene with protein product		601590				8938451, 10409435	Standard	NM_001988		Approved	EVPK	uc002jqi.2	Q92817		ENST00000301607.3:c.2812C>T	17.37:g.74006474G>A	ENSP00000301607:p.Gln938*	Somatic		WXS	Illumina HiSeq	Phase_I	A0AUV5	Nonsense_Mutation	SNP	ENST00000301607.3	37	CCDS11737.1	.	.	.	.	.	.	.	.	.	.	G	37	6.602199	0.97697	4.54E-4	0.0	ENSG00000167880	ENST00000301607	.	.	.	4.85	4.85	0.62838	.	0.342375	0.31589	N	0.007395	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	-31.8895	13.3284	0.60473	0.0:0.0:0.842:0.158	.	.	.	.	X	938	.	ENSP00000301607:Q938X	Q	-	1	0	EVPL	71518069	1.000000	0.71417	0.978000	0.43139	0.142000	0.21351	3.745000	0.55119	2.397000	0.81536	0.561000	0.74099	CAG		0.662	EVPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449483.1	NM_001988	
P4HB	5034	bcgsc.ca	37	17	79801891	79801892	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	AC	AC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr17:79801891_79801892delAC	ENST00000331483.4	-	11	1745_1746	c.1523_1524delGT	c.(1522-1524)cgtfs	p.R508fs	RP11-498C9.2_ENST00000576784.1_RNA|P4HB_ENST00000439918.2_Frame_Shift_Del_p.R464fs|P4HB_ENST00000472244.1_5'Flank|P4HB_ENST00000576390.1_Intron	NM_000918.3	NP_000909.2	P07237	PDIA1_HUMAN	prolyl 4-hydroxylase, beta polypeptide	508					cell redox homeostasis (GO:0045454)|cellular response to hypoxia (GO:0071456)|extracellular matrix organization (GO:0030198)|lipoprotein metabolic process (GO:0042157)|peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)|protein folding (GO:0006457)|regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902175)|response to endoplasmic reticulum stress (GO:0034976)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|procollagen-proline 4-dioxygenase complex (GO:0016222)	poly(A) RNA binding (GO:0044822)|procollagen-proline 4-dioxygenase activity (GO:0004656)|protein disulfide isomerase activity (GO:0003756)			NS(1)|breast(1)|large_intestine(2)|lung(17)|urinary_tract(1)	22	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0509)			TTGCGTATTACAGTTCATCTTT	0.609																																					Colon(49;444 983 1296 7887 42561)	.											0																																										SO:0001589	frameshift_variant	5034			J02783	CCDS11787.1	17q25	2011-10-19	2008-12-09		ENSG00000185624	ENSG00000185624	1.14.11.2, 5.3.4.1	"""Protein disulfide isomerases"""	8548	protein-coding gene	gene with protein product	"""protein disulfide isomerase-associated 1"", ""protein disulfide isomerase family A, member 1"", ""collagen prolyl 4-hydroxylase beta"""	176790	"""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), beta polypeptide (protein disulfide isomerase; thyroid hormone binding protein p55)"", ""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), beta polypeptide (protein disulfide isomerase-associated 1)"", ""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), beta polypeptide"""	PO4DB, ERBA2L		8111381	Standard	NM_000918		Approved	PDIA1, PROHB, DSI, GIT, PDI, PO4HB, P4Hbeta	uc002kbn.1	P07237	OTTHUMG00000150269	ENST00000331483.4:c.1523_1524delGT	17.37:g.79801891_79801892delAC	ENSP00000327801:p.Arg508fs	Somatic		WXS	Illumina HiSeq	Phase_I	B2RDQ2|P30037|P32079|Q15205|Q6LDE5	Frame_Shift_Del	DEL	ENST00000331483.4	37	CCDS11787.1																																																																																				0.609	P4HB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317250.3	NM_000918	
ZNF577	84765	bcgsc.ca	37	19	52375849	52375849	+	Missense_Mutation	SNP	T	T	A			TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr19:52375849T>A	ENST00000301399.5	-	7	1759	c.1394A>T	c.(1393-1395)gAa>gTa	p.E465V	ZNF577_ENST00000485702.1_Intron|ZNF577_ENST00000420592.1_Missense_Mutation_p.E406V|ZNF577_ENST00000451628.2_Missense_Mutation_p.E406V|ZNF577_ENST00000412216.1_Intron	NM_032679.2	NP_116068.2	Q9BSK1	ZN577_HUMAN	zinc finger protein 577	465					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	21		all_neural(266;0.0602)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.019)		CACATTCACTTCATTTGTGAG	0.348																																						.											0													59.0	56.0	57.0					19																	52375849		2203	4300	6503	SO:0001583	missense	84765			AL832871	CCDS12842.2, CCDS46160.1	19q13.41	2013-09-20			ENSG00000161551	ENSG00000161551		"""Zinc fingers, C2H2-type"", ""-"""	28673	protein-coding gene	gene with protein product						12477932	Standard	NM_032679		Approved	MGC4400	uc010yde.2	Q9BSK1	OTTHUMG00000157045	ENST00000301399.5:c.1394A>T	19.37:g.52375849T>A	ENSP00000301399:p.Glu465Val	Somatic		WXS	Illumina HiSeq	Phase_I	A8K0B4|A8K6Z7|C9JFB9	Missense_Mutation	SNP	ENST00000301399.5	37	CCDS12842.2	.	.	.	.	.	.	.	.	.	.	.	1.312	-0.601860	0.03744	.	.	ENSG00000161551	ENST00000301399;ENST00000420592;ENST00000451628;ENST00000458390	T;T;T;T	0.07114	3.22;3.27;3.27;3.22	3.04	-3.78	0.04333	.	.	.	.	.	T	0.04952	0.0133	N	0.22421	0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.39522	-0.9610	9	0.87932	D	0	.	4.5645	0.12177	0.5822:0.0:0.2307:0.1871	.	465;406	Q9BSK1;Q9BSK1-2	ZN577_HUMAN;.	V	465;406;406;465	ENSP00000301399:E465V;ENSP00000413476:E406V;ENSP00000389652:E406V;ENSP00000404509:E465V	ENSP00000301399:E465V	E	-	2	0	ZNF577	57067661	0.000000	0.05858	0.023000	0.16930	0.157000	0.22087	-1.374000	0.02566	-0.952000	0.03649	-0.336000	0.08194	GAA		0.348	ZNF577-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347243.1	NM_032679	
ATL2	64225	bcgsc.ca	37	2	38525660	38525660	+	Missense_Mutation	SNP	C	C	G	rs7582826	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr2:38525660C>G	ENST00000378954.4	-	12	1259	c.1258G>C	c.(1258-1260)Gat>Cat	p.D420H	ATL2_ENST00000332337.4_Missense_Mutation_p.D402H|ATL2_ENST00000406122.1_Missense_Mutation_p.D249H|ATL2_ENST00000402054.1_Missense_Mutation_p.D249H|ATL2_ENST00000539122.1_Missense_Mutation_p.D249H|ATL2_ENST00000419554.2_Missense_Mutation_p.D420H|ATL2_ENST00000452935.2_Missense_Mutation_p.D402H|ATL2_ENST00000546051.1_Missense_Mutation_p.D249H	NM_001135673.1|NM_022374.2	NP_001129145.1|NP_071769.2	Q8NHH9	ATLA2_HUMAN	atlastin GTPase 2	420			D -> H (in dbSNP:rs7582826).		endoplasmic reticulum organization (GO:0007029)|Golgi organization (GO:0007030)|GTP catabolic process (GO:0006184)|protein homooligomerization (GO:0051260)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	22						TCCTTGAGATCCAAGTGTTTT	0.418													C|||	335	0.066893	0.2428	0.0159	5008	,	,		20456	0.0		0.003	False		,,,				2504	0.0					.											0								C	HIS/ASP,HIS/ASP	866,3540	338.9+/-305.5	83,700,1420	127.0	125.0	126.0		1258,1258	3.6	1.0	2	dbSNP_116	126	4,8596	3.7+/-12.6	0,4,4296	yes	missense,missense	ATL2	NM_001135673.1,NM_022374.2	81,81	83,704,5716	GG,GC,CC		0.0465,19.655,6.6892	benign,benign	420/584,420/580	38525660	870,12136	2203	4300	6503	SO:0001583	missense	64225				CCDS1795.1, CCDS46260.1	2p22.3	2008-09-17	2008-09-17	2008-09-17	ENSG00000119787	ENSG00000119787			24047	protein-coding gene	gene with protein product		609368	"""ADP-ribosylation factor-like 6 interacting protein 2"""	ARL6IP2		10508919, 18270207	Standard	NM_022374		Approved		uc002rqq.3	Q8NHH9	OTTHUMG00000102074	ENST00000378954.4:c.1258G>C	2.37:g.38525660C>G	ENSP00000368237:p.Asp420His	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z1X2|B7Z7X8|Q4ZG30|Q7Z630|Q8NHH8|Q9H5M7	Missense_Mutation	SNP	ENST00000378954.4	37	CCDS46260.1	138	0.06318681318681318	130	0.26422764227642276	7	0.019337016574585635	0	0.0	1	0.0013192612137203166	C	13.53	2.264129	0.39995	0.19655	4.65E-4	ENSG00000119787	ENST00000378954;ENST00000406122;ENST00000402054;ENST00000539122;ENST00000332337;ENST00000419554;ENST00000452935;ENST00000546051	T;T;T;T;T;T;T;T	0.02258	4.37;4.37;4.37;4.37;4.37;4.37;4.37;4.37	5.51	3.6	0.41247	Guanylate-binding protein, C-terminal (3);	0.187724	0.56097	D	0.000028	T	0.00012	0.0000	N	0.02011	-0.69	0.19575	P	0.999962805	P;B;B;B;B	0.43633	0.813;0.0;0.002;0.0;0.001	P;B;B;B;B	0.51055	0.657;0.02;0.012;0.007;0.012	T	0.60347	-0.7281	9	0.40728	T	0.16	-14.0153	10.4882	0.44735	0.0:0.7938:0.1332:0.0731	rs7582826;rs52809531;rs7582826	249;402;402;420;420	B5MCN0;B7Z7X8;Q8NHH9-4;Q8NHH9-2;Q8NHH9	.;.;.;.;ATLA2_HUMAN	H	420;249;249;249;402;420;402;249	ENSP00000368237:D420H;ENSP00000385446:D249H;ENSP00000384062:D249H;ENSP00000446192:D249H;ENSP00000333393:D402H;ENSP00000415336:D420H;ENSP00000390743:D402H;ENSP00000438938:D249H	ENSP00000333393:D402H	D	-	1	0	ATL2	38379164	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.578000	0.46051	1.463000	0.47967	0.591000	0.81541	GAT		0.418	ATL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219886.2	NM_022374	
CLEC4F	165530	bcgsc.ca	37	2	71043461	71043461	+	Missense_Mutation	SNP	C	C	T	rs722896	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr2:71043461C>T	ENST00000272367.2	-	4	1128	c.1052G>A	c.(1051-1053)cGt>cAt	p.R351H	CLEC4F_ENST00000426626.1_Missense_Mutation_p.R351H	NM_001258027.1|NM_173535.2	NP_001244956.1|NP_775806.2	Q8N1N0	CLC4F_HUMAN	C-type lectin domain family 4, member F	351			R -> H (in dbSNP:rs722896).		endocytosis (GO:0006897)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			endometrium(1)|large_intestine(5)|lung(18)|ovary(5)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)	37						CTGGTCCAGACGGCCATTTGC	0.403													C|||	1693	0.338059	0.1195	0.4006	5008	,	,		21626	0.5248		0.3101	False		,,,				2504	0.4254				Colon(107;10 2157 6841 26035)	.											0								C	HIS/ARG	739,3667	303.5+/-288.0	60,619,1524	86.0	83.0	84.0		1052	-5.1	0.0	2	dbSNP_86	84	2597,6003	421.6+/-353.8	431,1735,2134	yes	missense	CLEC4F	NM_173535.2	29	491,2354,3658	TT,TC,CC		30.1977,16.7726,25.6497	benign	351/590	71043461	3336,9670	2203	4300	6503	SO:0001583	missense	165530			AK096429	CCDS1910.1	2p13.3	2008-02-05	2005-02-09	2005-02-11	ENSG00000152672	ENSG00000152672		"""C-type lectin domain containing"""	25357	protein-coding gene	gene with protein product			"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 13"""	CLECSF13		8889548, 1846367	Standard	NM_001258027		Approved	FLJ39110, KCLR	uc002shf.3	Q8N1N0	OTTHUMG00000129713	ENST00000272367.2:c.1052G>A	2.37:g.71043461C>T	ENSP00000272367:p.Arg351His	Somatic		WXS	Illumina HiSeq	Phase_I	A4QPA5	Missense_Mutation	SNP	ENST00000272367.2	37	CCDS1910.1	753	0.3447802197802198	58	0.11788617886178862	124	0.3425414364640884	343	0.5996503496503497	228	0.3007915567282322	C	7.700	0.692882	0.15039	0.167726	0.301977	ENSG00000152672	ENST00000272367;ENST00000426626	D;D	0.82893	-1.66;-1.66	3.79	-5.05	0.02955	.	1.546170	0.04013	N	0.298500	T	0.00012	0.0000	N	0.04355	-0.22	0.80722	P	0.0	B;B	0.12630	0.002;0.006	B;B	0.04013	0.001;0.001	T	0.16600	-1.0397	9	0.13470	T	0.59	.	11.5395	0.50659	0.0:0.2236:0.0:0.7764	rs722896;rs59663124;rs722896	351;351	B7ZMM1;Q8N1N0	.;CLC4F_HUMAN	H	351	ENSP00000272367:R351H;ENSP00000390581:R351H	ENSP00000272367:R351H	R	-	2	0	CLEC4F	70896969	0.000000	0.05858	0.000000	0.03702	0.779000	0.44077	-1.034000	0.03567	-1.226000	0.02574	0.467000	0.42956	CGT		0.403	CLEC4F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251922.1	NM_173535	
GPD2	2820	bcgsc.ca	37	2	157406249	157406249	+	Missense_Mutation	SNP	G	G	A	rs2116665	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr2:157406249G>A	ENST00000310454.6	+	7	1163	c.791G>A	c.(790-792)cGt>cAt	p.R264H	GPD2_ENST00000409674.1_Missense_Mutation_p.R264H|GPD2_ENST00000438166.2_Missense_Mutation_p.R264H|GPD2_ENST00000540309.1_Missense_Mutation_p.R264H|GPD2_ENST00000409125.4_Missense_Mutation_p.R37H	NM_001083112.2	NP_001076581.2	P43304	GPDM_HUMAN	glycerol-3-phosphate dehydrogenase 2 (mitochondrial)	264			R -> H (in dbSNP:rs2116665). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:7821823, ECO:0000269|PubMed:8549872, ECO:0000269|PubMed:8682323, ECO:0000269|PubMed:9110174, ECO:0000269|Ref.4, ECO:0000269|Ref.6, ECO:0000269|Ref.8}.		camera-type eye development (GO:0043010)|cellular lipid metabolic process (GO:0044255)|gluconeogenesis (GO:0006094)|glycerol catabolic process (GO:0019563)|glycerol-3-phosphate metabolic process (GO:0006072)|multicellular organism growth (GO:0035264)|small molecule metabolic process (GO:0044281)	glycerol-3-phosphate dehydrogenase complex (GO:0009331)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|glycerol-3-phosphate dehydrogenase activity (GO:0004368)|sn-glycerol-3-phosphate:ubiquinone-8 oxidoreductase activity (GO:0052591)	p.R264H(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(1)|stomach(1)	22						GGGAAAGTGCGTGTGAGCGGC	0.522													G|||	3295	0.657947	0.4849	0.7032	5008	,	,		19139	0.7847		0.6889	False		,,,				2504	0.6973					.											1	Substitution - Missense(1)	stomach(1)	GRCh37	CM012769	GPD2	M	rs2116665	G	HIS/ARG,HIS/ARG	2093,2313	572.1+/-383.2	503,1087,613	66.0	63.0	64.0		791,791	3.2	0.0	2	dbSNP_96	64	6102,2498	694.7+/-404.8	2144,1814,342	yes	missense,missense	GPD2	NM_000408.4,NM_001083112.2	29,29	2647,2901,955	AA,AG,GG		29.0465,47.5034,36.9906	possibly-damaging,possibly-damaging	264/728,264/728	157406249	8195,4811	2203	4300	6503	SO:0001583	missense	2820				CCDS2202.1	2q24.1	2013-01-10			ENSG00000115159	ENSG00000115159	1.1.1.8	"""EF-hand domain containing"""	4456	protein-coding gene	gene with protein product		138430					Standard	NM_001083112		Approved		uc002tzd.4	P43304	OTTHUMG00000131951	ENST00000310454.6:c.791G>A	2.37:g.157406249G>A	ENSP00000308610:p.Arg264His	Somatic		WXS	Illumina HiSeq	Phase_I	A8K4V0|B3KSA9|Q59FR1|Q9HAP9	Missense_Mutation	SNP	ENST00000310454.6	37	CCDS2202.1	1431	0.6552197802197802	228	0.4634146341463415	241	0.6657458563535912	441	0.7709790209790209	521	0.6873350923482849	G	7.674	0.687659	0.14973	0.475034	0.709535	ENSG00000115159	ENST00000310454;ENST00000409125;ENST00000438166;ENST00000540309;ENST00000409674	T;T;T;T;T	0.67523	-0.27;-0.27;-0.27;-0.27;-0.27	5.91	3.17	0.36434	FAD dependent oxidoreductase (1);	0.321794	0.38436	N	0.001700	T	0.00012	0.0000	L	0.51422	1.61	0.29245	P	0.872348	B	0.17038	0.02	B	0.15484	0.013	T	0.34800	-0.9814	9	0.51188	T	0.08	.	10.1454	0.42760	0.2664:0.0:0.7336:0.0	rs2116665;rs2228475;rs17847134;rs17858516;rs2116665	264	P43304	GPDM_HUMAN	H	264;37;264;264;264	ENSP00000308610:R264H;ENSP00000386484:R37H;ENSP00000409708:R264H;ENSP00000440892:R264H;ENSP00000386425:R264H	ENSP00000308610:R264H	R	+	2	0	GPD2	157114495	0.930000	0.31532	0.004000	0.12327	0.333000	0.28666	1.958000	0.40402	0.412000	0.25729	0.650000	0.86243	CGT		0.522	GPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254910.3		
PPIG	9360	bcgsc.ca	37	2	170493677	170493677	+	Missense_Mutation	SNP	C	C	G	rs78054206	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr2:170493677C>G	ENST00000260970.3	+	14	2129	c.1909C>G	c.(1909-1911)Caa>Gaa	p.Q637E	PPIG_ENST00000448752.2_Missense_Mutation_p.Q637E|PPIG_ENST00000409714.3_Missense_Mutation_p.Q622E	NM_004792.2	NP_004783.2	Q13427	PPIG_HUMAN	peptidylprolyl isomerase G (cyclophilin G)	637	Arg/Ser-rich (RS domain).				protein folding (GO:0006457)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(17)|ovary(2)|stomach(1)|urinary_tract(1)	43					L-Proline(DB00172)	AGAAGAAAGTCAAAGCAGAAA	0.423													C|||	53	0.0105831	0.0378	0.0043	5008	,	,		19841	0.0		0.0	False		,,,				2504	0.0					.											0								C	GLU/GLN	127,4279	91.6+/-130.3	1,125,2077	69.0	70.0	70.0		1909	4.7	1.0	2	dbSNP_132	70	3,8597	3.0+/-9.4	0,3,4297	yes	missense	PPIG	NM_004792.2	29	1,128,6374	GG,GC,CC		0.0349,2.8824,0.9995	benign	637/755	170493677	130,12876	2203	4300	6503	SO:0001583	missense	9360			X99717	CCDS2235.1	2q31.1	2010-07-23	2006-01-12		ENSG00000138398	ENSG00000138398	6.1.1.16		14650	protein-coding gene	gene with protein product	"""SR-related CTD-associated factor 10"""	606093	"""peptidyl-prolyl isomerase G (cyclophilin G)"""			8973360, 9153302	Standard	NM_004792		Approved	CARS-Cyp, SRCyp, SCAF10	uc002uez.3	Q13427	OTTHUMG00000132206	ENST00000260970.3:c.1909C>G	2.37:g.170493677C>G	ENSP00000260970:p.Gln637Glu	Somatic		WXS	Illumina HiSeq	Phase_I	D3DPC5|D3DPC6|O00706|Q53R40|Q53SN4|Q96DG9	Missense_Mutation	SNP	ENST00000260970.3	37	CCDS2235.1	34	0.015567765567765568	32	0.06504065040650407	2	0.0055248618784530384	0	0.0	0	0.0	C	13.29	2.192937	0.38707	0.028824	3.49E-4	ENSG00000138398	ENST00000260970;ENST00000409714;ENST00000448752	T;T;T	0.15834	2.39;2.39;2.39	5.6	4.73	0.59995	.	0.054301	0.85682	D	0.000000	T	0.01029	0.0034	L	0.27053	0.805	0.33842	D	0.631606	B;B;B	0.22800	0.075;0.075;0.075	B;B;B	0.19946	0.027;0.027;0.027	T	0.04115	-1.0976	10	0.87932	D	0	-24.8159	16.0895	0.81082	0.1352:0.8648:0.0:0.0	rs62652316	622;622;637	E9PG73;Q2NKQ6;Q13427	.;.;PPIG_HUMAN	E	637;622;637	ENSP00000260970:Q637E;ENSP00000386245:Q622E;ENSP00000407083:Q637E	ENSP00000260970:Q637E	Q	+	1	0	PPIG	170201923	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	4.558000	0.60789	1.376000	0.46267	-0.189000	0.12847	CAA		0.423	PPIG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255264.2		
C2orf88	84281	bcgsc.ca	37	2	191064753	191064753	+	Missense_Mutation	SNP	C	C	T	rs6753459	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr2:191064753C>T	ENST00000340623.4	+	2	578	c.167C>T	c.(166-168)aCt>aTt	p.T56I	C2orf88_ENST00000396974.2_Missense_Mutation_p.T56I|C2orf88_ENST00000443551.2_Missense_Mutation_p.T56I|C2orf88_ENST00000409870.1_Missense_Mutation_p.T56I	NM_001042519.1|NM_001042520.1|NM_001042521.1|NM_032321.2	NP_001035984.1|NP_001035985.1|NP_001035986.1|NP_115697.2	Q9BSF0	SMAKA_HUMAN	chromosome 2 open reading frame 88	56	PKA-RI-binding.		T -> I (in dbSNP:rs6753459). {ECO:0000269|PubMed:15489334}.			plasma membrane (GO:0005886)				kidney(1)|large_intestine(1)|lung(1)	3						GGGACCAATACTGTGATCTTG	0.458													T|||	1771	0.353634	0.5008	0.2752	5008	,	,		21385	0.4355		0.2435	False		,,,				2504	0.2393					.											0								T	ILE/THR,ILE/THR,ILE/THR,ILE/THR	1769,2189		415,939,625	189.0	191.0	191.0		167,167,167,167	-3.0	0.0	2	dbSNP_116	191	1970,6336		227,1516,2410	yes	missense,missense,missense,missense	C2orf88	NM_001042519.1,NM_001042520.1,NM_001042521.1,NM_032321.2	89,89,89,89	642,2455,3035	TT,TC,CC		23.7178,44.6943,30.4876	benign,benign,benign,benign	56/96,56/96,56/96,56/96	191064753	3739,8525	1979	4153	6132	SO:0001583	missense	84281			BC005083	CCDS42792.1	2q32.2	2014-02-12	2009-04-08		ENSG00000187699	ENSG00000187699			28191	protein-coding gene	gene with protein product	"""small membrane AKAP"""	615117				23996002	Standard	NM_032321		Approved	MGC13057, smAKAP	uc002urt.3	Q9BSF0	OTTHUMG00000154361	ENST00000340623.4:c.167C>T	2.37:g.191064753C>T	ENSP00000345107:p.Thr56Ile	Somatic		WXS	Illumina HiSeq	Phase_I	D3DPI3|P0C876|Q53TC7	Missense_Mutation	SNP	ENST00000340623.4	37	CCDS42792.1	810	0.3708791208791209	246	0.5	103	0.2845303867403315	276	0.4825174825174825	185	0.24406332453825857	T	6.053	0.378138	0.11466	0.446943	0.237178	ENSG00000187699	ENST00000396974;ENST00000409545;ENST00000409870;ENST00000340623;ENST00000443551	T;T;T;T;T	0.46819	0.86;0.86;0.86;0.86;0.86	5.31	-3.0	0.05480	.	1.022090	0.07888	N	0.970707	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.04013	0.001	T	0.47711	-0.9096	7	.	.	.	0.2971	8.7611	0.34676	0.0:0.5139:0.114:0.3721	rs6753459;rs17845041;rs17857815;rs56561086;rs61523734;rs6753459	56	Q9BSF0	CB088_HUMAN	I	56	ENSP00000380172:T56I;ENSP00000386976:T56I;ENSP00000386649:T56I;ENSP00000345107:T56I;ENSP00000405225:T56I	.	T	+	2	0	C2orf88	190772998	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.449000	0.02392	-0.951000	0.03654	-2.280000	0.00272	ACT		0.458	C2orf88-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334954.1	NM_032321	
MAVS	57506	bcgsc.ca	37	20	3838399	3838399	+	Missense_Mutation	SNP	T	T	A	rs11908032|rs34591263	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr20:3838399T>A	ENST00000428216.2	+	3	363	c.235T>A	c.(235-237)Tgt>Agt	p.C79S	MAVS_ENST00000416600.2_Intron|MAVS_ENST00000358134.6_Missense_Mutation_p.C79S	NM_020746.4	NP_065797.2	Q7Z434	MAVS_HUMAN	mitochondrial antiviral signaling protein	79			C -> F (in dbSNP:rs11905552).|C -> S (in dbSNP:rs11908032).		activation of innate immune response (GO:0002218)|cellular response to exogenous dsRNA (GO:0071360)|defense response to bacterium (GO:0042742)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|negative regulation of viral genome replication (GO:0045071)|positive regulation of chemokine (C-C motif) ligand 5 production (GO:0071651)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of IP-10 production (GO:0071660)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of peroxisome organization (GO:1900063)|RIG-I signaling pathway (GO:0039529)|signal transduction (GO:0007165)|viral process (GO:0016032)	integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)	CARD domain binding (GO:0050700)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(3)|endometrium(1)|large_intestine(3)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	14						ACTGAGGGGCTGTGAGCTAGT	0.632													T|||	180	0.0359425	0.1301	0.0086	5008	,	,		14935	0.0		0.002	False		,,,				2504	0.0					.											0								T	,SER/CYS	26,4380		10,6,2187	139.0	112.0	121.0		,235	4.7	0.9	20	dbSNP_120	121	0,8600		0,0,4300	yes	intron,missense	MAVS	NM_001206491.1,NM_020746.4	,112	10,6,6487	AA,AT,TT		0.0,0.5901,0.1999	,probably-damaging	,79/541	3838399	26,12980	2203	4300	6503	SO:0001583	missense	57506			DQ174270	CCDS33437.1, CCDS56176.1	20p13	2009-04-02			ENSG00000088888	ENSG00000088888			29233	protein-coding gene	gene with protein product	"""virus-induced signaling adaptor"", ""IFN-B promoter stimulator 1"", ""CARD adaptor inducing IFN-beta"""	609676				16125763, 16153868	Standard	NM_020746		Approved	VISA, KIAA1271, IPS-1, Cardif	uc002wjw.4	Q7Z434	OTTHUMG00000031765	ENST00000428216.2:c.235T>A	20.37:g.3838399T>A	ENSP00000401980:p.Cys79Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A8K6X0|B2BD33|B2BD34|F5H6C8|Q2HWT5|Q3I0Y2|Q5T7I6|Q86VY7|Q9H1H3|Q9H4Y1|Q9H8D3|Q9ULE9	Missense_Mutation	SNP	ENST00000428216.2	37	CCDS33437.1	38	0.0173992673992674	36	0.07317073170731707	2	0.0055248618784530384	0	0.0	0	0.0	T	10.77	1.442585	0.25987	0.005901	0.0	ENSG00000088888	ENST00000428216;ENST00000358134	T;T	0.09538	2.97;2.97	4.67	4.67	0.58626	.	0.000000	0.85682	D	0.000000	T	0.02083	0.0065	M	0.63428	1.95	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.955;0.998;0.998	T	0.00032	-1.2277	10	0.51188	T	0.08	-14.2787	10.4331	0.44419	0.0:0.0:0.0:1.0	rs11908032	79;79;79	B2BD34;Q7Z434;Q7Z434-2	.;MAVS_HUMAN;.	S	79	ENSP00000401980:C79S;ENSP00000350852:C79S	ENSP00000350852:C79S	C	+	1	0	MAVS	3786399	0.993000	0.37304	0.915000	0.36163	0.035000	0.12851	3.409000	0.52657	1.950000	0.56595	0.496000	0.49642	TGT		0.632	MAVS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077784.3	NM_020746	
SRMS	6725	bcgsc.ca	37	20	62173561	62173561	+	Missense_Mutation	SNP	C	C	G	rs310657	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr20:62173561C>G	ENST00000217188.1	-	5	941	c.901G>C	c.(901-903)Gtc>Ctc	p.V301L		NM_080823.2	NP_543013.1	Q9H3Y6	SRMS_HUMAN	src-related kinase lacking C-terminal regulatory tyrosine and N-terminal myristylation sites	301	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		V -> L (in dbSNP:rs310657). {ECO:0000269|PubMed:17344846}.		peptidyl-tyrosine autophosphorylation (GO:0038083)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(9)|prostate(2)|stomach(1)	19	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;9.69e-09)|all cancers(9;5.84e-08)|BRCA - Breast invasive adenocarcinoma(10;3.63e-06)			AGTTCCGTGACGATGTACACA	0.677													C|||	579	0.115615	0.3608	0.0576	5008	,	,		16696	0.0139		0.0258	False		,,,				2504	0.0225					.											0								C	LEU/VAL	1389,3009	452.2+/-349.9	215,959,1025	96.0	76.0	83.0		901	4.6	1.0	20	dbSNP_79	83	166,8434	77.5+/-140.1	0,166,4134	yes	missense	SRMS	NM_080823.2	32	215,1125,5159	GG,GC,CC		1.9302,31.5825,11.9634	probably-damaging	301/489	62173561	1555,11443	2199	4300	6499	SO:0001583	missense	6725				CCDS13525.1	20q13.33	2013-02-14	2003-08-22		ENSG00000125508	ENSG00000125508		"""SH2 domain containing"""	11298	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 148"""	C20orf148		7935409	Standard	NM_080823		Approved	SRM, dJ697K14.1	uc002yfi.1	Q9H3Y6	OTTHUMG00000032977	ENST00000217188.1:c.901G>C	20.37:g.62173561C>G	ENSP00000217188:p.Val301Leu	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000217188.1	37	CCDS13525.1	235	0.10760073260073261	192	0.3902439024390244	16	0.04419889502762431	10	0.017482517482517484	17	0.022427440633245383	C	17.54	3.416230	0.62511	0.315825	0.019302	ENSG00000125508	ENST00000217188	D	0.87179	-2.22	4.62	4.62	0.57501	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.124501	0.35936	N	0.002882	T	0.00012	0.0000	L	0.53780	1.695	0.31636	P	0.648475	B	0.33549	0.417	P	0.45377	0.478	T	0.01706	-1.1291	9	0.87932	D	0	.	12.0155	0.53311	0.0:0.9126:0.0:0.0873	rs310657;rs311541;rs1757734;rs58635261;rs310657	301	Q9H3Y6	SRMS_HUMAN	L	301	ENSP00000217188:V301L	ENSP00000217188:V301L	V	-	1	0	SRMS	61644005	1.000000	0.71417	1.000000	0.80357	0.211000	0.24417	1.512000	0.35812	2.120000	0.65058	0.561000	0.74099	GTC		0.677	SRMS-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080148.1	NM_080823	
KRTAP12-2	353323	bcgsc.ca	37	21	46086377	46086377	+	Missense_Mutation	SNP	A	A	G	rs2838622	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr21:46086377A>G	ENST00000360770.3	-	1	467	c.427T>C	c.(427-429)Tct>Cct	p.S143P	TSPEAR_ENST00000323084.4_Intron	NM_181684.2	NP_859012.1	P59991	KR122_HUMAN	keratin associated protein 12-2	143			S -> P (in dbSNP:rs2838622).			keratin filament (GO:0045095)				central_nervous_system(1)|endometrium(1)|lung(3)	5						CAGCAGGAAGAGATACTGTAG	0.602													G|||	2918	0.582668	0.6967	0.5403	5008	,	,		19253	0.5655		0.492	False		,,,				2504	0.5695					.											0								G	,PRO/SER	2893,1387		1004,885,251	54.0	59.0	57.0		,427	1.8	0.0	21	dbSNP_100	57	3867,4609		924,2019,1295	yes	intron,missense	TSPEAR,KRTAP12-2	NM_144991.2,NM_181684.2	,74	1928,2904,1546	GG,GA,AA		45.6229,32.4065,47.0053	,benign	,143/147	46086377	6760,5996	2140	4238	6378	SO:0001583	missense	353323			AJ566389	CCDS42965.1	21q22.3	2006-03-13			ENSG00000221864	ENSG00000221864		"""Keratin associated proteins"""	20530	protein-coding gene	gene with protein product							Standard	NM_181684		Approved	KRTAP12.2, KAP12.2	uc002zfu.3	P59991	OTTHUMG00000057636	ENST00000360770.3:c.427T>C	21.37:g.46086377A>G	ENSP00000354001:p.Ser143Pro	Somatic		WXS	Illumina HiSeq	Phase_I	A6NIS1|A6NMS9|Q0VAS4	Missense_Mutation	SNP	ENST00000360770.3	37	CCDS42965.1	1234	0.565018315018315	353	0.717479674796748	203	0.5607734806629834	303	0.5297202797202797	375	0.4947229551451187	g	0.003	-2.494097	0.00159	0.675935	0.456229	ENSG00000221864	ENST00000360770;ENST00000539483	T	0.02067	4.47	3.62	1.78	0.24846	.	.	.	.	.	T	0.00012	0.0000	N	0.00368	-1.59	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.15780	-1.0425	8	0.02654	T	1	.	5.8109	0.18465	0.3543:0.0:0.6457:0.0	rs2838622;rs61048872;rs2838622	143	P59991	KR122_HUMAN	P	143;93	ENSP00000354001:S143P	ENSP00000354001:S143P	S	-	1	0	KRTAP12-2	44910805	0.003000	0.15002	0.002000	0.10522	0.008000	0.06430	-0.301000	0.08232	-0.049000	0.13379	-0.355000	0.07637	TCT		0.602	KRTAP12-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128039.1	NM_181684	
LPP	4026	bcgsc.ca	37	3	188327555	188327555	+	Missense_Mutation	SNP	T	T	C	rs7645635	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr3:188327555T>C	ENST00000312675.4	+	6	1282	c.1036T>C	c.(1036-1038)Tat>Cat	p.Y346H	LPP_ENST00000448637.1_Missense_Mutation_p.Y346H|LPP_ENST00000543006.1_Missense_Mutation_p.Y346H|LPP_ENST00000471917.1_3'UTR	NM_001167672.1|NM_005578.3	NP_001161144.1|NP_005569.1	Q93052	LPP_HUMAN	LIM domain containing preferred translocation partner in lipoma	346	Pro-rich.		Y -> H (in dbSNP:rs7645635).		cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)		HMGA2/LPP(161)	NS(1)|breast(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(2)	10	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)		TCCTGGGATGTATCCAGTCAC	0.522			T	"""HMGA2, MLL, C12orf9"""	"""lipoma, leukemia"""								T|||	1002	0.20008	0.7126	0.0764	5008	,	,		18753	0.0		0.005	False		,,,				2504	0.002					.		Dom	yes		3	3q28	4026	LIM domain containing preferred translocation partner in lipoma		"""L, M"""	0								T	HIS/TYR,,HIS/TYR	2581,1825		769,1043,391	42.0	42.0	42.0		1036,,1036	6.2	0.9	3	dbSNP_116	42	34,8564		0,34,4265	yes	missense,intron,missense	LPP	NM_001167671.1,NM_001167672.1,NM_005578.3	83,,83	769,1077,4656	CC,CT,TT		0.3954,41.4208,20.1092	probably-damaging,,probably-damaging	346/613,,346/613	188327555	2615,10389	2203	4299	6502	SO:0001583	missense	4026			AL833171	CCDS3291.1	3q27-q28	2004-03-02	2002-01-14		ENSG00000145012	ENSG00000145012			6679	protein-coding gene	gene with protein product		600700	"""LIM domain-containing preferred translocation partner in lipoma"""			8812423	Standard	XM_005247453		Approved		uc003frs.2	Q93052	OTTHUMG00000156387	ENST00000312675.4:c.1036T>C	3.37:g.188327555T>C	ENSP00000318089:p.Tyr346His	Somatic		WXS	Illumina HiSeq	Phase_I	A1L4L6|D3DNV6|Q8NFX5	Missense_Mutation	SNP	ENST00000312675.4	37	CCDS3291.1	360	0.16483516483516483	328	0.6666666666666666	28	0.07734806629834254	0	0.0	4	0.005277044854881266	T	16.16	3.043406	0.55003	0.585792	0.003954	ENSG00000145012	ENST00000448637;ENST00000312675;ENST00000543006;ENST00000415906	T;T;T;T	0.54866	1.79;0.55;0.55;1.41	6.17	6.17	0.99709	.	0.188754	0.37348	N	0.002140	T	0.00012	0.0000	M	0.66939	2.045	0.22050	P	0.999392708	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.965	T	0.47611	-0.9104	9	0.15499	T	0.54	.	16.0034	0.80327	0.0:0.0:0.0:1.0	rs7645635;rs52823079;rs57290235;rs7645635	346;346	C9JUT4;Q93052	.;LPP_HUMAN	H	346;346;346;183	ENSP00000393602:Y346H;ENSP00000318089:Y346H;ENSP00000438891:Y346H;ENSP00000393008:Y183H	ENSP00000318089:Y346H	Y	+	1	0	LPP	189810249	1.000000	0.71417	0.850000	0.33497	0.194000	0.23727	5.358000	0.66064	2.371000	0.80710	0.533000	0.62120	TAT		0.522	LPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344030.1	NM_005578	
CATSPER3	347732	bcgsc.ca	37	5	134343766	134343766	+	Missense_Mutation	SNP	T	T	G	rs3896260	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr5:134343766T>G	ENST00000282611.6	+	4	698	c.612T>G	c.(610-612)aaT>aaG	p.N204K		NM_178019.2	NP_821138.1	Q86XQ3	CTSR3_HUMAN	cation channel, sperm associated 3	204			N -> K (in dbSNP:rs3896260).		calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sodium ion transport (GO:0006814)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)	acrosomal vesicle (GO:0001669)|CatSper complex (GO:0036128)|endoplasmic reticulum (GO:0005783)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|stomach(1)|urinary_tract(1)	18			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CTCCAGACAATGGTGACCATG	0.552													G|||	646	0.128994	0.4584	0.0461	5008	,	,		15472	0.0		0.007	False		,,,				2504	0.001					.											0								G	LYS/ASN	1758,2648	644.5+/-398.0	347,1064,792	184.0	145.0	158.0		612	-2.1	0.0	5	dbSNP_108	158	24,8576	818.1+/-406.9	0,24,4276	yes	missense	CATSPER3	NM_178019.2	94	347,1088,5068	GG,GT,TT		0.2791,39.9001,13.7014	benign	204/399	134343766	1782,11224	2203	4300	6503	SO:0001583	missense	347732			AF432876	CCDS4181.1	5q31.2	2011-07-05			ENSG00000152705	ENSG00000152705		"""Voltage-gated ion channels / Cation channels, sperm associated"""	20819	protein-coding gene	gene with protein product		609120				12646162, 12932298, 17227845, 16382101	Standard	NM_178019		Approved	CACRC	uc003lag.3	Q86XQ3	OTTHUMG00000129137	ENST00000282611.6:c.612T>G	5.37:g.134343766T>G	ENSP00000282611:p.Asn204Lys	Somatic		WXS	Illumina HiSeq	Phase_I	Q86XS6	Missense_Mutation	SNP	ENST00000282611.6	37	CCDS4181.1	241	0.11034798534798534	221	0.4491869918699187	17	0.04696132596685083	0	0.0	3	0.00395778364116095	G	0.003	-2.468589	0.00169	0.399001	0.002791	ENSG00000152705	ENST00000282611	D	0.97553	-4.43	4.33	-2.08	0.07254	Ion transport (1);	1.918400	0.01976	N	0.044466	T	0.00012	0.0000	N	0.02539	-0.55	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.50440	-0.8828	8	.	.	.	1.4415	0.1834	0.00126	0.2523:0.1883:0.202:0.3574	rs3896260;rs52815255;rs60117234;rs3896260	204	Q86XQ3	CTSR3_HUMAN	K	204	ENSP00000282611:N204K	.	N	+	3	2	CATSPER3	134371665	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-1.154000	0.03166	-0.973000	0.03555	-0.358000	0.07595	AAT		0.552	CATSPER3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251191.2	NM_178019	
EBF2	64641	bcgsc.ca	37	8	25708131	25708131	+	Missense_Mutation	SNP	C	C	T	rs17054477	byFrequency	TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr8:25708131C>T	ENST00000520164.1	-	15	2212	c.1675G>A	c.(1675-1677)Ggc>Agc	p.G559S	EBF2_ENST00000408929.3_Missense_Mutation_p.G411S|EBF2_ENST00000535548.1_3'UTR	NM_022659.3	NP_073150.2	Q9HAK2	COE2_HUMAN	early B-cell factor 2	559			G -> S (in dbSNP:rs17054477).		adipose tissue development (GO:0060612)|brown fat cell differentiation (GO:0050873)|cell fate determination (GO:0001709)|positive regulation of chromatin binding (GO:0035563)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(3)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	39		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)		TTTCCATTGCCGCTGGAGCAG	0.488													C|||	192	0.0383387	0.1377	0.0101	5008	,	,		20848	0.001		0.0	False		,,,				2504	0.002				Esophageal Squamous(166;1018 1046 3854 8328 13429 13634 14071 26624 32918)	.											0								C	SER/GLY	378,3518		19,340,1589	129.0	126.0	127.0		1675	5.4	1.0	8	dbSNP_123	127	28,8236		0,28,4104	yes	missense	EBF2	NM_022659.2	56	19,368,5693	TT,TC,CC		0.3388,9.7023,3.3388	benign	559/576	25708131	406,11754	1948	4132	6080	SO:0001583	missense	64641			AK021562, AK001144	CCDS43726.1	8p21.1	2007-07-26			ENSG00000221818	ENSG00000221818			19090	protein-coding gene	gene with protein product		609934				9151732	Standard	NM_022659		Approved	FLJ11500, COE2	uc003xes.2	Q9HAK2	OTTHUMG00000163838	ENST00000520164.1:c.1675G>A	8.37:g.25708131C>T	ENSP00000430241:p.Gly559Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A0PJM4|A6NMF7|F5H645|Q66VZ3|Q6DK36|Q6IS86|Q6ISA4	Missense_Mutation	SNP	ENST00000520164.1	37	CCDS43726.1	83	0.038003663003663	77	0.1565040650406504	4	0.011049723756906077	2	0.0034965034965034965	0	0.0	C	11.94	1.788711	0.31685	0.097023	0.003388	ENSG00000221818	ENST00000520164;ENST00000408929	T;T	0.40756	1.02;1.02	5.45	5.45	0.79879	.	0.181162	0.48286	D	0.000190	T	0.00073	0.0002	N	0.02247	-0.625	0.09310	P	1.0	B	0.02656	0.0	B	0.04013	0.001	T	0.10683	-1.0619	9	0.19590	T	0.45	-17.0497	14.4976	0.67700	0.1468:0.8532:0.0:0.0	rs17054477;rs52802933;rs17054477	559	Q9HAK2	COE2_HUMAN	S	559;411	ENSP00000430241:G559S;ENSP00000386178:G411S	ENSP00000386178:G411S	G	-	1	0	EBF2	25764048	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	3.857000	0.55972	2.714000	0.92807	0.563000	0.77884	GGC		0.488	EBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375886.2	NM_022659	
SLC52A2	79581	bcgsc.ca	37	8	145583036	145583036	+	Missense_Mutation	SNP	A	A	G	rs141698844		TCGA-KO-8417-01A-11D-2310-10	TCGA-KO-8417-11A-01D-2311-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c7af04b-e171-47c4-8be5-5db33f20148e	32e33f58-0399-49bb-bc8c-1eeb122d4df4	g.chr8:145583036A>G	ENST00000532887.1	+	2	666	c.83A>G	c.(82-84)aAt>aGt	p.N28S	SLC52A2_ENST00000402965.1_Missense_Mutation_p.N28S|FBXL6_ENST00000331890.5_5'Flank|FBXL6_ENST00000455319.2_5'Flank|FBXL6_ENST00000526524.1_5'Flank|SLC52A2_ENST00000530047.1_Missense_Mutation_p.N28S|SLC52A2_ENST00000526752.1_Missense_Mutation_p.N28S|SLC52A2_ENST00000540505.1_Intron|SLC52A2_ENST00000527078.1_Missense_Mutation_p.N28S|SLC52A2_ENST00000526891.1_Intron|SLC52A2_ENST00000329994.2_Missense_Mutation_p.N28S			Q9HAB3	S52A2_HUMAN	solute carrier family 52 (riboflavin transporter), member 2	28					riboflavin transport (GO:0032218)	integral component of plasma membrane (GO:0005887)	riboflavin transporter activity (GO:0032217)|virus receptor activity (GO:0001618)									Gamma Hydroxybutyric Acid(DB01440)	GCTGCGGTCAATGGGATCTGG	0.662													A|||	1	0.000199681	0.0	0.0	5008	,	,		18507	0.0		0.001	False		,,,				2504	0.0					.											0								A	SER/ASN	2,4400	4.2+/-10.8	0,2,2199	84.0	77.0	79.0		83	1.7	0.0	8	dbSNP_134	79	2,8598	2.2+/-6.3	0,2,4298	yes	missense	GPR172A	NM_024531.3	46	0,4,6497	GG,GA,AA		0.0233,0.0454,0.0308	probably-damaging	28/446	145583036	4,12998	2201	4300	6501	SO:0001583	missense	79581			AY070774	CCDS6423.1	8q24.3	2013-07-17	2013-07-17	2012-02-29		ENSG00000185803		"""Solute carriers"""	30224	protein-coding gene	gene with protein product		607882	"""G protein-coupled receptor 172A"""	GPR172A		12740431	Standard	NM_024531		Approved	FLJ11856, PAR1, GPCR41, D15Ertd747e, RFVT2, hRFT3	uc003zcd.2	Q9HAB3		ENST00000532887.1:c.83A>G	8.37:g.145583036A>G	ENSP00000436768:p.Asn28Ser	Somatic		WXS	Illumina HiSeq	Phase_I	A8K6B6|D3DWL8|G1UCY1|Q86UT1	Missense_Mutation	SNP	ENST00000532887.1	37	CCDS6423.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	A	19.02	3.744904	0.69418	4.54E-4	2.33E-4	ENSG00000185803	ENST00000524541;ENST00000530047;ENST00000527078;ENST00000526338;ENST00000402965;ENST00000534725;ENST00000532887;ENST00000329994;ENST00000526752	T;T;T;T;T;T;T;T;T	0.78816	-1.21;-1.21;-1.21;-1.21;-1.21;-1.21;-1.21;-1.21;-1.21	4.33	1.72	0.24424	.	0.053970	0.64402	D	0.000001	D	0.85173	0.5636	M	0.84773	2.715	0.80722	D	1	D	0.69078	0.997	D	0.75020	0.985	T	0.82133	-0.0608	10	0.52906	T	0.07	.	5.0614	0.14559	0.7124:0.1836:0.104:0.0	.	28	Q9HAB3	RFT3_HUMAN	S	28	ENSP00000434239:N28S;ENSP00000435820:N28S;ENSP00000434728:N28S;ENSP00000433583:N28S;ENSP00000385961:N28S;ENSP00000431965:N28S;ENSP00000436768:N28S;ENSP00000333638:N28S;ENSP00000433796:N28S	ENSP00000333638:N28S	N	+	2	0	GPR172A	145553844	0.993000	0.37304	0.047000	0.18901	0.654000	0.38779	3.228000	0.51270	0.531000	0.28639	0.379000	0.24179	AAT		0.662	SLC52A2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382405.1	NM_024531	
