#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MECR	51102	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	29557328	29557328	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr1:29557328C>T	ENST00000263702.6	-	1	116	c.91G>A	c.(91-93)Gcc>Acc	p.A31T	MECR_ENST00000489248.1_5'UTR|MECR_ENST00000373791.3_5'UTR			Q9BV79	MECR_HUMAN	mitochondrial trans-2-enoyl-CoA reductase	31					fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	trans-2-enoyl-CoA reductase (NADPH) activity (GO:0019166)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(2)|prostate(1)	11		Colorectal(325;0.000389)|Breast(348;0.00765)|Lung NSC(340;0.0081)|all_lung(284;0.00914)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.39e-07)|COAD - Colon adenocarcinoma(152;2.04e-05)|STAD - Stomach adenocarcinoma(196;0.0195)|BRCA - Breast invasive adenocarcinoma(304;0.053)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.137)		TAGGAGGAGGCGGCAGGTCCG	0.701																																					p.A31T		.											.	MECR-91	0			c.G91A						.						9.0	12.0	11.0					1																	29557328		2186	4279	6465	SO:0001583	missense	51102	exon1			AGGAGGCGGCAGG		CCDS30659.1, CCDS30660.1	1p35.3	2012-09-20			ENSG00000116353	ENSG00000116353	1.3.1.38		19691	protein-coding gene	gene with protein product	"""nuclear receptor binding factor 1"", ""mitochondrial 2-enoyl thioester reductase"""	608205				9795230, 12654921	Standard	XM_005245885		Approved	CGI-63, NRBF1, FASN2B	uc001brq.1	Q9BV79	OTTHUMG00000059082	ENST00000263702.6:c.91G>A	1.37:g.29557328C>T	ENSP00000263702:p.Ala31Thr	Somatic	44	0		WXS	Illumina HiSeq	Phase_I	30	20	NM_016011	0	0	1	6	5	B3KT72|Q5SYU0|Q5SYU1|Q5SYU2|Q6IBU9|Q9Y373	Missense_Mutation	SNP	ENST00000263702.6	37	CCDS30659.1	.	.	.	.	.	.	.	.	.	.	C	13.00	2.106638	0.37145	.	.	ENSG00000116353	ENST00000263702	T	0.03496	3.91	4.92	-0.97	0.10306	.	1.626230	0.03313	N	0.190804	T	0.02807	0.0084	N	0.19112	0.55	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	T	0.44817	-0.9303	9	.	.	.	.	4.5591	0.12151	0.5172:0.3021:0.0:0.1807	.	31	Q9BV79	MECR_HUMAN	T	31	ENSP00000263702:A31T	.	A	-	1	0	MECR	29429915	0.000000	0.05858	0.002000	0.10522	0.434000	0.31775	-1.074000	0.03427	-0.262000	0.09392	-0.140000	0.14226	GCC	.		0.701	MECR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130740.1	NM_016011	
AGO3	192669	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	36475164	36475164	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr1:36475164C>T	ENST00000373191.4	+	9	1467	c.1118C>T	c.(1117-1119)gCa>gTa	p.A373V	AGO3_ENST00000246314.6_Missense_Mutation_p.A139V|RP4-665N4.8_ENST00000479395.2_RNA|RP4-665N4.8_ENST00000466576.2_RNA	NM_024852.3	NP_079128.2	Q9H9G7	AGO3_HUMAN	argonaute RISC catalytic component 3	373					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA catabolic process (GO:0006402)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of stem cell proliferation (GO:0072091)	cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|RISC complex (GO:0016442)	miRNA binding (GO:0035198)|poly(A) RNA binding (GO:0044822)										GCAAGATCTGCACCAGATAGA	0.378																																					p.A373V		.											.	.	0			c.C1118T						.						105.0	98.0	100.0					1																	36475164		2203	4300	6503	SO:0001583	missense	192669	exon9			GATCTGCACCAGA	AB046787	CCDS399.1, CCDS400.1	1p34	2013-06-03	2013-02-15	2013-02-15	ENSG00000126070	ENSG00000126070		"""Argonaute/PIWI family"""	18421	protein-coding gene	gene with protein product	"""argonaute 3"""	607355	"""eukaryotic translation initiation factor 2C, 3"""	EIF2C3		12906857	Standard	NM_024852		Approved	hAGO3, FLJ12765	uc001bzp.3	Q9H9G7	OTTHUMG00000184172	ENST00000373191.4:c.1118C>T	1.37:g.36475164C>T	ENSP00000362287:p.Ala373Val	Somatic	309	0		WXS	Illumina HiSeq	Phase_I	254	99	NM_024852	0	0	0	1	1	B1ALI0|Q5TA55|Q9H1U6	Missense_Mutation	SNP	ENST00000373191.4	37	CCDS399.1	.	.	.	.	.	.	.	.	.	.	C	36	5.888335	0.97068	.	.	ENSG00000126070	ENST00000373191;ENST00000246314	T;T	0.10960	2.82;2.82	6.17	6.17	0.99709	Argonaute/Dicer protein, PAZ (1);	0.000000	0.85682	D	0.000000	T	0.45135	0.1327	M	0.93283	3.4	0.80722	D	1	D	0.71674	0.998	P	0.62491	0.903	T	0.55023	-0.8205	10	0.87932	D	0	-12.0124	20.8794	0.99867	0.0:1.0:0.0:0.0	.	373	Q9H9G7	AGO3_HUMAN	V	373;139	ENSP00000362287:A373V;ENSP00000246314:A139V	ENSP00000246314:A139V	A	+	2	0	EIF2C3	36247751	1.000000	0.71417	0.995000	0.50966	0.982000	0.71751	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	GCA	.		0.378	AGO3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019831.4	NM_024852	
INTS3	65123	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	153740253	153740253	+	Nonsense_Mutation	SNP	G	G	T			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr1:153740253G>T	ENST00000318967.2	+	21	2762	c.2194G>T	c.(2194-2196)Gag>Tag	p.E732*	INTS3_ENST00000435409.2_Nonsense_Mutation_p.E732*|INTS3_ENST00000476843.1_3'UTR|INTS3_ENST00000512605.1_Nonsense_Mutation_p.E526*|INTS3_ENST00000456435.1_Nonsense_Mutation_p.E526*	NM_023015.3	NP_075391.3	Q68E01	INT3_HUMAN	integrator complex subunit 3	733					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|mitotic cell cycle checkpoint (GO:0007093)|response to ionizing radiation (GO:0010212)|snRNA processing (GO:0016180)	integrator complex (GO:0032039)|nucleus (GO:0005634)|SOSS complex (GO:0070876)				breast(1)|cervix(4)|endometrium(10)|kidney(1)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			GGCCTGCCAGGAGGACGATGT	0.612																																					p.E732X		.											.	INTS3-93	0			c.G2194T						.						113.0	94.0	100.0					1																	153740253		2203	4300	6503	SO:0001587	stop_gained	65123	exon21			TGCCAGGAGGACG	BX640950	CCDS1052.1	1q21.3	2012-03-16	2006-03-15	2006-03-15	ENSG00000143624	ENSG00000143624			26153	protein-coding gene	gene with protein product	"""sensor of single-strand DNA complex subunit A"""	611347	"""chromosome 1 open reading frame 60"""	C1orf60		16239144	Standard	NM_023015		Approved	FLJ21919, INT3, SOSS-A	uc001fct.3	Q68E01	OTTHUMG00000037089	ENST00000318967.2:c.2194G>T	1.37:g.153740253G>T	ENSP00000318641:p.Glu732*	Somatic	78	0		WXS	Illumina HiSeq	Phase_I	95	33	NM_023015	0	0	5	8	3	A8K1W0|B4DQC8|B4E3U9|D3DV57|Q4G0E5|Q5VUQ5|Q5VUQ6|Q5VUR0|Q5VUR1|Q68DJ1|Q69YR5|Q6AI57|Q6DKG7|Q6MZQ4|Q6MZZ9|Q8NC46|Q8TB23|Q9H6S9	Nonsense_Mutation	SNP	ENST00000318967.2	37	CCDS1052.1	.	.	.	.	.	.	.	.	.	.	G	42	9.404468	0.99161	.	.	ENSG00000143624	ENST00000318967;ENST00000456435;ENST00000435409;ENST00000512605	.	.	.	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	.	15.6279	0.76878	0.0:0.0:1.0:0.0	.	.	.	.	X	732;526;732;526	.	ENSP00000318641:E732X	E	+	1	0	INTS3	152006877	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	9.055000	0.93873	2.768000	0.95171	0.561000	0.74099	GAG	.		0.612	INTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090045.2	NM_023015	
CFH	3075	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	196654324	196654324	+	Silent	SNP	A	A	G	rs1061147	byFrequency	TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr1:196654324A>G	ENST00000359637.2	+	6	791	c.729A>G	c.(727-729)gcA>gcG	p.A243A	CFH_ENST00000367429.4_Silent_p.A307A|CFH_ENST00000439155.2_Silent_p.A307A			P08603	CFAH_HUMAN	complement factor H	307	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)			NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						GAAATACAGCAAAATGCACAA	0.393																																					p.A307A		.											.	CFH-566	0			c.A921G	GRCh37	CM057396	CFH	M	rs1061147	.						119.0	108.0	112.0					1																	196654324		2203	4300	6503	SO:0001819	synonymous_variant	3075	exon7			TACAGCAAAATGC	Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000359637.2:c.729A>G	1.37:g.196654324A>G		Somatic	292	0		WXS	Illumina HiSeq	Phase_I	239	84	NM_001014975	0	0	1	1	0	A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Silent	SNP	ENST00000359637.2	37																																																																																				A|0.353;C|0.647		0.393	CFH-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000087502.1	NM_000186	
PTPRC	5788	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	198678922	198678922	+	Silent	SNP	C	C	T	rs200643724		TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr1:198678922C>T	ENST00000367376.2	+	11	1305	c.1134C>T	c.(1132-1134)aaC>aaT	p.N378N	PTPRC_ENST00000348564.6_Silent_p.N219N|PTPRC_ENST00000442510.2_Silent_p.N380N|PTPRC_ENST00000352140.3_Silent_p.N330N|PTPRC_ENST00000594404.1_Silent_p.N217N	NM_002838.4	NP_002829.3	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	378					axon guidance (GO:0007411)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|bone marrow development (GO:0048539)|cell cycle phase transition (GO:0044770)|cell surface receptor signaling pathway (GO:0007166)|defense response to virus (GO:0051607)|dephosphorylation (GO:0016311)|hematopoietic progenitor cell differentiation (GO:0002244)|immunoglobulin biosynthetic process (GO:0002378)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of antigen receptor-mediated signaling pathway (GO:0050857)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of T cell proliferation (GO:0042102)|protein dephosphorylation (GO:0006470)|regulation of cell cycle (GO:0051726)|release of sequestered calcium ion into cytosol (GO:0051209)|stem cell development (GO:0048864)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(7)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(22)|lung(41)|ovary(4)|pancreas(2)|prostate(1)|skin(13)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	111						AGTTTACTAACGCAAGTAAAA	0.269																																					p.N380N		.											.	PTPRC-295	0			c.C1140T						.	C	,	0,4398		0,0,2199	74.0	89.0	84.0		1134,651	-9.0	0.0	1		84	2,8534	2.2+/-6.3	0,2,4266	no	coding-synonymous,coding-synonymous	PTPRC	NM_002838.3,NM_080921.2	,	0,2,6465	TT,TC,CC		0.0234,0.0,0.0155	,	378/1305,217/1144	198678922	2,12932	2199	4268	6467	SO:0001819	synonymous_variant	5788	exon11			TACTAACGCAAGT	Y00062	CCDS1397.1, CCDS1398.1, CCDS44291.1, CCDS1397.2, CCDS1398.2, CCDS44291.2	1q31-q32	2014-09-17			ENSG00000081237	ENSG00000081237		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9666	protein-coding gene	gene with protein product		151460		CD45		2169617	Standard	NM_001267798		Approved	LCA, T200, GP180	uc001gur.2	P08575	OTTHUMG00000035702	ENST00000367376.2:c.1134C>T	1.37:g.198678922C>T		Somatic	222	0		WXS	Illumina HiSeq	Phase_I	149	40	NM_002838	0	0	0	0	0	A8K7W6|Q16614|Q9H0Y6	Silent	SNP	ENST00000367376.2	37																																																																																				C|0.999;T|0.001		0.269	PTPRC-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding			
GPR37L1	9283	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	202097357	202097357	+	Silent	SNP	C	C	T			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr1:202097357C>T	ENST00000367282.5	+	2	1225	c.1119C>T	c.(1117-1119)ctC>ctT	p.L373L		NM_004767.3	NP_004758.3	O60883	ETBR2_HUMAN	G protein-coupled receptor 37 like 1	373					negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of cerebellar granule cell precursor proliferation (GO:0021940)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)	18						TCTGCACCCTCCCAGAGAACG	0.622																																					p.L373L		.											.	GPR37L1-91	0			c.C1119T						.						157.0	139.0	145.0					1																	202097357		2203	4300	6503	SO:0001819	synonymous_variant	9283	exon2			CACCCTCCCAGAG	AJ310210	CCDS1420.1	1q32	2012-08-21	2006-02-15		ENSG00000170075	ENSG00000170075		"""GPCR / Class A : Orphans"""	14923	protein-coding gene	gene with protein product						9539149	Standard	NM_004767		Approved	ETBR-LP-2	uc001gxj.3	O60883	OTTHUMG00000035924	ENST00000367282.5:c.1119C>T	1.37:g.202097357C>T		Somatic	124	0		WXS	Illumina HiSeq	Phase_I	108	8	NM_004767	0	0	0	0	0	B2R7M9|Q5SXP7|Q86VP7	Silent	SNP	ENST00000367282.5	37	CCDS1420.1																																																																																			.		0.622	GPR37L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087496.2	NM_004767	
RCOR3	55758	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	211449723	211449723	+	Missense_Mutation	SNP	G	G	C			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr1:211449723G>C	ENST00000367005.4	+	4	446	c.305G>C	c.(304-306)aGt>aCt	p.S102T	RCOR3_ENST00000452621.2_Missense_Mutation_p.S160T|RCOR3_ENST00000419091.2_Missense_Mutation_p.S160T|RCOR3_ENST00000367006.4_Missense_Mutation_p.S160T	NM_018254.3	NP_060724.1	Q9P2K3	RCOR3_HUMAN	REST corepressor 3	102	SANT 1. {ECO:0000255|PROSITE- ProRule:PRU00624}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(81;0.00961)|all cancers(67;0.0999)|Epithelial(68;0.171)		CAAGCCTTTAGTTTTCATGGA	0.363																																					p.S160T		.											.	RCOR3-91	0			c.G479C						.						164.0	162.0	163.0					1																	211449723		2203	4300	6503	SO:0001583	missense	55758	exon5			CCTTTAGTTTTCA	AK001738	CCDS31016.1, CCDS44312.1, CCDS44313.1, CCDS44314.1	1q32.3	2008-02-05			ENSG00000117625	ENSG00000117625			25594	protein-coding gene	gene with protein product						10718198	Standard	NM_018254		Approved	FLJ10876	uc010psw.2	Q9P2K3	OTTHUMG00000036996	ENST00000367005.4:c.305G>C	1.37:g.211449723G>C	ENSP00000355972:p.Ser102Thr	Somatic	105	0		WXS	Illumina HiSeq	Phase_I	104	9	NM_001136223	0	0	1	1	0	B3KYA2|B4DYY7|Q5VT47|Q7L9I5|Q8N5U3|Q9NV83	Missense_Mutation	SNP	ENST00000367005.4	37	CCDS31016.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.435982	0.83885	.	.	ENSG00000117625	ENST00000533469;ENST00000367006;ENST00000452621;ENST00000419091;ENST00000367005	T;T;T;T;T	0.28666	1.6;1.6;1.6;1.6;1.6	5.02	5.02	0.67125	SANT domain, DNA binding (1);Homeodomain-like (1);SANT, eukarya (1);	0.000000	0.85682	D	0.000000	T	0.45377	0.1339	L	0.35542	1.07	0.80722	D	1	D;B;B;B	0.56035	0.974;0.065;0.364;0.389	D;B;B;B	0.70487	0.969;0.066;0.341;0.198	T	0.21177	-1.0253	9	.	.	.	-4.1499	18.6937	0.91593	0.0:0.0:1.0:0.0	.	160;102;160;160	Q9P2K3-3;Q9P2K3;Q9P2K3-2;Q9P2K3-4	.;RCOR3_HUMAN;.;.	T	102;160;160;160;102	ENSP00000436838:S102T;ENSP00000355973:S160T;ENSP00000398558:S160T;ENSP00000413929:S160T;ENSP00000355972:S102T	.	S	+	2	0	RCOR3	209516346	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.639000	0.98448	2.495000	0.84180	0.484000	0.47621	AGT	.		0.363	RCOR3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000089821.1	NM_018254	
CENPF	1063	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	214815375	214815375	+	Nonsense_Mutation	SNP	G	G	T			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr1:214815375G>T	ENST00000366955.3	+	12	3862	c.3694G>T	c.(3694-3696)Gag>Tag	p.E1232*		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	0					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)	p.E1232*(1)		NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		GAAGGAGAAGGAGTGCCTGCA	0.373																																					p.E1232X	Colon(80;575 1284 11000 14801 43496)												.	CENPF-567	1	Substitution - Nonsense(1)	lung(1)	c.G3694T						.						42.0	46.0	45.0					1																	214815375		2203	4298	6501	SO:0001587	stop_gained	1063	exon12			GAGAAGGAGTGCC	U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.3694G>T	1.37:g.214815375G>T	ENSP00000355922:p.Glu1232*	Somatic	187	1		WXS	Illumina HiSeq	Phase_I	118	33	NM_016343	0	0	0	0	0	Q13171|Q13246|Q5VVM7	Nonsense_Mutation	SNP	ENST00000366955.3	37	CCDS31023.1	.	.	.	.	.	.	.	.	.	.	G	42	9.517275	0.99193	.	.	ENSG00000117724	ENST00000366955	.	.	.	5.17	2.19	0.27852	.	1.270870	0.05898	N	0.629477	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	.	6.3943	0.21603	0.1645:0.1498:0.6857:0.0	.	.	.	.	X	1232	.	ENSP00000355922:E1232X	E	+	1	0	CENPF	212881998	0.848000	0.29623	0.000000	0.03702	0.898000	0.52572	0.913000	0.28611	0.168000	0.19655	0.511000	0.50034	GAG	.		0.373	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	NM_016343	
CAPN2	824	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	223959597	223959597	+	Missense_Mutation	SNP	C	C	G			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr1:223959597C>G	ENST00000295006.5	+	19	2299	c.1990C>G	c.(1990-1992)Cgg>Ggg	p.R664G	CAPN2_ENST00000474026.1_3'UTR|CAPN2_ENST00000433674.2_Missense_Mutation_p.R586G	NM_001748.4	NP_001739	P17655	CAN2_HUMAN	calpain 2, (m/II) large subunit	664	Domain IV.				blastocyst development (GO:0001824)|cellular response to amino acid stimulus (GO:0071230)|myoblast fusion (GO:0007520)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of cytoskeleton organization (GO:0051493)|response to hypoxia (GO:0001666)	chromatin (GO:0000785)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cysteine-type peptidase activity (GO:0008234)|cytoskeletal protein binding (GO:0008092)			breast(3)|endometrium(1)|kidney(1)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|stomach(3)	29				GBM - Glioblastoma multiforme(131;0.109)		TAATTTTGTTCGGTGTTTGGT	0.443																																					p.R664G													.	CAPN2-523	0			c.C1990G						.						239.0	216.0	224.0					1																	223959597		2203	4300	6503	SO:0001583	missense	824	exon19			TTTGTTCGGTGTT	J04700	CCDS31035.1, CCDS53478.1	1q41-q42	2013-01-10			ENSG00000162909	ENSG00000162909	3.4.22.52	"""EF-hand domain containing"""	1479	protein-coding gene	gene with protein product		114230				2852952, 2539381	Standard	NM_001748		Approved	mCANP, CANPml, CANPL2	uc001hob.4	P17655	OTTHUMG00000037376	ENST00000295006.5:c.1990C>G	1.37:g.223959597C>G	ENSP00000295006:p.Arg664Gly	Somatic	215	1		WXS	Illumina HiSeq	Phase_I	215	62	NM_001748	0	0	104	220	116	A6NDG7|B7ZA96|E7ES58|Q16738|Q6PJT3|Q8WU26|Q9HBB1	Missense_Mutation	SNP	ENST00000295006.5	37	CCDS31035.1	.	.	.	.	.	.	.	.	.	.	C	13.60	2.284324	0.40394	.	.	ENSG00000162909	ENST00000433674;ENST00000295006;ENST00000366869	T;T	0.30981	1.51;1.51	5.63	4.72	0.59763	EF-hand-like domain (1);	0.323633	0.33712	N	0.004621	T	0.21387	0.0515	L	0.27053	0.805	0.51767	D	0.999932	B;B;B	0.29955	0.058;0.151;0.263	B;B;B	0.31016	0.074;0.123;0.114	T	0.05733	-1.0867	10	0.35671	T	0.21	.	9.67	0.40006	0.1402:0.7874:0.0:0.0724	.	586;247;664	B7ZA96;B3KUH9;P17655	.;.;CAN2_HUMAN	G	586;664;693	ENSP00000413158:R586G;ENSP00000295006:R664G	ENSP00000295006:R664G	R	+	1	2	CAPN2	222026220	0.061000	0.20836	0.881000	0.34555	0.995000	0.86356	0.282000	0.18829	1.377000	0.46286	0.561000	0.74099	CGG	.		0.443	CAPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090973.1	NM_001748	
SNAP47	116841	hgsc.bcm.edu;bcgsc.ca	37	1	227946738	227946738	+	Missense_Mutation	SNP	C	C	A			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr1:227946738C>A	ENST00000366759.4	+	3	1089	c.675C>A	c.(673-675)agC>agA	p.S225R	SNAP47_ENST00000366760.1_5'UTR|SNAP47_ENST00000315781.5_Missense_Mutation_p.S225R	NM_053052.3	NP_444280.2	Q5SQN1	SNP47_HUMAN	synaptosomal-associated protein, 47kDa	225					long-term synaptic potentiation (GO:0060291)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|membrane (GO:0016020)|neuronal cell body (GO:0043025)				endometrium(1)|large_intestine(5)|liver(2)|lung(6)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	17						GGCCCTTTAGCTCCAAGCTTT	0.433																																					p.S225R		.											.	SNAP47-91	0			c.C675A						.						86.0	94.0	91.0					1																	227946738		2203	4300	6503	SO:0001583	missense	116841	exon3			CTTTAGCTCCAAG	AY090635	CCDS1562.1	1q42.13	2013-10-11	2008-10-27	2008-10-27	ENSG00000143740	ENSG00000143740			30669	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 142"""	C1orf142		16621800	Standard	NM_053052		Approved	SVAP1, SNAP-47	uc001hrf.2	Q5SQN1	OTTHUMG00000037697	ENST00000366759.4:c.675C>A	1.37:g.227946738C>A	ENSP00000355721:p.Ser225Arg	Somatic	91	0		WXS	Illumina HiSeq	Phase_I	73	4	NM_053052	0	0	26	26	0	B6EDE0|Q5HYB5|Q5TBZ3|Q8N558|Q8TB31|Q8TCW8|Q8WV46|Q96CQ3|Q96FE1|Q96I66|Q96NU3|Q9BT10|Q9BVB2	Missense_Mutation	SNP	ENST00000366759.4	37	CCDS1562.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.74|10.74	1.434984|1.434984	0.25813|0.25813	.|.	.|.	ENSG00000143740|ENSG00000143740	ENST00000418653;ENST00000426344|ENST00000366759;ENST00000315781	.|T;T	.|0.17054	.|2.3;2.3	4.95|4.95	0.434|0.434	0.16539|0.16539	.|.	.|0.129162	.|0.64402	.|D	.|0.000001	T|T	0.31231|0.31231	0.0790|0.0790	M|M	0.78637|0.78637	2.42|2.42	0.30113|0.30113	N|N	0.8064|0.8064	.|D;D	.|0.67145	.|0.989;0.996	.|P;P	.|0.61201	.|0.885;0.885	T|T	0.20638|0.20638	-1.0269|-1.0269	5|10	.|0.26408	.|T	.|0.33	-7.4349|-7.4349	8.0504|8.0504	0.30575|0.30575	0.0:0.4696:0.0:0.5304|0.0:0.4696:0.0:0.5304	.|.	.|225;225	.|Q5SQN1;Q5SQN1-2	.|SNP47_HUMAN;.	I|R	38;217|225	.|ENSP00000355721:S225R;ENSP00000314157:S225R	.|ENSP00000314157:S225R	L|S	+|+	1|3	0|2	SNAP47|SNAP47	226013361|226013361	0.994000|0.994000	0.37717|0.37717	0.678000|0.678000	0.29963|0.29963	0.565000|0.565000	0.35776|0.35776	0.206000|0.206000	0.17375|0.17375	-0.047000|-0.047000	0.13423|0.13423	0.561000|0.561000	0.74099|0.74099	CTC|AGC	.		0.433	SNAP47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091961.1	NM_053052	
SDCCAG8	10806	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	243419490	243419490	+	Silent	SNP	G	G	A			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr1:243419490G>A	ENST00000366541.3	+	1	133	c.15G>A	c.(13-15)ccG>ccA	p.P5P	SDCCAG8_ENST00000391846.1_Silent_p.P5P|SDCCAG8_ENST00000343783.6_5'UTR|CEP170_ENST00000366544.1_5'Flank|SDCCAG8_ENST00000355875.4_Silent_p.P5P|CEP170_ENST00000366542.1_5'Flank|CEP170_ENST00000366543.1_5'Flank	NM_006642.3	NP_006633.1	Q86SQ7	SDCG8_HUMAN	serologically defined colon cancer antigen 8	5					establishment of cell polarity (GO:0030010)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|tube formation (GO:0035148)	cell-cell junction (GO:0005911)|centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)		CGAAGTCCCCGGAGAACTCTA	0.617																																					p.P5P		.											.	SDCCAG8-90	0			c.G15A						.						78.0	79.0	78.0					1																	243419490		2203	4300	6503	SO:0001819	synonymous_variant	10806	exon1			GTCCCCGGAGAAC	AF039690	CCDS31075.1	1q43	2011-08-02			ENSG00000054282	ENSG00000054282			10671	protein-coding gene	gene with protein product		613524				9610721, 20835237	Standard	NM_006642		Approved	NY-CO-8, CCCAP, SLSN7, NPHP10, BBS16	uc001hzw.3	Q86SQ7	OTTHUMG00000039996	ENST00000366541.3:c.15G>A	1.37:g.243419490G>A		Somatic	146	0		WXS	Illumina HiSeq	Phase_I	123	7	NM_006642	0	0	1	1	0	O60527|Q3ZCR6|Q8N5F2|Q9P0F1	Silent	SNP	ENST00000366541.3	37	CCDS31075.1																																																																																			.		0.617	SDCCAG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096485.1	NM_006642	
TAF3	83860	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	8007636	8007636	+	Missense_Mutation	SNP	G	G	C			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr10:8007636G>C	ENST00000344293.5	+	3	2369	c.2163G>C	c.(2161-2163)aaG>aaC	p.K721N		NM_031923.3	NP_114129.1	Q5VWG9	TAF3_HUMAN	TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa	721	Lys-rich.				maintenance of protein location in nucleus (GO:0051457)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	zinc ion binding (GO:0008270)			NS(2)|breast(4)|endometrium(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(3)|prostate(4)|skin(2)	40						agaaggagaaggaaagagaga	0.383																																					p.K721N		.											.	TAF3-69	0			c.G2163C						.						18.0	18.0	18.0					10																	8007636		1856	4075	5931	SO:0001583	missense	83860	exon3			GGAGAAGGAAAGA	AJ292190	CCDS41487.1	10p15.1	2013-01-28	2002-08-29		ENSG00000165632	ENSG00000165632		"""Zinc fingers, PHD-type"""	17303	protein-coding gene	gene with protein product		606576	"""TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140 kD"""			11438666, 18549481	Standard	NM_031923		Approved	TAF140, TAFII140	uc010qbd.3	Q5VWG9	OTTHUMG00000017643	ENST00000344293.5:c.2163G>C	10.37:g.8007636G>C	ENSP00000340271:p.Lys721Asn	Somatic	66	0		WXS	Illumina HiSeq	Phase_I	82	21	NM_031923	0	0	3	5	2	Q05DA0|Q6GMS5|Q6P6B5|Q86VY6|Q9BQS9|Q9UFI8	Missense_Mutation	SNP	ENST00000344293.5	37	CCDS41487.1	.	.	.	.	.	.	.	.	.	.	G	11.76	1.735163	0.30774	.	.	ENSG00000165632	ENST00000344293	T	0.08634	3.07	5.68	4.59	0.56863	.	0.459877	0.21158	N	0.079203	T	0.13798	0.0334	M	0.81802	2.56	0.49299	D	0.999772	P	0.46706	0.883	B	0.40375	0.327	T	0.02301	-1.1180	10	0.36615	T	0.2	-14.6137	13.0132	0.58743	0.1321:0.0:0.8679:0.0	.	721	Q5VWG9	TAF3_HUMAN	N	721	ENSP00000340271:K721N	ENSP00000340271:K721N	K	+	3	2	TAF3	8047642	1.000000	0.71417	1.000000	0.80357	0.798000	0.45092	2.385000	0.44371	2.689000	0.91719	0.655000	0.94253	AAG	.		0.383	TAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046725.1	NM_031923	
DHTKD1	55526	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	12139749	12139749	+	Missense_Mutation	SNP	G	G	C			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr10:12139749G>C	ENST00000263035.4	+	8	1487	c.1425G>C	c.(1423-1425)gaG>gaC	p.E475D	DHTKD1_ENST00000465617.1_3'UTR	NM_018706.5	NP_061176	Q96HY7	DHTK1_HUMAN	dehydrogenase E1 and transketolase domain containing 1	475					cell death (GO:0008219)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hematopoietic progenitor cell differentiation (GO:0002244)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(1)	44		Renal(717;0.228)	BRCA - Breast invasive adenocarcinoma(52;0.188)			TGACGCAGGAGGAGGTGTCTG	0.488																																					p.E475D		.											.	DHTKD1-515	0			c.G1425C						.						67.0	62.0	64.0					10																	12139749		2203	4300	6503	SO:0001583	missense	55526	exon8			GCAGGAGGAGGTG	BC002477	CCDS7087.1	10p14	2003-11-24			ENSG00000181192	ENSG00000181192			23537	protein-coding gene	gene with protein product		614984				10997877	Standard	NM_018706		Approved	KIAA1630, MGC3090, DKFZP762M115	uc001ild.5	Q96HY7	OTTHUMG00000017677	ENST00000263035.4:c.1425G>C	10.37:g.12139749G>C	ENSP00000263035:p.Glu475Asp	Somatic	116	0		WXS	Illumina HiSeq	Phase_I	125	53	NM_018706	0	0	3	6	3	Q68CU5|Q9BUM8|Q9HCE2	Missense_Mutation	SNP	ENST00000263035.4	37	CCDS7087.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.11|12.11	1.839538|1.839538	0.32513|0.32513	.|.	.|.	ENSG00000181192|ENSG00000181192	ENST00000263035|ENST00000448829	T|.	0.16196|.	2.36|.	5.35|5.35	1.27|1.27	0.21489|0.21489	Dehydrogenase, E1 component (1);|.	0.112246|.	0.64402|.	D|.	0.000014|.	T|T	0.35770|0.35770	0.0943|0.0943	N|N	0.25144|0.25144	0.715|0.715	0.41129|0.41129	D|D	0.985874|0.985874	B|.	0.14012|.	0.009|.	B|.	0.17979|.	0.02|.	T|T	0.07046|0.07046	-1.0793|-1.0793	10|5	0.24483|.	T|.	0.36|.	-13.3397|-13.3397	4.01|4.01	0.09618|0.09618	0.3596:0.0:0.3864:0.254|0.3596:0.0:0.3864:0.254	.|.	475|.	Q96HY7|.	DHTK1_HUMAN|.	D|R	475|27	ENSP00000263035:E475D|.	ENSP00000263035:E475D|.	E|G	+|+	3|1	2|0	DHTKD1|DHTKD1	12179755|12179755	0.982000|0.982000	0.34865|0.34865	1.000000|1.000000	0.80357|0.80357	0.863000|0.863000	0.49368|0.49368	0.093000|0.093000	0.15086|0.15086	0.264000|0.264000	0.21851|0.21851	0.462000|0.462000	0.41574|0.41574	GAG|GGA	.		0.488	DHTKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046777.1	NM_018706	
CSGALNACT2	55454	broad.mit.edu	37	10	43659419	43659419	+	Missense_Mutation	SNP	G	G	T	rs79064394		TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr10:43659419G>T	ENST00000374466.3	+	5	1421	c.1086G>T	c.(1084-1086)ttG>ttT	p.L362F		NM_018590.3	NP_061060.3	Q8N6G5	CGAT2_HUMAN	chondroitin sulfate N-acetylgalactosaminyltransferase 2	362					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050653)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|dermatan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050652)|glycosaminoglycan metabolic process (GO:0030203)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	acetylgalactosaminyltransferase activity (GO:0008376)|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047237)|metal ion binding (GO:0046872)	p.L362F(5)		endometrium(12)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						GAGAGGTCTTGATGTTTTTCT	0.433																																					p.L362F													.	CSGALNACT2-69	5	Substitution - Missense(5)	endometrium(4)|kidney(1)	c.G1086T						.						223.0	221.0	222.0					10																	43659419		2203	4300	6503	SO:0001583	missense	55454	exon5			GGTCTTGATGTTT	AF116646	CCDS7201.1	10q11.21	2013-02-19			ENSG00000169826	ENSG00000169826		"""Beta 4-glycosyltransferases"""	24292	protein-coding gene	gene with protein product	"""chondroitin beta1,4 N-acetylgalactosaminyltransferase 2"""					12446672	Standard	NM_018590		Approved	GALNACT2, MGC40204, PRO0082, GALNACT-2	uc001jan.4	Q8N6G5	OTTHUMG00000018023	ENST00000374466.3:c.1086G>T	10.37:g.43659419G>T	ENSP00000363590:p.Leu362Phe	Somatic	142	2		WXS	Illumina HiSeq	Phase_I	154	5	NM_018590	0	0	1	1	0	B3KWL7|Q6MZJ5|Q6MZP6|Q8TCH4|Q9P1I6	Missense_Mutation	SNP	ENST00000374466.3	37	CCDS7201.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.499782	0.85176	.	.	ENSG00000169826	ENST00000374466	T	0.27256	1.68	6.08	5.17	0.71159	.	0.064535	0.64402	D	0.000004	T	0.57359	0.2048	M	0.89095	3.005	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.63721	-0.6573	10	0.87932	D	0	-11.7375	14.8306	0.70146	0.0683:0.0:0.9317:0.0	.	362	Q8N6G5	CGAT2_HUMAN	F	362	ENSP00000363590:L362F	ENSP00000363590:L362F	L	+	3	2	CSGALNACT2	42979425	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.683000	0.37638	2.894000	0.99253	0.591000	0.81541	TTG	.		0.433	CSGALNACT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047693.1	NM_018590	
NCOA4	8031	broad.mit.edu	37	10	51579175	51579175	+	Missense_Mutation	SNP	A	A	C			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr10:51579175A>C	ENST00000443446.1	+	2	263	c.34A>C	c.(34-36)Agt>Cgt	p.S12R	NCOA4_ENST00000430396.2_Intron|NCOA4_ENST00000374082.1_Missense_Mutation_p.S12R|NCOA4_ENST00000452682.1_Missense_Mutation_p.S28R|NCOA4_ENST00000438493.1_Missense_Mutation_p.S28R|NCOA4_ENST00000374087.4_Missense_Mutation_p.S12R|NCOA4_ENST00000498586.1_Intron|NCOA4_ENST00000344348.6_Missense_Mutation_p.S12R|NCOA4_ENST00000414907.2_Intron	NM_001145262.1	NP_001138734.1	Q13772	NCOA4_HUMAN	nuclear receptor coactivator 4	12					androgen receptor signaling pathway (GO:0030521)|male gonad development (GO:0008584)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|transcription coactivator activity (GO:0003713)			NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|skin(1)	5						TGGCAGCTCCAGTAATAGAGA	0.408			T	RET	papillary thyroid																																p.S28R				Dom	yes		10	10q11.2	8031	nuclear receptor coactivator 4 - PTC3 (ELE1)		E	.	NCOA4-1042	0			c.A82C						.						48.0	55.0	53.0					10																	51579175		2203	4300	6503	SO:0001583	missense	8031	exon3			AGCTCCAGTAATA	L49399	CCDS73092.1, CCDS73093.1, CCDS73094.1	10q11.2	2014-04-10			ENSG00000138293	ENSG00000266412			7671	protein-coding gene	gene with protein product	"""RET-activating gene ELE1"""	601984				8290261, 8643607, 24695223	Standard	NM_001145260		Approved	ARA70, RFG, ELE1, PTC3, DKFZp762E1112	uc009xon.3	Q13772	OTTHUMG00000188314	ENST00000443446.1:c.34A>C	10.37:g.51579175A>C	ENSP00000390713:p.Ser12Arg	Somatic	67	3		WXS	Illumina HiSeq	Phase_I	64	7	NM_001145261	0	0	6	6	0	A8K8W5|B4E260|E9PAV7|J3KQN8|Q14239	Missense_Mutation	SNP	ENST00000443446.1	37	CCDS7237.1	.	.	.	.	.	.	.	.	.	.	A	19.95	3.921905	0.73213	.	.	ENSG00000138293	ENST00000438493;ENST00000452682;ENST00000374087;ENST00000330923;ENST00000344348;ENST00000374082;ENST00000443446	T;T;T;T;T;T	0.21191	2.36;2.34;2.34;2.34;2.02;2.34	5.79	5.79	0.91817	.	0.460516	0.24321	N	0.039555	T	0.23806	0.0576	L	0.32530	0.975	0.80722	D	1	P;D;P	0.53619	0.931;0.961;0.808	P;P;P	0.49752	0.621;0.621;0.467	T	0.01262	-1.1402	10	0.66056	D	0.02	-18.2451	11.0233	0.47730	0.8279:0.0:0.0:0.1721	.	28;28;12	B4E260;E9PAV7;Q13772	.;.;NCOA4_HUMAN	R	28;28;12;12;12;12;12	ENSP00000405146:S28R;ENSP00000395465:S28R;ENSP00000363200:S12R;ENSP00000344552:S12R;ENSP00000363195:S12R;ENSP00000390713:S12R	ENSP00000332421:S12R	S	+	1	0	NCOA4	51249181	0.809000	0.29036	0.998000	0.56505	0.989000	0.77384	0.888000	0.28268	2.212000	0.71576	0.533000	0.62120	AGT	.		0.408	NCOA4-204	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048052.1	NM_005437	
DNA2	1763	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	70182074	70182074	+	Missense_Mutation	SNP	C	C	T	rs369018277		TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr10:70182074C>T	ENST00000358410.3	-	17	2655	c.2605G>A	c.(2605-2607)Gaa>Aaa	p.E869K	DNA2_ENST00000399180.2_Missense_Mutation_p.E955K|DNA2_ENST00000399179.2_Intron	NM_001080449.2	NP_001073918.2	P51530	DNA2_HUMAN	DNA replication helicase/nuclease 2	869	Helicase activity. {ECO:0000250}.				ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|DNA replication, Okazaki fragment processing (GO:0033567)|DNA replication, removal of RNA primer (GO:0043137)|DNA strand elongation involved in DNA replication (GO:0006271)|mitochondrial DNA repair (GO:0043504)|mitochondrial DNA replication (GO:0006264)|mitotic cell cycle (GO:0000278)|positive regulation of DNA replication (GO:0045740)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	mitochondrial nucleoid (GO:0042645)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|5'-flap endonuclease activity (GO:0017108)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|nuclease activity (GO:0004518)|single-stranded DNA-dependent ATPase activity (GO:0043142)|site-specific endodeoxyribonuclease activity, specific for altered base (GO:0016890)			breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(7)|prostate(1)	20						AATTCCAGTTCCAGCTTCACA	0.393																																					p.E869K		.											.	.	0			c.G2605A						.	C	LYS/GLU	0,3782		0,0,1891	90.0	87.0	88.0		2605	3.0	1.0	10		88	1,8241		0,1,4120	no	missense	DNA2	NM_001080449.2	56	0,1,6011	TT,TC,CC		0.0121,0.0,0.0083	possibly-damaging	869/1061	70182074	1,12023	1891	4121	6012	SO:0001583	missense	1763	exon17			CCAGTTCCAGCTT	D42046	CCDS44415.1, CCDS44415.2	10q21.3-q22.1	2013-05-13	2013-05-13	2008-01-08	ENSG00000138346	ENSG00000138346			2939	protein-coding gene	gene with protein product		601810	"""DNA2 DNA replication helicase 2-like (yeast)"", ""DNA replication helicase 2 homolog (yeast)"""	DNA2L		8938459, 17032657, 23352259	Standard	NM_001080449		Approved	KIAA0083	uc031pvh.1	P51530	OTTHUMG00000018352	ENST00000358410.3:c.2605G>A	10.37:g.70182074C>T	ENSP00000351185:p.Glu869Lys	Somatic	156	0		WXS	Illumina HiSeq	Phase_I	167	58	NM_001080449	0	0	0	0	0	Q2NKM1|Q5TC49|Q5TC50|Q6P455|Q6PI80|Q7Z6H9|Q8N346	Missense_Mutation	SNP	ENST00000358410.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.14|16.14	3.040039|3.040039	0.55003|0.55003	0.0|0.0	1.21E-4|1.21E-4	ENSG00000138346|ENSG00000138346	ENST00000399180;ENST00000358410|ENST00000440722	D;D|.	0.91464|.	-2.85;-2.83|.	4.93|4.93	3.02|3.02	0.34903|0.34903	.|.	1.268580|.	0.05029|.	N|.	0.474288|.	T|T	0.58779|0.58779	0.2146|0.2146	L|L	0.49350|0.49350	1.555|1.555	0.80722|0.80722	D|D	1|1	P|.	0.49358|.	0.923|.	P|.	0.46796|.	0.527|.	T|T	0.54931|0.54931	-0.8219|-0.8219	10|5	0.11182|.	T|.	0.66|.	.|.	10.956|10.956	0.47358|0.47358	0.0:0.845:0.0:0.155|0.0:0.845:0.0:0.155	.|.	869|.	P51530|.	DNA2L_HUMAN|.	K|E	955;869|190	ENSP00000382133:E955K;ENSP00000351185:E869K|.	ENSP00000351185:E869K|.	E|G	-|-	1|2	0|0	DNA2|DNA2	69852080|69852080	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.905000|0.905000	0.53344|0.53344	2.929000|2.929000	0.48916|0.48916	1.035000|1.035000	0.39972|0.39972	0.655000|0.655000	0.94253|0.94253	GAA|GGA	.		0.393	DNA2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000048334.2		
HELLS	3070	bcgsc.ca	37	10	96305697	96305697	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr10:96305697G>A	ENST00000348459.5	+	1	124	c.19G>A	c.(19-21)Gcg>Acg	p.A7T	HELLS_ENST00000394045.1_Missense_Mutation_p.A7T|HELLS_ENST00000394036.1_Missense_Mutation_p.A7T|HELLS_ENST00000394044.1_Missense_Mutation_p.A7T|HELLS_ENST00000371332.4_Missense_Mutation_p.A7T|HELLS_ENST00000239026.6_Missense_Mutation_p.A7T	NM_018063.3	NP_060533.2			helicase, lymphoid-specific											endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22		Colorectal(252;0.0429)		all cancers(201;2.13e-05)		GGAACGGCCCGCGGGCAGCGG	0.692																																					p.A7T													.	HELLS-92	0			c.G19A						.						12.0	13.0	13.0					10																	96305697		2121	4139	6260	SO:0001583	missense	3070	exon1			CGGCCCGCGGGCA	AF155827	CCDS7434.1, CCDS73162.1, CCDS73163.1, CCDS73164.1, CCDS73165.1	10q24.2	2008-08-01			ENSG00000119969	ENSG00000119969			4861	protein-coding gene	gene with protein product	"""SWI/SNF2-related, matrix-associated, actin-dependent regulator of chromatin, subfamily A, member 6"", ""proliferation-associated SNF2-like protein"""	603946				9878251, 10910076	Standard	NM_018063		Approved	PASG, SMARCA6, LSH, Nbla10143	uc001kjt.3	Q9NRZ9	OTTHUMG00000018793	ENST00000348459.5:c.19G>A	10.37:g.96305697G>A	ENSP00000239027:p.Ala7Thr	Somatic	152	4		WXS	Illumina HiSeq	Phase_1	67	36	NM_018063	0	0	0	0	0		Missense_Mutation	SNP	ENST00000348459.5	37	CCDS7434.1	.	.	.	.	.	.	.	.	.	.	G	11.90	1.777463	0.31411	.	.	ENSG00000119969	ENST00000348459;ENST00000394045;ENST00000394044;ENST00000394036;ENST00000371332;ENST00000239026	D;D;D;D	0.96200	-2.52;-2.2;-3.94;-2.7	4.41	3.43	0.39272	.	0.221844	0.36591	N	0.002517	D	0.89598	0.6761	L	0.29908	0.895	0.22866	N	0.998634	B;P;P;B	0.44946	0.382;0.82;0.846;0.382	B;B;B;B	0.36608	0.039;0.202;0.229;0.058	D	0.85080	0.0945	10	0.72032	D	0.01	-13.4778	9.7376	0.40397	0.0:0.211:0.789:0.0	.	7;7;7;7	Q6I7N8;Q9NRZ9-6;Q9NRZ9-5;Q9NRZ9	.;.;.;HELLS_HUMAN	T	7	ENSP00000239027:A7T;ENSP00000377609:A7T;ENSP00000377608:A7T;ENSP00000360383:A7T	ENSP00000239026:A7T	A	+	1	0	HELLS	96295687	0.218000	0.23608	0.996000	0.52242	0.025000	0.11179	1.648000	0.37271	2.450000	0.82876	0.591000	0.81541	GCG	.		0.692	HELLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049475.1	NM_018063	
HPSE2	60495	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	100481443	100481443	+	Silent	SNP	C	C	T	rs200916817		TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr10:100481443C>T	ENST00000370552.3	-	5	986	c.927G>A	c.(925-927)ccG>ccA	p.P309P	HPSE2_ENST00000370546.1_Silent_p.P309P|HPSE2_ENST00000404542.1_Silent_p.P197P|HPSE2_ENST00000370549.1_Silent_p.P251P	NM_021828.4	NP_068600.4	Q8WWQ2	HPSE2_HUMAN	heparanase 2 (inactive)	309					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	intracellular (GO:0005622)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparan sulfate proteoglycan binding (GO:0043395)|heparanase activity (GO:0030305)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	40				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		CATTCTTCCTCGGCCGCCCAA	0.438																																					p.P309P		.											.	HPSE2-91	0			c.G927A						.						55.0	54.0	54.0					10																	100481443		2203	4300	6503	SO:0001819	synonymous_variant	60495	exon5			CTTCCTCGGCCGC	AF282885	CCDS7477.1, CCDS53567.1, CCDS53568.1	10q23-q24	2014-05-09	2014-05-09		ENSG00000172987	ENSG00000172987			18374	protein-coding gene	gene with protein product		613469	"""urofacial syndrome"", ""heparanase 2"""	UFS		11027606, 20605132, 9199567, 20576607	Standard	NM_021828		Approved	HPA2, HPR2	uc001kpn.2	Q8WWQ2	OTTHUMG00000018880	ENST00000370552.3:c.927G>A	10.37:g.100481443C>T		Somatic	59	0		WXS	Illumina HiSeq	Phase_I	64	7	NM_001166246	0	0	0	0	0	Q5VUH4|Q5VUH5|Q5VUH6|Q8WWQ1|Q9HB37|Q9HB38|Q9HB39	Silent	SNP	ENST00000370552.3	37	CCDS7477.1																																																																																			C|0.999;T|0.001		0.438	HPSE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049789.1	NM_021828	
ACADSB	36	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	124800167	124800167	+	Silent	SNP	G	G	A			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr10:124800167G>A	ENST00000358776.4	+	4	503	c.489G>A	c.(487-489)ttG>ttA	p.L163L	ACADSB_ENST00000496730.2_3'UTR|ACADSB_ENST00000368869.4_Silent_p.L61L	NM_001609.3	NP_001600.1	P45954	ACDSB_HUMAN	acyl-CoA dehydrogenase, short/branched chain	163					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|fatty acid metabolic process (GO:0006631)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	17		all_neural(114;0.0765)|Colorectal(57;0.102)|all_lung(145;0.11)|Lung NSC(174;0.163)		Colorectal(40;0.0811)|COAD - Colon adenocarcinoma(40;0.0835)	L-Isoleucine(DB00167)|Valproic Acid(DB00313)	CCACCTATTTGCCTCAGCTCA	0.353																																					p.L163L													.	ACADSB-92	0			c.G489A						.						93.0	92.0	92.0					10																	124800167		2203	4300	6503	SO:0001819	synonymous_variant	36	exon4			CTATTTGCCTCAG	U12778	CCDS7634.1	10q25-q26	2014-09-17	2010-04-30		ENSG00000196177	ENSG00000196177	1.3.99.-		91	protein-coding gene	gene with protein product		600301	"""acyl-Coenzyme A dehydrogenase, short/branched chain"""			7698750, 7759115	Standard	NM_001609		Approved	SBCAD, ACAD7	uc001lhb.3	P45954	OTTHUMG00000019200	ENST00000358776.4:c.489G>A	10.37:g.124800167G>A		Somatic	104	1		WXS	Illumina HiSeq	Phase_I	79	20	NM_001609	0	0	3	6	3	B4DQ51|Q5SQN6|Q96CX7	Silent	SNP	ENST00000358776.4	37	CCDS7634.1	.	.	.	.	.	.	.	.	.	.	G	1.569	-0.534723	0.04082	.	.	ENSG00000196177	ENST00000411816	.	.	.	5.41	1.02	0.19986	.	.	.	.	.	T	0.51092	0.1654	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.33854	-0.9852	4	.	.	.	.	5.0983	0.14745	0.0737:0.1255:0.5425:0.2584	.	.	.	.	Y	169	.	.	C	+	2	0	ACADSB	124790157	0.743000	0.28239	0.081000	0.20488	0.482000	0.33219	1.056000	0.30480	-0.077000	0.12752	-0.345000	0.07892	TGC	.		0.353	ACADSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050843.1	NM_001609	
FRG2B	441581	broad.mit.edu	37	10	135439107	135439107	+	Splice_Site	SNP	C	C	T			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr10:135439107C>T	ENST00000425520.1	-	4	385	c.333G>A	c.(331-333)ggG>ggA	p.G111G	FRG2B_ENST00000443774.1_Splice_Site_p.G112G	NM_001080998.1	NP_001074467.1	Q96QU4	FRG2B_HUMAN	FSHD region gene 2 family, member B	111						nucleus (GO:0005634)				endometrium(2)|kidney(2)|lung(14)|ovary(1)|prostate(1)	20		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		CTGGACAGTTCCCTGCAAAGA	0.512																																					p.G111G													.	.	0			c.G333A						.						15.0	19.0	18.0					10																	135439107		1984	4077	6061	SO:0001630	splice_region_variant	441581	exon4			ACAGTTCCCTGCA	AY744466	CCDS44502.1	10q26.3	2012-10-02			ENSG00000225899	ENSG00000225899			33518	protein-coding gene	gene with protein product						15520407	Standard	NM_001080998		Approved		uc010qvg.2	Q96QU4	OTTHUMG00000019328	ENST00000425520.1:c.332-1G>A	10.37:g.135439107C>T		Somatic	135	0		WXS	Illumina HiSeq	Phase_I	109	3	NM_001080998	0	0	0	0	0	Q5VSQ1	Silent	SNP	ENST00000425520.1	37	CCDS44502.1																																																																																			.		0.512	FRG2B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000467780.1	NM_001080998	Silent
CARNS1	57571	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	67186592	67186592	+	Missense_Mutation	SNP	G	G	C			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr11:67186592G>C	ENST00000307823.3	+	4	813	c.361G>C	c.(361-363)Gga>Cga	p.G121R	CARNS1_ENST00000531040.1_Missense_Mutation_p.G244R|CARNS1_ENST00000423745.2_Missense_Mutation_p.G121R|CARNS1_ENST00000445895.2_Missense_Mutation_p.G244R	NM_020811.1	NP_065862.1	A5YM72	CRNS1_HUMAN	carnosine synthase 1	121					ATP catabolic process (GO:0006200)|carnosine biosynthetic process (GO:0035499)		ATP binding (GO:0005524)|ATPase activity (GO:0016887)|carnosine synthase activity (GO:0047730)|metal ion binding (GO:0046872)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(7)	11						GCTGCTGCGGGGAGGGGATGC	0.652																																					p.G244R		.											.	CARNS1-46	0			c.G730C						.						5.0	7.0	6.0					11																	67186592		1871	3990	5861	SO:0001583	missense	57571	exon5			CTGCGGGGAGGGG		CCDS44658.1, CCDS53667.1	11q13.1	2010-03-25	2010-03-25	2010-03-25	ENSG00000172508	ENSG00000172508			29268	protein-coding gene	gene with protein product		613368	"""ATP-grasp domain containing 1"""	ATPGD1		20097752	Standard	NM_020811		Approved	KIAA1394	uc010rpr.2	A5YM72		ENST00000307823.3:c.361G>C	11.37:g.67186592G>C	ENSP00000308268:p.Gly121Arg	Somatic	46	0		WXS	Illumina HiSeq	Phase_I	37	20	NM_001166222	0	0	0	0	0	A8K1M3|B4DFC6|E9PK38|F5H427|Q8N467|Q9P2F3	Missense_Mutation	SNP	ENST00000307823.3	37	CCDS44658.1	.	.	.	.	.	.	.	.	.	.	G	9.966	1.224062	0.22457	.	.	ENSG00000172508	ENST00000531040;ENST00000307823;ENST00000542831;ENST00000539452;ENST00000423745;ENST00000445895	T;T;T;T	0.32753	1.44;1.47;1.47;1.47	4.38	2.5	0.30297	.	.	.	.	.	T	0.31765	0.0807	N	0.19112	0.55	0.09310	N	1	D;P;D	0.62365	0.982;0.94;0.991	P;P;P	0.60068	0.868;0.605;0.868	T	0.09552	-1.0669	9	0.41790	T	0.15	.	7.4523	0.27246	0.2888:0.0:0.7112:0.0	.	244;121;260	F5H427;A5YM72;A5YM72-3	.;CRNS1_HUMAN;.	R	244;121;244;260;121;244	ENSP00000431670:G244R;ENSP00000308268:G121R;ENSP00000401519:G121R;ENSP00000389009:G244R	ENSP00000308268:G121R	G	+	1	0	CARNS1	66943168	0.111000	0.22076	0.569000	0.28460	0.012000	0.07955	2.541000	0.45735	0.487000	0.27698	0.561000	0.74099	GGA	.		0.652	CARNS1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395501.1	NM_020811	
DYNC2H1	79659	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	103006543	103006543	+	Missense_Mutation	SNP	A	A	G			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr11:103006543A>G	ENST00000375735.2	+	17	2584	c.2440A>G	c.(2440-2442)Aag>Gag	p.K814E	DYNC2H1_ENST00000334267.7_Intron|DYNC2H1_ENST00000398093.3_Missense_Mutation_p.K814E	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	814	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		AAATCAGTTTAAGGGAGTGGG	0.373																																					p.K814E													.	DYNC2H1-68	0			c.A2440G						.						66.0	62.0	63.0					11																	103006543		1812	4068	5880	SO:0001583	missense	79659	exon17			CAGTTTAAGGGAG	AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.2440A>G	11.37:g.103006543A>G	ENSP00000364887:p.Lys814Glu	Somatic	67	1		WXS	Illumina HiSeq	Phase_I	52	26	NM_001377	0	0	0	0	0	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	ENST00000375735.2	37	CCDS53701.1	.	.	.	.	.	.	.	.	.	.	A	17.80	3.479055	0.63849	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	T;T	0.27720	1.65;1.65	5.3	5.3	0.74995	.	.	.	.	.	T	0.29190	0.0726	L	0.51422	1.61	0.42561	D	0.993144	B;B	0.17038	0.02;0.015	B;B	0.24701	0.04;0.055	T	0.10019	-1.0648	9	0.10111	T	0.7	.	15.2748	0.73734	1.0:0.0:0.0:0.0	.	814;814	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	E	814	ENSP00000364887:K814E;ENSP00000381167:K814E	ENSP00000364887:K814E	K	+	1	0	DYNC2H1	102511753	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.018000	0.76406	2.006000	0.58801	0.460000	0.39030	AAG	.		0.373	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	XM_370652	
C11orf53	341032	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	111156468	111156468	+	Missense_Mutation	SNP	A	A	C			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr11:111156468A>C	ENST00000280325.4	+	4	547	c.400A>C	c.(400-402)Agt>Cgt	p.S134R		NM_198498.1	NP_940900.1	Q8IXP5	CK053_HUMAN	chromosome 11 open reading frame 53	134										endometrium(1)|large_intestine(2)|lung(3)|skin(2)	8		all_cancers(61;2.05e-09)|Melanoma(852;4.04e-05)|all_epithelial(67;6.15e-05)|all_hematologic(158;0.000826)|Acute lymphoblastic leukemia(157;0.000966)|all_neural(223;0.0332)|Medulloblastoma(222;0.0425)|Breast(348;0.147)		Epithelial(105;1.7e-06)|BRCA - Breast invasive adenocarcinoma(274;3.16e-06)|all cancers(92;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0507)		ACCCAGCACGAGTTGCCTCTC	0.632																																					p.S134R		.											.	C11orf53-226	0			c.A400C						.						76.0	69.0	71.0					11																	111156468		2201	4297	6498	SO:0001583	missense	341032	exon4			AGCACGAGTTGCC	BC039669	CCDS31674.1	11q23.1	2012-05-31			ENSG00000150750	ENSG00000150750			30527	protein-coding gene	gene with protein product						12477932	Standard	NM_198498		Approved	MGC50104	uc001plc.3	Q8IXP5	OTTHUMG00000166656	ENST00000280325.4:c.400A>C	11.37:g.111156468A>C	ENSP00000280325:p.Ser134Arg	Somatic	101	0		WXS	Illumina HiSeq	Phase_I	50	16	NM_198498	0	0	0	0	0		Missense_Mutation	SNP	ENST00000280325.4	37	CCDS31674.1	.	.	.	.	.	.	.	.	.	.	A	15.69	2.908387	0.52333	.	.	ENSG00000150750	ENST00000280325	.	.	.	4.8	0.97	0.19692	.	0.382752	0.29198	N	0.012842	T	0.39009	0.1062	L	0.55481	1.735	0.09310	N	0.999997	P	0.43701	0.815	P	0.45681	0.49	T	0.21415	-1.0246	9	0.42905	T	0.14	-1.3318	7.5852	0.27989	0.7125:0.0:0.2875:0.0	.	134	Q8IXP5	CK053_HUMAN	R	134	.	ENSP00000280325:S134R	S	+	1	0	C11orf53	110661678	0.055000	0.20627	0.041000	0.18516	0.940000	0.58332	1.282000	0.33226	-0.088000	0.12506	0.459000	0.35465	AGT	.		0.632	C11orf53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390989.1	NM_198498	
TMPRSS13	84000	hgsc.bcm.edu;ucsc.edu	37	11	117789342	117789342	+	Missense_Mutation	SNP	T	T	C	rs75037497		TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr11:117789342T>C	ENST00000430170.2	-	2	320	c.233A>G	c.(232-234)cAg>cGg	p.Q78R	TMPRSS13_ENST00000524993.1_Missense_Mutation_p.Q78R|TMPRSS13_ENST00000526090.1_Missense_Mutation_p.Q78R|TMPRSS13_ENST00000528626.1_Missense_Mutation_p.Q78R|TMPRSS13_ENST00000445164.2_Missense_Mutation_p.Q78R	NM_001244995.1	NP_001231924.1	Q9BYE2	TMPSD_HUMAN	transmembrane protease, serine 13	78	13 X 5 AA repeats of A-S-P-A-[GLQR].|Ala-rich.					blood microparticle (GO:0072562)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			endometrium(1)|kidney(3)|large_intestine(6)|lung(7)|pancreas(1)|prostate(1)|urinary_tract(1)	20	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.00106)		TGGAGATGCCTGGGCTGGAGA	0.672																																					p.Q78R		.											.	TMPRSS13-91	0			c.A233G						.						40.0	48.0	46.0					11																	117789342		1932	4119	6051	SO:0001583	missense	84000	exon2			GATGCCTGGGCTG	AB048796	CCDS41721.1, CCDS55788.1, CCDS55789.1, CCDS58185.1	11q23	2010-04-13	2005-03-11	2005-03-12	ENSG00000137747	ENSG00000137747		"""Serine peptidases / Transmembrane"""	29808	protein-coding gene	gene with protein product		610050	"""transmembrane protease, serine 11"""	TMPRSS11		11267681	Standard	NM_001077263		Approved	MSPL	uc001prs.2	Q9BYE2	OTTHUMG00000166992	ENST00000430170.2:c.233A>G	11.37:g.117789342T>C	ENSP00000387702:p.Gln78Arg	Somatic	73	0		WXS	Illumina HiSeq	Phase_I	52	7	NM_001206790	0	0	0	0	0	B4DTM9|E9PIJ5|F8WAJ3|Q86YM4|Q96JY8|Q9BYE1	Missense_Mutation	SNP	ENST00000430170.2	37	CCDS58185.1	.	.	.	.	.	.	.	.	.	.	t	0.008	-1.884785	0.00532	.	.	ENSG00000137747	ENST00000528626;ENST00000524993;ENST00000430170;ENST00000445164;ENST00000526090	D;D;D;D;D	0.87966	-2.32;-2.25;-2.25;-2.25;-2.14	3.14	-4.2	0.03823	.	0.847229	0.09877	N	0.744233	T	0.60090	0.2242	N	0.01048	-1.04	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.55780	-0.8087	9	0.11182	T	0.66	.	9.3313	0.38023	0.0:0.381:0.0:0.619	.	78	E9PRA0	.	R	78	ENSP00000435813:Q78R;ENSP00000434279:Q78R;ENSP00000387702:Q78R;ENSP00000394114:Q78R;ENSP00000436502:Q78R	ENSP00000387702:Q78R	Q	-	2	0	TMPRSS13	117294552	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.313000	0.08103	-0.789000	0.04498	-1.186000	0.01703	CAG	T|0.500;C|0.500		0.672	TMPRSS13-006	PUTATIVE	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000392318.1	NM_032046	
TMPRSS13	84000	hgsc.bcm.edu;ucsc.edu	37	11	117789345	117789345	+	Missense_Mutation	SNP	G	G	C	rs61900347	byFrequency	TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr11:117789345G>C	ENST00000430170.2	-	2	317	c.230C>G	c.(229-231)gCc>gGc	p.A77G	TMPRSS13_ENST00000524993.1_Missense_Mutation_p.A77G|TMPRSS13_ENST00000526090.1_Missense_Mutation_p.A77G|TMPRSS13_ENST00000528626.1_Missense_Mutation_p.A77G|TMPRSS13_ENST00000445164.2_Missense_Mutation_p.A77G	NM_001244995.1	NP_001231924.1	Q9BYE2	TMPSD_HUMAN	transmembrane protease, serine 13	77	13 X 5 AA repeats of A-S-P-A-[GLQR].|Ala-rich.					blood microparticle (GO:0072562)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			endometrium(1)|kidney(3)|large_intestine(6)|lung(7)|pancreas(1)|prostate(1)|urinary_tract(1)	20	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.00106)		AGATGCCTGGGCTGGAGATGC	0.672													G|||	2	0.000399361	0.0	0.0	5008	,	,		14255	0.002		0.0	False		,,,				2504	0.0				p.A77G		.											.	TMPRSS13-91	0			c.C230G						.						39.0	48.0	45.0					11																	117789345		1921	4109	6030	SO:0001583	missense	84000	exon2			GCCTGGGCTGGAG	AB048796	CCDS41721.1, CCDS55788.1, CCDS55789.1, CCDS58185.1	11q23	2010-04-13	2005-03-11	2005-03-12	ENSG00000137747	ENSG00000137747		"""Serine peptidases / Transmembrane"""	29808	protein-coding gene	gene with protein product		610050	"""transmembrane protease, serine 11"""	TMPRSS11		11267681	Standard	NM_001077263		Approved	MSPL	uc001prs.2	Q9BYE2	OTTHUMG00000166992	ENST00000430170.2:c.230C>G	11.37:g.117789345G>C	ENSP00000387702:p.Ala77Gly	Somatic	75	0		WXS	Illumina HiSeq	Phase_I	49	6	NM_001206790	0	0	0	0	0	B4DTM9|E9PIJ5|F8WAJ3|Q86YM4|Q96JY8|Q9BYE1	Missense_Mutation	SNP	ENST00000430170.2	37	CCDS58185.1	219|219	0.10027472527472528|0.10027472527472528	67|67	0.13617886178861788|0.13617886178861788	52|52	0.143646408839779|0.143646408839779	45|45	0.07867132867132867|0.07867132867132867	55|55	0.07255936675461741|0.07255936675461741	G|G	4.978|4.978	0.181711|0.181711	0.09495|0.09495	.|.	.|.	ENSG00000137747|ENSG00000137747	ENST00000336500|ENST00000528626;ENST00000524993;ENST00000430170;ENST00000445164;ENST00000526090	.|D;D;D;D;D	.|0.88431	.|-2.38;-2.36;-2.36;-2.34;-2.24	3.11|3.11	1.04|1.04	0.20106|0.20106	.|.	.|1.049680	.|0.07486	.|N	.|0.904837	.|T	.|0.02380	.|0.0073	L|L	0.32530|0.32530	0.975|0.975	0.80722|0.80722	P|P	0.0|0.0	.|B	.|0.02656	.|0.0	.|B	.|0.04013	.|0.001	.|T	.|0.28776	.|-1.0033	.|9	.|0.20046	.|T	.|0.44	.|.	6.0296|6.0296	0.19673|0.19673	0.1228:0.2258:0.6514:0.0|0.1228:0.2258:0.6514:0.0	rs61900347|rs61900347	.|77	.|E9PRA0	.|.	.|G	-1|77	.|ENSP00000435813:A77G;ENSP00000434279:A77G;ENSP00000387702:A77G;ENSP00000394114:A77G;ENSP00000436502:A77G	.|ENSP00000387702:A77G	.|A	-|-	.|2	.|0	TMPRSS13|TMPRSS13	117294555|117294555	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	0.105000|0.105000	0.15333|0.15333	-0.045000|-0.045000	0.13468|0.13468	-0.189000|-0.189000	0.12847|0.12847	.|GCC	G|0.899;C|0.101		0.672	TMPRSS13-006	PUTATIVE	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000392318.1	NM_032046	
FOXRED1	55572	broad.mit.edu	37	11	126146393	126146393	+	Missense_Mutation	SNP	A	A	G			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr11:126146393A>G	ENST00000263578.5	+	9	1150	c.1076A>G	c.(1075-1077)tAc>tGc	p.Y359C	FOXRED1_ENST00000532125.1_Missense_Mutation_p.Y345C|FOXRED1_ENST00000442061.2_Missense_Mutation_p.Y189C|FOXRED1_ENST00000534011.1_3'UTR	NM_017547.3	NP_060017.1	Q96CU9	FXRD1_HUMAN	FAD-dependent oxidoreductase domain containing 1	359						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	oxidoreductase activity (GO:0016491)			breast(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(6)|prostate(1)|urinary_tract(1)	15	all_hematologic(175;0.145)	Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0739)|all_lung(97;0.0798)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0729)		GGTAGCAACTACCTAGGTGGT	0.542																																					p.Y359C													.	FOXRED1-90	0			c.A1076G						.						96.0	92.0	94.0					11																	126146393		2201	4298	6499	SO:0001583	missense	55572	exon9			GCAACTACCTAGG		CCDS8471.1	11q24.2	2006-02-03			ENSG00000110074	ENSG00000110074			26927	protein-coding gene	gene with protein product		613622				10497265	Standard	NM_017547		Approved	H17	uc001qdi.3	Q96CU9	OTTHUMG00000165827	ENST00000263578.5:c.1076A>G	11.37:g.126146393A>G	ENSP00000263578:p.Tyr359Cys	Somatic	233	0		WXS	Illumina HiSeq	Phase_I	205	5	NM_017547	0	0	44	47	3	B3KN84|B4DHU2|Q71MG0|Q9BU39|Q9UKY9	Missense_Mutation	SNP	ENST00000263578.5	37	CCDS8471.1	.	.	.	.	.	.	.	.	.	.	a	26.7	4.764863	0.90020	.	.	ENSG00000110074	ENST00000263578;ENST00000442061;ENST00000532125	D;D;D	0.83075	-1.68;-1.68;-1.68	5.63	5.63	0.86233	FAD dependent oxidoreductase (1);	0.106801	0.64402	D	0.000003	D	0.92714	0.7684	M	0.91038	3.17	0.80722	D	1	D;D;D	0.76494	0.996;0.999;0.996	D;D;D	0.72075	0.923;0.976;0.969	D	0.94089	0.7351	9	.	.	.	-9.8756	15.9066	0.79436	1.0:0.0:0.0:0.0	.	345;226;359	Q96CU9-3;B4DI59;Q96CU9	.;.;FXRD1_HUMAN	C	359;189;345	ENSP00000263578:Y359C;ENSP00000404371:Y189C;ENSP00000434178:Y345C	.	Y	+	2	0	FOXRED1	125651603	1.000000	0.71417	0.995000	0.50966	0.982000	0.71751	6.418000	0.73341	2.161000	0.67846	0.468000	0.43344	TAC	.		0.542	FOXRED1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386434.1	NM_017547	
SLC6A13	6540	broad.mit.edu	37	12	347126	347126	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr12:347126C>T	ENST00000343164.4	-	5	581	c.529G>A	c.(529-531)Gag>Aag	p.E177K	SLC6A13_ENST00000445055.2_Missense_Mutation_p.E85K	NM_016615.4	NP_057699.2	Q9NSD5	S6A13_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 13	177					neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(11)|prostate(1)|urinary_tract(1)	28	all_cancers(10;0.0416)|all_epithelial(11;0.0537)|all_lung(10;0.0989)|Lung NSC(10;0.139)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00153)|BRCA - Breast invasive adenocarcinoma(9;0.239)			GTGGCATTCTCAGAGGTACCA	0.532																																					p.E177K													.	SLC6A13-90	0			c.G529A						.						163.0	138.0	146.0					12																	347126		2203	4300	6503	SO:0001583	missense	6540	exon5			CATTCTCAGAGGT	U76343	CCDS8502.1, CCDS53729.1, CCDS58198.1	12p13.33	2013-07-19	2013-07-19		ENSG00000010379	ENSG00000010379		"""Solute carriers"""	11046	protein-coding gene	gene with protein product	"""GABA transporter 2"""	615097	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 13"""				Standard	NM_001243392		Approved	GAT2	uc001qic.2	Q9NSD5	OTTHUMG00000168053	ENST00000343164.4:c.529G>A	12.37:g.347126C>T	ENSP00000339260:p.Glu177Lys	Somatic	225	0		WXS	Illumina HiSeq	Phase_I	220	6	NM_016615	0	0	65	66	1	B4DJL1|Q8TCC2|Q8WW56	Missense_Mutation	SNP	ENST00000343164.4	37	CCDS8502.1	.	.	.	.	.	.	.	.	.	.	C	8.909	0.958247	0.18507	.	.	ENSG00000010379	ENST00000445055;ENST00000313154;ENST00000343164;ENST00000546319	T;T;T	0.74106	-0.81;-0.81;-0.81	5.23	5.23	0.72850	.	0.158145	0.56097	D	0.000033	T	0.65811	0.2727	L	0.37897	1.145	0.46096	D	0.998866	B;B;B	0.18013	0.018;0.025;0.025	B;B;B	0.29524	0.021;0.103;0.014	T	0.59669	-0.7411	10	0.06494	T	0.89	.	17.3393	0.87291	0.0:1.0:0.0:0.0	.	85;156;177	B4DJL1;B4DJS3;Q9NSD5	.;.;S6A13_HUMAN	K	85;156;177;85	ENSP00000407104:E85K;ENSP00000339260:E177K;ENSP00000444606:E85K	ENSP00000318097:E156K	E	-	1	0	SLC6A13	217387	0.997000	0.39634	0.994000	0.49952	0.059000	0.15707	3.474000	0.53129	2.596000	0.87737	0.561000	0.74099	GAG	.		0.532	SLC6A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397801.1	NM_016615	
TPI1	7167	broad.mit.edu;bcgsc.ca	37	12	6976718	6976718	+	Silent	SNP	C	C	T	rs375712848		TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr12:6976718C>T	ENST00000229270.4	+	1	436	c.99C>T	c.(97-99)ctC>ctT	p.L33L	TPI1_ENST00000396705.5_5'UTR|TPI1_ENST00000488464.2_5'Flank|TPI1_ENST00000535434.1_5'Flank	NM_001159287.1	NP_001152759.1	P60174	TPIS_HUMAN	triosephosphate isomerase 1	33					carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glyceraldehyde-3-phosphate metabolic process (GO:0019682)|glycolytic process (GO:0006096)|multicellular organismal development (GO:0007275)|pentose-phosphate shunt (GO:0006098)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	triose-phosphate isomerase activity (GO:0004807)			endometrium(2)|kidney(2)|large_intestine(1)|lung(11)|prostate(1)|skin(2)	19						TTCAGCGCCTCGGCTCCAGCG	0.642																																					p.L33L													.	TPI1-226	0			c.C99T						.	C	,	1,4387		0,1,2193	12.0	16.0	14.0		,99	-0.5	0.0	12		14	0,8590		0,0,4295	no	utr-5,coding-synonymous	TPI1	NM_000365.5,NM_001159287.1	,	0,1,6488	TT,TC,CC		0.0,0.0228,0.0077	,	,33/287	6976718	1,12977	2194	4295	6489	SO:0001819	synonymous_variant	7167	exon1			GCGCCTCGGCTCC		CCDS8566.1, CCDS53740.1, CCDS58206.1	12p13.31	2012-10-02			ENSG00000111669	ENSG00000111669	5.3.1.1		12009	protein-coding gene	gene with protein product		190450					Standard	NM_000365		Approved		uc001qrk.4	P60174	OTTHUMG00000133767	ENST00000229270.4:c.99C>T	12.37:g.6976718C>T		Somatic	91	0		WXS	Illumina HiSeq	Phase_I	69	6	NM_001159287	0	0	91	96	5	B7Z5D8|D3DUS9|P00938|Q6FHP9|Q6IS07|Q8WWD0|Q96AG5	Silent	SNP	ENST00000229270.4	37	CCDS53740.1																																																																																			.		0.642	TPI1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000258252.1	NM_000365	
C14orf39	317761	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	60921717	60921717	+	Splice_Site	SNP	A	A	T			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr14:60921717A>T	ENST00000321731.3	-	16	1663		c.e16+1			NM_174978.2	NP_777638	Q8N1H7	S6OS1_HUMAN	chromosome 14 open reading frame 39						multicellular organismal development (GO:0007275)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)					breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(108;0.0448)		TTCTCATATTACCTGATCTGA	0.313																																					.		.											.	C14orf39-94	0			c.1503+2T>A						.						36.0	39.0	38.0					14																	60921717		2198	4285	6483	SO:0001630	splice_region_variant	317761	exon17			CATATTACCTGAT	AK098187	CCDS9746.1	14q23.1	2012-11-05	2012-11-05	2012-11-05	ENSG00000179008	ENSG00000179008			19849	protein-coding gene	gene with protein product							Standard	NM_174978		Approved	SIX6OS1	uc001xez.4	Q8N1H7	OTTHUMG00000140332	ENST00000321731.3:c.1503+1T>A	14.37:g.60921717A>T		Somatic	24	0		WXS	Illumina HiSeq	Phase_I	15	8	NM_174978	0	0	0	0	0	Q08AQ4	Splice_Site	SNP	ENST00000321731.3	37	CCDS9746.1	.	.	.	.	.	.	.	.	.	.	A	18.17	3.563953	0.65651	.	.	ENSG00000179008	ENST00000321731	.	.	.	5.84	5.84	0.93424	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.5881	0.61944	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	C14orf39	59991470	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	5.199000	0.65152	2.234000	0.73211	0.459000	0.35465	.	.		0.313	C14orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276948.1	NM_174978	Intron
ATAD5	79915	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	29162089	29162089	+	Silent	SNP	T	T	A			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr17:29162089T>A	ENST00000321990.4	+	2	1368	c.990T>A	c.(988-990)ccT>ccA	p.P330P	CTD-2349P21.11_ENST00000580873.1_RNA	NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	330					cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				AGGTTCACCCTATTCCGCCCA	0.378																																					p.P330P		.											.	ATAD5-93	0			c.T990A						.						49.0	51.0	50.0					17																	29162089		2139	4265	6404	SO:0001819	synonymous_variant	79915	exon2			TCACCCTATTCCG		CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.990T>A	17.37:g.29162089T>A		Somatic	189	0		WXS	Illumina HiSeq	Phase_I	167	75	NM_024857	0	0	0	0	0	Q05DH0|Q69YR6|Q9H9I1	Silent	SNP	ENST00000321990.4	37	CCDS11260.1																																																																																			.		0.378	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256206.2	NM_024857	
ORMDL3	94103	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	38078866	38078866	+	Missense_Mutation	SNP	G	G	C			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr17:38078866G>C	ENST00000394169.1	-	6	1893	c.399C>G	c.(397-399)agC>agG	p.S133R	ORMDL3_ENST00000584220.1_Missense_Mutation_p.S117R|ORMDL3_ENST00000579695.1_Missense_Mutation_p.S133R|ORMDL3_ENST00000304046.2_Missense_Mutation_p.S133R			Q8N138	ORML3_HUMAN	ORMDL sphingolipid biosynthesis regulator 3	133					ceramide metabolic process (GO:0006672)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|SPOTS complex (GO:0035339)				endometrium(3)|kidney(1)|lung(1)	5	Colorectal(19;0.000442)		Lung(15;0.0234)			GGATAAGCACGCTCATCAGGG	0.557																																					p.S133R		.											.	ORMDL3-68	0			c.C399G						.						149.0	142.0	144.0					17																	38078866		2203	4300	6503	SO:0001583	missense	94103	exon4			AAGCACGCTCATC		CCDS11355.1	17q12	2014-06-16	2014-06-16		ENSG00000172057	ENSG00000172057			16038	protein-coding gene	gene with protein product		610075	"""ORM1 (S. cerevisiae)-like 3"", ""ORM1-like 3 (S. cerevisiae)"""			23066021	Standard	NM_139280		Approved		uc002htj.2	Q8N138	OTTHUMG00000133249	ENST00000394169.1:c.399C>G	17.37:g.38078866G>C	ENSP00000377724:p.Ser133Arg	Somatic	159	0		WXS	Illumina HiSeq	Phase_I	141	29	NM_139280	0	0	47	83	36	B3KS83|Q6UY83	Missense_Mutation	SNP	ENST00000394169.1	37	CCDS11355.1	.	.	.	.	.	.	.	.	.	.	G	18.25	3.582713	0.65992	.	.	ENSG00000172057	ENST00000304046;ENST00000394169	.	.	.	5.39	-5.34	0.02705	.	0.110120	0.64402	D	0.000008	T	0.59432	0.2193	M	0.65975	2.015	0.34860	D	0.74254	P	0.37573	0.6	P	0.47744	0.556	T	0.65915	-0.6052	9	0.51188	T	0.08	-14.1116	13.4255	0.61022	0.658:0.0:0.342:0.0	.	133	Q8N138	ORML3_HUMAN	R	133	.	ENSP00000304858:S133R	S	-	3	2	ORMDL3	35332392	0.062000	0.20869	0.906000	0.35671	0.939000	0.58152	-0.588000	0.05774	-1.031000	0.03308	-0.345000	0.07892	AGC	.		0.557	ORMDL3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257003.1	NM_139280	
CEP112	201134	ucsc.edu	37	17	63923752	63923752	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr17:63923752G>A	ENST00000392769.2	-	19	2146	c.1928C>T	c.(1927-1929)tCa>tTa	p.S643L	CEP112_ENST00000535342.2_Missense_Mutation_p.S643L|CEP112_ENST00000537949.1_Missense_Mutation_p.S601L|CEP112_ENST00000541355.1_Missense_Mutation_p.S278L	NM_145036.3	NP_659473.2	Q8N8E3	CE112_HUMAN	centrosomal protein 112kDa	643					receptor localization to synapse (GO:0097120)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|inhibitory synapse (GO:0060077)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(8)|lung(11)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	28						AAACTCCTTTGATTGTTTCTC	0.303																																					p.S643L													.	CEP112-90	0			c.C1928T						.						102.0	97.0	98.0					17																	63923752		2203	4300	6503	SO:0001583	missense	201134	exon19			TCCTTTGATTGTT	AF458591	CCDS32710.1, CCDS32711.1	17q24.2	2014-02-20	2011-05-06	2011-05-06	ENSG00000154240	ENSG00000154240			28514	protein-coding gene	gene with protein product			"""coiled-coil domain containing 46"""	CCDC46		21399614	Standard	NM_145036		Approved	MGC33887	uc002jfl.3	Q8N8E3		ENST00000392769.2:c.1928C>T	17.37:g.63923752G>A	ENSP00000376522:p.Ser643Leu	Somatic	23	0		WXS	Illumina HiSeq		34	4	NM_001199165	0	0	5	5	0	Q6PIB5|Q8NCR4|Q8NFR4	Missense_Mutation	SNP	ENST00000392769.2	37	CCDS32710.1	.	.	.	.	.	.	.	.	.	.	G	15.44	2.834098	0.50951	.	.	ENSG00000154240	ENST00000535342;ENST00000392769;ENST00000541355;ENST00000537949	T;T;T;T	0.51574	0.7;0.7;0.7;0.7	4.93	4.93	0.64822	.	0.227463	0.36932	N	0.002336	T	0.52917	0.1764	L	0.51422	1.61	0.32590	N	0.527272	D;D;D	0.54964	0.969;0.969;0.969	P;P;P	0.53313	0.723;0.654;0.723	T	0.58440	-0.7636	10	0.22109	T	0.4	-6.2893	15.4349	0.75137	0.0:0.0:1.0:0.0	.	601;601;643	F5GYE8;A2RRR7;Q8N8E3	.;.;CE112_HUMAN	L	643;643;278;601	ENSP00000442784:S643L;ENSP00000376522:S643L;ENSP00000443711:S278L;ENSP00000440775:S601L	ENSP00000376522:S643L	S	-	2	0	CEP112	61354214	0.984000	0.35163	0.409000	0.26459	0.986000	0.74619	4.019000	0.57181	2.446000	0.82766	0.650000	0.86243	TCA	.		0.303	CEP112-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446582.1	NM_145036	
HELZ	9931	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	65110487	65110487	+	Missense_Mutation	SNP	T	T	G			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr17:65110487T>G	ENST00000358691.5	-	28	4037	c.3871A>C	c.(3871-3873)Att>Ctt	p.I1291L	HELZ_ENST00000580168.1_Missense_Mutation_p.I1292L	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	1291						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					ATCTTATTAATTTCAGGTCCG	0.348																																					p.I1291L		.											.	HELZ-92	0			c.A3871C						.						152.0	136.0	141.0					17																	65110487		1802	4071	5873	SO:0001583	missense	9931	exon28			TATTAATTTCAGG	D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.3871A>C	17.37:g.65110487T>G	ENSP00000351524:p.Ile1291Leu	Somatic	21	0		WXS	Illumina HiSeq	Phase_I	47	31	NM_014877	0	0	0	3	3	I6L9H4	Missense_Mutation	SNP	ENST00000358691.5	37	CCDS42374.1	.	.	.	.	.	.	.	.	.	.	T	12.72	2.022328	0.35701	.	.	ENSG00000198265	ENST00000358691	D	0.82344	-1.6	5.65	4.56	0.56223	.	0.541833	0.21875	N	0.067829	T	0.64283	0.2584	N	0.14661	0.345	0.28505	N	0.913814	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.50625	-0.8806	10	0.10111	T	0.7	-10.9431	7.073	0.25189	0.0:0.078:0.1469:0.7752	.	1292;1291	B7ZLW2;P42694	.;HELZ_HUMAN	L	1291	ENSP00000351524:I1291L	ENSP00000351524:I1291L	I	-	1	0	HELZ	62540949	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	2.522000	0.45572	2.154000	0.67381	0.445000	0.29226	ATT	.		0.348	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000447068.1	NM_014877	
DSC3	1825	bcgsc.ca	37	18	28598133	28598133	+	Nonsense_Mutation	SNP	C	C	T			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr18:28598133C>T	ENST00000360428.4	-	9	1247	c.1167G>A	c.(1165-1167)tgG>tgA	p.W389*	DSC3_ENST00000434452.1_Nonsense_Mutation_p.W389*	NM_001941.3	NP_001932.2	Q14574	DSC3_HUMAN	desmocollin 3	389	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|protein stabilization (GO:0050821)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|desmosome (GO:0030057)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)			endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(6)|lung(29)|ovary(2)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56			OV - Ovarian serous cystadenocarcinoma(10;0.125)			AATTGACTCTCCAATTGGCAG	0.323																																					p.W389X													.	DSC3-94	0			c.G1167A						.						100.0	97.0	98.0					18																	28598133		2202	4294	6496	SO:0001587	stop_gained	1825	exon9			GACTCTCCAATTG	X83929	CCDS32810.1	18q12.1	2014-07-30			ENSG00000134762	ENSG00000134762		"""Cadherins / Major cadherins"""	3037	protein-coding gene	gene with protein product		600271		DSC4		7774948, 8486729	Standard	NM_001941		Approved	CDHF3, DSC, DSC1, DSC2	uc002kwj.4	Q14574	OTTHUMG00000179622	ENST00000360428.4:c.1167G>A	18.37:g.28598133C>T	ENSP00000353608:p.Trp389*	Somatic	58	0		WXS	Illumina HiSeq	Phase_1	54	4	NM_024423	0	0	0	0	0	A6NN35|Q14200|Q9HAZ9	Nonsense_Mutation	SNP	ENST00000360428.4	37	CCDS32810.1	.	.	.	.	.	.	.	.	.	.	C	38	6.731705	0.97796	.	.	ENSG00000134762	ENST00000360428;ENST00000434452	.	.	.	5.36	5.36	0.76844	.	0.784395	0.10265	N	0.695489	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.6188	0.76790	0.0:0.8623:0.1377:0.0	.	.	.	.	X	389	.	ENSP00000353608:W389X	W	-	3	0	DSC3	26852131	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.982000	0.56909	2.805000	0.96524	0.579000	0.79373	TGG	.		0.323	DSC3-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000447384.1	NM_001941, NM_024423	
CREB3L3	84699	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	4171149	4171149	+	Missense_Mutation	SNP	G	G	T			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr19:4171149G>T	ENST00000078445.2	+	8	1099	c.952G>T	c.(952-954)Gcc>Tcc	p.A318S	CREB3L3_ENST00000602147.1_Missense_Mutation_p.S282I|CREB3L3_ENST00000602257.1_Missense_Mutation_p.A316S|CREB3L3_ENST00000252587.3_Intron|CREB3L3_ENST00000595923.1_Missense_Mutation_p.A317S	NM_001271995.1|NM_001271996.1|NM_032607.1	NP_001258924.1|NP_001258925.1|NP_115996.1	Q68CJ9	CR3L3_HUMAN	cAMP responsive element binding protein 3-like 3	318					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|skin(2)|urinary_tract(3)	24				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0232)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGCAAGTCAGCCCAGACAGG	0.607																																					p.A318S		.											.	CREB3L3-92	0			c.G952T						.						75.0	70.0	72.0					19																	4171149		2203	4300	6503	SO:0001583	missense	84699	exon8			AAGTCAGCCCAGA		CCDS12121.1, CCDS62498.1, CCDS62499.1, CCDS62500.1	19p13.3	2013-01-10				ENSG00000060566		"""basic leucine zipper proteins"""	18855	protein-coding gene	gene with protein product		611998				11353085	Standard	NM_032607		Approved	CREB-H	uc002lzl.4	Q68CJ9		ENST00000078445.2:c.952G>T	19.37:g.4171149G>T	ENSP00000078445:p.Ala318Ser	Somatic	147	0		WXS	Illumina HiSeq	Phase_I	115	42	NM_032607	0	0	0	0	0	B2R7S6|B7ZL69|M0QYW7|Q6ZMC5|Q96TB9	Missense_Mutation	SNP	ENST00000078445.2	37	CCDS12121.1	.	.	.	.	.	.	.	.	.	.	G	10.83	1.462217	0.26248	.	.	ENSG00000060566	ENST00000078445;ENST00000381943	D	0.84800	-1.9	4.58	4.58	0.56647	.	0.130552	0.51477	D	0.000098	D	0.87172	0.6111	M	0.67569	2.06	0.52099	D	0.999947	D;P;P	0.62365	0.991;0.712;0.589	P;B;B	0.57204	0.815;0.396;0.223	D	0.84697	0.0726	10	0.26408	T	0.33	-0.2402	8.6838	0.34225	0.1062:0.0:0.8938:0.0	.	316;317;318	B7ZL69;Q68CJ9-2;Q68CJ9	.;.;CR3L3_HUMAN	S	318;276	ENSP00000078445:A318S	ENSP00000078445:A318S	A	+	1	0	CREB3L3	4122149	0.995000	0.38212	0.954000	0.39281	0.235000	0.25334	4.071000	0.57556	2.093000	0.63338	0.561000	0.74099	GCC	.		0.607	CREB3L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457922.1	NM_032607	
OR7G3	390883	broad.mit.edu	37	19	9237432	9237432	+	Missense_Mutation	SNP	G	G	C			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr19:9237432G>C	ENST00000305444.2	-	1	194	c.195C>G	c.(193-195)atC>atG	p.I65M		NM_001001958.1	NP_001001958.1	Q8NG95	OR7G3_HUMAN	olfactory receptor, family 7, subfamily G, member 3	65						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(1)|large_intestine(3)|liver(1)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	15						CCAAGGACAGGATAGAGAGGA	0.547																																					p.I65M													.	OR7G3-69	0			c.C195G						.						130.0	103.0	112.0					19																	9237432		2203	4300	6503	SO:0001583	missense	390883	exon1			GGACAGGATAGAG		CCDS32899.1	19p13.2	2013-09-24			ENSG00000170920	ENSG00000170920		"""GPCR / Class A : Olfactory receptors"""	8467	protein-coding gene	gene with protein product							Standard	NM_001001958		Approved	OST085	uc010xkl.2	Q8NG95	OTTHUMG00000165520	ENST00000305444.2:c.195C>G	19.37:g.9237432G>C	ENSP00000302867:p.Ile65Met	Somatic	257	0		WXS	Illumina HiSeq	Phase_I	233	4	NM_001001958	0	0	0	0	0	Q6IFJ6|Q96R99	Missense_Mutation	SNP	ENST00000305444.2	37	CCDS32899.1	.	.	.	.	.	.	.	.	.	.	G	5.991	0.366728	0.11352	.	.	ENSG00000170920	ENST00000305444	T	0.02974	4.09	4.02	-5.34	0.02705	GPCR, rhodopsin-like superfamily (1);	0.000000	0.45126	U	0.000383	T	0.01523	0.0049	N	0.12569	0.235	0.09310	N	1	B	0.27732	0.187	B	0.28385	0.089	T	0.39440	-0.9614	10	0.87932	D	0	.	7.1572	0.25645	0.4886:0.116:0.3955:0.0	.	65	Q8NG95	OR7G3_HUMAN	M	65	ENSP00000302867:I65M	ENSP00000302867:I65M	I	-	3	3	OR7G3	9098432	0.000000	0.05858	0.000000	0.03702	0.040000	0.13550	-0.199000	0.09491	-1.049000	0.03234	0.558000	0.71614	ATC	.		0.547	OR7G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384611.1		
ZNF227	7770	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	44739325	44739325	+	Nonsense_Mutation	SNP	A	A	T			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr19:44739325A>T	ENST00000313040.7	+	6	947	c.742A>T	c.(742-744)Aaa>Taa	p.K248*	ZNF227_ENST00000589005.1_Nonsense_Mutation_p.K197*|ZNF227_ENST00000391961.2_Nonsense_Mutation_p.K197*	NM_182490.1	NP_872296.1	Q86WZ6	ZN227_HUMAN	zinc finger protein 227	248					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(12)|ovary(2)|stomach(1)|urinary_tract(1)	24		Prostate(69;0.0435)				CTTAGGAGAGAAACCCCATCC	0.428																																					p.K248X		.											.	ZNF227-91	0			c.A742T						.						50.0	52.0	51.0					19																	44739325		2203	4300	6503	SO:0001587	stop_gained	7770	exon6			GGAGAGAAACCCC	AK092253	CCDS12636.1, CCDS74388.1	19q13.32	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	13020	protein-coding gene	gene with protein product							Standard	XM_005259232		Approved		uc002oyu.3	Q86WZ6		ENST00000313040.7:c.742A>T	19.37:g.44739325A>T	ENSP00000321049:p.Lys248*	Somatic	99	0		WXS	Illumina HiSeq	Phase_I	73	29	NM_182490	0	0	1	1	0	B3KRU7|B7Z5P9	Nonsense_Mutation	SNP	ENST00000313040.7	37	CCDS12636.1	.	.	.	.	.	.	.	.	.	.	A	37	6.426321	0.97559	.	.	ENSG00000131115	ENST00000313040;ENST00000328297;ENST00000391961;ENST00000418980	.	.	.	4.04	1.86	0.25419	.	.	.	.	.	.	.	.	.	.	.	0.23150	N	0.99822	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.6647	0.23035	0.7832:0.0:0.2168:0.0	.	.	.	.	X	248;205;197;227	.	ENSP00000321049:K248X	K	+	1	0	ZNF227	49431165	0.006000	0.16342	0.000000	0.03702	0.751000	0.42716	2.219000	0.42899	0.218000	0.20820	0.460000	0.39030	AAA	.		0.428	ZNF227-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460720.1	NM_182490	
C5AR1	728	broad.mit.edu	37	19	47823729	47823729	+	Missense_Mutation	SNP	G	G	A	rs201394213		TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr19:47823729G>A	ENST00000355085.3	+	2	717	c.695G>A	c.(694-696)cGc>cAc	p.R232H		NM_001736.3	NP_001727.1	P21730	C5AR1_HUMAN	complement component 5a receptor 1	232					activation of MAPK activity (GO:0000187)|activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|cell proliferation in hindbrain (GO:0021534)|cellular defense response (GO:0006968)|chemotaxis (GO:0006935)|complement component C5a signaling pathway (GO:0038178)|defense response to Gram-positive bacterium (GO:0050830)|immune response (GO:0006955)|inflammatory response (GO:0006954)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of neuron apoptotic process (GO:0043524)|neutrophil chemotaxis (GO:0030593)|organ regeneration (GO:0031100)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|response to lipopolysaccharide (GO:0032496)|response to peptidoglycan (GO:0032494)|sensory perception of chemical stimulus (GO:0007606)|signal transduction (GO:0007165)	apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C5a anaphylatoxin receptor activity (GO:0004944)|complement component C5a receptor activity (GO:0004878)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(11)|ovary(2)|prostate(1)|skin(1)	20		all_cancers(25;2e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;0.000267)|OV - Ovarian serous cystadenocarcinoma(262;0.000618)|Epithelial(262;0.0142)|GBM - Glioblastoma multiforme(486;0.0242)		ACGTGGAGCCGCAGGGCCACG	0.597																																					.													.	C5AR1-93	0			.						.	G	HIS/ARG	0,4406		0,0,2203	91.0	88.0	89.0		695	4.8	1.0	19		89	1,8599	1.2+/-3.3	0,1,4299	no	missense	C5AR1	NM_001736.3	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	232/351	47823729	1,13005	2203	4300	6503	SO:0001583	missense	728	.			GGAGCCGCAGGGC		CCDS33063.1	19q13.3-q13.4	2012-08-10	2006-02-09	2006-02-09		ENSG00000197405		"""CD molecules"", ""Complement system"", ""GPCR / Class A : Complement component receptors"""	1338	protein-coding gene	gene with protein product		113995	"""complement component 5 receptor 1 (C5a ligand)"""	C5R1		1612600	Standard	NM_001736		Approved	C5A, C5AR, CD88	uc002pgj.1	P21730		ENST00000355085.3:c.695G>A	19.37:g.47823729G>A	ENSP00000347197:p.Arg232His	Somatic	149	0		WXS	Illumina HiSeq	Phase_I	146	4	.	0	0	4	4	0		Missense_Mutation	SNP	ENST00000355085.3	37	CCDS33063.1	.	.	.	.	.	.	.	.	.	.	g	28.0	4.881187	0.91740	0.0	1.16E-4	ENSG00000197405	ENST00000355085	T	0.38560	1.13	4.85	4.85	0.62838	GPCR, rhodopsin-like superfamily (1);	0.459330	0.21120	U	0.079828	T	0.57359	0.2048	M	0.81179	2.53	0.52099	D	0.999945	D	0.61080	0.989	P	0.52066	0.689	T	0.63470	-0.6630	10	0.51188	T	0.08	.	14.8986	0.70661	0.0:0.0:1.0:0.0	.	232	P21730	C5AR_HUMAN	H	232	ENSP00000347197:R232H	ENSP00000347197:R232H	R	+	2	0	C5AR1	52515569	0.000000	0.05858	0.976000	0.42696	0.893000	0.52053	0.899000	0.28417	2.221000	0.72209	0.472000	0.43445	CGC	.		0.597	C5AR1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466925.1	NM_001736	
SIGLEC5	8778	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	52131213	52131213	+	Missense_Mutation	SNP	T	T	A			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr19:52131213T>A	ENST00000534261.2	-	6	1270	c.871A>T	c.(871-873)Acc>Tcc	p.T291S	SIGLEC5_ENST00000429354.3_Missense_Mutation_p.T291S|SIGLEC5_ENST00000599649.1_Missense_Mutation_p.T291S|SIGLEC5_ENST00000222107.4_Missense_Mutation_p.T291S|SIGLEC5_ENST00000570106.2_Missense_Mutation_p.T291S			O15389	SIGL5_HUMAN	sialic acid binding Ig-like lectin 5	291	Ig-like C2-type 2.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|large_intestine(4)|lung(9)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27		all_neural(266;0.0726)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0218)		GAGATGGGGGTGGCGTTCAGG	0.647																																					p.T291S		.											.	SIGLEC5-92	0			c.A871T						.						64.0	71.0	69.0					19																	52131213		2203	4300	6503	SO:0001583	missense	8778	exon5			TGGGGGTGGCGTT	U71383	CCDS33088.1	19q13.41	2013-01-29			ENSG00000105501	ENSG00000105501		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10874	protein-coding gene	gene with protein product		604200		CD33L2		10343116	Standard	NM_003830		Approved	OB-BP2, SIGLEC-5, CD170	uc002pxe.4	O15389	OTTHUMG00000165510	ENST00000534261.2:c.871A>T	19.37:g.52131213T>A	ENSP00000473238:p.Thr291Ser	Somatic	82	0		WXS	Illumina HiSeq	Phase_I	93	37	NM_003830	0	0	0	0	0		Missense_Mutation	SNP	ENST00000534261.2	37	CCDS33088.1	.	.	.	.	.	.	.	.	.	.	T	3.867	-0.028769	0.07589	.	.	ENSG00000105501	ENST00000222107;ENST00000429354	T;T	0.13420	2.59;2.59	3.76	-6.36	0.01969	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.943120	0.02702	N	0.111846	T	0.04952	0.0133	N	0.11560	0.145	0.09310	N	1	B	0.32829	0.386	B	0.35931	0.214	T	0.26883	-1.0090	10	0.02654	T	1	.	1.2256	0.01932	0.4652:0.1053:0.2382:0.1914	.	291	O15389	SIGL5_HUMAN	S	291	ENSP00000222107:T291S;ENSP00000415200:T291S	ENSP00000222107:T291S	T	-	1	0	SIGLEC5	56823025	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-1.639000	0.02011	-1.347000	0.02208	0.383000	0.25322	ACC	.		0.647	SIGLEC5-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466897.2	NM_003830	
MOGS	7841	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	74688599	74688599	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr2:74688599C>T	ENST00000233616.4	-	4	2479	c.2317G>A	c.(2317-2319)Gag>Aag	p.E773K	MOGS_ENST00000409065.1_3'UTR|MOGS_ENST00000452063.2_Missense_Mutation_p.E667K|MOGS_ENST00000462443.1_5'Flank	NM_006302.2	NP_006293.2	Q13724	MOGS_HUMAN	mannosyl-oligosaccharide glucosidase	773					cellular protein metabolic process (GO:0044267)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucosidase activity (GO:0015926)|mannosyl-oligosaccharide glucosidase activity (GO:0004573)			cervix(1)|endometrium(6)|large_intestine(3)|lung(10)|prostate(1)|urinary_tract(2)	23						TGAGGACCCTCCAGATGCCCA	0.592																																					p.E773K		.											.	MOGS-90	0			c.G2317A						.						80.0	88.0	85.0					2																	74688599		2075	4200	6275	SO:0001583	missense	7841	exon4			GACCCTCCAGATG	X87237	CCDS42700.1, CCDS54370.1	2p13.1	2012-01-31			ENSG00000115275	ENSG00000115275	3.2.1.106		24862	protein-coding gene	gene with protein product	"""glucosidase I"", ""processing A-glucosidase I"""	601336				7635146, 8786151	Standard	NM_006302		Approved	GCS1, CWH41, DER7	uc010ffj.3	Q13724	OTTHUMG00000152886	ENST00000233616.4:c.2317G>A	2.37:g.74688599C>T	ENSP00000233616:p.Glu773Lys	Somatic	248	0		WXS	Illumina HiSeq	Phase_I	197	56	NM_006302	0	0	48	70	22	A8K938|F5H6D0|Q17RN9|Q8TCT5	Missense_Mutation	SNP	ENST00000233616.4	37	CCDS42700.1	.	.	.	.	.	.	.	.	.	.	C	7.668	0.686371	0.14973	.	.	ENSG00000115275	ENST00000233616;ENST00000452063	T;T	0.48522	0.81;0.81	4.48	0.633	0.17712	Six-hairpin glycosidase-like (1);	0.109437	0.64402	N	0.000010	T	0.35508	0.0934	L	0.55103	1.725	0.80722	D	1	B	0.06786	0.001	B	0.14023	0.01	T	0.14008	-1.0488	10	0.11794	T	0.64	-2.6164	8.6268	0.33895	0.0:0.6721:0.0:0.3279	.	773	Q13724	MOGS_HUMAN	K	773;667	ENSP00000233616:E773K;ENSP00000388201:E667K	ENSP00000233616:E773K	E	-	1	0	MOGS	74542107	0.580000	0.26733	0.793000	0.32043	0.621000	0.37620	1.175000	0.31944	0.004000	0.14682	-0.244000	0.11960	GAG	.		0.592	MOGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328382.1	NM_006302	
ACMSD	130013	hgsc.bcm.edu;broad.mit.edu	37	2	135621133	135621133	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr2:135621133G>A	ENST00000356140.5	+	5	554	c.418G>A	c.(418-420)Ggg>Agg	p.G140R	ACMSD_ENST00000283054.4_Missense_Mutation_p.G82R|AC016725.4_ENST00000392929.2_RNA|ACMSD_ENST00000392928.1_Missense_Mutation_p.G82R	NM_138326.2	NP_612199.2	Q8TDX5	ACMSD_HUMAN	aminocarboxymuconate semialdehyde decarboxylase	140					cellular nitrogen compound metabolic process (GO:0034641)|quinolinate metabolic process (GO:0046874)|small molecule metabolic process (GO:0044281)|tryptophan catabolic process (GO:0006569)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aminocarboxymuconate-semialdehyde decarboxylase activity (GO:0001760)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(4)|lung(6)|skin(1)	14				BRCA - Breast invasive adenocarcinoma(221;0.115)		GGGCTTTCCCGGGGTCCAAAT	0.632																																					p.G140R		.											.	ACMSD-91	0			c.G418A						.						71.0	58.0	62.0					2																	135621133		2203	4300	6503	SO:0001583	missense	130013	exon5			TTTCCCGGGGTCC	AB071418	CCDS2173.2	2q21.3	2008-03-11			ENSG00000153086	ENSG00000153086	4.1.1.45		19288	protein-coding gene	gene with protein product		608889				12140278	Standard	NM_138326		Approved		uc002ttz.3	Q8TDX5	OTTHUMG00000131711	ENST00000356140.5:c.418G>A	2.37:g.135621133G>A	ENSP00000348459:p.Gly140Arg	Somatic	116	0		WXS	Illumina HiSeq	Phase_I	98	6	NM_138326	0	0	94	99	5	Q3B7X3|Q53SR5|Q96KY2	Missense_Mutation	SNP	ENST00000356140.5	37	CCDS2173.2	.	.	.	.	.	.	.	.	.	.	G	28.8	4.950082	0.92660	.	.	ENSG00000153086	ENST00000356140;ENST00000283054;ENST00000392928	.	.	.	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	D	0.90518	0.7029	H	0.97315	3.98	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.93490	0.6835	9	0.87932	D	0	-10.2027	19.6085	0.95589	0.0:0.0:1.0:0.0	.	82;140	Q53SR5;Q8TDX5	.;ACMSD_HUMAN	R	140;82;82	.	ENSP00000283054:G82R	G	+	1	0	ACMSD	135337603	1.000000	0.71417	0.959000	0.39883	0.755000	0.42902	9.463000	0.97652	2.618000	0.88619	0.561000	0.74099	GGG	.		0.632	ACMSD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254627.1		
SSFA2	6744	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	182774650	182774650	+	Missense_Mutation	SNP	C	C	G			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr2:182774650C>G	ENST00000431877.2	+	9	1617	c.1438C>G	c.(1438-1440)Cct>Gct	p.P480A	SSFA2_ENST00000320370.7_Missense_Mutation_p.P480A|SSFA2_ENST00000428267.2_Missense_Mutation_p.P327A|SSFA2_ENST00000409001.1_Missense_Mutation_p.P480A|SSFA2_ENST00000409136.1_5'Flank	NM_001130445.1	NP_001123917.1	P28290	SSFA2_HUMAN	sperm specific antigen 2	480						cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(18)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	38			OV - Ovarian serous cystadenocarcinoma(117;0.0856)			GGGAGAAGCTCCTCATGTTCC	0.368																																					p.P480A		.											.	SSFA2-153	0			c.C1438G						.						71.0	62.0	65.0					2																	182774650		2203	4300	6503	SO:0001583	missense	6744	exon9			GAAGCTCCTCATG	M61199	CCDS2284.1, CCDS46467.1, CCDS74611.1	2q32.1	2012-02-01			ENSG00000138434	ENSG00000138434			11319	protein-coding gene	gene with protein product	"""cleavage signal-1 protein"", ""KRAS-induced actin-interacting protein"", ""sperm associated antigen 13"""	118990				1555770	Standard	XM_005246812		Approved	CS-1, SPAG13, KRAP, KIAA1927	uc002uoh.3	P28290	OTTHUMG00000132584	ENST00000431877.2:c.1438C>G	2.37:g.182774650C>G	ENSP00000388731:p.Pro480Ala	Somatic	120	0		WXS	Illumina HiSeq	Phase_I	92	39	NM_001130445	0	0	0	1	1	A8K6T0|Q68DA6|Q7Z7L2|Q8N1L3|Q8N263|Q8N7H2|Q8NEN5|Q96E36|Q96PW1	Missense_Mutation	SNP	ENST00000431877.2	37	CCDS46467.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.304280	0.81136	.	.	ENSG00000138434	ENST00000431877;ENST00000320370;ENST00000409001;ENST00000428267	T;T;T;T	0.15372	2.66;2.43;2.66;2.66	5.98	5.98	0.97165	.	0.175872	0.50627	D	0.000116	T	0.44138	0.1279	M	0.73598	2.24	0.58432	D	0.999993	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.997;0.997;0.997	T	0.04946	-1.0916	10	0.33141	T	0.24	-18.1989	18.6367	0.91380	0.0:1.0:0.0:0.0	.	327;480;480;480	E7END2;E9PHV5;P28290;P28290-3	.;.;SSFA2_HUMAN;.	A	480;480;480;327	ENSP00000388731:P480A;ENSP00000314669:P480A;ENSP00000387319:P480A;ENSP00000409867:P327A	ENSP00000314669:P480A	P	+	1	0	SSFA2	182482895	0.994000	0.37717	1.000000	0.80357	0.889000	0.51656	3.435000	0.52849	2.847000	0.97988	0.591000	0.81541	CCT	.		0.368	SSFA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255793.2	NM_006751	
NCKAP1	10787	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	183792879	183792879	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr2:183792879C>T	ENST00000361354.4	-	29	3518	c.3146G>A	c.(3145-3147)gGa>gAa	p.G1049E	NCKAP1_ENST00000478449.1_5'UTR|NCKAP1_ENST00000360982.2_Missense_Mutation_p.G1055E	NM_013436.3	NP_038464.1	Q9Y2A7	NCKP1_HUMAN	NCK-associated protein 1	1049					apical protein localization (GO:0045176)|apoptotic process (GO:0006915)|basal protein localization (GO:0045175)|central nervous system development (GO:0007417)|embryonic body morphogenesis (GO:0010172)|embryonic foregut morphogenesis (GO:0048617)|embryonic heart tube development (GO:0035050)|endoderm development (GO:0007492)|establishment or maintenance of actin cytoskeleton polarity (GO:0030950)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|lamellipodium assembly (GO:0030032)|mesodermal cell migration (GO:0008078)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|paraxial mesoderm morphogenesis (GO:0048340)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|positive regulation of lamellipodium assembly (GO:0010592)|protein stabilization (GO:0050821)|Rac protein signal transduction (GO:0016601)|regulation of protein localization (GO:0032880)|somitogenesis (GO:0001756)|zygotic determination of anterior/posterior axis, embryo (GO:0007354)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)			breast(3)|cervix(2)|endometrium(3)|kidney(4)|large_intestine(11)|lung(16)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			TTCAATGCTTCCTTTGTGAAT	0.358																																					p.G1055E													.	NCKAP1-92	0			c.G3164A						.						122.0	116.0	118.0					2																	183792879		2203	4300	6503	SO:0001583	missense	10787	exon30			ATGCTTCCTTTGT	AB014509	CCDS2287.1, CCDS2288.1	2q32	2009-08-14			ENSG00000061676	ENSG00000061676			7666	protein-coding gene	gene with protein product		604891				10673335, 12181570, 9344857	Standard	NM_013436		Approved	Nap1, HEM2, NAP125	uc002upb.4	Q9Y2A7	OTTHUMG00000132623	ENST00000361354.4:c.3146G>A	2.37:g.183792879C>T	ENSP00000355348:p.Gly1049Glu	Somatic	48	1		WXS	Illumina HiSeq	Phase_I	48	14	NM_205842	0	0	37	77	40	O60329|Q53QN5|Q53S94|Q53Y35	Missense_Mutation	SNP	ENST00000361354.4	37	CCDS2287.1	.	.	.	.	.	.	.	.	.	.	C	17.94	3.511992	0.64522	.	.	ENSG00000061676	ENST00000361354;ENST00000360982	T;T	0.27557	1.66;1.66	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.24353	0.0590	L	0.29908	0.895	0.80722	D	1	B;B	0.20261	0.043;0.035	B;B	0.22152	0.038;0.023	T	0.09618	-1.0666	10	0.06099	T	0.92	-19.0359	19.8353	0.96655	0.0:1.0:0.0:0.0	.	1049;1055	Q9Y2A7;Q9Y2A7-2	NCKP1_HUMAN;.	E	1049;1055	ENSP00000355348:G1049E;ENSP00000354251:G1055E	ENSP00000354251:G1055E	G	-	2	0	NCKAP1	183501124	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.768000	0.85345	2.698000	0.92095	0.586000	0.80456	GGA	.		0.358	NCKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255867.2	NM_205842	
TGIF2	60436	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	35219589	35219589	+	Missense_Mutation	SNP	C	C	A			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr20:35219589C>A	ENST00000373874.2	+	3	668	c.469C>A	c.(469-471)Ctg>Atg	p.L157M	TGIF2-C20orf24_ENST00000558530.1_Intron|TGIF2_ENST00000373872.4_Missense_Mutation_p.L157M|RP5-977B1.11_ENST00000561134.1_RNA	NM_001199514.1|NM_001199515.1	NP_001186443.1|NP_001186444.1	Q9GZN2	TGIF2_HUMAN	TGFB-induced factor homeobox 2	157	Repressive function.				gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nodal signaling pathway (GO:0038092)|positive regulation of neuron differentiation (GO:0045666)|regulation of gastrulation (GO:0010470)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(3)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	14	Breast(12;0.114)	Myeloproliferative disorder(115;0.00878)				TCCCAAGCCCCTGGTGACCCC	0.632																																					p.L157M		.											.	TGIF2-92	0			c.C469A						.						36.0	42.0	40.0					20																	35219589		2203	4300	6503	SO:0001583	missense	60436	exon3			AAGCCCCTGGTGA	AB042646	CCDS13278.1	20q11.23	2012-12-12	2007-02-07		ENSG00000118707	ENSG00000118707		"""Homeoboxes / TALE class"""	15764	protein-coding gene	gene with protein product		607294	"""TGFB-induced factor 2 (TALE family homeobox)"""			11006116	Standard	NM_021809		Approved		uc021wcv.1	Q9GZN2	OTTHUMG00000172332	ENST00000373874.2:c.469C>A	20.37:g.35219589C>A	ENSP00000362981:p.Leu157Met	Somatic	89	0		WXS	Illumina HiSeq	Phase_I	53	30	NM_021809	0	0	1	2	1	B2R9U3|E1P5T9|H0YNI0	Missense_Mutation	SNP	ENST00000373874.2	37	CCDS13278.1	.	.	.	.	.	.	.	.	.	.	C	13.95	2.390012	0.42410	.	.	ENSG00000118707	ENST00000373874;ENST00000373872	T;T	0.65732	-0.17;-0.17	5.57	2.49	0.30216	.	3.072470	0.00622	N	0.000451	T	0.50718	0.1632	N	0.14661	0.345	0.80722	D	1	P	0.47106	0.89	P	0.44990	0.466	T	0.35822	-0.9773	10	0.46703	T	0.11	-14.2668	5.1002	0.14754	0.1452:0.6315:0.0:0.2233	.	157	Q9GZN2	TGIF2_HUMAN	M	157	ENSP00000362981:L157M;ENSP00000362979:L157M	ENSP00000362979:L157M	L	+	1	2	TGIF2	34653003	0.043000	0.20138	0.816000	0.32577	0.586000	0.36452	0.322000	0.19576	0.262000	0.21774	0.561000	0.74099	CTG	.		0.632	TGIF2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079004.2	NM_021809	
SUSD2	56241	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	24583996	24583996	+	Missense_Mutation	SNP	C	C	A			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr22:24583996C>A	ENST00000358321.3	+	13	2495	c.2234C>A	c.(2233-2235)tCc>tAc	p.S745Y		NM_019601.3	NP_062547.1	Q9UGT4	SUSD2_HUMAN	sushi domain containing 2	745	Sushi. {ECO:0000255|PROSITE- ProRule:PRU00302}.				immune response (GO:0006955)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	26						CTGGCGGGTTCCACCATCTAC	0.642																																					p.S745Y		.											.	SUSD2-91	0			c.C2234A						.						80.0	82.0	81.0					22																	24583996		2203	4300	6503	SO:0001583	missense	56241	exon13			CGGGTTCCACCAT	AK026431	CCDS13824.1	22q11-q12	2005-08-16			ENSG00000099994	ENSG00000099994			30667	protein-coding gene	gene with protein product		615825				12477932	Standard	NM_019601		Approved	BK65A6.2, FLJ22778	uc002zzn.1	Q9UGT4	OTTHUMG00000150792	ENST00000358321.3:c.2234C>A	22.37:g.24583996C>A	ENSP00000351075:p.Ser745Tyr	Somatic	472	0		WXS	Illumina HiSeq	Phase_I	357	138	NM_019601	0	0	2	3	1	Q9H5Y6	Missense_Mutation	SNP	ENST00000358321.3	37	CCDS13824.1	.	.	.	.	.	.	.	.	.	.	C	17.35	3.366350	0.61513	.	.	ENSG00000099994	ENST00000358321	T	0.68181	-0.31	4.75	4.75	0.60458	Complement control module (2);Sushi/SCR/CCP (3);	0.119454	0.64402	D	0.000016	D	0.83403	0.5247	M	0.89414	3.03	0.41536	D	0.988484	D	0.76494	0.999	D	0.77004	0.989	D	0.86729	0.1947	10	0.72032	D	0.01	-53.0137	13.6888	0.62533	0.0:1.0:0.0:0.0	.	745	Q9UGT4	SUSD2_HUMAN	Y	745	ENSP00000351075:S745Y	ENSP00000351075:S745Y	S	+	2	0	SUSD2	22913996	0.999000	0.42202	0.998000	0.56505	0.451000	0.32288	4.155000	0.58131	2.383000	0.81215	0.505000	0.49811	TCC	.		0.642	SUSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320088.1	NM_019601	
RFPL1	5988	broad.mit.edu	37	22	29837996	29837996	+	Missense_Mutation	SNP	A	A	G			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr22:29837996A>G	ENST00000354373.2	+	2	1048	c.839A>G	c.(838-840)cAc>cGc	p.H280R	RFPL1S_ENST00000539579.1_RNA|RFPL1S_ENST00000461286.3_RNA	NM_021026.2	NP_066306.2	O75677	RFPL1_HUMAN	ret finger protein-like 1	280	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.						zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(1)|lung(6)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	16						GAGCCACTGCACTTGTTTTTT	0.463																																					p.H280R													.	RFPL1-90	0			c.A839G						.						104.0	89.0	94.0					22																	29837996		2203	4300	6503	SO:0001583	missense	5988	exon2			CACTGCACTTGTT	AJ010228	CCDS13857.2	22q12	2006-04-25			ENSG00000128250	ENSG00000128250		"""RING-type (C3HC4) zinc fingers"""	9977	protein-coding gene	gene with protein product		605968				10508838	Standard	NM_021026		Approved	RNF78	uc003afn.3	O75677	OTTHUMG00000150516	ENST00000354373.2:c.839A>G	22.37:g.29837996A>G	ENSP00000346342:p.His280Arg	Somatic	201	2		WXS	Illumina HiSeq	Phase_I	195	5	NM_021026	0	0	0	0	0	Q6IC06|Q9UJ97	Missense_Mutation	SNP	ENST00000354373.2	37	CCDS13857.2	.	.	.	.	.	.	.	.	.	.	G	3.480	-0.106045	0.06924	.	.	ENSG00000128250	ENST00000354373	T	0.67865	-0.29	1.42	0.296	0.15757	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	.	.	.	.	T	0.23133	0.0559	N	0.00387	-1.565	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.33574	-0.9863	9	0.02654	T	1	.	4.6941	0.12795	0.6416:0.0:0.3584:0.0	.	280	O75677	RFPL1_HUMAN	R	280	ENSP00000346342:H280R	ENSP00000346342:H280R	H	+	2	0	RFPL1	28167996	0.000000	0.05858	0.003000	0.11579	0.009000	0.06853	-1.609000	0.02066	-0.124000	0.11724	-1.063000	0.02288	CAC	.		0.463	RFPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318719.1	NM_021026	
NEFH	4744	hgsc.bcm.edu	37	22	29885562	29885562	+	Missense_Mutation	SNP	G	G	A	rs370929798		TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr22:29885562G>A	ENST00000310624.6	+	4	1966	c.1933G>A	c.(1933-1935)Gaa>Aaa	p.E645K		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	645	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						AACGAAGGAGGAAGCAAAGTC	0.562																																					p.E645K		.											.	NEFH-90	0			c.G1933A						.						82.0	88.0	86.0					22																	29885562		2203	4300	6503	SO:0001583	missense	4744	exon4			AAGGAGGAAGCAA		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1933G>A	22.37:g.29885562G>A	ENSP00000311997:p.Glu645Lys	Somatic	135	0		WXS	Illumina HiSeq	Phase_I	146	49	NM_021076	0	0	0	0	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Missense_Mutation	SNP	ENST00000310624.6	37	CCDS13858.1	.	.	.	.	.	.	.	.	.	.	G	9.212	1.031217	0.19590	.	.	ENSG00000100285	ENST00000328842;ENST00000310624	D	0.83914	-1.78	4.97	4.97	0.65823	.	0.115504	0.38778	N	0.001569	D	0.87783	0.6264	L	0.61218	1.895	0.29104	N	0.881289	P	0.36712	0.566	P	0.52267	0.694	D	0.83526	0.0088	10	0.44086	T	0.13	.	16.1111	0.81263	0.0:0.0:1.0:0.0	.	645	P12036	NFH_HUMAN	K	645	ENSP00000311997:E645K	ENSP00000311997:E645K	E	+	1	0	NEFH	28215562	0.001000	0.12720	0.367000	0.25926	0.091000	0.18340	0.923000	0.28757	2.745000	0.94114	0.491000	0.48974	GAA	.		0.562	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
CACNG2	10369	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	37098581	37098581	+	Missense_Mutation	SNP	G	G	T			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr22:37098581G>T	ENST00000300105.6	-	1	1022	c.41C>A	c.(40-42)aCc>aAc	p.T14N	RP1-293L6.1_ENST00000430281.1_RNA	NM_006078.3	NP_006069.1	Q9Y698	CCG2_HUMAN	calcium channel, voltage-dependent, gamma subunit 2	14					membrane depolarization (GO:0051899)|membrane hyperpolarization (GO:0060081)|neuromuscular junction development (GO:0007528)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(4)|prostate(1)|skin(1)|urinary_tract(1)	18						AGCACCAACGGTGGTTAAAAG	0.488																																					p.T14N		.											.	CACNG2-90	0			c.C41A						.						154.0	142.0	146.0					22																	37098581		2203	4300	6503	SO:0001583	missense	10369	exon1			CCAACGGTGGTTA	AF096322	CCDS13931.1	22q13.1	2006-08-01			ENSG00000166862	ENSG00000166862		"""Calcium channel subunits"""	1406	protein-coding gene	gene with protein product		602911					Standard	NM_006078		Approved	stargazin, MGC138502, MGC138504	uc003aps.2	Q9Y698	OTTHUMG00000030612	ENST00000300105.6:c.41C>A	22.37:g.37098581G>T	ENSP00000300105:p.Thr14Asn	Somatic	104	0		WXS	Illumina HiSeq	Phase_I	149	56	NM_006078	0	0	0	0	0	Q2M1M1|Q5TGT3|Q9UGZ7	Missense_Mutation	SNP	ENST00000300105.6	37	CCDS13931.1	.	.	.	.	.	.	.	.	.	.	g	19.64	3.865847	0.71949	.	.	ENSG00000166862	ENST00000300105	D	0.89681	-2.55	4.77	4.77	0.60923	.	0.000000	0.85682	D	0.000000	D	0.94971	0.8373	M	0.84948	2.725	0.80722	D	1	D	0.62365	0.991	D	0.76071	0.987	D	0.95765	0.8804	10	0.72032	D	0.01	-20.8031	17.8661	0.88795	0.0:0.0:1.0:0.0	.	14	Q9Y698	CCG2_HUMAN	N	14	ENSP00000300105:T14N	ENSP00000300105:T14N	T	-	2	0	CACNG2	35428527	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.265000	0.95647	2.192000	0.70111	0.546000	0.68486	ACC	.		0.488	CACNG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075500.2		
KCNH8	131096	broad.mit.edu;bcgsc.ca	37	3	19554559	19554559	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr3:19554559C>T	ENST00000328405.2	+	13	2443	c.2177C>T	c.(2176-2178)tCc>tTc	p.S726F		NM_144633.2	NP_653234.2	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 8	726					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(3)|lung(37)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	77						gaggCAGTCTCCCTCTCTCCC	0.532																																					p.S726F	NSCLC(124;1625 1765 8018 24930 42026)												.	KCNH8-524	0			c.C2177T						.						67.0	55.0	59.0					3																	19554559		2203	4300	6503	SO:0001583	missense	131096	exon13			CAGTCTCCCTCTC	AY053503	CCDS2632.1	3p24.3	2012-07-05			ENSG00000183960	ENSG00000183960		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18864	protein-coding gene	gene with protein product		608260				16382104	Standard	NM_144633		Approved	Kv12.1, elk3	uc003cbk.1	Q96L42	OTTHUMG00000129891	ENST00000328405.2:c.2177C>T	3.37:g.19554559C>T	ENSP00000328813:p.Ser726Phe	Somatic	248	0		WXS	Illumina HiSeq	Phase_I	265	13	NM_144633	0	0	0	0	0	B7Z2I7|Q59GQ6	Missense_Mutation	SNP	ENST00000328405.2	37	CCDS2632.1	.	.	.	.	.	.	.	.	.	.	C	14.12	2.441905	0.43326	.	.	ENSG00000183960	ENST00000328405	D	0.98792	-5.14	5.44	5.44	0.79542	.	0.000000	0.31709	U	0.007193	D	0.97495	0.9180	L	0.47716	1.5	0.80722	D	1	P	0.37158	0.585	B	0.42188	0.379	D	0.97417	1.0006	9	.	.	.	.	17.4503	0.87590	0.0:1.0:0.0:0.0	.	726	Q96L42	KCNH8_HUMAN	F	726	ENSP00000328813:S726F	.	S	+	2	0	KCNH8	19529563	0.164000	0.22935	0.087000	0.20705	0.252000	0.25951	1.912000	0.39946	2.559000	0.86315	0.585000	0.79938	TCC	.		0.532	KCNH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252139.2	NM_144633	
TRANK1	9881	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	36874430	36874430	+	Missense_Mutation	SNP	C	C	T	rs370553712		TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr3:36874430C>T	ENST00000429976.2	-	21	6759	c.6512G>A	c.(6511-6513)cGt>cAt	p.R2171H	TRANK1_ENST00000428977.2_Missense_Mutation_p.R1621H|TRANK1_ENST00000301807.6_Missense_Mutation_p.R1621H	NM_014831.2	NP_055646.2	O15050	TRNK1_HUMAN	tetratricopeptide repeat and ankyrin repeat containing 1	2171							ATP binding (GO:0005524)|hydrolase activity (GO:0016787)			NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(20)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	73						GGCTTCACAACGCCGCAGAGG	0.438																																					p.R2171H		.											.	TRANK1-24	0			c.G6512A						.	C	HIS/ARG	0,3780		0,0,1890	32.0	32.0	32.0		6512	5.2	0.9	3		32	1,8203		0,1,4101	no	missense	TRANK1	NM_014831.2	29	0,1,5991	TT,TC,CC		0.0122,0.0,0.0083	probably-damaging	2171/2926	36874430	1,11983	1890	4102	5992	SO:0001583	missense	9881	exon21			TCACAACGCCGCA	AK096678	CCDS46789.1, CCDS46789.2	3p22.2	2013-01-11			ENSG00000168016	ENSG00000168016		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29011	protein-coding gene	gene with protein product	"""lupus brain antigen 1"", ""KIAA0342"""					9205841	Standard	NM_014831		Approved	LBA1, KIAA0342	uc003cgj.3	O15050	OTTHUMG00000155848	ENST00000429976.2:c.6512G>A	3.37:g.36874430C>T	ENSP00000416168:p.Arg2171His	Somatic	42	0		WXS	Illumina HiSeq	Phase_I	22	10	NM_014831	0	0	0	0	0	Q8N8K0	Missense_Mutation	SNP	ENST00000429976.2	37	CCDS46789.2	.	.	.	.	.	.	.	.	.	.	C	15.37	2.812080	0.50527	0.0	1.22E-4	ENSG00000168016	ENST00000428977;ENST00000429976;ENST00000301807	T;T;T	0.34667	1.35;1.76;1.35	5.16	5.16	0.70880	.	0.000000	0.48767	D	0.000162	T	0.40743	0.1129	L	0.34521	1.04	0.22156	N	0.999323	D	0.76494	0.999	P	0.57324	0.818	T	0.28459	-1.0043	10	0.72032	D	0.01	.	9.7288	0.40348	0.0:0.8452:0.0:0.1548	.	2171	O15050	TRNK1_HUMAN	H	1621;2171;1621	ENSP00000416826:R1621H;ENSP00000416168:R2171H;ENSP00000301807:R1621H	ENSP00000301807:R1621H	R	-	2	0	TRANK1	36849434	0.977000	0.34250	0.855000	0.33649	0.731000	0.41821	3.068000	0.50018	2.562000	0.86427	0.555000	0.69702	CGT	.		0.438	TRANK1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014831	
KLHDC8B	200942	ucsc.edu;bcgsc.ca	37	3	49212587	49212587	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr3:49212587G>A	ENST00000332780.2	+	5	1068	c.859G>A	c.(859-861)Ggg>Agg	p.G287R	C3orf84_ENST00000443990.1_5'Flank	NM_173546.2	NP_775817.1	Q8IXV7	KLD8B_HUMAN	kelch domain containing 8B	287						cytoplasm (GO:0005737)				endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|skin(1)|stomach(1)	7				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00217)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		TGTGGCCATTGGGGGCCTTGG	0.602																																					p.G287R													.	KLHDC8B-90	0			c.G859A						.						31.0	33.0	33.0					3																	49212587		2203	4300	6503	SO:0001583	missense	200942	exon5			GCCATTGGGGGCC		CCDS2791.1	3p21.31	2008-02-05			ENSG00000185909	ENSG00000185909			28557	protein-coding gene	gene with protein product		613169					Standard	NM_173546		Approved	MGC35097	uc003cwh.3	Q8IXV7	OTTHUMG00000156814	ENST00000332780.2:c.859G>A	3.37:g.49212587G>A	ENSP00000327468:p.Gly287Arg	Somatic	41	0		WXS	Illumina HiSeq		27	4	NM_173546	0	0	0	0	0		Missense_Mutation	SNP	ENST00000332780.2	37	CCDS2791.1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.859659	0.91433	.	.	ENSG00000185909	ENST00000332780;ENST00000538729	D	0.84370	-1.84	5.84	5.84	0.93424	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	D	0.95909	0.8668	H	0.98701	4.305	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97368	0.9974	10	0.87932	D	0	-9.6158	17.2994	0.87178	0.0:0.0:1.0:0.0	.	287	Q8IXV7	KLD8B_HUMAN	R	287;38	ENSP00000327468:G287R	ENSP00000327468:G287R	G	+	1	0	KLHDC8B	49187591	1.000000	0.71417	0.999000	0.59377	0.986000	0.74619	8.455000	0.90355	2.769000	0.95229	0.563000	0.77884	GGG	.		0.602	KLHDC8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345974.1	NM_173546	
BAP1	8314	hgsc.bcm.edu;bcgsc.ca	37	3	52439275	52439275	+	Missense_Mutation	SNP	C	C	A			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr3:52439275C>A	ENST00000460680.1	-	11	1438	c.967G>T	c.(967-969)Gcc>Tcc	p.A323S	BAP1_ENST00000296288.5_Missense_Mutation_p.A305S	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.P324fs*7(1)		NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		TGGGATGGGGCTTGTGCGCAT	0.592			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															p.A323S	GBM(101;493 1458 7992 21037 25532)	.		Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	.	BAP1-1032	1	Deletion - Frameshift(1)	pleura(1)	c.G967T						.						113.0	118.0	116.0					3																	52439275		2203	4300	6503	SO:0001583	missense	8314	exon11			ATGGGGCTTGTGC	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.967G>T	3.37:g.52439275C>A	ENSP00000417132:p.Ala323Ser	Somatic	99	0		WXS	Illumina HiSeq	Phase_I	84	65	NM_004656	0	0	0	0	0	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Missense_Mutation	SNP	ENST00000460680.1	37	CCDS2853.1	.	.	.	.	.	.	.	.	.	.	C	10.53	1.375375	0.24857	.	.	ENSG00000163930	ENST00000460680;ENST00000296288	T;T	0.55588	0.51;0.51	5.7	4.82	0.62117	Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (1);	0.290995	0.39341	N	0.001388	T	0.41789	0.1174	L	0.44542	1.39	0.21782	N	0.999546	B	0.09022	0.002	B	0.14023	0.01	T	0.24512	-1.0158	10	0.24483	T	0.36	-12.9423	9.1237	0.36801	0.0:0.8178:0.0:0.1822	.	323	Q92560	BAP1_HUMAN	S	323;305	ENSP00000417132:A323S;ENSP00000296288:A305S	ENSP00000296288:A305S	A	-	1	0	BAP1	52414315	0.962000	0.33011	0.955000	0.39395	0.115000	0.19883	0.927000	0.28818	1.398000	0.46701	0.655000	0.94253	GCC	.		0.592	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1		
COL8A1	1295	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	99514774	99514774	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr3:99514774G>A	ENST00000261037.3	+	5	2409	c.2029G>A	c.(2029-2031)Gct>Act	p.A677T	COL8A1_ENST00000273342.4_Missense_Mutation_p.A677T	NM_001850.4	NP_001841.2	P27658	CO8A1_HUMAN	collagen, type VIII, alpha 1	677	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.|Nonhelical region (NC1).				angiogenesis (GO:0001525)|camera-type eye morphogenesis (GO:0048593)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epithelial cell proliferation (GO:0050673)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	collagen type VIII trimer (GO:0005591)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)				breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(15)|skin(5)|upper_aerodigestive_tract(1)	27						CGTGTGGGTTGCTCTATTCAA	0.547																																					p.A677T													.	COL8A1-90	0			c.G2029A						.						94.0	87.0	89.0					3																	99514774		2203	4300	6503	SO:0001583	missense	1295	exon5			TGGGTTGCTCTAT	AF170702	CCDS2934.1	3q11.1-q13.2	2013-01-16			ENSG00000144810	ENSG00000144810		"""Collagens"""	2215	protein-coding gene	gene with protein product		120251	"""chromosome 3 open reading frame 7"""	C3orf7		2029894	Standard	NM_001850		Approved	MGC9568	uc003dth.2	P27658	OTTHUMG00000148669	ENST00000261037.3:c.2029G>A	3.37:g.99514774G>A	ENSP00000261037:p.Ala677Thr	Somatic	122	1		WXS	Illumina HiSeq	Phase_I	116	82	NM_001850	0	0	4	4	0	D3DN42|Q53XI6|Q96D07	Missense_Mutation	SNP	ENST00000261037.3	37	CCDS2934.1	.	.	.	.	.	.	.	.	.	.	G	19.48	3.835784	0.71373	.	.	ENSG00000144810	ENST00000261037;ENST00000273342	T;T	0.75260	-0.92;-0.92	6.08	6.08	0.98989	Tumour necrosis factor-like (2);Complement C1q protein (3);	0.051256	0.85682	D	0.000000	D	0.85423	0.5693	M	0.71581	2.175	0.58432	D	0.999998	D;D	0.76494	0.999;0.999	D;D	0.67548	0.952;0.952	D	0.85567	0.1231	10	0.66056	D	0.02	.	18.1659	0.89727	0.0:0.0:1.0:0.0	.	678;677	E7EPK9;P27658	.;CO8A1_HUMAN	T	677	ENSP00000261037:A677T;ENSP00000273342:A677T	ENSP00000261037:A677T	A	+	1	0	COL8A1	100997464	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.869000	0.99810	2.894000	0.99253	0.591000	0.81541	GCT	.		0.547	COL8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309001.1	NM_001850	
XRN1	54464	broad.mit.edu;bcgsc.ca	37	3	142030528	142030528	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr3:142030528C>T	ENST00000264951.4	-	42	5063	c.4946G>A	c.(4945-4947)aGc>aAc	p.S1649N	XRN1_ENST00000392981.2_Missense_Mutation_p.S1637N	NM_019001.3	NP_061874.3	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1	1649					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA catabolic process (GO:0016075)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)	5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(6)|kidney(12)|large_intestine(11)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	61						AGCTGATGAGCTCTCCCGTGG	0.448																																					p.S1649N													.	XRN1-93	0			c.G4946A						.						152.0	153.0	153.0					3																	142030528		2203	4300	6503	SO:0001583	missense	54464	exon42			GATGAGCTCTCCC	AY137776	CCDS3123.1, CCDS63801.1, CCDS75028.1	3q23	2008-02-05			ENSG00000114127	ENSG00000114127			30654	protein-coding gene	gene with protein product		607994				12515382	Standard	XM_005247544		Approved	SEP1	uc003eus.3	Q8IZH2	OTTHUMG00000159251	ENST00000264951.4:c.4946G>A	3.37:g.142030528C>T	ENSP00000264951:p.Ser1649Asn	Somatic	129	1		WXS	Illumina HiSeq	Phase_I	101	8	NM_019001	0	0	0	0	0	Q4G0S3|Q68D88|Q6AI24|Q6MZS8|Q86WS7|Q8N8U4|Q9UF39	Missense_Mutation	SNP	ENST00000264951.4	37	CCDS3123.1	.	.	.	.	.	.	.	.	.	.	C	5.401	0.259143	0.10239	.	.	ENSG00000114127	ENST00000264951;ENST00000392981	T;T	0.31247	1.5;1.5	5.75	0.665	0.17896	.	1.065370	0.07165	N	0.851388	T	0.19406	0.0466	N	0.24115	0.695	0.09310	N	1	B;B	0.27416	0.178;0.112	B;B	0.18263	0.021;0.009	T	0.24048	-1.0171	10	0.49607	T	0.09	-0.0078	6.6837	0.23134	0.0:0.4384:0.3549:0.2066	.	1637;1649	Q8IZH2-2;Q8IZH2	.;XRN1_HUMAN	N	1649;1637	ENSP00000264951:S1649N;ENSP00000376707:S1637N	ENSP00000264951:S1649N	S	-	2	0	XRN1	143513218	0.000000	0.05858	0.001000	0.08648	0.218000	0.24690	0.337000	0.19841	-0.162000	0.10964	-0.345000	0.07892	AGC	.		0.448	XRN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354087.2	NM_019001	
CLDN11	5010	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	170141043	170141043	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr3:170141043C>T	ENST00000064724.3	+	2	521	c.319C>T	c.(319-321)Cgg>Tgg	p.R107W	CLDN11_ENST00000486975.1_Missense_Mutation_p.R107W|CLDN11_ENST00000451576.1_Missense_Mutation_p.R107W|CLDN11_ENST00000489485.1_3'UTR	NM_005602.5	NP_005593.2	O75508	CLD11_HUMAN	claudin 11	107					axon ensheathment (GO:0008366)|calcium-independent cell-cell adhesion (GO:0016338)|spermatogenesis (GO:0007283)	basal part of cell (GO:0045178)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			central_nervous_system(2)|endometrium(2)|large_intestine(1)|liver(2)|lung(3)|ovary(2)	12	all_cancers(22;5.62e-23)|all_epithelial(15;7.54e-28)|all_lung(20;2.51e-17)|Lung NSC(18;1.02e-16)|Ovarian(172;0.000567)|Breast(254;0.137)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)			TCCCTGCATCCGGATGGGCCA	0.607																																					p.R107W		.											.	CLDN11-90	0			c.C319T						.						111.0	105.0	107.0					3																	170141043		2203	4300	6503	SO:0001583	missense	5010	exon2			TGCATCCGGATGG	AF068863	CCDS3213.1	3q26.2-q26.3	2008-08-01	2008-08-01		ENSG00000013297	ENSG00000013297		"""Claudins"""	8514	protein-coding gene	gene with protein product		601326	"""oligodendrocyte transmembrane protein"""	OTM		8661061, 8797478	Standard	NM_005602		Approved	OSP	uc003fgx.3	O75508	OTTHUMG00000158940	ENST00000064724.3:c.319C>T	3.37:g.170141043C>T	ENSP00000064724:p.Arg107Trp	Somatic	210	0		WXS	Illumina HiSeq	Phase_I	174	15	NM_005602	0	0	1	1	0	B2R7C1|D3DNQ5|Q5U0P3	Missense_Mutation	SNP	ENST00000064724.3	37	CCDS3213.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.128510	0.77549	.	.	ENSG00000013297	ENST00000064724;ENST00000486975;ENST00000451576	D;D;D	0.89681	-2.55;-2.55;-2.55	5.81	4.91	0.64330	.	0.175301	0.50627	D	0.000106	D	0.94265	0.8158	M	0.79123	2.44	0.47621	D	0.999477	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.949	D	0.94887	0.8044	10	0.87932	D	0	.	15.8994	0.79362	0.1364:0.8636:0.0:0.0	.	107;107	B4DFI2;O75508	.;CLD11_HUMAN	W	107	ENSP00000064724:R107W;ENSP00000417434:R107W;ENSP00000410185:R107W	ENSP00000064724:R107W	R	+	1	2	CLDN11	171623737	1.000000	0.71417	1.000000	0.80357	0.799000	0.45148	2.422000	0.44696	1.391000	0.46566	0.557000	0.71058	CGG	.		0.607	CLDN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352403.1	NM_005602	
MFN1	55669	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	179082985	179082985	+	Missense_Mutation	SNP	C	C	G			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr3:179082985C>G	ENST00000471841.1	+	7	851	c.725C>G	c.(724-726)tCt>tGt	p.S242C	MFN1_ENST00000280653.7_Missense_Mutation_p.S242C|MFN1_ENST00000263969.5_Missense_Mutation_p.S242C	NM_033540.2	NP_284941	Q8IWA4	MFN1_HUMAN	mitofusin 1	242	Dynamin-type G.				mitochondrial fusion (GO:0008053)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(14)|ovary(3)|prostate(1)|urinary_tract(1)	31	all_cancers(143;1.67e-16)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.00225)|BRCA - Breast invasive adenocarcinoma(182;0.0923)			TGGGATGCCTCTGCATCAGAG	0.328																																					p.S242C		.											.	MFN1-155	0			c.C725G						.						50.0	54.0	53.0					3																	179082985		2203	4300	6503	SO:0001583	missense	55669	exon7			ATGCCTCTGCATC	AF054986	CCDS3228.1	3q26.32	2006-12-13			ENSG00000171109	ENSG00000171109			18262	protein-coding gene	gene with protein product		608506				8358434, 11181170	Standard	NM_033540		Approved	FLJ20693	uc003fjs.3	Q8IWA4	OTTHUMG00000157385	ENST00000471841.1:c.725C>G	3.37:g.179082985C>G	ENSP00000420617:p.Ser242Cys	Somatic	120	0		WXS	Illumina HiSeq	Phase_I	86	66	NM_033540	0	0	0	0	0	B2RAR1|D3DNR6|O15323|O60639|Q9BZB5|Q9NWQ2	Missense_Mutation	SNP	ENST00000471841.1	37	CCDS3228.1	.	.	.	.	.	.	.	.	.	.	C	19.98	3.927490	0.73327	.	.	ENSG00000171109	ENST00000471841;ENST00000280653;ENST00000539169;ENST00000263969;ENST00000489329;ENST00000474903	D;D;D;D;D	0.95447	-3.71;-3.71;-3.71;-3.66;-3.66	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	D	0.98128	0.9382	M	0.88241	2.94	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.998	D;P;P	0.87578	0.998;0.907;0.907	D	0.98003	1.0361	10	0.48119	T	0.1	-19.0836	19.7394	0.96219	0.0:1.0:0.0:0.0	.	242;270;242	Q8IWA4-3;Q4AEJ4;Q8IWA4	.;.;MFN1_HUMAN	C	242;242;242;242;95;105	ENSP00000420617:S242C;ENSP00000280653:S242C;ENSP00000263969:S242C;ENSP00000420148:S95C;ENSP00000419926:S105C	ENSP00000263969:S242C	S	+	2	0	MFN1	180565679	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.739000	0.68622	2.649000	0.89929	0.563000	0.77884	TCT	.		0.328	MFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348654.2	NM_017927	
MUC4	4585	bcgsc.ca	37	3	195510149	195510149	+	Missense_Mutation	SNP	G	G	A	rs542186658	byFrequency	TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr3:195510149G>A	ENST00000463781.3	-	2	8761	c.8302C>T	c.(8302-8304)Cct>Tct	p.P2768S	MUC4_ENST00000475231.1_Missense_Mutation_p.P2768S|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.P2768S(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACAGGAAGAGGGGTGGCGTGA	0.577													.|||	2	0.000399361	0.0015	0.0	5008	,	,		5215	0.0		0.0	False		,,,				2504	0.0				p.P2768S													.	MUC4-90	1	Substitution - Missense(1)	endometrium(1)	c.C8302T						.																																			SO:0001583	missense	4585	exon2			GAAGAGGGGTGGC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8302C>T	3.37:g.195510149G>A	ENSP00000417498:p.Pro2768Ser	Somatic	467	12		WXS	Illumina HiSeq	Phase_1	555	24	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	5.381	0.255488	0.10185	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.27256	1.68;1.68	1.02	-2.03	0.07365	.	.	.	.	.	T	0.09158	0.0226	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.33523	-0.9865	8	.	.	.	.	2.0272	0.03521	0.2702:0.0:0.2738:0.456	.	2640	E7ESK3	.	S	2768	ENSP00000417498:P2768S;ENSP00000420243:P2768S	.	P	-	1	0	MUC4	196994928	0.000000	0.05858	0.010000	0.14722	0.113000	0.19764	-2.060000	0.01392	-0.413000	0.07507	0.074000	0.15403	CCT	.		0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
DSPP	1834	hgsc.bcm.edu	37	4	88536475	88536475	+	Missense_Mutation	SNP	A	A	C	rs576476534	byFrequency	TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr4:88536475A>C	ENST00000282478.7	+	4	2694	c.2661A>C	c.(2659-2661)gaA>gaC	p.E887D	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Missense_Mutation_p.E887D			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	887	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		acagcaacgaaagcagcaata	0.488													a|||	3	0.000599042	0.0008	0.0	5008	,	,		31731	0.001		0.001	False		,,,				2504	0.0				p.E887D		.											.	DSPP-90	0			c.A2661C						.						76.0	91.0	86.0					4																	88536475		1633	2927	4560	SO:0001583	missense	1834	exon5			CAACGAAAGCAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.2661A>C	4.37:g.88536475A>C	ENSP00000282478:p.Glu887Asp	Somatic	321	0		WXS	Illumina HiSeq	Phase_I	356	45	NM_014208	0	0	0	0	0	A8MUI0|O95815	Missense_Mutation	SNP	ENST00000282478.7	37	CCDS43248.1	.	.	.	.	.	.	.	.	.	.	a	0.030	-1.340968	0.01277	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.87650	-2.28;-2.28	0.951	0.0257	0.14146	.	.	.	.	.	T	0.59404	0.2191	N	0.00621	-1.32	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.52852	-0.8520	9	0.44086	T	0.13	.	1.9373	0.03340	0.3085:0.4592:0.0:0.2323	.	887	Q9NZW4	DSPP_HUMAN	D	887	ENSP00000382213:E887D;ENSP00000282478:E887D	ENSP00000282478:E887D	E	+	3	2	DSPP	88755499	0.000000	0.05858	0.916000	0.36221	0.001000	0.01503	-1.876000	0.01633	-0.574000	0.05990	-3.628000	0.00027	GAA	.		0.488	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
FGG	2266	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	155526043	155526043	+	Silent	SNP	T	T	C			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr4:155526043T>C	ENST00000336098.3	-	9	1343	c.1305A>G	c.(1303-1305)agA>agG	p.R435R	FGG_ENST00000407946.1_Silent_p.R443R|FGG_ENST00000404648.3_Intron|FGG_ENST00000405164.1_Intron	NM_021870.2	NP_068656.2	P02679	FIBG_HUMAN	fibrinogen gamma chain	435	Platelet aggregation and Staphylococcus clumping.			R -> Y (in Ref. 15; AA sequence). {ECO:0000305}.	blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|extracellular matrix organization (GO:0030198)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|receptor binding (GO:0005102)|structural molecule activity (GO:0005198)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(9)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	27	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	GGTGCTCTGGTCTGACCTGTT	0.433																																					p.R435R		.											.	FGG-90	0			c.A1305G						.						198.0	188.0	192.0					4																	155526043		2203	4300	6503	SO:0001819	synonymous_variant	2266	exon9			CTCTGGTCTGACC		CCDS3788.1, CCDS47153.1	4q28	2014-09-17			ENSG00000171557	ENSG00000171557		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3694	protein-coding gene	gene with protein product		134850	"""fibrinogen, gamma polypeptide"""				Standard	NM_000509		Approved		uc003ioj.3	P02679	OTTHUMG00000150329	ENST00000336098.3:c.1305A>G	4.37:g.155526043T>C		Somatic	66	0		WXS	Illumina HiSeq	Phase_I	93	37	NM_021870	0	0	0	0	0	A8K057|P04469|P04470|Q53Y18|Q96A14|Q96KJ3|Q9UC62|Q9UC63|Q9UCF3	Silent	SNP	ENST00000336098.3	37	CCDS3788.1																																																																																			.		0.433	FGG-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000317581.1	NM_021870	
CDH18	1016	broad.mit.edu;bcgsc.ca	37	5	19612631	19612631	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr5:19612631C>T	ENST00000507958.1	-	8	1713	c.723G>A	c.(721-723)atG>atA	p.M241I	CDH18_ENST00000274170.4_Missense_Mutation_p.M241I|CDH18_ENST00000502796.1_Missense_Mutation_p.M241I|CDH18_ENST00000506372.1_Missense_Mutation_p.M241I|CDH18_ENST00000382275.1_Missense_Mutation_p.M241I|CDH18_ENST00000511273.1_Missense_Mutation_p.M241I			Q13634	CAD18_HUMAN	cadherin 18, type 2	241	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.M241I(2)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(24)|lung(76)|ovary(5)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)	138	Lung NSC(1;0.00734)|all_lung(1;0.0197)					CTTGCCCAGCCATGTCTTTGG	0.418																																					p.M241I													.	CDH18-159	2	Substitution - Missense(2)	lung(2)	c.G723A						.						143.0	132.0	136.0					5																	19612631		2203	4300	6503	SO:0001583	missense	1016	exon6			CCCAGCCATGTCT	U59325	CCDS3889.1, CCDS54835.1, CCDS75229.1	5p14.3	2010-01-26			ENSG00000145526	ENSG00000145526		"""Cadherins / Major cadherins"""	1757	protein-coding gene	gene with protein product		603019				9030594, 10191097	Standard	NM_004934		Approved	CDH14, EY-CADHERIN	uc003jgd.3	Q13634	OTTHUMG00000090578	ENST00000507958.1:c.723G>A	5.37:g.19612631C>T	ENSP00000425093:p.Met241Ile	Somatic	207	0		WXS	Illumina HiSeq	Phase_I	209	7	NM_001167667	0	0	0	0	0	A8K0I2|B4DHG6|Q8N5Z2	Missense_Mutation	SNP	ENST00000507958.1	37	CCDS3889.1	.	.	.	.	.	.	.	.	.	.	C	33	5.199495	0.94997	.	.	ENSG00000145526	ENST00000382275;ENST00000507958;ENST00000542864;ENST00000274170;ENST00000506372;ENST00000502796;ENST00000515257;ENST00000511273	T;T;T;T;T;T;T	0.51817	0.69;0.69;0.69;0.69;0.69;0.69;0.69	5.95	5.95	0.96441	Cadherin (5);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.69405	0.3107	M	0.69823	2.125	0.58432	D	0.999999	D;D	0.89917	0.99;1.0	D;D	0.91635	0.972;0.999	T	0.66610	-0.5880	9	.	.	.	.	18.9386	0.92597	0.0:1.0:0.0:0.0	.	241;241	B4DHG6;Q13634	.;CAD18_HUMAN	I	241;241;241;241;241;241;187;241	ENSP00000371710:M241I;ENSP00000425093:M241I;ENSP00000274170:M241I;ENSP00000424931:M241I;ENSP00000422138:M241I;ENSP00000427383:M187I;ENSP00000425854:M241I	.	M	-	3	0	CDH18	19648388	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.672000	0.83956	2.817000	0.96982	0.563000	0.77884	ATG	.		0.418	CDH18-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366747.1	NM_004934	
AMACR	23600	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	34004755	34004755	+	Missense_Mutation	SNP	A	A	G	rs147265006		TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr5:34004755A>G	ENST00000335606.6	-	3	564	c.476T>C	c.(475-477)aTg>aCg	p.M159T	RP11-1084J3.4_ENST00000382079.3_Intron|AMACR_ENST00000514195.1_Intron|AMACR_ENST00000382085.3_Missense_Mutation_p.M159T|AMACR_ENST00000502637.1_Missense_Mutation_p.M159T|AMACR_ENST00000426255.2_Missense_Mutation_p.M159T|AMACR_ENST00000382068.3_Intron|AMACR_ENST00000441713.2_Intron|AMACR_ENST00000512079.1_Missense_Mutation_p.M159T|AMACR_ENST00000382072.2_Intron	NM_001167595.1|NM_014324.5	NP_001161067.1|NP_055139.4	Q9UHK6	AMACR_HUMAN	alpha-methylacyl-CoA racemase	159					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	alpha-methylacyl-CoA racemase activity (GO:0008111)|receptor binding (GO:0005102)			endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|stomach(1)|urinary_tract(1)	19						CAGTGCACACATAAGGCCACC	0.463																																					p.M159T													.	AMACR-90	0			c.T476C						.						127.0	112.0	117.0					5																	34004755		2203	4300	6503	SO:0001583	missense	23600	exon3			GCACACATAAGGC	AF047020	CCDS3902.1, CCDS3903.1, CCDS54836.1	5p13.2	2012-05-16			ENSG00000242110	ENSG00000242110	5.1.99.4		451	protein-coding gene	gene with protein product		604489				9307041	Standard	NM_014324		Approved	RACE	uc003jij.3	Q9UHK6	OTTHUMG00000090734	ENST00000335606.6:c.476T>C	5.37:g.34004755A>G	ENSP00000334424:p.Met159Thr	Somatic	519	2		WXS	Illumina HiSeq	Phase_I	398	148	NM_014324	0	0	7	13	6	A5YM47|B8Y916|B8Y918|F8W9N1|O43673|Q3KT79|Q96GH1|Q9Y3Q1	Missense_Mutation	SNP	ENST00000335606.6	37	CCDS3902.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	A	3.429	-0.116430	0.06881	.	.	ENSG00000242110	ENST00000335606;ENST00000382085;ENST00000502637	T;T;T	0.54071	0.59;0.59;0.59	5.92	3.25	0.37280	CoA-transferase family III domain (2);	0.285879	0.49305	D	0.000146	T	0.36552	0.0971	N	0.20845	0.615	0.80722	D	1	B;B;B;B	0.22146	0.016;0.065;0.044;0.044	B;B;B;B	0.25405	0.06;0.02;0.034;0.034	T	0.15838	-1.0423	10	0.37606	T	0.19	-16.8025	11.0712	0.48004	0.855:0.0:0.145:0.0	.	159;159;159;159	B3KMU8;F8W9N1;D6RB81;Q9UHK6	.;.;.;AMACR_HUMAN	T	159	ENSP00000334424:M159T;ENSP00000371517:M159T;ENSP00000424351:M159T	ENSP00000334424:M159T	M	-	2	0	AMACR	34040512	0.734000	0.28142	1.000000	0.80357	0.008000	0.06430	3.781000	0.55394	1.074000	0.40909	-0.250000	0.11733	ATG	A|0.999;G|0.000		0.463	AMACR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207467.1	NM_014324	
TNXB	7148	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	32052212	32052212	+	Silent	SNP	C	C	T			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr6:32052212C>T	ENST00000375244.3	-	8	3624	c.3423G>A	c.(3421-3423)ccG>ccA	p.P1141P	TNXB_ENST00000375247.2_Silent_p.P1141P			P22105	TENX_HUMAN	tenascin XB	1228					actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						CAGCCACCAGCGGACCATGCC	0.557																																					p.P1141P													.	TNXB-90	0			c.G3423A						.						68.0	74.0	72.0					6																	32052212		1364	2608	3972	SO:0001819	synonymous_variant	7148	exon8			CACCAGCGGACCA	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.3423G>A	6.37:g.32052212C>T		Somatic	174	1		WXS	Illumina HiSeq	Phase_I	150	53	NM_019105	0	0	0	0	0	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Silent	SNP	ENST00000375244.3	37																																																																																				.		0.557	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000268927.2	NM_019105	
THSD7A	221981	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	11675888	11675888	+	Silent	SNP	G	G	A	rs375820480		TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr7:11675888G>A	ENST00000423059.4	-	2	1142	c.891C>T	c.(889-891)cgC>cgT	p.R297R	THSD7A_ENST00000480061.1_5'Flank	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	297					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		TAATAAGCTCGCGGGCTTCTG	0.463										HNSCC(18;0.044)																											p.R297R		.											.	THSD7A-71	0			c.C891T						.	G		0,3716		0,0,1858	137.0	131.0	133.0		891	-11.2	0.6	7		133	1,8219		0,1,4109	no	coding-synonymous	THSD7A	NM_015204.2		0,1,5967	AA,AG,GG		0.0122,0.0,0.0084		297/1658	11675888	1,11935	1858	4110	5968	SO:0001819	synonymous_variant	221981	exon2			AAGCTCGCGGGCT		CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.891C>T	7.37:g.11675888G>A		Somatic	80	0		WXS	Illumina HiSeq	Phase_I	46	21	NM_015204	0	0	0	0	0		Silent	SNP	ENST00000423059.4	37	CCDS47543.1																																																																																			.		0.463	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325944.4	XM_928187.2	
ZAN	7455	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	100352929	100352929	+	RNA	SNP	C	C	G			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr7:100352929C>G	ENST00000348028.3	+	0	3370				ZAN_ENST00000546292.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000542585.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			CTGTGGGCCCCTCTGTCGGGA	0.557																																					.													.	ZAN-142	0			.						.						121.0	127.0	125.0					7																	100352929		1929	4130	6059			7455	.			GGGCCCCTCTGTC	U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100352929C>G		Somatic	98	0		WXS	Illumina HiSeq	Phase_I	112	41	.	0	0	0	0	0	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Missense_Mutation	SNP	ENST00000348028.3	37		.	.	.	.	.	.	.	.	.	.	c	5.830	0.337470	0.11013	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585	D;D;D	0.90324	-2.65;-2.65;-2.65	5.13	-0.258	0.12975	Protease inhibitor I8, cysteine-rich trypsin inhibitor-like (2);	1.663920	0.03653	N	0.241360	T	0.81470	0.4829	N	0.10645	0.015	0.09310	N	0.999999	B;B	0.18461	0.023;0.028	B;B	0.18263	0.012;0.021	T	0.67518	-0.5650	10	0.30078	T	0.28	.	10.313	0.43721	0.0:0.3794:0.5402:0.0803	.	1069;1069	F5H0T8;Q9Y493	.;ZAN_HUMAN	V	1069	ENSP00000445943:L1069V;ENSP00000445091:L1069V;ENSP00000444427:L1069V	ENSP00000423579:L1069V	L	+	1	0	ZAN	100190865	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-0.012000	0.12699	-0.157000	0.11059	0.651000	0.88453	CTC	.		0.557	ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000347214.1	NM_003386	
IMMP2L	83943	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	111161447	111161447	+	Silent	SNP	G	G	A			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr7:111161447G>A	ENST00000405709.2	-	2	499	c.57C>T	c.(55-57)ttC>ttT	p.F19F	IMMP2L_ENST00000331762.3_Silent_p.F19F|IMMP2L_ENST00000447215.1_Silent_p.F19F|IMMP2L_ENST00000452895.1_Silent_p.F19F|IMMP2L_ENST00000437687.1_Silent_p.F19F|IMMP2L_ENST00000415362.1_Silent_p.F19F	NM_032549.3	NP_115938.1	Q96T52	IMP2L_HUMAN	IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae)	19					ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|protein processing involved in protein targeting to mitochondrion (GO:0006627)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|mitochondrial inner membrane peptidase complex (GO:0042720)	peptidase activity (GO:0008233)|serine-type peptidase activity (GO:0008236)			endometrium(3)|large_intestine(6)|lung(5)	14				UCEC - Uterine corpus endometrioid carcinoma (4;0.053)|Epithelial(3;2.27e-07)|all cancers(3;1.36e-05)|STAD - Stomach adenocarcinoma(3;0.00148)|KIRC - Kidney renal clear cell carcinoma(11;0.0339)|Lung(3;0.0375)|Kidney(11;0.0415)|LUSC - Lung squamous cell carcinoma(290;0.173)		CCGCCACAAAGAAGCCTTTAC	0.433																																					p.F19F		.											.	IMMP2L-93	0			c.C57T						.						107.0	106.0	106.0					7																	111161447		2203	4300	6503	SO:0001819	synonymous_variant	83943	exon2			CACAAAGAAGCCT	AF359563	CCDS5753.1	7q31	2014-01-06	2005-08-17		ENSG00000184903	ENSG00000184903			14598	protein-coding gene	gene with protein product		605977	"""IMP2 inner mitochondrial membrane protease-like (S. cerevisiae)"", ""IMMP2L intronic transcript 1 (non-protein coding)"""	IMMP2L-IT1		11254443	Standard	NM_032549		Approved	IMP2	uc010ljr.2	Q96T52	OTTHUMG00000155023	ENST00000405709.2:c.57C>T	7.37:g.111161447G>A		Somatic	86	0		WXS	Illumina HiSeq	Phase_I	58	17	NM_032549	0	0	8	14	6	Q75MF1|Q75MN9|Q75MP0|Q75MS5|Q75MS8|Q96HJ2	Silent	SNP	ENST00000405709.2	37	CCDS5753.1																																																																																			.		0.433	IMMP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338109.4	NM_032549	
KIAA1147	57189	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	141365048	141365048	+	Silent	SNP	A	A	T			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr7:141365048A>T	ENST00000536163.1	-	6	890	c.891T>A	c.(889-891)ccT>ccA	p.P297P	RP5-894A10.6_ENST00000602609.1_RNA|KIAA1147_ENST00000482493.1_Silent_p.P193P	NM_001080392.1	NP_001073861.1	A4D1U4	LCHN_HUMAN	KIAA1147	297										breast(3)|endometrium(4)|kidney(2)|large_intestine(1)|ovary(1)|skin(1)	12	Melanoma(164;0.0171)					CGTAGAAGAAAGGTTTGGACT	0.597																																					p.P297P		.											.	KIAA1147-69	0			c.T891A						.						82.0	89.0	87.0					7																	141365048		2145	4228	6373	SO:0001819	synonymous_variant	57189	exon6			GAAGAAAGGTTTG	AB032973	CCDS47726.1	7q34	2012-10-04			ENSG00000257093	ENSG00000257093			29472	protein-coding gene	gene with protein product							Standard	NM_001080392		Approved	LCHN	uc003vwk.3	A4D1U4	OTTHUMG00000157539	ENST00000536163.1:c.891T>A	7.37:g.141365048A>T		Somatic	250	0		WXS	Illumina HiSeq	Phase_I	190	65	NM_001080392	0	0	4	7	3	Q9ULS3	Silent	SNP	ENST00000536163.1	37	CCDS47726.1																																																																																			.		0.597	KIAA1147-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349104.1		
CUL1	8454	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	148496376	148496376	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr7:148496376G>A	ENST00000325222.4	+	21	2425	c.2146G>A	c.(2146-2148)Gtg>Atg	p.V716M	CUL1_ENST00000409469.1_Missense_Mutation_p.V716M|CUL1_ENST00000602748.1_Missense_Mutation_p.V716M	NM_003592.2	NP_003583.2	Q13616	CUL1_HUMAN	cullin 1	716					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic cell cycle (GO:0000278)|negative regulation of cell proliferation (GO:0008285)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|viral process (GO:0016032)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|SCF ubiquitin ligase complex (GO:0019005)				breast(2)|central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(10)|liver(2)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	40	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			GGCGGCCATCGTGAGAATCAT	0.478																																					p.V716M		.											.	CUL1-226	0			c.G2146A						.						139.0	106.0	117.0					7																	148496376		2203	4300	6503	SO:0001583	missense	8454	exon21			GCCATCGTGAGAA	U58087	CCDS34772.1	7q36.1	2011-05-24			ENSG00000055130	ENSG00000055130			2551	protein-coding gene	gene with protein product		603134				8681378	Standard	NM_003592		Approved		uc003wey.3	Q13616	OTTHUMG00000152776	ENST00000325222.4:c.2146G>A	7.37:g.148496376G>A	ENSP00000326804:p.Val716Met	Somatic	181	0		WXS	Illumina HiSeq	Phase_I	114	42	NM_003592	0	0	0	0	0	D3DWG3|O60719|Q08AL6|Q8IYW1	Missense_Mutation	SNP	ENST00000325222.4	37	CCDS34772.1	.	.	.	.	.	.	.	.	.	.	.	28.3	4.905971	0.92107	.	.	ENSG00000055130	ENST00000409469;ENST00000325222;ENST00000433865	D;D	0.89270	-2.49;-2.49	5.3	5.3	0.74995	Cullin protein, neddylation domain (2);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.96417	0.8831	H	0.96633	3.855	0.80722	D	1	D;D	0.76494	0.999;0.999	D;P	0.65233	0.933;0.64	D	0.97776	1.0229	10	0.87932	D	0	-16.3531	18.9531	0.92647	0.0:0.0:1.0:0.0	.	643;716	E7EWR0;Q13616	.;CUL1_HUMAN	M	716;716;643	ENSP00000387160:V716M;ENSP00000326804:V716M	ENSP00000326804:V716M	V	+	1	0	CUL1	148127309	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	9.472000	0.97709	2.467000	0.83353	0.557000	0.71058	GTG	.		0.478	CUL1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467785.1	NM_003592	
DEFA6	1671	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	6783427	6783427	+	Missense_Mutation	SNP	G	G	A	rs371286175		TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr8:6783427G>A	ENST00000297436.2	-	1	171	c.131C>T	c.(130-132)gCa>gTa	p.A44V	GS1-24F4.3_ENST00000526235.1_RNA	NM_001926.3	NP_001917.1	Q01524	DEF6_HUMAN	defensin, alpha 6, Paneth cell-specific	44					antibacterial humoral response (GO:0019731)|defense response to fungus (GO:0050832)|innate immune response (GO:0045087)|killing of cells of other organism (GO:0031640)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)				lung(4)	4			STAD - Stomach adenocarcinoma(24;0.0322)	COAD - Colon adenocarcinoma(149;0.0572)|READ - Rectum adenocarcinoma(644;0.121)		CTGGTCATTTGCCCCACGCTG	0.557																																					p.A44V		.											.	DEFA6-90	0			c.C131T						.	G	VAL/ALA	0,4406		0,0,2203	70.0	58.0	62.0		131	-3.3	0.0	8		62	1,8599		0,1,4299	no	missense	DEFA6	NM_001926.3	64	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	44/101	6783427	1,13005	2203	4300	6503	SO:0001583	missense	1671	exon1			TCATTTGCCCCAC	M98331	CCDS5960.1	8p23.1	2007-02-20			ENSG00000164822	ENSG00000164822		"""Defensins, alpha"""	2765	protein-coding gene	gene with protein product		600471				8417977	Standard	NM_001926		Approved	HD-6, DEF6	uc003wqt.3	Q01524	OTTHUMG00000149984	ENST00000297436.2:c.131C>T	8.37:g.6783427G>A	ENSP00000297436:p.Ala44Val	Somatic	101	0		WXS	Illumina HiSeq	Phase_I	65	25	NM_001926	0	0	0	0	0	Q6EZF9	Missense_Mutation	SNP	ENST00000297436.2	37	CCDS5960.1	.	.	.	.	.	.	.	.	.	.	.	2.180	-0.387804	0.04932	0.0	1.16E-4	ENSG00000164822	ENST00000297436	T	0.32023	1.47	1.85	-3.35	0.04928	Defensin propeptide (1);	2.198720	0.02497	N	0.090070	T	0.24624	0.0597	L	0.39245	1.2	0.09310	N	1	B	0.30763	0.294	B	0.29942	0.109	T	0.12293	-1.0553	10	0.44086	T	0.13	.	5.9699	0.19346	0.0:0.1529:0.3749:0.4722	.	44	Q01524	DEF6_HUMAN	V	44	ENSP00000297436:A44V	ENSP00000297436:A44V	A	-	2	0	DEFA6	6770837	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.753000	0.04792	-1.668000	0.01471	-1.471000	0.01009	GCA	.		0.557	DEFA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206739.1	NM_001926	
MFHAS1	9258	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	8655002	8655002	+	Splice_Site	SNP	C	C	A			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr8:8655002C>A	ENST00000276282.6	-	2	3585		c.e2-1		MFHAS1_ENST00000520091.1_Splice_Site	NM_004225.2	NP_004216.2	Q9Y4C4	MFHA1_HUMAN	malignant fibrous histiocytoma amplified sequence 1											endometrium(1)|kidney(3)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|stomach(1)	21		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.124)		AGCAACTCCCCTGTAGGAGGA	0.547																																					.	Melanoma(103;1201 2045 17515 28966)	.											.	MFHAS1-90	0			c.2999-1G>T						.						78.0	66.0	70.0					8																	8655002		2203	4300	6503	SO:0001630	splice_region_variant	9258	exon3			ACTCCCCTGTAGG	AB016816	CCDS34844.1	8p23.1	2014-03-07			ENSG00000147324	ENSG00000147324			16982	protein-coding gene	gene with protein product	"""leucine rich repeat containing 65"", ""malignant fibrous histiocytoma-amplified sequences with leucine-rich tandem repeats 1"""	605352				9973190	Standard	NM_004225		Approved	MASL1, LRRC65	uc003wsj.1	Q9Y4C4	OTTHUMG00000163676	ENST00000276282.6:c.2999-1G>T	8.37:g.8655002C>A		Somatic	120	0		WXS	Illumina HiSeq	Phase_I	116	47	NM_004225	0	0	0	0	0	Q96CI0	Splice_Site	SNP	ENST00000276282.6	37	CCDS34844.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.752676	0.89753	.	.	ENSG00000147324	ENST00000276282	.	.	.	5.73	5.73	0.89815	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.882	0.92358	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MFHAS1	8692412	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.251000	0.78297	2.703000	0.92315	0.551000	0.68910	.	.		0.547	MFHAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374724.2	NM_004225	Intron
PNMA2	10687	broad.mit.edu	37	8	26365721	26365721	+	Nonsense_Mutation	SNP	C	C	T			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr8:26365721C>T	ENST00000522362.2	-	3	1445	c.551G>A	c.(550-552)tGg>tAg	p.W184*	PNMA2_ENST00000522764.1_5'Flank	NM_007257.5	NP_009188.1	Q9UL42	PNMA2_HUMAN	paraneoplastic Ma antigen 2	184					positive regulation of apoptotic process (GO:0043065)	nucleus (GO:0005634)				NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)	11		all_cancers(63;0.109)|Ovarian(32;2.61e-05)|all_epithelial(46;0.105)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0196)|Epithelial(17;3.13e-11)|Colorectal(74;0.123)		ctgttccaaccagacctcaaa	0.587																																					p.W184X													.	PNMA2-90	0			c.G551A						.						70.0	71.0	71.0					8																	26365721		2203	4300	6503	SO:0001587	stop_gained	10687	exon3			TCCAACCAGACCT		CCDS34868.1	8p21.1	2012-02-09	2012-02-09		ENSG00000240694	ENSG00000240694		"""Paraneoplastic Ma antigens"""	9159	protein-coding gene	gene with protein product		603970	"""paraneoplastic antigen MA2"""			10362822	Standard	NM_007257		Approved	MA2, RGAG2	uc003xez.2	Q9UL42	OTTHUMG00000163816	ENST00000522362.2:c.551G>A	8.37:g.26365721C>T	ENSP00000429344:p.Trp184*	Somatic	100	0		WXS	Illumina HiSeq	Phase_I	91	3	NM_007257	0	0	2	2	0	B3KNY9|O94959|O95145|Q49A18|Q9UL43	Nonsense_Mutation	SNP	ENST00000522362.2	37	CCDS34868.1	.	.	.	.	.	.	.	.	.	.	C	42	9.576920	0.99210	.	.	ENSG00000240694	ENST00000522362	.	.	.	4.22	4.22	0.49857	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-26.614	12.388	0.55343	0.0:1.0:0.0:0.0	.	.	.	.	X	184	.	ENSP00000429344:W184X	W	-	2	0	PNMA2	26421638	1.000000	0.71417	1.000000	0.80357	0.634000	0.38068	2.873000	0.48475	2.640000	0.89533	0.655000	0.94253	TGG	.		0.587	PNMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375709.2	NM_007257	
ADAM9	8754	ucsc.edu	37	8	38871523	38871523	+	Silent	SNP	C	C	T			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr8:38871523C>T	ENST00000487273.2	+	4	372	c.294C>T	c.(292-294)aaC>aaT	p.N98N	ADAM9_ENST00000466936.1_Silent_p.N98N|ADAM9_ENST00000481513.1_Silent_p.N98N	NM_003816.2	NP_003807.1	Q13443	ADAM9_HUMAN	ADAM metallopeptidase domain 9	98				Missing (in Ref. 2; no nucleotide entry). {ECO:0000305}.	activation of MAPKK activity (GO:0000186)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-matrix adhesion (GO:0007160)|cellular response to lipopolysaccharide (GO:0071222)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|keratinocyte differentiation (GO:0030216)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte activation (GO:0042117)|PMA-inducible membrane protein ectodomain proteolysis (GO:0051088)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of keratinocyte migration (GO:0051549)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of protein secretion (GO:0050714)|response to calcium ion (GO:0051592)|response to glucocorticoid (GO:0051384)|response to hydrogen peroxide (GO:0042542)|response to laminar fluid shear stress (GO:0034616)|response to manganese ion (GO:0010042)|response to tumor necrosis factor (GO:0034612)|transforming growth factor beta receptor signaling pathway (GO:0007179)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intrinsic component of external side of plasma membrane (GO:0031233)	collagen binding (GO:0005518)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|protein kinase C binding (GO:0005080)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.0153)	LUSC - Lung squamous cell carcinoma(45;2.74e-07)			ATACTTACAACAAGGAAGGGA	0.308																																					p.N98N													.	ADAM9-227	0			c.C294T						.						135.0	140.0	139.0					8																	38871523		2203	4300	6503	SO:0001819	synonymous_variant	8754	exon4			TTACAACAAGGAA	U41766	CCDS6112.1	8p11.23	2011-03-18	2010-06-24		ENSG00000168615	ENSG00000168615		"""ADAM metallopeptidase domain containing"""	216	protein-coding gene	gene with protein product	"""meltrin gamma"""	602713	"""a disintegrin and metalloproteinase domain 9 (meltrin gamma)"", ""cone rod dystrophy 9"""	CORD9		8647900, 11581183, 19409519	Standard	NR_027638		Approved	MDC9, KIAA0021, MCMP, Mltng	uc003xmr.3	Q13443	OTTHUMG00000159783	ENST00000487273.2:c.294C>T	8.37:g.38871523C>T		Somatic	45	0		WXS	Illumina HiSeq		34	4	NM_003816	0	0	2	2	0	B7ZLN7|Q10718|Q8NFM6	Silent	SNP	ENST00000487273.2	37	CCDS6112.1																																																																																			.		0.308	ADAM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357291.2		
ZC3H3	23144	broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	144522452	144522452	+	Silent	SNP	G	G	T			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr8:144522452G>T	ENST00000262577.5	-	11	2605	c.2574C>A	c.(2572-2574)ccC>ccA	p.P858P		NM_015117.2	NP_055932.2	Q8IXZ2	ZC3H3_HUMAN	zinc finger CCCH-type containing 3	858					mRNA polyadenylation (GO:0006378)|poly(A)+ mRNA export from nucleus (GO:0016973)|regulation of mRNA export from nucleus (GO:0010793)	nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	23	all_cancers(97;8.64e-11)|all_epithelial(106;6.43e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.107)			CTGGGCAGTGGGGAGGTGCAG	0.682																																					p.P858P													.	ZC3H3-91	0			c.C2574A						.						15.0	18.0	17.0					8																	144522452		2192	4293	6485	SO:0001819	synonymous_variant	23144	exon11			GCAGTGGGGAGGT	D63484	CCDS6402.1	8q24.3	2012-07-05	2005-06-02	2005-06-02	ENSG00000014164	ENSG00000014164		"""Zinc fingers, CCCH-type domain containing"""	28972	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 3"""	ZC3HDC3		8590280	Standard	NM_015117		Approved	KIAA0150	uc003yyd.2	Q8IXZ2	OTTHUMG00000165127	ENST00000262577.5:c.2574C>A	8.37:g.144522452G>T		Somatic	46	0		WXS	Illumina HiSeq	Phase_I	29	15	NM_015117	0	0	8	12	4	Q14163|Q8N4E2|Q9BUS4	Silent	SNP	ENST00000262577.5	37	CCDS6402.1																																																																																			.		0.682	ZC3H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382011.2	NM_015117	
SETX	23064	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	135163729	135163729	+	Missense_Mutation	SNP	A	A	G			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr9:135163729A>G	ENST00000224140.5	-	17	6400	c.6218T>C	c.(6217-6219)tTa>tCa	p.L2073S	SETX_ENST00000372169.2_Missense_Mutation_p.L2073S|SETX_ENST00000393220.1_Missense_Mutation_p.L2073S	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin	2073					cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		ATGAGAAGGTAACTCTTTTTC	0.358																																					p.L2073S		.											.	SETX-93	0			c.T6218C						.						33.0	32.0	32.0					9																	135163729		2203	4300	6503	SO:0001583	missense	23064	exon17			GAAGGTAACTCTT	AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.6218T>C	9.37:g.135163729A>G	ENSP00000224140:p.Leu2073Ser	Somatic	78	0		WXS	Illumina HiSeq	Phase_I	63	25	NM_015046	0	0	0	0	0	A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Missense_Mutation	SNP	ENST00000224140.5	37	CCDS6947.1	.	.	.	.	.	.	.	.	.	.	A	13.01	2.108442	0.37242	.	.	ENSG00000107290	ENST00000224140;ENST00000436441;ENST00000372169;ENST00000393220	D;D;D;D	0.90900	-2.18;-2.75;-2.26;-1.87	5.5	5.5	0.81552	.	0.381500	0.24779	N	0.035673	D	0.89406	0.6706	L	0.31476	0.935	0.39629	D	0.970154	B;D;D	0.76494	0.203;0.999;0.998	B;D;P	0.68483	0.075;0.958;0.876	D	0.85262	0.1051	10	0.09338	T	0.73	.	8.5286	0.33319	0.9131:0.0:0.0869:0.0	.	2073;2073;2073	Q7Z333-3;Q7Z333;Q7Z333-4	.;SETX_HUMAN;.	S	2073;315;2073;2073	ENSP00000224140:L2073S;ENSP00000409143:L315S;ENSP00000361242:L2073S;ENSP00000376913:L2073S	ENSP00000224140:L2073S	L	-	2	0	SETX	134153550	0.972000	0.33761	0.996000	0.52242	0.786000	0.44442	2.256000	0.43231	2.221000	0.72209	0.528000	0.53228	TTA	.		0.358	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054774.3	NM_015046	
FAM47A	158724	hgsc.bcm.edu;broad.mit.edu	37	X	34148936	34148936	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chrX:34148936C>T	ENST00000346193.3	-	1	1511	c.1460G>A	c.(1459-1461)cGg>cAg	p.R487Q		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	487								p.R487Q(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						ACTGGACCTCCGACGTGTCTT	0.642																																					p.R487Q		.											.	FAM47A-134	1	Substitution - Missense(1)	large_intestine(1)	c.G1460A						.						47.0	54.0	51.0					X																	34148936		2192	4286	6478	SO:0001583	missense	158724	exon1			GACCTCCGACGTG	BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.1460G>A	X.37:g.34148936C>T	ENSP00000345029:p.Arg487Gln	Somatic	91	0		WXS	Illumina HiSeq	Phase_I	70	4	NM_203408	0	0	0	0	0	A8K8I9|Q8TAA0	Missense_Mutation	SNP	ENST00000346193.3	37	CCDS43926.1	.	.	.	.	.	.	.	.	.	.	c	9.489	1.100058	0.20552	.	.	ENSG00000185448	ENST00000346193	T	0.16196	2.36	0.446	0.446	0.16602	.	.	.	.	.	T	0.10380	0.0254	N	0.24115	0.695	0.09310	N	1	D	0.62365	0.991	P	0.44811	0.461	T	0.23762	-1.0179	8	0.13470	T	0.59	.	.	.	.	.	487	Q5JRC9	FA47A_HUMAN	Q	487	ENSP00000345029:R487Q	ENSP00000345029:R487Q	R	-	2	0	FAM47A	34058857	0.022000	0.18835	0.006000	0.13384	0.016000	0.09150	0.010000	0.13242	0.435000	0.26365	0.183000	0.17082	CGG	.		0.642	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408	
TMEM164	84187	bcgsc.ca	37	X	109352336	109352336	+	Missense_Mutation	SNP	C	C	G			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chrX:109352336C>G	ENST00000372073.1	+	4	805	c.469C>G	c.(469-471)Ctt>Gtt	p.L157V	TMEM164_ENST00000372068.2_Missense_Mutation_p.L157V|TMEM164_ENST00000288381.4_Intron|TMEM164_ENST00000372072.3_Missense_Mutation_p.L8V			Q5U3C3	TM164_HUMAN	transmembrane protein 164	157						integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|large_intestine(5)|lung(6)|skin(1)	14						GAATGGAGCTCTTCTGGCATT	0.453																																					p.L157V													.	TMEM164-193	0			c.C469G						.						231.0	186.0	201.0					X																	109352336		2203	4300	6503	SO:0001583	missense	84187	exon4			GGAGCTCTTCTGG	AK094127	CCDS14550.2, CCDS55475.1	Xq22.3	2008-02-05			ENSG00000157600	ENSG00000157600			26217	protein-coding gene	gene with protein product						12477932	Standard	NM_032227		Approved	FLJ22679, RP13-360B22.2	uc004eom.3	Q5U3C3	OTTHUMG00000022192	ENST00000372073.1:c.469C>G	X.37:g.109352336C>G	ENSP00000361143:p.Leu157Val	Somatic	78	1		WXS	Illumina HiSeq	Phase_1	57	4	NM_032227	0	0	0	0	0	B3KSQ8|F5H2P2	Missense_Mutation	SNP	ENST00000372073.1	37	CCDS14550.2	.	.	.	.	.	.	.	.	.	.	C	17.37	3.371759	0.61624	.	.	ENSG00000157600	ENST00000372072;ENST00000372073;ENST00000372068	T;T;T	0.48522	0.81;0.81;0.81	5.92	5.92	0.95590	.	0.058058	0.64402	D	0.000003	T	0.54334	0.1852	L	0.52266	1.64	0.53005	D	0.999965	D	0.55800	0.973	P	0.53593	0.73	T	0.49163	-0.8968	10	0.32370	T	0.25	-5.3101	14.484	0.67603	0.0:1.0:0.0:0.0	.	157	Q5U3C3	TM164_HUMAN	V	8;157;157	ENSP00000384075:L8V;ENSP00000361143:L157V;ENSP00000361138:L157V	ENSP00000361138:L157V	L	+	1	0	TMEM164	109238992	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.616000	0.61197	2.498000	0.84270	0.600000	0.82982	CTT	.		0.453	TMEM164-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057898.1	NM_032227	
GBF1	8729	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	104123472	104123472	+	Frame_Shift_Del	DEL	A	A	-			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr10:104123472delA	ENST00000369983.3	+	17	2280	c.2020delA	c.(2020-2022)aaafs	p.K675fs		NM_001199378.1|NM_001199379.1|NM_004193.2	NP_001186307.1|NP_001186308.1|NP_004184.1	Q92538	GBF1_HUMAN	golgi brefeldin A resistant guanine nucleotide exchange factor 1	675					COPI coating of Golgi vesicle (GO:0048205)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of ARF protein signal transduction (GO:0032012)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	cis-Golgi network (GO:0005801)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(14)|kidney(8)|large_intestine(15)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	71		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		CCTAGCTGACAAAAAGTTTGC	0.423																																					p.K675fs		.											.	GBF1-91	0			c.2023delA						.						113.0	119.0	117.0					10																	104123472		2203	4300	6503	SO:0001589	frameshift_variant	8729	exon17			.	D87435	CCDS7533.1	10q24	2010-02-12	2010-02-12		ENSG00000107862	ENSG00000107862			4181	protein-coding gene	gene with protein product		603698	"""golgi-specific brefeldin A resistance factor 1"""			9828135	Standard	NM_004193		Approved	KIAA0248, ARF1GEF	uc001kux.2	Q92538	OTTHUMG00000018955	ENST00000369983.3:c.2020delA	10.37:g.104123472delA	ENSP00000359000:p.Lys675fs	Somatic	76	0		WXS	Illumina HiSeq	Phase_I	69	19	NM_001199378	0	0	0	0	0	Q5VXX3|Q96CK6|Q96HZ3|Q9H473	Frame_Shift_Del	DEL	ENST00000369983.3	37	CCDS7533.1																																																																																			.		0.423	GBF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050051.1		
LAMA3	3909	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	21511115	21511115	+	Frame_Shift_Del	DEL	G	G	-	rs546328935		TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr18:21511115delG	ENST00000313654.9	+	65	8767	c.8526delG	c.(8524-8526)acgfs	p.T2842fs	LAMA3_ENST00000588770.1_3'UTR|LAMA3_ENST00000269217.6_Frame_Shift_Del_p.T1233fs|LAMA3_ENST00000587184.1_Frame_Shift_Del_p.T1177fs|LAMA3_ENST00000399516.3_Frame_Shift_Del_p.T2786fs	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	2842	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					CTCCACAGACGTATATGGATG	0.428																																					p.T2842fs		.											.	LAMA3-100	0			c.8526delG						.						110.0	110.0	110.0					18																	21511115		2203	4300	6503	SO:0001589	frameshift_variant	3909	exon65			.	L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.8526delG	18.37:g.21511115delG	ENSP00000324532:p.Thr2842fs	Somatic	52	0		WXS	Illumina HiSeq	Phase_I	49	13	NM_198129	0	0	0	0	0	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Frame_Shift_Del	DEL	ENST00000313654.9	37	CCDS42419.1																																																																																			.		0.428	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129	
LAMA3	3909	hgsc.bcm.edu	37	18	21511115	21511118	+	Frame_Shift_Del	DEL	GTAT	GTAT	-	rs546328935		TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	GTAT	GTAT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr18:21511115_21511118delGTAT	ENST00000313654.9	+	65	8767_8770	c.8526_8529delGTAT	c.(8524-8529)acgtatfs	p.TY2842fs	LAMA3_ENST00000588770.1_3'UTR|LAMA3_ENST00000269217.6_Frame_Shift_Del_p.TY1233fs|LAMA3_ENST00000587184.1_Frame_Shift_Del_p.TY1177fs|LAMA3_ENST00000399516.3_Frame_Shift_Del_p.TY2786fs	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	2842	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					CTCCACAGACGTATATGGATGGTT	0.431																																					p.2842_2843del		.											.	LAMA3-100	0			c.8526_8529del						.																																			SO:0001589	frameshift_variant	3909	exon65			.	L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.8526_8529delGTAT	18.37:g.21511115_21511118delGTAT	ENSP00000324532:p.Thr2842fs	Somatic	51	0		WXS	Illumina HiSeq	Phase_I	54	14	NM_198129	0	0	0	0	0	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Frame_Shift_Del	DEL	ENST00000313654.9	37	CCDS42419.1																																																																																			.		0.431	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129	
LAMA3	3909	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	21511118	21511118	+	Frame_Shift_Del	DEL	T	T	-			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr18:21511118delT	ENST00000313654.9	+	65	8770	c.8529delT	c.(8527-8529)tatfs	p.Y2843fs	LAMA3_ENST00000588770.1_3'UTR|LAMA3_ENST00000269217.6_Frame_Shift_Del_p.Y1234fs|LAMA3_ENST00000587184.1_Frame_Shift_Del_p.Y1178fs|LAMA3_ENST00000399516.3_Frame_Shift_Del_p.Y2787fs	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	2843	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					CACAGACGTATATGGATGGTT	0.428																																					p.Y2843X		.											.	LAMA3-100	0			c.8529delT						.						112.0	111.0	111.0					18																	21511118		2203	4300	6503	SO:0001589	frameshift_variant	3909	exon65			.	L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.8529delT	18.37:g.21511118delT	ENSP00000324532:p.Tyr2843fs	Somatic	54	0		WXS	Illumina HiSeq	Phase_I	57	13	NM_198129	0	0	0	0	0	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Nonsense_Mutation	DEL	ENST00000313654.9	37	CCDS42419.1																																																																																			.		0.428	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129	
ZNF233	353355	hgsc.bcm.edu	37	19	44778797	44778797	+	Frame_Shift_Del	DEL	T	T	-	rs386809644|rs386809645|rs2884015	byFrequency	TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr19:44778797delT	ENST00000391958.2	+	5	2111	c.1984delT	c.(1984-1986)ttgfs	p.L662fs	ZNF235_ENST00000589799.1_Intron|ZNF233_ENST00000334152.1_Frame_Shift_Del_p.L644fs|ZNF233_ENST00000592581.1_3'UTR	NM_181756.2	NP_861421.2	A6NK53	ZN233_HUMAN	zinc finger protein 233	662					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(4)|skin(3)|urinary_tract(1)	20		Prostate(69;0.0435)|all_neural(266;0.226)				TAAGAGTTCGTTGTCTTCAGA	0.413																																					p.L662fs		.											.	ZNF233-92	0			c.1984delT						.		,	2463,1797		712,1039,379	70.0	79.0	75.0		,	-8.4	0.0	19	dbSNP_129	61	1034,7216		69,896,3160	no	frameshift,frameshift	ZNF233	NM_181756.2,NM_001207005.1	,	781,1935,3539	A1A1,A1R,RR		12.5333,42.1831,27.9536	,	,	44778797	3497,9013	2201	4300	6501	SO:0001589	frameshift_variant	353355	exon5			.	AY166792	CCDS33047.1	19q13.31	2013-01-08				ENSG00000159915		"""Zinc fingers, C2H2-type"", ""-"""	30946	protein-coding gene	gene with protein product						12743021	Standard	NM_001207005		Approved	FLJ38032	uc021uvi.1	A6NK53		ENST00000391958.2:c.1984delT	19.37:g.44778797delT	ENSP00000375820:p.Leu662fs	Somatic	61	0		WXS	Illumina HiSeq	Phase_I	56	20	NM_001207005	0	0	0	0	0	B2RN78|B2RN79|Q86WL8	Frame_Shift_Del	DEL	ENST00000391958.2	37	CCDS33047.1																																																																																			.		0.413	ZNF233-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000460737.1	NM_181756	
BAP1	8314	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	52439271	52439271	+	Frame_Shift_Del	DEL	G	G	-			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr3:52439271delG	ENST00000460680.1	-	11	1442	c.971delC	c.(970-972)ccafs	p.P324fs	BAP1_ENST00000296288.5_Frame_Shift_Del_p.P306fs	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.P324fs*11(1)|p.A323fs*71(1)|p.P324fs*7(1)		NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		GCTGTGGGATGGGGCTTGTGC	0.592			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															p.P324fs	GBM(101;493 1458 7992 21037 25532)	.		Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	.	BAP1-1032	3	Deletion - Frameshift(3)	eye(1)|kidney(1)|pleura(1)	c.971delC						.						115.0	120.0	118.0					3																	52439271		2203	4300	6503	SO:0001589	frameshift_variant	8314	exon11			.	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.971delC	3.37:g.52439271delG	ENSP00000417132:p.Pro324fs	Somatic	100	0		WXS	Illumina HiSeq	Phase_I	81	60	NM_004656	0	0	0	0	0	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Frame_Shift_Del	DEL	ENST00000460680.1	37	CCDS2853.1																																																																																			.		0.592	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1		
PPWD1	23398	broad.mit.edu;bcgsc.ca	37	5	64867921	64867921	+	Frame_Shift_Del	DEL	C	C	-			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr5:64867921delC	ENST00000261308.5	+	5	849	c.777delC	c.(775-777)ttcfs	p.F259fs	PPWD1_ENST00000538977.1_Frame_Shift_Del_p.F103fs|PPWD1_ENST00000535264.1_Frame_Shift_Del_p.F229fs	NM_015342.3	NP_056157.1	Q96BP3	PPWD1_HUMAN	peptidylprolyl isomerase domain and WD repeat containing 1	259					mRNA splicing, via spliceosome (GO:0000398)|protein folding (GO:0006457)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)	19		Lung NSC(167;7.21e-05)|Prostate(74;0.0174)|Ovarian(174;0.186)		Lung(70;0.00451)		AATATAAATTCCCCAAAAATG	0.393																																					p.F259fs													.	PPWD1-91	0			c.777delC						.						65.0	70.0	68.0					5																	64867921		2203	4300	6503	SO:0001589	frameshift_variant	23398	exon5			TAAATTCCCCAAA	AK025679	CCDS3985.1, CCDS64161.1, CCDS64162.1	5q12.3	2013-01-09			ENSG00000113593	ENSG00000113593		"""WD repeat domain containing"""	28954	protein-coding gene	gene with protein product						7584044	Standard	NM_015342		Approved	KIAA0073	uc003jtv.5	Q96BP3	OTTHUMG00000131226	ENST00000261308.5:c.777delC	5.37:g.64867921delC	ENSP00000261308:p.Phe259fs	Somatic	52	0		WXS	Illumina HiSeq	Phase_I	35	9	NM_015342	0	0	0	0	0	B4DWR9|Q15002|Q7KZ89	Frame_Shift_Del	DEL	ENST00000261308.5	37	CCDS3985.1																																																																																			.		0.393	PPWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253970.2	NM_015342	
Unknown	0	broad.mit.edu;bcgsc.ca	37	13	103402101	103402102	+	IGR	INS	-	-	A			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr13:103402101_103402102insA								LINC00283 (4527 upstream) : TEX30 (16237 downstream)																							GCTTGACTAGTAAATTGGACTT	0.391																																					p.T316fs													.	.	0			c.946_947insT						.																																			SO:0001628	intergenic_variant	643677	exon4			GACTAGTAAATTG																													13.37:g.103402104_103402104dupA		Somatic	30	0		WXS	Illumina HiSeq	Phase_I	26	9	NM_001146197	0	0	0	0	0		Frame_Shift_Ins	INS		37																																																																																				.	0	0.391								
HNF4A	3172	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	43052875	43052876	+	Frame_Shift_Ins	INS	-	-	C			TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr20:43052875_43052876insC	ENST00000316099.4	+	8	1199_1200	c.1110_1111insC	c.(1111-1113)cagfs	p.Q371fs	HNF4A_ENST00000457232.1_Frame_Shift_Ins_p.Q349fs|HNF4A_ENST00000443598.2_Frame_Shift_Ins_p.Q371fs|HNF4A_ENST00000609795.1_Frame_Shift_Ins_p.Q349fs|HNF4A_ENST00000415691.2_Frame_Shift_Ins_p.Q371fs|HNF4A_ENST00000316673.4_Frame_Shift_Ins_p.Q349fs|AL132772.1_ENST00000581483.1_RNA	NM_000457.4|NM_001258355.1|NM_178849.2	NP_000448.3|NP_001245284.1|NP_849180.1	P41235	HNF4A_HUMAN	hepatocyte nuclear factor 4, alpha	371					blood coagulation (GO:0007596)|endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|ornithine metabolic process (GO:0006591)|phospholipid homeostasis (GO:0055091)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gastrulation (GO:0010470)|regulation of growth hormone receptor signaling pathway (GO:0060398)|regulation of insulin secretion (GO:0050796)|regulation of lipid metabolic process (GO:0019216)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|sex differentiation (GO:0007548)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|fatty acid binding (GO:0005504)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(7)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	34		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			ACAACCTGTTGCAGGAGATGCT	0.609																																					p.L370fs	Colon(79;2 1269 8820 14841 52347)	.											.	HNF4A-227	0			c.1110_1111insC						.																																			SO:0001589	frameshift_variant	3172	exon8			.	X76930	CCDS13330.1, CCDS13331.1, CCDS42876.1, CCDS46604.1, CCDS46605.1, CCDS68131.1, CCDS74728.1	20q13.12	2014-09-17			ENSG00000101076	ENSG00000101076		"""Nuclear hormone receptors"""	5024	protein-coding gene	gene with protein product		600281		TCF14, MODY, MODY1		7926813, 9048927	Standard	NM_001030003		Approved	NR2A1, HNF4	uc010zwo.1	P41235	OTTHUMG00000032531	ENST00000316099.4:c.1111dupC	20.37:g.43052876_43052876dupC	ENSP00000312987:p.Gln371fs	Somatic	185	0		WXS	Illumina HiSeq	Phase_I	148	50	NM_178849	0	0	0	0	0	A5JW41|B2RPP8|O00659|O00723|Q14540|Q5QPB8|Q6B4V5|Q6B4V6|Q6B4V7|Q92653|Q92654|Q92655|Q99864|Q9NQH0	Frame_Shift_Ins	INS	ENST00000316099.4	37	CCDS13330.1																																																																																			.		0.609	HNF4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079363.3		
NEFH	4744	broad.mit.edu	37	22	29885622	29885623	+	In_Frame_Ins	INS	-	-	AGGAAG	rs267607534|rs267607535		TCGA-MH-A560-01A-11D-A26P-10	TCGA-MH-A560-10A-01D-A26P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cf5deb22-f7eb-409d-a0e4-882716199c39	8fa7c1a8-e64c-4ee8-9012-187aa9da1210	g.chr22:29885622_29885623insAGGAAG	ENST00000310624.6	+	4	2026_2027	c.1993_1994insAGGAAG	c.(1993-1995)aag>aAGGAAGag	p.665_666insEE		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	671	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						GTCCCCTGAGAAGGCCAAGTCC	0.579																																					p.K665delinsKEE													.	NEFH-90	0			c.1993_1994insAGGAAG						.																																			SO:0001652	inframe_insertion	4744	exon4			CCTGAGAAGGCCA		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	Exception_encountered	22.37:g.29885622_29885623insAGGAAG	ENSP00000311997:p.Lys665_Ala666insGluGlu	Somatic	394	0		WXS	Illumina HiSeq	Phase_I	280	0	NM_021076	0	0	0	0	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Ins	INS	ENST00000310624.6	37	CCDS13858.1																																																																																			.		0.579	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
