#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ZMPSTE24	10269	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	40724033	40724033	+	Silent	SNP	G	G	C			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr1:40724033G>C	ENST00000372759.3	+	1	255	c.90G>C	c.(88-90)gtG>gtC	p.V30V	ZMPSTE24_ENST00000479131.1_3'UTR|RP1-39G22.7_ENST00000567508.1_RNA	NM_005857.4	NP_005848.2	O75844	FACE1_HUMAN	zinc metallopeptidase STE24	30					CAAX-box protein processing (GO:0071586)|nuclear envelope organization (GO:0006998)|prenylated protein catabolic process (GO:0030327)|proteolysis (GO:0006508)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|metalloexopeptidase activity (GO:0008235)			endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|prostate(1)|skin(1)	16	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;6.3e-18)			CCTGGACAGTGTATCTTTGGG	0.622																																					p.V30V		.											.	ZMPSTE24-226	0			c.G90C						.						121.0	104.0	109.0					1																	40724033		2203	4300	6503	SO:0001819	synonymous_variant	10269	exon1			GACAGTGTATCTT	Y13834	CCDS449.1	1p34	2014-09-17	2012-12-10		ENSG00000084073	ENSG00000084073	3.4.24.84		12877	protein-coding gene	gene with protein product	"""Hutchinson-Gilford progeria syndrome"", ""CAAX prenyl protease 1 homolog"""	606480	"""zinc metalloproteinase (STE24 homolog, yeast)"", ""zinc metallopeptidase (STE24 homolog, yeast)"", ""zinc metallopeptidase STE24 homolog (S. cerevisiae)"""			10373325, 9700155, 16671095	Standard	NM_005857		Approved	FACE-1, Ste24p, STE24, HGPS, PRO1	uc001cfg.4	O75844	OTTHUMG00000005762	ENST00000372759.3:c.90G>C	1.37:g.40724033G>C		Somatic	83	0		WXS	Illumina HiSeq	Phase_I	99	32	NM_005857	0	0	0	0	0	B3KQI7|D3DPU7|Q8NDZ8|Q9UBQ2	Silent	SNP	ENST00000372759.3	37	CCDS449.1																																																																																			.		0.622	ZMPSTE24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015766.1		
GSTM4	2948	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	110201466	110201466	+	Missense_Mutation	SNP	C	C	A			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr1:110201466C>A	ENST00000369836.4	+	6	700	c.391C>A	c.(391-393)Ctt>Att	p.L131I	GSTM4_ENST00000495742.1_3'UTR|GSTM4_ENST00000369833.1_Missense_Mutation_p.L90I|GSTM4_ENST00000326729.5_Missense_Mutation_p.L131I|GSTM4_ENST00000336075.5_Missense_Mutation_p.L70I	NM_000850.4	NP_000841.1	Q03013	GSTM4_HUMAN	glutathione S-transferase mu 4	131	GST C-terminal.				glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|small molecule metabolic process (GO:0044281)|xenobiotic catabolic process (GO:0042178)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	enzyme binding (GO:0019899)|glutathione binding (GO:0043295)|glutathione transferase activity (GO:0004364)|protein homodimerization activity (GO:0042803)			endometrium(3)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	12		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		all cancers(265;0.0123)|Colorectal(144;0.0129)|Epithelial(280;0.0147)|Lung(183;0.0422)|COAD - Colon adenocarcinoma(174;0.0471)|LUSC - Lung squamous cell carcinoma(189;0.227)	Glutathione(DB00143)	CTTGGAGGAACTTCCTACAAT	0.517																																					p.L131I		.											.	GSTM4-44	0			c.C391A						.						164.0	158.0	160.0					1																	110201466		2203	4300	6503	SO:0001583	missense	2948	exon6			GAGGAACTTCCTA	M96234	CCDS806.1, CCDS807.1	1p13.3	2012-06-22	2008-11-26		ENSG00000168765	ENSG00000168765	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4636	protein-coding gene	gene with protein product		138333	"""glutathione S-transferase M4"""			8276420	Standard	NM_000850		Approved		uc001dyf.3	Q03013	OTTHUMG00000011642	ENST00000369836.4:c.391C>A	1.37:g.110201466C>A	ENSP00000358851:p.Leu131Ile	Somatic	327	0		WXS	Illumina HiSeq	Phase_I	303	97	NM_147148	0	0	16	18	2	A8K765|Q05465|Q32NC1|Q4JNT8|Q6FH87	Missense_Mutation	SNP	ENST00000369836.4	37	CCDS807.1	.	.	.	.	.	.	.	.	.	.	C	15.16	2.750271	0.49257	.	.	ENSG00000168765	ENST00000369836;ENST00000336075;ENST00000326729;ENST00000369833	T;T;T;T	0.04603	3.59;4.46;3.59;3.59	4.0	-0.554	0.11811	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);Glutathione S-transferase, C-terminal (1);	0.201178	0.32473	N	0.006046	T	0.01940	0.0061	L	0.41961	1.31	0.38907	D	0.957449	B;B;B	0.17852	0.024;0.007;0.0	B;B;B	0.23716	0.035;0.048;0.009	T	0.40346	-0.9568	10	0.44086	T	0.13	-16.1138	11.7266	0.51712	0.6127:0.3873:0.0:0.0	.	70;131;131	Q4JNT8;Q03013-2;Q03013	.;.;GSTM4_HUMAN	I	131;70;131;90	ENSP00000358851:L131I;ENSP00000336744:L70I;ENSP00000316471:L131I;ENSP00000358848:L90I	ENSP00000316471:L131I	L	+	1	0	GSTM4	110002989	0.010000	0.17322	0.005000	0.12908	0.847000	0.48162	0.193000	0.17116	-0.165000	0.10908	-0.901000	0.02856	CTT	.		0.517	GSTM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032187.1	NM_000850	
IGSF3	3321	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	117120184	117120184	+	Splice_Site	SNP	C	C	G			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr1:117120184C>G	ENST00000369486.3	-	11	4100	c.3335G>C	c.(3334-3336)aGt>aCt	p.S1112T	IGSF3_ENST00000369483.1_Splice_Site_p.S1132T|IGSF3_ENST00000318837.6_Splice_Site_p.S1132T	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	1112					lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		GAGGGTGGGACCTGAAAAGAA	0.493																																					p.S1132T		.											.	IGSF3-92	0			c.G3395C						.						98.0	102.0	101.0					1																	117120184		2203	4300	6503	SO:0001630	splice_region_variant	3321	exon12			GTGGGACCTGAAA	AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.3335-1G>C	1.37:g.117120184C>G		Somatic	57	0		WXS	Illumina HiSeq	Phase_I	88	30	NM_001542	0	0	0	0	0	A6NJZ6|A6NMC7	Missense_Mutation	SNP	ENST00000369486.3	37	CCDS30813.1	.	.	.	.	.	.	.	.	.	.	C	7.587	0.670001	0.14776	.	.	ENSG00000143061	ENST00000369486;ENST00000369483;ENST00000318837	T;T;T	0.02890	4.12;4.13;4.13	4.88	4.88	0.63580	.	0.310318	0.31199	N	0.008076	T	0.00695	0.0023	N	0.08118	0	0.32760	N	0.505191	B;B	0.24368	0.084;0.102	B;B	0.22386	0.028;0.039	T	0.52845	-0.8521	10	0.31617	T	0.26	.	9.0162	0.36170	0.0:0.9027:0.0:0.0973	.	1112;1132	O75054;A6NJZ6	IGSF3_HUMAN;.	T	1112;1132;1132	ENSP00000358498:S1112T;ENSP00000358495:S1132T;ENSP00000321184:S1132T	ENSP00000321184:S1132T	S	-	2	0	IGSF3	116921707	0.997000	0.39634	1.000000	0.80357	0.699000	0.40488	3.210000	0.51129	2.536000	0.85505	0.655000	0.94253	AGT	.		0.493	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000059040.1	NM_001542	Missense_Mutation
PBXIP1	57326	broad.mit.edu	37	1	154920116	154920116	+	Splice_Site	SNP	A	A	C			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr1:154920116A>C	ENST00000368463.3	-	8	810		c.e8+1		PBXIP1_ENST00000368465.1_Splice_Site|PBXIP1_ENST00000542459.1_Splice_Site|PBXIP1_ENST00000539880.1_Splice_Site|PBXIP1_ENST00000368460.3_Splice_Site|PBXIP1_ENST00000498553.1_Splice_Site	NM_020524.2	NP_065385.2	Q96AQ6	PBIP1_HUMAN	pre-B-cell leukemia homeobox interacting protein 1						cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)	cytosol (GO:0005829)|microtubule (GO:0005874)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)			breast(1)|kidney(2)|large_intestine(6)|lung(13)|prostate(1)|urinary_tract(1)	24	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			ATTCACACATACCTGCCTGTC	0.622																																					.													.	PBXIP1-153	0			c.738+2T>G						.						70.0	78.0	76.0					1																	154920116		2203	4300	6503	SO:0001630	splice_region_variant	57326	exon9			ACACATACCTGCC	AF221521	CCDS1074.1	1q22	2008-02-05	2007-01-30		ENSG00000163346	ENSG00000163346			21199	protein-coding gene	gene with protein product			"""pre-B-cell leukemia transcription factor interacting protein 1"""			7505766, 10825160	Standard	NM_020524		Approved	HPIP	uc001ffr.3	Q96AQ6	OTTHUMG00000037369	ENST00000368463.3:c.738+1T>G	1.37:g.154920116A>C		Somatic	106	18		WXS	Illumina HiSeq	Phase_I	130	27	NM_020524	0	0	0	0	0	Q5T174|Q5T176|Q9H8X6|Q9HA02|Q9HD85	Splice_Site	SNP	ENST00000368463.3	37	CCDS1074.1	.	.	.	.	.	.	.	.	.	.	A	13.68	2.309902	0.40895	.	.	ENSG00000163346	ENST00000368465;ENST00000368463;ENST00000351146;ENST00000539880;ENST00000543593;ENST00000542459;ENST00000368460	.	.	.	4.25	1.91	0.25777	.	.	.	.	.	.	.	.	.	.	.	0.42929	D	0.994319	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.461	0.21956	0.7777:0.0:0.2223:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PBXIP1	153186740	0.722000	0.28017	0.336000	0.25522	0.408000	0.30992	1.419000	0.34793	0.205000	0.20568	0.260000	0.18958	.	.		0.622	PBXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090943.1	NM_020524	Intron
INSRR	3645	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	156824054	156824054	+	Missense_Mutation	SNP	G	G	A	rs140386495		TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr1:156824054G>A	ENST00000368195.3	-	2	523	c.127C>T	c.(127-129)Cgt>Tgt	p.R43C	NTRK1_ENST00000392302.2_Intron	NM_014215.2	NP_055030.1	P14616	INSRR_HUMAN	insulin receptor-related receptor	43					actin cytoskeleton reorganization (GO:0031532)|cellular response to alkaline pH (GO:0071469)|male sex determination (GO:0030238)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(7)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	42	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					TCCAGCTGACGAAGCTCTGCC	0.622																																					p.R43C		.											.	INSRR-1403	0			c.C127T						.	G	,CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	37.0	39.0	39.0		,127	3.1	1.0	1	dbSNP_134	39	2,8598	2.2+/-6.3	0,2,4298	yes	intron,missense	INSRR,NTRK1	NM_001007792.1,NM_014215.2	,180	0,3,6500	AA,AG,GG		0.0233,0.0227,0.0231	,probably-damaging	,43/1298	156824054	3,13003	2203	4300	6503	SO:0001583	missense	3645	exon2			GCTGACGAAGCTC	J05046	CCDS1160.1	1q21-q23	2013-02-11			ENSG00000027644	ENSG00000027644		"""Fibronectin type III domain containing"""	6093	protein-coding gene	gene with protein product		147671				2768234, 2249481	Standard	NM_014215		Approved	IRR	uc010pht.2	P14616	OTTHUMG00000041291	ENST00000368195.3:c.127C>T	1.37:g.156824054G>A	ENSP00000357178:p.Arg43Cys	Somatic	57	0		WXS	Illumina HiSeq	Phase_I	59	14	NM_014215	0	0	0	0	0	O60724|Q5VZS3	Missense_Mutation	SNP	ENST00000368195.3	37	CCDS1160.1	.	.	.	.	.	.	.	.	.	.	G	15.00	2.703881	0.48412	2.27E-4	2.33E-4	ENSG00000027644	ENST00000368195	T	0.32272	1.46	5.06	3.13	0.36017	.	0.000000	0.43416	D	0.000563	T	0.19604	0.0471	.	.	.	0.48288	D	0.999626	D	0.67145	0.996	P	0.46885	0.53	T	0.03403	-1.1040	9	0.72032	D	0.01	.	7.1713	0.25721	0.0913:0.0:0.7361:0.1726	.	43	P14616	INSRR_HUMAN	C	43	ENSP00000357178:R43C	ENSP00000357178:R43C	R	-	1	0	INSRR	155090678	0.003000	0.15002	1.000000	0.80357	0.342000	0.28953	1.267000	0.33050	1.098000	0.41479	0.557000	0.71058	CGT	G|1.000;A|0.000		0.622	INSRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098929.1	NM_014215	
KLHDC9	126823	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	161069269	161069269	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr1:161069269G>A	ENST00000368011.4	+	2	803	c.661G>A	c.(661-663)Ggg>Agg	p.G221R	PFDN2_ENST00000468311.1_5'Flank|KLHDC9_ENST00000392192.2_Missense_Mutation_p.G221R|KLHDC9_ENST00000490724.2_3'UTR	NM_152366.4	NP_689579.3	Q8NEP7	KLDC9_HUMAN	kelch domain containing 9	221										lung(5)|upper_aerodigestive_tract(1)	6	all_cancers(52;1.28e-19)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			AGAAGTAGCTGGGCATTGGAG	0.498																																					p.G221R		.											.	KLHDC9-22	0			c.G661A						.						120.0	122.0	121.0					1																	161069269		2203	4300	6503	SO:0001583	missense	126823	exon2			GTAGCTGGGCATT	BC022077	CCDS30919.1, CCDS41425.1	1q23.3	2008-02-05			ENSG00000162755	ENSG00000162755			28489	protein-coding gene	gene with protein product	"""kelch/ankyrin repeat containing cyclin A1 interacting protein"""					15159402	Standard	NM_152366		Approved	KARCA1	uc001fxr.3	Q8NEP7	OTTHUMG00000031479	ENST00000368011.4:c.661G>A	1.37:g.161069269G>A	ENSP00000356990:p.Gly221Arg	Somatic	193	0		WXS	Illumina HiSeq	Phase_I	230	70	NM_001007255	0	0	26	39	13	Q5SY56|Q6NXT9|Q6PKN4|Q8N5E1|Q8NA16	Missense_Mutation	SNP	ENST00000368011.4	37	CCDS30919.1	.	.	.	.	.	.	.	.	.	.	G	14.59	2.580835	0.46006	.	.	ENSG00000162755	ENST00000368011;ENST00000392192	T;T	0.59364	1.77;0.27	4.47	3.55	0.40652	Galactose oxidase/kelch, beta-propeller (1);	0.000000	0.64402	D	0.000018	T	0.64583	0.2611	M	0.72118	2.19	0.35694	D	0.815117	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.68500	-0.5392	10	0.46703	T	0.11	-6.0987	13.2992	0.60315	0.0878:0.0:0.9122:0.0	.	221;221	Q8NEP7-2;Q8NEP7	.;KLDC9_HUMAN	R	221	ENSP00000356990:G221R;ENSP00000376030:G221R	ENSP00000356990:G221R	G	+	1	0	KLHDC9	159335893	1.000000	0.71417	0.955000	0.39395	0.891000	0.51852	3.599000	0.54045	0.526000	0.28541	-0.797000	0.03246	GGG	.		0.498	KLHDC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077092.1	NM_152366	
IARS2	55699	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	220311360	220311360	+	Missense_Mutation	SNP	A	A	G			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr1:220311360A>G	ENST00000302637.5	+	17	2254	c.2150A>G	c.(2149-2151)aAt>aGt	p.N717S	IARS2_ENST00000366922.1_Missense_Mutation_p.N645S|snoU13_ENST00000459443.1_RNA	NM_018060.3	NP_060530.3	Q9NSE4	SYIM_HUMAN	isoleucyl-tRNA synthetase 2, mitochondrial	717					gene expression (GO:0010467)|isoleucyl-tRNA aminoacylation (GO:0006428)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|isoleucine-tRNA ligase activity (GO:0004822)			NS(1)|breast(1)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(7)|lung(17)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	51				GBM - Glioblastoma multiforme(131;0.0554)	L-Isoleucine(DB00167)	TCCGTGCTCAATGCTGCCAGA	0.408																																					p.N717S		.											.	IARS2-94	0			c.A2150G						.						141.0	126.0	131.0					1																	220311360		2203	4300	6503	SO:0001583	missense	55699	exon17			TGCTCAATGCTGC	AK022665	CCDS1523.1	1q41	2011-07-01	2007-02-26		ENSG00000067704	ENSG00000067704	6.1.1.5	"""Aminoacyl tRNA synthetases / Class I"""	29685	protein-coding gene	gene with protein product	"""isoleucine tRNA ligase 2, mitochondrial"""	612801					Standard	NM_018060		Approved	FLJ10326	uc001hmc.3	Q9NSE4	OTTHUMG00000037287	ENST00000302637.5:c.2150A>G	1.37:g.220311360A>G	ENSP00000303279:p.Asn717Ser	Somatic	141	0		WXS	Illumina HiSeq	Phase_I	142	11	NM_018060	0	0	7	7	0	B2RPG8|Q1M2P9|Q6PI85|Q7L439|Q86WU9|Q96D91|Q9H9Q8|Q9NW42	Missense_Mutation	SNP	ENST00000302637.5	37	CCDS1523.1	.	.	.	.	.	.	.	.	.	.	A	15.56	2.868965	0.51588	.	.	ENSG00000067704	ENST00000366922;ENST00000302637	T;T	0.41758	0.99;0.99	5.94	-2.49	0.06403	.	0.500458	0.25060	N	0.033452	T	0.22820	0.0551	N	0.26162	0.8	0.29693	N	0.840771	B	0.06786	0.001	B	0.08055	0.003	T	0.05289	-1.0894	10	0.54805	T	0.06	-2.622	5.3859	0.16218	0.4679:0.2548:0.2773:0.0	.	717	Q9NSE4	SYIM_HUMAN	S	645;717	ENSP00000355889:N645S;ENSP00000303279:N717S	ENSP00000303279:N717S	N	+	2	0	IARS2	218377983	0.015000	0.18098	0.161000	0.22692	0.442000	0.32017	0.217000	0.17603	-0.335000	0.08451	-0.385000	0.06624	AAT	.		0.408	IARS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_018060	
URB2	9816	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	229771821	229771821	+	Silent	SNP	G	G	A			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr1:229771821G>A	ENST00000258243.2	+	4	1597	c.1461G>A	c.(1459-1461)caG>caA	p.Q487Q		NM_014777.2	NP_055592.2	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog (S. cerevisiae)	487						aggresome (GO:0016235)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(6)	73						CACTGAGGCAGCCTGTGCTGG	0.582																																					p.Q487Q		.											.	URB2-174	0			c.G1461A						.						111.0	119.0	116.0					1																	229771821		2203	4300	6503	SO:0001819	synonymous_variant	9816	exon4			GAGGCAGCCTGTG	D50923	CCDS31052.1	1q42.13	2009-11-06	2008-10-01	2008-10-01	ENSG00000135763	ENSG00000135763			28967	protein-coding gene	gene with protein product	"""nucleolar preribosomal-associated protein 1"""		"""KIAA0133"""	KIAA0133		8590280	Standard	NM_014777		Approved	NPA2, NET10	uc001hts.1	Q14146	OTTHUMG00000039464	ENST00000258243.2:c.1461G>A	1.37:g.229771821G>A		Somatic	114	0		WXS	Illumina HiSeq	Phase_I	117	55	NM_014777	0	0	0	0	0	Q5VYC9	Silent	SNP	ENST00000258243.2	37	CCDS31052.1																																																																																			.		0.582	URB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095232.1	NM_014777	
HNRNPU	3192	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	245018785	245018785	+	Missense_Mutation	SNP	A	A	G			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr1:245018785A>G	ENST00000283179.9	-	12	2456	c.2293T>C	c.(2293-2295)Tac>Cac	p.Y765H	HNRNPU-AS1_ENST00000489705.1_RNA|HNRNPU_ENST00000444376.2_Missense_Mutation_p.Y746H|HNRNPU-AS1_ENST00000475997.1_RNA			Q00839	HNRPU_HUMAN	heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A)	765	Gly-rich.				CRD-mediated mRNA stabilization (GO:0070934)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|CRD-mediated mRNA stability complex (GO:0070937)|cytoplasmic ribonucleoprotein granule (GO:0036464)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|endometrium(2)|large_intestine(1)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20	all_cancers(71;6.97e-06)|all_epithelial(71;0.000104)|all_neural(11;0.0269)|Breast(184;0.0545)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0989)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.00868)			CTGTTTGAGTAACTACCACGG	0.512																																					p.Y765H	NSCLC(33;911 1010 3329 23631 49995)	.											.	HNRNPU-22	0			c.T2293C						.						169.0	168.0	168.0					1																	245018785		2203	4300	6503	SO:0001583	missense	3192	exon12			TTGAGTAACTACC	X65488	CCDS31081.1, CCDS41479.1	1q44	2011-10-24		2007-08-16	ENSG00000153187	ENSG00000153187			5048	protein-coding gene	gene with protein product		602869		HNRPU		7509195, 8068679	Standard	NM_031844		Approved	SAF-A, hnRNPU	uc001iaz.1	Q00839	OTTHUMG00000040396	ENST00000283179.9:c.2293T>C	1.37:g.245018785A>G	ENSP00000283179:p.Tyr765His	Somatic	138	0		WXS	Illumina HiSeq	Phase_I	119	45	NM_031844	0	0	75	110	35	O75507|Q8N174|Q96HY9|Q9BQ09	Missense_Mutation	SNP	ENST00000283179.9	37	CCDS41479.1	.	.	.	.	.	.	.	.	.	.	A	16.34	3.094744	0.56075	.	.	ENSG00000153187	ENST00000444376;ENST00000283179;ENST00000427948	T;T	0.47177	0.85;0.86	5.51	5.51	0.81932	.	0.337558	0.31936	N	0.006827	T	0.42177	0.1191	N	0.04508	-0.205	0.44289	D	0.997152	D;D;P	0.69078	0.997;0.995;0.919	P;P;P	0.62184	0.899;0.795;0.543	T	0.42732	-0.9434	10	0.15952	T	0.53	-5.3765	15.623	0.76824	1.0:0.0:0.0:0.0	.	746;765;489	Q00839-2;Q00839;Q5RI19	.;HNRPU_HUMAN;.	H	746;765;690	ENSP00000393151:Y746H;ENSP00000283179:Y765H	ENSP00000283179:Y765H	Y	-	1	0	HNRNPU	243085408	1.000000	0.71417	0.798000	0.32154	0.954000	0.61252	6.268000	0.72552	2.088000	0.63022	0.482000	0.46254	TAC	.		0.512	HNRNPU-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000097163.3	NM_031844	
NRP1	8829	ucsc.edu;bcgsc.ca	37	10	33543118	33543118	+	Silent	SNP	G	G	A			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr10:33543118G>A	ENST00000265371.4	-	7	1344	c.819C>T	c.(817-819)ttC>ttT	p.F273F	NRP1_ENST00000374867.2_Silent_p.F273F|NRP1_ENST00000374822.4_Silent_p.F273F|NRP1_ENST00000374816.3_Silent_p.F273F|NRP1_ENST00000374821.5_Silent_p.F273F|NRP1_ENST00000374823.5_Silent_p.F273F|NRP1_ENST00000432372.2_Silent_p.F273F|NRP1_ENST00000395995.1_Silent_p.F273F|NRP1_ENST00000374875.1_Silent_p.F92F			O14786	NRP1_HUMAN	neuropilin 1	273					angiogenesis (GO:0001525)|angiogenesis involved in coronary vascular morphogenesis (GO:0060978)|artery morphogenesis (GO:0048844)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-cell signaling (GO:0007267)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|commissural neuron axon guidance (GO:0071679)|coronary artery morphogenesis (GO:0060982)|dendrite development (GO:0016358)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell chemotaxis (GO:0035767)|endothelial tip cell fate specification (GO:0097102)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neuron migration (GO:0001764)|organ morphogenesis (GO:0009887)|patterning of blood vessels (GO:0001569)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of cytokine activity (GO:0060301)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of retinal ganglion cell axon guidance (GO:1902336)|positive regulation of smooth muscle cell migration (GO:0014911)|protein localization to early endosome (GO:1902946)|regulation of retinal ganglion cell axon guidance (GO:0090259)|regulation of vesicle-mediated transport (GO:0060627)|renal artery morphogenesis (GO:0061441)|response to wounding (GO:0009611)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal ganglion cell axon guidance (GO:0031290)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|signal transduction (GO:0007165)|sprouting angiogenesis (GO:0002040)|sympathetic ganglion development (GO:0061549)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|VEGF-activated neuropilin signaling pathway (GO:0038190)|VEGF-activated neuropilin signaling pathway involved in axon guidance (GO:1902378)	axon (GO:0030424)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neurofilament (GO:0005883)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|semaphorin receptor complex (GO:0002116)|sorting endosome (GO:0097443)	coreceptor activity (GO:0015026)|cytokine binding (GO:0019955)|growth factor binding (GO:0019838)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)|semaphorin receptor activity (GO:0017154)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(2)	48					Palifermin(DB00039)|Pegaptanib(DB04895)	CCATACATTTGAAATCTGAAG	0.418																																					p.F273F	Melanoma(104;886 1489 44640 45944 51153)												.	NRP1-525	0			c.C819T						.						69.0	67.0	68.0					10																	33543118		2203	4300	6503	SO:0001819	synonymous_variant	8829	exon6			ACATTTGAAATCT	AF016050	CCDS7177.1, CCDS31179.1, CCDS31180.1	10p12	2006-02-23			ENSG00000099250	ENSG00000099250		"""CD molecules"""	8004	protein-coding gene	gene with protein product		602069				9529250, 9331348	Standard	NM_003873		Approved	NRP, VEGF165R, CD304	uc001iwx.4	O14786	OTTHUMG00000019343	ENST00000265371.4:c.819C>T	10.37:g.33543118G>A		Somatic	73	0		WXS	Illumina HiSeq		46	5	NM_001244973	0	0	0	0	0	B0LPG9|O60461|Q5T7F1|Q5T7F2|Q5T7F3|Q86T59|Q96I90|Q96IH5	Silent	SNP	ENST00000265371.4	37	CCDS7177.1	.	.	.	.	.	.	.	.	.	.	G	9.065	0.995376	0.19043	.	.	ENSG00000099250	ENST00000455749	.	.	.	5.28	2.14	0.27477	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-24.4103	8.6907	0.34264	0.3214:0.0:0.6786:0.0	.	.	.	.	X	74	.	.	Q	-	1	0	NRP1	33583124	1.000000	0.71417	0.999000	0.59377	0.954000	0.61252	1.436000	0.34980	0.214000	0.20742	0.650000	0.86243	CAA	.		0.418	NRP1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051203.2		
OPN4	94233	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	88419072	88419072	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr10:88419072G>A	ENST00000241891.5	+	5	814	c.647G>A	c.(646-648)gGg>gAg	p.G216E	OPN4_ENST00000372071.2_Missense_Mutation_p.G227E	NM_033282.3	NP_150598.1	Q9UHM6	OPN4_HUMAN	opsin 4	216					phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)|rhodopsin mediated signaling pathway (GO:0016056)|rhythmic process (GO:0048511)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	11-cis retinal binding (GO:0005502)|G-protein coupled photoreceptor activity (GO:0008020)	p.G227V(2)		breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(5)|ovary(3)	18						GTGCCCGAGGGGTTGCTGACA	0.612																																					p.G227E		.											.	OPN4-69	2	Substitution - Missense(2)	liver(2)	c.G680A						.						167.0	135.0	146.0					10																	88419072		2203	4300	6503	SO:0001583	missense	94233	exon6			CCGAGGGGTTGCT	AF147788	CCDS7376.1, CCDS31237.1	10q22	2012-08-08	2008-04-16		ENSG00000122375	ENSG00000122375		"""GPCR / Class A : Opsin receptors"""	14449	protein-coding gene	gene with protein product	"""melanopsin"""	606665	"""opsin 4 (melanopsin)"""			10632589	Standard	NM_001030015		Approved	MOP, melanopsin	uc001kdp.3	Q9UHM6	OTTHUMG00000018654	ENST00000241891.5:c.647G>A	10.37:g.88419072G>A	ENSP00000241891:p.Gly216Glu	Somatic	56	0		WXS	Illumina HiSeq	Phase_I	77	29	NM_001030015	0	0	0	0	0	B7ZLB3|Q14D01|Q2PP22|Q8NGQ9	Missense_Mutation	SNP	ENST00000241891.5	37	CCDS7376.1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.985781	0.93044	.	.	ENSG00000122375	ENST00000372071;ENST00000241891;ENST00000443292	T;T;T	0.70282	-0.47;-0.47;-0.47	5.15	5.15	0.70609	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.86694	0.5994	M	0.87269	2.87	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.89121	0.3503	10	0.87932	D	0	.	18.6376	0.91384	0.0:0.0:1.0:0.0	.	227;216;227	C9JWU6;Q9UHM6;Q9UHM6-2	.;OPN4_HUMAN;.	E	227;216;227	ENSP00000361141:G227E;ENSP00000241891:G216E;ENSP00000393132:G227E	ENSP00000241891:G216E	G	+	2	0	OPN4	88409052	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	9.705000	0.98719	2.397000	0.81536	0.655000	0.94253	GGG	.		0.612	OPN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049158.2	NM_033282	
KCNA4	3739	hgsc.bcm.edu;broad.mit.edu	37	11	30034138	30034138	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr11:30034138G>A	ENST00000328224.6	-	2	1321	c.88C>T	c.(88-90)Cgg>Tgg	p.R30W	KCNA4_ENST00000526518.1_5'Flank	NM_002233.3	NP_002224.1	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 4	30					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(39)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	78					Dalfampridine(DB06637)	AGCCTCTCCCGCTCCCGGGCC	0.637																																					p.R30W		.											.	KCNA4-517	0			c.C88T						.						58.0	60.0	59.0					11																	30034138		1910	4113	6023	SO:0001583	missense	3739	exon2			TCTCCCGCTCCCG	M55514	CCDS41629.1	11p14	2012-07-05	2002-07-10			ENSG00000182255		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6222	protein-coding gene	gene with protein product		176266	"""potassium voltage-gated channel, shaker-related subfamily, member 4-like"""	KCNA4L		2263489, 16382104	Standard	NM_002233		Approved	Kv1.4, HK1, HPCN2	uc001msk.3	P22459		ENST00000328224.6:c.88C>T	11.37:g.30034138G>A	ENSP00000328511:p.Arg30Trp	Somatic	14	0		WXS	Illumina HiSeq	Phase_I	12	5	NM_002233	0	0	0	0	0		Missense_Mutation	SNP	ENST00000328224.6	37	CCDS41629.1	.	.	.	.	.	.	.	.	.	.	G	15.97	2.988463	0.53934	.	.	ENSG00000182255	ENST00000328224	D	0.98012	-4.66	4.97	2.88	0.33553	Potassium channel, voltage dependent, Kv1.4, tandem inactivation (2);	269.221000	0.00166	N	0.000002	D	0.95290	0.8472	N	0.24115	0.695	0.47276	D	0.999375	B	0.29671	0.254	B	0.21360	0.034	T	0.80362	-0.1414	10	0.87932	D	0	.	14.4391	0.67303	0.0:0.0:0.6478:0.3522	.	30	P22459	KCNA4_HUMAN	W	30	ENSP00000328511:R30W	ENSP00000328511:R30W	R	-	1	2	KCNA4	29990714	1.000000	0.71417	0.992000	0.48379	0.963000	0.63663	0.619000	0.24388	1.065000	0.40693	0.655000	0.94253	CGG	.		0.637	KCNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388074.2	NM_002233	
API5	8539	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	43350300	43350300	+	Silent	SNP	A	A	T			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr11:43350300A>T	ENST00000531273.1	+	9	1123	c.984A>T	c.(982-984)ggA>ggT	p.G328G	API5_ENST00000378852.3_Silent_p.G328G|API5_ENST00000455725.2_Silent_p.G317G|API5_ENST00000420461.2_Silent_p.G274G|API5_ENST00000534695.1_Intron|RP11-484D2.2_ENST00000526220.1_RNA|API5_ENST00000534600.1_Silent_p.G328G|Y_RNA_ENST00000516843.1_RNA			Q9BZZ5	API5_HUMAN	apoptosis inhibitor 5	328	ARM-like and Heat-like helical repeats.				apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|negative regulation of fibroblast apoptotic process (GO:2000270)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	fibroblast growth factor binding (GO:0017134)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|prostate(2)|urinary_tract(1)	20						CAGAAAATGGAGAGAATGCTG	0.373																																					p.G328G	Pancreas(1;98 122 5625 20895 49453)	.											.	API5-136	0			c.A984T						.						82.0	72.0	75.0					11																	43350300		2203	4300	6503	SO:0001819	synonymous_variant	8539	exon9			AAATGGAGAGAAT	U83857	CCDS31465.1, CCDS44572.1, CCDS44573.1	11p12	2010-09-30			ENSG00000166181	ENSG00000166181			594	protein-coding gene	gene with protein product	"""API5-like 1"", ""fibroblast growth factor 2-interacting factor 2"", ""migration-inducing protein MIG8"""	609774				9307294	Standard	NR_024625		Approved	AAC-11, API5L1, AAC11	uc010rfh.1	Q9BZZ5	OTTHUMG00000166395	ENST00000531273.1:c.984A>T	11.37:g.43350300A>T		Somatic	244	0		WXS	Illumina HiSeq	Phase_I	234	73	NM_006595	0	0	2	2	0	B4DGR0|B4DRJ2|D3DR21|O15441|Q9Y4J7	Silent	SNP	ENST00000531273.1	37	CCDS44572.1																																																																																			.		0.373	API5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389545.1	NM_006595	
NRXN2	9379	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	64428553	64428553	+	Silent	SNP	A	A	T			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr11:64428553A>T	ENST00000377551.1	-	9	2068	c.1857T>A	c.(1855-1857)atT>atA	p.I619I	NRXN2_ENST00000377559.3_Silent_p.I588I|NRXN2_ENST00000265459.6_Silent_p.I619I|NRXN2_ENST00000409571.1_Silent_p.I612I|AP001092.4_ENST00000433606.1_RNA|NRXN2_ENST00000496291.1_5'UTR			Q9P2S2	NRX2A_HUMAN	neurexin 2	619	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|gephyrin clustering (GO:0097116)|neuroligin clustering (GO:0097118)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	calcium channel regulator activity (GO:0005246)|cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|neuroligin family protein binding (GO:0097109)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	71						CCAGGTCCAGAATCTCGCTGT	0.637																																					p.I619I													.	NRXN2-232	0			c.T1857A						.						28.0	31.0	30.0					11																	64428553		2201	4297	6498	SO:0001819	synonymous_variant	9379	exon10			GTCCAGAATCTCG		CCDS8077.1, CCDS31597.1, CCDS8078.1	11q13	2008-07-18			ENSG00000110076	ENSG00000110076			8009	protein-coding gene	gene with protein product	"""neurexin II"""	600566				1621094	Standard	NM_015080		Approved		uc021qkw.1	P58401	OTTHUMG00000045214	ENST00000377551.1:c.1857T>A	11.37:g.64428553A>T		Somatic	146	2		WXS	Illumina HiSeq	Phase_I	174	72	NM_015080	0	0	0	0	0	A7E2C1|Q9Y2D6	Silent	SNP	ENST00000377551.1	37	CCDS8077.1																																																																																			.		0.637	NRXN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104967.3	NM_015080	
MCAM	4162	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	119185945	119185945	+	Silent	SNP	C	C	T	rs558009680		TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr11:119185945C>T	ENST00000264036.4	-	2	110	c.96G>A	c.(94-96)gcG>gcA	p.A32A	MCAM_ENST00000530144.2_5'UTR|MCAM_ENST00000392814.1_5'Flank	NM_006500.2	NP_006491.2	P43121	MUC18_HUMAN	melanoma cell adhesion molecule	32	Ig-like V-type 1.				anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|glomerular filtration (GO:0003094)|vascular wound healing (GO:0061042)	external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(3)|skin(1)	22		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.78e-05)		CCAGCTCAGGCGCAGGCTGCT	0.682													C|||	1	0.000199681	0.0008	0.0	5008	,	,		15849	0.0		0.0	False		,,,				2504	0.0				p.A32A		.											.	MCAM-137	0			c.G96A						.						41.0	37.0	38.0					11																	119185945		2199	4294	6493	SO:0001819	synonymous_variant	4162	exon2			CTCAGGCGCAGGC	X68264	CCDS31690.1	11q23.3	2013-01-29				ENSG00000076706		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6934	protein-coding gene	gene with protein product	"""Gicerin"""	155735				2602381, 10702685	Standard	XM_005271552		Approved	MUC18, CD146	uc001pwf.3	P43121		ENST00000264036.4:c.96G>A	11.37:g.119185945C>T		Somatic	42	0		WXS	Illumina HiSeq	Phase_I	48	5	NM_006500	0	0	0	0	0	O95812|Q59E86|Q6PHR3|Q6ZTR2	Silent	SNP	ENST00000264036.4	37	CCDS31690.1																																																																																			.		0.682	MCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388332.2		
C2CD5	9847	broad.mit.edu	37	12	22646273	22646273	+	Splice_Site	SNP	T	T	A			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr12:22646273T>A	ENST00000333957.4	-	11	1403		c.e11-2		C2CD5_ENST00000446597.1_Splice_Site|C2CD5_ENST00000536386.1_Splice_Site|C2CD5_ENST00000396028.2_Splice_Site|C2CD5_ENST00000545552.1_Splice_Site|C2CD5_ENST00000544930.1_Splice_Site|C2CD5_ENST00000542676.1_Splice_Site	NM_014802.1	NP_055617.1	Q86YS7	C2CD5_HUMAN	C2 calcium-dependent domain containing 5						cellular response to insulin stimulus (GO:0032869)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|intracellular protein transmembrane transport (GO:0065002)|positive regulation of glucose transport (GO:0010828)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)										CTGGTTCATCTGAAAAATAAA	0.318																																					.													.	.	0			c.1148-2A>T						.						151.0	136.0	141.0					12																	22646273		2203	4300	6503	SO:0001630	splice_region_variant	9847	exon12			TTCATCTGAAAAA	AB011100	CCDS31758.1, CCDS66337.1, CCDS66338.1, CCDS66339.1, CCDS66340.1	12p12.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000111731	ENSG00000111731			29062	protein-coding gene	gene with protein product	"""138 kDa C2 domain-containing phosphoprotein"""		"""KIAA0528"""	KIAA0528		21907143	Standard	XM_005253538		Approved	CDP138	uc001rfq.3	Q86YS7	OTTHUMG00000169100	ENST00000333957.4:c.1148-2A>T	12.37:g.22646273T>A		Somatic	21	0		WXS	Illumina HiSeq	Phase_I	39	3	NM_014802	0	0	0	0	0	B4DJ03|B4DRN7|B7ZLL0|F5H2A1|F5H5R1|O60280|Q17RY7|Q7Z619|Q86SU3	Splice_Site	SNP	ENST00000333957.4	37	CCDS31758.1	.	.	.	.	.	.	.	.	.	.	T	23.9	4.474467	0.84640	.	.	ENSG00000111731	ENST00000333957;ENST00000446597;ENST00000536386;ENST00000396028;ENST00000542676;ENST00000545552;ENST00000544930;ENST00000535555	.	.	.	5.71	5.71	0.89125	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.5538	0.68086	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	KIAA0528	22537540	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.895000	0.87343	2.176000	0.68965	0.477000	0.44152	.	.		0.318	C2CD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402257.1	NM_014802	Intron
GLI1	2735	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	57861257	57861257	+	Missense_Mutation	SNP	C	C	A			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr12:57861257C>A	ENST00000228682.2	+	9	1145	c.1054C>A	c.(1054-1056)Cag>Aag	p.Q352K	GLI1_ENST00000543426.1_Missense_Mutation_p.Q224K|GLI1_ENST00000546141.1_Missense_Mutation_p.Q311K	NM_005269.2	NP_005260.1	P08151	GLI1_HUMAN	GLI family zinc finger 1	352					cerebellar cortex morphogenesis (GO:0021696)|digestive tract morphogenesis (GO:0048546)|dorsal/ventral pattern formation (GO:0009953)|epidermal cell differentiation (GO:0009913)|lung development (GO:0030324)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|notochord regression (GO:0060032)|osteoblast differentiation (GO:0001649)|pituitary gland development (GO:0021983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proximal/distal pattern formation (GO:0009954)|regulation of smoothened signaling pathway (GO:0008589)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|spermatogenesis (GO:0007283)|ventral midline development (GO:0007418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|primary cilium (GO:0072372)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(8)|lung(22)|ovary(6)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69			GBM - Glioblastoma multiforme(3;3.99e-32)			AGCCAAGCACCAGAATCGGAC	0.547																																					p.Q352K	Pancreas(157;841 1936 10503 41495 50368)	.											.	GLI1-722	0			c.C1054A						.						120.0	80.0	94.0					12																	57861257		2203	4300	6503	SO:0001583	missense	2735	exon9			AAGCACCAGAATC		CCDS8940.1, CCDS53806.1, CCDS53807.1	12q13.2-q13.3	2013-01-25	2009-03-05	2005-01-14		ENSG00000111087		"""Zinc fingers, C2H2-type"""	4317	protein-coding gene	gene with protein product		165220	"""glioma-associated oncogene homolog 1 (zinc finger protein)"", ""glioma-associated oncogene family zinc finger 1"""	GLI		2850480	Standard	NM_005269		Approved		uc001snx.3	P08151		ENST00000228682.2:c.1054C>A	12.37:g.57861257C>A	ENSP00000228682:p.Gln352Lys	Somatic	214	0		WXS	Illumina HiSeq	Phase_I	368	92	NM_005269	0	0	0	0	0	D0EUY3|E9PQQ9|F5H6H8|Q8TDN9	Missense_Mutation	SNP	ENST00000228682.2	37	CCDS8940.1	.	.	.	.	.	.	.	.	.	.	C	29.4	5.001063	0.93227	.	.	ENSG00000111087	ENST00000543426;ENST00000228682;ENST00000546141;ENST00000528467;ENST00000443131	T;T;T;T	0.24151	1.87;1.87;1.87;1.87	4.77	4.77	0.60923	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.49916	D	0.000133	T	0.34454	0.0898	N	0.14661	0.345	0.80722	D	1	D	0.59357	0.985	D	0.68765	0.96	T	0.34601	-0.9822	10	0.87932	D	0	.	17.1156	0.86688	0.0:1.0:0.0:0.0	.	352	P08151	GLI1_HUMAN	K	224;352;311;311;224	ENSP00000437607:Q224K;ENSP00000228682:Q352K;ENSP00000441006:Q311K;ENSP00000434408:Q311K	ENSP00000228682:Q352K	Q	+	1	0	GLI1	56147524	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.578000	0.82498	2.644000	0.89710	0.655000	0.94253	CAG	.		0.547	GLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394197.1	NM_005269	
PAWR	5074	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	80083606	80083606	+	Missense_Mutation	SNP	G	G	A	rs369162125		TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr12:80083606G>A	ENST00000328827.4	-	2	791	c.419C>T	c.(418-420)tCg>tTg	p.S140L	RP11-530C5.1_ENST00000551995.1_lincRNA|PAWR_ENST00000547571.1_5'UTR	NM_002583.2	NP_002574.2	Q96IZ0	PAWR_HUMAN	PRKC, apoptosis, WT1, regulator	140					actin filament bundle assembly (GO:0051017)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|interleukin-2 biosynthetic process (GO:0042094)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of amyloid precursor protein biosynthetic process (GO:0042986)|positive regulation of apoptotic process (GO:0043065)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	actin binding (GO:0003779)|enzyme binding (GO:0019899)|leucine zipper domain binding (GO:0043522)|transcription corepressor activity (GO:0003714)			NS(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)	8						ACTGGGGCCCGAGCTCTTGCC	0.706																																					p.S140L		.											.	PAWR-90	0			c.C419T						.	G	LEU/SER	0,4392		0,0,2196	11.0	11.0	11.0		419	2.6	1.0	12		11	1,8579		0,1,4289	no	missense	PAWR	NM_002583.2	145	0,1,6485	AA,AG,GG		0.0117,0.0,0.0077	possibly-damaging	140/341	80083606	1,12971	2196	4290	6486	SO:0001583	missense	5074	exon2			GGGCCCGAGCTCT	U63809	CCDS31863.1	12q21.2	2013-03-07			ENSG00000177425	ENSG00000177425			8614	protein-coding gene	gene with protein product	"""prostate apoptosis response-4"""	601936				8943350, 9790775	Standard	NM_002583		Approved	par-4, PAR4	uc001syx.3	Q96IZ0	OTTHUMG00000170080	ENST00000328827.4:c.419C>T	12.37:g.80083606G>A	ENSP00000328088:p.Ser140Leu	Somatic	40	0		WXS	Illumina HiSeq	Phase_I	100	5	NM_002583	0	0	0	0	0	O75796|Q6FHY9|Q8N700	Missense_Mutation	SNP	ENST00000328827.4	37	CCDS31863.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.494262	0.85069	0.0	1.17E-4	ENSG00000177425	ENST00000328827	T	0.10192	2.9	3.48	2.59	0.31030	.	0.352131	0.26887	N	0.021991	T	0.08133	0.0203	L	0.50333	1.59	0.42430	D	0.992671	P	0.35944	0.529	B	0.28305	0.088	T	0.29274	-1.0017	9	.	.	.	-1.0638	6.7459	0.23460	0.0988:0.1793:0.7219:0.0	.	140	Q96IZ0	PAWR_HUMAN	L	140	ENSP00000328088:S140L	.	S	-	2	0	PAWR	78607737	1.000000	0.71417	1.000000	0.80357	0.788000	0.44548	6.058000	0.71126	0.650000	0.30769	0.563000	0.77884	TCG	.		0.706	PAWR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407175.1	NM_002583	
P2RX2	22953	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	133197702	133197702	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr12:133197702C>T	ENST00000389110.3	+	8	927	c.890C>T	c.(889-891)tCa>tTa	p.S297L	P2RX2_ENST00000449132.2_Missense_Mutation_p.S263L|P2RX2_ENST00000343948.4_Missense_Mutation_p.S297L|P2RX2_ENST00000352418.4_Missense_Mutation_p.S225L|P2RX2_ENST00000348800.5_Missense_Mutation_p.S297L|P2RX2_ENST00000351222.4_Missense_Mutation_p.S205L|P2RX2_ENST00000350048.5_Missense_Mutation_p.S273L	NM_170682.2|NM_170683.2|NM_174873.1	NP_733782.1|NP_733783.1|NP_777362.1	Q9UBL9	P2RX2_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 2	297					behavioral response to pain (GO:0048266)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of hypoxic conditions in blood by carotid body chemoreceptor signaling (GO:0003029)|ion transmembrane transport (GO:0034220)|neuromuscular junction development (GO:0007528)|neuromuscular synaptic transmission (GO:0007274)|neuronal action potential (GO:0019228)|peristalsis (GO:0030432)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of calcium-mediated signaling (GO:0050850)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|response to ATP (GO:0033198)|response to carbohydrate (GO:0009743)|response to hypoxia (GO:0001666)|sensory perception of sound (GO:0007605)|sensory perception of taste (GO:0050909)|skeletal muscle fiber development (GO:0048741)|urinary bladder smooth muscle contraction (GO:0014832)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|dendritic spine (GO:0043197)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|cadmium ion binding (GO:0046870)|cobalt ion binding (GO:0050897)|copper ion binding (GO:0005507)|drug binding (GO:0008144)|extracellular ATP-gated cation channel activity (GO:0004931)|identical protein binding (GO:0042802)|ligand-gated ion channel activity (GO:0015276)|mercury ion binding (GO:0045340)|nickel cation binding (GO:0016151)|phosphatidylinositol binding (GO:0035091)|purinergic nucleotide receptor activity (GO:0001614)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|kidney(2)|large_intestine(2)|liver(2)|lung(8)|ovary(1)|prostate(3)	20	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0767)		OV - Ovarian serous cystadenocarcinoma(86;2.32e-08)|Epithelial(86;8.62e-08)|all cancers(50;4.5e-06)		CCTGCCTCGTCAGGCTACAAC	0.607																																					p.S297L		.											.	P2RX2-68	0			c.C890T						.						103.0	84.0	90.0					12																	133197702		2203	4300	6503	SO:0001583	missense	22953	exon8			CCTCGTCAGGCTA	AF109387	CCDS31930.1, CCDS31931.1, CCDS31932.1, CCDS31933.1, CCDS31934.1, CCDS31935.1, CCDS61286.1, CCDS73548.1	12q24.33	2013-03-22			ENSG00000187848	ENSG00000187848		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	15459	protein-coding gene	gene with protein product		600844	"""deafness, autosomal dominant 41"""	DFNA41		10570044, 7523952, 23345450	Standard	XM_005266154		Approved	P2X2	uc001ukk.1	Q9UBL9	OTTHUMG00000168018	ENST00000389110.3:c.890C>T	12.37:g.133197702C>T	ENSP00000373762:p.Ser297Leu	Somatic	124	0		WXS	Illumina HiSeq	Phase_I	182	11	NM_170683	0	0	0	0	0	A6NGB4|A6NH93|A6NHC2|A6NHU3|A6NIG9|Q6V9R6|Q9NR37|Q9NR38|Q9UHD5|Q9UHD6|Q9UHD7|Q9Y637|Q9Y638	Missense_Mutation	SNP	ENST00000389110.3	37	CCDS31931.1	.	.	.	.	.	.	.	.	.	.	C	16.49	3.138279	0.56936	.	.	ENSG00000187848	ENST00000389110;ENST00000449132;ENST00000343948;ENST00000352418;ENST00000350048;ENST00000351222;ENST00000348800	T;T;T;T;T;T;T	0.04406	3.63;3.63;3.63;3.63;3.63;3.63;3.63	4.96	4.96	0.65561	.	0.120057	0.64402	D	0.000017	T	0.13628	0.0330	M	0.76002	2.32	0.28672	N	0.905593	P;P;P;D;P;P;P;P	0.53745	0.751;0.58;0.928;0.962;0.716;0.716;0.849;0.575	P;P;P;B;B;P;P;B	0.49887	0.527;0.476;0.625;0.341;0.407;0.487;0.622;0.392	T	0.01375	-1.1371	10	0.54805	T	0.06	-13.2945	16.1502	0.81611	0.0:1.0:0.0:0.0	.	297;263;205;225;273;297;297;297	Q32MC3;Q9UBL9-7;Q9UBL9-5;Q9UBL9-6;Q9UBL9-3;Q9UBL9-4;Q9UBL9;Q9UBL9-2	.;.;.;.;.;.;P2RX2_HUMAN;.	L	297;263;297;225;273;205;297	ENSP00000373762:S297L;ENSP00000405531:S263L;ENSP00000343339:S297L;ENSP00000341419:S225L;ENSP00000343904:S273L;ENSP00000344502:S205L;ENSP00000345095:S297L	ENSP00000343339:S297L	S	+	2	0	P2RX2	131707775	0.343000	0.24818	0.655000	0.29622	0.406000	0.30931	3.786000	0.55431	2.584000	0.87258	0.561000	0.74099	TCA	.		0.607	P2RX2-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397542.1		
POU4F1	5457	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	79175599	79175599	+	Missense_Mutation	SNP	C	C	A			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr13:79175599C>A	ENST00000377208.5	-	2	1422	c.1211G>T	c.(1210-1212)tGc>tTc	p.C404F	RNF219-AS1_ENST00000560209.2_RNA|RNF219-AS1_ENST00000430549.2_RNA|RNF219-AS1_ENST00000607220.1_RNA|RNF219-AS1_ENST00000607860.1_RNA|RNF219-AS1_ENST00000606376.1_RNA|RNF219-AS1_ENST00000444769.3_RNA|RNF219-AS1_ENST00000606429.1_RNA|RNF219-AS1_ENST00000560584.2_RNA|RNF219-AS1_ENST00000606124.1_RNA|RNF219-AS1_ENST00000607205.1_RNA|RP11-52L5.6_ENST00000607269.1_RNA	NM_006237.3	NP_006228.3	Q01851	PO4F1_HUMAN	POU class 4 homeobox 1	404					axonogenesis (GO:0007409)|cell migration in hindbrain (GO:0021535)|central nervous system neuron differentiation (GO:0021953)|habenula development (GO:0021986)|innervation (GO:0060384)|mesoderm development (GO:0007498)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate specification (GO:0048665)|peripheral nervous system neuron development (GO:0048935)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proprioception involved in equilibrioception (GO:0051355)|regulation of neurogenesis (GO:0050767)|sensory system development (GO:0048880)|suckling behavior (GO:0001967)|synapse assembly (GO:0007416)|transcription from RNA polymerase II promoter (GO:0006366)|trigeminal nerve development (GO:0021559)|ventricular compact myocardium morphogenesis (GO:0003223)	neuron projection (GO:0043005)|nuclear chromatin (GO:0000790)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)			central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(4)|lung(5)|ovary(1)	16		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)		GBM - Glioblastoma multiforme(99;0.129)		TCTCTGGTTGCAAAACCACAC	0.597																																					p.C404F	Melanoma(109;347 2166 14574 42843)|Ovarian(81;1394 1854 22417 48351)	.											.	POU4F1-515	0			c.G1211T						.						91.0	88.0	89.0					13																	79175599		2203	4300	6503	SO:0001583	missense	5457	exon2			TGGTTGCAAAACC	X64624	CCDS31996.1	13q31.1	2011-06-20	2007-07-13		ENSG00000152192	ENSG00000152192		"""Homeoboxes / POU class"""	9218	protein-coding gene	gene with protein product		601632	"""POU domain class 4, transcription factor 1"""	BRN3A		1357630	Standard	NM_006237		Approved	RDC-1	uc001vkv.3	Q01851	OTTHUMG00000017119	ENST00000377208.5:c.1211G>T	13.37:g.79175599C>A	ENSP00000366413:p.Cys404Phe	Somatic	48	0		WXS	Illumina HiSeq	Phase_I	43	12	NM_006237	0	0	0	0	0	Q14986|Q15318|Q5T227	Missense_Mutation	SNP	ENST00000377208.5	37	CCDS31996.1	.	.	.	.	.	.	.	.	.	.	C	16.94	3.260312	0.59431	.	.	ENSG00000152192	ENST00000377208	D	0.96232	-3.95	4.35	4.35	0.52113	Homeodomain-related (1);Homeobox (3);POU (1);Homeodomain-like (1);Homeobox, conserved site (1);	0.053289	0.85682	U	0.000000	D	0.98239	0.9417	M	0.87758	2.905	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.99560	1.0968	10	0.87932	D	0	.	16.8947	0.86097	0.0:1.0:0.0:0.0	.	404	Q01851	PO4F1_HUMAN	F	404	ENSP00000366413:C404F	ENSP00000366413:C404F	C	-	2	0	POU4F1	78073600	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.629000	0.83207	2.159000	0.67721	0.499000	0.49734	TGC	.		0.597	POU4F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045360.3		
LINC00238	440184	ucsc.edu	37	14	66965190	66965190	+	lincRNA	SNP	G	G	A			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr14:66965190G>A	ENST00000556874.1	-	0	498				LINC00238_ENST00000389594.3_RNA																							tgaagaattagcaggctttcg	0.408																																					.													.	.	0			.						.																																					440184	.			GAATTAGCAGGCT																													14.37:g.66965190G>A		Somatic	59	0		WXS	Illumina HiSeq		46	4	.	0	0	0	0	0		RNA	SNP	ENST00000556874.1	37																																																																																				.		0.408	RP11-72M17.1-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000412209.1		
DCAF5	8816	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	69521317	69521317	+	Missense_Mutation	SNP	T	T	C			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr14:69521317T>C	ENST00000341516.5	-	9	2233	c.2086A>G	c.(2086-2088)Acc>Gcc	p.T696A	DCAF5_ENST00000556847.1_Missense_Mutation_p.T614A|DCAF5_ENST00000554215.1_Missense_Mutation_p.T614A|DCAF5_ENST00000557386.1_Missense_Mutation_p.T695A|DCAF5_ENST00000553293.1_5'Flank	NM_001284206.1|NM_001284207.1|NM_003861.2	NP_001271135.1|NP_001271136.1|NP_003852.1	Q96JK2	DCAF5_HUMAN	DDB1 and CUL4 associated factor 5	696					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|mitochondrion (GO:0005739)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|upper_aerodigestive_tract(2)	29						TTGTGGCTGGTTCCTGCTCTC	0.527																																					p.T696A		.											.	DCAF5-91	0			c.A2086G						.						110.0	118.0	115.0					14																	69521317		2203	4300	6503	SO:0001583	missense	8816	exon9			GGCTGGTTCCTGC	AB058727	CCDS32106.1, CCDS61480.1, CCDS61481.1, CCDS73646.1	14q23-q24.1	2013-01-09	2009-07-17	2009-07-17				"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	20224	protein-coding gene	gene with protein product		603812	"""WD repeat domain 22"""	WDR22		9740667, 9521877	Standard	NM_003861		Approved	BCRP2, D14S1461E, BCRG2, KIAA1824	uc001xkp.3	Q96JK2		ENST00000341516.5:c.2086A>G	14.37:g.69521317T>C	ENSP00000341351:p.Thr696Ala	Somatic	60	0		WXS	Illumina HiSeq	Phase_I	68	21	NM_003861	0	0	8	14	6	B2RN31|G3V4J7|O60559|Q8N3V3|Q8N3V5	Missense_Mutation	SNP	ENST00000341516.5	37	CCDS32106.1	.	.	.	.	.	.	.	.	.	.	T	15.58	2.875191	0.51695	.	.	ENSG00000139990	ENST00000341516;ENST00000554215;ENST00000556847;ENST00000557386	T;T;T;T	0.71461	-0.57;-0.41;-0.41;0.08	4.99	3.83	0.44106	.	0.081881	0.51477	D	0.000095	T	0.56292	0.1975	L	0.29908	0.895	0.80722	D	1	P;P	0.37864	0.61;0.476	B;B	0.35114	0.196;0.096	T	0.53056	-0.8492	10	0.33141	T	0.24	-17.9216	11.9573	0.52988	0.0:0.0:0.1454:0.8546	.	695;696	G3V4J7;Q96JK2	.;DCAF5_HUMAN	A	696;614;614;695	ENSP00000341351:T696A;ENSP00000451551:T614A;ENSP00000452052:T614A;ENSP00000451845:T695A	ENSP00000341351:T696A	T	-	1	0	DCAF5	68591070	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.462000	0.53042	0.902000	0.36520	0.459000	0.35465	ACC	.		0.527	DCAF5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000414806.2	NM_003861	
IRF2BPL	64207	hgsc.bcm.edu	37	14	77493794	77493794	+	Silent	SNP	T	T	C	rs377151545|rs28718623|rs71125518	byFrequency	TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr14:77493794T>C	ENST00000238647.3	-	1	1240	c.342A>G	c.(340-342)caA>caG	p.Q114Q		NM_024496.3	NP_078772.1	Q9H1B7	I2BPL_HUMAN	interferon regulatory factor 2 binding protein-like	114	Poly-Gln.				development of secondary female sexual characteristics (GO:0046543)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	extracellular space (GO:0005615)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	11						gctgctgctgttgctgctgct	0.697													T|||	1146	0.228834	0.1649	0.1758	5008	,	,		5976	0.2659		0.2614	False		,,,				2504	0.2812				p.Q114Q		.											.	IRF2BPL-90	0			c.A342G						.	-		160,2330		6,148,1091	2.0	2.0	2.0		342	0.6	0.0	14	dbSNP_125	2	324,4012		7,310,1851	no	coding-synonymous	IRF2BPL	NM_024496.2		13,458,2942	CC,CT,TT		7.4723,6.4257,7.0905		114/797	77493794	484,6342	1245	2168	3413	SO:0001819	synonymous_variant	64207	exon1			CTGCTGTTGCTGC	AJ277365	CCDS9854.1	14q24.3	2011-02-23	2011-02-23	2011-02-23	ENSG00000119669	ENSG00000119669			14282	protein-coding gene	gene with protein product	"""enhanced at puberty 1"""	611720	"""chromosome 14 open reading frame 4"""	C14orf4		11095982, 17627301	Standard	NM_024496		Approved	EAP1, KIAA1865	uc001xsy.4	Q9H1B7		ENST00000238647.3:c.342A>G	14.37:g.77493794T>C		Somatic	3	0		WXS	Illumina HiSeq	Phase_I	8	4	NM_024496	1	2	8	4805	4794	Q8NDQ2|Q96JG2|Q9H3I7	Silent	SNP	ENST00000238647.3	37	CCDS9854.1																																																																																			.		0.697	IRF2BPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414298.1	NM_024496	
IGDCC4	57722	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	65684246	65684246	+	Missense_Mutation	SNP	C	C	G			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr15:65684246C>G	ENST00000352385.2	-	12	2405	c.2196G>C	c.(2194-2196)aaG>aaC	p.K732N		NM_020962.1	NP_066013.1	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member 4	732	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	44						CCGTCTTGCCCTTCCACACTG	0.612																																					p.K732N		.											.	IGDCC4-93	0			c.G2196C						.						122.0	120.0	121.0					15																	65684246		2201	4299	6500	SO:0001583	missense	57722	exon12			CTTGCCCTTCCAC		CCDS10206.1	15q22.31	2013-02-11			ENSG00000103742	ENSG00000103742		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13770	protein-coding gene	gene with protein product	"""likely ortholog of mouse neighbor of Punc E11"""						Standard	NM_020962		Approved	NOPE, LOC57722	uc002aou.1	Q8TDY8	OTTHUMG00000133136	ENST00000352385.2:c.2196G>C	15.37:g.65684246C>G	ENSP00000319623:p.Lys732Asn	Somatic	92	0		WXS	Illumina HiSeq	Phase_I	112	40	NM_020962	0	0	0	0	0	Q9HCE4	Missense_Mutation	SNP	ENST00000352385.2	37	CCDS10206.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.416366	0.83449	.	.	ENSG00000103742	ENST00000352385;ENST00000356152	T	0.59638	0.25	5.15	4.22	0.49857	Fibronectin, type III (2);	0.055747	0.64402	D	0.000002	T	0.62708	0.2450	L	0.59436	1.845	0.48135	D	0.999599	D	0.65815	0.995	P	0.52856	0.711	T	0.64799	-0.6322	10	0.49607	T	0.09	-22.1714	12.3562	0.55176	0.0:0.9194:0.0:0.0806	.	732	Q8TDY8	IGDC4_HUMAN	N	732;461	ENSP00000319623:K732N	ENSP00000319623:K732N	K	-	3	2	IGDCC4	63471299	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	1.066000	0.30604	2.406000	0.81754	0.561000	0.74099	AAG	.		0.612	IGDCC4-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000256825.2	NM_020962	
SLC24A1	9187	broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	65942809	65942809	+	Silent	SNP	A	A	G			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr15:65942809A>G	ENST00000261892.6	+	7	2609	c.2322A>G	c.(2320-2322)ggA>ggG	p.G774G	SLC24A1_ENST00000449142.2_3'UTR|SLC24A1_ENST00000546330.1_Silent_p.G756G|SLC24A1_ENST00000339868.6_Silent_p.G756G|SLC24A1_ENST00000544319.2_Silent_p.G660G|SLC24A1_ENST00000537259.1_Silent_p.G756G|SLC24A1_ENST00000399033.4_Silent_p.G774G	NM_001254740.1|NM_004727.2	NP_001241669.1|NP_004718.1	O60721	NCKX1_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 1	774					calcium ion transport (GO:0006816)|ion transport (GO:0006811)|phototransduction, visible light (GO:0007603)|response to light intensity (GO:0009642)|rhodopsin mediated signaling pathway (GO:0016056)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|outer membrane (GO:0019867)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)			breast(2)|endometrium(7)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23						agaaaagtggaggtgaaactc	0.463																																					p.G774G													.	.	0			c.A2322G						.						79.0	84.0	82.0					15																	65942809		1489	2962	4451	SO:0001819	synonymous_variant	9187	exon7			AAGTGGAGGTGAA	AF062922	CCDS45284.1, CCDS73742.1, CCDS73743.1, CCDS73744.1	15q22.31	2014-01-28			ENSG00000074621	ENSG00000074621		"""Solute carriers"""	10975	protein-coding gene	gene with protein product		603617				9856482	Standard	NM_004727		Approved	NCKX1, NCKX, RODX, KIAA0702, HsT17412, CSNB1D	uc010ujf.2	O60721	OTTHUMG00000167960	ENST00000261892.6:c.2322A>G	15.37:g.65942809A>G		Somatic	229	2		WXS	Illumina HiSeq	Phase_I	226	72	NM_004727	0	0	3	3	0	O43485|O75184|Q17RM9	Silent	SNP	ENST00000261892.6	37	CCDS45284.1																																																																																			.		0.463	SLC24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397304.1	NM_004727	
PEAK1	79834	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	77472613	77472613	+	Silent	SNP	A	A	T			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr15:77472613A>T	ENST00000560626.2	-	4	2131	c.1656T>A	c.(1654-1656)acT>acA	p.T552T	PEAK1_ENST00000558305.1_Silent_p.T552T|PEAK1_ENST00000312493.4_Silent_p.T552T			Q9H792	PEAK1_HUMAN	pseudopodium-enriched atypical kinase 1	552					cell migration (GO:0016477)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										CAGTTCCACTAGTAATTAGTT	0.413																																					p.T552T		.											.	.	0			c.T1656A						.						217.0	198.0	204.0					15																	77472613		1881	4115	5996	SO:0001819	synonymous_variant	0	exon5			TCCACTAGTAATT		CCDS42062.1	15q24.3	2013-09-27			ENSG00000173517	ENSG00000173517			29431	protein-coding gene	gene with protein product		614248				16879967, 20534451	Standard	NM_024776		Approved	KIAA2002, sgk269		Q9H792	OTTHUMG00000172618	ENST00000560626.2:c.1656T>A	15.37:g.77472613A>T		Somatic	140	0		WXS	Illumina HiSeq	Phase_I	110	35	NM_024776	0	0	0	0	0	Q6ZS78|Q8NAZ4|Q8NCM3|Q8TEG7	Silent	SNP	ENST00000560626.2	37	CCDS42062.1																																																																																			.		0.413	PEAK1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419483.3		
CARHSP1	23589	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	8953055	8953055	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr16:8953055G>A	ENST00000396593.2	-	2	490	c.131C>T	c.(130-132)cCc>cTc	p.P44L	CARHSP1_ENST00000562843.1_Missense_Mutation_p.P44L|CARHSP1_ENST00000567626.1_5'Flank|RP11-77H9.2_ENST00000565934.1_RNA|CARHSP1_ENST00000561530.1_Missense_Mutation_p.P44L|CARHSP1_ENST00000567554.1_Missense_Mutation_p.P44L|CARHSP1_ENST00000311052.5_Missense_Mutation_p.P44L	NM_001042476.1|NM_001278260.1|NM_001278261.1|NM_001278262.1|NM_001278263.1|NM_001278264.1|NM_001278265.1|NM_001278266.1|NM_014316.3	NP_001035941.1|NP_001265189.1|NP_001265190.1|NP_001265191.1|NP_001265192.1|NP_001265193.1|NP_001265194.1|NP_001265195.1|NP_055131.2	Q9Y2V2	CHSP1_HUMAN	calcium regulated heat stable protein 1, 24kDa	44					intracellular signal transduction (GO:0035556)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasmic exosome (RNase complex) (GO:0000177)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|P granule (GO:0043186)	DNA binding (GO:0003677)|mRNA 3'-UTR binding (GO:0003730)|phosphatase binding (GO:0019902)			endometrium(2)|lung(1)	3						CCGGCGAGTGGGCAGTGGGCT	0.652																																					p.P44L		.											.	CARHSP1-90	0			c.C131T						.						27.0	23.0	25.0					16																	8953055		2195	4300	6495	SO:0001583	missense	23589	exon2			CGAGTGGGCAGTG	AF115345	CCDS10537.1	16p13.2	2008-02-05	2002-08-29		ENSG00000153048	ENSG00000153048			17150	protein-coding gene	gene with protein product			"""calcium regulated heat stable protein 1 (24kD)"""			9712905	Standard	NM_014316		Approved	CRHSP-24, CSDC1	uc031quz.1	Q9Y2V2	OTTHUMG00000129695	ENST00000396593.2:c.131C>T	16.37:g.8953055G>A	ENSP00000379838:p.Pro44Leu	Somatic	110	0		WXS	Illumina HiSeq	Phase_I	112	42	NM_001042476	0	0	46	90	44	B2R4C3|D3DUF5|Q2YDX5|Q9BQ53	Missense_Mutation	SNP	ENST00000396593.2	37	CCDS10537.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.292618	0.80914	.	.	ENSG00000153048	ENST00000396593;ENST00000311052	.	.	.	5.35	4.38	0.52667	.	0.000000	0.85682	D	0.000000	T	0.77811	0.4186	M	0.85299	2.745	0.80722	D	1	D	0.89917	1.0	D	0.64877	0.93	T	0.77389	-0.2606	9	0.19590	T	0.45	-3.558	14.7061	0.69191	0.0:0.1461:0.8539:0.0	.	44	Q9Y2V2	CHSP1_HUMAN	L	44	.	ENSP00000311847:P44L	P	-	2	0	CARHSP1	8860556	1.000000	0.71417	0.996000	0.52242	0.993000	0.82548	9.057000	0.93889	1.221000	0.43506	0.563000	0.77884	CCC	.		0.652	CARHSP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251902.1	NM_014316	
IL4R	3566	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	27374134	27374134	+	Silent	SNP	G	G	A			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr16:27374134G>A	ENST00000395762.2	+	11	1720	c.1461G>A	c.(1459-1461)acG>acA	p.T487T	IL4R_ENST00000543915.2_Silent_p.T487T|IL4R_ENST00000170630.2_Silent_p.T487T|IL4R_ENST00000380922.3_Silent_p.T472T	NM_000418.3	NP_000409.1	P24394	IL4RA_HUMAN	interleukin 4 receptor	487	Required for IRS1 activation and IL4- induced cell growth.				defense response to protozoan (GO:0042832)|immune response (GO:0006955)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|ovulation (GO:0030728)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of macrophage activation (GO:0043032)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|production of molecular mediator involved in inflammatory response (GO:0002532)|regulation of cell proliferation (GO:0042127)|response to estrogen (GO:0043627)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	interleukin-4 receptor activity (GO:0004913)|receptor signaling protein activity (GO:0005057)			breast(3)|endometrium(2)|kidney(2)|large_intestine(2)|lung(15)|ovary(2)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	33						GCACAGAGACGCCCCTCGTCA	0.642																																					p.T487T		.											.	IL4R-227	0			c.G1461A						.						91.0	94.0	93.0					16																	27374134		2197	4300	6497	SO:0001819	synonymous_variant	3566	exon11			AGAGACGCCCCTC	X52425	CCDS10629.1, CCDS58441.1	16p12.1-p11.2	2008-05-14			ENSG00000077238	ENSG00000077238		"""Interleukins and interleukin receptors"", ""CD molecules"""	6015	protein-coding gene	gene with protein product		147781				1679753	Standard	NM_000418		Approved	CD124	uc010bxy.4	P24394	OTTHUMG00000097015	ENST00000395762.2:c.1461G>A	16.37:g.27374134G>A		Somatic	86	0		WXS	Illumina HiSeq	Phase_I	117	40	NM_000418	0	0	0	0	0	B4E076|B9EKU8|H3BSY5|Q96P01|Q9H181|Q9H182|Q9H183|Q9H184|Q9H185|Q9H186|Q9H187|Q9H188	Silent	SNP	ENST00000395762.2	37	CCDS10629.1																																																																																			.		0.642	IL4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214104.4		
SETD1A	9739	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	30970101	30970101	+	Missense_Mutation	SNP	T	T	C			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr16:30970101T>C	ENST00000262519.8	+	2	735	c.49T>C	c.(49-51)Tgg>Cgg	p.W17R		NM_014712.1	NP_055527.1	O15047	SET1A_HUMAN	SET domain containing 1A	17					histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(21)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	59						GAGCTTCCAGTGGCGGAACTA	0.557																																					p.W17R		.											.	SETD1A-93	0			c.T49C						.						109.0	105.0	107.0					16																	30970101		2197	4300	6497	SO:0001583	missense	9739	exon2			TTCCAGTGGCGGA	AB002337	CCDS32435.1	16p11.2	2013-02-12			ENSG00000099381	ENSG00000099381		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29010	protein-coding gene	gene with protein product		611052				9205841, 12670868	Standard	XM_005255723		Approved	KIAA0339, Set1, KMT2F	uc002ead.1	O15047	OTTHUMG00000150474	ENST00000262519.8:c.49T>C	16.37:g.30970101T>C	ENSP00000262519:p.Trp17Arg	Somatic	136	0		WXS	Illumina HiSeq	Phase_I	152	46	NM_014712	0	0	0	0	0	A6NP62|Q6PIF3|Q8TAJ6	Missense_Mutation	SNP	ENST00000262519.8	37	CCDS32435.1	.	.	.	.	.	.	.	.	.	.	T	17.44	3.389372	0.61956	.	.	ENSG00000099381	ENST00000262519;ENST00000452917;ENST00000449974	D	0.94828	-3.53	5.1	5.1	0.69264	.	0.000000	0.64402	U	0.000001	D	0.96494	0.8856	M	0.68593	2.085	0.58432	D	0.999997	D	0.89917	1.0	D	0.87578	0.998	D	0.96642	0.9475	10	0.56958	D	0.05	.	13.8869	0.63714	0.0:0.0:0.0:1.0	.	17	O15047	SET1A_HUMAN	R	17	ENSP00000262519:W17R	ENSP00000262519:W17R	W	+	1	0	SETD1A	30877602	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.599000	0.82757	1.920000	0.55613	0.533000	0.62120	TGG	.		0.557	SETD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318244.2	NM_014712	
SALL1	6299	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	51171349	51171349	+	Missense_Mutation	SNP	A	A	C			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr16:51171349A>C	ENST00000251020.4	-	3	3682	c.3649T>G	c.(3649-3651)Ttc>Gtc	p.F1217V	SALL1_ENST00000566102.1_3'UTR|SALL1_ENST00000440970.1_Missense_Mutation_p.F1120V|SALL1_ENST00000541611.1_Missense_Mutation_p.F40V	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	1217					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			TCCTTCTGGAACATTTCTGGG	0.562																																					p.F1217V	GBM(103;1352 1446 1855 4775 8890)	.											.	SALL1-98	0			c.T3649G						.						54.0	51.0	52.0					16																	51171349		2198	4300	6498	SO:0001583	missense	6299	exon3			TCTGGAACATTTC	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.3649T>G	16.37:g.51171349A>C	ENSP00000251020:p.Phe1217Val	Somatic	133	0		WXS	Illumina HiSeq	Phase_I	116	29	NM_002968	0	0	5	7	2	Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	ENST00000251020.4	37	CCDS10747.1	.	.	.	.	.	.	.	.	.	.	A	15.45	2.837676	0.50951	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559;ENST00000541611	T;T;T	0.47869	3.22;3.21;0.83	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.66752	0.2821	M	0.76170	2.325	0.80722	D	1	D;B	0.76494	0.999;0.372	D;B	0.78314	0.991;0.083	T	0.64188	-0.6466	10	0.20046	T	0.44	.	15.6652	0.77225	1.0:0.0:0.0:0.0	.	1217;40	Q9NSC2;F5H733	SALL1_HUMAN;.	V	1217;1120;1181;40	ENSP00000251020:F1217V;ENSP00000407914:F1120V;ENSP00000442827:F40V	ENSP00000251020:F1217V	F	-	1	0	SALL1	49728850	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.311000	0.96282	2.104000	0.64026	0.523000	0.50628	TTC	.		0.562	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968	
RANBP10	57610	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	67761787	67761787	+	Missense_Mutation	SNP	G	G	T			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr16:67761787G>T	ENST00000317506.3	-	12	1602	c.1487C>A	c.(1486-1488)cCt>cAt	p.P496H	RANBP10_ENST00000536251.1_Missense_Mutation_p.P267H|RANBP10_ENST00000602677.1_Missense_Mutation_p.P526H|RANBP10_ENST00000448631.2_Missense_Mutation_p.P470H|RANBP10_ENST00000411657.2_Missense_Mutation_p.P409H	NM_020850.1	NP_065901.1	Q6VN20	RBP10_HUMAN	RAN binding protein 10	496					microtubule cytoskeleton organization (GO:0000226)	cytoplasmic microtubule (GO:0005881)|nucleus (GO:0005634)	Ran guanyl-nucleotide exchange factor activity (GO:0005087)			endometrium(5)|kidney(2)|large_intestine(3)|lung(10)|ovary(2)|skin(1)	23		Acute lymphoblastic leukemia(13;4.34e-06)|all_hematologic(13;0.000643)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.00522)|Epithelial(162;0.025)|all cancers(182;0.157)		CTGCCGCCGAGGATGCCTGTC	0.622																																					p.P496H		.											.	RANBP10-227	0			c.C1487A						.						34.0	31.0	32.0					16																	67761787		2198	4300	6498	SO:0001583	missense	57610	exon12			CGCCGAGGATGCC	AB040897	CCDS32469.1	16q22	2008-02-05				ENSG00000141084			29285	protein-coding gene	gene with protein product		614031				14684163	Standard	NM_020850		Approved	KIAA1464	uc002eud.3	Q6VN20		ENST00000317506.3:c.1487C>A	16.37:g.67761787G>T	ENSP00000316589:p.Pro496His	Somatic	118	0		WXS	Illumina HiSeq	Phase_I	108	32	NM_020850	0	0	0	0	0	A4FTY2|B4DID0|B4DQH9|E7EW27|Q9P264	Missense_Mutation	SNP	ENST00000317506.3	37	CCDS32469.1	.	.	.	.	.	.	.	.	.	.	G	12.84	2.057947	0.36277	.	.	ENSG00000141084	ENST00000317506;ENST00000448631;ENST00000536251;ENST00000411657	.	.	.	5.93	5.93	0.95920	.	0.631540	0.17547	N	0.170307	T	0.69006	0.3063	M	0.62723	1.935	0.80722	D	1	P;B;B	0.37573	0.6;0.006;0.012	P;B;B	0.46110	0.504;0.007;0.02	T	0.67413	-0.5677	9	0.48119	T	0.1	-12.1716	15.4231	0.75028	0.0:0.1386:0.8614:0.0	.	409;470;496	B4DID0;B4DQH9;Q6VN20	.;.;RBP10_HUMAN	H	496;470;267;409	.	ENSP00000316589:P496H	P	-	2	0	RANBP10	66319288	0.996000	0.38824	0.997000	0.53966	0.794000	0.44872	4.807000	0.62576	2.814000	0.96858	0.563000	0.77884	CCT	.		0.622	RANBP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467896.1	NM_020850	
CDK10	8558	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	89760632	89760632	+	Silent	SNP	C	C	T			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr16:89760632C>T	ENST00000353379.7	+	9	703	c.660C>T	c.(658-660)atC>atT	p.I220I	CDK10_ENST00000505473.1_Silent_p.I149I|CDK10_ENST00000331006.8_Silent_p.I173I	NM_001098533.2|NM_001160367.1|NM_052988.4	NP_001092003.2|NP_001153839.1|NP_443714.3	Q15131	CDK10_HUMAN	cyclin-dependent kinase 10	220	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of cell proliferation (GO:0008285)|traversing start control point of mitotic cell cycle (GO:0007089)		ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			ovary(1)	1		Lung NSC(15;2.19e-05)|all_lung(18;3.07e-05)|all_hematologic(23;0.0256)		BRCA - Breast invasive adenocarcinoma(80;0.0276)		CCACCAGCATCGACATGTGGT	0.632																																					p.I220I		.											.	CDK10-508	0			c.C660T						.						102.0	78.0	86.0					16																	89760632		2198	4300	6498	SO:0001819	synonymous_variant	8558	exon9			CAGCATCGACATG	L33264	CCDS10984.2, CCDS32514.1, CCDS32514.2	16q24.3	2011-11-08	2007-11-21		ENSG00000185324	ENSG00000185324		"""Cyclin-dependent kinases"""	1770	protein-coding gene	gene with protein product		603464	"""cyclin-dependent kinase (CDC2-like) 10"""			8208557, 8084611	Standard	NM_052988		Approved	PISSLRE	uc010cio.3	Q15131	OTTHUMG00000138049	ENST00000353379.7:c.660C>T	16.37:g.89760632C>T		Somatic	169	0		WXS	Illumina HiSeq	Phase_I	158	65	NM_052988	0	0	6	32	26	A8K370|A8K8I6|A8MXU6|B3KQJ3|B7Z420|D3DX82|D3DX83|Q0VGZ7|Q15130|Q6PJC0	Silent	SNP	ENST00000353379.7	37	CCDS10984.2																																																																																			.		0.632	CDK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269925.2		
CAMTA2	23125	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	4877742	4877742	+	Missense_Mutation	SNP	T	T	G			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr17:4877742T>G	ENST00000348066.3	-	12	2077	c.1954A>C	c.(1954-1956)Atg>Ctg	p.M652L	CAMTA2_ENST00000381311.5_Missense_Mutation_p.M654L|RP5-1050D4.2_ENST00000430920.1_RNA|CAMTA2_ENST00000572543.1_Missense_Mutation_p.M657L|CAMTA2_ENST00000358183.4_Missense_Mutation_p.M652L|CAMTA2_ENST00000361571.5_Missense_Mutation_p.M651L|CAMTA2_ENST00000414043.3_Missense_Mutation_p.M675L	NM_015099.3	NP_055914.2	O94983	CMTA2_HUMAN	calmodulin binding transcription activator 2	652					cardiac muscle hypertrophy in response to stress (GO:0014898)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(5)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	31						ATCTCTGCCATCCGCTTCTCC	0.597																																					p.M675L		.											.	CAMTA2-91	0			c.A2023C						.						155.0	119.0	132.0					17																	4877742		2203	4300	6503	SO:0001583	missense	23125	exon12			CTGCCATCCGCTT	AB020716	CCDS11063.1, CCDS54071.1, CCDS54072.1, CCDS54073.1	17p13.3	2004-09-01			ENSG00000108509	ENSG00000108509			18807	protein-coding gene	gene with protein product		611508				11925432	Standard	NM_015099		Approved	KIAA0909	uc010cku.2	O94983	OTTHUMG00000099417	ENST00000348066.3:c.1954A>C	17.37:g.4877742T>G	ENSP00000321813:p.Met652Leu	Somatic	153	0		WXS	Illumina HiSeq	Phase_I	193	89	NM_001171167	0	0	0	1	1	B9EGL0|D3DTL5|E7EWU5|Q7Z6M8|Q8N3V0|Q8NDG4|Q96G17	Missense_Mutation	SNP	ENST00000348066.3	37	CCDS11063.1	.	.	.	.	.	.	.	.	.	.	T	16.40	3.111402	0.56398	.	.	ENSG00000108509	ENST00000414043;ENST00000381311;ENST00000361571;ENST00000358183;ENST00000348066	T;T;T;T;T	0.27557	2.87;1.91;1.66;1.91;1.69	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.30885	0.0779	N	0.11560	0.145	0.44454	D	0.997389	B;B;P;B;P	0.43024	0.077;0.077;0.471;0.34;0.798	B;B;P;P;P	0.60236	0.045;0.152;0.65;0.448;0.871	T	0.11891	-1.0569	10	0.13108	T	0.6	-18.4138	13.2241	0.59905	0.0:0.0:0.0:1.0	.	628;675;654;652;651	B7ZM30;E7EWU5;O94983-3;O94983;O94983-4	.;.;.;CMTA2_HUMAN;.	L	675;654;651;652;652	ENSP00000412886:M675L;ENSP00000370712:M654L;ENSP00000354828:M651L;ENSP00000350910:M652L;ENSP00000321813:M652L	ENSP00000321813:M652L	M	-	1	0	CAMTA2	4818466	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.777000	0.85628	2.232000	0.73038	0.482000	0.46254	ATG	.		0.597	CAMTA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216876.1	NM_015099	
SLC5A10	125206	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	18880267	18880267	+	Missense_Mutation	SNP	T	T	A			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr17:18880267T>A	ENST00000395645.3	+	9	965	c.947T>A	c.(946-948)aTc>aAc	p.I316N	FAM83G_ENST00000585154.2_Intron|SLC5A10_ENST00000395642.1_Missense_Mutation_p.I233N|SLC5A10_ENST00000417251.2_Missense_Mutation_p.I316N|SLC5A10_ENST00000317977.6_Missense_Mutation_p.I233N|FAM83G_ENST00000388995.6_Intron|SLC5A10_ENST00000395647.2_Missense_Mutation_p.I316N|FAM83G_ENST00000345041.4_Intron|SLC5A10_ENST00000395643.2_Missense_Mutation_p.I289N	NM_001042450.2	NP_001035915.1	A0PJK1	SC5AA_HUMAN	solute carrier family 5 (sodium/sugar cotransporter), member 10	316					sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(3)|ovary(3)|prostate(3)|skin(3)	24						GGCCTGATCATCATGCCGGGC	0.637																																					p.I316N													.	SLC5A10-91	0			c.T947A						.						112.0	91.0	98.0					17																	18880267		2203	4300	6503	SO:0001583	missense	125206	exon9			TGATCATCATGCC		CCDS11201.2, CCDS42275.1, CCDS59277.1, CCDS59278.1, CCDS74008.1	17p11.2	2013-07-19	2013-07-19		ENSG00000154025	ENSG00000154025		"""Solute carriers"""	23155	protein-coding gene	gene with protein product			"""solute carrier family 5 (sodium/glucose cotransporter), member 10"""				Standard	NM_152351		Approved	SGLT5	uc002gut.2	A0PJK1	OTTHUMG00000178143	ENST00000395645.3:c.947T>A	17.37:g.18880267T>A	ENSP00000379007:p.Ile316Asn	Somatic	82	1		WXS	Illumina HiSeq	Phase_I	134	73	NM_001042450	0	0	0	0	0	A8MUC9|B4DPI0|B7WPR4|Q6P5X0|Q8IXM4|Q96LQ1	Missense_Mutation	SNP	ENST00000395645.3	37	CCDS42275.1	.	.	.	.	.	.	.	.	.	.	T	25.4	4.632337	0.87660	.	.	ENSG00000154025	ENST00000317977;ENST00000395647;ENST00000395642;ENST00000417251;ENST00000395645;ENST00000395643	D;D;D;D;D;D	0.89196	-2.48;-2.48;-2.48;-2.48;-2.48;-2.48	5.97	5.97	0.96955	.	0.102615	0.64402	D	0.000004	D	0.93867	0.8038	M	0.82823	2.61	0.80722	D	1	D;D;D;D;D	0.58970	0.977;0.971;0.977;0.971;0.984	P;P;P;P;P	0.62089	0.898;0.771;0.853;0.847;0.894	D	0.94502	0.7710	10	0.87932	D	0	.	13.4408	0.61112	0.0:0.0:0.1303:0.8697	.	316;289;316;316;233	B4DPI0;A0PJK1-2;A0PJK1;A0PJK1-4;A0PJK1-3	.;.;SC5AA_HUMAN;.;.	N	233;316;233;316;316;289	ENSP00000324346:I233N;ENSP00000379008:I316N;ENSP00000379004:I233N;ENSP00000401875:I316N;ENSP00000379007:I316N;ENSP00000379005:I289N	ENSP00000324346:I233N	I	+	2	0	SLC5A10	18820992	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.173000	0.71937	2.288000	0.76882	0.533000	0.62120	ATC	.		0.637	SLC5A10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132129.2	NM_152351	
LGALS9B	284194	broad.mit.edu	37	17	20355185	20355185	+	Silent	SNP	G	G	A			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr17:20355185G>A	ENST00000423676.3	-	9	747	c.684C>T	c.(682-684)ttC>ttT	p.F228F	LGALS9B_ENST00000324290.5_Silent_p.F227F			Q3B8N2	LEG9B_HUMAN	lectin, galactoside-binding, soluble, 9B	228	Galectin 2. {ECO:0000255|PROSITE- ProRule:PRU00639}.						carbohydrate binding (GO:0030246)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|skin(1)|upper_aerodigestive_tract(2)	10						TGGTGGTGATGAAAGGCATCG	0.572																																					p.F227F													.	LGALS9B-23	0			c.C681T						.						23.0	17.0	19.0					17																	20355185		2192	4110	6302	SO:0001819	synonymous_variant	284194	exon9			GGTGATGAAAGGC		CCDS42283.1	17p11.2	2011-08-04			ENSG00000170298	ENSG00000170298		"""Lectins, galactoside-binding"""	24842	protein-coding gene	gene with protein product						11997339	Standard	NM_001042685		Approved		uc002gwz.1	Q3B8N2	OTTHUMG00000130730	ENST00000423676.3:c.684C>T	17.37:g.20355185G>A		Somatic	199	0		WXS	Illumina HiSeq	Phase_I	243	7	NM_001042685	0	0	0	0	0	A6NLF8|A8K2J8	Silent	SNP	ENST00000423676.3	37																																																																																				.		0.572	LGALS9B-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000253230.2	NM_001042685	
ASB16	92591	broad.mit.edu	37	17	42255640	42255640	+	Missense_Mutation	SNP	C	C	G	rs192236945		TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr17:42255640C>G	ENST00000293414.1	+	5	1328	c.1244C>G	c.(1243-1245)gCc>gGc	p.A415G	ASB16-AS1_ENST00000588785.1_RNA|ASB16-AS1_ENST00000585457.1_RNA|ASB16-AS1_ENST00000591166.1_RNA|ASB16-AS1_ENST00000592897.1_RNA	NM_080863.4	NP_543139.4	Q96NS5	ASB16_HUMAN	ankyrin repeat and SOCS box containing 16	415	SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.				intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(2)|liver(2)|lung(2)|prostate(1)	14		Breast(137;0.00765)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.114)		CAGCACCTGGCCCGACTAGCT	0.662																																					p.A415G													.	ASB16-227	0			c.C1244G						.						40.0	34.0	36.0					17																	42255640		2203	4300	6503	SO:0001583	missense	92591	exon5			ACCTGGCCCGACT	AK054727	CCDS11478.1	17q21.31	2013-01-10	2011-01-25		ENSG00000161664	ENSG00000161664		"""Ankyrin repeat domain containing"""	19768	protein-coding gene	gene with protein product		615056	"""ankyrin repeat and SOCS box-containing 16"""			12076535	Standard	NM_080863		Approved	FLJ30165	uc002ifl.1	Q96NS5	OTTHUMG00000181809	ENST00000293414.1:c.1244C>G	17.37:g.42255640C>G	ENSP00000293414:p.Ala415Gly	Somatic	15	0		WXS	Illumina HiSeq	Phase_I	25	6	NM_080863	0	0	0	0	0	B2RBC0|Q8WXK0	Missense_Mutation	SNP	ENST00000293414.1	37	CCDS11478.1	.	.	.	.	.	.	.	.	.	.	C	19.29	3.798393	0.70567	.	.	ENSG00000161664	ENST00000293414	T	0.46451	0.87	5.36	5.36	0.76844	SOCS protein, C-terminal (3);	0.245753	0.42548	D	0.000691	T	0.61148	0.2324	M	0.69358	2.11	0.34275	D	0.681456	D	0.76494	0.999	D	0.72338	0.977	T	0.70479	-0.4860	10	0.52906	T	0.07	-19.0493	13.7126	0.62678	0.0:0.8453:0.1547:0.0	.	415	Q96NS5	ASB16_HUMAN	G	415	ENSP00000293414:A415G	ENSP00000293414:A415G	A	+	2	0	ASB16	39611166	0.992000	0.36948	1.000000	0.80357	0.682000	0.39822	2.768000	0.47645	2.793000	0.96121	0.561000	0.74099	GCC	C|0.999;T|0.001		0.662	ASB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457703.1		
SCRN2	90507	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	45916860	45916860	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr17:45916860G>A	ENST00000290216.9	-	4	631	c.506C>T	c.(505-507)gCg>gTg	p.A169V	SCRN2_ENST00000407215.3_Missense_Mutation_p.A169V|SCRN2_ENST00000584123.1_Missense_Mutation_p.A177V	NM_001145023.1|NM_138355.3	NP_001138495.1|NP_612364.2	Q96FV2	SCRN2_HUMAN	secernin 2	169						extracellular vesicular exosome (GO:0070062)	dipeptidase activity (GO:0016805)			cervix(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	14						CAGCACCCACGCCTCAGTGCG	0.612																																					p.A169V		.											.	SCRN2-91	0			c.C506T						.						78.0	72.0	74.0					17																	45916860		2203	4300	6503	SO:0001583	missense	90507	exon4			ACCCACGCCTCAG	BC002980	CCDS11519.1, CCDS45723.1	17q21	2008-02-05							30381	protein-coding gene	gene with protein product		614966				12221138	Standard	NM_001145023		Approved		uc002imd.3	Q96FV2		ENST00000290216.9:c.506C>T	17.37:g.45916860G>A	ENSP00000290216:p.Ala169Val	Somatic	170	0		WXS	Illumina HiSeq	Phase_I	220	108	NM_138355	0	0	17	58	41	A8K3N1|B7Z8S7|E9PBV5|Q96AC3|Q9BU04	Missense_Mutation	SNP	ENST00000290216.9	37	CCDS11519.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.593412	0.86953	.	.	ENSG00000141295	ENST00000290216;ENST00000407215	T;T	0.17370	2.28;2.28	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.44705	0.1306	M	0.74258	2.255	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.42207	-0.9465	10	0.87932	D	0	-27.8264	17.8079	0.88607	0.0:0.0:1.0:0.0	.	169;169;169	E9PBV5;Q96FV2;B7Z8S7	.;SCRN2_HUMAN;.	V	169	ENSP00000290216:A169V;ENSP00000383935:A169V	ENSP00000290216:A169V	A	-	2	0	SCRN2	43271859	1.000000	0.71417	0.935000	0.37517	0.396000	0.30629	9.756000	0.98918	2.504000	0.84457	0.561000	0.74099	GCG	.		0.612	SCRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441383.1	NM_138355	
NXPH3	11248	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	47656051	47656051	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr17:47656051C>T	ENST00000328741.5	+	2	510	c.148C>T	c.(148-150)Cgg>Tgg	p.R50W	RP5-1029K10.4_ENST00000503624.1_RNA|NXPH3_ENST00000513748.1_Missense_Mutation_p.R50W	NM_007225.2	NP_009156.2	O95157	NXPH3_HUMAN	neurexophilin 3	50	II.				neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)				endometrium(2)|large_intestine(3)|lung(4)|pancreas(1)|skin(2)	12	all_cancers(4;7.45e-14)|Breast(4;1.08e-27)|all_epithelial(4;2.27e-17)					GCCTCGGAAGCGGGGCCACAT	0.677																																					p.R50W		.											.	NXPH3-70	0			c.C148T						.						35.0	39.0	37.0					17																	47656051		2203	4299	6502	SO:0001583	missense	11248	exon2			CGGAAGCGGGGCC	AF043468	CCDS11550.1	17q	2008-07-03				ENSG00000182575			8077	protein-coding gene	gene with protein product		604636				9570794	Standard	NM_007225		Approved	NPH3	uc002ipa.3	O95157		ENST00000328741.5:c.148C>T	17.37:g.47656051C>T	ENSP00000329295:p.Arg50Trp	Somatic	72	0		WXS	Illumina HiSeq	Phase_I	169	101	NM_007225	0	0	0	0	0	Q8NDC3|Q8TBF6|Q9ULR1	Missense_Mutation	SNP	ENST00000328741.5	37	CCDS11550.1	.	.	.	.	.	.	.	.	.	.	c	16.57	3.159520	0.57368	.	.	ENSG00000182575	ENST00000328741;ENST00000513748	.	.	.	4.55	3.56	0.40772	.	0.310331	0.31381	N	0.007749	T	0.34250	0.0891	N	0.08118	0	0.09310	N	1	D;D	0.89917	1.0;0.998	D;P	0.70935	0.971;0.834	T	0.07578	-1.0765	9	0.72032	D	0.01	-23.4594	7.973	0.30138	0.428:0.4299:0.1421:0.0	.	50;50	D6RGW2;O95157	.;NXPH3_HUMAN	W	50	.	ENSP00000329295:R50W	R	+	1	2	NXPH3	45011050	0.037000	0.19845	1.000000	0.80357	0.994000	0.84299	0.755000	0.26405	1.110000	0.41699	0.556000	0.70494	CGG	.		0.677	NXPH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365143.1		
SCN4A	6329	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	62045582	62045582	+	Silent	SNP	C	C	T			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr17:62045582C>T	ENST00000435607.1	-	6	913	c.837G>A	c.(835-837)aaG>aaA	p.K279K	SCN4A_ENST00000578147.1_Silent_p.K279K	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	279					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AGCGCACACACTTCTGCCTCA	0.547																																					p.K279K		.											.	SCN4A-93	0			c.G837A						.																																			SO:0001819	synonymous_variant	6329	exon6			CACACACTTCTGC	U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.837G>A	17.37:g.62045582C>T		Somatic	365	0		WXS	Illumina HiSeq	Phase_I	518	129	NM_000334	0	0	0	0	0	Q15478|Q16447|Q7Z6B1	Silent	SNP	ENST00000435607.1	37	CCDS45761.1																																																																																			.		0.547	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_000334	
SCN4A	6329	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	62045585	62045585	+	Silent	SNP	C	C	T			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr17:62045585C>T	ENST00000435607.1	-	6	910	c.834G>A	c.(832-834)caG>caA	p.Q278Q	SCN4A_ENST00000578147.1_Silent_p.Q278Q	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	278					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GCACACACTTCTGCCTCAGGT	0.542																																					p.Q278Q		.											.	SCN4A-93	0			c.G834A						.						136.0	140.0	139.0					17																	62045585		2180	4283	6463	SO:0001819	synonymous_variant	6329	exon6			ACACTTCTGCCTC	U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.834G>A	17.37:g.62045585C>T		Somatic	359	0		WXS	Illumina HiSeq	Phase_I	504	125	NM_000334	0	0	0	0	0	Q15478|Q16447|Q7Z6B1	Silent	SNP	ENST00000435607.1	37	CCDS45761.1																																																																																			.		0.542	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_000334	
DENND1C	79958	hgsc.bcm.edu	37	19	6475944	6475944	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr19:6475944G>A	ENST00000381480.2	-	11	795	c.683C>T	c.(682-684)aCc>aTc	p.T228I	DENND1C_ENST00000543576.1_Missense_Mutation_p.T184I|DENND1C_ENST00000591030.1_5'Flank	NM_024898.2	NP_079174.2	Q8IV53	DEN1C_HUMAN	DENN/MADD domain containing 1C	228	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				positive regulation of Rab GTPase activity (GO:0032851)	cytoplasmic vesicle (GO:0031410)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			endometrium(3)|kidney(3)|large_intestine(1)|lung(3)	10						GACGCACGAGGTCAGCTGGGG	0.672																																					p.T228I		.											.	DENND1C-67	0			c.C683T						.						8.0	10.0	9.0					19																	6475944		2158	4249	6407	SO:0001583	missense	79958	exon11			CACGAGGTCAGCT	AL713770	CCDS45938.1	19p13.3	2014-02-06	2005-08-17	2005-08-17	ENSG00000205744	ENSG00000205744		"""DENN/MADD domain containing"""	26225	protein-coding gene	gene with protein product		613634	"""family with sequence similarity 31, member C"""	FAM31C		12477932	Standard	XM_005259646		Approved	FLJ22757	uc002mfe.3	Q8IV53	OTTHUMG00000180853	ENST00000381480.2:c.683C>T	19.37:g.6475944G>A	ENSP00000370889:p.Thr228Ile	Somatic	4	0		WXS	Illumina HiSeq	Phase_I	8	6	NM_024898	0	0	0	0	0	B4E051|D3PFD4|Q8NDB1|Q9H5Z2	Missense_Mutation	SNP	ENST00000381480.2	37	CCDS45938.1	.	.	.	.	.	.	.	.	.	.	G	32	5.166750	0.94768	.	.	ENSG00000205744	ENST00000381480;ENST00000543576	T;T	0.13089	2.62;2.62	5.31	5.31	0.75309	DENN (3);	0.054596	0.64402	D	0.000001	T	0.47040	0.1424	M	0.90870	3.155	0.50171	D	0.999858	D	0.67145	0.996	D	0.79784	0.993	T	0.58211	-0.7676	10	0.87932	D	0	-9.2935	16.4592	0.84031	0.0:0.0:1.0:0.0	.	228	Q8IV53	DEN1C_HUMAN	I	228;184	ENSP00000370889:T228I;ENSP00000437805:T184I	ENSP00000370889:T228I	T	-	2	0	DENND1C	6426944	1.000000	0.71417	0.950000	0.38849	0.890000	0.51754	8.957000	0.93082	2.498000	0.84270	0.561000	0.74099	ACC	.		0.672	DENND1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453332.2	NM_024898	
CYP4F22	126410	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	15651480	15651480	+	Silent	SNP	C	C	T			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr19:15651480C>T	ENST00000269703.3	+	8	1090	c.891C>T	c.(889-891)gcC>gcT	p.A297A	CYP4F22_ENST00000601005.2_Silent_p.A297A	NM_173483.3	NP_775754.2	Q6NT55	CP4FN_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 22	297						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			endometrium(6)|large_intestine(9)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|soft_tissue(1)	37						GGCTTAAGGCCAAGCAGGGGA	0.652																																					p.A297A		.											.	CYP4F22-92	0			c.C891T						.						52.0	47.0	49.0					19																	15651480		2203	4300	6503	SO:0001819	synonymous_variant	126410	exon8			TAAGGCCAAGCAG		CCDS12331.1	19p13.12	2013-11-11			ENSG00000171954	ENSG00000171954		"""Cytochrome P450s"""	26820	protein-coding gene	gene with protein product		611495				16436457	Standard	NM_173483		Approved	FLJ39501	uc002nbh.4	Q6NT55	OTTHUMG00000182451	ENST00000269703.3:c.891C>T	19.37:g.15651480C>T		Somatic	98	0		WXS	Illumina HiSeq	Phase_I	102	23	NM_173483	0	0	0	0	0	Q8N8H4	Silent	SNP	ENST00000269703.3	37	CCDS12331.1																																																																																			.		0.652	CYP4F22-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461338.2	NM_173483	
NCAN	1463	broad.mit.edu	37	19	19338433	19338433	+	Silent	SNP	A	A	C			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr19:19338433A>C	ENST00000252575.6	+	8	2103	c.2004A>C	c.(2002-2004)ccA>ccC	p.P668P	NCAN_ENST00000538881.1_Silent_p.P119P	NM_004386.2	NP_004377.2	O14594	NCAN_HUMAN	neurocan	668					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|regulation of synapse structural plasticity (GO:0051823)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(32)|ovary(5)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64			Epithelial(12;0.00544)		Hyaluronan(DB08818)	CCACGGCTCCACCCTCCCCTG	0.617																																					p.P668P													.	NCAN-94	0			c.A2004C						.						94.0	97.0	96.0					19																	19338433		2203	4300	6503	SO:0001819	synonymous_variant	1463	exon8			GGCTCCACCCTCC	AF026547	CCDS12397.1	19p12	2014-01-30	2007-02-15	2007-02-15	ENSG00000130287	ENSG00000130287		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"", ""Endogenous ligands"""	2465	protein-coding gene	gene with protein product	"""neurocan proteoglycan"""	600826	"""chondroitin sulfate proteoglycan 3"""	CSPG3		1326557, 21353194	Standard	NM_004386		Approved		uc002nlz.3	O14594		ENST00000252575.6:c.2004A>C	19.37:g.19338433A>C		Somatic	134	9		WXS	Illumina HiSeq	Phase_I	175	27	NM_004386	0	0	0	0	0	Q9UPK6	Silent	SNP	ENST00000252575.6	37	CCDS12397.1																																																																																			.		0.617	NCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460111.2	NM_004386	
KMT2B	9757	ucsc.edu;bcgsc.ca	37	19	36210764	36210764	+	Missense_Mutation	SNP	C	C	A	rs60207923	byFrequency	TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr19:36210764C>A	ENST00000222270.7	+	3	515	c.515C>A	c.(514-516)aCc>aAc	p.T172N	KMT2B_ENST00000607650.1_RNA|KMT2B_ENST00000341701.1_Missense_Mutation_p.T172N|KMT2B_ENST00000420124.1_Missense_Mutation_p.T172N	NM_014727.1	NP_055542.1	Q9UMN6	KMT2B_HUMAN	lysine (K)-specific methyltransferase 2B	172			T -> I (in dbSNP:rs60207923).		chromatin-mediated maintenance of transcription (GO:0048096)|gene silencing (GO:0016458)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|oocyte differentiation (GO:0009994)|ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|regulation of histone H3-K4 methylation (GO:0051569)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										GTGGCTCCTACCCCCCCAAAG	0.632																																					p.T172N													.	MLL4-697	0			c.C515A						.						44.0	52.0	50.0					19																	36210764		1952	4133	6085	SO:0001583	missense	8085	exon3			CTCCTACCCCCCC	AJ007041	CCDS46055.1	19q13.1	2014-02-18			ENSG00000105663	ENSG00000272333		"""Chromatin-modifying enzymes / K-methyltransferases"""	15840	protein-coding gene	gene with protein product	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 4"""	606834				10409430, 10637508	Standard	XM_006723513		Approved	KIAA0304, MLL2, TRX2, HRX2, WBP7, MLL1B, MLL4		Q9UMN6	OTTHUMG00000048119	ENST00000222270.7:c.515C>A	19.37:g.36210764C>A	ENSP00000222270:p.Thr172Asn	Somatic	254	1		WXS	Illumina HiSeq		200	74	NM_014727	0	0	0	0	0	O15022|O95836|Q96GP2|Q96IP3|Q9UK25|Q9Y668|Q9Y669	Missense_Mutation	SNP	ENST00000222270.7	37	CCDS46055.1	.	.	.	.	.	.	.	.	.	.	C	16.67	3.186587	0.57909	.	.	ENSG00000105663	ENST00000222270;ENST00000420124;ENST00000341701	D;D;T	0.84944	-1.92;-1.92;0.74	5.06	0.327	0.15913	.	1.012260	0.07944	N	0.979811	T	0.68540	0.3012	N	0.08118	0	0.23260	N	0.998024	B	0.02656	0.0	B	0.01281	0.0	T	0.56968	-0.7891	10	0.66056	D	0.02	.	4.2499	0.10689	0.1601:0.5853:0.0:0.2545	.	172	Q9UMN6	MLL4_HUMAN	N	172	ENSP00000222270:T172N;ENSP00000398837:T172N;ENSP00000345761:T172N	ENSP00000222270:T172N	T	+	2	0	AD000671.1	40902604	0.045000	0.20229	0.988000	0.46212	0.996000	0.88848	0.030000	0.13688	0.019000	0.15079	0.561000	0.74099	ACC	C|0.998;T|0.002		0.632	KMT2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014727	
CAPN12	147968	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	39226166	39226166	+	Silent	SNP	G	G	T	rs267605468		TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr19:39226166G>T	ENST00000328867.4	-	13	1910	c.1602C>A	c.(1600-1602)atC>atA	p.I534I	CTD-2540F13.2_ENST00000602255.1_RNA|CAPN12_ENST00000601953.1_Silent_p.I385I	NM_144691.3	NP_653292.2	Q6ZSI9	CAN12_HUMAN	calpain 12	534	Domain III.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(60;2.87e-05)|Ovarian(47;0.0454)		Lung(45;0.00416)|LUSC - Lung squamous cell carcinoma(53;0.00741)			GGTCTGCGCTGATCACGTCGT	0.642																																					p.I534I		.											.	CAPN12-91	0			c.C1602A						.						38.0	36.0	37.0					19																	39226166		2192	4295	6487	SO:0001819	synonymous_variant	147968	exon13			TGCGCTGATCACG	BC014027	CCDS12519.1	19q13.2	2014-08-12			ENSG00000182472	ENSG00000182472		"""EF-hand domain containing"""	13249	protein-coding gene	gene with protein product		608839					Standard	NM_144691		Approved		uc002ojd.1	Q6ZSI9	OTTHUMG00000182525	ENST00000328867.4:c.1602C>A	19.37:g.39226166G>T		Somatic	89	0		WXS	Illumina HiSeq	Phase_I	75	26	NM_144691	0	0	0	6	6		Silent	SNP	ENST00000328867.4	37	CCDS12519.1																																																																																			.		0.642	CAPN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462151.1		
PSG5	5673	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	43689069	43689069	+	Nonsense_Mutation	SNP	C	C	A			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr19:43689069C>A	ENST00000366175.3	-	2	425	c.295G>T	c.(295-297)Gaa>Taa	p.E99*	PSG5_ENST00000342951.6_Nonsense_Mutation_p.E99*|PSG5_ENST00000407568.1_Nonsense_Mutation_p.E99*|PSG5_ENST00000401992.1_5'UTR|PSG5_ENST00000404580.1_Nonsense_Mutation_p.E99*|PSG5_ENST00000599812.1_Nonsense_Mutation_p.E99*|PSG5_ENST00000407356.1_Nonsense_Mutation_p.E99*			Q15238	PSG5_HUMAN	pregnancy specific beta-1-glycoprotein 5	99	Ig-like V-type.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(18)|prostate(1)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(69;0.00899)				TATACTGTTTCTCGTCCAGTG	0.438																																					p.E99X		.											.	PSG5-93	0			c.G295T						.						331.0	309.0	317.0					19																	43689069		2203	4295	6498	SO:0001587	stop_gained	5673	exon2			CTGTTTCTCGTCC		CCDS12617.1	19q13.2	2013-01-29			ENSG00000204941	ENSG00000204941		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9522	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1 glycoprotein"", ""pregnancy-specific beta 1 glycoprotein"""	176394				2735907	Standard	NM_002781		Approved	FL-NCA-3, PSG	uc002ovx.3	Q15238	OTTHUMG00000151539	ENST00000366175.3:c.295G>T	19.37:g.43689069C>A	ENSP00000382334:p.Glu99*	Somatic	254	0		WXS	Illumina HiSeq	Phase_I	252	79	NM_002781	0	0	0	0	0	Q15239|Q96QJ1|Q9UQ75	Nonsense_Mutation	SNP	ENST00000366175.3	37	CCDS12617.1	.	.	.	.	.	.	.	.	.	.	N	17.25	3.342999	0.61073	.	.	ENSG00000204941	ENST00000366175;ENST00000407356;ENST00000407568;ENST00000342951;ENST00000404580;ENST00000401992	.	.	.	1.58	1.58	0.23477	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	6.6423	0.22917	0.0:1.0:0.0:0.0	.	.	.	.	X	99	.	ENSP00000344413:E99X	E	-	1	0	PSG5	48380909	0.000000	0.05858	0.161000	0.22692	0.021000	0.10359	-0.245000	0.08890	1.195000	0.43115	0.423000	0.28283	GAA	.		0.438	PSG5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000323055.1	NM_002781	
LILRB3	11025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	54721052	54721052	+	Silent	SNP	G	G	T			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr19:54721052G>T	ENST00000391750.1	-	14	1942	c.1806C>A	c.(1804-1806)acC>acA	p.T602T	LILRA6_ENST00000419410.2_Silent_p.T603T|LILRB3_ENST00000245620.9_Silent_p.T603T|LILRB3_ENST00000469273.1_5'UTR|LILRA6_ENST00000440558.2_Silent_p.T602T|LILRB3_ENST00000407860.2_Silent_p.T619T|LILRA6_ENST00000270464.5_Silent_p.T603T|LILRB3_ENST00000424807.1_Silent_p.T602T|LILRB3_ENST00000346401.6_Silent_p.T614T|LILRA6_ENST00000391735.3_3'UTR			O75022	LIRB3_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3	602					cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)	integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			endometrium(3)|kidney(13)|large_intestine(1)|lung(6)|ovary(2)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	34	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		TCCGTCTAAGGGTCAAGCTGT	0.632																																					p.T603T		.											.	LILRB3-93	0			c.C1809A						.						104.0	105.0	105.0					19																	54721052		2202	4300	6502	SO:0001819	synonymous_variant	11025	exon13			TCTAAGGGTCAAG	U91928	CCDS33105.1, CCDS46175.1	19q13.4	2013-01-11			ENSG00000204577	ENSG00000204577		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6607	protein-coding gene	gene with protein product		604820				9278324, 9382880	Standard	NM_006864		Approved	LIR-3, HL9, ILT5, LIR3, CD85a	uc002qee.1	O75022	OTTHUMG00000066626	ENST00000391750.1:c.1806C>A	19.37:g.54721052G>T		Somatic	180	0		WXS	Illumina HiSeq	Phase_I	189	101	NM_001081450	0	0	0	0	0	C9J1P3|C9JIP1|O15471|Q86U49	Silent	SNP	ENST00000391750.1	37	CCDS33105.1																																																																																			.		0.632	LILRB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000142844.5	NM_006864	
OSR1	130497	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	19552164	19552164	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr2:19552164G>A	ENST00000272223.2	-	3	1017	c.673C>T	c.(673-675)Cac>Tac	p.H225Y	OSR1_ENST00000536433.1_Missense_Mutation_p.H225Y	NM_145260.2	NP_660303.1	Q8TAX0	OSR1_HUMAN	odd-skipped related transciption factor 1	225					cell differentiation (GO:0030154)|cell proliferation involved in kidney development (GO:0072111)|cellular response to retinoic acid (GO:0071300)|chondrocyte differentiation (GO:0002062)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic skeletal joint development (GO:0072498)|embryonic skeletal joint morphogenesis (GO:0060272)|embryonic skeletal limb joint morphogenesis (GO:0036023)|gonad development (GO:0008406)|heart development (GO:0007507)|intermediate mesoderm development (GO:0048389)|mesangial cell development (GO:0072143)|mesonephric duct morphogenesis (GO:0072180)|mesonephros development (GO:0001823)|metanephric cap mesenchymal cell proliferation involved in metanephros development (GO:0090094)|metanephric epithelium development (GO:0072207)|metanephric glomerulus vasculature development (GO:0072239)|metanephric interstitial fibroblast development (GO:0072259)|metanephric mesenchymal cell differentiation (GO:0072162)|metanephric mesenchyme development (GO:0072075)|metanephric mesenchyme morphogenesis (GO:0072133)|metanephric nephron tubule development (GO:0072234)|metanephric smooth muscle tissue development (GO:0072208)|middle ear morphogenesis (GO:0042474)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of nephron tubule epithelial cell differentiation (GO:0072183)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis (GO:0042476)|palate development (GO:0060021)|pattern specification involved in metanephros development (GO:0072268)|positive regulation of bone mineralization (GO:0030501)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gastrulation (GO:2000543)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|posterior mesonephric tubule development (GO:0072166)|pronephros development (GO:0048793)|renal vesicle progenitor cell differentiation (GO:0072184)|specification of anterior mesonephric tubule identity (GO:0072168)|specification of posterior mesonephric tubule identity (GO:0072169)|stem cell differentiation (GO:0048863)|transcription, DNA-templated (GO:0006351)|ureter urothelium development (GO:0072190)|ureteric bud development (GO:0001657)|urogenital system development (GO:0001655)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			breast(1)|large_intestine(2)|lung(4)|ovary(1)	8	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)	Acute lymphoblastic leukemia(84;0.221)				TCTTTGGAGTGAATATATCTG	0.493																																					p.H225Y		.											.	OSR1-257	0			c.C673T						.						119.0	109.0	112.0					2																	19552164		2203	4300	6503	SO:0001583	missense	130497	exon3			TGGAGTGAATATA	BC025712	CCDS1694.1	2p24.1	2013-10-17	2013-10-17	2004-11-26	ENSG00000143867	ENSG00000143867		"""Zinc fingers, C2H2-type"""	8111	protein-coding gene	gene with protein product		608891	"""odd-skipped (Drosophila) homolog"", ""odd-skipped related 1 (Drosophila)"""	ODD		2120051, 12119563	Standard	XM_006711942		Approved		uc002rdc.3	Q8TAX0	OTTHUMG00000088793	ENST00000272223.2:c.673C>T	2.37:g.19552164G>A	ENSP00000272223:p.His225Tyr	Somatic	107	0		WXS	Illumina HiSeq	Phase_I	101	9	NM_145260	0	0	0	0	0	B3KV97|D6W521	Missense_Mutation	SNP	ENST00000272223.2	37	CCDS1694.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.550306	0.86127	.	.	ENSG00000143867	ENST00000272223;ENST00000536433	D;D	0.88896	-2.44;-2.44	5.01	5.01	0.66863	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.049292	0.85682	D	0.000000	D	0.95245	0.8458	M	0.93283	3.4	0.58432	D	0.999996	P	0.38148	0.62	P	0.52758	0.708	D	0.95373	0.8466	9	.	.	.	-8.151	18.0945	0.89485	0.0:0.0:1.0:0.0	.	225	Q8TAX0	OSR1_HUMAN	Y	225	ENSP00000272223:H225Y;ENSP00000441801:H225Y	.	H	-	1	0	OSR1	19415645	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.595000	0.98260	2.606000	0.88127	0.561000	0.74099	CAC	.		0.493	OSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000201432.2	NM_145260	
PNO1	56902	broad.mit.edu	37	2	68385203	68385203	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr2:68385203G>A	ENST00000263657.2	+	1	228	c.137G>A	c.(136-138)cGc>cAc	p.R46H	WDR92_ENST00000492039.2_5'Flank|RP11-474G23.1_ENST00000406334.3_Missense_Mutation_p.R163W|WDR92_ENST00000409164.1_5'Flank|WDR92_ENST00000295121.6_5'Flank|WDR92_ENST00000406245.2_5'Flank	NM_020143.2	NP_064528.1	Q9NRX1	PNO1_HUMAN	partner of NOB1 homolog (S. cerevisiae)	46						nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(1)|lung(2)	4						GATGCGGGCCGCATGGACACA	0.677																																					p.R46H	NSCLC(83;642 1410 13044 32832 40058)												.	PNO1-68	0			c.G137A						.						18.0	26.0	23.0					2																	68385203		2202	4297	6499	SO:0001583	missense	56902	exon1			CGGGCCGCATGGA	AF164799	CCDS1885.1	2p14	2010-07-06			ENSG00000115946	ENSG00000115946			32790	protein-coding gene	gene with protein product	"""RNA binding protein"""		"""KH-type RNA binding protein 1"", ""KH-type RNA-binding protein 1"""	KHRBP1		15497447	Standard	NM_020143		Approved	RRP20	uc002seh.3	Q9NRX1	OTTHUMG00000129563	ENST00000263657.2:c.137G>A	2.37:g.68385203G>A	ENSP00000263657:p.Arg46His	Somatic	42	0		WXS	Illumina HiSeq	Phase_I	45	4	NM_020143	0	0	0	0	0	A8K6Q0|Q53G13|Q8WVB8	Missense_Mutation	SNP	ENST00000263657.2	37	CCDS1885.1	.	.	.	.	.	.	.	.	.	.	G	13.22	2.171546	0.38315	.	.	ENSG00000115946	ENST00000263657	T	0.41400	1.0	6.03	-1.94	0.07571	.	0.478698	0.19273	N	0.118341	T	0.15392	0.0371	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.08868	-1.0701	10	0.52906	T	0.07	0.9051	0.011	0.00001	0.289:0.1962:0.2222:0.2926	.	46	Q9NRX1	PNO1_HUMAN	H	46	ENSP00000263657:R46H	ENSP00000263657:R46H	R	+	2	0	PNO1	68238707	0.014000	0.17966	0.015000	0.15790	0.004000	0.04260	0.190000	0.17057	-0.050000	0.13356	-1.832000	0.00591	CGC	.		0.677	PNO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251756.1	NM_020143	
ANKRD30BL	554226	bcgsc.ca	37	2	132919192	132919192	+	Silent	SNP	G	G	A	rs111295191		TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr2:132919192G>A	ENST00000409867.1	-	1	336	c.87C>T	c.(85-87)aaC>aaT	p.N29N	ANKRD30BL_ENST00000470729.1_Intron			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like	29										endometrium(1)|kidney(3)	4						CGTAAGAGTCGTTGTTGGTGT	0.602																																					.													.	.	0			.						.																																			SO:0001819	synonymous_variant	554226	.			AGAGTCGTTGTTG			2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.87C>T	2.37:g.132919192G>A		Somatic	325	8		WXS	Illumina HiSeq	Phase_1	382	16	.	0	0	0	0	0	B8ZZL7	RNA	SNP	ENST00000409867.1	37																																																																																				.		0.602	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331353.2	NR_027019	
MARS2	92935	broad.mit.edu	37	2	198570300	198570300	+	Silent	SNP	G	G	T			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr2:198570300G>T	ENST00000282276.6	+	1	214	c.171G>T	c.(169-171)gcG>gcT	p.A57A	AC011997.1_ENST00000409845.1_Intron	NM_138395.3	NP_612404.1	Q96GW9	SYMM_HUMAN	methionyl-tRNA synthetase 2, mitochondrial	57					cell death (GO:0008219)|gene expression (GO:0010467)|methionyl-tRNA aminoacylation (GO:0006431)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|methionine-tRNA ligase activity (GO:0004825)	p.A57A(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	22					L-Methionine(DB00134)	TGAACGCGGCGCCGCACATCG	0.647																																					p.A57A													.	MARS2-92	1	Substitution - coding silent(1)	prostate(1)	c.G171T						.																																			SO:0001819	synonymous_variant	92935	exon1			CGCGGCGCCGCAC	BC009115	CCDS33358.1	2q33.1	2014-01-30	2007-02-26		ENSG00000247626	ENSG00000247626	6.1.1.10	"""Aminoacyl tRNA synthetases / Class I"""	25133	protein-coding gene	gene with protein product	"""methionine tRNA ligase 2, mitochondrial"""	609728				15274629	Standard	NM_138395		Approved	mtMetRS, SPAX3	uc002uuq.3	Q96GW9	OTTHUMG00000154487	ENST00000282276.6:c.171G>T	2.37:g.198570300G>T		Somatic	58	1		WXS	Illumina HiSeq	Phase_I	93	9	NM_138395	0	0	0	0	0	A0AVC3|Q76E79|Q8IW62|Q8N7N4	Silent	SNP	ENST00000282276.6	37	CCDS33358.1																																																																																			.		0.647	MARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335477.1	NM_138395	
UNC80	285175	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	210714187	210714187	+	Missense_Mutation	SNP	T	T	G			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr2:210714187T>G	ENST00000439458.1	+	22	3553	c.3473T>G	c.(3472-3474)tTt>tGt	p.F1158C	UNC80_ENST00000272845.6_Missense_Mutation_p.F1153C	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	1158					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						TGCCACAGTTTTGATGATCAT	0.418																																					p.F1158C		.											.	UNC80-90	0			c.T3473G						.						65.0	53.0	57.0					2																	210714187		692	1590	2282	SO:0001583	missense	285175	exon22			ACAGTTTTGATGA	AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.3473T>G	2.37:g.210714187T>G	ENSP00000391088:p.Phe1158Cys	Somatic	168	0		WXS	Illumina HiSeq	Phase_I	171	59	NM_032504	0	0	0	0	0	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	ENST00000439458.1	37	CCDS46504.1	.	.	.	.	.	.	.	.	.	.	T	18.04	3.533780	0.64972	.	.	ENSG00000144406	ENST00000439458;ENST00000272845	T;T	0.35973	1.29;1.28	5.71	5.71	0.89125	.	0.055299	0.64402	D	0.000001	T	0.35219	0.0924	L	0.36672	1.1	0.80722	D	1	P	0.49447	0.924	P	0.46479	0.518	T	0.17379	-1.0371	10	0.72032	D	0.01	-17.6283	11.7113	0.51626	0.1322:0.0:0.0:0.8678	.	1158	Q8N2C7	UNC80_HUMAN	C	1158;1153	ENSP00000391088:F1158C;ENSP00000272845:F1153C	ENSP00000272845:F1153C	F	+	2	0	UNC80	210422432	1.000000	0.71417	0.876000	0.34364	0.756000	0.42949	6.203000	0.72137	2.168000	0.68352	0.528000	0.53228	TTT	.		0.418	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_182587	
BCL2L1	598	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	30253881	30253881	+	Silent	SNP	A	A	G			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr20:30253881A>G	ENST00000307677.4	-	3	983	c.573T>C	c.(571-573)ttT>ttC	p.F191F	BCL2L1_ENST00000376062.2_Silent_p.F191F|BCL2L1_ENST00000376055.4_Silent_p.F128F|BCL2L1_ENST00000420653.1_Silent_p.F191F	NM_138578.1	NP_612815.1	Q07817	B2CL1_HUMAN	BCL2-like 1	191					apoptotic mitochondrial changes (GO:0008637)|apoptotic process (GO:0006915)|apoptotic process in bone marrow (GO:0071839)|cell proliferation (GO:0008283)|cellular process regulating host cell cycle in response to virus (GO:0060154)|cellular response to alkaloid (GO:0071312)|cellular response to amino acid stimulus (GO:0071230)|cellular response to gamma radiation (GO:0071480)|cytokinesis (GO:0000910)|endocytosis (GO:0006897)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|fertilization (GO:0009566)|germ cell development (GO:0007281)|growth (GO:0040007)|hepatocyte apoptotic process (GO:0097284)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|male gonad development (GO:0008584)|mitochondrion morphogenesis (GO:0070584)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of autophagy (GO:0010507)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of execution phase of apoptosis (GO:1900118)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|ovarian follicle development (GO:0001541)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|release of cytochrome c from mitochondria (GO:0001836)|response to cycloheximide (GO:0046898)|response to cytokine (GO:0034097)|spermatogenesis (GO:0007283)|suppression by virus of host apoptotic process (GO:0019050)	Bcl-2 family protein complex (GO:0097136)|cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|synapse (GO:0045202)	BH3 domain binding (GO:0051434)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(1)|large_intestine(2)|lung(4)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11	all_cancers(5;3.47e-06)|all_epithelial(3;1.83e-06)|Lung NSC(7;2.08e-06)|all_lung(7;3.63e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Epithelial(4;2.97e-06)|all cancers(5;3.21e-05)|OV - Ovarian serous cystadenocarcinoma(3;0.00052)|Colorectal(19;0.0055)|COAD - Colon adenocarcinoma(19;0.0264)			AGAGTTCCACAAAAGTATCCT	0.567																																					p.F191F	Colon(51;693 1004 1401 20431 21026)	.											.	BCL2L1-1084	0			c.T573C						.						84.0	78.0	80.0					20																	30253881		2203	4300	6503	SO:0001819	synonymous_variant	598	exon3			TTCCACAAAAGTA	Z23115	CCDS13188.1, CCDS13189.1	20q11.21	2014-03-07			ENSG00000171552	ENSG00000171552		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	992	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 52"""	600039				8358789	Standard	NM_001191		Approved	BCLX, BCL2L, Bcl-X, bcl-xL, bcl-xS, PPP1R52	uc002wwl.3	Q07817	OTTHUMG00000032192	ENST00000307677.4:c.573T>C	20.37:g.30253881A>G		Somatic	84	0		WXS	Illumina HiSeq	Phase_I	137	71	NM_138578	0	0	0	0	0	E1P5L6|Q5CZ89|Q5TE65|Q92976	Silent	SNP	ENST00000307677.4	37	CCDS13189.1																																																																																			.		0.567	BCL2L1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078575.1	NM_138578	
ADAMTS5	11096	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	28305272	28305272	+	Missense_Mutation	SNP	C	C	G			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr21:28305272C>G	ENST00000284987.5	-	5	1902	c.1781G>C	c.(1780-1782)tGt>tCt	p.C594S	AP001601.2_ENST00000426771.1_RNA	NM_007038.3	NP_008969.2	Q9UNA0	ATS5_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 5	594	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	72						AGGGTTATTACAGTGACGATA	0.567																																					p.C594S	Esophageal Squamous(53;683 1080 10100 14424 45938)	.											.	ADAMTS5-229	0			c.G1781C						.						152.0	105.0	121.0					21																	28305272		2203	4300	6503	SO:0001583	missense	11096	exon5			TTATTACAGTGAC	AF142099	CCDS13579.1	21q21.3	2008-07-31	2008-07-31		ENSG00000154736	ENSG00000154736		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	221	protein-coding gene	gene with protein product	"""aggrecanase-2"""	605007	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)"""			10438522	Standard	NM_007038		Approved	ADMP-2, ADAMTS11	uc002ymg.3	Q9UNA0	OTTHUMG00000078686	ENST00000284987.5:c.1781G>C	21.37:g.28305272C>G	ENSP00000284987:p.Cys594Ser	Somatic	163	0		WXS	Illumina HiSeq	Phase_I	198	57	NM_007038	0	0	0	0	0	Q52LV4|Q9UKP2	Missense_Mutation	SNP	ENST00000284987.5	37	CCDS13579.1	.	.	.	.	.	.	.	.	.	.	C	33	5.248311	0.95305	.	.	ENSG00000154736	ENST00000284987	T	0.69040	-0.37	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	D	0.91778	0.7399	H	0.99922	4.955	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.95071	0.8204	10	0.87932	D	0	.	20.5666	0.99351	0.0:1.0:0.0:0.0	.	594	Q9UNA0	ATS5_HUMAN	S	594	ENSP00000284987:C594S	ENSP00000284987:C594S	C	-	2	0	ADAMTS5	27227143	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.487000	0.81328	2.854000	0.98071	0.655000	0.94253	TGT	.		0.567	ADAMTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171648.1		
SEZ6L	23544	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	26761491	26761491	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr22:26761491G>A	ENST00000248933.6	+	13	2848	c.2753G>A	c.(2752-2754)gGa>gAa	p.G918E	SEZ6L_ENST00000529632.2_Missense_Mutation_p.G918E|SEZ6L_ENST00000404234.3_Missense_Mutation_p.G918E|SEZ6L_ENST00000343706.4_Intron|SEZ6L_ENST00000411842.2_Missense_Mutation_p.G115E|SEZ6L_ENST00000402979.1_Missense_Mutation_p.G691E|SEZ6L_ENST00000403121.1_Intron|SEZ6L_ENST00000360929.3_Missense_Mutation_p.G854E|SEZ6L_ENST00000494013.1_3'UTR			Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	918	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)				breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(35)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	80						TGCATCCTGGGACAGCCATCC	0.582																																					p.G918E		.											.	SEZ6L-95	0			c.G2753A						.						82.0	73.0	76.0					22																	26761491		2203	4300	6503	SO:0001583	missense	23544	exon13			TCCTGGGACAGCC	AL050253	CCDS13833.1, CCDS54508.1, CCDS54510.1, CCDS54511.1, CCDS74837.1	22q12.1	2008-05-14	2001-11-28		ENSG00000100095	ENSG00000100095			10763	protein-coding gene	gene with protein product		607021	"""seizure related gene 6 (mouse)-like"""				Standard	NM_021115		Approved		uc003acb.3	Q9BYH1	OTTHUMG00000150870	ENST00000248933.6:c.2753G>A	22.37:g.26761491G>A	ENSP00000248933:p.Gly918Glu	Somatic	174	0		WXS	Illumina HiSeq	Phase_I	149	49	NM_021115	0	0	0	0	0	A0AUW7|B0QYG4|B0QYG5|B7ZLJ6|G8JLP3|O95917|Q5THY5|Q6IBZ4|Q6UXD4|Q9NUI3|Q9NUI4|Q9NUI5|Q9Y2E1|Q9Y3J6	Missense_Mutation	SNP	ENST00000248933.6	37	CCDS13833.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.605986	0.87157	.	.	ENSG00000100095	ENST00000404234;ENST00000529632;ENST00000360929;ENST00000248933;ENST00000402979;ENST00000411842	T;T;T;T;T;T	0.62941	-0.01;-0.01;-0.01;-0.01;-0.01;-0.01	5.27	5.27	0.74061	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.53938	D	0.000046	T	0.80884	0.4709	M	0.80332	2.49	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	T	0.83060	-0.0148	10	0.87932	D	0	.	18.0747	0.89423	0.0:0.0:1.0:0.0	.	918;918;854;918;918	B7ZLJ8;B7ZLJ6;Q9BYH1-4;B0QYG3;Q9BYH1	.;.;.;.;SE6L1_HUMAN	E	918;918;854;918;691;115	ENSP00000384772:G918E;ENSP00000437037:G918E;ENSP00000354185:G854E;ENSP00000248933:G918E;ENSP00000384733:G691E;ENSP00000397274:G115E	ENSP00000248933:G918E	G	+	2	0	SEZ6L	25091491	1.000000	0.71417	0.997000	0.53966	0.731000	0.41821	8.973000	0.93428	2.735000	0.93741	0.655000	0.94253	GGA	.		0.582	SEZ6L-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320359.3		
IP6K2	51447	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	48728866	48728866	+	Missense_Mutation	SNP	A	A	G			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr3:48728866A>G	ENST00000328631.5	-	4	701	c.478T>C	c.(478-480)Tac>Cac	p.Y160H		NM_001005909.2|NM_016291.3	NP_001005909.1|NP_057375.2	Q9UHH9	IP6K2_HUMAN	inositol hexakisphosphate kinase 2	160					cytokine-mediated signaling pathway (GO:0019221)|inositol phosphate metabolic process (GO:0043647)|negative regulation of cell growth (GO:0030308)|phosphate ion transport (GO:0006817)|phosphatidylinositol phosphorylation (GO:0046854)|positive regulation of apoptotic process (GO:0043065)|small molecule metabolic process (GO:0044281)|type I interferon signaling pathway (GO:0060337)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			biliary_tract(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)	15						ACAGTGTAGTACAAGACTTCA	0.363																																					p.Y160H		.											.	IP6K2-265	0			c.T478C						.						154.0	146.0	149.0					3																	48728866		2203	4300	6503	SO:0001583	missense	51447	exon4			TGTAGTACAAGAC	AF177145	CCDS2777.1, CCDS33752.1, CCDS54579.1, CCDS54580.1, CCDS54581.1	3p21.31	2009-01-05	2009-01-05	2008-12-22	ENSG00000068745	ENSG00000068745			17313	protein-coding gene	gene with protein product		606992	"""inositol hexaphosphate kinase 2"""	IHPK2		10574768	Standard	NM_016291		Approved		uc003cup.3	Q9UHH9	OTTHUMG00000133543	ENST00000328631.5:c.478T>C	3.37:g.48728866A>G	ENSP00000331103:p.Tyr160His	Somatic	171	0		WXS	Illumina HiSeq	Phase_I	146	51	NM_016291	0	0	8	14	6	A8K3B1|B4E3G6|G8JLL6|Q6P0N8|Q9BSZ6|Q9BUW3|Q9H4P7|Q9NT63|Q9UFU6	Missense_Mutation	SNP	ENST00000328631.5	37	CCDS2777.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.109209	0.77096	.	.	ENSG00000068745	ENST00000328631	T	0.18657	2.2	5.6	5.6	0.85130	.	0.169966	0.53938	D	0.000049	T	0.23330	0.0564	L	0.58101	1.795	0.80722	D	1	P	0.49447	0.924	B	0.40782	0.34	T	0.03852	-1.0998	10	0.22706	T	0.39	-18.3925	15.8359	0.78796	1.0:0.0:0.0:0.0	.	160	Q9UHH9	IP6K2_HUMAN	H	160	ENSP00000331103:Y160H	ENSP00000331103:Y160H	Y	-	1	0	IP6K2	48703870	1.000000	0.71417	0.993000	0.49108	0.991000	0.79684	7.511000	0.81718	2.141000	0.66446	0.524000	0.50904	TAC	.		0.363	IP6K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257521.2	NM_016291	
LAMB2	3913	broad.mit.edu	37	3	49158999	49158999	+	Silent	SNP	C	C	T			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr3:49158999C>T	ENST00000418109.1	-	32	5291	c.5127G>A	c.(5125-5127)caG>caA	p.Q1709Q	USP19_ENST00000488993.1_5'Flank|LAMB2_ENST00000305544.4_Silent_p.Q1709Q|USP19_ENST00000434032.2_5'Flank|USP19_ENST00000398898.2_5'Flank|USP19_ENST00000398888.2_5'Flank|USP19_ENST00000453664.1_5'Flank|USP19_ENST00000417901.1_5'Flank|USP19_ENST00000398892.3_5'Flank	NM_002292.3	NP_002283.3	P55268	LAMB2_HUMAN	laminin, beta 2 (laminin S)	1709	Domain I.				astrocyte development (GO:0014002)|axon extension involved in regeneration (GO:0048677)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|metanephric glomerular basement membrane development (GO:0072274)|metanephric glomerular visceral epithelial cell development (GO:0072249)|neuromuscular junction development (GO:0007528)|retina development in camera-type eye (GO:0060041)|Schwann cell development (GO:0014044)|visual perception (GO:0007601)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-11 complex (GO:0043260)|laminin-3 complex (GO:0005608)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(15)|kidney(3)|large_intestine(6)|lung(21)|ovary(4)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CCGTCTGGTACTGATCACCCA	0.607																																					p.Q1709Q													.	LAMB2-93	0			c.G5127A						.						48.0	48.0	48.0					3																	49158999		2203	4300	6503	SO:0001819	synonymous_variant	3913	exon31			CTGGTACTGATCA		CCDS2789.1	3p21.3-p21.2	2013-03-01			ENSG00000172037	ENSG00000172037		"""Laminins"""	6487	protein-coding gene	gene with protein product	"""laminin S"""	150325		LAMS		2922051, 10393422	Standard	NM_002292		Approved		uc003cwe.3	P55268	OTTHUMG00000156807	ENST00000418109.1:c.5127G>A	3.37:g.49158999C>T		Somatic	234	0		WXS	Illumina HiSeq	Phase_I	266	6	NM_002292	0	0	287	291	4	Q16321	Silent	SNP	ENST00000418109.1	37	CCDS2789.1																																																																																			.		0.607	LAMB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345939.1	NM_002292	
OR5H2	79310	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	98001882	98001882	+	Missense_Mutation	SNP	A	A	C			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr3:98001882A>C	ENST00000355273.2	+	1	151	c.151A>C	c.(151-153)Att>Ctt	p.I51L	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005482.1	NP_001005482.1	Q8NGV7	OR5H2_HUMAN	olfactory receptor, family 5, subfamily H, member 2	51						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(5)|lung(13)|ovary(3)|upper_aerodigestive_tract(1)	24						CCTTGGTCTGATTGCTCTTAT	0.433																																					p.I51L		.											.	OR5H2-71	0			c.A151C						.						359.0	331.0	340.0					3																	98001882		2203	4300	6503	SO:0001583	missense	79310	exon1			GGTCTGATTGCTC		CCDS33801.1	3q11.2	2013-09-23			ENSG00000197938	ENSG00000197938		"""GPCR / Class A : Olfactory receptors"""	14752	protein-coding gene	gene with protein product							Standard	NM_001005482		Approved		uc003dsj.1	Q8NGV7	OTTHUMG00000160080	ENST00000355273.2:c.151A>C	3.37:g.98001882A>C	ENSP00000347418:p.Ile51Leu	Somatic	252	0		WXS	Illumina HiSeq	Phase_I	275	97	NM_001005482	0	0	0	0	0	Q6IF87	Missense_Mutation	SNP	ENST00000355273.2	37	CCDS33801.1	.	.	.	.	.	.	.	.	.	.	A	9.652	1.141906	0.21205	.	.	ENSG00000197938	ENST00000355273	T	0.00614	6.21	3.2	3.2	0.36748	GPCR, rhodopsin-like superfamily (1);	0.180712	0.26582	U	0.023580	T	0.01061	0.0035	L	0.52905	1.665	0.09310	N	1	P	0.45768	0.866	P	0.46585	0.521	T	0.48864	-0.8997	10	0.72032	D	0.01	.	5.7492	0.18138	0.7608:0.0:0.0:0.2391	.	51	Q8NGV7	OR5H2_HUMAN	L	51	ENSP00000347418:I51L	ENSP00000347418:I51L	I	+	1	0	OR5H2	99484572	0.003000	0.15002	0.516000	0.27786	0.041000	0.13682	0.917000	0.28665	1.458000	0.47871	0.443000	0.29094	ATT	.		0.433	OR5H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359113.2		
TPRA1	131601	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	127292425	127292425	+	Missense_Mutation	SNP	G	G	C	rs201165800	byFrequency	TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr3:127292425G>C	ENST00000355552.3	-	11	1437	c.1061C>G	c.(1060-1062)cCc>cGc	p.P354R	TPRA1_ENST00000296210.7_3'UTR|TPRA1_ENST00000465915.1_5'Flank|TPRA1_ENST00000450633.2_Missense_Mutation_p.P354R|TPRA1_ENST00000489960.1_Missense_Mutation_p.P354R	NM_001136053.1	NP_001129525.1	Q86W33	TPRA1_HUMAN	transmembrane protein, adipocyte asscociated 1	354					aging (GO:0007568)|G-protein coupled receptor signaling pathway (GO:0007186)|lipid metabolic process (GO:0006629)	integral component of membrane (GO:0016021)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	9						AGTGTGGCAGGGCATGGAAGC	0.657																																					p.P354R		.											.	TPRA1-90	0			c.C1061G						.						47.0	48.0	47.0					3																	127292425		2202	4300	6502	SO:0001583	missense	131601	exon11			TGGCAGGGCATGG	AK056759	CCDS3042.1, CCDS46899.1	3q21.2	2012-08-22	2009-07-08	2009-07-08	ENSG00000163870	ENSG00000163870		"""GPCR / Unclassified : 7TM orphan receptors"""	30413	protein-coding gene	gene with protein product	"""transmembrane protein 227"""	608336	"""G protein-coupled receptor 175"""	GPR175		10342878	Standard	NM_001136053		Approved	TPRA40, FLJ32197, TMEM227	uc003ejn.3	Q86W33	OTTHUMG00000159639	ENST00000355552.3:c.1061C>G	3.37:g.127292425G>C	ENSP00000347748:p.Pro354Arg	Somatic	66	0		WXS	Illumina HiSeq	Phase_I	74	24	NM_001136053	0	0	54	117	63	A8MVB8|D3DNA9|Q8WZ24|Q96AJ6|Q9P2R4	Missense_Mutation	SNP	ENST00000355552.3	37	CCDS3042.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.553183	0.86127	.	.	ENSG00000163870	ENST00000450633;ENST00000355552;ENST00000489960	.	.	.	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	T	0.66489	0.2794	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.70135	-0.4955	9	0.56958	D	0.05	-26.1417	18.2482	0.89993	0.0:0.0:1.0:0.0	.	354	Q86W33	TPRA1_HUMAN	R	354	.	ENSP00000347748:P354R	P	-	2	0	TPRA1	128775115	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	9.058000	0.93896	2.305000	0.77605	0.491000	0.48974	CCC	G|0.999;A|0.001		0.657	TPRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356624.1	NM_016372	
MUC4	4585	bcgsc.ca	37	3	195509322	195509322	+	Silent	SNP	G	G	A			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr3:195509322G>A	ENST00000463781.3	-	2	9588	c.9129C>T	c.(9127-9129)gtC>gtT	p.V3043V	MUC4_ENST00000475231.1_Silent_p.V3043V|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	984					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.V3043V(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AAGTGTCGGTGACAGGAAGCG	0.612																																					p.V3043V													.	MUC4-90	1	Substitution - coding silent(1)	kidney(1)	c.C9129T						.																																			SO:0001819	synonymous_variant	4585	exon2			GTCGGTGACAGGA	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9129C>T	3.37:g.195509322G>A		Somatic	382	11		WXS	Illumina HiSeq	Phase_1	488	33	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																			.		0.612	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
TNK2	10188	broad.mit.edu;bcgsc.ca	37	3	195615329	195615329	+	Missense_Mutation	SNP	T	T	C			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr3:195615329T>C	ENST00000333602.6	-	2	748	c.131A>G	c.(130-132)gAg>gGg	p.E44G	TNK2_ENST00000381916.2_Missense_Mutation_p.E107G|TNK2_ENST00000428187.1_Missense_Mutation_p.E76G|TNK2_ENST00000316664.3_Missense_Mutation_p.E44G|TNK2_ENST00000392400.1_Missense_Mutation_p.E44G|TNK2_ENST00000468819.1_5'UTR	NM_005781.4	NP_005772.3	Q07912	ACK1_HUMAN	tyrosine kinase, non-receptor, 2	44	SAM-like domain.				cell surface receptor signaling pathway (GO:0007166)|endocytosis (GO:0006897)|negative regulation of catalytic activity (GO:0043086)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of clathrin-mediated endocytosis (GO:2000369)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|endosome (GO:0005768)|Grb2-EGFR complex (GO:0070436)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|WW domain binding (GO:0050699)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(11)|ovary(3)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	29	all_cancers(143;6.48e-09)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;1.46e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.3e-19)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;0.000757)	Adenosine triphosphate(DB00171)	CTCCAGGTCCTCATTCTTGAC	0.597																																					p.E107G													.	TNK2-957	0			c.A320G						.						137.0	118.0	125.0					3																	195615329		2203	4300	6503	SO:0001583	missense	10188	exon2			AGGTCCTCATTCT	L13738	CCDS33927.1, CCDS33928.1	3q29	2013-09-02			ENSG00000061938	ENSG00000061938			19297	protein-coding gene	gene with protein product	"""activated Cdc42-associated kinase 1"""	606994				8497321, 14506255	Standard	XM_006713460		Approved	p21cdc42Hs, ACK, ACK1	uc003fvt.1	Q07912	OTTHUMG00000155737	ENST00000333602.6:c.131A>G	3.37:g.195615329T>C	ENSP00000329425:p.Glu44Gly	Somatic	280	0		WXS	Illumina HiSeq	Phase_I	255	8	NM_001010938	0	0	0	0	0	Q6ZMQ0|Q8N6U7|Q96H59	Missense_Mutation	SNP	ENST00000333602.6	37	CCDS33928.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.84|18.84	3.709073|3.709073	0.68615|0.68615	.|.	.|.	ENSG00000061938|ENSG00000061938	ENST00000333602;ENST00000381916;ENST00000428187;ENST00000392400;ENST00000316664;ENST00000433111;ENST00000427576|ENST00000438207	T;T;T;T;T;T;T|.	0.21543|.	2.0;2.0;2.0;2.0;2.0;2.0;2.0|.	5.21|5.21	5.21|5.21	0.72293|0.72293	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.72011|0.72011	0.3408|0.3408	M|M	0.78456|0.78456	2.415|2.415	0.49389|0.49389	D|D	0.999786|0.999786	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;0.976|.	D;D;D;D|.	0.91635|.	0.997;0.997;0.999;0.909|.	T|T	0.73620|0.73620	-0.3925|-0.3925	10|5	0.72032|.	D|.	0.01|.	.|.	9.6494|9.6494	0.39888|0.39888	0.1553:0.0:0.0:0.8447|0.1553:0.0:0.0:0.8447	.|.	44;44;107;76|.	Q07912-2;Q07912;Q07912-3;C9J1X3|.	.;ACK1_HUMAN;.;.|.	G|G	44;107;76;44;44;44;108|43	ENSP00000329425:E44G;ENSP00000371341:E107G;ENSP00000392546:E76G;ENSP00000376201:E44G;ENSP00000323216:E44G;ENSP00000395154:E44G;ENSP00000390088:E108G|.	ENSP00000323216:E44G|.	E|R	-|-	2|1	0|2	TNK2|TNK2	197099726|197099726	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.480000|0.480000	0.33159|0.33159	5.977000|5.977000	0.70492|0.70492	1.975000|1.975000	0.57531|0.57531	0.383000|0.383000	0.25322|0.25322	GAG|AGG	.		0.597	TNK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341437.3	NM_005781	
SLC26A1	10861	broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	982690	982690	+	Silent	SNP	A	A	G			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr4:982690A>G	ENST00000361661.2	-	4	2414	c.2037T>C	c.(2035-2037)agT>agC	p.S679S	SLC26A1_ENST00000513138.1_5'Flank|IDUA_ENST00000453894.1_Intron|IDUA_ENST00000509744.1_Intron|IDUA_ENST00000247933.4_Intron|SLC26A1_ENST00000398516.2_Silent_p.S679S|SLC26A1_ENST00000398520.2_Intron	NM_213613.2	NP_998778.1	Q9H2B4	S26A1_HUMAN	solute carrier family 26 (anion exchanger), member 1	679	STAS. {ECO:0000255|PROSITE- ProRule:PRU00198}.				3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|carbohydrate metabolic process (GO:0005975)|chloride transport (GO:0006821)|glycosaminoglycan metabolic process (GO:0030203)|ion transport (GO:0006811)|oxalate transport (GO:0019532)|small molecule metabolic process (GO:0044281)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	anion:anion antiporter activity (GO:0015301)|chloride transmembrane transporter activity (GO:0015108)|oxalate transmembrane transporter activity (GO:0019531)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)			central_nervous_system(1)|endometrium(4)|pancreas(1)|prostate(1)|skin(1)	8			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			CATCGTGCACACTGAGGAACA	0.672																																					p.S679S													.	SLC26A1-91	0			c.T2037C						.						26.0	23.0	24.0					4																	982690		2188	4289	6477	SO:0001819	synonymous_variant	10861	exon3			GTGCACACTGAGG	AF297659	CCDS33933.1, CCDS33934.1	4p16.3	2013-07-18	2013-07-18		ENSG00000145217	ENSG00000145217		"""Solute carriers"""	10993	protein-coding gene	gene with protein product		610130	"""solute carrier family 26 (sulfate transporter), member 1"""				Standard	NM_213613		Approved	SAT-1, EDM4	uc003gcc.3	Q9H2B4	OTTHUMG00000160003	ENST00000361661.2:c.2037T>C	4.37:g.982690A>G		Somatic	106	1		WXS	Illumina HiSeq	Phase_I	114	29	NM_022042	0	0	0	0	0	A8K9N2|Q7Z5R3|Q96BK0	Silent	SNP	ENST00000361661.2	37	CCDS33934.1																																																																																			.		0.672	SLC26A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358783.1	NM_022042, NM_134425	
ADD1	118	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	2883755	2883755	+	Missense_Mutation	SNP	C	C	A			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr4:2883755C>A	ENST00000398129.1	+	2	346	c.326C>A	c.(325-327)gCt>gAt	p.A109D	ADD1_ENST00000398123.2_Missense_Mutation_p.A109D|ADD1_ENST00000446856.1_Missense_Mutation_p.A109D|ADD1_ENST00000398125.1_Missense_Mutation_p.A109D|ADD1_ENST00000513328.2_Missense_Mutation_p.A109D|ADD1_ENST00000355842.3_Missense_Mutation_p.A109D|ADD1_ENST00000503455.2_Missense_Mutation_p.A109D|ADD1_ENST00000264758.7_Missense_Mutation_p.A109D			P35611	ADDA_HUMAN	adducin 1 (alpha)	109					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic process (GO:0006915)|barbed-end actin filament capping (GO:0051016)|cell morphogenesis (GO:0000902)|cell volume homeostasis (GO:0006884)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular protein metabolic process (GO:0044267)|cellular response to retinoic acid (GO:0071300)|endoplasmic reticulum unfolded protein response (GO:0030968)|erythrocyte differentiation (GO:0030218)|hemoglobin metabolic process (GO:0020027)|homeostasis of number of cells within a tissue (GO:0048873)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein binding (GO:0032092)	cytosol (GO:0005829)|dendritic spine (GO:0043197)|F-actin capping protein complex (GO:0008290)|focal adhesion (GO:0005925)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)|transcription factor binding (GO:0008134)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)	22				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		TACCCAGCAGCTCCGCAAGGA	0.423																																					p.A109D	Esophageal Squamous(71;505 1201 20414 34538 37449)	.											.	ADD1-92	0			c.C326A						.						152.0	144.0	147.0					4																	2883755		2203	4300	6503	SO:0001583	missense	118	exon3			CAGCAGCTCCGCA	L07261	CCDS3363.1, CCDS3364.1, CCDS43205.1, CCDS75094.1	4p16.3	2009-04-22			ENSG00000087274	ENSG00000087274			243	protein-coding gene	gene with protein product		102680				1840603	Standard	NM_001119		Approved		uc003gfq.3	P35611	OTTHUMG00000122080	ENST00000398129.1:c.326C>A	4.37:g.2883755C>A	ENSP00000381197:p.Ala109Asp	Somatic	161	0		WXS	Illumina HiSeq	Phase_I	220	91	NM_014190	0	0	0	0	0	A2A3N8|A2A3P0|B4DI79|D3DVR3|D3DVR4|D3DVR5|Q13734|Q14729|Q16156|Q86XM2|Q9UJB6	Missense_Mutation	SNP	ENST00000398129.1	37	CCDS43205.1	.	.	.	.	.	.	.	.	.	.	C	15.64	2.894195	0.52121	.	.	ENSG00000087274	ENST00000264758;ENST00000446856;ENST00000398125;ENST00000398124;ENST00000511797;ENST00000513328;ENST00000503455;ENST00000355842;ENST00000398123;ENST00000398129	T;T;T;T;T;T;T;T;T	0.31769	1.48;1.48;1.48;1.48;1.48;1.48;1.48;1.48;1.48	4.88	4.88	0.63580	.	0.000000	0.85682	D	0.000000	T	0.25717	0.0626	N	0.22421	0.69	0.80722	D	1	B;B;P;B;B;P;B	0.42556	0.003;0.0;0.783;0.005;0.014;0.741;0.19	B;B;B;B;B;B;B	0.40477	0.006;0.002;0.33;0.01;0.022;0.238;0.042	T	0.04386	-1.0955	10	0.45353	T	0.12	-22.0196	18.2285	0.89926	0.0:1.0:0.0:0.0	.	109;109;109;109;109;109;109	E7ENY0;B4DI79;Q86XM2;P35611;P35611-3;P35611-2;A2A3N8	.;.;.;ADDA_HUMAN;.;.;.	D	109	ENSP00000264758:A109D;ENSP00000399828:A109D;ENSP00000381193:A109D;ENSP00000421918:A109D;ENSP00000421907:A109D;ENSP00000423024:A109D;ENSP00000348100:A109D;ENSP00000381191:A109D;ENSP00000381197:A109D	ENSP00000264758:A109D	A	+	2	0	ADD1	2853553	1.000000	0.71417	0.863000	0.33907	0.601000	0.36947	5.634000	0.67833	2.540000	0.85666	0.491000	0.48974	GCT	.		0.423	ADD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242840.1	NM_014189	
SLC34A2	10568	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	25676246	25676246	+	Missense_Mutation	SNP	C	C	G	rs375377923		TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr4:25676246C>G	ENST00000382051.3	+	12	1503	c.1453C>G	c.(1453-1455)Ctc>Gtc	p.L485V	SLC34A2_ENST00000504570.1_Missense_Mutation_p.L484V|SLC34A2_ENST00000503434.1_Missense_Mutation_p.L484V	NM_001177998.1|NM_006424.2	NP_001171469.1|NP_006415	O95436	NPT2B_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 2	485					aging (GO:0007568)|cellular phosphate ion homeostasis (GO:0030643)|in utero embryonic development (GO:0001701)|ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|response to estradiol (GO:0032355)|response to estrogen (GO:0043627)|response to fructose (GO:0009750)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	phosphate ion binding (GO:0042301)|sodium ion binding (GO:0031402)|sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:phosphate symporter activity (GO:0005436)		SLC34A2/ROS1(14)	breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|skin(4)	41		Breast(46;0.0503)				GAGGAGTTCACTCCAGGTCAG	0.602			T	ROS1	NSCLC																																p.L485V		.		Dom	yes		4	4p15.2	10568	"""solute carrier family 34 (sodium phosphate), member 2"""		E	.	SLC34A2-95	0			c.C1453G						.						69.0	74.0	72.0					4																	25676246		2203	4300	6503	SO:0001583	missense	10568	exon12			AGTTCACTCCAGG	AF111856	CCDS3435.1, CCDS54750.1	4p15.2	2013-07-17	2013-07-17		ENSG00000157765	ENSG00000157765		"""Solute carriers"""	11020	protein-coding gene	gene with protein product		604217	"""solute carrier family 34 (sodium phosphate), member 2"""			10329428, 10610722	Standard	NM_006424		Approved	NAPI-3B	uc003grr.3	O95436	OTTHUMG00000097757	ENST00000382051.3:c.1453C>G	4.37:g.25676246C>G	ENSP00000371483:p.Leu485Val	Somatic	174	0		WXS	Illumina HiSeq	Phase_I	206	80	NM_006424	0	0	0	0	0	A5PL17|Q8N2K2|Q8WYA9|Q9P0V7	Missense_Mutation	SNP	ENST00000382051.3	37	CCDS3435.1	.	.	.	.	.	.	.	.	.	.	C	3.915	-0.019199	0.07634	.	.	ENSG00000157765	ENST00000504570;ENST00000382051;ENST00000503434	D;D;D	0.86497	-2.13;-2.13;-2.13	5.31	3.54	0.40534	.	0.068142	0.64402	D	0.000012	D	0.84079	0.5393	L	0.55103	1.725	0.42232	D	0.991895	P;P	0.35944	0.473;0.529	B;P	0.44696	0.336;0.458	T	0.78534	-0.2167	10	0.37606	T	0.19	-25.8301	2.7152	0.05185	0.3196:0.4244:0.1554:0.1006	.	484;485	O95436-2;O95436	.;NPT2B_HUMAN	V	484;485;484	ENSP00000425501:L484V;ENSP00000371483:L485V;ENSP00000423021:L484V	ENSP00000371483:L485V	L	+	1	0	SLC34A2	25285344	0.105000	0.21958	0.623000	0.29173	0.023000	0.10783	0.614000	0.24314	0.698000	0.31739	0.561000	0.74099	CTC	.		0.602	SLC34A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214990.1	NM_006424	
CWH43	80157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	49032879	49032879	+	Silent	SNP	T	T	G			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr4:49032879T>G	ENST00000226432.4	+	11	1593	c.1410T>G	c.(1408-1410)tcT>tcG	p.S470S	CWH43_ENST00000513409.1_Silent_p.S443S	NM_025087.2	NP_079363.2	Q9H720	PG2IP_HUMAN	cell wall biogenesis 43 C-terminal homolog (S. cerevisiae)	470					GPI anchor biosynthetic process (GO:0006506)	integral component of membrane (GO:0016021)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(26)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43						GTGATGCTTCTAAGCCCTATA	0.403																																					p.S470S		.											.	CWH43-93	0			c.T1410G						.						130.0	131.0	130.0					4																	49032879		2203	4300	6503	SO:0001819	synonymous_variant	80157	exon11			TGCTTCTAAGCCC		CCDS3486.1, CCDS68697.1	4p12-p11	2010-09-21			ENSG00000109182	ENSG00000109182			26133	protein-coding gene	gene with protein product						17714445, 17761529	Standard	NM_025087		Approved	FLJ21511, CWH43-C	uc003gyv.3	Q9H720	OTTHUMG00000128627	ENST00000226432.4:c.1410T>G	4.37:g.49032879T>G		Somatic	142	0		WXS	Illumina HiSeq	Phase_I	115	41	NM_025087	0	0	0	0	0	B2RPD7	Silent	SNP	ENST00000226432.4	37	CCDS3486.1																																																																																			.		0.403	CWH43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250496.2	NM_025087	
PRKG2	5593	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	82061797	82061797	+	Silent	SNP	A	A	T			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr4:82061797A>T	ENST00000395578.1	-	12	1550	c.1434T>A	c.(1432-1434)gcT>gcA	p.A478A	PRKG2_ENST00000264399.1_Silent_p.A478A|PRKG2_ENST00000509169.1_5'UTR|PRKG2_ENST00000545647.1_Silent_p.A58A|PRKG2_ENST00000418486.2_Silent_p.A449A			Q13237	KGP2_HUMAN	protein kinase, cGMP-dependent, type II	478	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood coagulation (GO:0007596)|circadian regulation of gene expression (GO:0032922)|nitric oxide metabolic process (GO:0046209)|protein phosphorylation (GO:0006468)|regulation of nitric-oxide synthase activity (GO:0050999)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)|protein kinase activity (GO:0004672)			NS(1)|breast(4)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	37						TCATAGCAAAAGCAACATTCT	0.353																																					p.A478A		.											.	PRKG2-524	0			c.T1434A						.						130.0	116.0	121.0					4																	82061797		2203	4300	6503	SO:0001819	synonymous_variant	5593	exon11			AGCAAAAGCAACA	X94612	CCDS3589.1, CCDS75150.1	4q13.1-q21.1	2009-07-10			ENSG00000138669	ENSG00000138669	2.7.11.1		9416	protein-coding gene	gene with protein product		601591				7498513	Standard	XM_005263126		Approved	cGKII, PRKGR2	uc003hmh.2	Q13237	OTTHUMG00000130296	ENST00000395578.1:c.1434T>A	4.37:g.82061797A>T		Somatic	139	0		WXS	Illumina HiSeq	Phase_I	156	37	NM_006259	0	0	0	0	0	B4DMX3|E7EPE6|O00125|O60916	Silent	SNP	ENST00000395578.1	37	CCDS3589.1																																																																																			.		0.353	PRKG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252639.1	NM_006259	
DSPP	1834	bcgsc.ca	37	4	88537018	88537018	+	Silent	SNP	T	T	C	rs370264407		TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr4:88537018T>C	ENST00000282478.7	+	4	3237	c.3204T>C	c.(3202-3204)gaT>gaC	p.D1068D	DSPP_ENST00000399271.1_Silent_p.D1068D|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1068	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		acagcagtgatagcagtgaca	0.532																																					p.D1068D													.	DSPP-90	0			c.T3204C						.	T		27,3131		0,27,1552	54.0	66.0	62.0		3204	0.6	0.3	4	dbSNP_134	62	95,5593		2,91,2751	no	coding-synonymous	DSPP	NM_014208.3		2,118,4303	CC,CT,TT		1.6702,0.855,1.3792		1068/1302	88537018	122,8724	1579	2844	4423	SO:0001819	synonymous_variant	1834	exon5			CAGTGATAGCAGT	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3204T>C	4.37:g.88537018T>C		Somatic	274	8		WXS	Illumina HiSeq	Phase_1	361	24	NM_014208	0	0	0	0	0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.532	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
DSPP	1834	bcgsc.ca	37	4	88537027	88537027	+	Missense_Mutation	SNP	C	C	A			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr4:88537027C>A	ENST00000282478.7	+	4	3246	c.3213C>A	c.(3211-3213)gaC>gaA	p.D1071E	DSPP_ENST00000399271.1_Missense_Mutation_p.D1071E|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1071	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		atagcagtgacagcagtgaca	0.542																																					p.D1071E													.	DSPP-90	0			c.C3213A						.						56.0	66.0	63.0					4																	88537027		1577	2848	4425	SO:0001583	missense	1834	exon5			CAGTGACAGCAGT	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3213C>A	4.37:g.88537027C>A	ENSP00000282478:p.Asp1071Glu	Somatic	253	1		WXS	Illumina HiSeq	Phase_1	338	20	NM_014208	0	0	0	0	0	A8MUI0|O95815	Missense_Mutation	SNP	ENST00000282478.7	37	CCDS43248.1	.	.	.	.	.	.	.	.	.	.	c	2.636	-0.285341	0.05605	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.88124	-2.34;-2.34	1.15	-2.31	0.06765	.	.	.	.	.	T	0.69196	0.3084	L	0.38175	1.15	0.09310	N	1	P	0.46952	0.887	B	0.36766	0.232	T	0.66364	-0.5942	9	0.02654	T	1	.	2.058	0.03586	0.2533:0.3578:0.0:0.3889	.	1071	Q9NZW4	DSPP_HUMAN	E	1071	ENSP00000382213:D1071E;ENSP00000282478:D1071E	ENSP00000282478:D1071E	D	+	3	2	DSPP	88756051	0.029000	0.19370	0.018000	0.16275	0.040000	0.13550	-0.117000	0.10708	-0.986000	0.03498	0.282000	0.19409	GAC	.		0.542	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
FAT1	2195	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	187627969	187627969	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr4:187627969C>T	ENST00000441802.2	-	2	3222	c.3013G>A	c.(3013-3015)Gac>Aac	p.D1005N		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	1005	Cadherin 8. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						TTTCCCTTGTCTTTGGCCCTC	0.458										HNSCC(5;0.00058)																											p.D1005N	Colon(197;1040 2055 4143 4984 49344)	.											.	FAT1-34	0			c.G3013A						.						108.0	110.0	109.0					4																	187627969		1971	4147	6118	SO:0001583	missense	2195	exon2			CCTTGTCTTTGGC	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.3013G>A	4.37:g.187627969C>T	ENSP00000406229:p.Asp1005Asn	Somatic	219	0		WXS	Illumina HiSeq	Phase_I	262	91	NM_005245	0	0	0	2	2		Missense_Mutation	SNP	ENST00000441802.2	37	CCDS47177.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.374390	0.82573	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	T	0.65364	-0.15	4.55	4.55	0.56014	Cadherin (5);Cadherin-like (1);	0.106734	0.64402	D	0.000008	T	0.79191	0.4404	M	0.82132	2.575	0.80722	D	1	D	0.59767	0.986	D	0.63703	0.917	T	0.82963	-0.0196	10	0.87932	D	0	.	17.8551	0.88760	0.0:1.0:0.0:0.0	.	1005	Q14517	FAT1_HUMAN	N	1005	ENSP00000406229:D1005N	ENSP00000260147:D1005N	D	-	1	0	FAT1	187864963	1.000000	0.71417	1.000000	0.80357	0.733000	0.41908	7.606000	0.82863	2.508000	0.84585	0.491000	0.48974	GAC	.		0.458	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245	
SKIV2L2	23517	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	54635905	54635905	+	Missense_Mutation	SNP	A	A	G			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr5:54635905A>G	ENST00000230640.5	+	6	837	c.583A>G	c.(583-585)Agt>Ggt	p.S195G	SKIV2L2_ENST00000545714.1_Missense_Mutation_p.S94G	NM_015360.4	NP_056175.3	P42285	SK2L2_HUMAN	superkiller viralicidic activity 2-like 2 (S. cerevisiae)	195	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				maturation of 5.8S rRNA (GO:0000460)|mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			NS(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|lung(12)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Lung NSC(810;0.000744)|Breast(144;0.181)|Prostate(74;0.194)				TAAGGCTCTGAGTAACCAAAA	0.363																																					p.S195G	Melanoma(2;92 134 23744 29976 33782)	.											.	SKIV2L2-92	0			c.A583G						.						141.0	137.0	139.0					5																	54635905		2203	4300	6503	SO:0001583	missense	23517	exon6			GCTCTGAGTAACC	D29641	CCDS3967.1	5q11.2	2008-11-25	2005-02-18	2005-02-18	ENSG00000039123	ENSG00000039123			18734	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 118"""		"""KIAA0052"""	KIAA0052			Standard	NM_015360		Approved	Mtr4, Dob1, fSAP118	uc003jpy.4	P42285	OTTHUMG00000097019	ENST00000230640.5:c.583A>G	5.37:g.54635905A>G	ENSP00000230640:p.Ser195Gly	Somatic	102	0		WXS	Illumina HiSeq	Phase_I	80	24	NM_015360	0	0	0	0	0	Q2M386|Q6MZZ8|Q6P170|Q8N5R0|Q8TAG2	Missense_Mutation	SNP	ENST00000230640.5	37	CCDS3967.1	.	.	.	.	.	.	.	.	.	.	A	24.5	4.543682	0.86022	.	.	ENSG00000039123	ENST00000230640;ENST00000545714	T;T	0.15139	2.45;2.45	5.98	5.98	0.97165	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.088703	0.85682	D	0.000000	T	0.55289	0.1911	H	0.94345	3.525	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.993;0.999	T	0.68704	-0.5338	10	0.87932	D	0	-18.2935	16.4566	0.84019	1.0:0.0:0.0:0.0	.	94;195	F5H7E2;P42285	.;SK2L2_HUMAN	G	195;94	ENSP00000230640:S195G;ENSP00000442583:S94G	ENSP00000230640:S195G	S	+	1	0	SKIV2L2	54671662	1.000000	0.71417	0.999000	0.59377	0.970000	0.65996	7.102000	0.77005	2.293000	0.77203	0.477000	0.44152	AGT	.		0.363	SKIV2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214108.1		
VCAN	1462	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	82815685	82815685	+	Silent	SNP	G	G	A			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr5:82815685G>A	ENST00000265077.3	+	7	2125	c.1560G>A	c.(1558-1560)ttG>ttA	p.L520L	VCAN_ENST00000343200.5_Intron|VCAN_ENST00000502527.2_Intron|VCAN_ENST00000342785.4_Silent_p.L520L|VCAN_ENST00000512590.2_Silent_p.L472L	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	520	GAG-alpha (glucosaminoglycan attachment domain).				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	AAACACCATTGGTAACTGCAA	0.393																																					p.L520L		.											.	VCAN-238	0			c.G1560A						.						127.0	127.0	127.0					5																	82815685		2203	4300	6503	SO:0001819	synonymous_variant	1462	exon7			ACCATTGGTAACT	X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.1560G>A	5.37:g.82815685G>A		Somatic	148	0		WXS	Illumina HiSeq	Phase_I	134	43	NM_004385	0	0	0	0	0	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Silent	SNP	ENST00000265077.3	37	CCDS4060.1																																																																																			.		0.393	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
CHD1	1105	ucsc.edu;bcgsc.ca	37	5	98238644	98238644	+	Missense_Mutation	SNP	C	C	T	rs368581644		TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr5:98238644C>T	ENST00000284049.3	-	4	546	c.397G>A	c.(397-399)Gat>Aat	p.D133N		NM_001270.2	NP_001261.2	O14646	CHD1_HUMAN	chromodomain helicase DNA binding protein 1	133	Ser-rich.				chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|methylated histone binding (GO:0035064)			NS(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(2)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	49		all_cancers(142;5.36e-08)|all_epithelial(76;6.97e-11)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|all_lung(232;0.00119)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0717)	Epirubicin(DB00445)	GATGAGTCATCGGAATCTTCA	0.294																																					p.D133N													.	CHD1-274	0			c.G397A						.	C	ASN/ASP	1,4405	2.1+/-5.4	0,1,2202	77.0	74.0	75.0		397	4.8	1.0	5		75	0,8584		0,0,4292	no	missense	CHD1	NM_001270.2	23	0,1,6494	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	133/1711	98238644	1,12989	2203	4292	6495	SO:0001583	missense	1105	exon4			AGTCATCGGAATC	AF006513	CCDS34204.1	5q15-q21	2008-07-18			ENSG00000153922	ENSG00000153922			1915	protein-coding gene	gene with protein product		602118				8460153, 9326634	Standard	XM_005271866		Approved		uc003knf.3	O14646	OTTHUMG00000162744	ENST00000284049.3:c.397G>A	5.37:g.98238644C>T	ENSP00000284049:p.Asp133Asn	Somatic	37	0		WXS	Illumina HiSeq		37	4	NM_001270	0	0	0	0	0	Q17RZ3	Missense_Mutation	SNP	ENST00000284049.3	37	CCDS34204.1	.	.	.	.	.	.	.	.	.	.	C	12.01	1.809530	0.31961	2.27E-4	0.0	ENSG00000153922	ENST00000284049;ENST00000540681	D	0.89746	-2.56	4.84	4.84	0.62591	.	0.000000	0.34460	U	0.003957	D	0.86674	0.5989	L	0.55481	1.735	0.58432	D	0.999995	B	0.10296	0.003	B	0.04013	0.001	T	0.81967	-0.0690	10	0.25751	T	0.34	.	18.4531	0.90711	0.0:1.0:0.0:0.0	.	133	O14646	CHD1_HUMAN	N	133	ENSP00000284049:D133N	ENSP00000284049:D133N	D	-	1	0	CHD1	98266544	0.998000	0.40836	0.998000	0.56505	0.887000	0.51463	4.282000	0.58971	2.632000	0.89209	0.462000	0.41574	GAT	.		0.294	CHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370295.1	NM_001270	
BTNL8	79908	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	180338541	180338541	+	Silent	SNP	C	C	T	rs377605273		TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr5:180338541C>T	ENST00000340184.4	+	3	806	c.600C>T	c.(598-600)aaC>aaT	p.N200N	BTNL8_ENST00000508408.1_Silent_p.N200N|BTNL8_ENST00000533815.2_Silent_p.N16N|BTNL8_ENST00000511704.1_Silent_p.N84N|BTNL8_ENST00000231229.4_Silent_p.N200N|BTNL8_ENST00000400707.3_Silent_p.N75N|BTNL8_ENST00000505126.1_5'UTR|Y_RNA_ENST00000410920.1_RNA	NM_001040462.2	NP_001035552.1	Q6UX41	BTNL8_HUMAN	butyrophilin-like 8	200	Ig-like V-type 2.				immune system process (GO:0002376)	integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(12)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	28	all_cancers(89;3.37e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.0801)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TCCAAGAGAACGCCGGGAGCA	0.537																																					p.N200N													.	BTNL8-24	0			c.C600T						.	C	,,,,,	0,4406		0,0,2203	82.0	80.0	80.0		600,252,600,225,48,600	-7.4	0.0	5		80	1,8591	1.2+/-3.3	0,1,4295	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	BTNL8	NM_001040462.2,NM_001159707.1,NM_001159708.1,NM_001159709.1,NM_001159710.1,NM_024850.2	,,,,,	0,1,6498	TT,TC,CC		0.0116,0.0,0.0077	,,,,,	200/501,84/385,200/341,75/376,16/317,200/348	180338541	1,12997	2203	4296	6499	SO:0001819	synonymous_variant	79908	exon3			AGAGAACGCCGGG	AK025111	CCDS4459.1, CCDS43413.1, CCDS54956.1, CCDS54957.1, CCDS54958.1, CCDS54959.1	5q35.3	2014-01-14			ENSG00000113303	ENSG00000113303		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	26131	protein-coding gene	gene with protein product		615606				12975309	Standard	NM_024850		Approved	FLJ21458, BTN9.2	uc003mmp.3	Q6UX41	OTTHUMG00000130932	ENST00000340184.4:c.600C>T	5.37:g.180338541C>T		Somatic	83	1		WXS	Illumina HiSeq	Phase_I	96	30	NM_001159708	0	0	0	0	0	A4QMZ8|A6NEX6|B7Z409|B7Z5B1|E9PEF6|E9PG07|F2Z2B2|F8W712|Q9H730	Silent	SNP	ENST00000340184.4	37	CCDS43413.1																																																																																			.		0.537	BTNL8-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000368440.1	NM_024850	
PHACTR1	221692	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	13283687	13283687	+	Missense_Mutation	SNP	G	G	C			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr6:13283687G>C	ENST00000379335.3	+	3	340	c.235G>C	c.(235-237)Gaa>Caa	p.E79Q	RP1-257A7.4_ENST00000606150.1_RNA|PHACTR1_ENST00000332995.7_Missense_Mutation_p.E515Q|PHACTR1_ENST00000457702.2_Missense_Mutation_p.E370Q|PHACTR1_ENST00000379329.1_Missense_Mutation_p.E79Q|RP1-257A7.4_ENST00000399446.2_RNA			Q9C0D0	PHAR1_HUMAN	phosphatase and actin regulator 1	515					actin cytoskeleton reorganization (GO:0031532)|actomyosin structure organization (GO:0031032)|cell motility (GO:0048870)|stress fiber assembly (GO:0043149)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)|synapse (GO:0045202)	actin binding (GO:0003779)|protein phosphatase inhibitor activity (GO:0004864)			breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	26	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)			AGAGCTTCGGGAAAGAAAGAT	0.597																																					p.E515Q		.											.	.	0			c.G1543C						.						125.0	138.0	134.0					6																	13283687		2033	4200	6233	SO:0001583	missense	221692	exon13			CTTCGGGAAAGAA	AB051520	CCDS75401.1	6p23	2013-01-24	2004-05-20	2004-05-21	ENSG00000112137	ENSG00000112137		"""Phosphatase and actin regulators"""	20990	protein-coding gene	gene with protein product		608723	"""RPEL repeat containing 1"""	RPEL1		11214970, 15107502	Standard	NM_030948		Approved	KIAA1733, dJ257A7.2	uc010jpc.3	Q9C0D0	OTTHUMG00000014270	ENST00000379335.3:c.235G>C	6.37:g.13283687G>C	ENSP00000368639:p.Glu79Gln	Somatic	78	0		WXS	Illumina HiSeq	Phase_I	124	43	NM_030948	0	0	2	2	0	A8K1V2|Q3MJ93|Q5JSJ2	Missense_Mutation	SNP	ENST00000379335.3	37		.	.	.	.	.	.	.	.	.	.	G	21.1	4.095811	0.76870	.	.	ENSG00000112137	ENST00000332995;ENST00000457702;ENST00000379335;ENST00000379329	T;T	0.32988	1.43;1.43	5.78	5.78	0.91487	.	0.094270	0.64402	D	0.000001	T	0.32224	0.0822	N	0.21448	0.665	0.80722	D	1	D	0.63046	0.992	D	0.67548	0.952	T	0.03193	-1.1062	10	0.33940	T	0.23	-15.365	19.0064	0.92852	0.0:0.0:1.0:0.0	.	515	Q9C0D0	PHAR1_HUMAN	Q	515;370;79;79	ENSP00000329880:E515Q;ENSP00000397669:E370Q	ENSP00000329880:E515Q	E	+	1	0	PHACTR1	13391666	1.000000	0.71417	0.985000	0.45067	0.919000	0.55068	9.623000	0.98386	2.738000	0.93877	0.655000	0.94253	GAA	.		0.597	PHACTR1-003	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000039878.1	XM_166420	
ZFP57	346171	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	29643249	29643249	+	Missense_Mutation	SNP	T	T	C			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr6:29643249T>C	ENST00000488757.1	-	3	416	c.266A>G	c.(265-267)cAt>cGt	p.H89R	ZFP57_ENST00000376881.3_Missense_Mutation_p.H69R|ZFP57_ENST00000376883.1_Missense_Mutation_p.H69R	NM_001109809.2	NP_001103279.2	Q9NU63	ZFP57_HUMAN	ZFP57 zinc finger protein	61					DNA methylation involved in embryo development (GO:0043045)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peripheral nervous system development (GO:0007422)|regulation of gene expression by genetic imprinting (GO:0006349)|transcription, DNA-templated (GO:0006351)	nuclear heterochromatin (GO:0005720)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(16)|ovary(4)|skin(4)|urinary_tract(5)	44						CTCTGGCTTATGCAGAAAGAT	0.483																																					p.H89R		.											.	ZFP57-5	0			c.A266G						.						221.0	207.0	212.0					6																	29643249		1947	4153	6100	SO:0001583	missense	346171	exon3			GGCTTATGCAGAA	AL050328	CCDS43436.1, CCDS43436.2	6p22.1	2013-01-08	2012-11-27	2005-07-20	ENSG00000204644	ENSG00000204644		"""Zinc fingers, C2H2-type"", ""-"""	18791	protein-coding gene	gene with protein product		612192	"""chromosome 6 open reading frame 40"", ""zinc finger protein 57 homolog (mouse)"""	C6orf40			Standard	NM_001109809		Approved	ZNF698, bA145L22, bA145L22.2	uc011dlw.2	Q9NU63	OTTHUMG00000031158	ENST00000488757.1:c.266A>G	6.37:g.29643249T>C	ENSP00000418259:p.His89Arg	Somatic	223	0		WXS	Illumina HiSeq	Phase_I	218	91	NM_001109809	0	0	0	0	0	B0S894|B0V254|B2RXJ7|Q5SSB1	Missense_Mutation	SNP	ENST00000488757.1	37	CCDS43436.2	.	.	.	.	.	.	.	.	.	.	T	4.922	0.171264	0.09391	.	.	ENSG00000204644	ENST00000488757;ENST00000376881;ENST00000376883	T;T;T	0.00768	5.72;5.72;5.72	4.36	0.288	0.15719	.	0.866899	0.09598	N	0.780620	T	0.00210	0.0006	N	0.14661	0.345	0.09310	N	1	B;B	0.25169	0.119;0.119	B;B	0.23574	0.047;0.047	T	0.25152	-1.0140	10	0.34782	T	0.22	0.7587	4.8209	0.13390	0.173:0.0:0.599:0.2281	.	89;69	Q9NU63-3;Q9NU63-2	.;.	R	89;69;69	ENSP00000418259:H89R;ENSP00000366078:H69R;ENSP00000366080:H69R	ENSP00000366078:H69R	H	-	2	0	ZFP57	29751228	0.003000	0.15002	0.001000	0.08648	0.153000	0.21895	0.428000	0.21395	-0.071000	0.12886	-0.313000	0.08912	CAT	.		0.483	ZFP57-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355773.1	XM_294093	
ABHD16A	7920	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	31657863	31657863	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr6:31657863C>T	ENST00000395952.3	-	11	1111	c.949G>A	c.(949-951)Gga>Aga	p.G317R	ABHD16A_ENST00000440843.2_Missense_Mutation_p.G284R|XXbac-BPG32J3.20_ENST00000461287.1_3'UTR|ABHD16A_ENST00000471644.1_5'UTR|ABHD16A_ENST00000375842.4_Missense_Mutation_p.G98R	NM_021160.2	NP_066983.1	O95870	ABHGA_HUMAN	abhydrolase domain containing 16A	317						integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)			endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)	10						ACCGTGCTTCCAGCAAAGCCT	0.547																																					p.G317R		.											.	ABHD16A-91	0			c.G949A						.						68.0	56.0	60.0					6																	31657863		1511	2709	4220	SO:0001583	missense	7920	exon11			TGCTTCCAGCAAA	AF129756	CCDS4713.1, CCDS54988.1	6p21.3	2013-01-17	2010-12-09	2010-12-09	ENSG00000204427	ENSG00000204427		"""Abhydrolase domain containing"""	13921	protein-coding gene	gene with protein product		142620	"""HLA-B associated transcript 5"""	BAT5		2911734, 2813433	Standard	NM_021160		Approved	NG26, D6S82E	uc003nvy.2	O95870	OTTHUMG00000031177	ENST00000395952.3:c.949G>A	6.37:g.31657863C>T	ENSP00000379282:p.Gly317Arg	Somatic	91	0		WXS	Illumina HiSeq	Phase_I	76	25	NM_021160	0	0	0	0	0	A2BEY3|B7Z4R6|Q5SRR1|Q5SRR2|Q8WYH0|Q9NW33	Missense_Mutation	SNP	ENST00000395952.3	37	CCDS4713.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.733977	0.89482	.	.	ENSG00000204427	ENST00000395952;ENST00000375842;ENST00000440843	T;T;T	0.21191	2.02;2.02;2.02	5.4	5.4	0.78164	.	0.108527	0.64402	D	0.000008	T	0.30792	0.0776	L	0.55834	1.745	0.80722	D	1	D;D	0.76494	0.96;0.999	P;D	0.71656	0.772;0.974	T	0.00909	-1.1518	10	0.30078	T	0.28	-9.9061	16.6668	0.85255	0.0:1.0:0.0:0.0	.	284;317	B7Z4R6;O95870	.;ABHGA_HUMAN	R	317;98;284	ENSP00000379282:G317R;ENSP00000365002:G98R;ENSP00000410347:G284R	ENSP00000365002:G98R	G	-	1	0	ABHD16A	31765842	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.008000	0.63991	2.536000	0.85505	0.655000	0.94253	GGA	.		0.547	ABHD16A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076342.4		
STXBP5	134957	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	147648298	147648298	+	Missense_Mutation	SNP	G	G	C			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr6:147648298G>C	ENST00000321680.6	+	18	1966	c.1966G>C	c.(1966-1968)Gac>Cac	p.D656H	STXBP5_ENST00000367480.3_Missense_Mutation_p.D656H|STXBP5_ENST00000367481.3_Missense_Mutation_p.D656H|STXBP5_ENST00000179882.6_Missense_Mutation_p.D327H	NM_001127715.2	NP_001121187.1	Q5T5C0	STXB5_HUMAN	syntaxin binding protein 5 (tomosyn)	656					exocytosis (GO:0006887)|negative regulation of exocytosis (GO:0045920)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|synapse (GO:0045202)	syntaxin-1 binding (GO:0017075)			breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(21)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	42		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)		TGCTATGGTTGACTACCTCCA	0.403																																					p.D656H													.	STXBP5-90	0			c.G1966C						.						147.0	139.0	142.0					6																	147648298		2203	4300	6503	SO:0001583	missense	134957	exon18			ATGGTTGACTACC	AK055484	CCDS5211.1, CCDS47499.1	6q24.3	2013-01-10			ENSG00000164506	ENSG00000164506		"""WD repeat domain containing"""	19665	protein-coding gene	gene with protein product		604586				9620695, 14767561	Standard	NM_139244		Approved	tomosyn, LLGL3	uc010khz.2	Q5T5C0	OTTHUMG00000015766	ENST00000321680.6:c.1966G>C	6.37:g.147648298G>C	ENSP00000321826:p.Asp656His	Somatic	83	1		WXS	Illumina HiSeq	Phase_I	86	28	NM_139244	0	0	0	0	0	Q14DF3|Q5T5C1|Q5T5C2|Q8NBG8|Q96NG9	Missense_Mutation	SNP	ENST00000321680.6	37	CCDS47499.1	.	.	.	.	.	.	.	.	.	.	G	29.6	5.016315	0.93404	.	.	ENSG00000164506	ENST00000367479;ENST00000367481;ENST00000321680;ENST00000367480;ENST00000179882	T;T;T;T	0.74737	0.99;1.31;0.85;-0.87	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	D	0.87014	0.6072	M	0.83774	2.66	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.998	D	0.87084	0.2168	10	0.87932	D	0	.	20.6525	0.99598	0.0:0.0:1.0:0.0	.	656;656;327	Q5T5C0-2;Q5T5C0;B3KXX0	.;STXB5_HUMAN;.	H	3;656;656;656;327	ENSP00000356451:D656H;ENSP00000321826:D656H;ENSP00000356450:D656H;ENSP00000179882:D327H	ENSP00000179882:D327H	D	+	1	0	STXBP5	147689991	1.000000	0.71417	0.994000	0.49952	0.998000	0.95712	9.813000	0.99286	2.890000	0.99128	0.585000	0.79938	GAC	.		0.403	STXBP5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042606.1		
GRB10	2887	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	50742288	50742288	+	Silent	SNP	G	G	A			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr7:50742288G>A	ENST00000401949.1	-	6	676	c.207C>T	c.(205-207)gcC>gcT	p.A69A	GRB10_ENST00000398812.2_Silent_p.A69A|GRB10_ENST00000398810.2_Silent_p.A11A|GRB10_ENST00000439599.1_Silent_p.A63A|GRB10_ENST00000357271.5_Silent_p.A69A|GRB10_ENST00000402497.1_Silent_p.A11A|GRB10_ENST00000402578.1_Silent_p.A11A|GRB10_ENST00000403097.1_Silent_p.A63A|GRB10_ENST00000335866.3_Silent_p.A11A|GRB10_ENST00000406641.1_Silent_p.A11A|GRB10_ENST00000407526.1_Silent_p.A11A			Q13322	GRB10_HUMAN	growth factor receptor-bound protein 10	69					insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of phosphorylation (GO:0042326)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of phosphorylation (GO:0042327)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|response to insulin (GO:0032868)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(19)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	41	Glioma(55;0.08)|all_neural(89;0.245)					GCATGCTGCAGGCCGAGTACA	0.587									Russell-Silver syndrome																												p.A69A		.											.	GRB10-1272	0			c.C207T						.						57.0	63.0	61.0					7																	50742288		2066	4214	6280	SO:0001819	synonymous_variant	2887	exon3	Familial Cancer Database	Silver-Russell Dwarfism, Silver-Russell syndrome, SRS, Russel-Silver Dwarfism	GCTGCAGGCCGAG		CCDS43582.1, CCDS43583.1, CCDS47586.1	7p12.2	2013-02-14			ENSG00000106070	ENSG00000106070		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4564	protein-coding gene	gene with protein product		601523					Standard	NM_005311		Approved		uc003tpi.2	Q13322	OTTHUMG00000150622	ENST00000401949.1:c.207C>T	7.37:g.50742288G>A		Somatic	51	0		WXS	Illumina HiSeq	Phase_I	91	8	NM_005311	0	0	2	2	0	A4D258|A7VJ95|A8K0E6|D3DVM9|O00427|O00701|O75222|Q92606|Q92907|Q92948	Silent	SNP	ENST00000401949.1	37	CCDS43582.1																																																																																			.		0.587	GRB10-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319157.1		
WDR91	29062	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	134893687	134893687	+	Missense_Mutation	SNP	C	C	A			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr7:134893687C>A	ENST00000354475.4	-	3	398	c.367G>T	c.(367-369)Gct>Tct	p.A123S	WDR91_ENST00000485942.1_5'Flank|WDR91_ENST00000344400.5_Missense_Mutation_p.A123S|WDR91_ENST00000423565.1_Missense_Mutation_p.A88S	NM_014149.3	NP_054868.3	A4D1P6	WDR91_HUMAN	WD repeat domain 91	123										breast(3)|endometrium(2)|kidney(2)|large_intestine(12)|lung(14)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	40						TTCCACTCAGCCTGGTTCTGG	0.537																																					p.A123S		.											.	WDR91-137	0			c.G367T						.						184.0	155.0	165.0					7																	134893687		2203	4300	6503	SO:0001583	missense	29062	exon3			ACTCAGCCTGGTT	AF161534	CCDS34758.1	7q33	2013-01-09			ENSG00000105875	ENSG00000105875		"""WD repeat domain containing"""	24997	protein-coding gene	gene with protein product						11042152, 11230166	Standard	NM_014149		Approved	HSPC049	uc003vsp.2	A4D1P6	OTTHUMG00000155414	ENST00000354475.4:c.367G>T	7.37:g.134893687C>A	ENSP00000346466:p.Ala123Ser	Somatic	290	0		WXS	Illumina HiSeq	Phase_I	521	195	NM_014149	0	0	0	3	3	A6NK54|C9JMI4|Q6FI65|Q6MZQ1|Q6P4I1|Q96AE5|Q96G63|Q9H062|Q9H9B6|Q9NVG7|Q9NZY6	Missense_Mutation	SNP	ENST00000354475.4	37	CCDS34758.1	.	.	.	.	.	.	.	.	.	.	C	10.92	1.488114	0.26686	.	.	ENSG00000105875	ENST00000344400;ENST00000354475;ENST00000423565	D;D;D	0.91521	-2.86;-2.86;-2.86	5.77	4.89	0.63831	.	0.145674	0.64402	D	0.000009	D	0.82733	0.5101	N	0.25890	0.77	0.58432	D	0.999999	P	0.41524	0.753	B	0.35278	0.199	T	0.81028	-0.1118	10	0.18276	T	0.48	-19.4769	15.1712	0.72875	0.0:0.9322:0.0:0.0678	.	123	A4D1P6	WDR91_HUMAN	S	123;123;88	ENSP00000340877:A123S;ENSP00000346466:A123S;ENSP00000392555:A88S	ENSP00000340877:A123S	A	-	1	0	WDR91	134544227	1.000000	0.71417	0.998000	0.56505	0.041000	0.13682	4.739000	0.62080	1.587000	0.49959	-0.145000	0.13849	GCT	.		0.537	WDR91-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340019.1	NM_014149	
CSMD1	64478	bcgsc.ca	37	8	2832127	2832127	+	Silent	SNP	T	T	C			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr8:2832127T>C	ENST00000520002.1	-	57	9144	c.8589A>G	c.(8587-8589)ccA>ccG	p.P2863P	CSMD1_ENST00000537824.1_Silent_p.P2862P|CSMD1_ENST00000602723.1_Silent_p.P2805P|CSMD1_ENST00000400186.3_Silent_p.P2805P|CSMD1_ENST00000542608.1_Silent_p.P2804P|CSMD1_ENST00000602557.1_Silent_p.P2863P			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2863	Sushi 21. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CAGGGACCCCTGGGTGTCCAC	0.502																																					p.P2862P													.	CSMD1-86	0			c.A8586G						.						32.0	34.0	34.0					8																	2832127		1949	4131	6080	SO:0001819	synonymous_variant	64478	exon56			GACCCCTGGGTGT			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.8589A>G	8.37:g.2832127T>C		Somatic	64	0		WXS	Illumina HiSeq	Phase_1	54	4	NM_033225	0	0	0	0	0	Q0H0J5|Q96QU9|Q96RM4	Silent	SNP	ENST00000520002.1	37		.	.	.	.	.	.	.	.	.	.	T	1.147	-0.647742	0.03506	.	.	ENSG00000183117	ENST00000335551	.	.	.	5.81	-9.87	0.00470	.	.	.	.	.	T	0.44180	0.1281	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53514	-0.8428	4	.	.	.	.	7.2183	0.25971	0.374:0.3553:0.0:0.2707	.	.	.	.	G	2280	.	.	R	-	1	2	CSMD1	2819534	0.049000	0.20398	0.145000	0.22337	0.041000	0.13682	-0.674000	0.05233	-1.259000	0.02468	0.533000	0.62120	AGG	.		0.502	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
ZFHX4	79776	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	77616434	77616434	+	Silent	SNP	G	G	A			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr8:77616434G>A	ENST00000521891.2	+	2	559	c.111G>A	c.(109-111)ggG>ggA	p.G37G	ZFHX4_ENST00000517683.1_Intron|ZFHX4_ENST00000050961.6_Silent_p.G37G|ZFHX4_ENST00000455469.2_Silent_p.G37G|ZFHX4_ENST00000518282.1_Silent_p.G37G	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	37					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			AAGTTGCAGGGATGGAGCCTG	0.502										HNSCC(33;0.089)																											p.G37G		.											.	ZFHX4-98	0			c.G111A						.						64.0	67.0	66.0					8																	77616434		2025	4211	6236	SO:0001819	synonymous_variant	79776	exon2			TGCAGGGATGGAG		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.111G>A	8.37:g.77616434G>A		Somatic	238	0		WXS	Illumina HiSeq	Phase_I	274	84	NM_024721	0	0	0	0	0	G3V138|Q18PS0|Q6ZN20	Silent	SNP	ENST00000521891.2	37	CCDS47878.2																																																																																			.		0.502	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
TONSL	4796	hgsc.bcm.edu	37	8	145654714	145654714	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr8:145654714C>T	ENST00000409379.3	-	26	3978	c.3949G>A	c.(3949-3951)Gcc>Acc	p.A1317T	VPS28_ENST00000529182.1_5'Flank|VPS28_ENST00000526054.1_5'Flank|VPS28_ENST00000526734.1_5'Flank|VPS28_ENST00000377348.2_5'Flank|VPS28_ENST00000292510.4_5'Flank	NM_013432.4	NP_038460.4	Q96HA7	TONSL_HUMAN	tonsoku-like, DNA repair protein	1317					cytoplasmic sequestering of transcription factor (GO:0042994)|double-strand break repair via homologous recombination (GO:0000724)|regulation of RNA biosynthetic process (GO:2001141)|replication fork processing (GO:0031297)	cytoplasm (GO:0005737)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	histone binding (GO:0042393)|transcription corepressor activity (GO:0003714)			biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|lung(14)|ovary(3)|prostate(1)|skin(1)	26						CCCTGGACGGCGCAGCCTGCG	0.706																																					p.A1317T		.											.	TONSL-92	0			c.G3949A						.						5.0	5.0	5.0					8																	145654714		2056	4038	6094	SO:0001583	missense	4796	exon26			GGACGGCGCAGCC		CCDS34968.2	8q24.3	2013-01-10	2010-12-02	2010-11-30	ENSG00000160949	ENSG00000160949		"""Ankyrin repeat domain containing"""	7801	protein-coding gene	gene with protein product		604546	"""nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 2"""	NFKBIL2		7738005, 11246458	Standard	NM_013432		Approved	IKBR	uc011llg.2	Q96HA7	OTTHUMG00000153122	ENST00000409379.3:c.3949G>A	8.37:g.145654714C>T	ENSP00000386239:p.Ala1317Thr	Somatic	0	0		WXS	Illumina HiSeq	Phase_I	7	5	NM_013432	0	0	0	0	0	B5MDP0|C9JKB1|C9JNV8|Q13006|Q9UGJ2	Missense_Mutation	SNP	ENST00000409379.3	37	CCDS34968.2	.	.	.	.	.	.	.	.	.	.	c	8.974	0.973627	0.18736	.	.	ENSG00000160949	ENST00000409379;ENST00000422691	T	0.52983	0.64	5.39	0.26	0.15588	.	0.776034	0.12482	N	0.465083	T	0.35624	0.0938	L	0.47016	1.485	0.09310	N	1	B	0.20052	0.041	B	0.06405	0.002	T	0.28522	-1.0041	10	0.54805	T	0.06	-3.5453	5.4749	0.16690	0.5793:0.2411:0.0:0.1796	.	1317	Q96HA7	TONSL_HUMAN	T	1317;1316	ENSP00000386239:A1317T	ENSP00000386239:A1317T	A	-	1	0	TONSL	145625522	0.000000	0.05858	0.421000	0.26609	0.136000	0.21042	-0.691000	0.05133	0.097000	0.17492	0.511000	0.50034	GCC	.		0.706	TONSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329668.2	NM_013432	
CD274	29126	broad.mit.edu	37	9	5457410	5457410	+	Silent	SNP	G	G	A			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr9:5457410G>A	ENST00000381577.3	+	3	470	c.384G>A	c.(382-384)gtG>gtA	p.V128V	CD274_ENST00000498261.1_3'UTR|CD274_ENST00000381573.4_Intron	NM_014143.3	NP_054862.1	Q9NZQ7	PD1L1_HUMAN	CD274 molecule	128					cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of interleukin-10 secretion (GO:2001181)|positive regulation of T cell proliferation (GO:0042102)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)	11	all_hematologic(13;0.158)	Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000742)|Lung(218;0.111)		GAATTACTGTGAAAGTCAATG	0.398			T	CIITA	"""PMBL, Hodgkin Lymphona, """																																p.V128V				Dom	yes		9	9p24	29126	CD274 molecule		L	.	CD274-227	0			c.G384A						.						38.0	41.0	40.0					9																	5457410		2203	4300	6503	SO:0001819	synonymous_variant	29126	exon3			TACTGTGAAAGTC	AF177937	CCDS6464.1, CCDS59118.1	9p24.1	2014-01-30	2006-03-28	2005-02-25	ENSG00000120217	ENSG00000120217		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Endogenous ligands"""	17635	protein-coding gene	gene with protein product	"""B7 homolog 1"""	605402	"""programmed cell death 1 ligand 1"", ""CD274 antigen"""	PDCD1LG1		11015443, 10581077	Standard	NM_014143		Approved	B7-H, B7H1, PD-L1, PDL1, B7-H1	uc003zje.3	Q9NZQ7	OTTHUMG00000019503	ENST00000381577.3:c.384G>A	9.37:g.5457410G>A		Somatic	77	0		WXS	Illumina HiSeq	Phase_I	101	3	NM_014143	0	0	0	0	0	B2RBA2|B4DU27|Q14CJ2|Q2V8D5|Q66RK1|Q6WEX4|Q9NUZ5	Silent	SNP	ENST00000381577.3	37	CCDS6464.1																																																																																			.		0.398	CD274-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051631.2	NM_014143	
FOXD4L5	653427	broad.mit.edu	37	9	70177822	70177822	+	Silent	SNP	T	T	C	rs199878768	byFrequency	TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr9:70177822T>C	ENST00000377420.1	-	1	993	c.162A>G	c.(160-162)tcA>tcG	p.S54S		NM_001126334.1	NP_001119806.1	Q5VV16	FX4L5_HUMAN	forkhead box D4-like 5	54					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(5)|lung(2)	7						CCGGCTGGAGTGACTGCTCTA	0.642													C|||	4144	0.827476	0.5461	0.9337	5008	,	,		2717	0.8869		0.9573	False		,,,				2504	0.9376				p.S54S													.	.	0			c.A162G						.						23.0	1.0	10.0					9																	70177822		359	613	972	SO:0001819	synonymous_variant	653427	exon1			CTGGAGTGACTGC		CCDS47977.1	9q13	2008-07-21			ENSG00000204779	ENSG00000204779			18522	protein-coding gene	gene with protein product						12234674	Standard	NM_001126334		Approved	bA15J10.2, OTTHUMG00000013332	uc010moc.3	Q5VV16	OTTHUMG00000013332	ENST00000377420.1:c.162A>G	9.37:g.70177822T>C		Somatic	194	1		WXS	Illumina HiSeq	Phase_I	234	6	NM_001126334	0	0	0	0	0		Silent	SNP	ENST00000377420.1	37	CCDS47977.1																																																																																			C|1.000;|0.000		0.642	FOXD4L5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000037122.1	NM_001126334	
PTCHD1	139411	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	23411325	23411325	+	Missense_Mutation	SNP	A	A	G			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chrX:23411325A>G	ENST00000379361.4	+	3	2550	c.1690A>G	c.(1690-1692)Ata>Gta	p.I564V		NM_173495.2	NP_775766.2	Q96NR3	PTHD1_HUMAN	patched domain containing 1	564					cognition (GO:0050890)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(4)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(4)|skin(2)|urinary_tract(2)	42						ATATGAGTCTATAGAATACTG	0.413																																					p.I564V													.	PTCHD1-135	0			c.A1690G						.						94.0	89.0	91.0					X																	23411325		2203	4300	6503	SO:0001583	missense	139411	exon3			GAGTCTATAGAAT	AK054858	CCDS35215.2	Xp22.13	2008-02-05			ENSG00000165186	ENSG00000165186			26392	protein-coding gene	gene with protein product		300828					Standard	NM_173495		Approved	FLJ30296	uc004dal.4	Q96NR3	OTTHUMG00000021251	ENST00000379361.4:c.1690A>G	X.37:g.23411325A>G	ENSP00000368666:p.Ile564Val	Somatic	56	1		WXS	Illumina HiSeq	Phase_I	41	10	NM_173495	0	0	0	0	0	B4DQH0|Q0IJ60|Q6P6B8	Missense_Mutation	SNP	ENST00000379361.4	37	CCDS35215.2	.	.	.	.	.	.	.	.	.	.	A	6.272	0.418245	0.11870	.	.	ENSG00000165186	ENST00000379361	D	0.84800	-1.9	5.69	5.69	0.88448	.	0.106864	0.64402	D	0.000004	T	0.73009	0.3532	N	0.20685	0.6	0.33814	D	0.628248	B	0.17667	0.023	B	0.12837	0.008	T	0.71988	-0.4426	10	0.15066	T	0.55	.	10.9815	0.47497	0.8463:0.1537:0.0:0.0	.	564	Q96NR3	PTHD1_HUMAN	V	564	ENSP00000368666:I564V	ENSP00000368666:I564V	I	+	1	0	PTCHD1	23321246	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.967000	0.76079	1.904000	0.55121	0.486000	0.48141	ATA	.		0.413	PTCHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056047.2	NM_173495	
CTAGE5	4253	broad.mit.edu	37	14	39815176	39815179	+	Frame_Shift_Del	DEL	CTGT	CTGT	-			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	CTGT	CTGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr14:39815176_39815179delCTGT	ENST00000280083.3	+	21	2214_2217	c.1900_1903delCTGT	c.(1900-1905)ctgtctfs	p.LS634fs	CTAGE5_ENST00000557038.1_Frame_Shift_Del_p.LS554fs|CTAGE5_ENST00000341502.5_Frame_Shift_Del_p.LS634fs|RP11-407N17.3_ENST00000603904.1_Frame_Shift_Del_p.LS605fs|RP11-407N17.3_ENST00000553728.1_Frame_Shift_Del_p.LS1169fs|CTAGE5_ENST00000341749.3_Frame_Shift_Del_p.LS622fs|CTAGE5_ENST00000396165.4_Frame_Shift_Del_p.LS605fs|CTAGE5_ENST00000556148.1_Frame_Shift_Del_p.LS559fs|CTAGE5_ENST00000348007.3_Frame_Shift_Del_p.LS591fs|CTAGE5_ENST00000553352.1_Frame_Shift_Del_p.LS605fs|CTAGE5_ENST00000396158.2_Frame_Shift_Del_p.LS639fs			O15320	CTGE5_HUMAN	CTAGE family, member 5	634	Pro-rich.				positive regulation of catalytic activity (GO:0043085)	membrane (GO:0016020)	enzyme activator activity (GO:0008047)		CTAGE5/SIP1(2)	breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0475)		TTCTGGTAGACTGTCTGGACCAGC	0.353																																					p.639_640del													.	CTAGE5-90	0			c.1915_1918del						.																																			SO:0001589	frameshift_variant	4253	exon21			GGTAGACTGTCTG	U94780	CCDS9673.1, CCDS9674.1, CCDS9675.1, CCDS9676.1, CCDS58316.1, CCDS58317.1	14q21.1	2009-09-11	2004-08-24	2004-08-26	ENSG00000150527	ENSG00000150527			7057	protein-coding gene	gene with protein product		602132	"""meningioma expressed antigen 6 (coiled-coil proline-rich)"""	MGEA, MGEA6		9356211, 11149944	Standard	NM_203355		Approved	MEA6, cTAGE-5A, cTAGE-5B, cTAGE-5C, cTAGE-5D, MGEA11	uc001wvi.4	O15320	OTTHUMG00000140258	ENST00000280083.3:c.1900_1903delCTGT	14.37:g.39815176_39815179delCTGT	ENSP00000280083:p.Leu634fs	Somatic	220	0		WXS	Illumina HiSeq	Phase_I	200	11	NM_001247989	0	0	0	0	0	B3KRA6|B4DQS6|D3DSA6|G3XAC5|O00169|Q6MZN2|Q6P2R8|Q86TF6|Q8IX92|Q8IX93	Frame_Shift_Del	DEL	ENST00000280083.3	37	CCDS9674.1																																																																																			.		0.353	CTAGE5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000276771.2	NM_005930	
EZH1	2145	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	40880917	40880920	+	Frame_Shift_Del	DEL	AGTA	AGTA	-			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	AGTA	AGTA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr17:40880917_40880920delAGTA	ENST00000428826.2	-	3	161_164	c.40_43delTACT	c.(40-45)tactggfs	p.YW14fs	EZH1_ENST00000415827.2_Frame_Shift_Del_p.YW14fs|EZH1_ENST00000435174.1_5'UTR|EZH1_ENST00000585893.1_Frame_Shift_Del_p.YW14fs|EZH1_ENST00000590078.1_Intron|EZH1_ENST00000592743.1_Frame_Shift_Del_p.YW14fs			Q92800	EZH1_HUMAN	enhancer of zeste 1 polycomb repressive complex 2 subunit	14					anatomical structure morphogenesis (GO:0009653)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)			breast(1)|endometrium(4)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|skin(1)|urinary_tract(2)	27		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0784)		TTTCTTTTCCAGTAAGTGATACAT	0.373																																					p.14_15del		.											.	EZH1-229	0			c.40_43del						.																																			SO:0001589	frameshift_variant	2145	exon3			.		CCDS32659.1	17q21.1-q21.3	2014-05-28	2014-05-28			ENSG00000108799		"""Chromatin-modifying enzymes / K-methyltransferases"""	3526	protein-coding gene	gene with protein product		601674	"""enhancer of zeste (Drosophila) homolog 1"", ""enhancer of zeste homolog 1 (Drosophila)"""			8921387	Standard	NM_001991		Approved	KIAA0388, KMT6B	uc002iaz.3	Q92800		ENST00000428826.2:c.40_43delTACT	17.37:g.40880917_40880920delAGTA	ENSP00000404658:p.Tyr14fs	Somatic	78	0		WXS	Illumina HiSeq	Phase_I	93	26	NM_001991	0	0	0	0	0	A6NCH6|B4DIJ1|B4DIZ7|B4DSS2|B4E3R7|O43287|Q14459|Q53XP3	Frame_Shift_Del	DEL	ENST00000428826.2	37	CCDS32659.1																																																																																			.		0.373	EZH1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452347.1	NM_001991	
MYPOP	339344	broad.mit.edu	37	19	46394285	46394285	+	Frame_Shift_Del	DEL	G	G	-			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr19:46394285delG	ENST00000322217.5	-	3	882	c.796delC	c.(796-798)cagfs	p.Q267fs		NM_001012643.2	NP_001012661.1	Q86VE0	MYPOP_HUMAN	Myb-related transcription factor, partner of profilin	267	Pro-rich.					nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			large_intestine(2)|lung(1)|skin(1)	4						GTCTCCTGCTGGGCCCGCAGG	0.706																																					p.Q266fs													.	MYPOP-90	0			c.796delC						.						6.0	5.0	6.0					19																	46394285		2129	4163	6292	SO:0001589	frameshift_variant	339344	exon3			CCTGCTGGGCCCG	BC044311	CCDS33055.1	19q13.32	2014-06-13			ENSG00000176182	ENSG00000176182			20178	protein-coding gene	gene with protein product	"""p42 Myb-related transcription factor, partner of profilin"""					15615774	Standard	NM_001012643		Approved	P42pop	uc002pdt.3	Q86VE0	OTTHUMG00000182486	ENST00000322217.5:c.796delC	19.37:g.46394285delG	ENSP00000325402:p.Gln267fs	Somatic	21	0		WXS	Illumina HiSeq	Phase_I	17	7	NM_001012643	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000322217.5	37	CCDS33055.1																																																																																			.		0.706	MYPOP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461684.1	NM_001012643	
RAD51AP2	729475	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	17692220	17692220	+	Frame_Shift_Del	DEL	T	T	-			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr2:17692220delT	ENST00000399080.2	-	3	3354	c.3331delA	c.(3331-3333)agtfs	p.S1111fs		NM_001099218.2	NP_001092688.1	Q09MP3	R51A2_HUMAN	RAD51 associated protein 2	1111	Interaction with RAD51.									endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(10)|liver(1)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					GGAAAGTGACTACCTAAAAAT	0.313																																					p.S1111fs		.											.	RAD51AP2-23	0			c.3331delA						.						82.0	72.0	75.0					2																	17692220		1815	4072	5887	SO:0001589	frameshift_variant	729475	exon3			.	AK310498	CCDS42656.1	2p24.2	2009-01-13			ENSG00000214842	ENSG00000214842			34417	protein-coding gene	gene with protein product						16990250	Standard	NM_001099218		Approved	FLJ17540	uc002rcl.1	Q09MP3	OTTHUMG00000151761	ENST00000399080.2:c.3331delA	2.37:g.17692220delT	ENSP00000382030:p.Ser1111fs	Somatic	87	0		WXS	Illumina HiSeq	Phase_I	105	17	NM_001099218	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000399080.2	37	CCDS42656.1																																																																																			.		0.313	RAD51AP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323801.3	NM_001099218	
MPHOSPH10	10199	broad.mit.edu;bcgsc.ca	37	2	71368372	71368378	+	Frame_Shift_Del	DEL	ATGTAGT	ATGTAGT	-			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	ATGTAGT	ATGTAGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr2:71368372_71368378delATGTAGT	ENST00000244230.2	+	7	1671_1677	c.1319_1325delATGTAGT	c.(1318-1326)gatgtagtafs	p.DVV440fs		NM_005791.2	NP_005782.1	O00566	MPP10_HUMAN	M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein)	440					negative regulation of phosphatase activity (GO:0010923)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|rRNA processing (GO:0006364)	chromosome (GO:0005694)|nucleolus (GO:0005730)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|pancreas(2)|skin(2)|stomach(1)	26						GCTTGGGATGATGTAGTACGTAAAGAA	0.324																																					p.440_442del													.	MPHOSPH10-93	0			c.1319_1325del						.																																			SO:0001589	frameshift_variant	10199	exon7			GGGATGATGTAGT	X98494	CCDS1916.1	2p13.3	2014-06-12			ENSG00000124383	ENSG00000124383			7213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 106"""	605503				8885239, 9450966	Standard	NM_005791		Approved	MPP10, MPP10P, CT90, PPP1R106	uc002sht.2	O00566	OTTHUMG00000129715	ENST00000244230.2:c.1319_1325delATGTAGT	2.37:g.71368372_71368378delATGTAGT	ENSP00000244230:p.Asp440fs	Somatic	187	0		WXS	Illumina HiSeq	Phase_I	155	16	NM_005791	0	0	0	0	0	A0AVJ8	Frame_Shift_Del	DEL	ENST00000244230.2	37	CCDS1916.1																																																																																			.		0.324	MPHOSPH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251924.2	NM_005791	
TRMT10C	54931	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	101284160	101284160	+	Frame_Shift_Del	DEL	T	T	-			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr3:101284160delT	ENST00000309922.6	+	2	689	c.535delT	c.(535-537)tttfs	p.F179fs		NM_017819.2	NP_060289.2	Q7L0Y3	MRRP1_HUMAN	tRNA methyltransferase 10 homolog C (S. cerevisiae)	179					mitochondrial RNA 5'-end processing (GO:0000964)|tRNA processing (GO:0008033)	mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	methyltransferase activity (GO:0008168)|poly(A) RNA binding (GO:0044822)										AAACTTTCTATTTTTACGACT	0.408																																					p.F179fs		.											.	.	0			c.535delT						.						84.0	80.0	81.0					3																	101284160		1827	4080	5907	SO:0001589	frameshift_variant	54931	exon2			.	AK000439	CCDS43122.1	3q12.3	2012-06-28	2012-06-28	2012-06-28	ENSG00000174173	ENSG00000174173			26022	protein-coding gene	gene with protein product	"""mitochondrial RNase P subunit 1"""	615423	"""RNA (guanine-9-) methyltransferase domain containing 1"""	RG9MTD1		18984158	Standard	NM_017819		Approved	FLJ20432, MRPP1	uc003duz.4	Q7L0Y3	OTTHUMG00000159114	ENST00000309922.6:c.535delT	3.37:g.101284160delT	ENSP00000312356:p.Phe179fs	Somatic	30	0		WXS	Illumina HiSeq	Phase_I	46	18	NM_017819	0	0	0	0	0	Q9NRG5|Q9NX54|Q9Y596	Frame_Shift_Del	DEL	ENST00000309922.6	37	CCDS43122.1																																																																																			.		0.408	TRMT10C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353400.2	NM_017819	
VCAN	1462	broad.mit.edu	37	5	82836607	82836608	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chr5:82836607_82836608delAG	ENST00000265077.3	+	8	8350_8351	c.7785_7786delAG	c.(7783-7788)acagatfs	p.D2596fs	VCAN_ENST00000343200.5_Frame_Shift_Del_p.D1609fs|VCAN-AS1_ENST00000513899.1_RNA|VCAN_ENST00000502527.2_Intron|VCAN_ENST00000342785.4_Intron|VCAN_ENST00000512590.2_Intron|VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000513016.1_3'UTR	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	2596	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	GAATGCAAACAGATATAGATAC	0.376																																					p.2595_2596del													.	VCAN-238	0			c.7785_7786del						.																																			SO:0001589	frameshift_variant	1462	exon8			GCAAACAGATATA	X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.7785_7786delAG	5.37:g.82836607_82836608delAG	ENSP00000265077:p.Asp2596fs	Somatic	146	0		WXS	Illumina HiSeq	Phase_I	139	8	NM_004385	0	0	0	0	0	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Frame_Shift_Del	DEL	ENST00000265077.3	37	CCDS4060.1																																																																																			.		0.376	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
PLS3	5358	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	114880464	114880465	+	Frame_Shift_Ins	INS	-	-	A			TCGA-MH-A562-01A-11D-A26P-10	TCGA-MH-A562-10A-01D-A26P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dddea2e4-b8c3-4157-9d92-6de472e8375a	bd8aec5f-0589-436d-9c8e-eaf4e60046e2	g.chrX:114880464_114880465insA	ENST00000420625.2	+	12	1469_1470	c.1335_1336insA	c.(1336-1338)aatfs	p.N446fs	PLS3_ENST00000289290.3_Frame_Shift_Ins_p.N410fs|PLS3_ENST00000537301.1_Frame_Shift_Ins_p.N433fs|PLS3_ENST00000355899.3_Frame_Shift_Ins_p.N446fs|PLS3_ENST00000539310.1_Frame_Shift_Ins_p.N401fs|PLS3_ENST00000543070.1_Frame_Shift_Ins_p.N40fs	NM_001136025.3|NM_001172335.1|NM_001282338.1	NP_001129497.1|NP_001165806.1|NP_001269267.1	P13797	PLST_HUMAN	plastin 3	446	Actin-binding 2.|CH 3. {ECO:0000255|PROSITE- ProRule:PRU00044}.				bone development (GO:0060348)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|endometrium(2)|kidney(4)|large_intestine(3)|lung(11)	26						GGAGTAAGGTTAATAAACCTCC	0.322																																					p.V445fs	Colon(160;1047 1864 8490 12969 29601)	.											.	PLS3-193	0			c.1335_1336insA						.																																			SO:0001589	frameshift_variant	5358	exon12			.	L05491	CCDS14568.1, CCDS65312.1	Xq23	2013-01-10	2010-02-10		ENSG00000102024	ENSG00000102024		"""EF-hand domain containing"""	9091	protein-coding gene	gene with protein product		300131	"""plastin 3 (T isoform)"""			8428952	Standard	NM_005032		Approved	T-plastin	uc004eqe.3	P13797	OTTHUMG00000022237	ENST00000420625.2:c.1337dupA	X.37:g.114880466_114880466dupA	ENSP00000398945:p.Asn446fs	Somatic	140	0		WXS	Illumina HiSeq	Phase_I	141	92	NM_005032	0	0	0	0	0	A8K579|B1AQ09|B4DGB4|B7Z6M1|Q86YI6	Frame_Shift_Ins	INS	ENST00000420625.2	37	CCDS14568.1																																																																																			.		0.322	PLS3-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057976.2		
