#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ADCK1	57143	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	78365584	78365584	+	Missense_Mutation	SNP	C	C	G			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0198f3c3-78f2-4c19-90d5-c77b74044ca2	30e43131-d7aa-407d-9bed-28ae34db1b68	g.chr14:78365584C>G	ENST00000238561.5	+	6	823	c.724C>G	c.(724-726)Cat>Gat	p.H242D	ADCK1_ENST00000341211.5_Missense_Mutation_p.H174D	NM_020421.3	NP_065154.2	Q86TW2	ADCK1_HUMAN	aarF domain containing kinase 1	249	Protein kinase.					extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.H174D(1)|p.H242D(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(2)|skin(2)|stomach(2)	25			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0376)		GATGCTCAGGCATTTTGACTT	0.512																																																	2	Substitution - Missense(2)	kidney(2)											153.0	134.0	140.0					14																	78365584		2203	4300	6503	SO:0001583	missense	57143			AK096919	CCDS9869.1, CCDS45144.1	14q24	2005-10-30							19038	protein-coding gene	gene with protein product						12471243	Standard	NM_020421		Approved	FLJ39600	uc001xui.3	Q86TW2		ENST00000238561.5:c.724C>G	14.37:g.78365584C>G	ENSP00000238561:p.His242Asp	Somatic		WXS	Illumina HiSeq	Phase_I	B3KUD5|Q6PD65|Q9UIE6	Missense_Mutation	SNP	ENST00000238561.5	37	CCDS9869.1	.	.	.	.	.	.	.	.	.	.	C	9.868	1.198270	0.22037	.	.	ENSG00000063761	ENST00000238561;ENST00000557501;ENST00000341211	T;T;T	0.52057	0.68;0.68;0.68	5.61	4.69	0.59074	.	0.299800	0.41396	D	0.000881	T	0.24275	0.0588	N	0.04063	-0.285	0.37033	D	0.896761	B;B	0.14012	0.009;0.004	B;B	0.21360	0.034;0.013	T	0.15867	-1.0422	10	0.08381	T	0.77	-4.7631	13.9936	0.64382	0.3347:0.6653:0.0:0.0	.	174;242	Q9UIE6;Q86TW2-2	.;.	D	242;242;174	ENSP00000238561:H242D;ENSP00000451549:H242D;ENSP00000339663:H174D	ENSP00000238561:H242D	H	+	1	0	ADCK1	77435337	0.930000	0.31532	1.000000	0.80357	0.937000	0.57800	1.541000	0.36126	2.641000	0.89580	0.591000	0.81541	CAT		0.512	ADCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413864.1		NM_020421	
AGAP6	414189	hgsc.bcm.edu	37	10	51768675	51768676	+	Frame_Shift_Del	DEL	AA	AA	-	rs141217862|rs200646112	byFrequency	TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10	AA	AA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0198f3c3-78f2-4c19-90d5-c77b74044ca2	30e43131-d7aa-407d-9bed-28ae34db1b68	g.chr10:51768675_51768676delAA	ENST00000374056.4	+	7	1119_1120	c.721_722delAA	c.(721-723)aaafs	p.K241fs	AGAP6_ENST00000412531.3_Frame_Shift_Del_p.K264fs			Q5VW22	AGAP6_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 6	241					regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|liver(1)|lung(8)|prostate(3)|skin(1)|stomach(2)	29						TGACCCAGACAAAGAGAGGAAA	0.55														591	0.118011	0.0356	0.1542	5008	,	,		18267	0.0327		0.2694	False		,,,				2504	0.136																0																																										SO:0001589	frameshift_variant	414189				CCDS44397.1	10q11.23	2013-01-10	2008-09-22	2008-09-22	ENSG00000204149	ENSG00000204149		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	23466	protein-coding gene	gene with protein product			"""centaurin, gamma-like family, member 3"""	CTGLF3			Standard	NM_001077665		Approved	bA324H6.1	uc001jix.4	Q5VW22	OTTHUMG00000018220	ENST00000374056.4:c.721_722delAA	10.37:g.51768675_51768676delAA	ENSP00000363168:p.Lys241fs	Somatic		WXS	Illumina HiSeq	Phase_I		Frame_Shift_Del	DEL	ENST00000374056.4	37																																																																																					0.550	AGAP6-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding			NM_001077665	
BTG4	54766	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	111368759	111368759	+	Missense_Mutation	SNP	A	A	G			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0198f3c3-78f2-4c19-90d5-c77b74044ca2	30e43131-d7aa-407d-9bed-28ae34db1b68	g.chr11:111368759A>G	ENST00000356018.2	-	3	474	c.275T>C	c.(274-276)aTg>aCg	p.M92T	BTG4_ENST00000525791.1_Missense_Mutation_p.M92T	NM_017589.3	NP_060059.1	Q9NY30	BTG4_HUMAN	B-cell translocation gene 4	92					cell cycle arrest (GO:0007050)|negative regulation of cell proliferation (GO:0008285)|negative regulation of mitotic cell cycle (GO:0045930)|neuron differentiation (GO:0030182)			p.M92T(1)		large_intestine(2)|upper_aerodigestive_tract(1)	3		all_cancers(61;3.78e-13)|all_epithelial(67;5.29e-08)|Melanoma(852;3.15e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0204)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;1.22e-06)|BRCA - Breast invasive adenocarcinoma(274;1.72e-06)|all cancers(92;2.18e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0509)		CCATATGGTCATCTCCTTCGG	0.398																																																	1	Substitution - Missense(1)	kidney(1)											191.0	160.0	170.0					11																	111368759		2201	4297	6498	SO:0001583	missense	54766			AJ271351	CCDS8346.1	11q23	2008-05-27				ENSG00000137707			13862	protein-coding gene	gene with protein product		605673				10995567	Standard	NM_017589		Approved	PC3B	uc001plj.3	Q9NY30		ENST00000356018.2:c.275T>C	11.37:g.111368759A>G	ENSP00000348300:p.Met92Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q8NEH7	Missense_Mutation	SNP	ENST00000356018.2	37	CCDS8346.1	.	.	.	.	.	.	.	.	.	.	A	18.81	3.702616	0.68501	.	.	ENSG00000137707	ENST00000356018;ENST00000525791;ENST00000456861	.	.	.	5.2	5.2	0.72013	Anti-proliferative protein (4);	0.038999	0.85682	D	0.000000	T	0.72003	0.3407	M	0.78049	2.395	0.80722	D	1	B;P	0.48350	0.14;0.909	B;P	0.50537	0.351;0.643	T	0.76661	-0.2877	9	0.62326	D	0.03	.	14.7504	0.69522	1.0:0.0:0.0:0.0	.	92;92	Q8NEH7;Q9NY30	.;BTG4_HUMAN	T	92	.	ENSP00000348300:M92T	M	-	2	0	BTG4	110873969	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.971000	0.88012	1.977000	0.57605	0.533000	0.62120	ATG		0.398	BTG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391177.1			
BTNL8	79908	broad.mit.edu;hgsc.bcm.edu	37	5	180377117	180377117	+	Missense_Mutation	SNP	G	G	A			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0198f3c3-78f2-4c19-90d5-c77b74044ca2	30e43131-d7aa-407d-9bed-28ae34db1b68	g.chr5:180377117G>A	ENST00000340184.4	+	8	1282	c.1076G>A	c.(1075-1077)cGg>cAg	p.R359Q	BTNL8_ENST00000508408.1_3'UTR|BTNL8_ENST00000533815.2_Missense_Mutation_p.R175Q|BTNL8_ENST00000511704.1_Missense_Mutation_p.R243Q|BTNL8_ENST00000400707.3_Missense_Mutation_p.R234Q|BTNL8_ENST00000505126.1_Missense_Mutation_p.R152Q|BTNL8_ENST00000231229.4_3'UTR	NM_001040462.2	NP_001035552.1	Q6UX41	BTNL8_HUMAN	butyrophilin-like 8	359	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				immune system process (GO:0002376)	integral component of membrane (GO:0016021)		p.R359Q(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(12)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	28	all_cancers(89;3.37e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.0801)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGAGTGTGCCGGGATGATGTG	0.498																																																	1	Substitution - Missense(1)	kidney(1)											148.0	146.0	147.0					5																	180377117		2123	3926	6049	SO:0001583	missense	79908			AK025111	CCDS4459.1, CCDS43413.1, CCDS54956.1, CCDS54957.1, CCDS54958.1, CCDS54959.1	5q35.3	2014-01-14			ENSG00000113303	ENSG00000113303		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	26131	protein-coding gene	gene with protein product		615606				12975309	Standard	NM_024850		Approved	FLJ21458, BTN9.2	uc003mmp.3	Q6UX41	OTTHUMG00000130932	ENST00000340184.4:c.1076G>A	5.37:g.180377117G>A	ENSP00000342197:p.Arg359Gln	Somatic		WXS	Illumina HiSeq	Phase_I	A4QMZ8|A6NEX6|B7Z409|B7Z5B1|E9PEF6|E9PG07|F2Z2B2|F8W712|Q9H730	Missense_Mutation	SNP	ENST00000340184.4	37	CCDS43413.1	.	.	.	.	.	.	.	.	.	.	G	8.888	0.953311	0.18431	.	.	ENSG00000113303	ENST00000340184;ENST00000400707;ENST00000511704;ENST00000505126;ENST00000533815	T;T;T;T;T	0.70399	-0.48;-0.48;-0.48;-0.48;-0.48	1.89	0.913	0.19354	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	.	.	.	.	T	0.62011	0.2393	L	0.37800	1.135	0.09310	N	1	P;D;B	0.57257	0.896;0.979;0.253	B;P;B	0.51582	0.16;0.674;0.041	T	0.50508	-0.8820	9	0.31617	T	0.26	.	2.4348	0.04480	0.1838:0.0:0.5198:0.2963	.	234;243;359	E9PG07;E9PEF6;Q6UX41	.;.;BTNL8_HUMAN	Q	359;234;243;152;175	ENSP00000342197:R359Q;ENSP00000383543:R234Q;ENSP00000425207:R243Q;ENSP00000427441:R152Q;ENSP00000435098:R175Q	ENSP00000342197:R359Q	R	+	2	0	BTNL8	180309723	0.013000	0.17824	0.151000	0.22473	0.260000	0.26232	0.475000	0.22164	0.111000	0.17947	0.430000	0.28490	CGG		0.498	BTNL8-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000368440.1		NM_024850	
TMEM234	56063	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	32682463	32682463	+	Intron	SNP	A	A	T			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0198f3c3-78f2-4c19-90d5-c77b74044ca2	30e43131-d7aa-407d-9bed-28ae34db1b68	g.chr1:32682463A>T	ENST00000344461.3	-	5	403				TMEM234_ENST00000485689.1_5'UTR|TMEM234_ENST00000309777.6_Silent_p.S138S|TMEM234_ENST00000545122.1_Intron|TMEM234_ENST00000373593.1_3'UTR			Q8WY98	TM234_HUMAN	transmembrane protein 234							integral component of membrane (GO:0016021)		p.S138S(1)		kidney(2)|lung(3)	5						CTCAAAGGGTAGACTGTTGCC	0.572																																																	1	Substitution - coding silent(1)	kidney(1)											83.0	73.0	77.0					1																	32682463		2203	4300	6503	SO:0001627	intron_variant	0			AY358586	CCDS356.2	1p36.11-p34.2	2011-02-14	2011-02-14	2011-02-14	ENSG00000160055	ENSG00000160055			28837	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 91"""	C1orf91		12477932	Standard	XM_005271045		Approved	RP4-622L5, dJ622L5.7, FLJ90779	uc001buq.4	Q8WY98	OTTHUMG00000005742	ENST00000344461.3:c.387+26T>A	1.37:g.32682463A>T		Somatic		WXS	Illumina HiSeq	Phase_I	B2R535|D3DPP7|Q6UWY9|Q8N2H6|Q9BSR2|Q9NU76	Silent	SNP	ENST00000344461.3	37																																																																																					0.572	TMEM234-009	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000092260.2		NM_019118	
DRC1	92749	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	26647271	26647271	+	Missense_Mutation	SNP	C	C	A			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0198f3c3-78f2-4c19-90d5-c77b74044ca2	30e43131-d7aa-407d-9bed-28ae34db1b68	g.chr2:26647271C>A	ENST00000288710.2	+	4	563	c.489C>A	c.(487-489)caC>caA	p.H163Q		NM_145038.2	NP_659475.2	Q96MC2	DRC1_HUMAN	dynein regulatory complex subunit 1	163					axonemal dynein complex assembly (GO:0070286)|bacterial-type flagellum-dependent cell motility (GO:0071973)|cilium-dependent cell motility (GO:0060285)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)		p.H163Q(1)									AACAGCTGCACTGTGCTGGAC	0.527																																																	1	Substitution - Missense(1)	kidney(1)											82.0	78.0	79.0					2																	26647271		2203	4300	6503	SO:0001583	missense	0			AL833892	CCDS1723.1	2p23.3	2014-07-18	2014-07-18	2013-03-14	ENSG00000157856	ENSG00000157856			24245	protein-coding gene	gene with protein product		615288	"""chromosome 2 open reading frame 39"", ""coiled-coil domain containing 164"", ""dynein regulatory complex subunit 1 homolog (Chlamydomonas)"""	C2orf39, CCDC164		23354437	Standard	NM_145038		Approved	MGC16372, FLJ32660, CILD21	uc002rhg.2	Q96MC2	OTTHUMG00000125531	ENST00000288710.2:c.489C>A	2.37:g.26647271C>A	ENSP00000288710:p.His163Gln	Somatic		WXS	Illumina HiSeq	Phase_I	A8K1N8|Q53R91|Q53TA3|Q8NDI5	Missense_Mutation	SNP	ENST00000288710.2	37	CCDS1723.1	.	.	.	.	.	.	.	.	.	.	C	7.228	0.598773	0.13939	.	.	ENSG00000157856	ENST00000288710	T	0.12984	2.63	5.43	-0.371	0.12525	.	0.365309	0.30392	N	0.009723	T	0.04003	0.0112	N	0.03177	-0.4	0.28781	N	0.899854	B	0.21753	0.06	B	0.26416	0.069	T	0.37126	-0.9719	10	0.12766	T	0.61	-25.9027	3.0159	0.06059	0.1223:0.4692:0.2403:0.1682	.	163	Q96MC2	CC164_HUMAN	Q	163	ENSP00000288710:H163Q	ENSP00000288710:H163Q	H	+	3	2	CCDC164	26500775	0.264000	0.24093	1.000000	0.80357	0.639000	0.38242	-0.727000	0.04931	0.244000	0.21351	-0.126000	0.14955	CAC		0.527	DRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246862.1		NM_145038	
CYB5R1	51706	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	202932810	202932810	+	Missense_Mutation	SNP	G	G	C			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0198f3c3-78f2-4c19-90d5-c77b74044ca2	30e43131-d7aa-407d-9bed-28ae34db1b68	g.chr1:202932810G>C	ENST00000367249.4	-	7	679	c.605C>G	c.(604-606)cCt>cGt	p.P202R	CYB5R1_ENST00000497655.1_5'UTR	NM_016243.2	NP_057327.2	Q9UHQ9	NB5R1_HUMAN	cytochrome b5 reductase 1	202					sterol biosynthetic process (GO:0016126)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)	p.P202R(1)		breast(1)|kidney(2)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	12			BRCA - Breast invasive adenocarcinoma(75;0.141)		Flavin adenine dinucleotide(DB03147)	TGGATCTTCAGGGACTTTCAG	0.512																																																	1	Substitution - Missense(1)	kidney(1)											126.0	103.0	111.0					1																	202932810		2203	4300	6503	SO:0001583	missense	51706			AF169481	CCDS1431.1	1q32.1	2011-04-08		2005-07-13	ENSG00000159348	ENSG00000159348	1.6.2.2		13397	protein-coding gene	gene with protein product		608341	"""NAD(P)H:quinone oxidoreductase type 3, polypeptide A2"""	NQO3A2		12975309, 10611283	Standard	NM_016243		Approved	humb5R2	uc001gyt.2	Q9UHQ9	OTTHUMG00000041387	ENST00000367249.4:c.605C>G	1.37:g.202932810G>C	ENSP00000356218:p.Pro202Arg	Somatic		WXS	Illumina HiSeq	Phase_I	A0PK21|B2R8E0|O95329|Q53F73|Q8NCL5|Q9UHJ1	Missense_Mutation	SNP	ENST00000367249.4	37	CCDS1431.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.41|19.41	3.822582|3.822582	0.71028|0.71028	.|.	.|.	ENSG00000159348|ENSG00000159348	ENST00000446185|ENST00000367249	.|D	.|0.94758	.|-3.51	5.93|5.93	3.95|3.95	0.45737|0.45737	.|Oxidoreductase FAD/NAD(P)-binding (1);	.|0.074673	.|0.52532	.|N	.|0.000072	D|D	0.96222|0.96222	0.8768|0.8768	M|M	0.79926|0.79926	2.475|2.475	0.52501|0.52501	D|D	0.999958|0.999958	.|D	.|0.58620	.|0.983	.|P	.|0.61658	.|0.892	D|D	0.96087|0.96087	0.9058|0.9058	5|10	.|0.87932	.|D	.|0	-2.4753|-2.4753	9.9037|9.9037	0.41364|0.41364	0.0:0.2805:0.5748:0.1447|0.0:0.2805:0.5748:0.1447	.|.	.|202	.|Q9UHQ9	.|NB5R1_HUMAN	V|R	134|202	.|ENSP00000356218:P202R	.|ENSP00000356218:P202R	L|P	-|-	1|2	2|0	CYB5R1|CYB5R1	201199433|201199433	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.972000|0.972000	0.66771|0.66771	2.937000|2.937000	0.48979|0.48979	1.461000|1.461000	0.47929|0.47929	0.655000|0.655000	0.94253|0.94253	CTG|CCT		0.512	CYB5R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099155.1		NM_016243	
ELL2	22936	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	95242241	95242241	+	Missense_Mutation	SNP	C	C	A	rs368751191		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0198f3c3-78f2-4c19-90d5-c77b74044ca2	30e43131-d7aa-407d-9bed-28ae34db1b68	g.chr5:95242241C>A	ENST00000237853.4	-	5	1076	c.727G>T	c.(727-729)Gca>Tca	p.A243S	ELL2_ENST00000506628.1_5'UTR|ELL2_ENST00000431061.2_Intron	NM_012081.5	NP_036213.2	O00472	ELL2_HUMAN	elongation factor, RNA polymerase II, 2	243					regulation of transcription, DNA-templated (GO:0006355)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|transcription elongation from RNA polymerase II promoter (GO:0006368)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)		p.A243S(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|pancreas(1)|prostate(2)	24		all_cancers(142;2.04e-06)|all_epithelial(76;3.1e-09)|all_lung(232;0.00309)|Lung NSC(167;0.00454)|Ovarian(225;0.0165)|Colorectal(57;0.0343)|Breast(839;0.198)		all cancers(79;2.16e-15)		TGCAGAATTGCTCCCAGGGAG	0.428																																																	1	Substitution - Missense(1)	kidney(1)											93.0	100.0	98.0					5																	95242241		2203	4299	6502	SO:0001583	missense	22936			U88629	CCDS4080.1	5q15	2010-11-29			ENSG00000118985	ENSG00000118985			17064	protein-coding gene	gene with protein product		601874				9108030	Standard	NM_012081		Approved		uc003klr.4	O00472	OTTHUMG00000122085	ENST00000237853.4:c.727G>T	5.37:g.95242241C>A	ENSP00000237853:p.Ala243Ser	Somatic		WXS	Illumina HiSeq	Phase_I	B4DNK7	Missense_Mutation	SNP	ENST00000237853.4	37	CCDS4080.1	.	.	.	.	.	.	.	.	.	.	C	6.870	0.529910	0.13127	.	.	ENSG00000118985	ENST00000237853	T	0.28454	1.61	6.08	4.32	0.51571	.	0.315773	0.38720	N	0.001595	T	0.08044	0.0201	N	0.00368	-1.59	0.80722	D	1	B	0.16603	0.018	B	0.18263	0.021	T	0.30268	-0.9984	10	0.05721	T	0.95	-0.1821	14.1015	0.65059	0.0:0.9078:0.0:0.0922	.	243	O00472	ELL2_HUMAN	S	243	ENSP00000237853:A243S	ENSP00000237853:A243S	A	-	1	0	ELL2	95267997	0.997000	0.39634	1.000000	0.80357	0.995000	0.86356	2.281000	0.43452	0.911000	0.36747	0.591000	0.81541	GCA		0.428	ELL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242846.1		NM_012081	
FRMPD2	143162	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	49420118	49420118	+	Missense_Mutation	SNP	T	T	A	rs527289137		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0198f3c3-78f2-4c19-90d5-c77b74044ca2	30e43131-d7aa-407d-9bed-28ae34db1b68	g.chr10:49420118T>A	ENST00000374201.3	-	13	1792	c.1490A>T	c.(1489-1491)gAt>gTt	p.D497V	FRMPD2_ENST00000305531.3_Missense_Mutation_p.D472V|FRMPD2_ENST00000407470.4_Missense_Mutation_p.D465V	NM_001018071.3|NM_001042512.2	NP_001018081|NP_001035977.2	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2	497	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				tight junction assembly (GO:0070830)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)	1-phosphatidylinositol binding (GO:0005545)	p.D497V(1)		NS(2)|autonomic_ganglia(2)|breast(5)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(15)|lung(24)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	66				Kidney(211;0.201)		TGGGATGTAATCTTCAACGTG	0.542																																																	1	Substitution - Missense(1)	kidney(1)											116.0	93.0	101.0					10																	49420118		2203	4300	6503	SO:0001583	missense	143162			AK123038	CCDS31195.1	10q11	2010-10-13			ENSG00000170324	ENSG00000170324			28572	protein-coding gene	gene with protein product		613323	"""PDZ domain containing 5C"""	PDZD5C, PDZK5C			Standard	NM_001018071		Approved	MGC35285	uc001jdv.3	Q68DX3	OTTHUMG00000018171	ENST00000374201.3:c.1490A>T	10.37:g.49420118T>A	ENSP00000363317:p.Asp497Val	Somatic		WXS	Illumina HiSeq	Phase_I	B7WNW0|B7ZML5|Q2VY07|Q6GMQ9|Q6ZN38|Q6ZWI2|Q8N5T9	Missense_Mutation	SNP	ENST00000374201.3	37	CCDS31195.1	.	.	.	.	.	.	.	.	.	.	T	17.41	3.382061	0.61845	.	.	ENSG00000170324	ENST00000374201;ENST00000305531;ENST00000407470	T;T;T	0.30182	1.54;1.54;1.54	5.28	2.97	0.34412	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	.	.	.	.	T	0.41282	0.1152	L	0.45285	1.41	0.46222	D	0.998935	D;D;D	0.67145	0.996;0.979;0.996	D;P;D	0.70016	0.967;0.821;0.955	T	0.10268	-1.0637	9	0.48119	T	0.1	.	7.592	0.28027	0.0:0.1673:0.0:0.8327	.	472;497;465	Q68DX3-2;Q68DX3;F8WCT2	.;FRPD2_HUMAN;.	V	497;472;465	ENSP00000363317:D497V;ENSP00000307079:D472V;ENSP00000384339:D465V	ENSP00000307079:D472V	D	-	2	0	FRMPD2	49090124	1.000000	0.71417	0.988000	0.46212	0.795000	0.44927	2.933000	0.48948	0.351000	0.24027	0.459000	0.35465	GAT		0.542	FRMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047923.3		NM_152428	
HAUS4	54930	hgsc.bcm.edu;ucsc.edu	37	14	23421803	23421806	+	Frame_Shift_Del	DEL	GTGA	GTGA	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10	GTGA	GTGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0198f3c3-78f2-4c19-90d5-c77b74044ca2	30e43131-d7aa-407d-9bed-28ae34db1b68	g.chr14:23421803_23421806delGTGA	ENST00000206474.7	-	3	394_397	c.142_145delTCAC	c.(142-147)tcacagfs	p.SQ48fs	HAUS4_ENST00000342454.8_Frame_Shift_Del_p.SQ48fs|RP11-298I3.1_ENST00000548322.1_RNA|HAUS4_ENST00000554446.1_5'UTR|HAUS4_ENST00000541587.1_Frame_Shift_Del_p.SQ48fs|HAUS4_ENST00000490506.1_Intron|HAUS4_ENST00000397409.4_Frame_Shift_Del_p.SQ48fs|RP11-298I3.1_ENST00000548819.1_RNA|HAUS4_ENST00000555367.1_Frame_Shift_Del_p.SQ48fs|RP11-298I3.5_ENST00000555074.1_Intron|HAUS4_ENST00000347758.2_Frame_Shift_Del_p.SQ48fs|HAUS4_ENST00000555986.1_Frame_Shift_Del_p.SQ48fs			Q9H6D7	HAUS4_HUMAN	HAUS augmin-like complex, subunit 4	48					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)				breast(3)|cervix(1)|endometrium(2)|lung(6)|ovary(1)|skin(1)	14						TCCACATGCTGTGAGAGATTCAGG	0.471																																																	0																																										SO:0001589	frameshift_variant	54930			AK000431	CCDS9580.1, CCDS53886.1	14q11.1	2011-10-24	2009-04-20	2009-04-20	ENSG00000092036	ENSG00000092036		"""HAUS augmin-like complex subunits"""	20163	protein-coding gene	gene with protein product		613431	"""chromosome 14 open reading frame 94"""	C14orf94		19427217	Standard	NM_017815		Approved	FLJ20424	uc001wht.3	Q9H6D7	OTTHUMG00000028710	ENST00000206474.7:c.142_145delTCAC	14.37:g.23421803_23421806delGTGA	ENSP00000206474:p.Ser48fs	Somatic		WXS	Illumina HiSeq	Phase_I	B7WP17|D3DS34|Q86T15|Q86T16|Q86U43|Q9NX59	Frame_Shift_Del	DEL	ENST00000206474.7	37	CCDS9580.1																																																																																				0.471	HAUS4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071680.3			
HEATR1	55127	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	236740185	236740185	+	Missense_Mutation	SNP	C	C	A			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0198f3c3-78f2-4c19-90d5-c77b74044ca2	30e43131-d7aa-407d-9bed-28ae34db1b68	g.chr1:236740185C>A	ENST00000366582.3	-	21	2934	c.2820G>T	c.(2818-2820)caG>caT	p.Q940H	HEATR1_ENST00000366581.2_Missense_Mutation_p.Q940H	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	940					rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)	p.Q940H(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			CCTGGAGACACTGAATGGCAG	0.403																																																	1	Substitution - Missense(1)	kidney(1)											81.0	86.0	84.0					1																	236740185		2203	4300	6503	SO:0001583	missense	55127			BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.2820G>T	1.37:g.236740185C>A	ENSP00000355541:p.Gln940His	Somatic		WXS	Illumina HiSeq	Phase_I	Q5T3Q8|Q6P197|Q9NW23	Missense_Mutation	SNP	ENST00000366582.3	37	CCDS31066.1	.	.	.	.	.	.	.	.	.	.	C	1.633	-0.518490	0.04171	.	.	ENSG00000119285	ENST00000366582;ENST00000366581	T;T	0.66460	-0.21;-0.21	5.36	-10.7	0.00240	Armadillo-like helical (1);Armadillo-type fold (2);	0.928471	0.09175	N	0.838270	T	0.34658	0.0905	N	0.04880	-0.145	0.41873	D	0.990286	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.09037	-1.0693	10	0.14656	T	0.56	.	11.2315	0.48914	0.2822:0.0935:0.5702:0.0541	.	940;940	Q5T3Q7;Q9H583	.;HEAT1_HUMAN	H	940	ENSP00000355541:Q940H;ENSP00000355540:Q940H	ENSP00000355540:Q940H	Q	-	3	2	HEATR1	234806808	0.000000	0.05858	0.000000	0.03702	0.515000	0.34225	-1.766000	0.01797	-2.755000	0.00372	-0.368000	0.07277	CAG		0.403	HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096635.1		XM_375853	
HERC2	8924	broad.mit.edu;hgsc.bcm.edu	37	15	28515959	28515959	+	Missense_Mutation	SNP	G	G	A			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	0198f3c3-78f2-4c19-90d5-c77b74044ca2	30e43131-d7aa-407d-9bed-28ae34db1b68	g.chr15:28515959G>A	ENST00000261609.7	-	10	1247	c.1139C>T	c.(1138-1140)cCa>cTa	p.P380L		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2									p.P380L(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		GTTGTCTTGTGGAAGGGTGAG	0.493																																																	1	Substitution - Missense(1)	kidney(1)											69.0	52.0	58.0					15																	28515959		2203	4300	6503	SO:0001583	missense	8924			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.1139C>T	15.37:g.28515959G>A	ENSP00000261609:p.Pro380Leu	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000261609.7	37	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	G	35	5.573379	0.96553	.	.	ENSG00000128731	ENST00000261609	T	0.80738	-1.41	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	D	0.89993	0.6876	M	0.73962	2.25	0.80722	D	1	D	0.71674	0.998	D	0.76071	0.987	D	0.90218	0.4269	10	0.72032	D	0.01	.	19.918	0.97070	0.0:0.0:1.0:0.0	.	380	O95714	HERC2_HUMAN	L	380	ENSP00000261609:P380L	ENSP00000261609:P380L	P	-	2	0	HERC2	26189554	1.000000	0.71417	0.853000	0.33588	0.924000	0.55760	9.852000	0.99516	2.706000	0.92434	0.650000	0.86243	CCA		0.493	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2		NM_004667	
IPP	3652	hgsc.bcm.edu	37	1	46211923	46211924	+	Frame_Shift_Ins	INS	-	-	C	rs201163825		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0198f3c3-78f2-4c19-90d5-c77b74044ca2	30e43131-d7aa-407d-9bed-28ae34db1b68	g.chr1:46211923_46211924insC	ENST00000396478.3	-	2	262_263	c.160_161insG	c.(160-162)gttfs	p.V54fs		NM_005897.2	NP_005888.1	Q9Y573	IPP_HUMAN	intracisternal A particle-promoted polypeptide	54	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.					actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	actin binding (GO:0003779)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(5)|ovary(1)|stomach(2)	20	Acute lymphoblastic leukemia(166;0.155)					GGCAGCCAAAACCAGCCGATGA	0.441																																																	0																																										SO:0001589	frameshift_variant	3652			BC032544	CCDS30702.1, CCDS44132.1	1p34-p32	2013-01-30			ENSG00000197429	ENSG00000197429		"""Kelch-like"", ""BTB/POZ domain containing"""	6108	protein-coding gene	gene with protein product	"""kelch-like family member 27"""	147485				1905535, 8432546	Standard	NM_005897		Approved	KLHL27	uc001cou.3	Q9Y573	OTTHUMG00000008004	ENST00000396478.3:c.161dupG	1.37:g.46211925_46211925dupC	ENSP00000379739:p.Val54fs	Somatic		WXS	Illumina HiSeq	Phase_I	A2A6V4|D3DQ11|Q8N5C3	Frame_Shift_Ins	INS	ENST00000396478.3	37	CCDS30702.1																																																																																				0.441	IPP-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021974.3		NM_005897	
KDM5C	8242	broad.mit.edu;ucsc.edu	37	X	53244975	53244975	+	Splice_Site	SNP	A	A	G			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	0198f3c3-78f2-4c19-90d5-c77b74044ca2	30e43131-d7aa-407d-9bed-28ae34db1b68	g.chrX:53244975A>G	ENST00000375401.3	-	7	1496		c.e7+1		KDM5C_ENST00000404049.3_Splice_Site|KDM5C_ENST00000452825.3_Splice_Site|KDM5C_ENST00000375383.3_Splice_Site|KDM5C-IT1_ENST00000412242.1_RNA|KDM5C_ENST00000375379.3_Splice_Site	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C						histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)	p.?(2)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						CTGGGTCCTTACAAACTGGGC	0.532			"""N, F, S"""		clear cell renal carcinoma																																			Rec	yes		X	Xp11.22-p11.21	8242	lysine (K)-specific demethylase 5C (JARID1C)		E	2	Unknown(2)	kidney(2)											238.0	162.0	188.0					X																	53244975		2203	4300	6503	SO:0001630	splice_region_variant	8242			Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.963+1T>C	X.37:g.53244975A>G		Somatic		WXS	Illumina GAIIx	Phase_I	B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Splice_Site	SNP	ENST00000375401.3	37	CCDS14351.1	.	.	.	.	.	.	.	.	.	.	A	16.60	3.169511	0.57584	.	.	ENSG00000126012	ENST00000452825;ENST00000375401;ENST00000404049;ENST00000375379;ENST00000375383	.	.	.	5.45	4.24	0.50183	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.8527	0.35210	0.8298:0.0:0.0:0.1702	.	.	.	.	.	-1	.	.	.	-	.	.	KDM5C	53261700	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.502000	0.90505	0.659000	0.30945	0.430000	0.28490	.		0.532	KDM5C-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056737.2		NM_004187	Intron
NSMCE2	286053	hgsc.bcm.edu	37	8	126114663	126114664	+	Frame_Shift_Ins	INS	-	-	A	rs76206666		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0198f3c3-78f2-4c19-90d5-c77b74044ca2	30e43131-d7aa-407d-9bed-28ae34db1b68	g.chr8:126114663_126114664insA	ENST00000287437.3	+	3	307_308	c.91_92insA	c.(91-93)caafs	p.Q31fs	NSMCE2_ENST00000522563.1_Frame_Shift_Ins_p.Q31fs	NM_173685.2	NP_775956.1	Q96MF7	NSE2_HUMAN	non-SMC element 2, MMS21 homolog (S. cerevisiae)	31					cellular senescence (GO:0090398)|double-strand break repair via homologous recombination (GO:0000724)|mitotic nuclear division (GO:0007067)|positive regulation of maintenance of mitotic sister chromatid cohesion (GO:0034184)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|protein sumoylation (GO:0016925)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|nucleus (GO:0005634)|PML body (GO:0016605)|Smc5-Smc6 complex (GO:0030915)	SUMO ligase activity (GO:0019789)|zinc ion binding (GO:0008270)			breast(1)|lung(4)|ovary(1)|skin(1)|urinary_tract(2)	9	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)			GAAAAACTTCCAAGCCTGTATC	0.406																																																	0																																										SO:0001589	frameshift_variant	286053			AK057002	CCDS6356.1	8q24.13	2013-01-28	2006-12-21	2006-07-05	ENSG00000156831	ENSG00000156831		"""Zinc fingers, MIZ-type"""	26513	protein-coding gene	gene with protein product	"""zinc finger, MIZ-type containing 7"""		"""chromosome 8 open reading frame 36"", ""non-SMC element 2 homolog (MMS21, S. cerevisiae)"""	C8orf36		12477932	Standard	NM_173685		Approved	FLJ32440, MMS21, NSE2, ZMIZ7	uc003yrw.2	Q96MF7	OTTHUMG00000164993	ENST00000287437.3:c.93dupA	8.37:g.126114665_126114665dupA	ENSP00000287437:p.Gln31fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q8N549	Frame_Shift_Ins	INS	ENST00000287437.3	37	CCDS6356.1																																																																																				0.406	NSMCE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381378.1		NM_173685	
OR2T27	403239	hgsc.bcm.edu	37	1	248813651	248813653	+	In_Frame_Del	DEL	AGA	AGA	-	rs199590470	byFrequency	TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10	AGA	AGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0198f3c3-78f2-4c19-90d5-c77b74044ca2	30e43131-d7aa-407d-9bed-28ae34db1b68	g.chr1:248813651_248813653delAGA	ENST00000344889.3	-	1	532_534	c.533_535delTCT	c.(532-537)ttctgc>tgc	p.F178del		NM_001001824.1	NP_001001824.1	Q8NH04	O2T27_HUMAN	olfactory receptor, family 2, subfamily T, member 27	178						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|endometrium(2)|large_intestine(4)|lung(20)|skin(3)|stomach(1)	32	all_cancers(71;1.15e-05)|all_epithelial(71;5.29e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.089)|Lung NSC(105;0.0969)|Melanoma(84;0.199)	all_cancers(173;0.237)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GGCACCTCGCAGAAGAAGTGGTT	0.567														657	0.13119	0.1884	0.0821	5008	,	,		21206	0.249		0.0795	False		,,,				2504	0.0204																0										658,3330		87,484,1423						3.3	1.0			11	805,5661		188,429,2616	no	coding	OR2T27	NM_001001824.1		275,913,4039	A1A1,A1R,RR		12.4497,16.4995,13.9946				1463,8991				SO:0001651	inframe_deletion	403239				CCDS31124.1	1q44	2012-08-09			ENSG00000187701	ENSG00000187701		"""GPCR / Class A : Olfactory receptors"""	31252	protein-coding gene	gene with protein product							Standard	NM_001001824		Approved		uc010pzo.2	Q8NH04	OTTHUMG00000040376	ENST00000344889.3:c.533_535delTCT	1.37:g.248813654_248813656delAGA	ENSP00000342008:p.Phe178del	Somatic		WXS	Illumina HiSeq	Phase_I		In_Frame_Del	DEL	ENST00000344889.3	37	CCDS31124.1																																																																																				0.567	OR2T27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097124.1		NM_001001824	
PBRM1	55193	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	52620525	52620525	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0198f3c3-78f2-4c19-90d5-c77b74044ca2	30e43131-d7aa-407d-9bed-28ae34db1b68	g.chr3:52620525delA	ENST00000296302.7	-	20	3304	c.3303delT	c.(3301-3303)tttfs	p.F1101fs	PBRM1_ENST00000409114.3_Frame_Shift_Del_p.F1116fs|PBRM1_ENST00000394830.3_Frame_Shift_Del_p.F1076fs|PBRM1_ENST00000409057.1_Frame_Shift_Del_p.F1101fs|PBRM1_ENST00000409767.1_Frame_Shift_Del_p.F1116fs|PBRM1_ENST00000410007.1_Frame_Shift_Del_p.F1076fs|PBRM1_ENST00000356770.4_Frame_Shift_Del_p.F1069fs|PBRM1_ENST00000337303.4_Frame_Shift_Del_p.F1101fs			Q86U86	PB1_HUMAN	polybromo 1	1101					chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		CTGCATTTGCAAATACAGAGG	0.438			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																			Rec	yes		3	3p21	55193	polybromo 1		E	0													130.0	129.0	129.0					3																	52620525		2203	4300	6503	SO:0001589	frameshift_variant	55193			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.3303delT	3.37:g.52620525delA	ENSP00000296302:p.Phe1101fs	Somatic		WXS	Illumina HiSeq	Phase_I	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Frame_Shift_Del	DEL	ENST00000296302.7	37																																																																																					0.438	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1		NM_018165	
PEG3	5178	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	57329187	57329187	+	Silent	SNP	G	G	A	rs142177720		TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0198f3c3-78f2-4c19-90d5-c77b74044ca2	30e43131-d7aa-407d-9bed-28ae34db1b68	g.chr19:57329187G>A	ENST00000326441.9	-	9	1152	c.789C>T	c.(787-789)gaC>gaT	p.D263D	ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000221722.5_Intron|PEG3_ENST00000423103.2_Silent_p.D263D|PEG3_ENST00000593695.1_Silent_p.D137D|ZIM2_ENST00000601070.1_Intron|PEG3_ENST00000598410.1_Silent_p.D139D|ZIM2_ENST00000391708.3_Intron|ZIM2_ENST00000593711.1_Intron	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	263					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.D263D(2)		NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		AGTGGCCATCGTCTTCAGCAA	0.502													G|||	1	0.000199681	0.0	0.0	5008	,	,		19337	0.0		0.001	False		,,,				2504	0.0																2	Substitution - coding silent(2)	kidney(2)											148.0	107.0	121.0					19																	57329187		2203	4300	6503	SO:0001819	synonymous_variant	5178			AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.789C>T	19.37:g.57329187G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Silent	SNP	ENST00000326441.9	37	CCDS12948.1																																																																																				0.502	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416099.2			
PLIN2	123	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	19116637	19116637	+	Missense_Mutation	SNP	G	G	A			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0198f3c3-78f2-4c19-90d5-c77b74044ca2	30e43131-d7aa-407d-9bed-28ae34db1b68	g.chr9:19116637G>A	ENST00000276914.2	-	8	1102	c.923C>T	c.(922-924)tCa>tTa	p.S308L	PLIN2_ENST00000411567.1_Missense_Mutation_p.S227L	NM_001122.3	NP_001113.2	Q99541	PLIN2_HUMAN	perilipin 2	308					cellular lipid metabolic process (GO:0044255)|lipid storage (GO:0019915)|long-chain fatty acid transport (GO:0015909)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|lipid particle (GO:0005811)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.S308L(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	19						AAGAGTACGTGACTCAATGTG	0.453																																																	1	Substitution - Missense(1)	kidney(1)											107.0	95.0	99.0					9																	19116637		2203	4300	6503	SO:0001583	missense	123			X97324	CCDS6490.1	9p22.1	2009-08-12	2009-08-12	2009-08-12	ENSG00000147872	ENSG00000147872		"""Perilipins"""	248	protein-coding gene	gene with protein product	"""adipophilin"""	103195	"""adipose differentiation-related protein"""	ADFP		9003395, 19638644	Standard	NM_001122		Approved	ADRP	uc003zno.3	Q99541	OTTHUMG00000019624	ENST00000276914.2:c.923C>T	9.37:g.19116637G>A	ENSP00000276914:p.Ser308Leu	Somatic		WXS	Illumina HiSeq	Phase_I	Q9BSC3	Missense_Mutation	SNP	ENST00000276914.2	37	CCDS6490.1	.	.	.	.	.	.	.	.	.	.	G	18.64	3.667724	0.67814	.	.	ENSG00000147872	ENST00000411567;ENST00000276914	T;T	0.06218	3.33;3.33	6.0	6.0	0.97389	.	0.124032	0.56097	D	0.000027	T	0.25158	0.0611	M	0.69185	2.1	0.58432	D	0.999993	D	0.76494	0.999	D	0.74674	0.984	T	0.00039	-1.2243	10	0.33141	T	0.24	.	20.4945	0.99205	0.0:0.0:1.0:0.0	.	308	Q99541	PLIN2_HUMAN	L	227;308	ENSP00000415270:S227L;ENSP00000276914:S308L	ENSP00000276914:S308L	S	-	2	0	PLIN2	19106637	1.000000	0.71417	1.000000	0.80357	0.396000	0.30629	7.923000	0.87546	2.846000	0.97976	0.650000	0.86243	TCA		0.453	PLIN2-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051835.1		NM_001122	
PLXNA2	5362	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	208215470	208215470	+	Missense_Mutation	SNP	T	T	C			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0198f3c3-78f2-4c19-90d5-c77b74044ca2	30e43131-d7aa-407d-9bed-28ae34db1b68	g.chr1:208215470T>C	ENST00000367033.3	-	22	5016	c.4259A>G	c.(4258-4260)aAg>aGg	p.K1420R		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	1420					axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)	p.K1420R(1)		NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		GGGGTGGTTCTTGTTCTCCAG	0.587																																																	1	Substitution - Missense(1)	kidney(1)											77.0	78.0	78.0					1																	208215470		2203	4300	6503	SO:0001583	missense	5362			X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.4259A>G	1.37:g.208215470T>C	ENSP00000356000:p.Lys1420Arg	Somatic		WXS	Illumina HiSeq	Phase_I	A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Missense_Mutation	SNP	ENST00000367033.3	37	CCDS31013.1	.	.	.	.	.	.	.	.	.	.	T	19.97	3.925683	0.73213	.	.	ENSG00000076356	ENST00000367033	T	0.16457	2.34	5.16	5.16	0.70880	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.044822	0.85682	N	0.000000	T	0.23492	0.0568	L	0.48260	1.515	0.80722	D	1	P	0.40250	0.709	P	0.45099	0.469	T	0.01305	-1.1390	10	0.56958	D	0.05	.	15.005	0.71504	0.0:0.0:0.0:1.0	.	1420	O75051	PLXA2_HUMAN	R	1420	ENSP00000356000:K1420R	ENSP00000356000:K1420R	K	-	2	0	PLXNA2	206282093	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.648000	0.83479	1.941000	0.56285	0.379000	0.24179	AAG		0.587	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088932.6		NM_025179	
PLXNC1	10154	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	94673352	94673352	+	Missense_Mutation	SNP	A	A	C			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0198f3c3-78f2-4c19-90d5-c77b74044ca2	30e43131-d7aa-407d-9bed-28ae34db1b68	g.chr12:94673352A>C	ENST00000258526.4	+	22	3951	c.3702A>C	c.(3700-3702)aaA>aaC	p.K1234N	PLXNC1_ENST00000547057.1_Missense_Mutation_p.K281N|RP11-1105G2.3_ENST00000547927.1_5'Flank|RP11-1105G2.4_ENST00000550111.1_RNA|PLXNC1_ENST00000545312.1_5'UTR|RP11-1105G2.3_ENST00000551941.1_Intron	NM_005761.2	NP_005752.1	O60486	PLXC1_HUMAN	plexin C1	1234					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)	p.K1234N(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(12)|lung(30)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						GCCAAGCCAAAGAAAAGATTT	0.433																																																	1	Substitution - Missense(1)	kidney(1)											100.0	97.0	98.0					12																	94673352		2203	4300	6503	SO:0001583	missense	10154			AF030339	CCDS9049.1	12q23	2009-04-17				ENSG00000136040		"""CD molecules"", ""Plexins"""	9106	protein-coding gene	gene with protein product		604259					Standard	NR_037687		Approved	VESPR, CD232	uc001tdc.3	O60486	OTTHUMG00000170235	ENST00000258526.4:c.3702A>C	12.37:g.94673352A>C	ENSP00000258526:p.Lys1234Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q59H25	Missense_Mutation	SNP	ENST00000258526.4	37	CCDS9049.1	.	.	.	.	.	.	.	.	.	.	A	19.13	3.768437	0.69878	.	.	ENSG00000136040	ENST00000258526;ENST00000547057	T;T	0.23754	1.89;1.89	5.28	2.9	0.33743	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.51244	0.1663	M	0.88377	2.95	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.53760	-0.8393	10	0.87932	D	0	.	6.7487	0.23475	0.7544:0.0:0.2456:0.0	.	281;1234	B4DHQ7;O60486	.;PLXC1_HUMAN	N	1234;281	ENSP00000258526:K1234N;ENSP00000446720:K281N	ENSP00000258526:K1234N	K	+	3	2	PLXNC1	93197483	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.881000	0.39638	1.020000	0.39573	0.533000	0.62120	AAA		0.433	PLXNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408126.2			
PPFIBP2	8495	hgsc.bcm.edu	37	11	7661048	7661050	+	In_Frame_Del	DEL	CTC	CTC	-	rs375552735|rs143023559	byFrequency	TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10	CTC	CTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0198f3c3-78f2-4c19-90d5-c77b74044ca2	30e43131-d7aa-407d-9bed-28ae34db1b68	g.chr11:7661048_7661050delCTC	ENST00000299492.4	+	15	1710_1712	c.1322_1324delCTC	c.(1321-1326)tctcct>tct	p.P443del	PPFIBP2_ENST00000528883.1_In_Frame_Del_p.P331del|PPFIBP2_ENST00000533792.1_In_Frame_Del_p.P285del|PPFIBP2_ENST00000530582.1_3'UTR|PPFIBP2_ENST00000530181.1_In_Frame_Del_p.P300del	NM_003621.3	NP_003612	Q8ND30	LIPB2_HUMAN	PTPRF interacting protein, binding protein 2 (liprin beta 2)	443					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|intracellular (GO:0005622)|presynaptic active zone (GO:0048786)	DNA binding (GO:0003677)|integrase activity (GO:0008907)	p.P442S(1)		breast(8)|cervix(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32				Epithelial(150;2.01e-07)|BRCA - Breast invasive adenocarcinoma(625;0.236)		GCTGCCAAATCTCCTCCCACCAT	0.596														226	0.0451278	0.0129	0.0576	5008	,	,		18604	0.0933		0.0477	False		,,,				2504	0.0276																1	Substitution - Missense(1)	upper_aerodigestive_tract(1)								85,4179		1,83,2048						1.4	0.0		dbSNP_134	94	316,7928		9,298,3815	no	coding	PPFIBP2	NM_003621.2		10,381,5863	A1A1,A1R,RR		3.8331,1.9934,3.2059				401,12107				SO:0001651	inframe_deletion	8495			AF034803	CCDS31419.1, CCDS58116.1, CCDS58117.1	11p15.4	2013-01-10			ENSG00000166387	ENSG00000166387		"""Sterile alpha motif (SAM) domain containing"""	9250	protein-coding gene	gene with protein product		603142				9624153	Standard	NM_003621		Approved	Cclp1	uc001mfj.5	Q8ND30	OTTHUMG00000165617	ENST00000299492.4:c.1322_1324delCTC	11.37:g.7661051_7661053delCTC	ENSP00000299492:p.Pro443del	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z433|E9PK77|O75337|Q8WW26	In_Frame_Del	DEL	ENST00000299492.4	37	CCDS31419.1																																																																																				0.596	PPFIBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385345.2		NM_003621	
PRG4	10216	hgsc.bcm.edu	37	1	186275463	186275463	+	Missense_Mutation	SNP	G	G	C	rs139300692	byFrequency	TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0198f3c3-78f2-4c19-90d5-c77b74044ca2	30e43131-d7aa-407d-9bed-28ae34db1b68	g.chr1:186275463G>C	ENST00000445192.2	+	7	657	c.612G>C	c.(610-612)aaG>aaC	p.K204N	PRG4_ENST00000367483.4_Missense_Mutation_p.K163N|PRG4_ENST00000367486.3_Missense_Mutation_p.K161N|PRG4_ENST00000367485.4_Missense_Mutation_p.K111N|PRG4_ENST00000367484.3_Missense_Mutation_p.K163N	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	204					cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						AAGATAACAAGAAGAACAGAA	0.338																																																	0													97.0	102.0	100.0					1																	186275463		2203	4298	6501	SO:0001583	missense	23572			U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.612G>C	1.37:g.186275463G>C	ENSP00000399679:p.Lys204Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Missense_Mutation	SNP	ENST00000445192.2	37	CCDS1369.1	.	.	.	.	.	.	.	.	.	.	G	5.532	0.283134	0.10458	.	.	ENSG00000116690	ENST00000367486;ENST00000367484;ENST00000533951;ENST00000367482;ENST00000367483;ENST00000367485;ENST00000445192	T;T;T;T;T;T	0.53206	3.01;3.4;0.63;3.31;3.22;3.4	4.08	2.85	0.33270	.	0.000000	0.45867	U	0.000327	T	0.58133	0.2101	M	0.66939	2.045	0.21579	N	0.999635	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.72075	0.976;0.976;0.946;0.976	T	0.43360	-0.9396	10	0.44086	T	0.13	-1.2255	4.9237	0.13883	0.2093:0.0:0.7907:0.0	.	70;111;204;163	Q92954-4;Q92954-3;Q92954;Q92954-2	.;.;PRG4_HUMAN;.	N	161;163;113;70;163;111;204	ENSP00000356456:K161N;ENSP00000356454:K163N;ENSP00000431330:K113N;ENSP00000356453:K163N;ENSP00000356455:K111N;ENSP00000399679:K204N	ENSP00000356452:K70N	K	+	3	2	PRG4	184542086	1.000000	0.71417	0.999000	0.59377	0.393000	0.30537	2.358000	0.44134	1.979000	0.57680	0.467000	0.42956	AAG		0.338	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086346.1		NM_005807	
PRSS50	29122	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	46783933	46783933	+	Intron	SNP	C	C	A			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0198f3c3-78f2-4c19-90d5-c77b74044ca2	30e43131-d7aa-407d-9bed-28ae34db1b68	g.chr3:46783933C>A	ENST00000460241.1	-	4	1129				PRSS45_ENST00000442359.2_Missense_Mutation_p.K198N			Q9UI38	TSP50_HUMAN	protease, serine, 50						proteolysis (GO:0006508)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)	serine-type endopeptidase activity (GO:0004252)|threonine-type endopeptidase activity (GO:0004298)	p.K198N(1)		endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	11						TCATTTGCTTCTTGATCCATT	0.567																																					Pancreas(41;915 1239 11561 17469)												1	Substitution - Missense(1)	kidney(1)											230.0	288.0	269.0					3																	46783933		2111	4250	6361	SO:0001627	intron_variant	377047			AF100707	CCDS2745.1	3p21.31	2011-05-24			ENSG00000206549	ENSG00000206549		"""Serine peptidases / Serine peptidases"""	17910	protein-coding gene	gene with protein product	"""cancer/testis antigen 20"", ""testes specific protease 50"""	607950				10397268	Standard	NM_013270		Approved	TSP50, CT20	uc003cqe.1	Q9UI38	OTTHUMG00000164067	ENST00000460241.1:c.541+6181G>T	3.37:g.46783933C>A		Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000460241.1	37	CCDS2745.1	.	.	.	.	.	.	.	.	.	.	C	12.96	2.094184	0.36952	.	.	ENSG00000188086	ENST00000331814;ENST00000442359	D	0.93189	-3.18	5.65	1.63	0.23807	.	0.961452	0.08644	N	0.915124	D	0.86083	0.5848	.	.	.	0.09310	N	1	B	0.14438	0.01	B	0.16289	0.015	T	0.72157	-0.4375	9	0.25106	T	0.35	.	4.4084	0.11420	0.1487:0.4822:0.2884:0.0806	.	198	Q7RTY3-2	.	N	230;198	ENSP00000401932:K198N	ENSP00000330940:K230N	K	-	3	2	PRSS45	46758937	0.000000	0.05858	0.030000	0.17652	0.980000	0.70556	0.251000	0.18257	0.416000	0.25844	0.655000	0.94253	AAG		0.567	PRSS50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354544.1			
RIOK3	8780	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	21043937	21043937	+	Silent	SNP	T	T	C			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0198f3c3-78f2-4c19-90d5-c77b74044ca2	30e43131-d7aa-407d-9bed-28ae34db1b68	g.chr18:21043937T>C	ENST00000339486.3	+	3	803	c.186T>C	c.(184-186)gcT>gcC	p.A62A	RIOK3_ENST00000577501.1_Silent_p.A62A|RIOK3_ENST00000581585.1_Intron	NM_003831.3	NP_003822.2	O14730	RIOK3_HUMAN	RIO kinase 3	62					chromosome segregation (GO:0007059)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.A62A(1)		central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(3)|ovary(2)	10	all_cancers(21;0.000106)|all_epithelial(16;6.74e-07)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0202)|Ovarian(20;0.127)					ATAGTGTTGCTGAAGGACCAT	0.373																																																	1	Substitution - coding silent(1)	kidney(1)											137.0	133.0	134.0					18																	21043937		2203	4300	6503	SO:0001819	synonymous_variant	8780			AF013591	CCDS11877.1	18q11.2	2012-12-10	2012-12-10	2003-06-25	ENSG00000101782	ENSG00000101782			11451	protein-coding gene	gene with protein product		603579	"""sudD (suppressor of bimD6, Aspergillus nidulans) homolog"", ""RIO kinase 3 (yeast)"""	SUDD		9602165	Standard	NM_003831		Approved		uc002kui.4	O14730	OTTHUMG00000131813	ENST00000339486.3:c.186T>C	18.37:g.21043937T>C		Somatic		WXS	Illumina HiSeq	Phase_I	Q8IXN9	Silent	SNP	ENST00000339486.3	37	CCDS11877.1																																																																																				0.373	RIOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254756.1		NM_003831	
RPL34	6164	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	109543328	109543328	+	Missense_Mutation	SNP	G	G	A			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0198f3c3-78f2-4c19-90d5-c77b74044ca2	30e43131-d7aa-407d-9bed-28ae34db1b68	g.chr4:109543328G>A	ENST00000394668.2	+	3	199	c.133G>A	c.(133-135)Gca>Aca	p.A45T	RPL34_ENST00000502534.1_Missense_Mutation_p.A45T|RPL34_ENST00000394667.3_Missense_Mutation_p.A45T|RPL34-AS1_ENST00000507248.1_lincRNA|RPL34_ENST00000506397.1_Missense_Mutation_p.A45T|RPL34_ENST00000394665.1_Missense_Mutation_p.A45T	NM_033625.2	NP_296374.1	P49207	RL34_HUMAN	ribosomal protein L34	45					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)	RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)	p.A45T(1)		kidney(2)|lung(1)|upper_aerodigestive_tract(1)	4		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000286)		ACCAAAATCTGCATGTGGTGT	0.453																																																	1	Substitution - Missense(1)	kidney(1)											67.0	68.0	68.0					4																	109543328		2203	4299	6502	SO:0001583	missense	6164			AB007181	CCDS3680.1	4q25	2011-04-06			ENSG00000109475	ENSG00000109475		"""L ribosomal proteins"""	10340	protein-coding gene	gene with protein product						9582194, 7490091	Standard	XM_005263172		Approved	L34	uc003hyz.3	P49207	OTTHUMG00000131839	ENST00000394668.2:c.133G>A	4.37:g.109543328G>A	ENSP00000378163:p.Ala45Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q6FG66|Q9BUZ2	Missense_Mutation	SNP	ENST00000394668.2	37	CCDS3680.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.086404	0.76642	.	.	ENSG00000109475	ENST00000394667;ENST00000502534;ENST00000394665;ENST00000506397;ENST00000394668	.	.	.	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.53222	0.1783	L	0.27053	0.805	0.80722	D	1	B	0.10296	0.003	B	0.14023	0.01	T	0.49428	-0.8941	9	0.52906	T	0.07	.	18.7612	0.91851	0.0:0.0:1.0:0.0	.	45	P49207	RL34_HUMAN	T	45	.	ENSP00000378160:A45T	A	+	1	0	RPL34	109762777	1.000000	0.71417	0.975000	0.42487	0.974000	0.67602	9.410000	0.97335	2.588000	0.87417	0.655000	0.94253	GCA		0.453	RPL34-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363468.1		NM_033625, NM_000995	
SLC13A4	26266	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	135370372	135370372	+	Silent	SNP	C	C	T			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0198f3c3-78f2-4c19-90d5-c77b74044ca2	30e43131-d7aa-407d-9bed-28ae34db1b68	g.chr7:135370372C>T	ENST00000354042.4	-	14	2192	c.1503G>A	c.(1501-1503)ccG>ccA	p.P501P	C7orf73_ENST00000422968.1_Intron|SLC13A4_ENST00000491630.1_5'UTR	NM_012450.2	NP_036582.2	Q9UKG4	S13A4_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 4	501					sodium ion transmembrane transport (GO:0035725)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)	p.P501P(1)		breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(2)	24						TGACAGCCCACGGTGGGAGGC	0.542																																																	1	Substitution - coding silent(1)	kidney(1)											192.0	169.0	177.0					7																	135370372		2203	4300	6503	SO:0001819	synonymous_variant	26266			AF169301	CCDS5840.1	7q33	2013-07-18	2013-07-18		ENSG00000164707	ENSG00000164707		"""Solute carriers"""	15827	protein-coding gene	gene with protein product	"""sulphate transporter 1"""	604309	"""solute carrier family 13 (sodium/sulphate symporters), member 4"""			10535998	Standard	NM_012450		Approved	SUT-1, SUT1	uc003vta.3	Q9UKG4	OTTHUMG00000155539	ENST00000354042.4:c.1503G>A	7.37:g.135370372C>T		Somatic		WXS	Illumina HiSeq	Phase_I	A4D1Q4|Q8N631	Silent	SNP	ENST00000354042.4	37	CCDS5840.1																																																																																				0.542	SLC13A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340558.1		NM_012450	
TCL6	27004	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	96129842	96129842	+	RNA	SNP	T	T	C			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0198f3c3-78f2-4c19-90d5-c77b74044ca2	30e43131-d7aa-407d-9bed-28ae34db1b68	g.chr14:96129842T>C	ENST00000467865.1	+	0	250				RP11-1070N10.6_ENST00000461160.1_RNA					T-cell leukemia/lymphoma 6 (non-protein coding)											large_intestine(1)|lung(7)	8		all_cancers(154;0.103)		Epithelial(152;0.0655)|all cancers(159;0.149)|BRCA - Breast invasive adenocarcinoma(234;0.206)|COAD - Colon adenocarcinoma(157;0.207)		ccaggtttcctgccccagtgc	0.527			T	TRA@	T-ALL																																			Dom	yes		14	14q32.1	27004	T-cell leukemia/lymphoma 6		L	0													111.0	96.0	101.0					14																	96129842		2203	4300	6503			27004			AB035338		14q32.1	2012-10-16	2010-06-01		ENSG00000187621	ENSG00000187621		"""Long non-coding RNAs"""	13463	non-coding RNA	RNA, long non-coding		604412	"""T-cell leukemia/lymphoma 6"""			10588720, 10851082	Standard	NR_028288		Approved	TCL6e1, TNG2, TNG1	uc001yev.2		OTTHUMG00000149979		14.37:g.96129842T>C		Somatic		WXS	Illumina HiSeq	Phase_I		RNA	SNP	ENST00000467865.1	37																																																																																					0.527	TCL6-009	KNOWN	basic	lincRNA	processed_transcript	OTTHUMT00000315133.1		NM_012468	
TECTA	7007	hgsc.bcm.edu;ucsc.edu	37	11	121030869	121030870	+	Frame_Shift_Ins	INS	-	-	AT			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0198f3c3-78f2-4c19-90d5-c77b74044ca2	30e43131-d7aa-407d-9bed-28ae34db1b68	g.chr11:121030869_121030870insAT	ENST00000392793.1	+	15	4986_4987	c.4715_4716insAT	c.(4714-4719)ccatttfs	p.F1573fs	TECTA_ENST00000264037.2_Frame_Shift_Ins_p.F1573fs			O75443	TECTA_HUMAN	tectorin alpha	1573	VWFD 4. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)			TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		GTGAATGTTCCATTTATAACTG	0.431																																																	0																																										SO:0001589	frameshift_variant	7007			AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.4716_4717dupAT	11.37:g.121030870_121030871dupAT	ENSP00000376543:p.Phe1573fs	Somatic		WXS	Illumina HiSeq	Phase_I		Frame_Shift_Ins	INS	ENST00000392793.1	37	CCDS8434.1																																																																																				0.431	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313850.1		NM_005422	
TIGD6	81789	broad.mit.edu;ucsc.edu	37	5	149375454	149375454	+	Missense_Mutation	SNP	T	T	C			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0198f3c3-78f2-4c19-90d5-c77b74044ca2	30e43131-d7aa-407d-9bed-28ae34db1b68	g.chr5:149375454T>C	ENST00000296736.3	-	2	1232	c.458A>G	c.(457-459)gAt>gGt	p.D153G	TIGD6_ENST00000515406.2_Missense_Mutation_p.D153G	NM_030953.3	NP_112215.1	Q17RP2	TIGD6_HUMAN	tigger transposable element derived 6	153						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.D153G(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|stomach(1)	10			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			ATTAATCTTATCTATTCCTAG	0.413																																																	1	Substitution - Missense(1)	kidney(1)											186.0	196.0	193.0					5																	149375454		2203	4300	6503	SO:0001583	missense	81789			AK056604	CCDS4301.1	5q33.1	2008-02-05			ENSG00000164296	ENSG00000164296			18332	protein-coding gene	gene with protein product						11230166	Standard	NM_030953		Approved	DKFZp761E2110	uc003lrj.3	Q17RP2	OTTHUMG00000130045	ENST00000296736.3:c.458A>G	5.37:g.149375454T>C	ENSP00000296736:p.Asp153Gly	Somatic		WXS	Illumina GAIIx	Phase_I	B3KTZ8|Q96MQ4|Q9H0X7	Missense_Mutation	SNP	ENST00000296736.3	37	CCDS4301.1	.	.	.	.	.	.	.	.	.	.	T	13.17	2.156732	0.38119	.	.	ENSG00000164296	ENST00000296736;ENST00000515406	T;T	0.15952	2.38;2.38	4.69	4.69	0.59074	.	0.000000	0.35739	U	0.003017	T	0.18045	0.0433	N	0.08118	0	0.25349	N	0.988882	D	0.69078	0.997	D	0.63597	0.916	T	0.17715	-1.0360	10	0.23891	T	0.37	.	12.4362	0.55600	0.0:0.0:0.0:1.0	.	153	Q17RP2	TIGD6_HUMAN	G	153	ENSP00000296736:D153G;ENSP00000425318:D153G	ENSP00000296736:D153G	D	-	2	0	TIGD6	149355647	0.970000	0.33590	1.000000	0.80357	0.964000	0.63967	0.931000	0.28871	2.103000	0.63969	0.529000	0.55759	GAT		0.413	TIGD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252324.1		NM_030953	
UBE2R2	54926	broad.mit.edu;ucsc.edu	37	9	33817901	33817901	+	Missense_Mutation	SNP	C	C	T			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0198f3c3-78f2-4c19-90d5-c77b74044ca2	30e43131-d7aa-407d-9bed-28ae34db1b68	g.chr9:33817901C>T	ENST00000263228.3	+	1	337	c.146C>T	c.(145-147)cCc>cTc	p.P49L	RP11-133O22.6_ENST00000454429.2_RNA	NM_017811.3	NP_060281.2	Q712K3	UB2R2_HUMAN	ubiquitin-conjugating enzyme E2R 2	49					protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)		acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)	p.P49L(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(3)	8			LUSC - Lung squamous cell carcinoma(29;0.0176)	GBM - Glioblastoma multiforme(74;0.188)		TTCGGACCCCCCAACACCCTC	0.657																																																	1	Substitution - Missense(1)	kidney(1)											84.0	82.0	83.0					9																	33817901		2203	4300	6503	SO:0001583	missense	54926			AK000426	CCDS6546.1	9p11.2	2008-02-05			ENSG00000107341	ENSG00000107341		"""Ubiquitin-conjugating enzymes E2"""	19907	protein-coding gene	gene with protein product		612506				12037680	Standard	XM_005251496		Approved	UBC3B, CDC34B, FLJ20419, MGC10481	uc003ztm.3	Q712K3	OTTHUMG00000019797	ENST00000263228.3:c.146C>T	9.37:g.33817901C>T	ENSP00000263228:p.Pro49Leu	Somatic		WXS	Illumina GAIIx	Phase_I	D3DRL5|Q9NX64	Missense_Mutation	SNP	ENST00000263228.3	37	CCDS6546.1	.	.	.	.	.	.	.	.	.	.	c	33	5.198065	0.94997	.	.	ENSG00000107341	ENST00000263228	T	0.38077	1.16	4.67	4.67	0.58626	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.165784	0.53938	D	0.000041	T	0.65533	0.2700	M	0.84846	2.72	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.72776	-0.4191	10	0.87932	D	0	0.238	17.8196	0.88647	0.0:1.0:0.0:0.0	.	49	Q712K3	UB2R2_HUMAN	L	49	ENSP00000263228:P49L	ENSP00000263228:P49L	P	+	2	0	UBE2R2	33807901	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.680000	0.74518	2.438000	0.82558	0.645000	0.84053	CCC		0.657	UBE2R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052118.1		NM_017811	
TNFSF15	9966	hgsc.bcm.edu;ucsc.edu	37	9	117552995	117552995	+	Missense_Mutation	SNP	T	T	A			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0198f3c3-78f2-4c19-90d5-c77b74044ca2	30e43131-d7aa-407d-9bed-28ae34db1b68	g.chr9:117552995T>A	ENST00000374045.4	-	4	606	c.493A>T	c.(493-495)Atc>Ttc	p.I165F	AL390240.1_ENST00000408807.1_RNA|TNFSF15_ENST00000374044.1_Missense_Mutation_p.I88F	NM_001204344.1|NM_005118.3	NP_001191273.1|NP_005109.2	O95150	TNF15_HUMAN	tumor necrosis factor (ligand) superfamily, member 15	165					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|cytokine metabolic process (GO:0042107)|immune response (GO:0006955)|positive regulation of cytokine secretion (GO:0050715)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|skin(1)	11						GCTTGTCTGATTTCACTGCAC	0.512																																																	0													192.0	161.0	171.0					9																	117552995		2203	4300	6503	SO:0001583	missense	9966			AF039390	CCDS6809.1	9q32	2008-07-21			ENSG00000181634	ENSG00000181634		"""Tumor necrosis factor (ligand) superfamily"""	11931	protein-coding gene	gene with protein product	"""vascular endothelial cell growth inhibitor"", ""TNF superfamily ligand TL1A"", ""TNF ligand-related molecule 1"", ""vascular endothelial growth inhibitor-192A"""	604052				9434163	Standard	NM_005118		Approved	TL1, VEGI, TL1A, VEGI192A, MGC129934, MGC129935	uc004bjh.3	O95150	OTTHUMG00000021011	ENST00000374045.4:c.493A>T	9.37:g.117552995T>A	ENSP00000363157:p.Ile165Phe	Somatic		WXS	Illumina HiSeq	Phase_I	Q3SX69|Q5VJK8|Q5VWH1|Q8NFE9	Missense_Mutation	SNP	ENST00000374045.4	37	CCDS6809.1	.	.	.	.	.	.	.	.	.	.	T	8.726	0.915450	0.17907	.	.	ENSG00000181634	ENST00000374045;ENST00000374044	T;T	0.35048	1.91;1.33	5.69	3.25	0.37280	Tumour necrosis factor (3);Tumour necrosis factor-like (2);	0.182888	0.37955	N	0.001877	T	0.32556	0.0833	M	0.61703	1.905	0.09310	N	0.999995	P;B	0.37370	0.592;0.364	B;B	0.36134	0.218;0.106	T	0.26189	-1.0110	10	0.56958	D	0.05	-16.847	7.5044	0.27536	0.0:0.0735:0.2479:0.6786	.	165;106	O95150;O95150-2	TNF15_HUMAN;.	F	165;88	ENSP00000363157:I165F;ENSP00000363156:I88F	ENSP00000363156:I88F	I	-	1	0	TNFSF15	116592816	0.000000	0.05858	0.017000	0.16124	0.068000	0.16541	0.579000	0.23788	0.990000	0.38787	0.533000	0.62120	ATC		0.512	TNFSF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055424.2		NM_005118	
USP28	57646	broad.mit.edu;ucsc.edu	37	11	113701632	113701632	+	Silent	SNP	C	C	A			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0198f3c3-78f2-4c19-90d5-c77b74044ca2	30e43131-d7aa-407d-9bed-28ae34db1b68	g.chr11:113701632C>A	ENST00000003302.4	-	9	935	c.867G>T	c.(865-867)gtG>gtT	p.V289V	USP28_ENST00000542033.1_5'UTR|USP28_ENST00000544967.1_5'Flank|USP28_ENST00000260188.5_Silent_p.V289V|USP28_ENST00000537706.1_Silent_p.V289V|USP28_ENST00000545540.1_Silent_p.V164V	NM_020886.2	NP_065937.1	Q96RU2	UBP28_HUMAN	ubiquitin specific peptidase 28	289	USP.			VQLFYGTFLTEGVRE -> IVIVMSFLKSLSLCL (in Ref. 4; BAA96039). {ECO:0000305}.	cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|protein deubiquitination (GO:0016579)|response to ionizing radiation (GO:0010212)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.V289V(1)		breast(4)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(12)|lung(24)|ovary(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	59		all_cancers(61;3.74e-18)|all_epithelial(67;3.75e-11)|Melanoma(852;1.46e-05)|all_hematologic(158;4.65e-05)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|Prostate(24;0.0153)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|Epithelial(105;0.000122)|all cancers(92;0.00104)		AGAACAGCTGCACCATTGGAT	0.373																																					Melanoma(4;162 555 7664)|GBM(79;500 2010 17506)|Esophageal Squamous(9;463 924 15765)												1	Substitution - coding silent(1)	kidney(1)											171.0	162.0	165.0					11																	113701632		2201	4296	6497	SO:0001819	synonymous_variant	57646			AB040948	CCDS31680.1, CCDS73394.1	11q23	2008-04-11	2005-08-08		ENSG00000048028	ENSG00000048028		"""Ubiquitin-specific peptidases"""	12625	protein-coding gene	gene with protein product		610748	"""ubiquitin specific protease 28"""			12838346, 11597335	Standard	XM_005271630		Approved	KIAA1515	uc001poh.3	Q96RU2	OTTHUMG00000168205	ENST00000003302.4:c.867G>T	11.37:g.113701632C>A		Somatic		WXS	Illumina GAIIx	Phase_I	B0YJC0|B0YJC1|Q9P213	Silent	SNP	ENST00000003302.4	37	CCDS31680.1																																																																																				0.373	USP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398789.1			
VHL	7428	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	10188203	10188205	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10	CTT	CTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0198f3c3-78f2-4c19-90d5-c77b74044ca2	30e43131-d7aa-407d-9bed-28ae34db1b68	g.chr3:10188203_10188205delCTT	ENST00000256474.2	+	2	1186_1188	c.346_348delCTT	c.(346-348)cttdel	p.L116del	VHL_ENST00000477538.1_3'UTR|VHL_ENST00000345392.2_Intron	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	116	Involved in binding to CCT complex.		L -> V (in VHLD). {ECO:0000269|PubMed:8730290}.		cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.?(3)|p.L116fs*43(3)|p.W117fs*14(2)|p.L116L(1)|p.L116V(1)|p.H115fs*15(1)|p.L116fs*16(1)|p.W117fs*40(1)|p.W117fs*42(1)|p.H115fs*41(1)|p.H115fs*42(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		GATAGGTCACCTTTGGCTCTTCA	0.527		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																														yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	16	Deletion - Frameshift(10)|Unknown(3)|Substitution - Missense(1)|Substitution - coding silent(1)|Insertion - Frameshift(1)	kidney(16)	GRCh37	CM961424	VHL	M																																				SO:0001651	inframe_deletion	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.346_348delCTT	3.37:g.10188203_10188205delCTT	ENSP00000256474:p.Leu116del	Somatic		WXS	Illumina HiSeq	Phase_I	B2RE45|Q13599|Q6PDA9	In_Frame_Del	DEL	ENST00000256474.2	37	CCDS2597.1																																																																																				0.527	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	
AMOT	154796	broad.mit.edu	37	X	112048309	112048309	+	Missense_Mutation	SNP	G	G	C			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0198f3c3-78f2-4c19-90d5-c77b74044ca2	30e43131-d7aa-407d-9bed-28ae34db1b68	g.chrX:112048309G>C	ENST00000524145.1	-	6	1716	c.1642C>G	c.(1642-1644)Cag>Gag	p.Q548E	AMOT_ENST00000371958.1_Missense_Mutation_p.Q316E|AMOT_ENST00000371962.1_Missense_Mutation_p.Q316E|AMOT_ENST00000371959.3_Missense_Mutation_p.Q548E|AMOT_ENST00000304758.1_Missense_Mutation_p.Q139E			Q4VCS5	AMOT_HUMAN	angiomotin	548					actin cytoskeleton organization (GO:0030036)|blood vessel endothelial cell migration (GO:0043534)|cell migration involved in gastrulation (GO:0042074)|cell-cell junction assembly (GO:0007043)|cellular protein localization (GO:0034613)|chemotaxis (GO:0006935)|establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|gastrulation with mouth forming second (GO:0001702)|hippo signaling (GO:0035329)|in utero embryonic development (GO:0001701)|negative regulation of angiogenesis (GO:0016525)|negative regulation of GTPase activity (GO:0034260)|negative regulation of vascular permeability (GO:0043116)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell size (GO:0045793)|positive regulation of embryonic development (GO:0040019)|positive regulation of stress fiber assembly (GO:0051496)|regulation of cell migration (GO:0030334)|regulation of small GTPase mediated signal transduction (GO:0051056)|vasculogenesis (GO:0001570)	actin filament (GO:0005884)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|ruffle (GO:0001726)|stress fiber (GO:0001725)|tight junction (GO:0005923)	angiostatin binding (GO:0043532)|receptor activity (GO:0004872)	p.Q139E(1)|p.Q548E(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	43						TTCTCACGCTGGCTTTCTTTA	0.493																																																	2	Substitution - Missense(2)	kidney(2)											191.0	169.0	176.0					X																	112048309		2203	4300	6503	SO:0001583	missense	154796			AB028994	CCDS14563.1, CCDS48154.1	Xq23	2006-02-08			ENSG00000126016	ENSG00000126016			17810	protein-coding gene	gene with protein product		300410				11257124, 16043488, 12406577	Standard	NM_001113490		Approved	KIAA1071	uc004epr.3	Q4VCS5	OTTHUMG00000022216	ENST00000524145.1:c.1642C>G	X.37:g.112048309G>C	ENSP00000429013:p.Gln548Glu	Somatic		WXS	Illumina GAIIx	Phase_I	Q504X5|Q9HD27|Q9UPT1	Missense_Mutation	SNP	ENST00000524145.1	37	CCDS48154.1	.	.	.	.	.	.	.	.	.	.	g	14.08	2.427288	0.43122	.	.	ENSG00000126016	ENST00000304758;ENST00000371959;ENST00000371962;ENST00000524145;ENST00000371958	T;T;T;T;T	0.24350	1.86;1.86;1.86;1.86;1.86	5.96	5.09	0.68999	.	0.467991	0.25138	N	0.032844	T	0.23094	0.0558	M	0.74258	2.255	0.44908	D	0.997926	P	0.39391	0.671	B	0.29077	0.098	T	0.17228	-1.0376	10	0.02654	T	1	-2.7811	14.594	0.68392	0.0:0.0:0.8533:0.1467	.	548	Q4VCS5	AMOT_HUMAN	E	139;548;316;548;316	ENSP00000305557:Q139E;ENSP00000361027:Q548E;ENSP00000361030:Q316E;ENSP00000429013:Q548E;ENSP00000361026:Q316E	ENSP00000305557:Q139E	Q	-	1	0	AMOT	111934965	1.000000	0.71417	0.846000	0.33378	0.991000	0.79684	4.712000	0.61888	1.247000	0.43917	0.597000	0.82753	CAG		0.493	AMOT-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378570.1		NM_133265	
CCDC144A	9720	broad.mit.edu	37	17	16664760	16664760	+	Missense_Mutation	SNP	G	G	A			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0198f3c3-78f2-4c19-90d5-c77b74044ca2	30e43131-d7aa-407d-9bed-28ae34db1b68	g.chr17:16664760G>A	ENST00000360524.8	+	13	3470	c.3394G>A	c.(3394-3396)Gaa>Aaa	p.E1132K	RP11-219A15.1_ENST00000448331.3_Missense_Mutation_p.E1132K|CCDC144A_ENST00000443444.2_Missense_Mutation_p.E1132K|CCDC144A_ENST00000456009.1_Missense_Mutation_p.E898K|CCDC144A_ENST00000399273.1_Missense_Mutation_p.E1132K	NM_014695.1	NP_055510.1	A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A	1132								p.E1132K(1)									AGAAGCACAGGAAACTGTACC	0.333																																																	1	Substitution - Missense(1)	kidney(1)											6.0	7.0	6.0					17																	16664760		1578	3633	5211	SO:0001583	missense	9720			BC133019	CCDS45621.1	17p11.2	2008-10-23			ENSG00000170160	ENSG00000170160			29072	protein-coding gene	gene with protein product						9628581, 11997339	Standard	NM_014695		Approved	KIAA0565, FLJ43983	uc002gqk.1	A2RUR9	OTTHUMG00000059178	ENST00000360524.8:c.3394G>A	17.37:g.16664760G>A	ENSP00000353717:p.Glu1132Lys	Somatic		WXS	Illumina GAIIx	Phase_I	O60311|Q6ZU57	Missense_Mutation	SNP	ENST00000360524.8	37	CCDS45621.1	.	.	.	.	.	.	.	.	.	.	.	6.681	0.494324	0.12702	.	.	ENSG00000170160	ENST00000399273;ENST00000443444;ENST00000360524;ENST00000456009	T;T;T;T	0.02763	4.18;4.17;4.17;4.17	2.1	2.1	0.27182	.	.	.	.	.	T	0.02970	0.0088	N	0.25485	0.75	0.09310	N	0.999999	B;P	0.36222	0.244;0.544	B;B	0.38655	0.113;0.278	T	0.48175	-0.9058	9	0.37606	T	0.19	.	9.8677	0.41154	0.0:0.0:1.0:0.0	.	898;1132	A2RUR9-3;A2RUR9	.;C144A_HUMAN	K	1132;1132;1132;898	ENSP00000382215:E1132K;ENSP00000439262:E1132K;ENSP00000353717:E1132K;ENSP00000394201:E898K	ENSP00000353717:E1132K	E	+	1	0	CCDC144A	16605485	1.000000	0.71417	0.015000	0.15790	0.081000	0.17604	3.900000	0.56295	1.160000	0.42584	0.184000	0.17185	GAA		0.333	CCDC144A-013	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000444093.1			
CNDP1	84735	broad.mit.edu	37	18	72234669	72234669	+	Splice_Site	SNP	G	G	T			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0198f3c3-78f2-4c19-90d5-c77b74044ca2	30e43131-d7aa-407d-9bed-28ae34db1b68	g.chr18:72234669G>T	ENST00000358821.3	+	6	984		c.e6+1		CNDP1_ENST00000582365.1_Splice_Site	NM_032649.5	NP_116038	Q96KN2	CNDP1_HUMAN	carnosine dipeptidase 1 (metallopeptidase M20 family)							extracellular region (GO:0005576)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|tripeptidase activity (GO:0034701)	p.?(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(12)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27		Esophageal squamous(42;0.129)|Prostate(75;0.157)|Melanoma(33;0.211)		BRCA - Breast invasive adenocarcinoma(31;0.109)		CATGGTGGAGGTATCCACAGA	0.502																																					Melanoma(32;1029 1042 25286 38395 44237)												1	Unknown(1)	kidney(1)											73.0	67.0	69.0					18																	72234669		2203	4300	6503	SO:0001630	splice_region_variant	84735				CCDS12007.1	18q22.3	2014-07-14			ENSG00000150656	ENSG00000150656	3.4.13.20		20675	protein-coding gene	gene with protein product	"""carnosinase 1"", ""glutamate carboxypeptidase-like protein 2"""	609064				12473676	Standard	NM_032649		Approved	MGC10825, CN1, CPGL2, HsT2308	uc002llq.3	Q96KN2	OTTHUMG00000132852	ENST00000358821.3:c.756+1G>T	18.37:g.72234669G>T		Somatic		WXS	Illumina GAIIx	Phase_I	Q14D40|Q17S05|Q2TBG0|Q6UWK2|Q9BT98	Splice_Site	SNP	ENST00000358821.3	37	CCDS12007.1	.	.	.	.	.	.	.	.	.	.	G	13.22	2.173117	0.38413	.	.	ENSG00000150656	ENST00000358821	.	.	.	5.21	5.21	0.72293	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.3473	0.90326	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CNDP1	70385649	1.000000	0.71417	1.000000	0.80357	0.201000	0.24016	7.284000	0.78650	2.431000	0.82371	0.585000	0.79938	.		0.502	CNDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256326.1		NM_032649	Intron
EPHX1	2052	broad.mit.edu	37	1	226032308	226032308	+	Missense_Mutation	SNP	A	A	G			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0198f3c3-78f2-4c19-90d5-c77b74044ca2	30e43131-d7aa-407d-9bed-28ae34db1b68	g.chr1:226032308A>G	ENST00000366837.4	+	8	1346	c.1150A>G	c.(1150-1152)Acc>Gcc	p.T384A	RP11-285F7.2_ENST00000424332.1_RNA|EPHX1_ENST00000272167.5_Missense_Mutation_p.T384A	NM_000120.3	NP_000111.1	P07099	HYEP_HUMAN	epoxide hydrolase 1, microsomal (xenobiotic)	384					aromatic compound catabolic process (GO:0019439)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	cis-stilbene-oxide hydrolase activity (GO:0033961)|epoxide hydrolase activity (GO:0004301)	p.T384A(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(7)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	28	Breast(184;0.197)					GGGCTGGATGACCCAGAAGCA	0.622																																																	1	Substitution - Missense(1)	kidney(1)											61.0	52.0	55.0					1																	226032308		2203	4300	6503	SO:0001583	missense	2052			J03518	CCDS1547.1	1q42.1	2009-07-10			ENSG00000143819	ENSG00000143819	3.3.2.9		3401	protein-coding gene	gene with protein product		132810		EPHX		9925921	Standard	NM_000120		Approved		uc001hpk.3	P07099	OTTHUMG00000037743	ENST00000366837.4:c.1150A>G	1.37:g.226032308A>G	ENSP00000355802:p.Thr384Ala	Somatic		WXS	Illumina GAIIx	Phase_I	B2R8N0|Q5VTJ6|Q9NP75|Q9NPE7|Q9NQU6|Q9NQU7|Q9NQU8|Q9NQU9|Q9NQV0|Q9NQV1|Q9NQV2	Missense_Mutation	SNP	ENST00000366837.4	37	CCDS1547.1	.	.	.	.	.	.	.	.	.	.	A	7.350	0.622642	0.14193	.	.	ENSG00000143819	ENST00000272167;ENST00000366837	T;T	0.26810	1.71;1.71	5.02	-6.24	0.02046	Alpha/beta hydrolase fold-1 (1);	2.299120	0.01467	N	0.016132	T	0.10895	0.0266	N	0.05230	-0.09	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.44283	-0.9338	10	0.02654	T	1	-17.3512	12.3198	0.54979	0.7685:0.108:0.1236:0.0	.	384	P07099	HYEP_HUMAN	A	384	ENSP00000272167:T384A;ENSP00000355802:T384A	ENSP00000272167:T384A	T	+	1	0	EPHX1	224098931	0.000000	0.05858	0.000000	0.03702	0.872000	0.50106	-0.104000	0.10923	-0.877000	0.04012	-0.366000	0.07423	ACC		0.622	EPHX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092064.1		NM_000120	
GTF3C4	9329	broad.mit.edu	37	9	135555166	135555166	+	Silent	SNP	A	A	G			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0198f3c3-78f2-4c19-90d5-c77b74044ca2	30e43131-d7aa-407d-9bed-28ae34db1b68	g.chr9:135555166A>G	ENST00000372146.4	+	2	2724	c.2160A>G	c.(2158-2160)gaA>gaG	p.E720E		NM_012204.2	NP_036336.2	Q9UKN8	TF3C4_HUMAN	general transcription factor IIIC, polypeptide 4, 90kDa	720					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|positive regulation of catalytic activity (GO:0043085)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase III promoter (GO:0006384)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)|enzyme activator activity (GO:0008047)|histone acetyltransferase activity (GO:0004402)	p.E720E(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|skin(1)	20				OV - Ovarian serous cystadenocarcinoma(145;8.15e-07)|Epithelial(140;2.6e-05)		TGTCTGATGAAGAGTATGATG	0.408																																					Pancreas(142;417 1875 11086 31973 47667)												1	Substitution - coding silent(1)	kidney(1)											72.0	71.0	72.0					9																	135555166		2203	4300	6503	SO:0001819	synonymous_variant	9329			AF142328	CCDS6953.1	9q34.3	2011-07-01	2002-08-29		ENSG00000125484	ENSG00000125484		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""General transcription factors"""	4667	protein-coding gene	gene with protein product		604892	"""general transcription factor IIIC, polypeptide 4 (90kD)"""			10523658	Standard	NM_012204		Approved	TFIIIC90, KAT12	uc010mzv.3	Q9UKN8	OTTHUMG00000020842	ENST00000372146.4:c.2160A>G	9.37:g.135555166A>G		Somatic		WXS	Illumina GAIIx	Phase_I	Q5VZJ7	Silent	SNP	ENST00000372146.4	37	CCDS6953.1																																																																																				0.408	GTF3C4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054792.1			
MUC4	4585	broad.mit.edu	37	3	195510108	195510108	+	Silent	SNP	G	G	A	rs371875294	byFrequency	TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0198f3c3-78f2-4c19-90d5-c77b74044ca2	30e43131-d7aa-407d-9bed-28ae34db1b68	g.chr3:195510108G>A	ENST00000463781.3	-	2	8802	c.8343C>T	c.(8341-8343)caC>caT	p.H2781H	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Silent_p.H2781H|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.H2781H(4)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGGGTGGCGTGACCTGTGG	0.592													.|||	19	0.00379393	0.0129	0.0014	5008	,	,		5980	0.0		0.0	False		,,,				2504	0.001																4	Substitution - coding silent(4)	kidney(3)|endometrium(1)											44.0	27.0	32.0					3																	195510108		687	1544	2231	SO:0001819	synonymous_variant	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8343C>T	3.37:g.195510108G>A		Somatic		WXS	Illumina GAIIx	Phase_I	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																				0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6		NM_018406	
PTPRCAP	5790	broad.mit.edu	37	11	67203476	67203476	+	Missense_Mutation	SNP	G	G	T			TCGA-AK-3458-01A-01D-1501-10	TCGA-AK-3458-10A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0198f3c3-78f2-4c19-90d5-c77b74044ca2	30e43131-d7aa-407d-9bed-28ae34db1b68	g.chr11:67203476G>T	ENST00000326294.3	-	2	796	c.349C>A	c.(349-351)Cac>Aac	p.H117N	CORO1B_ENST00000539724.1_5'Flank|AP003419.16_ENST00000535922.1_RNA	NM_005608.2	NP_005599.1	Q14761	PTCA_HUMAN	protein tyrosine phosphatase, receptor type, C-associated protein	117					defense response (GO:0006952)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.H117N(1)		skin(1)|upper_aerodigestive_tract(1)	2			BRCA - Breast invasive adenocarcinoma(15;3.26e-06)			TCCGCGACGTGGTCATAGTCT	0.667																																																	1	Substitution - Missense(1)	kidney(1)											78.0	61.0	66.0					11																	67203476		2200	4295	6495	SO:0001583	missense	5790				CCDS8163.1	11q13.2	2011-06-09			ENSG00000213402	ENSG00000213402			9667	protein-coding gene	gene with protein product		601577					Standard	NM_005608		Approved	LPAP, CD45-AP	uc001oli.1	Q14761	OTTHUMG00000150325	ENST00000326294.3:c.349C>A	11.37:g.67203476G>T	ENSP00000325589:p.His117Asn	Somatic		WXS	Illumina GAIIx	Phase_I	B2R512|O00643|Q6I9S6	Missense_Mutation	SNP	ENST00000326294.3	37	CCDS8163.1	.	.	.	.	.	.	.	.	.	.	G	8.717	0.913429	0.17907	.	.	ENSG00000213402	ENST00000326294	T	0.46451	0.87	3.69	-6.58	0.01836	.	1.183380	0.06861	U	0.799154	T	0.19327	0.0464	N	0.19112	0.55	0.09310	N	1	B	0.09022	0.002	B	0.01281	0.0	T	0.16660	-1.0395	10	0.25106	T	0.35	-2.5126	2.0133	0.03493	0.1749:0.493:0.1053:0.2268	.	117	Q14761	PTCA_HUMAN	N	117	ENSP00000325589:H117N	ENSP00000325589:H117N	H	-	1	0	PTPRCAP	66960052	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.776000	0.04674	-1.089000	0.03073	-1.263000	0.01449	CAC		0.667	PTPRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317563.1		NM_005608	
