#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ABCA12	26154	hgsc.bcm.edu	37	2	215845228	215845228	+	Silent	SNP	G	G	A			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr2:215845228G>A	ENST00000272895.7	-	31	4938	c.4719C>T	c.(4717-4719)caC>caT	p.H1573H	ABCA12_ENST00000389661.4_Silent_p.H1255H	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	1573	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		TAAGCGTGAGGTGATACCCAT	0.473																																					Ovarian(66;664 1488 5121 34295)												0													85.0	82.0	83.0					2																	215845228		2203	4300	6503	SO:0001819	synonymous_variant	26154			AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.4719C>T	2.37:g.215845228G>A		Somatic		WXS	SOLID	Phase_I	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Silent	SNP	ENST00000272895.7	37	CCDS33372.1																																																																																				0.473	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1		NM_173076	
ADNP2	22850	hgsc.bcm.edu;ucsc.edu	37	18	77894041	77894041	+	Missense_Mutation	SNP	T	T	G			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr18:77894041T>G	ENST00000262198.4	+	4	1200	c.745T>G	c.(745-747)Tct>Gct	p.S249A		NM_014913.3	NP_055728.1	Q6IQ32	ADNP2_HUMAN	ADNP homeobox 2	249					cellular response to oxidative stress (GO:0034599)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell death (GO:0060548)|neuron differentiation (GO:0030182)|positive regulation of cell growth (GO:0030307)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(9)|liver(1)|lung(15)|ovary(5)|prostate(2)	42		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)		TAAGCTTAGATCTGTGATTTC	0.433																																																	0													75.0	76.0	75.0					18																	77894041		2203	4300	6503	SO:0001583	missense	22850			AB020670	CCDS32853.1	18q23	2013-01-07	2007-07-17	2007-07-17	ENSG00000101544	ENSG00000101544		"""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	23803	protein-coding gene	gene with protein product			"""zinc finger protein 508"""	ZNF508			Standard	NM_014913		Approved	KIAA0863	uc002lnw.3	Q6IQ32	OTTHUMG00000172535	ENST00000262198.4:c.745T>G	18.37:g.77894041T>G	ENSP00000262198:p.Ser249Ala	Somatic		WXS	SOLID	Phase_I	A8K951|O94943|Q9H9P3	Missense_Mutation	SNP	ENST00000262198.4	37	CCDS32853.1	.	.	.	.	.	.	.	.	.	.	T	11.78	1.740047	0.30865	.	.	ENSG00000101544	ENST00000262198	.	.	.	5.41	5.41	0.78517	.	0.094910	0.46145	D	0.000303	T	0.19327	0.0464	N	0.19112	0.55	0.28984	N	0.888481	P	0.40970	0.734	B	0.35470	0.203	T	0.10497	-1.0627	8	.	.	.	-29.2533	6.876	0.24147	0.0:0.0751:0.1524:0.7725	.	249	Q6IQ32	ADNP2_HUMAN	A	249	.	.	S	+	1	0	ADNP2	75995032	0.969000	0.33509	0.931000	0.37212	0.999000	0.98932	1.504000	0.35726	2.281000	0.76405	0.533000	0.62120	TCT		0.433	ADNP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418979.1		NM_014913	
AHRR	57491	hgsc.bcm.edu;ucsc.edu	37	5	413518	413518	+	Silent	SNP	A	A	G			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr5:413518A>G	ENST00000505113.1	+	5	467	c.423A>G	c.(421-423)gcA>gcG	p.A141A	AHRR_ENST00000512529.1_5'UTR|AHRR_ENST00000316418.5_Silent_p.A141A	NM_001242412.1	NP_001229341.1	A9YTQ3	AHRR_HUMAN	aryl-hydrocarbon receptor repressor	141	PAS. {ECO:0000255|PROSITE- ProRule:PRU00140}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of protein sumoylation (GO:0033235)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(2)|endometrium(4)|large_intestine(1)|lung(12)|prostate(1)	20			Epithelial(17;0.0011)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00354)|Lung(60;0.0863)			ATGCATCAGCAACGATCGTGG	0.398																																																	0													135.0	124.0	128.0					5																	413518		1907	4115	6022	SO:0001819	synonymous_variant	57491			AB033060	CCDS43297.1, CCDS56355.1	5p15.33	2013-05-21	2003-09-11	2003-09-12	ENSG00000063438	ENSG00000063438		"""Basic helix-loop-helix proteins"""	346	protein-coding gene	gene with protein product		606517	"""aryl hydrocarbon receptor regulator"""	AHH, AHHR		1070014, 11423533	Standard	NM_020731		Approved	KIAA1234, bHLHe77	uc003jaw.3	A9YTQ3	OTTHUMG00000162171	ENST00000505113.1:c.423A>G	5.37:g.413518A>G		Somatic		WXS	SOLID	Phase_I	A7MBN5|D6RAZ1|Q9HAZ3|Q9ULI6	Silent	SNP	ENST00000505113.1	37	CCDS56355.1																																																																																				0.398	AHRR-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000367720.1		NM_020731	
ANAPC7	51434	hgsc.bcm.edu	37	12	110820691	110820691	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr12:110820691A>T	ENST00000455511.3	-	7	994	c.994T>A	c.(994-996)Ttc>Atc	p.F332I	ANAPC7_ENST00000450008.2_Missense_Mutation_p.F332I	NM_016238.2	NP_057322.2	Q9UJX3	APC7_HUMAN	anaphase promoting complex subunit 7	332					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)			breast(3)|endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)	19						GAGATATTGAAAAGGCGGCAT	0.453																																																	0													213.0	205.0	208.0					12																	110820691		2203	4300	6503	SO:0001583	missense	51434			AF191340	CCDS9145.2, CCDS44971.1	12q13.12	2013-01-10			ENSG00000196510	ENSG00000196510		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	17380	protein-coding gene	gene with protein product		606949					Standard	NM_016238		Approved	APC7	uc001tqo.2	Q9UJX3	OTTHUMG00000157009	ENST00000455511.3:c.994T>A	12.37:g.110820691A>T	ENSP00000394394:p.Phe332Ile	Somatic		WXS	SOLID	Phase_I	Q96AC4|Q96GF4|Q9BU24|Q9NT16	Missense_Mutation	SNP	ENST00000455511.3	37	CCDS9145.2	.	.	.	.	.	.	.	.	.	.	A	11.75	1.730450	0.30684	.	.	ENSG00000196510	ENST00000455511;ENST00000450008;ENST00000471602;ENST00000548234	T;T	0.61742	0.08;0.75	5.89	5.89	0.94794	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.53818	0.1820	N	0.10874	0.06	0.58432	D	0.999999	D;B	0.57899	0.981;0.055	D;B	0.69142	0.962;0.008	T	0.50931	-0.8769	10	0.02654	T	1	-5.4396	16.3158	0.82923	1.0:0.0:0.0:0.0	.	332;332	Q9UJX3-2;Q9UJX3	.;APC7_HUMAN	I	332;332;25;34	ENSP00000394394:F332I;ENSP00000402314:F332I	ENSP00000402314:F332I	F	-	1	0	ANAPC7	109305074	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	8.930000	0.92872	2.254000	0.74563	0.533000	0.62120	TTC		0.453	ANAPC7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347075.3		NM_016238	
ARHGAP17	55114	hgsc.bcm.edu	37	16	24960732	24960732	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr16:24960732T>A	ENST00000289968.6	-	13	1189	c.1120A>T	c.(1120-1122)Aac>Tac	p.N374Y	ARHGAP17_ENST00000441763.2_3'UTR|ARHGAP17_ENST00000303665.5_Missense_Mutation_p.N374Y	NM_001006634.1	NP_001006635.1	Q68EM7	RHG17_HUMAN	Rho GTPase activating protein 17	374	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	GTPase activator activity (GO:0005096)			breast(2)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|urinary_tract(2)	30				GBM - Glioblastoma multiforme(48;0.0407)		TACCTAAAGTTAACAAAATTT	0.363																																																	0													110.0	98.0	102.0					16																	24960732		2196	4300	6496	SO:0001583	missense	55114			AJ306731	CCDS32408.1, CCDS32409.1	16p12.2-p12.1	2011-06-29				ENSG00000140750		"""Rho GTPase activating proteins"""	18239	protein-coding gene	gene with protein product		608293				10967100, 11431473	Standard	XM_005255413		Approved	RICH1, FLJ10308, NADRIN, FLJ13219, WBP15	uc002dnb.3	Q68EM7		ENST00000289968.6:c.1120A>T	16.37:g.24960732T>A	ENSP00000289968:p.Asn374Tyr	Somatic		WXS	SOLID	Phase_I	A8K6M6|Q6ZUS4|Q7Z2F2|Q8NDG2|Q96KS2|Q96KS3|Q96SS8|Q9BVF6|Q9H8U5|Q9NW54	Missense_Mutation	SNP	ENST00000289968.6	37	CCDS32409.1	.	.	.	.	.	.	.	.	.	.	T	25.9	4.686981	0.88639	.	.	ENSG00000140750	ENST00000289968;ENST00000303665;ENST00000455311	T;T	0.18338	2.22;2.22	6.06	6.06	0.98353	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.45867	D	0.000328	T	0.50086	0.1595	M	0.90814	3.15	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.59236	-0.7492	10	0.72032	D	0.01	.	14.5614	0.68140	0.0:0.0:0.0:1.0	.	374;374;374	C9IZD3;Q68EM7-2;Q68EM7	.;.;RHG17_HUMAN	Y	374	ENSP00000289968:N374Y;ENSP00000303130:N374Y	ENSP00000289968:N374Y	N	-	1	0	ARHGAP17	24868233	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.111000	0.77077	2.324000	0.78689	0.533000	0.62120	AAC		0.363	ARHGAP17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436548.3		NM_018054	
ARHGEF5	7984	hgsc.bcm.edu	37	7	144061222	144061222	+	Missense_Mutation	SNP	A	A	G	rs1209412		TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr7:144061222A>G	ENST00000056217.5	+	2	1634	c.1460A>G	c.(1459-1461)gAa>gGa	p.E487G	ARHGEF5_ENST00000471847.2_5'Flank	NM_005435.3	NP_005426.2	Q12774	ARHG5_HUMAN	Rho guanine nucleotide exchange factor (GEF) 5	487				E -> G (in Ref. 2; BAD18708). {ECO:0000305}.	actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)|myeloid dendritic cell chemotaxis (GO:0002408)|positive regulation of podosome assembly (GO:0071803)|regulation of Rho GTPase activity (GO:0032319)		GTP binding (GO:0005525)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.E487G(5)		breast(1)|endometrium(6)|kidney(8)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Melanoma(164;0.14)					CAGCAAGAGGAATCCAGGCTG	0.537																																																	5	Substitution - Missense(5)	kidney(5)											33.0	30.0	31.0					7																	144061222		1051	1888	2939	SO:0001583	missense	7984			U02082	CCDS34771.1	7q35	2012-09-20			ENSG00000050327	ENSG00000050327		"""Rho guanine nucleotide exchange factors"""	13209	protein-coding gene	gene with protein product	"""transforming immortalized mammary oncogene"", ""guanine nucleotide regulatory protein TIM"""	600888				8134109, 7656213	Standard	NM_005435		Approved	TIM, TIM1, GEF5, P60	uc003wel.3	Q12774	OTTHUMG00000158004	ENST00000056217.5:c.1460A>G	7.37:g.144061222A>G	ENSP00000056217:p.Glu487Gly	Somatic		WXS	SOLID	Phase_I	A6NNJ2|Q6ZML7	Missense_Mutation	SNP	ENST00000056217.5	37	CCDS34771.1	.	.	.	.	.	.	.	.	.	.	G	0.025	-1.380873	0.01204	.	.	ENSG00000050327	ENST00000056217	T	0.74842	-0.88	3.96	-1.85	0.07784	.	0.740232	0.11016	N	0.608952	T	0.38054	0.1026	N	0.01168	-0.975	0.36950	P	0.10716800000000004	B	0.02656	0.0	B	0.01281	0.0	T	0.33624	-0.9861	8	.	.	.	-1.3111	5.374	0.16154	0.5924:0.1606:0.247:0.0	.	487	Q12774	ARHG5_HUMAN	G	487	ENSP00000056217:E487G	.	E	+	2	0	ARHGEF5	143692155	0.000000	0.05858	0.017000	0.16124	0.097000	0.18754	-1.265000	0.02844	-0.559000	0.06110	-1.294000	0.01345	GAA		0.537	ARHGEF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349981.1		NM_005435	
ARVCF	421	hgsc.bcm.edu;ucsc.edu	37	22	19969473	19969473	+	Missense_Mutation	SNP	G	G	C	rs372018220		TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr22:19969473G>C	ENST00000263207.3	-	4	643	c.352C>G	c.(352-354)Cgg>Ggg	p.R118G	ARVCF_ENST00000401994.1_Missense_Mutation_p.R55G|ARVCF_ENST00000406259.1_Missense_Mutation_p.R118G|ARVCF_ENST00000406522.1_Missense_Mutation_p.R55G|ARVCF_ENST00000344269.3_Missense_Mutation_p.R55G|ARVCF_ENST00000487793.1_5'UTR	NM_001670.2	NP_001661.1	O00192	ARVC_HUMAN	armadillo repeat gene deleted in velocardiofacial syndrome	118					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|single organismal cell-cell adhesion (GO:0016337)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|endometrium(3)|liver(1)|lung(4)|prostate(1)|urinary_tract(2)	13	Colorectal(54;0.0993)					TCGGTGCGCCGGGTTGTGCCA	0.632																																																	0													99.0	75.0	83.0					22																	19969473		2203	4299	6502	SO:0001583	missense	421				CCDS13771.1	22q11.21	2013-02-14	2010-04-28		ENSG00000099889	ENSG00000099889		"""Armadillo repeat containing"""	728	protein-coding gene	gene with protein product		602269				9126485, 15456900	Standard	NM_001670		Approved		uc002zqz.3	O00192	OTTHUMG00000030426	ENST00000263207.3:c.352C>G	22.37:g.19969473G>C	ENSP00000263207:p.Arg118Gly	Somatic		WXS	SOLID	Phase_I	B7WNV2	Missense_Mutation	SNP	ENST00000263207.3	37	CCDS13771.1	.	.	.	.	.	.	.	.	.	.	G	15.20	2.763701	0.49574	.	.	ENSG00000099889	ENST00000263207;ENST00000344269;ENST00000401994;ENST00000406522;ENST00000406259	T;T;T;T;T	0.32753	1.44;1.44;1.44;1.44;1.44	3.45	3.45	0.39498	.	.	.	.	.	T	0.48642	0.1511	M	0.66939	2.045	0.54753	D	0.999988	D	0.69078	0.997	D	0.76071	0.987	T	0.42932	-0.9422	8	.	.	.	-13.4396	9.1927	0.37209	0.0:0.0:0.6131:0.3869	.	118	O00192	ARVC_HUMAN	G	118;55;55;55;118	ENSP00000263207:R118G;ENSP00000342042:R55G;ENSP00000384341:R55G;ENSP00000384732:R55G;ENSP00000385444:R118G	.	R	-	1	2	ARVCF	18349473	0.623000	0.27094	0.952000	0.39060	0.591000	0.36615	0.874000	0.28065	2.217000	0.71921	0.462000	0.41574	CGG		0.632	ARVCF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000075314.5		NM_001670	
ATRNL1	26033	hgsc.bcm.edu;ucsc.edu	37	10	117075206	117075206	+	Silent	SNP	C	C	T			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr10:117075206C>T	ENST00000355044.3	+	18	3123	c.2997C>T	c.(2995-2997)ccC>ccT	p.P999P	ATRNL1_ENST00000423111.2_Silent_p.P96P|ATRNL1_ENST00000303745.7_5'UTR	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	999	PSI 5.				G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		ATCTTTGCCCCAAAGAAAAGA	0.408																																																	0													103.0	98.0	100.0					10																	117075206		2203	4300	6503	SO:0001819	synonymous_variant	26033			AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.2997C>T	10.37:g.117075206C>T		Somatic		WXS	SOLID	Phase_I	O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Silent	SNP	ENST00000355044.3	37	CCDS7592.1	.	.	.	.	.	.	.	.	.	.	C	9.052	0.992449	0.18966	.	.	ENSG00000107518	ENST00000526373	.	.	.	5.34	-0.14	0.13456	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-13.0648	3.6639	0.08249	0.2646:0.3933:0.0:0.3421	.	.	.	.	X	129	.	.	Q	+	1	0	ATRNL1	117065196	0.067000	0.21026	0.997000	0.53966	0.992000	0.81027	-0.578000	0.05841	-0.076000	0.12775	0.455000	0.32223	CAA		0.408	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050507.3		XM_049349	
ATXN1L	342371	hgsc.bcm.edu	37	16	71884268	71884268	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr16:71884268G>T	ENST00000427980.2	+	3	918	c.625G>T	c.(625-627)Ggg>Tgg	p.G209W	ATXN1L_ENST00000569119.1_Intron	NM_001137675.3	NP_001131147.1	P0C7T5	ATX1L_HUMAN	ataxin 1-like	209	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell projection (GO:0042995)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(3)	4						CTCCCCATCTGGGCAATTGCC	0.557																																																	0													29.0	27.0	27.0					16																	71884268		692	1591	2283	SO:0001583	missense	342371				CCDS45523.1	16q22.2	2014-09-04			ENSG00000224470	ENSG00000224470			33279	protein-coding gene	gene with protein product	"""brother of ataxin 1"""	614301				16121196, 17322884, 21475249	Standard	NM_001137675		Approved	BOAT1	uc002fbd.3	P0C7T5	OTTHUMG00000176872	ENST00000427980.2:c.625G>T	16.37:g.71884268G>T	ENSP00000415822:p.Gly209Trp	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000427980.2	37	CCDS45523.1	.	.	.	.	.	.	.	.	.	.	G	15.52	2.856984	0.51376	.	.	ENSG00000224470	ENST00000427980	T	0.35236	1.32	5.5	5.5	0.81552	.	.	.	.	.	T	0.25865	0.0630	N	0.14661	0.345	0.29466	N	0.857394	P	0.39131	0.661	B	0.33042	0.157	T	0.24870	-1.0148	9	0.72032	D	0.01	.	18.7637	0.91864	0.0:0.0:1.0:0.0	.	209	P0C7T5	ATX1L_HUMAN	W	209	ENSP00000415822:G209W	ENSP00000415822:G209W	G	+	1	0	ATXN1L	70441769	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	5.624000	0.67764	2.764000	0.94973	0.555000	0.69702	GGG		0.557	ATXN1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434171.1		NM_001137675.2	
BCL2L14	79370	hgsc.bcm.edu;ucsc.edu	37	12	12232325	12232325	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr12:12232325A>T	ENST00000308721.5	+	2	292	c.86A>T	c.(85-87)tAc>tTc	p.Y29F	BCL2L14_ENST00000266434.4_Missense_Mutation_p.Y29F|BCL2L14_ENST00000589718.1_Missense_Mutation_p.Y29F|BCL2L14_ENST00000396369.1_Missense_Mutation_p.Y29F|BCL2L14_ENST00000396367.1_Missense_Mutation_p.Y29F|BCL2L14_ENST00000586576.1_Missense_Mutation_p.Y62F	NM_138723.1	NP_620049.1	Q9BZR8	B2L14_HUMAN	BCL2-like 14 (apoptosis facilitator)	29					apoptotic process (GO:0006915)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|regulation of apoptotic process (GO:0042981)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular organelle (GO:0043229)|membrane (GO:0016020)	protein kinase binding (GO:0019901)			large_intestine(1)|lung(2)|skin(3)	6		Prostate(47;0.0872)		BRCA - Breast invasive adenocarcinoma(232;0.154)		ATCCTCGCCTACTACACCAGA	0.488																																																	0													136.0	120.0	125.0					12																	12232325		2203	4300	6503	SO:0001583	missense	79370			AF281254	CCDS8645.1, CCDS8646.1	12p13-p12	2014-03-07			ENSG00000121380	ENSG00000121380			16657	protein-coding gene	gene with protein product		606126				11054413	Standard	NM_030766		Approved	BCLG, BCL-G	uc001rac.3	Q9BZR8	OTTHUMG00000159528	ENST00000308721.5:c.86A>T	12.37:g.12232325A>T	ENSP00000309132:p.Tyr29Phe	Somatic		WXS	SOLID	Phase_I	A8KAD0|Q96QR5|Q9BZR7	Missense_Mutation	SNP	ENST00000308721.5	37	CCDS8645.1	.	.	.	.	.	.	.	.	.	.	A	0.005	-2.181943	0.00308	.	.	ENSG00000121380	ENST00000464885;ENST00000461264;ENST00000308721;ENST00000266434;ENST00000396369;ENST00000396367	.	.	.	4.11	-1.58	0.08479	.	0.361702	0.26590	N	0.023539	T	0.06781	0.0173	N	0.00788	-1.185	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.10450	0.005;0.003	T	0.40194	-0.9576	9	0.02654	T	1	-11.4484	9.151	0.36962	0.7094:0.0:0.0:0.2906	.	29;29	Q9BZR8-2;Q9BZR8	.;B2L14_HUMAN	F	29;32;29;29;29;29	.	ENSP00000266434:Y29F	Y	+	2	0	BCL2L14	12123592	0.924000	0.31332	0.113000	0.21522	0.029000	0.11900	0.314000	0.19432	-0.251000	0.09542	0.460000	0.39030	TAC		0.488	BCL2L14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355994.3		NM_030766	
STPG1	90529	hgsc.bcm.edu;ucsc.edu	37	1	24710488	24710488	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr1:24710488A>T	ENST00000374409.1	-	4	449	c.195T>A	c.(193-195)gaT>gaA	p.D65E	STPG1_ENST00000003583.8_Missense_Mutation_p.D18E|STPG1_ENST00000440416.1_Missense_Mutation_p.D18E|STPG1_ENST00000468303.1_5'UTR|STPG1_ENST00000337248.4_Missense_Mutation_p.D65E	NM_001199012.1	NP_001185941.1	Q5TH74	STPG1_HUMAN	sperm-tail PG-rich repeat containing 1	65					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)|nucleus (GO:0005634)											GTCCTGGGATATCATTCTGAA	0.433																																																	0													156.0	143.0	147.0					1																	24710488		2203	4300	6503	SO:0001583	missense	0			BC047705	CCDS253.1, CCDS55581.1	1p36.11	2012-10-31	2012-07-30	2012-07-30	ENSG00000001460	ENSG00000001460			28070	protein-coding gene	gene with protein product	"""O6-methylguanine-induced apoptosis 2"""	615826	"""chromosome 1 open reading frame 201"""	C1orf201		23028632	Standard	NM_001199012		Approved	FLJ33340, MAPO2	uc001bjc.3	Q5TH74	OTTHUMG00000003297	ENST00000374409.1:c.195T>A	1.37:g.24710488A>T	ENSP00000363530:p.Asp65Glu	Somatic		WXS	SOLID	Phase_I	Q49AP0|Q6P3R4|Q86VU9|Q8WVQ3	Missense_Mutation	SNP	ENST00000374409.1	37	CCDS55581.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	0.379|0.379	-0.929555|-0.929555	0.02359|0.02359	.|.	.|.	ENSG00000001460|ENSG00000001460	ENST00000374409;ENST00000440416;ENST00000003583;ENST00000337248;ENST00000437986|ENST00000435187	.|.	.|.	.|.	6.03|6.03	-9.71|-9.71	0.00518|0.00518	.|.	0.520075|.	0.19756|.	N|.	0.106775|.	T|T	0.14227|0.14227	0.0344|0.0344	N|N	0.16478|0.16478	0.41|0.41	0.09310|0.09310	N|N	1|1	B;B|.	0.11235|.	0.003;0.004|.	B;B|.	0.11329|.	0.003;0.006|.	T|T	0.14811|0.14811	-1.0459|-1.0459	9|5	0.06757|.	T|.	0.87|.	-1.9517|-1.9517	2.5784|2.5784	0.04812|0.04812	0.3142:0.0867:0.3647:0.2344|0.3142:0.0867:0.3647:0.2344	.|.	65;18|.	Q5TH74;Q5TH74-3|.	CA201_HUMAN;.|.	E|K	65;18;18;65;65|42	.|.	ENSP00000003583:D18E|.	D|I	-|-	3|2	2|0	C1orf201|C1orf201	24583075|24583075	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.028000|0.028000	0.11728|0.11728	-1.145000|-1.145000	0.03194|0.03194	-1.677000|-1.677000	0.01455|0.01455	-1.426000|-1.426000	0.01102|0.01102	GAT|ATA		0.433	STPG1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009172.1		NM_178122	
BRK1	55845	hgsc.bcm.edu	37	3	10167959	10167959	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr3:10167959A>C	ENST00000530758.1	+	3	318	c.208A>C	c.(208-210)Aaa>Caa	p.K70Q	BRK1_ENST00000256463.6_Missense_Mutation_p.K70Q	NM_018462.4	NP_060932.2	Q8WUW1	BRK1_HUMAN	BRICK1, SCAR/WAVE actin-nucleating complex subunit	70					actin cytoskeleton organization (GO:0030036)|cell motility (GO:0048870)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|positive regulation of cell proliferation (GO:0008284)|positive regulation of lamellipodium assembly (GO:0010592)|protein homotrimerization (GO:0070207)|Rac protein signal transduction (GO:0016601)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)			breast(1)|skin(1)	2						ACAGGTGACAAAAGGTGAGAC	0.438																																																	0													41.0	37.0	38.0					3																	10167959		1882	4108	5990	SO:0001583	missense	0			AF161418	CCDS54553.1	3p25.3	2011-06-07	2011-06-07	2011-06-07	ENSG00000254999	ENSG00000254999			23057	protein-coding gene	gene with protein product	"""haematopoietic stem/progenitor cell protein 300"", ""BRICK1, SCAR/WAVE actin-nucleating complex subunit, homolog (Arabidopsis thaliana)"""	611183	"""chromosome 3 open reading frame 10"""	C3orf10		14695531	Standard	NM_018462		Approved	MDS027, HSPC300	uc003bvb.3	Q8WUW1	OTTHUMG00000155400	ENST00000530758.1:c.208A>C	3.37:g.10167959A>C	ENSP00000432472:p.Lys70Gln	Somatic		WXS	SOLID	Phase_I	B2R5E2|Q9P082	Missense_Mutation	SNP	ENST00000530758.1	37	CCDS54553.1	.	.	.	.	.	.	.	.	.	.	A	15.35	2.808023	0.50421	.	.	ENSG00000254999	ENST00000530758;ENST00000256463	.	.	.	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.52693	0.1750	.	.	.	0.38394	D	0.945497	B	0.18610	0.029	B	0.14578	0.011	T	0.52548	-0.8561	8	0.39692	T	0.17	.	13.8402	0.63435	1.0:0.0:0.0:0.0	.	70	Q8WUW1	BRK1_HUMAN	Q	70	.	ENSP00000444659:K70Q	K	+	1	0	BRK1	10142959	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	5.367000	0.66127	2.157000	0.67596	0.524000	0.50904	AAA		0.438	BRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339900.2		NM_018462	
C6orf211	79624	hgsc.bcm.edu	37	6	151790069	151790069	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr6:151790069C>T	ENST00000367294.3	+	5	1409	c.1150C>T	c.(1150-1152)Cca>Tca	p.P384S	C6orf211_ENST00000545879.1_Missense_Mutation_p.P265S	NM_024573.1	NP_078849.1	Q9H993	CF211_HUMAN	chromosome 6 open reading frame 211	384										breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(7)	15			BRCA - Breast invasive adenocarcinoma(37;0.183)	OV - Ovarian serous cystadenocarcinoma(155;5.27e-11)		GTTTTCTGTTCCATTTCATCA	0.418																																																	0													64.0	69.0	67.0					6																	151790069		2203	4300	6503	SO:0001583	missense	79624			AJ420548	CCDS5233.1, CCDS69224.1	6q25.1	2013-01-07			ENSG00000146476	ENSG00000146476			17872	protein-coding gene	gene with protein product							Standard	NM_001286562		Approved	FLJ12910	uc003qok.1	Q9H993	OTTHUMG00000015838	ENST00000367294.3:c.1150C>T	6.37:g.151790069C>T	ENSP00000356263:p.Pro384Ser	Somatic		WXS	SOLID	Phase_I	Q96FC6|Q9UFY5	Missense_Mutation	SNP	ENST00000367294.3	37	CCDS5233.1	.	.	.	.	.	.	.	.	.	.	C	12.13	1.844358	0.32606	.	.	ENSG00000146476	ENST00000367294;ENST00000545879	T;T	0.08282	3.11;3.11	6.16	5.29	0.74685	Domain of unknown function DUF89 (2);	0.287421	0.39210	N	0.001434	T	0.05777	0.0151	L	0.39566	1.225	0.29831	N	0.830056	B	0.31519	0.327	B	0.41619	0.361	T	0.24048	-1.0171	10	0.33940	T	0.23	.	14.9931	0.71406	0.0:0.9326:0.0:0.0674	.	384	Q9H993	CF211_HUMAN	S	384;265	ENSP00000356263:P384S;ENSP00000444121:P265S	ENSP00000356263:P384S	P	+	1	0	C6orf211	151831762	0.408000	0.25360	0.264000	0.24511	0.877000	0.50540	1.744000	0.38268	2.937000	0.99478	0.650000	0.86243	CCA		0.418	C6orf211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042724.1		NM_024573	
CBLL1	79872	hgsc.bcm.edu;ucsc.edu	37	7	107393906	107393906	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr7:107393906C>G	ENST00000440859.3	+	3	699	c.232C>G	c.(232-234)Ctg>Gtg	p.L78V	CBLL1_ENST00000415884.2_Missense_Mutation_p.L78V|CBLL1_ENST00000222597.2_Missense_Mutation_p.L77V	NM_001284291.1|NM_024814.2	NP_001271220.1|NP_079090.2	Q75N03	HAKAI_HUMAN	Cbl proto-oncogene-like 1, E3 ubiquitin protein ligase	78					negative regulation of cell adhesion (GO:0007162)|positive regulation of cell migration (GO:0030335)|positive regulation of endocytosis (GO:0045807)|protein ubiquitination (GO:0016567)|single organismal cell-cell adhesion (GO:0016337)	ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(3)|skin(3)	21						AGGGGGTGAGCTGTTTGCAAA	0.299																																																	0													67.0	75.0	72.0					7																	107393906		2203	4300	6503	SO:0001583	missense	79872			AK026762	CCDS5747.1, CCDS64754.1	7q22.3	2013-07-09	2013-07-09		ENSG00000105879	ENSG00000105879		"""RING-type (C3HC4) zinc fingers"""	21225	protein-coding gene	gene with protein product	"""Casitas B-lineage lymphoma-like"""	606872	"""Cas-Br-M (murine) ecotropic retroviral transforming sequence-like 1"""			11836526, 11944035	Standard	NM_001284291		Approved	HAKAI, FLJ23109, RNF188	uc003veq.3	Q75N03	OTTHUMG00000154809	ENST00000440859.3:c.232C>G	7.37:g.107393906C>G	ENSP00000401277:p.Leu78Val	Somatic		WXS	SOLID	Phase_I	B7ZM03|Q8TAJ4|Q9H5S6	Missense_Mutation	SNP	ENST00000440859.3	37	CCDS5747.1	.	.	.	.	.	.	.	.	.	.	C	6.502	0.460876	0.12342	.	.	ENSG00000105879	ENST00000440859;ENST00000222597;ENST00000420796;ENST00000415884;ENST00000417616	T;T;T	0.32023	1.49;1.47;1.53	5.67	3.87	0.44632	.	0.429133	0.23149	N	0.051373	T	0.17831	0.0428	L	0.36672	1.1	0.25024	N	0.991311	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.30563	-0.9974	10	0.08837	T	0.75	-1.2181	4.1847	0.10392	0.2354:0.459:0.2317:0.0739	.	77;78	B7ZM03;Q75N03	.;HAKAI_HUMAN	V	78;77;28;28;24	ENSP00000401277:L78V;ENSP00000222597:L77V;ENSP00000410615:L28V	ENSP00000222597:L77V	L	+	1	2	CBLL1	107181142	0.992000	0.36948	0.268000	0.24571	0.320000	0.28249	1.149000	0.31626	0.754000	0.32968	0.563000	0.77884	CTG		0.299	CBLL1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337156.2		NM_024814	
CCDC93	54520	hgsc.bcm.edu;ucsc.edu	37	2	118732771	118732771	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr2:118732771G>C	ENST00000376300.2	-	9	880	c.743C>G	c.(742-744)gCt>gGt	p.A248G	CCDC93_ENST00000460781.1_5'UTR|CCDC93_ENST00000319432.5_Missense_Mutation_p.A247G	NM_019044.4	NP_061917.3	Q567U6	CCD93_HUMAN	coiled-coil domain containing 93	248										breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(2)	29						CACCTCTTCAGCTGCTCGAAG	0.517																																																	0													264.0	246.0	252.0					2																	118732771		2203	4300	6503	SO:0001583	missense	54520			BC028609	CCDS2121.2	2q14.1	2008-02-05			ENSG00000125633	ENSG00000125633			25611	protein-coding gene	gene with protein product						12477932	Standard	NM_019044		Approved	FLJ10996	uc002tlj.3	Q567U6	OTTHUMG00000058517	ENST00000376300.2:c.743C>G	2.37:g.118732771G>C	ENSP00000365477:p.Ala248Gly	Somatic		WXS	SOLID	Phase_I	A8K3V7|Q4LE78|Q53TJ2|Q8TBX5|Q9H6R5|Q9NV15	Missense_Mutation	SNP	ENST00000376300.2	37	CCDS2121.2	.	.	.	.	.	.	.	.	.	.	G	16.38	3.105834	0.56291	.	.	ENSG00000125633	ENST00000376300;ENST00000319432	T;T	0.19105	2.17;2.17	4.99	4.11	0.48088	.	0.163454	0.53938	D	0.000055	T	0.18045	0.0433	L	0.56769	1.78	0.44807	D	0.997812	P	0.40638	0.725	B	0.32211	0.142	T	0.05022	-1.0911	10	0.25751	T	0.34	-9.867	12.2617	0.54655	0.0792:0.0:0.9208:0.0	.	248	Q567U6	CCD93_HUMAN	G	248;247	ENSP00000365477:A248G;ENSP00000324135:A247G	ENSP00000324135:A247G	A	-	2	0	CCDC93	118449241	1.000000	0.71417	0.998000	0.56505	0.918000	0.54935	6.091000	0.71406	1.463000	0.47967	0.557000	0.71058	GCT		0.517	CCDC93-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000129615.1		NM_019044	
CCDC93	54520	hgsc.bcm.edu;ucsc.edu	37	2	118732797	118732797	+	Silent	SNP	G	G	T			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr2:118732797G>T	ENST00000376300.2	-	9	854	c.717C>A	c.(715-717)gcC>gcA	p.A239A	CCDC93_ENST00000460781.1_5'UTR|CCDC93_ENST00000319432.5_Silent_p.A238A	NM_019044.4	NP_061917.3	Q567U6	CCD93_HUMAN	coiled-coil domain containing 93	239										breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(2)	29						CTTCCTCGTGGGCATCAGCTT	0.507																																																	0													259.0	236.0	244.0					2																	118732797		2203	4300	6503	SO:0001819	synonymous_variant	54520			BC028609	CCDS2121.2	2q14.1	2008-02-05			ENSG00000125633	ENSG00000125633			25611	protein-coding gene	gene with protein product						12477932	Standard	NM_019044		Approved	FLJ10996	uc002tlj.3	Q567U6	OTTHUMG00000058517	ENST00000376300.2:c.717C>A	2.37:g.118732797G>T		Somatic		WXS	SOLID	Phase_I	A8K3V7|Q4LE78|Q53TJ2|Q8TBX5|Q9H6R5|Q9NV15	Silent	SNP	ENST00000376300.2	37	CCDS2121.2																																																																																				0.507	CCDC93-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000129615.1		NM_019044	
CDK20	23552	hgsc.bcm.edu	37	9	90585696	90585696	+	Silent	SNP	G	G	T			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr9:90585696G>T	ENST00000325303.8	-	4	800	c.495C>A	c.(493-495)gcC>gcA	p.A165A	CDK20_ENST00000375871.4_Silent_p.A165A|CDK20_ENST00000336654.5_Silent_p.A178A|CDK20_ENST00000605159.1_Silent_p.A165A|CDK20_ENST00000375883.3_Silent_p.A165A	NM_001039803.2	NP_001034892.1	Q8IZL9	CDK20_HUMAN	cyclin-dependent kinase 20	165	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|cell division (GO:0051301)|multicellular organismal development (GO:0007275)	cilium (GO:0005929)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			skin(1)	1						CCTACCTGGTGGCCACCTGGT	0.602																																																	0													44.0	47.0	46.0					9																	90585696		2203	4300	6503	SO:0001819	synonymous_variant	23552			AF035013	CCDS6677.1, CCDS6678.1, CCDS35060.1, CCDS55324.1, CCDS65075.1	9q22.1	2011-11-08	2009-12-16	2009-12-16	ENSG00000156345	ENSG00000156345		"""Cyclin-dependent kinases"""	21420	protein-coding gene	gene with protein product		610076	"""cell cycle related kinase"""	CCRK		19884882	Standard	NM_178432		Approved	p42	uc004apr.3	Q8IZL9	OTTHUMG00000020161	ENST00000325303.8:c.495C>A	9.37:g.90585696G>T		Somatic		WXS	SOLID	Phase_I	A2A389|A2A390|B4DQX1|O95137|Q5EDC4|Q5VYW1|Q9BUF4	Silent	SNP	ENST00000325303.8	37	CCDS35060.1																																																																																				0.602	CDK20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214996.1		NM_012119	
CHID1	66005	hgsc.bcm.edu;ucsc.edu	37	11	902972	902972	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr11:902972T>C	ENST00000449825.1	-	3	607	c.251A>G	c.(250-252)tAt>tGt	p.Y84C	CHID1_ENST00000323541.7_Missense_Mutation_p.Y114C|CHID1_ENST00000436108.2_Missense_Mutation_p.Y84C|CHID1_ENST00000526714.1_5'UTR|CHID1_ENST00000429789.2_Missense_Mutation_p.Y84C|CHID1_ENST00000528581.1_Missense_Mutation_p.Y109C|CHID1_ENST00000336845.5_Missense_Mutation_p.Y109C|CHID1_ENST00000323578.8_Missense_Mutation_p.Y84C|CHID1_ENST00000454838.2_Missense_Mutation_p.Y109C	NM_001142675.1	NP_001136147.1	Q9BWS9	CHID1_HUMAN	chitinase domain containing 1	84					carbohydrate metabolic process (GO:0005975)|chitin catabolic process (GO:0006032)|innate immune response (GO:0045087)|negative regulation of cytokine production involved in inflammatory response (GO:1900016)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	chitinase activity (GO:0004568)|oligosaccharide binding (GO:0070492)			endometrium(4)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	13		all_cancers(49;9.46e-06)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;5.48e-25)|Epithelial(43;3.75e-24)|BRCA - Breast invasive adenocarcinoma(625;4.65e-05)|Lung(200;0.0624)|LUSC - Lung squamous cell carcinoma(625;0.0735)		TGGAGTGACATAGCCCAGTAC	0.607																																					Pancreas(117;992 2327 5172 41921)												0													102.0	80.0	88.0					11																	902972		2203	4299	6502	SO:0001583	missense	66005			AK124697	CCDS7722.1, CCDS44510.1, CCDS44511.1	11p15.5	2005-10-27			ENSG00000177830	ENSG00000177830			28474	protein-coding gene	gene with protein product		615692					Standard	NM_023947		Approved	MGC3234, FLJ42707	uc001lsm.3	Q9BWS9	OTTHUMG00000133314	ENST00000449825.1:c.251A>G	11.37:g.902972T>C	ENSP00000391255:p.Tyr84Cys	Somatic		WXS	SOLID	Phase_I	B3KWB0|Q8NBM9|Q96CZ3|Q96S93|Q96SK0|Q9BY52	Missense_Mutation	SNP	ENST00000449825.1	37	CCDS7722.1	.	.	.	.	.	.	.	.	.	.	T	16.38	3.107600	0.56291	.	.	ENSG00000177830	ENST00000323541;ENST00000449825;ENST00000454838;ENST00000323578;ENST00000429789;ENST00000528581;ENST00000336845;ENST00000436108;ENST00000531859;ENST00000533056;ENST00000533059;ENST00000530939;ENST00000525225	T;T;T;T;T;T;T;T	0.61742	0.08;0.08;0.08;0.08;0.08;0.08;0.08;0.08	4.64	4.64	0.57946	Chitinase II (1);Glycoside hydrolase, family 18, catalytic domain (1);Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	T	0.80008	0.4545	M	0.91818	3.245	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.84800	0.0784	10	0.87932	D	0	-29.7576	13.3395	0.60537	0.0:0.0:0.0:1.0	.	145;114;84;109;84	B4DN31;B7Z705;Q9BWS9-3;Q9BWS9-2;Q9BWS9	.;.;.;.;CHID1_HUMAN	C	114;84;109;84;84;109;109;84;84;84;84;84;84	ENSP00000324821:Y114C;ENSP00000391255:Y84C;ENSP00000398722:Y109C;ENSP00000325055:Y84C;ENSP00000416034:Y84C;ENSP00000435503:Y109C;ENSP00000338838:Y109C;ENSP00000388156:Y84C	ENSP00000324821:Y114C	Y	-	2	0	CHID1	892972	1.000000	0.71417	0.998000	0.56505	0.542000	0.35054	5.668000	0.68074	1.876000	0.54355	0.379000	0.24179	TAT		0.607	CHID1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257112.1		NM_023947	
CHMP1B	57132	hgsc.bcm.edu;ucsc.edu	37	18	11851688	11851688	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr18:11851688A>C	ENST00000526991.2	+	1	294	c.178A>C	c.(178-180)Aac>Cac	p.N60H	RP11-78A19.3_ENST00000586474.1_RNA|GNAL_ENST00000535121.1_Intron|GNAL_ENST00000334049.6_Intron|GNAL_ENST00000423027.3_Intron|GNAL_ENST00000269162.5_Intron	NM_020412.4	NP_065145.2	Q7LBR1	CHM1B_HUMAN	charged multivesicular body protein 1B	60					cytokinesis (GO:0000910)|establishment of protein localization (GO:0045184)|protein transport (GO:0015031)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	protein domain specific binding (GO:0019904)			endometrium(1)|lung(1)|urinary_tract(1)	3						CCGCCAGAAGAACCAGGCGGT	0.537																																																	0													75.0	81.0	79.0					18																	11851688		2122	4246	6368	SO:0001583	missense	57132			AF306520	CCDS54180.1	18p11.21	2011-09-21	2011-09-21		ENSG00000255112	ENSG00000255112		"""Charged multivesicular body proteins"""	24287	protein-coding gene	gene with protein product		606486	"""chromatin modifying protein 1B"""			15537668	Standard	NM_020412		Approved	CHMP1.5, C18orf2, Vps46B	uc002kqe.3	Q7LBR1	OTTHUMG00000165820	ENST00000526991.2:c.178A>C	18.37:g.11851688A>C	ENSP00000432279:p.Asn60His	Somatic		WXS	SOLID	Phase_I	Q96E89|Q9HD41	Missense_Mutation	SNP	ENST00000526991.2	37	CCDS54180.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.048327	0.75846	.	.	ENSG00000255112	ENST00000526991	T	0.72505	-0.66	5.54	5.54	0.83059	.	.	.	.	.	T	0.79370	0.4434	M	0.87682	2.9	0.80722	D	1	B	0.30526	0.283	B	0.40565	0.333	T	0.80348	-0.1420	9	0.54805	T	0.06	.	13.9287	0.63981	1.0:0.0:0.0:0.0	.	60	Q7LBR1	CHM1B_HUMAN	H	60	ENSP00000432279:N60H	ENSP00000432279:N60H	N	+	1	0	CHMP1B	11841688	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.962000	0.93254	2.235000	0.73313	0.533000	0.62120	AAC		0.537	CHMP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386375.2		NM_020412	
CHRNA4	1137	hgsc.bcm.edu	37	20	61981763	61981763	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr20:61981763A>T	ENST00000370263.4	-	5	1221	c.1000T>A	c.(1000-1002)Tcg>Acg	p.S334T	CHRNA4_ENST00000463705.1_5'UTR	NM_000744.6|NM_001256573.1	NP_000735.1|NP_001243502.1	P43681	ACHA4_HUMAN	cholinergic receptor, nicotinic, alpha 4 (neuronal)	334					action potential (GO:0001508)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|cognition (GO:0050890)|DNA repair (GO:0006281)|exploration behavior (GO:0035640)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|neurological system process (GO:0050877)|regulation of dopamine secretion (GO:0014059)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of membrane potential (GO:0042391)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|response to oxidative stress (GO:0006979)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(19)|prostate(3)|skin(3)|soft_tissue(1)	33	all_cancers(38;1.71e-10)				Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Nicotine(DB00184)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)|Varenicline(DB01273)	GTGCGTGGCGAGCGGTGGTGC	0.607																																																	0													182.0	127.0	146.0					20																	61981763		2203	4300	6503	SO:0001583	missense	1137				CCDS13517.1	20q13.33	2013-09-20	2012-02-07		ENSG00000101204	ENSG00000101204		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1958	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 4 (neuronal)"""	118504	"""cholinergic receptor, nicotinic, alpha polypeptide 4"""	EBN, EBN1		1505988	Standard	NM_000744		Approved	BFNC	uc002yes.3	P43681	OTTHUMG00000033080	ENST00000370263.4:c.1000T>A	20.37:g.61981763A>T	ENSP00000359285:p.Ser334Thr	Somatic		WXS	SOLID	Phase_I	Q4JGR7|Q4VAQ5|Q4VAQ6	Missense_Mutation	SNP	ENST00000370263.4	37	CCDS13517.1	.	.	.	.	.	.	.	.	.	.	A	15.69	2.909198	0.52439	.	.	ENSG00000101204	ENST00000370258;ENST00000370263;ENST00000539366	T	0.71461	-0.57	5.15	4.04	0.47022	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	T	0.70193	0.3196	L	0.39514	1.22	0.58432	D	0.999999	P;B	0.41450	0.75;0.029	P;B	0.53401	0.725;0.121	T	0.62548	-0.6831	10	0.13470	T	0.59	.	12.0761	0.53644	0.8556:0.1443:0.0:0.0	.	263;334	Q4VAQ5;P43681	.;ACHA4_HUMAN	T	240;334;263	ENSP00000359285:S334T	ENSP00000359280:S240T	S	-	1	0	CHRNA4	61452207	1.000000	0.71417	0.913000	0.36048	0.368000	0.29767	9.042000	0.93793	0.777000	0.33496	-0.313000	0.08912	TCG		0.607	CHRNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080508.3			
CLEC1A	51267	hgsc.bcm.edu	37	12	10225998	10225998	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr12:10225998A>G	ENST00000315330.4	-	5	618	c.556T>C	c.(556-558)Tct>Cct	p.S186P	CLEC1A_ENST00000457018.2_Missense_Mutation_p.S153P|CLEC1A_ENST00000420265.2_Missense_Mutation_p.S94P	NM_016511.2	NP_057595.2	Q8NC01	CLC1A_HUMAN	C-type lectin domain family 1, member A	186	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(9)|ovary(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	23						TAGCTCTGAGACGCGGCAAAT	0.488																																																	0													74.0	69.0	71.0					12																	10225998		2203	4300	6503	SO:0001583	missense	51267			AY358587	CCDS8612.1, CCDS73443.1	12p13.31	2005-02-09				ENSG00000150048		"""C-type lectin domain containing"""	24355	protein-coding gene	gene with protein product		606782				10671229, 11745369	Standard	XM_005253383		Approved	CLEC1, MGC34328	uc001qxb.3	Q8NC01		ENST00000315330.4:c.556T>C	12.37:g.10225998A>G	ENSP00000326407:p.Ser186Pro	Somatic		WXS	SOLID	Phase_I	Q8IUW7|Q9NZH3	Missense_Mutation	SNP	ENST00000315330.4	37	CCDS8612.1	.	.	.	.	.	.	.	.	.	.	A	2.673	-0.277063	0.05679	.	.	ENSG00000150048	ENST00000315330;ENST00000457018;ENST00000420265	T;T;T	0.19669	2.13;2.13;2.13	5.4	4.5	0.54988	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.342835	0.25604	N	0.029522	T	0.11750	0.0286	N	0.16037	0.36	0.21697	N	0.999588	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.21999	-1.0229	10	0.26408	T	0.33	.	9.6637	0.39972	0.099:0.0:0.901:0.0	.	94;153;186	E7ESV9;E9PFB4;Q8NC01	.;.;CLC1A_HUMAN	P	186;153;94	ENSP00000326407:S186P;ENSP00000415048:S153P;ENSP00000417010:S94P	ENSP00000326407:S186P	S	-	1	0	CLEC1A	10117265	1.000000	0.71417	1.000000	0.80357	0.001000	0.01503	2.038000	0.41184	1.382000	0.46385	-0.242000	0.12053	TCT		0.488	CLEC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399924.1		NM_016511	
COG7	91949	hgsc.bcm.edu;ucsc.edu	37	16	23417539	23417539	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr16:23417539G>A	ENST00000307149.5	-	12	1705	c.1520C>T	c.(1519-1521)cCc>cTc	p.P507L		NM_153603.3	NP_705831.1	P83436	COG7_HUMAN	component of oligomeric golgi complex 7	507					intracellular protein transport (GO:0006886)|protein glycosylation (GO:0006486)|protein localization to Golgi apparatus (GO:0034067)|protein localization to organelle (GO:0033365)|protein stabilization (GO:0050821)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(7)|large_intestine(9)|liver(1)|lung(7)|urinary_tract(1)	27				GBM - Glioblastoma multiforme(48;0.0401)		CAGGCTCCGGGGGCTGCAGGA	0.453																																																	0													70.0	76.0	74.0					16																	23417539		2197	4300	6497	SO:0001583	missense	91949			AF070568	CCDS10610.1	16p12.2	2008-02-05			ENSG00000168434	ENSG00000168434		"""Components of oligomeric golgi complex"""	18622	protein-coding gene	gene with protein product		606978				11980916	Standard	NM_153603		Approved		uc002dlo.3	P83436	OTTHUMG00000094807	ENST00000307149.5:c.1520C>T	16.37:g.23417539G>A	ENSP00000305442:p.Pro507Leu	Somatic		WXS	SOLID	Phase_I	Q6UWU7	Missense_Mutation	SNP	ENST00000307149.5	37	CCDS10610.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.611805	0.87258	.	.	ENSG00000168434	ENST00000307149	T	0.47177	0.85	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.52517	0.1739	N	0.14661	0.345	0.80722	D	1	D	0.76494	0.999	D	0.73708	0.981	T	0.50406	-0.8832	10	0.26408	T	0.33	-26.8027	18.8096	0.92053	0.0:0.0:1.0:0.0	.	507	P83436	COG7_HUMAN	L	507	ENSP00000305442:P507L	ENSP00000305442:P507L	P	-	2	0	COG7	23325040	1.000000	0.71417	0.998000	0.56505	0.650000	0.38633	9.869000	0.99810	2.679000	0.91253	0.650000	0.86243	CCC		0.453	COG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211625.1			
CYBRD1	79901	hgsc.bcm.edu	37	2	172409900	172409900	+	Silent	SNP	T	T	C			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr2:172409900T>C	ENST00000321348.4	+	3	645	c.447T>C	c.(445-447)ctT>ctC	p.L149L	CYBRD1_ENST00000375252.3_Missense_Mutation_p.F80L|CYBRD1_ENST00000409484.1_Silent_p.L91L	NM_024843.3	NP_079119.3	Q53TN4	CYBR1_HUMAN	cytochrome b reductase 1	149	Cytochrome b561. {ECO:0000255|PROSITE- ProRule:PRU00242}.				cellular iron ion homeostasis (GO:0006879)|response to iron ion (GO:0010039)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ferric-chelate reductase activity (GO:0000293)|metal ion binding (GO:0046872)|oxidoreductase activity, oxidizing metal ions (GO:0016722)			endometrium(1)|kidney(1)|large_intestine(3)|liver(2)|lung(3)	10						GGGCTCCGCTTTCTCTCCGAG	0.373																																																	0													111.0	108.0	109.0					2																	172409900		2203	4300	6503	SO:0001819	synonymous_variant	79901			AK027115	CCDS2244.1, CCDS46449.1, CCDS58736.1	2q31	2013-03-14			ENSG00000071967	ENSG00000071967		"""Cytochrome b genes"""	20797	protein-coding gene	gene with protein product	"""ferric-chelate reductase 3"", ""cytochrome b561 family, member A2"""	605745				11230685	Standard	NM_001127383		Approved	DCYTB, FLJ23462, FRRS3, CYB561A2	uc002ugy.4	Q53TN4	OTTHUMG00000132260	ENST00000321348.4:c.447T>C	2.37:g.172409900T>C		Somatic		WXS	SOLID	Phase_I	B2RE79|B4DWD7|Q6KC16|Q6KC17|Q6P147|Q6ZR51|Q9H0Q8|Q9H5G5	Missense_Mutation	SNP	ENST00000321348.4	37	CCDS2244.1	.	.	.	.	.	.	.	.	.	.	T	14.54	2.564620	0.45694	.	.	ENSG00000071967	ENST00000375252	.	.	.	5.65	-4.57	0.03421	.	.	.	.	.	T	0.14787	0.0357	.	.	.	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.26052	-1.0114	6	.	.	.	-0.047	1.0222	0.01520	0.1761:0.1968:0.2905:0.3366	.	80	Q53TN4-2	.	L	80	.	.	F	+	1	0	CYBRD1	172118146	0.002000	0.14202	0.478000	0.27316	0.925000	0.55904	-0.469000	0.06648	-0.488000	0.06726	0.383000	0.25322	TTC		0.373	CYBRD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255344.2		NM_024843	
DHX40	79665	hgsc.bcm.edu	37	17	57656854	57656854	+	Silent	SNP	C	C	T	rs375795771		TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr17:57656854C>T	ENST00000251241.4	+	9	1242	c.1095C>T	c.(1093-1095)ttC>ttT	p.F365F	DHX40_ENST00000451169.2_Silent_p.F317F|DHX40_ENST00000425628.3_Silent_p.F288F	NM_024612.4	NP_078888.4	Q8IX18	DHX40_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 40	365	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.						ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)			endometrium(7)|large_intestine(6)|lung(6)|prostate(1)	20	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					ATGGTGGCTTCGTGAAGCAGT	0.358																																																	0													38.0	57.0	53.0					17																	57656854		984	4080	5064	SO:0001819	synonymous_variant	79665			AF260270	CCDS11617.1, CCDS54150.1	17q22	2014-01-28	2003-06-13	2003-06-20		ENSG00000108406		"""DEAH-boxes"""	18018	protein-coding gene	gene with protein product		607570	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 40 (RNA helicase)"""	DDX40			Standard	NM_024612		Approved	ARG147, PAD, FLJ22060	uc002ixn.2	Q8IX18		ENST00000251241.4:c.1095C>T	17.37:g.57656854C>T		Somatic		WXS	SOLID	Phase_I	B3KTJ5|C9JR60|Q5JPH4|Q8TC86|Q8WY53|Q9BXM1|Q9H6M9	Silent	SNP	ENST00000251241.4	37	CCDS11617.1																																																																																				0.358	DHX40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446095.1		NM_024612	
DIRAS1	148252	hgsc.bcm.edu	37	19	2717570	2717570	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr19:2717570C>A	ENST00000323469.4	-	2	418	c.235G>T	c.(235-237)Ggc>Tgc	p.G79C	DIRAS1_ENST00000585334.1_Missense_Mutation_p.G79C	NM_145173.3	NP_660156.1	O95057	DIRA1_HUMAN	DIRAS family, GTP-binding RAS-like 1	79					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.G79C(1)		kidney(1)|lung(2)|ovary(2)|prostate(1)	6				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AAGGCGTGGCCCTTGGAGATG	0.622																																																	1	Substitution - Missense(1)	kidney(1)											70.0	59.0	62.0					19																	2717570		2201	4299	6500	SO:0001583	missense	148252			BC030660	CCDS12092.1	19p13.3	2014-05-09				ENSG00000176490			19127	protein-coding gene	gene with protein product		607862				12107278	Standard	NM_145173		Approved	Di-Ras1, GBTS1, RIG	uc002lwf.3	O95057		ENST00000323469.4:c.235G>T	19.37:g.2717570C>A	ENSP00000325836:p.Gly79Cys	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000323469.4	37	CCDS12092.1	.	.	.	.	.	.	.	.	.	.	C	17.73	3.462126	0.63513	.	.	ENSG00000176490	ENST00000323469	T	0.69561	-0.41	4.07	4.07	0.47477	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.75845	0.3905	L	0.45581	1.43	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.78841	-0.2045	10	0.87932	D	0	.	13.7485	0.62890	0.0:1.0:0.0:0.0	.	79	O95057	DIRA1_HUMAN	C	79	ENSP00000325836:G79C	ENSP00000325836:G79C	G	-	1	0	DIRAS1	2668570	1.000000	0.71417	1.000000	0.80357	0.514000	0.34195	7.539000	0.82063	1.813000	0.52934	0.549000	0.68633	GGC		0.622	DIRAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451350.1			
DMBT1	1755	hgsc.bcm.edu	37	10	124358420	124358420	+	Silent	SNP	C	C	G	rs2277242	byFrequency	TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr10:124358420C>G	ENST00000338354.3	+	26	3193	c.3087C>G	c.(3085-3087)gtC>gtG	p.V1029V	DMBT1_ENST00000368955.3_Silent_p.V1019V|DMBT1_ENST00000330163.4_Silent_p.V530V|DMBT1_ENST00000344338.3_Silent_p.V1019V|DMBT1_ENST00000368956.2_Silent_p.V530V|DMBT1_ENST00000368909.3_Silent_p.V1029V|DMBT1_ENST00000359586.6_Intron			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	1029	SRCR 8. {ECO:0000255|PROSITE- ProRule:PRU00196}.				defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)			breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				ATGCCAATGTCGTCTGCAGGC	0.602													g|||	642	0.128195	0.1566	0.1052	5008	,	,		20028	0.2093		0.0368	False		,,,				2504	0.1166				Ovarian(182;93 2026 18125 22222 38972)												0								G	,,	605,3461		52,501,1480	264.0	263.0	263.0		1590,3087,3057	-0.8	0.9	10	dbSNP_100	263	241,8183		3,235,3974	no	coding-synonymous,coding-synonymous,coding-synonymous	DMBT1	NM_004406.2,NM_007329.2,NM_017579.2	,,	55,736,5454	GG,GC,CC		2.8609,14.8795,6.7734	,,	530/1786,1029/2414,1019/2404	124358420	846,11644	2033	4212	6245	SO:0001819	synonymous_variant	1755				CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.3087C>G	10.37:g.124358420C>G		Somatic		WXS	SOLID	Phase_I	A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Silent	SNP	ENST00000338354.3	37																																																																																					0.602	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050792.2		NM_004406	
DNHD1	144132	hgsc.bcm.edu	37	11	6584780	6584780	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr11:6584780G>A	ENST00000527990.2	+	28	9838	c.9838G>A	c.(9838-9840)Gag>Aag	p.E3280K	DNHD1_ENST00000254579.6_Missense_Mutation_p.E3280K			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	3280					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		GTTATGCACTGAGGATTTTTA	0.507																																																	0													110.0	99.0	103.0					11																	6584780		692	1591	2283	SO:0001583	missense	144132			AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.9838G>A	11.37:g.6584780G>A	ENSP00000436180:p.Glu3280Lys	Somatic		WXS	SOLID	Phase_I	Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Missense_Mutation	SNP	ENST00000527990.2	37	CCDS44532.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.694150	0.88735	.	.	ENSG00000179532	ENST00000254579;ENST00000527990;ENST00000526486;ENST00000526027	T;T	0.74002	-0.8;-0.8	5.21	5.21	0.72293	Dynein heavy chain, coiled coil stalk (1);	.	.	.	.	T	0.74366	0.3707	N	0.14661	0.345	0.38409	D	0.945884	D;D	0.89917	0.999;1.0	D;D	0.80764	0.989;0.994	T	0.71244	-0.4650	9	0.13108	T	0.6	.	17.5396	0.87843	0.0:0.0:1.0:0.0	.	192;3280	E9PNB2;Q96M86	.;DNHD1_HUMAN	K	3280;3280;192;192	ENSP00000254579:E3280K;ENSP00000436180:E3280K	ENSP00000254579:E3280K	E	+	1	0	DNHD1	6541356	0.996000	0.38824	1.000000	0.80357	0.968000	0.65278	2.862000	0.48388	2.438000	0.82558	0.467000	0.42956	GAG		0.507	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384673.2		NM_144666	
E2F7	144455	hgsc.bcm.edu;ucsc.edu	37	12	77426862	77426862	+	Silent	SNP	A	A	G			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr12:77426862A>G	ENST00000322886.7	-	9	1585	c.1350T>C	c.(1348-1350)gcT>gcC	p.A450A	E2F7_ENST00000416496.2_Silent_p.A450A	NM_203394.2	NP_976328.2	Q96AV8	E2F7_HUMAN	E2F transcription factor 7	450					chorionic trophoblast cell differentiation (GO:0060718)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|hepatocyte differentiation (GO:0070365)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytokinesis (GO:0032466)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|placenta development (GO:0001890)|positive regulation of DNA endoreduplication (GO:0032877)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sprouting angiogenesis (GO:0002040)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|identical protein binding (GO:0042802)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(15)|lung(14)|ovary(3)|upper_aerodigestive_tract(2)	42						GTCTATAGACAGCTGCCAGGC	0.353																																																	0													80.0	84.0	83.0					12																	77426862		2203	4300	6503	SO:0001819	synonymous_variant	144455			BC016658	CCDS9016.1	12q21.1	2008-02-05				ENSG00000165891			23820	protein-coding gene	gene with protein product		612046				12893818	Standard	NM_203394		Approved		uc001sym.4	Q96AV8	OTTHUMG00000169969	ENST00000322886.7:c.1350T>C	12.37:g.77426862A>G		Somatic		WXS	SOLID	Phase_I	A6NC74|B2RMR7|B3KTZ5|B3KUP8|B5MED9	Silent	SNP	ENST00000322886.7	37	CCDS9016.1																																																																																				0.353	E2F7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406716.1		XM_084871	
E2F7	144455	hgsc.bcm.edu;ucsc.edu	37	12	77427723	77427723	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr12:77427723T>C	ENST00000322886.7	-	8	1458	c.1223A>G	c.(1222-1224)cAt>cGt	p.H408R	E2F7_ENST00000416496.2_Missense_Mutation_p.H408R	NM_203394.2	NP_976328.2	Q96AV8	E2F7_HUMAN	E2F transcription factor 7	408					chorionic trophoblast cell differentiation (GO:0060718)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|hepatocyte differentiation (GO:0070365)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytokinesis (GO:0032466)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|placenta development (GO:0001890)|positive regulation of DNA endoreduplication (GO:0032877)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sprouting angiogenesis (GO:0002040)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|identical protein binding (GO:0042802)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(15)|lung(14)|ovary(3)|upper_aerodigestive_tract(2)	42						AAAAGAACCATGGCGAGCCAG	0.463																																																	0													124.0	111.0	116.0					12																	77427723		2203	4300	6503	SO:0001583	missense	144455			BC016658	CCDS9016.1	12q21.1	2008-02-05				ENSG00000165891			23820	protein-coding gene	gene with protein product		612046				12893818	Standard	NM_203394		Approved		uc001sym.4	Q96AV8	OTTHUMG00000169969	ENST00000322886.7:c.1223A>G	12.37:g.77427723T>C	ENSP00000323246:p.His408Arg	Somatic		WXS	SOLID	Phase_I	A6NC74|B2RMR7|B3KTZ5|B3KUP8|B5MED9	Missense_Mutation	SNP	ENST00000322886.7	37	CCDS9016.1	.	.	.	.	.	.	.	.	.	.	T	15.11	2.737191	0.49045	.	.	ENSG00000165891	ENST00000322886;ENST00000416496;ENST00000550669	T;T;T	0.22539	2.19;1.95;1.96	6.17	5.03	0.67393	.	0.089583	0.85682	N	0.000000	T	0.25158	0.0611	M	0.68952	2.095	0.41032	D	0.985163	B	0.14012	0.009	B	0.14023	0.01	T	0.03453	-1.1035	10	0.66056	D	0.02	-10.4684	11.5972	0.50981	0.0:0.0688:0.0:0.9312	.	408	Q96AV8	E2F7_HUMAN	R	408	ENSP00000323246:H408R;ENSP00000393639:H408R;ENSP00000448245:H408R	ENSP00000323246:H408R	H	-	2	0	E2F7	75951854	1.000000	0.71417	0.684000	0.30055	0.942000	0.58702	4.675000	0.61619	1.155000	0.42497	0.533000	0.62120	CAT		0.463	E2F7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406716.1		XM_084871	
EP400	57634	hgsc.bcm.edu	37	12	132512584	132512584	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr12:132512584A>G	ENST00000333577.4	+	28	5349	c.5240A>G	c.(5239-5241)aAa>aGa	p.K1747R	EP400_ENST00000332482.4_Missense_Mutation_p.K1674R|EP400_ENST00000389561.2_Missense_Mutation_p.K1711R|EP400_ENST00000330386.6_Missense_Mutation_p.K1630R|EP400_ENST00000389562.2_Missense_Mutation_p.K1710R			Q96L91	EP400_HUMAN	E1A binding protein p400	1747					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		AGACTCTTGAAAGAGCGCCTG	0.463																																																	0													38.0	41.0	40.0					12																	132512584		2203	4300	6503	SO:0001583	missense	57634			U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.5240A>G	12.37:g.132512584A>G	ENSP00000333602:p.Lys1747Arg	Somatic		WXS	SOLID	Phase_I	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Missense_Mutation	SNP	ENST00000333577.4	37		.	.	.	.	.	.	.	.	.	.	A	14.10	2.435109	0.43224	.	.	ENSG00000183495	ENST00000333577;ENST00000389561;ENST00000389562;ENST00000332482;ENST00000330386;ENST00000541296;ENST00000542457	D;D;D;D;D	0.90900	-2.75;-2.74;-2.75;-2.75;-2.74	6.07	-3.59	0.04583	.	0.263584	0.43416	N	0.000574	T	0.81716	0.4881	L	0.31371	0.925	0.26132	N	0.980394	B;B;B	0.12630	0.006;0.006;0.006	B;B;B	0.12156	0.007;0.007;0.007	T	0.64360	-0.6426	10	0.32370	T	0.25	.	12.6763	0.56895	0.5485:0.0:0.4515:0.0	.	1711;1630;1710	Q96L91-2;Q96L91-4;Q96L91-5	.;.;.	R	1747;1711;1710;1674;1630;1711;1630	ENSP00000333602:K1747R;ENSP00000374212:K1711R;ENSP00000374213:K1710R;ENSP00000331737:K1674R;ENSP00000330620:K1630R	ENSP00000330620:K1630R	K	+	2	0	EP400	131078537	1.000000	0.71417	0.022000	0.16811	0.925000	0.55904	1.975000	0.40569	-0.936000	0.03723	0.533000	0.62120	AAA		0.463	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			NM_015409	
FGFR4	2264	hgsc.bcm.edu;ucsc.edu	37	5	176516674	176516674	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr5:176516674C>T	ENST00000292408.4	+	2	316	c.71C>T	c.(70-72)gCc>gTc	p.A24V	FGFR4_ENST00000292410.3_Missense_Mutation_p.A24V|FGFR4_ENST00000393648.2_Missense_Mutation_p.A24V|FGFR4_ENST00000393637.1_Missense_Mutation_p.A24V|FGFR4_ENST00000507708.1_3'UTR|FGFR4_ENST00000502906.1_Missense_Mutation_p.A24V	NM_002011.3|NM_213647.1	NP_002002.3|NP_998812.1	P22455	FGFR4_HUMAN	fibroblast growth factor receptor 4	24	Ig-like C2-type 1.				alveolar secondary septum development (GO:0061144)|cell migration (GO:0016477)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphate ion homeostasis (GO:0055062)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of proteolysis (GO:0045862)|protein autophosphorylation (GO:0046777)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of cholesterol homeostasis (GO:2000188)|regulation of extracellular matrix disassembly (GO:0010715)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	34	all_cancers(89;5.93e-05)|Renal(175;0.000269)|Lung NSC(126;0.0088)|all_lung(126;0.0142)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Palifermin(DB00039)|Ponatinib(DB08901)	TCCCTGGAGGCCTCTGAGGAA	0.642										TSP Lung(9;0.080)																																							0													54.0	50.0	51.0					5																	176516674		2203	4300	6503	SO:0001583	missense	2264			AF202063	CCDS4410.1, CCDS4411.1	5q35.2	2013-09-19			ENSG00000160867	ENSG00000160867		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3691	protein-coding gene	gene with protein product		134935					Standard	XM_005265837		Approved	JTK2, CD334	uc003mfm.3	P22455	OTTHUMG00000151523	ENST00000292408.4:c.71C>T	5.37:g.176516674C>T	ENSP00000292408:p.Ala24Val	Somatic		WXS	SOLID	Phase_I	G3JVM2|G3JVM5|G3JVM7|G3JVM9|O43785|Q14309|Q71TW8|Q8TDA0|Q96KE5	Missense_Mutation	SNP	ENST00000292408.4	37	CCDS4410.1	.	.	.	.	.	.	.	.	.	.	C	12.53	1.964768	0.34659	.	.	ENSG00000160867	ENST00000292408;ENST00000503708;ENST00000393648;ENST00000514472;ENST00000502906;ENST00000292410;ENST00000510911;ENST00000513166;ENST00000393637	T;T;T;D;T;T;T;D;T	0.89681	-1.19;-0.96;-1.15;-2.55;-1.19;-1.18;0.63;-2.52;-1.18	4.63	2.85	0.33270	.	.	.	.	.	T	0.79341	0.4429	N	0.22421	0.69	0.27093	N	0.962812	B;B;B;B;B	0.12630	0.003;0.0;0.0;0.006;0.0	B;B;B;B;B	0.18263	0.002;0.001;0.001;0.021;0.001	T	0.63998	-0.6510	9	0.22109	T	0.4	.	7.3654	0.26770	0.0:0.7938:0.0:0.2062	.	24;24;24;24;24	B5A965;B4DVP5;P22455-2;E7EWF4;P22455	.;.;.;.;FGFR4_HUMAN	V	24	ENSP00000292408:A24V;ENSP00000424905:A24V;ENSP00000377259:A24V;ENSP00000426492:A24V;ENSP00000424960:A24V;ENSP00000292410:A24V;ENSP00000427222:A24V;ENSP00000422889:A24V;ENSP00000377254:A24V	ENSP00000292408:A24V	A	+	2	0	FGFR4	176449280	1.000000	0.71417	0.997000	0.53966	0.854000	0.48673	1.687000	0.37680	0.513000	0.28278	0.491000	0.48974	GCC		0.642	FGFR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253410.1			
FSHB	2488	hgsc.bcm.edu;ucsc.edu	37	11	30253599	30253599	+	Silent	SNP	C	C	T			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr11:30253599C>T	ENST00000417547.1	+	2	189	c.150C>T	c.(148-150)tgC>tgT	p.C50C	FSHB_ENST00000254122.3_Silent_p.C50C|FSHB_ENST00000533718.1_Silent_p.C50C	NM_001018080.1	NP_001018090.1	P01225	FSHB_HUMAN	follicle stimulating hormone, beta polypeptide	50					cellular protein metabolic process (GO:0044267)|female gamete generation (GO:0007292)|female pregnancy (GO:0007565)|follicle-stimulating hormone signaling pathway (GO:0042699)|peptide hormone processing (GO:0016486)|positive regulation of bone resorption (GO:0045780)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|progesterone biosynthetic process (GO:0006701)|regulation of osteoclast differentiation (GO:0045670)|Sertoli cell proliferation (GO:0060011)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	hormone activity (GO:0005179)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(3)|skin(1)	12						CTGGCTACTGCTACACCAGGG	0.423																																																	0													76.0	69.0	71.0					11																	30253599		2202	4299	6501	SO:0001819	synonymous_variant	2488				CCDS7868.1	11p13	2013-02-26				ENSG00000131808		"""Endogenous ligands"""	3964	protein-coding gene	gene with protein product	"""follitropin, beta chain"", ""follicle-stimulating hormone beta subunit"""	136530				2885163, 3151250	Standard	NM_000510		Approved		uc001msm.3	P01225		ENST00000417547.1:c.150C>T	11.37:g.30253599C>T		Somatic		WXS	SOLID	Phase_I	A2TF08|A5JVV3|Q14D61	Silent	SNP	ENST00000417547.1	37	CCDS7868.1																																																																																				0.423	FSHB-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389757.1		NM_000510	
DDX42	11325	hgsc.bcm.edu	37	17	61899416	61899416	+	IGR	SNP	G	G	C			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr17:61899416G>C	ENST00000578681.1	+	0	4337				FTSJ3_ENST00000427159.2_Missense_Mutation_p.S468C	NM_007372.2	NP_031398.2	Q86XP3	DDX42_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 42						protein localization (GO:0008104)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)	46						ACTATCCAGAGATGTGTCATC	0.522																																																	0													130.0	106.0	114.0					17																	61899416		2203	4300	6503	SO:0001628	intergenic_variant	117246			BC015505	CCDS32704.1	17q23	2014-02-14	2013-05-13			ENSG00000198231		"""DEAD-boxes"""	18676	protein-coding gene	gene with protein product	"""splicing factor 3b, subunit 8"""	613369	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 42"""			10727850, 16397294	Standard	NM_007372		Approved	RNAHP, RHELP, SF3b125, SF3B8	uc002jbv.3	Q86XP3			17.37:g.61899416G>C		Somatic		WXS	SOLID	Phase_I	A6NML1|A8KA43|O75619|Q68G51|Q96BK1|Q96HR7|Q9Y3V8	Missense_Mutation	SNP	ENST00000578681.1	37	CCDS32704.1	.	.	.	.	.	.	.	.	.	.	G	15.99	2.996002	0.54147	.	.	ENSG00000108592	ENST00000427159	T	0.32515	1.45	5.21	5.21	0.72293	.	0.000000	0.64402	D	0.000001	T	0.49029	0.1533	L	0.46157	1.445	0.53688	D	0.999973	D	0.89917	1.0	D	0.83275	0.996	T	0.32079	-0.9920	10	0.42905	T	0.14	-15.436	16.3053	0.82846	0.0:0.0:1.0:0.0	.	468	Q8IY81	RRMJ3_HUMAN	C	468	ENSP00000396673:S468C	ENSP00000396673:S468C	S	-	2	0	FTSJ3	59253148	1.000000	0.71417	0.561000	0.28357	0.004000	0.04260	6.126000	0.71635	2.716000	0.92895	0.650000	0.86243	TCT		0.522	DDX42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444368.1		NM_007372	
GLI2	2736	hgsc.bcm.edu	37	2	121708840	121708840	+	Silent	SNP	C	C	T			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr2:121708840C>T	ENST00000452319.1	+	4	336	c.276C>T	c.(274-276)agC>agT	p.S92S	GLI2_ENST00000435313.2_3'UTR|GLI2_ENST00000314490.11_5'UTR|GLI2_ENST00000361492.4_Silent_p.S92S					GLI family zinc finger 2											NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				TCAGCGGCAGCCCTGTCATCT	0.637																																																	0													98.0	110.0	106.0					2																	121708840		2203	4300	6503	SO:0001819	synonymous_variant	2736				CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.276C>T	2.37:g.121708840C>T		Somatic		WXS	SOLID	Phase_I		Silent	SNP	ENST00000452319.1	37	CCDS33283.1																																																																																				0.637	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332293.3		NM_005270	
GPR133	283383	hgsc.bcm.edu;ucsc.edu	37	12	131488769	131488769	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr12:131488769T>A	ENST00000261654.5	+	11	1742	c.1183T>A	c.(1183-1185)Tcc>Acc	p.S395T	GPR133_ENST00000376682.4_Missense_Mutation_p.S81T|GPR133_ENST00000535015.1_Missense_Mutation_p.S427T	NM_198827.3	NP_942122.2	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133	395					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(2)|endometrium(6)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|pancreas(6)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	67	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		GACCGTGAATTCCTCCCATTA	0.612																																																	0													86.0	76.0	79.0					12																	131488769		2203	4300	6503	SO:0001583	missense	283383			AY278561	CCDS9272.1	12q24.33	2014-08-08			ENSG00000111452	ENSG00000111452		"""-"", ""GPCR / Class B : Orphans"""	19893	protein-coding gene	gene with protein product		613639					Standard	NM_198827		Approved	DKFZp434B1272, PGR25	uc001uit.4	Q6QNK2	OTTHUMG00000168339	ENST00000261654.5:c.1183T>A	12.37:g.131488769T>A	ENSP00000261654:p.Ser395Thr	Somatic		WXS	SOLID	Phase_I	B2CKK9|B7ZLF7|Q2M1L3|Q6ZMQ1|Q7Z7M2|Q86SM4	Missense_Mutation	SNP	ENST00000261654.5	37	CCDS9272.1	.	.	.	.	.	.	.	.	.	.	T	12.63	1.996916	0.35226	.	.	ENSG00000111452	ENST00000261654;ENST00000535015;ENST00000544673;ENST00000545900;ENST00000376682	T;T;T	0.40476	1.05;1.05;1.03	4.95	-9.25	0.00666	.	0.940610	0.08950	N	0.870251	T	0.24851	0.0603	L	0.42245	1.32	0.09310	N	1	B;B	0.10296	0.001;0.003	B;B	0.06405	0.001;0.002	T	0.21827	-1.0234	10	0.16420	T	0.52	.	8.0851	0.30767	0.2894:0.0:0.5396:0.1709	.	427;395	B7ZLF7;Q6QNK2	.;GP133_HUMAN	T	395;427;86;91;81	ENSP00000261654:S395T;ENSP00000444425:S427T;ENSP00000365872:S81T	ENSP00000261654:S395T	S	+	1	0	GPR133	130054722	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.586000	0.05787	-1.347000	0.02208	-0.678000	0.03780	TCC		0.612	GPR133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399356.1		NM_198827	
GRIA1	2890	hgsc.bcm.edu;ucsc.edu	37	5	153149729	153149729	+	Splice_Site	SNP	G	G	A			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr5:153149729G>A	ENST00000285900.5	+	13	2367	c.2024G>A	c.(2023-2025)aGg>aAg	p.R675K	GRIA1_ENST00000521843.2_Splice_Site_p.R606K|GRIA1_ENST00000518783.1_Splice_Site_p.R685K|GRIA1_ENST00000518142.1_Splice_Site_p.R595K|GRIA1_ENST00000448073.4_Splice_Site_p.R685K|GRIA1_ENST00000340592.5_Splice_Site_p.R675K	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	675					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)			NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	CCCTACCAGAGGTCTAAAATT	0.463																																																	0													151.0	147.0	149.0					5																	153149729		2203	4300	6503	SO:0001630	splice_region_variant	2890				CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.2023-1G>A	5.37:g.153149729G>A		Somatic		WXS	SOLID	Phase_I	B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Missense_Mutation	SNP	ENST00000285900.5	37	CCDS4322.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.958531	0.74016	.	.	ENSG00000155511	ENST00000285900;ENST00000544403;ENST00000518142;ENST00000537037;ENST00000340592;ENST00000521843;ENST00000544794;ENST00000518783;ENST00000448073	T;T;T;T;T;T;T	0.37752	1.18;1.18;1.18;1.18;1.18;1.18;1.18	5.41	5.41	0.78517	Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.41259	0.1151	N	0.12182	0.205	0.80722	D	1	D;D;B;D;B	0.71674	0.998;0.998;0.012;0.997;0.238	D;D;B;D;B	0.80764	0.994;0.994;0.016;0.99;0.145	T	0.26849	-1.0091	10	0.15499	T	0.54	.	18.1724	0.89751	0.0:0.0:1.0:0.0	.	685;685;595;675;675	E7ESV8;B7Z9G9;B7Z3F6;P42261-2;P42261	.;.;.;.;GRIA1_HUMAN	K	675;675;595;629;675;608;606;685;685	ENSP00000285900:R675K;ENSP00000427920:R595K;ENSP00000339343:R675K;ENSP00000427864:R608K;ENSP00000442108:R606K;ENSP00000428994:R685K;ENSP00000415569:R685K	ENSP00000285900:R675K	R	+	2	0	GRIA1	153129922	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	9.640000	0.98453	2.525000	0.85131	0.655000	0.94253	AGG		0.463	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252456.3			Missense_Mutation
KDM5C	8242	hgsc.bcm.edu	37	X	53230752	53230752	+	Nonsense_Mutation	SNP	G	G	A	rs370032584		TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chrX:53230752G>A	ENST00000375401.3	-	14	2573	c.2041C>T	c.(2041-2043)Cga>Tga	p.R681*	KDM5C_ENST00000465402.1_5'UTR|KDM5C_ENST00000375379.3_Nonsense_Mutation_p.R681*|KDM5C_ENST00000452825.3_Nonsense_Mutation_p.R614*|KDM5C_ENST00000375383.3_Nonsense_Mutation_p.R640*|KDM5C_ENST00000404049.3_Nonsense_Mutation_p.R680*	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	681					histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)	p.R681*(2)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						AGGGCCTTTCGTAGACGCCGC	0.562			"""N, F, S"""		clear cell renal carcinoma																																			Rec	yes		X	Xp11.22-p11.21	8242	lysine (K)-specific demethylase 5C (JARID1C)		E	2	Substitution - Nonsense(2)	large_intestine(1)|kidney(1)											86.0	82.0	83.0					X																	53230752		2203	4300	6503	SO:0001587	stop_gained	8242			Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.2041C>T	X.37:g.53230752G>A	ENSP00000364550:p.Arg681*	Somatic		WXS	SOLID	Phase_I	B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Nonsense_Mutation	SNP	ENST00000375401.3	37	CCDS14351.1	.	.	.	.	.	.	.	.	.	.	G	45	11.613684	0.99582	.	.	ENSG00000126012	ENST00000452825;ENST00000375401;ENST00000404049;ENST00000375379;ENST00000375383	.	.	.	5.43	5.43	0.79202	.	0.059417	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.565	15.5376	0.76016	0.0:0.0:1.0:0.0	.	.	.	.	X	614;681;680;681;640	.	ENSP00000364528:R681X	R	-	1	2	KDM5C	53247477	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	3.048000	0.49862	2.263000	0.75096	0.600000	0.82982	CGA		0.562	KDM5C-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056737.2		NM_004187	
LPL	4023	hgsc.bcm.edu;ucsc.edu	37	8	19819627	19819627	+	Splice_Site	SNP	G	G	A			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr8:19819627G>A	ENST00000311322.8	+	9	1794	c.1324G>A	c.(1324-1326)Gtg>Atg	p.V442M		NM_000237.2	NP_000228.1	P06858	LIPL_HUMAN	lipoprotein lipase	442	PLAT. {ECO:0000255|PROSITE- ProRule:PRU00152}.				chylomicron remodeling (GO:0034371)|fatty acid biosynthetic process (GO:0006633)|lipoprotein metabolic process (GO:0042157)|phospholipid metabolic process (GO:0006644)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of sequestering of triglyceride (GO:0010890)|response to cold (GO:0009409)|response to drug (GO:0042493)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|triglyceride catabolic process (GO:0019433)|triglyceride homeostasis (GO:0070328)|triglyceride metabolic process (GO:0006641)|very-low-density lipoprotein particle remodeling (GO:0034372)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|chylomicron (GO:0042627)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	apolipoprotein binding (GO:0034185)|heparin binding (GO:0008201)|lipoprotein lipase activity (GO:0004465)|phospholipase activity (GO:0004620)|receptor binding (GO:0005102)|triglyceride binding (GO:0017129)|triglyceride lipase activity (GO:0004806)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	36				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	AST-120(DB05269)|Tyloxapol(DB06439)	CTTCCACAGGGTGATCTTCTG	0.403																																																	0													142.0	132.0	135.0					8																	19819627		2203	4300	6503	SO:0001630	splice_region_variant	4023				CCDS6012.1	8p22	2012-10-02			ENSG00000175445	ENSG00000175445	3.1.1.34		6677	protein-coding gene	gene with protein product		609708		LIPD			Standard	NM_000237		Approved		uc003wzk.4	P06858	OTTHUMG00000036645	ENST00000311322.8:c.1323-1G>A	8.37:g.19819627G>A		Somatic		WXS	SOLID	Phase_I	B2R5T9|Q16282|Q16283|Q96FC4	Missense_Mutation	SNP	ENST00000311322.8	37	CCDS6012.1	.	.	.	.	.	.	.	.	.	.	G	9.899	1.206253	0.22205	.	.	ENSG00000175445	ENST00000311322;ENST00000535763	T	0.68025	-0.3	5.89	5.02	0.67125	Lipoxygenase, LH2 (4);Lipase/lipooxygenase, PLAT/LH2 (1);	0.476837	0.24256	N	0.040122	T	0.55433	0.1920	N	0.20357	0.565	0.38057	D	0.935966	P	0.37663	0.604	P	0.45712	0.491	T	0.63747	-0.6567	8	.	.	.	-16.0923	7.6812	0.28515	0.0818:0.0:0.7558:0.1623	.	442	P06858	LIPL_HUMAN	M	442;428	ENSP00000309757:V442M	.	V	+	1	0	LPL	19863907	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	1.349000	0.33998	1.504000	0.48704	0.655000	0.94253	GTG		0.403	LPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089113.3			Missense_Mutation
LRRC16A	55604	hgsc.bcm.edu;ucsc.edu	37	6	25538187	25538187	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr6:25538187G>T	ENST00000329474.6	+	25	2540	c.2172G>T	c.(2170-2172)atG>atT	p.M724I		NM_001173977.1|NM_017640.5	NP_001167448.1|NP_060110.4	Q5VZK9	LR16A_HUMAN	leucine rich repeat containing 16A	724					actin filament organization (GO:0007015)|barbed-end actin filament uncapping (GO:0051638)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|lamellipodium assembly (GO:0030032)|negative regulation of barbed-end actin filament capping (GO:2000813)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell migration (GO:0030335)|positive regulation of lamellipodium organization (GO:1902745)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|ruffle organization (GO:0031529)|urate metabolic process (GO:0046415)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|lamellipodium (GO:0030027)|nucleus (GO:0005634)	protein complex binding (GO:0032403)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	50						AGCGGCTCATGCGTGATGCTA	0.388																																																	0													48.0	46.0	47.0					6																	25538187		1882	4119	6001	SO:0001583	missense	55604			AK000055	CCDS54973.1	6p22.1	2010-09-10	2008-02-12	2008-02-12	ENSG00000079691	ENSG00000079691			21581	protein-coding gene	gene with protein product	"""capping protein, Arp2/3, and Myosin-I Linker homolog 1 (Dictyostelium)"""	609593	"""leucine rich repeat containing 16"""	LRRC16		19846667	Standard	NM_017640		Approved	dJ501N12.1, FLJ20048, CARMIL, CARMIL1	uc011djw.2	Q5VZK9	OTTHUMG00000014393	ENST00000329474.6:c.2172G>T	6.37:g.25538187G>T	ENSP00000331983:p.Met724Ile	Somatic		WXS	SOLID	Phase_I	B8X1J0|Q6ZUH5|Q6ZW07|Q9NXU7	Missense_Mutation	SNP	ENST00000329474.6	37	CCDS54973.1	.	.	.	.	.	.	.	.	.	.	G	5.934	0.356365	0.11239	.	.	ENSG00000079691	ENST00000329474;ENST00000399313	T	0.08720	3.06	5.79	5.79	0.91817	.	0.076532	0.85682	D	0.000000	T	0.01189	0.0039	N	0.01168	-0.975	0.80722	D	1	B;B;B;B	0.25441	0.045;0.077;0.126;0.045	B;B;B;B	0.25140	0.026;0.017;0.058;0.026	T	0.40813	-0.9543	10	0.02654	T	1	-26.1428	19.6157	0.95633	0.0:0.0:1.0:0.0	.	724;724;724;724	Q5VZK9;B2RTQ5;Q5VZK9-2;B8X1J0	LR16A_HUMAN;.;.;.	I	724	ENSP00000331983:M724I	ENSP00000331983:M724I	M	+	3	0	LRRC16A	25646166	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.376000	0.59556	2.731000	0.93534	0.591000	0.81541	ATG		0.388	LRRC16A-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000040045.2		NM_017640	
MED24	9862	hgsc.bcm.edu;ucsc.edu	37	17	38176135	38176135	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr17:38176135G>T	ENST00000394128.2	-	25	2837	c.2756C>A	c.(2755-2757)cCc>cAc	p.P919H	MED24_ENST00000501516.3_Missense_Mutation_p.P938H|MED24_ENST00000394126.1_Missense_Mutation_p.P944H|MED24_ENST00000356271.3_Missense_Mutation_p.P906H|MED24_ENST00000394127.2_Missense_Mutation_p.P906H	NM_014815.3	NP_055630.2	O75448	MED24_HUMAN	mediator complex subunit 24	919					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	41	Colorectal(19;0.000442)					CTGGGTGTGGGGGCCAGCGGT	0.627																																																	0													33.0	30.0	31.0					17																	38176135		2195	4296	6491	SO:0001583	missense	9862			AF055995	CCDS11359.1, CCDS42315.1	17q21.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000008838	ENSG00000008838			22963	protein-coding gene	gene with protein product		607000	"""thyroid hormone receptor associated protein 4"", ""cofactor required for Sp1 transcriptional activation, subunit 4, 100kDa"""	THRAP4, CRSP4			Standard	NM_001079518		Approved	TRAP100, KIAA0130, DRIP100, CRSP100	uc002htt.3	O75448	OTTHUMG00000133329	ENST00000394128.2:c.2756C>A	17.37:g.38176135G>T	ENSP00000377686:p.Pro919His	Somatic		WXS	SOLID	Phase_I	A8K4S5|B3KMR9|Q14143|Q9NNY5	Missense_Mutation	SNP	ENST00000394128.2	37	CCDS11359.1	.	.	.	.	.	.	.	.	.	.	G	13.42	2.230967	0.39399	.	.	ENSG00000008838	ENST00000394126;ENST00000356271;ENST00000394128;ENST00000394127;ENST00000536318;ENST00000431269	T;T	0.55760	0.5;0.5	5.05	5.05	0.67936	Mediator complex, subunit Med24, N-terminal (1);	0.112431	0.64402	D	0.000006	T	0.67325	0.2881	L	0.53249	1.67	0.58432	D	0.999999	D;D;D;D;D;D	0.76494	0.99;0.995;0.982;0.986;0.99;0.999	P;D;P;P;P;P	0.64237	0.73;0.923;0.73;0.823;0.73;0.905	T	0.68542	-0.5381	10	0.56958	D	0.05	-25.5742	18.2135	0.89878	0.0:0.0:1.0:0.0	.	829;829;906;919;861;496	F8W9R9;B4E1A5;O75448-2;O75448;F5H0K1;B4E0S3	.;.;.;MED24_HUMAN;.;.	H	919;919;919;906;861;829	ENSP00000377686:P919H;ENSP00000377685:P906H	ENSP00000348610:P919H	P	-	2	0	MED24	35429661	1.000000	0.71417	0.998000	0.56505	0.382000	0.30200	9.625000	0.98406	2.621000	0.88768	0.650000	0.86243	CCC		0.627	MED24-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257147.2		NM_014815	
DENND1A	57706	hgsc.bcm.edu;ucsc.edu	37	9	126164863	126164863	+	Intron	SNP	G	G	T			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr9:126164863G>T	ENST00000373624.2	-	20	1779				DENND1A_ENST00000373620.3_Intron|DENND1A_ENST00000542603.1_Intron|DENND1A_ENST00000473039.1_Intron|MIR601_ENST00000385256.1_RNA|DENND1A_ENST00000394215.2_Intron|DENND1A_ENST00000394219.3_Intron	NM_020946.1	NP_065997.1	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A						endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|regulation of Rab protein signal transduction (GO:0032483)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|liver(2)|lung(18)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43						AACAATCCTAGACCAAGACGA	0.527											OREG0019470	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													70.0	66.0	67.0					9																	126164863		1568	3582	5150	SO:0001627	intron_variant	693186			AB046828	CCDS35133.1, CCDS35134.1	9q34.11	2012-10-03	2005-08-17	2005-08-17	ENSG00000119522	ENSG00000119522		"""DENN/MADD domain containing"""	29324	protein-coding gene	gene with protein product		613633	"""KIAA1608"""	KIAA1608		10997877	Standard	XM_005252109		Approved	FLJ21129, FAM31A	uc004bnz.1	Q8TEH3	OTTHUMG00000020643	ENST00000373624.2:c.1577+817C>A	9.37:g.126164863G>T		Somatic	1547	WXS	SOLID	Phase_I	A8MZA3|B1AM80|B7Z3C8|B7Z669|D3PFD3|Q05C88|Q5VWF0|Q6PJZ5|Q8IVD6|Q9H796	RNA	SNP	ENST00000373624.2	37	CCDS35133.1																																																																																				0.527	DENND1A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053997.1		NM_024820	
NBPF7	343505	hgsc.bcm.edu	37	1	120384017	120384017	+	IGR	SNP	A	A	T			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr1:120384017A>T								REG4 (29734 upstream) : ADAM30 (52138 downstream)																							ACCTGGGCTGAGCTTGTGGAC	0.577																																																	0													73.0	79.0	77.0					1																	120384017		2203	4300	6503	SO:0001628	intergenic_variant	343505																															1.37:g.120384017A>T		Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP		37																																																																																				0	0.577									
NFAT5	10725	hgsc.bcm.edu	37	16	69727924	69727924	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr16:69727924T>C	ENST00000354436.2	+	12	4460	c.4142T>C	c.(4141-4143)aTg>aCg	p.M1381T	NFAT5_ENST00000566899.1_Missense_Mutation_p.M1305T|NFAT5_ENST00000349945.1_Missense_Mutation_p.M1305T|NFAT5_ENST00000393742.2_Missense_Mutation_p.M1305T|NFAT5_ENST00000432919.1_Missense_Mutation_p.M1399T|NFAT5_ENST00000567239.1_Missense_Mutation_p.M1398T	NM_006599.3	NP_006590.1	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5, tonicity-responsive	1381					cytokine production (GO:0001816)|excretion (GO:0007588)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of calcineurin-NFAT signaling cascade (GO:0070884)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						CCAGCATCCATGTCTGCCTTG	0.463																																																	0													141.0	118.0	126.0					16																	69727924		2198	4300	6498	SO:0001583	missense	10725			AF134870	CCDS10881.1, CCDS10882.1, CCDS45519.1	16q22.1	2009-11-24			ENSG00000102908	ENSG00000102908		"""Nuclear factor of activated T-cells"""	7774	protein-coding gene	gene with protein product		604708				10377394	Standard	NM_173214		Approved	TONEBP, KIAA0827, NFATL1, OREBP, NFATZ, NF-AT5	uc002exl.2	O94916	OTTHUMG00000137572	ENST00000354436.2:c.4142T>C	16.37:g.69727924T>C	ENSP00000346420:p.Met1381Thr	Somatic		WXS	SOLID	Phase_I	A2RRB4|A6H8V5|E9PHR7|O95693|Q7LA65|Q969Q8|Q96QH3|Q9UN18	Missense_Mutation	SNP	ENST00000354436.2	37	CCDS10881.1	.	.	.	.	.	.	.	.	.	.	T	13.74	2.327730	0.41197	.	.	ENSG00000102908	ENST00000432919;ENST00000426654;ENST00000349945;ENST00000354436;ENST00000393742	T;T;T;T	0.54866	0.55;0.56;0.55;0.56	5.87	5.87	0.94306	.	0.036775	0.85682	D	0.000000	T	0.51534	0.1680	L	0.56769	1.78	0.53005	D	0.999968	D;P;D	0.59357	0.985;0.956;0.985	B;B;B	0.40940	0.344;0.344;0.344	T	0.60229	-0.7304	10	0.87932	D	0	-2.7108	16.2674	0.82597	0.0:0.0:0.0:1.0	.	1398;1381;1399	A2RRB4;O94916;E9PHR7	.;NFAT5_HUMAN;.	T	1399;1398;1305;1381;1305	ENSP00000396538:M1399T;ENSP00000338806:M1305T;ENSP00000346420:M1381T;ENSP00000377343:M1305T	ENSP00000338806:M1305T	M	+	2	0	NFAT5	68285425	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.212000	0.72188	2.242000	0.73789	0.533000	0.62120	ATG		0.463	NFAT5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268952.2		NM_138714	
NPEPPS	9520	hgsc.bcm.edu	37	17	45669359	45669359	+	Missense_Mutation	SNP	T	T	G	rs200616431		TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr17:45669359T>G	ENST00000322157.4	+	11	1535	c.1298T>G	c.(1297-1299)tTt>tGt	p.F433C	NPEPPS_ENST00000530173.1_Missense_Mutation_p.F429C|NPEPPS_ENST00000544660.1_Missense_Mutation_p.F353C|NPEPPS_ENST00000525037.1_3'UTR	NM_006310.3	NP_006301.3	P55786	PSA_HUMAN	aminopeptidase puromycin sensitive	433					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular response to hypoxia (GO:0071456)|protein polyubiquitination (GO:0000209)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.F433C(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(6)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	27						GATGAGATATTTGATGCTATA	0.383																																																	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											123.0	78.0	93.0					17																	45669359		2020	4149	6169	SO:0001583	missense	9520			Y07701	CCDS45721.1	17q12-q21	2008-07-18			ENSG00000141279	ENSG00000141279	3.4.11.2		7900	protein-coding gene	gene with protein product	"""puromycin-sensitive aminopeptidase"", ""metalloproteinase MP100"""	606793				9048733, 10329370	Standard	NM_006310		Approved	PSA, MP100	uc002ilr.4	P55786	OTTHUMG00000165471	ENST00000322157.4:c.1298T>G	17.37:g.45669359T>G	ENSP00000320324:p.Phe433Cys	Somatic		WXS	SOLID	Phase_I	B7Z463|Q6P145|Q9NP16|Q9UEM2	Missense_Mutation	SNP	ENST00000322157.4	37	CCDS45721.1	.	.	.	.	.	.	.	.	.	.	T	24.3	4.519381	0.85495	.	.	ENSG00000141279	ENST00000530173;ENST00000322157;ENST00000539572;ENST00000544660;ENST00000527964;ENST00000527360	T;T;T;T;T	0.09911	2.93;2.93;2.93;2.93;2.93	5.51	5.51	0.81932	Peptidase M1, membrane alanine aminopeptidase, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.54532	0.1864	H	0.99435	4.565	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.76427	-0.2963	10	0.87932	D	0	.	15.6257	0.76855	0.0:0.0:0.0:1.0	.	433;429;433	A6NEC2;E9PLK3;P55786	PSAL_HUMAN;.;PSA_HUMAN	C	429;433;420;353;116;130	ENSP00000433287:F429C;ENSP00000320324:F433C;ENSP00000442461:F353C;ENSP00000435639:F116C;ENSP00000435966:F130C	ENSP00000320324:F433C	F	+	2	0	NPEPPS	43024358	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.850000	0.86915	2.099000	0.63709	0.528000	0.53228	TTT		0.383	NPEPPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384269.1		NM_006310	
PARD3	56288	hgsc.bcm.edu;ucsc.edu	37	10	34671492	34671492	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr10:34671492T>A	ENST00000374789.3	-	9	1700	c.1375A>T	c.(1375-1377)Agg>Tgg	p.R459W	PARD3_ENST00000374776.1_Missense_Mutation_p.R459W|PARD3_ENST00000346874.4_Missense_Mutation_p.R459W|PARD3_ENST00000374794.3_Missense_Mutation_p.R415W|PARD3_ENST00000545260.1_Missense_Mutation_p.R415W|PARD3_ENST00000374788.3_Missense_Mutation_p.R459W|PARD3_ENST00000545693.1_Missense_Mutation_p.R459W|PARD3_ENST00000374790.3_Missense_Mutation_p.R415W|PARD3_ENST00000544292.1_Missense_Mutation_p.R189W|PARD3_ENST00000374773.1_Missense_Mutation_p.R459W|PARD3_ENST00000340077.5_Missense_Mutation_p.R459W|PARD3_ENST00000350537.4_Missense_Mutation_p.R459W	NM_019619.3	NP_062565.2	Q8TEW0	PARD3_HUMAN	par-3 family cell polarity regulator	459					apical constriction (GO:0003383)|asymmetric cell division (GO:0008356)|axonogenesis (GO:0007409)|cell cycle (GO:0007049)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|centrosome localization (GO:0051642)|establishment of epithelial cell polarity (GO:0090162)|establishment or maintenance of cell polarity (GO:0007163)|microtubule cytoskeleton organization (GO:0000226)|myelination in peripheral nervous system (GO:0022011)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|positive regulation of myelination (GO:0031643)|protein complex assembly (GO:0006461)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein targeting to membrane (GO:0006612)|regulation of actin filament-based process (GO:0032970)|regulation of cellular localization (GO:0060341)|tight junction assembly (GO:0070830)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing, spreading of cells (GO:0044319)	apical part of cell (GO:0045177)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|internode region of axon (GO:0033269)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|tight junction (GO:0005923)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	63		Breast(68;0.0707)				ATATTAAGCCTCTTGCCTATT	0.418																																																	0													119.0	120.0	120.0					10																	34671492		2203	4300	6503	SO:0001583	missense	56288			AF252293	CCDS7178.1, CCDS53509.1, CCDS53510.1, CCDS53511.1, CCDS53512.1, CCDS53513.1, CCDS53514.1, CCDS53515.1, CCDS53516.1	10p11.22	2014-06-13	2013-08-28		ENSG00000148498	ENSG00000148498			16051	protein-coding gene	gene with protein product	"""atypical PKC isotype-specific interacting protein"", ""par-3 family cell polarity regulator alpha"", ""protein phosphatase 1, regulatory subunit 118"""	606745	"""par-3 (partitioning defective 3, C.elegans) homolog"", ""par-3 partitioning defective 3 homolog (C. elegans)"""			10934474	Standard	NM_001184790		Approved	PAR3, PARD3A, Bazooka, Baz, ASIP, PPP1R118	uc010qej.2	Q8TEW0	OTTHUMG00000017948	ENST00000374789.3:c.1375A>T	10.37:g.34671492T>A	ENSP00000363921:p.Arg459Trp	Somatic		WXS	SOLID	Phase_I	F5H5T0|Q5T2U1|Q5VUA2|Q5VUA3|Q5VWV0|Q5VWV1|Q5VWV3|Q5VWV4|Q5VWV5|Q6IQ47|Q8TCZ9|Q8TEW1|Q8TEW2|Q8TEW3|Q96K28|Q96RM6|Q96RM7|Q9BY57|Q9BY58|Q9HC48|Q9NWL4|Q9NYE6	Missense_Mutation	SNP	ENST00000374789.3	37	CCDS7178.1	.	.	.	.	.	.	.	.	.	.	T	22.4	4.287097	0.80803	.	.	ENSG00000148498	ENST00000545693;ENST00000545260;ENST00000374789;ENST00000374788;ENST00000346874;ENST00000374794;ENST00000350537;ENST00000374790;ENST00000374776;ENST00000340077;ENST00000374773;ENST00000544292	T;T;T;T;T;T;T;T;T;T;T;T	0.17528	2.27;2.27;2.27;2.27;2.27;2.27;2.27;2.27;2.27;2.27;2.27;2.27	5.88	2.08	0.27032	PDZ/DHR/GLGF (1);	0.170844	0.64402	D	0.000008	T	0.36936	0.0985	M	0.61703	1.905	0.50813	D	0.999899	D;D;D;D;D;D;D;P;P;D;D;D;D;D;D	0.71674	0.991;0.989;0.965;0.996;0.965;0.996;0.996;0.934;0.892;0.993;0.997;0.997;0.993;0.998;0.992	P;P;P;D;P;D;D;P;P;P;P;P;D;D;P	0.71870	0.901;0.744;0.856;0.926;0.856;0.926;0.926;0.633;0.516;0.846;0.9;0.856;0.937;0.975;0.798	T	0.10683	-1.0619	10	0.72032	D	0.01	.	14.6114	0.68519	0.0:0.0:0.4761:0.5239	.	415;415;459;459;459;459;459;459;415;459;459;459;459;459;189	Q8TEW0-5;Q8TEW0-3;Q8TEW0-7;Q8TEW0-6;F5H5T0;Q8TEW0-4;Q8TEW0-2;Q8TEW0;Q5VWV2;Q6IQ47;Q5VWU8;Q8TEW0-8;Q8TEW0-9;Q8TEW0-10;F5GZI3	.;.;.;.;.;.;.;PARD3_HUMAN;.;.;.;.;.;.;.	W	459;415;459;459;459;415;459;415;459;459;459;189	ENSP00000443147:R459W;ENSP00000440857:R415W;ENSP00000363921:R459W;ENSP00000363920:R459W;ENSP00000340591:R459W;ENSP00000363926:R415W;ENSP00000311986:R459W;ENSP00000363922:R415W;ENSP00000363908:R459W;ENSP00000341844:R459W;ENSP00000363905:R459W;ENSP00000444429:R189W	ENSP00000341844:R459W	R	-	1	2	PARD3	34711498	1.000000	0.71417	0.990000	0.47175	0.998000	0.95712	3.638000	0.54332	0.090000	0.17273	0.533000	0.62120	AGG		0.418	PARD3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047527.1		NM_019619	
PARP1	142	hgsc.bcm.edu	37	1	226566974	226566974	+	Splice_Site	SNP	T	T	A			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr1:226566974T>A	ENST00000366794.5	-	12	1757	c.1614A>T	c.(1612-1614)ggA>ggT	p.G538G		NM_001618.3	NP_001609.2	P09874	PARP1_HUMAN	poly (ADP-ribose) polymerase 1	538					base-excision repair (GO:0006284)|cellular response to insulin stimulus (GO:0032869)|DNA damage response, detection of DNA damage (GO:0042769)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|gene expression (GO:0010467)|macrophage differentiation (GO:0030225)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|protein ADP-ribosylation (GO:0006471)|protein autoprocessing (GO:0016540)|protein poly-ADP-ribosylation (GO:0070212)|regulation of growth rate (GO:0040009)|signal transduction involved in regulation of gene expression (GO:0023019)|telomere maintenance (GO:0000723)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|NAD binding (GO:0051287)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|kidney(4)|large_intestine(8)|lung(15)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	44	Breast(184;0.133)			GBM - Glioblastoma multiforme(131;0.0531)		AGTGTTCCAGTCCTGTCCCAG	0.547								Poly(ADP-ribose) polymerase (PARP) enzymes that bind to DNA																																									0													134.0	123.0	127.0					1																	226566974		2203	4300	6503	SO:0001630	splice_region_variant	142			BC037545	CCDS1554.1	1q41-q42	2010-02-16	2008-07-28	2004-08-26	ENSG00000143799	ENSG00000143799	2.4.2.30	"""Poly (ADP-ribose) polymerases"""	270	protein-coding gene	gene with protein product		173870	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)"", ""poly (ADP-ribose) polymerase family, member 1"""	PPOL, ADPRT		10964595	Standard	NM_001618		Approved	PARP	uc001hqd.4	P09874	OTTHUMG00000037556	ENST00000366794.5:c.1613-1A>T	1.37:g.226566974T>A		Somatic		WXS	SOLID	Phase_I	B1ANJ4|Q8IUZ9	Silent	SNP	ENST00000366794.5	37	CCDS1554.1																																																																																				0.547	PARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091519.1		NM_001618	Silent
PARP4	143	hgsc.bcm.edu;ucsc.edu	37	13	25074499	25074499	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr13:25074499C>T	ENST00000381989.3	-	4	461	c.356G>A	c.(355-357)tGc>tAc	p.C119Y		NM_006437.3	NP_006428.2	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	119					cell death (GO:0008219)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|protein ADP-ribosylation (GO:0006471)|response to drug (GO:0042493)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(18)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		ACTGTCCGGGCATAGACCTTC	0.398																																																	0													115.0	110.0	112.0					13																	25074499		2203	4300	6503	SO:0001583	missense	143			AF057160	CCDS9307.1	13q11	2010-09-29	2004-08-20	2004-08-26	ENSG00000102699	ENSG00000102699		"""Poly (ADP-ribose) polymerases"""	271	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 5C"""	607519	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 1"""	ADPRTL1		10644454	Standard	NM_006437		Approved	VAULT3, p193, VPARP, VWA5C	uc001upl.3	Q9UKK3	OTTHUMG00000016582	ENST00000381989.3:c.356G>A	13.37:g.25074499C>T	ENSP00000371419:p.Cys119Tyr	Somatic		WXS	SOLID	Phase_I	O75903|Q14682|Q5QNZ9|Q9H1M6	Missense_Mutation	SNP	ENST00000381989.3	37	CCDS9307.1	.	.	.	.	.	.	.	.	.	.	C	0.004	-2.290430	0.00248	.	.	ENSG00000102699	ENST00000381989	T	0.41065	1.01	3.38	0.491	0.16867	.	2.572970	0.01284	N	0.009827	T	0.26376	0.0644	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.27606	-1.0069	10	0.02654	T	1	0.0154	11.6264	0.51147	0.0:0.6475:0.3525:0.0	.	119	Q9UKK3	PARP4_HUMAN	Y	119	ENSP00000371419:C119Y	ENSP00000371419:C119Y	C	-	2	0	PARP4	23972499	0.076000	0.21285	0.005000	0.12908	0.002000	0.02628	0.357000	0.20199	0.055000	0.16094	-0.385000	0.06624	TGC		0.398	PARP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044189.1		NM_006437	
PLAT	5327	hgsc.bcm.edu;ucsc.edu	37	8	42046557	42046557	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr8:42046557A>G	ENST00000220809.4	-	4	404	c.148T>C	c.(148-150)Tac>Cac	p.Y50H	PLAT_ENST00000429089.2_Missense_Mutation_p.Y50H|PLAT_ENST00000524009.1_Missense_Mutation_p.Y50H|PLAT_ENST00000270189.6_Missense_Mutation_p.Y50H|PLAT_ENST00000352041.3_Intron|PLAT_ENST00000519510.1_Missense_Mutation_p.Y50H|PLAT_ENST00000429710.2_Missense_Mutation_p.Y50H	NM_000930.3	NP_000921.1	P00750	TPA_HUMAN	plasminogen activator, tissue	50	Fibronectin type-I. {ECO:0000255|PROSITE- ProRule:PRU00478}.|Important for binding to annexin A2.				blood coagulation (GO:0007596)|cellular protein modification process (GO:0006464)|fibrinolysis (GO:0042730)|negative regulation of proteolysis (GO:0045861)|plasminogen activation (GO:0031639)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of ovulation (GO:0060279)|proteolysis (GO:0006508)|regulation of synaptic plasticity (GO:0048167)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|smooth muscle cell migration (GO:0014909)|synaptic transmission, glutamatergic (GO:0035249)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|secretory granule (GO:0030141)|synapse (GO:0045202)	serine-type endopeptidase activity (GO:0004252)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(10)|skin(1)|soft_tissue(1)|urinary_tract(1)	27	all_cancers(6;3.84e-26)|all_epithelial(6;9.61e-28)|all_lung(13;7.2e-13)|Lung NSC(13;1.18e-11)|Ovarian(28;0.00438)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000378)|Lung NSC(58;0.00145)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;5.23e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00135)|Colorectal(10;0.00165)|Lung(22;0.00467)|COAD - Colon adenocarcinoma(11;0.0171)|LUSC - Lung squamous cell carcinoma(45;0.024)		Aminocaproic Acid(DB00513)|Ibuprofen(DB01050)|Iloprost(DB01088)|Urokinase(DB00013)	TGTTGCTGGTATATCATCTGC	0.502																																																	0													175.0	169.0	171.0					8																	42046557		2203	4300	6503	SO:0001583	missense	5327				CCDS6126.1, CCDS6127.1	8p11.21	2012-10-02			ENSG00000104368	ENSG00000104368			9051	protein-coding gene	gene with protein product		173370					Standard	NM_033011		Approved		uc003xos.2	P00750	OTTHUMG00000164072	ENST00000220809.4:c.148T>C	8.37:g.42046557A>G	ENSP00000220809:p.Tyr50His	Somatic		WXS	SOLID	Phase_I	A8K022|B2R8E8|Q15103|Q503B0|Q6PJA5|Q7Z7N2|Q86YK8|Q9BU99|Q9BZW1	Missense_Mutation	SNP	ENST00000220809.4	37	CCDS6126.1	.	.	.	.	.	.	.	.	.	.	A	11.29	1.595683	0.28445	.	.	ENSG00000104368	ENST00000270189;ENST00000429089;ENST00000220809;ENST00000519510;ENST00000429710;ENST00000524009;ENST00000520523;ENST00000521694	T;T;T;T;T;T;T;T	0.78364	-1.17;-1.17;-1.17;-1.17;-1.17;-1.17;-1.17;-1.17	5.25	5.25	0.73442	Fibronectin, type I (4);Complement control module (1);	0.308175	0.31461	N	0.007609	D	0.83575	0.5284	M	0.70903	2.155	0.43965	D	0.99664	P;P;P;B	0.41978	0.767;0.642;0.767;0.058	P;P;P;B	0.52424	0.698;0.698;0.505;0.096	D	0.84312	0.0511	10	0.49607	T	0.09	.	13.7746	0.63046	1.0:0.0:0.0:0.0	.	50;50;50;50	B4DNJ1;B4DN26;B4DV92;P00750	.;.;.;TPA_HUMAN	H	50	ENSP00000270189:Y50H;ENSP00000392045:Y50H;ENSP00000220809:Y50H;ENSP00000428886:Y50H;ENSP00000407861:Y50H;ENSP00000429401:Y50H;ENSP00000428797:Y50H;ENSP00000429801:Y50H	ENSP00000220809:Y50H	Y	-	1	0	PLAT	42165714	0.999000	0.42202	0.174000	0.22961	0.053000	0.15095	4.878000	0.63093	1.995000	0.58328	0.477000	0.44152	TAC		0.502	PLAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377100.1		NM_000930	
POLQ	10721	hgsc.bcm.edu	37	3	121158955	121158955	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr3:121158955G>T	ENST00000264233.5	-	27	7401	c.7273C>A	c.(7273-7275)Caa>Aaa	p.Q2425K		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	2425					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		GTCATGAATTGATTAATCCCT	0.358								DNA polymerases (catalytic subunits)																													Pancreas(152;907 1925 26081 31236 36904)												0													76.0	76.0	76.0					3																	121158955		2201	4299	6500	SO:0001583	missense	10721			AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.7273C>A	3.37:g.121158955G>T	ENSP00000264233:p.Gln2425Lys	Somatic		WXS	SOLID	Phase_I	O95160|Q6VMB5	Missense_Mutation	SNP	ENST00000264233.5	37	CCDS33833.1	.	.	.	.	.	.	.	.	.	.	G	1.428	-0.570929	0.03910	.	.	ENSG00000051341	ENST00000543272;ENST00000264233;ENST00000393672	D	0.96365	-3.99	4.85	3.01	0.34805	DNA-directed DNA polymerase, family A, palm domain (2);	0.910788	0.09715	N	0.765129	D	0.85057	0.5610	N	0.01668	-0.77	0.21445	N	0.999685	B;B	0.17465	0.022;0.003	B;B	0.16722	0.016;0.002	T	0.75786	-0.3195	10	0.05721	T	0.95	.	6.5595	0.22479	0.0877:0.0:0.4334:0.4789	.	2425;1597	O75417;O75417-2	DPOLQ_HUMAN;.	K	2048;2425;2561	ENSP00000264233:Q2425K	ENSP00000264233:Q2425K	Q	-	1	0	POLQ	122641645	0.978000	0.34361	1.000000	0.80357	0.834000	0.47266	1.586000	0.36611	0.620000	0.30215	0.563000	0.77884	CAA		0.358	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355097.1		NM_199420	
POM121C	100101267	hgsc.bcm.edu	37	7	75055733	75055733	+	Silent	SNP	G	G	C	rs372291559		TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr7:75055733G>C	ENST00000257665.5	-	6	1208	c.1209C>G	c.(1207-1209)ctC>ctG	p.L403L	POM121C_ENST00000473168.1_Intron|POM121C_ENST00000453279.2_Silent_p.L161L			A8CG34	P121C_HUMAN	POM121 transmembrane nucleoporin C	403	Pore side. {ECO:0000255}.|Ser-rich.				mRNA transport (GO:0051028)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|nuclear pore (GO:0005643)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	14						TTCTCTTCCAGAGCTAAAAAT	0.448																																																	0													36.0	45.0	42.0					7																	75055733		1138	3018	4156	SO:0001819	synonymous_variant	100101267				CCDS47617.1	7q11.23	2012-03-13	2012-03-13		ENSG00000135213	ENSG00000272391			34005	protein-coding gene	gene with protein product		615754	"""POM121 membrane glycoprotein C"""			17900573	Standard	NM_001099415		Approved		uc003udk.4	A8CG34	OTTHUMG00000156238	ENST00000257665.5:c.1209C>G	7.37:g.75055733G>C		Somatic		WXS	SOLID	Phase_I	O75115|Q9Y2N3|Q9Y4S7	Silent	SNP	ENST00000257665.5	37																																																																																					0.448	POM121C-003	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000343919.2		NM_001099415	
POTED	317754	hgsc.bcm.edu	37	21	15013735	15013735	+	Missense_Mutation	SNP	A	A	G	rs78643169	byFrequency	TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr21:15013735A>G	ENST00000299443.5	+	11	1655	c.1603A>G	c.(1603-1605)Atg>Gtg	p.M535V		NM_174981.3|NM_207355.2	NP_778146.2|NP_997238.2	Q86YR6	POTED_HUMAN	POTE ankyrin domain family, member D	535				M -> V (in Ref. 1; AAO23914). {ECO:0000305}.		plasma membrane (GO:0005886)				central_nervous_system(1)|large_intestine(10)|liver(2)|lung(8)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(1)	33						AGAAATTGCCATGCTAAGACT	0.353																																																	0													36.0	52.0	48.0					21																	15013735		1440	3652	5092	SO:0001583	missense	317754			AY172978	CCDS13562.1	21q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000166351	ENSG00000166351		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	23822	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 1"""	607549	"""ankyrin repeat domain 21"", ""ANKRD26-like family B, member 3"""	ANKRD21, A26B3		12475935, 15276201, 16364570	Standard	NM_174981		Approved	POTE, POTE-21, POTE21, CT104.1	uc002yjb.1	Q86YR6	OTTHUMG00000074197	ENST00000299443.5:c.1603A>G	21.37:g.15013735A>G	ENSP00000299443:p.Met535Val	Somatic		WXS	SOLID	Phase_I	C9JCF7	Missense_Mutation	SNP	ENST00000299443.5	37	CCDS13562.1	.	.	.	.	.	.	.	.	.	.	a	4.658	0.122353	0.08931	.	.	ENSG00000166351	ENST00000299443	T	0.14391	2.51	2.1	2.1	0.27182	.	.	.	.	.	T	0.08447	0.0210	L	0.42581	1.335	0.09310	N	0.999995	B	0.21225	0.053	B	0.12156	0.007	T	0.42292	-0.9460	9	0.05620	T	0.96	.	3.8841	0.09091	0.8091:0.0:0.1909:0.0	.	535	Q86YR6	POTED_HUMAN	V	535	ENSP00000299443:M535V	ENSP00000299443:M535V	M	+	1	0	POTED	13935606	0.045000	0.20229	0.309000	0.25155	0.004000	0.04260	1.396000	0.34531	0.975000	0.38392	0.352000	0.21897	ATG		0.353	POTED-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157660.1		NM_174981	
PRAMEF22	653606	hgsc.bcm.edu	37	1	13038119	13038119	+	Missense_Mutation	SNP	G	G	C	rs202041730		TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr1:13038119G>C	ENST00000376187.1	+	3	1184	c.1184G>C	c.(1183-1185)gGt>gCt	p.G395A	PRAMEF6_ENST00000376192.5_Intron	NM_001100631.1	NP_001094101.1	A3QJZ6	PRA22_HUMAN	PRAME family member 22	395					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					kidney(1)|large_intestine(2)|lung(1)|skin(1)	5						TCCATGGATGGTCTGAAGGAC	0.562																																																	0													1.0	1.0	1.0					1																	13038119		13	46	59	SO:0001583	missense	653606					1p36.21	2013-01-17			ENSG00000204508			"""-"""	34393	protein-coding gene	gene with protein product							Standard	NM_001100631		Approved	PRAMEF3L	uc009vnq.1	A3QJZ6	OTTHUMG00000074726	ENST00000376187.1:c.1184G>C	1.37:g.13038119G>C	ENSP00000365358:p.Gly395Ala	Somatic		WXS	SOLID	Phase_I	A6NMM3	Missense_Mutation	SNP	ENST00000376187.1	37	CCDS41256.1	1226	0.5613553113553114	266	0.540650406504065	207	0.5718232044198895	352	0.6153846153846154	401	0.5290237467018469	.	0.005	-2.169174	0.00315	.	.	ENSG00000204508	ENST00000376187	T	0.61510	0.1	1.23	-1.52	0.08637	.	2.708670	0.01331	N	0.011249	T	0.00012	0.0000	N	0.01197	-0.965	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.36601	-0.9741	9	0.06891	T	0.86	.	2.9042	0.05715	0.0:0.367:0.2412:0.3918	.	395	A3QJZ6	PRA22_HUMAN	A	395	ENSP00000365358:G395A	ENSP00000365358:G395A	G	+	2	0	PRAMEF22	12960706	0.000000	0.05858	0.001000	0.08648	0.056000	0.15407	-3.898000	0.00339	-1.100000	0.03030	-1.116000	0.02052	GGT		0.562	PRAMEF22-001	KNOWN	mRNA_start_NF|mRNA_end_NF|cds_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000158511.1		NM_001100631	
PRPF40B	25766	hgsc.bcm.edu;ucsc.edu	37	12	50029153	50029153	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr12:50029153C>T	ENST00000380281.1	+	13	1170	c.1106C>T	c.(1105-1107)gCa>gTa	p.A369V	PRPF40B_ENST00000548825.2_Missense_Mutation_p.A391V|FMNL3_ENST00000550668.1_5'Flank|PRPF40B_ENST00000261897.1_Missense_Mutation_p.A363V			Q6NWY9	PR40B_HUMAN	PRP40 pre-mRNA processing factor 40 homolog B (S. cerevisiae)	369	FF 2.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	34						CACAGGCGGGCAGAACAGACC	0.557																																																	0													113.0	120.0	117.0					12																	50029153		2203	4300	6503	SO:0001583	missense	25766			AF049525	CCDS31796.1, CCDS31796.2	12q13.12	2014-09-17	2006-04-04			ENSG00000110844			25031	protein-coding gene	gene with protein product	"""Huntingtin interacting protein C"""		"""PRP40 pre-mRNA processing factor 40 homolog B (yeast)"""			9700202	Standard	NM_001031698		Approved	HYPC	uc001rus.2	Q6NWY9		ENST00000380281.1:c.1106C>T	12.37:g.50029153C>T	ENSP00000369634:p.Ala369Val	Somatic		WXS	SOLID	Phase_I	O75401|Q6PI09|Q6ZWB3|Q8NCZ1|Q9H5G4|Q9NT95	Missense_Mutation	SNP	ENST00000380281.1	37		.	.	.	.	.	.	.	.	.	.	C	29.1	4.977474	0.92982	.	.	ENSG00000110844	ENST00000261897;ENST00000380281	T;T	0.27402	1.67;1.68	5.0	5.0	0.66597	FF domain (1);	0.000000	0.64402	D	0.000012	T	0.40094	0.1103	L	0.60455	1.87	0.80722	D	1	P;P;P	0.40302	0.589;0.537;0.712	B;B;P	0.45794	0.298;0.316;0.493	T	0.08513	-1.0718	9	.	.	.	-9.8155	17.599	0.88021	0.0:1.0:0.0:0.0	.	369;363;369	Q6NWY9;Q6NWY9-2;Q6NWY9-3	PR40B_HUMAN;.;.	V	363;369	ENSP00000261897:A363V;ENSP00000369634:A369V	.	A	+	2	0	PRPF40B	48315420	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	7.447000	0.80620	2.775000	0.95449	0.563000	0.77884	GCA		0.557	PRPF40B-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000404838.1		NM_012272	
PRX	57716	hgsc.bcm.edu	37	19	40902613	40902613	+	Missense_Mutation	SNP	G	G	A	rs150582069		TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr19:40902613G>A	ENST00000324001.7	-	7	1916	c.1646C>T	c.(1645-1647)cCg>cTg	p.P549L	PRX_ENST00000291825.7_3'UTR	NM_181882.2	NP_870998.2	Q9BXM0	PRAX_HUMAN	periaxin	549	55 X 5 AA approximate tandem repeats of [LVMAG]-[PSREQC]-[EDKL]-[LIVMAP]- [AQKHRPE]; that may have a tripeptide spacer of [LV]-P-[KER].				axon ensheathment (GO:0008366)|cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.E545_P549delEVQLP(1)|p.P549Q(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|urinary_tract(9)	47			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			TGACACTTTCGGCAGCTGTAC	0.577													g|||	1	0.000199681	0.0	0.0	5008	,	,		16952	0.001		0.0	False		,,,				2504	0.0																2	Substitution - Missense(1)|Deletion - In frame(1)	breast(1)|kidney(1)											88.0	101.0	96.0					19																	40902613		2202	4297	6499	SO:0001583	missense	57716			AB046840	CCDS12556.1, CCDS33028.1	19q13.2	2014-09-17				ENSG00000105227			13797	protein-coding gene	gene with protein product		605725				10839370, 9143514	Standard	NM_181882		Approved	KIAA1620	uc002onr.3	Q9BXM0		ENST00000324001.7:c.1646C>T	19.37:g.40902613G>A	ENSP00000326018:p.Pro549Leu	Somatic		WXS	SOLID	Phase_I	Q9BXL9|Q9HCF2	Missense_Mutation	SNP	ENST00000324001.7	37	CCDS33028.1	.	.	.	.	.	.	.	.	.	.	g	4.883	0.164188	0.09287	.	.	ENSG00000105227	ENST00000324001;ENST00000341562	T	0.03580	3.88	4.14	3.11	0.35812	.	.	.	.	.	T	0.05502	0.0145	M	0.77820	2.39	0.09310	N	0.999996	P	0.40332	0.713	B	0.30401	0.115	T	0.29640	-1.0005	9	0.66056	D	0.02	-6.8118	7.829	0.29332	0.1975:0.0:0.8025:0.0	.	549	Q9BXM0	PRAX_HUMAN	L	549	ENSP00000326018:P549L	ENSP00000326018:P549L	P	-	2	0	PRX	45594453	0.005000	0.15991	0.169000	0.22859	0.015000	0.08874	0.659000	0.24994	0.962000	0.38057	-0.185000	0.12909	CCG		0.577	PRX-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000462582.1		NM_020956	
PTCH1	5727	hgsc.bcm.edu	37	9	98231217	98231217	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr9:98231217G>T	ENST00000331920.6	-	14	2365	c.2066C>A	c.(2065-2067)cCc>cAc	p.P689H	PTCH1_ENST00000375274.2_Missense_Mutation_p.P688H|PTCH1_ENST00000430669.2_Missense_Mutation_p.P623H|PTCH1_ENST00000437951.1_Missense_Mutation_p.P623H|PTCH1_ENST00000418258.1_Missense_Mutation_p.P538H|PTCH1_ENST00000429896.2_Missense_Mutation_p.P538H|PTCH1_ENST00000421141.1_Missense_Mutation_p.P538H	NM_000264.3	NP_000255.2	Q13635	PTC1_HUMAN	patched 1	689					brain development (GO:0007420)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation involved in kidney development (GO:0061005)|cell proliferation involved in metanephros development (GO:0072203)|cellular response to cholesterol (GO:0071397)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|embryonic organ development (GO:0048568)|epidermis development (GO:0008544)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|hindlimb morphogenesis (GO:0035137)|in utero embryonic development (GO:0001701)|keratinocyte proliferation (GO:0043616)|limb morphogenesis (GO:0035108)|mammary gland duct morphogenesis (GO:0060603)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell division (GO:0051782)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate axis specification (GO:0021997)|neural tube closure (GO:0001843)|neural tube patterning (GO:0021532)|organ morphogenesis (GO:0009887)|pharyngeal system development (GO:0060037)|positive regulation of cholesterol efflux (GO:0010875)|protein processing (GO:0016485)|protein targeting to plasma membrane (GO:0072661)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein localization (GO:0032880)|regulation of smoothened signaling pathway (GO:0008589)|renal system development (GO:0072001)|response to chlorate (GO:0010157)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to mechanical stimulus (GO:0009612)|response to retinoic acid (GO:0032526)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|somite development (GO:0061053)|spinal cord motor neuron differentiation (GO:0021522)	axonal growth cone (GO:0044295)|caveola (GO:0005901)|dendritic growth cone (GO:0044294)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)	cholesterol binding (GO:0015485)|cyclin binding (GO:0030332)|hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|heparin binding (GO:0008201)|smoothened binding (GO:0005119)	p.P689L(2)		NS(8)|bone(33)|breast(10)|central_nervous_system(95)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(8)|kidney(2)|large_intestine(18)|lung(22)|meninges(1)|oesophagus(3)|ovary(6)|prostate(2)|skin(262)|upper_aerodigestive_tract(11)|urinary_tract(2)|vulva(1)	490		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				CACGGTGACGGGCTGCACAGA	0.632																																																	2	Substitution - Missense(2)	skin(2)											123.0	116.0	119.0					9																	98231217		2203	4300	6503	SO:0001583	missense	5727			AI494442	CCDS6714.1, CCDS43851.1, CCDS47995.1, CCDS47996.1	9q22.1-q31	2014-09-17	2010-06-24	2006-09-26	ENSG00000185920	ENSG00000185920			9585	protein-coding gene	gene with protein product		601309	"""patched (Drosophila) homolog"", ""patched homolog (Drosophila)"", ""patched homolog 1 (Drosophila)"""	NBCCS, PTCH		8658145	Standard	NM_001083603		Approved	BCNS	uc004avk.4	Q13635	OTTHUMG00000020280	ENST00000331920.6:c.2066C>A	9.37:g.98231217G>T	ENSP00000332353:p.Pro689His	Somatic		WXS	SOLID	Phase_I	A3KBI9|E9PEJ8|Q13463|Q5R1U7|Q5R1U9|Q5R1V0|Q5VZC0|Q5VZC2|Q86XG7	Missense_Mutation	SNP	ENST00000331920.6	37	CCDS6714.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.782729	0.90282	.	.	ENSG00000185920	ENST00000331920;ENST00000437951;ENST00000421141;ENST00000418258;ENST00000375275;ENST00000430669;ENST00000429896;ENST00000375274	D;D;D;D;D;D;D	0.90955	-2.75;-2.74;-2.73;-2.73;-2.74;-2.73;-2.76	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	D	0.93552	0.7942	M	0.74881	2.28	0.80722	D	1	D;D;D;B	0.59357	0.985;0.975;0.964;0.237	P;P;P;B	0.55161	0.77;0.694;0.688;0.122	D	0.93150	0.6549	10	0.41790	T	0.15	-20.4818	18.1325	0.89606	0.0:0.0:1.0:0.0	.	538;623;688;689	Q13635-4;Q13635-3;Q13635-2;Q13635	.;.;.;PTC1_HUMAN	H	689;623;538;538;125;623;538;688	ENSP00000332353:P689H;ENSP00000389744:P623H;ENSP00000399981:P538H;ENSP00000396135:P538H;ENSP00000410287:P623H;ENSP00000414823:P538H;ENSP00000364423:P688H	ENSP00000332353:P689H	P	-	2	0	PTCH1	97271038	1.000000	0.71417	0.964000	0.40570	0.942000	0.58702	9.308000	0.96247	2.505000	0.84491	0.557000	0.71058	CCC		0.632	PTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053229.2		NM_000264	
PTK7	5754	hgsc.bcm.edu;ucsc.edu	37	6	43109480	43109480	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr6:43109480G>T	ENST00000230419.4	+	11	1914	c.1693G>T	c.(1693-1695)Gct>Tct	p.A565S	PTK7_ENST00000352931.2_Missense_Mutation_p.A565S|PTK7_ENST00000349241.2_Missense_Mutation_p.A435S|PTK7_ENST00000481273.1_Missense_Mutation_p.A573S|PTK7_ENST00000345201.2_Missense_Mutation_p.A525S	NM_002821.4	NP_002812.2	Q13308	PTK7_HUMAN	protein tyrosine kinase 7	565	Ig-like C2-type 6.				actin cytoskeleton reorganization (GO:0031532)|axis elongation (GO:0003401)|canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|establishment of epithelial cell apical/basal polarity (GO:0045198)|establishment of planar polarity (GO:0001736)|lung-associated mesenchyme development (GO:0060484)|neural tube closure (GO:0001843)|peptidyl-tyrosine phosphorylation (GO:0018108)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of neuron projection development (GO:0010976)|signal transduction (GO:0007165)|wound healing (GO:0042060)	cell-cell junction (GO:0005911)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(12)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00784)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)			TCGAGATGACGCTGGCAACTA	0.612																																																	0													141.0	136.0	138.0					6																	43109480		2203	4300	6503	SO:0001583	missense	5754			AF447176	CCDS4884.1, CCDS4885.1, CCDS4886.1, CCDS4887.1, CCDS59021.1	6p21.1-p12.2	2013-02-18	2013-02-18		ENSG00000112655	ENSG00000112655	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9618	protein-coding gene	gene with protein product		601890	"""PTK7 protein tyrosine kinase 7"""			7478540	Standard	NM_002821		Approved	CCK4	uc011dve.2	Q13308	OTTHUMG00000014721	ENST00000230419.4:c.1693G>T	6.37:g.43109480G>T	ENSP00000230419:p.Ala565Ser	Somatic		WXS	SOLID	Phase_I	A8K974|B7Z477|E9PFZ5|Q13417|Q5T650|Q6IQ54|Q8NFA5|Q8NFA6|Q8NFA7|Q8NFA8	Missense_Mutation	SNP	ENST00000230419.4	37	CCDS4884.1	.	.	.	.	.	.	.	.	.	.	G	17.49	3.402708	0.62288	.	.	ENSG00000112655	ENST00000230419;ENST00000349241;ENST00000352931;ENST00000345201;ENST00000481273	T;T;T;T;T	0.26373	1.74;2.81;1.74;2.81;1.74	5.23	5.23	0.72850	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.106076	0.64402	D	0.000005	T	0.14614	0.0353	N	0.17872	0.535	0.58432	D	0.999995	B;P;B;P;P	0.44659	0.058;0.824;0.383;0.84;0.592	B;P;B;P;B	0.49922	0.176;0.626;0.273;0.532;0.279	T	0.05178	-1.0901	10	0.23891	T	0.37	.	14.6159	0.68547	0.0:0.0:0.845:0.155	.	573;435;525;565;565	E9PFZ5;Q13308-3;Q13308-2;Q13308-4;Q13308	.;.;.;.;PTK7_HUMAN	S	565;435;565;525;573	ENSP00000230419:A565S;ENSP00000325462:A435S;ENSP00000326029:A565S;ENSP00000325992:A525S;ENSP00000418754:A573S	ENSP00000230418:A565S	A	+	1	0	PTK7	43217458	1.000000	0.71417	0.262000	0.24481	0.519000	0.34347	4.793000	0.62474	2.440000	0.82611	0.561000	0.74099	GCT		0.612	PTK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040580.2			
RALGAPA2	57186	hgsc.bcm.edu;ucsc.edu	37	20	20486076	20486076	+	Silent	SNP	A	A	G			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr20:20486076A>G	ENST00000202677.7	-	34	5038	c.5031T>C	c.(5029-5031)ttT>ttC	p.F1677F		NM_020343.3	NP_065076.2	Q2PPJ7	RGPA2_HUMAN	Ral GTPase activating protein, alpha subunit 2 (catalytic)	1677	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				activation of Ral GTPase activity (GO:0032859)|membrane organization (GO:0061024)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(25)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	54						GTCCAGCAACAAAGTCTTCAT	0.393																																																	0													74.0	70.0	71.0					20																	20486076		1940	4180	6120	SO:0001819	synonymous_variant	57186			AL078634, DQ310704	CCDS46584.1	20p11.23	2009-09-09	2009-09-09	2009-09-09	ENSG00000188559	ENSG00000188559			16207	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 74"""	C20orf74		16490346, 19520869	Standard	NM_020343		Approved	dJ1049G11.4, AS250, KIAA1272, RapGAPalpha2	uc002wrz.3	Q2PPJ7	OTTHUMG00000032010	ENST00000202677.7:c.5031T>C	20.37:g.20486076A>G		Somatic		WXS	SOLID	Phase_I	Q4VXU6|Q5JUA3|Q5JUA4|Q5T9K3|Q96CX9|Q9BQT7|Q9H9D9|Q9ULE8	Silent	SNP	ENST00000202677.7	37	CCDS46584.1	.	.	.	.	.	.	.	.	.	.	A	8.080	0.772267	0.16051	.	.	ENSG00000188559	ENST00000430436;ENST00000427175	.	.	.	5.97	2.43	0.29744	.	.	.	.	.	T	0.58935	0.2157	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51132	-0.8744	4	.	.	.	.	10.0558	0.42244	0.8075:0.0:0.1925:0.0	.	.	.	.	S	1494;88	.	.	L	-	2	0	RALGAPA2	20434076	1.000000	0.71417	1.000000	0.80357	0.810000	0.45777	3.145000	0.50623	0.137000	0.18759	-0.256000	0.11100	TTG		0.393	RALGAPA2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000471941.1		NM_020343	
RHBDL3	162494	hgsc.bcm.edu	37	17	30621399	30621399	+	Silent	SNP	T	T	G			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr17:30621399T>G	ENST00000269051.4	+	5	620	c.606T>G	c.(604-606)gtT>gtG	p.V202V	RHBDL3_ENST00000538145.1_Silent_p.V194V|RHBDL3_ENST00000536287.1_Silent_p.V104V	NM_138328.2	NP_612201.1	P58872	RHBL3_HUMAN	rhomboid, veinlet-like 3 (Drosophila)	202						integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)			breast(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(2)|skin(1)	16		Breast(31;0.116)|Ovarian(249;0.182)				ACTCCCTGGTTTACCACCCAC	0.483																																																	0													173.0	141.0	151.0					17																	30621399		2203	4300	6503	SO:0001819	synonymous_variant	162494			AJ313480	CCDS32613.1	17q11.2	2013-01-10				ENSG00000141314		"""EF-hand domain containing"""	16502	protein-coding gene	gene with protein product			"""rhomboid, veinlet-like 4 (Drosophila)"""	RHBDL4		11900977	Standard	XM_006721733		Approved	VRHO	uc002hhe.1	P58872		ENST00000269051.4:c.606T>G	17.37:g.30621399T>G		Somatic		WXS	SOLID	Phase_I	A6NMH1|Q495Y4|Q495Y5|Q495Y6	Silent	SNP	ENST00000269051.4	37	CCDS32613.1																																																																																				0.483	RHBDL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000447120.1		NM_138328	
RNF17	56163	hgsc.bcm.edu;ucsc.edu	37	13	25367463	25367463	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr13:25367463A>T	ENST00000255324.5	+	10	1271	c.1219A>T	c.(1219-1221)Att>Ttt	p.I407F	RNF17_ENST00000381921.1_Missense_Mutation_p.I407F|RNF17_ENST00000255325.6_Missense_Mutation_p.I407F|RNF17_ENST00000255326.4_3'UTR	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	Q9BXT8	RNF17_HUMAN	ring finger protein 17	407					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(3)|skin(6)	36		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		AATTGAAGAAATTATTGAAGA	0.393																																																	0													121.0	119.0	120.0					13																	25367463		2203	4300	6503	SO:0001583	missense	56163			AF285602, AK001907	CCDS9308.2	13q12.13	2013-01-23			ENSG00000132972	ENSG00000132972		"""RING-type (C3HC4) zinc fingers"", ""Tudor domain containing"""	10060	protein-coding gene	gene with protein product	"""spermatogenesis associated 23"""	605793	"""tudor domain containing 4"""	TDRD4		11279525	Standard	NM_001184993		Approved	Mmip-2, SPATA23, FLJ11045	uc001upr.3	Q9BXT8	OTTHUMG00000016589	ENST00000255324.5:c.1219A>T	13.37:g.25367463A>T	ENSP00000255324:p.Ile407Phe	Somatic		WXS	SOLID	Phase_I	Q5T2J9|Q6P1W3|Q9BXT7|Q9NUY9	Missense_Mutation	SNP	ENST00000255324.5	37	CCDS9308.2	.	.	.	.	.	.	.	.	.	.	A	19.97	3.924933	0.73213	.	.	ENSG00000132972	ENST00000255324;ENST00000381921;ENST00000429047;ENST00000255325;ENST00000255326	T;T;T	0.28255	2.74;2.75;1.62	5.29	4.1	0.47936	.	0.466245	0.19463	N	0.113658	T	0.47581	0.1453	M	0.64997	1.995	0.35590	D	0.807023	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.87578	0.996;0.96;0.998	T	0.53114	-0.8484	10	0.25106	T	0.35	.	9.1002	0.36664	0.9158:0.0:0.0842:0.0	.	407;407;407	B7Z7S1;Q9BXT8;Q9BXT8-2	.;RNF17_HUMAN;.	F	407;407;266;408;407	ENSP00000255324:I407F;ENSP00000371346:I407F;ENSP00000255325:I408F	ENSP00000255324:I407F	I	+	1	0	RNF17	24265463	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.717000	0.37991	1.025000	0.39708	0.528000	0.53228	ATT		0.393	RNF17-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044217.1		NM_031994	
PTBP3	9991	hgsc.bcm.edu;ucsc.edu	37	9	114993689	114993689	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr9:114993689A>C	ENST00000374255.2	-	11	1256	c.1109T>G	c.(1108-1110)aTc>aGc	p.I370S	PTBP3_ENST00000334318.6_Missense_Mutation_p.I373S|PTBP3_ENST00000374257.1_Missense_Mutation_p.I342S|PTBP3_ENST00000343327.2_Missense_Mutation_p.I275S|PTBP3_ENST00000458258.1_Missense_Mutation_p.I376S			O95758	PTBP3_HUMAN	polypyrimidine tract binding protein 3	370	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				anatomical structure morphogenesis (GO:0009653)|erythrocyte maturation (GO:0043249)|mRNA processing (GO:0006397)|negative regulation of RNA splicing (GO:0033119)|regulation of cell differentiation (GO:0045595)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)										ATGTGGTGTGATAAGCTGTAA	0.274																																																	0													78.0	78.0	78.0					9																	114993689		2203	4299	6502	SO:0001583	missense	0			AB023967	CCDS6784.1, CCDS55332.1, CCDS55333.1, CCDS59140.1, CCDS59141.1	9q32	2013-07-16	2011-11-16	2011-11-16	ENSG00000119314	ENSG00000119314		"""RNA binding motif (RRM) containing"""	10253	protein-coding gene	gene with protein product		607527	"""regulator of differentiation (in S. pombe) 1"", ""ROD1 regulator of differentiation 1 (S. pombe)"""	ROD1		10207106	Standard	NM_005156		Approved	DKFZp781I1117	uc004bfx.3	O95758	OTTHUMG00000020503	ENST00000374255.2:c.1109T>G	9.37:g.114993689A>C	ENSP00000363373:p.Ile370Ser	Somatic		WXS	SOLID	Phase_I	B1ALY2|B1ALY3|B1ALY5|B1ALY6|B3KME7|Q68DB9|Q86YB3|Q86YH9	Missense_Mutation	SNP	ENST00000374255.2	37	CCDS6784.1	.	.	.	.	.	.	.	.	.	.	A	15.10	2.734525	0.48939	.	.	ENSG00000119314	ENST00000374257;ENST00000334318;ENST00000458258;ENST00000374255;ENST00000343327	T;T;T;T;T	0.56776	3.26;3.26;0.44;3.26;1.46	5.36	4.2	0.49525	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.339109	0.29752	N	0.011294	T	0.47948	0.1473	L	0.49699	1.58	0.49687	D	0.999812	B;B;B;P;B;B	0.42518	0.228;0.09;0.114;0.782;0.107;0.171	B;B;B;B;B;B	0.41174	0.091;0.124;0.066;0.349;0.058;0.124	T	0.44452	-0.9327	10	0.49607	T	0.09	-0.6126	11.2789	0.49181	0.8629:0.0:0.0:0.1371	.	342;342;275;373;370;376	B1ALY5;O95758-2;B1ALY6;O95758-5;O95758;O95758-4	.;.;.;.;ROD1_HUMAN;.	S	342;373;376;370;275	ENSP00000363375:I342S;ENSP00000334499:I373S;ENSP00000414921:I376S;ENSP00000363373:I370S;ENSP00000340705:I275S	ENSP00000334499:I373S	I	-	2	0	ROD1	114033510	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.132000	0.77251	0.841000	0.35020	0.533000	0.62120	ATC		0.274	PTBP3-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000053679.1			
SAMD3	154075	hgsc.bcm.edu;ucsc.edu	37	6	130505739	130505739	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr6:130505739C>A	ENST00000368134.2	-	8	1021	c.413G>T	c.(412-414)aGc>aTc	p.S138I	SAMD3_ENST00000532763.1_Missense_Mutation_p.S136I|SAMD3_ENST00000533296.1_5'UTR|SAMD3_ENST00000324172.6_Missense_Mutation_p.S138I|SAMD3_ENST00000437477.2_Missense_Mutation_p.S138I|SAMD3_ENST00000457563.2_Missense_Mutation_p.S162I|SAMD3_ENST00000439090.2_Missense_Mutation_p.S138I	NM_001258275.1	NP_001245204.1	Q8N6K7	SAMD3_HUMAN	sterile alpha motif domain containing 3	138										breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(3)|lung(15)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	29				GBM - Glioblastoma multiforme(226;0.00594)|OV - Ovarian serous cystadenocarcinoma(155;0.128)		TAATGCTTTGCTTCTTGCTAG	0.368																																																	0													97.0	88.0	91.0					6																	130505739		2203	4300	6503	SO:0001583	missense	154075			AK091351	CCDS34539.1, CCDS64525.1	6q23.1	2013-01-10			ENSG00000164483	ENSG00000164483		"""Sterile alpha motif (SAM) domain containing"""	21574	protein-coding gene	gene with protein product							Standard	NM_001017373		Approved	bA73O6.2, FLJ34032	uc031spp.1	Q8N6K7	OTTHUMG00000015556	ENST00000368134.2:c.413G>T	6.37:g.130505739C>A	ENSP00000357116:p.Ser138Ile	Somatic		WXS	SOLID	Phase_I	B4DY20|E1P576|J3KQK4|Q4VXD8|Q8NAY1|Q8NB96	Missense_Mutation	SNP	ENST00000368134.2	37	CCDS34539.1	.	.	.	.	.	.	.	.	.	.	C	6.031	0.374018	0.11409	.	.	ENSG00000164483	ENST00000368134;ENST00000457563;ENST00000439090;ENST00000437477;ENST00000532763;ENST00000324172;ENST00000532309;ENST00000531544;ENST00000529723	T;T;T;T;T;T;T;T;T	0.44083	0.94;0.93;0.94;0.94;0.96;0.95;0.96;0.96;0.96	5.67	3.29	0.37713	.	0.398707	0.26616	N	0.023387	T	0.07234	0.0183	N	0.08118	0	0.20764	N	0.999852	B;P;B;B	0.44521	0.229;0.837;0.167;0.105	B;B;B;B	0.32022	0.063;0.139;0.044;0.029	T	0.07424	-1.0773	10	0.72032	D	0.01	.	8.5343	0.33353	0.0:0.2228:0.0:0.7772	.	162;137;138;138	B4DY20;Q4VXD9;Q8N6K7-2;Q8N6K7	.;.;.;SAMD3_HUMAN	I	138;162;138;138;136;138;137;138;135	ENSP00000357116:S138I;ENSP00000402092:S162I;ENSP00000403565:S138I;ENSP00000391163:S138I;ENSP00000436088:S136I;ENSP00000324874:S138I;ENSP00000436115:S137I;ENSP00000435875:S138I;ENSP00000434139:S135I	ENSP00000324874:S138I	S	-	2	0	SAMD3	130547432	0.992000	0.36948	0.996000	0.52242	0.096000	0.18686	0.884000	0.28214	0.426000	0.26116	-0.793000	0.03317	AGC		0.368	SAMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042197.3		NM_152552	
SERPINB13	5275	hgsc.bcm.edu	37	18	61264230	61264230	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr18:61264230G>A	ENST00000344731.5	+	8	911	c.809G>A	c.(808-810)tGg>tAg	p.W270*	SERPINB13_ENST00000269489.5_Nonsense_Mutation_p.W218*	NM_012397.3	NP_036529.1	Q9UIV8	SPB13_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 13	270					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)|response to UV (GO:0009411)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|prostate(2)|urinary_tract(1)	25						TTGGTAGAGTGGACTAGTCCA	0.408																																																	0													80.0	85.0	83.0					18																	61264230		2203	4300	6503	SO:0001587	stop_gained	5275			AF169949, BC101821	CCDS11985.1	18q21.33	2014-02-18	2005-08-18		ENSG00000197641	ENSG00000197641		"""Serine (or cysteine) peptidase inhibitors"""	8944	protein-coding gene	gene with protein product		604445	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 13"""	PI13		9297979, 10512713, 24172014	Standard	NM_012397		Approved	HUR7, hurpin, headpin	uc002ljc.3	Q9UIV8	OTTHUMG00000060406	ENST00000344731.5:c.809G>A	18.37:g.61264230G>A	ENSP00000341584:p.Trp270*	Somatic		WXS	SOLID	Phase_I	A8K2Q8|Q3MII2|Q9HCX1|Q9UBW1|Q9UKG0	Nonsense_Mutation	SNP	ENST00000344731.5	37	CCDS11985.1	.	.	.	.	.	.	.	.	.	.	G	35	5.444662	0.96187	.	.	ENSG00000197641	ENST00000269489;ENST00000539341;ENST00000344731	.	.	.	5.43	4.53	0.55603	.	0.000000	0.46442	D	0.000281	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.7012	0.69157	0.0:0.0:0.8549:0.1451	.	.	.	.	X	218;188;270	.	ENSP00000269489:W218X	W	+	2	0	SERPINB13	59415210	1.000000	0.71417	0.994000	0.49952	0.733000	0.41908	5.304000	0.65744	2.563000	0.86464	0.650000	0.86243	TGG		0.408	SERPINB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133798.1		NM_012397	
SETD2	29072	hgsc.bcm.edu	37	3	47155365	47155365	+	Splice_Site	SNP	C	C	A			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr3:47155365C>A	ENST00000409792.3	-	5	4758		c.e5+1			NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2						angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		AAAGAACTTACGAAGGAAGGT	0.453			"""N, F, S, Mis"""		clear cell renal carcinoma																																			Rec	yes		3	3p21.31	29072	SET domain containing 2		E	0													106.0	107.0	106.0					3																	47155365		2203	4300	6503	SO:0001630	splice_region_variant	29072			AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.4715+1G>T	3.37:g.47155365C>A		Somatic		WXS	SOLID	Phase_I	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Splice_Site	SNP	ENST00000409792.3	37	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	C	22.6	4.317096	0.81469	.	.	ENSG00000181555	ENST00000451092;ENST00000543224;ENST00000409792	.	.	.	4.53	4.53	0.55603	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.8075	0.88606	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SETD2	47130369	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.256000	0.78350	2.518000	0.84900	0.585000	0.79938	.		0.453	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2		NM_014159	Intron
SGCA	6442	hgsc.bcm.edu	37	17	48245918	48245918	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr17:48245918A>G	ENST00000262018.3	+	5	605	c.569A>G	c.(568-570)gAg>gGg	p.E190G	SGCA_ENST00000513942.1_3'UTR|SGCA_ENST00000451235.2_Missense_Mutation_p.E88G|SGCA_ENST00000543315.1_Missense_Mutation_p.E190G|HILS1_ENST00000504307.1_RNA|SGCA_ENST00000344627.6_Missense_Mutation_p.E190G	NM_000023.2	NP_000014.1	Q16586	SGCA_HUMAN	sarcoglycan, alpha (50kDa dystrophin-associated glycoprotein)	190					muscle contraction (GO:0006936)|muscle organ development (GO:0007517)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|sarcoglycan complex (GO:0016012)|sarcolemma (GO:0042383)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(7)|ovary(2)|skin(1)	14						CTTCCCATTGAGGGCCGAAAA	0.592																																																	0													22.0	23.0	23.0					17																	48245918		2197	4294	6491	SO:0001583	missense	6442			L34355	CCDS32679.1, CCDS45729.1	17q21	2014-09-17	2002-08-29		ENSG00000108823	ENSG00000108823			10805	protein-coding gene	gene with protein product	"""50kD DAG"", ""Sarcoglycan, alpha (50kD dystrophin-associated glycoprotein; adhalin)"", ""adhalin (limb girdle muscular dystrophy 2D)"""	600119	"""sarcoglycan, alpha (50kD dystrophin-associated glycoprotein)"""	ADL		7937874	Standard	NM_000023		Approved	SCARMD1, LGMD2D, adhalin, DMDA2, A2	uc002iqi.3	Q16586	OTTHUMG00000162024	ENST00000262018.3:c.569A>G	17.37:g.48245918A>G	ENSP00000262018:p.Glu190Gly	Somatic		WXS	SOLID	Phase_I	A6NEB8|A8K3K7|Q13710|Q13712	Missense_Mutation	SNP	ENST00000262018.3	37	CCDS32679.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.01|12.01	1.810263|1.810263	0.32053|0.32053	.|.	.|.	ENSG00000108823|ENSG00000108823	ENST00000344627;ENST00000262018;ENST00000543315;ENST00000451235;ENST00000511303|ENST00000504073	D;D;D;D;D|.	0.97831|.	-4.56;-4.56;-4.56;-4.56;-4.56|.	4.58|4.58	3.5|3.5	0.40072|0.40072	.|.	0.313613|.	0.28425|.	N|.	0.015385|.	T|.	0.39332|.	0.1074|.	L|L	0.33485|0.33485	1.01|1.01	0.33000|0.33000	D|D	0.526087|0.526087	B;B;B|.	0.23442|.	0.016;0.085;0.004|.	B;B;B|.	0.22753|.	0.03;0.041;0.015|.	T|.	0.48127|.	-0.9062|.	10|.	0.26408|.	T|.	0.33|.	-6.7071|-6.7071	7.7404|7.7404	0.28837|0.28837	0.9:0.0:0.1:0.0|0.9:0.0:0.1:0.0	.|.	88;190;190|.	B7Z1L1;Q16586-2;Q16586|.	.;.;SGCA_HUMAN|.	G|W	190;190;190;88;97|12	ENSP00000345522:E190G;ENSP00000262018:E190G;ENSP00000444539:E190G;ENSP00000390371:E88G;ENSP00000426104:E97G|.	ENSP00000262018:E190G|.	E|X	+|+	2|3	0|0	SGCA|SGCA	45600917|45600917	0.958000|0.958000	0.32768|0.32768	0.956000|0.956000	0.39512|0.39512	0.824000|0.824000	0.46624|0.46624	2.159000|2.159000	0.42339|0.42339	0.721000|0.721000	0.32231|0.32231	0.379000|0.379000	0.24179|0.24179	GAG|TGA		0.592	SGCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366841.1		NM_000023	
SIGLEC10	89790	hgsc.bcm.edu	37	19	51919998	51919998	+	Missense_Mutation	SNP	T	T	C	rs61741677	byFrequency	TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr19:51919998T>C	ENST00000339313.5	-	3	744	c.628A>G	c.(628-630)Aac>Gac	p.N210D	SIGLEC10_ENST00000436984.2_Missense_Mutation_p.N162D|CTD-2616J11.2_ENST00000532688.1_RNA|SIGLEC10_ENST00000439889.2_Missense_Mutation_p.N152D|SIGLEC10_ENST00000353836.5_Missense_Mutation_p.N210D|CTD-2616J11.3_ENST00000532473.1_RNA|CTD-2616J11.2_ENST00000526996.1_RNA|SIGLEC10_ENST00000441969.3_Missense_Mutation_p.N152D|SIGLEC10_ENST00000356298.5_Missense_Mutation_p.N210D|SIGLEC10_ENST00000442846.3_Missense_Mutation_p.N152D|SIGLEC10_ENST00000432469.2_Intron|SIGLEC10_ENST00000525998.1_Missense_Mutation_p.N210D			Q96LC7	SIG10_HUMAN	sialic acid binding Ig-like lectin 10	210	Ig-like C2-type 1.				cell adhesion (GO:0007155)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(27)|ovary(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000668)|OV - Ovarian serous cystadenocarcinoma(262;0.0101)		AGGTCGGTGTTGTGGTCCTGG	0.617													c|||	420	0.0838658	0.0325	0.0793	5008	,	,		16648	0.0645		0.1233	False		,,,				2504	0.136																0								C	ASP/ASN,ASP/ASN,ASP/ASN,ASP/ASN,,ASP/ASN,ASP/ASN	160,4246		4,152,2047	134.0	105.0	115.0		454,628,484,454,,454,628	-0.2	0.0	19	dbSNP_129	115	984,7616		61,862,3377	no	missense,missense,missense,missense,intron,missense,missense	SIGLEC10	NM_001171156.1,NM_001171157.1,NM_001171158.1,NM_001171159.1,NM_001171160.1,NM_001171161.1,NM_033130.4	23,23,23,23,,23,23	65,1014,5424	CC,CT,TT		11.4419,3.6314,8.7959	benign,benign,benign,benign,,benign,benign	152/640,210/603,162/555,152/545,,152/455,210/698	51919998	1144,11862	2203	4300	6503	SO:0001583	missense	89790			AF310233	CCDS12832.1, CCDS54301.1, CCDS54302.1, CCDS54303.1, CCDS54304.1, CCDS54305.1	19q13.3	2013-01-29			ENSG00000142512	ENSG00000142512		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15620	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 10 Ig-like lectin 7"", ""siglec-like gene 2"""	606091				11284738	Standard	NM_033130		Approved	SIGLEC-10, SLG2, PRO940, MGC126774	uc002pwo.3	Q96LC7	OTTHUMG00000165521	ENST00000339313.5:c.628A>G	19.37:g.51919998T>C	ENSP00000345243:p.Asn210Asp	Somatic		WXS	SOLID	Phase_I	A8K1I5|A8K3C7|C9JJ33|C9JM10|F8W917|Q3MIR5|Q6UXI8|Q96G54|Q96LC8	Missense_Mutation	SNP	ENST00000339313.5	37	CCDS12832.1	124	0.056776556776556776	7	0.014227642276422764	24	0.06629834254143646	22	0.038461538461538464	71	0.09366754617414248	.	7.781	0.709455	0.15239	0.036314	0.114419	ENSG00000142512	ENST00000353836;ENST00000442846;ENST00000356298;ENST00000441969;ENST00000525998;ENST00000439889;ENST00000436984;ENST00000339313;ENST00000529627;ENST00000530476	T;D;T;D;T;D;D;T;D;T	0.86097	-1.02;-2.07;-1.02;-2.07;-1.02;-2.07;-2.07;-1.02;-2.07;-1.02	4.69	-0.23	0.13090	CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.619920	0.03179	N	0.171767	T	0.03871	0.0109	N	0.11064	0.09	0.80722	P	0.0	B;B;B;B;B;B;B	0.15141	0.0;0.0;0.012;0.001;0.0;0.0;0.001	B;B;B;B;B;B;B	0.15052	0.001;0.002;0.006;0.003;0.001;0.001;0.012	T	0.34700	-0.9818	9	0.12103	T	0.63	.	7.9734	0.30140	0.0:0.4756:0.0:0.5244	.	162;210;152;210;152;152;210	C9JM10;E9PL79;C9JJ33;Q96LC7-2;Q96LC7-6;Q96LC7-3;Q96LC7	.;.;.;.;.;.;SIG10_HUMAN	D	210;152;210;152;210;152;162;210;24;177	ENSP00000342389:N210D;ENSP00000395475:N152D;ENSP00000348646:N210D;ENSP00000408387:N152D;ENSP00000431444:N210D;ENSP00000389132:N152D;ENSP00000414324:N162D;ENSP00000345243:N210D;ENSP00000435281:N24D;ENSP00000433838:N177D	ENSP00000345243:N210D	N	-	1	0	SIGLEC10	56611810	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.379000	0.02554	-0.499000	0.06623	-1.940000	0.00497	AAC		0.617	SIGLEC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384620.2		NM_033130	
SIPA1L2	57568	hgsc.bcm.edu	37	1	232650234	232650234	+	Silent	SNP	T	T	G			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr1:232650234T>G	ENST00000366630.1	-	2	1210	c.852A>C	c.(850-852)tcA>tcC	p.S284S	SIPA1L2_ENST00000262861.4_Silent_p.S284S			Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like 2	284					regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(49)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	103		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				CCACCGACTCTGATTTCAACC	0.493																																																	0													76.0	77.0	77.0					1																	232650234		1912	4117	6029	SO:0001819	synonymous_variant	57568			AB037810	CCDS41474.1	1q42.2	2008-02-05			ENSG00000116991	ENSG00000116991			23800	protein-coding gene	gene with protein product		611609					Standard	NM_020808		Approved	KIAA1389	uc001hvg.3	Q9P2F8	OTTHUMG00000037820	ENST00000366630.1:c.852A>C	1.37:g.232650234T>G		Somatic		WXS	SOLID	Phase_I	Q2TV88|Q5VXR7|Q5VXR8|Q641Q4|Q8NA38|Q96DZ3|Q9H9F6	Silent	SNP	ENST00000366630.1	37	CCDS41474.1																																																																																				0.493	SIPA1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092318.1		XM_045839	
SLC25A23	79085	hgsc.bcm.edu	37	19	6454351	6454351	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr19:6454351A>G	ENST00000301454.4	-	6	884	c.778T>C	c.(778-780)Ttc>Ctc	p.F260L	SLC25A23_ENST00000334510.5_Missense_Mutation_p.F260L|SLC25A23_ENST00000414491.2_Missense_Mutation_p.F77L	NM_024103.2	NP_077008.2	Q9BV35	SCMC3_HUMAN	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23	260					adenine nucleotide transport (GO:0051503)|cellular response to calcium ion (GO:0071277)|regulation of cellular respiration (GO:0043457)|regulation of oxidative phosphorylation (GO:0002082)|regulation of sequestering of calcium ion (GO:0051282)|transmembrane transport (GO:0055085)|urea homeostasis (GO:0097274)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)			endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|pancreas(1)|skin(1)	17						TAGGCCATGAACTTGATAGCT	0.542																																																	0													132.0	129.0	130.0					19																	6454351		2203	4300	6503	SO:0001583	missense	79085			AJ619962	CCDS32882.1	19p13.1	2014-02-06			ENSG00000125648	ENSG00000125648		"""Solute carriers"", ""EF-hand domain containing"""	19375	protein-coding gene	gene with protein product		608746				15123600	Standard	NM_024103		Approved	FLJ30339, MGC2615, APC2	uc002mex.1	Q9BV35	OTTHUMG00000180852	ENST00000301454.4:c.778T>C	19.37:g.6454351A>G	ENSP00000301454:p.Phe260Leu	Somatic		WXS	SOLID	Phase_I	B4DGB6|Q4LBC2|Q705K3|Q86Y43|Q8N2N4|Q96NQ4	Missense_Mutation	SNP	ENST00000301454.4	37	CCDS32882.1	.	.	.	.	.	.	.	.	.	.	A	25.9	4.682624	0.88542	.	.	ENSG00000125648	ENST00000264088;ENST00000301454;ENST00000414491;ENST00000334510	D;D;D;D	0.83673	-1.75;-1.75;-1.75;-1.75	5.79	5.79	0.91817	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.91385	0.7282	M	0.84511	2.7	0.80722	D	1	D;D	0.60575	0.988;0.975	D;P	0.67382	0.951;0.883	D	0.92665	0.6145	10	0.87932	D	0	-34.024	15.1042	0.72306	1.0:0.0:0.0:0.0	.	77;260	E7ESZ5;Q9BV35	.;SCMC3_HUMAN	L	307;260;77;260	ENSP00000264088:F307L;ENSP00000301454:F260L;ENSP00000408814:F77L;ENSP00000334537:F260L	ENSP00000264088:F307L	F	-	1	0	SLC25A23	6405351	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.898000	0.92538	2.217000	0.71921	0.533000	0.62120	TTC		0.542	SLC25A23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453325.1		NM_024103	
LRIG1	26018	hgsc.bcm.edu	37	3	66428112	66428112	+	IGR	SNP	A	A	C			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr3:66428112A>C	ENST00000273261.3	-	0	5273				SLC25A26_ENST00000354883.6_Splice_Site|SLC25A26_ENST00000413054.1_Splice_Site|LRIG1_ENST00000496559.2_5'Flank|SLC25A26_ENST00000336733.6_Splice_Site|SLC25A26_ENST00000536651.1_Splice_Site	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1						innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		TTTTTCCCCTAGATTATTTGC	0.433																																																	0													105.0	109.0	108.0					3																	66428112		2203	4300	6503	SO:0001628	intergenic_variant	115286			AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727		3.37:g.66428112A>C		Somatic		WXS	SOLID	Phase_I	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Splice_Site	SNP	ENST00000273261.3	37	CCDS33783.1	.	.	.	.	.	.	.	.	.	.	A	16.26	3.074014	0.55646	.	.	ENSG00000144741	ENST00000354883;ENST00000336733	.	.	.	6.07	6.07	0.98685	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.6288	0.85011	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SLC25A26	66510802	1.000000	0.71417	0.941000	0.38009	0.369000	0.29798	8.631000	0.90991	2.326000	0.78906	0.533000	0.62120	.		0.433	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1		NM_015541	
SLC25A4	291	hgsc.bcm.edu	37	4	186067039	186067039	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr4:186067039C>G	ENST00000281456.6	+	3	857	c.725C>G	c.(724-726)tCc>tGc	p.S242C		NM_001151.3	NP_001142.2	P12235	ADT1_HUMAN	solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4	242					adenine transport (GO:0015853)|apoptotic mitochondrial changes (GO:0008637)|energy reserve metabolic process (GO:0006112)|generation of precursor metabolites and energy (GO:0006091)|mitochondrial genome maintenance (GO:0000002)|negative regulation of necroptotic process (GO:0060546)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	adenine transmembrane transporter activity (GO:0015207)			endometrium(2)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)	10		all_lung(41;1.19e-13)|Lung NSC(41;3.16e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00872)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;4.48e-44)|Epithelial(43;2.1e-41)|all cancers(43;1.37e-36)|Colorectal(24;4.79e-05)|BRCA - Breast invasive adenocarcinoma(30;7.72e-05)|GBM - Glioblastoma multiforme(59;0.000274)|COAD - Colon adenocarcinoma(29;0.000362)|STAD - Stomach adenocarcinoma(60;0.000756)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.155)	Adenosine triphosphate(DB00171)|Clodronate(DB00720)	ATGATGCAGTCCGGCCGGAAA	0.507																																																	0													80.0	69.0	73.0					4																	186067039		2203	4300	6503	SO:0001583	missense	291			BC008664	CCDS34114.1	4q35	2014-09-17			ENSG00000151729	ENSG00000151729		"""Solute carriers"""	10990	protein-coding gene	gene with protein product		103220		PEO3, PEO2, ANT1		1582253	Standard	NM_001151		Approved	T1	uc003ixd.3	P12235	OTTHUMG00000134299	ENST00000281456.6:c.725C>G	4.37:g.186067039C>G	ENSP00000281456:p.Ser242Cys	Somatic		WXS	SOLID	Phase_I	D3DP59	Missense_Mutation	SNP	ENST00000281456.6	37	CCDS34114.1	.	.	.	.	.	.	.	.	.	.	C	17.23	3.337197	0.60963	.	.	ENSG00000151729	ENST00000281456	T	0.80214	-1.35	5.27	5.27	0.74061	Mitochondrial carrier domain (2);	0.053328	0.85682	D	0.000000	D	0.93963	0.8067	H	0.97983	4.12	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.95850	0.8874	10	0.87932	D	0	-0.0879	19.0978	0.93260	0.0:1.0:0.0:0.0	.	242	P12235	ADT1_HUMAN	C	242	ENSP00000281456:S242C	ENSP00000281456:S242C	S	+	2	0	SLC25A4	186304033	1.000000	0.71417	1.000000	0.80357	0.047000	0.14425	7.638000	0.83328	2.735000	0.93741	0.655000	0.94253	TCC		0.507	SLC25A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259170.3		NM_001151	
SRRD	402055	hgsc.bcm.edu;ucsc.edu	37	22	26884408	26884408	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr22:26884408T>C	ENST00000215917.7	+	4	577	c.563T>C	c.(562-564)aTt>aCt	p.I188T		NM_001013694.2	NP_001013716.2	Q9UH36	SRR1L_HUMAN	SRR1 domain containing	188					rhythmic process (GO:0048511)					endometrium(1)|large_intestine(1)|lung(1)|prostate(1)	4						CAACTTGAAATTGAAGTCCTT	0.438																																																	0													183.0	181.0	182.0					22																	26884408		1912	4127	6039	SO:0001583	missense	402055			BC066962	CCDS42995.1	22q12.1	2008-10-31			ENSG00000100104	ENSG00000100104			33910	protein-coding gene	gene with protein product	"""hepatocellular carcinoma complicating hemochromatosis"""	602254					Standard	NM_001013694		Approved	HC/HCC, SRR1L	uc010gve.3	Q9UH36	OTTHUMG00000150885	ENST00000215917.7:c.563T>C	22.37:g.26884408T>C	ENSP00000215917:p.Ile188Thr	Somatic		WXS	SOLID	Phase_I	Q6NXP8	Missense_Mutation	SNP	ENST00000215917.7	37	CCDS42995.1	.	.	.	.	.	.	.	.	.	.	T	9.951	1.220114	0.22373	.	.	ENSG00000100104	ENST00000215917	T	0.47177	0.85	5.46	-0.111	0.13576	Sensitivity To Red Light Reduced-like, SRR1 (1);	1.047530	0.07355	N	0.882984	T	0.39655	0.1086	L	0.46157	1.445	0.09310	N	1	B;B	0.22211	0.066;0.066	B;B	0.22880	0.042;0.042	T	0.31336	-0.9947	10	0.22706	T	0.39	-4.6276	9.5964	0.39576	0.0:0.3626:0.0:0.6374	.	188;181	Q9UH36;B4DF37	SRR1L_HUMAN;.	T	188	ENSP00000215917:I188T	ENSP00000215917:I188T	I	+	2	0	SRRD	25214408	0.014000	0.17966	0.001000	0.08648	0.274000	0.26718	0.017000	0.13399	-0.266000	0.09339	-0.264000	0.10439	ATT		0.438	SRRD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320423.2		NM_001013694	
THADA	63892	hgsc.bcm.edu;ucsc.edu	37	2	43735802	43735802	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr2:43735802A>C	ENST00000405006.4	-	23	3843	c.3492T>G	c.(3490-3492)atT>atG	p.I1164M	THADA_ENST00000405975.2_Missense_Mutation_p.I1164M|THADA_ENST00000415080.2_Missense_Mutation_p.I874M|THADA_ENST00000330266.7_Missense_Mutation_p.I874M	NM_001083953.1|NM_001271643.1	NP_001077422.1|NP_001258572.1	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	1164										breast(1)|endometrium(9)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	66		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				TGTAGAAAGGAATTCCAGCAC	0.408																																																	0													87.0	83.0	84.0					2																	43735802		1900	4112	6012	SO:0001583	missense	63892			AY149629	CCDS46268.1, CCDS62901.1, CCDS62902.1	2p21	2008-02-05			ENSG00000115970	ENSG00000115970			19217	protein-coding gene	gene with protein product		611800				12063398, 11214970	Standard	NM_022065		Approved	FLJ21877, KIAA1767, GITA	uc002rsx.4	Q6YHU6	OTTHUMG00000152398	ENST00000405006.4:c.3492T>G	2.37:g.43735802A>C	ENSP00000385995:p.Ile1164Met	Somatic		WXS	SOLID	Phase_I	A8K1V8|B7WNS6|Q3KR04|Q53RC6|Q53TB2|Q6YHU2|Q6ZU38|Q8IY32|Q8TAU8|Q96I88|Q9BZF7|Q9C096|Q9H6U0|Q9H6W7	Missense_Mutation	SNP	ENST00000405006.4	37	CCDS46268.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.49|15.49	2.850487|2.850487	0.51270|0.51270	.|.	.|.	ENSG00000115970|ENSG00000115970	ENST00000407351|ENST00000330266;ENST00000405975;ENST00000356975;ENST00000415080;ENST00000405006	.|T;T;T;T	.|0.52754	.|0.65;0.65;0.65;0.65	4.61|4.61	0.553|0.553	0.17235|0.17235	.|Domain of unknown function DUF2428, death-receptor-like (1);Armadillo-type fold (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.57315|0.57315	0.2045|0.2045	L|L	0.53249|0.53249	1.67|1.67	0.38843|0.38843	D|D	0.956119|0.956119	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.91635	.|0.996;0.999;0.998;0.999	T|T	0.57148|0.57148	-0.7861|-0.7861	5|10	.|0.87932	.|D	.|0	-12.5536|-12.5536	7.7005|7.7005	0.28619|0.28619	0.6856:0.0:0.3144:0.0|0.6856:0.0:0.3144:0.0	.|.	.|874;1165;874;1164	.|Q6YHU6-2;B6ZDQ0;C9JJB1;Q6YHU6	.|.;.;.;THADA_HUMAN	C|M	478|874;1164;1165;874;1164	.|ENSP00000331105:I874M;ENSP00000386088:I1164M;ENSP00000416048:I874M;ENSP00000385995:I1164M	.|ENSP00000331105:I874M	F|I	-|-	2|3	0|3	THADA|THADA	43589306|43589306	0.993000|0.993000	0.37304|0.37304	0.987000|0.987000	0.45799|0.45799	0.982000|0.982000	0.71751|0.71751	0.295000|0.295000	0.19065|0.19065	0.003000|0.003000	0.14656|0.14656	0.533000|0.533000	0.62120|0.62120	TTC|ATT		0.408	THADA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326070.3		NM_022065	
TMEM62	80021	hgsc.bcm.edu;ucsc.edu	37	15	43476766	43476766	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr15:43476766A>C	ENST00000260403.2	+	14	2193	c.1914A>C	c.(1912-1914)aaA>aaC	p.K638N	RP11-473C18.3_ENST00000565685.1_RNA|CCNDBP1_ENST00000356633.5_5'Flank|EPB42_ENST00000563128.1_Intron|CCNDBP1_ENST00000300213.4_5'Flank	NM_024956.3	NP_079232.3	Q0P6H9	TMM62_HUMAN	transmembrane protein 62	638						integral component of membrane (GO:0016021)				breast(1)|cervix(1)|endometrium(3)|large_intestine(3)|lung(4)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	18		all_cancers(109;1.16e-10)|all_epithelial(112;2.01e-09)|Lung NSC(122;8.91e-07)|all_lung(180;8.8e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;4.23e-07)		TGCAGTTAAAAAGCCACCTGA	0.552																																																	0													61.0	62.0	62.0					15																	43476766		2203	4299	6502	SO:0001583	missense	80021			BC009981	CCDS32210.1	15q15.2	2014-09-11			ENSG00000137842	ENSG00000137842			26269	protein-coding gene	gene with protein product							Standard	NM_024956		Approved	FLJ23375	uc001zqr.3	Q0P6H9	OTTHUMG00000176485	ENST00000260403.2:c.1914A>C	15.37:g.43476766A>C	ENSP00000260403:p.Lys638Asn	Somatic		WXS	SOLID	Phase_I	Q6I9Y5|Q9H5J6	Missense_Mutation	SNP	ENST00000260403.2	37	CCDS32210.1	.	.	.	.	.	.	.	.	.	.	A	15.39	2.820400	0.50633	.	.	ENSG00000137842	ENST00000260403	.	.	.	5.4	5.4	0.78164	.	0.329807	0.33327	N	0.005032	T	0.62146	0.2404	N	0.22421	0.69	0.44956	D	0.997974	D	0.76494	0.999	D	0.63283	0.913	T	0.67039	-0.5771	9	0.72032	D	0.01	-11.5502	15.5811	0.76439	1.0:0.0:0.0:0.0	.	638	Q0P6H9	TMM62_HUMAN	N	638	.	ENSP00000260403:K638N	K	+	3	2	TMEM62	41264058	1.000000	0.71417	1.000000	0.80357	0.010000	0.07245	4.288000	0.59007	2.270000	0.75569	0.459000	0.35465	AAA		0.552	TMEM62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432227.1		NM_024956	
TYW1B	441250	hgsc.bcm.edu	37	7	72178756	72178756	+	RNA	SNP	C	C	A	rs146095374	byFrequency	TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr7:72178756C>A	ENST00000435769.2	-	0	1316				TYW1B_ENST00000343721.5_RNA|TYW1B_ENST00000438125.1_RNA			Q6NUM6	TYW1B_HUMAN	tRNA-yW synthesizing protein 1 homolog B (S. cerevisiae)						tRNA processing (GO:0008033)		4 iron, 4 sulfur cluster binding (GO:0051539)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|lyase activity (GO:0016829)|oxidoreductase activity (GO:0016491)										GCCCGGTACTCCTGGAGAATA	0.433													C|||	632	0.126198	0.0325	0.1571	5008	,	,		21772	0.3165		0.0398	False		,,,				2504	0.1237																0													40.0	38.0	38.0					7																	72178756		692	1590	2282			441250			BC068520	CCDS69309.1	7q11.23	2011-08-11	2009-07-28		ENSG00000254184	ENSG00000277149			33908	protein-coding gene	gene with protein product	"""radical S-adenosyl methionine and flavodoxin domains 1"", ""non-protein coding RNA 69"", ""long intergenic non-protein coding RNA 69"""		"""tRNA-yW synthesizing protein 1 homolog B (non-protein coding)"""				Standard	NM_001145440		Approved	RSAFD2, MGC87315, NCRNA00069, LINC00069	uc011kej.2	Q6NUM6	OTTHUMG00000157067		7.37:g.72178756C>A		Somatic		WXS	SOLID	Phase_I	A6NG09|B4DFY2|Q3KQX2	Missense_Mutation	SNP	ENST00000435769.2	37																																																																																					0.433	TYW1B-001	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000347346.2		NM_001145440	
USH1C	10083	hgsc.bcm.edu	37	11	17523513	17523513	+	Nonsense_Mutation	SNP	A	A	C			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr11:17523513A>C	ENST00000318024.4	-	16	1407	c.1299T>G	c.(1297-1299)taT>taG	p.Y433*	USH1C_ENST00000527020.1_Nonsense_Mutation_p.Y414*|USH1C_ENST00000005226.7_Nonsense_Mutation_p.Y733*|USH1C_ENST00000529563.1_5'UTR|USH1C_ENST00000527720.1_Nonsense_Mutation_p.Y402*	NM_005709.3	NP_005700.2	Q9Y6N9	USH1C_HUMAN	Usher syndrome 1C (autosomal recessive, severe)	433					auditory receptor cell differentiation (GO:0042491)|equilibrioception (GO:0050957)|G2/M transition of mitotic cell cycle (GO:0000086)|inner ear morphogenesis (GO:0042472)|parallel actin filament bundle assembly (GO:0030046)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	spectrin binding (GO:0030507)	p.Y733*(1)		central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	48						AGCCTTCCTCATATTTCCGGA	0.527																																																	1	Substitution - Nonsense(1)	large_intestine(1)											101.0	93.0	96.0					11																	17523513		2200	4293	6493	SO:0001587	stop_gained	10083			AB006955	CCDS7825.1, CCDS31438.1, CCDS73265.1	11p14.3	2013-06-19	2004-05-19		ENSG00000006611	ENSG00000006611			12597	protein-coding gene	gene with protein product	"""harmonin"""	605242	"""deafness, autosomal recessive 18"""	DFNB18		10973247, 12107438	Standard	NM_005709		Approved	PDZ73, harmonin, NY-CO-37, NY-CO-38, PDZ-73, AIE-75, PDZD7C	uc001mne.3	Q9Y6N9	OTTHUMG00000166323	ENST00000318024.4:c.1299T>G	11.37:g.17523513A>C	ENSP00000317018:p.Tyr433*	Somatic		WXS	SOLID	Phase_I	A8K423|Q7RTU8|Q96B29|Q9UM04|Q9UM17|Q9UPC3	Nonsense_Mutation	SNP	ENST00000318024.4	37	CCDS31438.1	.	.	.	.	.	.	.	.	.	.	A	39	7.480544	0.98309	.	.	ENSG00000006611	ENST00000318024;ENST00000527720;ENST00000527020;ENST00000005226	.	.	.	5.37	-1.29	0.09288	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10377	T	0.69	.	9.4852	0.38924	0.5993:0.0:0.4007:0.0	.	.	.	.	X	433;402;414;733	.	ENSP00000005226:Y733X	Y	-	3	2	USH1C	17480089	0.927000	0.31430	0.996000	0.52242	0.998000	0.95712	-0.016000	0.12613	-0.235000	0.09767	0.528000	0.53228	TAT		0.527	USH1C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000389146.1		NM_005709	
USP34	9736	hgsc.bcm.edu;ucsc.edu	37	2	61441707	61441707	+	Silent	SNP	G	G	A			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr2:61441707G>A	ENST00000398571.2	-	68	8246	c.8170C>T	c.(8170-8172)Cta>Tta	p.L2724L	USP34_ENST00000472689.1_Intron	NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	2724					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			ACCTGATGTAGGACTACTGTT	0.468																																																	0													107.0	105.0	106.0					2																	61441707		2006	4175	6181	SO:0001819	synonymous_variant	9736			AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.8170C>T	2.37:g.61441707G>A		Somatic		WXS	SOLID	Phase_I	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Silent	SNP	ENST00000398571.2	37	CCDS42686.1	.	.	.	.	.	.	.	.	.	.	G	7.410	0.634642	0.14322	.	.	ENSG00000115464	ENST00000411912	.	.	.	5.87	4.99	0.66335	.	.	.	.	.	T	0.70996	0.3288	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.68708	-0.5337	4	.	.	.	.	15.2946	0.73894	0.0678:0.0:0.9322:0.0	.	.	.	.	L	483	.	.	P	-	2	0	USP34	61295211	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.791000	0.75120	2.785000	0.95823	0.655000	0.94253	CCT		0.468	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4			
VWCE	220001	hgsc.bcm.edu	37	11	61053852	61053852	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr11:61053852C>G	ENST00000335613.5	-	5	861	c.475G>C	c.(475-477)Gaa>Caa	p.E159Q		NM_152718.2	NP_689931.2	Q96DN2	VWCE_HUMAN	von Willebrand factor C and EGF domains	159	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37						AACCCACCTTCTGTGTTCACA	0.572																																																	0													125.0	112.0	117.0					11																	61053852		2203	4299	6502	SO:0001583	missense	220001			AK056571	CCDS8002.1	11q12.2	2006-08-04			ENSG00000167992	ENSG00000167992			26487	protein-coding gene	gene with protein product		611115				12869306	Standard	NM_152718		Approved	URG11, FLJ32009, VWC1	uc001nra.3	Q96DN2	OTTHUMG00000168208	ENST00000335613.5:c.475G>C	11.37:g.61053852C>G	ENSP00000334186:p.Glu159Gln	Somatic		WXS	SOLID	Phase_I	A5PKV0|Q7Z7L6|Q86WK8	Missense_Mutation	SNP	ENST00000335613.5	37	CCDS8002.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.060112	0.76074	.	.	ENSG00000167992	ENST00000335613	D	0.92099	-2.97	5.28	5.28	0.74379	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.53938	D	0.000051	D	0.89438	0.6715	N	0.02345	-0.59	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89024	0.3437	10	0.19147	T	0.46	.	18.5131	0.90925	0.0:1.0:0.0:0.0	.	159	Q96DN2	VWCE_HUMAN	Q	159	ENSP00000334186:E159Q	ENSP00000301770:E159Q	E	-	1	0	VWCE	60810428	0.998000	0.40836	0.955000	0.39395	0.547000	0.35210	5.059000	0.64306	2.465000	0.83290	0.655000	0.94253	GAA		0.572	VWCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398811.1		NM_152718	
XRCC6BP1	91419	hgsc.bcm.edu;ucsc.edu	37	12	58347427	58347427	+	Silent	SNP	C	C	T			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr12:58347427C>T	ENST00000300145.3	+	5	617	c.492C>T	c.(490-492)gtC>gtT	p.V164V	XRCC6BP1_ENST00000546709.1_3'UTR	NM_033276.2	NP_150592.1	Q9Y6H3	ATP23_HUMAN	XRCC6 binding protein 1	164					double-strand break repair via nonhomologous end joining (GO:0006303)|protein phosphorylation (GO:0006468)	DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)	DNA-dependent protein kinase activity (GO:0004677)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)	11						GCTCACTTGTCAATGAAATAT	0.353																																																	0													156.0	136.0	142.0					12																	58347427		1839	4109	5948	SO:0001819	synonymous_variant	91419			AF078164	CCDS41802.1	12q14.1	2006-01-09				ENSG00000166896			29452	protein-coding gene	gene with protein product	"""Ku70 binding protein 3"""					10219089	Standard	XM_005269223		Approved	KUB3	uc001sqp.3	Q9Y6H3	OTTHUMG00000170493	ENST00000300145.3:c.492C>T	12.37:g.58347427C>T		Somatic		WXS	SOLID	Phase_I	Q1RLM4|Q96E81	Silent	SNP	ENST00000300145.3	37	CCDS41802.1																																																																																				0.353	XRCC6BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409390.1		NM_033276	
PBRM1	55193	ucsc.edu	37	3	52643806	52643806	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	T	T	T	-	T	T	Unknown	Valid	Somatic	Phase_I	WXS	PGM	.		Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr3:52643806delT	ENST00000296302.7	-	16	2091	c.2090delA	c.(2089-2091)tatfs	p.Y697fs	PBRM1_ENST00000337303.4_Frame_Shift_Del_p.Y697fs|PBRM1_ENST00000356770.4_Frame_Shift_Del_p.Y665fs|PBRM1_ENST00000409114.3_Frame_Shift_Del_p.Y712fs|PBRM1_ENST00000394830.3_Frame_Shift_Del_p.Y697fs|PBRM1_ENST00000409057.1_Frame_Shift_Del_p.Y697fs|PBRM1_ENST00000409767.1_Frame_Shift_Del_p.Y712fs|PBRM1_ENST00000410007.1_Frame_Shift_Del_p.Y697fs			Q86U86	PB1_HUMAN	polybromo 1	697	Bromo 5. {ECO:0000255|PROSITE- ProRule:PRU00035}.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		AATAGTCAGATAGTAGTCAGG	0.433			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																	.		Rec	yes		3	3p21	55193	polybromo 1		E	0													117.0	122.0	121.0					3																	52643806		2203	4300	6503	SO:0001589	frameshift_variant	55193			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.2090delA	3.37:g.52643806delT	ENSP00000296302:p.Tyr697fs	Somatic		WXS	SOLID	.	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Frame_Shift_Del	DEL	ENST00000296302.7	37																																																																																					0.433	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1		NM_018165	
ZBBX	79740	hgsc.bcm.edu	37	3	166960361	166960361	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-4718-01A-01D-1361-10	TCGA-B0-4718-11A-01D-1361-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	698af929-547a-47d9-b7b6-3c096b1b3c75	d427b9ce-b2aa-4b47-97d5-0a74096d4e02	g.chr3:166960361T>C	ENST00000392766.2	-	20	2548	c.2208A>G	c.(2206-2208)atA>atG	p.I736M	ZBBX_ENST00000455345.2_Missense_Mutation_p.I775M|ZBBX_ENST00000307529.5_Missense_Mutation_p.I775M|ZBBX_ENST00000392764.1_Missense_Mutation_p.I707M|ZBBX_ENST00000392767.2_Missense_Mutation_p.I736M	NM_001199201.1|NM_024687.3	NP_001186130.1|NP_078963.2	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	736						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(9)|liver(1)|lung(38)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	70						AAATCTGACTTATATTCAGTG	0.368																																																	0													96.0	94.0	95.0					3																	166960361		1827	4077	5904	SO:0001583	missense	79740			AK026702	CCDS3199.2, CCDS56295.1, CCDS56296.1	3q26.1	2010-03-23			ENSG00000169064	ENSG00000169064			26245	protein-coding gene	gene with protein product						12477932	Standard	NM_024687		Approved	FLJ23049	uc011bpc.2	A8MT70	OTTHUMG00000133560	ENST00000392766.2:c.2208A>G	3.37:g.166960361T>C	ENSP00000376519:p.Ile736Met	Somatic		WXS	SOLID	Phase_I	A8MV69|B3KSC1|B5MDJ6|F2Z370|Q9H5T8	Missense_Mutation	SNP	ENST00000392766.2	37	CCDS3199.2	.	.	.	.	.	.	.	.	.	.	T	4.980	0.181967	0.09495	.	.	ENSG00000169064	ENST00000392766;ENST00000392767;ENST00000455345;ENST00000307529;ENST00000392764	T;T;T;T;T	0.56103	0.48;0.48;0.48;0.48;0.48	5.48	1.9	0.25705	.	1.180180	0.06171	N	0.677624	T	0.40448	0.1117	L	0.29908	0.895	0.09310	N	0.999995	B;B	0.14438	0.007;0.01	B;B	0.14023	0.01;0.004	T	0.29971	-0.9994	10	0.41790	T	0.15	1.9145	6.3855	0.21558	0.0:0.2809:0.0:0.7191	.	775;736	A8MT70-2;A8MT70	.;ZBBX_HUMAN	M	736;736;775;775;707	ENSP00000376519:I736M;ENSP00000376520:I736M;ENSP00000390232:I775M;ENSP00000305065:I775M;ENSP00000376517:I707M	ENSP00000305065:I775M	I	-	3	3	ZBBX	168443055	0.005000	0.15991	0.232000	0.24009	0.005000	0.04900	0.072000	0.14617	0.396000	0.25283	-0.415000	0.06103	ATA		0.368	ZBBX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257657.3		NM_024687	
