#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
AKAP12	9590	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	151670459	151670459	+	Silent	SNP	C	C	A			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr6:151670459C>A	ENST00000253332.1	+	3	1122	c.933C>A	c.(931-933)acC>acA	p.T311T	AKAP12_ENST00000359755.5_Silent_p.T206T|AKAP12_ENST00000354675.6_Silent_p.T213T|snoU13_ENST00000458767.1_RNA|AKAP12_ENST00000402676.2_Silent_p.T311T			Q02952	AKA12_HUMAN	A kinase (PRKA) anchor protein 12	311	Involved in PKC-binding. {ECO:0000305}.				G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of protein kinase A signaling (GO:0010739)|protein targeting (GO:0006605)|regulation of protein kinase C signaling (GO:0090036)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	adenylate cyclase binding (GO:0008179)|protein kinase A binding (GO:0051018)	p.T311T(1)		breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	68		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.98e-11)		GCAAAAAGACCAGTTTCAGGA	0.483																																					Melanoma(141;1616 1805 10049 24534 51979)												1	Substitution - coding silent(1)	kidney(1)											44.0	52.0	49.0					6																	151670459		2203	4300	6503	SO:0001819	synonymous_variant	9590			U81607	CCDS5229.1, CCDS5230.1	6q24-q25	2011-07-01	2008-08-29		ENSG00000131016	ENSG00000131016		"""A-kinase anchor proteins"""	370	protein-coding gene	gene with protein product	"""gravin"", ""Src-Suppressed C Kinase Substrate"""	604698	"""A kinase (PRKA) anchor protein (gravin) 12"""			9000000	Standard	NM_144497		Approved	AKAP250, SSeCKS	uc011eep.2	Q02952	OTTHUMG00000015833	ENST00000253332.1:c.933C>A	6.37:g.151670459C>A		Somatic		WXS	Illumina HiSeq	Phase_I	O00310|O00498|Q4LE68|Q5SZ80|Q5TGN1|Q68D82|Q99970	Silent	SNP	ENST00000253332.1	37	CCDS5229.1																																																																																				0.483	AKAP12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042712.1			
ALPI	248	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	233321772	233321772	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr2:233321772C>A	ENST00000295463.3	+	4	541	c.464C>A	c.(463-465)gCc>gAc	p.A155D		NM_001631.3	NP_001622.2	P09923	PPBI_HUMAN	alkaline phosphatase, intestinal	155					dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|magnesium ion binding (GO:0000287)|protease binding (GO:0002020)|zinc ion binding (GO:0008270)	p.A155D(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|prostate(2)|upper_aerodigestive_tract(1)	24		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;1.64e-16)|Kidney(3;9.71e-08)|KIRC - Kidney renal clear cell carcinoma(3;2.74e-06)|BRCA - Breast invasive adenocarcinoma(100;0.000763)|Lung(119;0.00564)|LUSC - Lung squamous cell carcinoma(224;0.00746)		ATGAACCGGGCCAAGCAAGCA	0.607																																																	1	Substitution - Missense(1)	kidney(1)											41.0	36.0	37.0					2																	233321772		2203	4300	6503	SO:0001583	missense	248			M15694	CCDS2492.1	2q37.1	2008-02-05			ENSG00000163295	ENSG00000163295	3.1.3.1		437	protein-coding gene	gene with protein product		171740				3468508, 3469665	Standard	NM_001631		Approved		uc002vst.4	P09923	OTTHUMG00000133258	ENST00000295463.3:c.464C>A	2.37:g.233321772C>A	ENSP00000295463:p.Ala155Asp	Somatic		WXS	Illumina HiSeq	Phase_I	B2R7Y4|Q53S80|Q9UBV5|Q9UCL2	Missense_Mutation	SNP	ENST00000295463.3	37	CCDS2492.1	.	.	.	.	.	.	.	.	.	.	C	19.71	3.878176	0.72294	.	.	ENSG00000163295	ENST00000295463	D	0.98996	-5.31	5.5	5.5	0.81552	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.99722	0.9892	H	0.99847	4.84	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96959	0.9700	10	0.87932	D	0	.	18.7561	0.91833	0.0:1.0:0.0:0.0	.	155	P09923	PPBI_HUMAN	D	155	ENSP00000295463:A155D	ENSP00000295463:A155D	A	+	2	0	ALPI	233030016	1.000000	0.71417	1.000000	0.80357	0.190000	0.23558	7.441000	0.80485	2.757000	0.94681	0.561000	0.74099	GCC		0.607	ALPI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257035.2		NM_001631	
AMDHD2	51005	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	2579481	2579481	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr16:2579481G>A	ENST00000293971.6	+	11	1241	c.1147G>A	c.(1147-1149)Gtg>Atg	p.V383M	CEMP1_ENST00000382350.1_Intron|AMDHD2_ENST00000565570.1_Intron|AMDHD2_ENST00000302956.4_Missense_Mutation_p.V413M|MIR3178_ENST00000581887.1_RNA|AMDHD2_ENST00000413459.3_Missense_Mutation_p.V413M	NM_015944.3	NP_057028.2	Q9Y303	NAGA_HUMAN	amidohydrolase domain containing 2	383					carbohydrate metabolic process (GO:0005975)|N-acetylglucosamine metabolic process (GO:0006044)|N-acetylneuraminate catabolic process (GO:0019262)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|N-acetylglucosamine-6-phosphate deacetylase activity (GO:0008448)	p.V413M(2)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(3)|skin(2)|urinary_tract(2)	19						CCCAGACTTCGTGGTGCTCGA	0.652																																																	2	Substitution - Missense(2)	endometrium(1)|kidney(1)											128.0	103.0	112.0					16																	2579481		2198	4300	6498	SO:0001583	missense	51005			AF132948	CCDS10471.1, CCDS53984.1	16p13.3	2008-02-05			ENSG00000162066	ENSG00000162066			24262	protein-coding gene	gene with protein product						10810093	Standard	NM_001145815		Approved	CGI-14	uc010uwc.2	Q9Y303	OTTHUMG00000128866	ENST00000293971.6:c.1147G>A	16.37:g.2579481G>A	ENSP00000293971:p.Val383Met	Somatic		WXS	Illumina HiSeq	Phase_I	B4DL77|Q8WV54	Missense_Mutation	SNP	ENST00000293971.6	37		.	.	.	.	.	.	.	.	.	.	G	20.6	4.011412	0.75046	.	.	ENSG00000162066	ENST00000413459;ENST00000302956;ENST00000293971	T;D;T	0.92446	0.27;-3.04;0.56	5.28	5.28	0.74379	Amidohydrolase 1 (1);Metal-dependent hydrolase, composite domain (1);	0.123452	0.53938	D	0.000048	D	0.96237	0.8773	M	0.87682	2.9	0.80722	D	1	D;D;D	0.89917	1.0;0.993;0.991	D;D;D	0.76071	0.987;0.95;0.917	D	0.96697	0.9515	10	0.87932	D	0	-28.0632	14.0668	0.64834	0.0:0.1518:0.8482:0.0	.	413;383;413	Q9Y303-3;Q9Y303;Q9Y303-2	.;NAGA_HUMAN;.	M	413;413;383	ENSP00000391596:V413M;ENSP00000307481:V413M;ENSP00000293971:V383M	ENSP00000293971:V383M	V	+	1	0	AMDHD2	2519482	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	4.263000	0.58853	2.470000	0.83445	0.655000	0.94253	GTG		0.652	AMDHD2-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000435652.1		NM_015944	
ANKRD39	51239	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	97514102	97514102	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr2:97514102T>C	ENST00000393537.4	-	4	595	c.488A>G	c.(487-489)aAg>aGg	p.K163R		NM_016466.5	NP_057550.3	Q53RE8	ANR39_HUMAN	ankyrin repeat domain 39	163								p.K163R(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)	6						TAGCCGTGCCTTTCGGTCCCG	0.612																																																	1	Substitution - Missense(1)	kidney(1)											89.0	78.0	82.0					2																	97514102		2203	4300	6503	SO:0001583	missense	51239			BC031303	CCDS2028.1	2q11.2	2013-01-10			ENSG00000213337	ENSG00000213337		"""Ankyrin repeat domain containing"""	28640	protein-coding gene	gene with protein product						11042152	Standard	NM_016466		Approved	MGC41816	uc002sxd.4	Q53RE8	OTTHUMG00000130530	ENST00000393537.4:c.488A>G	2.37:g.97514102T>C	ENSP00000377170:p.Lys163Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q59FU2|Q8N5X5|Q9P0S5	Missense_Mutation	SNP	ENST00000393537.4	37	CCDS2028.1	.	.	.	.	.	.	.	.	.	.	T	17.10	3.303747	0.60305	.	.	ENSG00000213337	ENST00000393537	T	0.66638	-0.22	5.62	5.62	0.85841	Ankyrin repeat-containing domain (2);	0.233302	0.34314	U	0.004061	T	0.54078	0.1836	L	0.41961	1.31	0.34198	D	0.672862	B	0.25719	0.132	B	0.17098	0.017	T	0.61023	-0.7146	10	0.27785	T	0.31	-14.5316	8.4423	0.32822	0.0:0.0865:0.0:0.9135	.	163	Q53RE8	ANR39_HUMAN	R	163	ENSP00000377170:K163R	ENSP00000377170:K163R	K	-	2	0	ANKRD39	96877829	1.000000	0.71417	0.996000	0.52242	0.949000	0.60115	0.759000	0.26461	2.160000	0.67779	0.477000	0.44152	AAG		0.612	ANKRD39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252951.2		NM_016466	
MROH9	80133	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	170965678	170965678	+	Silent	SNP	G	G	T			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr1:170965678G>T	ENST00000367758.3	+	14	1467	c.1368G>T	c.(1366-1368)ctG>ctT	p.L456L	MROH9_ENST00000367759.4_Silent_p.L456L	NM_025063.2	NP_079339.2	Q5TGP6	MROH9_HUMAN	maestro heat-like repeat family member 9	456								p.L456L(2)									GAGTTCTGCTGAATTGTTCTG	0.418																																																	2	Substitution - coding silent(2)	kidney(2)											149.0	143.0	145.0					1																	170965678		1878	4111	5989	SO:0001819	synonymous_variant	0			AK027203	CCDS41436.1, CCDS53429.1	1q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000117501	ENSG00000117501		"""maestro heat-like repeat containing"""	26287	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 129"""	C1orf129			Standard	NM_025063		Approved	FLJ23550, ARMC11	uc010plz.2	Q5TGP6	OTTHUMG00000041456	ENST00000367758.3:c.1368G>T	1.37:g.170965678G>T		Somatic		WXS	Illumina HiSeq	Phase_I	A0PJM0|A0PJM2|F5GWX6|Q9H5D7	Silent	SNP	ENST00000367758.3	37	CCDS41436.1	.	.	.	.	.	.	.	.	.	.	G	8.589	0.884128	0.17467	.	.	ENSG00000117501	ENST00000426136	.	.	.	5.75	0.451	0.16629	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-12.4043	5.2698	0.15618	0.3153:0.1376:0.5471:0.0	.	.	.	.	X	63	.	.	E	+	1	0	C1orf129	169232302	0.817000	0.29147	0.934000	0.37439	0.847000	0.48162	-0.046000	0.11983	-0.154000	0.11118	-0.136000	0.14681	GAA		0.418	MROH9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000099327.1		NM_025063	
CFAP61	26074	broad.mit.edu;ucsc.edu	37	20	20123553	20123553	+	Silent	SNP	G	G	A			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr20:20123553G>A	ENST00000245957.5	+	9	988	c.912G>A	c.(910-912)ttG>ttA	p.L304L	C20orf26_ENST00000451767.2_Silent_p.L304L|C20orf26_ENST00000377309.2_5'UTR|C20orf26_ENST00000377306.1_Silent_p.L304L|C20orf26_ENST00000389656.3_5'UTR	NM_015585.3	NP_056400.3	Q8NHU2	CT026_HUMAN		304								p.L304L(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(42)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	77				READ - Rectum adenocarcinoma(2;0.171)		TCGAGGAGTTGCAGGAACCTG	0.488																																																	1	Substitution - coding silent(1)	kidney(1)											47.0	39.0	42.0					20																	20123553		2203	4299	6502	SO:0001819	synonymous_variant	26074																														ENST00000245957.5:c.912G>A	20.37:g.20123553G>A		Somatic		WXS	Illumina GAIIx	Phase_I	A6NHA1|Q5JXV4|Q5TE18|Q8N5R9|Q96M59|Q9BQL2|Q9H127|Q9H128|Q9NQH4|Q9UFV8|Q9Y4V7	Silent	SNP	ENST00000245957.5	37	CCDS33447.1																																																																																				0.488	C20orf26-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078228.3			
C20orf166	128826	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	61167749	61167749	+	Silent	SNP	G	G	A			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr20:61167749G>A	ENST00000370527.3	+	4	998	c.219G>A	c.(217-219)caG>caA	p.Q73Q	C20orf166_ENST00000370524.2_Silent_p.Q55Q|C20orf166_ENST00000370523.1_Silent_p.Q55Q	NM_178463.3	NP_848558.1			chromosome 20 open reading frame 166									p.Q73Q(1)		endometrium(1)|kidney(1)|lung(2)	4	Breast(26;1.04e-08)		BRCA - Breast invasive adenocarcinoma(19;7.17e-06)			CTCAGCCCCAGCCCCACAGTG	0.522																																																	1	Substitution - coding silent(1)	kidney(1)											52.0	55.0	54.0					20																	61167749		2019	4168	6187	SO:0001819	synonymous_variant	128826			AL449263	CCDS46627.1	20q13.33	2014-01-21			ENSG00000174407	ENSG00000174407			16159	protein-coding gene	gene with protein product	"""MIR133A2 host gene"""						Standard	NM_178463		Approved	dJ353C17.1, MIR1-1HG, MIR133A2HG	uc011aaj.2	Q9H1L0	OTTHUMG00000048000	ENST00000370527.3:c.219G>A	20.37:g.61167749G>A		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000370527.3	37	CCDS46627.1																																																																																				0.522	C20orf166-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109262.1		NM_178463	
CCDC180	100499483	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	100132270	100132270	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr9:100132270A>C	ENST00000357054.1	+	44	5158	c.4223A>C	c.(4222-4224)aAt>aCt	p.N1408T	CCDC180_ENST00000375202.2_Missense_Mutation_p.N1463T|CCDC180_ENST00000395220.1_3'UTR|RP11-23J9.4_ENST00000534123.1_RNA|CCDC180_ENST00000529487.1_Missense_Mutation_p.N1463T			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180	1408						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.N1408T(1)|p.N1463T(1)									GTGATGGAGAATTTCAAGGAA	0.517																																																	2	Substitution - Missense(2)	kidney(2)											68.0	69.0	69.0					9																	100132270		2203	4300	6503	SO:0001583	missense	100499483			AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.4223A>C	9.37:g.100132270A>C	ENSP00000349562:p.Asn1408Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Missense_Mutation	SNP	ENST00000357054.1	37		.	.	.	.	.	.	.	.	.	.	A	17.41	3.383227	0.61845	.	.	ENSG00000197816	ENST00000357054;ENST00000375202;ENST00000529487	T;T;T	0.45668	0.89;0.89;0.89	5.58	2.91	0.33838	.	0.431704	0.30850	N	0.008752	T	0.45175	0.1329	M	0.65975	2.015	0.80722	D	1	P;D	0.57899	0.802;0.981	B;P	0.53401	0.422;0.725	T	0.38351	-0.9665	10	0.32370	T	0.25	-8.2765	3.732	0.08496	0.6485:0.2193:0.1321:0.0	.	1602;1408	B7ZMG3;Q9P1Z9	.;CI174_HUMAN	T	1408;1463;1463	ENSP00000349562:N1408T;ENSP00000364348:N1463T;ENSP00000434727:N1463T	ENSP00000349562:N1408T	N	+	2	0	C9orf174	99172091	0.985000	0.35326	0.990000	0.47175	0.824000	0.46624	1.148000	0.31614	1.023000	0.39654	0.533000	0.62120	AAT		0.517	CCDC180-201	KNOWN	basic	protein_coding	protein_coding			NM_020893	
CACNA1A	773	broad.mit.edu;hgsc.bcm.edu	37	19	13325351	13325351	+	Nonsense_Mutation	SNP	G	G	A			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr19:13325351G>A	ENST00000360228.5	-	39	5802	c.5803C>T	c.(5803-5805)Cag>Tag	p.Q1935*	CACNA1A_ENST00000573710.2_Nonsense_Mutation_p.Q1936*	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	1936					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)	p.Q1936*(3)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	AGCGTCTTCTGGGACAGATTG	0.587																																																	3	Substitution - Nonsense(3)	kidney(3)											63.0	67.0	66.0					19																	13325351		2165	4259	6424	SO:0001587	stop_gained	773			U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.5803C>T	19.37:g.13325351G>A	ENSP00000353362:p.Gln1935*	Somatic		WXS	Illumina HiSeq	Phase_I	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Nonsense_Mutation	SNP	ENST00000360228.5	37	CCDS45998.1	.	.	.	.	.	.	.	.	.	.	G	46	12.936400	0.99707	.	.	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018;ENST00000325084	.	.	.	4.72	4.72	0.59763	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	16.4549	0.84009	0.0:0.0:1.0:0.0	.	.	.	.	X	1935;1941;1936;1936	.	ENSP00000317661:Q1936X	Q	-	1	0	CACNA1A	13186351	1.000000	0.71417	1.000000	0.80357	0.413000	0.31143	9.231000	0.95317	2.184000	0.69523	0.491000	0.48974	CAG		0.587	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104062.2		NM_000068	
CCDC61	729440	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	46519960	46519960	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr19:46519960A>C	ENST00000595358.1	+	10	1149	c.1100A>C	c.(1099-1101)cAg>cCg	p.Q367P	CCDC61_ENST00000536603.1_Missense_Mutation_p.Q187P|CCDC61_ENST00000594087.1_Missense_Mutation_p.Q187P|CCDC61_ENST00000263284.2_Missense_Mutation_p.Q386P|MIR769_ENST00000390225.1_RNA	NM_001267723.1	NP_001254652.1	Q9Y6R9	CCD61_HUMAN	coiled-coil domain containing 61	367						centrosome (GO:0005813)		p.Q386P(1)		endometrium(3)|kidney(3)|large_intestine(1)|lung(5)|ovary(1)	13		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.00221)|GBM - Glioblastoma multiforme(486;0.0233)|Epithelial(262;0.164)		AGGCAGCAGCAGCGGAACCGC	0.672																																																	1	Substitution - Missense(1)	kidney(1)											11.0	14.0	13.0					19																	46519960		1940	4111	6051	SO:0001583	missense	729440				CCDS46120.1, CCDS46120.2	19q13.32	2014-09-04			ENSG00000104983	ENSG00000104983			33629	protein-coding gene	gene with protein product							Standard	NM_001267723		Approved		uc031rlj.1	Q9Y6R9	OTTHUMG00000182488	ENST00000595358.1:c.1100A>C	19.37:g.46519960A>C	ENSP00000471454:p.Gln367Pro	Somatic		WXS	Illumina HiSeq	Phase_I	C8CAP4|Q9HDB6	Missense_Mutation	SNP	ENST00000595358.1	37	CCDS46120.2	.	.	.	.	.	.	.	.	.	.	A	19.47	3.834244	0.71373	.	.	ENSG00000104983	ENST00000263284;ENST00000536603	.	.	.	3.99	3.99	0.46301	.	0.055965	0.64402	D	0.000001	T	0.55257	0.1909	L	0.56769	1.78	0.22701	N	0.998838	D	0.64830	0.994	D	0.73380	0.98	T	0.41698	-0.9494	9	0.38643	T	0.18	-17.1558	9.5026	0.39026	1.0:0.0:0.0:0.0	.	329	Q9Y6R9	CCD61_HUMAN	P	386;187	.	ENSP00000263284:Q386P	Q	+	2	0	CCDC61	51211800	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	1.614000	0.36911	1.809000	0.52856	0.445000	0.29226	CAG		0.672	CCDC61-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461689.1		NM_001080402	
CDC14A	8556	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	100928332	100928332	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr1:100928332T>C	ENST00000336454.3	+	9	1088	c.733T>C	c.(733-735)Tat>Cat	p.Y245H	CDC14A_ENST00000370124.3_Missense_Mutation_p.Y245H|RP5-837M10.4_ENST00000432210.1_RNA|CDC14A_ENST00000544534.1_Missense_Mutation_p.Y245H|CDC14A_ENST00000361544.6_Missense_Mutation_p.Y245H|CDC14A_ENST00000542213.1_Missense_Mutation_p.Y187H|CDC14A_ENST00000370125.2_3'UTR	NM_003672.3	NP_003663.2	Q9UNH5	CC14A_HUMAN	cell division cycle 14A	245	B.				cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.Y245H(1)		breast(1)|endometrium(5)|kidney(6)|large_intestine(6)|lung(10)|skin(2)|urinary_tract(1)	31		all_epithelial(167;3.71e-06)|all_lung(203;0.00097)|Lung NSC(277;0.001)		Epithelial(280;0.0676)|all cancers(265;0.127)|COAD - Colon adenocarcinoma(174;0.201)|Lung(183;0.227)|Colorectal(144;0.241)		CTTCGAGCACTATGACCTCTT	0.473																																																	1	Substitution - Missense(1)	kidney(1)											91.0	81.0	84.0					1																	100928332		2203	4300	6503	SO:0001583	missense	8556			AF000367	CCDS769.1, CCDS770.1, CCDS771.1	1p21	2013-01-17	2013-01-17		ENSG00000079335	ENSG00000079335		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : CDC14s"""	1718	protein-coding gene	gene with protein product		603504	"""CDC10 (cell division cycle 10, S. cerevisiae, homolog)"", ""CDC14 cell division cycle 14 homolog A (S. cerevisiae)"""			9367992, 10409437	Standard	NM_033312		Approved	Cdc14A1, Cdc14A2, cdc14	uc001dtf.2	Q9UNH5	OTTHUMG00000010987	ENST00000336454.3:c.733T>C	1.37:g.100928332T>C	ENSP00000336739:p.Tyr245His	Somatic		WXS	Illumina HiSeq	Phase_I	A6MA65|B1AQ14|B1AQ15|O43171|O60727|O60728|Q52LH9|Q8IXX0	Missense_Mutation	SNP	ENST00000336454.3	37	CCDS769.1	.	.	.	.	.	.	.	.	.	.	T	16.90	3.250473	0.59212	.	.	ENSG00000079335	ENST00000542213;ENST00000455467;ENST00000361544;ENST00000370124;ENST00000336454;ENST00000544534	T;T;T;T;T;T	0.27104	1.69;1.69;1.69;1.69;1.69;1.69	5.78	4.66	0.58398	Dual specificity phosphatase, catalytic domain (1);	0.103679	0.64402	D	0.000002	T	0.03564	0.0102	N	0.02842	-0.48	0.50313	D	0.999864	B;B;B;B;B	0.09022	0.001;0.002;0.001;0.001;0.0	B;B;B;B;B	0.16289	0.002;0.015;0.013;0.005;0.004	T	0.33317	-0.9873	10	0.09084	T	0.74	-10.4471	11.2334	0.48925	0.0:0.0711:0.0:0.9289	.	187;245;245;245;245	F5H7B3;A6MA65;Q9UNH5;Q9UNH5-2;Q52LH9	.;.;CC14A_HUMAN;.;.	H	187;246;245;245;245;245	ENSP00000442640:Y187H;ENSP00000388501:Y246H;ENSP00000354916:Y245H;ENSP00000359142:Y245H;ENSP00000336739:Y245H;ENSP00000442543:Y245H	ENSP00000336739:Y245H	Y	+	1	0	CDC14A	100700920	1.000000	0.71417	0.983000	0.44433	0.991000	0.79684	1.552000	0.36244	2.201000	0.70794	0.459000	0.35465	TAT		0.473	CDC14A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000030220.1		NM_033312	
CHAF1A	10036	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	4409322	4409322	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr19:4409322C>G	ENST00000301280.5	+	3	627	c.526C>G	c.(526-528)Ctt>Gtt	p.L176V		NM_005483.2	NP_005474	Q13111	CAF1A_HUMAN	chromatin assembly factor 1, subunit A (p150)	176	Binds to CBX1 chromo shadow domain.				cell cycle (GO:0007049)|chromatin assembly (GO:0031497)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|protein complex assembly (GO:0006461)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	CAF-1 complex (GO:0033186)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|identical protein binding (GO:0042802)|unfolded protein binding (GO:0051082)	p.L176V(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	27		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGAGAGACCCTTTCAGACAT	0.567								Chromatin Structure																																									1	Substitution - Missense(1)	kidney(1)											85.0	85.0	85.0					19																	4409322		2203	4300	6503	SO:0001583	missense	10036			U20979	CCDS32875.1	19p13.3	2008-07-16				ENSG00000167670			1910	protein-coding gene	gene with protein product	"""chromatin assembly factor I (150 kDa)"""	601246				7600578	Standard	NM_005483		Approved	CAF1P150, CAF1B, CAF-1, CAF1, P150, MGC71229	uc002mal.3	Q13111		ENST00000301280.5:c.526C>G	19.37:g.4409322C>G	ENSP00000301280:p.Leu176Val	Somatic		WXS	Illumina HiSeq	Phase_I	Q6NXG5|Q7Z7K3|Q9UJY8	Missense_Mutation	SNP	ENST00000301280.5	37	CCDS32875.1	.	.	.	.	.	.	.	.	.	.	C	12.90	2.077907	0.36662	.	.	ENSG00000167670	ENST00000344143;ENST00000535117;ENST00000301280	T	0.49720	0.77	5.56	3.35	0.38373	.	.	.	.	.	T	0.36358	0.0964	L	0.51422	1.61	0.21105	N	0.99978	P	0.38922	0.651	B	0.35859	0.212	T	0.43278	-0.9401	9	0.87932	D	0	-11.3419	2.8191	0.05467	0.1981:0.5325:0.167:0.1024	.	176	Q13111	CAF1A_HUMAN	V	176	ENSP00000301280:L176V	ENSP00000301280:L176V	L	+	1	0	CHAF1A	4360322	0.078000	0.21339	0.956000	0.39512	0.973000	0.67179	0.890000	0.28295	2.604000	0.88044	0.561000	0.74099	CTT		0.567	CHAF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458310.2		NM_005483	
COL8A2	1296	hgsc.bcm.edu	37	1	36563461	36563462	+	Frame_Shift_Ins	INS	-	-	G			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr1:36563461_36563462insG	ENST00000397799.1	-	4	2044_2045	c.1820_1821insC	c.(1819-1821)ccafs	p.P607fs	COL8A2_ENST00000303143.4_Frame_Shift_Ins_p.P607fs|COL8A2_ENST00000481785.1_Frame_Shift_Ins_p.P542fs			P25067	CO8A2_HUMAN	collagen, type VIII, alpha 2	607	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.|Nonhelical region (NC1).				angiogenesis (GO:0001525)|camera-type eye morphogenesis (GO:0048593)|collagen catabolic process (GO:0030574)|epithelial cell proliferation (GO:0050673)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)			NS(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				TGCCAGTGGCTGGGTTGTAGCC	0.604																																																	0																																										SO:0001589	frameshift_variant	1296			M60832	CCDS403.1, CCDS72756.1	1p34.2-p32.3	2014-02-14			ENSG00000171812	ENSG00000171812		"""Collagens"""	2216	protein-coding gene	gene with protein product		120252		FECD		11689488	Standard	XM_005270477		Approved	PPCD, FECD1, PPCD2	uc001bzv.2	P25067	OTTHUMG00000007665	ENST00000397799.1:c.1821dupC	1.37:g.36563464_36563464dupG	ENSP00000380901:p.Pro607fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q5JV31|Q8TEJ5	Frame_Shift_Ins	INS	ENST00000397799.1	37	CCDS403.1																																																																																				0.604	COL8A2-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313674.1		NM_005202	
CUL9	23113	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	43170869	43170869	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr6:43170869G>T	ENST00000252050.4	+	18	3860	c.3776G>T	c.(3775-3777)aGc>aTc	p.S1259I	CUL9_ENST00000372647.2_Missense_Mutation_p.S1259I|CUL9_ENST00000354495.3_Missense_Mutation_p.S1149I	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	1259	DOC. {ECO:0000255|PROSITE- ProRule:PRU00614}.				microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)	p.S1259I(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						CCCTCTGCCAGCCGGGTGATC	0.552																																																	1	Substitution - Missense(1)	kidney(1)											92.0	85.0	88.0					6																	43170869		2203	4300	6503	SO:0001583	missense	23113			AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.3776G>T	6.37:g.43170869G>T	ENSP00000252050:p.Ser1259Ile	Somatic		WXS	Illumina HiSeq	Phase_I	O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Missense_Mutation	SNP	ENST00000252050.4	37	CCDS4890.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.304743	0.81247	.	.	ENSG00000112659	ENST00000252050;ENST00000354495;ENST00000372647	T;T;T	0.72051	-0.62;-0.62;-0.62	5.2	4.31	0.51392	Anaphase-promoting complex, subunit 10/DOC domain (2);Galactose-binding domain-like (1);	0.191344	0.64402	D	0.000014	T	0.77751	0.4177	M	0.68952	2.095	0.44061	D	0.996802	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.83275	0.983;0.996;0.996	T	0.81653	-0.0835	10	0.87932	D	0	-23.2318	14.2736	0.66166	0.0:0.1488:0.8512:0.0	.	1149;1259;1259	Q8IWT3-3;E9PEZ1;Q8IWT3	.;.;CUL9_HUMAN	I	1259;1149;1259	ENSP00000252050:S1259I;ENSP00000346490:S1149I;ENSP00000361730:S1259I	ENSP00000252050:S1259I	S	+	2	0	CUL9	43278847	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	6.218000	0.72224	1.278000	0.44430	0.561000	0.74099	AGC		0.552	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040582.2		NM_015089	
DDX50	79009	hgsc.bcm.edu;ucsc.edu	37	10	70706119	70706128	+	Frame_Shift_Del	DEL	TGATTCCGAC	TGATTCCGAC	-	rs144659191	byFrequency	TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	TGATTCCGAC	TGATTCCGAC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr10:70706119_70706128delTGATTCCGAC	ENST00000373585.3	+	15	2054_2063	c.1947_1956delTGATTCCGAC	c.(1945-1956)catgattccgacfs	p.HDSD649fs	DDX50_ENST00000466265.1_3'UTR	NM_024045.1	NP_076950.1	Q9BQ39	DDX50_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 50	649						membrane (GO:0016020)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(5)|liver(2)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	29						CAGAGTGGCATGATTCCGACTGGATACTCT	0.386																																																	0																																										SO:0001589	frameshift_variant	79009			AF334103	CCDS7283.1	10q22.2	2010-09-30			ENSG00000107625	ENSG00000107625		"""DEAD-boxes"""	17906	protein-coding gene	gene with protein product		610373				11891046	Standard	NM_024045		Approved	GU2, MGC3199, GUB, RH-II/GuB	uc001jou.3	Q9BQ39	OTTHUMG00000018362	ENST00000373585.3:c.1947_1956delTGATTCCGAC	10.37:g.70706119_70706128delTGATTCCGAC	ENSP00000362687:p.His649fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q5VX37|Q8WV76|Q9BWI8	Frame_Shift_Del	DEL	ENST00000373585.3	37	CCDS7283.1																																																																																				0.386	DDX50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048363.1		NM_024045	
DHX15	1665	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	24541862	24541862	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr4:24541862T>A	ENST00000336812.4	-	10	1811	c.1655A>T	c.(1654-1656)gAt>gTt	p.D552V	DHX15_ENST00000508032.1_5'Flank	NM_001358.2	NP_001349.2	O43143	DHX15_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 15	552					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|U12-type spliceosomal complex (GO:0005689)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)	p.D552V(1)		breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(5)|liver(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	30		Breast(46;0.0503)				CAGATCTCCATCATCATTTAA	0.418																																																	1	Substitution - Missense(1)	kidney(1)											137.0	140.0	139.0					4																	24541862		2203	4300	6503	SO:0001583	missense	1665			AB001636	CCDS33966.1	4p15.3	2013-05-13	2013-05-13	2003-06-20	ENSG00000109606	ENSG00000109606		"""DEAH-boxes"""	2738	protein-coding gene	gene with protein product		603403	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 15"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 15"""	DDX15		9388478	Standard	NM_001358		Approved	HRH2, DBP1, PRP43, PrPp43p, PRPF43	uc003gqx.3	O43143	OTTHUMG00000160304	ENST00000336812.4:c.1655A>T	4.37:g.24541862T>A	ENSP00000336741:p.Asp552Val	Somatic		WXS	Illumina HiSeq	Phase_I	Q9NQT7	Missense_Mutation	SNP	ENST00000336812.4	37	CCDS33966.1	.	.	.	.	.	.	.	.	.	.	T	24.5	4.538808	0.85917	.	.	ENSG00000109606	ENST00000336812;ENST00000535946	T	0.32023	1.47	6.16	6.16	0.99307	Helicase-associated domain (2);	0.000000	0.85682	D	0.000000	T	0.58779	0.2146	M	0.82193	2.58	0.80722	D	1	D	0.53885	0.963	P	0.62740	0.906	T	0.63765	-0.6563	10	0.87932	D	0	-20.366	16.8061	0.85666	0.0:0.0:0.0:1.0	.	552	O43143	DHX15_HUMAN	V	552;541	ENSP00000336741:D552V	ENSP00000336741:D552V	D	-	2	0	DHX15	24150960	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.698000	0.84413	2.367000	0.80283	0.528000	0.53228	GAT		0.418	DHX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360143.1		NM_001358	
DNAJA4	55466	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	78565450	78565450	+	Silent	SNP	A	A	G			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr15:78565450A>G	ENST00000394852.3	+	3	517	c.327A>G	c.(325-327)gtA>gtG	p.V109V	DNAJA4_ENST00000343789.3_Silent_p.V109V|DNAJA4_ENST00000394855.3_Silent_p.V138V|DNAJA4_ENST00000446172.2_Silent_p.V82V	NM_001130182.1	NP_001123654.1	Q8WW22	DNJA4_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 4	109					negative regulation of inclusion body assembly (GO:0090084)|protein refolding (GO:0042026)|response to heat (GO:0009408)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|unfolded protein binding (GO:0051082)	p.V82V(1)|p.V109V(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|skin(1)	8						AGAATGTTGTACACCAGTTAT	0.338																																																	2	Substitution - coding silent(2)	kidney(2)											111.0	119.0	117.0					15																	78565450		2196	4293	6489	SO:0001819	synonymous_variant	55466			AF116663	CCDS10299.2, CCDS45316.1, CCDS45317.1	15q24.1	2011-09-02			ENSG00000140403	ENSG00000140403		"""Heat shock proteins / DNAJ (HSP40)"""	14885	protein-coding gene	gene with protein product						11147971	Standard	NM_018602		Approved	PRO1472	uc002bdi.3	Q8WW22	OTTHUMG00000143733	ENST00000394852.3:c.327A>G	15.37:g.78565450A>G		Somatic		WXS	Illumina HiSeq	Phase_I	E9PDM9|Q6AW87|Q8N5Z4|Q8N7P2	Silent	SNP	ENST00000394852.3	37	CCDS45316.1																																																																																				0.338	DNAJA4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289801.1		NM_018602	
EPT1	85465	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	26587787	26587787	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr2:26587787G>A	ENST00000260585.7	+	3	333	c.214G>A	c.(214-216)Gat>Aat	p.D72N		NM_033505.2	NP_277040.1	Q9C0D9	EPT1_HUMAN	ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific)	72					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ethanolaminephosphotransferase activity (GO:0004307)|metal ion binding (GO:0046872)	p.D72N(1)									GGCATACTTTGATCCTGACTT	0.328																																																	1	Substitution - Missense(1)	kidney(1)											91.0	80.0	84.0					2																	26587787		1797	4059	5856	SO:0001583	missense	85465				CCDS46240.1	2p23.3	2012-03-01			ENSG00000138018	ENSG00000138018	2.7.8.1		29361	protein-coding gene	gene with protein product	"""selenoprotein I"""	607915				11214970, 17132865	Standard	NM_033505		Approved	KIAA1724, SELI, SEPI	uc021veu.1	Q9C0D9	OTTHUMG00000151931	ENST00000260585.7:c.214G>A	2.37:g.26587787G>A	ENSP00000260585:p.Asp72Asn	Somatic		WXS	Illumina HiSeq	Phase_I	Q63ZE3	Missense_Mutation	SNP	ENST00000260585.7	37	CCDS46240.1	.	.	.	.	.	.	.	.	.	.	G	32	5.161250	0.94727	.	.	ENSG00000138018	ENST00000442141;ENST00000260585;ENST00000447170	T;T	0.41758	0.99;0.99	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.58935	0.2157	L	0.52126	1.63	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.44467	-0.9326	10	0.16896	T	0.51	0.0	18.9858	0.92769	0.0:0.0:1.0:0.0	.	72	Q9C0D9	EPT1_HUMAN	N	40;72;72	ENSP00000415280:D40N;ENSP00000260585:D72N	ENSP00000260585:D72N	D	+	1	0	EPT1	26441291	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.943000	0.92975	2.832000	0.97577	0.655000	0.94253	GAT		0.328	EPT1-001	KNOWN	basic|appris_principal|CCDS|seleno	protein_coding	protein_coding	OTTHUMT00000324484.3		NM_033505.2	
EVX1	2128	broad.mit.edu;ucsc.edu	37	7	27282680	27282680	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr7:27282680C>G	ENST00000496902.4	+	1	517	c.31C>G	c.(31-33)Ctg>Gtg	p.L11V	EVX1_ENST00000222761.3_Missense_Mutation_p.L11V|RP1-170O19.17_ENST00000523608.2_lincRNA|EVX1-AS_ENST00000517726.1_RNA|EVX1-AS_ENST00000519218.1_RNA|EVX1_ENST00000535619.1_5'Flank|EVX1-AS_ENST00000519050.1_RNA			P49640	EVX1_HUMAN	even-skipped homeobox 1	11					embryo development ending in birth or egg hatching (GO:0009792)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter involved in ventral spinal cord interneuron specification (GO:0021913)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L11V(1)		kidney(1)|liver(1)|lung(10)|prostate(1)|skin(1)	14						GGTTGTGTTTCTGGATGGGGG	0.627																																																	1	Substitution - Missense(1)	kidney(1)											42.0	47.0	45.0					7																	27282680		2203	4300	6503	SO:0001583	missense	2128				CCDS5413.1	7p15.2	2012-03-09	2007-02-15		ENSG00000106038	ENSG00000106038		"""Homeoboxes / ANTP class : HOXL subclass"""	3506	protein-coding gene	gene with protein product		142996	"""eve, even-skipped homeobox homolog 1 (Drosophila)"""			1684419	Standard	XM_005249640		Approved		uc003szd.1	P49640	OTTHUMG00000023093	ENST00000496902.4:c.31C>G	7.37:g.27282680C>G	ENSP00000419266:p.Leu11Val	Somatic		WXS	Illumina GAIIx	Phase_I	A4D199|B4DQJ0	Missense_Mutation	SNP	ENST00000496902.4	37	CCDS5413.1	.	.	.	.	.	.	.	.	.	.	C	11.04	1.522527	0.27211	.	.	ENSG00000106038	ENST00000496902;ENST00000222761	D	0.91631	-2.88	5.09	-0.782	0.10961	.	0.270734	0.36200	N	0.002722	D	0.85919	0.5809	L	0.60455	1.87	0.80722	D	1	P;B	0.42296	0.775;0.014	B;B	0.36464	0.225;0.019	T	0.77133	-0.2700	10	0.62326	D	0.03	-12.5529	4.9264	0.13896	0.1334:0.4523:0.0:0.4143	.	11;11	F8W9J5;P49640	.;EVX1_HUMAN	V	11	ENSP00000419266:L11V	ENSP00000222761:L11V	L	+	1	2	EVX1	27249205	0.986000	0.35501	0.983000	0.44433	0.987000	0.75469	0.231000	0.17872	-0.539000	0.06273	0.462000	0.41574	CTG		0.627	EVX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358750.3			
FERMT2	10979	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	53417220	53417220	+	Missense_Mutation	SNP	G	G	A	rs147527926		TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr14:53417220G>A	ENST00000395631.2	-	2	283	c.67C>T	c.(67-69)Cat>Tat	p.H23Y	FERMT2_ENST00000399304.3_Missense_Mutation_p.H23Y|FERMT2_ENST00000343279.4_Missense_Mutation_p.H23Y|FERMT2_ENST00000341590.3_Missense_Mutation_p.H23Y|FERMT2_ENST00000553373.1_Missense_Mutation_p.H23Y			Q96AC1	FERM2_HUMAN	fermitin family member 2	23					cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|focal adhesion assembly (GO:0048041)|integrin activation (GO:0033622)|integrin-mediated signaling pathway (GO:0007229)|protein localization to membrane (GO:0072657)|regulation of cell shape (GO:0008360)|substrate adhesion-dependent cell spreading (GO:0034446)|transforming growth factor beta receptor signaling pathway (GO:0007179)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|filamentous actin (GO:0031941)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|stress fiber (GO:0001725)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)	p.H23Y(1)	ERO1L/FERMT2(2)	NS(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	20	Breast(41;0.0342)					TCCGTCACATGGACACTCAGT	0.597													G|||	1	0.000199681	0.0	0.0014	5008	,	,		15301	0.0		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	kidney(1)						G	TYR/HIS,TYR/HIS,TYR/HIS	0,4406		0,0,2203	217.0	180.0	193.0		67,67,67	4.5	1.0	14	dbSNP_134	193	5,8595	4.3+/-15.6	0,5,4295	yes	missense,missense,missense	FERMT2	NM_001134999.1,NM_001135000.1,NM_006832.2	83,83,83	0,5,6498	AA,AG,GG		0.0581,0.0,0.0384	benign,benign,benign	23/688,23/634,23/681	53417220	5,13001	2203	4300	6503	SO:0001583	missense	10979			Z24725	CCDS9713.1, CCDS45107.1, CCDS45108.1	14q22.1	2013-01-10	2010-06-24	2007-12-14	ENSG00000073712	ENSG00000073712		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	15767	protein-coding gene	gene with protein product	"""kindlin-2"""	607746	"""pleckstrin homology domain containing, family C (with FERM domain) member 1"", ""fermitin family homolog 2 (Drosophila)"""	PLEKHC1		8175911, 12697302	Standard	NM_006832		Approved	mig-2, KIND2, UNC112B	uc001xac.3	Q96AC1	OTTHUMG00000140309	ENST00000395631.2:c.67C>T	14.37:g.53417220G>A	ENSP00000378993:p.His23Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	B5TJY2|Q14840|Q86TY7	Missense_Mutation	SNP	ENST00000395631.2	37	CCDS9713.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	10.61	1.398236	0.25205	0.0	5.81E-4	ENSG00000073712	ENST00000395631;ENST00000341590;ENST00000343279;ENST00000553373;ENST00000399304;ENST00000554712	T;T;T;T;T	0.42900	0.97;0.97;0.96;0.96;0.96	4.47	4.47	0.54385	.	0.000000	0.85682	D	0.000000	T	0.14874	0.0359	N	0.01048	-1.04	0.80722	D	1	B;P;B	0.41498	0.011;0.752;0.044	B;B;B	0.38225	0.021;0.268;0.017	T	0.34153	-0.9840	10	0.02654	T	1	.	16.7199	0.85407	0.0:0.0:1.0:0.0	.	23;23;23	Q96AC1-2;Q96AC1;B5TJY2	.;FERM2_HUMAN;.	Y	23	ENSP00000378993:H23Y;ENSP00000340391:H23Y;ENSP00000342858:H23Y;ENSP00000451084:H23Y;ENSP00000382243:H23Y	ENSP00000340391:H23Y	H	-	1	0	FERMT2	52486970	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	9.416000	0.97383	2.006000	0.58801	0.462000	0.41574	CAT		0.597	FERMT2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276907.2		NM_006832	
FHOD3	80206	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	34156435	34156435	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr18:34156435A>G	ENST00000359247.4	+	6	533	c.533A>G	c.(532-534)tAt>tGt	p.Y178C	FHOD3_ENST00000257209.4_Missense_Mutation_p.Y178C|FHOD3_ENST00000591635.1_5'UTR|FHOD3_ENST00000445677.1_Missense_Mutation_p.Y178C|FHOD3_ENST00000590592.1_Missense_Mutation_p.Y178C	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	178	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)		p.Y178C(1)		NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				ATTATGTTGTATGTGGATGGA	0.368																																																	1	Substitution - Missense(1)	kidney(1)											146.0	129.0	135.0					18																	34156435		2203	4300	6503	SO:0001583	missense	80206			AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.533A>G	18.37:g.34156435A>G	ENSP00000352186:p.Tyr178Cys	Somatic		WXS	Illumina HiSeq	Phase_I	A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Missense_Mutation	SNP	ENST00000359247.4	37		.	.	.	.	.	.	.	.	.	.	A	22.5	4.296822	0.81025	.	.	ENSG00000134775	ENST00000257209;ENST00000359247;ENST00000445677	T;T;T	0.19394	2.15;2.15;2.15	5.73	5.73	0.89815	GTPase-binding/formin homology 3 (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.48132	0.1483	M	0.79123	2.44	0.47276	D	0.99937	D;D;D	0.89917	0.998;1.0;0.997	D;D;D	0.91635	0.987;0.999;0.985	T	0.51679	-0.8675	10	0.87932	D	0	.	13.9605	0.64175	1.0:0.0:0.0:0.0	.	178;178;178	Q2V2M9;Q2V2M9-3;E5F5Q0	FHOD3_HUMAN;.;.	C	178	ENSP00000257209:Y178C;ENSP00000352186:Y178C;ENSP00000411430:Y178C	ENSP00000257209:Y178C	Y	+	2	0	FHOD3	32410433	1.000000	0.71417	0.991000	0.47740	0.995000	0.86356	8.862000	0.92283	2.176000	0.68965	0.533000	0.62120	TAT		0.368	FHOD3-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460884.1		XM_371114	
FHOD3	80206	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	34192014	34192014	+	Nonsense_Mutation	SNP	A	A	T			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr18:34192014A>T	ENST00000359247.4	+	9	913	c.913A>T	c.(913-915)Aaa>Taa	p.K305*	FHOD3_ENST00000257209.4_Nonsense_Mutation_p.K305*|FHOD3_ENST00000591635.1_5'UTR|FHOD3_ENST00000445677.1_Nonsense_Mutation_p.K305*|FHOD3_ENST00000590592.1_Nonsense_Mutation_p.K305*	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	305	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)		p.K305*(1)		NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				CTTGAACAAGAAAGGGACTGA	0.502																																																	1	Substitution - Nonsense(1)	kidney(1)											201.0	161.0	174.0					18																	34192014		2203	4300	6503	SO:0001587	stop_gained	80206			AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.913A>T	18.37:g.34192014A>T	ENSP00000352186:p.Lys305*	Somatic		WXS	Illumina HiSeq	Phase_I	A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Nonsense_Mutation	SNP	ENST00000359247.4	37		.	.	.	.	.	.	.	.	.	.	A	38	7.143663	0.98092	.	.	ENSG00000134775	ENST00000257209;ENST00000359247;ENST00000445677	.	.	.	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.4855	0.67614	1.0:0.0:0.0:0.0	.	.	.	.	X	305	.	ENSP00000257209:K305X	K	+	1	0	FHOD3	32446012	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.256000	0.78350	2.158000	0.67659	0.454000	0.30748	AAA		0.502	FHOD3-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460884.1		XM_371114	
FLT4	2324	hgsc.bcm.edu;ucsc.edu	37	5	180039595	180039600	+	In_Frame_Del	DEL	TCAGCA	TCAGCA	-			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	TCAGCA	TCAGCA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr5:180039595_180039600delTCAGCA	ENST00000261937.6	-	26	3521_3526	c.3443_3448delTGCTGA	c.(3442-3450)atgctgaac>aac	p.ML1148del	FLT4_ENST00000393347.3_In_Frame_Del_p.ML1148del|FLT4_ENST00000502649.1_In_Frame_Del_p.ML1148del	NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	1148	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GACCAGCAGTTCAGCATGATGCGGCG	0.665																																					Colon(97;1075 1466 27033 27547 35871)												0																																										SO:0001651	inframe_deletion	2324			X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.3443_3448delTGCTGA	5.37:g.180039595_180039600delTCAGCA	ENSP00000261937:p.Met1148_Leu1149del	Somatic		WXS	Illumina HiSeq	Phase_I	A8K6L4|B5A926|Q16067|Q86W07|Q86W08	In_Frame_Del	DEL	ENST00000261937.6	37	CCDS4457.1																																																																																				0.665	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253527.4			
GIMAP8	155038	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	150164190	150164190	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr7:150164190G>A	ENST00000307271.3	+	2	978	c.404G>A	c.(403-405)cGg>cAg	p.R135Q		NM_175571.2	NP_783161.1	Q8ND71	GIMA8_HUMAN	GTPase, IMAP family member 8	135	AIG1-type G 1.					cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)	p.R135Q(1)		breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(26)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)		GTCTTCACTCGGAAGGATGAT	0.468																																																	1	Substitution - Missense(1)	kidney(1)											81.0	77.0	78.0					7																	150164190		2203	4300	6503	SO:0001583	missense	155038			AL834361	CCDS34777.1	7q36.1	2014-04-04			ENSG00000171115	ENSG00000171115		"""GTPases, IMAP"""	21792	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 9"""					15474311	Standard	XM_005249951		Approved	DKFZp667I133, hIAN6, IAN9	uc003whj.3	Q8ND71	OTTHUMG00000158327	ENST00000307271.3:c.404G>A	7.37:g.150164190G>A	ENSP00000305107:p.Arg135Gln	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000307271.3	37	CCDS34777.1	.	.	.	.	.	.	.	.	.	.	G	11.86	1.766140	0.31228	.	.	ENSG00000171115	ENST00000307271	T	0.61392	0.11	4.47	2.56	0.30785	AIG1 (1);	0.525245	0.15496	N	0.259278	T	0.52419	0.1733	M	0.81179	2.53	0.09310	N	1	P	0.37330	0.59	B	0.30572	0.117	T	0.49143	-0.8970	10	0.51188	T	0.08	.	6.7004	0.23223	0.2189:0.0:0.7811:0.0	.	135	Q8ND71	GIMA8_HUMAN	Q	135	ENSP00000305107:R135Q	ENSP00000305107:R135Q	R	+	2	0	GIMAP8	149795123	0.000000	0.05858	0.018000	0.16275	0.011000	0.07611	0.256000	0.18351	0.461000	0.27071	-1.000000	0.02509	CGG		0.468	GIMAP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350701.1		NM_175571	
GLIS1	148979	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	53972295	53972295	+	Silent	SNP	G	G	T			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr1:53972295G>T	ENST00000312233.2	-	10	2426	c.1860C>A	c.(1858-1860)acC>acA	p.T620T		NM_147193.2	NP_671726.2			GLIS family zinc finger 1									p.T620T(1)		endometrium(3)|kidney(2)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|skin(3)|urinary_tract(4)	24						GGCTCCTTCAGGTGTCTGTGT	0.637																																																	1	Substitution - coding silent(1)	kidney(1)											63.0	60.0	61.0					1																	53972295		2203	4300	6503	SO:0001819	synonymous_variant	148979			AK093474	CCDS582.1	1p32.3	2008-02-05			ENSG00000174332	ENSG00000174332		"""Zinc fingers, C2H2-type"""	29525	protein-coding gene	gene with protein product		610378				12042312, 14500813	Standard	NM_147193		Approved	FLJ36155	uc001cvr.1	Q8NBF1	OTTHUMG00000008079	ENST00000312233.2:c.1860C>A	1.37:g.53972295G>T		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000312233.2	37	CCDS582.1																																																																																				0.637	GLIS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022109.1		NM_147193	
GON4L	54856	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	155730387	155730387	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr1:155730387G>T	ENST00000368331.1	-	24	5005	c.4957C>A	c.(4957-4959)Ctt>Att	p.L1653I	GON4L_ENST00000437809.1_Missense_Mutation_p.L1653I|GON4L_ENST00000271883.5_Missense_Mutation_p.L1653I	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	1653	PAH 1. {ECO:0000255|PROSITE- ProRule:PRU00810}.				regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.L1653I(2)		NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					ATGACTTGAAGGAAGTCTTCA	0.463																																																	2	Substitution - Missense(2)	kidney(2)											121.0	114.0	116.0					1																	155730387		1875	4114	5989	SO:0001583	missense	54856			AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.4957C>A	1.37:g.155730387G>T	ENSP00000357315:p.Leu1653Ile	Somatic		WXS	Illumina HiSeq	Phase_I	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Missense_Mutation	SNP	ENST00000368331.1	37		.	.	.	.	.	.	.	.	.	.	G	20.4	3.984742	0.74474	.	.	ENSG00000116580	ENST00000437809;ENST00000368331;ENST00000271883	T;T;T	0.13657	2.57;2.57;2.57	5.11	5.11	0.69529	.	0.000000	0.64402	D	0.000005	T	0.19087	0.0458	L	0.32530	0.975	0.41166	D	0.986138	D;D;D	0.76494	0.969;0.999;0.999	P;D;D	0.70227	0.793;0.968;0.945	T	0.01413	-1.1361	10	0.44086	T	0.13	.	18.3285	0.90261	0.0:0.0:1.0:0.0	.	849;1653;1653	Q1ED43;Q3T8J9;Q3T8J9-3	.;GON4L_HUMAN;.	I	1653	ENSP00000396117:L1653I;ENSP00000357315:L1653I;ENSP00000271883:L1653I	ENSP00000271883:L1653I	L	-	1	0	GON4L	153997011	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.847000	0.62867	2.654000	0.90174	0.655000	0.94253	CTT		0.463	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			NM_032292	
GRHPR	9380	hgsc.bcm.edu	37	9	37424907	37424908	+	Frame_Shift_Ins	INS	-	-	GG	rs369721488|rs150805048		TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr9:37424907_37424908insGG	ENST00000318158.6	+	2	234_235	c.149_150insGG	c.(148-153)gcggggfs	p.AG50fs	GRHPR_ENST00000493368.1_3'UTR|GRHPR_ENST00000607784.1_Frame_Shift_Ins_p.AG50fs	NM_012203.1	NP_036335.1	Q9UBQ7	GRHPR_HUMAN	glyoxylate reductase/hydroxypyruvate reductase	50					cellular nitrogen compound metabolic process (GO:0034641)|dicarboxylic acid metabolic process (GO:0043648)|excretion (GO:0007588)|glyoxylate metabolic process (GO:0046487)|metabolic process (GO:0008152)|oxidation-reduction process (GO:0055114)|protein oligomerization (GO:0051259)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|peroxisomal matrix (GO:0005782)	carboxylic acid binding (GO:0031406)|glycerate dehydrogenase activity (GO:0008465)|glyoxylate reductase (NADP) activity (GO:0030267)|hydroxypyruvate reductase activity (GO:0016618)|NAD binding (GO:0051287)|NADPH binding (GO:0070402)|protein homodimerization activity (GO:0042803)			endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	12				GBM - Glioblastoma multiforme(29;0.00687)		CGAGGTGTGGCGGGGGCCCACG	0.658																																																	0										127,75,4062		0,0,127,0,75,1930						1.0	0.0			47	270,115,7869		0,0,270,0,115,3742	no	codingComplex	GRHPR	NM_012203.1		0,0,397,0,190,5672	A1A1,A1A2,A1R,A2A2,A2R,RR		4.6644,4.7373,4.6892				397,190,11931				SO:0001589	frameshift_variant	9380			AF134895	CCDS6609.1	9q12	2012-07-13			ENSG00000137106	ENSG00000137106	1.1.1.79, 1.1.1.81		4570	protein-coding gene	gene with protein product	"""primary hyperoxaluria type 2"""	604296		GLXR		10524214, 10484776	Standard	XM_005251631		Approved	PH2	uc003zzu.1	Q9UBQ7	OTTHUMG00000019914	ENST00000318158.6:c.152_153dupGG	9.37:g.37424910_37424911dupGG	ENSP00000313432:p.Ala50fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q5T945|Q9H3E9|Q9H636|Q9UKX1	Frame_Shift_Ins	INS	ENST00000318158.6	37	CCDS6609.1																																																																																				0.658	GRHPR-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052442.1		NM_012203	
LAMTOR5	10542	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	110948984	110948984	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr1:110948984A>G	ENST00000602318.1	-	2	140	c.53T>C	c.(52-54)aTt>aCt	p.I18T	LAMTOR5-AS1_ENST00000609709.1_RNA|LAMTOR5-AS1_ENST00000608486.1_RNA|LAMTOR5-AS1_ENST00000609512.1_RNA|LAMTOR5-AS1_ENST00000610148.1_RNA|LAMTOR5-AS1_ENST00000590826.1_RNA|LAMTOR5-AS1_ENST00000608067.1_RNA|LAMTOR5-AS1_ENST00000608253.1_RNA|LAMTOR5_ENST00000602858.1_Missense_Mutation_p.I6T|LAMTOR5-AS1_ENST00000598454.1_RNA|LAMTOR5-AS1_ENST00000608499.1_RNA|LAMTOR5-AS1_ENST00000457535.1_RNA|LAMTOR5-AS1_ENST00000608602.1_RNA|LAMTOR5-AS1_ENST00000609244.1_RNA|LAMTOR5_ENST00000483260.1_Missense_Mutation_p.I17T|LAMTOR5_ENST00000474861.2_Missense_Mutation_p.I17T|LAMTOR5_ENST00000256644.4_Missense_Mutation_p.I100T|LAMTOR5-AS1_ENST00000587691.1_RNA|LAMTOR5-AS1_ENST00000590413.1_RNA			O43504	LTOR5_HUMAN	late endosomal/lysosomal adaptor, MAPK and MTOR activator 5	18					cellular response to amino acid stimulus (GO:0071230)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of GTPase activity (GO:0043547)|positive regulation of TOR signaling (GO:0032008)|protein localization to lysosome (GO:0061462)|regulation of cell size (GO:0008361)|response to virus (GO:0009615)|viral genome replication (GO:0019079)	cytosol (GO:0005829)|lysosome (GO:0005764)|Ragulator complex (GO:0071986)		p.I100T(1)									GACTCCAACAATGGAGGGATT	0.368																																																	1	Substitution - Missense(1)	kidney(1)											116.0	103.0	108.0					1																	110948984		2203	4300	6503	SO:0001583	missense	0			AF029890	CCDS824.1	1p12	2012-09-24	2012-09-24	2012-09-24	ENSG00000134248	ENSG00000134248			17955	protein-coding gene	gene with protein product	"""HBx-interacting protein"", ""hepatitis B virus x-interacting protein (9.6kD)"""	608521	"""hepatitis B virus x interacting protein"""	HBXIP		9499022, 22980980	Standard	NM_006402		Approved	XIP, MGC71071	uc001dzr.3	O43504	OTTHUMG00000011568	ENST00000602318.1:c.53T>C	1.37:g.110948984A>G	ENSP00000473439:p.Ile18Thr	Somatic		WXS	Illumina HiSeq	Phase_I	Q6IBD8	Missense_Mutation	SNP	ENST00000602318.1	37		.	.	.	.	.	.	.	.	.	.	A	14.87	2.664944	0.47572	.	.	ENSG00000134248	ENST00000483260;ENST00000474861;ENST00000256644	.	.	.	4.88	4.88	0.63580	.	0.127278	0.52532	D	0.000067	T	0.39627	0.1085	.	.	.	0.46376	D	0.99901	B	0.06786	0.001	B	0.06405	0.002	T	0.39742	-0.9599	8	0.44086	T	0.13	-15.2352	14.1734	0.65525	1.0:0.0:0.0:0.0	.	18	O43504	HBXIP_HUMAN	T	17;17;100	.	ENSP00000256644:I100T	I	-	2	0	HBXIP	110750507	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.800000	0.85949	2.131000	0.65755	0.533000	0.62120	ATT		0.368	LAMTOR5-007	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000467909.1		NM_006402	
HECTD2	143279	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	93220253	93220253	+	Missense_Mutation	SNP	C	C	T			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr10:93220253C>T	ENST00000298068.5	+	3	432	c.338C>T	c.(337-339)tCc>tTc	p.S113F	HECTD2_ENST00000371681.4_Missense_Mutation_p.S113F|HECTD2_ENST00000446394.1_Missense_Mutation_p.S113F|HECTD2_ENST00000536715.1_5'Flank	NM_182765.3	NP_877497	Q5U5R9	HECD2_HUMAN	HECT domain containing E3 ubiquitin protein ligase 2	113					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.S113F(1)		breast(2)|endometrium(2)|kidney(4)|large_intestine(10)|lung(7)|skin(1)|urinary_tract(1)	27						GCATCATCATCCGAAATGAAG	0.373																																					NSCLC(12;376 469 1699 39910 41417)												1	Substitution - Missense(1)	kidney(1)											150.0	134.0	139.0					10																	93220253		2203	4300	6503	SO:0001583	missense	143279			AK094625	CCDS7414.1, CCDS7415.1, CCDS60591.1	10q23.32	2013-09-20	2012-02-23		ENSG00000165338	ENSG00000165338			26736	protein-coding gene	gene with protein product			"""HECT domain containing 2"""			8619474, 9110174	Standard	NM_001284274		Approved	FLJ37306	uc001khl.2	Q5U5R9	OTTHUMG00000018742	ENST00000298068.5:c.338C>T	10.37:g.93220253C>T	ENSP00000298068:p.Ser113Phe	Somatic		WXS	Illumina HiSeq	Phase_I	Q5VZ97|Q5VZ98|Q5VZ99|Q8N1X7|Q8TCP5	Missense_Mutation	SNP	ENST00000298068.5	37	CCDS7414.1	.	.	.	.	.	.	.	.	.	.	C	10.53	1.376557	0.24857	.	.	ENSG00000165338	ENST00000446394;ENST00000371681;ENST00000298068	T;T;T	0.48201	1.17;0.82;1.17	5.39	4.48	0.54585	.	0.184440	0.47852	D	0.000219	T	0.52484	0.1737	L	0.44542	1.39	0.80722	D	1	B;P;D	0.61080	0.128;0.511;0.989	B;B;P	0.58172	0.04;0.087;0.834	T	0.52533	-0.8563	10	0.56958	D	0.05	.	10.0663	0.42306	0.1355:0.7897:0.0:0.0748	.	113;113;113	E7ERR3;Q5U5R9;Q5VZ98	.;HECD2_HUMAN;.	F	113	ENSP00000401023:S113F;ENSP00000360746:S113F;ENSP00000298068:S113F	ENSP00000298068:S113F	S	+	2	0	HECTD2	93210233	0.998000	0.40836	0.978000	0.43139	0.049000	0.14656	3.686000	0.54685	2.502000	0.84385	0.563000	0.77884	TCC		0.373	HECTD2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098620.1			
HRC	3270	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	49657389	49657389	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr19:49657389A>T	ENST00000252825.4	-	1	1292	c.1106T>A	c.(1105-1107)gTc>gAc	p.V369D	HRC_ENST00000595625.1_Missense_Mutation_p.V369D	NM_002152.2	NP_002143.1	P23327	SRCH_HUMAN	histidine rich calcium binding protein	369					cytosolic calcium ion homeostasis (GO:0051480)|muscle contraction (GO:0006936)|positive regulation of heart contraction (GO:0045823)|positive regulation of heart rate (GO:0010460)|positive regulation of relaxation of cardiac muscle (GO:1901899)|regulation of calcium ion transmembrane transport (GO:1903169)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)	p.V369D(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(10)|lung(10)|ovary(1)|prostate(3)|urinary_tract(2)	34		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		GCCATGGTGGACATGTTGGGG	0.547																																					Melanoma(37;75 1097 24567 25669 30645)												1	Substitution - Missense(1)	kidney(1)											165.0	135.0	145.0					19																	49657389		2203	4300	6503	SO:0001583	missense	3270				CCDS12759.1	19q13.3	2008-07-16	2001-11-28			ENSG00000130528			5178	protein-coding gene	gene with protein product		142705	"""histidine-rich calcium-binding protein"""			2037293	Standard	XR_243928		Approved	MGC133236	uc002pmv.3	P23327		ENST00000252825.4:c.1106T>A	19.37:g.49657389A>T	ENSP00000252825:p.Val369Asp	Somatic		WXS	Illumina HiSeq	Phase_I	Q504Y6	Missense_Mutation	SNP	ENST00000252825.4	37	CCDS12759.1	.	.	.	.	.	.	.	.	.	.	A	1.314	-0.601495	0.03744	.	.	ENSG00000130528	ENST00000252825;ENST00000391863;ENST00000434964	T	0.32753	1.44	2.33	0.134	0.14771	.	.	.	.	.	T	0.13543	0.0328	N	0.22421	0.69	0.09310	N	1	P	0.37466	0.596	B	0.32289	0.143	T	0.19451	-1.0305	9	0.12430	T	0.62	-0.4146	4.2587	0.10730	0.377:0.0:0.623:0.0	.	369	P23327	SRCH_HUMAN	D	369;68;339	ENSP00000252825:V369D	ENSP00000252825:V369D	V	-	2	0	HRC	54349201	0.000000	0.05858	0.082000	0.20525	0.012000	0.07955	-0.673000	0.05239	0.091000	0.17302	-0.464000	0.05259	GTC		0.547	HRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465649.1		NM_002152	
HSPA8	3312	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	122931841	122931841	+	Silent	SNP	G	G	A			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr11:122931841G>A	ENST00000532636.1	-	2	311	c.192C>T	c.(190-192)acC>acT	p.T64T	HSPA8_ENST00000526110.1_Silent_p.T64T|HSPA8_ENST00000534319.1_5'Flank|SNORD14D_ENST00000384390.1_RNA|HSPA8_ENST00000526862.1_5'Flank|HSPA8_ENST00000534624.1_Silent_p.T64T|SNORD14C_ENST00000365382.1_RNA|HSPA8_ENST00000227378.3_Silent_p.T64T|HSPA8_ENST00000453788.2_Silent_p.T64T|HSPA8_ENST00000533540.1_Silent_p.T64T|SNORD14E_ENST00000364009.1_RNA			P11142	HSP7C_HUMAN	heat shock 70kDa protein 8	64					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|chaperone mediated protein folding requiring cofactor (GO:0051085)|clathrin coat disassembly (GO:0072318)|gene expression (GO:0010467)|membrane organization (GO:0061024)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|negative regulation of fibril organization (GO:1902904)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotransmitter secretion (GO:0007269)|post-Golgi vesicle-mediated transport (GO:0006892)|protein folding (GO:0006457)|protein refolding (GO:0042026)|regulation of cell cycle (GO:0051726)|response to unfolded protein (GO:0006986)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	blood microparticle (GO:0072562)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Prp19 complex (GO:0000974)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|enzyme binding (GO:0019899)|G-protein coupled receptor binding (GO:0001664)|heat shock protein binding (GO:0031072)|MHC class II protein complex binding (GO:0023026)|poly(A) RNA binding (GO:0044822)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)	p.T64T(1)		breast(1)|central_nervous_system(7)|endometrium(1)|kidney(9)|large_intestine(4)|lung(13)|upper_aerodigestive_tract(1)	36		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		AAACTGTGTTGGTGGGGTTCA	0.428																																					Colon(21;486 594 5900 6733 14272)												1	Substitution - coding silent(1)	kidney(1)											61.0	55.0	57.0					11																	122931841		2202	4299	6501	SO:0001819	synonymous_variant	3312			Y00371	CCDS8440.1, CCDS44754.1	11q24.1	2011-09-02	2002-08-29		ENSG00000109971	ENSG00000109971		"""Heat shock proteins / HSP70"""	5241	protein-coding gene	gene with protein product		600816	"""heat shock 70kD protein 8"""	HSPA10		8530083, 3037489	Standard	NM_006597		Approved	HSC71, HSC70, HSP73	uc001pyo.3	P11142	OTTHUMG00000166030	ENST00000532636.1:c.192C>T	11.37:g.122931841G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q9H3R6	Silent	SNP	ENST00000532636.1	37	CCDS8440.1																																																																																				0.428	HSPA8-004	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387515.1			
HTT	3064	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	3138012	3138012	+	Silent	SNP	A	A	G			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr4:3138012A>G	ENST00000355072.5	+	21	2902	c.2757A>G	c.(2755-2757)gaA>gaG	p.E919E		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	919					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)	p.E919E(1)		breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		TTGGAGATGAAGACCCCAGGG	0.348																																																	1	Substitution - coding silent(1)	kidney(1)											146.0	139.0	141.0					4																	3138012		1876	4117	5993	SO:0001819	synonymous_variant	3064			L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.2757A>G	4.37:g.3138012A>G		Somatic		WXS	Illumina HiSeq	Phase_I	Q9UQB7	Silent	SNP	ENST00000355072.5	37	CCDS43206.1																																																																																				0.348	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358234.2		NM_002111	
IRX1	79192	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	3599432	3599432	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr5:3599432C>A	ENST00000302006.3	+	2	422	c.370C>A	c.(370-372)Caa>Aaa	p.Q124K	CTD-2012M11.3_ENST00000559410.1_RNA	NM_024337.3	NP_077313.3	P78414	IRX1_HUMAN	iroquois homeobox 1	124					proximal/distal pattern formation involved in metanephric nephron development (GO:0072272)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.Q124K(1)		biliary_tract(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(18)|ovary(2)|pancreas(1)|prostate(5)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						CGGCCAGTTCCAATACGGGGA	0.652																																																	1	Substitution - Missense(1)	kidney(1)											44.0	48.0	47.0					5																	3599432		2203	4300	6503	SO:0001583	missense	79192			U90307	CCDS34132.1	5p15.33	2011-12-16	2007-07-13		ENSG00000170549	ENSG00000170549		"""Homeoboxes / TALE class"""	14358	protein-coding gene	gene with protein product		606197					Standard	NM_024337		Approved	IRX-5	uc003jde.3	P78414	OTTHUMG00000161632	ENST00000302006.3:c.370C>A	5.37:g.3599432C>A	ENSP00000305244:p.Gln124Lys	Somatic		WXS	Illumina HiSeq	Phase_I	Q7Z2F8|Q8N312	Missense_Mutation	SNP	ENST00000302006.3	37	CCDS34132.1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.741198	0.89573	.	.	ENSG00000170549	ENST00000302006	T	0.61627	0.09	4.83	4.83	0.62350	Homeodomain-like (1);	0.114355	0.64402	D	0.000011	T	0.70386	0.3218	M	0.71036	2.16	0.80722	D	1	D	0.60160	0.987	P	0.57101	0.813	T	0.69760	-0.5058	10	0.32370	T	0.25	.	17.895	0.88885	0.0:1.0:0.0:0.0	.	124	P78414	IRX1_HUMAN	K	124	ENSP00000305244:Q124K	ENSP00000305244:Q124K	Q	+	1	0	IRX1	3652432	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.460000	0.80816	2.348000	0.79779	0.655000	0.94253	CAA		0.652	IRX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365546.1		NM_024337	
KDM5C	8242	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	53239905	53239905	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chrX:53239905G>C	ENST00000375401.3	-	11	2068	c.1536C>G	c.(1534-1536)tgC>tgG	p.C512W	KDM5C_ENST00000404049.3_Missense_Mutation_p.C511W|KDM5C_ENST00000465402.1_5'Flank|KDM5C_ENST00000375379.3_Missense_Mutation_p.C512W|KDM5C_ENST00000452825.3_Missense_Mutation_p.C445W|KDM5C_ENST00000375383.3_Missense_Mutation_p.C471W|KDM5C-IT1_ENST00000412242.1_RNA	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	512	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)	p.C512W(1)|p.C445W(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						CAATATGCCAGCAAAAGGCTG	0.537			"""N, F, S"""		clear cell renal carcinoma																																			Rec	yes		X	Xp11.22-p11.21	8242	lysine (K)-specific demethylase 5C (JARID1C)		E	2	Substitution - Missense(2)	kidney(2)											164.0	105.0	125.0					X																	53239905		2203	4300	6503	SO:0001583	missense	8242			Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.1536C>G	X.37:g.53239905G>C	ENSP00000364550:p.Cys512Trp	Somatic		WXS	Illumina HiSeq	Phase_I	B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Missense_Mutation	SNP	ENST00000375401.3	37	CCDS14351.1	.	.	.	.	.	.	.	.	.	.	G	15.51	2.853973	0.51270	.	.	ENSG00000126012	ENST00000452825;ENST00000375401;ENST00000404049;ENST00000375379;ENST00000375383	T;T;T;T;T	0.70516	-0.49;-0.49;-0.49;-0.49;-0.49	5.21	3.42	0.39159	Transcription factor jumonji/aspartyl beta-hydroxylase (2);Transcription factor jumonji (1);	0.000000	0.85682	D	0.000000	D	0.87281	0.6138	H	0.95850	3.73	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.88300	0.2949	10	0.87932	D	0	-14.6961	9.3654	0.38221	0.1871:0.0:0.8129:0.0	.	445;511;512	F5H3T1;B0QZ44;P41229	.;.;KDM5C_HUMAN	W	445;512;511;512;471	ENSP00000445176:C445W;ENSP00000364550:C512W;ENSP00000385394:C511W;ENSP00000364528:C512W;ENSP00000364532:C471W	ENSP00000364528:C512W	C	-	3	2	KDM5C	53256630	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.454000	0.44979	0.976000	0.38417	0.600000	0.82982	TGC		0.537	KDM5C-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056737.2		NM_004187	
KIAA1210	57481	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	118222879	118222879	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chrX:118222879T>C	ENST00000402510.2	-	11	2313	c.2314A>G	c.(2314-2316)Agg>Ggg	p.R772G		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	772								p.R596G(1)|p.R772G(1)		breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						TCAGGCTTCCTTGAGGACTGA	0.478																																																	2	Substitution - Missense(2)	kidney(2)											43.0	41.0	41.0					X																	118222879		1872	4103	5975	SO:0001583	missense	57481			AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.2314A>G	X.37:g.118222879T>C	ENSP00000384670:p.Arg772Gly	Somatic		WXS	Illumina HiSeq	Phase_I	B7ZCI8|Q5JPN4	Missense_Mutation	SNP	ENST00000402510.2	37	CCDS48156.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	3.188|3.188	-0.166407|-0.166407	0.06461|0.06461	.|.	.|.	ENSG00000248857|ENSG00000250423	ENST00000440399|ENST00000402510	.|T	.|0.12147	.|2.71	4.37|4.37	1.18|1.18	0.20946|0.20946	.|.	.|.	.|.	.|.	.|.	T|T	0.04003|0.04003	0.0112|0.0112	N|N	0.01874|0.01874	-0.695|-0.695	0.09310|0.09310	N|N	1|1	.|B	.|0.06786	.|0.001	.|B	.|0.04013	.|0.001	T|T	0.42965|0.42965	-0.9420|-0.9420	5|9	.|0.22109	.|T	.|0.4	.|.	2.8268|2.8268	0.05487|0.05487	0.2154:0.5147:0.0:0.27|0.2154:0.5147:0.0:0.27	.|.	.|772	.|Q9ULL0	.|K1210_HUMAN	R|G	178|772	.|ENSP00000384670:R772G	.|ENSP00000384670:R772G	K|R	-|-	2|1	0|2	KIAA1210|RP13-347D8.6	118106907|118106907	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.011000|0.011000	0.07611|0.07611	-0.157000|-0.157000	0.10085|0.10085	0.119000|0.119000	0.18210|0.18210	-0.385000|-0.385000	0.06624|0.06624	AAG|AGG		0.478	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371251.2		NM_020721	
LINGO1	84894	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	77907673	77907673	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr15:77907673G>C	ENST00000355300.6	-	2	750	c.576C>G	c.(574-576)agC>agG	p.S192R	LINGO1_ENST00000561030.1_Missense_Mutation_p.S186R	NM_032808.5	NP_116197.4	Q96FE5	LIGO1_HUMAN	leucine rich repeat and Ig domain containing 1	192					central nervous system neuron development (GO:0021954)|negative regulation of axonogenesis (GO:0050771)|negative regulation of oligodendrocyte differentiation (GO:0048715)|neuron projection development (GO:0031175)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein kinase B signaling (GO:0043491)|regulation of axonogenesis (GO:0050770)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S186R(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31						GCTGCTCCAGGCTGTTGAGGC	0.597																																																	1	Substitution - Missense(1)	kidney(1)											118.0	125.0	122.0					15																	77907673		2168	4272	6440	SO:0001583	missense	84894			AK027500	CCDS45313.1, CCDS73766.1	15q24	2013-01-11	2007-02-01	2007-02-01		ENSG00000169783		"""Immunoglobulin superfamily / I-set domain containing"""	21205	protein-coding gene	gene with protein product		609791	"""leucine rich repeat neuronal 6A"""	LRRN6A		14686891	Standard	XM_006720723		Approved	FLJ14594, LERN1	uc002bct.1	Q96FE5		ENST00000355300.6:c.576C>G	15.37:g.77907673G>C	ENSP00000347451:p.Ser192Arg	Somatic		WXS	Illumina HiSeq	Phase_I	D3DW80|Q6NUK3|Q6UXM3|Q6VVG0|Q6VVG1|Q6VVG2|Q8N3K5|Q96K52	Missense_Mutation	SNP	ENST00000355300.6	37	CCDS45313.1	.	.	.	.	.	.	.	.	.	.	G	17.38	3.374915	0.61735	.	.	ENSG00000169783	ENST00000355300	D	0.81659	-1.52	5.29	3.3	0.37823	.	0.079382	0.85682	D	0.000000	T	0.78400	0.4277	L	0.42581	1.335	0.80722	D	1	D	0.60575	0.988	P	0.51777	0.679	T	0.76296	-0.3011	10	0.37606	T	0.19	.	10.3879	0.44152	0.0735:0.1348:0.7917:0.0	.	192	Q96FE5	LIGO1_HUMAN	R	192	ENSP00000347451:S192R	ENSP00000347451:S192R	S	-	3	2	LINGO1	75694728	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.711000	0.68400	1.239000	0.43787	-0.258000	0.10820	AGC		0.597	LINGO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419546.1		NM_032808	
LPPR4	9890	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	99771417	99771417	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr1:99771417A>T	ENST00000370185.3	+	7	1640	c.1143A>T	c.(1141-1143)agA>agT	p.R381S	LPPR4_ENST00000457765.1_Missense_Mutation_p.R323S|LPPR4_ENST00000370184.1_Missense_Mutation_p.R223S	NM_014839.4	NP_055654.2	Q7Z2D5	LPPR4_HUMAN		381					axonogenesis (GO:0007409)|inner ear development (GO:0048839)|phospholipid dephosphorylation (GO:0046839)	integral component of plasma membrane (GO:0005887)	lipid phosphatase activity (GO:0042577)|phosphatidate phosphatase activity (GO:0008195)	p.R381S(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(39)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	72		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)		GAAACCACAGAGATGCTAGCT	0.458																																																	1	Substitution - Missense(1)	kidney(1)											86.0	84.0	84.0					1																	99771417		2203	4300	6503	SO:0001583	missense	9890																														ENST00000370185.3:c.1143A>T	1.37:g.99771417A>T	ENSP00000359204:p.Arg381Ser	Somatic		WXS	Illumina HiSeq	Phase_I	E7EPS1|O75043|Q5T9R9|Q86XQ5|Q8N3F1|Q96MP0	Missense_Mutation	SNP	ENST00000370185.3	37	CCDS757.1	.	.	.	.	.	.	.	.	.	.	A	12.47	1.947872	0.34377	.	.	ENSG00000117600	ENST00000370185;ENST00000457765;ENST00000263178;ENST00000370184	T;T;T	0.30182	2.09;1.78;1.54	5.71	2.03	0.26663	.	0.178903	0.47455	D	0.000222	T	0.25680	0.0625	L	0.60455	1.87	0.54753	D	0.999984	B;D	0.55605	0.131;0.972	B;P	0.56398	0.033;0.797	T	0.02713	-1.1120	9	.	.	.	-19.3123	7.6191	0.28175	0.6628:0.2672:0.0699:0.0	.	323;381	E7EPS1;Q7Z2D5	.;LPPR4_HUMAN	S	381;323;381;223	ENSP00000359204:R381S;ENSP00000394913:R323S;ENSP00000359203:R223S	.	R	+	3	2	RP4-788L13.1	99544005	1.000000	0.71417	0.995000	0.50966	0.195000	0.23768	1.314000	0.33597	0.087000	0.17167	-0.323000	0.08544	AGA		0.458	LPPR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029670.2			
MAP7	9053	broad.mit.edu;hgsc.bcm.edu	37	6	136683700	136683700	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr6:136683700C>A	ENST00000354570.3	-	11	1824	c.1414G>T	c.(1414-1416)Ggc>Tgc	p.G472C	MAP7_ENST00000544465.1_Missense_Mutation_p.G457C|MAP7_ENST00000438100.2_Missense_Mutation_p.G457C|MAP7_ENST00000454590.1_Missense_Mutation_p.G494C|RP3-406A7.3_ENST00000571188.1_RNA|MAP7_ENST00000432797.2_Missense_Mutation_p.G326C	NM_001198616.1|NM_001198617.1|NM_001198619.1|NM_003980.4	NP_001185545.1|NP_001185546.1|NP_001185548.1|NP_003971.1	Q14244	MAP7_HUMAN	microtubule-associated protein 7	472					cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|establishment or maintenance of cell polarity (GO:0007163)|fertilization (GO:0009566)|germ cell development (GO:0007281)|glycosphingolipid metabolic process (GO:0006687)|homeostasis of number of cells (GO:0048872)|Leydig cell differentiation (GO:0033327)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|nucleus organization (GO:0006997)|organ growth (GO:0035265)|protein localization to plasma membrane (GO:0072659)|response to osmotic stress (GO:0006970)|response to retinoic acid (GO:0032526)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)|structural molecule activity (GO:0005198)	p.G472C(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(11)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00199)|OV - Ovarian serous cystadenocarcinoma(155;0.00643)		TCGGTGGTGCCTGCAGAAGTC	0.622																																																	1	Substitution - Missense(1)	kidney(1)											75.0	74.0	75.0					6																	136683700		2203	4300	6503	SO:0001583	missense	9053			X73882	CCDS5178.1, CCDS56452.1, CCDS56453.1, CCDS56454.1, CCDS56455.1, CCDS75527.1, CCDS75528.1, CCDS75529.1	6q23.2	2008-07-28			ENSG00000135525	ENSG00000135525			6869	protein-coding gene	gene with protein product		604108				8408219	Standard	NM_003980		Approved	E-MAP-115	uc011edg.2	Q14244	OTTHUMG00000015646	ENST00000354570.3:c.1414G>T	6.37:g.136683700C>A	ENSP00000346581:p.Gly472Cys	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z290|B7Z400|B7Z5S7|B7Z9U7|C9JPS0|E9PCP3|F5H1E2|Q7Z6S0|Q8TAU5|Q9NY82|Q9NY83	Missense_Mutation	SNP	ENST00000354570.3	37	CCDS5178.1	.	.	.	.	.	.	.	.	.	.	C	14.96	2.691104	0.48097	.	.	ENSG00000135525	ENST00000354570;ENST00000454590;ENST00000544465;ENST00000438100;ENST00000432797;ENST00000345567	T;T;T;T;T	0.49432	0.78;0.78;0.78;0.78;0.78	5.67	5.67	0.87782	.	0.000000	0.56097	D	0.000024	T	0.73621	0.3610	M	0.90870	3.155	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0	T	0.79482	-0.1785	10	0.87932	D	0	-17.2869	19.7743	0.96385	0.0:1.0:0.0:0.0	.	457;494;457;494;378;435;472	B7Z290;B7ZB64;F5H1E2;E9PCP3;F8W783;Q14244-2;Q14244	.;.;.;.;.;.;MAP7_HUMAN	C	472;494;457;457;326;378	ENSP00000346581:G472C;ENSP00000414712:G494C;ENSP00000445737:G457C;ENSP00000400790:G457C;ENSP00000414879:G326C	ENSP00000344217:G378C	G	-	1	0	MAP7	136725393	1.000000	0.71417	1.000000	0.80357	0.118000	0.20060	7.414000	0.80117	2.663000	0.90544	0.557000	0.71058	GGC		0.622	MAP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042382.2		NM_003980	
MBNL3	55796	hgsc.bcm.edu	37	X	131525019	131525019	+	Frame_Shift_Del	DEL	A	A	-			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chrX:131525019delA	ENST00000370853.3	-	4	705	c.627delT	c.(625-627)agtfs	p.S209fs	MBNL3_ENST00000370839.3_Frame_Shift_Del_p.S209fs|RAP2C-AS1_ENST00000421483.2_RNA|MBNL3_ENST00000538204.1_Frame_Shift_Del_p.S159fs|MBNL3_ENST00000370857.3_Frame_Shift_Del_p.S209fs|MBNL3_ENST00000370844.1_Frame_Shift_Del_p.S113fs|MBNL3_ENST00000473364.1_5'UTR|MBNL3_ENST00000370849.3_Frame_Shift_Del_p.S159fs|MBNL3_ENST00000394311.2_Frame_Shift_Del_p.S113fs|RAP2C-AS1_ENST00000441399.2_RNA	NM_018388.3	NP_060858.2	Q9NUK0	MBNL3_HUMAN	muscleblind-like splicing regulator 3	209					mRNA processing (GO:0006397)|multicellular organismal development (GO:0007275)|negative regulation of myoblast differentiation (GO:0045662)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(5)|prostate(2)	16	Acute lymphoblastic leukemia(192;0.000127)					CAGTATTATCACTCGCTTCAA	0.473																																																	0													152.0	120.0	131.0					X																	131525019		2203	4300	6503	SO:0001589	frameshift_variant	55796			AF491305	CCDS14633.1, CCDS14634.1, CCDS55492.1, CCDS55493.1, CCDS55494.1	Xq26.2	2013-01-18	2012-02-23		ENSG00000076770	ENSG00000076770		"""Zinc fingers, CCCH-type domain containing"""	20564	protein-coding gene	gene with protein product		300413	"""muscleblind-like 3 (Drosophila)"""			12297108, 10970838	Standard	NM_018388		Approved	CHCR, FLJ11316, MBLX39, MBXL	uc004ewv.4	Q9NUK0	OTTHUMG00000022426	ENST00000370853.3:c.627delT	X.37:g.131525019delA	ENSP00000359890:p.Ser209fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q5JXN8|Q5JXN9|Q5JXP4|Q6UDQ1|Q8IUR4|Q8TAD9|Q8TAF4|Q9H0Z7|Q9UF37	Frame_Shift_Del	DEL	ENST00000370853.3	37	CCDS14633.1																																																																																				0.473	MBNL3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058319.1		NM_018388	
MRPL22	29093	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	154330404	154330404	+	Missense_Mutation	SNP	A	A	T			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr5:154330404A>T	ENST00000523037.1	+	3	142	c.101A>T	c.(100-102)cAc>cTc	p.H34L	MRPL22_ENST00000439747.3_Missense_Mutation_p.H60L|MRPL22_ENST00000522038.1_Missense_Mutation_p.H40L|MRPL22_ENST00000265229.8_Intron	NM_014180.3	NP_054899.2	Q9NWU5	RM22_HUMAN	mitochondrial ribosomal protein L22	34					translation (GO:0006412)	large ribosomal subunit (GO:0015934)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.H34L(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|urinary_tract(2)	10	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TCATATATCCACACAAGTGCT	0.388																																																	1	Substitution - Missense(1)	kidney(1)											124.0	122.0	123.0					5																	154330404		2203	4300	6503	SO:0001583	missense	29093			AB051622	CCDS4331.1, CCDS43391.1	5q33.2	2012-09-13			ENSG00000082515	ENSG00000082515		"""Mitochondrial ribosomal proteins / large subunits"""	14480	protein-coding gene	gene with protein product		611835					Standard	NM_014180		Approved	MRP-L25, RPML25, HSPC158	uc003lvy.4	Q9NWU5	OTTHUMG00000130190	ENST00000523037.1:c.101A>T	5.37:g.154330404A>T	ENSP00000431040:p.His34Leu	Somatic		WXS	Illumina HiSeq	Phase_I	A6NGJ8|Q5H9Q1|Q96Q51|Q9P006	Missense_Mutation	SNP	ENST00000523037.1	37	CCDS4331.1	.	.	.	.	.	.	.	.	.	.	A	13.05	2.122464	0.37436	.	.	ENSG00000082515	ENST00000523037;ENST00000439747;ENST00000522038	T;T;T	0.55234	0.62;0.53;0.73	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	T	0.54791	0.1880	M	0.79693	2.465	0.80722	D	1	B	0.23806	0.091	B	0.18263	0.021	T	0.58747	-0.7582	10	0.59425	D	0.04	-3.8561	12.3452	0.55116	1.0:0.0:0.0:0.0	.	34	Q9NWU5	RM22_HUMAN	L	34;60;40	ENSP00000431040:H34L;ENSP00000411177:H60L;ENSP00000429039:H40L	ENSP00000411177:H60L	H	+	2	0	MRPL22	154310597	1.000000	0.71417	0.996000	0.52242	0.431000	0.31685	6.701000	0.74624	1.947000	0.56498	0.482000	0.46254	CAC		0.388	MRPL22-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252508.2			
MUC5B	727897	broad.mit.edu;hgsc.bcm.edu	37	11	1264224	1264224	+	Silent	SNP	C	C	A			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr11:1264224C>A	ENST00000529681.1	+	31	6172	c.6114C>A	c.(6112-6114)acC>acA	p.T2038T	MUC5B_ENST00000447027.1_Silent_p.T2041T|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	2038	11 X approximate tandem repeats, Ser/Thr- rich.|7 X Cys-rich subdomain repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)		p.T2041T(1)|p.T2038T(1)		cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CTGTGGCCACCCCCTCCTCCA	0.647																																																	2	Substitution - coding silent(2)	kidney(2)											112.0	142.0	132.0					11																	1264224		2074	4192	6266	SO:0001819	synonymous_variant	727897			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.6114C>A	11.37:g.1264224C>A		Somatic		WXS	Illumina HiSeq	Phase_I	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	37	CCDS44515.2																																																																																				0.647	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2		XM_001126093	
MX2	4600	hgsc.bcm.edu;ucsc.edu	37	21	42778676	42778676	+	Silent	SNP	G	G	A	rs61730267	byFrequency	TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr21:42778676G>A	ENST00000330714.3	+	13	1840	c.1656G>A	c.(1654-1656)acG>acA	p.T552T		NM_002463.1	NP_002454.1	P20592	MX2_HUMAN	MX dynamin-like GTPase 2	552					cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|defense response to virus (GO:0051607)|GTP catabolic process (GO:0006184)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of nucleocytoplasmic transport (GO:0046822)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.T552T(1)		breast(2)|endometrium(3)|large_intestine(6)|lung(12)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	34		Prostate(19;1.57e-07)|all_epithelial(19;0.0222)				ACCAGAGCACGATTGAAGACA	0.338													G|||	200	0.0399361	0.1029	0.0101	5008	,	,		12195	0.0248		0.004	False		,,,				2504	0.0286																1	Substitution - coding silent(1)	stomach(1)						G		370,4036	187.8+/-214.3	16,338,1849	96.0	84.0	88.0		1656	-2.2	0.0	21	dbSNP_129	88	27,8573	19.8+/-62.0	0,27,4273	no	coding-synonymous	MX2	NM_002463.1		16,365,6122	AA,AG,GG		0.314,8.3976,3.0524		552/716	42778676	397,12609	2203	4300	6503	SO:0001819	synonymous_variant	4600				CCDS13672.1	21q22.3	2014-07-15	2014-07-15		ENSG00000183486	ENSG00000183486			7533	protein-coding gene	gene with protein product	"""interferon-regulated resistance GTP-binding protein MXB"", ""second interferon-induced protein p78"""	147890	"""myxovirus (influenza) resistance 2, homolog of murine"", ""myxovirus (influenza virus) resistance 2 (mouse)"""			2481229, 8798556	Standard	NM_002463		Approved	MXB	uc002yzf.1	P20592	OTTHUMG00000086753	ENST00000330714.3:c.1656G>A	21.37:g.42778676G>A		Somatic		WXS	Illumina HiSeq	Phase_I	B7Z5D3|D3DSI7	Silent	SNP	ENST00000330714.3	37	CCDS13672.1																																																																																				0.338	MX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195147.1		NM_002463	
NAT9	26151	broad.mit.edu;ucsc.edu	37	17	72769778	72769778	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr17:72769778A>G	ENST00000357814.3	-	3	200	c.127T>C	c.(127-129)Tcg>Ccg	p.S43P	NAT9_ENST00000582870.1_Missense_Mutation_p.S47P|NAT9_ENST00000582524.1_Missense_Mutation_p.S43P|TMEM104_ENST00000417024.2_5'Flank|NAT9_ENST00000580216.1_5'UTR|TMEM104_ENST00000582773.1_5'Flank|TMEM104_ENST00000335464.5_5'Flank|NAT9_ENST00000583757.1_Missense_Mutation_p.S42P|NAT9_ENST00000580632.1_Missense_Mutation_p.S42P|NAT9_ENST00000578822.1_Missense_Mutation_p.S48P|NAT9_ENST00000581136.1_Missense_Mutation_p.S43P|NAT9_ENST00000583476.1_Missense_Mutation_p.S43P|TMEM104_ENST00000582330.1_5'Flank|NAT9_ENST00000580301.1_Missense_Mutation_p.S42P	NM_015654.3	NP_056469.2	Q9BTE0	NAT9_HUMAN	N-acetyltransferase 9 (GCN5-related, putative)	43	N-acetyltransferase.					protein complex (GO:0043234)	N-acetyltransferase activity (GO:0008080)	p.S43P(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)	8						AGCGGCTCCGAGGCTGTCAAA	0.592																																																	1	Substitution - Missense(1)	kidney(1)											110.0	100.0	103.0					17																	72769778		2203	4300	6503	SO:0001583	missense	26151			AK123115	CCDS11706.1	17q25.2	2011-11-25	2008-09-24		ENSG00000109065	ENSG00000109065			23133	protein-coding gene	gene with protein product			"""N-acetyltransferase 9"""			14608357	Standard	NM_015654		Approved	DKFZP564C103	uc002jlq.3	Q9BTE0		ENST00000357814.3:c.127T>C	17.37:g.72769778A>G	ENSP00000350467:p.Ser43Pro	Somatic		WXS	Illumina GAIIx	Phase_I	B2R7F0|Q9BTD0|Q9Y3T3	Missense_Mutation	SNP	ENST00000357814.3	37	CCDS11706.1	.	.	.	.	.	.	.	.	.	.	A	15.61	2.883029	0.51908	.	.	ENSG00000109065	ENST00000357814	T	0.45276	0.9	4.87	4.87	0.63330	Acyl-CoA N-acyltransferase (2);	0.072630	0.64402	D	0.000016	T	0.73682	0.3618	H	0.95780	3.72	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.80799	-0.1221	10	0.44086	T	0.13	-11.0843	14.7688	0.69659	1.0:0.0:0.0:0.0	.	42;43	Q9BTE0-2;Q9BTE0	.;NAT9_HUMAN	P	43	ENSP00000350467:S43P	ENSP00000350467:S43P	S	-	1	0	NAT9	70281373	1.000000	0.71417	0.990000	0.47175	0.945000	0.59286	9.248000	0.95456	1.948000	0.56530	0.260000	0.18958	TCG		0.592	NAT9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000443700.1		NM_015654	
NDN	4692	broad.mit.edu;hgsc.bcm.edu	37	15	23932263	23932263	+	Silent	SNP	C	C	T			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr15:23932263C>T	ENST00000331837.4	-	1	187	c.102G>A	c.(100-102)ccG>ccA	p.P34P		NM_002487.2	NP_002478.1	Q99608	NECD_HUMAN	necdin, melanoma antigen (MAGE) family member	34					axon extension (GO:0048675)|axonal fasciculation (GO:0007413)|central nervous system development (GO:0007417)|genetic imprinting (GO:0071514)|glial cell migration (GO:0008347)|multicellular organismal homeostasis (GO:0048871)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|post-embryonic development (GO:0009791)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|respiratory system process (GO:0003016)|sensory perception of pain (GO:0019233)|transcription, DNA-templated (GO:0006351)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.P34P(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(23)|ovary(1)|prostate(2)|skin(1)	39		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;8.37e-11)|Epithelial(43;9.29e-10)|BRCA - Breast invasive adenocarcinoma(123;0.00179)|GBM - Glioblastoma multiforme(186;0.018)|Lung(196;0.153)		GGGTCGCGGACGGAGGAACCC	0.692									Prader-Willi syndrome																																								1	Substitution - coding silent(1)	kidney(1)											11.0	12.0	12.0					15																	23932263		1716	3420	5136	SO:0001819	synonymous_variant	4692	Familial Cancer Database	Prader-Labhart-Willi syndrome	U35139	CCDS10014.1	15q11-q12	2012-12-07	2012-12-07		ENSG00000182636	ENSG00000182636			7675	protein-coding gene	gene with protein product	"""Prader-Willi syndrome chromosome region"""	602117	"""necdin (mouse) homolog"", ""necdin homolog (mouse)"""			9302265	Standard	NM_002487		Approved	HsT16328, PWCR	uc001ywk.3	Q99608	OTTHUMG00000129161	ENST00000331837.4:c.102G>A	15.37:g.23932263C>T		Somatic		WXS	Illumina HiSeq	Phase_I	B2R6Z5	Silent	SNP	ENST00000331837.4	37	CCDS10014.1																																																																																				0.692	NDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251226.2		NM_002487	
NFAT5	10725	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	69727140	69727140	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr16:69727140C>A	ENST00000354436.2	+	12	3676	c.3358C>A	c.(3358-3360)Caa>Aaa	p.Q1120K	NFAT5_ENST00000432919.1_Missense_Mutation_p.Q1138K|NFAT5_ENST00000566899.1_Missense_Mutation_p.Q1044K|NFAT5_ENST00000349945.1_Missense_Mutation_p.Q1044K|NFAT5_ENST00000393742.2_Missense_Mutation_p.Q1044K|NFAT5_ENST00000567239.1_Missense_Mutation_p.Q1137K	NM_006599.3	NP_006590.1	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5, tonicity-responsive	1120					cytokine production (GO:0001816)|excretion (GO:0007588)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of calcineurin-NFAT signaling cascade (GO:0070884)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q1044K(1)|p.Q1138K(1)		NS(1)|breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						GTTTCACTCTCAAAGTACCAT	0.428																																																	2	Substitution - Missense(2)	kidney(2)											106.0	108.0	107.0					16																	69727140		2198	4300	6498	SO:0001583	missense	10725			AF134870	CCDS10881.1, CCDS10882.1, CCDS45519.1	16q22.1	2009-11-24			ENSG00000102908	ENSG00000102908		"""Nuclear factor of activated T-cells"""	7774	protein-coding gene	gene with protein product		604708				10377394	Standard	NM_173214		Approved	TONEBP, KIAA0827, NFATL1, OREBP, NFATZ, NF-AT5	uc002exl.2	O94916	OTTHUMG00000137572	ENST00000354436.2:c.3358C>A	16.37:g.69727140C>A	ENSP00000346420:p.Gln1120Lys	Somatic		WXS	Illumina HiSeq	Phase_I	A2RRB4|A6H8V5|E9PHR7|O95693|Q7LA65|Q969Q8|Q96QH3|Q9UN18	Missense_Mutation	SNP	ENST00000354436.2	37	CCDS10881.1	.	.	.	.	.	.	.	.	.	.	C	18.12	3.552582	0.65425	.	.	ENSG00000102908	ENST00000432919;ENST00000426654;ENST00000349945;ENST00000354436;ENST00000393742	T;T;T;T	0.53857	0.6;0.68;0.68;0.68	5.83	5.83	0.93111	.	0.269957	0.38605	N	0.001636	T	0.69637	0.3133	L	0.59436	1.845	0.58432	D	0.999999	D;D;D	0.54964	0.969;0.969;0.969	D;D;D	0.64877	0.93;0.93;0.93	T	0.65936	-0.6047	10	0.42905	T	0.14	-1.5194	20.1162	0.97934	0.0:1.0:0.0:0.0	.	1137;1120;1138	A2RRB4;O94916;E9PHR7	.;NFAT5_HUMAN;.	K	1138;1137;1044;1120;1044	ENSP00000396538:Q1138K;ENSP00000338806:Q1044K;ENSP00000346420:Q1120K;ENSP00000377343:Q1044K	ENSP00000338806:Q1044K	Q	+	1	0	NFAT5	68284641	1.000000	0.71417	0.989000	0.46669	0.993000	0.82548	5.790000	0.69038	2.756000	0.94617	0.655000	0.94253	CAA		0.428	NFAT5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268952.2		NM_138714	
NFKBID	84807	hgsc.bcm.edu	37	19	36387710	36387711	+	Frame_Shift_Ins	INS	-	-	G			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr19:36387710_36387711insG	ENST00000396901.1	-	6	748_749	c.175_176insC	c.(175-177)cggfs	p.R59fs	NFKBID_ENST00000585544.1_5'Flank|NFKBID_ENST00000606253.1_Frame_Shift_Ins_p.R59fs|NFKBID_ENST00000352614.2_Frame_Shift_Ins_p.R211fs	NM_139239.1	NP_640332.1	Q8NI38	IKBD_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, delta	59					inflammatory response (GO:0006954)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of T cell differentiation in thymus (GO:0033085)|positive regulation of thymocyte apoptotic process (GO:0070245)	nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	14						GCGCAGCCCCCGAGCCGCAAAC	0.614																																																	0																																										SO:0001589	frameshift_variant	84807			AF385434	CCDS42552.1	19q13.12	2013-01-10				ENSG00000167604		"""Ankyrin repeat domain containing"""	15671	protein-coding gene	gene with protein product						12477932	Standard	NM_139239		Approved	TA-NFKBH, IkappaBNS	uc002oci.1	Q8NI38		ENST00000396901.1:c.176dupC	19.37:g.36387711_36387711dupG	ENSP00000380109:p.Arg59fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q8NI39|Q9BRG9	Frame_Shift_Ins	INS	ENST00000396901.1	37	CCDS42552.1																																																																																				0.614	NFKBID-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000452927.3		NM_032721	
NIPSNAP3B	55335	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	107528730	107528730	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr9:107528730T>C	ENST00000374762.3	+	2	256	c.185T>C	c.(184-186)cTt>cCt	p.L62P	NIPSNAP3B_ENST00000461177.1_Intron	NM_018376.2	NP_060846.2	Q9BS92	NPS3B_HUMAN	nipsnap homolog 3B (C. elegans)	62								p.L62P(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)|skin(1)|stomach(2)	11						AACATTCATCTTCGGACCTCT	0.358																																																	1	Substitution - Missense(1)	kidney(1)											148.0	153.0	151.0					9																	107528730		2203	4300	6503	SO:0001583	missense	55335			BC017914	CCDS6761.1	9q31.3	2003-11-27			ENSG00000165028	ENSG00000165028			23641	protein-coding gene	gene with protein product		608872				12477932	Standard	NM_018376		Approved	FLJ11275	uc004bci.3	Q9BS92	OTTHUMG00000020414	ENST00000374762.3:c.185T>C	9.37:g.107528730T>C	ENSP00000363894:p.Leu62Pro	Somatic		WXS	Illumina HiSeq	Phase_I	Q5VX30|Q9NUM2	Missense_Mutation	SNP	ENST00000374762.3	37	CCDS6761.1	.	.	.	.	.	.	.	.	.	.	T	17.19	3.325333	0.60743	.	.	ENSG00000165028	ENST00000374762	T	0.53206	0.63	3.93	3.93	0.45458	Dimeric alpha-beta barrel (1);	0.073760	0.56097	D	0.000027	T	0.68044	0.2958	M	0.83953	2.67	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	T	0.70883	-0.4751	10	0.44086	T	0.13	-1.7056	12.1681	0.54141	0.0:0.0:0.0:1.0	.	62	Q9BS92	NPS3B_HUMAN	P	62	ENSP00000363894:L62P	ENSP00000363894:L62P	L	+	2	0	NIPSNAP3B	106568551	1.000000	0.71417	0.975000	0.42487	0.808000	0.45660	5.762000	0.68809	1.753000	0.51906	0.528000	0.53228	CTT		0.358	NIPSNAP3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053486.1		NM_018376	
NPFFR2	10886	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	73013490	73013490	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr4:73013490G>A	ENST00000308744.6	+	4	1628	c.1530G>A	c.(1528-1530)atG>atA	p.M510I	NPFFR2_ENST00000395999.1_Missense_Mutation_p.M411I|NPFFR2_ENST00000358749.3_Missense_Mutation_p.M408I|NPFFR2_ENST00000344413.5_3'UTR|NPFFR2_ENST00000506359.1_3'UTR	NM_004885.2	NP_004876.2	Q9Y5X5	NPFF2_HUMAN	neuropeptide FF receptor 2	510					detection of abiotic stimulus (GO:0009582)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of adenylate cyclase activity (GO:0045761)|regulation of cAMP-dependent protein kinase activity (GO:2000479)|regulation of MAPK cascade (GO:0043408)	actin cytoskeleton (GO:0015629)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)	p.M510I(1)		NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(24)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43			Lung(101;0.0935)|LUSC - Lung squamous cell carcinoma(112;0.138)			AATTAGTGATGGAAGAATTAA	0.348																																																	1	Substitution - Missense(1)	kidney(1)											49.0	53.0	52.0					4																	73013490		2202	4299	6501	SO:0001583	missense	10886			AF236083	CCDS3551.1, CCDS3552.1, CCDS47072.1	4q21	2012-08-10	2006-02-15	2006-02-15	ENSG00000056291	ENSG00000056291		"""GPCR / Class A :  Neuropeptide receptors : FF/AF"", ""GPCR / Class A : RF amide peptide receptors"""	4525	protein-coding gene	gene with protein product	"""neuropeptide FF 2"""	607449	"""G protein-coupled receptor 74"""	GPR74		10079187, 10851242	Standard	NM_001144756		Approved	NPFF2, NPGPR	uc003hgg.2	Q9Y5X5	OTTHUMG00000129918	ENST00000308744.6:c.1530G>A	4.37:g.73013490G>A	ENSP00000307822:p.Met510Ile	Somatic		WXS	Illumina HiSeq	Phase_I	Q96RV1|Q9NR49	Missense_Mutation	SNP	ENST00000308744.6	37	CCDS3551.1	.	.	.	.	.	.	.	.	.	.	G	14.53	2.561823	0.45590	.	.	ENSG00000056291	ENST00000308744;ENST00000395999;ENST00000358749	T;T;T	0.72282	-0.64;-0.45;-0.47	5.24	-4.29	0.03721	.	0.224870	0.31872	N	0.006926	T	0.45895	0.1365	L	0.31065	0.9	0.41188	D	0.986285	B;B	0.18863	0.002;0.031	B;B	0.12837	0.006;0.008	T	0.01810	-1.1269	10	0.34782	T	0.22	.	2.3248	0.04220	0.2944:0.1948:0.4111:0.0998	.	411;510	Q9Y5X5-3;Q9Y5X5	.;NPFF2_HUMAN	I	510;411;408	ENSP00000307822:M510I;ENSP00000379321:M411I;ENSP00000351599:M408I	ENSP00000307822:M510I	M	+	3	0	NPFFR2	73232354	1.000000	0.71417	0.000000	0.03702	0.181000	0.23173	1.089000	0.30890	-1.016000	0.03371	0.563000	0.77884	ATG		0.348	NPFFR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252170.2		NM_004885	
NT5C2	22978	hgsc.bcm.edu;ucsc.edu	37	10	104934672	104934673	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	AT	AT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr10:104934672_104934673delAT	ENST00000404739.3	-	1	66_67	c.43_44delAT	c.(43-45)atgfs	p.M15fs	NT5C2_ENST00000369857.4_Intron|NT5C2_ENST00000343289.5_Frame_Shift_Del_p.M15fs|NT5C2_ENST00000470299.1_Frame_Shift_Del_p.M15fs			P49902	5NTC_HUMAN	5'-nucleotidase, cytosolic II	15					cell death (GO:0008219)|dephosphorylation (GO:0016311)|drug metabolic process (GO:0017144)|nucleobase-containing small molecule metabolic process (GO:0055086)|phosphorylation (GO:0016310)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	5'-nucleotidase activity (GO:0008253)|metal ion binding (GO:0046872)|nucleoside phosphotransferase activity (GO:0050146)|nucleotide binding (GO:0000166)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|urinary_tract(1)	16		all_hematologic(284;0.176)|Colorectal(252;0.178)		Epithelial(162;1.33e-08)|all cancers(201;1.04e-07)|BRCA - Breast invasive adenocarcinoma(275;0.159)	Adenosine triphosphate(DB00171)|Ribavirin(DB00811)	GTTAGCAGGCATATCTGCTGCA	0.347																																																	0																																										SO:0001589	frameshift_variant	22978			D38524	CCDS7544.1	10q24.32	2014-03-03	2002-04-18	2002-04-19	ENSG00000076685	ENSG00000076685			8022	protein-coding gene	gene with protein product	"""purine 5' nucleotidase"""	600417	"""5'-nucleotidase (purine), cytosolic type B"""	NT5B		7999131, 24482476	Standard	NM_012229		Approved	PNT5, GMP, cN-II, SPG65	uc001kwq.3	P49902	OTTHUMG00000018981	ENST00000404739.3:c.43_44delAT	10.37:g.104934674_104934675delAT	ENSP00000383960:p.Met15fs	Somatic		WXS	Illumina HiSeq	Phase_I	B7Z382|D3DR91|Q5JUV5	Frame_Shift_Del	DEL	ENST00000404739.3	37	CCDS7544.1																																																																																				0.347	NT5C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050121.1		NM_012229	
NUP210	23225	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	13429823	13429823	+	Missense_Mutation	SNP	T	T	A	rs573887922		TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr3:13429823T>A	ENST00000254508.5	-	5	746	c.664A>T	c.(664-666)Atc>Ttc	p.I222F		NM_024923.2	NP_079199.2	Q8TEM1	PO210_HUMAN	nucleoporin 210kDa	222					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)		p.I222F(1)		NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|ovary(7)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	66	all_neural(104;0.187)					GCCTCCTGGATGCGAGCCTTG	0.592																																																	1	Substitution - Missense(1)	kidney(1)											87.0	83.0	85.0					3																	13429823		2203	4300	6503	SO:0001583	missense	23225			AB020713	CCDS33704.1	3p25	2008-02-05			ENSG00000132182	ENSG00000132182			30052	protein-coding gene	gene with protein product		607703				2184032, 7504063	Standard	NM_024923		Approved	GP210, POM210, FLJ22389, KIAA0906	uc003bxv.1	Q8TEM1	OTTHUMG00000157268	ENST00000254508.5:c.664A>T	3.37:g.13429823T>A	ENSP00000254508:p.Ile222Phe	Somatic		WXS	Illumina HiSeq	Phase_I	A6NN56|O94980|Q6NXG6|Q8NBJ1|Q9H6C8|Q9UFP3	Missense_Mutation	SNP	ENST00000254508.5	37	CCDS33704.1	.	.	.	.	.	.	.	.	.	.	T	16.45	3.127758	0.56721	.	.	ENSG00000132182	ENST00000254508	T	0.05786	3.39	5.59	5.59	0.84812	.	0.090386	0.64402	D	0.000001	T	0.11707	0.0285	L	0.45228	1.405	0.58432	D	0.999995	D	0.53462	0.96	P	0.49853	0.624	T	0.02173	-1.1201	10	0.45353	T	0.12	-27.1231	15.4331	0.75121	0.0:0.0:0.0:1.0	.	222	Q8TEM1	PO210_HUMAN	F	222	ENSP00000254508:I222F	ENSP00000254508:I222F	I	-	1	0	NUP210	13404823	1.000000	0.71417	0.873000	0.34254	0.003000	0.03518	3.879000	0.56138	2.129000	0.65627	0.528000	0.53228	ATC		0.592	NUP210-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340085.1		NM_024923	
OR1D2	4991	broad.mit.edu;hgsc.bcm.edu	37	17	2995985	2995985	+	Nonsense_Mutation	SNP	G	G	T	rs140264769		TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr17:2995985G>T	ENST00000331459.1	-	1	305	c.306C>A	c.(304-306)taC>taA	p.Y102*		NM_002548.2	NP_002539.2	P34982	OR1D2_HUMAN	olfactory receptor, family 1, subfamily D, member 2	102					cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|G-protein coupled receptor signaling pathway (GO:0007186)|protein import into nucleus, translocation (GO:0000060)|sensory perception of smell (GO:0007608)|single fertilization (GO:0007338)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Y102*(1)		kidney(2)|large_intestine(2)|lung(10)|ovary(1)	15						AGACCAGGAAGTAGAGCTGTG	0.547																																																	1	Substitution - Nonsense(1)	kidney(1)						G	stop/TYR	0,4406		0,0,2203	163.0	169.0	167.0		306	0.8	1.0	17	dbSNP_134	167	1,8595	1.2+/-3.3	0,1,4297	no	stop-gained	OR1D2	NM_002548.2		0,1,6500	TT,TG,GG		0.0116,0.0,0.0077		102/313	2995985	1,13001	2203	4298	6501	SO:0001587	stop_gained	4991			U04678	CCDS11019.1	17p13.3	2012-08-09			ENSG00000184166	ENSG00000184166		"""GPCR / Class A : Olfactory receptors"""	8183	protein-coding gene	gene with protein product		164342		OLFR1		1370859, 1840504	Standard	NM_002548		Approved	OR17-4	uc010vrb.2	P34982	OTTHUMG00000090619	ENST00000331459.1:c.306C>A	17.37:g.2995985G>T	ENSP00000327585:p.Tyr102*	Somatic		WXS	Illumina HiSeq	Phase_I	Q6IFL8|Q96RA4|Q9UM78	Nonsense_Mutation	SNP	ENST00000331459.1	37	CCDS11019.1	.	.	.	.	.	.	.	.	.	.	g	19.37	3.814342	0.70912	0.0	1.16E-4	ENSG00000184166	ENST00000331459	.	.	.	3.0	0.841	0.18918	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.7208	0.17986	0.4933:0.0:0.5067:0.0	.	.	.	.	X	102	.	ENSP00000327585:Y102X	Y	-	3	2	OR1D2	2942735	0.000000	0.05858	0.997000	0.53966	0.992000	0.81027	-0.198000	0.09505	0.447000	0.26695	0.543000	0.68304	TAC		0.547	OR1D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207207.1		NM_002548	
PALLD	23022	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	169633073	169633073	+	Splice_Site	SNP	C	C	A			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr4:169633073C>A	ENST00000505667.1	+	10	2136	c.1963C>A	c.(1963-1965)Cta>Ata	p.L655I	PALLD_ENST00000512127.1_Splice_Site_p.L273I|PALLD_ENST00000335742.7_Splice_Site_p.L273M|PALLD_ENST00000261509.6_Splice_Site_p.L655I			Q8WX93	PALLD_HUMAN	palladin, cytoskeletal associated protein	655	Interaction with LASP1. {ECO:0000250}.|Pro-rich.				cytoskeleton organization (GO:0007010)	actin filament (GO:0005884)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	muscle alpha-actinin binding (GO:0051371)	p.L273M(1)|p.L655I(1)		breast(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(18)|ovary(3)|prostate(3)|skin(4)	48		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)		CAAACCAAAACTGTGAGTATT	0.408									Pancreatic Cancer, Familial Clustering of																												Esophageal Squamous(109;1482 1532 18347 40239 51172)												2	Substitution - Missense(2)	kidney(2)											54.0	59.0	57.0					4																	169633073		2203	4299	6502	SO:0001630	splice_region_variant	23022	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1	AB023209	CCDS34098.1, CCDS54818.1, CCDS54819.1, CCDS54820.1	4q32.3	2013-01-11			ENSG00000129116	ENSG00000129116		"""Immunoglobulin superfamily / I-set domain containing"""	17068	protein-coding gene	gene with protein product		608092				10231032, 10931874	Standard	NM_001166108		Approved	KIAA0992, SIH002, CGI-151	uc011cjx.2	Q8WX93	OTTHUMG00000161097	ENST00000505667.1:c.1964+1C>A	4.37:g.169633073C>A		Somatic		WXS	Illumina HiSeq	Phase_I	B3KTG2|B5MD56|B7ZMM5|Q7L3E0|Q7Z3W0|Q86WE8|Q8N1M2|Q9UGA0|Q9UQF5|Q9Y2J6|Q9Y3E9	Missense_Mutation	SNP	ENST00000505667.1	37	CCDS54818.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.14|18.14	3.558568|3.558568	0.65538|0.65538	.|.	.|.	ENSG00000129116|ENSG00000129116	ENST00000261509;ENST00000505667;ENST00000512127|ENST00000335742	T;T;T|T	0.67171|0.70516	-0.25;0.0;-0.19|-0.49	5.7|5.7	5.7|5.7	0.88788|0.88788	.|.	0.000000|0.000000	0.26492|0.26492	U|U	0.024071|0.024071	D|D	0.83138|0.83138	0.5189|0.5189	M|M	0.77313|0.77313	2.365|2.365	0.49915|0.49915	D|D	0.99983|0.99983	D;D;D|.	0.76494|.	0.999;0.993;0.999|.	D;D;D|.	0.76071|.	0.987;0.967;0.987|.	T|T	0.81731|0.81731	-0.0799|-0.0799	10|8	0.35671|0.40728	T|T	0.21|0.16	.|.	19.8321|19.8321	0.96640|0.96640	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	655;273;655|.	B7ZMM5;B3KTG2;B2RTX2|.	.;.;.|.	I|M	655;655;273|273	ENSP00000261509:L655I;ENSP00000425556:L655I;ENSP00000426947:L273I|ENSP00000336735:L273M	ENSP00000261509:L655I|ENSP00000336735:L273M	L|L	+|+	1|1	2|2	PALLD|PALLD	169869648|169869648	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.833000|0.833000	0.47200|0.47200	6.512000|6.512000	0.73737|0.73737	2.685000|2.685000	0.91497|0.91497	0.655000|0.655000	0.94253|0.94253	CTA|CTG		0.408	PALLD-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000363762.1		NM_016081	Missense_Mutation
PAN3	255967	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	28844883	28844883	+	Missense_Mutation	SNP	C	C	A			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr13:28844883C>A	ENST00000380958.3	+	13	1990	c.1838C>A	c.(1837-1839)cCa>cAa	p.P613Q	PAN3_ENST00000399613.1_Missense_Mutation_p.P413Q|PAN3_ENST00000282391.5_Missense_Mutation_p.P301Q	NM_175854.7	NP_787050.6			PAN3 poly(A) specific ribonuclease subunit									p.P413Q(1)|p.P613Q(1)		endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)	Colorectal(13;0.000334)	all cancers(112;0.0102)|Epithelial(112;0.0803)|GBM - Glioblastoma multiforme(144;0.121)|OV - Ovarian serous cystadenocarcinoma(117;0.13)|Lung(94;0.174)		GGATTATTGCCAGAATCTCTT	0.403																																																	2	Substitution - Missense(2)	kidney(2)											158.0	144.0	149.0					13																	28844883		2203	4300	6503	SO:0001583	missense	255967			AK091307	CCDS9329.1, CCDS9329.2	13q12.2	2014-03-27	2014-03-27		ENSG00000152520	ENSG00000152520			29991	protein-coding gene	gene with protein product			"""PAN3 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)"""			14583602	Standard	NM_175854		Approved		uc001urz.3	Q58A45	OTTHUMG00000016645	ENST00000380958.3:c.1838C>A	13.37:g.28844883C>A	ENSP00000370345:p.Pro613Gln	Somatic		WXS	Illumina HiSeq	Phase_I		Missense_Mutation	SNP	ENST00000380958.3	37	CCDS9329.2	.	.	.	.	.	.	.	.	.	.	C	27.7	4.856725	0.91433	.	.	ENSG00000152520	ENST00000380958;ENST00000399613;ENST00000282391	T;T;T	0.21543	2.0;2.0;2.0	5.42	5.42	0.78866	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.48519	0.1504	M	0.71036	2.16	0.80722	D	1	P;D;D;D	0.89917	0.845;1.0;1.0;1.0	P;D;D;D	0.91635	0.729;0.999;0.999;0.999	T	0.36237	-0.9756	10	0.46703	T	0.11	-11.4912	19.5822	0.95471	0.0:1.0:0.0:0.0	.	613;613;301;559	Q58A45-4;Q58A45;Q58A45-2;Q58A45-3	.;PAN3_HUMAN;.;.	Q	613;413;301	ENSP00000370345:P613Q;ENSP00000382522:P413Q;ENSP00000282391:P301Q	ENSP00000282391:P301Q	P	+	2	0	PAN3	27742883	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.776000	0.85560	2.704000	0.92352	0.563000	0.77884	CCA		0.403	PAN3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044318.4		NM_175854	
PCDHA5	56143	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	140203675	140203675	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr5:140203675G>T	ENST00000529859.1	+	1	2315	c.2315G>T	c.(2314-2316)aGt>aTt	p.S772I	PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529619.1_Missense_Mutation_p.S772I|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000378126.3_Missense_Mutation_p.S772I|PCDHA3_ENST00000522353.2_Intron	NM_018908.2	NP_061731.1	Q9Y5H7	PCDA5_HUMAN	protocadherin alpha 5	772					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.S772I(2)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(3)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATGGCCTTCAGTCCAAGCCTT	0.502																																																	2	Substitution - Missense(2)	kidney(2)											85.0	79.0	81.0					5																	140203675		2203	4300	6503	SO:0001583	missense	56143			AF152483	CCDS54917.1	5q31	2010-11-26				ENSG00000204965		"""Cadherins / Protocadherins : Clustered"""	8671	other	complex locus constituent	"""ortholog of mouse CNR6"", ""KIAA0345-like 9"""	606311		CNRS6		10380929, 10662547	Standard	NM_018908		Approved	CNR6, CRNR6, CNRN6, PCDH-ALPHA5		Q9Y5H7		ENST00000529859.1:c.2315G>T	5.37:g.140203675G>T	ENSP00000436557:p.Ser772Ile	Somatic		WXS	Illumina HiSeq	Phase_I	O75284|Q8N4R3	Missense_Mutation	SNP	ENST00000529859.1	37	CCDS54917.1	.	.	.	.	.	.	.	.	.	.	G	14.53	2.562664	0.45694	.	.	ENSG00000204965	ENST00000529619;ENST00000529859;ENST00000378126	T;T;T	0.20463	2.07;2.07;2.07	4.22	4.22	0.49857	.	.	.	.	.	T	0.52565	0.1742	M	0.89601	3.045	0.24939	N	0.991862	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.80764	0.973;0.991;0.994	T	0.48927	-0.8991	9	0.87932	D	0	.	12.231	0.54488	0.0:0.3138:0.6862:0.0	.	772;772;772	Q9Y5H7;Q9Y5H7-3;Q9Y5H7-2	PCDA5_HUMAN;.;.	I	772	ENSP00000433416:S772I;ENSP00000436557:S772I;ENSP00000367366:S772I	ENSP00000367366:S772I	S	+	2	0	PCDHA5	140183859	1.000000	0.71417	0.998000	0.56505	0.427000	0.31564	3.087000	0.50167	2.066000	0.61787	0.491000	0.48974	AGT		0.502	PCDHA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372883.2		NM_018908	
PHACTR1	221692	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	13206174	13206174	+	Silent	SNP	G	G	A			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr6:13206174G>A	ENST00000379350.1	+	7	921	c.792G>A	c.(790-792)caG>caA	p.Q264Q	PHACTR1_ENST00000457702.2_Silent_p.Q119Q|PHACTR1_ENST00000332995.7_Silent_p.Q264Q|PHACTR1_ENST00000379345.2_Intron			Q9C0D0	PHAR1_HUMAN	phosphatase and actin regulator 1	264					actin cytoskeleton reorganization (GO:0031532)|actomyosin structure organization (GO:0031032)|cell motility (GO:0048870)|stress fiber assembly (GO:0043149)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)|synapse (GO:0045202)	actin binding (GO:0003779)|protein phosphatase inhibitor activity (GO:0004864)	p.Q264Q(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	26	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)			ACACAGCCCAGAAGAGTGGCC	0.627																																																	1	Substitution - coding silent(1)	kidney(1)											52.0	62.0	59.0					6																	13206174		2087	4193	6280	SO:0001819	synonymous_variant	221692			AB051520	CCDS75401.1	6p23	2013-01-24	2004-05-20	2004-05-21	ENSG00000112137	ENSG00000112137		"""Phosphatase and actin regulators"""	20990	protein-coding gene	gene with protein product		608723	"""RPEL repeat containing 1"""	RPEL1		11214970, 15107502	Standard	NM_030948		Approved	KIAA1733, dJ257A7.2	uc010jpc.3	Q9C0D0	OTTHUMG00000014270	ENST00000379350.1:c.792G>A	6.37:g.13206174G>A		Somatic		WXS	Illumina HiSeq	Phase_I	A8K1V2|Q3MJ93|Q5JSJ2	Silent	SNP	ENST00000379350.1	37		.	.	.	.	.	.	.	.	.	.	G	7.556	0.663710	0.14710	.	.	ENSG00000112137	ENST00000415087	.	.	.	5.12	4.25	0.50352	.	.	.	.	.	T	0.57681	0.2070	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59161	-0.7506	4	.	.	.	-18.8855	13.0992	0.59210	0.0774:0.0:0.9226:0.0	.	.	.	.	K	99	.	.	R	+	2	0	PHACTR1	13314153	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.828000	0.55753	1.380000	0.46344	0.561000	0.74099	AGA		0.627	PHACTR1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039876.1		XM_166420	
JADE2	23338	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	133887864	133887864	+	Silent	SNP	T	T	C			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr5:133887864T>C	ENST00000402835.1	+	4	531	c.276T>C	c.(274-276)ccT>ccC	p.P92P	PHF15_ENST00000395003.1_Silent_p.P92P|PHF15_ENST00000361895.2_Silent_p.P92P|PHF15_ENST00000282605.4_Silent_p.P92P														p.P92P(1)		NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|prostate(1)|skin(1)	22			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TGCAGGTGCCTGCCGGGGCAG	0.637																																																	1	Substitution - coding silent(1)	kidney(1)											47.0	44.0	45.0					5																	133887864		2203	4300	6503	SO:0001819	synonymous_variant	23338																														ENST00000402835.1:c.276T>C	5.37:g.133887864T>C		Somatic		WXS	Illumina HiSeq	Phase_I		Silent	SNP	ENST00000402835.1	37																																																																																					0.637	PHF15-007	PUTATIVE	alternative_5_UTR|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000318543.1			
PITPNM2	57605	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	123481921	123481921	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr12:123481921G>T	ENST00000542749.1	-	9	1486	c.1423C>A	c.(1423-1425)Ctg>Atg	p.L475M	PITPNM2_ENST00000320201.4_Missense_Mutation_p.L475M|PITPNM2_ENST00000392428.1_Missense_Mutation_p.L196M|PITPNM2_ENST00000451868.2_5'Flank|PITPNM2_ENST00000280562.5_Missense_Mutation_p.L475M			Q9BZ72	PITM2_HUMAN	phosphatidylinositol transfer protein, membrane-associated 2	475					metabolic process (GO:0008152)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)	p.L475M(1)		NS(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	39	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)		CAGGGCACCAGGCGGATGGCA	0.652																																																	1	Substitution - Missense(1)	kidney(1)											80.0	78.0	79.0					12																	123481921		2203	4300	6503	SO:0001583	missense	57605			AF334585	CCDS9242.1, CCDS73543.1	12q24.31	2008-02-05				ENSG00000090975			21044	protein-coding gene	gene with protein product		608920				10022914	Standard	XM_005253582		Approved	RDGBA2, RDGB2, NIR3	uc001uej.1	Q9BZ72		ENST00000542749.1:c.1423C>A	12.37:g.123481921G>T	ENSP00000437611:p.Leu475Met	Somatic		WXS	Illumina HiSeq	Phase_I	Q9P271	Missense_Mutation	SNP	ENST00000542749.1	37	CCDS9242.1	.	.	.	.	.	.	.	.	.	.	G	14.64	2.595905	0.46318	.	.	ENSG00000090975	ENST00000280562;ENST00000320201;ENST00000392428;ENST00000542749	T;T;T;T	0.20332	2.08;2.08;2.08;2.08	4.83	4.83	0.62350	.	0.174710	0.37955	N	0.001870	T	0.26448	0.0646	L	0.55743	1.74	0.40762	D	0.983019	P;P	0.39903	0.694;0.5	B;B	0.40410	0.328;0.11	T	0.05435	-1.0885	10	0.40728	T	0.16	-17.8402	17.9593	0.89079	0.0:0.0:1.0:0.0	.	475;475	Q9BZ72-2;Q9BZ72	.;PITM2_HUMAN	M	475;475;196;475	ENSP00000280562:L475M;ENSP00000322218:L475M;ENSP00000376223:L196M;ENSP00000437611:L475M	ENSP00000280562:L475M	L	-	1	2	PITPNM2	122047874	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.062000	0.49971	2.235000	0.73313	0.563000	0.77884	CTG		0.652	PITPNM2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401342.1		NM_020845	
PKHD1L1	93035	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	110530496	110530496	+	Silent	SNP	T	T	A			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr8:110530496T>A	ENST00000378402.5	+	73	11894	c.11790T>A	c.(11788-11790)gtT>gtA	p.V3930V		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	3930					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.V3934V(1)		NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			CTATACCTGTTGAAATTCACA	0.373										HNSCC(38;0.096)																																							1	Substitution - coding silent(1)	kidney(1)											124.0	119.0	120.0					8																	110530496		1862	4090	5952	SO:0001819	synonymous_variant	93035			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.11790T>A	8.37:g.110530496T>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q567P2|Q9UF27	Silent	SNP	ENST00000378402.5	37	CCDS47911.1																																																																																				0.373	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1		NM_177531	
PLCD4	84812	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	219498885	219498885	+	Missense_Mutation	SNP	T	T	C			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr2:219498885T>C	ENST00000450993.2	+	12	2003	c.1664T>C	c.(1663-1665)cTg>cCg	p.L555P	PLCD4_ENST00000417849.1_Missense_Mutation_p.L555P|RP11-548H3.1_ENST00000607946.1_RNA|PLCD4_ENST00000432688.1_Missense_Mutation_p.L587P	NM_032726.3	NP_116115.1	Q9BRC7	PLCD4_HUMAN	phospholipase C, delta 4	555	PI-PLC Y-box. {ECO:0000255|PROSITE- ProRule:PRU00271}.				acrosome reaction (GO:0007340)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phosphatidylinositol metabolic process (GO:0046488)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)	p.L555P(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(3)|prostate(1)|urinary_tract(3)	23		Renal(207;0.0915)		Epithelial(149;5.11e-07)|all cancers(144;0.000104)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		CCCAGCGGCCTGAGGACAGAC	0.552																																																	1	Substitution - Missense(1)	kidney(1)											54.0	51.0	52.0					2																	219498885		1989	4169	6158	SO:0001583	missense	84812			AI366170	CCDS46516.1	2q35	2013-01-10			ENSG00000115556	ENSG00000115556	3.1.4.11	"""EF-hand domain containing"""	9062	protein-coding gene	gene with protein product		605939				10702683, 9056492	Standard	NM_032726		Approved		uc021vwx.1	Q9BRC7	OTTHUMG00000154743	ENST00000450993.2:c.1664T>C	2.37:g.219498885T>C	ENSP00000388631:p.Leu555Pro	Somatic		WXS	Illumina HiSeq	Phase_I	Q53FS8	Missense_Mutation	SNP	ENST00000450993.2	37	CCDS46516.1	.	.	.	.	.	.	.	.	.	.	T	17.68	3.449868	0.63290	.	.	ENSG00000115556	ENST00000450993;ENST00000251959;ENST00000417849;ENST00000432688	T;T;T	0.55234	0.53;0.53;0.53	5.43	5.43	0.79202	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific, Y domain (3);	0.146541	0.48767	D	0.000163	T	0.74989	0.3789	M	0.85041	2.73	0.58432	D	0.999999	D	0.76494	0.999	D	0.77557	0.99	T	0.78735	-0.2088	10	0.56958	D	0.05	.	15.3041	0.73979	0.0:0.0:0.0:1.0	.	555	Q9BRC7	PLCD4_HUMAN	P	555;555;555;587	ENSP00000388631:L555P;ENSP00000396942:L555P;ENSP00000396185:L587P	ENSP00000251959:L555P	L	+	2	0	PLCD4	219207129	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.206000	0.51098	2.279000	0.76181	0.533000	0.62120	CTG		0.552	PLCD4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336876.1			
PSMC6	5706	broad.mit.edu;hgsc.bcm.edu	37	14	53187597	53187597	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr14:53187597G>A	ENST00000606149.1	+	11	812	c.796G>A	c.(796-798)Gga>Aga	p.G266R	PSMC6_ENST00000445930.2_Missense_Mutation_p.G280R	NM_002806.3	NP_002797.3	P62333	PRS10_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 6	266					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|protein binding, bridging (GO:0030674)	p.G266R(1)|p.G280R(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)	19	Breast(41;0.176)					TCAAATGGATGGATTTGATAC	0.323																																																	2	Substitution - Missense(2)	kidney(2)											44.0	46.0	45.0					14																	53187597		2203	4300	6503	SO:0001583	missense	5706				CCDS9710.2	14q22.1	2010-04-21			ENSG00000100519	ENSG00000100519		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9553	protein-coding gene	gene with protein product		602708				8674546, 9473509	Standard	NM_002806		Approved	p42	uc010tqx.2	P62333	OTTHUMG00000152333	ENST00000606149.1:c.796G>A	14.37:g.53187597G>A	ENSP00000475721:p.Gly266Arg	Somatic		WXS	Illumina HiSeq	Phase_I	B2R975|P49719|Q6IBU3|Q92524	Missense_Mutation	SNP	ENST00000606149.1	37		.	.	.	.	.	.	.	.	.	.	G	29.4	5.000866	0.93227	.	.	ENSG00000100519	ENST00000445930	D	0.95518	-3.73	4.93	4.93	0.64822	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.97297	0.9116	M	0.70842	2.15	0.80722	D	1	D	0.71674	0.998	D	0.67382	0.951	D	0.98014	1.0367	10	0.87932	D	0	.	18.4944	0.90860	0.0:0.0:1.0:0.0	.	266	P62333	PRS10_HUMAN	R	280	ENSP00000401802:G280R	ENSP00000401802:G280R	G	+	1	0	PSMC6	52257347	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.434000	0.97515	2.420000	0.82092	0.585000	0.79938	GGA		0.323	PSMC6-018	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000470741.1		NM_002806	
PTPN11	5781	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	112891015	112891015	+	Missense_Mutation	SNP	C	C	T	rs398122859		TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr12:112891015C>T	ENST00000351677.2	+	4	547	c.349C>T	c.(349-351)Ctc>Ttc	p.L117F	PTPN11_ENST00000392597.1_Missense_Mutation_p.L117F	NM_002834.3	NP_002825.3	Q06124	PTN11_HUMAN	protein tyrosine phosphatase, non-receptor type 11	117	SH2 2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				abortive mitotic cell cycle (GO:0033277)|activation of MAPK activity (GO:0000187)|atrioventricular canal development (GO:0036302)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage checkpoint (GO:0000077)|ephrin receptor signaling pathway (GO:0048013)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|genitalia development (GO:0048806)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|hormone metabolic process (GO:0042445)|hormone-mediated signaling pathway (GO:0009755)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte migration (GO:0050900)|megakaryocyte development (GO:0035855)|multicellular organismal reproductive process (GO:0048609)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cortisol secretion (GO:0051463)|negative regulation of growth hormone secretion (GO:0060125)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ growth (GO:0035265)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet formation (GO:0030220)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of hormone secretion (GO:0046887)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of multicellular organism growth (GO:0040014)|regulation of protein export from nucleus (GO:0046825)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|T cell costimulation (GO:0031295)|triglyceride metabolic process (GO:0006641)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	insulin receptor binding (GO:0005158)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|SH3/SH2 adaptor activity (GO:0005070)	p.L117F(1)		NS(1)|autonomic_ganglia(2)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(406)|kidney(2)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(3)|stomach(3)	451						TCATGGACATCTCTCTGGGAA	0.358			Mis		"""JMML, AML, MDS"""		Noonan Syndrome		Noonan syndrome																															Dom	yes		12	12q24.1	5781	"""protein tyrosine phosphatase, non-receptor type 11"""	yes	L	1	Substitution - Missense(1)	kidney(1)											69.0	74.0	72.0					12																	112891015		2203	4300	6503	SO:0001583	missense	5781	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	D13540	CCDS9163.1, CCDS58280.1	12q24.1	2014-09-17	2008-07-31		ENSG00000179295	ENSG00000179295		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"", ""SH2 domain containing"""	9644	protein-coding gene	gene with protein product		176876	"""Noonan syndrome 1"""	NS1		7894486, 1280823	Standard	NM_080601		Approved	BPTP3, SH-PTP2, SHP-2, PTP2C, SHP2	uc001ttx.3	Q06124	OTTHUMG00000134334	ENST00000351677.2:c.349C>T	12.37:g.112891015C>T	ENSP00000340944:p.Leu117Phe	Somatic		WXS	Illumina HiSeq	Phase_I	A8K1D9|Q96HD7	Missense_Mutation	SNP	ENST00000351677.2	37	CCDS9163.1	.	.	.	.	.	.	.	.	.	.	C	19.69	3.875583	0.72180	.	.	ENSG00000179295	ENST00000392597;ENST00000351677;ENST00000392596	D;D	0.89875	-2.58;-2.58	5.55	4.65	0.58169	.	0.061309	0.64402	D	0.000005	D	0.95351	0.8491	M	0.92122	3.275	0.58432	D	0.999998	D;D	0.71674	0.998;0.985	D;D	0.72625	0.978;0.94	D	0.95978	0.8975	10	0.72032	D	0.01	.	13.5218	0.61572	0.0:0.9236:0.0:0.0764	.	117;117	Q06124-2;Q06124-3	.;.	F	117	ENSP00000376376:L117F;ENSP00000340944:L117F	ENSP00000340944:L117F	L	+	1	0	PTPN11	111375398	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.886000	0.56190	1.326000	0.45319	0.555000	0.69702	CTC		0.358	PTPN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259496.2			
SLC17A1	6568	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	25811911	25811911	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr6:25811911T>A	ENST00000244527.4	-	9	1100	c.985A>T	c.(985-987)Aat>Tat	p.N329Y	SLC17A1_ENST00000476801.1_Missense_Mutation_p.N329Y|SLC17A1_ENST00000468082.1_Missense_Mutation_p.N275Y|SLC17A1_ENST00000427328.1_Missense_Mutation_p.N275Y	NM_005074.3	NP_005065.2	Q14916	NPT1_HUMAN	solute carrier family 17 (organic anion transporter), member 1	329					ion transport (GO:0006811)|phosphate ion transport (GO:0006817)|sodium ion transport (GO:0006814)|sodium-dependent phosphate transport (GO:0044341)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|symporter activity (GO:0015293)	p.N329Y(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(14)|ovary(3)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	36						CTGAGAATATTCCTGGTCAGG	0.453																																																	1	Substitution - Missense(1)	kidney(1)											99.0	89.0	93.0					6																	25811911		2203	4300	6503	SO:0001583	missense	6568				CCDS4565.1	6p22.2	2013-07-18	2013-07-18		ENSG00000124568	ENSG00000124568		"""Solute carriers"""	10929	protein-coding gene	gene with protein product		182308	"""solute carrier family 17 (sodium phosphate), member 1"""	NPT1		8288239	Standard	NM_005074		Approved	NAPI-1	uc003nfh.4	Q14916	OTTHUMG00000016297	ENST00000244527.4:c.985A>T	6.37:g.25811911T>A	ENSP00000244527:p.Asn329Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	A8K418|O60761|Q13783|Q3MIP5|Q5MJP8|Q5TB83|Q96KL8	Missense_Mutation	SNP	ENST00000244527.4	37	CCDS4565.1	.	.	.	.	.	.	.	.	.	.	T	11.47	1.647131	0.29246	.	.	ENSG00000124568	ENST00000244527;ENST00000427328;ENST00000476801;ENST00000468082	T;T;T;T	0.59083	0.29;0.29;0.29;0.29	3.38	3.38	0.38709	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.429800	0.19703	N	0.107988	T	0.55705	0.1937	M	0.83483	2.645	0.25126	N	0.990602	D;D	0.76494	0.999;0.999	D;D	0.72075	0.959;0.976	T	0.54316	-0.8312	10	0.06365	T	0.9	.	8.4902	0.33095	0.0:0.0:0.0:1.0	.	275;329	Q14916-2;Q14916	.;NPT1_HUMAN	Y	329;275;329;275	ENSP00000244527:N329Y;ENSP00000410549:N275Y;ENSP00000420614:N329Y;ENSP00000420546:N275Y	ENSP00000244527:N329Y	N	-	1	0	SLC17A1	25919890	0.999000	0.42202	0.568000	0.28447	0.112000	0.19704	1.949000	0.40313	1.779000	0.52309	0.528000	0.53228	AAT		0.453	SLC17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043647.2			
SLC3A2	6520	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	62650443	62650443	+	Missense_Mutation	SNP	A	A	G			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr11:62650443A>G	ENST00000377890.2	+	6	1133	c.965A>G	c.(964-966)cAg>cGg	p.Q322R	SLC3A2_ENST00000535296.1_Missense_Mutation_p.Q291R|SLC3A2_ENST00000338663.7_Missense_Mutation_p.Q221R|SLC3A2_ENST00000538682.1_3'UTR|SLC3A2_ENST00000377891.2_Missense_Mutation_p.Q323R|SLC3A2_ENST00000377892.1_Missense_Mutation_p.Q353R|SLC3A2_ENST00000377889.2_Missense_Mutation_p.Q260R|SLC3A2_ENST00000536981.1_5'UTR	NM_002394.5	NP_002385.3	P08195	4F2_HUMAN	solute carrier family 3 (amino acid transporter heavy chain), member 2	322					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|carbohydrate metabolic process (GO:0005975)|cell growth (GO:0016049)|ion transport (GO:0006811)|leucine import (GO:0060356)|leukocyte migration (GO:0050900)|response to exogenous dsRNA (GO:0043330)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|tryptophan transport (GO:0015827)	cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium:sodium antiporter activity (GO:0005432)|catalytic activity (GO:0003824)|cation binding (GO:0043169)|double-stranded RNA binding (GO:0003725)|neutral amino acid transmembrane transporter activity (GO:0015175)|poly(A) RNA binding (GO:0044822)	p.Q353R(1)		endometrium(1)|kidney(3)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(2)	22						TTCTCCACTCAGGTTGACACT	0.547																																																	1	Substitution - Missense(1)	kidney(1)											147.0	117.0	127.0					11																	62650443		2201	4298	6499	SO:0001583	missense	6520				CCDS8039.2, CCDS31588.1, CCDS31589.1, CCDS31590.1	11q12-q22	2013-07-19	2013-07-19		ENSG00000168003	ENSG00000168003		"""Solute carriers"""	11026	protein-coding gene	gene with protein product	"""antigen identified by monoclonal antibodies 4F2, TRA1.10, TROP4, and T43"", ""antigen defined by monoclonal antibody 4F2"", ""heavy chain"", ""4F2 heavy chain"", ""CD98 heavy chain"", ""monoclonal antibody 44D7"", ""4F2 cell-surface antigen heavy chain"", ""lymphocyte activation antigen 4F2 large subunit"""	158070	"""solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2"""	MDU1		3036867	Standard	NM_001012662		Approved	4T2HC, 4F2, NACAE, CD98, CD98HC, 4F2HC	uc001nwd.3	P08195	OTTHUMG00000074091	ENST00000377890.2:c.965A>G	11.37:g.62650443A>G	ENSP00000367122:p.Gln322Arg	Somatic		WXS	Illumina HiSeq	Phase_I	Q13543	Missense_Mutation	SNP	ENST00000377890.2	37	CCDS8039.2	.	.	.	.	.	.	.	.	.	.	A	15.57	2.872936	0.51695	.	.	ENSG00000168003	ENST00000377892;ENST00000377891;ENST00000377890;ENST00000542007;ENST00000377889;ENST00000535296;ENST00000338663;ENST00000422606	D;D;D;D;D;D	0.98296	-4.85;-4.85;-4.85;-4.85;-4.83;-4.85	4.58	4.58	0.56647	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	1.897130	0.02113	N	0.054979	D	0.97179	0.9078	M	0.63428	1.95	0.09310	N	1	B;B;B;B;B	0.28470	0.159;0.003;0.017;0.007;0.213	B;B;B;B;B	0.28784	0.036;0.015;0.028;0.008;0.094	D	0.87653	0.2529	10	0.14252	T	0.57	-2.611	12.2242	0.54451	1.0:0.0:0.0:0.0	.	260;291;322;221;353	P08195-3;F5GZS6;P08195;P08195-2;P08195-4	.;.;4F2_HUMAN;.;.	R	353;323;322;323;260;291;221;203	ENSP00000367124:Q353R;ENSP00000367123:Q323R;ENSP00000367122:Q322R;ENSP00000367121:Q260R;ENSP00000444236:Q291R;ENSP00000340815:Q221R	ENSP00000340815:Q221R	Q	+	2	0	SLC3A2	62407019	0.020000	0.18652	0.007000	0.13788	0.515000	0.34225	2.014000	0.40951	1.849000	0.53698	0.459000	0.35465	CAG		0.547	SLC3A2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000157306.1		NM_001012661	
SLC44A4	80736	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	31833744	31833744	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr6:31833744G>T	ENST00000229729.6	-	14	1413	c.1393C>A	c.(1393-1395)Ctc>Atc	p.L465I	SLC44A4_ENST00000544672.1_Missense_Mutation_p.L389I|SLC44A4_ENST00000375562.4_Missense_Mutation_p.L423I	NM_025257.2	NP_079533.2	Q53GD3	CTL4_HUMAN	solute carrier family 44, member 4	465					acetylcholine biosynthetic process (GO:0008292)|acetylcholine secretion (GO:0061526)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of cell growth (GO:0030307)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.L465I(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(3)|skin(1)|urinary_tract(2)	35					Choline(DB00122)	GCTCCAGCGAGGACGCATTGG	0.562																																																	1	Substitution - Missense(1)	kidney(1)											67.0	66.0	66.0					6																	31833744		2203	4300	6503	SO:0001583	missense	80736			AF134726	CCDS4724.2, CCDS54989.1, CCDS54990.1	6p21.3	2014-02-17	2005-09-06	2005-09-06	ENSG00000204385	ENSG00000204385		"""Solute carriers"""	13941	protein-coding gene	gene with protein product		606107	"""chromosome 6 open reading frame 29"""	C6orf29		10677542, 15715662, 24379411	Standard	NM_025257		Approved	NG22, CTL4, FLJ14491, TPPT	uc010jti.3	Q53GD3	OTTHUMG00000031133	ENST00000229729.6:c.1393C>A	6.37:g.31833744G>T	ENSP00000229729:p.Leu465Ile	Somatic		WXS	Illumina HiSeq	Phase_I	A2BED3|B0UXX8|B0UZY8|B4DU94|B4DWM2|E9PEK7|Q5JP84|Q5JQ93|Q658S8|Q6UX89|Q8TEW4|Q96C58|Q96K59|Q9Y332	Missense_Mutation	SNP	ENST00000229729.6	37	CCDS4724.2	.	.	.	.	.	.	.	.	.	.	G	14.90	2.673715	0.47781	.	.	ENSG00000204385	ENST00000229729;ENST00000375562;ENST00000544672	T;T;T	0.19105	2.17;2.17;2.17	5.21	1.39	0.22231	.	0.077283	0.53938	D	0.000055	T	0.18299	0.0439	L	0.45470	1.425	0.53005	D	0.999964	D	0.65815	0.995	D	0.67382	0.951	T	0.03394	-1.1041	10	0.51188	T	0.08	-19.1868	5.5995	0.17345	0.2286:0.0:0.6326:0.1389	.	465	Q53GD3	CTL4_HUMAN	I	465;423;389	ENSP00000229729:L465I;ENSP00000364712:L423I;ENSP00000444109:L389I	ENSP00000229729:L465I	L	-	1	0	SLC44A4	31941723	1.000000	0.71417	0.993000	0.49108	0.759000	0.43091	2.200000	0.42724	0.066000	0.16515	0.655000	0.94253	CTC		0.562	SLC44A4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076234.3			
SPTBN1	6711	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	54891784	54891784	+	Missense_Mutation	SNP	T	T	A			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr2:54891784T>A	ENST00000356805.4	+	33	6896	c.6615T>A	c.(6613-6615)aaT>aaA	p.N2205K	AC093110.3_ENST00000456363.1_RNA	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1	2205	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)	p.N2205K(1)		NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			GCTTCCTCAATCGGAAACACG	0.562																																																	1	Substitution - Missense(1)	kidney(1)											58.0	60.0	59.0					2																	54891784		2203	4300	6503	SO:0001583	missense	6711				CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.6615T>A	2.37:g.54891784T>A	ENSP00000349259:p.Asn2205Lys	Somatic		WXS	Illumina HiSeq	Phase_I	B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Missense_Mutation	SNP	ENST00000356805.4	37	CCDS33198.1	.	.	.	.	.	.	.	.	.	.	T	10.86	1.469490	0.26423	.	.	ENSG00000115306	ENST00000356805	T	0.30714	1.52	5.84	-7.04	0.01578	Pleckstrin homology-type (1);Pleckstrin homology domain, spectrin-type (1);Pleckstrin homology domain (3);	0.149816	0.47852	D	0.000216	T	0.25344	0.0616	L	0.39514	1.22	0.80722	D	1	P;B	0.34462	0.454;0.001	B;B	0.37387	0.248;0.016	T	0.01520	-1.1334	10	0.29301	T	0.29	.	21.4112	0.99953	0.0:0.7119:0.0:0.2881	.	195;2205	B4DIF8;Q01082	.;SPTB2_HUMAN	K	2205	ENSP00000349259:N2205K	ENSP00000349259:N2205K	N	+	3	2	SPTBN1	54745288	0.006000	0.16342	0.881000	0.34555	0.990000	0.78478	-1.016000	0.03633	-1.266000	0.02446	0.482000	0.46254	AAT		0.562	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258115.3			
STX7	8417	broad.mit.edu;hgsc.bcm.edu	37	6	132785212	132785213	+	Splice_Site	DNP	TA	TA	AT			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	T|A	T|A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr6:132785212_132785213TA>AT	ENST00000367941.2	-	9	725_726	c.612_613TA>AT	c.(610-615)gaTAgc>gaATgc	p.204_205DS>EC	STX7_ENST00000367937.4_Splice_Site_p.204_205DS>EC	NM_003569.2	NP_003560.2	O15400	STX7_HUMAN	syntaxin 7	204	t-SNARE coiled-coil homology. {ECO:0000255|PROSITE-ProRule:PRU00202}.				intracellular protein transport (GO:0006886)|post-Golgi vesicle-mediated transport (GO:0006892)|synaptic vesicle exocytosis (GO:0016079)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)|SNARE binding (GO:0000149)	p.S205C(1)|p.D204_S205>EC(1)|p.D204E(1)		NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|liver(1)|lung(5)	19	Breast(56;0.0615)			OV - Ovarian serous cystadenocarcinoma(155;0.00532)|GBM - Glioblastoma multiforme(226;0.0114)		GCTTCTATGCTATCTGTAAAAT	0.366																																																	3	Substitution - Missense(2)|Complex - compound substitution(1)	kidney(3)																																								SO:0001630	splice_region_variant	8417			U77942	CCDS5153.1	6q23.1	2008-02-05			ENSG00000079950	ENSG00000079950			11442	protein-coding gene	gene with protein product		603217				9358037	Standard	NM_003569		Approved		uc003qdg.2	O15400	OTTHUMG00000015577	ENST00000367941.2:c.612_613delinsAT	6.37:g.132785212_132785213delinsAT		Somatic		WXS	Illumina HiSeq	Phase_I	E1P579|Q5SZW2|Q96ES9	Missense_Mutation	SNP	ENST00000367941.2	37	CCDS5153.1																																																																																				0.366	STX7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042252.2			Missense_Mutation
SUDS3	64426	hgsc.bcm.edu	37	12	118839609	118839609	+	Frame_Shift_Del	DEL	T	T	-			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr12:118839609delT	ENST00000543473.1	+	8	971	c.659delT	c.(658-660)ctgfs	p.L220fs	SUDS3_ENST00000397564.2_Frame_Shift_Del_p.L221fs	NM_022491.2	NP_071936.2	Q9H7L9	SDS3_HUMAN	suppressor of defective silencing 3 homolog (S. cerevisiae)	220	Sin3 interaction domain (SID). {ECO:0000250|UniProtKB:Q8BR65}.				apoptotic process (GO:0006915)|histone deacetylation (GO:0016575)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|substantia nigra development (GO:0021762)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Sin3 complex (GO:0016580)	enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)			breast(1)|lung(1)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					ATGGAGGATCTGAGAACATTA	0.333																																																	0													197.0	178.0	184.0					12																	118839609		1827	4083	5910	SO:0001589	frameshift_variant	64426			AK023801	CCDS44993.1	12q24.23	2006-02-13	2006-02-13		ENSG00000111707	ENSG00000111707			29545	protein-coding gene	gene with protein product	"""sin3A-associated protein, 45kDa"""	608250	"""suppressor of defective silencing 3 homolog (SDS3, S. cerevisiae)"""			11909966	Standard	NM_022491		Approved	SDS3, FLJ00052, SAP45	uc001twz.3	Q9H7L9	OTTHUMG00000168884	ENST00000543473.1:c.659delT	12.37:g.118839609delT	ENSP00000443988:p.Leu220fs	Somatic		WXS	Illumina HiSeq	Phase_I	Q4KMQ5|Q8N6H0|Q9H8D2	Frame_Shift_Del	DEL	ENST00000543473.1	37	CCDS44993.1																																																																																				0.333	SUDS3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401504.1		NM_022491	
TACR3	6870	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	104510994	104510994	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr4:104510994G>C	ENST00000304883.2	-	5	1383	c.1243C>G	c.(1243-1245)Ccc>Gcc	p.P415A	RP11-297P16.3_ENST00000512401.1_RNA|RP11-297P16.3_ENST00000502936.1_RNA	NM_001059.2	NP_001050.1	P29371	NK3R_HUMAN	tachykinin receptor 3	415					aging (GO:0007568)|hyperosmotic salinity response (GO:0042538)|positive regulation of blood pressure (GO:0045777)|positive regulation of heart rate (GO:0010460)|positive regulation of uterine smooth muscle contraction (GO:0070474)|regulation of dopamine metabolic process (GO:0042053)|regulation of feeding behavior (GO:0060259)|response to cocaine (GO:0042220)|response to estradiol (GO:0032355)|response to morphine (GO:0043278)|tachykinin receptor signaling pathway (GO:0007217)	cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	tachykinin receptor activity (GO:0004995)	p.P415A(1)		breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51		Hepatocellular(203;0.217)		UCEC - Uterine corpus endometrioid carcinoma (10;0.22)|OV - Ovarian serous cystadenocarcinoma(123;3.4e-08)		GCATCGTTGGGGTCAAACACG	0.512																																																	1	Substitution - Missense(1)	kidney(1)											266.0	243.0	251.0					4																	104510994		2203	4300	6503	SO:0001583	missense	6870			M89473	CCDS3664.1	4q25	2012-08-08			ENSG00000169836	ENSG00000169836		"""GPCR / Class A : Tachykinin receptors"""	11528	protein-coding gene	gene with protein product	"""neurokinin beta receptor"""	162332				1374246	Standard	NM_001059		Approved	NK3R	uc003hxe.1	P29371	OTTHUMG00000131124	ENST00000304883.2:c.1243C>G	4.37:g.104510994G>C	ENSP00000303325:p.Pro415Ala	Somatic		WXS	Illumina HiSeq	Phase_I	Q0P510	Missense_Mutation	SNP	ENST00000304883.2	37	CCDS3664.1	.	.	.	.	.	.	.	.	.	.	G	0.005	-2.180401	0.00308	.	.	ENSG00000169836	ENST00000304883	T	0.62788	0.0	5.54	0.817	0.18773	.	0.512209	0.20185	N	0.097431	T	0.37073	0.0990	L	0.33339	1.005	0.28564	N	0.910962	B	0.06786	0.001	B	0.09377	0.004	T	0.25433	-1.0132	10	0.02654	T	1	.	2.4919	0.04612	0.2773:0.109:0.4904:0.1233	.	415	P29371	NK3R_HUMAN	A	415	ENSP00000303325:P415A	ENSP00000303325:P415A	P	-	1	0	TACR3	104730443	0.997000	0.39634	0.019000	0.16419	0.000000	0.00434	1.023000	0.30065	0.050000	0.15949	-1.100000	0.02121	CCC		0.512	TACR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253804.1		NM_001059	
TIAF1	9220	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	27401024	27401024	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr17:27401024G>T	ENST00000359450.6	-	1	4851	c.194C>A	c.(193-195)cCc>cAc	p.P65H	MYO18A_ENST00000527372.1_3'UTR|MYO18A_ENST00000533112.1_3'UTR|MYO18A_ENST00000529578.1_5'UTR|MYO18A_ENST00000354329.4_3'UTR|MYO18A_ENST00000531253.1_3'UTR|TIAF1_ENST00000408971.2_Missense_Mutation_p.P65H	NM_004740.3	NP_004731.2	O95411	TIAF1_HUMAN	TGFB1-induced anti-apoptotic factor 1	65					apoptotic process (GO:0006915)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of apoptotic process (GO:0043066)	nucleus (GO:0005634)		p.P65H(1)		kidney(1)|lung(1)|urinary_tract(1)	3	Lung NSC(42;0.015)		Epithelial(11;1.19e-05)|all cancers(11;6.57e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000153)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			AGACAAAGAGGGTGGGGTGGG	0.582																																																	1	Substitution - Missense(1)	kidney(1)											102.0	84.0	90.0					17																	27401024		2203	4300	6503	SO:0001583	missense	9220			AF105277	CCDS32599.1	17q11.2	2006-08-07				ENSG00000221995			11803	protein-coding gene	gene with protein product		609517				9918798	Standard	NM_004740		Approved		uc002hdv.1	O95411		ENST00000359450.6:c.194C>A	17.37:g.27401024G>T	ENSP00000352424:p.Pro65His	Somatic		WXS	Illumina HiSeq	Phase_I	A2RRE2|Q6PEG2	Missense_Mutation	SNP	ENST00000359450.6	37	CCDS32599.1	.	.	.	.	.	.	.	.	.	.	G	0.545	-0.851827	0.02651	.	.	ENSG00000221995	ENST00000408971;ENST00000511177	.	.	.	3.77	-0.597	0.11653	.	.	.	.	.	T	0.24547	0.0595	N	0.08118	0	0.09310	N	1	D	0.71674	0.998	P	0.59889	0.865	T	0.14117	-1.0484	8	0.87932	D	0	.	4.612	0.12408	0.2922:0.1623:0.5455:0.0	.	65	O95411	TIAF1_HUMAN	H	65	.	ENSP00000386130:P65H	P	-	2	0	TIAF1	24425150	0.111000	0.22076	0.000000	0.03702	0.130000	0.20726	1.159000	0.31749	-0.039000	0.13602	0.655000	0.94253	CCC		0.582	TIAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372394.2		NM_004740	
TRIOBP	11078	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	22	38130449	38130449	+	Missense_Mutation	SNP	G	G	C			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr22:38130449G>C	ENST00000406386.3	+	9	4361	c.4106G>C	c.(4105-4107)aGc>aCc	p.S1369T		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	1369					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)	p.S1369T(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					ACCCGGCGGAGCCAAGCAGAG	0.657																																																	1	Substitution - Missense(1)	kidney(1)											31.0	36.0	34.0					22																	38130449		1947	4129	6076	SO:0001583	missense	11078			AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.4106G>C	22.37:g.38130449G>C	ENSP00000384312:p.Ser1369Thr	Somatic		WXS	Illumina HiSeq	Phase_I	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	ENST00000406386.3	37	CCDS43015.1	.	.	.	.	.	.	.	.	.	.	G	7.940	0.742479	0.15642	.	.	ENSG00000100106	ENST00000406386;ENST00000417174	T	0.23348	1.91	5.62	4.59	0.56863	.	.	.	.	.	T	0.13628	0.0330	N	0.14661	0.345	0.26340	N	0.977379	B	0.24721	0.11	B	0.17979	0.02	T	0.23619	-1.0183	9	0.19590	T	0.45	.	8.0864	0.30775	0.0838:0.1612:0.7549:0.0	.	1369	Q9H2D6	TARA_HUMAN	T	1369;1330	ENSP00000384312:S1369T	ENSP00000384312:S1369T	S	+	2	0	TRIOBP	36460395	0.940000	0.31905	0.585000	0.28666	0.175000	0.22909	3.824000	0.55723	1.356000	0.45884	0.563000	0.77884	AGC		0.657	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2			
TSPYL1	7259	hgsc.bcm.edu;ucsc.edu	37	6	116599803	116599804	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	TT	TT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr6:116599803_116599804delTT	ENST00000368608.3	-	1	1262_1263	c.1190_1191delAA	c.(1189-1191)aaafs	p.K397fs	DSE_ENST00000452085.3_5'Flank|DSE_ENST00000540275.1_Intron|RP1-93H18.1_ENST00000449314.1_lincRNA	NM_003309.3	NP_003300.1	Q9H0U9	TSYL1_HUMAN	TSPY-like 1	397					nucleosome assembly (GO:0006334)	nucleus (GO:0005634)	enzyme binding (GO:0019899)			breast(1)|endometrium(2)|large_intestine(2)|lung(2)|ovary(3)|urinary_tract(1)	11		all_cancers(87;0.0144)|all_epithelial(87;0.021)|Colorectal(196;0.234)		all cancers(137;0.0235)|OV - Ovarian serous cystadenocarcinoma(136;0.0469)|GBM - Glioblastoma multiforme(226;0.0503)|Epithelial(106;0.094)		ACAGATCCTCTTTAATAATCTC	0.515																																																	0																																										SO:0001589	frameshift_variant	7259			AF042181	CCDS34518.1	6q22.1	2014-09-17	2004-04-05	2004-04-07	ENSG00000189241	ENSG00000189241			12382	protein-coding gene	gene with protein product		604714	"""TSPY-like"""	TSPYL		9730615	Standard	NM_003309		Approved		uc003pwp.4	Q9H0U9	OTTHUMG00000015427	ENST00000368608.3:c.1190_1191delAA	6.37:g.116599803_116599804delTT	ENSP00000357597:p.Lys397fs	Somatic		WXS	Illumina HiSeq	Phase_I	O75885|Q5TFE6	Frame_Shift_Del	DEL	ENST00000368608.3	37	CCDS34518.1																																																																																				0.515	TSPYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041929.1			
TUBG1	7283	broad.mit.edu;hgsc.bcm.edu	37	17	40765980	40765980	+	Silent	SNP	C	C	T	rs145699955	byFrequency	TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr17:40765980C>T	ENST00000251413.3	+	8	869	c.807C>T	c.(805-807)ctC>ctT	p.L269L		NM_001070.4	NP_001061.2	P23258	TBG1_HUMAN	tubulin, gamma 1	269					cytoplasmic microtubule organization (GO:0031122)|G2/M transition of mitotic cell cycle (GO:0000086)|meiotic spindle organization (GO:0000212)|microtubule cytoskeleton organization (GO:0000226)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	apical part of cell (GO:0045177)|cell leading edge (GO:0031252)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|gamma-tubulin complex (GO:0000930)|nonmotile primary cilium (GO:0031513)|pericentriolar material (GO:0000242)|polar microtubule (GO:0005827)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.L269L(1)		endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)	12		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.129)	Vinblastine(DB00570)	TCCACTTCCTCATGACCGGCT	0.632																																					Colon(20;114 698 11420 22864)												1	Substitution - coding silent(1)	kidney(1)						C		0,4406		0,0,2203	213.0	177.0	189.0		807	3.6	1.0	17	dbSNP_134	189	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	TUBG1	NM_001070.4		0,2,6501	TT,TC,CC		0.0233,0.0,0.0154		269/452	40765980	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	7283			BC000619	CCDS11433.1	17q21.31	2010-03-15	2000-01-20		ENSG00000131462	ENSG00000131462		"""Tubulins"""	12417	protein-coding gene	gene with protein product		191135	"""tubulin, gamma polypeptide"""	TUBG		1904010	Standard	NM_001070		Approved	TUBGCP1	uc002ian.3	P23258		ENST00000251413.3:c.807C>T	17.37:g.40765980C>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q53X79|Q9BW59	Silent	SNP	ENST00000251413.3	37	CCDS11433.1																																																																																				0.632	TUBG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450548.1		NM_001070	
TYK2	7297	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	10468695	10468695	+	Silent	SNP	G	G	A			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr19:10468695G>A	ENST00000525621.1	-	16	2776	c.2295C>T	c.(2293-2295)ggC>ggT	p.G765G	TYK2_ENST00000524462.1_Silent_p.G580G|TYK2_ENST00000529370.1_Silent_p.G765G|TYK2_ENST00000264818.6_Silent_p.G765G	NM_003331.4	NP_003322.3	P29597	TYK2_HUMAN	tyrosine kinase 2	765	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokine-mediated signaling pathway (GO:0019221)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)	p.G765G(1)		breast(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(11)|kidney(6)|large_intestine(3)|lung(19)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64			OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)			TGGAGAGGGCGCCCAGGCCCA	0.652																																																	1	Substitution - coding silent(1)	kidney(1)											29.0	28.0	29.0					19																	10468695		2203	4300	6503	SO:0001819	synonymous_variant	7297				CCDS12236.1	19p13.2	2014-09-17			ENSG00000105397	ENSG00000105397	2.7.10.1		12440	protein-coding gene	gene with protein product		176941				2156206	Standard	NM_003331		Approved	JTK1	uc002moc.4	P29597	OTTHUMG00000166373	ENST00000525621.1:c.2295C>T	19.37:g.10468695G>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q6QB10|Q96CH0	Silent	SNP	ENST00000525621.1	37	CCDS12236.1																																																																																				0.652	TYK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389443.1			
UCHL3	7347	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	76140954	76140954	+	Missense_Mutation	SNP	G	G	A			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr13:76140954G>A	ENST00000377595.3	+	4	337	c.307G>A	c.(307-309)Gct>Act	p.A103T	RP11-29G8.3_ENST00000563635.1_RNA	NM_001270952.1|NM_006002.4	NP_001257881.1|NP_005993.1	P15374	UCHL3_HUMAN	ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase)	103					protein catabolic process (GO:0030163)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	peptidase activity (GO:0008233)|ubiquitin binding (GO:0043130)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.A103T(1)		kidney(1)|large_intestine(2)|lung(3)|skin(1)	7				GBM - Glioblastoma multiforme(99;0.0125)		ACTGATTCATGCTATTGCAAA	0.343																																																	1	Substitution - Missense(1)	kidney(1)											131.0	125.0	127.0					13																	76140954		2203	4300	6503	SO:0001583	missense	7347			M30496	CCDS9453.1, CCDS73586.1	13q21.33	2008-02-05			ENSG00000118939	ENSG00000118939	3.2.1.15		12515	protein-coding gene	gene with protein product		603090				2530630	Standard	NM_001270952		Approved		uc001vjq.4	P15374	OTTHUMG00000017090	ENST00000377595.3:c.307G>A	13.37:g.76140954G>A	ENSP00000366819:p.Ala103Thr	Somatic		WXS	Illumina HiSeq	Phase_I	B2R970|Q5TBK8|Q6IBE9	Missense_Mutation	SNP	ENST00000377595.3	37	CCDS9453.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.021412	0.75275	.	.	ENSG00000118939	ENST00000377595;ENST00000377589;ENST00000419068	T;T	0.57436	0.4;0.4	5.91	5.91	0.95273	Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (5);	0.047481	0.85682	D	0.000000	T	0.63129	0.2485	M	0.87381	2.88	0.80722	D	1	P	0.35208	0.49	B	0.39840	0.311	T	0.67929	-0.5543	10	0.66056	D	0.02	-4.1301	13.4829	0.61348	0.0708:0.0:0.9291:0.0	.	103	P15374	UCHL3_HUMAN	T	103;60;37	ENSP00000366819:A103T;ENSP00000398189:A37T	ENSP00000366813:A60T	A	+	1	0	UCHL3	75038955	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.690000	0.84178	2.793000	0.96121	0.655000	0.94253	GCT		0.343	UCHL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045292.2		NM_006002	
UGT1A1	54658	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	234526875	234526875	+	Nonsense_Mutation	SNP	C	C	A			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr2:234526875C>A	ENST00000373450.4	+	1	585	c.522C>A	c.(520-522)tgC>tgA	p.C174*		NM_019076.4	NP_061949.3	P22309	UD11_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A1	177					acute-phase response (GO:0006953)|bilirubin conjugation (GO:0006789)|biphenyl catabolic process (GO:0070980)|cellular glucuronidation (GO:0052695)|cellular response to ethanol (GO:0071361)|cellular response to glucocorticoid stimulus (GO:0071385)|digestion (GO:0007586)|drug metabolic process (GO:0017144)|estrogen metabolic process (GO:0008210)|flavone metabolic process (GO:0051552)|flavonoid glucuronidation (GO:0052696)|heme catabolic process (GO:0042167)|heterocycle metabolic process (GO:0046483)|liver development (GO:0001889)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cellular glucuronidation (GO:2001030)|negative regulation of steroid metabolic process (GO:0045939)|organ regeneration (GO:0031100)|porphyrin-containing compound metabolic process (GO:0006778)|response to drug (GO:0042493)|response to lipopolysaccharide (GO:0032496)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|retinoic acid metabolic process (GO:0042573)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic glucuronidation (GO:0052697)|xenobiotic metabolic process (GO:0006805)	cytochrome complex (GO:0070069)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)|steroid binding (GO:0005496)	p.C174*(1)		breast(1)|central_nervous_system(2)|endometrium(7)|large_intestine(5)|lung(9)|skin(4)|urinary_tract(2)	30		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0461)|Lung SC(224;0.128)		Epithelial(121;4.1e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000435)|Lung(119;0.00211)|LUSC - Lung squamous cell carcinoma(224;0.0054)	Abacavir(DB01048)|Acetaminophen(DB00316)|Adenine(DB00173)|Atorvastatin(DB01076)|Axitinib(DB06626)|Diclofenac(DB00586)|Dolutegravir(DB08930)|Eltrombopag(DB06210)|Erlotinib(DB00530)|Estradiol(DB00783)|Etoposide(DB00773)|Ezetimibe(DB00973)|Ezogabine(DB04953)|Flunitrazepam(DB01544)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Ibuprofen(DB01050)|Indacaterol(DB05039)|Indomethacin(DB00328)|Irinotecan(DB00762)|Losartan(DB00678)|Lovastatin(DB00227)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Naltrexone(DB00704)|Naproxen(DB00788)|Nilotinib(DB04868)|Pazopanib(DB06589)|Propofol(DB00818)|Raltegravir(DB06817)|Regorafenib(DB08896)|Rifampicin(DB01045)|Simvastatin(DB00641)|Sorafenib(DB00398)|Suprofen(DB00870)|Testosterone Propionate(DB01420)	GAATAGCTTGCCACTATCTTG	0.478																																																	1	Substitution - Nonsense(1)	kidney(1)											178.0	179.0	179.0					2																	234526875		2203	4300	6503	SO:0001587	stop_gained	54576			M57899	CCDS2510.1	2q37.1	2014-09-17	2005-07-20		ENSG00000242366	ENSG00000242366	2.4.1.17	"""UDP glucuronosyltransferases"""	12530	other	complex locus constituent		191740	"""UDP glycosyltransferase 1 family, polypeptide A1"""	UGT1, GNT1		9295054, 9535849	Standard	NM_000463		Approved	UGT1A		P22309	OTTHUMG00000059117	ENST00000373450.4:c.522C>A	2.37:g.234526875C>A	ENSP00000362549:p.Cys174*	Somatic		WXS	Illumina HiSeq	Phase_I	A6NJC3|B8K286	Nonsense_Mutation	SNP	ENST00000373450.4	37	CCDS33402.1	.	.	.	.	.	.	.	.	.	.	C	14.35	2.509213	0.44660	.	.	ENSG00000242366	ENST00000373450	.	.	.	3.96	-1.13	0.09775	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18710	T	0.47	.	10.0827	0.42399	0.0:0.5035:0.0:0.4965	.	.	.	.	X	174	.	ENSP00000362549:C174X	C	+	3	2	UGT1A8	234191614	0.000000	0.05858	0.010000	0.14722	0.013000	0.08279	-1.548000	0.02184	-0.161000	0.10983	-0.424000	0.05967	TGC		0.478	UGT1A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000130994.1			
UTRN	7402	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	144812074	144812074	+	Missense_Mutation	SNP	C	C	G			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr6:144812074C>G	ENST00000367545.3	+	31	4273	c.4273C>G	c.(4273-4275)Cga>Gga	p.R1425G		NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	1425	Interaction with SYNM.				aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.R1425G(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		GAGGAAACTCCGAGAGGTGTC	0.443																																																	1	Substitution - Missense(1)	kidney(1)											46.0	47.0	47.0					6																	144812074		2203	4299	6502	SO:0001583	missense	7402			AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.4273C>G	6.37:g.144812074C>G	ENSP00000356515:p.Arg1425Gly	Somatic		WXS	Illumina HiSeq	Phase_I	Q5SYY1|Q5SZ57|Q9UJ40	Missense_Mutation	SNP	ENST00000367545.3	37	CCDS34547.1	.	.	.	.	.	.	.	.	.	.	C	19.68	3.872069	0.72180	.	.	ENSG00000152818	ENST00000367545	T	0.21191	2.02	5.67	5.67	0.87782	.	0.000000	0.44902	D	0.000415	T	0.34454	0.0898	L	0.57536	1.79	0.39245	D	0.963933	D	0.89917	1.0	D	0.85130	0.997	T	0.00899	-1.1522	10	0.21014	T	0.42	.	20.1421	0.98061	0.0:1.0:0.0:0.0	.	1425	P46939	UTRO_HUMAN	G	1425	ENSP00000356515:R1425G	ENSP00000356515:R1425G	R	+	1	2	UTRN	144853767	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.627000	0.61276	2.836000	0.97738	0.655000	0.94253	CGA		0.443	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042551.1			
VHL	7428	broad.mit.edu;hgsc.bcm.edu	37	3	10183867	10183867	+	Nonsense_Mutation	SNP	C	C	A			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454;Illumina Miseq;PacBio			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr3:10183867C>A	ENST00000256474.2	+	1	1176	c.336C>A	c.(334-336)taC>taA	p.Y112*	VHL_ENST00000345392.2_Nonsense_Mutation_p.Y112*|snoU13_ENST00000458986.1_RNA	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	112	Involved in binding to CCT complex.		Y -> H (in VHLD; type IIA).|Y -> N (in VHLD). {ECO:0000269|PubMed:10533030}.		cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.Y112*(2)|p.Y112fs*1(2)|p.?(1)|p.I109_R113del(1)|p.S111fs*45(1)|p.R113fs*46(1)|p.S111_Y112del(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		TCCACAGCTACCGAGGTACGG	0.697		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																														yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	9	Deletion - Frameshift(4)|Substitution - Nonsense(2)|Deletion - In frame(2)|Unknown(1)	kidney(9)	GRCh37	CM951282	VHL	M							10.0	11.0	11.0					3																	10183867		1837	3816	5653	SO:0001587	stop_gained	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.336C>A	3.37:g.10183867C>A	ENSP00000256474:p.Tyr112*	Somatic		WXS	Illumina HiSeq	Phase_I	B2RE45|Q13599|Q6PDA9	Nonsense_Mutation	SNP	ENST00000256474.2	37	CCDS2597.1	.	.	.	.	.	.	.	.	.	.	C	37	6.280702	0.97440	.	.	ENSG00000134086	ENST00000256474;ENST00000345392;ENST00000450183	.	.	.	5.17	5.17	0.71159	.	0.122627	0.56097	D	0.000026	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.3851	16.2596	0.82533	0.0:1.0:0.0:0.0	.	.	.	.	X	112;112;30	.	ENSP00000256474:Y112X	Y	+	3	2	VHL	10158867	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	3.307000	0.51888	2.425000	0.82216	0.479000	0.44913	TAC		0.697	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	
WFDC5	149708	broad.mit.edu;hgsc.bcm.edu	37	20	43739049	43739049	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr20:43739049G>T	ENST00000307971.4	-	3	437	c.359C>A	c.(358-360)cCt>cAt	p.P120H	WFDC5_ENST00000372789.4_Missense_Mutation_p.P120H			Q8TCV5	WFDC5_HUMAN	WAP four-disulfide core domain 5	120	WAP 2. {ECO:0000255|PROSITE- ProRule:PRU00722}.					extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.P120H(1)		kidney(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	5		Myeloproliferative disorder(115;0.0122)				ACCTCTGGCAGGATCCCGGCA	0.612																																					NSCLC(199;98 2227 9943 13455 41914)												1	Substitution - Missense(1)	kidney(1)											15.0	17.0	17.0					20																	43739049		2203	4299	6502	SO:0001583	missense	149708			AY038181	CCDS33475.1	20q13.11	2013-01-21			ENSG00000175121	ENSG00000175121		"""WAP four-disulfide core domain containing"""	20477	protein-coding gene	gene with protein product		605161				12206714, 10680116	Standard	NM_145652		Approved	WAP1, dJ211D12.5	uc002xne.2	Q8TCV5	OTTHUMG00000046411	ENST00000307971.4:c.359C>A	20.37:g.43739049G>T	ENSP00000312381:p.Pro120His	Somatic		WXS	Illumina HiSeq	Phase_I	Q5H981|Q6UWE4	Missense_Mutation	SNP	ENST00000307971.4	37		.	.	.	.	.	.	.	.	.	.	G	19.28	3.796760	0.70567	.	.	ENSG00000175121	ENST00000372789;ENST00000307971	T;T	0.49720	0.77;0.77	5.07	5.07	0.68467	Whey acidic protein, 4-disulphide core (5);4-disulphide core (1);	0.000000	0.53938	D	0.000053	T	0.79106	0.4390	H	0.97265	3.97	0.22562	N	0.998982	D	0.89917	1.0	D	0.97110	1.0	T	0.76642	-0.2884	10	0.87932	D	0	-30.388	13.962	0.64185	0.0:0.0:1.0:0.0	.	120	Q8TCV5	WFDC5_HUMAN	H	120	ENSP00000361875:P120H;ENSP00000312381:P120H	ENSP00000312381:P120H	P	-	2	0	WFDC5	43172463	0.997000	0.39634	0.127000	0.21898	0.262000	0.26303	4.674000	0.61612	2.363000	0.80096	0.462000	0.41574	CCT		0.612	WFDC5-002	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000107192.1			
XIRP1	165904	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	39225988	39225989	+	Missense_Mutation	DNP	GA	GA	AT			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	G|A	G|A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr3:39225988_39225989GA>AT	ENST00000340369.3	-	2	5176_5177	c.4948_4949TC>AT	c.(4948-4950)TCa>ATa	p.S1650I	XIRP1_ENST00000396251.1_3'UTR|XIRP1_ENST00000421646.1_Missense_Mutation_p.S333I	NM_194293.2	NP_919269.2	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	1650					cardiac muscle cell development (GO:0055013)|negative regulation of cell proliferation (GO:0008285)|regulation of membrane potential (GO:0042391)|sarcomere organization (GO:0045214)	fascia adherens (GO:0005916)	poly(A) RNA binding (GO:0044822)	p.S1650L(1)|p.S1650I(1)|p.S1650T(1)		breast(4)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(14)|lung(22)|ovary(4)|pancreas(1)|prostate(2)|skin(6)	71				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		ATACTCTCTTGATGTCTCCTGC	0.54																																																	3	Substitution - Missense(3)	kidney(3)																																								SO:0001583	missense	165904			AW755250	CCDS2683.1, CCDS56245.1	3p21.33	2008-02-05	2007-06-27	2007-06-27	ENSG00000168334	ENSG00000168334			14301	protein-coding gene	gene with protein product		609777	"""cardiomyopathy associated 1"""	CMYA1		12203715, 15454575	Standard	NM_001198621		Approved	DKFZp451D042, Xin	uc003cjk.2	Q702N8	OTTHUMG00000131297	ENST00000340369.3:c.4948_4949delinsAT	3.37:g.39225988_39225989delinsAT	ENSP00000343140:p.Ser1650Ile	Somatic		WXS	Illumina HiSeq	Phase_I	A0JP25|A4QPE2|Q68DF2|Q6ZTR3|Q702N9|Q8IVN7|Q8N1N3|Q8N904|Q8TCG7	Missense_Mutation	SNP	ENST00000340369.3	37	CCDS2683.1																																																																																				0.540	XIRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254065.1		XM_093522	
YAP1	10413	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	102100588	102100588	+	Silent	SNP	T	T	C			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr11:102100588T>C	ENST00000282441.5	+	9	1820	c.1432T>C	c.(1432-1434)Ttg>Ctg	p.L478L	YAP1_ENST00000345877.2_Silent_p.L428L|YAP1_ENST00000537274.1_Silent_p.L466L|YAP1_ENST00000526343.1_Silent_p.L424L|YAP1_ENST00000528834.1_3'UTR|RP11-864G5.3_ENST00000526310.1_RNA|YAP1_ENST00000524575.1_Silent_p.L300L|YAP1_ENST00000531439.1_Silent_p.L462L	NM_001130145.2|NM_001282101.1	NP_001123617.1|NP_001269030.1	P46937	YAP1_HUMAN	Yes-associated protein 1	478	Transactivation domain.				cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|contact inhibition (GO:0060242)|embryonic heart tube morphogenesis (GO:0003143)|gene expression (GO:0010467)|hippo signaling (GO:0035329)|keratinocyte differentiation (GO:0030216)|lateral mesoderm development (GO:0048368)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|notochord development (GO:0030903)|paraxial mesoderm development (GO:0048339)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|positive regulation of organ growth (GO:0046622)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of keratinocyte proliferation (GO:0010837)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|regulation of stem cell proliferation (GO:0072091)|somatic stem cell maintenance (GO:0035019)|transcription initiation from RNA polymerase II promoter (GO:0006367)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)	p.L478L(1)		central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)	4	all_cancers(8;0.000575)|all_epithelial(12;0.00564)	Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.00936)	Lung(13;0.245)	BRCA - Breast invasive adenocarcinoma(274;0.0189)		GCAGGAAGCTTTGAGTTCTGA	0.468																																					Colon(50;247 1103 7861 28956)												1	Substitution - coding silent(1)	kidney(1)											130.0	129.0	129.0					11																	102100588		2203	4299	6502	SO:0001819	synonymous_variant	10413				CCDS8314.1, CCDS44716.1, CCDS8314.2, CCDS53699.1, CCDS53700.1, CCDS60944.1, CCDS73373.1, CCDS73374.1	11q13	2010-03-19	2010-03-19		ENSG00000137693	ENSG00000137693			16262	protein-coding gene	gene with protein product		606608	"""Yes-associated protein 1, 65kDa"""			7782338	Standard	NM_001130145		Approved	YAP65	uc001pgt.3	P46937	OTTHUMG00000167322	ENST00000282441.5:c.1432T>C	11.37:g.102100588T>C		Somatic		WXS	Illumina HiSeq	Phase_I	B4DTY1|B7ZA01|E3WEB5|E3WEB6|E9PRV2|F5H202|K0KQ18|K0KYZ8|K0L195|K0L1G3|Q7Z574|Q8IUY9	Silent	SNP	ENST00000282441.5	37	CCDS44716.1																																																																																				0.468	YAP1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000394151.1		NM_006106	
ZBTB44	29068	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	130131043	130131043	+	Silent	SNP	A	A	T			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr11:130131043A>T	ENST00000357899.4	-	2	998	c.726T>A	c.(724-726)ccT>ccA	p.P242P	ZBTB44_ENST00000397753.1_Silent_p.P242P|ZBTB44_ENST00000525842.1_Silent_p.P242P|ZBTB44_ENST00000530205.1_Silent_p.P242P			Q8NCP5	ZBT44_HUMAN	zinc finger and BTB domain containing 44	242					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P242P(1)		autonomic_ganglia(1)|breast(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)	15	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0192)|Lung(977;0.235)		TAACTTTCTCAGGCTGAATCC	0.418																																																	1	Substitution - coding silent(1)	kidney(1)											63.0	58.0	59.0					11																	130131043		1839	4078	5917	SO:0001819	synonymous_variant	29068			AK024659	CCDS44776.1, CCDS73414.1, CCDS73415.1	11q24.3	2013-01-08	2006-09-19	2006-09-19		ENSG00000196323		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	25001	protein-coding gene	gene with protein product			"""BTB (POZ) domain containing 15"""	BTBD15		11042152	Standard	NM_014155		Approved	HSPC063, ZNF851	uc001qgb.4	Q8NCP5		ENST00000357899.4:c.726T>A	11.37:g.130131043A>T		Somatic		WXS	Illumina HiSeq	Phase_I	Q6IPT8|Q86VJ7|Q86XX5	Silent	SNP	ENST00000357899.4	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	7.394|7.394	0.631461|0.631461	0.14322|0.14322	.|.	.|.	ENSG00000196323|ENSG00000196323	ENST00000529982|ENST00000527478	.|.	.|.	.|.	5.58|5.58	1.77|1.77	0.24775|0.24775	.|.	.|.	.|.	.|.	.|.	T|.	0.54902|.	0.1887|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.49418|.	-0.8942|.	4|.	.|.	.|.	.|.	.|.	7.2665|7.2665	0.26232|0.26232	0.6346:0.1979:0.0:0.1675|0.6346:0.1979:0.0:0.1675	.|.	.|.	.|.	.|.	Q|R	96|239	.|.	.|.	L|X	-|-	2|1	0|0	ZBTB44|ZBTB44	129636253|129636253	0.973000|0.973000	0.33851|0.33851	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	0.163000|0.163000	0.16520|0.16520	0.909000|0.909000	0.36697|0.36697	0.460000|0.460000	0.39030|0.39030	CTG|TGA		0.418	ZBTB44-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000386126.1		NM_014155	
ZCCHC6	79670	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	88960584	88960584	+	Splice_Site	SNP	C	C	A			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr9:88960584C>A	ENST00000375963.3	-	4	991	c.819G>T	c.(817-819)aaG>aaT	p.K273N	ZCCHC6_ENST00000277141.6_De_novo_Start_InFrame|ZCCHC6_ENST00000375961.2_Splice_Site_p.K273N|ZCCHC6_ENST00000375948.1_5'Flank|ZCCHC6_ENST00000375960.2_Splice_Site_p.K273N|ZCCHC6_ENST00000375947.1_Splice_Site_p.K106N	NM_001185059.1|NM_024617.3	NP_001171988.1|NP_078893.2	Q5VYS8	TUT7_HUMAN	zinc finger, CCHC domain containing 6	273					RNA 3'-end processing (GO:0031123)		poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)	p.K273N(1)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	46						TTCAATTTACCTTAATGTTTT	0.353																																																	1	Substitution - Missense(1)	kidney(1)											224.0	191.0	202.0					9																	88960584		2203	4300	6503	SO:0001630	splice_region_variant	79670			AL832026	CCDS35057.1, CCDS55323.1	9q21	2014-03-05			ENSG00000083223	ENSG00000083223		"""Zinc fingers, CCHC domain containing"""	25817	protein-coding gene	gene with protein product	"""TUTase7"""					11214970	Standard	NM_001185059		Approved	KIAA1711, FLJ13409, PAPD6, TUT7	uc004aoq.3	Q5VYS8	OTTHUMG00000020137	ENST00000375963.3:c.819+1G>T	9.37:g.88960584C>A		Somatic		WXS	Illumina HiSeq	Phase_I	Q5H9T0|Q5VYS5|Q5VYS7|Q658Z9|Q659A2|Q6MZJ3|Q8N5F0|Q96N57|Q96NE8|Q9C0F2|Q9H8M6	Missense_Mutation	SNP	ENST00000375963.3	37	CCDS35057.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.224948	0.79576	.	.	ENSG00000083223	ENST00000375960;ENST00000375961;ENST00000375963;ENST00000427388;ENST00000375947	D;D;D;T	0.83506	-1.73;-1.73;-1.73;1.19	5.49	5.49	0.81192	.	0.067226	0.64402	D	0.000002	D	0.90038	0.6889	M	0.61703	1.905	0.53005	D	0.999968	D;D;D;D	0.89917	1.0;1.0;0.999;0.998	D;D;D;P	0.78314	0.991;0.987;0.961;0.852	D	0.88894	0.3348	9	.	.	.	-17.1358	19.3708	0.94484	0.0:1.0:0.0:0.0	.	273;273;273;273	Q5VYS8-5;Q5VYS8-2;Q5VYS8-4;Q5VYS8	.;.;.;TUT7_HUMAN	N	273;273;273;106;106	ENSP00000365127:K273N;ENSP00000365128:K273N;ENSP00000365130:K273N;ENSP00000365114:K106N	.	K	-	3	2	ZCCHC6	88150404	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	5.352000	0.66028	2.571000	0.86741	0.467000	0.42956	AAG		0.353	ZCCHC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052918.1		NM_024617	Missense_Mutation
ZNF879	345462	broad.mit.edu;ucsc.edu	37	5	178454496	178454496	+	Missense_Mutation	SNP	T	T	G			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr5:178454496T>G	ENST00000444149.2	+	3	244	c.56T>G	c.(55-57)gTg>gGg	p.V19G	ZNF879_ENST00000519896.1_Missense_Mutation_p.C30W	NM_001136116.1	NP_001129588.1	B4DU55	ZN879_HUMAN	zinc finger protein 879	19	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V19G(1)		endometrium(3)|kidney(2)|pancreas(1)|stomach(1)	7						TTCAGGGATGTGGCCGTGTTC	0.562																																																	1	Substitution - Missense(1)	kidney(1)											189.0	165.0	172.0					5																	178454496		692	1591	2283	SO:0001583	missense	345462			AK300504	CCDS47352.1	5q35.3	2013-01-08			ENSG00000234284	ENSG00000234284		"""Zinc fingers, C2H2-type"", ""-"""	37273	protein-coding gene	gene with protein product							Standard	NM_001136116		Approved	DKFZp686E2433	uc003mjt.4	B4DU55	OTTHUMG00000163596	ENST00000444149.2:c.56T>G	5.37:g.178454496T>G	ENSP00000414887:p.Val19Gly	Somatic		WXS	Illumina GAIIx	Phase_I		Missense_Mutation	SNP	ENST00000444149.2	37	CCDS47352.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.64|13.64	2.296203|2.296203	0.40594|0.40594	.|.	.|.	ENSG00000234284|ENSG00000234284	ENST00000519896|ENST00000444149;ENST00000522442;ENST00000521285	.|T;T;T	.|0.10477	.|2.87;2.87;2.87	3.93|3.93	3.93|3.93	0.45458|0.45458	.|Krueppel-associated box (4);	.|.	.|.	.|.	.|.	T|T	0.47673|0.47673	0.1458|0.1458	H|H	0.98559|0.98559	4.265|4.265	0.40085|0.40085	D|D	0.976186|0.976186	.|D	.|0.76494	.|0.999	.|D	.|0.87578	.|0.998	T|T	0.66114|0.66114	-0.6004|-0.6004	6|9	0.87932|0.87932	D|D	0|0	-7.329|-7.329	11.0149|11.0149	0.47682|0.47682	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|19	.|B4DU55	.|ZN879_HUMAN	W|G	30|19	.|ENSP00000414887:V19G;ENSP00000428477:V19G;ENSP00000431043:V19G	ENSP00000430047:C30W|ENSP00000414887:V19G	C|V	+|+	3|2	2|0	ZNF879|ZNF879	178387102|178387102	1.000000|1.000000	0.71417|0.71417	0.992000|0.992000	0.48379|0.48379	0.914000|0.914000	0.54420|0.54420	4.184000|4.184000	0.58323|0.58323	1.750000|1.750000	0.51863|0.51863	0.402000|0.402000	0.26972|0.26972	TGT|GTG		0.562	ZNF879-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374447.1		NM_001136116	
ZNF91	7644	hgsc.bcm.edu;ucsc.edu	37	19	23543184	23543187	+	Frame_Shift_Del	DEL	GATT	GATT	-			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	GATT	GATT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr19:23543184_23543187delGATT	ENST00000300619.7	-	4	2799_2802	c.2594_2597delAATC	c.(2593-2598)caatctfs	p.QS865fs	ZNF91_ENST00000397082.2_Frame_Shift_Del_p.QS833fs|ZNF91_ENST00000596528.1_5'Flank|ZNF91_ENST00000599743.1_Intron	NM_003430.2	NP_003421.2	Q05481	ZNF91_HUMAN	zinc finger protein 91	865					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.S866F(1)					all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				AAGATTTGAAGATTGATTAAAAGC	0.368																																																	1	Substitution - Missense(1)	cervix(1)								3,4101		1,1,2050						-2.8	0.0			73	4,8180		1,2,4089	no	frameshift	ZNF91	NM_003430.2		2,3,6139	A1A1,A1R,RR		0.0489,0.0731,0.057				7,12281				SO:0001589	frameshift_variant	7644			M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000300619.7:c.2594_2597delAATC	19.37:g.23543188_23543191delGATT	ENSP00000300619:p.Gln865fs	Somatic		WXS	Illumina HiSeq	Phase_I	A8K5E1|B7Z6G6	Frame_Shift_Del	DEL	ENST00000300619.7	37	CCDS42541.1																																																																																				0.368	ZNF91-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465891.1		NM_003430	
ZSWIM5	57643	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	45506168	45506168	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr1:45506168G>T	ENST00000359600.5	-	7	1857	c.1652C>A	c.(1651-1653)tCc>tAc	p.S551Y		NM_020883.1	NP_065934.1	Q9P217	ZSWM5_HUMAN	zinc finger, SWIM-type containing 5	551						extracellular space (GO:0005615)	zinc ion binding (GO:0008270)	p.S551Y(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(2)|liver(1)|lung(13)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Acute lymphoblastic leukemia(166;0.155)					ATAACCATGGGAACGCAGGGC	0.448																																																	1	Substitution - Missense(1)	kidney(1)											82.0	76.0	78.0					1																	45506168		1899	4114	6013	SO:0001583	missense	57643			AB040944	CCDS41319.1	1p34.1	2010-06-16			ENSG00000162415	ENSG00000162415		"""Zinc fingers, SWIM-type"""	29299	protein-coding gene	gene with protein product						10819331	Standard	NM_020883		Approved	KIAA1511	uc001cnd.2	Q9P217	OTTHUMG00000008950	ENST00000359600.5:c.1652C>A	1.37:g.45506168G>T	ENSP00000352614:p.Ser551Tyr	Somatic		WXS	Illumina HiSeq	Phase_I	Q5SXQ9	Missense_Mutation	SNP	ENST00000359600.5	37	CCDS41319.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.636508	0.87760	.	.	ENSG00000162415	ENST00000359600	T	0.57436	0.4	4.64	4.64	0.57946	.	0.000000	0.85682	D	0.000000	T	0.73087	0.3542	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.76997	-0.2751	10	0.72032	D	0.01	-11.491	18.4215	0.90592	0.0:0.0:1.0:0.0	.	551	Q9P217	ZSWM5_HUMAN	Y	551	ENSP00000352614:S551Y	ENSP00000352614:S551Y	S	-	2	0	ZSWIM5	45278755	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.420000	0.97426	2.523000	0.85059	0.655000	0.94253	TCC		0.448	ZSWIM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024823.2		XM_046581	
ARHGAP11B	89839	broad.mit.edu	37	15	30938440	30938440	+	lincRNA	SNP	A	A	G			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr15:30938440A>G	ENST00000602684.1	+	0	0																											CTCCTTTGCTATTTGTGCATG	0.493																																																	0																																												89839																															15.37:g.30938440A>G		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	SNP	ENST00000602684.1	37																																																																																					0.493	RP11-932O9.10-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000467507.1			
CXCR2P1	3580	broad.mit.edu	37	2	218925340	218925340	+	RNA	SNP	G	G	T			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr2:218925340G>T	ENST00000439871.1	-	0	1040					NR_002712.1				chemokine (C-X-C motif) receptor 2 pseudogene 1																		AGCAGGACCAGGTTGTAGGGC	0.557																																																	0																																												3580			M98335		2q35	2012-05-02	2010-04-14	2010-04-14	ENSG00000229754	ENSG00000229754			6028	pseudogene	pseudogene			"""interleukin 8 receptor, beta pseudogene"", ""chemokine (C-X-C motif) receptor 2 pseudogene"""	IL8RBP, CXCR2P		1427896, 1303245	Standard	NR_002712		Approved		uc002vgx.3		OTTHUMG00000155244		2.37:g.218925340G>T		Somatic		WXS	Illumina GAIIx	Phase_I		Silent	SNP	ENST00000439871.1	37																																																																																					0.557	CXCR2P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000338985.1		NR_002712	
FMN2	56776	broad.mit.edu	37	1	240255569	240255571	+	In_Frame_Del	DEL	GGC	GGC	-	rs71929261|rs140531536	byFrequency	TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	GGC	GGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr1:240255569_240255571delGGC	ENST00000319653.9	+	1	390_392	c.160_162delGGC	c.(160-162)ggcdel	p.G59del		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	59					cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)	p.G197delG(1)		NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			GGGGGGAgggggcggcggcggcg	0.665														3539	0.706669	0.7821	0.7507	5008	,	,		10143	0.4514		0.7893	False		,,,				2504	0.7515																1	Deletion - In frame(1)	prostate(1)																																								SO:0001651	inframe_deletion	56776			AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.160_162delGGC	1.37:g.240255578_240255580delGGC	ENSP00000318884:p.Gly59del	Somatic		WXS	Illumina GAIIx	Phase_I	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	In_Frame_Del	DEL	ENST00000319653.9	37	CCDS31069.2																																																																																				0.665	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2		XM_371352	
MRPL18	29074	broad.mit.edu	37	6	160218317	160218317	+	Splice_Site	SNP	A	A	C			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr6:160218317A>C	ENST00000367034.4	+	3	361		c.e3-1		PNLDC1_ENST00000392167.3_5'Flank|PNLDC1_ENST00000610273.1_5'Flank|MRPL18_ENST00000480842.1_Splice_Site	NM_014161.3	NP_054880.2	Q9H0U6	RM18_HUMAN	mitochondrial ribosomal protein L18						rRNA import into mitochondrion (GO:0035928)|translation (GO:0006412)	extracellular space (GO:0005615)|mitochondrial ribosome (GO:0005761)|mitochondrion (GO:0005739)	5S rRNA binding (GO:0008097)|structural constituent of ribosome (GO:0003735)	p.?(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)	11		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.44e-18)|BRCA - Breast invasive adenocarcinoma(81;5.79e-06)		CACCCCATTTAGGTTGCGAGT	0.388																																																	1	Unknown(1)	kidney(1)											90.0	75.0	80.0					6																	160218317		2203	4300	6503	SO:0001630	splice_region_variant	29074			AF161556	CCDS5270.1	6q25.3	2012-09-13			ENSG00000112110	ENSG00000112110		"""Mitochondrial ribosomal proteins / large subunits"""	14477	protein-coding gene	gene with protein product		611831				11042152, 11551941	Standard	NM_014161		Approved	HSPC071	uc003qsw.4	Q9H0U6	OTTHUMG00000015942	ENST00000367034.4:c.240-1A>C	6.37:g.160218317A>C		Somatic		WXS	Illumina GAIIx	Phase_I	Q5TAP9|Q9NZW8	Splice_Site	SNP	ENST00000367034.4	37	CCDS5270.1	.	.	.	.	.	.	.	.	.	.	A	18.44	3.624552	0.66901	.	.	ENSG00000112110	ENST00000367034	.	.	.	4.52	4.52	0.55395	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.026	0.64586	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MRPL18	160138307	1.000000	0.71417	0.998000	0.56505	0.960000	0.62799	6.511000	0.73733	1.883000	0.54544	0.533000	0.62120	.		0.388	MRPL18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042925.1			Intron
PARP12	64761	broad.mit.edu	37	7	139741631	139741631	+	Missense_Mutation	SNP	C	C	A	rs199656500		TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr7:139741631C>A	ENST00000263549.3	-	6	1868	c.995G>T	c.(994-996)tGc>tTc	p.C332F	PARP12_ENST00000470515.1_5'Flank	NM_022750.2	NP_073587.1	Q9H0J9	PAR12_HUMAN	poly (ADP-ribose) polymerase family, member 12	332	WWE 1. {ECO:0000255|PROSITE- ProRule:PRU00248}.					nucleus (GO:0005634)	metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)	p.C332F(1)		endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|skin(1)	19	Melanoma(164;0.0142)					TGACTCAGAGCACAGGATCCT	0.527																																																	1	Substitution - Missense(1)	kidney(1)											109.0	99.0	103.0					7																	139741631		2203	4300	6503	SO:0001583	missense	64761			AL136766	CCDS5857.1	7q34	2014-01-28	2005-06-02	2005-06-02	ENSG00000059378	ENSG00000059378		"""Zinc fingers, CCCH-type domain containing"", ""Poly (ADP-ribose) polymerases"""	21919	protein-coding gene	gene with protein product		612481	"""zinc finger CCCH-type domain containing 1"""	ZC3HDC1		11230166, 12851707	Standard	NM_022750		Approved	FLJ22693, PARP-12, ZC3H1	uc003vvl.1	Q9H0J9	OTTHUMG00000157315	ENST00000263549.3:c.995G>T	7.37:g.139741631C>A	ENSP00000263549:p.Cys332Phe	Somatic		WXS	Illumina GAIIx	Phase_I	Q9H610|Q9NP36|Q9NTI3	Missense_Mutation	SNP	ENST00000263549.3	37	CCDS5857.1	.	.	.	.	.	.	.	.	.	.	C	7.900	0.734279	0.15574	.	.	ENSG00000059378	ENST00000263549	T	0.06768	3.26	4.81	0.558	0.17266	WWE domain (1);	0.454286	0.24742	N	0.035973	T	0.05273	0.0140	L	0.47716	1.5	0.09310	N	1	B	0.25007	0.116	B	0.16289	0.015	T	0.34551	-0.9824	10	0.18276	T	0.48	.	1.9625	0.03389	0.3516:0.3701:0.1718:0.1066	.	332	Q9H0J9	PAR12_HUMAN	F	332	ENSP00000263549:C332F	ENSP00000263549:C332F	C	-	2	0	PARP12	139388100	0.008000	0.16893	0.003000	0.11579	0.004000	0.04260	0.964000	0.29306	0.528000	0.28580	-0.169000	0.13324	TGC		0.527	PARP12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348413.1		NM_022750	
PCDHGA10	56106	broad.mit.edu	37	5	140794506	140794506	+	Silent	SNP	C	C	T			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr5:140794506C>T	ENST00000398610.2	+	1	1764	c.1764C>T	c.(1762-1764)ccC>ccT	p.P588P	PCDHGA6_ENST00000517434.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB7_ENST00000398594.2_5'Flank	NM_018913.2|NM_032090.1	NP_061736.1|NP_114479.1	Q9Y5H3	PCDGA_HUMAN	protocadherin gamma subfamily A, 10	588	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P588P(1)		breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	43			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCGCAGAGCCCGGCTACCTGG	0.672																																																	1	Substitution - coding silent(1)	kidney(1)											80.0	95.0	90.0					5																	140794506		2200	4299	6499	SO:0001819	synonymous_variant	56106				CCDS47292.1, CCDS75343.1	5q31	2010-01-26			ENSG00000253846	ENSG00000253846		"""Cadherins / Protocadherins : Clustered"""	8697	other	protocadherin		606297				10380929	Standard	NM_018913		Approved	PCDH-GAMMA-A10		Q9Y5H3	OTTHUMG00000163688	ENST00000398610.2:c.1764C>T	5.37:g.140794506C>T		Somatic		WXS	Illumina GAIIx	Phase_I	Q9Y5E0	Silent	SNP	ENST00000398610.2	37	CCDS47292.1																																																																																				0.672	PCDHGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374747.1		NM_018913	
PLEC	5339	broad.mit.edu	37	8	145004392	145004392	+	Silent	SNP	G	G	A			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr8:145004392G>A	ENST00000322810.4	-	21	3112	c.2943C>T	c.(2941-2943)agC>agT	p.S981S	PLEC_ENST00000354589.3_Silent_p.S844S|PLEC_ENST00000356346.3_Silent_p.S830S|PLEC_ENST00000527096.1_Silent_p.S867S|PLEC_ENST00000357649.2_Silent_p.S848S|PLEC_ENST00000354958.2_Silent_p.S822S|PLEC_ENST00000345136.3_Silent_p.S844S|PLEC_ENST00000398774.2_Silent_p.S812S|PLEC_ENST00000436759.2_Silent_p.S871S	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	981	Globular 1.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)	p.S871S(1)|p.S981S(1)|p.S844S(1)		NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CGCTGCCGGAGCTGCTGAGCA	0.711																																																	3	Substitution - coding silent(3)	kidney(3)											11.0	15.0	14.0					8																	145004392		2138	4226	6364	SO:0001819	synonymous_variant	5339			U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.2943C>T	8.37:g.145004392G>A		Somatic		WXS	Illumina GAIIx	Phase_I	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																				0.711	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1		NM_000445	
POTEE	445582	broad.mit.edu	37	2	131995769	131995769	+	Missense_Mutation	SNP	A	A	C			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr2:131995769A>C	ENST00000356920.5	+	8	1294	c.1200A>C	c.(1198-1200)aaA>aaC	p.K400N	POTEE_ENST00000358087.5_Missense_Mutation_p.N387H|PLEKHB2_ENST00000404460.1_Intron|PLEKHB2_ENST00000303908.3_Intron	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	400					retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.K400N(1)|p.N387H(1)									CTCTGCAGAAAATGTCTCAAG	0.299																																																	2	Substitution - Missense(2)	kidney(2)											41.0	46.0	44.0					2																	131995769		2112	4277	6389	SO:0001583	missense	445582			AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.1200A>C	2.37:g.131995769A>C	ENSP00000439189:p.Lys400Asn	Somatic		WXS	Illumina GAIIx	Phase_I	Q6S8J4|Q6S8J5|Q6S8J8	Missense_Mutation	SNP	ENST00000356920.5	37	CCDS46414.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	7.140|7.140	0.581724|0.581724	0.13749|0.13749	.|.	.|.	ENSG00000188219|ENSG00000188219	ENST00000356920|ENST00000358087	T|T	0.25085|0.27890	1.82|1.64	0.993|0.993	-1.99|-1.99	0.07457|0.07457	.|.	.|.	.|.	.|.	.|.	T|T	0.19406|0.19406	0.0466|0.0466	L|L	0.32530|0.32530	0.975|0.975	0.09310|0.09310	N|N	1|1	B|.	0.17667|.	0.023|.	B|.	0.11329|.	0.006|.	T|T	0.26121|0.26121	-1.0112|-1.0112	9|7	0.87932|0.38643	D|T	0|0.18	.|.	1.3953|1.3953	0.02259|0.02259	0.4101:0.0:0.2612:0.3287|0.4101:0.0:0.2612:0.3287	.|.	400|.	Q6S8J3|.	POTEE_HUMAN|.	N|H	400|387	ENSP00000439189:K400N|ENSP00000443049:N387H	ENSP00000439189:K400N|ENSP00000443049:N387H	K|N	+|+	3|1	2|0	AC131180.1|AC131180.1	131712239|131712239	0.002000|0.002000	0.14202|0.14202	0.001000|0.001000	0.08648|0.08648	0.008000|0.008000	0.06430|0.06430	0.080000|0.080000	0.14802|0.14802	-0.735000|-0.735000	0.04837|0.04837	0.155000|0.155000	0.16302|0.16302	AAA|AAT		0.299	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			NM_001083538	
SNAI1	6615	broad.mit.edu	37	20	48600840	48600840	+	Missense_Mutation	SNP	G	G	T			TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr20:48600840G>T	ENST00000244050.2	+	2	623	c.562G>T	c.(562-564)Gcc>Tcc	p.A188S		NM_005985.3	NP_005976.2	O95863	SNAI1_HUMAN	snail family zinc finger 1	188	Required for nuclear localization and interaction with KPNB1, NOTCH1 and PARP1.				cartilage morphogenesis (GO:0060536)|cell migration (GO:0016477)|epithelial to mesenchymal transition (GO:0001837)|hair follicle morphogenesis (GO:0031069)|left/right pattern formation (GO:0060972)|mesoderm formation (GO:0001707)|negative regulation of cell differentiation involved in embryonic placenta development (GO:0060806)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vitamin D biosynthetic process (GO:0010957)|Notch signaling involved in heart development (GO:0061314)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of tight junction assembly (GO:2000810)|trophoblast giant cell differentiation (GO:0060707)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	kinase binding (GO:0019900)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)	p.A188S(1)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(10)|ovary(2)	17			BRCA - Breast invasive adenocarcinoma(9;4.03e-06)			CTGCGGGAAGGCCTTCTCTAG	0.612																																																	1	Substitution - Missense(1)	kidney(1)											26.0	25.0	25.0					20																	48600840		2203	4300	6503	SO:0001583	missense	6615			AF125377	CCDS13423.1	20q13.2	2013-05-23	2013-05-23		ENSG00000124216	ENSG00000124216		"""Snail homologs"", ""Zinc fingers, C2H2-type"""	11128	protein-coding gene	gene with protein product		604238	"""snail 1 (drosophila homolog), zinc finger protein"", ""snail homolog 1 (Drosophila)"""			10585766	Standard	NM_005985		Approved	SNA, SLUGH2, SNAH, SNAIL1, SNAIL	uc002xuz.3	O95863	OTTHUMG00000033048	ENST00000244050.2:c.562G>T	20.37:g.48600840G>T	ENSP00000244050:p.Ala188Ser	Somatic		WXS	Illumina GAIIx	Phase_I	B2R842|Q9P113|Q9UBP7|Q9UHH7	Missense_Mutation	SNP	ENST00000244050.2	37	CCDS13423.1	.	.	.	.	.	.	.	.	.	.	G	33	5.290599	0.95546	.	.	ENSG00000124216	ENST00000244050	T	0.08282	3.11	4.59	4.59	0.56863	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.18800	0.0451	N	0.25992	0.78	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.04178	-1.0971	10	0.49607	T	0.09	-30.1877	17.7788	0.88517	0.0:0.0:1.0:0.0	.	188	O95863	SNAI1_HUMAN	S	188	ENSP00000244050:A188S	ENSP00000244050:A188S	A	+	1	0	SNAI1	48034247	1.000000	0.71417	1.000000	0.80357	0.749000	0.42624	9.420000	0.97426	2.260000	0.74910	0.563000	0.77884	GCC		0.612	SNAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080350.1			
STAG3L2	442582	broad.mit.edu	37	7	74300557	74300564	+	RNA	DEL	AGAGCTCC	AGAGCTCC	-	rs367732188		TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	AGAGCTCC	AGAGCTCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr7:74300557_74300564delAGAGCTCC	ENST00000423186.1	-	0	573_580							P0CL84	ST3L2_HUMAN	stromal antigen 3-like 2 (pseudogene)							nucleus (GO:0005634)		p.E82fs*32(2)		breast(1)|central_nervous_system(1)|large_intestine(1)|lung(1)|pancreas(1)	5						CGGCCAGTGAAGAGCTCCAGGCGTGCGG	0.572																																																	2	Deletion - Frameshift(2)	large_intestine(1)|central_nervous_system(1)								96,356		38,20,168							0.0			1	208,1036		88,32,502	no	frameshift	STAG3L2	NM_001025202.2		126,52,670	A1A1,A1R,RR		16.7203,21.2389,17.9245				304,1392						442582					7q11.23	2013-06-26	2013-06-26			ENSG00000277072			33886	pseudogene	pseudogene			"""stromal antigen 3-like 2"""				Standard	NR_040584		Approved	MGC131759, STAG3L2P	uc011kfj.2	P0CL84	OTTHUMG00000156216		7.37:g.74300557_74300564delAGAGCTCC		Somatic		WXS	Illumina GAIIx	Phase_I	A6NMT8|A8K0A1|Q32NE4|Q6NXR2|Q7L5M5|Q7Z5K6	Frame_Shift_Del	DEL	ENST00000423186.1	37																																																																																					0.572	STAG3L2-002	KNOWN	basic	retained_intron	pseudogene	OTTHUMT00000343523.2		NM_001025202	
KRT16P6	353194	broad.mit.edu	37	17	16725606	16725607	+	RNA	INS	-	-	C	rs372586850	byFrequency	TCGA-B0-5106-01A-01D-1421-08	TCGA-B0-5106-11A-01D-1421-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c0e28603-7204-416d-ba3d-5377a38f677d	6d436195-d34a-4f6a-83ca-217c4489b212	g.chr17:16725606_16725607insC	ENST00000417510.1	-	0	286_287																											CGCCATAGCCGCCCCCCAGCCT	0.668													cccccc|CCCCCC|CCCCCCC|insertion	75	0.014976	0.0	0.0519	5008	,	,		15528	0.001		0.0249	False		,,,				2504	0.0133																0																																												0																															17.37:g.16725612_16725612dupC		Somatic		WXS	Illumina GAIIx	Phase_I		RNA	INS	ENST00000417510.1	37																																																																																					0.668	AC022596.6-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000131123.1			
