#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ADM5	199800	hgsc.bcm.edu	37	19	50193437	50193437	+	Missense_Mutation	SNP	C	C	A	rs45613034	byFrequency	TCGA-BP-4347-01A-01D-1366-10	TCGA-BP-4347-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	249697ef-19f1-4d5e-8182-1eb1b5c38ec1	e453d958-081b-4680-a2ec-1e14aa549c08	g.chr19:50193437C>A	ENST00000420022.3	+	2	1323	c.149C>A	c.(148-150)gCg>gAg	p.A50E	CPT1C_ENST00000405931.2_5'Flank|CPT1C_ENST00000598293.1_5'Flank|CPT1C_ENST00000354199.5_5'Flank|CTB-33G10.6_ENST00000596472.1_RNA|CPT1C_ENST00000392518.4_5'Flank|CPT1C_ENST00000323446.5_5'Flank	NM_001101340.1	NP_001094810.1	C9JUS6	ADM5_HUMAN	adrenomedullin 5 (putative)	50						extracellular region (GO:0005576)											CACCGCCTGGCGGAGATCATA	0.687													c|||	54	0.0107827	0.0008	0.0029	5008	,	,		14330	0.002		0.0149	False		,,,				2504	0.0348																0								C	GLU/ALA	8,3944		0,8,1968	10.0	13.0	12.0		149	1.1	0.0	19	dbSNP_127	12	85,8165		0,85,4040	yes	missense	C19orf76	NM_001101340.1	107	0,93,6008	AA,AC,CC		1.0303,0.2024,0.7622	benign	50/154	50193437	93,12109	1976	4125	6101	SO:0001583	missense	0			BC032764	CCDS46146.1	19q13.33	2012-12-07	2012-12-07	2012-10-29	ENSG00000224420	ENSG00000224420			27293	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 76"", ""adrenomedullin 5 homolog (pig)"""	C19orf76		18434369	Standard	NM_001101340		Approved	AM5	uc002pph.2	C9JUS6		ENST00000420022.3:c.149C>A	19.37:g.50193437C>A	ENSP00000393631:p.Ala50Glu	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000420022.3	37	CCDS46146.1	18	0.008241758241758242	0	0.0	1	0.0027624309392265192	2	0.0034965034965034965	15	0.01978891820580475	C	11.62	1.692811	0.30052	0.002024	0.010303	ENSG00000224420	ENST00000420022	.	.	.	2.18	1.14	0.20703	.	.	.	.	.	T	0.06005	0.0156	N	0.08118	0	0.09310	N	1	B	0.33940	0.433	B	0.29267	0.1	T	0.16453	-1.0402	8	0.33940	T	0.23	.	4.9604	0.14063	0.0:0.8219:0.0:0.1781	rs45613034	50	C9JUS6	ADM5_HUMAN	E	50	.	ENSP00000393631:A50E	A	+	2	0	C19orf76	54885249	0.000000	0.05858	0.005000	0.12908	0.003000	0.03518	-0.146000	0.10250	0.503000	0.28060	-0.254000	0.11334	GCG		0.687	ADM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465777.1		NM_001101340	
PRR14L	253143	hgsc.bcm.edu;ucsc.edu	37	22	32108910	32108910	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4347-01A-01D-1366-10	TCGA-BP-4347-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	249697ef-19f1-4d5e-8182-1eb1b5c38ec1	e453d958-081b-4680-a2ec-1e14aa549c08	g.chr22:32108910G>A	ENST00000327423.6	-	4	5104	c.4915C>T	c.(4915-4917)Cgg>Tgg	p.R1639W	PRR14L_ENST00000397493.2_Missense_Mutation_p.R1639W|PRR14L_ENST00000434485.1_Missense_Mutation_p.R1639W	NM_173566.2	NP_775837.2	Q5THK1	PR14L_HUMAN	proline rich 14-like	1639										endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(5)|skin(1)|urinary_tract(2)	14						GAGGAACACCGTCGGTATCTT	0.468											OREG0003533	type=REGULATORY REGION|Gene=BC040859|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																					0													44.0	35.0	38.0					22																	32108910		692	1591	2283	SO:0001583	missense	0			BC040859	CCDS13900.2	22q12.2	2011-01-25	2011-01-25	2011-01-25	ENSG00000183530	ENSG00000183530			28738	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 30"""	C22orf30		12477932	Standard	NM_173566		Approved	MGC50372	uc003alp.4	Q5THK1	OTTHUMG00000030139	ENST00000327423.6:c.4915C>T	22.37:g.32108910G>A	ENSP00000331845:p.Arg1639Trp	Somatic	829	WXS	SOLID	Phase_I	Q5THK4|Q6ZNN1|Q6ZWH0|Q8IW74|Q9H5T4	Missense_Mutation	SNP	ENST00000327423.6	37	CCDS13900.2	.	.	.	.	.	.	.	.	.	.	G	10.94	1.493671	0.26774	.	.	ENSG00000183530	ENST00000397493;ENST00000327423;ENST00000434485	T;T;T	0.07327	3.2;3.22;3.21	5.37	5.37	0.77165	.	0.600221	0.14187	N	0.335599	T	0.15912	0.0383	N	0.22421	0.69	0.18873	N	0.999981	D;D;D	0.71674	0.998;0.998;0.998	P;P;P	0.62491	0.903;0.859;0.859	T	0.25572	-1.0128	9	.	.	.	0.072	16.2646	0.82568	0.0:0.0:1.0:0.0	.	1639;1639;1639	Q5THK1-2;Q5THK1;Q5THK1-4	.;PR14L_HUMAN;.	W	1639	ENSP00000380630:R1639W;ENSP00000331845:R1639W;ENSP00000388314:R1639W	.	R	-	1	2	PRR14L	30438910	0.739000	0.28196	0.026000	0.17262	0.505000	0.33919	3.277000	0.51654	2.511000	0.84671	0.650000	0.86243	CGG		0.468	PRR14L-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074993.2		NM_173566	
C9orf171	389799	hgsc.bcm.edu	37	9	135374869	135374869	+	Missense_Mutation	SNP	C	C	T	rs149346027	byFrequency	TCGA-BP-4347-01A-01D-1366-10	TCGA-BP-4347-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	249697ef-19f1-4d5e-8182-1eb1b5c38ec1	e453d958-081b-4680-a2ec-1e14aa549c08	g.chr9:135374869C>T	ENST00000343036.2	+	4	562	c.514C>T	c.(514-516)Cgg>Tgg	p.R172W	C9orf171_ENST00000393215.3_Missense_Mutation_p.R136W|C9orf171_ENST00000393216.2_Missense_Mutation_p.R136W	NM_207417.1	NP_997300.1	Q6ZQR2	CI171_HUMAN	chromosome 9 open reading frame 171	172			R -> W (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.					p.R172W(1)		large_intestine(7)|lung(9)|ovary(4)|prostate(3)	23						GGTGACTGCCCGGGAGAACTT	0.602													C|||	2	0.000399361	0.0008	0.0014	5008	,	,		17800	0.0		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	large_intestine(1)						C	TRP/ARG	10,4396	17.9+/-39.9	0,10,2193	84.0	85.0	85.0		514	2.1	0.9	9	dbSNP_134	85	2,8598	2.2+/-6.3	0,2,4298	yes	missense	C9orf171	NM_207417.1	101	0,12,6491	TT,TC,CC		0.0233,0.227,0.0923	probably-damaging	172/321	135374869	12,12994	2203	4300	6503	SO:0001583	missense	389799			AK128819	CCDS6949.1, CCDS65167.1	9q34.13	2012-04-03			ENSG00000188523	ENSG00000188523			33776	protein-coding gene	gene with protein product							Standard	NM_207417		Approved	FLJ46082	uc004cbn.3	Q6ZQR2	OTTHUMG00000131684	ENST00000343036.2:c.514C>T	9.37:g.135374869C>T	ENSP00000343290:p.Arg172Trp	Somatic		WXS	SOLID	Phase_I	Q147X1	Missense_Mutation	SNP	ENST00000343036.2	37	CCDS6949.1	.	.	.	.	.	.	.	.	.	.	C	18.05	3.537088	0.65085	0.00227	2.33E-4	ENSG00000188523	ENST00000393215;ENST00000343036;ENST00000393216	T;T;T	0.24538	1.85;1.85;1.85	5.26	2.09	0.27110	.	0.630262	0.15447	N	0.261890	T	0.39358	0.1075	L	0.43152	1.355	0.25878	N	0.983629	D;D	0.89917	0.997;1.0	P;P	0.62885	0.787;0.908	T	0.28106	-1.0054	10	0.72032	D	0.01	.	13.8143	0.63281	0.392:0.608:0.0:0.0	.	136;172	Q6ZQR2-2;Q6ZQR2	.;CI171_HUMAN	W	136;172;136	ENSP00000376908:R136W;ENSP00000343290:R172W;ENSP00000376909:R136W	ENSP00000343290:R172W	R	+	1	2	C9orf171	134364690	0.879000	0.30193	0.950000	0.38849	0.656000	0.38851	0.985000	0.29578	0.654000	0.30846	0.561000	0.74099	CGG		0.602	C9orf171-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254589.1		NM_207417	
CBX6	23466	hgsc.bcm.edu;ucsc.edu	37	22	39267730	39267730	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-4347-01A-01D-1366-10	TCGA-BP-4347-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	249697ef-19f1-4d5e-8182-1eb1b5c38ec1	e453d958-081b-4680-a2ec-1e14aa549c08	g.chr22:39267730A>T	ENST00000407418.3	-	3	269	c.146T>A	c.(145-147)cTg>cAg	p.L49Q	CBX6_ENST00000216083.6_Missense_Mutation_p.L49Q			O95503	CBX6_HUMAN	chromobox homolog 6	49	Chromo. {ECO:0000255|PROSITE- ProRule:PRU00053}.				chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	heterochromatin (GO:0000792)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)	single-stranded RNA binding (GO:0003727)			large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	6	Melanoma(58;0.04)					CCGCGAGTCCAGGATGTTCTC	0.627																																																	0													44.0	45.0	45.0					22																	39267730		2203	4300	6503	SO:0001583	missense	23466				CCDS13980.1	22q13.1	2013-04-23			ENSG00000183741	ENSG00000183741			1556	protein-coding gene	gene with protein product							Standard	NM_014292		Approved		uc003awl.3	O95503	OTTHUMG00000150456	ENST00000407418.3:c.146T>A	22.37:g.39267730A>T	ENSP00000384490:p.Leu49Gln	Somatic		WXS	SOLID	Phase_I	A8KAH0|Q96EM5	Missense_Mutation	SNP	ENST00000407418.3	37	CCDS13980.1	.	.	.	.	.	.	.	.	.	.	A	23.0	4.363477	0.82353	.	.	ENSG00000183741	ENST00000407418;ENST00000216083	D;D	0.82433	-1.61;-1.61	4.07	4.07	0.47477	Chromo domain (1);Chromo domain-like (1);Chromo domain/shadow (2);	4.692850	0.00797	N	0.001390	D	0.91040	0.7181	L	0.56396	1.775	0.50313	D	0.999869	D;D	0.89917	1.0;1.0	D;D	0.97110	0.997;1.0	T	0.77281	-0.2646	10	0.87932	D	0	.	13.0331	0.58854	1.0:0.0:0.0:0.0	.	49;49	B3KT27;O95503	.;CBX6_HUMAN	Q	49	ENSP00000384490:L49Q;ENSP00000216083:L49Q	ENSP00000216083:L49Q	L	-	2	0	CBX6	37597676	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.682000	0.74528	1.464000	0.47987	0.379000	0.24179	CTG		0.627	CBX6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000318190.1		NM_014292	
CLRN3	119467	hgsc.bcm.edu;ucsc.edu	37	10	129690978	129690978	+	Missense_Mutation	SNP	A	A	T			TCGA-BP-4347-01A-01D-1366-10	TCGA-BP-4347-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	249697ef-19f1-4d5e-8182-1eb1b5c38ec1	e453d958-081b-4680-a2ec-1e14aa549c08	g.chr10:129690978A>T	ENST00000368671.3	-	1	233	c.71T>A	c.(70-72)aTt>aAt	p.I24N		NM_152311.3	NP_689524.1	Q8NCR9	CLRN3_HUMAN	clarin 3	24						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	6		all_epithelial(44;0.00168)|all_lung(145;0.0586)|Lung NSC(174;0.0765)|all_neural(114;0.201)|Glioma(114;0.222)|Colorectal(57;0.235)				AATAGAGCAAATTACAATGAA	0.398																																																	0													116.0	104.0	108.0					10																	129690978		2203	4300	6503	SO:0001583	missense	119467			BC029478	CCDS7656.1	10q26.2	2006-11-24	2006-11-23	2006-11-23	ENSG00000180745	ENSG00000180745			20795	protein-coding gene	gene with protein product			"""transmembrane protein 12"""	TMEM12		12145752, 12080385	Standard	NM_152311		Approved	MGC32871, USH3AL1	uc001lka.1	Q8NCR9	OTTHUMG00000019253	ENST00000368671.3:c.71T>A	10.37:g.129690978A>T	ENSP00000357660:p.Ile24Asn	Somatic		WXS	SOLID	Phase_I	Q6MZX8	Missense_Mutation	SNP	ENST00000368671.3	37	CCDS7656.1	.	.	.	.	.	.	.	.	.	.	A	16.66	3.186180	0.57909	.	.	ENSG00000180745	ENST00000368671	T	0.70631	-0.5	5.52	4.37	0.52481	.	0.416972	0.23779	N	0.044642	T	0.75332	0.3835	L	0.53249	1.67	0.09310	N	1	D	0.58970	0.984	P	0.58331	0.837	T	0.67273	-0.5712	10	0.87932	D	0	.	9.5078	0.39058	0.9175:0.0:0.0825:0.0	.	24	Q8NCR9	CLRN3_HUMAN	N	24	ENSP00000357660:I24N	ENSP00000357660:I24N	I	-	2	0	CLRN3	129580968	0.007000	0.16637	0.007000	0.13788	0.125000	0.20455	2.176000	0.42500	2.323000	0.78572	0.533000	0.62120	ATT		0.398	CLRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050987.1		NM_152311	
CNOT1	23019	hgsc.bcm.edu;ucsc.edu	37	16	58585658	58585658	+	Silent	SNP	A	A	T			TCGA-BP-4347-01A-01D-1366-10	TCGA-BP-4347-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	249697ef-19f1-4d5e-8182-1eb1b5c38ec1	e453d958-081b-4680-a2ec-1e14aa549c08	g.chr16:58585658A>T	ENST00000317147.5	-	23	3368	c.3036T>A	c.(3034-3036)ccT>ccA	p.P1012P	CNOT1_ENST00000569732.1_5'UTR|CNOT1_ENST00000441024.2_Silent_p.P1012P|CNOT1_ENST00000245138.4_5'Flank|CNOT1_ENST00000569240.1_Silent_p.P1007P	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	1012	Interaction with ZFP36.				gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		CAATACTTCCAGGGGTTGTGA	0.478																																																	0													152.0	150.0	150.0					16																	58585658		2198	4300	6498	SO:0001819	synonymous_variant	23019			AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.3036T>A	16.37:g.58585658A>T		Somatic		WXS	SOLID	Phase_I	Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Silent	SNP	ENST00000317147.5	37	CCDS10799.1																																																																																				0.478	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257385.3		NM_016284	
DYSF	8291	hgsc.bcm.edu;ucsc.edu	37	2	71838425	71838425	+	Silent	SNP	C	C	A			TCGA-BP-4347-01A-01D-1366-10	TCGA-BP-4347-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	249697ef-19f1-4d5e-8182-1eb1b5c38ec1	e453d958-081b-4680-a2ec-1e14aa549c08	g.chr2:71838425C>A	ENST00000258104.3	+	37	4231	c.3954C>A	c.(3952-3954)atC>atA	p.I1318I	DYSF_ENST00000409744.1_Silent_p.I1305I|DYSF_ENST00000409582.3_Silent_p.I1335I|DYSF_ENST00000394120.2_Silent_p.I1319I|DYSF_ENST00000410020.3_Silent_p.I1336I|DYSF_ENST00000479049.2_3'UTR|DYSF_ENST00000429174.2_Silent_p.I1318I|DYSF_ENST00000409762.1_Silent_p.I1335I|DYSF_ENST00000409651.1_Silent_p.I1350I|DYSF_ENST00000410041.1_Silent_p.I1336I|DYSF_ENST00000413539.2_Silent_p.I1349I|DYSF_ENST00000409366.1_Silent_p.I1319I	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	1318					plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)			autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						AGGCCAACATCTACATGGTTC	0.622																																																	0													76.0	66.0	69.0					2																	71838425		2203	4300	6503	SO:0001819	synonymous_variant	8291			AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.3954C>A	2.37:g.71838425C>A		Somatic		WXS	SOLID	Phase_I	A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Silent	SNP	ENST00000258104.3	37	CCDS1918.1																																																																																				0.622	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251970.3		NM_003494	
GAN	8139	hgsc.bcm.edu;ucsc.edu	37	16	81411067	81411067	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-4347-01A-01D-1366-10	TCGA-BP-4347-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	249697ef-19f1-4d5e-8182-1eb1b5c38ec1	e453d958-081b-4680-a2ec-1e14aa549c08	g.chr16:81411067T>G	ENST00000568107.2	+	11	1822	c.1660T>G	c.(1660-1662)Tgg>Ggg	p.W554G		NM_022041.3	NP_071324.1	Q9H2C0	GAN_HUMAN	gigaxonin	554					cell death (GO:0008219)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)	25		Colorectal(91;0.153)				CACAGGAACCTGGCACCACAC	0.493																																					GBM(106;1239 1507 7582 9741 33976)												0													216.0	189.0	198.0					16																	81411067		2201	4300	6501	SO:0001583	missense	8139			AF291673	CCDS10935.1	16q24.1	2014-09-17	2008-08-01		ENSG00000261609	ENSG00000261609		"""Kelch-like"", ""BTB/POZ domain containing"""	4137	protein-coding gene	gene with protein product	"""kelch-like family member 16"""	605379	"""giant axonal neuropathy (gigaxonin)"""			9450783, 11062483	Standard	NM_022041		Approved	GAN1, KLHL16	uc002fgo.3	Q9H2C0	OTTHUMG00000137627	ENST00000568107.2:c.1660T>G	16.37:g.81411067T>G	ENSP00000476795:p.Trp554Gly	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000568107.2	37	CCDS10935.1	.	.	.	.	.	.	.	.	.	.	T	18.87	3.715812	0.68844	.	.	ENSG00000127688	ENST00000248272	T	0.75704	-0.96	5.52	4.39	0.52855	Galactose oxidase, beta-propeller (1);	0.164796	0.64402	D	0.000017	T	0.57946	0.2088	N	0.19112	0.55	0.80722	D	1	P	0.37781	0.608	B	0.32465	0.146	T	0.60964	-0.7158	10	0.87932	D	0	.	11.6647	0.51366	0.133:0.0:0.0:0.867	.	554	Q9H2C0	GAN_HUMAN	G	554	ENSP00000248272:W554G	ENSP00000248272:W554G	W	+	1	0	GAN	79968568	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	7.979000	0.88103	0.874000	0.35823	0.383000	0.25322	TGG		0.493	GAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269050.3			
GNB5	10681	hgsc.bcm.edu;ucsc.edu	37	15	52433455	52433455	+	Missense_Mutation	SNP	T	T	G			TCGA-BP-4347-01A-01D-1366-10	TCGA-BP-4347-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	249697ef-19f1-4d5e-8182-1eb1b5c38ec1	e453d958-081b-4680-a2ec-1e14aa549c08	g.chr15:52433455T>G	ENST00000261837.7	-	7	574	c.509A>C	c.(508-510)aAg>aCg	p.K170T	CTD-2184D3.7_ENST00000560613.1_RNA|GNB5_ENST00000358784.7_Missense_Mutation_p.K128T|GNB5_ENST00000396335.4_Intron|CTD-2184D3.7_ENST00000557898.1_RNA|GNB5_ENST00000559348.1_5'Flank	NM_016194.3	NP_057278.2	O14775	GBB5_HUMAN	guanine nucleotide binding protein (G protein), beta 5	170					GTP catabolic process (GO:0006184)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	chaperone binding (GO:0051087)|G-protein gamma-subunit binding (GO:0031682)|GTPase activity (GO:0003924)|signal transducer activity (GO:0004871)			large_intestine(1)|lung(1)	2				all cancers(107;0.0163)		CACAGAACACTTATTATCCAA	0.403																																																	0													131.0	122.0	125.0					15																	52433455		2195	4293	6488	SO:0001583	missense	10681			AF017656	CCDS10149.1, CCDS45261.1	15q21.1	2013-01-10			ENSG00000069966	ENSG00000069966		"""WD repeat domain containing"""	4401	protein-coding gene	gene with protein product		604447				9606987	Standard	NM_016194		Approved	GB5	uc031qrz.1	O14775	OTTHUMG00000131892	ENST00000261837.7:c.509A>C	15.37:g.52433455T>G	ENSP00000261837:p.Lys170Thr	Somatic		WXS	SOLID	Phase_I	B2RBR5|Q9HAU9|Q9UFT3	Missense_Mutation	SNP	ENST00000261837.7	37	CCDS10149.1	.	.	.	.	.	.	.	.	.	.	T	25.5	4.642092	0.87859	.	.	ENSG00000069966	ENST00000261837;ENST00000396335	T	0.01178	5.22	5.41	5.41	0.78517	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);G-protein, beta subunit (1);	0.000000	0.85682	D	0.000000	T	0.03959	0.0111	L	0.35644	1.08	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.63655	-0.6588	10	0.37606	T	0.19	-31.6173	15.6048	0.76658	0.0:0.0:0.0:1.0	.	170	O14775	GBB5_HUMAN	T	170;128	ENSP00000261837:K170T	ENSP00000261837:K170T	K	-	2	0	GNB5	50220747	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.757000	0.85209	2.265000	0.75225	0.533000	0.62120	AAG		0.403	GNB5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254842.1			
GPR61	83873	hgsc.bcm.edu;ucsc.edu	37	1	110086265	110086265	+	Silent	SNP	T	T	C			TCGA-BP-4347-01A-01D-1366-10	TCGA-BP-4347-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	249697ef-19f1-4d5e-8182-1eb1b5c38ec1	e453d958-081b-4680-a2ec-1e14aa549c08	g.chr1:110086265T>C	ENST00000527748.1	+	2	1304	c.621T>C	c.(619-621)ctT>ctC	p.L207L	RP5-1160K1.8_ENST00000526411.1_RNA	NM_031936.4	NP_114142.3	Q9BZJ8	GPR61_HUMAN	G protein-coupled receptor 61	207						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(9)|stomach(1)|urinary_tract(1)	23		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.0426)|Colorectal(144;0.11)|Epithelial(280;0.128)|all cancers(265;0.132)|LUSC - Lung squamous cell carcinoma(189;0.228)		ACTGCCAGCTTTTTGTGGTGG	0.582																																																	0													193.0	188.0	190.0					1																	110086265		2203	4300	6503	SO:0001819	synonymous_variant	83873			AF317652	CCDS801.1	1p13.3	2012-08-21			ENSG00000156097	ENSG00000156097		"""GPCR / Class A : Orphans"""	13300	protein-coding gene	gene with protein product		606916				11165367, 11690637	Standard	NM_031936		Approved	BALGR	uc001dxy.2	Q9BZJ8	OTTHUMG00000011633	ENST00000527748.1:c.621T>C	1.37:g.110086265T>C		Somatic		WXS	SOLID	Phase_I	A8K1W2|Q6NWS0|Q8TDV4|Q96PR4	Silent	SNP	ENST00000527748.1	37	CCDS801.1																																																																																				0.582	GPR61-005	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385575.1			
HNRNPUL1	11100	hgsc.bcm.edu;ucsc.edu	37	19	41808629	41808629	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4347-01A-01D-1366-10	TCGA-BP-4347-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	249697ef-19f1-4d5e-8182-1eb1b5c38ec1	e453d958-081b-4680-a2ec-1e14aa549c08	g.chr19:41808629C>A	ENST00000392006.3	+	12	1920	c.1747C>A	c.(1747-1749)Cag>Aag	p.Q583K	HNRNPUL1_ENST00000593587.1_Missense_Mutation_p.Q483K|HNRNPUL1_ENST00000352456.3_Missense_Mutation_p.Q483K|HNRNPUL1_ENST00000263367.3_Missense_Mutation_p.Q494K|HNRNPUL1_ENST00000602130.1_Missense_Mutation_p.Q583K|HNRNPUL1_ENST00000595018.1_Missense_Mutation_p.Q483K|HNRNPUL1_ENST00000378215.4_Missense_Mutation_p.Q469K	NM_007040.3	NP_008971.2	Q9BUJ2	HNRL1_HUMAN	heterogeneous nuclear ribonucleoprotein U-like 1	583	Necessary for interaction with BRD7 and transcriptional activation.|Necessary for interaction with TP53.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	29						CATTGAGCTGCAGCGGGAGGA	0.562																																																	0													84.0	79.0	81.0					19																	41808629		2203	4300	6503	SO:0001583	missense	11100			AJ007509	CCDS12576.1, CCDS12577.1	19q13.2	2013-06-12		2008-04-18	ENSG00000105323	ENSG00000105323			17011	protein-coding gene	gene with protein product	"""E1B 55kDa associated protein 5"""	605800		HNRPUL1		9733834, 12489984	Standard	XM_005258459		Approved	E1B-AP5, E1BAP5, FLJ12944	uc002oqb.4	Q9BUJ2	OTTHUMG00000182740	ENST00000392006.3:c.1747C>A	19.37:g.41808629C>A	ENSP00000375863:p.Gln583Lys	Somatic		WXS	SOLID	Phase_I	B3KMW7|O76022|Q6ZSZ0|Q7L8P4|Q8N6Z4|Q96G37|Q9HAL3|Q9UG75	Missense_Mutation	SNP	ENST00000392006.3	37	CCDS12576.1	.	.	.	.	.	.	.	.	.	.	C	28.8	4.947361	0.92593	.	.	ENSG00000105323	ENST00000352456;ENST00000392006;ENST00000378215;ENST00000263367	T;T;T;T	0.46819	0.86;1.85;1.44;1.43	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	T	0.67411	0.2890	M	0.65975	2.015	0.48341	D	0.999638	P;P;P;D;P;P;P	0.71674	0.47;0.602;0.917;0.998;0.955;0.643;0.723	B;B;P;D;P;B;P	0.78314	0.396;0.396;0.771;0.991;0.636;0.396;0.6	T	0.65948	-0.6044	10	0.46703	T	0.11	-12.7685	17.9067	0.88920	0.0:1.0:0.0:0.0	.	494;483;583;107;469;583;483	B7Z4B8;A8K3W4;Q9BUJ2-2;Q9BUJ2-5;Q9BUJ2-3;Q9BUJ2;Q9BUJ2-4	.;.;.;.;.;HNRL1_HUMAN;.	K	483;583;469;494	ENSP00000340857:Q483K;ENSP00000375863:Q583K;ENSP00000367460:Q469K;ENSP00000263367:Q494K	ENSP00000263367:Q494K	Q	+	1	0	HNRNPUL1	46500469	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.283000	0.78640	2.837000	0.97791	0.591000	0.81541	CAG		0.562	HNRNPUL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463406.1		NM_144732, NM_007040	
IL1RAPL2	26280	hgsc.bcm.edu;ucsc.edu	37	X	103903657	103903657	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4347-01A-01D-1366-10	TCGA-BP-4347-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	249697ef-19f1-4d5e-8182-1eb1b5c38ec1	e453d958-081b-4680-a2ec-1e14aa549c08	g.chrX:103903657G>A	ENST00000372582.1	+	2	819	c.63G>A	c.(61-63)atG>atA	p.M21I	IL1RAPL2_ENST00000344799.4_Missense_Mutation_p.M21I	NM_017416.1	NP_059112.1	Q9NP60	IRPL2_HUMAN	interleukin 1 receptor accessory protein-like 2	21	Ig-like C2-type 1.				central nervous system development (GO:0007417)|cytokine-mediated signaling pathway (GO:0019221)	integral component of membrane (GO:0016021)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type II, blocking receptor activity (GO:0004910)			breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(14)|lung(23)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						ATCTGAAGATGGTGTCAAAGA	0.423																																																	0													114.0	100.0	104.0					X																	103903657		2203	4299	6502	SO:0001583	missense	26280			AF181285	CCDS14517.1	Xq22	2013-01-11			ENSG00000189108	ENSG00000189108		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5997	protein-coding gene	gene with protein product		300277				10757639	Standard	NM_017416		Approved	IL-1R9, TIGIRR-1, IL1RAPL-2, IL1R9	uc004elz.1	Q9NP60	OTTHUMG00000022141	ENST00000372582.1:c.63G>A	X.37:g.103903657G>A	ENSP00000361663:p.Met21Ile	Somatic		WXS	SOLID	Phase_I	Q2M3U3|Q9NZN0	Missense_Mutation	SNP	ENST00000372582.1	37	CCDS14517.1	.	.	.	.	.	.	.	.	.	.	G	0.104	-1.147366	0.01714	.	.	ENSG00000189108	ENST00000372582;ENST00000344799	T;T	0.03181	4.02;4.02	4.96	4.96	0.65561	Immunoglobulin-like (1);	0.125321	0.36703	N	0.002449	T	0.02083	0.0065	N	0.08118	0	0.80722	D	1	B	0.14012	0.009	B	0.06405	0.002	T	0.55477	-0.8135	10	0.22706	T	0.39	.	8.1259	0.30999	0.0:0.1672:0.6568:0.176	.	21	Q9NP60	IRPL2_HUMAN	I	21	ENSP00000361663:M21I;ENSP00000344976:M21I	ENSP00000344976:M21I	M	+	3	0	IL1RAPL2	103790313	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	0.781000	0.26774	2.215000	0.71742	0.464000	0.42555	ATG		0.423	IL1RAPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057785.1		NM_017416	
KANK1	23189	hgsc.bcm.edu;ucsc.edu	37	9	712578	712578	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4347-01A-01D-1366-10	TCGA-BP-4347-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	249697ef-19f1-4d5e-8182-1eb1b5c38ec1	e453d958-081b-4680-a2ec-1e14aa549c08	g.chr9:712578C>A	ENST00000382303.1	+	7	2464	c.1812C>A	c.(1810-1812)agC>agA	p.S604R	KANK1_ENST00000382297.2_Missense_Mutation_p.S604R|KANK1_ENST00000382293.3_Missense_Mutation_p.S446R|KANK1_ENST00000489369.1_3'UTR	NM_001256876.1	NP_001243805.1	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1	604					negative regulation of actin filament polymerization (GO:0030837)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of lamellipodium morphogenesis (GO:2000393)|negative regulation of neuron projection development (GO:0010977)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of ruffle assembly (GO:1900028)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of wound healing (GO:0090303)|regulation of establishment of cell polarity (GO:2000114)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	beta-catenin binding (GO:0008013)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|stomach(4)|upper_aerodigestive_tract(1)	43		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		AAACAGGCAGCAACACAGAGG	0.493																																																	0													193.0	169.0	177.0					9																	712578		2203	4300	6503	SO:0001583	missense	23189			AL833161	CCDS6441.1, CCDS34976.1	9p24.3	2013-01-10	2008-01-29	2008-01-29	ENSG00000107104	ENSG00000107104		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	19309	protein-coding gene	gene with protein product		607704	"""ankyrin repeat domain 15"""	ANKRD15		12133830, 17996375, 19554261	Standard	NM_015158		Approved	KIAA0172, KANK	uc003zgn.2	Q14678	OTTHUMG00000019434	ENST00000382303.1:c.1812C>A	9.37:g.712578C>A	ENSP00000371740:p.Ser604Arg	Somatic		WXS	SOLID	Phase_I	A2A2W8|D3DRH3|Q5W0W0|Q8IY65|Q8WX74	Missense_Mutation	SNP	ENST00000382303.1	37	CCDS34976.1	.	.	.	.	.	.	.	.	.	.	C	13.36	2.214238	0.39102	.	.	ENSG00000107104	ENST00000382303;ENST00000354485;ENST00000382297;ENST00000382293	T;T;T	0.79749	-1.3;-1.3;-1.3	5.96	4.12	0.48240	.	0.084429	0.51477	D	0.000086	T	0.78310	0.4263	L	0.54323	1.7	0.80722	D	1	D;P	0.54397	0.966;0.902	B;P	0.47470	0.445;0.548	T	0.77469	-0.2576	10	0.40728	T	0.16	-17.5898	10.1948	0.43047	0.0:0.7926:0.0:0.2074	.	604;604	Q5W0W1;Q14678	.;KANK1_HUMAN	R	604;604;604;446	ENSP00000371740:S604R;ENSP00000371734:S604R;ENSP00000371730:S446R	ENSP00000346479:S604R	S	+	3	2	KANK1	702578	0.999000	0.42202	1.000000	0.80357	0.993000	0.82548	0.722000	0.25925	1.537000	0.49254	-0.145000	0.13849	AGC		0.493	KANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051484.2		NM_015158	
KIF17	57576	hgsc.bcm.edu	37	1	21042033	21042033	+	Missense_Mutation	SNP	T	T	C	rs35835983	byFrequency	TCGA-BP-4347-01A-01D-1366-10	TCGA-BP-4347-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	249697ef-19f1-4d5e-8182-1eb1b5c38ec1	e453d958-081b-4680-a2ec-1e14aa549c08	g.chr1:21042033T>C	ENST00000247986.2	-	2	641	c.331A>G	c.(331-333)Aga>Gga	p.R111G	KIF17_ENST00000400463.3_Missense_Mutation_p.R111G|KIF17_ENST00000375044.1_Missense_Mutation_p.R11G			Q9P2E2	KIF17_HUMAN	kinesin family member 17	111	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cell projection organization (GO:0030030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|protein complex localization (GO:0031503)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		ATGATGCCTCTCTGGGAGGGC	0.662													T|||	33	0.00658946	0.0015	0.0058	5008	,	,		19393	0.0		0.0249	False		,,,				2504	0.002																0								T	GLY/ARG,GLY/ARG	10,4396	16.8+/-37.8	0,10,2193	87.0	77.0	80.0		331,331	2.3	0.1	1	dbSNP_126	80	135,8465	67.7+/-130.1	3,129,4168	yes	missense,missense	KIF17	NM_001122819.1,NM_020816.2	125,125	3,139,6361	CC,CT,TT		1.5698,0.227,1.1149	probably-damaging,probably-damaging	111/1029,111/1030	21042033	145,12861	2203	4300	6503	SO:0001583	missense	57576			AB037826	CCDS213.1, CCDS44079.1, CCDS72722.1	1p36.13	2012-08-01			ENSG00000117245	ENSG00000117245		"""Kinesins"""	19167	protein-coding gene	gene with protein product	"""kinesin-like protein KIF17"", ""KIF3-related motor protein"", ""KIF17 variant protein"""	605037				10846156	Standard	XR_241202		Approved	KIAA1405, KIF3X, KIF17B, OSM-3, KLP-2	uc001bdr.4	Q9P2E2	OTTHUMG00000002863	ENST00000247986.2:c.331A>G	1.37:g.21042033T>C	ENSP00000247986:p.Arg111Gly	Somatic		WXS	SOLID	Phase_I	A2A3Q7|A2A3Q8|O95077|Q53YS6|Q5VWA9|Q6GSA8|Q8N411	Missense_Mutation	SNP	ENST00000247986.2	37	CCDS213.1	28	0.01282051282051282	1	0.0020325203252032522	5	0.013812154696132596	0	0.0	22	0.029023746701846966	T	16.03	3.008129	0.54361	0.00227	0.015698	ENSG00000117245	ENST00000375044;ENST00000400463;ENST00000247986	T;T;T	0.75477	-0.94;-0.94;-0.94	4.75	2.27	0.28462	Kinesin, motor domain (4);	0.231808	0.21774	U	0.069308	T	0.63450	0.2512	M	0.87827	2.91	0.41702	D	0.989409	P;D	0.58620	0.944;0.983	P;P	0.55161	0.596;0.77	T	0.73588	-0.3935	10	0.87932	D	0	.	6.4479	0.21887	0.1454:0.0:0.383:0.4716	rs35835983	111;111	Q9P2E2-3;Q9P2E2	.;KIF17_HUMAN	G	11;111;111	ENSP00000364184:R11G;ENSP00000383311:R111G;ENSP00000247986:R111G	ENSP00000247986:R111G	R	-	1	2	KIF17	20914620	0.972000	0.33761	0.110000	0.21437	0.548000	0.35241	1.358000	0.34102	0.245000	0.21373	0.533000	0.62120	AGA		0.662	KIF17-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276995.1		NM_020816	
L1CAM	3897	hgsc.bcm.edu	37	X	153131185	153131185	+	Missense_Mutation	SNP	C	C	A			TCGA-BP-4347-01A-01D-1366-10	TCGA-BP-4347-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	249697ef-19f1-4d5e-8182-1eb1b5c38ec1	e453d958-081b-4680-a2ec-1e14aa549c08	g.chrX:153131185C>A	ENST00000370060.1	-	20	2710	c.2521G>T	c.(2521-2523)Gtc>Ttc	p.V841F	L1CAM_ENST00000370057.3_Missense_Mutation_p.V841F|L1CAM_ENST00000370055.1_Missense_Mutation_p.V836F|L1CAM_ENST00000361699.4_Missense_Mutation_p.V841F|L1CAM_ENST00000543994.1_Missense_Mutation_p.V843F|L1CAM_ENST00000361981.3_Missense_Mutation_p.V836F|L1CAM_ENST00000538883.1_Missense_Mutation_p.V843F	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule	841	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TGGCCCTTGACCTGGGCCAGG	0.602																																																	0													90.0	94.0	93.0					X																	153131185		2203	4300	6503	SO:0001583	missense	3897			M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.2521G>T	X.37:g.153131185C>A	ENSP00000359077:p.Val841Phe	Somatic		WXS	SOLID	Phase_I	A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	Missense_Mutation	SNP	ENST00000370060.1	37	CCDS14733.1	.	.	.	.	.	.	.	.	.	.	C	17.89	3.499783	0.64298	.	.	ENSG00000198910	ENST00000370060;ENST00000543994;ENST00000370057;ENST00000538883;ENST00000361981;ENST00000370055;ENST00000361699	T;T;T;T;T;T;T	0.57595	0.39;0.39;0.39;0.39;0.39;0.39;0.39	4.49	4.49	0.54785	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.157170	0.29660	N	0.011523	T	0.69024	0.3065	M	0.75150	2.29	0.54753	D	0.999982	D;D;D	0.89917	1.0;0.976;1.0	D;P;D	0.87578	0.997;0.844;0.998	T	0.71991	-0.4425	10	0.72032	D	0.01	.	9.4193	0.38541	0.2123:0.7877:0.0:0.0	.	836;841;841	G3XAF4;P32004-2;P32004	.;.;L1CAM_HUMAN	F	841;843;841;843;836;836;841	ENSP00000359077:V841F;ENSP00000438430:V843F;ENSP00000359074:V841F;ENSP00000439645:V843F;ENSP00000354712:V836F;ENSP00000359072:V836F;ENSP00000355380:V841F	ENSP00000355380:V841F	V	-	1	0	L1CAM	152784379	1.000000	0.71417	1.000000	0.80357	0.729000	0.41735	2.491000	0.45303	1.951000	0.56629	0.436000	0.28706	GTC		0.602	L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061094.2		NM_024003	
MAST1	22983	hgsc.bcm.edu	37	19	12975920	12975920	+	Silent	SNP	G	G	T	rs201939350	byFrequency	TCGA-BP-4347-01A-01D-1366-10	TCGA-BP-4347-11A-01D-1366-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	249697ef-19f1-4d5e-8182-1eb1b5c38ec1	e453d958-081b-4680-a2ec-1e14aa549c08	g.chr19:12975920G>T	ENST00000251472.4	+	14	1605	c.1566G>T	c.(1564-1566)ggG>ggT	p.G522G		NM_014975.2	NP_055790.1			microtubule associated serine/threonine kinase 1											NS(1)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(20)|ovary(5)|prostate(5)|skin(3)	56						CCAAGATGGGGCTCATGAGCC	0.577																																																	0													123.0	106.0	112.0					19																	12975920		2203	4300	6503	SO:0001819	synonymous_variant	22983			AB023190	CCDS32921.1	19p13.2	2008-02-05				ENSG00000105613			19034	protein-coding gene	gene with protein product		612256					Standard	NM_014975		Approved	SAST, KIAA0973	uc002mvm.3	Q9Y2H9		ENST00000251472.4:c.1566G>T	19.37:g.12975920G>T		Somatic		WXS	SOLID	Phase_I		Silent	SNP	ENST00000251472.4	37	CCDS32921.1																																																																																				0.577	MAST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451733.2		NM_014975	
MFSD10	10227	hgsc.bcm.edu;ucsc.edu	37	4	2933580	2933580	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4347-01A-01D-1366-10	TCGA-BP-4347-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	249697ef-19f1-4d5e-8182-1eb1b5c38ec1	e453d958-081b-4680-a2ec-1e14aa549c08	g.chr4:2933580G>A	ENST00000329687.4	-	7	1420	c.886C>T	c.(886-888)Ctc>Ttc	p.L296F	MFSD10_ENST00000507555.1_Missense_Mutation_p.L296F|MFSD10_ENST00000355443.4_Missense_Mutation_p.L296F|MFSD10_ENST00000508221.1_Missense_Mutation_p.L296F|MFSD10_ENST00000514800.1_Missense_Mutation_p.L296F	NM_001120.4	NP_001111.3	Q14728	MFS10_HUMAN	major facilitator superfamily domain containing 10	296					apoptotic process (GO:0006915)|tetracycline transport (GO:0015904)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)	tetracycline transporter activity (GO:0008493)			breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|skin(1)	7				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		TGGTGTGTGAGGAAGCTCAGC	0.627																																																	0													53.0	55.0	55.0					4																	2933580		2202	4299	6501	SO:0001583	missense	10227			L11669	CCDS3365.1	4p16.3	2008-03-03			ENSG00000109736	ENSG00000109736			16894	protein-coding gene	gene with protein product	"""tetracycline transporter like protein"""	610977				8353488, 17362938	Standard	NM_001120		Approved	TETRAN, IT10C3	uc003gfz.3	Q14728	OTTHUMG00000122081	ENST00000329687.4:c.886C>T	4.37:g.2933580G>A	ENSP00000332646:p.Leu296Phe	Somatic		WXS	SOLID	Phase_I	Q07706	Missense_Mutation	SNP	ENST00000329687.4	37	CCDS3365.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.705022	0.88924	.	.	ENSG00000109736	ENST00000514800;ENST00000355443;ENST00000329687;ENST00000508221;ENST00000507555	T;T;T;T;T	0.54866	0.55;0.55;0.55;0.55;0.55	4.68	3.77	0.43336	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.071170	0.56097	D	0.000023	T	0.66187	0.2764	L	0.55213	1.73	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.997;0.999	T	0.66756	-0.5843	10	0.44086	T	0.13	-21.3635	14.1726	0.65519	0.0:0.1508:0.8492:0.0	.	296;296;296;296	D6RIZ4;D6RE79;D6RA47;Q14728	.;.;.;MFS10_HUMAN	F	296	ENSP00000426907:L296F;ENSP00000347619:L296F;ENSP00000332646:L296F;ENSP00000425757:L296F;ENSP00000423402:L296F	ENSP00000332646:L296F	L	-	1	0	MFSD10	2903378	1.000000	0.71417	0.988000	0.46212	0.984000	0.73092	5.037000	0.64170	2.134000	0.65973	0.555000	0.69702	CTC		0.627	MFSD10-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358072.2		NM_001120	
MIPEP	4285	hgsc.bcm.edu	37	13	24411774	24411774	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4347-01A-01D-1366-10	TCGA-BP-4347-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	249697ef-19f1-4d5e-8182-1eb1b5c38ec1	e453d958-081b-4680-a2ec-1e14aa549c08	g.chr13:24411774G>T	ENST00000382172.3	-	13	1558	c.1460C>A	c.(1459-1461)cCt>cAt	p.P487H		NM_005932.3	NP_005923	Q99797	MIPEP_HUMAN	mitochondrial intermediate peptidase	487					protein processing involved in protein targeting to mitochondrion (GO:0006627)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|liver(1)|lung(12)|prostate(2)|skin(1)	27		all_cancers(29;1.83e-22)|all_epithelial(30;8.75e-19)|all_lung(29;9.17e-18)|Lung SC(185;0.0225)|Breast(139;0.14)		all cancers(112;0.00389)|Epithelial(112;0.0266)|OV - Ovarian serous cystadenocarcinoma(117;0.0717)|Lung(94;0.207)|GBM - Glioblastoma multiforme(144;0.232)		CATCATGCTAGGAGTTAGCAA	0.468																																																	0													151.0	143.0	146.0					13																	24411774		2203	4300	6503	SO:0001583	missense	4285				CCDS9303.1	13q12	2011-01-17			ENSG00000027001	ENSG00000027001	3.4.24.59		7104	protein-coding gene	gene with protein product		602241				9073519	Standard	NM_005932		Approved	MIP	uc001uox.4	Q99797	OTTHUMG00000016573	ENST00000382172.3:c.1460C>A	13.37:g.24411774G>T	ENSP00000371607:p.Pro487His	Somatic		WXS	SOLID	Phase_I	Q5JV15|Q5T9Q9|Q96G65	Missense_Mutation	SNP	ENST00000382172.3	37	CCDS9303.1	.	.	.	.	.	.	.	.	.	.	G	27.2	4.810462	0.90707	.	.	ENSG00000027001	ENST00000382172	T	0.09817	2.94	5.82	5.82	0.92795	Metallopeptidase, catalytic domain (1);	0.046538	0.85682	D	0.000000	T	0.18676	0.0448	N	0.25789	0.76	0.80722	D	1	P	0.49862	0.929	P	0.59357	0.856	T	0.05649	-1.0872	10	0.11182	T	0.66	.	20.1022	0.97879	0.0:0.0:1.0:0.0	.	487	Q99797	MIPEP_HUMAN	H	487	ENSP00000371607:P487H	ENSP00000371607:P487H	P	-	2	0	MIPEP	23309774	1.000000	0.71417	0.991000	0.47740	0.899000	0.52679	9.727000	0.98787	2.759000	0.94783	0.555000	0.69702	CCT		0.468	MIPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044169.1			
NAB2	4665	hgsc.bcm.edu;ucsc.edu	37	12	57485620	57485620	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4347-01A-01D-1366-10	TCGA-BP-4347-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	249697ef-19f1-4d5e-8182-1eb1b5c38ec1	e453d958-081b-4680-a2ec-1e14aa549c08	g.chr12:57485620T>C	ENST00000300131.3	+	2	1174	c.796T>C	c.(796-798)Tcc>Ccc	p.S266P	NAB2_ENST00000357680.4_Missense_Mutation_p.S266P|NAB2_ENST00000342556.6_Missense_Mutation_p.S266P	NM_005967.3	NP_005958.1	Q15742	NAB2_HUMAN	NGFI-A binding protein 2 (EGR1 binding protein 2)	266					cell proliferation (GO:0008283)|endochondral ossification (GO:0001958)|myelination (GO:0042552)|negative regulation of transcription from RNA polymerase III promoter (GO:0016480)|nervous system development (GO:0007399)|regulation of epidermis development (GO:0045682)|Schwann cell differentiation (GO:0014037)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	20						GGAGGTCACATCCCTGCTAAA	0.542																																																	0													119.0	123.0	122.0					12																	57485620		2203	4300	6503	SO:0001583	missense	4665			BC065931	CCDS8930.1	12q13.3	2008-05-14				ENSG00000166886			7627	protein-coding gene	gene with protein product		602381				8668170, 8649813	Standard	XM_005268894		Approved	MADER	uc001smz.3	Q15742		ENST00000300131.3:c.796T>C	12.37:g.57485620T>C	ENSP00000300131:p.Ser266Pro	Somatic		WXS	SOLID	Phase_I	B2RAK3|O76006|Q14797	Missense_Mutation	SNP	ENST00000300131.3	37	CCDS8930.1	.	.	.	.	.	.	.	.	.	.	T	16.92	3.254116	0.59212	.	.	ENSG00000166886	ENST00000300131;ENST00000342556;ENST00000357680	.	.	.	4.35	4.35	0.52113	NAB co-repressor, domain (1);	0.078821	0.52532	D	0.000078	T	0.63534	0.2519	L	0.40543	1.245	0.37523	D	0.917618	D	0.64830	0.994	D	0.63033	0.91	T	0.68383	-0.5423	9	0.49607	T	0.09	-15.0324	11.5334	0.50624	0.0:0.0:0.0:1.0	.	266	Q15742	NAB2_HUMAN	P	266	.	ENSP00000300131:S266P	S	+	1	0	NAB2	55771887	0.098000	0.21812	0.935000	0.37517	0.994000	0.84299	2.342000	0.43992	1.805000	0.52779	0.379000	0.24179	TCC		0.542	NAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412222.1		NM_005967	
NARS2	79731	hgsc.bcm.edu;ucsc.edu	37	11	78152161	78152161	+	Missense_Mutation	SNP	G	G	A			TCGA-BP-4347-01A-01D-1366-10	TCGA-BP-4347-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	249697ef-19f1-4d5e-8182-1eb1b5c38ec1	e453d958-081b-4680-a2ec-1e14aa549c08	g.chr11:78152161G>A	ENST00000281038.5	-	13	1640	c.1265C>T	c.(1264-1266)tCg>tTg	p.S422L	NARS2_ENST00000528850.1_Missense_Mutation_p.S195L|RP11-452H21.1_ENST00000534168.1_RNA	NM_001243251.1|NM_024678.5	NP_001230180.1|NP_078954.4	Q96I59	SYNM_HUMAN	asparaginyl-tRNA synthetase 2, mitochondrial (putative)	422					asparaginyl-tRNA aminoacylation (GO:0006421)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrion (GO:0005739)	asparagine-tRNA ligase activity (GO:0004816)|ATP binding (GO:0005524)|nucleic acid binding (GO:0003676)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(9)|ovary(2)|prostate(2)|skin(1)	27	all_cancers(14;2.63e-17)|all_epithelial(13;1.85e-19)				L-Asparagine(DB00174)	TGTAAGTCCCGATCTGTTTAA	0.368																																																	0													116.0	117.0	117.0					11																	78152161		2200	4292	6492	SO:0001583	missense	79731			BC007800	CCDS8261.1, CCDS58164.1	11q14.1	2011-07-01	2007-02-23		ENSG00000137513	ENSG00000137513	6.1.1.22	"""Aminoacyl tRNA synthetases / Class II"""	26274	protein-coding gene	gene with protein product	"""asparagine tRNA ligase 2, mitochondrial (putative)"""	612803				15779907	Standard	NM_024678		Approved	FLJ23441, SLM5	uc001ozi.3	Q96I59	OTTHUMG00000166702	ENST00000281038.5:c.1265C>T	11.37:g.78152161G>A	ENSP00000281038:p.Ser422Leu	Somatic		WXS	SOLID	Phase_I	G3V178	Missense_Mutation	SNP	ENST00000281038.5	37	CCDS8261.1	.	.	.	.	.	.	.	.	.	.	G	0.159	-1.083307	0.01888	.	.	ENSG00000137513	ENST00000281038;ENST00000528850	T;T	0.78126	-1.15;-1.15	5.27	-1.86	0.07760	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (D/K/N) (1);	0.948669	0.08800	N	0.891972	T	0.36908	0.0984	N	0.00155	-1.965	0.23882	N	0.996571	B	0.06786	0.001	B	0.04013	0.001	T	0.40021	-0.9585	10	0.09084	T	0.74	4.2631	11.0309	0.47772	0.7865:0.0:0.2135:0.0	.	422	Q96I59	SYNM_HUMAN	L	422;195	ENSP00000281038:S422L;ENSP00000432635:S195L	ENSP00000281038:S422L	S	-	2	0	NARS2	77829809	0.071000	0.21146	0.930000	0.37139	0.234000	0.25298	-0.038000	0.12144	-0.166000	0.10890	-0.136000	0.14681	TCG		0.368	NARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391138.2		NM_024678	
POLI	11201	hgsc.bcm.edu;ucsc.edu	37	18	51804217	51804217	+	Missense_Mutation	SNP	A	A	G	rs3218785	byFrequency	TCGA-BP-4347-01A-01D-1366-10	TCGA-BP-4347-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	249697ef-19f1-4d5e-8182-1eb1b5c38ec1	e453d958-081b-4680-a2ec-1e14aa549c08	g.chr18:51804217A>G	ENST00000579534.1	+	4	694	c.551A>G	c.(550-552)aAt>aGt	p.N184S	POLI_ENST00000406285.3_Missense_Mutation_p.N184S|POLI_ENST00000217800.5_Missense_Mutation_p.N58S|POLI_ENST00000579434.1_Missense_Mutation_p.N81S	NM_007195.2	NP_009126.2	Q9UNA4	POLI_HUMAN	polymerase (DNA directed) iota	184	UmuC. {ECO:0000255|PROSITE- ProRule:PRU00216}.				DNA repair (GO:0006281)|DNA-dependent DNA replication (GO:0006261)	intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(5)|ovary(3)|urinary_tract(1)	26				Colorectal(16;0.0234)|READ - Rectum adenocarcinoma(59;0.197)		CATGTATACAATAATCAGTGT	0.383								DNA polymerases (catalytic subunits)																																									0													102.0	95.0	97.0					18																	51804217		2203	4300	6503	SO:0001583	missense	11201				CCDS11954.2	18q21.1	2012-05-18			ENSG00000101751	ENSG00000101751		"""DNA polymerases"""	9182	protein-coding gene	gene with protein product		605252		RAD3OB, RAD30B		17609217	Standard	NM_007195		Approved		uc002lfj.4	Q9UNA4	OTTHUMG00000132704	ENST00000579534.1:c.551A>G	18.37:g.51804217A>G	ENSP00000462664:p.Asn184Ser	Somatic		WXS	SOLID	Phase_I	Q8N590|Q9H0S1|Q9NYH6	Missense_Mutation	SNP	ENST00000579534.1	37	CCDS11954.2	.	.	.	.	.	.	.	.	.	.	A	8.897	0.955506	0.18507	.	.	ENSG00000101751	ENST00000406285;ENST00000217800	T	0.21543	2.0	5.66	4.51	0.55191	DNA-repair protein, UmuC-like, N-terminal (1);DNA-repair protein, UmuC-like (1);	0.103312	0.64402	D	0.000007	T	0.08891	0.0220	N	0.02539	-0.55	0.40882	D	0.984008	B;B	0.31769	0.339;0.11	B;B	0.39419	0.299;0.016	T	0.25187	-1.0139	10	0.08381	T	0.77	-18.0841	7.9437	0.29974	0.8397:0.0:0.1603:0.0	.	183;184	B7Z780;Q9UNA4	.;POLI_HUMAN	S	184	ENSP00000385196:N184S	ENSP00000217800:N184S	N	+	2	0	POLI	50058215	1.000000	0.71417	0.085000	0.20634	0.677000	0.39632	2.457000	0.45005	0.999000	0.39023	0.482000	0.46254	AAT		0.383	POLI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256002.3		NM_007195	
PRKCE	5581	hgsc.bcm.edu	37	2	46203638	46203638	+	Silent	SNP	G	G	A			TCGA-BP-4347-01A-01D-1366-10	TCGA-BP-4347-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	249697ef-19f1-4d5e-8182-1eb1b5c38ec1	e453d958-081b-4680-a2ec-1e14aa549c08	g.chr2:46203638G>A	ENST00000306156.3	+	3	810	c.483G>A	c.(481-483)agG>agA	p.R161R		NM_005400.2	NP_005391.1	Q02156	KPCE_HUMAN	protein kinase C, epsilon	161					activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|cellular response to ethanol (GO:0071361)|cellular response to hypoxia (GO:0071456)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|locomotory exploration behavior (GO:0035641)|macrophage activation involved in immune response (GO:0002281)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cellular glucuronidation (GO:2001031)|positive regulation of cytokinesis (GO:0032467)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of insulin secretion (GO:0032024)|positive regulation of lipid catabolic process (GO:0050996)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mucus secretion (GO:0070257)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|release of sequestered calcium ion into cytosol (GO:0051209)|response to morphine (GO:0043278)|signal transduction (GO:0007165)|TRAM-dependent toll-like receptor 4 signaling pathway (GO:0035669)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|ethanol binding (GO:0035276)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|receptor activator activity (GO:0030546)|signal transducer activity (GO:0004871)		MBOAT2/PRKCE(2)	breast(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(13)|ovary(3)|upper_aerodigestive_tract(2)	34		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)		Tamoxifen(DB00675)	GGGCCGTCAGGCGCAGGGTCC	0.582																																																	0													59.0	68.0	65.0					2																	46203638		2185	4284	6469	SO:0001819	synonymous_variant	5581				CCDS1824.1	2p21	2009-07-10			ENSG00000171132	ENSG00000171132	2.7.11.1		9401	protein-coding gene	gene with protein product		176975				1382605, 7877991	Standard	NM_005400		Approved		uc002rut.3	Q02156	OTTHUMG00000128817	ENST00000306156.3:c.483G>A	2.37:g.46203638G>A		Somatic		WXS	SOLID	Phase_I	B0LPH7|Q32MQ3|Q53SL4|Q53SM5|Q9UE81	Silent	SNP	ENST00000306156.3	37	CCDS1824.1																																																																																				0.582	PRKCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250751.2			
PRSS48	345062	hgsc.bcm.edu	37	4	152201018	152201019	+	Frame_Shift_Ins	INS	-	-	CAGGT	rs148861921|rs71901196|rs77216366	byFrequency	TCGA-BP-4347-01A-01D-1366-10	TCGA-BP-4347-11A-01D-1366-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	249697ef-19f1-4d5e-8182-1eb1b5c38ec1	e453d958-081b-4680-a2ec-1e14aa549c08	g.chr4:152201018_152201019insCAGGT	ENST00000455694.2	+	2	125_126	c.123_124insCAGGT	c.(124-126)cagfs	p.-43fs	PRSS48_ENST00000441586.2_Intron|SH3D19_ENST00000604030.1_Intron	NM_183375.2	NP_899231.2	Q7RTY5	PRS48_HUMAN	protease, serine, 48							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			kidney(1)|large_intestine(2)|lung(2)|prostate(2)|urinary_tract(1)	8						GCTGGCCTTGGCAGGTCAGCCT	0.53														1064	0.21246	0.0787	0.2464	5008	,	,		20396	0.1766		0.4205	False		,,,				2504	0.1922																0										524,3274		60,404,1435						5.0	1.0		dbSNP_130	113	3418,4526		764,1890,1318	no	frameshift	PRSS48	NM_183375.2		824,2294,2753	A1A1,A1R,RR		43.0262,13.7967,33.5718				3942,7800				SO:0001589	frameshift_variant	345062			BN000134	CCDS47145.1	4q31.3	2010-05-07			ENSG00000189099	ENSG00000189099		"""Serine peptidases / Serine peptidases"""	24635	protein-coding gene	gene with protein product						12838346	Standard	NM_183375		Approved	ESSPL	uc011cif.2	Q7RTY5	OTTHUMG00000161673	ENST00000455694.2:c.124_128dupCAGGT	4.37:g.152201019_152201023dupCAGGT	ENSP00000401328:p.Val43fs	Somatic		WXS	SOLID	Phase_I	Q08E82|Q0VAD4	Frame_Shift_Ins	INS	ENST00000455694.2	37	CCDS47145.1																																																																																				0.530	PRSS48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365685.3		NM_183375	
PSMD1	5707	hgsc.bcm.edu;ucsc.edu	37	2	231937037	231937037	+	Silent	SNP	T	T	A			TCGA-BP-4347-01A-01D-1366-10	TCGA-BP-4347-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	249697ef-19f1-4d5e-8182-1eb1b5c38ec1	e453d958-081b-4680-a2ec-1e14aa549c08	g.chr2:231937037T>A	ENST00000308696.6	+	7	951	c.789T>A	c.(787-789)tcT>tcA	p.S263S	PSMD1_ENST00000409643.1_Silent_p.S263S|PSMD1_ENST00000373635.4_Silent_p.S263S	NM_002807.3	NP_002798.2	Q99460	PSMD1_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 1	263					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	enzyme regulator activity (GO:0030234)			breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)	31		Ovarian(221;0.000626)|Medulloblastoma(418;0.0109)|Renal(207;0.0112)|Lung NSC(271;0.0538)|all_lung(227;0.0713)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;4e-26)|LUSC - Lung squamous cell carcinoma(224;0.0138)|Lung(119;0.0168)	Bortezomib(DB00188)	TTTTGTCATCTGTAATCCAGA	0.423																																																	0													208.0	206.0	207.0					2																	231937037		2203	4300	6503	SO:0001819	synonymous_variant	5707			D44466	CCDS2482.1, CCDS54436.1	2q37.1	2008-05-22			ENSG00000173692	ENSG00000173692		"""Proteasome (prosome, macropain) subunits"""	9554	protein-coding gene	gene with protein product						8816993	Standard	NM_002807		Approved	S1, P112, Rpn2	uc002vrn.2	Q99460	OTTHUMG00000133223	ENST00000308696.6:c.789T>A	2.37:g.231937037T>A		Somatic		WXS	SOLID	Phase_I	B8ZZH9|Q24JU0|Q53TI2|Q6GMU5|Q6P2P4|Q6PJM7|Q6PKG9|Q86VU1|Q8IV79	Silent	SNP	ENST00000308696.6	37	CCDS2482.1																																																																																				0.423	PSMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256958.2			
PTER	9317	hgsc.bcm.edu;ucsc.edu	37	10	16547025	16547025	+	Silent	SNP	T	T	C			TCGA-BP-4347-01A-01D-1366-10	TCGA-BP-4347-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	249697ef-19f1-4d5e-8182-1eb1b5c38ec1	e453d958-081b-4680-a2ec-1e14aa549c08	g.chr10:16547025T>C	ENST00000378000.1	+	5	951	c.705T>C	c.(703-705)atT>atC	p.I235I	PTER_ENST00000423462.2_Intron|PTER_ENST00000298942.3_Silent_p.I235I|PTER_ENST00000535784.2_Silent_p.I235I	NM_001001484.2|NM_001261838.1|NM_030664.4	NP_001001484.1|NP_001248767.1|NP_109589.2	Q96BW5	PTER_HUMAN	phosphotriesterase related	235					catabolic process (GO:0009056)|epithelial cell differentiation (GO:0030855)	extracellular vesicular exosome (GO:0070062)	hydrolase activity, acting on ester bonds (GO:0016788)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(2)	15						CTAGGACTATTCTTGATAAGA	0.383																																					Ovarian(2;46 150 15648 38137 47908)												0													177.0	168.0	171.0					10																	16547025		2203	4300	6503	SO:0001819	synonymous_variant	9317			BC015092	CCDS7111.1, CCDS58070.1, CCDS73070.1	10p12	2003-11-05			ENSG00000165983	ENSG00000165983			9590	protein-coding gene	gene with protein product		604446				9925913	Standard	NM_001001484		Approved		uc001ioi.2	Q96BW5	OTTHUMG00000017737	ENST00000378000.1:c.705T>C	10.37:g.16547025T>C		Somatic		WXS	SOLID	Phase_I	B0YJ77|B3KTF5|D3DRU0|Q9BY46	Silent	SNP	ENST00000378000.1	37	CCDS7111.1																																																																																				0.383	PTER-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047001.2		NM_030664	
RNF113B	140432	hgsc.bcm.edu	37	13	98828965	98828965	+	Missense_Mutation	SNP	G	G	T			TCGA-BP-4347-01A-01D-1366-10	TCGA-BP-4347-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	249697ef-19f1-4d5e-8182-1eb1b5c38ec1	e453d958-081b-4680-a2ec-1e14aa549c08	g.chr13:98828965G>T	ENST00000267291.6	-	1	554	c.526C>A	c.(526-528)Ccc>Acc	p.P176T	FARP1_ENST00000376586.2_Intron|FARP1_ENST00000319562.6_Intron|FARP1_ENST00000595437.1_Intron|FARP1_ENST00000376581.5_Intron	NM_178861.4	NP_849192.1	Q8IZP6	R113B_HUMAN	ring finger protein 113B	176							zinc ion binding (GO:0008270)	p.P176S(1)		breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	18	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.13)			GCACGTATGGGGCCCTTCCTC	0.617																																																	1	Substitution - Missense(1)	central_nervous_system(1)											82.0	70.0	74.0					13																	98828965		2203	4300	6503	SO:0001583	missense	140432			AF539427	CCDS9486.1	13q32.2	2006-08-22	2005-03-22	2005-03-22	ENSG00000139797	ENSG00000139797		"""RING-type (C3HC4) zinc fingers"""	17267	protein-coding gene	gene with protein product			"""zinc finger protein 183-like 1"""	ZNF183L1			Standard	NM_178861		Approved	RNF161	uc001vnk.3	Q8IZP6	OTTHUMG00000017245	ENST00000267291.6:c.526C>A	13.37:g.98828965G>T	ENSP00000267291:p.Pro176Thr	Somatic		WXS	SOLID	Phase_I	Q8WWF9|Q96QY9	Missense_Mutation	SNP	ENST00000267291.6	37	CCDS9486.1	.	.	.	.	.	.	.	.	.	.	G	12.57	1.979142	0.34942	.	.	ENSG00000139797	ENST00000267291	T	0.52754	0.65	1.16	1.16	0.20824	.	0.215793	0.38959	U	0.001509	T	0.70046	0.3179	M	0.92219	3.285	0.46317	D	0.998981	D	0.89917	1.0	D	0.80764	0.994	T	0.73347	-0.4011	10	0.87932	D	0	.	8.184	0.31328	0.0:0.0:1.0:0.0	.	176	Q8IZP6	R113B_HUMAN	T	176	ENSP00000267291:P176T	ENSP00000267291:P176T	P	-	1	0	RNF113B	97626966	1.000000	0.71417	0.997000	0.53966	0.451000	0.32288	4.546000	0.60705	0.936000	0.37367	0.484000	0.47621	CCC		0.617	RNF113B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045536.3		NM_178861	
RRP12	23223	hgsc.bcm.edu;ucsc.edu	37	10	99148128	99148128	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BP-4347-01A-01D-1366-10	TCGA-BP-4347-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	249697ef-19f1-4d5e-8182-1eb1b5c38ec1	e453d958-081b-4680-a2ec-1e14aa549c08	g.chr10:99148128C>A	ENST00000370992.4	-	8	1009	c.898G>T	c.(898-900)Gag>Tag	p.E300*	RRP12_ENST00000414986.1_Nonsense_Mutation_p.E239*|RRP12_ENST00000536831.1_Intron|RRP12_ENST00000315563.6_Nonsense_Mutation_p.E200*	NM_015179.3	NP_055994.2	Q5JTH9	RRP12_HUMAN	ribosomal RNA processing 12 homolog (S. cerevisiae)	300						integral component of membrane (GO:0016021)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(2)|lung(13)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	37		Colorectal(252;0.162)		Epithelial(162;2.72e-09)|all cancers(201;1.76e-07)		GTGGTGGCCTCCTTGGAGCCT	0.632																																																	0													73.0	72.0	72.0					10																	99148128		2203	4300	6503	SO:0001587	stop_gained	23223				CCDS7457.1, CCDS44467.1, CCDS60605.1	10q24.2	2006-11-06	2006-11-06	2006-11-06	ENSG00000052749	ENSG00000052749			29100	protein-coding gene	gene with protein product			"""KIAA0690"""	KIAA0690		9734811	Standard	NM_015179		Approved		uc001knf.3	Q5JTH9	OTTHUMG00000018855	ENST00000370992.4:c.898G>T	10.37:g.99148128C>A	ENSP00000360031:p.Glu300*	Somatic		WXS	SOLID	Phase_I	B4DK00|E9PCK7|Q5JTH8|Q69YK4|Q96E87|Q9BUH3|Q9Y4C7	Nonsense_Mutation	SNP	ENST00000370992.4	37	CCDS7457.1	.	.	.	.	.	.	.	.	.	.	C	39	7.679027	0.98428	.	.	ENSG00000052749	ENST00000370992;ENST00000315563;ENST00000414986	.	.	.	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.13470	T	0.59	-35.4637	19.7274	0.96170	0.0:1.0:0.0:0.0	.	.	.	.	X	300;200;239	.	ENSP00000324315:E200X	E	-	1	0	RRP12	99138118	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.811000	0.69187	2.662000	0.90505	0.561000	0.74099	GAG		0.632	RRP12-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049699.4		NM_015179	
SART3	9733	hgsc.bcm.edu;ucsc.edu	37	12	108929189	108929189	+	Missense_Mutation	SNP	G	G	C			TCGA-BP-4347-01A-01D-1366-10	TCGA-BP-4347-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	249697ef-19f1-4d5e-8182-1eb1b5c38ec1	e453d958-081b-4680-a2ec-1e14aa549c08	g.chr12:108929189G>C	ENST00000228284.3	-	12	1736	c.1502C>G	c.(1501-1503)aCc>aGc	p.T501S	SART3_ENST00000431469.2_Missense_Mutation_p.T465S	NM_014706.3	NP_055521.1	Q15020	SART3_HUMAN	squamous cell carcinoma antigen recognized by T cells 3	501					cell morphogenesis (GO:0000902)|hematopoietic stem cell proliferation (GO:0071425)|homeostasis of number of cells (GO:0048872)|regulation of gene expression (GO:0010468)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|endometrium(8)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|stomach(1)	25						ATTTCCTCTGGTCATGATGCT	0.512									Porokeratosis																																								0													329.0	292.0	305.0					12																	108929189		2203	4300	6503	SO:0001583	missense	9733	Familial Cancer Database	incl.: Porokeratosis of Mibelli, Disseminated Superficial Actinic Porokertosis, Porokeratosis Palmaris Plantaris et Disseminata, Porokeratosis Punctata Palmaris et Plantaris, Linear Porokeratosis	AB020880	CCDS9117.1	12q24.11	2013-02-12	2006-12-07			ENSG00000075856		"""RNA binding motif (RRM) containing"""	16860	protein-coding gene	gene with protein product		611684	"""squamous cell carcinoma antigen recognised by T cells 3"""			12032085, 15840095, 20595234	Standard	NM_014706		Approved	KIAA0156, RP11-13G14, TIP110, p110	uc001tmz.1	Q15020	OTTHUMG00000169449	ENST00000228284.3:c.1502C>G	12.37:g.108929189G>C	ENSP00000228284:p.Thr501Ser	Somatic		WXS	SOLID	Phase_I	A8K2E4|Q2M2H0|Q58F06|Q8IUS1|Q96J95	Missense_Mutation	SNP	ENST00000228284.3	37	CCDS9117.1	.	.	.	.	.	.	.	.	.	.	G	13.02	2.111907	0.37242	.	.	ENSG00000075856	ENST00000228284;ENST00000431469;ENST00000535329;ENST00000412617;ENST00000546815	T;T;T	0.32023	1.47;1.47;1.47	5.97	5.97	0.96955	.	0.046700	0.85682	D	0.000000	T	0.19406	0.0466	N	0.11724	0.165	0.80722	D	1	B;B;B;B	0.27971	0.054;0.095;0.196;0.101	B;B;B;B	0.26416	0.028;0.069;0.032;0.047	T	0.08432	-1.0722	10	0.07175	T	0.84	-34.377	20.4238	0.99064	0.0:0.0:1.0:0.0	.	449;519;465;501	E7EMI4;F8VV04;B7ZKM0;Q15020	.;.;.;SART3_HUMAN	S	501;465;77;449;519	ENSP00000228284:T501S;ENSP00000414453:T465S;ENSP00000449386:T519S	ENSP00000228284:T501S	T	-	2	0	SART3	107453319	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.476000	0.97823	2.828000	0.97474	0.655000	0.94253	ACC		0.512	SART3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404094.1			
SCFD1	23256	hgsc.bcm.edu;ucsc.edu	37	14	31171516	31171516	+	Missense_Mutation	SNP	A	A	C			TCGA-BP-4347-01A-01D-1366-10	TCGA-BP-4347-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	249697ef-19f1-4d5e-8182-1eb1b5c38ec1	e453d958-081b-4680-a2ec-1e14aa549c08	g.chr14:31171516A>C	ENST00000458591.2	+	17	1652	c.1425A>C	c.(1423-1425)caA>caC	p.Q475H	SCFD1_ENST00000544052.2_Missense_Mutation_p.Q408H|SCFD1_ENST00000541123.1_Missense_Mutation_p.Q290H|SCFD1_ENST00000396629.2_Missense_Mutation_p.Q383H|SCFD1_ENST00000554486.1_3'UTR|SCFD1_ENST00000421551.3_Missense_Mutation_p.Q416H	NM_016106.3	NP_057190.2	Q8WVM8	SCFD1_HUMAN	sec1 family domain containing 1	475					post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|regulation of ER to Golgi vesicle-mediated transport (GO:0060628)|response to hypoxia (GO:0001666)|response to toxic substance (GO:0009636)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle docking involved in exocytosis (GO:0006904)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|Golgi transport complex (GO:0017119)|Golgi-associated vesicle (GO:0005798)|plasma membrane (GO:0005886)	syntaxin binding (GO:0019905)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)	13	Hepatocellular(127;0.0877)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)	GBM - Glioblastoma multiforme(265;0.0181)		ATTTGGAGCAATATAAAAAAG	0.269																																																	0													65.0	70.0	69.0					14																	31171516		2203	4298	6501	SO:0001583	missense	23256			AF110646	CCDS9639.1, CCDS45092.1, CCDS58308.1	14q12	2006-04-04	2004-01-15	2004-01-16	ENSG00000092108	ENSG00000092108			20726	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 163"""	C14orf163			Standard	NM_016106		Approved	RA410, KIAA0917, STXBP1L2, SLY1	uc001wqm.2	Q8WVM8	OTTHUMG00000029420	ENST00000458591.2:c.1425A>C	14.37:g.31171516A>C	ENSP00000390783:p.Gln475His	Somatic		WXS	SOLID	Phase_I	A8K2Z5|B7Z4U7|B7Z594|O60754|O94990|Q7Z529|Q9BZI3|Q9UNL3|Q9Y6A8	Missense_Mutation	SNP	ENST00000458591.2	37	CCDS9639.1	.	.	.	.	.	.	.	.	.	.	A	18.56	3.651264	0.67472	.	.	ENSG00000092108	ENST00000458591;ENST00000544052;ENST00000421551;ENST00000541123;ENST00000396629	T;T;T;T;T	0.77229	-1.08;-1.08;-1.08;-1.08;-1.08	5.06	-2.25	0.06888	.	0.000000	0.85682	D	0.000000	D	0.83440	0.5255	M	0.75777	2.31	0.51482	D	0.999928	P;P;P;P	0.40230	0.708;0.703;0.708;0.703	P;P;P;P	0.55545	0.778;0.54;0.676;0.663	D	0.83641	0.0150	10	0.72032	D	0.01	-25.9706	13.8215	0.63322	0.2672:0.0:0.7328:0.0	.	416;408;383;475	B7Z738;B7Z4U7;B7Z594;Q8WVM8	.;.;.;SCFD1_HUMAN	H	475;408;416;290;383	ENSP00000390783:Q475H;ENSP00000443010:Q408H;ENSP00000388078:Q416H;ENSP00000443537:Q290H;ENSP00000379870:Q383H	ENSP00000309417:Q483H	Q	+	3	2	SCFD1	30241267	0.997000	0.39634	0.993000	0.49108	0.997000	0.91878	0.288000	0.18939	-0.352000	0.08237	0.533000	0.62120	CAA		0.269	SCFD1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276612.3		NM_182835	
SOX13	9580	hgsc.bcm.edu	37	1	204092030	204092030	+	Missense_Mutation	SNP	G	G	A	rs200217733	byFrequency	TCGA-BP-4347-01A-01D-1366-10	TCGA-BP-4347-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	249697ef-19f1-4d5e-8182-1eb1b5c38ec1	e453d958-081b-4680-a2ec-1e14aa549c08	g.chr1:204092030G>A	ENST00000367204.1	+	10	1182	c.1073G>A	c.(1072-1074)cGg>cAg	p.R358Q		NM_005686.2	NP_005677.2	Q9UN79	SOX13_HUMAN	SRY (sex determining region Y)-box 13	358					anatomical structure morphogenesis (GO:0009653)|regulation of gamma-delta T cell differentiation (GO:0045586)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(2)|prostate(2)	13	all_cancers(21;0.0754)|Breast(84;0.116)|all_epithelial(62;0.189)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)			CAGGATGCTCGGCAGCTGCTG	0.612													G|||	2	0.000399361	0.0	0.0	5008	,	,		20529	0.0		0.001	False		,,,				2504	0.001																0								G	GLN/ARG	4,4062		0,4,2029	27.0	30.0	29.0		1073	5.3	1.0	1		29	31,8347		0,31,4158	yes	missense	SOX13	NM_005686.2	43	0,35,6187	AA,AG,GG		0.37,0.0984,0.2813	possibly-damaging	358/623	204092030	35,12409	2033	4189	6222	SO:0001583	missense	9580				CCDS44299.1	1q32	2008-07-18			ENSG00000143842	ENSG00000143842		"""SRY (sex determining region Y)-boxes"""	11192	protein-coding gene	gene with protein product	"""islet cell antibody 12"", ""SRY-related HMG-box gene 13"", ""type 1 diabetes autoantigen"", ""SRY-box 13"""	604748				10198172	Standard	NM_005686		Approved	Sox-13, ICA12, MGC117216	uc001ham.3	Q9UN79	OTTHUMG00000036050	ENST00000367204.1:c.1073G>A	1.37:g.204092030G>A	ENSP00000356172:p.Arg358Gln	Somatic		WXS	SOLID	Phase_I	B4E2B0|O95275|O95826|Q3KQV7|Q5SXX1|Q9UHW7	Missense_Mutation	SNP	ENST00000367204.1	37	CCDS44299.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	26.2	4.714567	0.89112	9.84E-4	0.0037	ENSG00000143842	ENST00000367204	D	0.98075	-4.7	5.31	5.31	0.75309	.	0.196944	0.46145	D	0.000314	D	0.97977	0.9334	L	0.49571	1.57	0.31830	N	0.624842	D;P;D	0.89917	1.0;0.499;1.0	P;B;D	0.63957	0.859;0.048;0.92	D	0.98055	1.0390	10	0.51188	T	0.08	.	18.5863	0.91191	0.0:0.0:1.0:0.0	.	225;225;358	B4DX26;B4E3N9;Q9UN79	.;.;SOX13_HUMAN	Q	358	ENSP00000356172:R358Q	ENSP00000356172:R358Q	R	+	2	0	SOX13	202358653	1.000000	0.71417	0.967000	0.41034	0.954000	0.61252	6.920000	0.75799	2.481000	0.83766	0.655000	0.94253	CGG		0.612	SOX13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087881.2		NM_005686	
SPATA24	202051	hgsc.bcm.edu;ucsc.edu	37	5	138737662	138737662	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4347-01A-01D-1366-10	TCGA-BP-4347-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	249697ef-19f1-4d5e-8182-1eb1b5c38ec1	e453d958-081b-4680-a2ec-1e14aa549c08	g.chr5:138737662C>T	ENST00000451821.2	-	3	262	c.256G>A	c.(256-258)Gga>Aga	p.G86R	SPATA24_ENST00000509959.1_Missense_Mutation_p.G64R|SPATA24_ENST00000507779.2_Missense_Mutation_p.G86R			Q86W54	SPA24_HUMAN	spermatogenesis associated 24	86					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)										TCTACCTCTCCGAGGGCAAAC	0.557																																																	0													134.0	120.0	124.0					5																	138737662		692	1591	2283	SO:0001583	missense	202051			AK098740	CCDS47274.1	5q31.2	2014-02-12	2009-09-30		ENSG00000170469	ENSG00000170469			27322	protein-coding gene	gene with protein product	"""coiled-coil domain containing 161"""					16146721	Standard	NM_194296		Approved	T6441, CCDC161	uc003lel.4	Q86W54	OTTHUMG00000163388	ENST00000451821.2:c.256G>A	5.37:g.138737662C>T	ENSP00000400524:p.Gly86Arg	Somatic		WXS	SOLID	Phase_I		Missense_Mutation	SNP	ENST00000451821.2	37		.	.	.	.	.	.	.	.	.	.	C	20.3	3.965019	0.74131	.	.	ENSG00000170469	ENST00000302091;ENST00000450845;ENST00000512761;ENST00000509959;ENST00000451821;ENST00000507779	.	.	.	5.02	5.02	0.67125	.	0.000000	0.49916	D	0.000121	T	0.64204	0.2577	L	0.27053	0.805	0.37018	D	0.896065	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.71269	-0.4643	9	0.87932	D	0	-10.72	13.7162	0.62697	0.0:1.0:0.0:0.0	.	86;86;86	Q86W54-2;Q86W54;Q8N799	.;SPA24_HUMAN;.	R	86;86;37;64;86;86	.	ENSP00000302917:G86R	G	-	1	0	SPATA24	138765561	0.994000	0.37717	0.958000	0.39756	0.910000	0.53928	4.243000	0.58721	2.612000	0.88384	0.655000	0.94253	GGA		0.557	SPATA24-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000372986.1		NM_194296	
SSC5D	284297	hgsc.bcm.edu	37	19	56011915	56011915	+	Silent	SNP	G	G	A	rs61107130	byFrequency	TCGA-BP-4347-01A-01D-1366-10	TCGA-BP-4347-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	249697ef-19f1-4d5e-8182-1eb1b5c38ec1	e453d958-081b-4680-a2ec-1e14aa549c08	g.chr19:56011915G>A	ENST00000389623.6	+	11	2384	c.2361G>A	c.(2359-2361)gtG>gtA	p.V787V	SSC5D_ENST00000587166.1_Silent_p.V787V	NM_001144950.1	NP_001138422.1	A1L4H1	SRCRL_HUMAN	scavenger receptor cysteine rich family, 5 domains	787	SRCR 5. {ECO:0000255|PROSITE- ProRule:PRU00196}.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterial lipoprotein (GO:0042494)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|negative regulation of interleukin-8 secretion (GO:2000483)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|intracellular (GO:0005622)|membrane (GO:0016020)	extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|skin(2)	4						GGCTGGAAGTGTGGCATGCCG	0.662													G|||	922	0.184105	0.0726	0.1873	5008	,	,		16639	0.3859		0.1511	False		,,,				2504	0.1585																0								G	,	87,1297		1,85,606	46.0	47.0	47.0		2361,2361	2.5	1.0	19	dbSNP_129	47	436,2746		27,382,1182	no	coding-synonymous,coding-synonymous	SSC5D	NM_001144950.1,NM_001195267.1	,	28,467,1788	AA,AG,GG		13.7021,6.2861,11.4542	,	787/1574,787/952	56011915	523,4043	692	1591	2283	SO:0001819	synonymous_variant	284297				CCDS46196.1, CCDS59424.1	19q13.42	2014-07-09	2014-07-09		ENSG00000179954	ENSG00000179954			26641	protein-coding gene	gene with protein product	"""soluble scavenger with 5 domains"""		"""scavenger receptor cysteine rich domain containing (5 domains)"""			19535143	Standard	NM_001144950		Approved	FLJ35258	uc002qlg.4	A1L4H1		ENST00000389623.6:c.2361G>A	19.37:g.56011915G>A		Somatic		WXS	SOLID	Phase_I	B5MDQ5|C7S7T9|C7S7U0|K7EP70	Silent	SNP	ENST00000389623.6	37	CCDS46196.1																																																																																				0.662	SSC5D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453345.2		XM_001718392	
TAS1R2	80834	hgsc.bcm.edu;ucsc.edu	37	1	19166613	19166613	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4347-01A-01D-1366-10	TCGA-BP-4347-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	249697ef-19f1-4d5e-8182-1eb1b5c38ec1	e453d958-081b-4680-a2ec-1e14aa549c08	g.chr1:19166613C>T	ENST00000375371.3	-	6	2021	c.2000G>A	c.(1999-2001)cGc>cAc	p.R667H		NM_152232.2	NP_689418.2	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2	667					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|sensory perception of sweet taste (GO:0050916)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(10)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(3)|stomach(1)	45		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	GCTGTAGGCGCGTGGGAAGCG	0.562																																																	0													132.0	141.0	138.0					1																	19166613		2203	4300	6503	SO:0001583	missense	80834				CCDS187.1	1p36.13	2012-08-22	2003-03-07		ENSG00000179002	ENSG00000179002		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14905	protein-coding gene	gene with protein product		606226	"""G protein-coupled receptor 71"""	GPR71			Standard	NM_152232		Approved	T1R2, TR2	uc001bba.1	Q8TE23	OTTHUMG00000002442	ENST00000375371.3:c.2000G>A	1.37:g.19166613C>T	ENSP00000364520:p.Arg667His	Somatic		WXS	SOLID	Phase_I	Q5TZ19	Missense_Mutation	SNP	ENST00000375371.3	37	CCDS187.1	.	.	.	.	.	.	.	.	.	.	C	12.56	1.974528	0.34848	.	.	ENSG00000179002	ENST00000375371	D	0.88124	-2.34	5.22	4.3	0.51218	GPCR, family 3, C-terminal (2);	0.286413	0.24776	N	0.035681	D	0.87877	0.6288	M	0.89214	3.015	0.09310	N	1	B	0.33299	0.407	B	0.34093	0.175	T	0.82444	-0.0454	10	0.49607	T	0.09	.	10.1003	0.42499	0.0:0.9039:0.0:0.0961	.	667	Q8TE23	TS1R2_HUMAN	H	667	ENSP00000364520:R667H	ENSP00000364520:R667H	R	-	2	0	TAS1R2	19039200	0.000000	0.05858	0.007000	0.13788	0.636000	0.38137	0.048000	0.14078	2.438000	0.82558	0.561000	0.74099	CGC		0.562	TAS1R2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000006953.1			
TBL2	26608	hgsc.bcm.edu;ucsc.edu	37	7	72988762	72988762	+	Missense_Mutation	SNP	T	T	A			TCGA-BP-4347-01A-01D-1366-10	TCGA-BP-4347-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	249697ef-19f1-4d5e-8182-1eb1b5c38ec1	e453d958-081b-4680-a2ec-1e14aa549c08	g.chr7:72988762T>A	ENST00000305632.5	-	2	453	c.212A>T	c.(211-213)aAg>aTg	p.K71M	TBL2_ENST00000432538.1_Missense_Mutation_p.K35M|TBL2_ENST00000452475.1_Missense_Mutation_p.K71M|TBL2_ENST00000459913.1_5'UTR	NM_012453.2	NP_036585.1	Q9Y4P3	TBL2_HUMAN	transducin (beta)-like 2	71							poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	19		Lung NSC(55;0.0659)|all_lung(88;0.152)				TTGTTGAGGCTTCTCCTTCCG	0.537																																																	0													293.0	241.0	258.0					7																	72988762		2203	4300	6503	SO:0001583	missense	26608			AF056183	CCDS5551.1	7q11.23	2013-01-10			ENSG00000106638	ENSG00000106638		"""WD repeat domain containing"""	11586	protein-coding gene	gene with protein product	"""Williams-Beuren syndrome chromosome region 13"""	605842				9860302, 10575226	Standard	XM_006715923		Approved	WS-betaTRP, WBSCR13, DKFZP43N024	uc003tyh.3	Q9Y4P3	OTTHUMG00000023427	ENST00000305632.5:c.212A>T	7.37:g.72988762T>A	ENSP00000307260:p.Lys71Met	Somatic		WXS	SOLID	Phase_I	Q9UQE2	Missense_Mutation	SNP	ENST00000305632.5	37	CCDS5551.1	.	.	.	.	.	.	.	.	.	.	T	24.0	4.480018	0.84747	.	.	ENSG00000106638	ENST00000305632;ENST00000541783;ENST00000432538;ENST00000452475	T;T;T	0.68624	0.27;3.33;-0.34	5.45	5.45	0.79879	WD40/YVTN repeat-like-containing domain (1);	0.044532	0.85682	D	0.000000	T	0.75280	0.3828	L	0.50333	1.59	0.53005	D	0.999964	D;D	0.76494	0.999;0.999	P;D	0.64042	0.87;0.921	T	0.77552	-0.2545	10	0.66056	D	0.02	-27.3591	13.4473	0.61148	0.0:0.0:0.0:1.0	.	35;71	E9PF19;Q9Y4P3	.;TBL2_HUMAN	M	71;71;35;71	ENSP00000307260:K71M;ENSP00000413979:K35M;ENSP00000407371:K71M	ENSP00000307260:K71M	K	-	2	0	TBL2	72626698	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.902000	0.56310	2.078000	0.62432	0.459000	0.35465	AAG		0.537	TBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252233.3		NM_012453	
TAS2R3	50831	hgsc.bcm.edu;ucsc.edu	37	7	141464727	141464727	+	Missense_Mutation	SNP	A	A	G			TCGA-BP-4347-01A-01D-1366-10	TCGA-BP-4347-11A-01D-1366-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	249697ef-19f1-4d5e-8182-1eb1b5c38ec1	e453d958-081b-4680-a2ec-1e14aa549c08	g.chr7:141464727A>G	ENST00000247879.2	+	1	831	c.769A>G	c.(769-771)Aat>Gat	p.N257D	SSBP1_ENST00000465582.1_Intron	NM_016943.2	NP_058639.1	Q9NYW6	TA2R3_HUMAN	taste receptor, type 2, member 3	257					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|sensory perception of taste (GO:0050909)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)	14	Melanoma(164;0.0171)					ATCATTTGGTAATTTCCTACC	0.398																																																	0													118.0	109.0	112.0					7																	141464727		2203	4300	6503	SO:0001583	missense	50831			AF227130	CCDS5867.1	7q31.3-q32	2012-08-22			ENSG00000127362	ENSG00000127362		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14910	protein-coding gene	gene with protein product		604868					Standard	NM_016943		Approved	T2R3	uc003vwp.1	Q9NYW6	OTTHUMG00000157637	ENST00000247879.2:c.769A>G	7.37:g.141464727A>G	ENSP00000247879:p.Asn257Asp	Somatic		WXS	SOLID	Phase_I	A4D1U2|Q645W2|Q75MV6	Missense_Mutation	SNP	ENST00000247879.2	37	CCDS5867.1	.	.	.	.	.	.	.	.	.	.	A	11.07	1.529404	0.27387	.	.	ENSG00000127362	ENST00000247879	T	0.36878	1.23	5.18	-9.12	0.00707	.	1.420560	0.04478	N	0.377356	T	0.14700	0.0355	N	0.11131	0.1	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.15694	-1.0428	10	0.41790	T	0.15	.	3.3013	0.06984	0.0958:0.166:0.3692:0.369	.	257	Q9NYW6	TA2R3_HUMAN	D	257	ENSP00000247879:N257D	ENSP00000247879:N257D	N	+	1	0	TAS2R3	141111196	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.978000	0.00664	-1.413000	0.02027	-1.348000	0.01239	AAT		0.398	TAS2R3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349288.1			
TTN	7273	hgsc.bcm.edu;ucsc.edu	37	2	179665291	179665291	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BP-4347-01A-01D-1366-10	TCGA-BP-4347-11A-01D-1366-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	249697ef-19f1-4d5e-8182-1eb1b5c38ec1	e453d958-081b-4680-a2ec-1e14aa549c08	g.chr2:179665291G>T	ENST00000591111.1	-	4	638	c.414C>A	c.(412-414)taC>taA	p.Y138*	TTN_ENST00000342992.6_Nonsense_Mutation_p.Y138*|TTN_ENST00000360870.5_Nonsense_Mutation_p.Y138*|TTN_ENST00000359218.5_Nonsense_Mutation_p.Y138*|TTN_ENST00000460472.2_Nonsense_Mutation_p.Y138*|TTN_ENST00000342175.6_Nonsense_Mutation_p.Y138*|TTN_ENST00000589042.1_Nonsense_Mutation_p.Y138*			Q8WZ42	TITIN_HUMAN	titin	32756	Ig-like 2.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTCCATCCCGGTAGAACTTCA	0.502																																																	0													144.0	126.0	132.0					2																	179665291		2203	4300	6503	SO:0001587	stop_gained	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.414C>A	2.37:g.179665291G>T	ENSP00000465570:p.Tyr138*	Somatic		WXS	SOLID	Phase_I	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	34	5.411301	0.96072	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	.	.	.	5.95	-1.64	0.08318	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	11.1399	0.48396	0.6586:0.0:0.3414:0.0	.	.	.	.	X	138	.	ENSP00000340554:Y138X	Y	-	3	2	TTN	179373536	0.999000	0.42202	0.994000	0.49952	0.998000	0.95712	0.573000	0.23699	-0.178000	0.10672	0.563000	0.77884	TAC		0.502	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1		NM_133378	
UBN1	29855	hgsc.bcm.edu	37	16	4924285	4924285	+	Nonsense_Mutation	SNP	C	C	G			TCGA-BP-4347-01A-01D-1366-10	TCGA-BP-4347-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	249697ef-19f1-4d5e-8182-1eb1b5c38ec1	e453d958-081b-4680-a2ec-1e14aa549c08	g.chr16:4924285C>G	ENST00000396658.4	+	14	2577	c.1874C>G	c.(1873-1875)tCa>tGa	p.S625*	UBN1_ENST00000262376.6_Nonsense_Mutation_p.S625*|UBN1_ENST00000590769.1_Nonsense_Mutation_p.S625*|UBN1_ENST00000545171.1_Nonsense_Mutation_p.S625*	NM_016936.3	NP_058632.2	Q9NPG3	UBN1_HUMAN	ubinuclein 1	625					chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of phosphatase activity (GO:0010923)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|tight junction (GO:0005923)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(6)|kidney(4)|large_intestine(10)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38						GCTTTGCCCTCAGATCACCAA	0.532																																																	0													102.0	110.0	107.0					16																	4924285		2197	4300	6497	SO:0001587	stop_gained	29855			AF108460	CCDS10525.1, CCDS73822.1	16p13.3	2010-11-09			ENSG00000118900	ENSG00000118900			12506	protein-coding gene	gene with protein product		609771				10725330	Standard	XM_005255277		Approved		uc002cyb.3	Q9NPG3	OTTHUMG00000129531	ENST00000396658.4:c.1874C>G	16.37:g.4924285C>G	ENSP00000379894:p.Ser625*	Somatic		WXS	SOLID	Phase_I	B7Z6D3|D3DUE8|Q13079|Q9P1P7	Nonsense_Mutation	SNP	ENST00000396658.4	37	CCDS10525.1	.	.	.	.	.	.	.	.	.	.	C	40	7.925252	0.98565	.	.	ENSG00000118900	ENST00000262376;ENST00000545171;ENST00000396658	.	.	.	4.64	3.69	0.42338	.	0.115951	0.39210	N	0.001437	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	-5.2157	11.547	0.50698	0.0:0.9166:0.0:0.0834	.	.	.	.	X	625	.	ENSP00000262376:S625X	S	+	2	0	UBN1	4864286	0.999000	0.42202	0.998000	0.56505	0.820000	0.46376	2.422000	0.44696	1.313000	0.45069	0.561000	0.74099	TCA		0.532	UBN1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251719.1		NM_016936	
UTP23	84294	hgsc.bcm.edu;ucsc.edu	37	8	117783987	117783987	+	Missense_Mutation	SNP	C	C	T			TCGA-BP-4347-01A-01D-1366-10	TCGA-BP-4347-11A-01D-1366-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	249697ef-19f1-4d5e-8182-1eb1b5c38ec1	e453d958-081b-4680-a2ec-1e14aa549c08	g.chr8:117783987C>T	ENST00000309822.2	+	3	757	c.656C>T	c.(655-657)tCa>tTa	p.S219L	UTP23_ENST00000517820.1_Intron|UTP23_ENST00000357148.3_Intron|UTP23_ENST00000520733.1_Intron	NM_032334.2	NP_115710.2	Q9BRU9	UTP23_HUMAN	UTP23, small subunit (SSU) processome component, homolog (yeast)	219					rRNA processing (GO:0006364)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|urinary_tract(1)	12						GACACACAATCATCTGCTTCT	0.363																																																	0													41.0	45.0	43.0					8																	117783987		2194	4286	6480	SO:0001583	missense	84294				CCDS6320.1	8q24.11	2008-06-12	2008-06-12	2008-06-12		ENSG00000147679			28224	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 53"""	C8orf53		16769905	Standard	NM_032334		Approved	MGC14595	uc003yoc.3	Q9BRU9		ENST00000309822.2:c.656C>T	8.37:g.117783987C>T	ENSP00000308332:p.Ser219Leu	Somatic		WXS	SOLID	Phase_I	B2RE25|Q96NJ8	Missense_Mutation	SNP	ENST00000309822.2	37	CCDS6320.1	.	.	.	.	.	.	.	.	.	.	C	10.87	1.471476	0.26423	.	.	ENSG00000147679	ENST00000309822	T	0.24151	1.87	5.96	5.96	0.96718	.	0.436998	0.25777	N	0.028376	T	0.21718	0.0523	L	0.31664	0.95	0.49582	D	0.999801	B	0.12630	0.006	B	0.08055	0.003	T	0.01725	-1.1287	10	0.51188	T	0.08	1.3219	15.0326	0.71720	0.1753:0.8247:0.0:0.0	.	219	Q9BRU9	UTP23_HUMAN	L	219	ENSP00000308332:S219L	ENSP00000308332:S219L	S	+	2	0	UTP23	117853168	0.023000	0.18921	0.397000	0.26308	0.388000	0.30384	2.825000	0.48096	2.826000	0.97356	0.655000	0.94253	TCA		0.363	UTP23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381173.1		NM_032334	
ZC3H18	124245	hgsc.bcm.edu;ucsc.edu	37	16	88644135	88644135	+	Splice_Site	SNP	G	G	A			TCGA-BP-4347-01A-01D-1366-10	TCGA-BP-4347-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	249697ef-19f1-4d5e-8182-1eb1b5c38ec1	e453d958-081b-4680-a2ec-1e14aa549c08	g.chr16:88644135G>A	ENST00000301011.5	+	2	803		c.e2+1		ZC3H18_ENST00000452588.2_Splice_Site	NM_144604.3	NP_653205.3	Q86VM9	ZCH18_HUMAN	zinc finger CCCH-type containing 18							nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(9)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	42				BRCA - Breast invasive adenocarcinoma(80;0.0542)		GGAAATAGACGTGAGTATGAT	0.532																																					Ovarian(121;375 2276 20373 38669)												0													74.0	80.0	78.0					16																	88644135		2181	4289	6470	SO:0001630	splice_region_variant	124245			BC001584	CCDS10967.1, CCDS73924.1	16q24.2-q24.3	2012-07-05			ENSG00000158545	ENSG00000158545		"""Zinc fingers, CCCH-type domain containing"""	25091	protein-coding gene	gene with protein product						17579712	Standard	NM_144604		Approved	NHN1	uc002fky.3	Q86VM9	OTTHUMG00000137679	ENST00000301011.5:c.603+1G>A	16.37:g.88644135G>A		Somatic		WXS	SOLID	Phase_I	Q96DG4|Q96MP7	Splice_Site	SNP	ENST00000301011.5	37	CCDS10967.1	.	.	.	.	.	.	.	.	.	.	G	17.57	3.422415	0.62622	.	.	ENSG00000158545	ENST00000301011;ENST00000289509;ENST00000452588	.	.	.	5.55	5.55	0.83447	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4978	0.95081	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ZC3H18	87171636	1.000000	0.71417	0.959000	0.39883	0.533000	0.34776	9.185000	0.94900	2.608000	0.88229	0.462000	0.41574	.		0.532	ZC3H18-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000269168.1		NM_144604	Intron
ZNF274	10782	hgsc.bcm.edu	37	19	58718359	58718360	+	Frame_Shift_Ins	INS	-	-	A	rs59557917|rs373818336		TCGA-BP-4347-01A-01D-1366-10	TCGA-BP-4347-11A-01D-1366-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	249697ef-19f1-4d5e-8182-1eb1b5c38ec1	e453d958-081b-4680-a2ec-1e14aa549c08	g.chr19:58718359_58718360insA	ENST00000326804.4	+	5	988_989	c.529_530insA	c.(529-531)gagfs	p.E177fs	ZNF274_ENST00000597818.1_3'UTR|ZNF274_ENST00000345813.3_Frame_Shift_Ins_p.E145fs|ZNF274_ENST00000424679.2_Frame_Shift_Ins_p.E72fs	NM_001278734.1|NM_133502.1	NP_001265663.1|NP_598009.1	Q96GC6	ZN274_HUMAN	zinc finger protein 274	177	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(13)|ovary(1)|prostate(1)|skin(1)	21		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Ovarian(87;0.0443)|Breast(46;0.0889)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)|Lung(386;0.215)		AGGTCCCCGGGAGCCCTGGACC	0.624																																																	0																																										SO:0001589	frameshift_variant	10782			AB029149	CCDS74473.1, CCDS74474.1, CCDS74475.1, CCDS74476.1	19q13.43	2013-01-09				ENSG00000171606		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13068	protein-coding gene	gene with protein product		605467				10777669	Standard	NM_133502		Approved	ZKSCAN19, ZSCAN51	uc002qrs.1	Q96GC6		ENST00000326804.4:c.530dupA	19.37:g.58718360_58718360dupA	ENSP00000321209:p.Glu177fs	Somatic		WXS	SOLID	Phase_I	Q53XU4|Q6MZG1|Q8WY37|Q8WY38|Q92969|Q9UII0|Q9UII1	Frame_Shift_Ins	INS	ENST00000326804.4	37																																																																																					0.624	ZNF274-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			NM_133502	
ZNF569	148266	hgsc.bcm.edu	37	19	37905300	37905300	+	Missense_Mutation	SNP	T	T	C			TCGA-BP-4347-01A-01D-1366-10	TCGA-BP-4347-11A-01D-1366-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	249697ef-19f1-4d5e-8182-1eb1b5c38ec1	e453d958-081b-4680-a2ec-1e14aa549c08	g.chr19:37905300T>C	ENST00000316950.6	-	6	817	c.260A>G	c.(259-261)gAg>gGg	p.E87G	ZNF569_ENST00000592490.1_Missense_Mutation_p.S13G|ZNF569_ENST00000392150.2_5'UTR|ZNF569_ENST00000392149.2_Missense_Mutation_p.E87G	NM_152484.2	NP_689697.2	Q5MCW4	ZN569_HUMAN	zinc finger protein 569	87			E -> G (in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E87G(1)		breast(5)|endometrium(4)|large_intestine(16)|lung(11)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	40			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TTTCTGATGCTCATCAACTCC	0.303																																																	1	Substitution - Missense(1)	breast(1)											45.0	46.0	46.0					19																	37905300		2202	4298	6500	SO:0001583	missense	148266			AL833408	CCDS12503.1	19q13.12	2013-09-20			ENSG00000196437	ENSG00000196437		"""Zinc fingers, C2H2-type"", ""-"""	24737	protein-coding gene	gene with protein product		613904				12477932	Standard	NM_152484		Approved	FLJ32053, ZAP1	uc002ogi.3	Q5MCW4	OTTHUMG00000048172	ENST00000316950.6:c.260A>G	19.37:g.37905300T>C	ENSP00000325018:p.Glu87Gly	Somatic		WXS	SOLID	Phase_I	A8K1S2|Q15925|Q17RR6|Q96MQ2	Missense_Mutation	SNP	ENST00000316950.6	37	CCDS12503.1	.	.	.	.	.	.	.	.	.	.	T	8.266	0.812358	0.16537	.	.	ENSG00000196437	ENST00000316950	T	0.08102	3.13	3.74	3.74	0.42951	.	0.788279	0.10321	N	0.688728	T	0.05640	0.0148	N	0.21373	0.66	0.80722	D	1	P	0.37781	0.608	B	0.32465	0.146	T	0.45934	-0.9227	10	0.24483	T	0.36	.	8.9857	0.35992	0.0:0.0:0.0:1.0	.	87	Q5MCW4	ZN569_HUMAN	G	87	ENSP00000325018:E87G	ENSP00000325018:E87G	E	-	2	0	ZNF569	42597140	0.105000	0.21958	0.962000	0.40283	0.340000	0.28889	2.999000	0.49473	1.695000	0.51148	0.482000	0.46254	GAG		0.303	ZNF569-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109594.2		NM_152484	
ZNHIT1	10467	hgsc.bcm.edu	37	7	100867081	100867081	+	Missense_Mutation	SNP	G	G	T	rs199842287		TCGA-BP-4347-01A-01D-1366-10	TCGA-BP-4347-11A-01D-1366-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	249697ef-19f1-4d5e-8182-1eb1b5c38ec1	e453d958-081b-4680-a2ec-1e14aa549c08	g.chr7:100867081G>T	ENST00000305105.2	+	4	929	c.401G>T	c.(400-402)cGg>cTg	p.R134L	ZNHIT1_ENST00000492315.1_3'UTR	NM_006349.2	NP_006340.1	O43257	ZNHI1_HUMAN	zinc finger, HIT-type containing 1	134			R -> W (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		negative regulation of G0 to G1 transition (GO:0070317)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of histone deacetylation (GO:0031063)|regulation of T cell proliferation (GO:0042129)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(2)	11	Lung NSC(181;0.168)|all_lung(186;0.215)					TGCGGTGCCCGGTACTGCACT	0.667																																																	0													91.0	76.0	81.0					7																	100867081		2203	4300	6503	SO:0001583	missense	10467			AF093571	CCDS5716.1	7q22.1	2010-09-15	2010-09-15	2003-08-08	ENSG00000106400	ENSG00000106400		"""Zinc fingers, HIT-type"""	21688	protein-coding gene	gene with protein product	"""putative cyclin G1 interacting protein"""		"""zinc finger protein, subfamily 4A (HIT domain containing), member 1"", ""zinc finger, HIT domain containing 1"""	ZNFN4A1			Standard	NM_006349		Approved	CG1I, H_DJ0747G18.14	uc003uye.3	O43257	OTTHUMG00000157113	ENST00000305105.2:c.401G>T	7.37:g.100867081G>T	ENSP00000304593:p.Arg134Leu	Somatic		WXS	SOLID	Phase_I	Q6IB12	Missense_Mutation	SNP	ENST00000305105.2	37	CCDS5716.1	.	.	.	.	.	.	.	.	.	.	G	34	5.301215	0.95601	.	.	ENSG00000106400	ENST00000305105	T	0.52057	0.68	4.96	4.96	0.65561	Zinc finger, HIT-type (2);	0.000000	0.85682	D	0.000000	T	0.68815	0.3042	M	0.88450	2.955	0.80722	D	1	D	0.55385	0.971	P	0.56563	0.801	T	0.75193	-0.3404	10	0.54805	T	0.06	-33.2427	16.067	0.80891	0.0:0.0:1.0:0.0	.	134	O43257	ZNHI1_HUMAN	L	134	ENSP00000304593:R134L	ENSP00000304593:R134L	R	+	2	0	ZNHIT1	100653801	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	8.745000	0.91600	2.475000	0.83589	0.549000	0.68633	CGG		0.667	ZNHIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347488.1		NM_006349	
